Science.gov

Sample records for coxsackievirus b3 rna-dependent

  1. Improved crystallization of the coxsackievirus B3 RNA-dependent RNA polymerase

    SciTech Connect

    Jabafi, Ilham; Selisko, Barbara; Coutard, Bruno; De Palma, Armando M.; Neyts, Johan; Egloff, Marie-Pierre; Grisel, Sacha; Dalle, Karen; Campanacci, Valerie; Spinelli, Silvia; Cambillau, Christian; Canard, Bruno; Gruez, Arnaud

    2007-06-01

    The first crystal of a coxsackievirus RNA-dependent RNA polymerase is reported. The Picornaviridae virus family contains a large number of human pathogens such as poliovirus, hepatitis A virus and rhinoviruses. Amongst the viruses belonging to the genus Enterovirus, several serotypes of coxsackievirus coexist for which neither vaccine nor therapy is available. Coxsackievirus B3 is involved in the development of acute myocarditis and dilated cardiomyopathy and is thought to be an important cause of sudden death in young adults. Here, the first crystal of a coxsackievirus RNA-dependent RNA polymerase is reported. Standard crystallization methods yielded crystals that were poorly suited to X-ray diffraction studies, with one axis being completely disordered. Crystallization was improved by testing crystallization solutions from commercial screens as additives. This approach yielded crystals that diffracted to 2.1 Å resolution and that were suitable for structure determination.

  2. Effects of mutations on active site conformation and dynamics of RNA-dependent RNA polymerase from Coxsackievirus B3.

    PubMed

    Shen, Hujun; Deng, Mingsen; Zhang, Yachao

    2017-09-12

    Recent crystal structures of RNA-dependent RNA polymerase (3D(pol)) from Coxsackievirus B3 (CVB3) revealed that a tyrosine mutation at Phe364 (F364Y) resulted in structures with open active site whereas a hydrophobic mutation at Phe364 (F364A) led to conformations with closed active site. Besides, the crystal structures showed that the F364W mutation had no preference between the open and closed active sites, similar to wild-type. In this paper, we present a molecular dynamics (MD) study on CVB3 3D(pol) in order to address some important questions raised by experiments. First, MD simulations of F364Y and F364A were carried out to explore how these mutations at Phe364 influence active site dynamics and conformations. Second, MD simulations of wild-type and mutants were performed to discover the connection between active site dynamics and polymerase function. MD simulations reveal that the effect of mutations on active site dynamics is associated with the interaction between the structural motifs A and D in CVB3 3D(pol). Interestingly, we discover that the active site state is influenced by the formation of a hydrogen bond between backbone atoms of Ala231 (in motif A) and Ala358 (in motif D), which has never been revealed before. Copyright © 2017. Published by Elsevier Inc.

  3. Human Astrocytic Cells Support Persistent Coxsackievirus B3 Infection

    PubMed Central

    Zhang, Xiaowei; Zheng, Zhenhua; Shu, Bo; Liu, Xijuan; Zhang, Zhenfeng; Liu, Yan; Bai, Bingke; Hu, Qinxue

    2013-01-01

    Enteroviruses can frequently target the human central nervous system to induce a variety of neurological diseases. Although enteroviruses are highly cytolytic, emerging evidence has shown that these viruses can establish persistent infections both in vivo and in vitro. Here, we investigated the susceptibility of three human brain cell lines, CCF-STTG1, T98G, and SK-N-SH, to infection with three enterovirus serotypes: coxsackievirus B3 (CVB3), enterovirus 71, and coxsackievirus A9. Persistent infection was observed in CVB3-infected CCF-STTG1 cells, as evidenced by prolonged detection of infectious virions, viral RNA, and viral antigens. Of note, infected CCF-STTG1 cells expressed the nonfunctional canonical viral receptors coxsackievirus-adenovirus receptor and decay-accelerating factor, while removal of cell surface chondroitin sulfate from CCF-STTG1 cells inhibited the replication of CVB3, suggesting that receptor usage was one of the major limiting factors in CVB3 persistence. In addition, CVB3 curtailed the induction of beta interferon in infected CCF-STTG1 cells, which likely contributed to the initiation of persistence. Furthermore, proinflammatory chemokines and cytokines, such as vascular cell adhesion molecule 1, interleukin-8 (IL-8), and IL-6, were upregulated in CVB3-infected CCF-STTG1 cells and human progenitor-derived astrocytes. Our data together demonstrate the potential of CCF-STTG1 cells to be a novel cell model for studying CVB3-central nervous system interactions, providing the basis toward a better understanding of CVB3-induced chronic neuropathogenesis. PMID:24027313

  4. Coxsackievirus B3 infection reduces female mouse fertility

    PubMed Central

    Shim, Hye Min; Hwang, Ji Young; Lee, Kyung Min; Kim, Yunhwa; Jeong, Daewon; Roh, Jaesook; Choi, Hyeonhae; Hwang, Jung Hye; Park, Hosun

    2015-01-01

    Previously we demonstrated coxsackievirus B3 (CVB3) infection during early gestation as a cause of pregnancy loss. Here, we investigated the impacts of CVB3 infection on female mouse fertility. Coxsackievirus-adenovirus receptor (CAR) expression and CVB3 replication in the ovary were evaluated by immunohistochemistry or reverse transcription-polymerase chain reaction (RT-PCR). CAR was highly expressed in granulosa cells (GCs) and CVB3 replicated in the ovary. Histological analysis showed a significant increase in the number of atretic follicles in the ovaries of CVB3-infected mice (CVBM). Estrous cycle evaluation demonstrated that a higher number of CVBM were in proestrus compared to mock mice (CVBM vs. mock; 61.5%, 28.5%, respectively). Estradiol concentration in GC culture supernatant and serum were measured by an enzyme-linked immunosorbent assay. Baseline and stimulated levels of estradiol in GC were decreased in CVBM, consistent with significantly reduced serum levels in these animals. In addition, aromatase transcript levels in GCs from CVBM were also decreased by 40% relative to the mock. Bone mineral density evaluated by micro-computed tomography was significantly decreased in the CVBM. Moreover, the fertility rate was also significantly decreased for the CVBM compared to the mock (CVBM vs. mock; 20%, 94.7%, respectively). This study suggests that CVB3 infection could interfere with reproduction by disturbing ovarian function and cyclic changes of the uterus. PMID:26062767

  5. Perinatal Coxsackievirus B3 Infection with Transient Thrombocytopenia.

    PubMed

    Kaga, Akimune; Katata, Yu; Suzuki, Akira; Otani, Kanako; Watanabe, Hiroshi; Kitaoka, Setsuko; Kumaki, Satoru

    2016-01-01

    Coxsackievirus (Cox) B is the second common picornaviruses, after echovirus, detected from children younger than 2 months of age. Neonates who present with Cox B3 infection in the first week are known to have severe illness such as myocarditis or menigoencephalitis. Severity is commonly associated with perinatal vertical transmission. Here, we report a neonatal case of Cox B3 infection with severe thrombocytopenia through horizontal transmission. The patient was a preterm infant born without asphyxia by selective cesarean section. From his 6(th) day of life, the patient had recurrent episodes of apnea. At that time, the laboratory investigations revealed a profound thrombocytopenia without any evidence of inflammation. Thus, neonatal alloimmune thrombocytopenia (NAIT) was suspected, and the patient received transfusion of immunoglobulin and platelets. Thereafter, the patient had no further episodes of apnea, and platelet counts of the patient increased gradually. Later, the possibility of NAIT was ruled out by the result of the platelet antigen genotyping of the patient and his parents. Culture obtained from his nasopharynx was positive for Cox B3. We thus speculate that the patient was exposed to the virus from his mother because she had a febrile episode at her 5(th) day after delivery, and her Cox B3 infection was confirmed by serology. Assuming that the thrombocytopenia was a complication of Cox B3 infection, the immunoglobulin transfusion might have provided a neutralizing antibody against Cox B3. It is important to consider the possibility of enterovirus infection as a differential diagnosis whenever unexplained thrombocytopenia was observed in neonates.

  6. Cinnamaldehyde Derivatives Inhibited Coxsackievirus B3-Induced Viral Myocarditis.

    PubMed

    Li, Xiao-Qiang; Liu, Xiao-Xiao; Wang, Xue-Ying; Xie, Yan-Hua; Yang, Qian; Liu, Xin-Xin; Ding, Yuan-Yuan; Cao, Wei; Wang, Si-Wang

    2016-10-17

    The chemical property of cinnamaldehyde is unstable in vivo, although early experiments have shown its obvious therapeutic effects on viral myocarditis (VMC). To overcome this problem, we used cinnamaldehyde as a leading compound to synthesize derivatives. Five derivatives of cinnamaldehyde were synthesized: 4-methylcinnamaldehyde (1), 4-chlorocinnamaldehyde (2), 4-methoxycinnamaldehyde (3), α-bromo-4-methylcinnamaldehyde (4), and α-bromo-4-chlorocinnamaldehyde (5). Neonatal rat cardiomyocytes and HeLa cells infected by coxsackievirus B3 (CVB3) were used to evaluate their antiviral and cytotoxic effects. In vivo BALB/c mice were infected with CVB3 for establishing VMC models. Among the derivatives, compound 4 and 5 inhibited the CVB3 in HeLa cells with the half-maximal inhibitory concentrations values of 11.38 ± 2.22 μM and 2.12 ± 0.37 μM, respectively. The 50% toxic concentrations of compound 4 and 5-treated cells were 39-fold and 87-fold higher than in the cinnamaldehyde group. Compound 4 and 5 effectively reduced the viral titers and cardiac pathological changes in a dose-dependent manner. In addition, compound 4 and 5 significantly inhibited the secretion, mRNA and protein expressions of inflammatory cytokines TNF-α, IL-1β and IL-6 in CVB3-infected cardiomyocytes, indicating that brominated cinnamaldehyde not only improved the anti-vital activities for VMC, but also had potent anti-inflammatory effects in cardiomyocytes induced by CVB3.

  7. Amiloride Derivatives Inhibit Coxsackievirus B3 RNA Replication▿

    PubMed Central

    Harrison, David N.; Gazina, Elena V.; Purcell, Damian F.; Anderson, David A.; Petrou, Steven

    2008-01-01

    Amiloride derivatives are known blockers of the cellular Na+/H+ exchanger and the epithelial Na+ channel. More recent studies demonstrate that they also inhibit ion channels formed by a number of viral proteins. We previously reported that 5-(N-ethyl-N-isopropyl)amiloride (EIPA) modestly inhibits intracellular replication and, to a larger extent, release of human rhinovirus 2 (HRV2) (E. V. Gazina, D. N. Harrison, M. Jefferies, H. Tan, D. Williams, D. A. Anderson and S. Petrou, Antiviral Res. 67:98-106, 2005). Here, we demonstrate that amiloride and EIPA strongly inhibit coxsackievirus B3 (CVB3) RNA replication and do not inhibit CVB3 release, in contrast to our previous findings on HRV2. Passaging of plasmid-derived CVB3 in the presence of amiloride generated mutant viruses with amino acid substitutions in position 299 or 372 of the CVB3 polymerase. Introduction of either of these mutations into the CVB3 plasmid produced resistance to amiloride and EIPA, suggesting that they act as inhibitors of CVB3 polymerase, a novel mechanism of antiviral activity for these compounds. PMID:18032495

  8. Attenuated virulence of pleconaril-resistant coxsackievirus B3 variants.

    PubMed

    Groarke, J M; Pevear, D C

    1999-06-01

    Pleconaril (VP 63843) is a novel orally bioavailable small molecule with broad antipicornavirus (enterovirus and rhinovirus) activity. Ten independently derived pleconaril-resistant variants of coxsackievirus B3 were isolated from cell culture. The molecular basis of drug resistance and the biologic properties of the drug-resistant viruses were investigated. RNA sequence analysis revealed amino acid changes in the drug-binding pocket of the resistant variants. Thermal stability studies showed the drug-resistant viruses to be significantly less stable than wild type virus. When evaluated in a murine model in which wild type virus infection is 100% lethal, the drug-resistant viruses showed attenuated virulence with both reduced mortality and delayed time to death. Virus titers in heart and spleen were dramatically lower in drug-resistant virus-infected mice than in wild type virus-infected animals. The study results indicate that pleconaril-resistant virus variants are attenuated and significantly less virulent than drug-sensitive wild type virus.

  9. Heparan Sulfates and Coxsackievirus-Adenovirus Receptor: Each One Mediates Coxsackievirus B3 PD Infection

    PubMed Central

    Zautner, A. E.; Körner, U.; Henke, A.; Badorff, C.; Schmidtke, M.

    2003-01-01

    Amino acid exchanges in the virus capsid protein VP1 allow the coxsackievirus B3 variant PD (CVB3 PD) to replicate in decay accelerating factor (DAF)-negative and coxsackievirus-adenovirus receptor (CAR)-negative cells. This suggests that molecules other than DAF and CAR are involved in attachment of this CVB3 variant to cell surfaces. The observation that productive infection associated with cytopathic effect occurred in Chinese hamster ovary (CHO-K1) cells, whereas heparinase-treated CHO-K1 cells, glucosaminoglycan-negative pgsA-745, heparan sulfate (HS)-negative pgsD-677, and pgsE-606 cells with significantly reduced N-sulfate expression resist CVB3 PD infection, indicates a critical role of highly sulfated HS. 2-O-sulfate-lacking pgsF-17 cells represented the cell line with minimum HS modifications susceptible for CVB3 PD. Inhibition of virus replication in CHO-K1 cells by polycationic compounds, pentosan polysulfate, lung heparin, and several intestinal but not kidney HS supported the hypothesis that CVB3 PD uses specific modified HS for entry. In addition, recombinant human hepatocyte growth factor blocked CVB3 PD infection. However, CAR also mediates CVB3 PD infection, because this CVB3 variant replicates in HS-lacking but CAR-bearing Raji cells, infection could be prevented by pretreatment of cells with CAR antibody, and HS-negative pgsD-677 cells transfected with CAR became susceptible for CVB3 PD. These results demonstrate that the amino acid substitutions in the viral capsid protein VP1 enable CVB3 PD to use specific modified HS as an entry receptor in addition to CAR. PMID:12941917

  10. Tyrosine phosphorylation events during coxsackievirus B3 replication.

    PubMed Central

    Huber, M; Selinka, H C; Kandolf, R

    1997-01-01

    In order to study cellular and viral determinants of pathogenicity, interactions between coxsackievirus B3 (CVB3) replication and cellular protein tyrosine phosphorylation were investigated. During CVB3 infection of HeLa cells, distinct proteins become phosphorylated on tyrosine residues, as detected by the use of antiphosphotyrosine Western blotting. Two proteins of 48 and 200 kDa showed enhanced tyrosine phosphorylation 4 to 5 h postinfection (p.i.), although virus-induced inhibition of cellular protein synthesis had already occurred 3 to 4 h p.i. Subcellular fractionation experiments revealed distinct localization of tyrosine-phosphorylated proteins of 48 and 200 kDa in the cytosol and membrane fractions of infected cells, respectively. In addition, in Vero cells infected with CVB3, echovirus (EV)11, or EV12, increased tyrosine phosphorylation of a 200-kDa protein was detected 6 h p.i. Herbimycin A, a specific inhibitor of Src-like protein tyrosine kinases, was shown to inhibit virus-induced tyrosine phosphorylations and to reduce the production of progeny virions. In contrast, in cells treated with the inhibitors staurosporine and calphostin C, the synthesis of progeny virions was not affected. Immunoprecipitation experiments suggested that the tyrosine-phosphorylated 200-kDa protein in CVB3-infected cells is of cellular origin. In summary, these investigations have begun to unravel the effect of CVB3 as well as EV11 and EV12 replication on cellular tyrosine phosphorylation and support the importance of tyrosine phosphorylation events for effective virus replication. Such cellular phosphorylation events triggered in the course of enterovirus infection may enhance virus replication. PMID:8985388

  11. In vitro cardioprotective effect of Wusen Erlian Granules through the inhibition of Coxsackievirus B3 replication.

    PubMed

    Cao, Yong; Hao, Lin; Han, Cong-hui; Zhang, Pei-ying

    2015-03-01

    Wusen Erlian Granules are a traditional Chinese medicine and we sought to determine the antiviral activity of Wusen Erlian Granules against Coxsackievirus B3 infection. First, cytotoxicity of Wusen Erlian Granules was determined in cultured cardiomyocytes isolated from day-old Wister rat pups. Later, cardiomyocytes were infected with Coxsackievirus B3 and the protective effect of Wusen Erlian Granules against cell injury was compared with that of ribavirin. Cell injury indicators including myoglobin, MB isozyme of Creatine Kinase, and cardiac Troponin were assessed by enzyme-linked immunosorbent assay (ELISA) and antiviral effect was assessed by MTT assay. We found that the 50 %-Toxic (TC50) and 50 %-Effective (EC50) concentrations of Wusen Erlian Granules were 394.05 and 30.26 μg/ml, respectively. Following infection of cardiomyocytes with Coxsackievirus B3, cell injury index of Wusen Erlian Granules, as determined by ELISA, was 125 μg/ml which yielded significant protection from virus-induced cell damage. The antiviral activity of Wusen Erlian Granules i.e., therapeutic index in MTT assay was higher (13.02) than that of ribavirin (6.93). It was, therefore, concluded that the Wusen Erlian Granules exerted better antiviral effect than ribavirin using Coxsackievirus B3 in vitro infection model in terms of rat cardiomyocytes protection from virus-induced cell injury.

  12. A functional nuclear localization sequence in the VP1 capsid protein of coxsackievirus B3

    SciTech Connect

    Wang, Tianying; Yu, Bohai; Lin, Lexun; Zhai, Xia; Han, Yelu; Qin, Ying; Guo, Zhiwei; Wu, Shuo; Zhong, Xiaoyan; Wang, Yan; Tong, Lei; Zhang, Fengmin; Si, Xiaoning; Zhao, Wenran; Zhong, Zhaohua

    2012-11-25

    The capsid proteins of some RNA viruses can translocate to the nucleus and interfere with cellular phenotypes. In this study we found that the VP1 capsid protein of coxsackievirus B3 (CVB3) was dominantly localized in the nucleus of the cells transfected with VP1-expressing plasmid. The VP1 nuclear localization also occurred in the cells infected with CVB3. Truncation analysis indicated that the VP1 nuclear localization sequence located near the C-terminal. The substitution of His220 with threonine completely abolished its translocation. The VP1 proteins of other CVB types might have the nuclear localization potential because this region was highly conserved. Moreover, the VP1 nuclear localization induced cell cycle deregulation, including a prolonged S phase and shortened G2-M phase. Besides these findings, we also found a domain between Ala72 and Phe106 that caused the VP1 truncates dotted distributed in the cytoplasm. Our results suggest a new pathogenic mechanism of CVB. - Highlights: Black-Right-Pointing-Pointer The VP1 protein of coxsackievirus B3 can specifically localize in the nucleus. Black-Right-Pointing-Pointer The nuclear localization signal of coxsackievirus B3 VP1 protein locates near its C-terminal. Black-Right-Pointing-Pointer The VP1 nuclear localization of coxsackievirus B3 can deregulate cell cycle. Black-Right-Pointing-Pointer There is a domain in the VP1 that determines it dotted distributed in the cytoplasm.

  13. Major Persistent 5′ Terminally Deleted Coxsackievirus B3 Populations in Human Endomyocardial Tissues

    PubMed Central

    Bouin, Alexis; Nguyen, Yohan; Wehbe, Michel; Renois, Fanny; Fornes, Paul; Bani-Sadr, Firouze; Metz, Damien

    2016-01-01

    We performed deep sequencing analysis of the enterovirus 5′ noncoding region in cardiac biopsies from a patient with dilated cardiomyopathy. Results displayed a mix of deleted and full-length coxsackievirus B3, characterized by a low viral RNA load (8.102 copies/μg of nucleic acids) and a low viral RNA positive-sense to RNA negative-sense ratio of 4.8. PMID:27434549

  14. Interaction of Decay-Accelerating Factor with Coxsackievirus B3

    PubMed Central

    Hafenstein, Susan; Bowman, Valorie D.; Chipman, Paul R.; Kelly, Carol M. Bator; Lin, Feng; Medof, M. Edward; Rossmann, Michael G.

    2007-01-01

    Many entero-, parecho-, and rhinoviruses use immunoglobulin (Ig)-like receptors that bind into the viral canyon and are required to initiate viral uncoating during infection. However, some of these viruses use an alternative or additional receptor that binds outside the canyon. Both the coxsackievirus-adenovirus receptor (CAR), an Ig-like molecule that binds into the viral canyon, and decay-accelerating factor (DAF) have been identified as cellular receptors for coxsackievirus B3 (CVB3). A cryoelectron microscopy reconstruction of a variant of CVB3 complexed with DAF shows full occupancy of the DAF receptor in each of 60 binding sites. The DAF molecule bridges the canyon, blocking the CAR binding site and causing the two receptors to compete with one another. The binding site of DAF on CVB3 differs from the binding site of DAF on the surface of echoviruses, suggesting independent evolutionary processes. PMID:17804498

  15. AUGMENTATION OF THE VIRULENCE OF MURINE COXSACKIE-VIRUS B-3 MYOCARDIOPATHY BY EXERCISE

    PubMed Central

    Gatmaitan, Bienvenido G.; Chason, Jacob L.; Lerner, A. Martin

    1970-01-01

    Coxsackievirus B-3 myocardiopathy was induced in weanling mice by intraperitoneal and intracerebral inoculations of the Nancy strain. Acute mortality was 5.5%. The cardiomyopathy is characterized by an early phase lasting about 9 days with myocardial necrosis, associated inflammation, and healing by fibrosis and calcification involving 25 to 50% of the contractile fibers in each affected mouse. Infectious coxsackievirus may be recovered from the heart during this phase. Continuing myocardial inflammatory lesions follow during the later phase, but infectious virus is no longer present. When mice were forced to swim in a preheated pool (33°C) during both phases of their myocardiopathy, virulence was strikingly augmented. Fully half of the mice died of congestive failure, the majority while swimming. Hearts were dilated, hypertrophied, and grossly necrotic. The myocardium was transformed to a completely necrotic, inflammatory, calcifying mass. At the peak of the infectious phase, myocardial replication of coxsackievirus was increased 530 times in nurslings which had been forced to swim. Myositis in hind limbs was more frequent, and inflammatory lesions in perirenal and pericardial fat were more severe in the mice which were forced to swim. When swimming was begun on the 9th day after infection, the virulence and lethality (13.8%) of infection were moderately increased. PMID:4246139

  16. Augmentation of the virulence of murine coxsackie-virus B-3 myocardiopathy by exercise.

    PubMed

    Gatmaitan, B G; Chason, J L; Lerner, A M

    1970-06-01

    Coxsackievirus B-3 myocardiopathy was induced in weanling mice by intraperitoneal and intracerebral inoculations of the Nancy strain. Acute mortality was 5.5%. The cardiomyopathy is characterized by an early phase lasting about 9 days with myocardial necrosis, associated inflammation, and healing by fibrosis and calcification involving 25 to 50% of the contractile fibers in each affected mouse. Infectious coxsackievirus may be recovered from the heart during this phase. Continuing myocardial inflammatory lesions follow during the later phase, but infectious virus is no longer present. When mice were forced to swim in a preheated pool (33 degrees C) during both phases of their myocardiopathy, virulence was strikingly augmented. Fully half of the mice died of congestive failure, the majority while swimming. Hearts were dilated, hypertrophied, and grossly necrotic. The myocardium was transformed to a completely necrotic, inflammatory, calcifying mass. At the peak of the infectious phase, myocardial replication of coxsackievirus was increased 530 times in nurslings which had been forced to swim. Myositis in hind limbs was more frequent, and inflammatory lesions in perirenal and pericardial fat were more severe in the mice which were forced to swim. When swimming was begun on the 9th day after infection, the virulence and lethality (13.8%) of infection were moderately increased.

  17. Vitamin E deficiency intensifies the myocardial injury of coxsackievirus B3 infection of mice.

    PubMed

    Beck, M A; Kolbeck, P C; Rohr, L H; Shi, Q; Morris, V C; Levander, O A

    1994-03-01

    Feeding a vitamin E-deficient diet increases pathology in hearts of mice infected with a myocarditic coxsackievirus B3 (CVB3/20). Hearts from infected mice fed a vitamin E-deficient diet rich in highly unsaturated fat (menhaden oil) exhibited more severe pathology than hearts from infected mice fed a vitamin E-deficient diet based largely on saturated fat (lard). Furthermore, a cloned and sequenced amyocarditic coxsackievirus B3 (CVB3/0), which caused little or no pathology in the hearts of vitamin E-supplemented mice, induced extensive cardiac pathology in vitamin E-deficient mice. In infected mice, both mitogen and antigen responses were depressed by vitamin E deficiency, although neutralizing antibody responses were unaffected. Natural killer cell responses were comparable in infected mice fed a lard-based diet with or without supplemented vitamin E. However, a menhaden oil-based diet, whether supplemented with vitamin E or not, significantly depressed natural killer cell activity in infected mice compared with mice fed the lard-based diet. Coxsackievirus B3/0 recovered from the heart of a vitamin E-deficient donor mouse, passaged one time onto HeLa cells, caused significant heart damage when passed back into vitamin E-supplemented recipient mice, demonstrating that the amyocarditic CVB3/0 had changed to a virulent phenotype. Enhanced virulence was also seen with CVB3/20 virus similarly passaged in a vitamin E-deficient donor. Our work demonstrates the important role of host nutritional antioxidant status in determining the severity of certain viral infections.

  18. Molecular epidemiology of coxsackievirus B3 infection in Spain, 2004-2014.

    PubMed

    Calderón, Katherine I; Díaz-de Cerio, María; Otero, Almudena; Muñoz-Almagro, Carmen; Rabella, Nuria; Martínez-Rienda, Inés; Moreno-Docón, Antonio; Trallero, Gloria; Cabrerizo, María

    2016-05-01

    Epidemiological and clinical characteristics of coxsackievirus B3 infections in Spain were investigated. This enterovirus (EV) type was detected mainly in young children (<6 months) and was associated with neurological (78 %) and respiratory diseases (10 %) but also with myo/pericarditis (10 %). Two myocarditis cases were fatal. Phylogenetic analysis of the VP1 region showed that genotype III circulated in the country between 2004 and 2008 and was replaced by genotype V in 2010. Furthermore, phylogenetic analysis of the 3D region indicated that recombination events have occurred and contributed to the genetic evolution of this EV type.

  19. Transplacental infection of Coxsackievirus B3 pathological findings in the fetus.

    PubMed

    Konstantinidou, Anastasia; Anninos, Hector; Spanakis, Nikolaos; Kotsiakis, Xenophon; Syridou, Garyfallia; Tsakris, Athanassios; Patsouris, Efstratios

    2007-06-01

    Coxsackievirus intrauterine infection has been documented mostly on the basis of indirect evidence of transplacental transmission, with neonatal manifestations ranging from asymptomatic infection to meningoencephalitis, myocarditis, and generalized sepsis. This is the first report of prenatal findings and fetoplacental pathology in a third trimester fetus with coxsackie B3 transplacental infection confirmed by molecular techniques. Prenatal ultrasound detected severe reduction of fetal movements at the 27th week. Late onset fetal akinesia deformation sequence with mild arthrogryposis, necrotic meningoencephalitis with vascular calcifications, interstitial pneumonitis, mild myocardial hypertrophy, and chronic monocytic placental villitis were the cardinal findings at fetal autopsy following interruption of the pregnancy.

  20. Emergence of a Large-Plaque Variant in Mice Infected with Coxsackievirus B3.

    PubMed

    Wang, Yao; Pfeiffer, Julie K

    2016-03-29

    Coxsackieviruses are enteric viruses that frequently infect humans. To examine coxsackievirus pathogenesis, we orally inoculated mice with the coxsackievirus B3 (CVB3) Nancy strain. Using HeLa cell plaque assays with agar overlays, we noticed that some fecal viruses generated plaques >100 times as large as inoculum viruses. These large-plaque variants emerged following viral replication in several different tissues. We identified a single amino acid change, N63Y, in the VP3 capsid protein that was sufficient to confer the large-plaque phenotype. Wild-type CVB3 and N63Y mutant CVB3 had similar plaque sizes when agarose was used in the overlay instead of agar. We determined that sulfated glycans in agar inhibited plaque formation by wild-type CVB3 but not by N63Y mutant CVB3. Furthermore, N63Y mutant CVB3 bound heparin, a sulfated glycan, less efficiently than wild-type CVB3 did. While N63Y mutant CVB3 had a growth defect in cultured cells and reduced attachment, it had enhanced replication and pathogenesis in mice. Infection with N63Y mutant CVB3 induced more severe hepatic damage than infection with wild-type CVB3, likely because N63Y mutant CVB3 disseminates more efficiently to the liver. Our data reinforce the idea that culture-adapted laboratory virus strains can have reduced fitnessin vivo N63Y mutant CVB3 may be useful as a platform to understand viral adaptation and pathogenesis in animal studies. Coxsackieviruses frequently infect humans, and although many infections are mild or asymptomatic, there can be severe outcomes, including heart inflammation. Most studies with coxsackieviruses and other viruses use laboratory-adapted viral strains because of their efficient replication in cell culture. We used a cell culture-adapted strain of CVB3, Nancy, to examine viral replication and pathogenesis in orally inoculated mice. We found that mice shed viruses distinct from input viruses because they formed extremely large plaques in cell culture. We identified a

  1. Emergence of a Large-Plaque Variant in Mice Infected with Coxsackievirus B3

    PubMed Central

    Wang, Yao

    2016-01-01

    ABSTRACT Coxsackieviruses are enteric viruses that frequently infect humans. To examine coxsackievirus pathogenesis, we orally inoculated mice with the coxsackievirus B3 (CVB3) Nancy strain. Using HeLa cell plaque assays with agar overlays, we noticed that some fecal viruses generated plaques >100 times as large as inoculum viruses. These large-plaque variants emerged following viral replication in several different tissues. We identified a single amino acid change, N63Y, in the VP3 capsid protein that was sufficient to confer the large-plaque phenotype. Wild-type CVB3 and N63Y mutant CVB3 had similar plaque sizes when agarose was used in the overlay instead of agar. We determined that sulfated glycans in agar inhibited plaque formation by wild-type CVB3 but not by N63Y mutant CVB3. Furthermore, N63Y mutant CVB3 bound heparin, a sulfated glycan, less efficiently than wild-type CVB3 did. While N63Y mutant CVB3 had a growth defect in cultured cells and reduced attachment, it had enhanced replication and pathogenesis in mice. Infection with N63Y mutant CVB3 induced more severe hepatic damage than infection with wild-type CVB3, likely because N63Y mutant CVB3 disseminates more efficiently to the liver. Our data reinforce the idea that culture-adapted laboratory virus strains can have reduced fitness in vivo. N63Y mutant CVB3 may be useful as a platform to understand viral adaptation and pathogenesis in animal studies. PMID:27025249

  2. Internalization and trafficking mechanisms of coxsackievirus B3 in HeLa cells

    SciTech Connect

    Chung, Sun-Ku; Kim, Joo-Young; Kim, In-Beom; Park, Sang-Ick; Paek, Kyung-Hee; Nam, Jae-Hwan . E-mail: jnam66@yahoo.com

    2005-03-01

    Coxsackievirus B3 (CVB3) is nonenveloped and has a single-stranded positive-sense RNA genome. CVB3 induces myocarditis and ultimately dilated cardiomyopathy. Although there are mounting evidences of an interaction between CVB3 particles and the cellular receptors, coxsackievirus and adenovirus receptor (CAR) and decay-accelerating factor (DAF), very little is known about the mechanisms of internalization and trafficking. In the present study, we used the CVB3 H3 strain, which is CAR-dependent but DAF-independent Woodruff variant and found that during entry, CVB3 particles were colocalized in clathrin, after interacting primarily with CAR, which was not recycled to the plasma membrane. We also found that CVB3 internalization was dependent on the function of dynamin, a large GTPase that has an essential role in endocytosis. Heat-shock cognate protein, Hsc70, which acts as a chaperone in the release of coat proteins from clathrin-coated vesicles (CCV), played a role in CVB3 trafficking processes. Moreover, endosomal acidification was crucial for CVB3 endocytosis. Finally, CVB3 was colocalized in early endosome autoantigen 1 (EEA1) molecules, which are involved in endosome-endosome tethering and fusion. In conclusion, these data together indicate that CVB3 uses clathrin-mediated endocytosis and is transcytosed to early endosomes.

  3. Coxsackievirus B3 VLPs purified by ion exchange chromatography elicit strong immune responses in mice.

    PubMed

    Koho, Tiia; Koivunen, Minni R L; Oikarinen, Sami; Kummola, Laura; Mäkinen, Selina; Mähönen, Anssi J; Sioofy-Khojine, Amirbabak; Marjomäki, Varpu; Kazmertsuk, Artur; Junttila, Ilkka; Kulomaa, Markku S; Hyöty, Heikki; Hytönen, Vesa P; Laitinen, Olli H

    2014-04-01

    Coxsackievirus B3 (CVB3) is an important cause of acute and chronic viral myocarditis, and dilated cardiomyopathy (DCM). Although vaccination against CVB3 could significantly reduce the incidence of serious or fatal viral myocarditis and various other diseases associated with CVB3 infection, there is currently no vaccine or therapeutic reagent in clinical use. In this study, we contributed towards the development of a CVB3 vaccine by establishing an efficient and scalable ion exchange chromatography-based purification method for CVB3 virus and baculovirus-insect cell-expressed CVB3 virus-like particles (VLPs). This purification system is especially relevant for vaccine development and production on an industrial scale. The produced VLPs were characterized using a number of biophysical methods and exhibited excellent quality and high purity. Immunization of mice with VLPs elicited a strong immune response, demonstrating the excellent vaccine potential of these VLPs.

  4. Pregnancy loss following coxsackievirus b3 infection in mice during early gestation due to high expression of coxsackievirus-adenovirus receptor (CAR) in uterus and embryo.

    PubMed

    Hwang, Ji Young; Lee, Kyung Min; Kim, Yun Hwa; Shim, Hye Min; Bae, Young Kyung; Hwang, Jung Hye; Park, Hosun

    2014-01-01

    Coxsackieviruses are important pathogens in children and the outcomes of neonatal infection can be serious or fatal. However, the outcomes of coxsackievirus infection during early gestation are not well defined. In this study, we examined the possibility of vertical transmission of coxsackievirus B3 (CVB3) and the effects of CVB3 infection on early pregnancy of ICR mice. We found that the coxsackievirus and adenovirus receptor (CAR) was highly expressed not only in embryos but also in the uterus of ICR mice. CVB3 replicated in the uterus 1 to 7 days post-infection (dpi), with the highest titer at 3 dpi. The pregnancy loss rate in mice infected with CVB3 during early gestation was 38.3%, compared to 4.7% and 2.7% in mock-infected and UV-inactivated-CVB3 infected pregnant mice, respectively. These data suggest that the uterus and embryo, which express abundant CAR, are important targets of CVB3 and that the vertical transmission of CVB3 during early gestation induces pregnancy loss.

  5. Pregnancy Loss Following Coxsackievirus B3 Infection in Mice during Early Gestation Due toHigh Expression of Coxsackievirus-Adenovirus Receptor (CAR) in Uterus and Embryo

    PubMed Central

    Hwang, Ji Young; Lee, Kyung Min; Kim, Yun Hwa; Shim, Hye Min; Bae, Young Kyung; Hwang, Jung Hye; Park, Hosun

    2014-01-01

    Coxsackieviruses are important pathogens in children and the outcomes of neonatal infection can be serious or fatal. However, the outcomes of coxsackievirus infection during early gestation are not well defined. In this study, we examined the possibility of vertical transmission of coxsackievirus B3 (CVB3) and the effects of CVB3 infection on early pregnancy of ICR mice. We found that the coxsackievirus and adenovirus receptor (CAR) was highly expressed not only in embryos but also in the uterus of ICR mice. CVB3 replicated in the uterus 1 to 7 days post-infection (dpi), with the highest titer at 3 dpi. The pregnancy loss rate in mice infected with CVB3 during early gestation was 38.3%, compared to 4.7% and 2.7% in mock-infected and UV-inactivated-CVB3 infected pregnant mice, respectively. These data suggest that the uterus and embryo, which express abundant CAR, are important targets of CVB3 and that the vertical transmission of CVB3 during early gestation induces pregnancy loss. PMID:24521864

  6. Design of a Genetically Stable High Fidelity Coxsackievirus B3 Polymerase That Attenuates Virus Growth in Vivo.

    PubMed

    McDonald, Seth; Block, Andrew; Beaucourt, Stéphanie; Moratorio, Gonzalo; Vignuzzi, Marco; Peersen, Olve B

    2016-07-01

    Positive strand RNA viruses replicate via a virally encoded RNA-dependent RNA polymerase (RdRP) that uses a unique palm domain active site closure mechanism to establish the canonical two-metal geometry needed for catalysis. This mechanism allows these viruses to evolutionarily fine-tune their replication fidelity to create an appropriate distribution of genetic variants known as a quasispecies. Prior work has shown that mutations in conserved motif A drastically alter RdRP fidelity, which can be either increased or decreased depending on the viral polymerase background. In the work presented here, we extend these studies to motif D, a region that forms the outer edge of the NTP entry channel where it may act as a nucleotide sensor to trigger active site closure. Crystallography, stopped-flow kinetics, quench-flow reactions, and infectious virus studies were used to characterize 15 engineered mutations in coxsackievirus B3 polymerase. Mutations that interfere with the transport of the metal A Mg(2+) ion into the active site had only minor effects on RdRP function, but the stacking interaction between Phe(364) and Pro(357), which is absolutely conserved in enteroviral polymerases, was found to be critical for processive elongation and virus growth. Mutating Phe(364) to tryptophan resulted in a genetically stable high fidelity virus variant with significantly reduced pathogenesis in mice. The data further illustrate the importance of the palm domain movement for RdRP active site closure and demonstrate that protein engineering can be used to alter viral polymerase function and attenuate virus growth and pathogenesis. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  7. Virus-Host Coevolution in a Persistently Coxsackievirus B3-Infected Cardiomyocyte Cell Line ▿

    PubMed Central

    Pinkert, Sandra; Klingel, Karin; Lindig, Vanessa; Dörner, Andrea; Zeichhardt, Heinz; Spiller, O. Brad; Fechner, Henry

    2011-01-01

    Coevolution of virus and host is a process that emerges in persistent virus infections. Here we studied the coevolutionary development of coxsackievirus B3 (CVB3) and cardiac myocytes representing the major target cells of CVB3 in the heart in a newly established persistently CVB3-infected murine cardiac myocyte cell line, HL-1CVB3. CVB3 persistence in HL-1CVB3 cells represented a typical carrier-state infection with high levels (106 to 108 PFU/ml) of infectious virus produced from only a small proportion (approximately 10%) of infected cells. CVB3 persistence was characterized by the evolution of a CVB3 variant (CVB3-HL1) that displayed strongly increased cytotoxicity in the naive HL-1 cell line and showed increased replication rates in cultured primary cardiac myocytes of mouse, rat, and naive HL-1 cells in vitro, whereas it was unable to establish murine cardiac infection in vivo. Resistance of HL-1CVB3 cells to CVB3-HL1 was associated with reduction of coxsackievirus and adenovirus receptor (CAR) expression. Decreasing host cell CAR expression was partially overcome by the CVB3-HL1 variant through CAR-independent entry into resistant cells. Moreover, CVB3-HL1 conserved the ability to infect cells via CAR. The employment of a soluble CAR variant resulted in the complete cure of HL-1CVB3 cells with respect to the adapted virus. In conclusion, this is the first report of a CVB3 carrier-state infection in a cardiomyocyte cell line, revealing natural coevolution of CAR downregulation with CAR-independent viral entry in resistant host cells as an important mechanism of induction of CVB3 persistence. PMID:21976640

  8. A decay-accelerating factor-binding strain of coxsackievirus B3 requires the coxsackievirus-adenovirus receptor protein to mediate lytic infection of rhabdomyosarcoma cells.

    PubMed Central

    Shafren, D R; Williams, D T; Barry, R D

    1997-01-01

    The composition of the cellular receptor complex for coxsackievirus B3 (CVB3) has been an area of much contention for the last 30 years. Recently, two individual components of a putative CVB3 cellular receptor complex have been identified as (i) decay-accelerating factor (DAF) and (ii) the coxsackievirus-adenovirus receptor protein (CAR). The present study elucidates the individual roles of DAF and CAR in cell entry of CVB3 Nancy. First, we confirm that the DAF-binding phenotype of CVB3 correlates to the presence of key amino acids located in the viral capsid protein, VP2. Second, using antibody blockade, we show that complete protection of permissive cells from infection by high input multiplicities of CVB3 requires a combination of both anti-DAF and anti-CAR antibodies. Finally, it is shown that expression of the CAR protein on the surface of nonpermissive DAF-expressing RD cells renders them highly susceptible to CVB3-mediated lytic infection. Therefore, although the majority of CVB3 Nancy attaches to the cell via DAF, only virus directly interacting with the CAR protein mediates lytic infection. The role of DAF in CVB3 cell infection may be analogous to that recently described for coxsackievirus A21 (D. R. Shafren, D. J. Dorahy, R. A. Ingham, G. F. Burns, and R. D. Barry, J. Virol. 71:4736-4743, 1997), in that DAF may act as a CVB3 sequestration site, enhancing viral presentation to the functional CAR protein. PMID:9371658

  9. Microarray analysis reveals altered circulating microRNA expression in mice infected with Coxsackievirus B3

    PubMed Central

    Sun, Chaoyu; Tong, Lei; Zhao, Wenran; Wang, Yan; Meng, Yuan; Lin, Lexun; Liu, Bingchen; Zhai, Yujia; Zhong, Zhaohua; Li, Xueqi

    2016-01-01

    Coxsackievirus B3 (CVB3) is a common causative agent in the development of inflammatory cardiomyopathy. However, whether the expression of peripheral blood microRNAs (miRNAs) is altered in this process is unknown. The present study investigated changes to miRNA expression in the peripheral blood of CVB3-infected mice. Utilizing miRNA microarray technology, differential miRNA expression was examined between normal and CVB3-infected mice. The present results suggest that specific miRNAs were differentially expressed in the peripheral blood of mice infected with CVB3, varying with infection duration. Using miRNA microarray analysis, a total of 96 and 89 differentially expressed miRNAs were identified in the peripheral blood of mice infected with CVB3 for 3 and 6 days, respectively. Quantitative polymerase chain reaction was used to validate differentially expressed miRNAs, revealing a consistency of these results with the miRNA microarray analysis results. The biological functions of the differentially expressed miRNAs were then predicted by bioinformatics analysis. The potential biological roles of differentially expressed miRNAs included hypertrophic cardiomyopathy, dilated cardiomyopathy and arrhythmogenic right ventricular cardiomyopathy. These results may provide important insights into the mechanisms responsible for the progression of CVB3 infection. PMID:27698715

  10. Inhibition of fatty acid synthase by amentoflavone reduces coxsackievirus B3 replication.

    PubMed

    Wilsky, Steffi; Sobotta, Katharina; Wiesener, Nadine; Pilas, Johanna; Althof, Nadine; Munder, Thomas; Wutzler, Peter; Henke, Andreas

    2012-02-01

    Coxsackievirus B3 (CVB3) is a human pathogen that causes acute and chronic infections, but an antiviral drug to treat these diseases has not yet been developed for clinical use. Several intracellular pathways are altered to assist viral transcription, RNA replication, and progeny release. Among these, fatty acid synthase (FAS) expression is increased. In order to test the potential of FAS inhibition as an anti-CVB3 strategy, several experiments were performed, including studies on the correlation of CVB3 replication and FAS expression in human Raji cells and an analysis of the time and dose dependence of the antiviral effect of FAS inhibition due to treatment with amentoflavone. The results demonstrate that CVB3 infection induces an up-regulation of FAS expression already at 1 h postinfection (p.i.). Incubation with increasing concentrations of amentoflavone inhibited CVB3 replication significantly up to 8 h p.i. In addition, suppression of p38 MAP kinase activity by treatment with SB239063 decreased FAS expression as well as viral replication. These data provide evidence that FAS inhibition via amentoflavone administration might present a target for anti-CVB3 therapy.

  11. Inhibition of nuclear factor kappa B activation reduces Coxsackievirus B3 replication in lymphoid cells.

    PubMed

    Sobotta, Katharina; Wilsky, Steffi; Althof, Nadine; Wiesener, Nadine; Wutzler, Peter; Henke, Andreas

    2012-02-01

    Interactions between viral replication machineries and host cell metabolism display interesting information how certain viruses capitalize cellular pathways to support progeny production. Among those pathogens, Coxsackievirus B3 (CVB3) has been identified to manipulate intracellular signaling very comprehensively. Next to others, this human pathogenic virus causes acute and chronic forms of myocarditis, pancreatitis, and meningitis. Here, activation of nuclear factor kappa B (NFκB) signaling appears to be involved in successful infection. Viral replication is not restricted to solid organs but involves susceptible immune cells as well. In the present study, p65 phosphorylation as one aspect of NFκB activation and inhibition via BAY 11-7085 administration was analyzed in the context of CVB3 replication in lymphoid cells. During CVB3 infection, an up-regulation of p65 translation is detectable, which is accompanied by noticeable phosphorylation. Inhibition of NFκB signaling reduces viral replication in a dose- and time-dependent manner. Taken together, these results indicate that during CVB3 replication in human and murine lymphoid cells, NFκB signaling is activated and facilitates viral replication. Therefore, antiviral strategies to target such central cellular signaling pathways may represent potential possibilities for the development of new virostatica.

  12. CX3CR1 knockout aggravates Coxsackievirus B3-induced myocarditis

    PubMed Central

    Savvatis, Konstantinos; Puhl, Kerstin; Dong, Fengquan; El-Shafeey, Muhammad; Hamdani, Nazha; Hamann, Isabell; Noutsias, Michel; Infante-Duarte, Carmen; Linke, Wolfgang A.

    2017-01-01

    Studies on inflammatory disorders elucidated the pivotal role of the CX3CL1/CX3CR1 axis with respect to the pathophysiology and diseases progression. Coxsackievirus B3 (CVB3)-induced myocarditis is associated with severe cardiac inflammation, which may progress to heart failure. We therefore investigated the influence of CX3CR1 ablation in the model of acute myocarditis, which was induced by inoculation with 5x105 plaque forming units of CVB3 (Nancy strain) in either CX3CR1-/- or C57BL6/j (WT) mice. Seven days after infection, myocardial inflammation, remodeling, and titin expression and phosphorylation were examined by immunohistochemistry, real-time PCR and Pro-Q diamond stain. Cardiac function was assessed by tip catheter. Compared to WT CVB3 mice, CX3CR1-/- CVB3 mice exhibited enhanced left ventricular expression of inflammatory cytokines and chemokines, which was associated with an increase of immune cell infiltration/presence. This shift towards a pro-inflammatory immune response further resulted in increased cardiac fibrosis and cardiomyocyte apoptosis, which was reflected by an impaired cardiac function in CX3CR1-/- CVB3 compared to WT CVB3 mice. These findings demonstrate a cardioprotective role of CX3CR1 in CVB3-infected mice and indicate the relevance of the CX3CL1/CX3CR1 system in CVB3-induced myocarditis. PMID:28800592

  13. Antiviral Activity of Chrysin Derivatives against Coxsackievirus B3 in vitro and in vivo

    PubMed Central

    Song, Jae-Hyoung; Kwon, Bo-Eun; Jang, Hongjun; Kang, Hyunju; Cho, Sungchan; Park, Kwisung; Ko, Hyun-Jeong; Kim, Hyoungsu

    2015-01-01

    Chrysin is a 5,7-dihydroxyflavone and was recently shown to potently inhibit enterovirus 71 (EV71) by suppressing viral 3C protease (3Cpro) activity. In the current study, we investigated whether chrysin also shows antiviral activity against coxsackievirus B3 (CVB3), which belongs to the same genus (Enterovirus) as EV71, and assessed its ability to prevent the resulting acute pancreatitis and myocarditis. We found that chrysin showed antiviral activity against CVB3 at 10 μM, but exhibited mild cellular cytotoxicity at 50 μM, prompting us to synthesize derivatives of chrysin to increase the antiviral activity and reduce its cytotoxicity. Among four 4-substituted benzyl derivatives derived from C(5) benzyl-protected derivatives 7, 9–11 had significant antiviral activity and showed the most potent activity against CVB3 with low cytotoxicity in Vero cells. Intraperitoneal injection of CVB3 in BALB/c mice with 1×106 TCID50 (50% tissue culture infective dose) of CVB3 induced acute pancreatitis with ablation of acinar cells and increased serum CXCL1 levels, whereas the daily administration of 9 for 5 days significantly alleviated the pancreatic inflammation and reduced the elevation in serum CXCL1 levels. Collectively, we assessed the anti-CVB3 activities of chrysin and its derivatives, and found that among 4-substituted benzyl derivatives, 9 exhibited the highest activity against CVB3 in vivo, and protected mice from CVB3-induced pancreatic damage, simultaneously lowering serum CXCL1 levels. PMID:26336587

  14. Antiviral activity of ginsenosides against coxsackievirus B3, enterovirus 71, and human rhinovirus 3

    PubMed Central

    Song, Jae-Hyoung; Choi, Hwa-Jung; Song, Hyuk-Hwan; Hong, Eun-Hye; Lee, Bo-Ra; Oh, Sei-Ryang; Choi, Kwangman; Yeo, Sang-Gu; Lee, Yong-Pyo; Cho, Sungchan; Ko, Hyun-Jeong

    2014-01-01

    Background Ginsenosides are the major components responsible for the biochemical and pharmacological actions of ginseng, and have been shown to have various biological activities. In this study, we investigated the antiviral activities of seven ginsenosides [protopanaxatriol (PT) type: Re, Rf, and Rg2; protopanaxadiol (PD) type: Rb1, Rb2, Rc, and Rd)] against coxsackievirus B3 (CVB3), enterovirus 71 (EV71), and human rhinovirus 3 (HRV3). Methods Assays of antiviral activity and cytotoxicity were evaluated by the sulforhodamine B method using the cytopathic effect (CPE) reduction assay. Results The antiviral assays demonstrated that, of the seven ginsenosides, the PT-type ginsenosides (Re, Rf, and Rg2) possess significant antiviral activities against CVB3 and HRV3 at a concentration of 100 μg/mL. Among the PT-type ginsenosides, only ginsenoside Rg2 showed significant anti-EV71 activity with no cytotoxicity to cells at 100 μg/mL. The PD-type ginsenosides (Rb1, Rb2, Rc, and Rd), by contrast, did not show any significant antiviral activity against CVB3, EV71, and HRV3, and exhibited cytotoxic effects to virus-infected cells. Notably, the antiviral efficacies of PT-type ginsenosides were comparable to those of ribavirin, a commonly used antiviral drug. Conclusion Collectively, our findings suggest that the ginsenosides Re, Rf, and Rg2 have the potential to be effective in the treatment of CVB3, EV71, and HRV3 infection. PMID:25378991

  15. Interferon and neutralizing antibody in sera of exercised mice with coxsackievirus B-3 myocarditis.

    PubMed

    Reyes, M P; Lerner, A M

    1976-02-01

    Weanling ICR albino Swiss mice were inoculated ip with 1.9 x 10(4) PFU of coxsackievirus B-3 (Nancy) and subsequently forced to swim vigorously daily in a preheated pool (33 degrees). Viremias and virus in hearts of exercised mice were respectively 75 x 1000 x greater than in infected, but not exercised mice. At 24 hr after inoculation, pooled serum from mice that had been swum had no circulating interferon, while infected but not swum mice had interferon activity at a dilution of 1:10. At 72 hr after infection, circulating interferon disappeared from infected (not swum) mice, but continued to be present in high titers through the sixth day in sucklings forced to swim. Interferon was first detected in the hearts of both groups at 48 hr. Quantities in both infected groups were generally similar. Neutralizing antibodies were found in these baby mice on the 13th day of infection and were 16 x greater in nurslings that were not exercised. Measures of corticosterone taken at 4 PM daily were similar in infected, infected-swum, and uninfected mice.

  16. Zinc finger antiviral protein inhibits coxsackievirus B3 virus replication and protects against viral myocarditis.

    PubMed

    Li, Min; Yan, Kepeng; Wei, Lin; Yang, Jie; Lu, Chenyu; Xiong, Fei; Zheng, Chunfu; Xu, Wei

    2015-11-01

    The host Zinc finger antiviral protein (ZAP) has been reported exhibiting antiviral activity against positive-stranded RNA viruses (Togaviridae), negative-stranded RNA viruses (Filoviridae) and retroviruses (Retroviridae). However, whether ZAP restricts the infection of enterovirus and the development of enterovirus mediated disease remains unknown. Here, we reported the antiviral properties of ZAP against coxsackievirus B3 (CVB3), a single-stranded RNA virus of the Enterovirus genus within the Picornaviridae as a major causative agent of viral myocarditis (VMC). We found that the expression of ZAP was significantly induced after CVB3 infection in heart tissues of VMC mice. ZAP potently inhibited CVB3 replication in cells after infection, while overexpression of ZAP in mice significantly increased the resistance to CVB3 replication and viral myocarditis by significantly reducing cardiac inflammatory cytokine production. The ZAP-responsive elements (ZREs) were mapped to the 3'UTR and 5'UTR of viral RNA. Taken together, ZAP confers resistance to CVB3 infection via directly targeting viral RNA and protects mice from acute myocarditis by suppressing viral replication and cardiac inflammatory cytokine production. Our finding further expands ZAP's range of viral targets, and suggests ZAP as a potential therapeutic target for viral myocarditis caused by CVB3.

  17. Coxsackievirus B3 induces viral myocarditis by upregulating toll-like receptor 4 expression.

    PubMed

    Zhao, Zhao; Cai, Tian-Zhi; Lu, Yan; Liu, Wen-Jun; Cheng, Man-Li; Ji, Yu-Qiang

    2015-04-01

    In the present study, we investigated the potential pathogenesis of coxsackievirus B3 (CVB3)-induced viral myocarditis and the promising protective effect of silencing RNA (small interfering RNA, siRNA). One hundred and twenty mice were included in the study, and 30 mice were intraperitoneally inoculated with CVB3 to establish an acute viral myocarditis model. The survival rate was observed for the CVB3-infected mouse model (MOD), and myocardial injury was examined by HE (hematoxylin and eosin) staining assay. Real-time PCR (RT-PCR) and Western blot assay were selected to detect the toll-like receptor 4 (TLR4) expression in myocardial tissues. The TLR4 gene was silenced for the MOD mice, and the effects of this treatment were observed. The results indicate that the expression of TLR4 mRNA and the protein significantly and persistently increased during the progression of CVB3-induced myocarditis. The activities of cardiac enzymes including CK, LDH, AST, and CK-MB were also enhanced in CVB3-induced myocardial tissues. Interestingly, when the TLR4 gene was silenced, the CVB3-induced TLR4 production was significantly decreased and the severity of myocarditis was significantly lessened. In conclusion, CVB3 may induce viral myocarditis by upregulating toll-like receptor 4 expression. The viral myocarditis can be ameliorated by silencing the TLR4 gene in the CVB3 viral myocarditis model, which may be a feasible therapeutic method for treatment of viral myocarditis.

  18. Dual roles of calpain in facilitating Coxsackievirus B3 replication and prompting inflammation in acute myocarditis.

    PubMed

    Li, Minghui; Su, Yangang; Yu, Yong; Yu, Ying; Wang, Xinggang; Zou, Yunzeng; Ge, Junbo; Chen, Ruizhen

    2016-10-15

    Viral myocarditis (VMC) treatment has long been lacking of effective methods. Our former studies indicated roles of calpain in VMC pathogenesis. This study aimed at verifying the potential of calpain in Coxsackievirus B3 (CVB3)-induced myocarditis treatment. A transgenic mouse overexpressing the endogenous calpain inhibitor, calpastatin, was introduced in the study. VMC mouse model was established via intraperitoneal injection of CVB3 in transgenic and wild mouse respectively. Myocardial injury was assayed histologically (HE staining and pathology grading) and serologically (myocardial damage markers of CK-MB and cTnI). CVB3 replication was observed in vivo and in vitro via the capsid protein VP1 detection or virus titration. Inflammation/fibrotic factors of MPO, perforin, IFNγ, IL17, Smad3 and MMP2 were evaluated using western blot or immunohistology stain. Role of calpain in regulating fibroblast migration was studied in scratch assays. Calpastatin overexpression ameliorated myocardial injury induced by CVB3 infection significantly in transgenic mouse indicated by reduced peripheral CK-MB and cTnI levels and improved histology injury. Comparing with CVB3-infected wild type mouse, the transgenic mouse heart tissue carried lower virus load. The inflammation factors of MPO, perforin, IFNγ and IL17 were down-regulated accompanied with fibrotic agents of Smad3 and MMP2 inhibition. And calpain participated in the migration of fibroblasts in vitro, which further proves its role in regulating fibrosis. Calpain plays dual roles of facilitating CVB3 replication and inflammation promotion. Calpain inhibition in CVB3-induced myocarditis showed significant treatment effect. Calpain might be a novel target for VMC treatment in clinical practices. Copyright © 2016. Published by Elsevier Ireland Ltd.

  19. PA28 modulates antigen processing and viral replication during coxsackievirus B3 infection

    PubMed Central

    Respondek, Dorota; Voss, Martin; Kühlewindt, Ina; Klingel, Karin; Krüger, Elke

    2017-01-01

    The function of the proteasome is modulated at the level of subunit expression and by association with its regulatory complexes. During coxsackievirus B3 (CVB3) myocarditis, IFN-induced formation of immunoproteasomes (ip) is known to be critical for regulating immune modulating molecules. The function of the IFN-γ-inducible proteasome regulator subunits PA28 α and β, however, in this context was unknown. During viral myocarditis, we found an increased abundance of PA28β subunits in heart tissue. PA28α/β exists in PA28-20S-PA28 and PA700-20S-PA28 hybrid proteasome complexes in cells both with either predominant ip and standard proteasome (sp) expression. Being in line with reduced proteasome activity in PA28α/β-deficient cells, we observed increased levels of oxidized and poly-ubiquitinated proteins upon TLR3-activation in these cells. Moreover, PA28α/β is capable to interfere directly with viral replication of CVB3 and facilitates the generation of CVB3-derived MHC class I epitopes by the proteasome. In contrast to a distinct function of PA28α/β in vitro, gene ablation of PA28α/β in mice being on a genetic background with resistance towards the development of severe infection had no significant impact on disease progression. Other than reported for the ip, in this host PA28α/β is dispensable to meet the demand of increased peptide hydrolysis capacity by the proteasome during viral myocarditis. PMID:28278207

  20. Antiviral Activity of Chrysin Derivatives against Coxsackievirus B3 in vitro and in vivo.

    PubMed

    Song, Jae-Hyoung; Kwon, Bo-Eun; Jang, Hongjun; Kang, Hyunju; Cho, Sungchan; Park, Kwisung; Ko, Hyun-Jeong; Kim, Hyoungsu

    2015-09-01

    Chrysin is a 5,7-dihydroxyflavone and was recently shown to potently inhibit enterovirus 71 (EV71) by suppressing viral 3C protease (3C(pro)) activity. In the current study, we investigated whether chrysin also shows antiviral activity against coxsackievirus B3 (CVB3), which belongs to the same genus (Enterovirus) as EV71, and assessed its ability to prevent the resulting acute pancreatitis and myocarditis. We found that chrysin showed antiviral activity against CVB3 at 10 μM, but exhibited mild cellular cytotoxicity at 50 μM, prompting us to synthesize derivatives of chrysin to increase the antiviral activity and reduce its cytotoxicity. Among four 4-substituted benzyl derivatives derived from C(5) benzyl-protected derivatives 7, 9-11 had significant antiviral activity and showed the most potent activity against CVB3 with low cytotoxicity in Vero cells. Intraperitoneal injection of CVB3 in BALB/c mice with 1×10(6) TCID50 (50% tissue culture infective dose) of CVB3 induced acute pancreatitis with ablation of acinar cells and increased serum CXCL1 levels, whereas the daily administration of 9 for 5 days significantly alleviated the pancreatic inflammation and reduced the elevation in serum CXCL1 levels. Collectively, we assessed the anti-CVB3 activities of chrysin and its derivatives, and found that among 4-substituted benzyl derivatives, 9 exhibited the highest activity against CVB3 in vivo, and protected mice from CVB3-induced pancreatic damage, simultaneously lowering serum CXCL1 levels.

  1. PA28 modulates antigen processing and viral replication during coxsackievirus B3 infection.

    PubMed

    Respondek, Dorota; Voss, Martin; Kühlewindt, Ina; Klingel, Karin; Krüger, Elke; Beling, Antje

    2017-01-01

    The function of the proteasome is modulated at the level of subunit expression and by association with its regulatory complexes. During coxsackievirus B3 (CVB3) myocarditis, IFN-induced formation of immunoproteasomes (ip) is known to be critical for regulating immune modulating molecules. The function of the IFN-γ-inducible proteasome regulator subunits PA28 α and β, however, in this context was unknown. During viral myocarditis, we found an increased abundance of PA28β subunits in heart tissue. PA28α/β exists in PA28-20S-PA28 and PA700-20S-PA28 hybrid proteasome complexes in cells both with either predominant ip and standard proteasome (sp) expression. Being in line with reduced proteasome activity in PA28α/β-deficient cells, we observed increased levels of oxidized and poly-ubiquitinated proteins upon TLR3-activation in these cells. Moreover, PA28α/β is capable to interfere directly with viral replication of CVB3 and facilitates the generation of CVB3-derived MHC class I epitopes by the proteasome. In contrast to a distinct function of PA28α/β in vitro, gene ablation of PA28α/β in mice being on a genetic background with resistance towards the development of severe infection had no significant impact on disease progression. Other than reported for the ip, in this host PA28α/β is dispensable to meet the demand of increased peptide hydrolysis capacity by the proteasome during viral myocarditis.

  2. A Genetically Engineered Attenuated Coxsackievirus B3 Strain Protects Mice against Lethal Infection

    PubMed Central

    Dan, M.; Chantler, J. K.

    2005-01-01

    Coxsackievirus B3 (CVB3) is a common human pathogen that is endemic throughout the world. There is currently no vaccine available, although the virus is known to be highly lethal to newborns and has been associated with heart disease and pancreatitis in older children and adults. Previously, we showed that the virulence of CVB3 is reduced by a lysine-to-arginine substitution in the capsid protein VP2 (K2168R) or a glutamic acid-to-glycine substitution in VP3 (E3060G). In this report, we show that the double mutant virus CVB3(KR/EG) displays additional attenuation, particularly for the pancreas, in A/J mice. In addition, two other attenuating mutations have been identified in the capsid protein VP1. When either the aspartic acid residue D1155 was replaced with glutamic acid or the proline residue P1126 was replaced with methionine, the resulting mutant also possessed an attenuated phenotype. Moreover, when either of these mutations was incorporated into CVB3(KR/EG), the resulting triple mutant viruses, CVB3(KR/EG/DE) and CVB3(KR/EG/PM), were completely noncardiovirulent and caused only small foci of damage to the pancreas, even at a high dose. Both triple mutants were found to be immunogenic, and a single injection of young A/J mice with either was found to protect them from a subsequent lethal challenge with wild-type CVB3. These findings indicate that the triple mutants could be exploited for the development of a live attenuated vaccine against CVB3. PMID:15994822

  3. Fructus Amomi Cardamomi Extract Inhibit Coxsackievirus-B3 Induced Myocarditis in Murine Myocarditis Model.

    PubMed

    Lee, Yun-Gyeong; Park, Jung-Ho; Jeon, Eun-Seok; Kim, Jin-Hee; Lim, Byung-Kwan

    2016-11-28

    Coxsackievirus B3 (CVB3) is the main cause of acute myocarditis and dilated cardiomyopathy. Plant extracts are considered as useful materials to develop new antiviral drugs. We had previously selected candidate plant extracts, which showed anti-inflammatory effects. We examined the antiviral effects by using a HeLa cell survival assay. Among these extracts, we chose the Amomi Cardamomi (Amomi) extract, which showed strong antiviral effect and preserved cell survival in CVB3 infection. We investigated the mechanisms underlying the ability of Amomi extract to inhibit CVB3 infection and replication. HeLa cells were infected by CVB3 with or without Amomi extract. Erk and Akt activities, and their correlation with virus replication were observed. Live virus titers in cell supernatants and viral positive- and negative-strand RNA amplification were measured. Amomi extract significantly increased HeLa cell survival in different concentrations (100-10 µg/ml). CVB3 capsid protein VP1 expression (76%) and viral protease 2A-induced eIF4G1 cleavage (70%) were significantly decreased in Amomi extract (100 µg/ml) treated cells. The levels of positive- (20%) and negative-strand (80%) RNA were dramatically decreased compared with the control, as revealed by reverse transcription-PCR. In addition, Amomi extract improved mice survival (51% vs 26%) and dramatically reduced heart inflammation in a CVB3-induced myocarditis mouse model. These results suggested that Amomi extract significantly inhibited Enterovirus replication and myocarditis damage. Amomi may be developed as a therapeutic drug for Enterovirus.

  4. The Coxsackievirus and Adenovirus Receptor: Glycosylation and the Extracellular D2 Domain Are Not Required for Coxsackievirus B3 Infection.

    PubMed

    Pinkert, Sandra; Röger, Carsten; Kurreck, Jens; Bergelson, Jeffrey M; Fechner, Henry

    2016-06-15

    The coxsackievirus and adenovirus receptor (CAR) is a member of the immunoglobulin superfamily (IgSF) and functions as a receptor for coxsackie B viruses (CVBs). The extracellular portion of CAR comprises two glycosylated immunoglobulin-like domains, D1 and D2. CAR-D1 binds to the virus and is essential for virus infection; however, it is not known whether D2 is also important for infection, and the role of glycosylation has not been explored. To understand the function of these structural components in CAR-mediated CVB3 infection, we generated a panel of human (h) CAR deletion and substitution mutants and analyzed their functionality as CVB receptors, examining both virus binding and replication. Lack of glycosylation of the CAR-D1 or -D2 domains did not adversely affect CVB3 binding or infection, indicating that the glycosylation of CAR is not required for its receptor functions. Deletion of the D2 domain reduced CVB3 binding, with a proportionate reduction in the efficiency of virus infection. Replacement of D2 with the homologous D2 domain from chicken CAR, or with the heterologous type C2 immunoglobulin-like domain from IgSF11, another IgSF member, fully restored receptor function; however, replacement of CAR-D2 with domains from CD155 or CD80 restored function only in part. These data indicate that glycosylation of the extracellular domain of hCAR plays no role in CVB3 receptor function and that CAR-D2 is not specifically required. The D2 domain may function largely as a spacer permitting virus access to D1; however, the data may also suggest that D2 affects virus binding by influencing the conformation of D1. An important step in virus infection is the initial interaction of the virus with its cellular receptor. Although the role in infection of the extracellular CAR-D1, cytoplasmic, and transmembrane domains have been analyzed extensively, nothing is known about the function of CAR-D2 and the extracellular glycosylation of CAR. Our data indicate that

  5. The Coxsackievirus and Adenovirus Receptor: Glycosylation and the Extracellular D2 Domain Are Not Required for Coxsackievirus B3 Infection

    PubMed Central

    Röger, Carsten; Kurreck, Jens; Bergelson, Jeffrey M.; Fechner, Henry

    2016-01-01

    ABSTRACT The coxsackievirus and adenovirus receptor (CAR) is a member of the immunoglobulin superfamily (IgSF) and functions as a receptor for coxsackie B viruses (CVBs). The extracellular portion of CAR comprises two glycosylated immunoglobulin-like domains, D1 and D2. CAR-D1 binds to the virus and is essential for virus infection; however, it is not known whether D2 is also important for infection, and the role of glycosylation has not been explored. To understand the function of these structural components in CAR-mediated CVB3 infection, we generated a panel of human (h) CAR deletion and substitution mutants and analyzed their functionality as CVB receptors, examining both virus binding and replication. Lack of glycosylation of the CAR-D1 or -D2 domains did not adversely affect CVB3 binding or infection, indicating that the glycosylation of CAR is not required for its receptor functions. Deletion of the D2 domain reduced CVB3 binding, with a proportionate reduction in the efficiency of virus infection. Replacement of D2 with the homologous D2 domain from chicken CAR, or with the heterologous type C2 immunoglobulin-like domain from IgSF11, another IgSF member, fully restored receptor function; however, replacement of CAR-D2 with domains from CD155 or CD80 restored function only in part. These data indicate that glycosylation of the extracellular domain of hCAR plays no role in CVB3 receptor function and that CAR-D2 is not specifically required. The D2 domain may function largely as a spacer permitting virus access to D1; however, the data may also suggest that D2 affects virus binding by influencing the conformation of D1. IMPORTANCE An important step in virus infection is the initial interaction of the virus with its cellular receptor. Although the role in infection of the extracellular CAR-D1, cytoplasmic, and transmembrane domains have been analyzed extensively, nothing is known about the function of CAR-D2 and the extracellular glycosylation of CAR. Our data

  6. Electrophysiological alterations in a murine model of chronic coxsackievirus B3 myocarditis

    PubMed Central

    Rohrbeck, Matthias; Frommeyer, Gerrit; Dechering, Dirk; Olligs, Jan; Schönhofer-Merl, Sabine; Wessely, Rainer; Klingel, Karin; Seebohm, Guiscard; Eckardt, Lars

    2017-01-01

    Introduction Coxsackievirus B3 (CVB3) is known to induce acute and chronic myocarditis. Most infections are clinically unapparent but some patients suffer from ventricular arrhythmias (VA) and sudden cardiac death (SCD). Studies showed that acute CVB3 infection may cause impaired function of cardiac ion channels, creating a proarrhythmic substrate. However, it is unknown whether low level CVB3+ expression in myocytes may cause altered cardiac electrophysiology leading to VA. Methods Cellular electrophysiology was used to analyze cellular action potentials (APs) and occurrence of afterdepolarizations from isolated cardiomyocytes of wildtype (WT) and transgenic CVB3ΔVP0 (CVB3+) mice. Further, we studied surface ECGs, monophasic APs, ventricular effective refractory period (VERP) and inducibility of VAs in Langendorff-perfused whole hearts. All used cardiomyocytes and whole hearts originated from male mice. Results Cellular action potential duration (APD) in WT and CVB3+ myocytes was unchanged. No difference in mean occurrence or amplitude of afterdepolarizations in WT and CVB3+ myocytes was found. Interestingly, resting membrane potential in CVB3+ myocytes was significantly hyperpolarized (WT: -90.0±2.2 mV, n = 7; CVB3+: -114.1±3.0 mV, n = 14; p<0.005). Consistently, in Langendorff-perfused hearts, APDs were also not different between WT and CVB3+ whole hearts. Within both groups, we found a heart rate dependent shortening of ADP90 with increasing heart rate in Langendorff-perfused hearts. VERP was significantly prolonged in CVB3+ hearts compared to WT (WT: 36.0±2.7 ms, n = 5; CVB3+: 47.0±2.0 ms, n = 7; p = 0.018). Resting heart rate (HR) in Langendorff-perfused hearts was not significantly different between both genotypes. Electrical pacing protocols induced no VA in WT and CVB3+ hearts. Conclusion In CVB3+ mice, prolonged ventricular refractoriness and hyperpolarized resting membrane potentials in presence of unchanged APD were observed, suggesting that low

  7. Characterization of a murine model of myocarditis induced by a reactivated coxsackievirus B3.

    PubMed Central

    Zhang, H.; Yousef, G. E.; Ouyang, X.; Archard, L. C.

    1994-01-01

    A transfection-reactivated Coxsackievirus B3 (rCVB3), from a full-length cDNA clone of Nancy strain, has previously been shown to be as cardiovirulent as the wild-type virus. Myocarditis induced by this genetically defined virus was compared in SWR mice with the traditional Balb/c model. SWR mice inoculated with rCVB3 developed more severe myocarditis but less severe pancreatitis than Balb/c mice. In contrast to the poor general health and frequent mortality of Balb/c mice following CVB3 infection, the body weight of SWR mice was not affected by CVB3 inoculation and no mortality occurred at titres of 10(2)-10(7) plaque forming units (PFU). Typical myocarditis developed in SWR mice 7 days post infection. Myocarditic foci consisting of necrotic myocardial fibres and mononuclear cell infiltrates resolved by day 30, similar to that observed in Balb/c. However, SWR mice were more sensitive to rCVB3-induced myocarditis than were Balb/c mice: mild myocarditis was induced (4/4) by as low as 10(2) PFU of the virus (ID50 < 10(1.5) PFU), and more severe myocarditis was seen at higher PFU of virus in a dose-dependent manner. The SWR model was tested with attenuated variants derived from cardiovirulent rCVB3. The ID50 for myocarditis was 10(7) PFU for a large plaque-size attenuant and 10(6) PFU for a minute plaque-size attenuant, indicating loss of cardiovirulence by a factor of more than 10(4)-10(5). rCVB3-induced SWR mouse is a sensitive and reliable model for myocarditis. It is useful in assessing the cardiovirulence of different CVB3 variants and evaluating the efficacies of anti-viral therapies. It will allow follow-up study after high dose infection with cardiovirulent rCVB3. Images Figure 1 Figure 2 p104-a Figure 4 p106-a Figure 5 PMID:8199011

  8. Comparison of Effects of Ivabradine versus Carvedilol in Murine Model with the Coxsackievirus B3-Induced Viral Myocarditis

    PubMed Central

    Yue-Chun, Li; Teng, Zhang; Na-Dan, Zhou; Li-Sha, Ge; Qin, Luo; Xue-Qiang, Guan; Jia-Feng, Lin

    2012-01-01

    Background Elevated heart rate is associated with increased cardiovascular morbidity. The selective If current inhibitor ivabradine reduces heart rate without affecting cardiac contractility, and has been shown to be cardioprotective in the failing heart. Ivabradine also exerts some of its beneficial effects by decreasing cardiac proinflammatory cytokines and inhibiting peroxidants and collagen accumulation in atherosclerosis or congestive heart failure. However, the effects of ivabradine in the setting of acute viral myocarditis and on the cytokines, oxidative stress and cardiomyocyte apoptosis have not been investigated. Methodology/Principal Findings The study was designed to compare the effects of ivabradine and carvedilol in acute viral myocarditis. In a coxsackievirus B3 murine myocarditis model (Balb/c), effects of ivabradine and carvedilol (a nonselective β-adrenoceptor antagonist) on myocardial histopathological changes, cardiac function, plasma noradrenaline, cytokine levels, cardiomyocyte apoptosis, malondialdehyde and superoxide dismutase contents were studied. Both ivabradine and carvedilol similarly and significantly reduced heart rate, attenuated myocardial lesions and improved the impairment of left ventricular function. In addition, ivabradine treatment as well as carvedilol treatment showed significant effects on altered myocardial cytokines with a decrease in the amount of plasma noradrenaline. The increased myocardial MCP-1, IL-6, and TNF-α. in the infected mice was significantly attenuated in the ivabradine treatment group. Only carvedilol had significant anti-oxidative and anti-apoptoic effects in coxsackievirus B3-infected mice. Conclusions/Significance These results show that the protective effects of heart rate reduction with ivabradine and carvedilol observed in the acute phase of coxsackievirus B3 murine myocarditis may be due not only to the heart rate reduction itself but also to the downregulation of inflammatory cytokines. PMID

  9. Intracellular viral localization in murine coxsackievirus-B3 myocarditis. Ultrastructural study by electron microscopic in situ hybridization.

    PubMed Central

    Ukimura, A.; Deguchi, H.; Kitaura, Y.; Fujioka, S.; Hirasawa, M.; Kawamura, K.; Hirai, K.

    1997-01-01

    Group B Coxsackieviruses are a common cause of myocarditis. To detect the viral genome and its localization in the myocardium, we examined C3H/He mice with Coxsackievirus B3 (CVB3) myocarditis on days 5, 8, and 14 after inoculation by the reverse transcriptase polymerase chain reaction and by in situ hybridization. Sense and antisense CVB3 RNA were detected in the myocardium of all mice up to day 14 by reverse transcriptase polymerase chain reaction. Light microscopic in situ hybridization with a cDNA probe for CVB3 showed clusters of positive signals in the areas of myocardial necrosis and cell infiltration. With electron microscopic in situ hybridization, CVB3 RNA was detected in the cytoplasm of cardiocytes, between the myofibrils, near the mitochondria, and in tubular or vesicular structures. Viral RNA was also detected in necrotic debris, in the cytoplasm of macrophages, and in the cytoplasm of interstitial fibroblasts. These findings suggest that CVB3 RNA is replicated in the cytoplasm of cardiocytes, transferred into tubular or vesicular structures, released into the interstitium, and phagocytosed by macrophages. Some positive signals were also detected in the cytoplasm of cardiocytes showing close contact with infiltrating lymphocytes, suggesting that the lymphocytes recognized virus-infected cardiocytes and caused cell-mediated immune cardiocyte damage. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Figure 11 Figure 12 PMID:9176398

  10. Intricacies of cardiac damage in coxsackievirus B3 infection: Implications for therapy

    PubMed Central

    Reddy, Jay

    2015-01-01

    Heart disease is the leading cause of death in humans, and myocarditis is one predominant cause of heart failure in young adults. Patients affected with myocarditis can develop dilated cardiomyopathy (DCM), a common reason for heart transplantation, which to date is the only viable option for combatting DCM. Myocarditis/DCM patients show antibodies to coxsackievirus B (CVB)3 and cardiac antigens, suggesting a role for CVB-mediated autoimmunity in the disease pathogenesis; however, a direct causal link remains to be determined clinically. Experimentally, myocarditis can be induced in susceptible strains of mice using the human isolates of CVB3, and the disease pathogenesis of postinfectious myocarditis resembles that of human disease, making the observations made in animals relevant to humans. In this review, we discuss the complex nature of CVB3-induced myocarditis as it relates to the damage caused by both the virus and the host's response to infection. Based on recent data we obtained in the mouse model of CVB3 infection, we provide evidence to suggest that CVB3 infection accompanies the generation of cardiac myosin-specific CD4 T cells that can transfer the disease to naïve recipients. The therapeutic implications of these observations are also discussed. PMID:25449464

  11. Effect of lovastatin on coxsackievirus B3 infection in human endothelial cells.

    PubMed

    Werner, Bianca; Dittmann, Sven; Funke, Carsten; Überla, Klaus; Piper, Cornelia; Niehaus, Karsten; Horstkotte, Dieter; Farr, Martin

    2014-04-01

    The coxsackie and adenovirus receptor (CAR) mediates the entry of coxsackievirus B (CVB) and adenovirus into host cells and is, therefore, a key determinant for the molecular pathogenesis of viral diseases such as myocarditis. The aim was to investigate the influence of HMG-CoA reductase inhibitor lovastatin on CAR expression in endothelial cells. Human umbilical vein endothelial cells (HUVECs) were exposed to different concentrations of lovastatin (0.05-5 μmol/l) for up to 48 h. Alterations in CAR expression were examined by quantitative real-time PCR (qRT-PCR) and flow cytometry. In addition, after treatment with 1 μmol/l lovastatin for 48 h, HUVECs were infected for 8 h with CVB3 and virus replication was detected by qRT-PCR using viral-specific TaqMan probes. We found that lovastatin decreases CAR mRNA expression by up to 80% (p < 0.01) and CAR protein expression by up to 19% (p < 0.01), in a concentration-dependent manner. Moreover, virus replication of CVB3 was significantly inhibited after lovastatin treatment (p < 0.05). The signaling mechanism of CAR down-regulation by lovastatin depends on the Rac1/Cdc42 pathway. This study shows for the first time that lovastatin reduces the expression of CAR and subsequently the replication of CVB3 in HUVECs.

  12. Functional Consequences of RNA 5'-Terminal Deletions on Coxsackievirus B3 RNA Replication and Ribonucleoprotein Complex Formation.

    PubMed

    Lévêque, Nicolas; Garcia, Magali; Bouin, Alexis; Nguyen, Joseph H C; Tran, Genevieve P; Andreoletti, Laurent; Semler, Bert L

    2017-08-15

    Group B coxsackieviruses are responsible for chronic cardiac infections. However, the molecular mechanisms by which the virus can persist in the human heart long after the signs of acute myocarditis have abated are still not completely understood. Recently, coxsackievirus B3 strains with 5'-terminal deletions in genomic RNAs were isolated from a patient suffering from idiopathic dilated cardiomyopathy, suggesting that such mutant viruses may be the forms responsible for persistent infection. These deletions lacked portions of 5' stem-loop I, which is an RNA secondary structure required for viral RNA replication. In this study, we assessed the consequences of the genomic deletions observed in vivo for coxsackievirus B3 biology. Using cell extracts from HeLa cells, as well as transfection of luciferase replicons in two types of cardiomyocytes, we demonstrated that coxsackievirus RNAs harboring 5' deletions ranging from 7 to 49 nucleotides in length can be translated nearly as efficiently as those of wild-type virus. However, these 5' deletions greatly reduced the synthesis of viral RNA in vitro, which was detected only for the 7- and 21-nucleotide deletions. Since 5' stem-loop I RNA forms a ribonucleoprotein complex with cellular and viral proteins involved in viral RNA replication, we investigated the binding of the host cell protein PCBP2, as well as viral protein 3CD(pro), to deleted positive-strand RNAs corresponding to the 5' end. We found that binding of these proteins was conserved but that ribonucleoprotein complex formation required higher PCBP2 and 3CD(pro) concentrations, depending on the size of the deletion. Overall, this study confirmed the characteristics of persistent CVB3 infection observed in heart tissues and provided a possible explanation for the low level of RNA replication observed for the 5'-deleted viral genomes-a less stable ribonucleoprotein complex formed with proteins involved in viral RNA replication.IMPORTANCE Dilated cardiomyopathy is

  13. Emodin inhibits coxsackievirus B3 replication via multiple signalling cascades leading to suppression of translation.

    PubMed

    Zhang, Huifang M; Wang, Fengping; Qiu, Ye; Ye, Xin; Hanson, Paul; Shen, Hongxing; Yang, Decheng

    2016-02-15

    CVB3 (coxsackievirus 3) is a primary causal agent of viral myocarditis. Emodin is a natural compound isolated from certain plant roots. In the present study, we found that emodin inhibited CVB3 replication in vitro and in mice, and now we report an unrecognized mechanism by which emodin inhibits CVB3 replication through suppression of viral protein translation via multiple pathways. On one hand, emodin treatment inhibited Akt/mTOR (mammalian target of rapamycin) signalling and activated 4EBP1 (eukaryotic initiation factor 4R-binding protein 1), leading to suppression of translation initiation of ribosomal protein L32 encoded by a 5'-TOP (terminal oligopyrimidine) mRNA. On the other hand, emodin treatment differentially regulated multiple signal cascades, including Akt/mTORC1/p70(S6K) (p70 S6 kinase), ERK1/2 (extracellular-signal-regulated kinase 1/2)/p90(RSK) (p90 ribosomal S6 kinase) and Ca(2+)/calmodulin, leading to activation of eEF2K (eukaryotic elongation factor 2 kinase) and subsequent inactivation of eEF2 (eukaryotic elongation factor 2), resulting in inhibition of CVB3 VP1 (viral protein 1) synthesis. These data imply that eEF2K is a major factor mediating cross-talk of different arms of signalling cascades in this signal network. This notion was verified by either overexpressing eEF2K or treating the cells with siRNAs or eEF2K inhibitor A484954. We showed further that the emodin-induced decrease in p70(S6K) phosphorylation plays a dominant positive role in activation of eEF2K and in turn in conferring the antiviral effect of emodin. This finding was further solidified by expressing constitutively active and dominant-negative Akt. Collectively, our data reveal that emodin inhibits viral replication through impairing translational machinery and suppression of viral translation elongation. © 2016 Authors; published by Portland Press Limited.

  14. Complete genome sequence of a coxsackievirus B3 recombinant isolated from an aseptic meningitis outbreak in eastern China.

    PubMed

    Zhang, Wenqiang; Lin, Xiaojuan; Jiang, Ping; Tao, Zexin; Liu, Xiaolin; Ji, Feng; Wang, Tongzhan; Wang, Suting; Lv, Hui; Xu, Aiqiang; Wang, Haiyan

    2016-08-01

    Coxsackievirus B3 (CV-B3) has frequently been associated with aseptic meningitis outbreaks in China. To identify sequence motifs related to aseptic meningitis and to construct an infectious clone, the genome sequence of 08TC170, a representative strain isolated from cerebrospinal fluid (CSF) samples from an outbreak in Shandong in 2008, was determined, and the coding regions for P1-P3 and VP1 were aligned. The first 21 and last 20 residues were "TTAAAACAGCCTGTGGGTTGT" and "ATTCTCCGCATTCGGTGCGG", respectively. The whole genome consisted of 7401 nucleotides, sharing 80.8 % identity with the prototype strain Nancy and low sequence similarity with members of clusters A-C. In contrast, 08TC170 showed high sequence similarity to members of cluster D. An especially high level of sequence identity (≥97.7 %) was found within a branch constituted by 08TC170 and four Chinese strains that clustered together in all of the P1-P3 phylogenic trees. In addition, 08TC170 also possessed a close relationship to the Hong Kong strain 26362/08 in VP1. Similarity plot analysis showed that 08TC170 was most similar to the Chinese CV-B3 strain SSM in P1 and the partial P2 coding region but to the CV-B5 or E-6 strain in 2C and following regions. A T277A mutation was found in 08TC170 and other strains isolated in 2008-2010, but not in strains isolated before 2008, which had high sequence similarity and formed the cluster A277. The results suggested that 08TC170 was the product of both intertypic recombination and point mutation, whose effects on viral neurovirulence will be investigated in a further study. The high homology between 08TC170 and other strains revealed their co-circulation in mainland China and Hong Kong and indicates that further surveillance is needed.

  15. Antiviral effect of compounds derived from Angelica archangelica L. on Herpes simplex virus-1 and Coxsackievirus B3 infections.

    PubMed

    Rajtar, Barbara; Skalicka-Woźniak, Krystyna; Świątek, Łukasz; Stec, Agnieszka; Boguszewska, Anastazja; Polz-Dacewicz, Małgorzata

    2017-05-06

    The dichloromethane extract from fruits of Angelica archangelica L. was separated by the modern high-performance countercurrent chromatography (HPCCC). The extract and five pure compounds: xanthotoxin, bergapten, imperatorin, phellopterin and isoimperatorin, and the mixture of imperatorin and phellopterin, have been studied as the potential antiviral agents against Herpes simplex virus type l and Coxsackievirus B3. The cytotoxicity was measured using the MTT method. Compounds were tested for the in vitro antiviral activity using the cytopathic effect (CPE) inhibitory assay and by the virus titre reduction assay. Real-time PCR was used to quantify the relative inhibition of the HSV-1 replication. The results indicate that the highest activity was demonstrated by the extract, imperatorin, phellopterin and the mixture of imperatorin and phellopterin, reducing the HSV-1 replication by 5.61 log, 4.7 log, 3.01 log and 3.73 log, respectively. The influence of isolated compounds on the CVB3 replication was not significant. Only the extract caused the decrease in the titre of virus in relation to the virus control. Our results show that coumarins of A. archangelica L. might be a potential candidate for the development of the alternative natural anti- HSV-1 compound. Moreover, the presence of isopentenyloxy moiety at C-8 position significantly improves their activity. Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. In vivo delivery of interleukin-35 relieves coxsackievirus-B3-induced viral myocarditis by inhibiting Th17 cells.

    PubMed

    Hu, Yadong; Dong, Chunsheng; Yue, Yan; Xiong, Sidong

    2014-09-01

    Interleukin (IL)-35 is a new member of the IL-12 cytokine family. The suppressive role of IL-35 in the immune response to parasitic and bacterial infections and in autoimmunity has been demonstrated in terms of its anti-inflammatory properties. However, the functional role of IL-35 in viral myocarditis has not been investigated. In this study, IL-35 expression was measured in heart tissues with coxsackievirus B3 (CVB3)-induced myocarditis. It was significantly reduced in the late stage of viral infection and correlated negatively with disease severity. To examine the therapeutic role of IL-35 in viral myocarditis, an IL-35-expressing plasmid (pIL-35-FC) was packaged with polyethyleneimine and delivered intraperitoneally to BALB/c male mice before and after CVB3 infection. The severity of myocarditis was assessed 7 days after infection. The in vivo delivery of IL-35 significantly ameliorated the severity of viral myocarditis, reflected in an increased survival rate and increased bodyweights, and reduced serum creatine kinase (CK) and CK-MB activities, cardiac pathological scores, and viral replication. We also show that the overexpression of IL-35 reduced splenic Th17 cells and Th17-related proinflammatory cytokines in heart tissues. In conclusion, our data indicate that IL-35 effectively protects the myocardium from the pathogenesis of CVB3-induced viral myocarditis, which may be attributable to reduced Th17 production. This suggests that supplementation with IL-35 could be a novel therapeutic treatment for viral myocarditis.

  17. Coxsackievirus B3 Directly Induced Th17 Cell Differentiation by Inhibiting Nup98 Expression in Patients with Acute Viral Myocarditis

    PubMed Central

    Long, Qi; Liao, Yu-Hua; Xie, Yu; Liang, Wei; Cheng, Xiang; Yuan, Jing; Yu, Miao

    2016-01-01

    Th17 cells play a key role in the progression of coxsackievirus B3 (CVB3)-induced acute viral myocarditis (AVMC). However, the direct effect of virus on Th17 cell differentiation is still unknown. Recently, nucleoporin (Nup) 98 has been proved to be associated with lymphocyte differentiation. Therefore, we investigated whether Nup98 mediated Th17 cell differentiation in AVMC. In our study, patients with AVMC and healthy controls were recruited. The results showed that CVB3 could enter into the CD4+ T cells in AVMC patients and healthy controls. After transfecting purified CD4+ T cells with CVB3 in vitro, the Th17 cell frequency, IL-17 secretion, and RORγT synthesis were increased while the Nup98 levels were decreased. Furthermore, down-regulating Nup98 expression by siRNA-Nup98 in CD4+ T cells resulted in the elevated Th17 cell frequency and IL-17 secretion, along with enhanced levels of RORγT, dissociative p300/CBP, and acetylated Stat3. Up-regulation of Nup98 expression by pcDNA3.1-Nup98 showed the opposite effects. Our results suggested that CVB3 directly induced CD4+ T cell differentiation into Th17 cells by inhibiting Nup98 expression, representing a therapeutic target in AVMC. PMID:28018858

  18. In situ immune autoradiographic identification of cells in heart tissues of mice with coxsackievirus B3-induced myocarditis

    SciTech Connect

    Godeny, E.K.; Gauntt, C.J.

    1987-11-01

    In adolescent CD-1 male mice inoculated with a myocarditic coxsackievirus B3 (CVB3m) acute focal lesions containing necrotic myocytes, infiltrating mononuclear cells, and fibroblasts develop. With the use of an in situ immune autoradiographic method with rat monoclonal antibodies (MAb) and an /sup 35/S-labeled antibody, viral antigens were detected outside of lesions. Macrophages, T lymphocytes, and natural killer (NK) cells were identified within myocarditic lesions during the acute phase of the disease. Macrophages detected by anti-Mac-1 MAb were in focal areas within myocarditic lesions on Days 4-7 after inoculation. T lymphocytes were detected in myocarditic lesions on Days 4-10, with MAb to Thy-1 and Lyt-1 antigens showing diffuse reaction patterns, suggesting random distribution of these cells in lesions. Focal areas of reactivity were detected with MAbs to L3T4 and Lyt-2 antigens, suggesting clusters of helper and cytotoxic/suppressor T lymphocytes, respectively. NK cells were presumptively detected by asialo GM1 surface marker in lesions at all times. The presence of activated NK cells in lesions was confirmed by assay of mechanically dissociated heart tissues on Day 8. These data describe the temporal sequence and identity of leukocytes entering into CVB3-induced focal myocarditic lesions during the acute phase of disease in CD-1 mice.

  19. Augmentation of pathogenesis of coxsackievirus B3 infections in mice by exogenous administration of interleukin-1 and interleukin-2.

    PubMed Central

    Huber, S A; Polgar, J; Schultheiss, P; Schwimmbeck, P

    1994-01-01

    Two variants of coxsackievirus B3 (CVB3) which differ dramatically in the ability to induce myocarditis in BALB/c mice were studied. H3 virus infection of murine monocytes in vitro resulted in release of concentrations of interleukin 1 (IL-1) and alpha/beta interferon that were high compared with those of cells infected with the H310A1 virus variant. In vivo, H3 virus infection caused substantial inflammatory cell infiltration of the myocardium, and lymphocytes from these animals gave predominantly Th1-cell responses to either whole H3 virus or overlapping peptides of the CVB3 vp1 capsid protein, as determined by IL-2 production. In contrast, H310A1 virus infection produced minimal myocarditis and Th1-cell responses, but Th2-cell activation was more pronounced than in H3 virus-infected mice (as determined by IL-4 concentrations). Exogenous treatment of H310A1 virus-infected mice with either IL-1 or IL-2 restored both myocarditis susceptibility and Th1-cell responses to whole virus and vp1 peptides. Furthermore, H310A1 virus-infected mice given exogenous IL-1 showed substantial in situ IL-2 deposition in the myocardium. These results indicate that CVB3-induced myocarditis may depend upon release of specific cytokines during infection and that activation of Th1 cells may be an important factor in pathogenesis. Images PMID:8254729

  20. Interleukin-37 Ameliorates Coxsackievirus B3-induced Viral Myocarditis by Modulating the Th17/Regulatory T cell Immune Response.

    PubMed

    An, Bang; Liu, Xuefei; Li, Ge; Yuan, Haitao

    2017-05-01

    Myocarditis is a heterogeneous group of disorders defined by inflammation of the heart muscle with an excessively activated immune response. Numerous interventions have been investigated for the treatment of myocarditis while success is limited. Interleukin-37 (IL-37), a novel member of the IL-1 cytokine family, is a natural inhibitor of innate immunity associated with autoimmune diseases. However, the modulatory effect of IL-37 in myocarditis is unknown. In this study, we investigated the immunological regulation of IL-37 in the coxsackievirus B3-induced model of murine viral myocarditis. The results show that IL-37 significantly ameliorates the signs of myocarditis with increased survival rate and bodyweight, improved histological changes, reduced activities of MB isoenzyme of creatine kinase and cardiac troponin I, and a suppressed response of Th17 cells and enhanced response of regulatory T cells (Tregs) in the spleen. Moreover, IL-37 down-regulates the expression of Th17-related cytokines IL-6 and IL-17A, while promoting Treg-related cytokine IL-10 levels in the heart. Therefore, IL-37 may exhibit anti-inflammatory activity in the murine model of myocarditis by regulating the balance between Th17 and Treg cells, thereby providing a possible novel therapeutic target in myocarditis.

  1. Hormonal Regulation of CD4+ T-Cell Responses in Coxsackievirus B3-Induced Myocarditis in Mice

    PubMed Central

    Huber, S. A.; Kupperman, J.; Newell, M. K.

    1999-01-01

    Coxsackievirus B3 infection causes significant cardiac inflammation in male, but not female, B1.Tg.Eα mice. This gender difference in disease susceptibility correlates with selective induction of CD4+ Th1 (gamma interferon-positive) cell responses in animals with testosterone, whereas estradiol promotes preferential CD4+ Th2 (interleukin-4 positive [IL-4+]) cell responses. Differences in immune deviation of CD4+ T cells cannot be explained by variation in B7-1 or B7-2 expression. Infection significantly upregulated both molecules, but no differences were detected between estradiol- and testosterone-treated groups. Significantly increased numbers of activated (CD69+) T cells expressing the γδ T-cell receptor were found in male and testosterone-treated male and female mice. In vivo depletion of γδ+ cells by using monoclonal antibodies inhibited myocarditis and resulted in a shift from a Th1 to Th2 response phenotype. Taken together, our results indicate that testosterone promotes a CD4+ Th1 cell response and myocarditis by promoting increased γδ+ cell activation. PMID:10233928

  2. Dose-dependent protective effect of nicotine in a murine model of viral myocarditis induced by coxsackievirus B3

    PubMed Central

    Li-Sha, Ge; Jing-Lin, Zhao; Guang-Yi, Chen; Li, Liu; De-Pu, Zhou; Yue-Chun, Li

    2015-01-01

    The alpha 7 nicotinic acetylcholine receptor (alpha7 nAChR) was recently described as an anti-inflammatory target in various inflammatory diseases. The aim of this study was to investigate the dose-related effects of nicotine, an alpha7 nAChR agonist, in murine model of viral myocarditis. BALB/C mice were infected by an intraperitoneally injection with coxsackievirus B3. Nicotine was administered at doses of 0.1, 0.2 or 0.4 mg/kg three times per day for 7 or 14 consecutive days. The effects of nicotine on survival, myocardial histopathological changes, cardiac function, and cytokine levels were studied. The survival rate on day 14 increased in a dose-dependent fashion and was markedly higher in the 0.2 and 0.4 mg/kg nicotine groups than in the infected untreated group. Treatment with high-dose nicotine reduced the myocardial inflammation and improved the impaired left ventricular function in infected mice. The mRNA expressions and protein levels of TNF-α, IL-1β, IL-6, and IL-17A were significantly downregulated in dose-dependent manners in the nicotine treatment groups compared to the infected untreated group. Nicotine dose-dependently reduced the severity of viral myocarditis through inhibiting the production of proinflammatory cytokines. The findings suggest that alpha7 nAChR agonists may be a promising new strategy for patients with viral myocarditis. PMID:26507386

  3. In situ immune autoradiographic identification of cells in heart tissues of mice with coxsackievirus B3-induced myocarditis.

    PubMed Central

    Godeny, E. K.; Gauntt, C. J.

    1987-01-01

    In adolescent CD-1 male mice inoculated with a myocarditic coxsackievirus B3 (CVB3m) acute focal lesions containing necrotic myocytes, infiltrating mononuclear cells, and fibroblasts develop. With the use of an in situ immune autoradiographic method with rat monoclonal antibodies (MAb) and an 35S-labeled antibody, viral antigens were detected outside of lesions. Macrophages, T lymphocytes, and natural killer (NK) cells were identified within myocarditic lesions during the acute phase of the disease. Macrophages detected by anti-Mac-1 MAb were in focal areas within myocarditic lesions on Days 4-7 after inoculation. T lymphocytes were detected in myocarditic lesions on Days 4-10, with MAb to Thy-1 and Lyt-1 antigens showing diffuse reaction patterns, suggesting random distribution of these cells in lesions. Focal areas of reactivity were detected with MAbs to L3T4 and Lyt-2 antigens, suggesting clusters of helper and cytotoxic/suppressor T lymphocytes, respectively. NK cells were presumptively detected by asialo GM1 surface marker in lesions at all times. The presence of activated NK cells in lesions was confirmed by assay of mechanically dissociated heart tissues on Day 8. These data describe the temporal sequence and identity of leukocytes entering into CVB3-induced focal myocarditic lesions during the acute phase of disease in CD-1 mice. Images Figure 1 Figure 2 Figure 3 PMID:2823612

  4. Panax Notoginseng Saponins Ameliorates Coxsackievirus B3-Induced Myocarditis by Activating the Cystathionine-γ-Lyase/Hydrogen Sulfide Pathway.

    PubMed

    Pan, Lulu; Zhang, Yuanhai; Lu, Jiacheng; Geng, Zhimin; Jia, Lianhong; Rong, Xing; Wang, Zhenquan; Zhao, Qifeng; Wu, Rongzhou; Chu, Maoping; Zhang, Chunxiang

    2015-12-01

    This study is to determine the therapeutic effects of Panax notoginseng saponins (PNSs) on coxsackievirus B3 (CVB3)-induced myocarditis, and whether cystathionine-γ-lyase (CSE)/hydrogen sulfide (H2S) pathway is involved. Mouse model of myocarditis was induced by CVB3 infection, and the mice were subjected to vehicle (saline) or drug treatments (sodium bisulfide (NaHS), propargylglycine (PAG), or PNSs). The results showed that there were inflammatory cell infiltrations, interstitial edemas, and elevated inflammatory cytokines, in CVB3-induced myocarditis. PAG administration increased, whereas NaHS treatment decreased the severity of the myocarditis. PNS treatment dramatically alleviated these myocardial injuries and decreased the viral messenger RNA (mRNA) expression by the enhanced expression of CSE/H2S pathway. Moreover, the therapeutic effects of PNSs on myocarditis were stronger than those of NaHS. Finally, the effect of PNSs on CSE/H2S pathway and cardiac cell protection were verified in cultured cardiac cells. PNSs may be a promising medication for viral myocarditis therapy.

  5. Protease-activated receptor-2 regulates the innate immune response to viral infection in a coxsackievirus B3-induced myocarditis.

    PubMed

    Weithauser, Alice; Bobbert, Peter; Antoniak, Silvio; Böhm, Andreas; Rauch, Bernhard H; Klingel, Karin; Savvatis, Konstantinos; Kroemer, Heyo K; Tschope, Carsten; Stroux, Andrea; Zeichhardt, Heinz; Poller, Wolfgang; Mackman, Nigel; Schultheiss, Heinz-Peter; Rauch, Ursula

    2013-11-05

    This study sought to evaluate the role of protease-activated receptor-2 (PAR2) in coxsackievirus B3 (CVB3)-induced myocarditis. An infection with CVB3 leads to myocarditis. PAR2 modulates the innate immune response. Toll-like receptor-3 (TLR3) is crucial for the innate immune response by inducing the expression of the antiviral cytokine interferon-beta (IFNβ). To induce myocarditis, wild-type (wt) and PAR2 knockout (ko) mice were infected with 10(5) plaque-forming units CVB3. Mice underwent hemodynamic measurements with a 1.2-F microconductance catheter. Wt and PAR2ko hearts and cardiac cells were analyzed for viral replication and immune response with plaque assay, quantitative polymerase chain reaction, Western blot, and immunohistochemistry. Compared with wt mice, PAR2ko mice and cardiomyocytes exhibited a reduced viral load and developed no myocarditis after infection with CVB3. Hearts and cardiac fibroblasts from PAR2ko mice expressed higher basal levels of IFNβ than wt mice did. Treatment with CVB3 and polyinosinic:polycytidylic acid led to higher IFNβ expression in PAR2ko than in wt fibroblasts and reduced virus replication in PAR2ko fibroblasts was abrogated by neutralizing IFNβ antibody. Overexpression of PAR2 reduced the basal IFNβ expression. Moreover, a direct interaction between PAR2 and Toll-like receptor 3 was observed. PAR2 expression in endomyocardial biopsies of patients with nonischemic cardiomyopathy was positively correlated with myocardial inflammation and negatively with IFNβ expression and left ventricular ejection fraction. PAR2 negatively regulates the innate immune response to CVB3 infection and contributes to myocardial dysfunction. The antagonism of PAR2 is of therapeutic interest to strengthen the antiviral response after an infection with a cardiotropic virus. Copyright © 2013 American College of Cardiology Foundation. Published by Elsevier Inc. All rights reserved.

  6. Genomic Determinants of Cardiovirulence in Coxsackievirus B3 Clinical Isolates: Localization to the 5′ Nontranslated Region

    PubMed Central

    Dunn, James J.; Chapman, Nora M.; Tracy, Steven; Romero, José R.

    2000-01-01

    Coxsackievirus B3 (CVB3) infections can cause myocarditis in humans and are implicated in the pathogenesis of dilated cardiomyopathy. The natural genetic determinants of cardiovirulence for CVB3 have not been identified, although using strains engineered in the laboratory, cardiovirulence determinants have been identified in the CVB3 5′ nontranslated region (5′NTR) and capsid. The myocarditic phenotypes of two CVB3 clinical isolates were determined using an established murine model of inflammatory heart disease. The 5′NTRs and capsid proteins of the noncardiovirulent CVB3/CO strain and cardiovirulent CVB3/AS strain were examined to determine their influence on the cardiovirulence phenotype. Six intratypic chimeric viruses were constructed in which 5′NTR and capsid sequences of the infectious cDNA copy of the cardiovirulent CVB3/20 genome were replaced by homologous sequences from CVB3/CO or CVB3/AS. Chimeric strains were tested for cardiovirulence by inoculation of C3H/HeJ mice. Sections of hearts removed at 10 days postinoculation were examined for evidence of myocarditis by light microscopy and assayed for the presence of virus. Replacement of the CVB3/20 capsid coding region by that from the homologous region of CVB3/CO resulted in no change in the cardiovirulent CVB3/20 phenotype, with virus recoverable from the heart at 10 days postinoculation. However, recombinant virus containing the CVB3/CO 5′NTR alone or the 5′NTR and capsid sequences together were not myocarditic, and infectious virus was not recovered from the myocardium. Chimeric viruses containing the CVB3/AS 5′NTR alone, capsid sequence alone, or both together preserved the myocarditic phenotype. These data support the 5′NTR as the primary site in the determination of the natural cardiovirulence phenotype of CVB3. PMID:10775617

  7. Coxsackievirus B3 Infects the Bone Marrow and Diminishes the Restorative Capacity of Erythroid and Lymphoid Progenitors

    PubMed Central

    Althof, Nadine

    2013-01-01

    Coxsackievirus B3 (CVB3) is known to infect stem cells in the neonatal central nervous system. Here, we evaluated the effects of CVB3 infection on the major source and repository of stem cells, the bone marrow (BM). Viral genome was detectable in BM within 24 h of infection, and productive infection of BM cells was evident, peaking at 48 h postinfection (p.i.), when ∼1 to 2% of BM cells produced infectious virus particles. Beginning at 2 to 3 days p.i., a dramatic and persistent loss of immature erythroid cells, B and T lymphocytes, and neutrophils was observed in BM and, by day 3 to 4 p.i., the femoral BM stroma was largely destroyed. Analysis of peripheral blood revealed a modest neutrophilia, a loss of reticulocytes, and a massive lymphopenia. The abundance of multipotent progenitor cells (Lin−/c-kit+/Flt3+) in BM declined ∼10-fold during CVB3 infection and, consistent with a deficiency of primitive hematopoietic progenitors, serum levels of the hematopoietic growth factor Flt3 ligand were dramatically elevated. Therefore, we analyzed the regenerative capacity of BM from CVB3-infected mice. Granulocyte/macrophage progenitors displayed a relatively normal proliferative ability, consistent with the fact that the peripheral blood level of neutrophils—which are very short-lived cells—remained high throughout infection. However, erythroid and lymphoid hematopoietic progenitors in BM from CVB3-infected mice showed a markedly reduced colony-forming capacity, consonant with the observed loss of both lymphocytes and immature erythroid cells/reticulocytes from the BM and peripheral blood. In summary, CVB3 infects the BM and exerts differential effects on the various hematopoietic progenitor populations. PMID:23269810

  8. Cyclosporine A Treatment Inhibits Abcc6-Dependent Cardiac Necrosis and Calcification following Coxsackievirus B3 Infection in Mice

    PubMed Central

    Marton, Jennifer; Albert, Danica; Wiltshire, Sean A.; Park, Robin; Bergen, Arthur; Qureshi, Salman; Malo, Danielle; Burelle, Yan; Vidal, Silvia M.

    2015-01-01

    Coxsackievirus type B3 (CVB3) is a cardiotropic enterovirus. Infection causes cardiomyocyte necrosis and myocardial inflammation. The damaged tissue that results is replaced with fibrotic or calcified tissue, which can lead to permanently altered cardiac function. The extent of pathogenesis among individuals exposed to CVB3 is dictated by a combination of host genetics, viral virulence, and the environment. Here, we aimed to identify genes that modulate cardiopathology following CVB3 infection. 129S1 mice infected with CVB3 developed increased cardiac pathology compared to 129X1 substrain mice despite no difference in viral burden. Linkage analysis identified a major locus on chromosome 7 (LOD: 8.307, P<0.0001) that controlled the severity of cardiac calcification and necrosis following infection. Sub-phenotyping and genetic complementation assays identified Abcc6 as the underlying gene. Microarray expression profiling identified genotype-dependent regulation of genes associated with mitochondria. Electron microscopy examination showed elevated deposition of hydroxyapatite-like material in the mitochondrial matrices of infected Abcc6 knockout (Abcc6-/-) mice but not in wildtype littermates. Cyclosporine A (CsA) inhibits mitochondrial permeability transition pore opening by inhibiting cyclophilin D (CypD). Treatment of Abcc6 -/- mice with CsA reduced cardiac necrosis and calcification by more than half. Furthermore, CsA had no effect on the CVB3-induced phenotype of doubly deficient CypD-/-Abcc6-/- mice. Altogether, our work demonstrates that mutations in Abcc6 render mice more susceptible to cardiac calcification following CVB3 infection. Moreover, we implicate CypD in the control of cardiac necrosis and calcification in Abcc6-deficient mice, whereby CypD inhibition is required for cardioprotection. PMID:26375467

  9. Relation between trace element levels in plasma and myocardium during coxsackievirus B3 myocarditis in the mouse.

    PubMed

    Funseth, E; Lindh, U; Friman, G; Ilbäck, N G

    2000-12-01

    During most infections the plasma levels of trace elements change, but it is not clear if this reflects changes in the infected tissues. Coxsackievirus B3 (CB3) infection may result in viral replication, subsequent inflammation and changed trace element levels in the myocardium. In the present study, the trace element levels in the plasma and heart of adult male A/J mice were determined during the pre-inflammatory stage (day 4) of CB3 myocarditis for the following trace elements: aluminium (Al), arsenic (As), calcium (Ca), cobalt (Co), copper (Cu), iron (Fe), magnesium (Mg), manganese (Mn), selenium (Se), silver (Ag), vanadium (V) and zinc (Zn). The severity of the infection was assessed through clinical signs of disease and trace element levels were measured through inductively-coupled plasma mass-spectrometry (ICP-MS). In the heart, the levels decreased for V (59%; p < 0.01), Co (38%; p < 0.01), Al (81%; p < 0.01), As (66%; p < 0.01) and Se (16%; p < 0.01). Increased levels were detected for Mn (13%; p < 0.05), Fe (48%; p < 0.01), Cu (34%; p < 0.01) and Ag (46%; p < 0.01). In the plasma, decreases were detected in the level of Zn (32%; p < 0.05), whereas increases were seen in Mn (362%; p < 0.05), Fe (272%; p < 0.01), Co (71%; p < 0.05), Cu (25%; n.s.) and Mg (43%; p < 0.01) levels. A correlation was found between the levels in plasma and myocardium for Co (r(s) = -0.636; p < 0.05), Fe (r(s) = 0.764; p < 0.05), Mn (r(s) = 0.682; p < 0.05) and Mg (r(s) = -0.791; p < 0.05). Thus, determination of some of these trace elements in the plasma may be useful to indicate target tissue involvement in the early pre- inflammatory stage of an infectious disease. Some of these elements are important nutrients for the immune system, while others may be associated with the development of disease complications, such as cardiac arrhythmias.

  10. Coxsackievirus B3-induced myocarditis: Infection of females during the estrus phase of the ovarian cycle leads to activation of T regulatory cells

    PubMed Central

    Huber, S.A.

    2008-01-01

    Transgenic female mice expressing the TNFα gene under the cardiac myosin promoter (TNF1.6) develop substantially increased myocarditis and increased numbers of CD4+Th1 (interferon gamma+) cells when infected with coxsackievirus B3 (CVB3) during the diestrus and proestrus phases of the estrus cycle compared to females infected during the estrus and metestrus phases. Cardiac virus titers were increased in females infected in estrus compared to females infected during the other phases. T regulatory cells (CD4+CD25+FoxP3+) were increased in both peripheral blood and inflammatory cells in the heart in females infected during estrus. Exogenous administration of 200 ng/mouse 17-β-estradiol to females protected against CVB3 induced myocarditis and increased CD4+CD25+FoxP3+ cells. These results demonstrate that hormonal fluctuations occurring in normally cycling females can determine T regulatory cell response and control virus-induced pathogenesis. PMID:18586295

  11. Kinetic and Structural Analysis of Coxsackievirus B3 Receptor Interactions and Formation of the A-Particle

    PubMed Central

    Organtini, Lindsey J.; Makhov, Alexander M.; Conway, James F.

    2014-01-01

    ABSTRACT The coxsackievirus and adenovirus receptor (CAR) has been identified as the cellular receptor for group B coxsackieviruses, including serotype 3 (CVB3). CAR mediates infection by binding to CVB3 and catalyzing conformational changes in the virus that result in formation of the altered, noninfectious A-particle. Kinetic analyses show that the apparent first-order rate constant for the inactivation of CVB3 by soluble CAR (sCAR) at physiological temperatures varies nonlinearly with sCAR concentration. Cryo-electron microscopy (cryo-EM) reconstruction of the CVB3-CAR complex resulted in a 9.0-Å resolution map that was interpreted with the four available crystal structures of CAR, providing a consensus footprint for the receptor binding site. The analysis of the cryo-EM structure identifies important virus-receptor interactions that are conserved across picornavirus species. These conserved interactions map to variable antigenic sites or structurally conserved regions, suggesting a combination of evolutionary mechanisms for receptor site preservation. The CAR-catalyzed A-particle structure was solved to a 6.6-Å resolution and shows significant rearrangement of internal features and symmetric interactions with the RNA genome. IMPORTANCE This report presents new information about receptor use by picornaviruses and highlights the importance of attaining at least an ∼9-Å resolution for the interpretation of cryo-EM complex maps. The analysis of receptor binding elucidates two complementary mechanisms for preservation of the low-affinity (initial) interaction of the receptor and defines the kinetics of receptor-catalyzed conformational change to the A-particle. PMID:24623425

  12. N- and 6-O-Sulfated Heparan Sulfates Mediate Internalization of Coxsackievirus B3 Variant PD into CHO-K1 Cells

    PubMed Central

    Zautner, Andreas E.; Jahn, Birgit; Hammerschmidt, Elke; Wutzler, Peter; Schmidtke, Michaela

    2006-01-01

    Recently, it was demonstrated that the coxsackievirus B3 variant PD (CVB3 PD) is able to infect coxsackievirus-adenovirus receptor (CAR)-lacking cells by using heparan sulfates (HS) as additional receptors (A. E. Zautner, U. Korner, A. Henke, C. Badorff, and M. Schmidtke, J. Virol. 77:10071-10077, 2003). For this study, competition experiments with growth factors binding to known HS sequences as well as with specifically desulfated heparins were performed with Chinese hamster ovary cells (CHO-K1) to determine the structural requirements of HS for interaction with CVB3. Hepatocyte growth factor interacting with HS sequences containing [IdUA-GlcNSO3(6OSO3)]n, but not basic fibroblast growth factor binding to [HexUA-GlcNSO3-HexUA-GlcNSO3-IdUA(2OSO3)]n, was shown to compete effectively with CVB3 PD for cell surface HS. Whereas unmodified heparin and 2-O-desulfated heparin strongly inhibited the CVB3 PD-induced cytopathic effect, the antiviral activity was markedly reduced after N-, O- and 6-O-desulfation of heparin. Taken together, these results indicate that 6-O- and N-sulfation of GlcNAc of HS is crucial for HS interaction with CVB3 PD and that the disaccharide [IdUA-GlcNSO3(6OSO3)]n is involved in viral binding. Results from experiments with various inhibitors of endocytic pathways suggest that HS-mediated virus internalization is pH dependent. Despite the fact that CVB3 PD initiates infection about four times slower by making use of HS as a receptor than by using CAR, the time required for a complete viral life cycle in Chinese hamster ovary cells was independent of the utilized receptor. PMID:16775350

  13. [Effect of total flavonoids of astragalus on endoplasmic reticulum chaperone, calumenin and connecxin 43 in suckling mouse myocardium with myocarditis caused by coxsackievirus B3].

    PubMed

    Xuan, Li-ying; Tao, Xie-xin; Zhao, Ya-jun; Ge, Hong-yan; Bao, Li-hong; Wang, Da-peng; Zhao, Ming

    2016-01-01

    To investigate the effect of total flavonoids of astragalus on the expression of endoplasmic reticulum chaperone, calumenin and connecxin 43 (CX43) in suckling mouse myocardium with myocarditis caused by coxsackievirus B3 (CVB3). The primary culture of suckling mouse myocardium cells were randomly divided into control group, CVB3 infected group and total flavonoids of astragalus group. Firstly, to confirm the identity of the suckling mouse myocardium, α-SMA was monitored by immunohistochemistry method. Then the protein expression changes of endoplasmic reticulum chaperone-glucose regulatory protein 78 ( GRP78), calumenin and CX43 were detected by Western blot. (1) Compared with that of the control group, the GRP78 expression level in CVB3 infected group was improved, the expression levels of calumenin and CX43 were all reduced. (2) Compared with that of CVB3 infected group, GRP78 expression level was decreased, and the expression levels of calumenin and CX43 were increased in total flavonoids of astragalus group. CVB3 infection may cause endoplasmic reticulum stress of rat myocardium cells by increasing the expression of GRP78 and decreasing the expression of calumenin and CX43. On the other hand, total flavonoids of astragalus can reduce the expression of GRP78 and increase the expression of calumenin and CX43.The results of this experiment may be closely related to the effects of anti-arrhythmia with viral myocarditis caused by CVB3.

  14. A mechanism of immunoreceptor tyrosine-based activation motif (ITAM)-like sequences in the capsid protein VP2 in viral growth and pathogenesis of Coxsackievirus B3.

    PubMed

    Kim, Dae-Sun; Park, Jung-Hyun; Kim, Joo-Young; Kim, Dokeun; Nam, Jae-Hwan

    2012-04-01

    Coxsackievirus B3 (CVB3) is an RNA virus that mainly causes myocarditis. We have reported previously that immunoreceptor tyrosine-based activation motif (ITAM)-like sequences are contained in the capsid protein VP2 of CVB3. The substitution of two tyrosines for phenylalanines in the ITAM-like region causes attenuation of CVB3, possibly via defective viral assembly. In this study, we found that Syk, a downstream molecule of ITAM, interacts with the wild-type (WT) CVB3 VP0 protein, but not with the mutant CVB3 VP0 (called YYFF), and that an inhibitor of Syk reduced the growth of CVB3. The WT CVB3 activated nuclear factor kappa B (NF-κB), a protein activated by ITAM, and eventually induced the production of interleukin-6 (IL-6)-one of the proinflammatory cytokines induced by NF-κB-in macrophages. However, the YYFF form did not. In addition, viral VP2 protein may be dependent on the phosphorylation of an ITAM-like region that affected the activation of NF-κB. Taken together, these results suggest that the ITAM-like sequences in CVB3 VP2 can not only affect viral structure but also act as signals in pathogenesis.

  15. Gene expression analysis during recovery process indicates the mechanism for innate immune injury and repair from Coxsackievirus B3-induced myocarditis.

    PubMed

    Yao, Hai-Lan; Song, Juan; Sun, Peng; Song, Qin-Qin; Sheng, Lin-Jun; Chi, Miao-Miao; Han, Jun

    2016-02-02

    To investigate the innate immune injury and repair mechanism during recovery from Coxsackievirus B3 (CVB3) induced myocarditis, we established an acute viral myocarditis recovery model by infecting BALB/c mice with CVB3. Histopathological examination of cardiac tissues after infection showed a gradual increase of myocardial injury to the maximum degree at 8 dpi (days post infection), followed by a recovery process with reduced viral replication. We also measured expression changes of innate immune genes in heart after 4, 8 and 12 days of infection using innate immune real-time PCR array. The results showed expression alterations in many Pattern Recognition Receptors (PRRs) genes upon CVB3 infection, which activated multiple important signaling pathways during recovery process. The expression of TLRs, RLRs, PKR and cytokines were strongly induced and reached the peak at 4 dpi in early myocarditis stage, followed by a gradual reduction in recovery stage, during which the levels were even lower than normal at 12 dpi. The strong correlation between cardiac histopathology score and chemokine expression level suggested that the chemokines might play a role in pathological changes during early myocarditis stage. In addition, we also found that both cell survival signaling pathways (AKT1, p38MAPK) and antiviral signaling pathways (IKKα/β/ε) were activated and promoted the recovery during late myocarditis stage. Altogether, our observations improved the understanding of formation and progression of the pathological lesions, as well as the repair mechanism for acute viral myocarditis.

  16. Cellular Proteins Act as Bridge Between 5' and 3' Ends of the Coxsackievirus B3 Mediating Genome Circularization During RNA Translation.

    PubMed

    Souii, Amira; M'hadheb-Gharbi, Manel Ben; Gharbi, Jawhar

    2015-09-01

    The positive single-stranded RNA genome of the Coxsackievirus B3 (CVB3) contains a 5' untranslated region (UTR) which hosts the internal ribosome entry site (IRES) element that governs cap-independent translation initiation and a polyadenylated 3' UTR which is required for stimulating the IRES activity. Viral RNA genomes could circularize to regulate initiation of translation and RNA synthesis at 5' and 3' ends. Interactions could either take place by direct RNA-RNA contacts, through cellular protein bridges mediating RNA circularization or both. Accordingly, we aimed to assess the nature of molecular interactions between these two regions and to evaluate cellular factors required for mRNA 3' end-mediated stimulation of CVB3 IRES-driven translation. By gel shift assays, we have showed that combining, in vitro, 5' and 3' UTR fragments had no discernible effect on the structures of RNAs, arguing against the presence of specific canonical RNA-RNA cyclization sequences between these two regions. Competitive UV crosslinking assays using BHK-21 cell extract showed common cellular proteins eIF3b, PTB, and La binding to both 5'- and 3' end RNAs. PCBP 1-2 and PABP were shown to bind, respectively, to 5' and 3' UTR probes. Taking together, these data suggest that CVB3 5'-3' end bridging occurs through 5' UTR-protein-protein-3' UTR interactions and not through RNA-RNA direct contact. The dual involvement of the 3' and 5' UTRs in controlling viral translation and RNA synthesis highlights the relevance of these regions in the infectious virus life cycle, making them suitable candidates for targeted CVB3 antiviral therapy.

  17. Protease-Activated Receptor-2 Regulates the Innate Immune Response to Viral Infection in a Coxsackievirus B3–Induced Myocarditis

    PubMed Central

    Weithauser, Alice; Bobbert, Peter; Antoniak, Silvio; Böhm, Andreas; Rauch, Bernhard H.; Klingel, Karin; Savvatis, Konstantinos; Kroemer, Heyo K.; Tschope, Carsten; Stroux, Andrea; Zeichhardt, Heinz; Poller, Wolfgang; Mackman, Nigel; Schultheiss, Heinz-Peter; Rauch, Ursula

    2014-01-01

    Objectives This study sought to evaluate the role of protease-activated receptor-2 (PAR2) in coxsackievirus B3 (CVB3)–induced myocarditis. Background An infection with CVB3 leads to myocarditis. PAR2 modulates the innate immune response. Toll-like receptor-3 (TLR3) is crucial for the innate immune response by inducing the expression of the antiviral cytokine interferon-beta (IFNβ). Methods To induce myocarditis, wild-type (wt) and PAR2 knockout (ko) mice were infected with 105 plaque-forming units CVB3. Mice underwent hemodynamic measurements with a 1.2-F microconductance catheter. Wt and PAR2ko hearts and cardiac cells were analyzed for viral replication and immune response with plaque assay, quantitative polymerase chain reaction, Western blot, and immunohistochemistry. Results Compared with wt mice, PAR2ko mice and cardiomyocytes exhibited a reduced viral load and developed no myocarditis after infection with CVB3. Hearts and cardiac fibroblasts from PAR2ko mice expressed higher basal levels of IFNβ than wt mice did. Treatment with CVB3 and polyinosinic:polycytidylic acid led to higher IFNβ expression in PAR2ko than in wt fibroblasts and reduced virus replication in PAR2ko fibroblasts was abrogated by neutralizing IFNβ antibody. Overexpression of PAR2 reduced the basal IFNβ expression. Moreover, a direct interaction between PAR2 and Toll-like receptor 3 was observed. PAR2 expression in endomyocardial biopsies of patients with nonischemic cardiomyopathy was positively correlated with myocardial inflammation and negatively with IFNβ expression and left ventricular ejection fraction. Conclusions PAR2 negatively regulates the innate immune response to CVB3 infection and contributes to myocardial dysfunction. The antagonism of PAR2 is of therapeutic interest to strengthen the antiviral response after an infection with a cardiotropic virus. PMID:23871888

  18. Attenuating Mutations in Coxsackievirus B3 Map to a Conformational Epitope That Comprises the Puff Region of VP2 and the Knob of VP3

    PubMed Central

    Stadnick, E.; Dan, M.; Sadeghi, A.; Chantler, J. K.

    2004-01-01

    Ten antibody escape mutants of coxsackievirus B3 (CVB3) were used to identify nucleotide substitutions that determine viral virulence for the heart and pancreas. The P1 region, encoding the structural genes of each mutant, was sequenced to identify mutations associated with the lack of neutralization. Eight mutants were found to have a lysine-to arginine mutation in the puff region of VP2, while two had a glutamate-to-glycine substitution in the knob of VP3. Two mutants, EM1 and EM10, representing each of these mutations, were further analyzed, initially by determining their entire sequence. In addition to the mutations in P1, EM1 was found to have two mutations in the 3D polymerase, while EM10 had a mutation in stem-loop II of the 5′ nontranslated region (5′NTR). The pathogenesis of the mutants relative to that of CVB3 strain RK [CVB3(RK)] then was examined in A/J mice. Both mutants were found to be less cardiotropic than the parental strain, with a 40-fold (EM1) or a 100- to 1,000-fold (EM10) reduction in viral titers in the heart relative to the titers of CVB3(RK). The mutations in VP2, VP3, and the 5′NTR were introduced independently into the RK infectious clone, and the phenotypes of the progeny viruses were determined. The results substantiated that the VP2 and VP3 mutations reduced cardiovirulence, while the 5′NTR mutation in EM10 was associated with a more virulent phenotype when expressed on its own. Stereographic imaging of the two mutations in the capsomer showed that they lie in close proximity on either side of a narrow cleft between the puff and the knob, forming a conformational epitope that is part of the putative binding site for coreceptor DAF. PMID:15564506

  19. AIM2 co-immunization favors specific multifunctional CD8(+) T cell induction and ameliorates coxsackievirus B3-induced chronic myocarditis.

    PubMed

    Chai, Dafei; Yue, Yan; Xu, Wei; Dong, Chunsheng; Xiong, Sidong

    2015-07-01

    Coxsackievirus B3 (CVB3) infection can cause acute myocarditis and chronic myocarditis, leading to dilated cardiomyopathy (DCM) with no effective therapeutic strategy. Therefore, we investigated the potential of absent in melanoma 2 (AIM2) to enhance the therapeutic efficacy of DNA vaccine against CVB3-induced chronic myocarditis. Mice were infected with CVB3 and then intranasally immunized with chitosan-pcDNA3.1 (mock), chitosan-pAIM2 (CS-pAIM2), chitosan-pVP1 (CS-pVP1), or chitosan-pAIM2 plus chitosan-pVP1 (CS-pAIM2/CS-pVP1) at 7, 21, and 35d. Therapeutic efficacies of various vaccines were evaluated at day 56d. Compared with CS-pVP1 immunization, CS-pAIM2/CS-pVP1 co-immunization significantly increased survival rate, improved cardiac function, as well as decreased myocardial injury and fibrosis, this result indicated that CVB3-induced chronic myocarditis was alleviated. CVB3-specific T lymphocyte proliferation and cytotoxic T lymphocyte responses of the CS-pAIM2/CS-pVP1 co-immunization group were also increased. More interestingly, CS-pAIM2/CS-pVP1 co-immunization could facilitate CVB3-specific multifunctional CD8(+) T cell induction in the intestinal mucosa, and this induction was closely correlated with myocardial scores, this result indicated that CS-pAIM2/CS-pVP1 vaccine exhibits therapeutic efficacy by enhancing multifunctional CD8(+) T cells. This study may represent a novel therapy for CVB3-induced chronic myocarditis.

  20. Beta Interferon Regulation of Glucose Metabolism Is PI3K/Akt Dependent and Important for Antiviral Activity against Coxsackievirus B3

    PubMed Central

    Burke, J. D.; Platanias, L. C.

    2014-01-01

    ABSTRACT An effective type I interferon (IFN)-mediated immune response requires the rapid expression of antiviral proteins that are necessary to inhibit viral replication and virus spread. We provide evidence that IFN-β regulates metabolic events important for the induction of a rapid antiviral response: IFN-β decreases the phosphorylation of AMP-activated protein kinase (AMPK), coincident with an increase in intracellular ATP. Our studies reveal a biphasic IFN-β-inducible uptake of glucose by cells, mediated by phosphatidylinositol 3-kinase (PI3K)/Akt, and IFN-β-inducible regulation of GLUT4 translocation to the cell surface. Additionally, we provide evidence that IFN-β-regulated glycolytic metabolism is important for the acute induction of an antiviral response during infection with coxsackievirus B3 (CVB3). Last, we demonstrate that the antidiabetic drug metformin enhances the antiviral potency of IFN-β against CVB3 both in vitro and in vivo. Taken together, these findings highlight an important role for IFN-β in modulating glucose metabolism during a virus infection and suggest that the use of metformin in combination with IFN-β during acute virus infection may result in enhanced antiviral responses. IMPORTANCE Type I interferons (IFN) are critical effectors of an antiviral response. These studies describe for the first time a role for IFN-β in regulating metabolism—glucose uptake and ATP production—to meet the energy requirements of a robust cellular antiviral response. Our data suggest that IFN-β regulates glucose metabolism mediated by signaling effectors similarly to activation by insulin. Interference with IFN-β-inducible glucose metabolism diminishes the antiviral response, whereas treatment with metformin, a drug that increases insulin sensitivity, enhances the antiviral potency of IFN-β. PMID:24403577

  1. Cleavage of DAP5 by coxsackievirus B3 2A protease facilitates viral replication and enhances apoptosis by altering translation of IRES-containing genes.

    PubMed

    Hanson, P J; Ye, X; Qiu, Y; Zhang, H M; Hemida, M G; Wang, F; Lim, T; Gu, A; Cho, B; Kim, H; Fung, G; Granville, D J; Yang, D

    2016-05-01

    Cleavage of eukaryotic translation initiation factor 4G (eIF4G) by enterovirus proteases during infection leads to the shutoff of cellular cap-dependent translation, but does not affect the initiation of cap-independent translation of mRNAs containing an internal ribosome entry site (IRES). Death-associated protein 5 (DAP5), a structural homolog of eIF4G, is a translation initiation factor specific for IRES-containing mRNAs. Coxsackievirus B3 (CVB3) is a positive single-stranded RNA virus and a primary causal agent of human myocarditis. Its RNA genome harbors an IRES within the 5'-untranslated region and is translated by a cap-independent, IRES-driven mechanism. Previously, we have shown that DAP5 is cleaved during CVB3 infection. However, the protease responsible for cleavage, cleavage site and effects on the translation of target genes during CVB3 infection have not been investigated. In the present study, we demonstrated that viral protease 2A but not 3C is responsible for DAP5 cleavage, generating 45- and 52-kDa N- (DAP5-N) and C-terminal (DAP5-C) fragments, respectively. By site-directed mutagenesis, we found that DAP5 is cleaved at amino acid G434. Upon cleavage, DAP5-N largely translocated to the nucleus at the later time points of infection, whereas the DAP5-C largely remained in the cytoplasm. Overexpression of these DAP5 truncates demonstrated that DAP5-N retained the capability of initiating IRES-driven translation of apoptosis-associated p53, but not the prosurvival Bcl-2 (B-cell lymphoma 2) when compared with the full-length DAP5. Similarly, DAP5-N expression promoted CVB3 replication and progeny release; on the other hand, DAP5-C exerted a dominant-negative effect on cap-dependent translation. Taken together, viral protease 2A-mediated cleavage of DAP5 results in the production of two truncates that exert differential effects on protein translation of the IRES-containing genes, leading to enhanced host cell death.

  2. Synthesis of Pyrazine-1,3-thiazine Hybrid Analogues as Antiviral Agent Against HIV-1, Influenza A (H1N1), Enterovirus 71 (EV71), and Coxsackievirus B3 (CVB3).

    PubMed

    Wu, Hong-Min; Zhou, Kuo; Wu, Tao; Cao, Yin-Guang

    2016-09-01

    A novel series of pyrazine-1,3-thiazine hybrid conjugates were synthesized in excellent yield. These derivatives were subsequently tested against human immunodeficiency virus (HIV-1); hemagglutinin type 1 and neuraminidase type 1-'influenza' A (H1N1) virus; enterovirus 71 (EV71); and coxsackievirus B3. The effect of these conjugates on the key enzymes responsible for the progression of these viral infections was also illustrated via enzyme-based assay, such as HIV-1 reverse transcriptase (RT) and neuraminidase, where entire tested molecules showed considerable inhibition. Particularly, among the tested derivatives, compound 3k was identified as most promising inhibitor of HIV-1 with 94% of inhibition (IC50 3.26 ± 0.2 μm). Moreover, the compound 3d was found to be the most potent analogue to inhibit the H1N1 virus with IC50 of 5.32 ± 0.4 μm together with inhibition of the neuraminidase enzyme (IC50 11.24 ± 1.1 μm). In regard to inhibitory activity against enterovirus 71 (EV71) and coxsackievirus B3 (CVB3), the tested derivatives showed considerable inhibition of infection. Molecular docking studies were also performed for the most promising inhibitors with their corresponding target protein to exemplify the structural requirement for better inhibitory activity. The results of inhibitory assay showed that designed molecules possess considerable inhibitory activity against the virus tested.

  3. Specificity of coxsackievirus B3 interaction with human, but not murine, decay-accelerating factor: replacement of a single residue within short consensus repeat 2 prevents virus attachment.

    PubMed

    Pan, Jieyan; Zhang, Lili; Organtini, Lindsey J; Hafenstein, Susan; Bergelson, Jeffrey M

    2015-01-15

    Many coxsackievirus B (CVB) isolates bind to human decay-accelerating factor (DAF) as well as to the coxsackievirus and adenovirus receptor (CAR). However, the virus does not interact with murine DAF. To understand why CVB3 binds specifically to human DAF, we constructed a series of chimeric molecules in which specific regions of the human DAF molecule were replaced by the corresponding murine sequences. We found that replacement of human short consensus repeat 2 (SCR2) with murine SCR2 ablated virus binding to human DAF, as did deletion of human SCR2. Although replacement of human SCR4 had a partial inhibitory effect, deletion of SCR4 had no effect. Within human SCR2, replacement of serine 104 (S104) with the proline residue found in murine DAF eliminated virus binding. On the basis of the structure of the CVB3-DAF complex determined by cryo-electron microscopy, DAF S104 is in close contact with a viral capsid residue, a threonine at VP1 position 271. Replacement of this capsid residue with larger amino acids specifically eliminated virus attachment to human DAF but had no effect on attachment to CAR or replication in HeLa cells. Taken together, these results support the current model of virus-DAF interaction and point to a specific role for VP1 T271 and DAF S104 at the virus-DAF interface. The results of the present study point to a specific role for VP1 T271 and DAF S104 at the interface between CVB3 and DAF, and they demonstrate how subtle structural changes can dramatically influence virus-receptor interactions. In addition, the results support a recent pseudoatomic model of the CVB3-DAF interaction obtained by cryo-electron microscopy. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  4. Mutations in the 5’ NTR and the Non-Structural Protein 3A of the Coxsackievirus B3 Selectively Attenuate Myocarditogenicity

    PubMed Central

    Basavalingappa, Rakesh H.; Rajasekaran, Rajkumar A.; Vu, Hiep; Riethoven, Jean-Jack; Steffen, David; Pattnaik, Asit K.; Reddy, Jay

    2015-01-01

    The 5’ non-translated region (NTR) is an important molecular determinant that controls replication and virulence of coxsackievirus B (CVB)3. Previous studies have reported many nucleotide (nt) sequence differences in the Nancy strain of the virus, including changes in the 5’ NTR with varying degrees of disease severity. In our studies of CVB3-induced myocarditis, we sought to generate an infectious clone of the virus for routine in vivo experimentation. By determining the viral nt sequence, we identified three new nt substitutions in the clone that differed from the parental virus strain: C97U in the 5’ NTR; a silent mutation, A4327G, in non-structural protein 2C; and C5088U (resulting in P1449L amino acid change) in non-structural protein 3A of the virus leading us to evaluate the role of these changes in the virulence properties of the virus. We noted that the disease-inducing ability of the infectious clone-derived virus in three mouse strains was restricted to pancreatitis alone, and the incidence and severity of myocarditis were significantly reduced. We then reversed the mutations by creating three new clones, representing 1) U97C; 2) G4327A and U5088C; and 3) their combination together in the third clone. The viral titers obtained from all the clones were comparable, but the virions derived from the third clone induced myocarditis comparable to that induced by wild type virus; however, the pancreatitis-inducing ability remained unaltered, suggesting that the mutations described above selectively influence myocarditogenicity. Because the accumulation of mutations during passages is a continuous process in RNA viruses, it is possible that CVB3 viruses containing such altered nts may evolve naturally, thus favoring their survival in the environment. PMID:26098885

  5. TLR3 is required for survival following Coxsackievirus B3 infection by driving T lymphocyte activation and polarization: The role of dendritic cells.

    PubMed

    Sesti-Costa, Renata; Françozo, Marcela Cristina Santiago; Silva, Grace Kelly; Proenca-Modena, José Luiz; Silva, João Santana

    2017-01-01

    Type B coxsackievirus (CVB) is a common cause of acute and chronic myocarditis, meningitis and pancreatitis, often leading to heart failure and pancreatic deficiency. The polarization of CD4+ T lymphocytes and their cytokine milieu are key factors in the outcome of CVB-induced diseases. Thus, sensing the virus and driving the adaptive immune response are essential for the establishment of a protective immune response. TLR3 is a crucial virus recognition receptor that confers the host with resistance to CVB infection. In the current study, we found that TLR3 expression in dendritic cells plays a role in their activation upon CVB3 infection in vitro, as TLR3-deficient dendritic cells up-regulate CD80 and CD86 to a less degree than WT cells. Instead, they up-regulated the inhibitory molecule PD-L1 and secreted considerably lower levels of TNF-α and IL-10 and a higher level of IL-23. T lymphocyte proliferation in co-culture with CVB3-infected dendritic cells was increased by TLR3-expressing DCs and other cells. Furthermore, in the absence of TLR3, the T lymphocyte response was shifted toward a Th17 profile, which was previously reported to be deleterious for the host. TLR3-deficient mice were very susceptible to CVB3 infection, with increased pancreatic injury and extensive inflammatory infiltrate in the heart that was associated with uncontrolled viral replication. Adoptive transfer of TLR3+ dendritic cells slightly improved the survival of TLR-deficient mice following CVB3 infection. Therefore, our findings highlight the importance of TLR3 signaling in DCs and in other cells to induce activation and polarization of the CD4+ T lymphocyte response toward a Th1 profile and consequently for a better outcome of CVB3 infection. These data provide new insight into the immune-mediated mechanisms by which CVBs are recognized and cleared in order to prevent the development of myocarditis and pancreatitis and may contribute to the design of therapies for enteroviral infections.

  6. Viral Protein VP4 Is a Target of Human Antibodies Enhancing Coxsackievirus B4- and B3-Induced Synthesis of Alpha Interferon

    PubMed Central

    Chehadeh, Wassim; Lobert, Pierre-Emmanuel; Sauter, Pierre; Goffard, Anne; Lucas, Bernadette; Weill, Jacques; Vantyghem, Marie-Christine; Alm, Gunnar; Pigny, Pascal; Hober, Didier

    2005-01-01

    Coxsackievirus B4 (CVB4)-induced production of alpha interferon (IFN-α) by peripheral blood mononuclear cells (PBMC) is enhanced in vitro by nonneutralizing anti-CVB4 antibodies from healthy subjects and, to a higher extent, from patients with insulin-dependent diabetes mellitus. In this study, we focused on identification of the viral target of these antibodies in CVB systems. High levels of IFN-α were obtained in supernatants of PBMC incubated with CVB4E2 or CVB3 and plasma from healthy subjects and, to a higher extent, from patients. The VP4 capsid proteins dissociated by heating at 56°C from CVB4E2 (VP4CVB4) and CVB3 (VP4CVB3) but not H antigen preincubated with plasma from healthy subjects or patients inhibited the plasma-dependent enhancement of CVB4E2- and CVB3-induced IFN-α synthesis. There was no cross-reaction between VP4CVB4 and VP4CVB3 in the inhibiting effect. IFN-α levels in culture supernatants showed dose-dependent correlation with anti-VP4 antibodies eluted from plasma specimens using VP4-coated plates. There were higher index values for anti-VP4 antibodies detected by enzyme-linked immunosorbent assay (ELISA) and higher proportions of positive detection in 40 patients than in 40 healthy subjects (80% versus 15% for anti-VP4CVB4). There was no relationship between the levels of anti-CVB neutralizing antibodies and the detection of anti-VP4 antibodies by ELISA. The CVB plasma-induced IFN-α levels obtained in PBMC cultures in the anti-VP4 antibody-positive groups were significantly higher than those obtained in the anti-VP4 antibody-negative groups regardless of the titers of anti-CVB neutralizing antibodies. These results show that VP4 is the target of antibodies involved in the plasma-dependent enhancement of CVB4E2- and CVB3-induced IFN-α synthesis by PBMC. PMID:16254324

  7. Prevalence of multiple enteroviruses associated with hand, foot, and mouth disease in Shijiazhuang City, Hebei province, China: outbreaks of coxsackieviruses a10 and b3.

    PubMed

    Tian, Huifang; Zhang, Yong; Sun, Qiang; Zhu, Shuangli; Li, Xiujuan; Pan, Zhuo; Xu, Wenbo; Xu, Baohong

    2014-01-01

    Hand, foot, and mouth disease (HFMD) has been one of the most common infectious diseases in Shijiazhuang City, as is the situation in China overall. In the National HFMD surveillance system, the pathogen detection was focused on EV-A71 and CVA16, and therefore, information on the other EVs is very limited. In order to identify the circulating EV serotypes in the HFMD outbreaks in Shijiazhuang City during 2010-2012, 4045 patients presented with HFMD were recruited in the study, and clinical samples were investigated. Typing of EV serotypes was performed using the molecular typing methods, and phylogenetic analyses based on entire VP1 sequences of human enterovirus 71 (EV-A71), coxsackievirus A16 (CVA16), CVA10 and CVB3 was performed. The results revealed that EV-A71 and CVA16 were the 2 most important pathogens but the circulating trends of the 2 viruses showed a shift, the spread of EV-A71 became increasingly weak, whereas the spread of CVA16 became increasingly stronger. CVA10 and CVB3 were the third and fourth most prevalent pathogens, respectively. Co-infection of two viruses at the same time was not found in these samples. Based on entire VP1 region sequences, the phylogenetic analysis revealed that C4a subgenotype EV-A71, B1a and B1b subgenotype CVA16 continued to evolve. The CVA10 strains were assigned to 4 genotypes (A-D), whereas the CVB3 strains were assigned to 5 genotypes (A-E), with clear geographical and temporal-specific distributions. The Shijiazhuang CVA10 sequences belonged to 4 epidemic lineages within genotype C, whereas the Shijiazhuang CVB3 sequences belonged to 2 epidemic lineages within genotype E, which may have the same origins as the strains reported in other part of China. CVA10 and CVB3, 2 pathogens that were previously infrequently detected, were identified as pathogens causing the HFMD outbreaks. This study underscores the need for detailed laboratory-based surveillances of HFMD in mainland China.

  8. Coxsackievirus B3-induced calpain activation facilitates the progeny virus replication via a likely mechanism related with both autophagy enhancement and apoptosis inhibition in the early phase of infection: an in vitro study in H9c2 cells.

    PubMed

    Li, Minghui; Wang, Xinggang; Yu, Yong; Yu, Ying; Xie, Yeqing; Zou, Yunzeng; Ge, Junbo; Peng, Tianqing; Chen, Ruizhen

    2014-01-22

    Calpain is a family of neutral cysteine proteinase involved in many physiological and pathological processes including virus replication, autophagy and apoptosis. Previous study has indicated the involvement of calpain in pathogenesis of coxsackievirus B3 (CVB3)-induced myocarditis. Besides, many studies demonstrated that host cell autophagy and apoptosis mechanisms participate in virus life cycle. However, role of calpain in CVB3 replication via autophagy/apoptosis mechanisms has not been reported, which was discussed here in H9c2 cardiomyocytes. The data demonstrated that calpain was activated following CVB3 infection. Calpain inhibition decreased autophagy, indicating role of calpain in enhancing autophagy during CVB3 infection. Both calpain activity and autophagy were involved in facilitating CVB3 replication demonstrated by virus titer and CVB3 capsid protein VP1 expression alterations resulting from calpain inhibitor ALLN and autophagy inhibitor 3MA intervention. We also found that both calpain activity and autophagy suppressed caspase3 activity and host cell apoptosis 5-10h post-infection (p.i.). In summary, the present study shows that CVB3 infection of H9c2 cells hinders caspase3 activity provocation and cell apoptosis at least in the early phase of infection (5-10h p.i.) via calpain-induced autophagy enhancement, which might be a mechanism facilitating CVB3 replication in host cells.

  9. Modulation of cytokine expression by CD4+ T cells during coxsackievirus B3 infections of BALB/c mice initiated by cells expressing the gamma delta + T-cell receptor.

    PubMed Central

    Huber, S A; Mortensen, A; Moulton, G

    1996-01-01

    Two variants of coxsackievirus B3 have been used to investigate the pathogenesis of myocarditis in BALB/c mice. H3 virus induces moderate myocarditis and H310A1 virus induces minimal myocarditis, although both viruses infect and replicate in the heart. Cells expressing the gamma delta+ T-cell receptor composed 5 to 13% of the lymphocytes infiltrating the hearts of H3 virus-infected mice and belonged to either the CD4- CD8+ gamma delta+- or CD4- CD8- gamma delta+-cell population. Giving 5,000 gamma delta+ cells isolated from the hearts of H3 virus-infected mice to H310A1 virus-infected recipients restored myocarditis susceptibility in the recipient animals and shifted the pattern of cytokine production in the virus-immune CD4+-cell population from being predominantly interleukin-4 producing to being predominantly gamma interferon producing in the H310A1 virus-infected mice. Apoptosis was evident in the infiltrating lymphocyte population in the myocardia of H3 virus-infected mice by the terminal deoxynucleotidyl transferase-mediated dUTP-biotin nick-end labeling assay and in splenic lymphocytes by DNA fragmentation in agarose gel electrophoresis and was confined to the CD4+ population. No apoptosis was observed in H310A1 virus-infected mice, but apoptosis was induced subsequent to gamma delta +-T-cell transfer. These results are consistent with the hypothesis that gamma delta+ T cells may help modulate cytokine responses during virus infections in vivo and that apoptosis might be involved in this modulation. PMID:8627781

  10. Wnt11 gene therapy with adeno-associated virus 9 improves the survival of mice with myocarditis induced by coxsackievirus B3 through the suppression of the inflammatory reaction.

    PubMed

    Aoyama, Yutaka; Kobayashi, Koichi; Morishita, Yoshihiro; Maeda, Kengo; Murohara, Toyoaki

    2015-07-01

    The wnt signaling pathway plays important roles in development and in many diseases. Recently several reports suggest that non-canonical Wnt proteins contribute to the inflammatory response in adult animals. However, the effects of Wnt proteins on virus-induced myocarditis have not been explored. Here, we investigated the effect of Wnt11 protein in a model of myocarditis induced by coxsackievirus B3 (CVB3) using recombinant adeno-associated virus 9 (rAAV9). The effect of Wnt11 gene therapy on a CVB3-induced myocarditis model was examined using male BALB/c mice. Mice received a single intravenous injection of either rAAV9-Wnt11 or rAAV9-LacZ 2 weeks before intraperitoneal administration of CVB3. Intravenous injection of the rAAV9 vector resulted in efficient, durable, and relatively cardiac-specific transgene expression. Survival was significantly greater among rAAV9-Wnt11 treated mice than among mice treated with rAAV9-LacZ (87.5% vs. 54.1%, P < 0.05). Wnt11 expression also reduced the infiltration of inflammatory cells, necrosis of the myocardium, and suppressed the mRNA expression of inflammatory cytokines. This is the first report to show that Wnt11 expression improves the survival of mice with CVB3-induced myocarditis. AAV9-mediated Wnt11 gene therapy produces beneficial effects on cardiac function and increases the survival of mice with CVB3-induced myocarditis through the suppression of both infiltration of inflammatory cells and gene expression of inflammatory cytokines.

  11. Coxsackievirus B transmission and possible new roles for extracellular vesicles.

    PubMed

    Inal, Jameel M; Jorfi, Samireh

    2013-02-01

    Coxsackievirus B1, a member of the Picornaviridae family is a non-enveloped single-stranded RNA virus associated with human diseases including myocarditis and pancreatitis. Infection of the intestinal mucosa, lined by polarized epithelial cells, requires interaction of coxsackievirus with apically located DAF (decay-accelerating factor) before transport to the basolaterally located CAR (coxsackie and adenovirus receptor), where entry is mediated by endocytosis. As with many other non-enveloped viruses, coxsackievirus has to induce lysis of host cells in order to perpetuate infection. However, recent evidence indicates that virus spread to secondary sites is not only achieved by a lytic mechanism and a non-lytic cell-cell strategy has been suggested for coxsackievirus B3. A physical interaction between infected and non-infected cells has been shown to be an efficient mechanism for retroviral transmission and one type of extracellular vesicle, the exosome, has been implicated in HIV-1 transmission. HIV-1 also takes advantage of depolymerization of actin for spread between T-cells. Calpain-mediated depolymerization of the actin cytoskeleton, as a result of increases in intracellular calcium concentration during coxsackievirus infection, would result in a release of host cell-derived microvesicles. If so, we speculate that maybe such microvesicles, increasingly recognized as major vehicles mediating intercellular communication, could play a role in the intercellular transmission of non-enveloped viruses.

  12. Expression of coxsackievirus and adenovirus receptor (CAR)-Fc fusion protein in Pichia pastoris and characterization of its anti-coxsackievirus activity.

    PubMed

    Zhang, Kebin; Yu, Hua; Xie, Wei; Xu, Zihui; Zhou, Shiwen; Huang, Chunji; Sheng, Halei; He, Xiaomei; Xiong, Junzhi; Qian, Guisheng

    2013-04-15

    Coxsackievirus and adenovirus receptors (CARs) are the common cellular receptors which mediate coxsackievirus or adenovirus infection. Receptor trap therapy, which uses soluble viral receptors to block the attachment and internalization of virus, has been developed for the inhibition of virus infection. In this study, we have constructed a pPIC3.5K/CAR-Fc expression plasmid for the economical and scale-up production of CAR-Fc fusion protein in Pichia pastoris. The coding sequence of the fusion protein was optimized according to the host codon usage bias. The amount of the CAR-Fc protein to total cell protein was up to 10% by 1% methanol induction for 96h and the purity was up to 96% after protein purification. Next, the virus pull-down assay demonstrated the binding activity of the CAR-Fc to coxsackievirus. The analyses of MTT assay, immunofluorescence staining and quantitative real-time PCR after virus neutralization assay revealed that CAR-Fc could significantly block coxsackievirus B3 infection in vitro. In coxsackievirus B3 infected mouse models, CAR-Fc treatment reduced mortality, myocardial edema, viral loads and inflammation, suggesting the significant virus blocking effect in vivo. Our results indicated that the P. pastoris expression system could be used to produce large quantities of bioactive CAR-Fc for further clinical purpose.

  13. The RNA Template Channel of the RNA-Dependent RNA Polymerase as a Target for Development of Antiviral Therapy of Multiple Genera within a Virus Family

    PubMed Central

    van der Linden, Lonneke; Vives-Adrián, Laia; Selisko, Barbara; Ferrer-Orta, Cristina; Liu, Xinran; Lanke, Kjerstin; Ulferts, Rachel; De Palma, Armando M.; Tanchis, Federica; Goris, Nesya; Lefebvre, David; De Clercq, Kris; Leyssen, Pieter; Lacroix, Céline; Pürstinger, Gerhard; Coutard, Bruno; Canard, Bruno; Boehr, David D.; Arnold, Jamie J.; Cameron, Craig E.; Verdaguer, Nuria

    2015-01-01

    The genus Enterovirus of the family Picornaviridae contains many important human pathogens (e.g., poliovirus, coxsackievirus, rhinovirus, and enterovirus 71) for which no antiviral drugs are available. The viral RNA-dependent RNA polymerase is an attractive target for antiviral therapy. Nucleoside-based inhibitors have broad-spectrum activity but often exhibit off-target effects. Most non-nucleoside inhibitors (NNIs) target surface cavities, which are structurally more flexible than the nucleotide-binding pocket, and hence have a more narrow spectrum of activity and are more prone to resistance development. Here, we report a novel NNI, GPC-N114 (2,2'-[(4-chloro-1,2-phenylene)bis(oxy)]bis(5-nitro-benzonitrile)) with broad-spectrum activity against enteroviruses and cardioviruses (another genus in the picornavirus family). Surprisingly, coxsackievirus B3 (CVB3) and poliovirus displayed a high genetic barrier to resistance against GPC-N114. By contrast, EMCV, a cardiovirus, rapidly acquired resistance due to mutations in 3Dpol. In vitro polymerase activity assays showed that GPC-N114 i) inhibited the elongation activity of recombinant CVB3 and EMCV 3Dpol, (ii) had reduced activity against EMCV 3Dpol with the resistance mutations, and (iii) was most efficient in inhibiting 3Dpol when added before the RNA template-primer duplex. Elucidation of a crystal structure of the inhibitor bound to CVB3 3Dpol confirmed the RNA-binding channel as the target for GPC-N114. Docking studies of the compound into the crystal structures of the compound-resistant EMCV 3Dpol mutants suggested that the resistant phenotype is due to subtle changes that interfere with the binding of GPC-N114 but not of the RNA template-primer. In conclusion, this study presents the first NNI that targets the RNA template channel of the picornavirus polymerase and identifies a new pocket that can be used for the design of broad-spectrum inhibitors. Moreover, this study provides important new insight into the

  14. Development of potent inhibitors of the coxsackievirus 3C protease

    SciTech Connect

    Lee, Eui Seung; Lee, Won Gil; Yun, Soo-Hyeon; Rho, Seong Hwan; Im, Isak; Yang, Sung Tae; Sellamuthu, Saravanan; Lee, Yong Jae; Kwon, Sun Jae; Park, Ohkmae K.; Jeon, Eun-Seok; Park, Woo Jin . E-mail: wjpark@gist.ac.kr; Kim, Yong-Chul . E-mail: yongchul@gist.ac.kr

    2007-06-22

    Coxsackievirus B3 (CVB3) 3C protease (3CP) plays essential roles in the viral replication cycle, and therefore, provides an attractive therapeutic target for treatment of human diseases caused by CVB3 infection. CVB3 3CP and human rhinovirus (HRV) 3CP have a high degree of amino acid sequence similarity. Comparative modeling of these two 3CPs revealed one prominent distinction; an Asn residue delineating the S2' pocket in HRV 3CP is replaced by a Tyr residue in CVB3 3CP. AG7088, a potent inhibitor of HRV 3CP, was modified by substitution of the ethyl group at the P2' position with various hydrophobic aromatic rings that are predicted to interact preferentially with the Tyr residue in the S2' pocket of CVB3 3CP. The resulting derivatives showed dramatically increased inhibitory activities against CVB3 3CP. In addition, one of the derivatives effectively inhibited the CVB3 proliferation in vitro.

  15. Interspecies Differences in Virus Uptake versus Cardiac Function of the Coxsackievirus and Adenovirus Receptor

    PubMed Central

    Freiberg, Fabian; Sauter, Martina; Pinkert, Sandra; Govindarajan, Thirupugal; Kaldrack, Joanna; Thakkar, Meghna; Fechner, Henry; Klingel, Karin

    2014-01-01

    ABSTRACT The coxsackievirus and adenovirus receptor (CAR) is a cell contact protein with an important role in virus uptake. Its extracellular immunoglobulin domains mediate the binding to coxsackievirus and adenovirus as well as homophilic and heterophilic interactions between cells. The cytoplasmic tail links CAR to the cytoskeleton and intracellular signaling cascades. In the heart, CAR is crucial for embryonic development, electrophysiology, and coxsackievirus B infection. Noncardiac functions are less well understood, in part due to the lack of suitable animal models. Here, we generated a transgenic mouse that rescued the otherwise embryonic-lethal CAR knockout (KO) phenotype by expressing chicken CAR exclusively in the heart. Using this rescue model, we addressed interspecies differences in coxsackievirus uptake and noncardiac functions of CAR. Survival of the noncardiac CAR KO (ncKO) mouse indicates an essential role for CAR in the developing heart but not in other tissues. In adult animals, cardiac activity was normal, suggesting that chicken CAR can replace the physiological functions of mouse CAR in the cardiomyocyte. However, chicken CAR did not mediate virus entry in vivo, so that hearts expressing chicken instead of mouse CAR were protected from infection and myocarditis. Comparison of sequence homology and modeling of the D1 domain indicate differences between mammalian and chicken CAR that relate to the sites important for virus binding but not those involved in homodimerization. Thus, CAR-directed anticoxsackievirus therapy with only minor adverse effects in noncardiac tissue could be further improved by selectively targeting the virus-host interaction while maintaining cardiac function. IMPORTANCE Coxsackievirus B3 (CVB3) is one of the most common human pathogens causing myocarditis. Its receptor, the coxsackievirus and adenovirus receptor (CAR), not only mediates virus uptake but also relates to cytoskeletal organization and intracellular signaling

  16. Nitric oxide inhibition of coxsackievirus replication in vitro.

    PubMed Central

    Zaragoza, C; Ocampo, C J; Saura, M; McMillan, A; Lowenstein, C J

    1997-01-01

    Nitric oxide is a radical molecule with antibacterial, -parasitic, and -viral properties. We investigated the mechanism of NO inhibition of Coxsackievirus B3 (CVB3) replication in vitro by determining the effect of NO upon a single replicative cycle of CVB3 grown in HeLa cells. Transfection of inducible NO synthase cDNA into HeLa cells reduces the number of viral particles produced during a single cycle of growth. Similarly, a noncytotoxic concentration of the NO donor S-nitroso-amino-penicillamine reduces the number of viral particles in a dose-dependent manner. To explore the mechanisms by which NO exerts its antiviral effect, we assayed the attachment, replication, and translation steps of the CVB3 life cycle. NO does not affect the attachment of CVB3 to HeLa cells. However, NO inhibits CVB3 RNA synthesis, as shown by a [3H]uridine incorporation assay, reverse transcription-PCR, and Northern analysis. In addition, NO inhibits CVB3 protein synthesis, as shown by [35S]methionine protein labeling and Western blot analysis of infected cells. Thus, NO inhibits CVB3 replication in part by inhibiting viral RNA synthesis by an unknown mechanism. PMID:9312175

  17. Coxsackievirus-induced chronic myocarditis in murine models.

    PubMed

    Gauntt, C J; Tracy, S M; Chapman, N; Wood, H J; Kolbeck, P C; Karaganis, A G; Winfrey, C L; Cunningham, M W

    1995-12-01

    Challenge of several murine strains with two highly myocarditic variants of coxsackievirus B3 (CVB3) induced acute and chronic myocarditis, detectable at 21 and 45 days post-inoculation (p.i.). In-situ hybridization of coronal heart sections showing chronic inflammation with a radiolabelled CVB3 probe detected viral genomic RNA at day 7 p.i. but rarely at 21 or 45 days p.i., suggesting few murine heart cells actively replicate virus during chronic myocardial inflammation. Data will be presented that favour an alternative hypothesis, i.e. autoimmune responses to shared epitopes among CVB3 proteins, cardiac myosin and myocardial cell surface proteins (molecular mimicry) can affect the severity of chronic inflammation. Mice inoculated with human cardiac myosin (HM) prior to a CVB3m challenge develop less myocarditis than mice inoculated with virus only, suggesting that antibodies stimulated by HM bind virus, reduce the virus burden and provide protection. Mice inoculated with HM only develop non-neutralizing antibodies against purified CVB3m particles. Several strains of mice inoculated with specific synthetic peptides of HM produce antibodies against CVB3m and/or develop cardiomyopathy. Thus antigen-challenged mice can produce antibodies which cross-react among CVB3m HM or cardiac cells to protect or exacerbate heart disease.

  18. RNA-dependent DNA-polymerase activity in human milk.

    PubMed

    McFarlane, E S; Ryan, S M; Mann, E

    1975-08-01

    A simple method is described for testing milk specimens from nursing mothers for the presence of RNA-dependent DNA-polymerase activity. Positive results were obtained in five of 137 women (3.6%) without a family history of breast cancer, and in six of 31 women (19.3%) with a family history of breast cancer.

  19. RNA-Dependent RNA Polymerase Activity in Influenza Virions

    PubMed Central

    Penhoet, Edward; Miller, Henry; Doyle, Michael; Blatti, Stanley

    1971-01-01

    An RNA-dependent RNA polymerase activity has been detected in purified preparations of influenza virus. In contrast to the replicase activity induced in influenza-infected cells, the virion-associated enzyme has an absolute requirement for Mn++. Most of the RNA synthesized in vitro is complementary to virion RNA. PMID:5288388

  20. Evolution of tertiary structure of viral RNA dependent polymerases.

    PubMed

    Černý, Jiří; Černá Bolfíková, Barbora; Valdés, James J; Grubhoffer, Libor; Růžek, Daniel

    2014-01-01

    Viral RNA dependent polymerases (vRdPs) are present in all RNA viruses; unfortunately, their sequence similarity is too low for phylogenetic studies. Nevertheless, vRdP protein structures are remarkably conserved. In this study, we used the structural similarity of vRdPs to reconstruct their evolutionary history. The major strength of this work is in unifying sequence and structural data into a single quantitative phylogenetic analysis, using powerful a Bayesian approach. The resulting phylogram of vRdPs demonstrates that RNA-dependent DNA polymerases (RdDPs) of viruses within Retroviridae family cluster in a clearly separated group of vRdPs, while RNA-dependent RNA polymerases (RdRPs) of dsRNA and +ssRNA viruses are mixed together. This evidence supports the hypothesis that RdRPs replicating +ssRNA viruses evolved multiple times from RdRPs replicating +dsRNA viruses, and vice versa. Moreover, our phylogram may be presented as a scheme for RNA virus evolution. The results are in concordance with the actual concept of RNA virus evolution. Finally, the methods used in our work provide a new direction for studying ancient virus evolution.

  1. The Impact of Juvenile Coxsackievirus Infection on Cardiac Progenitor Cells and Postnatal Heart Development

    PubMed Central

    Sin, Jon; Puccini, Jenna M.; Huang, Chengqun; Konstandin, Mathias H.; Gilbert, Paul E.; Sussman, Mark A.; Gottlieb, Roberta A.; Feuer, Ralph

    2014-01-01

    Coxsackievirus B (CVB) is an enterovirus that most commonly causes a self-limited febrile illness in infants, but cases of severe infection can manifest in acute myocarditis. Chronic consequences of mild CVB infection are unknown, though there is an epidemiologic association between early subclinical infections and late heart failure, raising the possibility of subtle damage leading to late-onset dysfunction, or chronic ongoing injury due to inflammatory reactions during latent infection. Here we describe a mouse model of juvenile infection with a subclinical dose of coxsackievirus B3 (CVB3) which showed no evident symptoms, either immediately following infection or in adult mice. However following physiological or pharmacologically-induced cardiac stress, juvenile-infected adult mice underwent cardiac hypertrophy and dilation indicative of progression to heart failure. Evaluation of the vasculature in the hearts of adult mice subjected to cardiac stress showed a compensatory increase in CD31+ blood vessel formation, although this effect was suppressed in juvenile-infected mice. Moreover, CVB3 efficiently infected juvenile c-kit+ cells, and cardiac progenitor cell numbers were reduced in the hearts of juvenile-infected adult mice. These results suggest that the exhausted cardiac progenitor cell pool following juvenile CVB3 infection may impair the heart's ability to increase capillary density to adapt to increased load. PMID:25079373

  2. Coxsackievirus B Infection Is Highly Related with Missed Abortion in Korea

    PubMed Central

    Hwang, Jung Hye; Kim, Jeong Wook; Hwang, Ji Young; Lee, Kyung Min; Shim, Hye Min; Bae, Young Kyung; Paik, Seung Sam

    2014-01-01

    Purpose This study investigated the possible relationship between viral infection and first trimester pregnancy loss. Materials and Methods A prospective study was performed on 51 gravidas with missed abortion, fetal anomaly, pre-term delivery, and full-tem delivery at Hanyang University Hospital. Enteroviruses were detected by semi-nested reverse transcription-polymerase chain reaction (RT-PCR) and immunohistochemistry in abortive tissues and placentas. Enterovirus serotypes were confirmed by genome sequencing. Herpesviruses were detected by PCR. Results Coxsackievirus B3 (CVB3) was detected in 8 of 14 missed abortion cases, 1 of 27 full-term cases, and none of the 9 pre-term cases. Coxsackievirus B1 (CVB1) was detected in an encephalocele case. Herpes simplex virus type 1 was found in 4 full-term cases, 3 pre-term cases, and none of the missed abortion cases. Conclusion The prevalence of CVB3 was significantly higher in missed abortion cases compared to full-term or pre-term delivery cases. CVB infection may therefore be an important etiological agent of missed abortion. PMID:25323892

  3. Cleavage of Grb2-Associated Binding Protein 2 by Viral Proteinase 2A during Coxsackievirus Infection

    PubMed Central

    Deng, Haoyu; Fung, Gabriel; Qiu, Ye; Wang, Chen; Zhang, Jingchun; Jin, Zheng-Gen; Luo, Honglin

    2017-01-01

    Coxsackievirus type B3 (CV-B3), an enterovirus associated with the pathogenesis of several human diseases, subverts, or employs the host intracellular signaling pathways to support effective viral infection. We have previously demonstrated that Grb2-associated binding protein 1 (GAB1), a signaling adaptor protein that serves as a platform for intracellular signaling assembly and transduction, is cleaved upon CV-B3 infection, resulting in a gain-of-pro-viral-function via the modification of GAB1-mediated ERK1/2 pathway. GAB2 is a mammalian homolog of GAB1. In this study, we aim to address whether GAB2 plays a synergistic role with GAB1 in the regulation of CV-B3 replication. Here, we reported that GAB2 is also a target of CV-B3-encoded viral proteinase. We showed that GAB2 is cleaved at G238 during CV-B3 infection by viral proteinase 2A, generating two cleaved fragments of GAB2-N1−237 and GAB2-C238−676. Moreover, knockdown of GAB2 significantly inhibits the synthesis of viral protein and subsequent viral progeny production, accompanied by reduced levels of phosphorylated p38, suggesting a pro-viral function for GAB2 linked to p38 activation. Finally, we examined whether the cleavage of GAB2 can promote viral replication as observed for GAB1 cleavage. We showed that expression of neither GAB2-N1−237 nor GAB2-C238−676 results in enhanced viral infectivity, indicating a loss-of-function, rather than a gain-of-function of GAB2 cleavage in mediating virus replication. Taken together, our findings in this study suggest a novel host defense machinery through which CV-B3 infection is limited by the cleavage of a pro-viral protein. PMID:28361043

  4. Structure-Function Relationships Among RNA-Dependent RNA Polymerases

    PubMed Central

    Ng, Kenneth K.-S.; Arnold, Jamie J.; Cameron, Craig E.

    2008-01-01

    RNA-dependent RNA polymerases (RdRPs) play key roles in viral transcription and genome replication, as well as epigenetic and post-transcriptional control of cellular gene expression. In this article, we review the crystallographic, biochemical, and molecular genetic data available for viral RdRPs that have led to a detailed description of substrate and cofactor binding, fidelity of nucleotide selection and incorporation, and catalysis. It is likely that the cellular RdRPs will share some of the basic structural and mechanistic principles gleaned from studies of viral RdRPs. Therefore, studies of the viral RdRP establish a framework for the study of cellular RdRPs, an important yet understudied class of nucleic acid polymerases. PMID:18268843

  5. Interstitial contacts in an RNA-dependent RNA polymerase lattice

    PubMed Central

    Tellez, Andres B.; Wang, Jing; Tanner, Elizabeth J.; Spagnolo, Jeannie F.; Kirkegaard, Karla; Bullitt, Esther

    2011-01-01

    Catalytic activities can be facilitated by ordered enzymatic arrays that co-localize and orient enzymes and their substrates. The purified RNA-dependent RNA polymerase from poliovirus self-assembles to form two-dimensional lattices, possibly facilitating the assembly of viral RNA replication complexes on the cytoplasmic face of intracellular membranes. Creation of a two-dimensional lattice requires at least two different molecular contacts between polymerase molecules. One set of polymerase contacts, between the ‘thumb’ domain of one polymerase and the back of the ‘palm’ domain of another, has been previously defined. To identify the second interface needed for lattice formation and to test its function in viral RNA synthesis, a hybrid approach of both electron microscopic and biochemical evaluation of wild-type and mutant viral polymerases was used to evaluate computationally generated models of this second interface. A unique solution satisfied all constraints and predicted a two-dimensional structure formed from antiparallel arrays of polymerase fibers that use contacts from the flexible amino-terminal region of the protein. Enzymes that contained mutations in this newly defined interface did not form lattices and altered the structure of wild-type lattices. When reconstructed into virus, mutations that disrupt lattice assembly exhibited growth defects, synthetic lethality, or both, supporting the function of the oligomeric lattice in infected cells. Understanding the structure of polymerase lattices within the multimeric RNA-dependent RNA polymerase complex should faciliate antiviral drug design and provide a precedent for other positive-strand RNA viruses. PMID:21839092

  6. c-erbB-3

    PubMed Central

    Offterdinger, Martin; Schöfer, Christian; Weipoltshammer, Klara; Grunt, Thomas W.

    2002-01-01

    c-erbB receptors are usually located in cell membranes and are activated by extracellular binding of EGF-like growth factors. Unexpectedly, using immunofluorescence we found high levels of c-erbB-3 within the nuclei of MTSV1-7 immortalized nonmalignant human mammary epithelial cells. Nuclear localization was mediated by the COOH terminus of c-erbB-3, and a nuclear localization signal was identified by site-directed mutagenesis and by transfer of the signal to chicken pyruvate kinase. A nuclear export inhibitor caused accumulation of c-erbB-3 in the nuclei of other mammary epithelial cell lines as demonstrated by immunofluorescence and biochemical cell fractionation, suggesting that c-erbB-3 shuttles between nuclear and nonnuclear compartments in these cells. Growth of MTSV1-7 on permeable filters induced epithelial polarity and concentration of c-erbB-3 within the nucleoli. However, the c-erbB-3 ligand heregulin β1 shifted c-erbB-3 from the nucleolus into the nucleoplasm and then into the cytoplasm. The subcellular localization of c-erbB-3 obviously depends on exogenous stimuli and on the stage of epithelial polarity and challenges the specific function of c-erbB-3 as a transmembrane receptor protein arguing for additional, as yet unidentified, roles of c-erbB-3 within the nucle(ol)us of mammary epithelial cells. PMID:12045181

  7. Coxsackievirus A6-induced hand-foot-mouth disease.

    PubMed

    Stewart, Campbell L; Chu, Emily Y; Introcaso, Camille E; Schaffer, Andras; James, William D

    2013-12-01

    Hand-foot-mouth disease (HFMD) is an acute, self-limited, highly contagious viral illness that commonly affects children younger than 5 years. It is most typically caused by enterovirus 71 or coxsackievirus A16 and results in asymptomatic infection or mild disease. Immunocompetent adults are rarely affected. Recently, there have been increasing reports of a more severe form of HFMD associated with fevers, joint pains, and widespread painful eruptions. Some of these patients required hospitalization for supportive care. These severe cases were most commonly caused by coxsackievirus A6. We describe a 37-year-old white man with widespread, crusted, pruritic papules on the scalp, ears, and face and a purpuric and targetoid painful vesicular eruption on his hands and feet, with associated fevers, neurologic symptoms, and arthritis, who required hospitalization for supportive care. His infection with coxsackievirus A6 was confirmed based on polymerase chain reaction from his oral mucosa and cutaneous vesicle fluid. Dermatologists should be familiar with the severe variant of HFMD caused by coxsackievirus A6, include it in their differential diagnosis of acute febrile blistering diseases, and be aware that certain patients may require hospitalization.

  8. 21 CFR 866.3145 - Coxsackievirus serological reagents.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Coxsackievirus serological reagents. 866.3145 Section 866.3145 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES... produce a variety of infections, including common colds, meningitis (inflammation of brain and spinal...

  9. 21 CFR 866.3145 - Coxsackievirus serological reagents.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Coxsackievirus serological reagents. 866.3145 Section 866.3145 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES... produce a variety of infections, including common colds, meningitis (inflammation of brain and spinal...

  10. 21 CFR 866.3145 - Coxsackievirus serological reagents.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Coxsackievirus serological reagents. 866.3145 Section 866.3145 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES... produce a variety of infections, including common colds, meningitis (inflammation of brain and spinal...

  11. 21 CFR 866.3145 - Coxsackievirus serological reagents.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Coxsackievirus serological reagents. 866.3145 Section 866.3145 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES... produce a variety of infections, including common colds, meningitis (inflammation of brain and spinal...

  12. 21 CFR 866.3145 - Coxsackievirus serological reagents.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Coxsackievirus serological reagents. 866.3145 Section 866.3145 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES... produce a variety of infections, including common colds, meningitis (inflammation of brain and spinal...

  13. Coxsackievirus A6 and hand, foot, and mouth disease, Finland.

    PubMed

    Osterback, Riikka; Vuorinen, Tytti; Linna, Mervi; Susi, Petri; Hyypiä, Timo; Waris, Matti

    2009-09-01

    During fall 2008, an outbreak of hand, foot, and mouth disease (HFMD) with onychomadesis (nail shedding) as a common feature occurred in Finland. We identified an unusual enterovirus type, coxsackievirus A6 (CVA6), as the causative agent. CVA6 infections may be emerging as a new and major cause of epidemic HFMD.

  14. Coxsackievirus A6 and Hand, Foot, and Mouth Disease, Finland

    PubMed Central

    Österback, Riikka; Vuorinen, Tytti; Linna, Mervi; Susi, Petri; Hyypiä, Timo

    2009-01-01

    During fall 2008, an outbreak of hand, foot, and mouth disease (HFMD) with onychomadesis (nail shedding) as a common feature occurred in Finland. We identified an unusual enterovirus type, coxsackievirus A6 (CVA6), as the causative agent. CVA6 infections may be emerging as a new and major cause of epidemic HFMD. PMID:19788821

  15. Origin and Evolution of RNA-Dependent RNA Polymerase.

    PubMed

    de Farias, Savio T; Dos Santos Junior, Ariosvaldo P; Rêgo, Thais G; José, Marco V

    2017-01-01

    RNA-dependent RNA polymerases (RdRp) are very ancient enzymes and are essential for all viruses with RNA genomes. We reconstruct the origin and evolution of this polymerase since the initial stages of the origin of life. The origin of the RdRp was traced back from tRNA ancestors. At the origin of the RdRp the most ancient part of the protein is the cofactor-binding site that had the capacity of binding to simple molecules as magnesium, calcium, and ribonucleotides. Our results suggest that RdRp originated from junctions of proto-tRNAs that worked as the first genes at the emergence of the primitive translation system, where the RNA was the informational molecule. The initial domain, worked as a building block for the emergence of the fingers and thumb domains. From the ancestral RdRp, we could establish the evolutionary stages of viral evolution from a rooted ancestor to modern viruses. It was observed that the selective pressure under the RdRp was the organization and functioning of the genome, where RNA double-stranded and RNA single-stranded virus formed a separate group. We propose an evolutionary route to the polymerases and the results suggest an ancient scenario for the origin of RNA viruses.

  16. Functional oligomerization of poliovirus RNA-dependent RNA polymerase.

    PubMed Central

    Pata, J D; Schultz, S C; Kirkegaard, K

    1995-01-01

    Using a hairpin primer/template RNA derived from sequences present at the 3' end of the poliovirus genome, we investigated the RNA-binding and elongation activities of highly purified poliovirus 3D polymerase. We found that surprisingly high polymerase concentrations were required for efficient template utilization. Binding of template RNAs appeared to be the primary determinant of efficient utilization because binding and elongation activities correlated closely. Using a three-filter binding assay, polymerase binding to RNA was found to be highly cooperative with respect to polymerase concentration. At pH 5.5, where binding was most cooperative, a Hill coefficient of 5 was obtained, indicating that several polymerase molecules interact to retain the 110-nt RNA in a filter-bound complex. Chemical crosslinking with glutaraldehyde demonstrated physical polymerase-polymerase interactions, supporting the cooperative binding data. We propose a model in which poliovirus 3D polymerase functions both as a catalytic polymerase and as a cooperative single-stranded RNA-binding protein during RNA-dependent RNA synthesis. Images FIGURE 1 FIGURE 2 FIGURE 5 FIGURE 6 FIGURE 8 PMID:7489508

  17. Iron and copper accumulation in the brain of coxsackievirus-infected mice exposed to cadmium

    SciTech Connect

    Ilbaeck, N.-G. . E-mail: nils-gunnar.ilback@slv.se; Lindh, U.; Minqin, R.; Friman, G.; Watt, F.

    2006-11-15

    Cadmium (Cd) is a potentially toxic metal widely distributed in the environment and known to cause adverse health effects in humans. During coxsackievirus infection, the concentrations of essential and nonessential trace elements (e.g., iron (Fe), copper (Cu), and Cd) change in different target organs of the infection. Fe and Cu are recognized cofactors in host defence reactions, and Fe is known to be associated with certain pathological conditions of the brain. However, whether nonessential trace elements could influence the balance of essential trace elements in the brain is unknown. In this study the brain Fe, Cu, and Cd contents were measured through inductively coupled plasma mass spectrometry and their distributions determined by nuclear microscopy in the early phase (day 3) of coxsackievirus B3 (CB3) infection in nonexposed and in Cd-exposed female Balb/c mice. In CB3 infection the brain is a well-known target that has not been studied with regard to trace element balance. The brain concentration of Cu compared with that of noninfected control mice was increased by 9% (P<0.05) in infected mice not exposed to Cd and by 10% (not significant) in infected Cd-exposed mice. A similar response was seen for Fe, which in infected Cd-exposed mice, compared to noninfected control mice, tended to increase by 16%. Cu showed an even tissue distribution, whereas Fe was distributed in focal deposits. Changes in Cd concentration in the brain of infected mice were less consistent but evenly distributed. Further studies are needed to define whether the accumulation and distribution of trace elements in the brain have an impact on brain function.

  18. Enzyme-linked immunosorbent assay for detection and identification of coxsackieviruses A.

    PubMed Central

    Yolken, R H; Torsch, V M

    1981-01-01

    Coxsackieviruses A are known to cause a wide range of human disease processes. However, because many coxsackieviruses A present in clinical specimens do not produce a recognizable cytopathic effect in readily available tissue culture systems, infections with coxsackieviruses A are often difficult to diagnose. We have thus developed enzyme-linked immunosorbent assay (ELISA) systems for the detection and serotyping of coxsackievirus A antigens. The assays consist of a double-antibody ELISA which utilizes type-specific monkey and mouse coxsackievirus antisera. Although some cross-reactivity was noted, the ELISA systems correctly identified the serotypes of 22 to 23 coxsackievirus A complement fixation antigens available for testing. Testing of tissue culture fluids revealed that antigen could often be detected by ELISA before the appearance of a cytopathic effect. In addition, the infecting coxsackievirus A antigen could be unequivocally identified in 8 of 11 stool specimens obtained from patients with coxsackievirus A infections. The ELISA system might thus represent an important tool in the diagnosis and study of coxsackievirus A infections. PMID:6260675

  19. Hand, foot, and mouth disease caused by coxsackievirus A6, Thailand, 2012.

    PubMed

    Puenpa, Jiratchaya; Chieochansin, Thaweesak; Linsuwanon, Piyada; Korkong, Sumeth; Thongkomplew, Siwanat; Vichaiwattana, Preyaporn; Theamboonlers, Apiradee; Poovorawan, Yong

    2013-04-01

    In Thailand, hand, foot, and mouth disease (HFMD) is usually caused by enterovirus 71 or coxsackievirus A16. To determine the cause of a large outbreak of HFMD in Thailand during June-August 2012, we examined patient specimens. Coxsackievirus A6 was the causative agent. To improve prevention and control, causes of HFMD should be monitored.

  20. Genome Sequence of a Novel Recombinant Coxsackievirus A6 Strain from Shanghai, China, 2013

    PubMed Central

    Feng, Xiaobo; Guan, Wencai; Guo, Yifeng; Yu, Huiju; Zhang, Xiaoling; Cheng, Ruhong; Wang, Zhen; Zhang, Zhen; Zhang, Jia; Li, Huaguo; Zhuang, Yin; Zhang, Hui; Lu, Zhiyong; Li, Ming; Yu, Hong; Bao, Yixiao

    2015-01-01

    A novel recombinant coxsackievirus A6 (CVA6) strain was isolated during a coxsackievirus A6 outbreak in Shanghai, China, in 2013. Genomic sequence and similarity plot analysis showed that the novel CVA6 strain shared higher similarity with a recent CVA4 strain rather than the recent CVA6 strain in the 2C and 3′ untranslated regions (UTRs). PMID:25573929

  1. Loss of Virus-Specific Memory T. cells in Coxsackievirus B3 and B4 Infected Mice

    EPA Science Inventory

    There are two major types of enteroviruses: polioviruses and non-polio enteroviruses. While vaccines have effectively eliminated poliovirus infections, no vaccine is currently available for the non-polio enteroviruses. Generation of long-term pathogen specific memory cells is cri...

  2. Increased expressions of IL-22 and Th22 cells in the coxsackievirus B3-Induced mice acute viral myocarditis.

    PubMed

    Kong, Qing; Wu, Weifeng; Yang, Fan; Liu, Yanli; Xue, Yimin; Gao, Mengsha; Lai, Wenyin; Pan, Xiaofen; Yan, Yuluan; Pang, Yu; Deng, Yuanhua

    2012-10-11

    Recently, a new subset of T helper (Th) cell that predominantly secret cytokine interleukin-22 (IL-22) is identified, termed Th22 cells. The Th22 subset has been demonstrated to be involved in immunity and tissue inflammation. However, the existence of Th22 cells and role of IL-22 in acute viral myocarditis (AVMC) remain unknown. BALB/c mice were intraperitoneally (i.p) infected with CVB3 for establishing AVMC models. Control mice were treated with phosphate-buffered saline (PBS) i.p. On day 14 post injection, frequencies of splenic Th22 cells were determined, productions of IL-22 and expressions of IL-22R (IL-22 receptor) were measured. To further investigate the effects of IL-22, AVMC mice treated with Anti-IL-22 neutralizing antibody were explored. The severity of AVMC were monitored; the frequencies of Th22 cells, the expressions of IL-22 and IL-22R were investigated; in addition to IFN-γ, inflammatory cytokines IL-17, TNF-α, IL-6 as well as IL-1β, were evaluated. Cardiac viral replication were detected. Compared with control group, significant elevations of circulating Th22 cells and IL-22, cardiac protein and mRNA of IL-22, and IL-22R1 were demonstrated in AVMC group. Treatment of AVMC mice with Anti-IL-22 Ab exacerbated the severity of viral myocarditis, verified by lower survival rate, higher HW/BW ratios and cardiac pathological scores. Anti-IL-22 Ab decreased the frequencies of Th22 cells and the levels of IL-22, and increased the expressions of cardiac IL-22R1. Up-regulations of IL-17, IL-6 and TNF-α, down-regulations of IFN-γ proteins and gene expressions in the plasma and myocardium, were observed in Anti-IL-22 Ab group. Furthermore, neutralization of IL-22 significantly promoted cardiac viral replication. Our data indicate that the increased frequencies of IL-22-producing Th22 cells may play an important role in the pathogenesis of CVB3-induced mice AVMC, IL-22 may act as an myocardium-protective cytokine via the IL-22-IL-22R pathway, and suggest that targeting the Th22 cell and IL-22-IL-22R pathway could provide new therapeutic modalities for the treatment of CVB3-induced AVMC.

  3. Increased Expressions of IL-22 and Th22 cells in the coxsackievirus B3-Induced mice acute viral myocarditis

    PubMed Central

    2012-01-01

    Background Recently, a new subset of T helper (Th) cell that predominantly secret cytokine interleukin-22 (IL-22) is identified, termed Th22 cells. The Th22 subset has been demonstrated to be involved in immunity and tissue inflammation. However, the existence of Th22 cells and role of IL-22 in acute viral myocarditis (AVMC) remain unknown. Methods BALB/c mice were intraperitoneally (i.p) infected with CVB3 for establishing AVMC models. Control mice were treated with phosphate-buffered saline (PBS) i.p. On day 14 post injection, frequencies of splenic Th22 cells were determined, productions of IL-22 and expressions of IL-22R (IL-22 receptor) were measured. To further investigate the effects of IL-22, AVMC mice treated with Anti-IL-22 neutralizing antibody were explored. The severity of AVMC were monitored; the frequencies of Th22 cells, the expressions of IL-22 and IL-22R were investigated; in addition to IFN-γ, inflammatory cytokines IL-17, TNF-α, IL-6 as well as IL-1β, were evaluated. Cardiac viral replication were detected. Results Compared with control group, significant elevations of circulating Th22 cells and IL-22, cardiac protein and mRNA of IL-22, and IL-22R1 were demonstrated in AVMC group. Treatment of AVMC mice with Anti-IL-22 Ab exacerbated the severity of viral myocarditis, verified by lower survival rate, higher HW/BW ratios and cardiac pathological scores. Anti-IL-22 Ab decreased the frequencies of Th22 cells and the levels of IL-22, and increased the expressions of cardiac IL-22R1. Up-regulations of IL-17, IL-6 and TNF-α, down-regulations of IFN-γ proteins and gene expressions in the plasma and myocardium, were observed in Anti-IL-22 Ab group. Furthermore, neutralization of IL-22 significantly promoted cardiac viral replication. Conclusions Our data indicate that the increased frequencies of IL-22-producing Th22 cells may play an important role in the pathogenesis of CVB3-induced mice AVMC, IL-22 may act as an myocardium-protective cytokine via the IL-22–IL-22R pathway, and suggest that targeting the Th22 cell and IL-22–IL-22R pathway could provide new therapeutic modalities for the treatment of CVB3-induced AVMC. PMID:23050732

  4. Loss of Virus-Specific Memory T. cells in Coxsackievirus B3 and B4 Infected Mice

    EPA Science Inventory

    There are two major types of enteroviruses: polioviruses and non-polio enteroviruses. While vaccines have effectively eliminated poliovirus infections, no vaccine is currently available for the non-polio enteroviruses. Generation of long-term pathogen specific memory cells is cri...

  5. Amiloride inhibits the initiation of Coxsackievirus and poliovirus RNA replication by inhibiting VPg uridylylation.

    PubMed

    Ogram, Sushma A; Boone, Christopher D; McKenna, Robert; Flanegan, James B

    2014-09-01

    The mechanism of amiloride inhibition of Coxsackievirus B3 (CVB3) and poliovirus type 1 (PV1) RNA replication was investigated using membrane-associated RNA replication complexes. Amiloride was shown to inhibit viral RNA replication and VPgpUpU synthesis. However, the drug had no effect on polymerase elongation activity during either (-) strand or (+) strand synthesis. These findings indicated that amiloride inhibited the initiation of RNA synthesis by inhibiting VPg uridylylation. In addition, in silico binding studies showed that amiloride docks in the VPg binding site on the back of the viral RNA polymerase, 3D(pol). Since VPg binding at this site on PV1 3D(pol) was previously shown to be required for VPg uridylylation, our results suggest that amiloride inhibits VPg binding to 3D(pol). In summary, our findings are consistent with a model in which amiloride inhibits VPgpUpU synthesis and viral RNA replication by competing with VPg for binding to 3D(pol).

  6. Targeted Delivery of Anti-coxsackievirus siRNAs Using Ligand-conjugated Packaging RNAs

    PubMed Central

    Zhang, Huifang M.; Su, Yue; Guo, Songchuan; Yuan, Ji; Lim, Travis; Liu, Jing; Guo, Peixuan; Yang, Decheng

    2013-01-01

    Coxsackievirus B3 (CVB3) is a common pathogen of myocarditis. We previously synthesized a siRNA targeting the CVB3 protease 2A (siRNA/2A) gene and achieved reduction of CVB3 replication by 92% in vitro. However, like other drugs under development, CVB3 siRNA faces a major challenge of targeted delivery. In this study, we investigated a novel approach to deliver CVB3 siRNAs to a specific cell population (e.g. HeLa cells containing folate receptor) using receptor ligand (folate)-linked packaging RNA (pRNA) from bacterial phage phi29. pRNA monomers can spontaneously form dimers and multimers under optimal conditions by base-pairing between their stem loops. By covalently linking a fluorescence-tag to folate, we delivered the conjugate specifically to HeLa cells without the need of transfection. We further demonstrated that pRNA covalently conjugated to siRNA/2A achieved an equivalent antiviral effect to that of the siRNA/2A alone. Finally, the drug targeted delivery was further evaluated by using pRNA monomers or dimers, which carried both the siRNA/2A and folate ligand and demonstrated that both of them strongly inhibited CVB3 replication. These data indicate that pRNA as a siRNA carrier can specifically deliver the drug to target cells via its ligand and specific receptor interaction and inhibit virus replication effectively. PMID:19616030

  7. Ongoing Coxsackievirus Myocarditis Is Associated with Increased Formation and Activity of Myocardial Immunoproteasomes

    PubMed Central

    Szalay, Gudrun; Meiners, Silke; Voigt, Antje; Lauber, Jörg; Spieth, Christian; Speer, Nora; Sauter, Martina; Kuckelkorn, Ulrike; Zell, Andreas; Klingel, Karin; Stangl, Karl; Kandolf, Reinhard

    2006-01-01

    A growing body of evidence indicates that viral infections of the heart contribute to ongoing myocarditis and dilated cardiomyopathy. Murine models of coxsackievirus B3 (CVB3)-induced myocarditis mimic the human disease and allow identification of susceptibility factors that modulate the course of viral myocarditis. Susceptible mouse strains develop chronic myocarditis on the basis of restricted viral replication, whereas resistant strains recover after successful virus elimination. In comparative whole-genome microarray analyses of infected hearts, several genes involved in the processing and presentation of viral epitopes were found to be uniformly up-regulated in acutely CVB3-infected susceptible mice compared with resistant animals. In particular, expression of the catalytic subunits LMP2, LMP7, and MECL-1, immunoproteasome proteins important in the generation of major histocompatibility complex (MHC) class I-restricted peptides, was clearly enhanced in the susceptible host. Increased expression resulted in enhanced formation of immunoproteasomes and altered proteolytic activities of proteasomes in the heart. This was accompanied by a concerted up-regulation of the antigen-presenting machinery in susceptible mice. Thus, we propose that increased formation of immunoproteasomes in susceptible mice affects the generation of antigenic peptides and the subsequent T-cell-mediated immune responses. PMID:16651621

  8. Evaluation of Coxsackievirus Infection in Children with Human Immunodeficiency Virus Type 1–Associated Cardiomyopathy

    PubMed Central

    Jenson, Hal B.; Gauntt, Charles J.; Easley, Kirk A.; Pitt, Jane; Lipshultz, Steven E.; McIntosh, Kenneth; Shearer, William T.

    2015-01-01

    In a matched case-control study of the association between coxsackieviruses and cardiac impairment, 24 human immunodeficiency virus (HIV) type 1–infected children with cardiac impairment were compared with 24 HIV-1–infected control subjects. Serologic evidence of coxsackievirus infection was present in all children, with no significant difference in geometric mean antibody titers between case patients and control subjects. Conditional logistic regression to test for an association between coxsackievirus antibody titer and the presence or absence of cardiac impairment, by any indicator, showed an odds ratio of 1.11 (95% confidence interval, 0.58–2.10; P = .75), indicating no association between coxsackievirus infection and cardiac impairment. Coxsackievirus antibody titers correlated positively with total IgG levels in nonrapid progressors but not in rapid progressors. Paired serum samples taken before and after diagnosis of cardiac impairment in 5 patients showed no evidence of intervening coxsackievirus infection. These results do not identify a causal role for coxsackieviruses for cardiomyopathy in HIV-1–infected children. PMID:12085328

  9. STRAIN DIFFERENTIATION AND DETERMINATION OF CAPSID PROTEINS OF COXSACKIEVIRUS BY MALDI-MS

    EPA Science Inventory

    Introduction: Contamination of viruses in water environments (rivers, lakes, sources of drinking water) is a new threat and serious health problem. Amongst organisms discharged from sewage septic systems is the coxsackievirus (single-stranded RNA virus). Differentiation betwee...

  10. STRAIN DIFFERENTIATION AND DETERMINATION OF CAPSID PROTEINS OF COXSACKIEVIRUS BY MALDI-MS

    EPA Science Inventory

    Introduction: Contamination of viruses in water environments (rivers, lakes, sources of drinking water) is a new threat and serious health problem. Amongst organisms discharged from sewage septic systems is the coxsackievirus (single-stranded RNA virus). Differentiation betwee...

  11. Ventricular aneurysms complicating coxsackievirus group B, types 1 and 4 murine myocarditis.

    PubMed

    El-Khatib, M R; Chason, J L; Lerner, A M

    1979-02-01

    Suckling Swiss Webster mice were inoculated with 10(4)TCD50 of coxsackieviruses, group B types 1 or 4. Virulent necrotizing myocarditis resulted in 185 infected mice. Of the latter group, three (14.3%) nurslings on the 17th and 23rd day after inoculations had left ventricular aneurysms postmortem. None of 61 concurrently matched control mice developed aneurysms. Ventricular aneurysm is a suggested but previously undocumented complication of murine, and possibly human necrotizing transmural coxsackievirus myocarditis.

  12. A structural and primary sequence comparison of the viral RNA-dependent RNA polymerases

    PubMed Central

    Bruenn, Jeremy A.

    2003-01-01

    A systematic bioinformatic approach to identifying the evolutionarily conserved regions of proteins has verified the universality of a newly described conserved motif in RNA-dependent RNA polymerases (motif F). In combination with structural comparisons, this approach has defined two regions that may be involved in unwinding double-stranded RNA (dsRNA) for transcription. One of these is the N-terminal portion of motif F and the second is a large insertion in motif F present in the RNA-dependent RNA polymerases of some dsRNA viruses. PMID:12654997

  13. Coxsackievirus and adenovirus receptor is essential for cardiomyocyte development.

    PubMed

    Asher, Damon R; Cerny, Anna M; Weiler, Sarah R; Horner, James W; Keeler, Marilyn L; Neptune, Mychell A; Jones, Stephen N; Bronson, Roderick T; Depinho, Ronald A; Finberg, Robert W

    2005-06-01

    The coxsackievirus and adenovirus receptor (CAR) is a transmembrane protein that is known to be a site of viral attachment and entry, but its physiologic functions are undefined. CAR expression is maximal in neonates and wanes rapidly after birth in organs such as heart, muscle, and brain, suggesting that CAR plays a role in the development of these tissues. Here, we show that CAR deficiency resulted in an embryonic lethal condition associated with cardiac defects. Specifically, commencing approximately 10.5 days postconception (dpc), CAR-/- cardiomyocytes exhibited regional apoptosis evidenced by both histopathologic features of cell death and positive staining for the apoptotic marker cleaved caspase 3. CAR-/- fetuses invariably suffered from degeneration of the myocardial wall and thoracic hemorrhaging, leading to death by 11.5 dpc. These findings are consistent with the view that CAR provides positive survival signals to cardiomyocytes that are essential for normal heart development.

  14. 32 CFR 242b.3 - Notice.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 32 National Defense 2 2014-07-01 2014-07-01 false Notice. 242b.3 Section 242b.3 National Defense Department of Defense (Continued) OFFICE OF THE SECRETARY OF DEFENSE (CONTINUED) MISCELLANEOUS GENERAL... SCIENCES § 242b.3 Notice. (a) Notice of all meetings of the Board shall be sent by the Secretary to each...

  15. 32 CFR 242b.3 - Notice.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 32 National Defense 2 2013-07-01 2013-07-01 false Notice. 242b.3 Section 242b.3 National Defense Department of Defense (Continued) OFFICE OF THE SECRETARY OF DEFENSE (CONTINUED) MISCELLANEOUS GENERAL... SCIENCES § 242b.3 Notice. (a) Notice of all meetings of the Board shall be sent by the Secretary to each...

  16. 32 CFR 242b.3 - Notice.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 32 National Defense 2 2011-07-01 2011-07-01 false Notice. 242b.3 Section 242b.3 National Defense Department of Defense (Continued) OFFICE OF THE SECRETARY OF DEFENSE (CONTINUED) MISCELLANEOUS GENERAL... SCIENCES § 242b.3 Notice. (a) Notice of all meetings of the Board shall be sent by the Secretary to each...

  17. 32 CFR 242b.3 - Notice.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 32 National Defense 2 2012-07-01 2012-07-01 false Notice. 242b.3 Section 242b.3 National Defense Department of Defense (Continued) OFFICE OF THE SECRETARY OF DEFENSE (CONTINUED) MISCELLANEOUS GENERAL... SCIENCES § 242b.3 Notice. (a) Notice of all meetings of the Board shall be sent by the Secretary to each...

  18. Coxsackievirus-induced disease. CD4+ cells initiate both myocarditis and pancreatitis in DBA/2 mice.

    PubMed Central

    Blay, R.; Simpson, K.; Leslie, K.; Huber, S.

    1989-01-01

    DBA/2 male mice inoculated intraperitoneally with 1.8 X 10(5) plaque-forming units (PFU) coxsackievirus B-3 (CVB3) showed extensive inflammatory cell infiltration of the myocardium and acinar tissue of the pancreas in 7 days. Selective depletion of T lymphocyte subpopulations indicated that CD4 cells were either completely or partially responsible for cell damage in both organs. Other organs such as the liver were infected and contained virus titers equivalent to those seen in the heart and pancreas but showed no apparent tissue injury. The role of the CD4 cell was confirmed by positive selection of either T cell subpopulation from CVB3-immune lymphocytes in vitro and adoptive transfer of these cells into T cell-deficient (thymectomized, irradiated, bone marrow reconstituted, TXBM) DBA/2 recipients. Lymphocytes from CVB3-infected donor mice were adsorbed to myocyte, skin fibroblast, or liver vascular endothelial cell (VEC) monolayers. The adherent population was retrieved and adoptively transferred into uninfected syngeneic recipients. When killed 7 days later, the animals receiving unfractionated immune lymphocytes or cells eluted from heart monolayers developed both myocarditis and pancreatitis. Anti-Thy 1.2 and C' treatment of the unfractionated cells completely abrogated transfer of disease. Cells eluted from either fibroblast or liver VEC monolayers showed no pathogenicity. Adsorption of immune cells to heart monolayers in the presence of anti-IAd (class II major histocompatibility complex antigen, MHC) inhibited attachment of the pathogenic T cell, whereas anti KdDd (a class I MHC antigen) had no effect. Images Figure 1 PMID:2573284

  19. Expression of the Coxsackievirus and Adenovirus Receptor in Cultured Human Umbilical Vein Endothelial Cells: Regulation in Response to Cell Density

    PubMed Central

    Carson, Steven D.; Hobbs, Justin T.; Tracy, Steven M.; Chapman, Nora M.

    1999-01-01

    Primary cultures of human umbilical vein endothelial cells (HUVEC) express the human coxsackievirus and adenovirus receptor (HCAR). Whereas HCAR expression in HeLa cells was constant with respect to cell density, HCAR expression in HUVEC increased with culture confluence. HCAR expression in HUVEC was not quantitatively altered by infection with coxsackievirus B. PMID:10400813

  20. Structural Analysis of Monomeric RNA-Dependent Polymerases: Evolutionary and Therapeutic Implications

    PubMed Central

    Jácome, Rodrigo; Becerra, Arturo; Ponce de León, Samuel; Lazcano, Antonio

    2015-01-01

    The crystal structures of monomeric RNA-dependent RNA polymerases and reverse transcriptases of more than 20 different viruses are available in the Protein Data Bank. They all share the characteristic right-hand shape of DNA- and RNA polymerases formed by the fingers, palm and thumb subdomains, and, in many cases, “fingertips” that extend from the fingers towards the thumb subdomain, giving the viral enzyme a closed right-hand appearance. Six conserved structural motifs that contain key residues for the proper functioning of the enzyme have been identified in all these RNA-dependent polymerases. These enzymes share a two divalent metal-ion mechanism of polymerization in which two conserved aspartate residues coordinate the interactions with the metal ions to catalyze the nucleotidyl transfer reaction. The recent availability of crystal structures of polymerases of the Orthomyxoviridae and Bunyaviridae families allowed us to make pairwise comparisons of the tertiary structures of polymerases belonging to the four main RNA viral groups, which has led to a phylogenetic tree in which single-stranded negative RNA viral polymerases have been included for the first time. This has also allowed us to use a homology-based structural prediction approach to develop a general three-dimensional model of the Ebola virus RNA-dependent RNA polymerase. Our model includes several of the conserved structural motifs and residues described in other viral RNA-dependent RNA polymerases that define the catalytic and highly conserved palm subdomain, as well as portions of the fingers and thumb subdomains. The results presented here help to understand the current use and apparent success of antivirals, i.e. Brincidofovir, Lamivudine and Favipiravir, originally aimed at other types of polymerases, to counteract the Ebola virus infection. PMID:26397100

  1. Chromatin remodeling complexes in the assembly of long noncoding RNA-dependent nuclear bodies.

    PubMed

    Kawaguchi, Tetsuya; Hirose, Tetsuro

    2015-01-01

    Paraspeckles are subnuclear structures that assemble on nuclear paraspeckle assembly transcript 1 (NEAT1) long noncoding (lnc)RNA. Paraspeckle formation requires appropriate NEAT1 biogenesis and subsequent assembly with multiple prion-like domain (PLD) containing RNA-binding proteins. We found that SWI/SNF chromatin remodeling complexes function as paraspeckle components that interact with paraspeckle proteins (PSPs) and NEAT1. SWI/SNF complexes play an essential role in paraspeckle formation that does not require their ATP-dependent chromatin remodeling activity. Instead, SWI/SNF complexes facilitate organization of the PSP interaction network required for intact paraspeckle assembly. SWI/SNF complexes may collectively bind multiple PSPs to recruit them onto NEAT1. SWI/SNF complexes are also required for Sat III (Satellite III) lncRNA-dependent formation of nuclear stress bodies under heat shock conditions. Organization of the lncRNA-dependent omega speckle in Drosophila also depends on the chromatin remodeling complex. These findings raise the possibility that a common mechanism controls the formation of lncRNA-dependent nuclear body architecture.

  2. Inhibition of RNA-dependent DNA polymerase of Rous sarcoma virus by thiosemicarbazones and several cations.

    PubMed

    Levinson, W; Faras, A; Woodson, B; Jackson, J; Bishop, J M

    1973-01-01

    The RNA-dependent DNA polymerase of Rous sarcoma virus is inhibited by N-methyl isatin beta-thiosemicarbazone and by thiosemicarbazide, but not by semicarbazide. These inhibitors also inactivate, upon contact with the virion, the transforming ability of Rous sarcoma virus. Sulfhydryl donors, such as 2-mercapto-ethanol, can prevent these effects. The RNA-directed activity of the purified polymerase is inhibited to a greater degree than is the DNA-directed activity. Two cations, Cu(++) and Hg(++), can inhibit RNA-dependent DNA polymerase and inactivate the transforming ability of the virus. Synergism between N-methyl isatin beta-thiosemicarbazone and Cu(++) occurs, since treatment of the virus with a low dose of either N-methyl isatin beta-thiosemicarbazone or Cu(++) has little effect; however, when the two compounds are mixed together, significant inactivation occurs. This observation supports the hypothesis that the antiviral action of thiosemicarbazones is a function of their ability to act as a ligand for metallic ions. Several cations (Ag(+), Co(++), Zn(++), Cd(++), and Ni(++)) significantly inactivate the RNA-dependent DNA polymerase, but have little effect on the transforming ability. In view of this result, the conclusion that the enzyme activity is required for transformation remains open to question.

  3. Type B coxsackieviruses and their interactions with the innate and adaptive immune systems

    PubMed Central

    Kemball, Christopher C; Alirezaei, Mehrdad; Whitton, J Lindsay

    2011-01-01

    Coxsackieviruses are important human pathogens, and their interactions with the innate and adaptive immune systems are of particular interest. Many viruses evade some aspects of the innate response, but coxsackieviruses go a step further by actively inducing, and then exploiting, some features of the host cell response. Furthermore, while most viruses encode proteins that hinder the effector functions of adaptive immunity, coxsackieviruses and their cousins demonstrate a unique capacity to almost completely evade the attention of naive CD8+ T cells. In this article, we discuss the above phenomena, describe the current status of research in the field, and present several testable hypotheses regarding possible links between virus infection, innate immune sensing and disease. PMID:20860480

  4. Recent Progress in Understanding Coxsackievirus Replication, Dissemination, and Pathogenesis

    PubMed Central

    Sin, Jon; Mangale, Vrushali; Thienphrapa, Wdee; Gottlieb, Roberta A.; Feuer, Ralph

    2015-01-01

    Coxsackieviruses (CVs) are relatively common viruses associated with a number of serious human diseases, including myocarditis and meningo-encephalitis. These viruses are considered cytolytic yet can persist for extended periods of time within certain host tissues requiring evasion from the host immune response and a greatly reduced rate of replication. A member of Picornaviridae family, CVs have been historically considered non-enveloped viruses – although recent evidence suggest that CV and other picornaviruses hijack host membranes and acquire an envelope. Acquisition of an envelope might provide distinct benefits to CV virions, such as resistance to neutralizing antibodies and efficient nonlytic viral spread. CV exhibits a unique tropism for progenitor cells in the host which may help to explain the susceptibility of the young host to infection and the establishment of chronic disease in adults. CVs have also been shown to exploit autophagy to maximize viral replication and assist in unconventional release from target cells. In this article, we review recent progress in clarifying virus replication and dissemination within the host cell, identifying determinants of tropism, and defining strategies utilized by the virus to evade the host immune response. Also, we will highlight unanswered questions and provide future perspectives regarding the potential mechanisms of CV pathogenesis. PMID:26142496

  5. Molecular epidemiology and the evolution of human coxsackievirus A6.

    PubMed

    Puenpa, Jiratchaya; Vongpunsawad, Sompong; Österback, Riikka; Waris, Matti; Eriksson, Eva; Albert, Jan; Midgley, Sofie; Fischer, Thea K; Eis-Hübinger, Anna M; Cabrerizo, María; Gaunt, Eleanor; Simmonds, Peter; Poovorawan, Yong

    2016-12-01

    Coxsackievirus A6 (CV-A6) is a major aetiologic agent for hand, foot and mouth disease (HFMD) in recent years. HFMD outbreaks associated with CV-A6 resulted from the evolutionary dynamics of CV-A6 and the appearance of novel recombinant forms (RFs). To examine this, 151 variants collected in 2013 and 2014 from Germany, Spain, Sweden, Denmark and Thailand were genotyped for the VP1 capsid and 3Dpol genes. Analysis of the VP1 gene showed an increasing correspondence between CV-A6 genome recombination and sequence divergence (estimated substitution rate of 8.1×10-3 substitutions site-1 year-1 and RF half-life of 3.1 years). Bayesian phylogenetic analysis showed that recent recombination groups (RF-E, -F, -H, -J and -K) shared a common ancestor (RF-A). Thirty-nine full-length genomes of different RFs revealed recombination breakpoints between the 2A-2C and the 5' UTRs. The emergence of new CV-A6 recombination groups has become widespread in Europe and Asia within the last 8 years.

  6. Molecular epidemiology of human coxsackievirus A16 strains

    PubMed Central

    YU, WENMIN; XU, HUANXIN; YIN, CHANGCHANG

    2016-01-01

    The hand, foot and mouth disease (HFMD) epidemics have mainly been caused by human enterovirus 71 and human coxsackievirus A16 (CA16), which circulated alternatively or together in the epidemic area. The aim of the present study was to provide guidance in the prevention and control of HFMD from CA16 infection. The molecular epidemiology of the human CA16 strains was investigated. Overall, 1,151 specimens (throat swabs) were collected from 1,151 patients with HFMD symptoms. The results of the homology comparison in the VP1 of CA16 strains showed that the CA16 strains belonged to the B1b subgenotype. The difference of the 6 CA16 strains analyzed showed that the most prominent strain was the A genotype, and the most close strains were the B1 gene subtype, particularly the B1b gene subtype. With regards to the amino acids, in addition to the A genotype, the differences of amino acids with other gene subtype was not significant. The present data suggest that more effective and highly targeted intervention mechanisms could be developed for the prevention and control of HFMD. PMID:27284420

  7. Characterization of a Putative Ancestor of Coxsackievirus B5 ▿

    PubMed Central

    Gullberg, Maria; Tolf, Conny; Jonsson, Nina; Mulders, Mick N.; Savolainen-Kopra, Carita; Hovi, Tapani; Van Ranst, Marc; Lemey, Philippe; Hafenstein, Susan; Lindberg, A. Michael

    2010-01-01

    Like other RNA viruses, coxsackievirus B5 (CVB5) exists as circulating heterogeneous populations of genetic variants. In this study, we present the reconstruction and characterization of a probable ancestral virion of CVB5. Phylogenetic analyses based on capsid protein-encoding regions (the VP1 gene of 41 clinical isolates and the entire P1 region of eight clinical isolates) of CVB5 revealed two major cocirculating lineages. Ancestral capsid sequences were inferred from sequences of these contemporary CVB5 isolates by using maximum likelihood methods. By using Bayesian phylodynamic analysis, the inferred VP1 ancestral sequence dated back to 1854 (1807 to 1898). In order to study the properties of the putative ancestral capsid, the entire ancestral P1 sequence was synthesized de novo and inserted into the replicative backbone of an infectious CVB5 cDNA clone. Characterization of the recombinant virus in cell culture showed that fully functional infectious virus particles were assembled and that these viruses displayed properties similar to those of modern isolates in terms of receptor preferences, plaque phenotypes, growth characteristics, and cell tropism. This is the first report describing the resurrection and characterization of a picornavirus with a putative ancestral capsid. Our approach, including a phylogenetics-based reconstruction of viral predecessors, could serve as a starting point for experimental studies of viral evolution and might also provide an alternative strategy for the development of vaccines. PMID:20631132

  8. Molecular determinants of disease in Coxsackievirus B1 murine infection

    PubMed Central

    Cifuente, Javier O.; Ferrer, María F.; de Giusti, Carolina Jaquenod; Song, Wen-Chao; Romanowski, Víctor; Hafenstein, Susan L.; Gómez, Ricardo M.

    2013-01-01

    To understand better how different genomic regions may confer pathogenicity for the coxsackievirus B (CVB), two intratypic CVB1 variants and a number of recombinant viruses were studied. Sequencing analysis showed 23 nucleotide changes between the parental non-pathogenic CVB1N and the pathogenic CVB1Nm. Mutations present in CVB1Nm were more conserved than those in CVB1N when compared to other CVB sequences. Inoculation in C3H/HeJ mice showed that the P1 region is critical for pathogenicity in murine pancreas and heart. The molecular determinants of disease for these organs partially overlap. Several P1 region amino acid differences appear to be located in the decay accelerating factor (DAF) footprint CVBs. CVB1N and CVB1Nm interacted with human CAR, but only CVB1N seemed to interact with human DAF, as determined using soluble receptors in a plaque reduction assay. However, the murine homologue Daf-1 did not interact with any virus assessed by haemagglutination. The results of this study suggest that an unknown receptor interaction with the virus play an important role in the pathogenicity of CVB1Nm. Further in vivo studies may clarify this issue. PMID:21739448

  9. Molecular determinants of disease in coxsackievirus B1 murine infection.

    PubMed

    Cifuente, Javier O; Ferrer, María F; Jaquenod de Giusti, Carolina; Song, Wen-Chao; Romanowski, Víctor; Hafenstein, Susan L; Gómez, Ricardo M

    2011-09-01

    To understand better how different genomic regions may confer pathogenicity for the coxsackievirus B (CVB), two intratypic CVB1 variants, and a number of recombinant viruses were studied. Sequencing analysis showed 23 nucleotide changes between the parental non-pathogenic CVB1N and the pathogenic CVB1Nm. Mutations present in CVB1Nm were more conserved than those in CVB1N when compared to other CVB sequences. Inoculation in C3H/HeJ mice showed that the P1 region is critical for pathogenicity in murine pancreas and heart. The molecular determinants of disease for these organs partially overlap. Several P1 region amino acid differences appear to be located in the decay-accelerating factor (DAF) footprint CVBs. CVB1N and CVB1Nm interacted with human CAR, but only CVB1N seemed to interact with human DAF, as determined using soluble receptors in a plaque-reduction assay. However, the murine homolog Daf-1 did not interact with any virus assessed by hemagglutination. The results of this study suggest that an unknown receptor interaction with the virus play an important role in the pathogenicity of CVB1Nm. Further in vivo studies may clarify this issue.

  10. 18 CFR 3b.3 - Notice requirements.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 18 Conservation of Power and Water Resources 1 2014-04-01 2014-04-01 false Notice requirements. 3b.3 Section 3b.3 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF ENERGY GENERAL RULES COLLECTION, MAINTENANCE, USE, AND DISSEMINATION OF RECORDS OF IDENTIFIABLE...

  11. 18 CFR 3b.3 - Notice requirements.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 18 Conservation of Power and Water Resources 1 2013-04-01 2013-04-01 false Notice requirements. 3b.3 Section 3b.3 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF ENERGY GENERAL RULES COLLECTION, MAINTENANCE, USE, AND DISSEMINATION OF RECORDS OF IDENTIFIABLE...

  12. 18 CFR 3b.3 - Notice requirements.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 18 Conservation of Power and Water Resources 1 2012-04-01 2012-04-01 false Notice requirements. 3b.3 Section 3b.3 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF ENERGY GENERAL RULES COLLECTION, MAINTENANCE, USE, AND DISSEMINATION OF RECORDS OF IDENTIFIABLE...

  13. 18 CFR 3b.3 - Notice requirements.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Notice requirements. 3b.3 Section 3b.3 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF ENERGY GENERAL RULES COLLECTION, MAINTENANCE, USE, AND DISSEMINATION OF RECORDS OF IDENTIFIABLE...

  14. A Group B Coxsackievirus/Poliovirus 5′ Nontranslated Region Chimera Can Act as an Attenuated Vaccine Strain in Mice

    PubMed Central

    Chapman, Nora M.; Ragland, Anna; Leser, J. Smith; Höfling, Katja; Willian, Sandra; Semler, Bert L.; Tracy, Steven

    2000-01-01

    The linear, single-stranded enterovirus RNA genome is flanked at either end with a nontranslated region (NTR). By replacing the entire 5′ NTR of coxsackievirus B3 (CVB3) with that from type 1 poliovirus, a progeny virus was obtained following transfection of HeLa cells. The chimeric virus, CPV/49, replicates like the parental CVB3 strain in HeLa cells but is attenuated for replication and yield in primary human coronary artery endothelial cell cultures, in a human pancreas tumor cell line, and in primary murine heart fibroblast cultures. Western blotting analyses of CPV/49 replication in murine heart fibroblast cultures demonstrate that synthesis of CPV/49 proteins is significantly slower than that of the parental CVB3 strain. CPV/49 replicates in murine hearts and pancreata, causing no disease in hearts and a minor pancreatic inflammation in some mice that resolves by 28 days postinoculation. A single inoculation with CPV/49 induces protective anti-CVB3 neutralizing antibody titers that completely protect mice from both heart and pancreatic disease when mice are challenged 28 days p.i. with genetically diverse virulent strains of CVB3. That a chimeric CVB3 strain, created from sequences of two virulent viruses, is sufficiently attenuated to act as an avirulent, protective vaccine strain in mice suggests that chimeric genome technology merits further evaluation for the development of new nonpoliovirus enteroviral vectors. PMID:10756016

  15. Change in the cells that express connective tissue growth factor in acute Coxsackievirus-induced myocardial fibrosis in mouse.

    PubMed

    Yun, Soo-Hyeon; Shin, Jae-Ok; Lim, Byung-Kwan; Kim, Kyoung-Li; Gil, Chae-Ok; Kim, Duk-Kyung; Jeon, Eun-Seok

    2007-06-01

    Cardiac fibrosis and inflammation are major pathologic conditions that result from viral myocarditis. Connective tissue growth factor (CTGF) stimulates fibroblast proliferation and induces production of extracellular matrix molecules. We studied the correlation between CTGF and cardiac fibrosis in an acute Coxsackievirus B3 (CVB3) myocarditis animal model. Eight-week-old BALB/c mice were infected intraperitoneally with 10(4) plaque forming units (PFU) of CVB3. Myocardial inflammation peaked on day 7 and decreased markedly by day 14 post-infection (pi); cardiac fibrosis was noted from day 7 and peaked on day 14. By contrast, CTGF was weakly expressed by the interstitial cells in uninfected control hearts and also in the hearts of day 3 pi. CTGF expression measured by real-time PCR was elevated on day 3 and peaked on day 7 pi. TGF-beta expression peaked at day 7 pi. The cell type of CTGF expression changed from interstitial cells to myocytes after virus infection. On day 7, CTGF was strongly expressed by myocytes and inflammatory cells surrounding calcified necrotic areas. In addition, cardiac myocytes expressed CTGF on day 14. Our results, based on an acute CVB3 model of myocarditis, provide evidence that CTGF may mediate the development of fibrosis after viral myocarditis, and that the cells expressed CTGF changes during the course of viral myocarditis.

  16. RNA-dependent RNA polymerase 1 in potato (Solanum tuberosum) and its relationship to other plant RNA-dependent RNA polymerases

    PubMed Central

    Hunter, Lydia J. R.; Brockington, Samuel F.; Murphy, Alex M.; Pate, Adrienne E.; Gruden, Kristina; MacFarlane, Stuart A.; Palukaitis, Peter; Carr, John P.

    2016-01-01

    Cellular RNA-dependent RNA polymerases (RDRs) catalyze synthesis of double-stranded RNAs that can serve to initiate or amplify RNA silencing. Arabidopsis thaliana has six RDR genes; RDRs 1, 2 and 6 have roles in anti-viral RNA silencing. RDR6 is constitutively expressed but RDR1 expression is elevated following plant treatment with defensive phytohormones. RDR1 also contributes to basal virus resistance. RDR1 has been studied in several species including A. thaliana, tobacco (Nicotiana tabacum), N. benthamiana, N. attenuata and tomato (Solanum lycopersicum) but not to our knowledge in potato (S. tuberosum). StRDR1 was identified and shown to be salicylic acid-responsive. StRDR1 transcript accumulation decreased in transgenic potato plants constitutively expressing a hairpin construct and these plants were challenged with three viruses: potato virus Y, potato virus X, and tobacco mosaic virus. Suppression of StRDR1 gene expression did not increase the susceptibility of potato to these viruses. Phylogenetic analysis of RDR genes present in potato and in a range of other plant species identified a new RDR gene family, not present in potato and found only in Rosids (but apparently lost in the Rosid A. thaliana) for which we propose the name RDR7. PMID:26979928

  17. RNA-dependent RNA polymerase 1 in potato (Solanum tuberosum) and its relationship to other plant RNA-dependent RNA polymerases.

    PubMed

    Hunter, Lydia J R; Brockington, Samuel F; Murphy, Alex M; Pate, Adrienne E; Gruden, Kristina; MacFarlane, Stuart A; Palukaitis, Peter; Carr, John P

    2016-03-16

    Cellular RNA-dependent RNA polymerases (RDRs) catalyze synthesis of double-stranded RNAs that can serve to initiate or amplify RNA silencing. Arabidopsis thaliana has six RDR genes; RDRs 1, 2 and 6 have roles in anti-viral RNA silencing. RDR6 is constitutively expressed but RDR1 expression is elevated following plant treatment with defensive phytohormones. RDR1 also contributes to basal virus resistance. RDR1 has been studied in several species including A. thaliana, tobacco (Nicotiana tabacum), N. benthamiana, N. attenuata and tomato (Solanum lycopersicum) but not to our knowledge in potato (S. tuberosum). StRDR1 was identified and shown to be salicylic acid-responsive. StRDR1 transcript accumulation decreased in transgenic potato plants constitutively expressing a hairpin construct and these plants were challenged with three viruses: potato virus Y, potato virus X, and tobacco mosaic virus. Suppression of StRDR1 gene expression did not increase the susceptibility of potato to these viruses. Phylogenetic analysis of RDR genes present in potato and in a range of other plant species identified a new RDR gene family, not present in potato and found only in Rosids (but apparently lost in the Rosid A. thaliana) for which we propose the name RDR7.

  18. Naturally Occurring Isoleucyl-tRNA Synthetase without tRNA-dependent Pre-transfer Editing*

    PubMed Central

    Cvetesic, Nevena; Dulic, Morana; Bilus, Mirna; Sostaric, Nikolina; Lenhard, Boris; Gruic-Sovulj, Ita

    2016-01-01

    Isoleucyl-tRNA synthetase (IleRS) is unusual among aminoacyl-tRNA synthetases in having a tRNA-dependent pre-transfer editing activity. Alongside the typical bacterial IleRS (such as Escherichia coli IleRS), some bacteria also have the enzymes (eukaryote-like) that cluster with eukaryotic IleRSs and exhibit low sensitivity to the antibiotic mupirocin. Our phylogenetic analysis suggests that the ileS1 and ileS2 genes of contemporary bacteria are the descendants of genes that might have arisen by an ancient duplication event before the separation of bacteria and archaea. We present the analysis of evolutionary constraints of the synthetic and editing reactions in eukaryotic/eukaryote-like IleRSs, which share a common origin but diverged through adaptation to different cell environments. The enzyme from the yeast cytosol exhibits tRNA-dependent pre-transfer editing analogous to E. coli IleRS. This argues for the presence of this proofreading in the common ancestor of both IleRS types and an ancient origin of the synthetic site-based quality control step. Yet surprisingly, the eukaryote-like enzyme from Streptomyces griseus IleRS lacks this capacity; at the same time, its synthetic site displays the 103-fold drop in sensitivity to antibiotic mupirocin relative to the yeast enzyme. The discovery that pre-transfer editing is optional in IleRSs lends support to the notion that the conserved post-transfer editing domain is the main checkpoint in these enzymes. We substantiated this by showing that under error-prone conditions S. griseus IleRS is able to rescue the growth of an E. coli lacking functional IleRS, providing the first evidence that tRNA-dependent pre-transfer editing in IleRS is not essential for cell viability. PMID:26921320

  19. Coxsackievirus B Exits the Host Cell in Shed Microvesicles Displaying Autophagosomal Markers

    PubMed Central

    Mangale, Vrushali; Rahawi, Shahad; McIntyre, Laura L.; Williams, Wesley; Kha, Nelson; Cruz, Casey; Hancock, Bryan M.; Nguyen, David P.; Sayen, M. Richard; Hilton, Brett J.; Doran, Kelly S.; Segall, Anca M.; Wolkowicz, Roland; Cornell, Christopher T.; Whitton, J. Lindsay; Gottlieb, Roberta A.; Feuer, Ralph

    2014-01-01

    Coxsackievirus B3 (CVB3), a member of the picornavirus family and enterovirus genus, causes viral myocarditis, aseptic meningitis, and pancreatitis in humans. We genetically engineered a unique molecular marker, “fluorescent timer” protein, within our infectious CVB3 clone and isolated a high-titer recombinant viral stock (Timer-CVB3) following transfection in HeLa cells. “Fluorescent timer” protein undergoes slow conversion of fluorescence from green to red over time, and Timer-CVB3 can be utilized to track virus infection and dissemination in real time. Upon infection with Timer-CVB3, HeLa cells, neural progenitor and stem cells (NPSCs), and C2C12 myoblast cells slowly changed fluorescence from green to red over 72 hours as determined by fluorescence microscopy or flow cytometric analysis. The conversion of “fluorescent timer” protein in HeLa cells infected with Timer-CVB3 could be interrupted by fixation, suggesting that the fluorophore was stabilized by formaldehyde cross-linking reactions. Induction of a type I interferon response or ribavirin treatment reduced the progression of cell-to-cell virus spread in HeLa cells or NPSCs infected with Timer-CVB3. Time lapse photography of partially differentiated NPSCs infected with Timer-CVB3 revealed substantial intracellular membrane remodeling and the assembly of discrete virus replication organelles which changed fluorescence color in an asynchronous fashion within the cell. “Fluorescent timer” protein colocalized closely with viral 3A protein within virus replication organelles. Intriguingly, infection of partially differentiated NPSCs or C2C12 myoblast cells induced the release of abundant extracellular microvesicles (EMVs) containing matured “fluorescent timer” protein and infectious virus representing a novel route of virus dissemination. CVB3 virions were readily observed within purified EMVs by transmission electron microscopy, and infectious virus was identified within low

  20. Epididymitis caused by coxsackievirus A6 in association with hand, foot, and mouth disease.

    PubMed

    Vuorinen, Tytti; Osterback, Riikka; Kuisma, Jani; Ylipalosaari, Pekka

    2014-12-01

    Coxsackievirus A6 (CV-A6) caused hand, foot, and mouth disease (HFMD) with a unique manifestation of epididymitis. The patient underwent operation due to suspicion of testicular torsion. Epididymitis was diagnosed by ultrasound examination. Enterovirus was detected from epididymal fluid by PCR and typed by partial sequencing of viral protein 1 as CV-A6.

  1. Epididymitis Caused by Coxsackievirus A6 in Association with Hand, Foot, and Mouth Disease

    PubMed Central

    Österback, Riikka; Kuisma, Jani; Ylipalosaari, Pekka

    2014-01-01

    Coxsackievirus A6 (CV-A6) caused hand, foot, and mouth disease (HFMD) with a unique manifestation of epididymitis. The patient underwent operation due to suspicion of testicular torsion. Epididymitis was diagnosed by ultrasound examination. Enterovirus was detected from epididymal fluid by PCR and typed by partial sequencing of viral protein 1 as CV-A6. PMID:25232161

  2. Coxsackievirus A21, Enterovirus 68, and Acute Respiratory Tract Infection, China

    PubMed Central

    Xiang, Zichun; Gonzalez, Richard; Wang, Zhong; Ren, Lili; Xiao, Yan; Li, Jianguo; Li, Yongjun; Vernet, Guy; Paranhos-Baccalà, Gláucia; Jin, Qi

    2012-01-01

    During August 2006–April 2010, in Beijing, China, 2 rare human enterovirus serotypes, coxsackievirus A21 and enterovirus 68, were detected most frequently in human enterovirus–positive adults with acute respiratory tract infections. Thus, during some years, these 2 viruses cause a substantial proportion of enterovirus-associated adult acute respiratory tract infections. PMID:22516379

  3. Molecular phylogeny of Coxsackievirus A16 in Shenzhen, China, from 2005 to 2009.

    PubMed

    Zong, Wenping; He, Yaqing; Yu, Shouyi; Yang, Hong; Xian, Huixia; Liao, Yuxue; Hu, Guifang

    2011-04-01

    Phylogenetic analysis of a Coxsackievirus A16 (CA16) sequence from Shenzhen, China, and other Chinese and international CA16 sequences revealed a pattern of endemic cocirculation of strains of clusters B2a and B2b within subtype B2 viruses. Amino acid evolution and nucleotide variation in the VP1 region were slight for 5 years.

  4. Seroprevalence of Enterovirus A71 and Coxsackievirus A16 in Healthy People in Shandong Province, China

    PubMed Central

    Lin, Yi; Pei, Yao-wen; Sun, Da-peng; Zhang, Yong; Wang, Xian-jun; Xu, Wen-bo; Ding, Shu-jun

    2016-01-01

    Background Hand, foot, and mouth disease has become very common in mainland of China in recent years, and enterovirus A71 and coxsackievirus A16 are its major etiologic factors. Here we investigated the seroprevalence of enterovirus A71 and coxsackievirus A16 based on a large group of healthy individuals in Shandong province, China. Methods A total of 1378 healthy individuals were tested for serum neutralizing antibodies against enterovirus A71 and coxsackievirus A16 using a micro neutralization test. Results The overall seroprevalence of enterovirus A71 neutralizing antibodies was 74.75%. It increased significantly from 48.84% in children aged 0–1 years old to 88.64% in those aged 20–29 years (p < 0.01) and decreased to 85.71% in adults > 40 years old with a significant gender-specific difference (p < 0.01). The overall coxsackievirus A16 antibody prevalence was 71.77%. It increased significantly from 39.53% in children aged 0–1 years to 80.68% in those aged 10–19 years (p < 0.01) and decreased to 75.63% in adults >40 years without a gender-specific difference. Nearly 50% of the children <1 year were susceptible to enterovirus A71 infection versus 40% to coxsackievirus A16 infection. Sample collection time and place also played a role in the enterovirus A71 and coxsackievirus A16 positive rates. The overall rates in January were significantly lower than those in April and August (p < 0.01); enterovirus A71 positive rates in Jinan city (capital city of Shandong province) were lower than those in Jining city and Zibo city (p < 0.05); and oxsackievirus A16 positive rates in Jining city were significantly higher than those in Jinan city and Zibo city (p < 0.01). Conclusion There were significant differences among age groups, locations, and time points in the seroprevalence rates of enterovirus A71 and coxsackievirus A16 neutralizing antibodies in healthy people in Shandong province. PMID:27611441

  5. Identification of four conserved motifs among the RNA-dependent polymerase encoding elements.

    PubMed Central

    Poch, O; Sauvaget, I; Delarue, M; Tordo, N

    1989-01-01

    Four consensus sequences are conserved with the same linear arrangement in RNA-dependent DNA polymerases encoded by retroid elements and in RNA-dependent RNA polymerases encoded by plus-, minus- and double-strand RNA viruses. One of these motifs corresponds to the YGDD span previously described by Kamer and Argos (1984). These consensus sequences altogether lead to 4 strictly and 18 conservatively maintained amino acids embedded in a large domain of 120 to 210 amino acids. As judged from secondary structure predictions, each of the 4 motifs, which may cooperate to form a well-ordered domain, places one invariant amino acid in or proximal to turn structures that may be crucial for their correct positioning in a catalytic process. We suggest that this domain may constitute a prerequisite 'polymerase module' implicated in template seating and polymerase activity. At the evolutionary level, the sequence similarities, gap distribution and distances between each motif strongly suggest that the ancestral polymerase module was encoded by an individual genetic element which was most closely related to the plus-strand RNA viruses and the non-viral retroposons. This polymerase module gene may have subsequently propagated in the viral kingdom by distinct gene set recombination events leading to the wide viral variety observed today. Images PMID:2555175

  6. Transfer RNA-dependent amino acid biosynthesis: An essential route to asparagine formation

    PubMed Central

    Min, Bokkee; Pelaschier, Joanne T.; Graham, David E.; Tumbula-Hansen, Debra; Söll, Dieter

    2002-01-01

    Biochemical experiments and genomic sequence analysis showed that Deinococcus radiodurans and Thermus thermophilus do not possess asparagine synthetase (encoded by asnA or asnB), the enzyme forming asparagine from aspartate. Instead these organisms derive asparagine from asparaginyl-tRNA, which is made from aspartate in the tRNA-dependent transamidation pathway [Becker, H. D. & Kern, D. (1998) Proc. Natl. Acad. Sci. USA 95, 12832–12837; and Curnow, A. W., Tumbula, D. L., Pelaschier, J. T., Min, B. & Söll, D. (1998) Proc. Natl. Acad. Sci. USA 95, 12838–12843]. A genetic knockout disrupting this pathway deprives D. radiodurans of the ability to synthesize asparagine and confers asparagine auxotrophy. The organism's capacity to make asparagine could be restored by transformation with Escherichia coli asnB. This result demonstrates that in Deinococcus, the only route to asparagine is via asparaginyl-tRNA. Analysis of the completed genomes of many bacteria reveal that, barring the existence of an unknown pathway of asparagine biosynthesis, a wide spectrum of bacteria rely on the tRNA-dependent transamidation pathway as the sole route to asparagine. PMID:11880622

  7. Structural insights into RNA-dependent eukaryal and archaeal selenocysteine formation

    PubMed Central

    Araiso, Yuhei; Palioura, Sotiria; Ishitani, Ryuichiro; Sherrer, R. Lynn; O’Donoghue, Patrick; Yuan, Jing; Oshikane, Hiroyuki; Domae, Naoshi; DeFranco, Julian; Söll, Dieter; Nureki, Osamu

    2008-01-01

    The micronutrient selenium is present in proteins as selenocysteine (Sec). In eukaryotes and archaea, Sec is formed in a tRNA-dependent conversion of O-phosphoserine (Sep) by O-phosphoseryl-tRNA:selenocysteinyl-tRNA synthase (SepSecS). Here, we present the crystal structure of Methanococcus maripaludis SepSecS complexed with PLP at 2.5 Å resolution. SepSecS, a member of the Fold Type I PLP enzyme family, forms an (α2)2 homotetramer through its N-terminal extension. The active site lies on the dimer interface with each monomer contributing essential residues. In contrast to other Fold Type I PLP enzymes, Asn247 in SepSecS replaces the conserved Asp in binding the pyridinium nitrogen of PLP. A structural comparison with Escherichia coli selenocysteine lyase allowed construction of a model of Sep binding to the SepSecS catalytic site. Mutations of three conserved active site arginines (Arg72, Arg94, Arg307), protruding from the neighboring subunit, led to loss of in vivo and in vitro activity. The lack of active site cysteines demonstrates that a perselenide is not involved in SepSecS-catalyzed Sec formation; instead, the conserved arginines may facilitate the selenation reaction. Structural phylogeny shows that SepSecS evolved early in the history of PLP enzymes, and indicates that tRNA-dependent Sec formation is a primordial process. PMID:18158303

  8. Epizootic of vesicular disease in pigs caused by coxsackievirus B4 in the Soviet Union in 1975.

    PubMed

    Lomakina, Natalia F; Yu Shustova, Elena; Strizhakova, Olga M; Felix Drexler, Jan; Lukashev, Alexander N

    2016-01-01

    Swine vesicular disease virus (SVDV) emerged around 1960 from a human enterovirus ancestor, coxsackievirus B5 (CVB5), and caused a series of epizootics in Europe and Asia. We characterized a coxsackievirus B4 strain that caused an epizootic involving 24 488 pigs in the Soviet Union in 1975. Phylogenetic evidence suggested that the swine virus emerged from a human ancestor between 1945 and 1975, almost simultaneously with the transfer of CVB5.

  9. Potent non-nucleoside inhibitors of the measles virus RNA-dependent RNA polymerase complex.

    PubMed

    Sun, Aiming; Yoon, Jeong-Joong; Yin, Yan; Prussia, Andrew; Yang, Yutao; Min, Jaeki; Plemper, Richard K; Snyder, James P

    2008-07-10

    Measles virus (MV) is one of the most infectious pathogens known. In spite of the existence of a vaccine, approximately 350000 deaths/year result from MV or associated complications. Antimeasles compounds could conceivably diminish these statistics and provide a therapy that complements vaccine treatment. We recently described a high-throughput screening hit compound 1 (16677) against MV-infected cells with the capacity to eliminate viral reproduction at 250 nM by inhibiting the action of the virus's RNA-dependent RNA polymerase complex (RdRp). The compound, 1-methyl-3-(trifluoromethyl)- N-[4-sulfonylphenyl]-1 H-pyrazole-5-carboxamide, 1 carries a critical CF 3 moiety on the 1,2-pyrazole ring. Elaborating on the preliminary structure-activity (SAR) study, the present work presents the synthesis and SAR of a much broader range of low nanomolar nonpeptidic MV inhibitors and speculates on the role of the CF 3 functionality.

  10. RNA-Dependent RNA Polymerases of Picornaviruses: From the Structure to Regulatory Mechanisms

    PubMed Central

    Ferrer-Orta, Cristina; Ferrero, Diego; Verdaguer, Núria

    2015-01-01

    RNA viruses typically encode their own RNA-dependent RNA polymerase (RdRP) to ensure genome replication within the infected cells. RdRP function is critical not only for the virus life cycle but also for its adaptive potential. The combination of low fidelity of replication and the absence of proofreading and excision activities within the RdRPs result in high mutation frequencies that allow these viruses a rapid adaptation to changing environments. In this review, we summarize the current knowledge about structural and functional aspects on RdRP catalytic complexes, focused mainly in the Picornaviridae family. The structural data currently available from these viruses provided high-resolution snapshots for a range of conformational states associated to RNA template-primer binding, rNTP recognition, catalysis and chain translocation. As these enzymes are major targets for the development of antiviral compounds, such structural information is essential for the design of new therapies. PMID:26258787

  11. Crystal structure of Zika virus NS5 RNA-dependent RNA polymerase.

    PubMed

    Godoy, Andre S; Lima, Gustavo M A; Oliveira, Ketllyn I Z; Torres, Naiara U; Maluf, Fernando V; Guido, Rafael V C; Oliva, Glaucius

    2017-03-27

    The current Zika virus (ZIKV) outbreak became a global health threat of complex epidemiology and devastating neurological impacts, therefore requiring urgent efforts towards the development of novel efficacious and safe antiviral drugs. Due to its central role in RNA viral replication, the non-structural protein 5 (NS5) RNA-dependent RNA-polymerase (RdRp) is a prime target for drug discovery. Here we describe the crystal structure of the recombinant ZIKV NS5 RdRp domain at 1.9 Å resolution as a platform for structure-based drug design strategy. The overall structure is similar to other flaviviral homologues. However, the priming loop target site, which is suitable for non-nucleoside polymerase inhibitor design, shows significant differences in comparison with the dengue virus structures, including a tighter pocket and a modified local charge distribution.

  12. Influenza virion RNA-dependent RNA polymerase: stimulation by guanosine and related compounds.

    PubMed Central

    McGeoch, D; Kitron, N

    1975-01-01

    The activity of RNA-dependent RNA polymerase of several influenza viruses is stimulated by guanosine. Depending upon the virus strain used, the stimulation of initial reaction rate is up to 10-fold. 5'-GMP, 3',5'-cyclic GMP, and 5'-GDP show lesser stimulation effects. No other nucleosides of 5'-NMPs stimulate, but the dinucleoside monophosphates GpG and GpC show large stimulations. We present evidence that the stimulation represents preferential initiation of genome complementary RNA chains with guanosine: (i) [3-H] guanosine is incorporated specifically at the 5'terminus of RNA in polymerase reaction mixes in vitro. (ii) This incorporation reaction has several properties similar to those of the virion polymerase elongation reaction. (iii) RNA made in the stimulated reaction behaves as complementary RNA in annealing kinetic studies, as does RNA labeled with [3-H]guanosine. PMID:163915

  13. Crystal structure of Zika virus NS5 RNA-dependent RNA polymerase

    PubMed Central

    Godoy, Andre S.; Lima, Gustavo M. A.; Oliveira, Ketllyn I. Z.; Torres, Naiara U.; Maluf, Fernando V.; Guido, Rafael V. C.; Oliva, Glaucius

    2017-01-01

    The current Zika virus (ZIKV) outbreak became a global health threat of complex epidemiology and devastating neurological impacts, therefore requiring urgent efforts towards the development of novel efficacious and safe antiviral drugs. Due to its central role in RNA viral replication, the non-structural protein 5 (NS5) RNA-dependent RNA-polymerase (RdRp) is a prime target for drug discovery. Here we describe the crystal structure of the recombinant ZIKV NS5 RdRp domain at 1.9 Å resolution as a platform for structure-based drug design strategy. The overall structure is similar to other flaviviral homologues. However, the priming loop target site, which is suitable for non-nucleoside polymerase inhibitor design, shows significant differences in comparison with the dengue virus structures, including a tighter pocket and a modified local charge distribution. PMID:28345596

  14. MicroRNA-Dependent Regulation of Transcription in Non-Small Cell Lung Cancer

    PubMed Central

    Molina-Pinelo, Sonia; Gutiérrez, Gabriel; Pastor, Maria Dolores; Hergueta, Marta; Moreno-Bueno, Gema; García-Carbonero, Rocío; Nogal, Ana; Suárez, Rocío; Salinas, Ana; Pozo-Rodríguez, Francisco; Lopez-Rios, Fernando; Agulló-Ortuño, Maria Teresa; Ferrer, Irene; Perpiñá, Asunción; Palacios, José; Carnero, Amancio; Paz-Ares, Luis

    2014-01-01

    Squamous cell lung cancer (SCC) and adenocarcinoma are the most common histological subtypes of non-small cell lung cancer (NSCLC), and have been traditionally managed in the clinic as a single entity. Increasing evidence, however, illustrates the biological diversity of these two histological subgroups of lung cancer, and supports the need to improve our understanding of the molecular basis beyond the different phenotypes if we aim to develop more specific and individualized targeted therapy. The purpose of this study was to identify microRNA (miRNA)-dependent transcriptional regulation differences between SCC and adenocarcinoma histological lung cancer subtypes. In this work, paired miRNA (667 miRNAs by TaqMan Low Density Arrays (TLDA)) and mRNA profiling (Whole Genome 44 K array G112A, Agilent) was performed in tumor samples of 44 NSCLC patients. Nine miRNAs and 56 mRNAs were found to be differentially expressed in SCC versus adenocarcinoma samples. Eleven of these 56 mRNA were predicted as targets of the miRNAs identified to be differently expressed in these two histological conditions. Of them, 6 miRNAs (miR-149, miR-205, miR-375, miR-378, miR-422a and miR-708) and 9 target genes (CEACAM6, CGN, CLDN3, ABCC3, MLPH, ACSL5, TMEM45B, MUC1) were validated by quantitative PCR in an independent cohort of 41 lung cancer patients. Furthermore, the inverse correlation between mRNAs and microRNAs expression was also validated. These results suggest miRNA-dependent transcriptional regulation differences play an important role in determining key hallmarks of NSCLC, and may provide new biomarkers for personalized treatment strategies. PMID:24625834

  15. MicroRNA-dependent regulation of transcription in non-small cell lung cancer.

    PubMed

    Molina-Pinelo, Sonia; Gutiérrez, Gabriel; Pastor, Maria Dolores; Hergueta, Marta; Moreno-Bueno, Gema; García-Carbonero, Rocío; Nogal, Ana; Suárez, Rocío; Salinas, Ana; Pozo-Rodríguez, Francisco; Lopez-Rios, Fernando; Agulló-Ortuño, Maria Teresa; Ferrer, Irene; Perpiñá, Asunción; Palacios, José; Carnero, Amancio; Paz-Ares, Luis

    2014-01-01

    Squamous cell lung cancer (SCC) and adenocarcinoma are the most common histological subtypes of non-small cell lung cancer (NSCLC), and have been traditionally managed in the clinic as a single entity. Increasing evidence, however, illustrates the biological diversity of these two histological subgroups of lung cancer, and supports the need to improve our understanding of the molecular basis beyond the different phenotypes if we aim to develop more specific and individualized targeted therapy. The purpose of this study was to identify microRNA (miRNA)-dependent transcriptional regulation differences between SCC and adenocarcinoma histological lung cancer subtypes. In this work, paired miRNA (667 miRNAs by TaqMan Low Density Arrays (TLDA)) and mRNA profiling (Whole Genome 44 K array G112A, Agilent) was performed in tumor samples of 44 NSCLC patients. Nine miRNAs and 56 mRNAs were found to be differentially expressed in SCC versus adenocarcinoma samples. Eleven of these 56 mRNA were predicted as targets of the miRNAs identified to be differently expressed in these two histological conditions. Of them, 6 miRNAs (miR-149, miR-205, miR-375, miR-378, miR-422a and miR-708) and 9 target genes (CEACAM6, CGN, CLDN3, ABCC3, MLPH, ACSL5, TMEM45B, MUC1) were validated by quantitative PCR in an independent cohort of 41 lung cancer patients. Furthermore, the inverse correlation between mRNAs and microRNAs expression was also validated. These results suggest miRNA-dependent transcriptional regulation differences play an important role in determining key hallmarks of NSCLC, and may provide new biomarkers for personalized treatment strategies.

  16. Structural and Functional Characterization of Sapovirus RNA-Dependent RNA Polymerase▿

    PubMed Central

    Fullerton, Stephen W. B.; Blaschke, Martina; Coutard, Bruno; Gebhardt, Julia; Gorbalenya, Alexander; Canard, Bruno; Tucker, Paul A.; Rohayem, Jacques

    2007-01-01

    Sapoviruses are one of the major agents of acute gastroenteritis in childhood. They form a tight genetic cluster (genus) in the Caliciviridae family that regroups both animal and human pathogenic strains. No permissive tissue culture has been developed for human sapovirus, limiting its characterization to surrogate systems. We report here on the first extensive characterization of the key enzyme of replication, the RNA-dependent RNA polymerase (RdRp) associated with the 3Dpol-like protein. Enzymatically active sapovirus 3Dpol and its defective mutant were expressed in Escherichia coli and purified. The overall structure of the sapovirus 3Dpol was determined by X-ray crystallography to 2.32-Å resolution. It revealed a right hand fold typical for template-dependent polynucleotide polymerases. The carboxyl terminus is located within the active site cleft, as observed in the RdRp of some (norovirus) but not other (lagovirus) caliciviruses. Sapovirus 3Dpol prefers Mn2+ over Mg2+ but may utilize either as a cofactor in vitro. In a synthetic RNA template-dependent reaction, sapovirus 3Dpol synthesizes a double-stranded RNA or labels the template 3′ terminus by terminal transferase activity. Initiation of RNA synthesis occurs de novo on heteropolymeric templates or in a primer-dependent manner on polyadenylated templates. Strikingly, this mode of initiation of RNA synthesis was also described for norovirus, but not for lagovirus, suggesting structural and functional homologies in the RNA-dependent RNA polymerase of human pathogenic caliciviruses. This first experimental evidence makes sapovirus 3Dpol an attractive target for developing drugs to control calicivirus infection in humans. PMID:17121797

  17. Enzymatic and nonenzymatic functions of viral RNA-dependent RNA polymerases within oligomeric arrays

    PubMed Central

    Spagnolo, Jeannie F.; Rossignol, Evan; Bullitt, Esther; Kirkegaard, Karla

    2010-01-01

    Few antivirals are effective against positive-strand RNA viruses, primarily because the high error rate during replication of these viruses leads to the rapid development of drug resistance. One of the favored current targets for the development of antiviral compounds is the active site of viral RNA-dependent RNA polymerases. However, like many subcellular processes, replication of the genomes of all positive-strand RNA viruses occurs in highly oligomeric complexes on the cytosolic surfaces of the intracellular membranes of infected host cells. In this study, catalytically inactive polymerases were shown to participate productively in functional oligomer formation and catalysis, as assayed by RNA template elongation. Direct protein transduction to introduce either active or inactive polymerases into cells infected with mutant virus confirmed the structural role for polymerase molecules during infection. Therefore, we suggest that targeting the active sites of polymerase molecules is not likely to be the best antiviral strategy, as inactivated polymerases do not inhibit replication of other viruses in the same cell and can, in fact, be useful in RNA replication complexes. On the other hand, polymerases that could not participate in functional RNA replication complexes were those that contained mutations in the amino terminus, leading to altered contacts in the folded polymerase and mutations in a known polymerase–polymerase interaction in the two-dimensional protein lattice. Thus, the functional nature of multimeric arrays of RNA-dependent RNA polymerase supplies a novel target for antiviral compounds and provides a new appreciation for enzymatic catalysis on membranous surfaces within cells. PMID:20051491

  18. 7 CFR 1b.3 - Categorical exclusions.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... Office of the Secretary of Agriculture NATIONAL ENVIRONMENTAL POLICY ACT § 1b.3 Categorical exclusions... environmental assessment (EA's) or environmental impact statement (EIS's), unless individual agency procedures prescribed otherwise. (1) Policy development, planning and implementation which relate to routine activities...

  19. 7 CFR 1b.3 - Categorical exclusions.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... Office of the Secretary of Agriculture NATIONAL ENVIRONMENTAL POLICY ACT § 1b.3 Categorical exclusions... environmental assessment (EA's) or environmental impact statement (EIS's), unless individual agency procedures prescribed otherwise. (1) Policy development, planning and implementation which relate to routine activities...

  20. 7 CFR 1b.3 - Categorical exclusions.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... Office of the Secretary of Agriculture NATIONAL ENVIRONMENTAL POLICY ACT § 1b.3 Categorical exclusions... environmental assessment (EA's) or environmental impact statement (EIS's), unless individual agency procedures prescribed otherwise. (1) Policy development, planning and implementation which relate to routine activities...

  1. 7 CFR 1b.3 - Categorical exclusions.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... Office of the Secretary of Agriculture NATIONAL ENVIRONMENTAL POLICY ACT § 1b.3 Categorical exclusions... environmental assessment (EA's) or environmental impact statement (EIS's), unless individual agency procedures prescribed otherwise. (1) Policy development, planning and implementation which relate to routine activities...

  2. Low-Dose Inorganic Mercury Increases Severity and Frequency of Chronic Coxsackievirus-Induced Autoimmune Myocarditis in Mice

    PubMed Central

    Nyland, Jennifer F.; Fairweather, DeLisa; Shirley, Devon L.; Davis, Sarah E.; Rose, Noel R.; Silbergeld, Ellen K.

    2012-01-01

    Mercury is a widespread environmental contaminant with neurotoxic impacts that have been observed over a range of exposures. In addition, there is increasing evidence that inorganic mercury (iHg) and organic mercury (including methyl mercury) have a range of immunotoxic effects, including immune suppression and induction of autoimmunity. In this study, we investigated the effect of iHg on a model of autoimmune heart disease in mice induced by infection with coxsackievirus B3 (CVB3). We examined the role of timing of iHg exposure on disease; in some experiments, mice were pretreated with iHg (200 μg/kg, every other day for 15 days) before disease induction with virus inoculation, and in others, they were treated with iHg after the acute (viral) phase of disease but before the development of dilated cardiomyopathy (DCM). iHg alone had no effect on heart pathology. Pretreatment with iHg before CVB3 infection significantly increased the severity of chronic myocarditis and DCM compared with control animals receiving vehicle alone. In contrast, treatment with iHg after acute myocarditis did not affect the severity of chronic disease. The increased chronic myocarditis, fibrosis, and DCM induced by iHg pretreatment were not due to increased viral replication in the heart, which was unaltered by iHg treatment. iHg pretreatment induced a macrophage infiltrate and mixed cytokine response in the heart during acute myocarditis, including significantly increased interleukin (IL)-12, IL-17, interferon-γ, and tumor necrosis factor-α levels. IL-17 levels were also significantly increased in the spleen during chronic disease. Thus, we show for the first time that low-dose Hg exposure increases chronic myocarditis and DCM in a murine model. PMID:21984480

  3. Molecular characterization of enterovirus 71 and coxsackievirus A16 using the 5' untranslated region and VP1 region.

    PubMed

    Zhou, Fei; Kong, Fanrong; Wang, Bin; McPhie, Kenneth; Gilbert, Gwendolyn L; Dwyer, Dominic E

    2011-03-01

    Enterovirus 71 (EV71) and coxsackievirus A16 (CVA16) are members of the species Human enterovirus A, and are both major and independent aetiological agents of hand-foot-and-mouth disease. The human enterovirus (HEV) 5' untranslated region (UTR) is fundamentally important for efficient virus replication and for virulence, whilst the VP1 region correlates well with antigenic typing by neutralization, and can be used for virus identification and evolutionary studies. A comparison was undertaken of the 5'UTR and VP1 nucleotide sequences of five EV71 clinical isolates and 10 CVA16 clinical isolates from one laboratory with the 5'UTR and VP1 sequences of 104 EV71 strains and 45 CVA16 strains available in GenBank. The genetic relationships were analysed using standard phylogenetic methods. The EV71 phylogenetic analysis showed that the VP1 sequences were clustered into three genogroups, A, B and C, with genogroups B and C further divided into five subgenogroups, B1-B5 and C1-C5, respectively. All EV71 strains were clustered similarly in the 5'UTR and VP1 trees, except for one Taiwanese strain, which demonstrated different clustering in the two trees, suggesting a recombination event in the phylogeny. The CVA16 phylogenetic analysis showed that the VP1 sequences were clustered into two genogroups, A and B, with genogroup B further divided into B1 (B1a and B1b), B2 and a possible B3; and that a similar pattern and grouping of all strains were displayed in the 5'UTR tree. This study demonstrated that comparing the two regions provides evidence of epidemiological linkage of HEV-A strains, and that mutation in the two regions plays a vital role in the evolution of these viruses. The combination of molecular typing and phylogenetic sequence analysis will be beneficial in both individual patient diagnosis and public health measures.

  4. An RNA replication-center assay for high content image-based quantifications of human rhinovirus and coxsackievirus infections

    PubMed Central

    2010-01-01

    Background Picornaviruses are common human and animal pathogens, including polio and rhinoviruses of the enterovirus family, and hepatits A or food-and-mouth disease viruses. There are no effective countermeasures against the vast majority of picornaviruses, with the exception of polio and hepatitis A vaccines. Human rhinoviruses (HRV) are the most prevalent picornaviruses comprising more than one hundred serotypes. The existing and also emerging HRVs pose severe health risks for patients with asthma or chronic obstructive pulmonary disease. Here, we developed a serotype-independent infection assay using a commercially available mouse monoclonal antibody (mabJ2) detecting double-strand RNA. Results Immunocytochemical staining for RNA replication centers using mabJ2 identified cells that were infected with either HRV1A, 2, 14, 16, 37 or coxsackievirus (CV) B3, B4 or A21. MabJ2 labeled-cells were immunocytochemically positive for newly synthesized viral capsid proteins from HRV1A, 14, 16, 37 or CVB3, 4. We optimized the procedure for detection of virus replication in settings for high content screening with automated fluorescence microscopy and single cell analysis. Our data show that the infection signal was dependent on multiplicity, time and temperature of infection, and the mabJ2-positive cell numbers correlated with viral titres determined in single step growth curves. The mabJ2 infection assay was adapted to determine the efficacy of anti-viral compounds and small interfering RNAs (siRNAs) blocking enterovirus infections. Conclusions We report a broadly applicable, rapid protocol to measure infection of cultured cells with enteroviruses at single cell resolution. This assay can be applied to a wide range of plus-sense RNA viruses, and hence allows comparative studies of viral infection biology without dedicated reagents or procedures. This protocol also allows to directly compare results from small compound or siRNA infection screens for different serotypes

  5. The B3-VLA quasar sample

    NASA Astrophysics Data System (ADS)

    Vigotti, M.; Vettolani, G.; Merighi, R.; Lahulla, J. F.; Pedani, M.

    1997-06-01

    A new low frequency radio selected Sample of 125 Quasars complete down to 100 mJy at 408 MHz is presented in this paper. The sample is a part of the B3-VLA sample: 1050 radiosources selected from the B3 catalogue at 408 MHz and observed at the VLA (1465 MHz, C and A configurations). Out of the 352 sources, identified on the POSS-I down to mr ~20.0, 172 are quasar candidates. In this paper we give the final assessment of the quasar sample from spectroscopic observations of the candidates. The final complete quasar sample consists of 125 objects. Furthermore 3 Bl Lac objects have been identified and two Bl Lac candidates. Tables 4, 5, 6 and Figs. 1, 2, 3, 4, 6 are also available in electronic form at the CDS via anonymous ftp to: cdsarc.u-strasbg.fr (130.79.128.5) or via http://cdsweb.u-strasbg.fr/Abstract.html.

  6. Cellular immune mechanisms in Coxsackievirus group B, type 3 induced myocarditis in Balb/C mice

    SciTech Connect

    Huber, S.A.; Job, L.P.

    1983-01-01

    Coxsackie B viruses are a common cause of viral myocarditis in humans. A murine model of the human disease has been developed using Coxsackievirus group B, type 3 and inbred Balb/c mice. Infection of T lymphocyte deficient mice does not result in significant myocarditis indicating the importance of T cells in this disease. The virus can be isolated from the hearts of T cell deficient and normal mice in equal concentrations. Virus elimination presumably is mediated by virus specific neutralizing antibody induced in both groups. T lymphocytes, natural killer cells and macrophage obtained from normal virus infected mice are all capable of lysing myofibers in vitro. Maximum lysis is obtained with the cytolytic T cells. When these cell populations or Coxsackievirus immune antibody were adoptively transferred into T lymphocyte deficient animals infected with the virus, only animals given T cells developed significant myocarditis.

  7. 216-B-3 expansion ponds closure plan

    SciTech Connect

    Not Available

    1994-10-01

    This document describes the activities for clean closure under the Resource Conservation and Recovery Act of 1976 (RCRA) of the 216-B-3 Expansion Ponds. The 216-B-3 Expansion Ponds are operated by the US Department of Energy, Richland Operations Office (DOE-RL) and co-operated by Westinghouse Hanford Company (Westinghouse Hanford). The 216-B-3 Expansion Ponds consists of a series of three earthen, unlined, interconnected ponds that receive waste water from various 200 East Area operating facilities. The 3A, 3B, and 3C ponds are referred to as Expansion Ponds because they expanded the capability of the B Pond System. Waste water (primarily cooling water, steam condensate, and sanitary water) from various 200 East Area facilities is discharged to the Bypass pipe (Project X-009). Water discharged to the Bypass pipe flows directly into the 216-B-3C Pond. The ponds were operated in a cascade mode, where the Main Pond overflowed into the 3A Pond and the 3A Pond overflowed into the 3C Pond. The 3B Pond has not received waste water since May 1985; however, when in operation, the 3B Pond received overflow from the 3A Pond. In the past, waste water discharges to the Expansion Ponds had the potential to have contained mixed waste (radioactive waste and dangerous waste). The radioactive portion of mixed waste has been interpreted by the US Department of Energy (DOE) to be regulated under the Atomic Energy Act of 1954; the dangerous waste portion of mixed waste is regulated under RCRA.

  8. Myocarditis, Disseminated Infection, and Early Viral Persistence Following Experimental Coxsackievirus B Infection of Cynomolgus Monkeys

    PubMed Central

    Cammock, Cheryl E.; Halnon, Nancy J.; Skoczylas, Jill; Blanchard, James; Bohm, Rudolf; Miller, Christopher J.; Lai, Chi; Krogstad, Paul A.

    2013-01-01

    Coxsackievirus B (CVB) infection is a common cause of acute viral myocarditis. The clinical presentation of myocarditis caused by this enterovirus is highly variable, ranging from mildly symptoms to complete hemodynamic collapse. These variations in initial symptoms and in the immediate and long term outcomes of this disease have impeded development of effective treatment strategies. Nine cynomolgus monkeys were inoculated with myocarditic strains of CVB. Virological studies performed up to 28 days post-inoculation demonstrated the development of neutralizing antibody in all animals, and the presence of CVB in plasma. High dose intravenous inoculation (n = 2) resulted in severe disseminated disease, while low dose intravenous (n = 6) or oral infection (1 animal) resulted in clinically unapparent infection. Transient, minor, echocardiographic abnormalities were noted in several animals, but no animals displayed signs of significant acute cardiac failure. Although viremia rapidly resolved, signs of myocardial inflammation and injury were observed in all animals at the time of necropsy, and CVB was detected in postmortem myocardial specimens up to 28 days PI. This non-human primate system replicates many features of illness in acute coxsackievirus myocarditis and demonstrates that myocardial involvement may be common in enteroviral infection; it may provide a model system for testing of treatment strategies for enteroviral infections and acute coxsackievirus myocarditis. PMID:24040287

  9. Episodic adaptive diversification of classical swine fever virus RNA-dependent RNA polymerase NS5B.

    PubMed

    Li, Yan; Yang, Zexiao

    2015-12-01

    Classical swine fever virus (CSFV) is the pathogen that causes a highly infectious disease of pigs and has led to disastrous losses to pig farms and related industries. The RNA-dependent RNA polymerase (RdRp) NS5B is a central component of the replicase complex (RC) in some single-stranded RNA viruses, including CSFV. On the basis of genetic variation, the CSFV RdRps could be clearly divided into 2 major groups and a minor group, which is consistent with the phylogenetic relationships and virulence diversification of the CSFV isolates. However, the adaptive signature underlying such an evolutionary profile of the polymerase and the virus is still an interesting open question. We analyzed the evolutionary trajectory of the CSFV RdRps over different timescales to evaluate the potential adaptation. We found that adaptive selection has driven the diversification of the RdRps between, but not within, CSFV major groups. Further, the major adaptive divergence-related sites are located in the surfaces relevant to the interaction with other component(s) of RC and the entrance and exit of the template-binding channel. These results might shed some light on the nature of the RdRp in virulence diversification of CSFV groups.

  10. The RNA-dependent RNA polymerase of Citrus tristeza virus forms oligomers.

    PubMed

    Cevik, Bayram

    2013-12-01

    The RNA-dependent RNA polymerases (RdRp) from Citrus tristeza virus (CTV) were tagged with HA and FLAG epitopes. Differentially tagged proteins were expressed either individually or concomitantly in Escherichia coli. Immunoprecipitation of the expressed proteins with anti-FLAG antibody followed by Western blot with anti-HA antibody demonstrated that molecules of RdRp from CTV interact to form oligomers. Yeast two-hybrid assays showed that molecules of RdRp interact in eukaryotic cells. Co-immunoprecipitation with anti-FLAG antibody of truncated HA-tagged RdRps (RdRpΔ1-166-HA, RdRpΔ1-390-HA, RdRp1-169-HA) co-expressed with full-length RdRp-FLAG showed that only RdRp1-169-HA interacted with the full-length FLAG-RdRp. Yeast two-hybrid assays with truncated RdRp constructs confirmed that the oligomerization site resides in the N-terminal region and that the first 169 aa of CTV RdRp are necessary and sufficient for oligomerization both in bacterial and yeast cells. Development of control strategies targeting viral RdRp oligomer formation may inhibit virus replication and prove useful in control of CTV. © 2013 Elsevier Inc. All rights reserved.

  11. Functional Evolution in Orthologous Cell-encoded RNA-dependent RNA Polymerases*

    PubMed Central

    Qian, Xinlei; Hamid, Fursham M.; El Sahili, Abbas; Darwis, Dina Amallia; Wong, Yee Hwa; Bhushan, Shashi; Makeyev, Eugene V.; Lescar, Julien

    2016-01-01

    Many eukaryotic organisms encode more than one RNA-dependent RNA polymerase (RdRP) that probably emerged as a result of gene duplication. Such RdRP paralogs often participate in distinct RNA silencing pathways and show characteristic repertoires of enzymatic activities in vitro. However, to what extent members of individual paralogous groups can undergo functional changes during speciation remains an open question. We show that orthologs of QDE-1, an RdRP component of the quelling pathway in Neurospora crassa, have rapidly diverged in evolution at the amino acid sequence level. Analyses of purified QDE-1 polymerases from N. crassa (QDE-1Ncr) and related fungi, Thielavia terrestris (QDE-1Tte) and Myceliophthora thermophila (QDE-1Mth), show that all three enzymes can synthesize RNA, but the precise modes of their action differ considerably. Unlike their QDE-1Ncr counterpart favoring processive RNA synthesis, QDE-1Tte and QDE-1Mth produce predominantly short RNA copies via primer-independent initiation. Surprisingly, a 3.19 Å resolution crystal structure of QDE-1Tte reveals a quasisymmetric dimer similar to QDE-1Ncr. Further electron microscopy analyses confirm that QDE-1Tte occurs as a dimer in solution and retains this status upon interaction with a template. We conclude that divergence of orthologous RdRPs can result in functional innovation while retaining overall protein fold and quaternary structure. PMID:26907693

  12. Organization, Function, and Therapeutic Targeting of the Morbillivirus RNA-Dependent RNA Polymerase Complex

    PubMed Central

    Sourimant, Julien; Plemper, Richard K.

    2016-01-01

    The morbillivirus genus comprises major human and animal pathogens, including the highly contagious measles virus. Morbilliviruses feature single stranded negative sense RNA genomes that are wrapped by a plasma membrane-derived lipid envelope. Genomes are encapsidated by the viral nucleocapsid protein forming ribonucleoprotein complexes, and only the encapsidated RNA is transcribed and replicated by the viral RNA-dependent RNA polymerase (RdRp). In this review, we discuss recent breakthroughs towards the structural and functional understanding of the morbillivirus polymerase complex. Considering the clinical burden imposed by members of the morbillivirus genus, the development of novel antiviral therapeutics is urgently needed. The viral polymerase complex presents unique structural and enzymatic properties that can serve as attractive candidates for druggable targets. We evaluate distinct strategies for therapeutic intervention and examine how high-resolution insight into the organization of the polymerase complex may pave the path towards the structure-based design and optimization of next-generation RdRp inhibitors. PMID:27626440

  13. RNA-dependent dynamic histone acetylation regulates MCL1 alternative splicing

    PubMed Central

    Khan, Dilshad H.; Gonzalez, Carolina; Cooper, Charlton; Sun, Jian-Min; Chen, Hou Yu; Healy, Shannon; Xu, Wayne; Smith, Karen T.; Workman, Jerry L.; Leygue, Etienne; Davie, James R.

    2014-01-01

    Histone deacetylases (HDACs) and lysine acetyltransferases (KATs) catalyze dynamic histone acetylation at regulatory and coding regions of transcribed genes. Highly phosphorylated HDAC2 is recruited within corepressor complexes to regulatory regions, while the nonphosphorylated form is associated with the gene body. In this study, we characterized the nonphosphorylated HDAC2 complexes recruited to the transcribed gene body and explored the function of HDAC-complex-mediated dynamic histone acetylation. HDAC1 and 2 were coimmunoprecipitated with several splicing factors, including serine/arginine-rich splicing factor 1 (SRSF1) which has roles in alternative splicing. The co-chromatin immunoprecipitation of HDAC1/2 and SRSF1 to the gene body was RNA-dependent. Inhibition of HDAC activity and knockdown of HDAC1, HDAC2 or SRSF1 showed that these proteins were involved in alternative splicing of MCL1. HDAC1/2 and KAT2B were associated with nascent pre-mRNA in general and with MCL1 pre-mRNA specifically. Inhibition of HDAC activity increased the occupancy of KAT2B and acetylation of H3 and H4 of the H3K4 methylated alternative MCL1 exon 2 nucleosome. Thus, nonphosphorylated HDAC1/2 is recruited to pre-mRNA by splicing factors to act at the RNA level with KAT2B and other KATs to catalyze dynamic histone acetylation of the MCL1 alternative exon and alter the splicing of MCL1 pre-mRNA. PMID:24234443

  14. RNAi: Mammalian oocytes do it without RNA-dependent RNA polymerase

    PubMed Central

    STEIN, PAULA; SVOBODA, PETR; ANGER, MARTIN; SCHULTZ, RICHARD M.

    2003-01-01

    Studies in mutant organisms deficient in RNA interference (RNAi) and related post-transcriptional gene silencing implicated a role for a single class of RNA-dependent RNA polymerases (RdRp). Nevertheless, sequence homologs to these RdRps have not been found in coelomate organisms such as Drosophila or mammals. This lack of homologous sequences does not exclude that an RdRp functions in RNAi in these organisms because an RdRp could be acquired by horizontal transfer from an RNA virus. In fact, such a sequence is found in mice (Aquarius) and we observe that it is expressed in mouse oocytes and early embryos, which exhibit RNAi. We report here that cordycepin, an inhibitor of RNA synthesis, does not prevent Mos double-strand RNA (dsRNA) to target endogenous Mos mRNA in mouse oocytes and that targeting a chimeric Mos–EGFP mRNA with dsRNA to EGFP does not reduce the endogenous Mos mRNA, but does target the chimeric mRNA. These results indicate that an RdRp is not involved in dsRNA-mediated mRNA degradation in mammalian oocytes, and possibly in mammals in general, and therefore that only homologous sequences to the dsRNA are targeted for degradation. PMID:12554861

  15. Multiple isoelectric forms of poliovirus RNA-dependent RNA polymerase: Evidence for phosphorylation

    SciTech Connect

    Ransone, L.J.; Dasgupta, A. )

    1989-11-01

    Poliovirus-specific RNA-dependent RNA polymerase (3Dpol) was purified to apparent homogeneity. A single polypeptide of an apparent molecular weight of 63,000 catalyzes the synthesis of dimeric and monomeric RNA products in response to the poliovirion RNA template. Analysis of purified 3Dpol by two-dimensional electrophoresis showed multiple forms of 3Dpol, suggesting posttranslational modification of the protein in virus-infected cells. The two major forms of 3Dpol appear to have approximate pI values of 7.1 and 7.4. Incubation of purified 3Dpol with calf intestinal phosphatase resulted in almost complete disappearance of the pI 7.1 form and a concomitant increase in the intensity of the pI 7.4 form of 3Dpol. Addition of 32P-labeled Pi during infection of HeLa cells with poliovirus resulted in specific labeling of 3Dpol and 3CD, a viral protein which contains the entire 3Dpol sequence. Both 3Dpol and 3CD appear to be phosphorylated at serine residues. Ribosomal salt washes prepared from both mock- and poliovirus-infected cells contain phosphatases capable of dephosphorylating quantitatively the phosphorylated form (pI 7.1) of 3Dpol.

  16. Potent Non-Nucleoside Inhibitors of the Measles Virus RNA-Dependent RNA Polymerase Complex

    PubMed Central

    Sun, Aiming; Yoon, Jeong-Joong; Yin, Yan; Prussia, Andrew; Yang, Yutao; Min, Jaeki; Plemper, Richard K.; Snyder, James P.

    2008-01-01

    Measles virus (MV) is one of the most infectious pathogens known. In spite of the existence of a vaccine, approximately 350,000 deaths/year result from MV or associated complications. Anti-measles compounds could conceivably diminish these statistics and provide a therapy that complements vaccine treatment. We recently described a high-throughput screening hit compound 1 (16677) against MV-infected cells with the capacity to eliminate viral reproduction at 250 nM by inhibiting the action of the virus’s RNA-dependent RNA polymerase complex (RdRp). The compound, 1-methyl-3-(trifluoromethyl)-N-[4-sulfonylphenyl]-1H-pyrazole-5-carboxamide, carries a critical CF3 moiety on the 1,2-pyrazole ring. Elaborating on the preliminary structure-activity (SAR) study, the present work presents the synthesis and SAR of a much broader range of low nanomolar non-peptidic MV inhibitors and speculates on the role of the CF3 functionality.1 PMID:18529043

  17. Structural basis for proteolysis-dependent activation of the poliovirus RNA-dependent RNA polymerase

    PubMed Central

    Thompson, Aaron A; Peersen, Olve B

    2004-01-01

    The active RNA-dependent RNA polymerase of poliovirus, 3Dpol, is generated by cleavage of the 3CDpro precursor protein, a protease that has no polymerase activity despite containing the entire polymerase domain. By intentionally disrupting a known and persistent crystal packing interaction, we have crystallized the poliovirus polymerase in a new space group and solved the complete structure of the protein at 2.0 Å resolution. It shows that the N-terminus of fully processed 3Dpol is buried in a surface pocket where it makes hydrogen bonds that act to position Asp238 in the active site. Asp238 is an essential residue that selects for the 2′ OH group of substrate rNTPs, as shown by a 2.35 Å structure of a 3Dpol–GTP complex. Mutational, biochemical, and structural data further demonstrate that 3Dpol activity is exquisitely sensitive to mutations at the N-terminus. This sensitivity is the result of allosteric effects where the structure around the buried N-terminus directly affects the positioning of Asp238 in the active site. PMID:15306852

  18. RNA-dependent RNA polymerase: Addressing Zika outbreak by a phylogeny-based drug target study.

    PubMed

    Stephen, Preyesh; Lin, Sheng-Xiang

    2017-06-21

    Since the first major outbreak of Zika virus (ZIKV) in 2007, ZIKV is spreading explosively through South and Central America, and recent reports in highly populated developing countries alarm the possibility of a more catastrophic outbreak. ZIKV infection in pregnant women leads to embryonic microcephaly and Guillain-Barré syndrome in adults. At present, there is limited understanding of the infectious mechanism, and no approved therapy has been reported. Despite the withdrawal of public health emergency, the WHO still considers the ZIKV as a highly significant and long-term public health challenge that the situation has to be addressed rapidly. Non-structural protein 5 is essential for capping and replication of viral RNA and comprises a methyltransferase and RNA-dependent RNA polymerase (RdRp) domain. We used molecular modeling to obtain the structure of ZIKV RdRp, and by molecular docking and phylogeny analysis, we here demonstrate the potential sites for drug screening. Two metal binding sites and an NS3-interacting region in ZIKV RdRp are demonstrated as potential drug screening sites. The docked structures reveal a remarkable degree of conservation at the substrate binding site and the potential drug screening sites. A phylogeny-based approach is provided for an emergency preparedness, where similar class of ligands could target phylogenetically related proteins. © 2017 John Wiley & Sons A/S.

  19. Engineering human PrimPol into an efficient RNA-dependent-DNA primase/polymerase.

    PubMed

    Agudo, Rubén; Calvo, Patricia A; Martínez-Jiménez, María I; Blanco, Luis

    2017-09-06

    We have developed a straightforward fluorometric assay to measure primase-polymerase activity of human PrimPol (HsPrimPol). The sensitivity of this procedure uncovered a novel RNA-dependent DNA priming-polymerization activity (RdDP) of this enzyme. In an attempt to enhance HsPrimPol RdDP activity, we constructed a smart mutant library guided by prior sequence-function analysis, and tested this library in an adapted screening platform of our fluorometric assay. After screening less than 500 variants, we found a specific HsPrimPol mutant, Y89R, which displays 10-fold higher RdDP activity than the wild-type enzyme. The improvement of RdDP activity in the Y89R variant was due mainly to an increased in the stabilization of the preternary complex (protein:template:incoming nucleotide), a specific step preceding dimer formation. Finally, in support of the biotechnological potential of PrimPol as a DNA primer maker during reverse transcription, mutant Y89R HsPrimPol rendered up to 17-fold more DNA than with random hexamer primers. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  20. Norovirus proteinase-polymerase and polymerase are both active forms of RNA-dependent RNA polymerase.

    PubMed

    Belliot, Gaël; Sosnovtsev, Stanislav V; Chang, Kyeong-Ok; Babu, Vijay; Uche, Uzo; Arnold, Jamie J; Cameron, Craig E; Green, Kim Y

    2005-02-01

    In vitro mapping studies of the MD145 norovirus (Caliciviridae) ORF1 polyprotein identified two stable cleavage products containing the viral RNA-dependent RNA polymerase (RdRp) domains: ProPol (a precursor comprised of both the proteinase and polymerase) and Pol (the mature polymerase). The goal of this study was to identify the active form (or forms) of the norovirus polymerase. The recombinant ProPol (expressed as Pro(-)Pol with an inactivated proteinase domain to prevent autocleavage) and recombinant Pol were purified after synthesis in bacteria and shown to be active RdRp enzymes. In addition, the mutant His-E1189A-ProPol protein (with active proteinase but with the natural ProPol cleavage site blocked) was active as an RdRp, confirming that the norovirus ProPol precursor could possess two enzymatic activities simultaneously. The effects of several UTP analogs on the RdRp activity of the norovirus and feline calicivirus Pro(-)Pol enzymes were compared and found to be similar. Our data suggest that the norovirus ProPol is a bifunctional enzyme during virus replication. The availability of this recombinant ProPol enzyme might prove useful in the development of antiviral drugs for control of the noroviruses associated with acute gastroenteritis.

  1. Norovirus Proteinase-Polymerase and Polymerase Are Both Active Forms of RNA-Dependent RNA Polymerase

    PubMed Central

    Belliot, Gaël; Sosnovtsev, Stanislav V.; Chang, Kyeong-Ok; Babu, Vijay; Uche, Uzo; Arnold, Jamie J.; Cameron, Craig E.; Green, Kim Y.

    2005-01-01

    In vitro mapping studies of the MD145 norovirus (Caliciviridae) ORF1 polyprotein identified two stable cleavage products containing the viral RNA-dependent RNA polymerase (RdRp) domains: ProPol (a precursor comprised of both the proteinase and polymerase) and Pol (the mature polymerase). The goal of this study was to identify the active form (or forms) of the norovirus polymerase. The recombinant ProPol (expressed as Pro−Pol with an inactivated proteinase domain to prevent autocleavage) and recombinant Pol were purified after synthesis in bacteria and shown to be active RdRp enzymes. In addition, the mutant His-E1189A-ProPol protein (with active proteinase but with the natural ProPol cleavage site blocked) was active as an RdRp, confirming that the norovirus ProPol precursor could possess two enzymatic activities simultaneously. The effects of several UTP analogs on the RdRp activity of the norovirus and feline calicivirus Pro−Pol enzymes were compared and found to be similar. Our data suggest that the norovirus ProPol is a bifunctional enzyme during virus replication. The availability of this recombinant ProPol enzyme might prove useful in the development of antiviral drugs for control of the noroviruses associated with acute gastroenteritis. PMID:15681440

  2. Norovirus RNA-dependent RNA polymerase: A computational study of metal-binding preferences.

    PubMed

    Shaik, Md Munan; Bhattacharjee, Nicholus; Feliks, Mikolaj; Ng, Kenneth K-S; Field, Martin J

    2017-04-06

    Norovirus (NV) RNA-dependent RNA polymerase (RdRP) is essential for replicating the genome of the virus, which makes this enzyme a key target for the development of antiviral agents against NV gastroenteritis. In this work, a complex of NV RdRP bound to manganese ions and an RNA primer-template duplex was investigated using X-ray crystallography and hybrid quantum chemical/molecular mechanical simulations. Experimentally, the complex crystallized in a tetragonal crystal form. The nature of the primer/template duplex binding in the resulting structure indicates that the complex is a closed back-tracked state of the enzyme, in which the 3'-end of the primer occupies the position expected for the post-incorporated nucleotide before translocation. Computationally, it is found that the complex can accept a range of divalent metal cations without marked distortions in the active site structure. The highest binding energy is for copper, followed closely by manganese and iron, and then by zinc, nickel and cobalt. This article is protected by copyright. All rights reserved.

  3. An RNA-dependent protein kinase is involved in tunicamycin-induced apoptosis and Alzheimer's disease

    PubMed Central

    Onuki, Reiko; Bando, Yoshio; Suyama, Eigo; Katayama, Taiichi; Kawasaki, Hiroaki; Baba, Tadashi; Tohyama, Masaya; Taira, Kazunari

    2004-01-01

    Various types of stress, such as disruption of calcium homeostasis, inhibition of protein glycosylation and reduction of disulfide bonds, result in accumulation of misfolded proteins in the endoplasmic reticulum (ER). The initial cellular response involves removal of such proteins by the ER, but excessive and/or long-term stress results in apoptosis. In this study, we used a randomized ribozyme library and ER stress-mediated apoptosis (tunicamycin-induced apoptosis) in SK-N-SH human neuroblastoma cells as a selective phenotype to identify factors involved in this process. We identified a double-stranded RNA-dependent protein kinase (PKR) as one of the participants in this process. The level of nuclear PKR was elevated, but the level of cytoplasmic PKR barely changed in tunicamycin-treated SK-N-SH cells. Furthermore, tunicamycin also raised levels of phosphorylated PKR in the nucleus. We also detected the accumulation of phosphorylated PKR in the nuclei of autopsied brain tissues in Alzheimer's disease. Thus, PKR might play a role in ER stress-induced apoptosis and in Alzheimer's disease. PMID:14765129

  4. The uncoupling of catalysis and translocation in the viral RNA-dependent RNA polymerase.

    PubMed

    Shu, Bo; Gong, Peng

    2017-03-01

    The nucleotide addition cycle of nucleic acid polymerases includes two major events: the pre-chemistry active site closure leading to the addition of one nucleotide to the product chain; the post-chemistry translocation step moving the polymerase active site one position downstream on its template. In viral RNA-dependent RNA polymerases (RdRPs), structural and biochemical evidences suggest that these two events are not tightly coupled, unlike the situation observed in A-family polymerases such as the bacteriophage T7 RNA polymerase. Recently, an RdRP translocation intermediate crystal structure of enterovirus 71 shed light on how translocation may be controlled by elements within RdRP catalytic motifs, and a series of poliovirus apo RdRP crystal structures explicitly suggest that a motif B loop may assist the movement of the template strand in late stages of transcription. Implications of RdRP catalysis-translocation uncoupling and the remaining challenges to further elucidate RdRP translocation mechanism are also discussed.

  5. Phosphorylation at the N-terminal finger subdomain of a viral RNA-dependent RNA polymerase.

    PubMed

    Hernández, Sergio; Figueroa, Daniella; Correa, Simón; Díaz, Ariel; Aguayo, Daniel; Villanueva, Rodrigo A

    2015-10-09

    The RNA-dependent RNA polymerase (RdRP) of the Hepatitis C virus (HCV), named NS5B, is phosphorylated by the cellular protein kinase C-related kinase 2 (PRK2) at two serine residues (Ser29 and Ser42) of the finger subdomain (genotype 1b). Herein, using bioinformatics, we selected four potential phosphorylation residues (Ser46, Ser76, Ser96 and Ser112) of NS5B (genotype 2a) for study. Whereas the NS5B Ser46D and Ser76D substitutions seemed to improve polymerase activity, the Ser96D mutation decreased colony formation efficiency. Active WT NS5B was utilized in in vitro kinase assays, and phosphopeptides were analyzed by mass spectrometry. Interestingly, the data indicated that both the NS5B Ser29 and Ser76 residues resulted phosphorylated. Thus, as Ser76 is absolutely conserved across HCV genotypes, our results confirmed the relevance of these sites for both genotypes and suggested that Ser76 becomes phosphorylated by a cellular kinase different from PRK2. By molecular dynamic simulations, we show that new interactions between space-adjacent amino acid chains could be established by the presence of a di-anionic phosphate group on the analyzed serines to possibly modify RNA polymerase activity. Together, our data present novel evidence on the complex regulation at the finger subdomain of HCV NS5B via phosphorylation. Copyright © 2015 Elsevier Inc. All rights reserved.

  6. Treatability of U.S. Environmental Protection Agency contaminant candidate list viruses: removal of coxsackievirus and echovirus using enhanced coagulation.

    PubMed

    Mayer, Brooke K; Ryu, Hodon; Abbaszadegan, Morteza

    2008-09-15

    Enhanced coagulation was evaluated for removal efficacy of coxsackievirus and echovirus (Contaminant Candidate List [CCL] enteroviruses), poliovirus, four potential surrogate bacteriophages, and dissolved organic carbon (DOC). Viruses and DOC were effectively removed using enhanced coagulation, with removals generally improving as dose increased and pH decreased. Optimal enhanced coagulation conditions of 40 mg/L FeCl3 and pH between 5 and 6.5 resulted in a maximum removal of 3.0 logs of coxsackievirus B6, 1.75 logs of echovirus 12, 2.5 logs of poliovirus 1, 1.8 logs of fr, 1.3 logs of phi-X174, 0.36 logs of MS2, 0.29 logs of PRD1, and 41% DOC. Bacteriophages fr and phi-X174 appear to be the most representative surrogates for the physical removal of coxsackievirus, while MS2 and PRD1 are more conservative. For echovirus, MS2 and PRD1 appearto bethe most appropriate surrogates. The relative removal profiles of the enteroviruses (greatest removal of coxsackievirus followed by poliovirus and then echovirus) suggest that studies of the physical removal of poliovirus may be extended to the CCL enteroviruses. These results contribute to evaluations of the CCL and regulatory status of coxsackievirus and echovirus and aid in building a database of the treatment efficiencies of enteroviruses and their surrogates.

  7. dsRNA-Dependent Protein Kinase PKR and its Role in Stress, Signaling and HCV Infection

    PubMed Central

    Dabo, Stéphanie; Meurs, Eliane F.

    2012-01-01

    The double-stranded RNA-dependent protein kinase PKR plays multiple roles in cells, in response to different stress situations. As a member of the interferon (IFN)‑Stimulated Genes, PKR was initially recognized as an actor in the antiviral action of IFN, due to its ability to control translation, through phosphorylation, of the alpha subunit of eukaryotic initiation factor 2 (eIF2α). As such, PKR participates in the generation of stress granules, or autophagy and a number of viruses have designed strategies to inhibit its action. However, PKR deficient mice resist most viral infections, indicating that PKR may play other roles in the cell other than just acting as an antiviral agent. Indeed, PKR regulates several signaling pathways, either as an adapter protein and/or using its kinase activity. Here we review the role of PKR as an eIF2α kinase, its participation in the regulation of the NF-κB, p38MAPK and insulin pathways, and we focus on its role during infection with the hepatitis C virus (HCV). PKR binds the HCV IRES RNA, cooperates with some functions of the HCV core protein and may represent a target for NS5A or E2. Novel data points out for a role of PKR as a pro-HCV agent, both as an adapter protein and as an eIF2α-kinase, and in cooperation with the di-ubiquitin-like protein ISG15. Developing pharmaceutical inhibitors of PKR may help in resolving some viral infections as well as stress-related damages. PMID:23202496

  8. Crystal structure of the RNA-dependent RNA polymerase from influenza C virus

    PubMed Central

    Hengrung, Narin; El Omari, Kamel; Martin, Itziar Serna; Vreede, Frank T.; Cusack, Stephen; Rambo, Robert P.; Vonrhein, Clemens; Bricogne, Gérard; Stuart, David I.; Grimes, Jonathan M.; Fodor, Ervin

    2016-01-01

    Negative-sense RNA viruses, such as influenza, encode large, multidomain RNA-dependent RNA polymerases that can both transcribe and replicate the viral RNA genome1. In influenza virus, the polymerase (FluPol) is composed of three polypeptides: PB1, PB2 and PA/P3. PB1 houses the polymerase active site, whereas PB2 and PA/P3 contain, respectively, cap-binding and endonuclease domains required for transcription initiation by cap-snatching2. Replication occurs through de novo initiation and involves a complementary RNA intermediate. Currently available structures of the influenza A and B virus polymerases include promoter RNA (the 5′ and 3′ termini of viral genome segments), showing FluPol in transcription pre-initiation states3,4. Here we report the structure of apo-FluPol from an influenza C virus, solved by X-ray crystallography to 3.9 Å, revealing a new ‘closed’ conformation. The apo-FluPol forms a compact particle with PB1 at its centre, capped on one face by PB2 and clamped between the two globular domains of P3. Notably, this structure is radically different from those of promoter-bound FluPols3,4. The endonuclease domain of P3 and the domains within the carboxy-terminal two-thirds of PB2 are completely rearranged. The cap-binding site is occluded by PB2, resulting in a conformation that is incompatible with transcription initiation. Thus, our structure captures FluPol in a closed, transcription pre-activation state. This reveals the conformation of newly made apo-FluPol in an infected cell, but may also apply to FluPol in the context of a non-transcribing ribonucleoprotein complex. Comparison of the apo-FluPol structure with those of promoter-bound FluPols allows us to propose a mechanism for FluPol activation. Our study demonstrates the remarkable flexibility of influenza virus RNA polymerase, and aids our understanding of the mechanisms controlling transcription and genome replication. PMID:26503046

  9. MicroRNA-Dependent Transcriptional Silencing of Transposable Elements in Drosophila Follicle Cells

    PubMed Central

    Mugat, Bruno; Akkouche, Abdou; Serrano, Vincent; Armenise, Claudia; Li, Blaise; Brun, Christine; Fulga, Tudor A.; Van Vactor, David; Pélisson, Alain; Chambeyron, Séverine

    2015-01-01

    RNA interference-related silencing mechanisms concern very diverse and distinct biological processes, from gene regulation (via the microRNA pathway) to defense against molecular parasites (through the small interfering RNA and the Piwi-interacting RNA pathways). Small non-coding RNAs serve as specificity factors that guide effector proteins to ribonucleic acid targets via base-pairing interactions, to achieve transcriptional or post-transcriptional regulation. Because of the small sequence complementarity required for microRNA-dependent post-transcriptional regulation, thousands of microRNA (miRNA) putative targets have been annotated in Drosophila. In Drosophila somatic ovarian cells, genomic parasites, such as transposable elements (TEs), are transcriptionally repressed by chromatin changes induced by Piwi-interacting RNAs (piRNAs) that prevent them from invading the germinal genome. Here we show, for the first time, that a functional miRNA pathway is required for the piRNA-mediated transcriptional silencing of TEs in this tissue. Global miRNA depletion, caused by tissue- and stage-specific knock down of drosha (involved in miRNA biogenesis), AGO1 or gawky (both responsible for miRNA activity), resulted in loss of TE-derived piRNAs and chromatin-mediated transcriptional de-silencing of TEs. This specific TE de-repression was also observed upon individual titration (by expression of the complementary miRNA sponge) of two miRNAs (miR-14 and miR-34) as well as in a miR-14 loss-of-function mutant background. Interestingly, the miRNA defects differentially affected TE- and 3' UTR-derived piRNAs. To our knowledge, this is the first indication of possible differences in the biogenesis or stability of TE- and 3' UTR-derived piRNAs. This work is one of the examples of detectable phenotypes caused by loss of individual miRNAs in Drosophila and the first genetic evidence that miRNAs have a role in the maintenance of genome stability via piRNA-mediated TE repression. PMID

  10. Saffold cardiovirus infection in children associated with respiratory disease and its similarity to coxsackievirus infection.

    PubMed

    Itagaki, Tsutomu; Abiko, Chieko; Aoki, Yoko; Ikeda, Tatsuya; Mizuta, Katsumi; Noda, Masahiro; Kimura, Hirokazu; Matsuzaki, Yoko

    2011-08-01

    Saffold virus (SAFV) is a newly discovered virus belonging to the genus Cardiovirus of the family Picornaviridae. Using molecular techniques, SAFV has been detected, although infrequently, in the stools of both healthy and diarrheic children and in respiratory specimens collected from children with respiratory disease. The epidemiology and pathogenicity of SAFV remain unclear. Between July 2009 and October 2010, nasopharyngeal specimens were collected from children with acute respiratory infections. The collected samples were used to isolate respiratory viruses, including coxsackievirus, by cell culture and were tested for SAFV by reverse transcription-polymerase chain reaction. SAFV genotype 2 (SAFV2) was detected in 54 (3.5%) of the 1525 children tested. SAFV2 detections showed an epidemic pattern for a 4-month period with a peak in October 2009. The median age of the SAFV2-positive children was 4 years (range: 7 months-16 years). Among the 35 SAFV2-positive children, excluding cases of viral coinfection, 13 (37.1%) had pharyngitis, 12 (34.3%) had tonsillitis, and 8 (22.8%) had herpangina. Bronchitis and gastroenteritis were detected in 1 case each. Fever (temperature, >38°C) was noted in 33 (94.3%) cases. The median duration of fever was 2 days (range: 1-3 days). Diarrhea was observed in 7 (20.0%) children, but watery and frequent diarrhea was not common. The age distribution and clinical diagnoses associated with SAFV2 infections were similar to those observed with coxsackievirus B4 infections, which detections showed an epidemic pattern during the study period. SAFV2 is a cause of upper respiratory tract illness that exhibits a pathogenicity similar to that of coxsackievirus B.

  11. Synergistic experimental/computational studies on arylazoenamine derivatives that target the bovine viral diarrhea virus RNA-dependent RNA polymerase.

    PubMed

    Giliberti, Gabriele; Ibba, Cristina; Marongiu, Esther; Loddo, Roberta; Tonelli, Michele; Boido, Vito; Laurini, Erik; Posocco, Paola; Fermeglia, Maurizio; Pricl, Sabrina

    2010-08-15

    Starting from a series of arylazoenamine derivatives, shown to be selectively and potently active against the bovine viral diarrhea virus (BVDV), we developed a hierarchical combined experimental/molecular modeling strategy to explore the drug leads for the BVDV RNA-dependent RNA polymerase. Accordingly, BVDV mutants resistant to lead compounds in our series were isolated, and the mutant residues on the viral molecular target, the RNA-dependent RNA polymerase, were identified. Docking procedures upon previously identified pharmacophoric constraints and actual mutational data were carried out, and the binding affinity of all active compounds for the RdRp was estimated. Given the excellent agreement between in silico and in vitro data, this procedure is currently being employed in the design a new series of more selective and potent BVDV inhibitors.

  12. The coxsackievirus A9 RGD motif is not essential for virus viability.

    PubMed Central

    Hughes, P J; Horsnell, C; Hyypiä, T; Stanway, G

    1995-01-01

    An RGD (arginine-glycine-aspartic acid) motif in coxsackievirus A9 has been implicated in internalization through an interaction with the integrin alpha v beta 3. We have produced a number of virus mutants, lacking the motif, which have a small-plaque phenotype in LLC-Mk2 and A-Vero cells and are phenotypically normal in RD cells. Substitution of flanking amino acids also affected plaque size. The results suggest that interaction between the RGD motif and alpha v beta 3 is not critical for virus viability in the cell lines tested and therefore that alternative regions of the CAV-9 capsid are involved in internalization. PMID:7494317

  13. Development and evaluation of a rapid recombinase polymerase amplification assay for detection of coxsackievirus A6.

    PubMed

    Wang, Kaifeng; Wu, Yue; Yin, Dan; Tang, Shixing; Hu, Guifang; He, Yaqing

    2017-01-01

    Coxsackievirus A6 (CV-A6) is an important pathogen causing hand, foot and mouth disease (HFMD). The aim of this study was to develop and evaluate a rapid real-time reverse transcription recombinase polymerase amplification (RT-RPA) assay for detection of CV-A6. The sensitivity of this assay was 202 copies/reaction, with 100 % specificity. Furthermore, this assay yielded consistent results comparable with a commercial qRT-PCR diagnostic kit. This assay is therefore potentially useful for surveillance of CV-A6 infections and outbreak control.

  14. Molecular epidemiology of coxsackievirus A16 strains from four sentinel surveillance sites in Peru.

    PubMed

    Carrion, Gladys; Huaman, Jose L; Silva, Maria; Ampuero, Julia S; Paz, Irmia; Ocaña, Victor R; Laguna-Torres, V Alberto; Hontz, Robert D

    2016-11-01

    To determine the molecular epidemiology of seven coxsackievirus A16 (CVA16) strains previously reported by this research group. Full-length VP1 and VP4 sequences were obtained and phylogenetic analyses were performed. Six strains were classified as genotype C. Moreover, one divergent strain not clustered in any of the three currently reported genotypes was found. This is the first report of CVA16 in Peru and provides valuable baseline data about its potential distribution in South America, as well as evidence of a potential divergent genotype that has never before been reported. Copyright © 2016. Published by Elsevier Ltd.

  15. RNA-dependent DNA polymerase of an endogenous type C virus of mice: purification and partial characterization.

    PubMed

    Hizi, A; Yaniv, A

    1980-06-01

    An RNA-dependent DNA polymerase was isolated from purified virions of endogenous oncornaviruses released by the MOPC-315 murine myeloma cell line. Upon sodium dodecyl sulfate-polyacrylamide gel electrophoresis, the purified enzyme was found to consist of two major polypeptides with molecular weights of about 28,000 and 26,500. The active enzyme had a molecular weight of approximately 56,000, as calculated from its sedimentation on glycerol density gradients, indicating that it is probably a dimer of the two subunit polypeptides. The isolated MOPC-315 virus polymerase exhibited all three activities known to be found in the DNA polymerase from oncornaviruses, namely, an RNA-dependent DNA polymerase, a DNA-dependent DNA polymerase, and an RNase H. The RNA-dependent polymerase activity showed a prounced preference for Mn2+ over Mg2+, whereas the DNA-dependent and RNase H reactions were catalyzed by these two cations to an almost equal extent. The purified polymerase was found to be immunologically related to the polymerase of Rauscher murine leukemia virus.

  16. C. elegans RNA-dependent RNA polymerases rrf-1 and ego-1 silence Drosophila transgenes by differing mechanisms.

    PubMed

    Duan, Guowen; Saint, Robert B; Helliwell, Chris A; Behm, Carolyn A; Wang, Ming-Bo; Waterhouse, Peter M; Gordon, Karl H J

    2013-04-01

    Drosophila possesses the core gene silencing machinery but, like all insects, lacks the canonical RNA-dependent RNA polymerases (RdRps) that in C. elegans either trigger or enhance two major small RNA-dependent gene silencing pathways. Introduction of two different nematode RdRps into Drosophila showed them to be functional, resulting in differing silencing activities. While RRF-1 enhanced transitive dsRNA-dependent silencing, EGO-1 triggered dsRNA-independent silencing, specifically of transgenes. The strain w; da-Gal4; UAST-ego-1, constitutively expressing ego-1, is capable of silencing transgene including dsRNA hairpin upon a single cross, which created a powerful tool for research in Drosophila. In C. elegans, EGO-1 is involved in transcriptional gene silencing (TGS) of chromosome regions that are unpaired during meiosis. There was no opportunity for meiotic interactions involving EGO-1 in Drosophila that would explain the observed transgene silencing. Transgene DNA is, however, unpaired during the pairing of chromosomes in embryonic mitosis that is an unusual characteristic of Diptera, suggesting that in Drosophila, EGO-1 triggers transcriptional silencing of unpaired DNA during embryonic mitosis.

  17. RNA-dependent DNA polymerase of an endogenous type C virus of mice: purification and partial characterization.

    PubMed Central

    Hizi, A; Yaniv, A

    1980-01-01

    An RNA-dependent DNA polymerase was isolated from purified virions of endogenous oncornaviruses released by the MOPC-315 murine myeloma cell line. Upon sodium dodecyl sulfate-polyacrylamide gel electrophoresis, the purified enzyme was found to consist of two major polypeptides with molecular weights of about 28,000 and 26,500. The active enzyme had a molecular weight of approximately 56,000, as calculated from its sedimentation on glycerol density gradients, indicating that it is probably a dimer of the two subunit polypeptides. The isolated MOPC-315 virus polymerase exhibited all three activities known to be found in the DNA polymerase from oncornaviruses, namely, an RNA-dependent DNA polymerase, a DNA-dependent DNA polymerase, and an RNase H. The RNA-dependent polymerase activity showed a prounced preference for Mn2+ over Mg2+, whereas the DNA-dependent and RNase H reactions were catalyzed by these two cations to an almost equal extent. The purified polymerase was found to be immunologically related to the polymerase of Rauscher murine leukemia virus. Images PMID:6155478

  18. A Novel Population of Myeloid Cells Responding to Coxsackievirus Infection Assists in the Dissemination of Virus within the Neonatal CNS

    PubMed Central

    Tabor-Godwin, Jenna M.; Ruller, Chelsea M.; Bagalso, Nolan; An, Naili; Pagarigan, Robb R.; Harkins, Stephanie; Gilbert, Paul E.; Kiosses, William B.; Gude, Natalie A.; Cornell, Christopher T.; Doran, Kelly S.; Sussman, Mark A.; Whitton, J. Lindsay; Feuer, Ralph

    2010-01-01

    Enterovirus infection in newborn infants is a significant cause of aseptic meningitis and encephalitis. Using a neonatal mouse model, we previously determined that coxsackievirus B3 (CVB3) preferentially targets proliferating neural stem cells located in the subventricular zone within 24 hours after infection. At later time points, immature neuroblasts, and eventually mature neurons, were infected as determined by expression of high levels of viral protein. Here, we show that blood-derived Mac3+ mononuclear cells were rapidly recruited to the CNS within 12 hours after intracranial infection with CVB3. These cells displayed a myeloid-like morphology, were of a peripheral origin based on GFP-tagged adoptive cell transplant examination, and were highly susceptible to CVB3 infection during their migration into the central nervous system (CNS). Serial immunofluorescence images suggested that the myeloid cells enter the CNS via the choroid plexus, and that they may be infected during their extravasation and passage through the choroid plexus epithelium; these infected myeloid cells ultimately penetrate into the parenchyma of the brain. Prior to their migration through the ependymal cell layer (ECL), a subset of these infected myeloid cells expressed detectable levels of nestin, a marker for neural stem and progenitor cells. As these nestin+ myeloid cells infected with CVB3 migrated through the ECL, they revealed distinct morphological characteristics typical of type B neural stem cells. The recruitment of these novel myeloid cells may be specifically set in motion by the induction of a unique chemokine profile in the CNS induced very early after CVB3 infection, which includes upregulation of CCL12. We propose that intracranial CVB3 infection may lead to the recruitment of nestin+ myeloid cells into the CNS which might represent an intrinsic host CNS repair response. In turn, the proliferative and metabolic status of recruited myeloid cells may render them attractive

  19. Genome Sequence of Coxsackievirus A6, Isolated during a Hand-Foot-and-Mouth Disease Outbreak in Finland in 2008

    PubMed Central

    Koskinen, Satu; Merilahti, Pirjo; Pursiheimo, Juha-Pekka; Blomqvist, Soile; Roivainen, Merja; Laiho, Asta; Susi, Petri; Waris, Matti

    2014-01-01

    Reports of hand-foot-and-mouth disease (HFMD) outbreaks caused by coxsackievirus A6 have increased worldwide after the report of the first outbreak in Finland in 2008. The complete genome of the first outbreak strain from a vesicle fluid specimen was determined. PMID:25323709

  20. Genome Sequence of Coxsackievirus A6, Isolated during a Hand-Foot-and-Mouth Disease Outbreak in Finland in 2008.

    PubMed

    Osterback, Riikka; Koskinen, Satu; Merilahti, Pirjo; Pursiheimo, Juha-Pekka; Blomqvist, Soile; Roivainen, Merja; Laiho, Asta; Susi, Petri; Waris, Matti

    2014-10-16

    Reports of hand-foot-and-mouth disease (HFMD) outbreaks caused by coxsackievirus A6 have increased worldwide after the report of the first outbreak in Finland in 2008. The complete genome of the first outbreak strain from a vesicle fluid specimen was determined. Copyright © 2014 Österback et al.

  1. Progression or Resolution of Coxsackievirus B4-Induced Pancreatitis: a Genomic Analysis†

    PubMed Central

    Ostrowski, Stephanie E.; Reilly, Andrew A.; Collins, Doris N.; Ramsingh, Arlene I.

    2004-01-01

    Group B coxsackieviruses are associated with chronic inflammatory diseases of the pancreas, heart, and central nervous system. Chronic pancreatitis, which can develop from acute pancreatitis, is considered a premalignant disorder because it is a major risk factor for pancreatic cancer. To explore the genetic events underlying the progression of acute to chronic disease, a comparative analysis of global gene expression during coxsackievirus B4-induced acute and chronic pancreatitis was undertaken. A key feature of acute pancreatitis that resolved was tissue regeneration, which was accompanied by increased expression of genes involved in cell growth, inhibition of apoptosis, and embryogenesis and by increased division of acinar cells. Acute pancreatitis that progressed to chronic pancreatitis was characterized by lack of tissue repair, and the expression map highlighted genes involved in apoptosis, acinoductular metaplasia, remodeling of the extracellular matrix, and fibrosis. Furthermore, immune responses appeared skewed toward development of alternatively activated (M2) macrophages and T helper 2 (Th2) cells during disease that resolved and toward classically activated (M1) macrophages and Th1 cells during disease that progressed. Our hypothesis is that growth and differentiation signals coupled with the M2/Th2 milieu favor acinar cell proliferation, while diminished growth signals and the M1/Th1 milieu favor apoptosis of acinar cells and remodeling/proliferation of the extracellular matrix, resulting in fibrosis. PMID:15254194

  2. Migration of epithelial cells in the small intestine of mice perorally infected with coxsackievirus B5.

    PubMed

    Shadoff, N; Loria, R M; Kibrick, S; Broitman, S A

    1979-03-01

    The rate of cell migration in the small intestine during enteric viral infections has not been assessed previously. CD-1 mice (33 days old) were infected perorally with 1.0 X 10(8) plague-forming units of coxsackievirus B5 and 12 hr later were injected intraperitoneally with 2 micron Ci of [3H]thymidine/g of body weight. After 2, 12, 24, 48, 60, and 72 hr, mice were killed, and the small intestine was removed. Specimens obtained at each interval were examined by radioautography; similar specimens were titrated for virus by plaque assay in HeLa cells. In mice perorally infected with coxsackievirus B5, epithelial cells migrated from crypt to villus tip in 60 hr, as compared with 48 hr in uninfected control mice and 24 hr previously reported for mice perorally infected with enteric bacteria (e.g., Salmonella typhimurium). Virus was recovered from intestinal tissue, but no inflammatory response in the limina propria was apparent. These observations are consistent with previous report that substrate absorption rates may be altered during viral and bacterial enteric infection.

  3. Expression of coxsackievirus and adenovirus receptor and its cellular localization in myocardial tissues of dilated cardiomyopathy

    PubMed Central

    Kaur, Tripta; Mishra, Baijayantimala; Saikia, Uma Nahar; Sharma, Mirnalini; Bahl, Ajay; Ratho, Radha Kanta

    2012-01-01

    BACKGROUND: Myocarditis and dilated cardiomyopathy (DCM) are common causes of morbidity and mortality in children and adults. Recently, the human coxsackievirus and adenovirus receptor (CAR), a common receptor for coxsackieviruses and adenoviruses, was discovered and its increased expression has been reported in patients with DCM and myocarditis. OBJECTIVE: To measure the expression of CAR in myocardial tissues of patients with DCM and its cellular localization in DCM cases. METHODS: Formalin-fixed myocardial tissues collected during autopsy from 26 cases of DCM, and 20 cases each of noncardiac disease and cardiac disease other than DCM were included as the test group, and control groups A and B, respectively. Expression of CAR was studied using immunohistochemical staining of myocardial tissue with a CAR-specific rabbit polyclonal antibody. CAR messenger RNA was semiquantified by reverse transcription polymerase chain reaction followed by agarose gel analysis and measurement of band intensity. RESULTS: CAR positivity in DCM cases was found to be 96% (25 of 26) compared with 30% in control group A and 40% in control group B. CAR was found to be expressed in myocytes, endothelial and interstitial cells; however, positivity in myocytes was significantly higher than in other cells in all groups. The site of CAR expression was predominantly the sarcolemma along with cytoplasm in cardiomyocytes. CONCLUSIONS: The present study highlighted the increased expression of CAR in DCM cases, with localization in myocytes and endothelial cells. PMID:23592932

  4. Visualization and Detection of Infectious Coxsackievirus Replication Using a Combined Cell Culture-Molecular Beacon Assay

    PubMed Central

    Wang, Aijun; Salazar, Andre M.; Yates, Marylynn V.; Mulchandani, Ashok; Chen, Wilfred

    2005-01-01

    Rapid detection of infectious viruses is of central importance for public health risk assessment. By directly visualizing newly synthesized viral RNA with molecular beacons (MBs), we have developed a generalized method for the rapid and sensitive detection of infectious viruses from cell culture. An MB, CVB1, specifically targeting the 5′ noncoding region of the enterovirus genome was designed and synthesized. Introduction of MB CVB1 into permeabilized cells highly infected with coxsackievirus B6 resulted in brightly fluorescent cells that can be easily visualized with a fluorescence microscope. In contrast, no detectable signal was observed with noninfected cells or with nonspecific MBs. The number of fluorescent cells also increased in a dose-responsive manner, enabling the direct quantification of infectious viral dosages by direct counting of fluorescent foci. As little as 1 PFU of infectious coxsackievirus B6 was detected within 6 h postinfection. When combined with nuclease-resistant MBs, this method could be useful not only for the real-time detection of infectious viruses but is also useful to study the life cycle of viral processing in vivo. PMID:16332827

  5. A Single Coxsackievirus B2 Capsid Residue Controls Cytolysis and Apoptosis in Rhabdomyosarcoma Cells▿

    PubMed Central

    Gullberg, Maria; Tolf, Conny; Jonsson, Nina; Polacek, Charlotta; Precechtelova, Jana; Badurova, Miriam; Sojka, Martin; Mohlin, Camilla; Israelsson, Stina; Johansson, Kjell; Bopegamage, Shubhada; Hafenstein, Susan; Lindberg, A. Michael

    2010-01-01

    Coxsackievirus B2 (CVB2), one of six human pathogens of the group B coxsackieviruses within the enterovirus genus of Picornaviridae, causes a wide spectrum of human diseases ranging from mild upper respiratory illnesses to myocarditis and meningitis. The CVB2 prototype strain Ohio-1 (CVB2O) was originally isolated from a patient with summer grippe in the 1950s. Later on, CVB2O was adapted to cytolytic replication in rhabdomyosarcoma (RD) cells. Here, we present analyses of the correlation between the adaptive mutations of this RD variant and the cytolytic infection in RD cells. Using reverse genetics, we identified a single amino acid change within the exposed region of the VP1 protein (glutamine to lysine at position 164) as the determinant for the acquired cytolytic trait. Moreover, this cytolytic virus induced apoptosis, including caspase activation and DNA degradation, in RD cells. These findings contribute to our understanding of the host cell adaptation process of CVB2O and provide a valuable tool for further studies of virus-host interactions. PMID:20375176

  6. Epidemic outbreak of acute haemorrhagic conjunctivitis caused by coxsackievirus A24 in Thailand, 2014.

    PubMed

    Chansaenroj, J; Vongpunsawad, S; Puenpa, J; Theamboonlers, A; Vuthitanachot, V; Chattakul, P; Areechokchai, D; Poovorawan, Y

    2015-10-01

    Acute haemorrhagic conjunctivitis outbreaks are often attributed to viral infection. In 2014, an unprecedented nationwide outbreak of infectious conjunctivitis occurred in Thailand, which affected >300 000 individuals over 3 months. To identify and characterize the virus responsible for the epidemic, eye swab specimens from 119 patients were randomly collected from five different provinces. Conserved regions in the enteroviral 5'-UTR and adenovirus hexon gene were analysed. Enterovirus was identified in 71·43% (85/119) of the samples, while no adenovirus was detected. From enterovirus-positive samples, the coxsackievirus A24 variant (70·59%, 84/119) and echovirus (0·84%, 1/119) were identified. Additional sequencing of full-length VP1 and 3C genes and subsequent phylogenetic analysis revealed that these clinical isolates form a new lineage cluster related to genotype IV-C5. In summary, the coxsackievirus A24 variant was identified as an aetiological agent for the recent acute haemorrhagic conjunctivitis outbreak in Thailand.

  7. EphrinB3 blocks EphB3 dependence receptor functions to prevent cell death following traumatic brain injury.

    PubMed

    Theus, M H; Ricard, J; Glass, S J; Travieso, L G; Liebl, D J

    2014-05-08

    Eph receptor tyrosine kinases and their membrane-bound ligands, ephrins, have a variety of roles in the developing and adult central nervous system that require direct cell-cell interactions; including regulating axon path finding, cell proliferation, migration and synaptic plasticity. Recently, we identified a novel pro-survival role for ephrins in the adult subventricular zone, where ephrinB3 blocks Eph-mediated cell death during adult neurogenesis. Here, we examined whether EphB3 mediates cell death in the adult forebrain following traumatic brain injury and whether ephrinB3 infusion could limit this effect. We show that EphB3 co-labels with microtubule-associated protein 2-positive neurons in the adult cortex and is closely associated with ephrinB3 ligand, which is reduced following controlled cortical impact (CCI) injury. In the complete absence of EphB3 (EphB3(-/-)), we observed reduced terminal deoxynucleotidyl transferase-dUTP nick end labeling (TUNEL), and functional improvements in motor deficits after CCI injury as compared with wild-type and ephrinB3(-/-) mice. We also demonstrated that EphB3 exhibits dependence receptor characteristics as it is cleaved by caspases and induces cell death, which is not observed in the presence of ephrinB3. Following trauma, infusion of pre-clustered ephrinB3-Fc molecules (eB3-Fc) into the contralateral ventricle reduced cortical infarct volume and TUNEL staining in the cortex, dentate gyrus and CA3 hippocampus of wild-type and ephrinB3(-/-) mice, but not EphB3(-/-) mice. Similarly, application of eB3-Fc improved motor functions after CCI injury. We conclude that EphB3 mediates cell death in the adult cortex through a novel dependence receptor-mediated cell death mechanism in the injured adult cortex and is attenuated following ephrinB3 stimulation.

  8. 18 CFR 1b.3 - Scope of investigations.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 18 Conservation of Power and Water Resources 1 2013-04-01 2013-04-01 false Scope of investigations. 1b.3 Section 1b.3 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF ENERGY GENERAL RULES RULES RELATING TO INVESTIGATIONS § 1b.3 Scope of investigations. The...

  9. 12 CFR 261b.3 - Conduct of agency business.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 12 Banks and Banking 3 2010-01-01 2010-01-01 false Conduct of agency business. 261b.3 Section 261b.3 Banks and Banking FEDERAL RESERVE SYSTEM (CONTINUED) BOARD OF GOVERNORS OF THE FEDERAL RESERVE SYSTEM RULES REGARDING PUBLIC OBSERVATION OF MEETINGS § 261b.3 Conduct of agency business. Members shall...

  10. 42 CFR 52b.3 - Who is eligible to apply?

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 42 Public Health 1 2014-10-01 2014-10-01 false Who is eligible to apply? 52b.3 Section 52b.3 Public Health PUBLIC HEALTH SERVICE, DEPARTMENT OF HEALTH AND HUMAN SERVICES GRANTS NATIONAL INSTITUTES OF HEALTH CONSTRUCTION GRANTS § 52b.3 Who is eligible to apply? In order to be eligible for a...

  11. 42 CFR 52b.3 - Who is eligible to apply?

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 42 Public Health 1 2011-10-01 2011-10-01 false Who is eligible to apply? 52b.3 Section 52b.3 Public Health PUBLIC HEALTH SERVICE, DEPARTMENT OF HEALTH AND HUMAN SERVICES GRANTS NATIONAL INSTITUTES OF HEALTH CONSTRUCTION GRANTS § 52b.3 Who is eligible to apply? In order to be eligible for a...

  12. 42 CFR 52b.3 - Who is eligible to apply?

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 42 Public Health 1 2013-10-01 2013-10-01 false Who is eligible to apply? 52b.3 Section 52b.3 Public Health PUBLIC HEALTH SERVICE, DEPARTMENT OF HEALTH AND HUMAN SERVICES GRANTS NATIONAL INSTITUTES OF HEALTH CONSTRUCTION GRANTS § 52b.3 Who is eligible to apply? In order to be eligible for a...

  13. 42 CFR 52b.3 - Who is eligible to apply?

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 42 Public Health 1 2012-10-01 2012-10-01 false Who is eligible to apply? 52b.3 Section 52b.3 Public Health PUBLIC HEALTH SERVICE, DEPARTMENT OF HEALTH AND HUMAN SERVICES GRANTS NATIONAL INSTITUTES OF HEALTH CONSTRUCTION GRANTS § 52b.3 Who is eligible to apply? In order to be eligible for a...

  14. 42 CFR 52b.3 - Who is eligible to apply?

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 42 Public Health 1 2010-10-01 2010-10-01 false Who is eligible to apply? 52b.3 Section 52b.3 Public Health PUBLIC HEALTH SERVICE, DEPARTMENT OF HEALTH AND HUMAN SERVICES GRANTS NATIONAL INSTITUTES OF HEALTH CONSTRUCTION GRANTS § 52b.3 Who is eligible to apply? In order to be eligible for a...

  15. [Relationship between EB virus, Cytomegalo virus, herpes simplex virus and coxsackievirus infection and relapse of multiple sclerosis].

    PubMed

    Feng, Zi-jing; Zhao, Ri-guang; Wang, De-xin

    2008-12-01

    To study the relation between the recent active infection with Epstein-Barr virus, cytomegalovirus,herpes simplex virus-1, coxsackievirus B I-IV and the relapse of relapsing-remitting multiple sclerosis (RR MS). Using ELISA method, IgM antibodies to Epstein-Barr virus, cytomegalovirus, herpes simplex virus-1, coxsackievirus BI-IV in the plasma from 34 RR MS patients and 200 normal controls were detected. The rates of recent active infection with the above mentioned viruses of the patients and controls were compared.For patients group,comparison was also made between the clinical data of recent active infected patients and patients without recent active infection. There was no statistically significant difference in positive rates of positive rates of IgM antibodies against Epstein-Barr virus, cytomegalovirus, herpes simplex virus-1 and coxsackievirus BI, II, III or VI between the two groups. While there was statistically significant difference in positive rates of IgM antibodies to coxsackievirus B VI and V in the RR MS patients and those in the controls (being 3/34 and 0/200 P < 0.05; 2/34 and 0/200 P < 0.05, respectively). In the patient group, when patients who had active infection with any of the viruses were compared with those who had no active infection, no significant difference between them was found in terms of age, course, frequency, body temperature on admission, differential leukocyte count (neutrophilic granulocyte, lymphocyte and monocytes), use of glucocorticoids, and EDSS point value. There is a high rate of recent active infection with coxsackievirus B VI and V in RR MS patients at relapsing stage. While the recent virus active infection is unrelated to the severity of the symptoms.

  16. RNA-dependent RNA polymerase activity associated with the yeast viral p91/20S RNA ribonucleoprotein complex.

    PubMed Central

    García-Cuéllar, M P; Esteban, R; Fujimura, T

    1997-01-01

    20S RNA is a noninfectious viral single-stranded RNA found in most laboratory strains of the yeast Saccharomyces cerevisiae. 20S RNA encodes a protein of 91 kDa (p91) that contains the common motifs found among RNA-dependent RNA polymerases from RNA viruses. p91 and 20S RNA are noncovalently associated in vivo, forming a ribonucleoprotein complex. We detected an RNA polymerase activity in p91/20S RNA complexes isolated by high-speed centrifugation. The activity was not inhibited by actinomycin D nor alpha-amanitin. The majority of the in vitro products was 20S RNA and the rest was the complementary strands of 20S RNA. Because the extracts were prepared from cells accumulating 20S RNA over its complementary strands, these in vitro products reflect the corresponding activities in vivo. When the p91/20S RNA complexes were subjected to sucrose gradient centrifugation, the polymerase activity cosedimented with the complexes. Furthermore, an RNA polymerase activity was detected in the complex by an antibody-linked polymerase assay using anti-p91 antiserum, suggesting that p91 is present in the active RNA polymerase machinery. These results together indicate that p91 is the RNA-dependent RNA polymerase or a subunit thereof responsible for 20S RNA replication. PMID:8990396

  17. Activation of innate antiviral immune response via double-stranded RNA-dependent RLR receptor-mediated necroptosis

    PubMed Central

    Wang, Wei; Wang, Wei-Hua; Azadzoi, Kazem M.; Su, Ning; Dai, Peng; Sun, Jianbin; Wang, Qin; Liang, Ping; Zhang, Wentao; Lei, Xiaoying; Yan, Zhen; Yang, Jing-Hua

    2016-01-01

    Viruses induce double-stranded RNA (dsRNA) in the host cells. The mammalian system has developed dsRNA-dependent recognition receptors such as RLRs that recognize the long stretches of dsRNA as PAMPs to activate interferon-mediated antiviral pathways and apoptosis in severe infection. Here we report an efficient antiviral immune response through dsRNA-dependent RLR receptor-mediated necroptosis against infections from different classes of viruses. We demonstrated that virus-infected A549 cells were efficiently killed in the presence of a chimeric RLR receptor, dsCARE. It measurably suppressed the interferon antiviral pathway but promoted IL-1β production. Canonical cell death analysis by morphologic assessment, phosphatidylserine exposure, caspase cleavage and chemical inhibition excluded the involvement of apoptosis and consistently suggested RLR receptor-mediated necroptosis as the underlying mechanism of infected cell death. The necroptotic pathway was augmented by the formation of RIP1-RIP3 necrosome, recruitment of MLKL protein and the activation of cathepsin D. Contributing roles of RIP1 and RIP3 were confirmed by gene knockdown. Furthermore, the necroptosis inhibitor necrostatin-1 but not the pan-caspase inhibitor zVAD impeded dsCARE-dependent infected cell death. Our data provides compelling evidence that the chimeric RLR receptor shifts the common interferon antiviral responses of infected cells to necroptosis and leads to rapid death of the virus-infected cells. This mechanism could be targeted as an efficient antiviral strategy. PMID:26935990

  18. Looking for inhibitors of the dengue virus NS5 RNA-dependent RNA-polymerase using a molecular docking approach

    PubMed Central

    Galiano, Vicente; Garcia-Valtanen, Pablo; Micol, Vicente; Encinar, José Antonio

    2016-01-01

    The dengue virus (DENV) nonstructural protein 5 (NS5) contains both an N-terminal methyltransferase domain and a C-terminal RNA-dependent RNA polymerase domain. Polymerase activity is responsible for viral RNA synthesis by a de novo initiation mechanism and represents an attractive target for antiviral therapy. The incidence of DENV has grown rapidly and it is now estimated that half of the human population is at risk of becoming infected with this virus. Despite this, there are no effective drugs to treat DENV infections. The present in silico study aimed at finding new inhibitors of the NS5 RNA-dependent RNA polymerase of the four serotypes of DENV. We used a chemical library comprising 372,792 nonnucleotide compounds (around 325,319 natural compounds) to perform molecular docking experiments against a binding site of the RNA template tunnel of the virus polymerase. Compounds with high negative free energy variation (ΔG <−10.5 kcal/mol) were selected as putative inhibitors. Additional filters for favorable druggability and good absorption, distribution, metabolism, excretion, and toxicity were applied. Finally, after the screening process was completed, we identified 39 compounds as lead DENV polymerase inhibitor candidates. Potentially, these compounds could act as efficient DENV polymerase inhibitors in vitro and in vivo. PMID:27784988

  19. Looking for inhibitors of the dengue virus NS5 RNA-dependent RNA-polymerase using a molecular docking approach.

    PubMed

    Galiano, Vicente; Garcia-Valtanen, Pablo; Micol, Vicente; Encinar, José Antonio

    2016-01-01

    The dengue virus (DENV) nonstructural protein 5 (NS5) contains both an N-terminal methyltransferase domain and a C-terminal RNA-dependent RNA polymerase domain. Polymerase activity is responsible for viral RNA synthesis by a de novo initiation mechanism and represents an attractive target for antiviral therapy. The incidence of DENV has grown rapidly and it is now estimated that half of the human population is at risk of becoming infected with this virus. Despite this, there are no effective drugs to treat DENV infections. The present in silico study aimed at finding new inhibitors of the NS5 RNA-dependent RNA polymerase of the four serotypes of DENV. We used a chemical library comprising 372,792 nonnucleotide compounds (around 325,319 natural compounds) to perform molecular docking experiments against a binding site of the RNA template tunnel of the virus polymerase. Compounds with high negative free energy variation (ΔG <-10.5 kcal/mol) were selected as putative inhibitors. Additional filters for favorable druggability and good absorption, distribution, metabolism, excretion, and toxicity were applied. Finally, after the screening process was completed, we identified 39 compounds as lead DENV polymerase inhibitor candidates. Potentially, these compounds could act as efficient DENV polymerase inhibitors in vitro and in vivo.

  20. Space constrained homology modelling: the paradigm of the RNA-dependent RNA polymerase of dengue (type II) virus.

    PubMed

    Vlachakis, Dimitrios; Kontopoulos, Dimitrios Georgios; Kossida, Sophia

    2013-01-01

    Protein structure is more conserved than sequence in nature. In this direction we developed a novel methodology that significantly improves conventional homology modelling when sequence identity is low, by taking into consideration 3D structural features of the template, such as size and shape. Herein, our new homology modelling approach was applied to the homology modelling of the RNA-dependent RNA polymerase (RdRp) of dengue (type II) virus. The RdRp of dengue was chosen due to the low sequence similarity shared between the dengue virus polymerase and the available templates, while purposely avoiding to use the actual X-ray structure that is available for the dengue RdRp. The novel approach takes advantage of 3D space corresponding to protein shape and size by creating a 3D scaffold of the template structure. The dengue polymerase model built by the novel approach exhibited all features of RNA-dependent RNA polymerases and was almost identical to the X-ray structure of the dengue RdRp, as opposed to the model built by conventional homology modelling. Therefore, we propose that the space-aided homology modelling approach can be of a more general use to homology modelling of enzymes sharing low sequence similarity with the template structures.

  1. Comparative transcriptome profiling of the injured zebrafish and mouse hearts identifies miRNA-dependent repair pathways

    PubMed Central

    Crippa, Stefania; Nemir, Mohamed; Ounzain, Samir; Ibberson, Mark; Berthonneche, Corinne; Sarre, Alexandre; Boisset, Gaëlle; Maison, Damien; Harshman, Keith; Xenarios, Ioannis; Diviani, Dario; Schorderet, Daniel; Pedrazzini, Thierry

    2016-01-01

    Aims The adult mammalian heart has poor regenerative capacity. In contrast, the zebrafish heart retains a robust capacity for regeneration into adulthood. These distinct responses are consequences of a differential utilization of evolutionary-conserved gene regulatory networks in the damaged heart. To systematically identify miRNA-dependent networks controlling cardiac repair following injury, we performed comparative gene and miRNA profiling of the cardiac transcriptome in adult mice and zebrafish. Methods and results Using an integrated approach, we show that 45 miRNA-dependent networks, involved in critical biological pathways, are differentially modulated in the injured zebrafish vs. mouse hearts. We study, more particularly, the miR-26a-dependent response. Therefore, miR-26a is down-regulated in the fish heart after injury, whereas its expression remains constant in the mouse heart. Targets of miR-26a involve activators of the cell cycle and Ezh2, a component of the polycomb repressive complex 2 (PRC2). Importantly, PRC2 exerts repressive functions on negative regulators of the cell cycle. In cultured neonatal cardiomyocytes, inhibition of miR-26a stimulates, therefore, cardiomyocyte proliferation. Accordingly, miR-26a knockdown prolongs the proliferative window of cardiomyocytes in the post-natal mouse heart. Conclusions This novel strategy identifies a series of miRNAs and associated pathways, in particular miR-26a, which represent attractive therapeutic targets for inducing repair in the injured heart. PMID:26857418

  2. Maturation of intestinal defenses against peroral infection with group B coxsackievirus in mice.

    PubMed Central

    Loria, R M; Shadoff, N; Kibrick, S; Broitman, S

    1976-01-01

    The intestinal tract of adult mice provides effective protection against peroral infection with group B coxsackievirus. This protective function consists of at least two separate components. One is a barrier effect that prevents virus from passing through the mucosal side of the gut into the circulation. It becomes clearly evident at 18 days of life and is present thereafter. The other is a clearance mechanism that acts to eliminate virus from the enteric tract after infection has occurred. This is first demonstrable at about 14 to 18 days and also persists. The appearance of these protective functions coincides with the known development of enzymatic and morphological changes in the gut associated with the transition from suckling to weanling. PMID:1270146

  3. Maturation of intestinal defenses against peroral infection with group B coxsackievirus in mice.

    PubMed

    Loria, R M; Shadoff, N; Kibrick, S; Broitman, S

    1976-05-01

    The intestinal tract of adult mice provides effective protection against peroral infection with group B coxsackievirus. This protective function consists of at least two separate components. One is a barrier effect that prevents virus from passing through the mucosal side of the gut into the circulation. It becomes clearly evident at 18 days of life and is present thereafter. The other is a clearance mechanism that acts to eliminate virus from the enteric tract after infection has occurred. This is first demonstrable at about 14 to 18 days and also persists. The appearance of these protective functions coincides with the known development of enzymatic and morphological changes in the gut associated with the transition from suckling to weanling.

  4. Release of Intracellular Calcium Stores Facilitates Coxsackievirus Entry into Polarized Endothelial Cells

    PubMed Central

    Bozym, Rebecca A.; Morosky, Stefanie A.; Kim, Kwang S.; Cherry, Sara; Coyne, Carolyn B.

    2010-01-01

    Group B coxsackieviruses (CVB) are associated with viral-induced heart disease and are among the leading causes of aseptic meningitis worldwide. Here we show that CVB entry into polarized brain microvasculature and aortic endothelial cells triggers a depletion of intracellular calcium stores initiated through viral attachment to the apical attachment factor decay-accelerating factor. Calcium release was dependent upon a signaling cascade that required the activity of the Src family of tyrosine kinases, phospholipase C, and the inositol 1,4,5-trisphosphate receptor isoform 3. CVB-mediated calcium release was required for the activation of calpain-2, a calcium-dependent cysteine protease, which controlled the vesicular trafficking of internalized CVB particles. These data point to a specific role for calcium signaling in CVB entry into polarized endothelial monolayers and highlight the unique signaling mechanisms used by these viruses to cross endothelial barriers. PMID:20949071

  5. Peroxynitrite inhibition of Coxsackievirus infection by prevention of viral RNA entry

    PubMed Central

    Padalko, Elizaveta; Ohnishi, Tomokazu; Matsushita, Kenji; Sun, Henry; Fox-Talbot, Karen; Bao, Clare; Baldwin, William M.; Lowenstein, Charles J.

    2004-01-01

    Although peroxynitrite is harmful to the host, the beneficial effects of peroxynitrite are less well understood. We explored the role of peroxynitrite in the host immune response to Coxsackievirus infection. Peroxynitrite inhibits viral replication in vitro, in part by inhibiting viral RNA entry into the host cell. Nitrotyrosine, a marker for peroxynitrite production, is colocalized with viral antigens in the hearts of infected mice but not control mice. Nitrotyrosine coprecipitates with the viral polypeptide VP1 as well. Guanidinoethyl disulfide, a scavenger of peroxynitrite, blocks peroxynitrite inhibition of viral replication in vitro and permits an increase in viral replication in vivo. These data suggest that peroxynitrite is an endogenous effector of the immune response to viruses. PMID:15286280

  6. Multiple Viral Determinants Mediate Myopathogenicity in Coxsackievirus B1-Induced Chronic Inflammatory Myopathy

    PubMed Central

    Tam, Patricia E.; Weber-Sanders, Melissa L.; Messner, Ronald P.

    2003-01-01

    Mice infected with myopathic coxsackievirus B1 Tucson (CVB1T) develop chronic inflammatory myopathy (CIM) consisting of hind limb weakness and inflammation. Amyopathic virus variants are infectious but attenuated for CIM. In this report, viral clones, chimeras, and sequencing were used to identify viral determinants of CIM. Chimeras identified several regions involved in CIM and localized a weakness determinant to nucleotides 2493 to 3200 of VP1. Sequencing of multiple clones and viruses identified five candidate determinants that were strictly conserved in myopathic viruses with one located in the 5′ untranslated region (UTR), three in the VP1 capsid, and one in the 3C protease. Taken together, these studies implicate Tyr-87 and/or Val-136 as candidate determinants of weakness. They also indicate that there are at least two determinants of inflammation and one additional determinant of weakness encoded by myopathic CVB1T. PMID:14557670

  7. Mouse cells expressing human intercellular adhesion molecule-1 are susceptible to infection by coxsackievirus A21.

    PubMed Central

    Shafren, D R; Dorahy, D J; Greive, S J; Burns, G F; Barry, R D

    1997-01-01

    Competitive viral binding assays have revealed previously that coxsackievirus A21 (CAV21) and human rhinovirus 14 (HRV14) share a common cell surface receptor. More recently, intercellular adhesion molecule-1 (ICAM-1) has been identified as the cellular receptor for HRV-14. Also, anti-ICAM-1 monoclonal antibodies (MAbs) blocked infection by HRV14, CAV13, CAV18, and CAV21, suggesting that these viruses share this receptor; however, this has never been established by more direct methods. In this study we show conclusively that CAV21 binds to ICAM-1 and that MAbs directed against the N-terminal domain of the molecule inhibit this attachment. Furthermore, we show that the specific interaction between ICAM-1 and 160S CAV21 virions induces formation of 135S A particles. Finally, we show transfection of normally nonsusceptible mouse L cells with human ICAM-1 cDNA renders them susceptible to infection by CAV21. PMID:8985417

  8. Coxsackievirus B5 induced apoptosis of HeLa cells: Effects on p53 and SUMO

    SciTech Connect

    Gomes, Rogerio; Guerra-Sa, Renata; Arruda, Eurico

    2010-01-20

    Coxsackievirus B5 (CVB5), a human enterovirus of the family Picornaviridae, is a frequent cause of acute and chronic human diseases. The pathogenesis of enteroviral infections is not completely understood, and the fate of the CVB5-infected cell has a pivotal role in this process. We have investigated the CVB5-induced apoptosis of HeLa cells and found that it happens by the intrinsic pathway by a mechanism dependent on the ubiquitin-proteasome system, associated with nuclear aggregation of p53. Striking redistribution of both SUMO and UBC9 was noted at 4 h post-infection, simultaneously with a reduction in the levels of the ubiquitin-ligase HDM2. Taken together, these results suggest that CVB5 infection of HeLa cells elicit the intrinsic pathway of apoptosis by MDM2 degradation and p53 activation, destabilizing protein sumoylation, by a mechanism that is dependent on a functional ubiquitin-proteasome system.

  9. 17 CFR 270.8b-3 - Title of securities.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 17 Commodity and Securities Exchanges 3 2013-04-01 2013-04-01 false Title of securities. 270.8b-3 Section 270.8b-3 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION (CONTINUED) RULES AND REGULATIONS, INVESTMENT COMPANY ACT OF 1940 § 270.8b-3 Title of securities. Wherever the title of securities is required to be stated,...

  10. 17 CFR 270.8b-3 - Title of securities.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 17 Commodity and Securities Exchanges 4 2014-04-01 2014-04-01 false Title of securities. 270.8b-3 Section 270.8b-3 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION (CONTINUED) RULES AND REGULATIONS, INVESTMENT COMPANY ACT OF 1940 § 270.8b-3 Title of securities. Wherever the title of securities is required to be stated,...

  11. 17 CFR 270.8b-3 - Title of securities.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 17 Commodity and Securities Exchanges 3 2011-04-01 2011-04-01 false Title of securities. 270.8b-3 Section 270.8b-3 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION (CONTINUED) RULES AND REGULATIONS, INVESTMENT COMPANY ACT OF 1940 § 270.8b-3 Title of securities. Wherever the title of securities is required to be stated,...

  12. 17 CFR 270.8b-3 - Title of securities.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 17 Commodity and Securities Exchanges 3 2012-04-01 2012-04-01 false Title of securities. 270.8b-3 Section 270.8b-3 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION (CONTINUED) RULES AND REGULATIONS, INVESTMENT COMPANY ACT OF 1940 § 270.8b-3 Title of securities. Wherever the title of securities is required to be stated,...

  13. 26 CFR 1.50B-3 - Estates and trusts.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 26 Internal Revenue 1 2010-04-01 2010-04-01 true Estates and trusts. 1.50B-3 Section 1.50B-3... Computing Credit for Expenses of Work Incentive Programs § 1.50B-3 Estates and trusts. (a) General rule—(1) In general. In the case of an estate or trust, WIN expenses (as defined in paragraph (a) of §...

  14. The Intracellular Domain of the Coxsackievirus and Adenovirus Receptor Differentially Influences Adenovirus Entry.

    PubMed

    Loustalot, Fabien; Kremer, Eric J; Salinas, Sara

    2015-09-01

    The coxsackievirus and adenovirus receptor (CAR) is a cell adhesion molecule used as a docking molecule by some adenoviruses (AdVs) and group B coxsackieviruses. We previously proposed that the preferential transduction of neurons by canine adenovirus type 2 (CAV-2) is due to CAR-mediated internalization. Our proposed pathway of CAV-2 entry is in contrast to that of human AdV type 5 (HAdV-C5) in nonneuronal cells, where internalization is mediated by auxiliary receptors such as integrins. We therefore asked if in fibroblast-like cells the intracellular domain (ICD) of CAR plays a role in the internalization of the CAV-2 fiber knob (FK(CAV)), CAV-2, or HAdV-C5 when the capsid cannot engage integrins. Here, we show that in fibroblast-like cells, the CAR ICD is needed for FK(CAV) entry and efficient CAV-2 transduction but dispensable for HAdV-C5 and an HAdV-C5 capsid lacking the RGD sequence (an integrin-interacting motif) in the penton. Moreover, the deletion of the CAR ICD further impacts CAV-2 intracellular trafficking, highlighting the crucial role of CAR in CAV-2 intracellular dynamics. These data demonstrate that the CAR ICD contains sequences important for the recruitment of the endocytic machinery that differentially influences AdV cell entry. Understanding how viruses interact with the host cell surface and reach the intracellular space is of crucial importance for applied and fundamental virology. Here, we compare the role of a cell adhesion molecule (CAR) in the internalization of adenoviruses that naturally infect humans and Canidae. We show that the intracellular domain of CAR differentially regulates AdV entry and trafficking. Our study highlights the mechanistic differences that a receptor can have for two viruses from the same family. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  15. Homology-Based Identification of a Mutation in the Coronavirus RNA-Dependent RNA Polymerase That Confers Resistance to Multiple Mutagens

    PubMed Central

    Sexton, Nicole R.; Smith, Everett Clinton; Blanc, Hervé; Vignuzzi, Marco; Peersen, Olve B.

    2016-01-01

    ABSTRACT Positive-sense RNA viruses encode RNA-dependent RNA polymerases (RdRps) essential for genomic replication. With the exception of the large nidoviruses, such as coronaviruses (CoVs), RNA viruses lack proofreading and thus are dependent on RdRps to control nucleotide selectivity and fidelity. CoVs encode a proofreading exonuclease in nonstructural protein 14 (nsp14-ExoN), which confers a greater-than-10-fold increase in fidelity compared to other RNA viruses. It is unknown to what extent the CoV polymerase (nsp12-RdRp) participates in replication fidelity. We sought to determine whether homology modeling could identify putative determinants of nucleotide selectivity and fidelity in CoV RdRps. We modeled the CoV murine hepatitis virus (MHV) nsp12-RdRp structure and superimposed it on solved picornaviral RdRp structures. Fidelity-altering mutations previously identified in coxsackie virus B3 (CVB3) were mapped onto the nsp12-RdRp model structure and then engineered into the MHV genome with [nsp14-ExoN(+)] or without [nsp14-ExoN(−)] ExoN activity. Using this method, we identified two mutations conferring resistance to the mutagen 5-fluorouracil (5-FU): nsp12-M611F and nsp12-V553I. For nsp12-V553I, we also demonstrate resistance to the mutagen 5-azacytidine (5-AZC) and decreased accumulation of mutations. Resistance to 5-FU, and a decreased number of genomic mutations, was effectively masked by nsp14-ExoN proofreading activity. These results indicate that nsp12-RdRp likely functions in fidelity regulation and that, despite low sequence conservation, some determinants of RdRp nucleotide selectivity are conserved across RNA viruses. The results also indicate that, with regard to nucleotide selectivity, nsp14-ExoN is epistatic to nsp12-RdRp, consistent with its proposed role in a multiprotein replicase-proofreading complex. IMPORTANCE RNA viruses have evolutionarily fine-tuned replication fidelity to balance requirements for genetic stability and diversity

  16. Targeted Delivery of Mutant Tolerant Anti-Coxsackievirus Artificial MicroRNAs Using Folate Conjugated Bacteriophage Phi29 pRNA

    PubMed Central

    Ye, Xin; Liu, Zhen; Hemida, Maged Gomaa; Yang, Decheng

    2011-01-01

    Background Myocarditis is the major heart disease in infants and young adults. It is very commonly caused by coxsackievirus B3 (CVB3) infection; however, no specific treatment or vaccine is available at present. RNA interference (RNAi)-based anti-viral therapy has shown potential to inhibit viral replication, but this strategy faces two major challenges; viral mutational escape from drug suppression and targeted delivery of the reagents to specific cell populations. Methodology/Principal Findings In this study, we designed artificial microRNAs (AmiRs) targeting the 3′untranslated region (3′UTR) of CVB3 genome with mismatches to the central region of their targeting sites. Antiviral evaluation showed that AmiR-1 and AmiR-2 reduced CVB3 (Kandolf and CG strains) replication approximately 100-fold in both HeLa cells and HL-1 cardiomyoctes. To achieve specific delivery, we linked AmiRs to the folate-conjugated bacterial phage packaging RNA (pRNA) and delivered the complexes into HeLa cells, a folate receptor positive cancer cells widely used as an in vitro model for CVB3 infection, via folate-mediated specific internalization. We found that our designed pRNA-AmiRs conjugates were tolerable to target mutations and have great potential to suppress viral mutational escape with little effect on triggering interferon induction. Conclusion/Significance This study provides important clues for designing AmiRs targeting the 3′UTR of viral genome. It also proves the feasibility of specific deliver of AmiRs using conjugated pRNA vehicles. These small AmiRs combined with pRNA-folate conjugates could form a promising system for antiviral drug development. PMID:21698212

  17. Study of mouse spleen "natural cytotoxic" (NC) cell activity related to in vivo administration of B4 coxsackievirus.

    PubMed

    Voiculescu, C; Roşu, L; Rogoz, S

    1987-01-01

    By using A2G 40-day-old mice as responders, the influence of in vivo infection with a human strain of B4 coxsackievirus on "natural cytotoxic" (NC) cell activity was assayed, in relation to other immunomodulating treatments (beta-interferon, interleukin-1, or prostaglandin-E2). A significant increase of NC cell cytolysis was noticed in virus-infected mouse group, as compared to the control. The NC cell stimulation exerted by in vivo administration of beta-interferon or of interleukin-1 was not modified in virus-infected groups, but coxsackievirus was able to prevent the inhibitory effects of prostaglandin-E2 at the NC cell activity level when the cytotoxic assays were performed with 20:1 and 10:1 effector/"target" cell ratios, respectively. A possible extrapolation of results in the human medical practice is discussed.

  18. Synthesis and evaluation of halogenated 12N-sulfonyl matrinic butanes as potential anti-coxsackievirus agents.

    PubMed

    Cheng, Xin-Yue; Li, Yu-Huan; Tang, Sheng; Zhang, Xin; Wang, Yan-Xiang; Wang, Sheng-Gang; Jiang, Jian-Dong; Li, Ying-Hong; Song, Dan-Qing

    2017-01-27

    Twenty-eight new 12N-benzenesulfonyl matrinic butane and halogenated 12N-sulfonyl matrinic butane/ethane derivatives were designed, synthesized and evaluated for their anti-coxsakievirus activities against CVB3 taking compound 1 as the lead. SAR analysis indicated the introduction of a fluoro atom on the 1'-position might be helpful for keeping potency. Among them, compound 8a exhibited potential activities against all CVBs with IC50 ranging from 0.69 to 5.14 μM, suggesting a broad-spectrum anti-coxsackievirus B feature. In addition, it also displayed an excellent PK and a good safety profile, indicating a highly druggable nature. Thus, we consider compound 8a to be a promising drug candidate in the treatment of not only viral myocarditis caused by CVB3 but also various diseases infected with coxsackieviruses B. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  19. 17 CFR 240.12b-3 - Title of securities.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... preference, if any; and if convertible, a statement to that effect. (b) In the case of funded debt, the rate... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Title of securities. 240.12b-3 Section 240.12b-3 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION...

  20. 17 CFR 270.8b-3 - Title of securities.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Title of securities. 270.8b-3 Section 270.8b-3 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION (CONTINUED) RULES... value, if any; the rate of dividends, if fixed, and whether cumulative or noncumulative; a...

  1. 26 CFR 1.652(b)-3 - Allocation of deductions.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... State income and personal property taxes. (d) To the extent that any items of deduction which are....652(b)-3 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) INCOME TAX (CONTINUED) INCOME TAXES (CONTINUED) Trusts Which Distribute Current Income Only § 1.652(b)-3 Allocation of...

  2. 26 CFR 1.652(b)-3 - Allocation of deductions.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... State income and personal property taxes. (d) To the extent that any items of deduction which are....652(b)-3 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) INCOME TAX (CONTINUED) INCOME TAXES (CONTINUED) Trusts Which Distribute Current Income Only § 1.652(b)-3 Allocation of...

  3. 26 CFR 1.652(b)-3 - Allocation of deductions.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... State income and personal property taxes. (d) To the extent that any items of deduction which are....652(b)-3 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) INCOME TAX (CONTINUED) INCOME TAXES (CONTINUED) Trusts Which Distribute Current Income Only § 1.652(b)-3 Allocation of...

  4. 18 CFR 1b.3 - Scope of investigations.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 18 Conservation of Power and Water Resources 1 2014-04-01 2014-04-01 false Scope of investigations. 1b.3 Section 1b.3 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION... Commission may conduct investigations relating to any matter subject to its jurisdiction. ...

  5. 18 CFR 1b.3 - Scope of investigations.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 18 Conservation of Power and Water Resources 1 2012-04-01 2012-04-01 false Scope of investigations. 1b.3 Section 1b.3 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION... Commission may conduct investigations relating to any matter subject to its jurisdiction. ...

  6. 18 CFR 1b.3 - Scope of investigations.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Scope of investigations. 1b.3 Section 1b.3 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION... Commission may conduct investigations relating to any matter subject to its jurisdiction. ...

  7. 18 CFR 1b.3 - Scope of investigations.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 18 Conservation of Power and Water Resources 1 2011-04-01 2011-04-01 false Scope of investigations. 1b.3 Section 1b.3 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION... Commission may conduct investigations relating to any matter subject to its jurisdiction. ...

  8. 17 CFR 240.12b-3 - Title of securities.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 17 Commodity and Securities Exchanges 3 2011-04-01 2011-04-01 false Title of securities. 240.12b-3 Section 240.12b-3 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION (CONTINUED) GENERAL RULES AND REGULATIONS, SECURITIES EXCHANGE ACT OF 1934 Rules and Regulations Under the Securities Exchange Act of 1934 General §...

  9. 17 CFR 240.12b-3 - Title of securities.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 17 Commodity and Securities Exchanges 3 2012-04-01 2012-04-01 false Title of securities. 240.12b-3 Section 240.12b-3 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION (CONTINUED) GENERAL RULES AND REGULATIONS, SECURITIES EXCHANGE ACT OF 1934 Rules and Regulations Under the Securities Exchange Act of 1934 General §...

  10. 17 CFR 240.12b-3 - Title of securities.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 17 Commodity and Securities Exchanges 3 2013-04-01 2013-04-01 false Title of securities. 240.12b-3 Section 240.12b-3 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION (CONTINUED) GENERAL RULES AND REGULATIONS, SECURITIES EXCHANGE ACT OF 1934 Rules and Regulations Under the Securities Exchange Act of 1934 General §...

  11. 17 CFR 240.12b-3 - Title of securities.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 17 Commodity and Securities Exchanges 4 2014-04-01 2014-04-01 false Title of securities. 240.12b-3 Section 240.12b-3 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION (CONTINUED) GENERAL RULES AND REGULATIONS, SECURITIES EXCHANGE ACT OF 1934 Rules and Regulations Under the Securities Exchange Act of 1934 General §...

  12. 12 CFR 261b.3 - Conduct of agency business.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 12 Banks and Banking 3 2011-01-01 2011-01-01 false Conduct of agency business. 261b.3 Section 261b... SYSTEM RULES REGARDING PUBLIC OBSERVATION OF MEETINGS § 261b.3 Conduct of agency business. Members shall not jointly conduct or dispose of official agency business other than in accordance with this part. ...

  13. 12 CFR 261b.3 - Conduct of agency business.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 12 Banks and Banking 4 2013-01-01 2013-01-01 false Conduct of agency business. 261b.3 Section 261b... SYSTEM (CONTINUED) RULES REGARDING PUBLIC OBSERVATION OF MEETINGS § 261b.3 Conduct of agency business. Members shall not jointly conduct or dispose of official agency business other than in accordance with...

  14. Seroepidemiology of Coxsackievirus A6, Coxsackievirus A16, and Enterovirus 71 Infections among Children and Adolescents in Singapore, 2008-2010

    PubMed Central

    Ang, Li Wei; Tay, Joanne; Phoon, Meng Chee; Hsu, Jung Pu; Cutter, Jeffery; James, Lyn; Goh, Kee Tai; Chow, Vincent Tak-Kwong

    2015-01-01

    Coxsackieviruses A6 (CV-A6) and A16 (CV-A16) and Enterovirus 71 (EV-A71) have caused periodic epidemics of hand, foot and mouth disease (HFMD) among children in Singapore. We conducted a cross-sectional study to estimate the seroprevalence of these enteroviruses among Singapore children and adolescents. The study was conducted between August 2008 and July 2010. It involved 700 Singapore residents aged 1–17 years whose residual sera were obtained following the completion of routine biochemical investigations in two public acute-care hospitals. The levels of neutralizing antibodies (NtAb) against CV-A6, CV-A16 and EV-A71 were analyzed by the microneutralization test. The age-specific geometric mean titer (GMT) of antibodies against each of the three enteroviruses and the 95% confidence intervals (CI) were calculated. The seroprevalence of CV-A6 and CV-A16 was high at 62.7% (95% CI: 59.1–66.2%) and 60.6% (95% CI: 56.9–64.1%), respectively. However, the seroprevalence of EV-A71 was significantly lower at 29.3% (95% CI: 26.0–32.8%). About 89.7% of the children and adolescents had been infected by at least one of the three enteroviruses by 13–17 years of age. About half (52.3%) were seropositive for two or all three enteroviruses, while only 16.1% had no NtAb against any of the three enteroviruses. High NtAb levels were observed in the younger age groups. CV-A6 and CV-A16 infections are very common among Singapore children and adolescents, while EV-A71 infections are less common. Infection is continually acquired from early childhood to adolescent age. PMID:26011735

  15. Seroepidemiology of Coxsackievirus A6, Coxsackievirus A16, and Enterovirus 71 Infections among Children and Adolescents in Singapore, 2008-2010.

    PubMed

    Ang, Li Wei; Tay, Joanne; Phoon, Meng Chee; Hsu, Jung Pu; Cutter, Jeffery; James, Lyn; Goh, Kee Tai; Chow, Vincent Tak-Kwong

    2015-01-01

    Coxsackieviruses A6 (CV-A6) and A16 (CV-A16) and Enterovirus 71 (EV-A71) have caused periodic epidemics of hand, foot and mouth disease (HFMD) among children in Singapore. We conducted a cross-sectional study to estimate the seroprevalence of these enteroviruses among Singapore children and adolescents. The study was conducted between August 2008 and July 2010. It involved 700 Singapore residents aged 1-17 years whose residual sera were obtained following the completion of routine biochemical investigations in two public acute-care hospitals. The levels of neutralizing antibodies (NtAb) against CV-A6, CV-A16 and EV-A71 were analyzed by the microneutralization test. The age-specific geometric mean titer (GMT) of antibodies against each of the three enteroviruses and the 95% confidence intervals (CI) were calculated. The seroprevalence of CV-A6 and CV-A16 was high at 62.7% (95% CI: 59.1-66.2%) and 60.6% (95% CI: 56.9-64.1%), respectively. However, the seroprevalence of EV-A71 was significantly lower at 29.3% (95% CI: 26.0-32.8%). About 89.7% of the children and adolescents had been infected by at least one of the three enteroviruses by 13-17 years of age. About half (52.3%) were seropositive for two or all three enteroviruses, while only 16.1% had no NtAb against any of the three enteroviruses. High NtAb levels were observed in the younger age groups. CV-A6 and CV-A16 infections are very common among Singapore children and adolescents, while EV-A71 infections are less common. Infection is continually acquired from early childhood to adolescent age.

  16. Thermolysis and solid state NMR studies of NaB3H8, NH3B3H7, and NH4B3H8.

    PubMed

    Huang, Zhenguo; Eagles, Mitch; Porter, Spencer; Sorte, Eric G; Billet, Beau; Corey, Robert L; Conradi, Mark S; Zhao, Ji-Cheng

    2013-01-21

    In an effort to broaden the search for high-capacity hydrogen storage materials, three triborane compounds, NaB(3)H(8), NH(3)B(3)H(7), and NH(4)B(3)H(8), were studied. In addition to hydrogen, thermal decomposition also releases volatile boranes, and the relative amounts and species depend on the cations (Na(+), NH(4)(+)) and the Lewis base (NH(3)). Static-sample hydrogen NMR is used to probe molecular motion in the three solids. In each case, the line width decreases from low temperatures to room temperature in accordance with a model of isotropic or nearly isotropic reorientations. Such motions also explain a deep minimum in the relaxation time T(1). Translational diffusion never appears to be rapid on the 10(-5) s time scale of NMR.

  17. Coxsackievirus Expression of the Murine Secretory Protein Interleukin-4 Induces Increased Synthesis of Immunoglobulin G1 in Mice

    PubMed Central

    Chapman, Nora M.; Kim, Kyung-Soo; Tracy, Steven; Jackson, John; Höfling, Katja; Leser, J. Smith; Malone, James; Kolbeck, Peter

    2000-01-01

    We cloned the sequence encoding murine interleukin-4 (mIL-4), including the secretory signal, into the genome of CVB3/0, an artificially attenuated strain of coxsackievirus B3, at the junction of the capsid protein 1D and the viral protease 2Apro. Two strains of chimeric CVB3 were constructed using, in one case, identical sequences to encode 2Apro cleavage sites (CVB3/0-mIL4/47) on either side of the inserted coding sequence and, in the other case, nonidentical sequences that varied at the nucleotide level without changing the amino acid sequences (CVB3-PL2-mIL4/46). Transfection of HeLa cells yielded progeny viruses that replicated with rates similar to that of the parental CVB3/0 strain, although yields of mIL-4-expressing strains were approximately 10-fold lower than those of the parental virus. Western blot analysis of viral proteins isolated from HeLa cells inoculated with either strain of chimeric virus demonstrated that the chimeric viruses synthesized capsid protein 1D at approximately twofold-higher levels than the parental virus. mIL-4 protein was detected by enzyme-linked immunosorbent assay (ELISA) in HeLa cells inoculated with either strain of chimeric virus. Lysates of HeLa cells inoculated with either chimeric virus induced the proliferation of the mIL-4-requiring murine MC-9 cell line, demonstrating biological activity of the CVB3-expressed mIL-4. Reverse transcription (RT)-PCR analysis of viral RNA derived from sequential passaging of CVB3/0-mIL4/47 in HeLa cells demonstrated deletion of the mIL-4 coding sequence occurring by the fourth passage, while similar analysis of CVB3-PL2-mIL4/46 RNA demonstrated detection of the mIL-4 coding sequence in the virus population through 10 generations in HeLa cells. mIL-4 protein levels determined by ELISA were consistent with the stability and loss data determined by RT-PCR analysis of the passaged viral genomes. Studies of insert stability of CVB3-PL2-mIL4/46 during replication in mice showed the presence of

  18. 3D Molecular Modelling Study of the H7N9 RNA-Dependent RNA Polymerase as an Emerging Pharmacological Target

    PubMed Central

    Vlachakis, Dimitrios

    2013-01-01

    Currently not much is known about the H7N9 strain, and this is the major drawback for a scientific strategy to tackle this virus. Herein, the 3D complex structure of the H7N9 RNA-dependent RNA polymerase has been established using a repertoire of molecular modelling techniques including homology modelling, molecular docking, and molecular dynamics simulations. Strikingly, it was found that the oligonucleotide cleft and tunnel in the H7N9 RNA-dependent RNA polymerase are structurally very similar to the corresponding region on the hepatitis C virus RNA-dependent RNA polymerase crystal structure. A direct comparison and a 3D postdynamics analysis of the 3D complex of the H7N9 RNA-dependent RNA polymerase provide invaluable clues and insight regarding the role and mode of action of a series of interacting residues on the latter enzyme. Our study provides a novel and efficiently intergraded platform with structural insights for the H7N9 RNA-dependent RNA Polymerase. We propose that future use and exploitation of these insights may prove invaluable in the fight against this lethal, ongoing epidemic. PMID:24187616

  19. The Application B3LYP to Large Systems

    NASA Technical Reports Server (NTRS)

    Bauschlicher, Charles W.; Arnold, James O. (Technical Monitor)

    1996-01-01

    The application of density functional theory (DFT), using the B3LYP functional, to a series of chemical problems is described. The first involves the calculation of silica-adsorbate bond energies, including both chemical bonds and weak hydrogen bonding. The calculation of vibrational frequencies for large organic systems is discussed. For the closed shell neutral systems, the B3LYP results are similar to the self- consistent- field results, however, for the positive ions, only the B3LYP level of theory is accurate and sufficiently inexpensive to allow the study of large systems. The final application involves the calculation of successive metal-ligand bond energies. The B3LYP bond energies and entropies are shown to be in good agreement with experiment.

  20. Construction of a subgenomic CV-B3 replicon expressing emerald green fluorescent protein to assess viral replication of a cardiotropic enterovirus strain in cultured human cells.

    PubMed

    Wehbe, Michel; Huguenin, Antoine; Leveque, Nicolas; Semler, Bert L; Hamze, Monzer; Andreoletti, Laurent; Bouin, Alexis

    2016-04-01

    Coxsackieviruses B (CV-B) (Picornaviridae) are a common infectious cause of acute myocarditis in children and young adults, a disease, which is a precursor to 10-20% of chronic myocarditis and dilated cardiomyopathy (DCM) cases. The mechanisms involved in the disease progression from acute to chronic myocarditis phase and toward the DCM clinical stage are not fully understood but are influenced by both viral and host factors. Subgenomic replicons of CV-B can be used to assess viral replication mechanisms in human cardiac cells and evaluate the effects of potential antiviral drugs on viral replication activities. Our objectives were to generate a reporter replicon from a cardiotropic prototype CV-B3/28 strain and to characterize its replication properties into human cardiac primary cells. To obtain this replicon, a cDNA plasmid containing the full CV-B3/28 genome flanked by a hammerhead ribozyme sequence and an MluI restriction site was generated and used as a platform for the insertion of sequences encoding emerald green fluorescent protein (EmGFP) in place of those encoding VP3. In vitro transcribed RNA from this plasmid was transfected into HeLa cells and human primary cardiac cells and was able to produce EmGFP and VP1-containing polypeptides. Moreover, non-structural protein biological activity was assessed by the specific cleavage of eIF4G1 by viral 2A(pro). Viral RNA replication was indirectly demonstrated by inhibition assays, fluoxetine was added to cell culture and prevented the EmGFP synthesis. Our results indicated that the EmGFP CV-B3 replicon was able to replicate and translate as well as the CV-B3/28 prototype strain. Our EmGFP CV-B3 replicon will be a valuable tool to readily investigate CV-B3 replication activities in human target cell models. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. Emergence, circulation, and spatiotemporal phylogenetic analysis of coxsackievirus a6- and coxsackievirus a10-associated hand, foot, and mouth disease infections from 2008 to 2012 in Shenzhen, China.

    PubMed

    He, Ya-Qing; Chen, Long; Xu, Wen-Bo; Yang, Hong; Wang, Han-Zhong; Zong, Wen-Ping; Xian, Hui-Xia; Chen, Hui-Ling; Yao, Xiang-Jie; Hu, Zhang-Li; Luo, Min; Zhang, Hai-Long; Ma, Han-Wu; Cheng, Jin-Quan; Feng, Qian-Jin; Zhao, De-Jian

    2013-11-01

    Sporadic hand, foot, and mouth disease (HFMD) outbreaks and other infectious diseases in recent years have frequently been associated with certain human enterovirus (HEV) serotypes. This study explored the prevalences and genetic characteristics of non-HEV71 and non-coxsackievirus A16 (CV-A16) human enterovirus-associated HFMD infections in Shenzhen, China. A total of 2,411 clinical stool specimens were collected from hospital-based surveillance for HFMD from 2008 to 2012. The detection of HEV was performed by real-time reverse transcription-PCR (RT-PCR) and RT-seminested PCR, and spatiotemporal phylogenetic analysis was performed based on the VP1 genes. A total of 1,803 (74.8%) strains comprising 28 different serotypes were detected. In the past 5 years, the predominant serotypes were HEV71 (60.0%), followed by CV-A16 (21.2%) and two uncommon serotypes, CV-A6 (13.0%) and CV-A10 (3.3%). However, CV-A6 replaced CV-A16 as the second most common serotype between 2010 and 2012. As an emerging pathogen, CV-A6 became as common a causative agent of HFMD as HEV71 in Shenzhen in 2012. Phylogenetic analysis revealed that little variation occurred in the Chinese HEV71 and CV-A16 strains. The genetic characteristics of the Chinese CV-A6 and CV-A10 strains displayed geographic differences. The CV-A6 and CV-A10 strains circulating in Shenzhen likely originated in Europe. It was found that human enteroviruses have a high mutation rate due to evolutionary pressure and frequent recombination (3.2 × 10(-3) to 6.4 ×10(-3) substitutions per site per year for HEV71, CV-A6, CV-A16, and CV-A10). Since certain serotypes are potential threats to the public health, this study provides further insights into the significance of the epidemiological surveillance of HFMD.

  2. Coxsackievirus myocarditis: interplay between virus and host in the pathogenesis of heart disease.

    PubMed

    Tam, Patricia E

    2006-01-01

    Coxsackievirus (CVB) infection is a significant cause of myocarditis and dilated cardiomyopathy (DCM). Heart disease may be caused by direct cytopathic effects of the virus, a pathologic immune response to persistent virus, or autoimmunity triggered by the viral infection. CVB interacts with its host at multiple stages during disease development. Signaling through viral receptors may alter the intracellular environment in addition to facilitating virus entry. Viral genetic determinants that encode cardiovirulence have been mapped and may change depending on the nutritional status of the host. Virus persistence is directly associated with pathology, and recent work demonstrates that CVB evolves into a slowly replicating form capable of establishing a low-grade infection in the heart. The innate immune response to CVB has taken on increasing importance because of its role in shaping the development of the adaptive immune response that is responsible for cardiac pathology. Studies of T cell responsiveness and the development of autoimmunity at the molecular level are beginning to clarify the mechanisms through which CVB infection causes inflammatory heart disease.

  3. Coxsackievirus B4 Can Infect Human Peripheral Blood-Derived Macrophages.

    PubMed

    Alidjinou, Enagnon Kazali; Sané, Famara; Trauet, Jacques; Copin, Marie-Christine; Hober, Didier

    2015-11-24

    Beyond acute infections, group B coxsackieviruses (CVB) are also reported to play a role in the development of chronic diseases, like type 1 diabetes. The viral pathogenesis mainly relies on the interplay between the viruses and innate immune response in genetically-susceptible individuals. We investigated the interaction between CVB4 and macrophages considered as major players in immune response. Monocyte-derived macrophages (MDM) generated with either M-CSF or GM-CSF were inoculated with CVB4, and infection, inflammation, viral replication and persistence were assessed. M-CSF-induced MDM, but not GM-CSF-induced MDM, can be infected by CVB4. In addition, enhancing serum was not needed to infect MDM in contrast with parental monocytes. The expression of viral receptor (CAR) mRNA was similar in both M-CSF and GM-CSF MDM. CVB4 induced high levels of pro-inflammatory cytokines (IL-6 and TNFα) in both MDM populations. CVB4 effectively replicated and persisted in M-CSF MDM, but IFNα was produced in the early phase of infection only. Our results demonstrate that CVB4 can replicate and persist in MDM. Further investigations are required to determine whether the interaction between the virus and MDM plays a role in the pathogenesis of CVB-induced chronic diseases.

  4. Coxsackievirus B4 Can Infect Human Peripheral Blood-Derived Macrophages

    PubMed Central

    Alidjinou, Enagnon Kazali; Sané, Famara; Trauet, Jacques; Copin, Marie-Christine; Hober, Didier

    2015-01-01

    Beyond acute infections, group B coxsackieviruses (CVB) are also reported to play a role in the development of chronic diseases, like type 1 diabetes. The viral pathogenesis mainly relies on the interplay between the viruses and innate immune response in genetically-susceptible individuals. We investigated the interaction between CVB4 and macrophages considered as major players in immune response. Monocyte-derived macrophages (MDM) generated with either M-CSF or GM-CSF were inoculated with CVB4, and infection, inflammation, viral replication and persistence were assessed. M-CSF-induced MDM, but not GM-CSF-induced MDM, can be infected by CVB4. In addition, enhancing serum was not needed to infect MDM in contrast with parental monocytes. The expression of viral receptor (CAR) mRNA was similar in both M-CSF and GM-CSF MDM. CVB4 induced high levels of pro-inflammatory cytokines (IL-6 and TNFα) in both MDM populations. CVB4 effectively replicated and persisted in M-CSF MDM, but IFNα was produced in the early phase of infection only. Our results demonstrate that CVB4 can replicate and persist in MDM. Further investigations are required to determine whether the interaction between the virus and MDM plays a role in the pathogenesis of CVB-induced chronic diseases. PMID:26610550

  5. Coxsackievirus-adenovirus receptor (CAR) is essential for early embryonic cardiac development.

    PubMed

    Dorner, Armin A; Wegmann, Frank; Butz, Stefan; Wolburg-Buchholz, Karen; Wolburg, Hartwig; Mack, Andreas; Nasdala, Ines; August, Benjamin; Westermann, Jürgen; Rathjen, Fritz G; Vestweber, Dietmar

    2005-08-01

    The coxsackievirus-adenovirus receptor (CAR) is a cell contact protein on various cell types with unknown physiological function. It belongs to a subfamily of the immunoglobulin-superfamily of which some members are junctional adhesion molecules on epithelial and/or endothelial cells. CAR is dominantly expressed in the hearts and brains of mice until the newborne phase after which it becomes mainly restricted to various epithelial cells. To understand more about the physiological function of CAR, we have generated CAR-deficient mice by gene targeting. We found that these mice die between E11.5 and E13.5 of embryonal development. Ultrastructural analysis of cardiomyocytes revealed that the density of myofibrils was reduced and that their orientation and bundling was disorganized. In addition, mitochondria were enlarged and glycogen storage strongly enriched. In line with these defects, we observed pericardial edema formation as a clear sign of insufficient heart function. Developmental abnormalities likely to be secondary effects of gene ablation were the persistent singular cardial atrio-ventricular canal and dilatations of larger blood vessels such as the cardinal veins. The secondary nature of these defects was supported by the fact that CAR was not expressed on vascular cells or on cells of the vascular wall. No obvious signs for alterations of the histological organization of the placenta were observed. We conclude that CAR is required for embryonal heart development, most likely due to its function during the organization of myofibrils in cardiomyocytes.

  6. Functional Effects of Coxsackievirus and Adenovirus Receptor Glycosylation on Homophilic Adhesion and Adenoviral Infection▿

    PubMed Central

    Excoffon, Katherine J. D. Ashbourne; Gansemer, Nicholas; Traver, Geri; Zabner, Joseph

    2007-01-01

    The coxsackievirus and adenovirus receptor (CAR) is both a viral receptor and homophilic adhesion protein. The extracellular portion of CAR consists of two immunoglobulin (Ig)-like domains, each with a consensus sequence for N-glycosylation. We used chemical, genetic, and biochemical studies to show that both sites are glycosylated and contribute to the function of CAR. Although the glycosylation of CAR does not alter cell surface levels or junctional localization, it affects both adhesion and adenovirus infection in unique ways. CAR-mediated adhesion appears to require at least one site of glycosylation since cells expressing CAR without glycosylation do not cluster with each other. In contrast, glycosylation of the Ig-like domain proximal to the membrane is key to the cooperative behavior of adenovirus binding and infection. Contrary to the hypothesis that cooperativity improves viral infection, our data show that although glycosylation of the D2 domain is required for adenovirus cooperative binding, it has a negative consequence upon infection. This is the first report dissecting the adhesion and receptor activities of CAR, revealing that factors other than the binding interface play a significant role in the function of CAR. These data have important implications for both cancers with altered glycosylation states and cancer treatments using oncolytic adenovirus. PMID:17376928

  7. In-utero coxsackievirus B4 infection of the mouse thymus.

    PubMed

    Jaïdane, H; Halouani, A; Jmii, H; Elmastour, F; Abdelkefi, S; Bodart, G; Michaux, H; Chakroun, T; Sane, F; Mokni, M; Geenen, V; Hober, D; Aouni, M

    2017-03-01

    Type B coxsackievirus (CV-B) infections are involved frequently in the triggering of several autoimmune diseases such as myocarditis, dilated cardiomyopathy, pericarditis, pancreatitis, type 1 diabetes, encephalitis, thyroiditis or Sjögren's syndrome. Serological and virological evidence suggests that maternal infections during pregnancy can play a role in the appearance of these diseases in offspring. The current study aims to explore the effect of an in-utero CV-B infection on the fetal thymus, the central site for programming immunological self-tolerance. In this perspective, female Swiss albino mice were inoculated intraperitoneally or orally with the diabetogenic CV-B4 E2 strain at gestational days 10 or 17. Offspring were killed at different post-inoculation times, and their thymuses were analysed for evidence of infection and alterations in thymic T cell subsets. In-utero CV-B infection of the thymus was demonstrated during the course of vertical transmission, as attested by viral RNA and infectious virus detection in most analysed samples. No histopathological changes were evident. Thymic T cells were not depleted, despite being positive for viral RNA. As evidenced by flow cytometry analysis, CV-B infection of the fetal thymus induced significant changes of thymic T cell populations, particularly with maternal inoculation at gestational day 10. Altogether, these findings suggest that CV-B infection of the fetal thymus may play an important role in the genesis of autoimmune diseases. © 2016 British Society for Immunology.

  8. Development of a coxsackievirus A16 neutralization test based on the enzyme-linked immunospot assay.

    PubMed

    Hou, Wangheng; Yang, Lisheng; He, Delei; Zheng, Jun; Xu, Longfa; Liu, Jian; Liu, Yajing; Zhao, Huan; Ye, Xiangzhong; Cheng, Tong; Xia, Ningshao

    2015-04-01

    Coxsackievirus A16 (CA16) is one of the major pathogens responsible for hand, foot and mouth disease (HFMD). The assessment of the humoral immunity response is indispensable in the development of vaccines against enteroviruses. The neutralization test based on the inhibition of cytopathic effects (Nt-CPE) is a common method for measuring neutralizing antibodies against CA16. However, an efficient neutralization test needs to be developed for seroepidemiological surveys and clinical trials of CA16 vaccines because Nt-CPE is time-consuming and labor-intensive. In this study, a high-throughput neutralization test for CA16 based on the enzyme-linked immunospot assay (Nt-ELISPOT) was developed. The monoclonal antibody 7D10, which reacted with the viral protein VP1, was used to detect the cells infected with CA16. The neutralizing titers of sera were proven to be unchanged over an infectious dose range from 10 to 10,000TCID50 per well. The Nt-ELISPOT results correlated well with the Nt-CPE results (R(2) = 0.9250), and the detection period was shortened from five days to approximately 30h. Overall, the Nt-ELISPOT is a reliable and efficient method for measuring neutralizing antibodies against CA16.

  9. Optimization and Characterization of Candidate Strain for Coxsackievirus A16 Inactivated Vaccine

    PubMed Central

    Li, Jingliang; Liu, Guanchen; Liu, Xin; Yang, Jiaxin; Chang, Junliang; Zhang, Wenyan; Yu, Xiao-Fang

    2015-01-01

    Coxsackievirus A16 (CA16) and enterovirus 71 (EV71), both of which can cause hand, foot and mouth disease (HFMD), are responsible for large epidemics in Asian and Pacific areas. Although inactivated EV71 vaccines have completed testing in phase III clinical trials in Mainland China, CA16 vaccines are still under development. A Vero cell-based inactivated CA16 vaccine was developed by our group. Screening identified a CA16 vaccine strain (CC024) isolated from HFMD patients, which had broad cross-protective abilities and satisfied all requirements for vaccine production. Identification of the biological characteristics showed that the CA16CC024 strain had the highest titer (107.5 CCID50/mL) in Vero cells, which would benefit the development of an EV71/CA16 divalent vaccine. A potential vaccine manufacturing process was established, including the selection of optimal time for virus harvesting, membrane for diafiltration and concentration, gel-filtration chromatography for the down-stream virus purification and virus inactivation method. Altogether, the analyses suggested that the CC-16, a limiting dilution clone of the CC024 strain, with good genetic stability, high titer and broad-spectrum immunogenicity, would be the best candidate strain for a CA16 inactivated vaccine. Therefore, our study provides valuable information for the development of a Vero cell-based CA16 or EV71-CA16 divalent inactivated vaccine. PMID:26193302

  10. Detection, characterization and quantitation of coxsackievirus A16 using polyclonal antibodies against recombinant capsid subunit proteins.

    PubMed

    Liu, Qingwei; Ku, Zhiqiang; Cai, Yicun; Sun, Bing; Leng, Qibin; Huang, Zhong

    2011-04-01

    Coxsackievirus A16 (CVA16), together with enterovirus type 71 (EV71), is responsible for most cases of hand, foot and mouth disease (HFMD) worldwide. Recent findings suggest that the recombination between CVA16 and EV71, and co-circulation of these two viruses may have contributed to the increase of HFMD cases in China over the past few years. Thus, for CVA16, further understanding of its virology, epidemiology and development of diagnostic tests and vaccines are of importance. The present study aimed to develop reagents and protocols for the detection, characterization and quantitation of CVA16. Recombinant CVA16 capsid subunit proteins VP0, VP3 and truncated VP1, were produced in Escherichia coli and used to immunize guinea pigs to generate polyclonal antibodies. The resultant three antisera detected specifically CVA16 propagated in Vero cells by immunostaining, ELISA and Western blotting. The antisera was used to show that CVA16 capsids were composed of correctly processed VP0, VP1 and VP3 subunits, and were present in the form of efficiently assembled particles. A method for the quantitation of the yield of CVA16 in Vero cells was established based on a Western blotting protocol using the recombinant VP0 as a reference standard and anti-VP0 as the detection antibody. This study shows the development and validation of reagents and methods, for qualitative and quantitative determination of CVA16, which are essential for the development of vaccines.

  11. Coxsackievirus A16 Elicits Incomplete Autophagy Involving the mTOR and ERK Pathways

    PubMed Central

    Zhu, Guoguo; Tu, Huilin; Liu, Zhongchun; Li, Wenhua; Han, Song; Yin, Jun; Peng, Biwen; Liu, Wanhong

    2015-01-01

    Autophagy is an important homeostatic process for the degradation of cytosolic proteins and organelles and has been reported to play an important role in cellular responses to pathogens and virus replication. However, the role of autophagy in Coxsackievirus A16 (CA16) infection and pathogenesis remains unknown. Here, we demonstrated that CA16 infection enhanced autophagosome formation, resulting in increased extracellular virus production. Moreover, expression of CA16 nonstructural proteins 2C and 3C was sufficient to trigger autophagosome accumulation by blocking the fusion of autophagosomes with lysosomes. Interestingly, we found that Immunity-related GTPase family M (IRGM) was crucial for the activation of CA16 infection-induced autophagy; in turn, reducing IRGM expression suppressed autophagy. Expression of viral protein 2C enhanced IRGM promoter activation, thereby increasing IRGM expression and inducing autophagy. CA16 infection inhibited Akt/mTOR signaling and activated extracellular signal-regulated kinase (ERK) signaling, both of which are necessary for autophagy induction. In summary, CA16 can use autophagy to enhance its own replication. These results raise the possibility of targeting the autophagic pathway for the treatment of hand, foot, and mouth disease (HFMD). PMID:25853521

  12. Antiviral Ability of Kalanchoe gracilis Leaf Extract against Enterovirus 71 and Coxsackievirus A16

    PubMed Central

    Wang, Ching-Ying; Huang, Shun-Chueh; Zhang, Yongjun; Lai, Zhen-Rung; Kung, Szu-Hao; Chang, Yuan-Shiun; Lin, Cheng-Wen

    2012-01-01

    Pandemic infection or reemergence of Enterovirus 71 (EV71) and coxsackievirus A16 (CVA16) occurs in tropical and subtropical regions, being associated with hand-foot-and-mouth disease, herpangina, aseptic meningitis, brain stem encephalitis, pulmonary edema, and paralysis. However, effective therapeutic drugs against EV71 and CVA16 are rare. Kalanchoe gracilis (L.) DC is used for the treatment of injuries, pain, and inflammation. This study investigated antiviral effects of K. gracilis leaf extract on EV71 and CVA16 replications. HPLC analysis with a C-18 reverse phase column showed fingerprint profiles of K. gracilis leaf extract had 15 chromatographic peaks. UV/vis absorption spectra revealed peaks 5, 12, and 15 as ferulic acid, quercetin, and kaempferol, respectively. K. gracilis leaf extract showed little cytotoxicity, but exhibited concentration-dependent antiviral activities including cytopathic effect, plaque, and virus yield reductions. K. gracilis leaf extract was shown to be more potent in antiviral activity than ferulic acid, quercetin, and kaempferol, significantly inhibiting in vitro replication of EV71 (IC50 = 35.88 μg/mL) and CVA16 (IC50 = 42.91 μg/mL). Moreover, K. gracilis leaf extract is a safe antienteroviral agent with the inactivation of viral 2A protease and reduction of IL-6 and RANTES expressions. PMID:22666293

  13. Immunological and pathological consequences of coxsackievirus RNA persistence in the heart.

    PubMed

    Flynn, Claudia T; Kimura, Taishi; Frimpong-Boateng, Kwesi; Harkins, Stephanie; Whitton, J Lindsay

    2017-09-23

    Type B coxsackieviruses (CVB) can cause myocarditis and dilated cardiomyopathy (DCM), a potentially-fatal sequela that has been correlated to the persistence of viral RNA. Herein, we demonstrate that cardiac RNA persistence can be established even after an inapparent primary infection. Using an inducible Cre/lox mouse model, we ask: (i) Does persistent CVB3 RNA cause ongoing immune activation? (ii) If T1IFN signaling into cardiomyocytes is ablated after RNA persistence is established, is there any change in the abundance of persistent CVB3 RNA and/or does cytopathic infectious virus re-emerge? (iii) Does this loss of T1IFN responsiveness by cardiomyocytes lead to the recurrence/exacerbation of myocarditis? Our findings suggest that persistent enteroviral RNAs probably do not contribute to ongoing myocardial disease, and are more likely to be the fading remnants of a recent, possibly sub-clinical, primary infection which may have set in motion the process that ultimately ends in DCM. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. Coxsackievirus B 1-induced polymyositis. Lack of disease expression in nu/nu mice.

    PubMed Central

    Ytterberg, S R; Mahowald, M L; Messner, R P

    1987-01-01

    Chronic inflammatory myositis similar to human polymyositis occurs in mice after infection with a strain of Coxsackievirus B 1 (CVB 1). To investigate the role of T cells in the pathogenesis of this disorder, we compared disease expression in T cell-deficient athymic nude (nu/nu) mice and heterozygotes (nu/+) with normal T cell function. Acute infectious myositis occurred in nu/nu and nu/+ mice. Chronic (greater than 21 d postinfection) weakness and myositis, however, developed only in nu/+. Resistance to disease in nu/nu mice was not explained by insusceptibility to infection; the amount of virus lethal for 50% of mice and virus replication were comparable in both groups. Additionally, anti-CVB 1 antibody production was similar in both groups. Reconstitution of infected nu/nu mice with spleen cells from normal mice resulted in disease. These results demonstrate that chronic weakness after infection with this virus is not simply a sequela of acute myonecrosis and suggest that T cells play a pivotal role in the pathogenesis of chronic myositis. Images PMID:3038960

  15. Characterization of a YAC-1 mouse cell receptor for group B coxsackieviruses.

    PubMed Central

    Hsu, K H; Crowell, R L

    1989-01-01

    A receptor on YAC-1 cells, a mouse T-lymphoma cell line, bound all six serotypes of the group B coxsackieviruses (CVB). In addition, the cells produced infectious virus. Each of the CVB competed for the same receptor on YAC-1 cells. CVB3 bound relatively slowly to YAC-1 cells (k = 4 x 10(-11) min-1 cell-1), and there were only 500 attachment sites per cell. A rabbit antiserum prepared against the HeLa cell receptor protein Rp-a specifically inhibited the binding of CVB1 and CVB3. A virus-receptor complex with CVB3 could be isolated from detergent (0.5% sodium deoxycholate, 1% Triton X-100)-solubilized YAC-1 plasma membranes. Analysis by sodium dodecyl sulfate-polyacrylamide gel electrophoresis of the iodinated virus-receptor complex revealed a band with the same mobility as Rp-a. The results suggested that the YAC-1 receptor for CVB resembles that of the HeLa cell receptor. Images PMID:2724420

  16. Lipid Raft- and Src Family Kinase-Dependent Entry of Coxsackievirus B into Human Placental Trophoblasts

    PubMed Central

    Delorme-Axford, Elizabeth; Sadovsky, Yoel

    2013-01-01

    Maternal-fetal transmission of group B coxsackieviruses (CVB) during pregnancy has been associated with a number of diverse pathological outcomes, including hydrops fetalis, fetal myocarditis, meningoencephalitis, neurodevelopmental delays, congenital skin lesions, miscarriage, and/or stillbirth. Throughout pregnancy, the placenta forms a critical antimicrobial protective barrier at the maternal-fetal interface. Despite the severity of diseases accompanying fetal CVB infections, little is known regarding the strategies used by CVB to gain entry into placental trophoblasts. Here we used both a trophoblast cell line and primary human trophoblasts to demonstrate the mechanism by which CVB gains entry into polarized placental trophoblasts. Our studies revealed that the kinetics of CVB entry into placental trophoblasts are similar to those previously described for polarized intestinal epithelial cells. Likewise, CVB entry into placental trophoblasts requires decay-accelerating factor (DAF) binding and involves relocalization of the virus from the apical surface to intercellular tight junctions. In contrast, we have identified a divergent mechanism for CVB entry into polarized trophoblasts that is clathrin, caveolin-1, and dynamin II independent but requires intact lipid rafts. In addition, we found that members of the Src family of tyrosine kinases were required for CVB entry. Our studies highlight the complexity of viral entry into human placental trophoblasts and may serve as a model for mechanisms used by diverse pathogens to penetrate the placental barrier. PMID:23720726

  17. Cytolytic replication of coxsackievirus B2 in CAR-deficient rhabdomyosarcoma cells.

    PubMed

    Polacek, Charlotta; Ekström, Jens-Ola; Lundgren, Anneli; Lindberg, A Michael

    2005-11-01

    The six coxsackievirus B serotypes (CVB1-6) use the coxsackie- and adenovirus receptor (CAR) for host cell entry. Four of these serotypes, CVB1, 3, 5 and 6, have also shown the capacity to replicate and cause cytolysis in rhabdomyosarcoma (RD) cells, a CAR-deficient cell line. This extended tropism has been associated with an acquired ability to bind decay accelerating factor (DAF). In this study, we have adapted the CVB2 prototype strain Ohio-1 (CVB2/O) to replicate in RD cells. Two types of infection were identified: (I) an enterovirus-typical, lytic infection, and (II) a non-lytic infection. Both CVB2/O-RD variants retained the prototype-ability to cause cytopathic effect in HeLa cells using CAR as receptor. Phenotypic and genotypic changes in the CVB2/O-RD-variants were determined and compared to the prototype cultured in HeLa cells. Inhibition studies using antibodies against CAR and DAF revealed a maintained ability of the CVB2/O-RD-variants to bind CAR, but no binding to DAF was observed. In addition, neither the prototype nor the CVB2/O-RD-variants were able to cause hemagglutination in human red blood cells, an enterovirus feature associated with affinity for DAF. Sequence analysis of the CVB2/O-RD-variants showed acquired mutations in the capsid region, suggesting extended receptor usage towards an alternative, yet unidentified, receptor for CVB2.

  18. Novel Role for Decay-Accelerating Factor in Coxsackievirus A21-Mediated Cell Infectivity

    PubMed Central

    Newcombe, Nicole G.; Beagley, Leone G.; Christiansen, Dale; Loveland, Bruce E.; Johansson, E. Susanne; Beagley, Ken W.; Barry, Richard D.; Shafren, Darren R.

    2004-01-01

    Decay-accelerating factor (DAF) is involved in the cell membrane attachment of many human enteroviruses. Presently, further specific active roles of DAF in mediating productive cell infection and in the pathogenesis of natural enterovirus infection are poorly understood. In an attempt to more fully understand the role of DAF in lytic cell infection we examined the specific interactions of the prototype strain of coxsackievirus A21 (CVA21) with surface-expressed DAF. Investigations into discrete DAF-CVA21 interactions focused on viral binding; viral particle elution with respect to the parameters of time, temperature, and pH; and subsequent cell infection. Radiolabeled-virus binding assays revealed that peak elution of CVA21 from DAF occurred within 15 min of initial attachment and that the DAF-eluted virus increased in a linear fashion with respect to temperature and pH. CVA21 eluted from endogenous surface-expressed DAF was highly infectious, in contrast to CVA21 eluted from intercellular adhesion molecule 1 (ICAM-1), which retained little to no infectivity. Using an adenovirus transduction system, we demonstrate that CVA21 can remain infectious for up to 24 h after DAF binding and is capable of initiating a multicycle lytic infection upon delayed ICAM-1 surface expression. Taken together, the data suggest that a major role of DAF in cell infection by the prototype strain of CVA21 is to provide membrane concentration of infectious virions, effectively increasing viral interactions with endogenous or induced ICAM-1. PMID:15507656

  19. Coxsackievirus A16 infection stimulates imbalances of T cells in children.

    PubMed

    Luo, Qingming; Peng, Wanjun; Chen, L I

    2015-06-01

    Immune reaction plays a crucial role in the regulation of the progression of Coxsackievirus A16 (CA16)-infected hand, foot and mouth disease (HFMD). However, no details of T-cell subset frequency or imbalance during the CA16 infection process have been revealed. In the present study, whether CA16-induced HFMD changes the frequency of different T-cell subsets and associated immune mediators was determined in children. The results indicate that the percentages of Th1 and Tc1 cells were significantly increased in children with HFMD compared with those in healthy children. In addition, the Th1/Th2 ratio and interferon (IFN)-γ levels were significant higher in children with HFMD. Furthermore, the percentage of Th17 cells and the Th17/Treg ratio as well as interleukin (IL)-17A levels were higher in HFMD cases. In conclusion, the present study demonstrated the dysregulation of T-cell subsets following CA16 infection. The Th1/Th2 and Th17/Treg ratios were imbalanced following infection. Also, the imbalance Th1/Th2 and Th17/Treg ratios contributed to the increased levels of IFN-γ and IL-17A. Based on this information, the present study provides new insights for the future study of CA16-induced HFMD and offers new data of diagnostic and therapeutic value for CA16 infection.

  20. Coxsackievirus A16 infection stimulates imbalances of T cells in children

    PubMed Central

    LUO, QINGMING; PENG, WANJUN; CHEN, LI

    2015-01-01

    Immune reaction plays a crucial role in the regulation of the progression of Coxsackievirus A16 (CA16)-infected hand, foot and mouth disease (HFMD). However, no details of T-cell subset frequency or imbalance during the CA16 infection process have been revealed. In the present study, whether CA16-induced HFMD changes the frequency of different T-cell subsets and associated immune mediators was determined in children. The results indicate that the percentages of Th1 and Tc1 cells were significantly increased in children with HFMD compared with those in healthy children. In addition, the Th1/Th2 ratio and interferon (IFN)-γ levels were significant higher in children with HFMD. Furthermore, the percentage of Th17 cells and the Th17/Treg ratio as well as interleukin (IL)-17A levels were higher in HFMD cases. In conclusion, the present study demonstrated the dysregulation of T-cell subsets following CA16 infection. The Th1/Th2 and Th17/Treg ratios were imbalanced following infection. Also, the imbalance Th1/Th2 and Th17/Treg ratios contributed to the increased levels of IFN-γ and IL-17A. Based on this information, the present study provides new insights for the future study of CA16-induced HFMD and offers new data of diagnostic and therapeutic value for CA16 infection. PMID:26136962

  1. Rift Valley fever virus NSs inhibits host transcription independently of the degradation of dsRNA-dependent protein kinase PKR.

    PubMed

    Kalveram, Birte; Lihoradova, Olga; Indran, Sabarish V; Lokugamage, Nandadeva; Head, Jennifer A; Ikegami, Tetsuro

    2013-01-20

    Rift Valley fever virus (RVFV) encodes one major virulence factor, the NSs protein. NSs suppresses host general transcription, including interferon (IFN)-β mRNA synthesis, and promotes degradation of the dsRNA-dependent protein kinase (PKR). We generated a novel RVFV mutant (rMP12-NSsR173A) specifically lacking the function to promote PKR degradation. rMP12-NSsR173A infection induces early phosphorylation of eIF2α through PKR activation, while retaining the function to inhibit host general transcription including IFN-β gene inhibition. MP-12 NSs but not R173A NSs binds to wt PKR. R173A NSs formed filamentous structure in nucleus in a mosaic pattern, which was distinct from MP-12 NSs filament pattern. Due to early phosphorylation of eIF2α, rMP12-NSsR173A could not efficiently accumulate viral proteins. Our results suggest that NSs-mediated host general transcription suppression occurs independently of PKR degradation, while the PKR degradation is important to inhibit the phosphorylation of eIF2α in infected cells undergoing host general transcription suppression.

  2. Triphosphate Reorientation of the Incoming Nucleotide as a Fidelity Checkpoint in Viral RNA-dependent RNA Polymerases.

    PubMed

    Yang, Xiaorong; Liu, Xinran; Musser, Derek M; Moustafa, Ibrahim M; Arnold, Jamie J; Cameron, Craig E; Boehr, David D

    2017-03-03

    The nucleotide incorporation fidelity of the viral RNA-dependent RNA polymerase (RdRp) is important for maintaining functional genetic information but, at the same time, is also important for generating sufficient genetic diversity to escape the bottlenecks of the host's antiviral response. We have previously shown that the structural dynamics of the motif D loop are closely related to nucleotide discrimination. Previous studies have also suggested that there is a reorientation of the triphosphate of the incoming nucleotide, which is essential before nucleophilic attack from the primer RNA 3'-hydroxyl. Here, we have used (31)P NMR with poliovirus RdRp to show that the binding environment of the triphosphate is different when correct versus incorrect nucleotide binds. We also show that amino acid substitutions at residues known to interact with the triphosphate can alter the binding orientation/environment of the nucleotide, sometimes lead to protein conformational changes, and lead to substantial changes in RdRp fidelity. The analyses of other fidelity variants also show that changes in the triphosphate binding environment are not always accompanied by changes in the structural dynamics of the motif D loop or other regions known to be important for RdRp fidelity, including motif B. Altogether, our studies suggest that the conformational changes in motifs B and D, and the nucleoside triphosphate reorientation represent separable, "tunable" fidelity checkpoints.

  3. microRNA dependent and independent deregulation of long non-coding RNAs by an oncogenic herpesvirus

    PubMed Central

    Jain, Vaibhav

    2017-01-01

    Kaposi’s sarcoma (KS) is a highly prevalent cancer in AIDS patients, especially in sub-Saharan Africa. Kaposi’s sarcoma-associated herpesvirus (KSHV) is the etiological agent of KS and other cancers like Primary Effusion Lymphoma (PEL). In KS and PEL, all tumors harbor latent KSHV episomes and express latency-associated viral proteins and microRNAs (miRNAs). The exact molecular mechanisms by which latent KSHV drives tumorigenesis are not completely understood. Recent developments have highlighted the importance of aberrant long non-coding RNA (lncRNA) expression in cancer. Deregulation of lncRNAs by miRNAs is a newly described phenomenon. We hypothesized that KSHV-encoded miRNAs deregulate human lncRNAs to drive tumorigenesis. We performed lncRNA expression profiling of endothelial cells infected with wt and miRNA-deleted KSHV and identified 126 lncRNAs as putative viral miRNA targets. Here we show that KSHV deregulates host lncRNAs in both a miRNA-dependent fashion by direct interaction and in a miRNA-independent fashion through latency-associated proteins. Several lncRNAs that were previously implicated in cancer, including MEG3, ANRIL and UCA1, are deregulated by KSHV. Our results also demonstrate that KSHV-mediated UCA1 deregulation contributes to increased proliferation and migration of endothelial cells. PMID:28715488

  4. Structural explanation for the role of Mn2+ in the activity of ϕ6 RNA-dependent RNA polymerase

    PubMed Central

    Poranen, Minna M.; Salgado, Paula S.; Koivunen, Minni R. L.; Wright, Sam; Bamford, Dennis H.; Stuart, David I.; Grimes, Jonathan M.

    2008-01-01

    The biological role of manganese (Mn2+) has been a long-standing puzzle, since at low concentrations it activates several polymerases whilst at higher concentrations it inhibits. Viral RNA polymerases possess a common architecture, reminiscent of a closed right hand. The RNA-dependent RNA polymerase (RdRp) of bacteriophage ϕ6 is one of the best understood examples of this important class of polymerases. We have probed the role of Mn2+ by biochemical, biophysical and structural analyses of the wild-type enzyme and of a mutant form with an altered Mn2+-binding site (E491 to Q). The E491Q mutant has much reduced affinity for Mn2+, reduced RNA binding and a compromised elongation rate. Loss of Mn2+ binding structurally stabilizes the enzyme. These data and a re-examination of the structures of other viral RNA polymerases clarify the role of manganese in the activation of polymerization: Mn2+ coordination of a catalytic aspartate is necessary to allow the active site to properly engage with the triphosphates of the incoming NTPs. The structural flexibility caused by Mn2+ is also important for the enzyme dynamics, explaining the requirement for manganese throughout RNA polymerization. PMID:18940872

  5. Molecular characterization of genome segment 2 encoding RNA dependent RNA polymerase of Antheraea mylitta cytoplasmic polyhedrosis virus

    SciTech Connect

    Ghorai, Suvankar; Chakrabarti, Mrinmay; Roy, Sobhan; Chavali, Venkata Ramana Murthy; Bagchi, Abhisek; Ghosh, Ananta Kumar

    2010-08-15

    Genome segment 2 (S2) from Antheraea mylitta cypovirus (AmCPV) was converted into cDNA, cloned and sequenced. S2 consisted of 3798 nucleotides with a long ORF encoding a 1116 amino acid long protein (123 kDa). BLAST and phylogenetic analysis showed 29% sequence identity and close relatedness of AmCPV S2 with RNA dependent RNA polymerase (RdRp) of other insect cypoviruses, suggesting a common origin of all insect cypoviruses. The ORF of S2 was expressed as 123 kDa soluble His-tagged fusion protein in insect cells via baculovirus recombinants which exhibited RdRp activity in an in vitro RNA polymerase assay without any intrinsic terminal transferase activity. Maximum activity was observed at 37 deg. C at pH 6.0 in the presence of 3 mM MgCl{sub 2.} Site directed mutagenesis confirmed the importance of the conserved GDD motif. This is the first report of functional characterization of a cypoviral RdRp which may lead to the development of anti-viral agents.

  6. microRNA dependent and independent deregulation of long non-coding RNAs by an oncogenic herpesvirus.

    PubMed

    Sethuraman, Sunantha; Gay, Lauren Appleby; Jain, Vaibhav; Haecker, Irina; Renne, Rolf

    2017-07-01

    Kaposi's sarcoma (KS) is a highly prevalent cancer in AIDS patients, especially in sub-Saharan Africa. Kaposi's sarcoma-associated herpesvirus (KSHV) is the etiological agent of KS and other cancers like Primary Effusion Lymphoma (PEL). In KS and PEL, all tumors harbor latent KSHV episomes and express latency-associated viral proteins and microRNAs (miRNAs). The exact molecular mechanisms by which latent KSHV drives tumorigenesis are not completely understood. Recent developments have highlighted the importance of aberrant long non-coding RNA (lncRNA) expression in cancer. Deregulation of lncRNAs by miRNAs is a newly described phenomenon. We hypothesized that KSHV-encoded miRNAs deregulate human lncRNAs to drive tumorigenesis. We performed lncRNA expression profiling of endothelial cells infected with wt and miRNA-deleted KSHV and identified 126 lncRNAs as putative viral miRNA targets. Here we show that KSHV deregulates host lncRNAs in both a miRNA-dependent fashion by direct interaction and in a miRNA-independent fashion through latency-associated proteins. Several lncRNAs that were previously implicated in cancer, including MEG3, ANRIL and UCA1, are deregulated by KSHV. Our results also demonstrate that KSHV-mediated UCA1 deregulation contributes to increased proliferation and migration of endothelial cells.

  7. The Midblastula Transition Defines the Onset of Y RNA-Dependent DNA Replication in Xenopus laevis ▿

    PubMed Central

    Collart, Clara; Christov, Christo P.; Smith, James C.; Krude, Torsten

    2011-01-01

    Noncoding Y RNAs are essential for the initiation of chromosomal DNA replication in mammalian cell extracts, but their role in this process during early vertebrate development is unknown. Here, we use antisense morpholino nucleotides (MOs) to investigate Y RNA function in Xenopus laevis and zebrafish embryos. We show that embryos in which Y RNA function is inhibited by MOs develop normally until the midblastula transition (MBT) but then fail to replicate their DNA and die before gastrulation. Consistent with this observation, Y RNA function is not required for DNA replication in Xenopus egg extracts but is required for replication in a post-MBT cell line. Y RNAs do not bind chromatin in karyomeres before MBT, but they associate with interphase nuclei after MBT in an origin recognition complex (ORC)-dependent manner. Y RNA-specific MOs inhibit the association of Y RNAs with ORC, Cdt1, and HMGA1a proteins, suggesting that these molecular associations are essential for Y RNA function in DNA replication. The MBT is thus a transition point between Y RNA-independent and Y RNA-dependent control of vertebrate DNA replication. Our data suggest that in vertebrates Y RNAs function as a developmentally regulated layer of control over the evolutionarily conserved eukaryotic DNA replication machinery. PMID:21791613

  8. Evidence for a Non-Catalytic Ion-Binding Site in Multiple RNA-Dependent RNA Polymerases

    PubMed Central

    Mönttinen, Heli A. M.; Ravantti, Janne J.; Poranen, Minna M.

    2012-01-01

    A high-affinity divalent cation-binding site located proximal to the catalytic center has been identified in several RNA-dependent RNA polymerases (RdRps), but the characteristics of such a site have not been systematically studied. Here, all available polymerase structures that follow the hand-like structural motif were screened for the presence of a divalent cation close to the catalytic site but distinct from catalytic metal ions. Such non-catalytic ions were found in all RNA virus families for which there were high-resolution RdRp structures available. Bound ions were always located in structurally similar locations at an approximate 6-Å distance from the catalytic site. Furthermore, the second aspartate residue in the highly conserved GDD sequence was found to be involved in the coordination of the bound ion in all viral RdRps studied. These results suggest that a non-catalytic ion-binding site is conserved across positive-sense, single-stranded, and double-stranded RNA viruses. Interestingly, a non-catalytic ion was also observed in a similar position in the reverse transcriptase of the human immunodeficiency virus. Moreover, two members of the DNA-dependent DNA polymerase B family displayed an ion at a comparable distance from the catalytic site, but the position was clearly distinct from the non-catalytic ion-binding sites of RdRps. PMID:22792374

  9. Inhibition of dengue virus replication by novel inhibitors of RNA-dependent RNA polymerase and protease activities.

    PubMed

    Pelliccia, Sveva; Wu, Yu-Hsuan; Coluccia, Antonio; La Regina, Giuseppe; Tseng, Chin-Kai; Famiglini, Valeria; Masci, Domiziana; Hiscott, John; Lee, Jin-Ching; Silvestri, Romano

    2017-12-01

    Dengue virus (DENV) is the leading mosquito-transmitted viral infection in the world. With more than 390 million new infections annually, and up to 1 million clinical cases with severe disease manifestations, there continues to be a need to develop new antiviral agents against dengue infection. In addition, there is no approved anti-DENV agents for treating DENV-infected patients. In the present study, we identified new compounds with anti-DENV replication activity by targeting viral replication enzymes - NS5, RNA-dependent RNA polymerase (RdRp) and NS3 protease, using cell-based reporter assay. Subsequently, we performed an enzyme-based assay to clarify the action of these compounds against DENV RdRp or NS3 protease activity. Moreover, these compounds exhibited anti-DENV activity in vivo in the ICR-suckling DENV-infected mouse model. Combination drug treatment exhibited a synergistic inhibition of DENV replication. These results describe novel prototypical small anti-DENV molecules for further development through compound modification and provide potential antivirals for treating DENV infection and DENV-related diseases.

  10. The influence of RNA-dependent RNA polymerase 1 on potato virus Y infection and on other antiviral response genes.

    PubMed

    Rakhshandehroo, Farshad; Takeshita, Minoru; Squires, Julie; Palukaitis, Peter

    2009-10-01

    The gene encoding RNA-dependent RNA polymerase 1 (RDR1) is involved in basal resistance to several viruses. Expression of the RDR1 gene also is induced in resistance to Tobacco mosaic virus (TMV) mediated by the N gene in tobacco (Nicotiana tabacum cv. Samsun NN) in an incompatible hypersensitive response, as well as in a compatible response against Potato virus Y (PVY). Reducing the accumulation of NtRDR1 transcripts by RNA inhibition mediated by transgenic expression of a double-stranded RNA hairpin corresponding to part of the RDR1 gene resulted in little or no induction of accumulation of RDR1 transcripts after infection by PVY. Plants with lower accumulation of RDR1 transcripts showed much higher accumulation levels of PVY. Reduced accumulation of NtRDR1 transcripts also resulted in lower or no induced expression of three other antiviral, defense-related genes after infection by PVY. These genes encoded a mitochondrial alternative oxidase, an inhibitor of virus replication (IVR), and a transcription factor, ERF5, all involved in resistance to infection by TMV, as well as RDR6, involved in RNA silencing. The extent of the effect on the induced NtIVR and NtERF5 genes correlated with the extent of suppression of the NtRDR1 gene.

  11. Purification and Biochemical Characterisation of Rabbit Calicivirus RNA-Dependent RNA Polymerases and Identification of Non-Nucleoside Inhibitors

    PubMed Central

    Urakova, Nadya; Netzler, Natalie; Kelly, Andrew G.; Frese, Michael; White, Peter A.; Strive, Tanja

    2016-01-01

    Rabbit haemorrhagic disease virus (RHDV) is a calicivirus that causes acute infections in both domestic and wild European rabbits (Oryctolagus cuniculus). The virus causes significant economic losses in rabbit farming and reduces wild rabbit populations. The recent emergence of RHDV variants capable of overcoming immunity to other strains emphasises the need to develop universally effective antivirals to enable quick responses during outbreaks until new vaccines become available. The RNA-dependent RNA polymerase (RdRp) is a primary target for the development of such antiviral drugs. In this study, we used cell-free in vitro assays to examine the biochemical characteristics of two rabbit calicivirus RdRps and the effects of several antivirals that were previously identified as human norovirus RdRp inhibitors. The non-nucleoside inhibitor NIC02 was identified as a potential scaffold for further drug development against rabbit caliciviruses. Our experiments revealed an unusually high temperature optimum (between 40 and 45 °C) for RdRps derived from both a pathogenic and a non-pathogenic rabbit calicivirus, possibly demonstrating an adaptation to a host with a physiological body temperature of more than 38 °C. Interestingly, the in vitro polymerase activity of the non-pathogenic calicivirus RdRp was at least two times higher than that of the RdRp of the highly virulent RHDV. PMID:27089358

  12. Multistep process of FUS aggregation in the cell cytoplasm involves RNA-dependent and RNA-independent mechanisms

    PubMed Central

    Shelkovnikova, Tatyana A.; Robinson, Hannah K.; Southcombe, Joshua A.; Ninkina, Natalia; Buchman, Vladimir L.

    2014-01-01

    Fused in sarcoma (FUS) is an RNA-binding protein involved in pathogenesis of several neurodegenerative diseases. Aggregation of mislocalized FUS into non-amyloid inclusions is believed to be pivotal in the development of cell dysfunction, but the mechanism of their formation is unclear. Using transient expression of a panel of deletion and chimeric FUS variants in various cultured cells, we demonstrated that FUS accumulating in the cytoplasm nucleates a novel type of RNA granules, FUS granules (FGs), that are structurally similar but not identical to physiological RNA transport granules. Formation of FGs requires FUS N-terminal prion-like domain and the ability to bind specific RNAs. Clustering of FGs coupled with further recruitment of RNA and proteins produce larger structures, FUS aggregates (FAs), that resemble but are clearly distinct from stress granules. In conditions of attenuated transcription, FAs lose RNA and dissociate into RNA-free FUS complexes that become precursors of large aggresome-like structures. We propose a model of multistep FUS aggregation involving RNA-dependent and RNA-independent stages. This model can be extrapolated to formation of pathological inclusions in human FUSopathies. PMID:24842888

  13. Isolation, expression and functional analysis of a putative RNA-dependent RNA polymerase gene from maize (Zea mays L.).

    PubMed

    He, Junguang; Dong, Zhigang; Jia, Zhiwei; Wang, Jianhua; Wang, Guoying

    2010-02-01

    RNA-dependent RNA polymerases (RdRPs) in plants have been reported to be involved in post-transcriptional gene silencing (PTGS) and antiviral defense. In this report, an RdRP gene from maize (ZmRdRP1) was obtained by rapid amplification of cDNA ends (RACE) and RT-PCR. The mRNA of ZmRdRP1 was composed of 3785 nucleotides, including a 167 nt 5' untranslated region (UTR), a 291 nt 3'UTR and a 3327 nt open reading frame (ORF), which encodes a putative protein of 1108 amino acids with an estimated molecular mass of 126.9 kDa and a predicated isoelectric point (pI) of 8.37. Real-time quantitative RT-PCR analysis showed that ZmRdRP1 was elicited by salicylic acid (SA) treatment, methyl jasmonate (MeJA) treatment and sugarcane mosaic virus (SCMV) infection. We silenced ZmRdRP1 by constitutively expressing an inverted-repeat fragment of ZmRdRP1 (ir-RdRP1) in transgenic maize plants. Further studies revealed that the ir-RdRP1 transgenic plants were more susceptible to SCMV infection than wild type plants. Virus-infected transgenic maize plants developed more serious disease symptoms and accumulated more virus than wild type plants. These findings suggested that ZmRdRP1 was involved in antiviral defense in maize.

  14. Inhibition of RNA binding to hepatitis C virus RNA-dependent RNA polymerase: a new mechanism for antiviral intervention

    PubMed Central

    Ahmed-Belkacem, Abdelhakim; Guichou, Jean-François; Brillet, Rozenn; Ahnou, Nazim; Hernandez, Eva; Pallier, Coralie; Pawlotsky, Jean-Michel

    2014-01-01

    The hepatitis C virus (HCV) RNA-dependent RNA polymerase (RdRp) is a key target for antiviral intervention. The goal of this study was to identify the binding site and unravel the molecular mechanism by which natural flavonoids efficiently inhibit HCV RdRp. Screening identified the flavonol quercetagetin as the most potent inhibitor of HCV RdRp activity. Quercetagetin was found to inhibit RdRp through inhibition of RNA binding to the viral polymerase, a yet unknown antiviral mechanism. X-ray crystallographic structure analysis of the RdRp-quercetagetin complex identified quercetagetin's binding site at the entrance of the RNA template tunnel, confirming its original mode of action. This antiviral mechanism was associated with a high barrier to resistance in both site-directed mutagenesis and long-term selection experiments. In conclusion, we identified a new mechanism for non-nucleoside inhibition of HCV RdRp through inhibition of RNA binding to the enzyme, a mechanism associated with broad genotypic activity and a high barrier to resistance. Our results open the way to new antiviral approaches for HCV and other viruses that use an RdRp based on RNA binding inhibition, that could prove to be useful in human, animal or plant viral infections. PMID:25053847

  15. dsRNA interference on expression of a RNA-dependent RNA polymerase gene of Bombyx mori cytoplasmic polyhedrosis virus.

    PubMed

    Pan, Zhong-Hua; Gao, Kun; Hou, Cheng-Xiang; Wu, Ping; Qin, Guang-Xing; Geng, Tao; Guo, Xi-Jie

    2015-07-01

    Bombyx mori cytoplasmic polyhedrosis virus (BmCPV) is one of the major viral pathogens in silkworm. Its infection often results in significant losses to sericulture. Studies have demonstrated that RNAi is one of the important anti-viral mechanisms in organisms. In this study, three dsRNAs targeting the RNA-dependent RNA polymerase (RDRP) gene of BmCPV were designed and synthesized with 2'-F modification to explore their interference effects on BmCPV replication in silkworm larvae. The results showed that injecting dsRNA in the dosage of 4-6 ng per mg body weight into the 5th instar larvae can interfere with the BmCPV-RDRP expression by 93% after virus infection and by 99.9% before virus infection. In addition, the expression of two viral structural protein genes (genome RNA segments 1 and 5) was also decreased with the decrease of RDRP expression, suggesting that RNAi interference of BmCPV-RDRP expression could affect viral replication. The study provides an effective method for investigating virus replication as well as the virus-host interactions in the silkworm larvae using dsRNA. Copyright © 2015 Elsevier B.V. All rights reserved.

  16. Purification and Biochemical Characterisation of Rabbit Calicivirus RNA-Dependent RNA Polymerases and Identification of Non-Nucleoside Inhibitors.

    PubMed

    Urakova, Nadya; Netzler, Natalie; Kelly, Andrew G; Frese, Michael; White, Peter A; Strive, Tanja

    2016-04-14

    Rabbit haemorrhagic disease virus (RHDV) is a calicivirus that causes acute infections in both domestic and wild European rabbits (Oryctolagus cuniculus). The virus causes significant economic losses in rabbit farming and reduces wild rabbit populations. The recent emergence of RHDV variants capable of overcoming immunity to other strains emphasises the need to develop universally effective antivirals to enable quick responses during outbreaks until new vaccines become available. The RNA-dependent RNA polymerase (RdRp) is a primary target for the development of such antiviral drugs. In this study, we used cell-free in vitro assays to examine the biochemical characteristics of two rabbit calicivirus RdRps and the effects of several antivirals that were previously identified as human norovirus RdRp inhibitors. The non-nucleoside inhibitor NIC02 was identified as a potential scaffold for further drug development against rabbit caliciviruses. Our experiments revealed an unusually high temperature optimum (between 40 and 45 °C) for RdRps derived from both a pathogenic and a non-pathogenic rabbit calicivirus, possibly demonstrating an adaptation to a host with a physiological body temperature of more than 38 °C. Interestingly, the in vitro polymerase activity of the non-pathogenic calicivirus RdRp was at least two times higher than that of the RdRp of the highly virulent RHDV.

  17. REMOTE-SITE CONTROL OF AN ACTIVE-SITE FIDELITY CHECKPOINT IN A VIRAL RNA-DEPENDENT RNA POLYMERASE

    PubMed Central

    Arnold, Jamie J.; Vignuzzi, Marco; Stone, Jeffrey K.; Andino, Raul; Cameron, Craig E.

    2005-01-01

    The kinetic, thermodynamic and structural basis for fidelity of nucleic acid polymerases remains controversial. An understanding of viral RNA-dependent RNA polymerase (RdRp) fidelity has become a topic of considerable interest as a result of recent experiments that show that a two-fold increase in fidelity attenuates viral pathogenesis and a two-fold decrease in fidelity reduces viral fitness. Here we show that a conformational-change step preceding phosphoryl transfer is a key fidelity checkpoint for the poliovirus RdRp (3Dpol). We provide evidence that this conformational-change step is orientation of the triphosphate into a conformation suitable for catalysis, suggesting a kinetic and structural model for RdRp fidelity that can be extrapolated to other classes of nucleic acid polymerases. Finally, we show that a site remote from the catalytic center can control this checkpoint, which occurs at the active site. Importantly, similar connections between a remote site and the active site exist in a wide variety of viral RdRps. The capacity for sites remote from the catalytic center to alter fidelity suggests new possibilities for targeting the viral RdRp for antiviral drug development. PMID:15878882

  18. The active form of the norovirus RNA-dependent RNA polymerase is a homodimer with cooperative activity.

    PubMed

    Högbom, Martin; Jäger, Katrin; Robel, Ivonne; Unge, Torsten; Rohayem, Jacques

    2009-02-01

    Norovirus (NV) is a leading cause of gastroenteritis worldwide and a major public health concern. So far, the replication strategy of NV remains poorly understood, mainly because of the lack of a cell system to cultivate the virus. In this study, the function and the structure of a key viral enzyme of replication, the RNA-dependent RNA polymerase (RdRp, NS7), was examined. The overall structure of the NV NS7 RdRp was determined by X-ray crystallography to a 2.3 A (0.23 nm) resolution (PDB ID 2B43), displaying a right-hand fold typical of the template-dependent polynucleotide polymerases. Biochemical analysis evidenced that NV NS7 RdRp is active as a homodimer, with an apparent K(d) of 0.649 microM and a positive cooperativity (Hill coefficient n(H)=1.86). Crystals of the NV NS7 homodimer displayed lattices containing dimeric arrangements with high shape complementarity statistics. This experimental data on the structure and function of the NV RdRp may set the cornerstone for the development of polymerase inhibitors to control the infection with NV, a medically relevant pathogen.

  19. Dual-targeted tRNA-dependent amidotransferase ensures both mitochondrial and chloroplastic Gln-tRNAGln synthesis in plants

    PubMed Central

    Pujol, Claire; Bailly, Marc; Kern, Daniel; Maréchal-Drouard, Laurence; Becker, Hubert; Duchêne, Anne-Marie

    2008-01-01

    Aminoacyl-tRNAs are generally formed by direct attachment of an amino acid to tRNAs by aminoacyl-tRNA synthetases, but Gln-tRNA is an exception to this rule. Gln-tRNAGln is formed by this direct pathway in the eukaryotic cytosol and in protists or fungi mitochondria but is formed by an indirect transamidation pathway in most of bacteria, archaea, and chloroplasts. We show here that the formation of Gln-tRNAGln is also achieved by the indirect pathway in plant mitochondria. The mitochondrial-encoded tRNAGln, which is the only tRNAGln present in mitochondria, is first charged with glutamate by a nondiscriminating GluRS, then is converted into Gln-tRNAGln by a tRNA-dependent amidotransferase (AdT). The three subunits GatA, GatB, and GatC are imported into mitochondria and assemble into a functional GatCAB AdT. Moreover, the mitochondrial pathway of Gln-tRNAGln formation is shared with chloroplasts as both the GluRS, and the three AdT subunits are dual-imported into mitochondria and chloroplasts. PMID:18441100

  20. RNA-Dependent RNA Polymerases of Both Virulent and Benign Rabbit Caliciviruses Induce Striking Rearrangement of Golgi Membranes

    PubMed Central

    Urakova, Nadya; Strive, Tanja

    2017-01-01

    The extremely pathogenic Rabbit haemorrhagic disease virus (RHDV) and the completely benign Rabbit calicivirus (RCV) are closely related members of the genus Lagovirus (family Caliciviridae). The molecular mechanisms that determine the dramatic difference in virulence are unknown, but indirect evidence suggests that different properties of their RNA-dependent RNA polymerases (RdRps) may at least partially be responsible for the contrasting phenotypes. Here we report that the unusual ability of the RHDV RdRp to induce a striking rearrangement of the Golgi network is not specific to RHDV, but a common feature of virulent and benign rabbit caliciviruses alike. Expression of rabbit calicivirus RdRps induced a redistribution of both cis/medial and medial/trans Golgi membrane markers, but not that of an endoplasmic reticulum membrane marker. Inactivating mutations in the conserved GDD motif did not abolish the ability of RHDV RdRp to rearrange the Golgi network, suggesting that polymerase activity and metal co-factors are not required for this function. Finally, we discuss possible implications of RdRp-induced membrane rearrangements on virus replication and host immune responses. PMID:28072826

  1. Heat shock 70 protein interaction with Turnip mosaic virus RNA-dependent RNA polymerase within virus-induced membrane vesicles

    SciTech Connect

    Dufresne, Philippe J.; Thivierge, Karine; Cotton, Sophie; Beauchemin, Chantal; Ide, Christine; Ubalijoro, Eliane; Laliberte, Jean-Francois Fortin, Marc G.

    2008-04-25

    Tandem affinity purification was used in Arabidopsis thaliana to identify cellular interactors of Turnip mosaic virus (TuMV) RNA-dependent RNA polymerase (RdRp). The heat shock cognate 70-3 (Hsc70-3) and poly(A)-binding (PABP) host proteins were recovered and shown to interact with the RdRp in vitro. As previously shown for PABP, Hsc70-3 was redistributed to nuclear and membranous fractions in infected plants and both RdRp interactors were co-immunoprecipitated from a membrane-enriched extract using RdRp-specific antibodies. Fluorescently tagged RdRp and Hsc70-3 localized to the cytoplasm and the nucleus when expressed alone or in combination in Nicotiana benthamiana. However, they were redistributed to large perinuclear ER-derived vesicles when co-expressed with the membrane binding 6K-VPg-Pro protein of TuMV. The association of Hsc70-3 with the RdRp could possibly take place in membrane-derived replication complexes. Thus, Hsc70-3 and PABP2 are potentially integral components of the replicase complex and could have important roles to play in the regulation of potyviral RdRp functions.

  2. Symmetry Breaking and the B3LYP Functional

    NASA Technical Reports Server (NTRS)

    Bauschlicher, Charles W., Jr.; Hudgins, Douglas M.; Allamandola, Louis J.; Arnold, James O. (Technical Monitor)

    1999-01-01

    The infrared spectra of six molecules, each of which contains a five-membered ring, and their cations are determined using density functional theory (DFT); both the B3LYP and BP86 functionals are used. The computed results are compared with the experimental spectra. For the neutral molecules, both methods are in good agreement with experiment. Even the Hartree-Fock (HF) approach is qualitatively correct for the neutrals. For the cations, the HF approach fails, as found for other organic ring systems. The B3LYP and BP86 approaches are in good mutual agreement for five of the six cation spectra, and in good agreement with experiment for four of the five cations where the experimental spectra are available. It is only for the fluoranthene cation, where the BP86 and B3LYP functionals yield different results; the BP86 yields the expected C2v symmetry, while the B3LYP approach breaks symmetry. The experimental spectra supports the BP86 spectra over the B3LYP, but the quality of the experimental spectra does not allow a critical evaluation of the accuracy of the BP86 approach for this difficult system.

  3. Symmetry Breaking and the B3LYP Functional

    NASA Technical Reports Server (NTRS)

    Bauschlicher, Charles W., Jr.; Hudgins, Douglas M.; Allamandola, Louis J.; Arnold, James O. (Technical Monitor)

    1999-01-01

    The infrared spectra of six molecules, each of which contains a five-membered ring, and their cations are determined using density functional theory (DFT); both the B3LYP and BP86 functionals are used. The computed results are compared with the experimental spectra. For the neutral molecules, both methods are in good agreement with experiment. Even the Hartree-Fock (HF) approach is qualitatively correct for the neutrals. For the cations, the HF approach fails, as found for other organic ring systems. The B3LYP and BP86 approaches are in good mutual agreement for five of the six cation spectra, and in good agreement with experiment for four of the five cations where the experimental spectra are available. It is only for the fluoranthene cation, where the BP86 and B3LYP functionals yield different results; the BP86 yields the expected C2v symmetry, while the B3LYP approach breaks symmetry. The experimental spectra supports the BP86 spectra over the B3LYP, but the quality of the experimental spectra does not allow a critical evaluation of the accuracy of the BP86 approach for this difficult system.

  4. Induction of Eph B3 after spinal cord injury.

    PubMed

    Miranda, J D; White, L A; Marcillo, A E; Willson, C A; Jagid, J; Whittemore, S R

    1999-03-01

    Spinal cord injury (SCI) in adult rats initiates a cascade of events producing a nonpermissive environment for axonal regeneration. This nonfavorable environment could be due to the expression of repulsive factors. The Eph receptor protein tyrosine kinases and their respective ligands (ephrins) are families of molecules that play a major role in axonal pathfinding and target recognition during central nervous system (CNS) development. Their mechanism of action is mediated by repellent forces between receptor and ligand. The possible role that these molecules play after CNS trauma is unknown. We hypothesized that an increase in the expression of Eph proteins and/or ephrins may be one of the molecular cues that restrict axonal regeneration after SCI. Rats received a contusive SCI at T10 and in situ hybridization studies 7 days posttrauma demonstrated: (i) a marked up-regulation of Eph B3 mRNA in cells located in the white matter at the lesion epicenter, but not rostral or caudal to the injury site, and (ii) an increase in Eph B3 mRNA in neurons in the ventral horn and intermediate zone of the gray matter, rostral and caudal to the lesion. Immunohistochemical analyses localizing Eph B3 protein were consistent with the mRNA results. Colocalization studies performed in injured animals demonstrated increased Eph B3 expression in white matter astrocytes and motor neurons of the gray matter. These results suggest that Eph B3 may contribute to the unfavorable environment for axonal regeneration after SCI. Copyright 1999 Academic Press.

  5. First report of a Chinese strain of coxsackie B3 virus infection in a newborn in Germany in 2011: a case report

    PubMed Central

    2014-01-01

    Introduction Enteroviruses commonly encounter babies and children and infections present in a wide variety of symptoms ranging from asymptomatic infection, benign illness, and aseptic meningitis, hand-foot-and-mouth disease to severe life-threatening disease. Some newborns develop severe disease in the first 2 weeks of life and long-term sequelae may occur among survivors. Case presentation We present a case report of a Caucasian newborn baby boy with severe encephalitis and systemic coxsackievirus B3 infection. The coincidence of maternal infection as well as previous mild respiratory illness in his sister suggests either prenatal or horizontal postnatal transmission. An electroencephalogram showed a severe pathologic pattern with theta-delta-rhythm and spike-wave complexes on both hemispheres. We also observed an unusual prolonged viremia for a period of 6 weeks. Due to the lack of specific antiviral treatment options, the supportive management included ventilation and medical treatment of seizures. Phylogenetic analysis revealed a genogroup D2 virus previously exclusively detected in China and now described in Europe for the first time. Conclusions Enteroviral infection is an important differential diagnosis in neonatal encephalitis. Prolonged viremia must be taken into account and might correlate with disease severity. The newly observed enterovirus genotype D2 is spreading from Asia to other continents. PMID:24885145

  6. Agrobacterium-mediated transformation of grapefruit with the wild-type and mutant RNA-dependent RNA polymerase genes of Citrus tristeza virus

    USDA-ARS?s Scientific Manuscript database

    Citrus paradisi Macf. cv. Duncan was transformed with constructs coding for the wild-type and mutant RNA-dependent RNA polymerase (RdRp) of Citrus tristeza virus (CTV) for exploring replicase-mediated pathogen-derived resistance (RM-PDR). The RdRp gene was amplified from CTV genome and used to gener...

  7. Efficient Interaction between Arenavirus Nucleoprotein (NP) and RNA-Dependent RNA Polymerase (L) Is Mediated by the Virus Nucleocapsid (NP-RNA) Template.

    PubMed

    Iwasaki, Masaharu; Ngo, Nhi; Cubitt, Beatrice; de la Torre, Juan C

    2015-05-01

    In this study, we document that efficient interaction between arenavirus nucleoprotein (NP) and RNA-dependent RNA polymerase (L protein), the two trans-acting viral factors required for both virus RNA replication and gene transcription, requires the presence of virus-specific RNA sequences located within the untranslated 5' and 3' termini of the viral genome.

  8. Buck-Buck- Boost Regulatr (B3R)

    NASA Astrophysics Data System (ADS)

    Mourra, Olivier; Fernandez, Arturo; Landstroem, Sven; Tonicello, Ferdinando

    2011-10-01

    In a satellite, the main function of a Power Conditioning Unit (PCU) is to manage the energy coming from several power sources (usually solar arrays and battery) and to deliver it continuously to the users in an appropriate form during the overall mission. The objective of this paper is to present an electronic switching DC-DC converter called Buck-Buck-Boost Regulator (B3R) that could be used as a modular and recurrent solution in a PCU for regulated or un- regulated 28Vsatellite power bus classes. The power conversion stages of the B3R topology are first described. Then theoretical equations and practical tests illustrate how the converter operates in term of power conversion, control loops performances and efficiency. The paper finally provides some examples of single point failure tolerant implementation using the B3R.

  9. Atypical hand, foot, and mouth disease associated with coxsackievirus A6 infection, Edinburgh, United Kingdom, January to February 2014.

    PubMed

    Sinclair, C; Gaunt, E; Simmonds, P; Broomfield, D; Nwafor, N; Wellington, L; Templeton, K; Willocks, L; Schofield, O; Harvala, H

    2014-03-27

    In January to February 2014, 16 hand, foot and mouth disease (HFMD) cases were identified in Edinburgh, United Kingdom. All presented with atypical features, with most (n=13) resembling eczema herpeticum or chickenpox. Coxsackievirus A6 (CV-A6) was identified in all the typed cases (n=11). As atypical forms of HFMD associated with CV-A6 are likely to emerge throughout Europe, clinicians should be alert to unusual clinical presentations of HFMD and virologists aware of effective diagnostic testing and enterovirus typing methods.

  10. The Crystal Structure of a Cardiovirus RNA-Dependent RNA Polymerase Reveals an Unusual Conformation of the Polymerase Active Site

    PubMed Central

    Vives-Adrian, Laia; Lujan, Celia; Oliva, Baldo; van der Linden, Lonneke; Selisko, Barbara; Coutard, Bruno; Canard, Bruno; van Kuppeveld, Frank J. M.

    2014-01-01

    ABSTRACT Encephalomyocarditis virus (EMCV) is a member of the Cardiovirus genus within the large Picornaviridae family, which includes a number of important human and animal pathogens. The RNA-dependent RNA polymerase (RdRp) 3Dpol is a key enzyme for viral genome replication. In this study, we report the X-ray structures of two different crystal forms of the EMCV RdRp determined at 2.8- and 2.15-Å resolution. The in vitro elongation and VPg uridylylation activities of the purified enzyme have also been demonstrated. Although the overall structure of EMCV 3Dpol is shown to be similar to that of the known RdRps of other members of the Picornaviridae family, structural comparisons show a large reorganization of the active-site cavity in one of the crystal forms. The rearrangement affects mainly motif A, where the conserved residue Asp240, involved in ribonucleoside triphosphate (rNTP) selection, and its neighbor residue, Phe239, move about 10 Å from their expected positions within the ribose binding pocket toward the entrance of the rNTP tunnel. This altered conformation of motif A is stabilized by a cation-π interaction established between the aromatic ring of Phe239 and the side chain of Lys56 within the finger domain. Other contacts, involving Phe239 and different residues of motif F, are also observed. The movement of motif A is connected with important conformational changes in the finger region flanked by residues 54 to 63, harboring Lys56, and in the polymerase N terminus. The structures determined in this work provide essential information for studies on the cardiovirus RNA replication process and may have important implications for the development of new antivirals targeting the altered conformation of motif A. IMPORTANCE The Picornaviridae family is one of the largest virus families known, including many important human and animal pathogens. The RNA-dependent RNA polymerase (RdRp) 3Dpol is a key enzyme for picornavirus genome replication and a validated

  11. In vivo and in vitro expression analysis of the RNA-dependent RNA polymerase of Citrus tristeza virus.

    PubMed

    Cevik, B; Lee, R F; Niblett, C L

    2008-01-01

    Expression of the RNA-dependent RNA polymerase (RdRp) of Citrus tristeza virus (CTV) was studied in vivo and in vitro using a polyclonal antiserum raised against the recombinant CTV-RdRp protein. Although a 57-kDa CTV-RdRp was expected to be expressed by a +1 translational frameshift at the carboxyl terminus of a 400-kDa polyprotein, a 50-kDa protein was detected in CTV-infected but not in healthy citrus tissue by Western blot. This suggests that the RdRp was cleaved from the CTV polyprotein. The 50-kDa protein was present in both the cytoplasmic and membrane fractions, but it accumulated mainly in the membrane fraction, where most of the replication-associated proteins of RNA viruses are found. When the expression of a cloned CTV-RdRp gene encoding a 60-kDa fusion protein was studied in vitro in a rabbit reticulocyte lysate system, two smaller proteins of about 50 kDa and 10 kDa were detected in addition to the expected 60-kDa protein. All three proteins were immunoprecipitated with the anti-CTV-RdRp serum, suggesting that the 50-kDa and 10-kDa proteins were fragments of the 60-kDa CTV-RdRp fusion protein. When the expression of the RdRp was analyzed at different times during in vitro translation, the 60-kDa and 50-kDa proteins were detected at all time points, and a small amount of the 10-kDa protein was detected after 30 min of translation. These results suggest that the CTV-RdRp may also be cleaved in vitro in the rabbit reticulocyte lysate.

  12. Identification, molecular cloning and expression analysis of five RNA-dependent RNA polymerase genes in Salvia miltiorrhiza.

    PubMed

    Shao, Fenjuan; Lu, Shanfa

    2014-01-01

    RNA-dependent RNA polymerases (RDRs) act as key components of the small RNA biogenesis pathways and play significant roles in post-transcriptional gene silencing (PTGS) and antiviral defense. However, there is no information about the RDR gene family in Salvia miltiorrhiza, an emerging model medicinal plant with great economic value. Through genome-wide predication and subsequent molecular cloning, five full-length S. miltiorrhiza RDR genes, termed SmRDR1-SmRDR5, were identified. The length of SmRDR cDNAs varies between 3,262 (SmRDR5) and 4,130 bp (SmRDR3). The intron number of SmRDR genes varies from 3 (SmRDR1, SmRDR3 and SmRDR4) to 17 (SmRDR5). All of the deduced SmRDR protein sequences contain the conserved RdRp domain. Moreover, SmRDR2 and SmRDR4 have an additional RRM domain. Based on the phylogenetic tree constructed with sixteen RDRs from Arabidopsis, rice and S. miltiorrhiza, plant RDRs may be divided into four groups (RDR1-RDR4). The RDR1 group contains an AtRDR and an OsRDR, while includes two SmRDRs. On the contrary, the RDR3 group contains three AtRDRs and two OsRDRs, but has only one SmRDR. SmRDRs were differentially expressed in flowers, leaves, stems and roots of S. miltiorrhiza and responsive to methyl jasmonate treatment and cucumber mosaic virus infection. The results suggest the involvement of RDRs in S. miltiorrhiza development and response to abiotic and biotic stresses. It provides a foundation for further studying the regulation and biological functions of SmRDRs and the biogenesis pathways of small RNAs in S. miltiorrhiza.

  13. RNA-dependent RNA polymerase 1 from Nicotiana tabacum suppresses RNA silencing and enhances viral infection in Nicotiana benthamiana.

    PubMed

    Ying, Xiao-Bao; Dong, Li; Zhu, Hui; Duan, Cheng-Guo; Du, Quan-Sheng; Lv, Dian-Qiu; Fang, Yuan-Yuan; Garcia, Juan Antonio; Fang, Rong-Xiang; Guo, Hui-Shan

    2010-04-01

    Endogenous eukaryotic RNA-dependent RNA polymerases (RDRs) produce double-stranded RNA intermediates in diverse processes of small RNA synthesis in RNA silencing pathways. RDR6 is required in plants for posttranscriptional gene silencing induced by sense transgenes (S-PTGS) and has an important role in amplification of antiviral silencing. Whereas RDR1 is also involved in antiviral defense in plants, this does not necessarily proceed through triggering silencing. In this study, we show that Nicotiana benthamiana transformed with RDR1 from Nicotiana tabacum (Nt-RDR1 plants) exhibits hypersusceptibility to Plum pox potyvirus and other viruses, resembling RDR6-silenced (RDR6i) N. benthamiana. Analysis of transient induction of RNA silencing in N. benthamiana Nt-RDR1 and RDR6i plants revealed that Nt-RDR1 possesses silencing suppression activity. We found that Nt-RDR1 does not interfere with RDR6-dependent siRNA accumulation but turns out to suppress RDR6-dependent S-PTGS. Our results, together with previously published data, suggest that RDR1 might have a dual role, contributing, on one hand, to salicylic acid-mediated antiviral defense, and suppressing, on the other hand, the RDR6-mediated antiviral RNA silencing. We propose a scenario in which the natural loss-of-function variant of RDR1 in N. benthamiana may be the outcome of selective pressure to maintain a high RDR6-dependent antiviral defense, which would be required to face the hypersensitivity of this plant to a large number of viruses.

  14. Activation of double-stranded RNA-dependent protein kinase inhibits proliferation of pancreatic β-cells

    SciTech Connect

    Chen, Shan-Shan; Jiang, Teng; Wang, Yi; Gu, Li-Ze; Wu, Hui-Wen; Tan, Lan; Guo, Jun

    2014-01-17

    Highlights: •PKR can be activated by glucolipitoxicity and pro-inflammatory cytokines in β-cells. •Activated PKR inhibited β-cell proliferation by arresting cell cycle at G1 phase. •Activated PKR fully abrogated the pro-proliferative effects of IGF-I on β-cells. -- Abstract: Double-stranded RNA-dependent protein kinase (PKR) is revealed to participate in the development of insulin resistance in peripheral tissues in type 2 diabetes (T2DM). Meanwhile, PKR is also characterized as a critical regulator of cell proliferation. To date, no study has focused on the impact of PKR on the proliferation of pancreatic β-cells. Here, we adopted insulinoma cell lines and mice islet β-cells to investigate: (1) the effects of glucolipotoxicity and pro-inflammatory cytokines on PKR activation; (2) the effects of PKR on proliferation of pancreatic β-cells and its underlying mechanisms; (3) the actions of PKR on pro-proliferative effects of IGF-I and its underlying pathway. Our results provided the first evidence that PKR can be activated by glucolipitoxicity and pro-inflammatory cytokines in pancreatic β-cells, and activated PKR significantly inhibited cell proliferation by arresting cell cycle at G1 phase. Reductions in cyclin D1 and D2 as well as increases in p27 and p53 were associated with the anti-proliferative effects of PKR, and proteasome-dependent degradation took part in the reduction of cyclin D1 and D2. Besides, PKR activation abrogated the pro-proliferative effects of IGF-I by activating JNK and disrupting IRS1/PI3K/Akt signaling pathway. These findings indicate that the anti-proliferative actions of PKR on pancreatic β-cells may contribute to the pathogenesis of T2DM.

  15. RNA dependent DNA replication fidelity of HIV-1 reverse transcriptase: evidence of discrimination between DNA and RNA substrates.

    PubMed

    Kerr, S G; Anderson, K S

    1997-11-18

    The RNA dependent DNA replication fidelity of HIV-1 reverse transcriptase has been investigated using pre-steady-state kinetics under single turnover conditions. In contrast to previous estimates of low replication fidelity of HIV-1 reverse transcriptase, the present study finds the enzyme to be more highly discriminating when an RNA/DNA template-primer is employed as compared with the corresponding DNA/DNA template-primer. The basis of this selectivity is due to extremely slow polymerization kinetics for incorporation of an incorrect deoxynucleotide. The maximum rates for misincorporation (kpol) of dGTP, dCTP, and dTTP opposite a template uridine were 0.2, 0.03, and 0.003 s-1, respectively. The equilibrium dissociation constants (Kd) for the incorrect nucleotide opposite a template uridine were 1.0, 1.1, and 0.7 mM for dGTP, dCTP, and dTTP, respectively. These kinetic values provide fidelity estimates of 26 000 for discrimination against dGTP, 176 000 for dCTP, and 1 x 10(6) for dTTP misincorporation at this position. Similar observations were obtained when incorrect nucleotide misincorporation was examined opposite a template adenine. Thus in a direct comparison of RNA/DNA and DNA/DNA template-primer substrates, HIV-1 RT exhibits approximately a 10-60-fold increase in fidelity. This study augments our current understanding of the similarities and differences of catalytic activity of HIV-1 reverse transcriptase using RNA and DNA substrates. Moreover, these studies lend further support for a model for nucleotide incorporation by HIV-1 reverse transcriptase involving a two-step binding mechanism governed by a rate-limiting conformational change for correct incorporation.

  16. Structural Dynamics as a Contributor to Error-prone Replication by an RNA-dependent RNA Polymerase*

    PubMed Central

    Moustafa, Ibrahim M.; Korboukh, Victoria K.; Arnold, Jamie J.; Smidansky, Eric D.; Marcotte, Laura L.; Gohara, David W.; Yang, Xiaorong; Sánchez-Farrán, María Antonieta; Filman, David; Maranas, Janna K.; Boehr, David D.; Hogle, James M.; Colina, Coray M.; Cameron, Craig E.

    2014-01-01

    RNA viruses encoding high- or low-fidelity RNA-dependent RNA polymerases (RdRp) are attenuated. The ability to predict residues of the RdRp required for faithful incorporation of nucleotides represents an essential step in any pipeline intended to exploit perturbed fidelity as the basis for rational design of vaccine candidates. We used x-ray crystallography, molecular dynamics simulations, NMR spectroscopy, and pre-steady-state kinetics to compare a mutator (H273R) RdRp from poliovirus to the wild-type (WT) enzyme. We show that the nucleotide-binding site toggles between the nucleotide binding-occluded and nucleotide binding-competent states. The conformational dynamics between these states were enhanced by binding to primed template RNA. For the WT, the occluded conformation was favored; for H273R, the competent conformation was favored. The resonance for Met-187 in our NMR spectra reported on the ability of the enzyme to check the correctness of the bound nucleotide. Kinetic experiments were consistent with the conformational dynamics contributing to the established pre-incorporation conformational change and fidelity checkpoint. For H273R, residues comprising the active site spent more time in the catalytically competent conformation and were more positively correlated than the WT. We propose that by linking the equilibrium between the binding-occluded and binding-competent conformations of the nucleotide-binding pocket and other active-site dynamics to the correctness of the bound nucleotide, faithful nucleotide incorporation is achieved. These studies underscore the need to apply multiple biophysical and biochemical approaches to the elucidation of the physical basis for polymerase fidelity. PMID:25378410

  17. RNA-dependent protein kinase (PKR) depletes nutrients, inducing phosphorylation of AMP-activated kinase in lung cancer.

    PubMed

    Guo, Chengcheng; Hao, Chuncheng; Shao, RuPing; Fang, Bingliang; Correa, Arlene M; Hofstetter, Wayne L; Roth, Jack A; Behrens, Carmen; Kalhor, Neda; Wistuba, Ignacio I; Swisher, Stephen G; Pataer, Apar

    2015-05-10

    We have demonstrated that RNA-dependent protein kinase (PKR) and its downstream protein p-eIF2α are independent prognostic markers for overall survival in lung cancer. In the current study, we further investigate the interaction between PKR and AMPK in lung tumor tissue and cancer cell lines. We examined PKR protein expression in 55 frozen primary lung tumor tissues by Western blotting and analyzed the association between PKR expression and expression of 139 proteins on tissue samples examined previously by Reverse Phase Protein Array (RPPA) from the same 55 patients. We observed that biomarkers were either positively (phosphorylated AMP-activated kinase(T172) [p-AMPK]) or negatively (insulin receptor substrate 1, meiotic recombination 11, ATR interacting protein, telomerase, checkpoint kinase 1, and cyclin E1) correlated with PKR. We further confirmed that induction of PKR with expression vectors in lung cancer cells causes activation of the AMPK protein independent of the LKB1, TAK1, and CaMKKβ pathway. We found that PKR causes nutrient depletion, which increases AMP levels and decreases ATP levels, causing AMPK phosphorylation. We further demonstrated that inhibiting AMPK expression with compound C or siRNA enhanced PKR-mediated cell death. We next explored the combination of PKR and p-AMPK expression in NSCLC patients and observed that expression of p-AMPK predicted a poor outcome for adenocarcinoma patients with high PKR expression and a better prognosis for those with low PKR expression. These findings were consistent with our in vitro results. AMPK might rescue cells facing metabolic stresses, such as ATP depletion caused by PKR. Our data indicate that PKR causes nutrient depletion, which induces the phosphorylation of AMPK. AMPK might act as a protective response to metabolic stresses, such as nutrient deprivation.

  18. Vaccine-derived mutation in motif D of poliovirus RNA-dependent RNA polymerase lowers nucleotide incorporation fidelity.

    PubMed

    Liu, Xinran; Yang, Xiaorong; Lee, Cheri A; Moustafa, Ibrahim M; Smidansky, Eric D; Lum, David; Arnold, Jamie J; Cameron, Craig E; Boehr, David D

    2013-11-08

    All viral RNA-dependent RNA polymerases (RdRps) have a conserved structural element termed motif D. Studies of the RdRp from poliovirus (PV) have shown that a conformational change of motif D leads to efficient and faithful nucleotide addition by bringing Lys-359 into the active site where it serves as a general acid. The RdRp of the Sabin I vaccine strain has Thr-362 changed to Ile. Such a drastic change so close to Lys-359 might alter RdRp function and contribute in some way to the attenuated phenotype of Sabin type I. Here we present our characterization of the T362I RdRp. We find that the T362I RdRp exhibits a mutator phenotype in biochemical experiments in vitro. Using NMR, we show that this change in nucleotide incorporation fidelity correlates with a change in the structural dynamics of motif D. A recombinant PV expressing the T362I RdRp exhibits normal growth properties in cell culture but expresses a mutator phenotype in cells. For example, the T362I-containing PV is more sensitive to the mutagenic activity of ribavirin than wild-type PV. Interestingly, the T362I change was sufficient to cause a statistically significant reduction in viral virulence. Collectively, these studies suggest that residues of motif D can be targeted when changes in nucleotide incorporation fidelity are desired. Given the observation that fidelity mutants can serve as vaccine candidates, it may be possible to use engineering of motif D for this purpose.

  19. DDX1 is an RNA-dependent ATPase involved in HIV-1 Rev function and virus replication.

    PubMed

    Edgcomb, Stephen P; Carmel, Andrew B; Naji, Souad; Ambrus-Aikelin, Geza; Reyes, Jason R; Saphire, Andrew C S; Gerace, Larry; Williamson, James R

    2012-01-06

    The human immunodeficiency virus type 1 (HIV-1) Rev protein is essential for the virus because it promotes nuclear export of alternatively processed mRNAs, and Rev is also linked to translation of viral mRNAs and genome encapsidation. Previously, the human DEAD-box helicase DDX1 was suggested to be involved in Rev functions, but this relationship is not well understood. Biochemical studies of DDX1 and its interactions with Rev and model RNA oligonucleotides were carried out to investigate the molecular basis for association of these components. A combination of gel-filtration chromatography and circular dichroism spectroscopy demonstrated that recombinant DDX1 expressed in Escherichia coli is a well-behaved folded protein. Binding assays using fluorescently labeled Rev and cell-based immunoprecipitation analysis confirmed a specific RNA-independent DDX1-Rev interaction. Additionally, DDX1 was shown to be an RNA-activated ATPase, wherein Rev-bound RNA was equally effective at stimulating ATPase activity as protein-free RNA. Gel mobility shift assays further demonstrated that DDX1 forms complexes with Rev-bound RNA. RNA silencing of DDX1 provided strong evidence that DDX1 is required for both Rev activity and HIV production from infected cells. Collectively, these studies demonstrate a clear link between DDX1 and HIV-1 Rev in cell-based assays of HIV-1 production and provide the first demonstration that recombinant DDX1 binds Rev and RNA and has RNA-dependent catalytic activity. Copyright © 2011 Elsevier Ltd. All rights reserved.

  20. Novel Stress-Inducible Antisense RNAs of Protein-Coding Loci Are Synthesized by RNA-Dependent RNA Polymerase.

    PubMed

    Matsui, Akihiro; Iida, Kei; Tanaka, Maho; Yamaguchi, Katsushi; Mizuhashi, Kayoko; Kim, Jong-Myong; Takahashi, Satoshi; Kobayashi, Norio; Shigenobu, Shuji; Shinozaki, Kazuo; Seki, Motoaki

    2017-09-01

    Our previous study identified approximately 6,000 abiotic stress-responsive noncoding transcripts existing on the antisense strand of protein-coding genes and implied that a type of antisense RNA was synthesized from a sense RNA template by RNA-dependent RNA polymerase (RDR). Expression analyses revealed that the expression of novel abiotic stress-induced antisense RNA on 1,136 gene loci was reduced in the rdr1/2/6 mutants. RNase protection indicated that the RD29A antisense RNA and other RDR1/2/6-dependent antisense RNAs are involved in the formation of dsRNA. The accumulation of stress-inducible antisense RNA was decreased and increased in dcp5 and xrn4, respectively, but not changed in dcl2/3/4, nrpd1a and nrpd1b RNA-seq analyses revealed that the majority of the RDR1/2/6-dependent antisense RNA loci did not overlap with RDR1/2/6-dependent 20-30 nt RNA loci. Additionally, rdr1/2/6 mutants decreased the degradation rate of the sense RNA and exhibited arrested root growth during the recovery stage following a drought stress, whereas dcl2/3/4 mutants did not. Collectively, these results indicate that RDRs have stress-inducible antisense RNA synthesis activity and a novel biological function that is different from the known endogenous small RNA pathways from protein-coding genes. These data reveal a novel mechanism of RNA regulation during abiotic stress response that involves complex RNA degradation pathways. © 2017 American Society of Plant Biologists. All Rights Reserved.

  1. Comparative analysis of RNA silencing suppression activities between viral suppressors and an endogenous plant RNA-dependent RNA polymerase.

    PubMed

    Yoon, Ju-Yeon; Han, Kyoung-Sik; Park, Han-Yong; Choi, Seung-Kook

    2012-06-01

    RNA silencing is an evolutionarily conserved system that functions as an antiviral mechanism in eukaryotes, including higher plants. To counteract this, several plant viruses express silencing suppressors that inhibit RNA silencing in host plants. Here, we show that both 2b protein from peanut stunt virus (PSV) and a hairpin construct (designated hp-RDR6) that silences endogenous RNA-dependent RNA polymerase 6 (RDR6) strongly suppress RNA silencing. The Agrobacterium infiltration system was used to demonstrate that both PSV 2b and hp-RDR6 suppressed local RNA silencing as strongly as helper component (HC-Pro) from potato virus Y (PVY) and P19 from tomato bush stunt virus (TBSV). The 2b protein from PSV eliminated the small-interfering RNAs (siRNAs) associated with RNA silencing and prevented systemic silencing, similar to 2b protein from cucumber mosaic virus (CMV). On the other hand, hp-RDR6 suppressed RNA silencing by inhibiting the generation of secondary siRNAs. The small coat protein (SCP) of squash mosaic virus (SqMV) also displayed weak suppression activity of RNA silencing. Agrobacterium-mediated gene transfer was used to investigate whether viral silencing suppressors or hp-RDR6 enhanced accumulations of green fluorescence protein (GFP) and β-glucuronidase (GUS) as markers of expression in leaf tissues of Nicotina benthamiana. Expression of both GFP and GUS was significantly enhanced in the presence of PSV 2b or CMV 2b, compared to no suppression or the weak SqMV SCP suppressor. Co-expression with hp-RDR6 also significantly increased the expression of GFP and GUS to levels similar to those induced by PVY HC-Pro and TBSV P19.

  2. Myocarditis induced by coxsackie B3 virus in mature mice.

    PubMed

    Jaśkiewicz, K; Mrozińska, B

    1975-01-01

    Forty female mice during breast-feeding were infected intraperitoneally with coxackie B3 virus. Gross and microscopic examination of the hearts of the mice 7, 20, 44 and 120 days after infection revealed myocarditis typical of the acute stage of the disease, not reported previously, and gradually increasing intensity of immunologic changes in the chronic stage.

  3. Mutation Analysis of B3GALTL in Peters Plus Syndrome

    PubMed Central

    Reis, Linda M.; Tyler, Rebecca C.; Abdul-Rahman, Omar; Trapane, Pamela; Wallerstein, Robert; Broome, Diane; Hoffman, Jodi; Khan, Aneal; Paradiso, Christina; Ron, Nitin; Bergner, Amanda; Semina, Elena V.

    2009-01-01

    Peters Plus syndrome comprises ocular anterior segment dysgenesis (most commonly Peters anomaly), short stature, hand anomalies, distinctive facial features, and often other additional defects and is inherited in an autosomal-recessive pattern. Mutations in the β1,3-glucosyltransferase gene (B3GALTL) were recently reported in 20 out of 20 patients with Peters Plus syndrome. In our study, B3GALTL was examined in four patients with typical Peters Plus syndrome and four patients that demonstrated a phenotypic overlap with this condition. Mutations in B3GALTL were identified in all four patients with typical Peters Plus syndrome, while no mutations were found in the remaining four patients that demonstrated some but not all characteristic features of the syndrome. The previously reported common mutation, c.660+1G>A, accounted for 75% of the mutant alleles in our Peters Plus syndrome population. In addition, two new mutant alleles, c.459+1G>A and c.230insT, were identified and predicted to result in truncated protein products. These data confirm an important role for B3GALTL in causing typical Peters Plus syndrome, and suggest that this gene may not be implicated in syndromic cases that involve Peters’ anomaly but lack other classic features of this complex condition. PMID:18798333

  4. 26 CFR 48.4161(b)-3 - Use considered sale.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 26 Internal Revenue 16 2010-04-01 2010-04-01 true Use considered sale. 48.4161(b)-3 Section 48... sale. For provisions relating to the tax on use of taxable articles by the manufacturer, producer, or importer thereof, see section 4218 relating to use by a manufacturer considered a sale, and the...

  5. How Does Thymus Infection by Coxsackievirus Contribute to the Pathogenesis of Type 1 Diabetes?

    PubMed Central

    Michaux, Hélène; Martens, Henri; Jaïdane, Hela; Halouani, Aymen; Hober, Didier; Geenen, Vincent

    2015-01-01

    Through synthesis and presentation of neuroendocrine self-antigens by major histocompatibility complex proteins, thymic epithelial cells (TECs) play a crucial role in programing central immune self-tolerance to neuroendocrine functions. Insulin-like growth factor-2 (IGF-2) is the dominant gene/polypeptide of the insulin family that is expressed in TECs from different animal species and humans. Igf2 transcription is defective in the thymus of diabetes-prone bio-breeding rats, and tolerance to insulin is severely decreased in Igf2−/− mice. For more than 15 years now, our group is investigating the hypothesis that, besides a pancreotropic action, infection by coxsackievirus B4 (CV-B4) could implicate the thymus as well, and interfere with the intrathymic programing of central tolerance to the insulin family and secondarily to insulin-secreting islet β cells. In this perspective, we have demonstrated that a productive infection of the thymus occurs after oral CV-B4 inoculation of mice. Moreover, our most recent data have demonstrated that CV-B4 infection of a murine medullary (m) TEC line induces a significant decrease in Igf2 expression and IGF-2 production. In these conditions, Igf1 expression was much less affected by CV-B4 infection, while Ins2 transcription was not detected in this cell line. Through the inhibition of Igf2 expression in TECs, CV-B4 infection could lead to a breakdown of central immune tolerance to the insulin family and promote an autoimmune response against insulin-secreting islet β cells. Our major research objective now is to understand the molecular mechanisms by which CV-B4 infection of TECs leads to a major decrease in Igf2 expression in these cells. PMID:26175734

  6. Persistent infection of human pancreatic cells with Coxsackievirus B4 is cured by fluoxetine.

    PubMed

    Alidjinou, Enagnon Kazali; Sané, Famara; Bertin, Antoine; Caloone, Delphine; Hober, Didier

    2015-04-01

    Group B Coxsackieviruses (CVB) are involved in various acute clinical features and they can play a role in the development of chronic diseases like type 1 diabetes. The persistence of CVB has been described in vitro and in vivo in various models. Fluoxetine was reported to inhibit the replication of CVB1-3, which prompted us to study the in vitro antiviral activity of fluoxetine against CVB4 in models of acute infection. In addition we took advantage of a chronically CVB4-infected Panc-1 cell line to evaluate the antiviral effect of fluoxetine in a model of persistent CVB4 infection. An inhibition of the CVB4 replication was obtained when fluoxetine was added at 5.48μM to Hep-2 cell cultures. No inhibitory effect was observed when CVB4 was mixed with fluoxetine for 2h and filtered to eliminate fluoxetine before inoculation to cells, or when cells were treated up to 96h and washed before viral inoculation. Fluoxetine (5.48μM) reduced viral replication by more than 50% in acutely infected Panc-1 cell cultures. A dramatic decrease of infectious particles levels in supernatants of Panc-1 cells chronically infected with CVB4 was obtained a few days after treatment with fluoxetine and no infectious viral particle was found as soon as day 21 of treatment, and intracellular enteroviral RNA was undetectable by RT-PCR after three weeks of treatment. These data display that fluoxetine can inhibit the replication of CVB4 and can cure Panc-1 cells chronically infected with CVB4.

  7. How Does Thymus Infection by Coxsackievirus Contribute to the Pathogenesis of Type 1 Diabetes?

    PubMed

    Michaux, Hélène; Martens, Henri; Jaïdane, Hela; Halouani, Aymen; Hober, Didier; Geenen, Vincent

    2015-01-01

    Through synthesis and presentation of neuroendocrine self-antigens by major histocompatibility complex proteins, thymic epithelial cells (TECs) play a crucial role in programing central immune self-tolerance to neuroendocrine functions. Insulin-like growth factor-2 (IGF-2) is the dominant gene/polypeptide of the insulin family that is expressed in TECs from different animal species and humans. Igf2 transcription is defective in the thymus of diabetes-prone bio-breeding rats, and tolerance to insulin is severely decreased in Igf2 (-/-) mice. For more than 15 years now, our group is investigating the hypothesis that, besides a pancreotropic action, infection by coxsackievirus B4 (CV-B4) could implicate the thymus as well, and interfere with the intrathymic programing of central tolerance to the insulin family and secondarily to insulin-secreting islet β cells. In this perspective, we have demonstrated that a productive infection of the thymus occurs after oral CV-B4 inoculation of mice. Moreover, our most recent data have demonstrated that CV-B4 infection of a murine medullary (m) TEC line induces a significant decrease in Igf2 expression and IGF-2 production. In these conditions, Igf1 expression was much less affected by CV-B4 infection, while Ins2 transcription was not detected in this cell line. Through the inhibition of Igf2 expression in TECs, CV-B4 infection could lead to a breakdown of central immune tolerance to the insulin family and promote an autoimmune response against insulin-secreting islet β cells. Our major research objective now is to understand the molecular mechanisms by which CV-B4 infection of TECs leads to a major decrease in Igf2 expression in these cells.

  8. The Coxsackievirus and Adenovirus Receptor (CAR) undergoes ectodomain shedding and regulated intramembrane proteolysis (RIP).

    PubMed

    Houri, Nadia; Huang, Kuo-Cheng; Nalbantoglu, Josephine

    2013-01-01

    The Coxsackievirus and Adenovirus Receptor (CAR) is a cell adhesion molecule originally characterized as a virus receptor but subsequently shown to be involved in physiological processes such as neuronal and heart development, epithelial tight junction integrity, and tumour suppression. Proteolysis of cell adhesion molecules and a wide variety of other cell surface proteins serves as a mechanism for protein turnover and, in some cases, cell signaling. Metalloproteases such as A Disintegrin and Metalloprotease (ADAM) family members cleave cell surface receptors to release their substrates' ectodomains, while the presenilin/ɣ-secretase complex mediates regulated intramembrane proteolysis (RIP), releasing intracellular domain fragments from the plasma membrane. In the case of some substrates such as Notch and amyloid precursor protein (APP), the released intracellular domains enter the nucleus to modulate gene expression. We report that CAR ectodomain is constitutively shed from glioma cells and developing neurons, and is also shed when cells are treated with the phorbol ester phorbol 12-myristate 13-acetate (PMA) and the calcium ionophore ionomycin. We identified ADAM10 as a sheddase of CAR using assays involving shRNA knockdown and rescue, overexpression of wild-type ADAM10 and inhibition of ADAM10 activity by addition of its prodomain. In vitro peptide cleavage, mass spectrometry and mutagenesis revealed the amino acids M224 to L227 of CAR as the site of ADAM10-mediated ectodomain cleavage. CAR also undergoes RIP by the presenilin/γ-secretase complex, and the intracellular domain of CAR enters the nucleus. Ectodomain shedding is a prerequisite for RIP of CAR. Thus, CAR belongs to the increasing list of cell surface molecules that undergo ectodomain shedding and that are substrates for ɣ-secretase-mediated RIP.

  9. Source water quality effects on monochloramine inactivation of adenovirus, coxsackievirus, echovirus, and murine norovirus.

    PubMed

    Kahler, Amy M; Cromeans, Theresa L; Roberts, Jacquelin M; Hill, Vincent R

    2011-02-01

    There is a need for more information regarding monochloramine disinfection efficacy for viruses in water. In this study, monochloramine disinfection efficacy was investigated for coxsackievirus B5 (CVB5), echovirus 11 (E11), murine norovirus (MNV), and human adenovirus 2 (HAdV2) in one untreated ground water and two partially treated surface waters. Duplicate disinfection experiments were completed at pH 7 and 8 in source water at concentrations of 1 and 3 mg/L monochloramine at 5 and 15 °C. The Efficiency Factor Hom (EFH) model was used to calculate CT values (mg-min/L) required to achieve 2-, 3-, and 4-log(10) reductions in viral titers. In all water types, monochloramine disinfection was most effective for MNV, with 3-log(10) CT values at 5 °C ranging from 27 to 110. Monochloramine disinfection was least effective for HAdV2 and E11, depending on water type, with 3-log(10) CT values at 5 °C ranging from 1200 to 3300 and 810 to 2300, respectively. Overall, disinfection proceeded faster at 15 °C and pH 7 for all water types. Inactivation of the study viruses was significantly different between water types, but there was no indication that overall disinfection efficacy was enhanced or inhibited in any one water type. CT values for HAdV2 in two types of source water exceeded federal CT value recommendations in the US. The results of this study demonstrate that water quality impacts the inactivation of viruses and should be considered when developing chloramination plans.

  10. Characterizing Enterovirus 71 and Coxsackievirus A16 virus-like particles production in insect cells.

    PubMed

    Somasundaram, Balaji; Chang, Cindy; Fan, Yuan Y; Lim, Pei-Yin; Cardosa, Jane; Lua, Linda

    2016-02-15

    Enterovirus 71 (EV71) and Coxsackievirus A16 (CVA16) are two viruses commonly responsible for hand, foot and mouth disease (HFMD) in children. The lack of prophylactic or therapeutic measures against HFMD is a major public health concern. Insect cell-based EV71 and CVA16 virus-like particles (VLPs) are promising vaccine candidates against HFMD and are currently under development. In this paper, the influence of insect cell line, incubation temperature, and serial passaging effect and stability of budded virus (BV) stocks on EV71 and CVA16 VLP production was investigated. Enhanced EV71 and CVA16 VLP production was observed in Sf9 cells compared to High Five™ cells. Lowering the incubation temperature from the standard 27°C to 21°C increased the production of both VLPs in Sf9 cells. Serial passaging of CVA16 BV stocks in cell culture had a detrimental effect on the productivity of the structural proteins and the effect was observed with only 5 passages of BV stocks. A 2.7× higher production yield was achieved with EV71 compared to CVA16. High-resolution asymmetric flow field-flow fractionation couple with multi-angle light scattering (AF4-MALS) was used for the first time to characterize EV71 and CVA16 VLPs, displaying an average root mean square radius of 15±1nm and 15.3±5.8 nm respectively. This study highlights the need for different approaches in the design of production process to develop a bivalent EV71 and CVA16 vaccine.

  11. The Coxsackievirus and Adenovirus Receptor (CAR) Undergoes Ectodomain Shedding and Regulated Intramembrane Proteolysis (RIP)

    PubMed Central

    Houri, Nadia; Huang, Kuo-Cheng; Nalbantoglu, Josephine

    2013-01-01

    The Coxsackievirus and Adenovirus Receptor (CAR) is a cell adhesion molecule originally characterized as a virus receptor but subsequently shown to be involved in physiological processes such as neuronal and heart development, epithelial tight junction integrity, and tumour suppression. Proteolysis of cell adhesion molecules and a wide variety of other cell surface proteins serves as a mechanism for protein turnover and, in some cases, cell signaling. Metalloproteases such as A Disintegrin and Metalloprotease (ADAM) family members cleave cell surface receptors to release their substrates’ ectodomains, while the presenilin/ɣ-secretase complex mediates regulated intramembrane proteolysis (RIP), releasing intracellular domain fragments from the plasma membrane. In the case of some substrates such as Notch and amyloid precursor protein (APP), the released intracellular domains enter the nucleus to modulate gene expression. We report that CAR ectodomain is constitutively shed from glioma cells and developing neurons, and is also shed when cells are treated with the phorbol ester phorbol 12-myristate 13-acetate (PMA) and the calcium ionophore ionomycin. We identified ADAM10 as a sheddase of CAR using assays involving shRNA knockdown and rescue, overexpression of wild-type ADAM10 and inhibition of ADAM10 activity by addition of its prodomain. In vitro peptide cleavage, mass spectrometry and mutagenesis revealed the amino acids M224 to L227 of CAR as the site of ADAM10-mediated ectodomain cleavage. CAR also undergoes RIP by the presenilin/γ-secretase complex, and the intracellular domain of CAR enters the nucleus. Ectodomain shedding is a prerequisite for RIP of CAR. Thus, CAR belongs to the increasing list of cell surface molecules that undergo ectodomain shedding and that are substrates for ɣ-secretase-mediated RIP. PMID:24015300

  12. Cardiovirulent coxsackieviruses and the decay-accelerating factor (CD55) receptor.

    PubMed

    Martino, T A; Petric, M; Brown, M; Aitken, K; Gauntt, C J; Richardson, C D; Chow, L H; Liu, P P

    1998-05-10

    Group B coxsackieviruses are etiologically linked with many human diseases including acute myocarditis and associated chronic dilated cardiomyopathy. Well-established CVB3 cardiovirulent strains (CVB3c(s)) with known phenotypic difference have been used to study the pathogenesis of virus-induced heart disease. The receptor-binding characteristics of cardiovirulent CVB3 are not known, but may represent one mechanism accounting for differences in disease virulence. In this study, interactions between CVB3c(s) and the decay-accelerating factor (DAF or CD55) cell surface receptor were examined. Anti-DAF monoclonal antibodies (MAbs) blocked virus binding and infection of susceptible HeLa cells. Virus binding was significantly reduced by treatment of these cells with phosphatidylinositol phospholipase C enzyme, which rendered them DAF-deficient CVB3c(s) exhibited a differential propensity for the DAF receptor, as several cardiovirulent strains interacted more strongly than others. However, virus binding and infection was always most effectively blocked by MAbs directed against the SCR 2 and 3 domains of DAF, suggesting that binding occurs at a similar site(s) on the molecule for all strains. Virus binding and internalization were associated with DAF down-regulation at the cell surface, as monitored by flow cytometry analysis. Cardiovirulent CVB3 did not interact with molecules functionally and/or structurally related to DAF, including CD35, CD46, Factor H, or C4-binding protein. Adenovirus type 2 (Ad2) does not use the DAF receptor. However, competitive binding assays between Ad2 and CVB1-6, CVB3c(s), anti-DAF MAbs, or DAF-reduced cells indicated that DAF is associated with Ad2 receptors on the HeLa cell membrane. In summary, this study indicates that DAF is an attachment receptor for cardiovirulent CVB3 and that DAF interaction may be important in the pathogenesis of CVB-mediated heart disease.

  13. Viral persistence during the developmental phase of Coxsackievirus B1-induced murine polymyositis.

    PubMed Central

    Tam, P E; Schmidt, A M; Ytterberg, S R; Messner, R P

    1991-01-01

    Mice infected with coxsackievirus B1 (CVB1) develop a chronic hindquarter muscle weakness which resembles human polymyositis. In this study, we used in situ hybridization to screen for persistent viral RNA in hamstring and quadriceps muscles from mice that displayed various degrees of clinical weakness. At 28 to 31 days postinfection, when chronic myositis is well developed but infectious virus can no longer be recovered, persistent CVB1 RNA was found in hindquarter skeletal muscle of all 12 infected animals examined. Persistent CVB1 showed a multifocal distribution within muscle and was associated with three different histopathology patterns (HPPs). These three HPPs (HPP-1, HPP-2, and HPP-3) represent potentially different stages in the mechanism of persistence. They are based on the pattern of grains, the location of hybridization signal within the muscle, and the accompanying histopathology. In HPP-1, virus persisted in nonnecrotic muscle fibers and was not directly associated with foci of inflammatory cells. HPP-2 consisted of virus contained within necrotic myocytes that were surrounded by inflammatory cells. HPP-3 was rare and showed virus inside infiltrating mononuclear cells in a region where muscle tissue had been extensively destroyed. Persistent CVB1 occurred more frequently in severely diseased animals and in tissue sections displaying intense inflammation. Moreover, HPP-2 showed a stronger association with tissue inflammation and hindquarter weakness than did HPP-1. These data demonstrate that CVB1 persists in skeletal muscle for at least 28 to 31 days postinfection and support the concept that this persistence plays a role in the development of murine polymyositis. Images PMID:1942249

  14. Phylodynamic Characterization of an Ocular-Tropism Coxsackievirus A24 Variant

    PubMed Central

    Lu, Po-Liang; Lin, Yung-Cheng; Shi, Yong-Ying; Chou, Li-Chiu; Wang, Chu-Feng; Lin, Yi-Ying; Su, Hui-Ju; Lin, Chien-Ching; Zeng, Jing-Yun; Tyan, Yu-Chang; Ke, Guan-Ming

    2016-01-01

    Recent phylodynamic studies have focused on using tree topology patterns to elucidate interactions among the epidemiological, evolutionary, and demographic characteristics of infectious agents. However, because studies of viral phylodynamics tend to focus on epidemic outbreaks, tree topology signatures of tissue-tropism pathogens might not be clearly identified. Therefore, this study used a novel Bayesian evolutionary approach to analyze the A24 variant of coxsackievirus (CV-A24v), an ocular-tropism agent of acute hemorrhagic conjunctivitis. Analyses of the 915-nucleotide VP1 and 690-nt 3Dpol regions of 21 strains isolated in Taiwan and worldwide during 1985–2010 revealed a clear chronological trend in both the VP1 and 3Dpol phylogenetic trees: the emergence of a single dominant cluster in each outbreak. The VP1 sequences included three genotypes: GI (prototype), GIII (isolated 1985–1999), and GIV (isolated after 2000); no VP1 sequences from GII strains have been deposited in GenBank. Another five genotypes identified in the 3Dpol region had support values >0.9. Geographic and demographic transitions among CV-A24v clusters were clearly identified by Bayes algorithm. The transmission route was mapped from India to China and then to Taiwan, and each prevalent viral population declined before new clusters emerged. Notably, the VP1 and 3Dpol genes had high nucleotide sequence similarities (94.1% and 95.2%, respectively). The lack of co-circulating lineages and narrow tissue tropism affected the CV-A24v gene pool. PMID:27529556

  15. Structural Analysis of Coxsackievirus A7 Reveals Conformational Changes Associated with Uncoating

    PubMed Central

    Seitsonen, Jani J. T.; Shakeel, Shabih; Susi, Petri; Pandurangan, Arun P.; Sinkovits, Robert S.; Hyvönen, Heini; Laurinmäki, Pasi; Ylä-Pelto, Jani; Topf, Maya; Hyypiä, Timo

    2012-01-01

    Coxsackievirus A7 (CAV7) is a rarely detected and poorly characterized serotype of the Enterovirus species Human enterovirus A (HEV-A) within the Picornaviridae family. The CAV7-USSR strain has caused polio-like epidemics and was originally thought to represent the fourth poliovirus type, but later evidence linked this strain to the CAV7-Parker prototype. Another isolate, CAV7-275/58, was also serologically similar to Parker but was noninfectious in a mouse model. Sequencing of the genomic region encoding the capsid proteins of the USSR and 275/58 strains and subsequent comparison with the corresponding amino acid sequences of the Parker strain revealed that the Parker and USSR strains are nearly identical, while the 275/58 strain is more distant. Using electron cryomicroscopy and three-dimensional image reconstruction, the structures of the CAV7-USSR virion and empty capsid were resolved to 8.2-Å and 6.1-Å resolutions, respectively. This is one of the first detailed structural analyses of the HEV-A species. Using homology modeling, reconstruction segmentation, and flexible fitting, we constructed a pseudoatomic T = 1 (pseudo T = 3) model incorporating the three major capsid proteins (VP1 to VP3), addressed the conformational changes of the capsid and its constituent viral proteins occurring during RNA release, and mapped the capsid proteins' variable regions to the structure. During uncoating, VP4 and RNA are released analogously to poliovirus 1, the interfaces of VP2 and VP3 are rearranged, and VP1 rotates. Variable regions in the capsid proteins were predicted to map mainly to the surface of VP1 and are thus likely to affect the tropism and pathogenicity of CAV7. PMID:22514349

  16. De Novo Initiation of RNA Synthesis by the RNA-Dependent RNA Polymerase (NS5B) of Hepatitis C Virus

    PubMed Central

    Luo, Guangxiang; Hamatake, Robert K.; Mathis, Danielle M.; Racela, Jason; Rigat, Karen L.; Lemm, Julie; Colonno, Richard J.

    2000-01-01

    Hepatitis C virus (HCV) NS5B protein possesses an RNA-dependent RNA polymerase (RdRp) activity, a major function responsible for replication of the viral RNA genome. To further characterize the RdRp activity, NS5B proteins were expressed from recombinant baculoviruses, purified to near homogeneity, and examined for their ability to synthesize RNA in vitro. As a result, a highly active NS5B RdRp (1b-42), which contains an 18-amino acid C-terminal truncation resulting from a newly created stop codon, was identified among a number of independent isolates. The RdRp activity of the truncated NS5B is comparable to the activity of the full-length protein and is 20 times higher in the presence of Mn2+ than in the presence of Mg2+. When a 384-nucleotide RNA was used as the template, two major RNA products were synthesized by 1b-42. One is a complementary RNA identical in size to the input RNA template (monomer), while the other is a hairpin dimer RNA synthesized by a “copy-back” mechanism. Substantial evidence derived from several experiments demonstrated that the RNA monomer was synthesized through de novo initiation by NS5B rather than by a terminal transferase activity. Synthesis of the RNA monomer requires all four ribonucleotides. The RNA monomer product was verified to be the result of de novo RNA synthesis, as two expected RNA products were generated from monomer RNA by RNase H digestion. In addition, modification of the RNA template by the addition of the chain terminator cordycepin at the 3′ end did not affect synthesis of the RNA monomer but eliminated synthesis of the self-priming hairpin dimer RNA. Moreover, synthesis of RNA on poly(C) and poly(U) homopolymer templates by 1b-42 NS5B did not require the oligonucleotide primer at high concentrations (≥50 μM) of GTP and ATP, further supporting a de novo initiation mechanism. These findings suggest that HCV NS5B is able to initiate RNA synthesis de novo. PMID:10623748

  17. Influenza Virus Infection Induces Host Pyruvate Kinase M Which Interacts with Viral RNA-Dependent RNA Polymerase.

    PubMed

    Miyake, Yukari; Ishii, Kosuke; Honda, Ayae

    2017-01-01

    Influenza virus RNA-dependent RNA polymerase (RdRp) is a heterotrimer of three viral proteins, PB1, PB2, and PA and is involved in both transcription and replication of the negative strand of the viral RNA (vRNA) genome. RdRp is multifunctional, possessing RNA polymerase, cap binding, and endonuclease activities. The enzyme synthesizes three different RNAs, complementary RNA (cRNA) and messenger RNA (mRNA) from vRNA, and vRNA from cRNA. To synthesize these three RNAs, RdRp requires conversion of its function by host factor. Here, we performed yeast two-hybrid screening to identify the relevant host factor, revealing that pyruvate kinase M2 (PKM2) interacted with the PA subunit of influenza virus RdRp. PKM2 is one of two enzymes (PKM1 and PKM2) produced by alternative splicing of the pyruvate kinase M (PKM) pre-mRNA. We determined the interacting regions in both PKM2 and PA, the expression level of PKM by western blotting at different time points after viral infection, and the effects of transfection of siRNA targeting PKM on influenza virus replication. The results demonstrated that the C-terminal region of PKM2 interacted with the C-terminus of the PA subunit, that the expression level of PKM2 increased with influenza virus infection time, and that this enzyme is essential for influenza virus multiplication. Moreover, isoelectric focusing of uninfected and influenza virus infected cell extracts, followed by gradient gel electrophoresis to separate the PKM1 and PKM2 isoforms and western blotting indicated that PKM2 became more acidic after influenza infection. The decreased pH of PKM2 may have been due to phosphorylation, and phosphorylated PKM2 is active as a pyruvate kinase and protein kinase; therefore, it is possible that PKM2 may transfer a phosphate group to PA and consequently transform the function of RdRp from transcriptase to replicase.

  18. Influenza Virus Infection Induces Host Pyruvate Kinase M Which Interacts with Viral RNA-Dependent RNA Polymerase

    PubMed Central

    Miyake, Yukari; Ishii, Kosuke; Honda, Ayae

    2017-01-01

    Influenza virus RNA-dependent RNA polymerase (RdRp) is a heterotrimer of three viral proteins, PB1, PB2, and PA and is involved in both transcription and replication of the negative strand of the viral RNA (vRNA) genome. RdRp is multifunctional, possessing RNA polymerase, cap binding, and endonuclease activities. The enzyme synthesizes three different RNAs, complementary RNA (cRNA) and messenger RNA (mRNA) from vRNA, and vRNA from cRNA. To synthesize these three RNAs, RdRp requires conversion of its function by host factor. Here, we performed yeast two-hybrid screening to identify the relevant host factor, revealing that pyruvate kinase M2 (PKM2) interacted with the PA subunit of influenza virus RdRp. PKM2 is one of two enzymes (PKM1 and PKM2) produced by alternative splicing of the pyruvate kinase M (PKM) pre-mRNA. We determined the interacting regions in both PKM2 and PA, the expression level of PKM by western blotting at different time points after viral infection, and the effects of transfection of siRNA targeting PKM on influenza virus replication. The results demonstrated that the C-terminal region of PKM2 interacted with the C-terminus of the PA subunit, that the expression level of PKM2 increased with influenza virus infection time, and that this enzyme is essential for influenza virus multiplication. Moreover, isoelectric focusing of uninfected and influenza virus infected cell extracts, followed by gradient gel electrophoresis to separate the PKM1 and PKM2 isoforms and western blotting indicated that PKM2 became more acidic after influenza infection. The decreased pH of PKM2 may have been due to phosphorylation, and phosphorylated PKM2 is active as a pyruvate kinase and protein kinase; therefore, it is possible that PKM2 may transfer a phosphate group to PA and consequently transform the function of RdRp from transcriptase to replicase. PMID:28232820

  19. CaRDR1, an RNA-Dependent RNA Polymerase Plays a Positive Role in Pepper Resistance against TMV.

    PubMed

    Qin, Lei; Mo, Ning; Zhang, Yang; Muhammad, Tayeb; Zhao, Guiye; Zhang, Yan; Liang, Yan

    2017-01-01

    RNA silencing functions as a major natural antiviral defense mechanism in plants. RNA-dependent RNA polymerases (RDRs) that catalyze the synthesis of double-stranded RNAs, are considered as a fundamental element in RNA silencing pathways. In Arabidopsis thaliana, RDR1, 2 and 6 play important roles in anti-viral RNA silencing. Expression of RDR1 can be elevated following plant treatment with defense hormones and virus infection. RDR1 has been studied in several crop species, but not in pepper (Capsicum annuum L.). Here, a RDR1 gene was isolated from Capsicum annuum L., designated as CaRDR1. The full-length cDNA of CaRDR1 was 3,351 bp, encoding a 1,116-amino acid protein, which contains conserved regions, such as the most remarkable motif DLDGD. The transcripts of CaRDR1 could be induced by salicylic acid (SA), abscisic acid (ABA), H2O2, and tobacco mosaic virus (TMV). Silencing of CaRDR1 in pepper resulted in increased susceptibility to TMV as evident by severe symptom, increased of TMV-CP transcript, higher malondialdehyde (MDA) content and lower antioxidant enzymes activities compared with that of control plants. CaRDR1-overexpressing in Nicotiana benthamiana showed mild disease symptom and reduced TMV-CP transcripts than that of empty vector (EV) following TMV inoculation. The RNA silencing related genes, including NbAGO2, NbDCL2, NbDCL3, and NbDCL4 elevated expression in overexpressed plants. Alternative oxidase (AOX), the terminal oxidase of the cyanide (CN)-resistant alternative respiratory pathway, catalyze oxygen-dependent oxidation of ubiquinol in plants. It has an important function in plant defense against TMV. In addition, CaRDR1 overexpression promoted the expression of NbAOX1a and NbAOX1b. In conclusion, these results suggest that CaRDR1 plays a positive role in TMV resistance by regulating antioxidant enzymes activities and RNA silencing-related genes expression to suppress the replication and movement of TMV.

  20. CaRDR1, an RNA-Dependent RNA Polymerase Plays a Positive Role in Pepper Resistance against TMV

    PubMed Central

    Qin, Lei; Mo, Ning; Zhang, Yang; Muhammad, Tayeb; Zhao, Guiye; Zhang, Yan; Liang, Yan

    2017-01-01

    RNA silencing functions as a major natural antiviral defense mechanism in plants. RNA-dependent RNA polymerases (RDRs) that catalyze the synthesis of double-stranded RNAs, are considered as a fundamental element in RNA silencing pathways. In Arabidopsis thaliana, RDR1, 2 and 6 play important roles in anti-viral RNA silencing. Expression of RDR1 can be elevated following plant treatment with defense hormones and virus infection. RDR1 has been studied in several crop species, but not in pepper (Capsicum annuum L.). Here, a RDR1 gene was isolated from Capsicum annuum L., designated as CaRDR1. The full-length cDNA of CaRDR1 was 3,351 bp, encoding a 1,116-amino acid protein, which contains conserved regions, such as the most remarkable motif DLDGD. The transcripts of CaRDR1 could be induced by salicylic acid (SA), abscisic acid (ABA), H2O2, and tobacco mosaic virus (TMV). Silencing of CaRDR1 in pepper resulted in increased susceptibility to TMV as evident by severe symptom, increased of TMV-CP transcript, higher malondialdehyde (MDA) content and lower antioxidant enzymes activities compared with that of control plants. CaRDR1-overexpressing in Nicotiana benthamiana showed mild disease symptom and reduced TMV-CP transcripts than that of empty vector (EV) following TMV inoculation. The RNA silencing related genes, including NbAGO2, NbDCL2, NbDCL3, and NbDCL4 elevated expression in overexpressed plants. Alternative oxidase (AOX), the terminal oxidase of the cyanide (CN)-resistant alternative respiratory pathway, catalyze oxygen-dependent oxidation of ubiquinol in plants. It has an important function in plant defense against TMV. In addition, CaRDR1 overexpression promoted the expression of NbAOX1a and NbAOX1b. In conclusion, these results suggest that CaRDR1 plays a positive role in TMV resistance by regulating antioxidant enzymes activities and RNA silencing-related genes expression to suppress the replication and movement of TMV. PMID:28702034

  1. Double stranded RNA-dependent protein kinase is involved in osteoclast differentiation of RAW264.7 cells in vitro

    SciTech Connect

    Teramachi, Junpei; Morimoto, Hiroyuki; Baba, Ryoko; Doi, Yoshiaki; Hirashima, Kanji; Haneji, Tatsuji

    2010-11-15

    Double-stranded RNA-dependent protein kinase (PKR) plays a critical role in antiviral defence of the host cells. PKR is also involved in cell cycle progression, cell proliferation, cell differentiation, tumorigenesis, and apoptosis. We previously reported that PKR is required for differentiation and calcification of osteoblasts. However, it is unknown about the role of PKR in osteoclast differentiation. A dominant-negative PKR mutant cDNA, in which the amino acid lysine at 296 was replaced with arginine, was transfected into RAW264.7 cells. We have established the cell line that stably expresses the PKR mutant gene (PKR-K/R). Phosphorylation of PKR and {alpha}-subunit of eukaryotic initiation factor 2 was not stimulated by polyinosic-polycytidylic acid in the PKR-K/R cells. RANKL stimulated the formation of TRAP-positive multinuclear cells in RAW264.7 cells. However, TRAP-positive multinuclear cells were not formed in the PKR-K/R cells even when the cells were stimulated with higher doses of RANKL. A specific inhibitor of PKR, 2-aminopurine, also suppressed the RANKL-induced osteoclast differentiation in RAW264.7 cells. The expression of macrophage fusion receptor and dendritic cell-specific transmembrane protein significantly decreased in the PKR-K/R cells by real time PCR analysis. The results of RT-PCR revealed that the mRNA expression of osteoclast markers (cathepsin K and calcitonin receptor) was suppressed in the PKR-K/R cells and RAW264.7 cells treated with 2-aminopurine. Expression of NF-{kappa}B protein was suppressed in the PKR-K/R cells and 2-aminopurine-treated RAW264.7 cells. The level of STAT1 protein expression was elevated in the PKR-K/R cells compared with that of the wild-type cells. Immunohistochemical study showed that PKR was localized in osteoclasts of metatarsal bone of newborn mouse. The finding that the PKR-positive multinuclear cells should be osteoclasts was confirmed by TRAP-staining. Our present study indicates that PKR plays important

  2. Synthesis and antioxidant activity of a procyanidin B3 analogue.

    PubMed

    Mizuno, Mirei; Nakanishi, Ikuo; Matsubayashi, Satoko; Imai, Kohei; Arai, Takuya; Matsumoto, Ken-Ichiro; Fukuhara, Kiyoshi

    2017-02-15

    Proanthocyanidin, an oligomer of catechin, is a natural antioxidant and a potent inhibitor of lectin-like oxidized LDL receptor-1, which is involved in the pathogenesis of arteriosclerosis. We synthesized proanthocyanidin analogue 1, in which the geometry of one catechin molecule in procyanidin B3, a dimer of (+)-catechin, is constrained to be planar. The antioxidant activities of the compounds were evaluated in terms of their capacities to scavenge galvinoxyl radicals, and results demonstrate that while procyanidin was 3.8 times more potent than (+)-catechin, the radical scavenging activity of proanthocyanidin analogue 1 was further increased to 1.9 times that of procyanidin B3. This newly designed proanthocyanidin analogue 1 may be a promising lead compound for the treatment of arteriosclerosis and related cerebrovascular diseases.

  3. Enterocin B3A-B3B produced by LAB collected from infant faeces: potential utilization in the food industry for Listeria monocytogenes biofilm management.

    PubMed

    Al-Seraih, Alaa; Belguesmia, Yanath; Baah, John; Szunerits, Sabine; Boukherroub, Rabah; Drider, Djamel

    2017-02-01

    Enterococcus faecalis B3A-B3B produces the bacteriocin B3A-B3B with activity against Listeria monocytogenes, Staphylococcus aureus, methicillin-resistant Staphylococcus aureus (MRSA) and Clostridium perfringens, but apparently not against fungi or Gram-negative bacteria, except for Salmonella Newport. B3A-B3B enterocin has two different nucleotides but similar amino acid composition to the class IIb MR10A-MR10B enterocin. B3A-B3B consists of two peptides of predicted molecular mass of 5176.31 Da (B3A) and 5182.21 Da (B3B). Importantly, B3A-B3B impeded biofilm formation of the foodborne pathogen L. monocytogenes 162 grown on stainless steel. The antimicrobial treatment of stainless steel with nisin (1 or 16 mg ml(-1)) decreased the cell numbers by about 2 log CFU ml(-1), thereby impeding the biofilm formation by L. monocytogenes 162 or its nisin-resistant derivative strain L. monocytogenes 162R. Furthermore, the combination of nisin and B3A-B3B enterocin reduced the MIC required to inhibit this pathogen grown in planktonic or biofilm cultures.

  4. NIR flaring of the blazar B3 1726+455

    NASA Astrophysics Data System (ADS)

    Carrasco, L.; Carramiñana, A.; Recillas, E.; Porras, A.; Valdes, J. R.; Mayya, Y. D.; Escobedo, G.; Torres, I.

    2010-10-01

    We report on our recent observation of the blazar B3 1726+455, also known as S4 1726+45, and CGRaBS J1727+4530, with the CANICA NIR camera on the 2.1m telescope at the Observatorio Astrofísico Guillermo Haro, located in Cananea, Mexico. On September 16th,2010 (JD2455455.7092), we found this source to be in outburst. On this date the source was found to have a flux corresponding to H = 14.32 +/- 0.06.

  5. Environmental survey of the B-3 and Ford's Farm ranges.

    SciTech Connect

    Stoetzel, G.A.; Waite, D.A.; Gilchrist, R.L.

    1983-08-01

    The Army has been firing depleted-uranium (DU) projectiles into targets on the Aberdeen Proving Ground, Maryland. An environmental survey was conducted of two areas known as the B-3 range and the Ford's Farm range to determine the location of DU in their environments. The survey included ground survey measurements and some environmental sampling. Several special studies were also conducted, including analyses of the isotopic composition of uranium in a limited number of samples and a dissolution rate study to estimate the solubility of DU dust in sea and river water.

  6. Summary of session B3 at GR20/Amaldi10

    NASA Astrophysics Data System (ADS)

    Garfinkle, David

    2014-05-01

    A wide variety of results was presented in session B3, the "non-astrophysical" numerical relativity parallel session. some results included improved numerical methods for such things as asymptotically flat spacetimes, generation of initial data, and characterization of binary black hole systems. Others included the propagation of various types of matter fields in the presence of black holes, naked singularities, and wormholes. There were also several simulations of spacetimes asymptotic to anti-de Sitter space. These simulations are of interest both for general relativity and (through the AdS/CFT correspondence) for the behavior of quantum field theories.

  7. Nucleic acid sequences encoding D1 and D1/D2 domains of human coxsackievirus and adenovirus receptor (CAR)

    DOEpatents

    Freimuth, Paul I.

    2010-04-06

    The invention provides recombinant human CAR (coxsackievirus and adenovirus receptor) polypeptides which bind adenovirus. Specifically, polypeptides corresponding to adenovirus binding domain D1 and the entire extracellular domain of human CAR protein comprising D1 and D2 are provided. In another aspect, the invention provides nucleic acid sequences encoding these domains and expression vectors for producing the domains and bacterial cells containing such vectors. The invention also includes an isolated fusion protein comprised of the D1 polypeptide fused to a polypeptide which facilitates folding of D1 when expressed in bacteria. The functional D1 domain finds application in a therapeutic method for treating a patient infected with a CAR D1-binding virus, and also in a method for identifying an antiviral compound which interferes with viral attachment. The invention also provides a method for specifically targeting a cell for infection by a virus which binds to D1.

  8. Properties of the deoxycholate-solubilized HeLa cell plasma membrane receptor for binding group B coxsackieviruses.

    PubMed Central

    Krah, D L; Crowell, R L

    1985-01-01

    Physical and chemical properties of deoxycholate-solubilized HeLa cell plasma membrane receptors for binding group B coxsackieviruses were determined. Receptors eluted from Sepharose 4B with an apparent molecular weight of 275,000 and sedimented with an S value of between 14.7 and 4.9 and a buoyant density of 1.06 to 1.10 g/cm3. Virus-binding activity was destroyed after treatment with proteases, glycosidases, and periodate but was unaffected by lipases or reducing or alkylating agents. Additionally, lectins, including concanavalin A, adsorbed receptors and inhibited virus attachment. The composite data suggested that glycoprotein is an integral part of the receptors for binding virus. PMID:2983096

  9. Structural optimization and physical properties of TcB3 and MoB3 at high-pressure: First-principles

    NASA Astrophysics Data System (ADS)

    Ying, Chun; Bai, Xiaowan; Du, Yungang; Zhao, Erjun; Lin, Lin; Hou, Qingyu

    2016-06-01

    The thermodynamic, mechanical and dynamic properties of TcB3 and MoB3 are systematically investigated at high-pressure by first-principles within density functional theory (DFT). The calculated formation enthalpies are negative for TcB3 with considered structures under the pressure range from 0 to 100 GPa. Triboride hP4-TcB3 (i.e., TcB3 in hP4-OsB3 type structure) has the lowest formation enthalpy of -1.44 eV under ambient condition. The largest shear modulus of 240 GPa and smallest Poisson’s ratio of 0.20 for oP16-TcB3 are comparable to those of 267 GPa and 0.15 for ReB2. The calculated elastic constants show that MB3 (M=Tc and Mo) are mechanically stable at ambient conditions, except for mP8-MoB3. The estimated high hardness of 33.4 and 33.1 GPa for oP16-TcB3 and hP4-TcB3, respectively, are reported for the first time. The calculated lattice parameters for MoB3 are in good agreement with the previously theoretical and experimental studies. Below 13 GPa, hP16-MoB3 and hR24-MoB3 are thermodynamically more favorable than MoB3 in other structures. A pressure-induced phase transition is predicted at 13 GPa from hP16-MoB3 and hR24-MoB3 to hP4-MoB3. Above 13 GPa, hP4-MoB3 becomes the thermodynamically most stable phase among MoB3 in considered structures. All compounds with considered structures are metallic, and the electronic structures of MB3 are governed by a strong hybridization between M-4d and B-2p states. The strong and directional covalent bonding between M-4d and B-2p as well as the strong interlayer interactions of boron layers are correlated to the high hardness of 38.0 and 38.4 GPa for hP16-MoB3 and hR24-MoB3, respectively.

  10. Multiple outbreaks of acute hemorrhagic conjunctivitis due to a variant of coxsackievirus A24: Guangdong, China, 2007.

    PubMed

    Wu, De; Ke, Chang-Wen; Mo, Yan-Ling; Sun, Li-Mei; Li, Hui; Chen, Qiu-Xia; Zou, Li-Rong; Fang, Ling; Huang, Ping; Zhen, Huan-ying

    2008-10-01

    Acute hemorrhagic conjunctivitis (AHC) is usually caused by enterovirus 70, coxsackievirus A24(CA24v) and adenoviruses. Several outbreaks of AHC caused by a CA24v have occurred since it was imported into China in 1971. Multiple outbreaks of AHC reappeared in 10 cities of Guangdong during June to November in 2007. The epidemic began in the June, and spread extensively, with a peak in the September. A total of 31,659 cases were reported to center for disease control and prevention of Guangdong, it was estimated that the number of actual AHC was >200 thousands. Forty conjunctival swab specimens were collected from the cases diagnosed clinically with AHC. (RT)-PCR testing on these conjunctival specimens revealed the presence of an enterovirus, and this was confirmed by 16 isolates. We demonstrated the most likely etiological agent for the multiple outbreaks was a variant of coxsackievirus A24 by molecular typing using a partial VP1 sequence. Sequence comparison and phylogenetic analyses of the VP1 and 3Cpro gene regions were performed by Neighbor-joining method, the strains from different outbreaks and different geographical areas within Guangdong had no sequence divergence in 2007. The representative isolates from mainland of China including Hangzhou, Ningbo, Beijing, Yunnan, Liaoning, and Henan were analyzed in this study. Phylogenetic analysis revealed theses isolates were located in different clusters, a close phylogenetic and chronological relationship with Singaporean, South Korean and Thailand isolates had been observed. This confirms CA24v circulated in China's mainland has not evolved independently, but co-evolved with the isolates of Southeast Asia.

  11. Structural and Functional Analysis of Coxsackievirus A9 Integrin αvβ6 Binding and Uncoating

    PubMed Central

    Shakeel, Shabih; Seitsonen, Jani J. T.; Kajander, Tommi; Laurinmäki, Pasi; Hyypiä, Timo; Susi, Petri

    2013-01-01

    Coxsackievirus A9 (CVA9) is an important pathogen of the Picornaviridae family. It utilizes cellular receptors from the integrin αv family for binding to its host cells prior to entry and genome release. Among the integrins tested, it has the highest affinity for αvβ6, which recognizes the arginine-glycine-aspartic acid (RGD) loop present on the C terminus of viral capsid protein, VP1. As the atomic model of CVA9 lacks the RGD loop, we used surface plasmon resonance, electron cryo-microscopy, and image reconstruction to characterize the capsid-integrin interactions and the conformational changes on genome release. We show that the integrin binds to the capsid with nanomolar affinity and that the binding of integrin to the virion does not induce uncoating, thereby implying that further steps are required for release of the genome. Electron cryo-tomography and single-particle image reconstruction revealed variation in the number and conformation of the integrins bound to the capsid, with the integrin footprint mapping close to the predicted site for the exposed RGD loop on VP1. Comparison of empty and RNA-filled capsid reconstructions showed that the capsid undergoes conformational changes when the genome is released, so that the RNA-capsid interactions in the N termini of VP1 and VP4 are lost, VP4 is removed, and the capsid becomes more porous, as has been reported for poliovirus 1, human rhinovirus 2, enterovirus 71, and coxsackievirus A7. These results are important for understanding the structural basis of integrin binding to CVA9 and the molecular events leading to CVA9 cell entry and uncoating. PMID:23365426

  12. Expression of an Antigenic Adenovirus Epitope in a Group B Coxsackievirus

    PubMed Central

    Höfling, Katja; Tracy, Steven; Chapman, Nora; Kim, Kyung-Soo; Smith Leser, J.

    2000-01-01

    Group B coxsackieviruses (CVB) cause human myocarditis, while human adenovirus type 2 (Ad2) is implicated as an agent of this disease. The L1 loop of the Ad2 hexon protein has been demonstrated to be antigenic in rabbits. To evaluate the feasibility of a multivalent vaccine strain against the CVB and Ad2, we cloned the sequence encoding the Ad2 hexon L1 loop, flanked by dissimilar sequences encoding the protease 2A (2Apro) recognition sites, into the genome of an attenuated strain of CVB type 3 (CVB3/0) at the junction of 2Apro and the capsid protein 1D. Progeny virus (CVB3-PL2-Ad2L1) was obtained following transfection of the construct into HeLa cells. Replication of CVB3-PL2-Ad2L1 in diverse cell cultures demonstrated that the yield of the chimeric virus was between 0.5 to 2 log units less than the parental strain. Western blot analyses of the CVB3 capsid protein 1D in CVB3-PL2-Ad2L1-infected HeLa cells demonstrated production of the expected capsid protein. Viral proteins were detected earlier and in approximately fourfold greater amounts in CVB3-PL2-Ad2L1-infected HeLa cells than in CVB3/0-infected cells. Cleavage of the CVB3-PL2-Ad2L1 polyprotein by 2Apro was slowed, accompanied by an accumulation of the fusion 1D-L1 loop protein. Reverse transcription-PCR sequence analysis of CVB3-PL2-Ad2L1 RNA demonstrated that the Ad2 hexon polypeptide coding sequence was maintained in the chimeric viral genome through at least 10 passages in HeLa cells. Mice inoculated with CVB3-PL2-Ad2L1 demonstrated a brief viremia with no replication detectable in the heart but prolonged replication of virus in the pancreas in the absence of pathologic changes in either organ. CVB3-PL2-Ad2L1 induced binding and neutralizing anti-Ad2 antibodies, in addition to antibodies against CVB3 in mice. CVB3-PL2-Ad2L1 was used to challenge mice previously inoculated with CVB3/0 and with preexisting anti-CVB3 neutralizing-antibody titers; anti-Ad2 neutralizing and binding antibodies were induced in

  13. Nonequilibrium dynamics in amorphous Si3B3N7.

    PubMed

    Hannemann, A; Schön, J C; Jansen, M; Sibani, P

    2005-06-16

    We present extensive numerical investigations of the structural relaxation dynamics of a realistic model of the amorphous high-temperature ceramic a-Si3B3N7, probing the mean-square displacement of the atoms, the bond survival probability, the average energy, the specific heat, and the two-point energy average. Combining the information from these different sources, we identify a transition temperature Tc approximately 2000 K below which the system is no longer ergodic and physical quantities observed over a time t(obs) show a systematic parametric dependence on the waiting time t(w), or age, elapsed after the quench. The aging dynamics "stiffens" as the system becomes older, which is similar to the behavior of highly idealized models such as Ising spin glasses and Lennard-Jones glasses.

  14. Human heart cell proteins interacting with a C-terminally truncated 2A protein of coxsackie B3 virus: identification by the yeast two-hybrid system.

    PubMed

    Zhao, Tiansheng; Huang, Xiaotian; Xia, Yanhua

    2016-04-01

    Protein 2A is a non-structural protein of coxsackievirus B3 (CVB3), an important human pathogen that can cause a variety of human diseases. Protein 2A not only participates in viral life cycle, but also regulates host cell functions; however, the underlying mechanisms remain poorly understood. In order to better understand the molecular mechanisms of CVB3 2A's function, the yeast two-hybrid (Y2H) system was adopted to screen for CVB3 2A interactive proteins in the human heart cDNA library. Full-length 2A shows strong transcriptional activity in yeast cells, which interferes with the application of Y2H system; therefore, a series of 2A deletion mutants were constructed. Analysis of transcriptional self-activation revealed that 2A lost its transcriptional activity after truncation of 60 amino acids (aa) at the N-terminus or deletion of 17 aa at the C-terminus. Choosing the 2A mutant with 17 aa deletion at the C-terminus as the bait protein, four interactive cellular proteins were identified, including TIMP4, MYL2, COX7C, and ENO1. These proteins are mostly related to protein degradation and metabolism. Although the interactions detected by the Y2H system should be considered as preliminary results, the finding of proteins translated from a human heart cDNA library that interacts with the CVB3 2A will stimulate experiments testing the reactivity of a translational mixture derived from that library with full-length 2A protein, followed by co-immunoprecipitation studies.

  15. [Persistent Shallot virus X infection correlates with transcriptional repression of plant cell RNA-dependent RNA polymerase and DCL proteins in plant roots].

    PubMed

    Arkhipov, A V; Solovyev, A G; Vishnichenko, V K

    2017-01-01

    Shallot virus X is a typical representative of Allexiviruses. The transcription levels of principal genes involved in the RNA silencing in healthy and shallot virus X-infected plants have been quantified by real-time polymerase chain reaction. There is a negative correlation between the reproduction rates of RNA virus and the levels of RNA-dependent RNA polymerase and DCL proteins in roots and leaves of infected plants. These observations indicate that Shallot X virus employs noncanonical ways of overcoming the antiviral defense of the plant by systemic RNA silencing.

  16. Disruption of the Coxsackievirus and Adenovirus Receptor-Homodimeric Interaction Triggers Lipid Microdomain- and Dynamin-dependent Endocytosis and Lysosomal Targeting*

    PubMed Central

    Salinas, Sara; Zussy, Charleine; Loustalot, Fabien; Henaff, Daniel; Menendez, Guillermo; Morton, Penny E.; Parsons, Maddy; Schiavo, Giampietro; Kremer, Eric J.

    2014-01-01

    The coxsackievirus and adenovirus receptor (CAR) serves as a docking factor for some adenovirus (AdV) types and group B coxsackieviruses. Its role in AdV internalization is unclear as studies suggest that its intracellular domain is dispensable for some AdV infection. We previously showed that in motor neurons, AdV induced CAR internalization and co-transport in axons, suggesting that CAR was linked to endocytic and long-range transport machineries. Here, we characterized the mechanisms of CAR endocytosis in neurons and neuronal cells. We found that CAR internalization was lipid microdomain-, actin-, and dynamin-dependent, and subsequently followed by CAR degradation in lysosomes. Moreover, ligands that disrupted the homodimeric CAR interactions in its D1 domains triggered an internalization cascade involving sequences in its intracellular tail. PMID:24273169

  17. Characterization of group B coxsackieviruses isolated from non-polio acute flaccid paralysis patients in Pakistan: vital assessment before polio eradication.

    PubMed

    Angez, M; Shaukat, S; Zahra, R; Alam, M M; Sharif, S; Khurshid, A; Arshad, Y; Suleman, M; Mujtaba, G; Zaidi, S S Z

    2017-09-01

    Pakistan is at the verge of polio eradication but isolation of non-polio enteroviruses (NPEVs) from acute flaccid paralysis (AFP) cases may result in serious or even fatal outcome. Many enteroviruses share similar symptoms and epidemiology as is the case with poliovirus and coxsackievirus (CV). The present study was designed to genetically characterize coxsackievirus B (CV-B) serotypes isolated from non-polio acute flaccid paralytic children, as well as to understand their probable role in paralysis. A total of 63 (20·1%) out of 313 stool samples during 2013 were found positive for NPEVs in rhabdomyosarcoma cells. Only 24 (38·0%) NPEVs were typed as CV-B by microneutralization assay and were further characterized by sequencing of the viral protein 1 (VP1) gene. Molecular phylogenetic analyses classified the study strains into six coxsackievirus B serotypes (coxsackievirus B1 to B6) with their respective prototype strains with evidence of epidemiological linkage and distinct clusters. Moreover, four major differences were found within the amino acid sequences of BC-loop in VP1 of CV-B strains. In conclusion, this study presented the molecular evolutionary genetic overview and distinct phylogenetic pattern of CV-B isolates from AFP cases in Pakistan, and explored the possible link between CV-B infections and AFP cases. Furthermore, our data reveal that these viruses might contribute to the incidence of paralysis in population and there is need of time to establish an enterovirus surveillance system for better understanding of epidemiological and virological characteristics of NPEV infections associated with AFP cases in the country.

  18. Visual detection of human enterovirus 71 subgenotype C4 and Coxsackievirus A16 by reverse transcription loop-mediated isothermal amplification with the hydroxynaphthol blue dye.

    PubMed

    Nie, Kai; Zhang, Yong; Luo, Le; Yang, Meng-Jie; Hu, Xiu-Mei; Wang, Miao; Zhu, Shuang-Li; Han, Feng; Xu, Wen-Bo; Ma, Xue-Jun

    2011-08-01

    A sensitive reverse transcription loop-mediated isothermal amplification (RT-LAMP) assay was developed for rapid visual detection of human enterovirus 71 subgenotype C4 (EV71-C4) and Coxsackievirus A16 (CVA16) infection, respectively. The reaction was performed in one step in a single tube at 65°C for 60 min with the addition of the hydroxynaphthol blue (HNB) dye prior to amplification. The detection limits of the RT-LAMP assay were 0.33 and 1.58 of a 50% tissue culture infective dose (TCID(50)) per reaction based on 10-fold dilutions of a titrated EV71 or CVA16 strain, respectively. No cross-reaction was observed with Coxsackievirus A (CVA) viruses (CVA2, 4, 5, 7, 9, 10, 14, and 24), Coxsackievirus B (CVB) viruses (CVB1,2,3,4, and 5) or ECHO viruses (ECHO3, 6, 11, and 19). The assay was further evaluated with 47 clinical stool specimens diagnosed previously with EV71, CVA16 or other human enterovirus infections. Virus isolates from stool samples were confirmed by virus neutralization testing and sequencing. RT-LAMP with HNB dye was demonstrated to be a sensitive and cost-effective assay for rapid visual detection of human EV71-C4 and CVA16. Copyright © 2011 Elsevier B.V. All rights reserved.

  19. In Type 1 Diabetes a Subset of Anti-Coxsackievirus B4 Antibodies Recognize Autoantigens and Induce Apoptosis of Pancreatic Beta Cells

    PubMed Central

    Dolcino, Marzia; Giannattasio, Alessandro; d’Annunzio, Giuseppe; Rigo, Antonella; Pedemonte, Nicoletta; Corrocher, Roberto; Puccetti, Antonio

    2013-01-01

    Type 1 diabetes is characterized by autoimmune destruction of pancreatic beta cells. The role played by autoantibodies directed against beta cells antigens in the pathogenesis of the disease is still unclear. Coxsackievirus B infection has been linked to the onset of type 1 diabetes; however its precise role has not been elucidated yet. To clarify these issues, we screened a random peptide library with sera obtained from 58 patients with recent onset type 1 diabetes, before insulin therapy. We identified an immunodominant peptide recognized by the majority of individual patients’sera, that shares homology with Coxsackievirus B4 VP1 protein and with beta-cell specific autoantigens such as phogrin, phosphofructokinase and voltage-gated L-type calcium channels known to regulate beta cell apoptosis. Antibodies against the peptide affinity-purified from patients’ sera, recognized the viral protein and autoantigens; moreover, such antibodies induced apoptosis of the beta cells upon binding the L-type calcium channels expressed on the beta cell surface, suggesting a calcium dependent mechanism. Our results provide evidence that in autoimmune diabetes a subset of anti-Coxsackievirus antibodies are able to induce apoptosis of pancreatic beta cells which is considered the most critical and final step in the development of autoimmune diabetes without which clinical manifestations do not occur. PMID:23469060

  20. Isolation from Tobacco Mosaic Virus-Infected Tobacco of a Solubilized Template-Specific RNA-Dependent RNA Polymerase Containing a 126K/183K Protein Heterodimer

    PubMed Central

    Watanabe, Takato; Honda, Ayae; Iwata, Akira; Ueda, Susumu; Hibi, Tadaaki; Ishihama, Akira

    1999-01-01

    The complete nucleotide sequence was determined for the putative RNA polymerase (183K protein) gene of tobacco mosaic virus (TMV) OM strain, which differed from the related strain, vulgare, by 51 positions in its nucleotide sequence and 6 residues in its amino acid sequence. Three segments of this 183K protein, each containing the sequence motif of methyltransferase (M), helicase (H), or RNA-dependent RNA polymerase (P), were expressed in Escherichia coli as fusion proteins with hexahistidine tags, and domain-specific antibodies were raised against purified His-tagged M and P polypeptides. By immunoaffinity purification, a template-specific RNA-dependent RNA polymerase containing a heterodimer of the full-length 183K and 126K (an amino-terminal-proximal portion of the 183K protein) viral proteins was isolated. We propose that the TMV RNA polymerase for minus-strand RNA synthesis is composed of one molecule each of the 183- and 126-kDa proteins, possibly together with two or more host proteins. PMID:10074108

  1. Transcriptional profiling and miRNA-dependent regulatory network analysis of longissimus dorsi muscle during prenatal and adult stages in two distinct pig breeds.

    PubMed

    Siengdee, P; Trakooljul, N; Murani, E; Schwerin, M; Wimmers, K; Ponsuksili, S

    2013-08-01

    MicroRNAs (miRNAs) and mRNAs establish a complex regulatory network influencing diverse biological pathways including muscle development and growth. Elucidating miRNA-dependent regulatory networks involved in muscle development could provide additional insights into muscle traits largely predefined during prenatal development. The present study aimed to determine differentially expressed transcripts and functional miRNA-mRNA relationships associated with different stages of skeletal muscle development in two pig breeds, German Landrace and Pietrain, distinct in muscle characteristics. A comparative transcriptional profiling of longissimus dorsi muscle tissues from fetuses at 35, 63 and 91 days post-conception as well as adult pigs (180 days postnatum) was performed using the Affymetrix GeneChip porcine genome microarray. Differential expression patterns were identified to be associated with muscularly developmental stages and breed types. The integration of miRNA expression data and ingenuity pathways analysis (ipa) pathway analysis revealed several miRNA-dependent regulatory networks related to muscle growth and development. The present results provide insights into muscle biology for further improvement of porcine meat quality.

  2. A multi-step strategy to obtain crystals of the dengue virus RNA-dependent RNA polymerase that diffract to high resolution

    SciTech Connect

    Yap, Thai Leong; Chen, Yen Liang; Xu, Ting; Wen, Daying; Vasudevan, Subhash G.; Lescar, Julien

    2007-02-01

    Crystals of the RNA-dependent RNA polymerase catalytic domain from the dengue virus NS5 protein have been obtained using a strategy that included expression screening of naturally occurring serotype variants of the protein, the addition of divalent metal ions and crystal dehydration. These crystals diffract to 1.85 Å resolution and are thus suitable for a structure-based drug-design program. Dengue virus, a member of the Flaviviridae genus, causes dengue fever, an important emerging disease with several million infections occurring annually for which no effective therapy exists. The viral RNA-dependent RNA polymerase NS5 plays an important role in virus replication and represents an interesting target for the development of specific antiviral compounds. Crystals that diffract to 1.85 Å resolution that are suitable for three-dimensional structure determination and thus for a structure-based drug-design program have been obtained using a strategy that included expression screening of naturally occurring serotype variants of the protein, the addition of divalent metal ions and crystal dehydration.

  3. Analysis of astrovirus serotype 1 RNA, identification of the viral RNA-dependent RNA polymerase motif, and expression of a viral structural protein.

    PubMed Central

    Lewis, T L; Greenberg, H B; Herrmann, J E; Smith, L S; Matsui, S M

    1994-01-01

    We report the results from sequence analysis and expression studies of the gastroenteritis agent astrovirus serotype 1. We have cloned and sequenced 5,944 nucleotides (nt) of the estimated 7.2-kb RNA genome and have identified three open reading frames (ORFs). ORF-3, at the 3' end, is 2,361 nt in length and is fully encoded in both the genomic and subgenomic viral RNAs. Expression of ORF-3 in vitro yields an 87-kDa protein that is immunoprecipitated with a monoclonal antibody specific for viral capsids. This protein comigrates with an authentic 87-kDa astrovirus protein immunoprecipitated from infected cells, indicating that this region encodes a viral structural protein. The adjacent upstream ORF (ORF-2) is 1,557 nt in length and contains a viral RNA-dependent RNA polymerase motif. The viral RNA-dependent RNA polymerase motifs from four astrovirus serotypes are compared. Partial sequence (2,018 nt) of the most 5' ORF (ORF-1) reveals a 3C-like serine protease motif. The ORF-1 sequence is incomplete. These results indicate that the astrovirus genome is organized with nonstructural proteins encoded at the 5' end and structural proteins at the 3' end. ORF-2 has no start methionine and is in the -1 frame compared with ORF-1. We present sequence evidence for a ribosomal frameshift mechanism for expression of the viral polymerase. Images PMID:8254779

  4. LNK (SH2B3): paradoxical effects in ovarian cancer

    PubMed Central

    Ding, Ling-Wen; Sun, Qiao-Yang; Lin, De-Chen; Chien, Wenwen; Hattori, Norimichi; Dong, Xue-Ming; Gery, Sigal; Garg, Manoj; Doan, Ngan B.; Said, Jonathan W.; Xiao, Jin-Fen; Yang, Henry; Liu, Li-Zhen; Meng, Xuan; Huang, Ruby Yun-Ju; Tang, Kai; Koeffler, H Phillip

    2014-01-01

    LNK (SH2B3) is an adaptor protein studied extensively in normal and malignant hematopoietic cells. In these cells, it down-regulates activated tyrosine kinases at the cell surface resulting in an antiproliferative effect. To date, no studies have examined activities of LNK in solid tumors. In this study, we found by in silico analysis and staining tissue arrays that the levels of LNK expression were elevated in high grade ovarian cancer. To test the functional importance of this observation, LNK was either overexpressed or silenced in several ovarian cancer cell lines. Remarkably, overexpression of LNK rendered the cells resistant to death induced by either serum starvation or nutrient deprivation, and generated larger tumors using a murine xenograft model. In contrast, silencing of LNK decreased ovarian cancer cell growth in vitro and in vivo. Western blot studies indicated that overexpression of LNK upregulated and extended the transduction of the mitogenic signal, whereas silencing of the LNK produced the opposite effects. Furthermore, forced expression of LNK reduced cell size, inhibited cell migration and markedly enhanced cell adhesion. LC-MS identified 14-3-3 as one of the LNK binding partners. Our results suggest that in contrast to the findings in hematologic malignancies, the adaptor protein LNK acts as a positive signal transduction modulator in ovarian cancers. PMID:24704825

  5. The G2(B3LYP/MP2/CC) Approach: A Modification of the G2(MP2) Approach and a Comparison with B3LYP Results

    NASA Technical Reports Server (NTRS)

    Bauschlicher, Charles W., Jr.; Partridge, Harry; Langhoff, Stephen R. (Technical Monitor)

    1995-01-01

    The quadratic configuration interaction calculation in the G2(MP2) approach is replaced by a coupled-cluster singles and doubles calculation including a perturbational estimate of the triples excitations. In addition, the SCF and MP2 geometry optimizations and SCF frequency calculation in the G2(MP2) approach are replaced by a B3LYP geometry optimization and frequency calculation in the proposed G2(B3LYP/MP2/CC) approach. This simplification does not affect the average absolute deviation from experiment, but decreases the maximum error compared with the G2(MP2) approach. The G2(B3LYP/MP2/CC) results are compared with those obtained using the B3LYP approach, and the G2(B3LYP/MP2/CC) model is found to be more reliable, even if the B3LYP calculations are performed using a large basis set.

  6. Structures and chemical bonding of B3O3 (-/0) and B3O3H(-/0): A combined photoelectron spectroscopy and first-principles theory study.

    PubMed

    Zhao, Li-Juan; Tian, Wen-Juan; Ou, Ting; Xu, Hong-Guang; Feng, Gang; Xu, Xi-Ling; Zhai, Hua-Jin; Li, Si-Dian; Zheng, Wei-Jun

    2016-03-28

    We present a combined photoelectron spectroscopy and first-principles theory study on the structural and electronic properties and chemical bonding of B3O3 (-/0) and B3O3H(-/0) clusters. The concerted experimental and theoretical data show that the global-minimum structures of B3O3 and B3O3H neutrals are very different from those of their anionic counterparts. The B3O3 (-) anion is characterized to possess a V-shaped OB-B-BO chain with overall C2 v symmetry (1A), in which the central B atom interacts with two equivalent boronyl (B≡O) terminals via B-B single bonds as well as with one O atom via a B=O double bond. The B3O3H(-) anion has a Cs (2A) structure, containing an asymmetric OB-B-OBO zig-zag chain and a terminal H atom interacting with the central B atom. In contrast, the C2 v (1a) global minimum of B3O3 neutral contains a rhombic B2O2 ring with one B atom bonded to a BO terminal and that of neutral B3O3H (2a) is also of C2 v symmetry, which is readily constructed from C2 v (1a) by attaching a H atom to the opposite side of the BO group. The H atom in B3O3H(-/0) (2A and 2a) prefers to interact terminally with a B atom, rather than with O. Chemical bonding analyses reveal a three-center four-electron (3c-4e) π hyperbond in the B3O3H(-) (2A) cluster and a four-center four-electron (4c-4e) π bond (that is, the so-called o-bond) in B3O3 (1a) and B3O3H (2a) neutral clusters.

  7. Functional cooperation of miR-125a, miR-125b, and miR-205 in entinostat-induced downregulation of erbB2/erbB3 and apoptosis in breast cancer cells

    PubMed Central

    Wang, S; Huang, J; Lyu, H; Lee, C-K; Tan, J; Wang, J; Liu, B

    2013-01-01

    We reported that the class I HDAC inhibitor entinostat induced apoptosis in erbB2-overexpressing breast cancer cells via downregulation of erbB2 and erbB3. Here, we study the molecular mechanism by which entinostat dual-targets erbB2/erbB3. Treatment with entinostat had no effect on erbB2/erbB3 mRNA, suggesting a transcription-independent mechanism. Entinostat decreased endogenous but not exogenous erbB2/erbB3, indicating it did not alter their protein stability. We hypothesized that entinostat might inhibit erbB2/erbB3 protein translation via specific miRNAs. Indeed, entinostat significantly upregulated miR-125a, miR-125b, and miR-205, that have been reported to target erbB2 and/or erbB3. Specific inhibitors were then used to determine whether these miRNAs had a causal role in entinostat-induced downregulation of erbB2/erbB3 and apoptosis. Transfection with a single inhibitor dramatically abrogated entinostat induction of miR-125a, miR-125b, or miR-205; however, none of the inhibitors blocked entinostat action on erbB2/erbB3. In contrast, co-transfection with two inhibitors not only reduced their corresponding miRNAs, but also significantly abrogated entinostat-mediated reduction of erbB2/erbB3. Moreover, simultaneous inhibition of two, but not one miRNA significantly attenuated entinostat-induced apoptosis. Interestingly, although the other HDAC inhibitors, such as SAHA and panobinostat, exhibited activity as potent as entinostat to induce growth inhibition and apoptosis in erbB2-overexpressing breast cancer cells, they had no significant effects on the three miRNAs. Instead, both SAHA- and panobinostat-decreased erbB2/erbB3 expression correlated with the reduction of their mRNA levels. Collectively, we demonstrate that entinostat specifically induces expression of miR-125a, miR-125b, and miR-205, which act in concert to downregulate erbB2/erbB3 in breast cancer cells. Our data suggest that epigenetic regulation via miRNA-dependent or -independent mechanisms may

  8. Optimization of Potent and Selective Quinazolinediones: Inhibitors of Respiratory Syncytial Virus That Block RNA-Dependent RNA-Polymerase Complex Activity

    PubMed Central

    2015-01-01

    A quinazolinedione-derived screening hit 2 was discovered with cellular antiviral activity against respiratory syncytial virus (CPE EC50 = 2.1 μM), moderate efficacy in reducing viral progeny (4.2 log at 10 μM), and marginal cytotoxic liability (selectivity index, SI ∼ 24). Scaffold optimization delivered analogs with improved potency and selectivity profiles. Most notable were compounds 15 and 19 (EC50 = 300–500 nM, CC50 > 50 μM, SI > 100), which significantly reduced viral titer (>400,000-fold), and several analogs were shown to block the activity of the RNA-dependent RNA-polymerase complex of RSV. PMID:25399509

  9. A strain-specific segment of the RNA-dependent RNA polymerase of grapevine fanleaf virus determines symptoms in Nicotiana species.

    PubMed

    Vigne, Emmanuelle; Gottula, John; Schmitt-Keichinger, Corinne; Komar, Véronique; Ackerer, Léa; Belval, Lorène; Rakotomalala, Lalaina; Lemaire, Olivier; Ritzenthaler, Christophe; Fuchs, Marc

    2013-12-01

    Factors involved in symptom expression of viruses from the genus Nepovirus in the family Secoviridae such as grapevine fanleaf virus (GFLV) are poorly characterized. To identify symptom determinants encoded by GFLV, infectious cDNA clones of RNA1 and RNA2 of strain GHu were developed and used alongside existing infectious cDNA clones of strain F13 in a reverse genetics approach. In vitro transcripts of homologous combinations of RNA1 and RNA2 induced systemic infection in Nicotiana benthamiana and Nicotiana clevelandii with identical phenotypes to WT virus strains, i.e. vein clearing and chlorotic spots on N. benthamiana and N. clevelandii for GHu, respectively, and lack of symptoms on both hosts for F13. The use of assorted transcripts mapped symptom determinants on RNA1 of GFLV strain GHu, in particular within the distal 408 nt of the RNA-dependent RNA polymerase (1E(Pol)), as shown by RNA1 transcripts for which coding regions or fragments derived thereof were swapped. Semi-quantitative analyses indicated no significant differences in virus titre between symptomatic and asymptomatic plants infected with various recombinants. Also, unlike the nepovirus tomato ringspot virus, no apparent proteolytic cleavage of GFLV protein 1E(Pol) was detected upon virus infection or transient expression in N. benthamiana. In addition, GFLV protein 1E(Pol) failed to suppress silencing of EGFP in transgenic N. benthamiana expressing EGFP or to enhance GFP expression in patch assays in WT N. benthamiana. Together, our results suggest the existence of strain-specific functional domains, including a symptom determinant module, on the RNA-dependent RNA polymerase of GFLV.

  10. Analysis of Ribonucleotide 5'-Triphosphate Analogs as Potential Inhibitors of Zika Virus RNA-Dependent RNA Polymerase by Using Nonradioactive Polymerase Assays.

    PubMed

    Lu, Gaofei; Bluemling, Gregory R; Collop, Paul; Hager, Michael; Kuiper, Damien; Gurale, Bharat P; Painter, George R; De La Rosa, Abel; Kolykhalov, Alexander A

    2017-03-01

    Zika virus (ZIKV) is an emerging human pathogen that is spreading rapidly through the Americas and has been linked to the development of microcephaly and to a dramatically increased number of Guillain-Barré syndrome cases. Currently, no vaccine or therapeutic options for the prevention or treatment of ZIKV infections exist. In the study described in this report, we expressed, purified, and characterized full-length nonstructural protein 5 (NS5) and the NS5 polymerase domain (NS5pol) of ZIKV RNA-dependent RNA polymerase. Using purified NS5, we developed an in vitro nonradioactive primer extension assay employing a fluorescently labeled primer-template pair. Both purified NS5 and NS5pol can carry out in vitro RNA-dependent RNA synthesis in this assay. Our results show that Mn(2+) is required for enzymatic activity, while Mg(2+) is not. We found that ZIKV NS5 can utilize single-stranded DNA but not double-stranded DNA as a template or a primer to synthesize RNA. The assay was used to compare the efficiency of incorporation of analog 5'-triphosphates by the ZIKV polymerase and to calculate their discrimination versus that of natural ribonucleotide triphosphates (rNTPs). The 50% inhibitory concentrations for analog rNTPs were determined in an alternative nonradioactive coupled-enzyme assay. We determined that, in general, 2'-C-methyl- and 2'-C-ethynyl-substituted analog 5'-triphosphates were efficiently incorporated by the ZIKV polymerase and were also efficient chain terminators. Derivatives of these molecules may serve as potential antiviral compounds to be developed to combat ZIKV infection. This report provides the first characterization of ZIKV polymerase and demonstrates the utility of in vitro polymerase assays in the identification of potential ZIKV inhibitors.

  11. Analysis of Ribonucleotide 5′-Triphosphate Analogs as Potential Inhibitors of Zika Virus RNA-Dependent RNA Polymerase by Using Nonradioactive Polymerase Assays

    PubMed Central

    Lu, Gaofei; Bluemling, Gregory R.; Collop, Paul; Hager, Michael; Kuiper, Damien; Gurale, Bharat P.; Painter, George R.; De La Rosa, Abel

    2016-01-01

    ABSTRACT Zika virus (ZIKV) is an emerging human pathogen that is spreading rapidly through the Americas and has been linked to the development of microcephaly and to a dramatically increased number of Guillain-Barré syndrome cases. Currently, no vaccine or therapeutic options for the prevention or treatment of ZIKV infections exist. In the study described in this report, we expressed, purified, and characterized full-length nonstructural protein 5 (NS5) and the NS5 polymerase domain (NS5pol) of ZIKV RNA-dependent RNA polymerase. Using purified NS5, we developed an in vitro nonradioactive primer extension assay employing a fluorescently labeled primer-template pair. Both purified NS5 and NS5pol can carry out in vitro RNA-dependent RNA synthesis in this assay. Our results show that Mn2+ is required for enzymatic activity, while Mg2+ is not. We found that ZIKV NS5 can utilize single-stranded DNA but not double-stranded DNA as a template or a primer to synthesize RNA. The assay was used to compare the efficiency of incorporation of analog 5′-triphosphates by the ZIKV polymerase and to calculate their discrimination versus that of natural ribonucleotide triphosphates (rNTPs). The 50% inhibitory concentrations for analog rNTPs were determined in an alternative nonradioactive coupled-enzyme assay. We determined that, in general, 2′-C-methyl- and 2′-C-ethynyl-substituted analog 5′-triphosphates were efficiently incorporated by the ZIKV polymerase and were also efficient chain terminators. Derivatives of these molecules may serve as potential antiviral compounds to be developed to combat ZIKV infection. This report provides the first characterization of ZIKV polymerase and demonstrates the utility of in vitro polymerase assays in the identification of potential ZIKV inhibitors. PMID:27993851

  12. 46 CFR 153.352 - B/3 and 4 m venting system outlets.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 46 Shipping 5 2011-10-01 2011-10-01 false B/3 and 4 m venting system outlets. 153.352 Section 153.352 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES... Cargo Venting Systems § 153.352 B/3 and 4 m venting system outlets. A B/3 or 4 m venting system...

  13. 40 CFR Table B-3 to Subpart B of... - Interferent Test Concentration, Parts per Million

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 40 Protection of Environment 6 2012-07-01 2012-07-01 false Interferent Test Concentration, Parts..., Subpt. B, Table B-3 Table B-3 to Subpart B of Part 53—Interferent Test Concentration, Parts per Million Table B-3 to Subpart B of Part 53—Interferent Test Concentration,1 Parts per Million Pollutant Analyzer...

  14. 7 CFR Exhibit B-3 to Subpart I of... - Pre-Construction and Construction Phase Breakdown

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 13 2011-01-01 2009-01-01 true Pre-Construction and Construction Phase Breakdown B Exhibit B-3 to Subpart I of Part 1944 Agriculture Regulations of the Department of Agriculture (Continued... Assistance Grants Pt. 1944, Subpt. I, Exh. B-3 Exhibit B-3 to Subpart I of Part 1944—Pre-Construction and...

  15. Up-regulated ephrinB3/EphB3 expression in intractable temporal lobe epilepsy patients and pilocarpine induced experimental epilepsy rat model.

    PubMed

    Huang, Hao; Li, Ruohan; Yuan, Jinxian; Zhou, Xin; Liu, Xi; Ou, Shu; Xu, Tao; Chen, Yangmei

    2016-05-15

    EphB family receptor tyrosine kinases, in cooperation with cell surface-bound ephrinB ligands, play a critical role in maintenance of dendritic spine morphogenesis, axons guidance, synaptogenesis, synaptic reorganization and plasticity in the central nervous system (CNS). However, the expression pattern of ephrinB/EphB in intractable temporal lobe epilepsy (TLE) and the underlying molecular mechanisms during epileptogenesis remain poorly understood. Here we investigated the expression pattern and cellular distribution of ephrinB/EphB in intractable TLE patients and lithium chloride-pilocarpine induced TLE rats using real-time quantitative polymerase chain reaction (RT-qPCR), immunohistochemistry, double-labeled immunofluorescence and Western blot analysis. Compared to control groups, ephrinB3 and EphB3 mRNA expression were significantly up-regulated in intractable TLE patients and TLE rats, while the mRNA expression trend of ephrinB1/2 and EphB1/2/4/6 in intractable TLE patients and TLE rats were inconsistent. Western blot analysis and semi-quantitative immunohistochemistry confirmed that ephrinB3 and EphB3 protein level were up-regulated in intractable TLE patients and TLE rats. At the same time, double-labeled immunofluorescence indicate that ephrinB3 was expressed mainly in the cytoplasm and protrusions of glia and neurons, while EphB3 was expressed mainly in the cytoplasm of neurons. Taken together, up-regulated expression of ephrinB3/EphB3 in intractable TLE patients and experimental TLE rats suggested that ephrinB3/EphB3 might be involved in the pathogenesis of TLE. Copyright © 2016 Elsevier B.V. All rights reserved.

  16. The Epidemiological Study of Coxsackievirus A6 revealing Hand, Foot and Mouth Disease Epidemic patterns in Guangdong, China

    PubMed Central

    Zeng, Hanri; Lu, Jing; Zheng, Huanying; Yi, Lina; Guo, Xue; Liu, Leng; Rutherford, Shannon; Sun, Limei; Tan, Xiaohua; Li, Hui; Ke, Changwen; Lin, Jinyan

    2015-01-01

    Enterovirus A71 (EVA71) and Coxsackievirus A16 (CVA16) are regarded as the two major causative pathogens in hand, foot and mouth disease (HFMD) epidemics. However, CVA6, previously largely ignored, became the predominant pathogen in China in 2013. In this study, we describe the epidemiological trendsofCVA6 during the annual HFMD outbreaks from 2008 to 2013 in Guangdong, China. The study results show that CVA6 has been one of three major causative agents of HFMD epidemics since 2009. The periodic rotation and dominance of the three pathogens, EVA71, CVA16 and CVA6, may have contributed to the continuously increasing HFMD epidemics. Moreover, phylogenetic analysis of the VP1 gene shows that major circulating CVA6 strains collected from 2009 to 2013 are distinct from the earlier strains collected before 2009. In conclusion, the discovery from this research investigating epidemiological trends of CVA6 from 2008 to 2013 explains the possible pattern of the continuous HFMD epidemic in China. The etiological change pattern also highlights the need for improvement for pathogen surveillance and vaccine strategies for HFMD control in China. PMID:25993899

  17. Mice depleted of the coxsackievirus and adenovirus receptor display normal spermatogenesis and an intact blood-testis barrier.

    PubMed

    Sultana, Taranum; Hou, Mi; Stukenborg, Jan-Bernd; Töhönen, Virpi; Inzunza, Jose; Chagin, Andrei S; Sollerbrant, Kerstin

    2014-06-01

    The coxsackievirus and adenovirus receptor (CXADR (CAR)) is a cell adhesion molecule expressed mainly in epithelial cells. Numerous evidence indicate that CXADR has an important role in testis development and function of the blood-testis barrier (BTB) in vitro. The role of CXADR in testis physiology in vivo has, however, not been addressed. We therefore constructed a conditional CXADR knockout (cKO) mouse model in which CXADR can be depleted at any chosen timepoint by the administration of tamoxifen. We report for the first time that testicular depletion of CXADR in adult and pubertal mice does not alter BTB permeability or germ cell migration across the BTB during spermatogenesis. Adult cKO mice display normal junctional ultra-structure and localization of the junctional proteins claudin-3, occludin, junction-associated molecule-A (JAM-A), and ZO1. The BTB was intact with no leakage of biotin and lanthanum tracers into the tubular lumen. Adult CXADR cKO mice were fertile with normal sperm parameters and litter size. Breeding experiments and genotyping of the pups demonstrated that CXADR-negative sperm could fertilize WT eggs. In addition, knocking down CXADR from postnatal day 9 (P9) does not affect testicular development and BTB formation. These cKO mice were analyzed at P49 and P90 and display an intact barrier and uncompromised fertility. We conclude that CXADR possesses no direct role in testicular physiology in vivo. © 2014 Society for Reproduction and Fertility.

  18. Two Genotypes of Coxsackievirus A2 Associated with Hand, Foot, and Mouth Disease Circulating in China since 2008

    PubMed Central

    Yang, Qian; Zhang, Yong; Yan, Dongmei; Zhu, Shuangli; Wang, Dongyan; Ji, Tianjiao; Li, Xiaolei; Song, Yang; Gu, Xinrui; Xu, Wenbo

    2016-01-01

    Coxsackievirus A2 (CV-A2) has been frequently detected and commonly associated with hand, foot, and mouth disease (HFMD) in China since 2008. However, limited sequences of CV-A2 are currently available. As a result, we have been focusing on the genetic characteristics of CV-A2 in the mainland of China during 2008–2015 based on national HFMD surveillance. In this study, 20 CV-A2 strains were isolated and phylogenetic analyses of the VP1 sequences were performed. Full-length genome sequences of two representative CV-A2 isolates were acquired and similarity plot and bootscanning analyses were performed. The phylogenetic dendrogram indicated that all CV-A2 strains could be divided into four genotypes (Genotypes A–D). The CV-A2 prototype strain (Fleetwood) was the sole member of genotype A. From 2008 to 2015, the CV-A2 strains isolated in China dispersed into two different genotypes (B and D). And the genotype D became the dominant circulating strains in China. Strains isolated in Russia and India from 2005 to 2011 converged into genotype C. Intertypic recombination occurred between the Chinese CV-A2 strains and other enterovirus-A donor sequences. This result reconfirmed that recombination is a common phenomenon among enteroviruses. This study helps expand the numbers of whole virus genome sequence and entire VP1 sequence of CV-A2 in the GenBank database for further researcher. PMID:28030650

  19. A novel inactivated enterovirus 71 vaccine can elicit cross-protective immunity against coxsackievirus A16 in mice.

    PubMed

    Yang, Lisheng; Liu, Yajing; Li, Shuxuan; Zhao, Huan; Lin, Qiaona; Yu, Hai; Huang, Xiumin; Zheng, Qingbing; Cheng, Tong; Xia, Ningshao

    2016-11-21

    Hand, foot, and mouth disease (HFMD) is a highly contagious disease that mainly affects infants and children. Enterovirus 71 (EV71) and coxsackievirus A16 (CA16) are the major pathogens of HFMD. Two EV71 vaccines were recently licensed in China and the administration of the EV71 vaccines is believed to significantly reduce the number of HFMD-related severe or fatal cases. However, a monovalent EV71 vaccine cannot cross-protect against CA16 infection, this may result in that it cannot effectively control the overall HFMD epidemic. In this study, a chimeric EV71, whose VP1/210-225 epitope was replaced by that of CA16, was constructed using a reverse genetics technique to produce a candidate EV71/CA16 bivalent vaccine strain. The chimeric EV71 was infectious and showed similar growth characteristics as its parental strain. The replacement of the VP1/210-225 epitope did not significantly affect the antigenicity and immunogenicity of EV71. More importantly, the chimeric EV71 could induce protective immunity against both EV71 and CA16, and protect neonatal mice against either EV71 or CA16 lethal infections, the chimeric EV71 constructed in this study was shown to be a feasible and promising candidate bivalent vaccine against both EV71 and CA16. The construction of a chimeric enterovirus also provides an alternative platform for broad-spectrum HFMD vaccines development.

  20. Coxsackievirus A16 induced neurological disorders in young gerbils which could serve as a new animal model for vaccine evaluation

    PubMed Central

    Sun, Yi-Sheng; Li, Ya-jing; Xia, Yong; Xu, Fang; Wang, Wei-wei; Yang, Zhang-Nv; Lu, Hang-Jing; Chen, Zhi-Ping; Miao, Zi-Ping; Liang, Wei-Feng; Xu, Zhi-Yao; Dong, Hong-Jun; Qiu, Dan-Hong; Zhu, Zhi-Yong; van der Veen, Stijn; Qian, Jie; Zhou, Bin; Yao, Ping-Ping; Zhu, Han-Ping

    2016-01-01

    Coxsackievirus A16 (CA16) is one of the major pathogens associated with human hand, foot, and mouth disease (HFMD) in the Asia-pacific region. Although CA16 infections are generally mild, severe neurological manifestations or even death has been reported. Studies on CA16 pathogenesis and vaccine development are severely hampered because the small animal models that are currently available show major limitations. In this study, gerbils (Meriones unguiculatus) were investigated for their suitability as an animal model to study CA16 pathogenesis and vaccine development. Our results showed that gerbils up to the age of 21 days were fully susceptible to CA16 and all died within five days post-infection. CA16 showed a tropism towards the skeletal muscle, spinal cord and brainstem of gerbils, and severe lesions, including necrosis, were observed. In addition, an inactivated CA16 whole-virus vaccine administrated to gerbils was able to provide full protection to the gerbils against lethal doses of CA16 strains. These results demonstrate that gerbils are a suitable animal model to study CA16 infection and vaccine development. PMID:27667023

  1. Identification of a nucleotide in 5′ untranslated region contributing to virus replication and virulence of Coxsackievirus A16

    PubMed Central

    Li, Zhaolong; Liu, Xin; Wang, Shaohua; Li, Jingliang; Hou, Min; Liu, Guanchen; Zhang, Wenyan; Yu, Xiao-Fang

    2016-01-01

    Coxsackievirus A16 (CA16) and enterovirus 71 (EV71) are two main causative pathogens of hand, foot and mouth disease (HFMD). Unlike EV71, virulence determinants of CA16, particularly within 5′ untranslated region (5′UTR), have not been investigated until now. Here, a series of nucleotides present in 5′UTR of lethal but not in non-lethal CA16 strains were screened by aligning nucleotide sequences of lethal circulating Changchun CA16 and the prototype G10 as well as non-lethal SHZH05 strains. A representative infectious clone based on a lethal Changchun024 sequence and infectious mutants with various nucleotide alterations in 5′UTR were constructed and further investigated by assessing virus replication in vitro and virulence in neonatal mice. Compared to the lethal infectious clone, the M2 mutant with a change from cytosine to uracil at nucleotide 104 showed weaker virulence and lower replication capacity. The predicted secondary structure of the 5′UTR of CA16 RNA showed that M2 mutant located between the cloverleaf and stem-loop II, affected interactions between the 5′UTR and the heterogeneous nuclear ribonucleoprotein K (hnRNP K) and A1 (hnRNP A1) that are important for translational activity. Thus, our research determined a virulence-associated site in the 5′UTR of CA16, providing a crucial molecular target for antiviral drug development. PMID:26861413

  2. Virus-Like Particles Produced in Pichia Pastoris Induce Protective Immune Responses Against Coxsackievirus A16 in Mice

    PubMed Central

    Feng, Qianjin; He, Yaqing; Lu, Jiahai

    2016-01-01

    Background Coxsackievirus A16 (CA16) is one of the main causative agents of hand, foot, and mouth disease (HFMD), and the development of a safe and effective vaccine has been a top priority among CA16 researchers. Material/Methods In this study, we developed a Pichia pastoris yeast system for secretory expression of the virus-like particles (VLPs) for CA16 by co-expression of the P1 and 3CD proteins of CA16. SDS-PAGE, Western blot, and transmission electron microscopy (TEM) were performed to identify the formation of VLPs. Immunogenicity and vaccine efficacy of the CA16 VLPs were assessed in BABL/c mouse models. Results Biochemical and biophysical analysis showed that the yeast-expressed CA16 VLPs were composed of VP0, VP1, and VP3 capsid subunit proteins, and present spherical particles with a diameter of 30 nm, similar to the parental infectious CA16 virus. Furthermore, CA16 VLPs elicited potent humoral and cellular immune responses, and VLPs-immunized sera conferred efficient protection to neonatal mice against lethal CA16 challenge. Conclusions Our results demonstrate that VLPs produced in Pichia pastoris represent a safe and effective vaccine strategy for CA16. PMID:27659054

  3. Coxsackievirus and adenovirus receptor (CAR) mediates atrioventricular-node function and connexin 45 localization in the murine heart

    PubMed Central

    Lim, Byung-Kwan; Xiong, Dingding; Dorner, Andrea; Youn, Tae-Jin; Yung, Aaron; Liu, Taylor I.; Gu, Yusu; Dalton, Nancy D.; Wright, Adam T.; Evans, Sylvia M.; Chen, Ju; Peterson, Kirk L.; McCulloch, Andrew D.; Yajima, Toshitaka; Knowlton, Kirk U.

    2008-01-01

    The coxsackievirus and adenovirus receptor (CAR) is a transmembrane protein that belongs to the family of adhesion molecules. In the postnatal heart, it is localized predominantly at the intercalated disc, where its function is not known. Here, we demonstrate that a first degree or complete block of atrioventricular (AV) conduction developed in the absence of CAR in the adult mouse heart and that prolongation of AV conduction occurred in the embryonic heart of the global CAR-KO mouse. In the cardiac-specific CAR-KO (CAR-cKO) mouse, we observed the loss of connexin 45 localization to the cell-cell junctions of the AV node but preservation of connexin 40 and 43 in contracting myocardial cells and connexin 30.2 in the AV node. There was also a marked decrease in β-catenin and zonula occludens-1 (ZO-1) localization to the intercalated discs of CAR-cKO mouse hearts at 8 weeks before the mice developed cardiomyopathy at 21 weeks of age. We also found that CAR formed a complex with connexin 45 via its PSD-95/DigA/ZO-1–binding (PDZ-binding) motifs. We conclude that CAR expression is required for normal AV-node conduction and cardiac function. Furthermore, localization of connexin 45 at the AV-node cell-cell junction and of β-catenin and ZO-1 at the ventricular intercalated disc are dependent on CAR. PMID:18636119

  4. Elimination of representative contaminant candidate list viruses, coxsackievirus, echovirus, hepatitis A virus, and norovirus, from water by coagulation processes.

    PubMed

    Shirasaki, N; Matsushita, T; Matsui, Y; Murai, K; Aochi, A

    2017-03-15

    We examined the removal of representative contaminant candidate list (CCL) viruses (coxsackievirus [CV] B5, echovirus type [EV] 11, and hepatitis A virus [HAV] IB), recombinant norovirus virus-like particles (rNV-VLPs), and murine norovirus (MNV) type 1 by coagulation. Water samples were subjected to coagulation with polyaluminum chloride (PACl, basicity 1.5) followed by either settling or settling and filtration. Together with our previously published results, the removal ratio order, as evaluated by a plaque-forming-unit method or an enzyme-linked immunosorbent assay after settling, was HAV>EV=rNV-VLPs≥CV=poliovirus type 1=MNV>adenovirus type 40 (range, 0.1-2.7-log10). Infectious HAV was likely inactivated by the PACl and therefore was removed to a greater extent than the other viruses. A nonsulfated high-basicity PACl (basicity 2.1), removed the CCL viruses more efficiently than did two other sulfated PACls (basicity 1.5 or 2.1), alum, or ferric chloride. We also examined the removal ratio of two bacteriophages. The removal ratios for MS2 tended to be larger than those of the CCL viruses, whereas those for φX174 were comparable with or smaller than those of the CCL viruses. Therefore, φX174 may be a useful conservative surrogate for CCL viruses during coagulation.

  5. Impact of Coxsackievirus A6 emergence on hand, foot, and mouth disease epidemic in Osaka City, Japan.

    PubMed

    Kanbayashi, Daiki; Kaida, Atsushi; Yamamoto, Seiji P; Hirai, Yuki; Kubo, Hideyuki; Fujimori, Ryoko; Hakui, Noritaka; Hirokawa, Hidetetsu; Iritani, Nobuhiro

    2017-08-03

    Hand, foot, and mouth disease (HFMD) is an acute febrile illness characterized by fever; sore throat; and vesicular eruptions on the hands, feet, and oral mucosa. Until 2010, HFMD was predominantly associated with enterovirus (EV) A71 and coxsackievirus (CV) A16 in Japan. In 2011, CV-A6 emerged as a primary causative agent, causing the largest HFMD epidemic in Japan since 1981. Since then, CV-A6 has caused large HFMD epidemics every 2 years. The phylogenetic analysis of complete Viral Protein 1 (VP1) sequences revealed that most CV-A6 strains detected from 2011 to 2015 in Osaka City were classified into a different clade compared with CV-A6 strains detected from 1999 until 2009. The majority of CV-A6 strains detected in 2011 and most CV-A6 strains detected from 2013 to 2015 were mainly divided into two distinct genetic groups. Each epidemic strain carried unique amino acid substitutions in the presumed DE, EF, and GH loops of the VP1 protein that is exposed on the surface of the virion. There is a possibility that the appearance of substitutions on the surface of the virion and an accumulation of a susceptible population are significant factors in recent HFMD epidemics. © 2017 Wiley Periodicals, Inc.

  6. Etiology of acute conjunctivitis due to coxsackievirus A24 variant, human adenovirus, herpes simplex virus, and Chlamydia in Beijing, China.

    PubMed

    Li, Jie; Yang, Yongsheng; Lin, Changying; Li, Weihong; Yang, Yang; Zhang, Yong; Jia, Lei; Li, Xitai; Chen, Lijuan; Wang, Quanyi

    2014-01-01

    Acute conjunctivitis is a common disease associated with high morbidity and economic burden. To clarify the etiological characteristics of acute conjunctivitis in Beijing, surveillance of acute conjunctivitis was conducted from July to October during 2007-2012 by collecting eye swabs from patients treated at surveillance hospitals affiliated with a surveillance program of 18 districts Center for Disease Prevention and Control in Beijing. Coxsackievirus A24 variant (CA24v), enterovirus 70 (EV70), human adenovirus (HAdV), herpes simplex virus (HSV), and chlamydia were identified by PCR. Phylogenetic analysis of the VP1 region of CA24v was conducted. Comparisons of proportions and statistical significance were performed using the chi-square test. HAdV was found to be the most prevalent pathogen, followed by CA24v, chlamydia, and HSV. Significant differences in the symptoms of ocular pain, photophobia, and epiphora were identified among the 4 agents. The prevalence of HAdV- and CA24v-mediated conjunctivitis peaked in July or August and September or October, respectively. Nucleotide sequences of the VP1 regions among the isolated CA24v strains shared 92.8%-100% homology. In conclusion, HAdV followed by CA24v, chlamydia, and HSV were the most common causative agents of acute conjunctivitis in Beijing. Comprehensive, continuous surveillance and advanced laboratory techniques are needed for further studies.

  7. A major outbreak of conjunctivitis caused by coxsackievirus A24, Réunion, January to April 2015.

    PubMed

    Marguerite, Nadège; Brottet, Elise; Pagès, Frédéric; Jaffar-Bandjee, Marie Christine; Schuffenecker, Isabelle; Josset, Laurence; Vilain, Pascal; Filleul, Laurent

    2016-06-30

    From January to April 2015, Réunion experienced a major outbreak of acute haemorrhagic conjunctivitis (AHC) caused by coxsackievirus A24, which heavily impacted the healthcare system. According to the general practitioners' (GP) sentinel network, the number of medical consultations due to conjunctivitis during this period was estimated at ca 100,000. This report describes the characteristics of the outbreak, which were obtained through several different yet complementary surveillance systems on the island. These included the network of hospital emergency departments (OSCOUR network), the GPs' sentinel network, an Internet-based population cohort ('Koman i lé') participating in a survey on distinct symptoms including 'red eyes' and the monitoring of eye drop sales. Overall the results of the different surveillance approaches were in good agreement regarding the outbreak dynamic. A peak of patients with conjunctivitis was detected in the first 15 days of March (week 10 and 11), coinciding with increased eye drop sales on the island. Strains recovered from outbreak cases belonged to genotype IV and were most closely related to strains identified in AHC outbreaks in China, Egypt and Japan since 2010. Continued surveillance of AHC in Réunion remains important not only locally, but also because frequent exchanges between the island and mainland France may lead to introduction of this virus in Europe. This article is copyright of The Authors, 2016.

  8. 5' terminal deletions in the genome of a coxsackievirus B2 strain occurred naturally in human heart

    PubMed Central

    Chapman, Nora M.; Kim, Kyung-Soo; Drescher, Kristen M.; Oka, Kuniyuki; Tracy, Steven

    2008-01-01

    Enteroviruses can induce human myocarditis, which can be modeled in mice inoculated with group B coxsackieviruses (CVB) and in which CVB evolve to produce defective, terminally deleted genomes. The 5' non-translated region (NTR) was enzymatically amplified from heart tissue of a fatal case of enterovirus-associated myocarditis in Japan in 2002. While no intact 5' viral genomic termini were detected, 5' terminal deletions ranged in size from 22−36 nucleotides. Sequence of the 5' third of this viral genome is of a modern strain, closely related to CVB2 strains isolated in Japan in 2002. A CVB3 chimera containing the 5’ NTR with a 22 nt deletion produced progeny virus upon transfection of HeLa cells. When the 5' 22 nucleotide deletion was repaired, the virus induced myocarditis in mice and replicated like wild-type virus in murine heart cells. This is the first report of these naturally occurring defective enteroviral genomes in human myocarditis. PMID:18378272

  9. Virus antibody survey in different European populations indicates risk association between coxsackievirus B1 and type 1 diabetes.

    PubMed

    Oikarinen, Sami; Tauriainen, Sisko; Hober, Didier; Lucas, Bernadette; Vazeou, Andriani; Sioofy-Khojine, Amirbabak; Bozas, Evangelos; Muir, Peter; Honkanen, Hanna; Ilonen, Jorma; Knip, Mikael; Keskinen, Päivi; Saha, Marja-Terttu; Huhtala, Heini; Stanway, Glyn; Bartsocas, Christos; Ludvigsson, Johnny; Taylor, Keith; Hyöty, Heikki

    2014-02-01

    Enteroviruses (EVs) have been connected to type 1 diabetes in various studies. The current study evaluates the association between specific EV subtypes and type 1 diabetes by measuring type-specific antibodies against the group B coxsackieviruses (CVBs), which have been linked to diabetes in previous surveys. Altogether, 249 children with newly diagnosed type 1 diabetes and 249 control children matched according to sampling time, sex, age, and country were recruited in Finland, Sweden, England, France, and Greece between 2001 and 2005 (mean age 9 years; 55% male). Antibodies against CVB1 were more frequent among diabetic children than among control children (odds ratio 1.7 [95% CI 1.0-2.9]), whereas other CVB types did not differ between the groups. CVB1-associated risk was not related to HLA genotype, age, or sex. Finnish children had a lower frequency of CVB antibodies than children in other countries. The results support previous studies that suggested an association between CVBs and type 1 diabetes, highlighting the possible role of CVB1 as a diabetogenic virus type.

  10. Differential cell autonomous responses determine the outcome of coxsackievirus infections in murine pancreatic α and β cells

    PubMed Central

    Marroqui, Laura; Lopes, Miguel; dos Santos, Reinaldo S; Grieco, Fabio A; Roivainen, Merja; Richardson, Sarah J; Morgan, Noel G; Op de beeck, Anne; Eizirik, Decio L

    2015-01-01

    Type 1 diabetes (T1D) is an autoimmune disease caused by loss of pancreatic β cells via apoptosis while neighboring α cells are preserved. Viral infections by coxsackieviruses (CVB) may contribute to trigger autoimmunity in T1D. Cellular permissiveness to viral infection is modulated by innate antiviral responses, which vary among different cell types. We presently describe that global gene expression is similar in cytokine-treated and virus-infected human islet cells, with up-regulation of gene networks involved in cell autonomous immune responses. Comparison between the responses of rat pancreatic α and β cells to infection by CVB5 and 4 indicate that α cells trigger a more efficient antiviral response than β cells, including higher basal and induced expression of STAT1-regulated genes, and are thus better able to clear viral infections than β cells. These differences may explain why pancreatic β cells, but not α cells, are targeted by an autoimmune response during T1D. DOI: http://dx.doi.org/10.7554/eLife.06990.001 PMID:26061776

  11. Systematic Identification and Bioinformatic Analysis of MicroRNAs in Response to Infections of Coxsackievirus A16 and Enterovirus 71

    PubMed Central

    Qi, Yuhua; Fan, Huan; Cui, Lunbiao; Shi, Zhiyang

    2016-01-01

    Hand, foot, and mouth disease (HFMD), mainly caused by coxsackievirus A16 (CVA16) and enterovirus 71 (EV71) infections, remains a serious public health issue with thousands of newly diagnostic cases each year since 2008 in China. The mechanisms underlying viral infection, however, are elusive to date. In the present study, we systematically investigated the host cellular microRNA (miRNA) expression patterns in response to CVA16 and EV71 infections. Through microarray examination, 27 miRNAs (15 upregulated and 12 downregulated) were found to be coassociated with the replication process of two viruses, while the expression levels of 15 and 5 miRNAs were significantly changed in CVA16- and EV71-infected cells, respectively. A great number of target genes of 27 common differentially expressed miRNAs were predicted by combined use of two computational target prediction algorithms, TargetScan and MiRanda. Comprehensive bioinformatic analysis of target genes in GO categories and KEGG pathways indicated the involvement of diverse biological functions and signaling pathways during viral infection. These results provide an overview of the roles of miRNAs in virus-host interaction, which will contribute to further understanding of HFMD pathological mechanisms. PMID:27843944

  12. Coxsackievirus and adenovirus receptor (CAR) mediates trafficking of acid sensing ion channel 3 (ASIC3) via PSD-95.

    PubMed

    Excoffon, Katherine J D A; Kolawole, Abimbola O; Kusama, Nobuyoshi; Gansemer, Nicholas D; Sharma, Priyanka; Hruska-Hageman, Alesia M; Petroff, Elena; Benson, Christopher J

    2012-08-17

    We have previously shown that the Coxsackievirus and adenovirus receptor (CAR) can interact with post-synaptic density 95 (PSD-95) and localize PSD-95 to cell-cell junctions. We have also shown that activity of the acid sensing ion channel (ASIC3), a H(+)-gated cation channel that plays a role in mechanosensation and pain signaling, is negatively modulated by PSD-95 through a PDZ-based interaction. We asked whether CAR and ASIC3 simultaneously interact with PSD-95, and if so, whether co-expression of these proteins alters their cellular distribution and localization. Results indicate that CAR and ASIC3 co-immunoprecipitate only when co-expressed with PSD-95. CAR also brings both PSD-95 and ASIC3 to the junctions of heterologous cells. Moreover, CAR rescues PSD-95-mediated inhibition of ASIC3 currents. These data suggest that, in addition to activity as a viral receptor and adhesion molecule, CAR can play a role in trafficking proteins, including ion channels, in a PDZ-based scaffolding complex. Copyright © 2012 Elsevier Inc. All rights reserved.

  13. The difficult-to-cultivate coxsackieviruses A can productively multiply in primary culture of mouse skeletal muscle.

    PubMed

    Nsaibia, Siwar; Wagner, Stéphanie; Rondé, Philippe; Warter, Jean-Marie; Poindron, Philippe; Aouni, Mahjoub; Dorchies, Olivier M

    2007-01-01

    Coxsackieviruses A (CVA) are associated with several clinical manifestations such as aseptic meningitis and paralytic syndromes in humans. Most CVA are difficult-to-cultivate, which impedes their propagation and isolation from clinical material. Here, we tested the ability of cultivable (CVA-13, CVA-14), and difficult-to-cultivate (CVA-6, CVA-22) strains to infect primary cultures of skeletal muscle cells established from newborn mice. We found that such cultures sustained the multiplication of these CVA, as evidenced by the development of a cytopathic effect, already in the initial preparation or after passaging once. Cultures established for no more than 24h were sensitive to infection whereas older preparations were resistant. Using confocal microscopy after double-immunolabeling of the VP1 capsid protein and the muscle cell marker myosin, we demonstrated that only the myoblasts were infected, resulting in VP1 expression throughout their cytoplasm. Inoculation of infected cultures to suckling mice resulted in paralysis indicating that infection was productive. The nature of candidate receptors for virus entry in such cultures and the influence of cell culture conditions on the expression of these putative receptors are discussed. This work suggests that primary cultures of skeletal muscle cells could be used to propagate and isolate any CVA strain.

  14. Genomic characterization of coxsackievirus type A24 strains associated with acute flaccid paralysis and rarely identified Hopkins syndrome.

    PubMed

    Laxmivandana, Rongala; Yergolkar, Prasanna; Rajeshwari, Mannapur; Chitambar, Shobha D

    2014-11-01

    The full-length genome sequence analysis of four coxsackievirus A24 (CV-A24) strains, detected in three paralytic and one post-asthmatic paralytic (Hopkins syndrome) cases, is reported here for the first time. A phylogenetic tree constructed on the basis of entire genomes displayed topology similar to that of the full-VP1 tree, classifying the study strains in genogroup CV-A24vGIV along with their temporal counterparts in strains from non-paralytic cases. The strains of the study formed a single genetic cluster C4 within CV-A24vGIV and showed 3.5-19.4 % nucleotide sequence divergence, with 2-4 novel nucleotide mutations in the 5'NCR and 3-8 unique amino acid substitutions in the polyprotein, with respect to the CV-A24 strains associated with non-paralytic cases. Among the nucleotide mutations, A299U was identified in the 5'NCRs of all of the study strains. CV-A24v strains of the same genogroup with few genomic variations but different disease manifestations need to be explored to investigate the molecular basis of evolution of neurovirulence.

  15. Differential Expression of OATP1B3 Mediates Unconjugated Testosterone Influx.

    PubMed

    Sissung, Tristan M; Ley, Ariel M; Strope, Jonathan D; McCrea, Edel M; Beedie, Shaunna L; Peer, Cody J; Shukla, Suneet; van Velkinburgh, Jennifer C; Reece, Kelie; Troutman, Sarah; Campbell, Tessa; Fernandez, Elena; Huang, Phoebe; Smith, Jordan; Thakkar, Nilay; Venzon, David; Brenner, Steffan; Lee, Wooin; Merino, Maria J; Luo, Ji; Jager, Walter; Chau, Cindy H; Price, Douglas K; Figg, William D

    2017-04-07

    Castration resistant prostate cancer (CRPC) has greater intratumoral testosterone concentrations than similar tumors from eugonadal men; simple diffusion does not account for this observation. The present study was undertaken to ascertain the androgen uptake kinetics, functional, and clinical relevance of de novo expression of the steroid hormone transporter OATP1B3 (SLCO1B3). Experiments testing the cellular uptake of androgens suggest that testosterone is an excellent substrate of OATP1B3 (KM=23.2µM; VMAX=321.6pmol/mg/min), and cells expressing a doxycycline-inducible SLCO1B3 construct had greater uptake of a clinically relevant concentration of 3H-testosterone (50nM; 1.6-fold, P=0.0027). When compared to Slco1b2 (-/-) mice, Slco1b2 (-/-)/hSLCO1B3 knockins had greater hepatic uptake (15% greater AUC, P=0.0040) and lower plasma exposure to 3H-testosterone (17% lower AUC, P=0.0030). Of 82 transporters genes, SLCO1B3 is the second-most differentially-expressed transporter in CRPC cell lines (116-fold vs androgen sensitive cells), with a differentially-spliced cancer-type ct-SLCO1B3 making up the majority of SLCO1B3 expression. Overexpression of SLCO1B3 in androgen responsive cells results in 1.5- to 2-fold greater testosterone uptake whereas siRNA knockdown of SLCO1B3 in CRPC cells did not change intracellular testosterone concentration. Primary human prostate tumors express SLCO1B3 to a greater extent than ct-SLCO1B3 (26% of total SLCO1B3 expression vs 0.08%), suggesting that androgen uptake in these tumor cells also is greater. Non-liver tumors do not differentially express SLCO1B3.

  16. Antiviral activity of Lactobacillus reuteri Protectis against Coxsackievirus A and Enterovirus 71 infection in human skeletal muscle and colon cell lines.

    PubMed

    Ang, Lei Yin Emily; Too, Horng Khit Issac; Tan, Eng Lee; Chow, Tak-Kwong Vincent; Shek, Pei-Chi Lynette; Tham, Elizabeth; Alonso, Sylvie

    2016-06-24

    Recurrence of hand, foot and mouth disease (HFMD) pandemics continues to threaten public health. Despite increasing awareness and efforts, effective vaccine and drug treatment have yet to be available. Probiotics have gained recognition in the field of healthcare worldwide, and have been extensively prescribed to babies and young children to relieve gastrointestinal (GI) disturbances and diseases, associated or not with microbial infections. Since the faecal-oral axis represents the major route of HFMD transmission, transient persistence of probiotic bacteria in the GI tract may confer some protection against HFMD and limit transmission among children. In this work, the antiviral activity of two commercially available probiotics, namely Lactobacillus reuteri Protectis (L. reuteri Protectis) and Lactobacillus casei Shirota (L. casei Shirota), was assayed against Coxsackieviruses and Enterovirus 71 (EV71), the main agents responsible for HFMD. In vitro infection set-ups using human skeletal muscle and colon cell lines were designed to assess the antiviral effect of the probiotic bacteria during entry and post-entry steps of the infection cycle. Our findings indicate that L. reuteri Protectis displays a significant dose-dependent antiviral activity against Coxsackievirus type A (CA) strain 6 (CA6), CA16 and EV71, but not against Coxsackievirus type B strain 2. Our data support that the antiviral effect is likely achieved through direct physical interaction between bacteria and virus particles, which impairs virus entry into its mammalian host cell. In contrast, no significant antiviral effect was observed with L. casei Shirota. Should the antiviral activity of L. reuteri Protectis observed in vitro be translated in vivo, such probiotics-based therapeutic approach may have the potential to address the urgent need for a safe and effective means to protect against HFMD and limit its transmission among children.

  17. Plexin B3 promotes neurite outgrowth, interacts homophilically, and interacts with Rin

    PubMed Central

    Hartwig, Christine; Veske, Andres; Krejcova, Sarka; Rosenberger, Georg; Finckh, Ulrich

    2005-01-01

    Background Plexins, known to date as receptors of semaphorins, are implicated in semaphorin-mediated axon repulsion and growth cone collapse. However, subtype-specific functions of the majority of the nine members of the mammalian plexin family are largely unknown. In order to investigate functional properties of B-plexins, we analyzed the expression of human and murine plexin B3 and expressed full-length human plexins B2 (B2) and B3 (B3) in NIH-3T3 cells. Results Unexpectedly, B3 strongly and B2 moderately stimulate neurite outgrowth of primary murine cerebellar neurons. Both plexins mediate Ca2+/Mg2+-dependent cell aggregation due to homophilic trans-interaction, which is strong in the case of B3 and moderate for B2. Using different deletion constructs we show that the sema domain of B3 is essential for homophilic interaction. Using yeast two-hybrid analysis, we identified the neuron-specific and calmodulin-binding Ras-related GTPase Rin as an interaction partner of the intracellular part of B3, but not of B2. Rin, also known for its neurite outgrowth-inducing characteristics, co-localizes and co-immunoprecipitates with B3 in co-transfected COS-7 cells. Conclusion Our data suggest an involvement of homophilic interaction of B3 in semaphorin-independent signaling mechanisms positively influencing neuronal morphogenesis or function. Furthermore the neuron-specific small GTPase Rin is involved in downstream signaling of plexin B3. PMID:16122393

  18. The N-terminal region of organic anion transporting polypeptide 1B3 (OATP1B3) plays an essential role in regulating its plasma membrane trafficking.

    PubMed

    Chun, Se-Eun; Thakkar, Nilay; Oh, Yunseok; Park, Ji Eun; Han, Songhee; Ryoo, Gongmi; Hahn, Hyunggu; Maeng, Sang Hyun; Lim, Young-Ran; Han, Byung Woo; Lee, Wooin

    2017-05-01

    Organic anion transporting polypeptide 1B3 (OATP1B3) is a major influx transporter mediating the hepatic uptake of various endogenous substrates as well as clinically important drugs such as statins and anticancer drugs. However, molecular mechanisms controlling the membrane trafficking of OATP1B3 have been largely unknown. Several reports recently indicated the presence of a distinct, cancer-type OATP1B3 variant lacking the N-terminal 28 amino acids compared to OATP1B3 expressed in non-malignant hepatocytes. Interestingly, the cancer-type OATP1B3 variant is located predominantly in the cytoplasm, implicating the involvement of the N-terminal region of OATP1B3 in its membrane trafficking. In the current study, we set out to experimentally validate the importance of the N-terminal region of OATP1B3 and to identify responsible sequence motif(s) in that region. A number of truncation or point mutants of OATP1B3 were transiently expressed in HEK293T, HCT-8 or MDCK II cells and their expression in cytoplasmic and surface membrane fractions were analyzed by immunoblotting. Our results indicated that the N-terminal sequence of OATP1B3, in particular, at the amino acid positions between 12 and 28, may be indispensable in its membrane trafficking. Moreover, our results using a fusion construct indicated that the first 50 amino acids of OATP1B3 are sufficient for its membrane localization. The importance of the N-terminal region in membranous localization was shared among the other OATP1B subfamily members, OATP1B1 and rat Oatp1b2. Our efforts to identify the responsible amino acid(s) or structure motif(s) in the N-terminal region did not pinpoint individual amino acids or motifs with putative secondary structures. Our current findings however demonstrate that the N-terminal region is important for the membrane localization of the OATP1B subfamily members and should facilitate future investigations of the mechanisms involved in the regulation and membrane trafficking of

  19. Development of a fluorescence-based assay for screening of modulators of human organic anion transporter 1B3 (OATP1B3).

    PubMed

    Baldes, C; Koenig, P; Neumann, D; Lenhof, H-P; Kohlbacher, O; Lehr, C-M

    2006-01-01

    The organic anion transporting protein 1B3 (OATP1B3), formerly termed OATP8, is responsible for uptake and subsequent elimination of multiple amphipathic drugs by the liver. In silico methods for the prediction of transport rates for drugs and drug-like molecules might provide an important tool in drug development. Most prediction methods however require a large training set of in vitro experimental data in order to yield reliable results. To obtain these data, we have developed a fluorescence-based assay that allows screening a relatively high number of substances for their transporter affinity. HEK293 cells overexpressing OATP1B3 (HEK-OATP8) [Y. Cui, J. Konig, D. Keppler, Vectorial transport by double-transfected cells expressing the human uptake transporter SLC21A8 and the apical export pump ABCC2, Mol. Pharmacol. 60 (2001) 934-943.] were tested for transport of Fluo-3. Fluo-3 uptake could be seen in a concentration-dependent manner. Uptake can be inhibited completely by the addition of the known OATP1B3-inhibitor rifampicin proving that Fluo-3 is transported by OATP1B3. To verify the suitability of the system to identify modulators of OATP1B3, we tested known substrates for competitively inhibiting the Fluo-3 transport by giving them simultaneously with a 2muM Fluo-3-solution to the cells. The transport of Fluo-3 was decreased by all test substrates in a concentration dependent manner.

  20. Role of coxsackievirus and adenovirus receptor (CAR) expression and viral load of adenovirus and enterovirus in patients with dilated cardiomyopathy.

    PubMed

    Sharma, Mirnalini; Mishra, Baijayantimala; Saikia, Uma Nahar; Bahl, Ajay; Ratho, Radha Kanta; Talwar, Kewal Kishan

    2016-01-01

    Enteroviruses (EVs) and adenoviruses (AdVs) are two important etiological agents of viral myocarditis and dilated cardiomyopathy (DCM). Both these viruses share a common receptor, the coxsackievirus and adenovirus receptor (CAR), for their infection. However, the role of viral load and CAR expression in disease severity has not yet been completely elucidated. The present study aimed to determine viral load of EV and AdV in DCM patients and correlate them with the level of CAR expression in these patients. Sixty-three DCM cases and 30 controls, each of whom died of heart disease other than DCM and non-cardiac disease respectively, were included. Viral load was determined by TaqMan real-time PCR using primers and probes specific for the AdV hexon gene and the 5'UTR region of EV. The CAR mRNA level was semi-quantitated by RT-PCR, and antigen expression was studied by immunohistochemistry. A significantly high AdV load (p < 0.05) and CAR expression (p < 0.05) were observed in DCM cases versus controls, whereas the EV load showed no significant difference. The data suggests a clinical threshold of 128 AdV copies/500 ng of DNA for DCM, with 66.7 % sensitivity and 65 % specificity. A positive correlation between AdV load and CAR expression (p < 0.001) was also observed in DCM cases. The high adenoviral load and increased CAR expression in DCM and their association with adverse disease outcome indicates role of both virus and receptor in disease pathogenesis. Thus, the need for targeting both the virus and the receptor for treatment of viral myocarditis and early DCM requires further confirmation with larger studies.

  1. Development and evaluation of a real-time method for testing human enteroviruses and coxsackievirus A16.

    PubMed

    Chen, Qian; Hu, Zheng; Zhang, Qihua; Yu, Minghui

    2016-05-01

    Hand, foot, and mouth disease (HFMD) is a common infectious disease caused by a group of the human enteroviruses (HEV), including coxsackievirus A16 (CA16) and enterovirus 71 (EV71). In recent years, another HEV-A serotype, CA6 or CA10, has emerged to be one of the major etiologic agents that can induce HFMD worldwide. The objective of this study is to develop specific, sensitive, and rapid methods to help diagnose HEV and CA16 specifically by using simultaneous amplification testing (SAT) based on isothermal amplification of RNA and real-time detection of fluorescence technique, which were named as SAT-HEV and SAT-CA16, respectively (SAT-HEV/SAT-CA16). The specificity and sensitivity of SAT were tested here. SAT-HEV/SAT-CA16 could measure viral titers that were at least 10-fold lower than those measured by real-time PCR. Non-false cross-reactive amplification indicated that SAT-HEV/SAT-CA16 were highly specific with the addition of internal control (IC) RNA (5000 copies/reaction). A total of 198 clinical specimens were assayed by SAT comparing with real-time PCR. The statistically robust assessment of SAT-HEV and HEV-specific real-time PCR plus sequencing reached 99.0% (196/198), with a kappa value of 0.97, and 99.5% (197/198) and a kappa value of 0.99 for CA16, respectively. Additionally, IC prevented false-negative readings and assured the SAT-HEV/SAT-CA16 method's accuracy. Overall, SAT-HEV/SAT-CA16 method may serve as a platform for the simple and rapid detection of HEV/CA16 in time of HFMD outbreak.

  2. Different Antibody Response against the Coxsackievirus A16 VP1 Capsid Protein: Specific or Non-Specific

    PubMed Central

    Zhang, Xi; Teng, Zheng; Gao, Caixia; Qian, Baohua; Wang, Lili; Feng, Jiaojiao; Wang, Jinhong; Zhao, Chunyan; Guo, Cunjiu; Pan, Wei

    2016-01-01

    Coxsackievirus A16 (CA16) is one of the major causative agents of hand, foot, and mouth disease worldwide. The non-neutralizing antibody response that targets CA16 VP1 remains poorly elucidated. In the present study, antibody responses against CA16 VP1 in Shanghai blood donors and Shanxi individuals were analyzed by ELISA and inhibitory ELISA using five CA16 VP1 antigens: VP11-297, VP141-297, VP11-60, VP145-58 and VP161-297. The correlation coefficients for most of the reactions against each of the five antigens and the inhibition of the anti-CA16 VP1 antibody response produced by the various antigens were higher in Shanghai blood donors compared to those in Shanxi individuals. VP11-297 and VP141-297 strongly inhibited the anti-CA16 VP1 response in serum samples from both populations, while VP145-58 and VP161-297 intermediately and weakly inhibited the anti-CA16 VP1 response, respectively, in only Shanghai group. A specific type of inhibition (anti-CA16 VP1 was completely inhibited by both VP11-60 and VP141-297) characterized by high neutralizing antibody titers was identified and accounted for 71.4% of the strongly reactive samples from the Shanghai group. These results indicate that the Shanghai blood donors exhibited a consistent and specific antibody response, while the Shanxi individuals showed an inconsistent and non-specific antibody response. These findings may improve the understanding of host humoral immunity against CA16 and help to identify an effective approach for seroepidemiological surveillance and specific diagnosis of CA16 infection based on normal and competitive ELISA. PMID:27622652

  3. The PDZ3 domain of the cellular scaffolding protein MAGI-1 interacts with the Coxsackievirus and adenovirus receptor (CAR).

    PubMed

    Yan, Ran; Sharma, Priyanka; Kolawole, Abimbola O; Martin, Sterling C T; Readler, James M; Kotha, Poornima L N; Hostetler, Heather A; Excoffon, Katherine J D A

    2015-04-01

    The Coxsackievirus and adenovirus receptor (CAR) is an essential cellular protein that is involved in cell-cell adhesion, protein trafficking, and viral infection. The major isoform of CAR is selectively sorted to the basolateral membrane of polarized epithelial cells where it co-localizes with the cellular scaffolding protein membrane-associated guanylate kinase with inverted domain structure-1 (MAGI-1). Previously, we demonstrated CAR interacts with MAGI-1 through a PDZ-domain dependent interaction. Here, we show that the PDZ3 domain of MAGI-1 is exclusively responsible for the high affinity interaction between the seven exon isoform of CAR and MAGI-1 using yeast-two-hybrid analysis and confirming this interaction biochemically and in cellular lysates by in vitro pull down assay and co-immunoprecipitation. The high affinity interaction between the PDZ3 domain and CAR C-terminus was measured by fluorescence resonance energy transfer. Further, we investigated the biological relevance of this high affinity interaction between CAR and the PDZ3 domain of MAGI-1 and found that it does not alter CAR-mediated adenovirus infection. By contrast, interruption of this high affinity interaction altered the localization of MAGI-1 indicating that CAR is able to traffic MAGI-1 to cell junctions. These data deepen the molecular understanding of the interaction between CAR and MAGI-1 and indicate that although CAR plays a role in trafficking PDZ-based scaffolding proteins to cellular junctions, association with a high affinity intracellular binding partner does not significantly alter adenovirus binding and entry via CAR.

  4. Expression of Coxsackievirus and Adenovirus Receptor Separates Hematopoietic and Cardiac Progenitor Cells in Fetal Liver Kinase 1-Expressing Mesoderm

    PubMed Central

    Tashiro, Katsuhisa; Hirata, Nobue; Okada, Atsumasa; Yamaguchi, Tomoko; Takayama, Kazuo; Mizuguchi, Hiroyuki

    2015-01-01

    In developing embryos or in vitro differentiation cultures using pluripotent stem cells (PSCs), such as embryonic stem cells and induced pluripotent stem cells, fetal liver kinase 1 (Flk1)-expressing mesodermal cells are thought to be a heterogeneous population that includes hematopoietic progenitors, endothelial progenitors, and cardiac progenitors. However, information on cell surface markers for separating these progenitors in Flk1+ cells is currently limited. In the present study, we show that distinct types of progenitor cells in Flk1+ cells could be separated according to the expression of coxsackievirus and adenovirus receptor (CAR, also known as CXADR), a tight junction component molecule. We found that mouse and human PSC- and mouse embryo-derived Flk1+ cells could be subdivided into Flk1+CAR+ cells and Flk1+CAR− cells. The progenitor cells with cardiac potential were almost entirely restricted to Flk1+CAR+ cells, and Flk1+CAR− cells efficiently differentiated into hematopoietic cells. Endothelial differentiation potential was observed in both populations. Furthermore, from the expression of CAR, Flk1, and platelet-derived growth factor receptor-α (PDGFRα), Flk1+ cells could be separated into three populations (Flk1+PDGFRα−CAR− cells, Flk1+PDGFRα−CAR+ cells, and Flk1+PDGFRα+CAR+ cells). Flk1+PDGFRα+ cells and Flk1+PDGFRα− cells have been reported as cardiac and hematopoietic progenitor cells, respectively. We identified a novel population (Flk1+PDGFRα−CAR+ cells) with the potential to differentiate into not only hematopoietic cells and endothelial cells but also cardiomyocytes. Our findings indicate that CAR would be a novel and prominent marker for separating PSC- and embryo-derived Flk1+ mesodermal cells with distinct differentiation potentials. PMID:25762001

  5. Detection of human enterovirus 71 and coxsackievirus A16 in children with hand, foot and mouth disease in China

    PubMed Central

    CHEN, LING; MOU, XIAOZHOU; ZHANG, QIONG; LI, YIFEI; LIN, JIAN; LIU, FANLONG; YUAN, LI; TANG, YIMING; XIANG, CHARLIE

    2012-01-01

    The aims of the present study were to investigate the genetic characteristics of enterovirus 71 (EV71) and coxsackievirus A16 (CVA16) strains in China and to evaluate the relationship between the genotypes of CVA16 and EV71 and their geographical distribution. A total of 399 stool specimens were collected from children with symptoms of hand, foot and mouth disease (HFMD) in Zhejiang Province. The presence of enteroviruses was determined using reverse transcription-semi-nested PCR targeted to the VP1 gene of all human enteroviruses and DNA sequencing. EV71 and CVA16, the major etiological agents of HFMD, were detected in 38.4% (38/99) and 35.4% (35/99) of HEV-A species-positive cases, respectively. Based on the phylogenetic analysis of the VP1 gene, EV71 strains identified in this study belong to subgenotype C4, and CVA16 strains herein were classified into clusters B2a and B2b within the genotype B2. Taking into consideration other published data, we conclude that the genetic characteristics of enteroviruses in China reflect the pattern of the endemic circulation of the subgenotype C4 to EV71 and clusters B2a and B2b within genotype B2 to CVA16, which have been continuously circulating in China since 1997. This observation indicates that the genetic characteristics of enteroviruses in China seem to depend on their special geographical and climatical features allowing them to be sustained with little external effect. PMID:22218731

  6. Detection of human enterovirus 71 and coxsackievirus A16 in children with hand, foot and mouth disease in China.

    PubMed

    Chen, Ling; Mou, Xiaozhou; Zhang, Qiong; Li, Yifei; Lin, Jian; Liu, Fanlong; Yuan, Li; Tang, Yiming; Xiang, Charlie

    2012-04-01

    The aims of the present study were to investigate the genetic characteristics of enterovirus 71 (EV71) and coxsackievirus A16 (CVA16) strains in China and to evaluate the relationship between the genotypes of CVA16 and EV71 and their geographical distribution. A total of 399 stool specimens were collected from children with symptoms of hand, foot and mouth disease (HFMD) in Zhejiang Province. The presence of enteroviruses was determined using reverse transcription-semi-nested PCR targeted to the VP1 gene of all human enteroviruses and DNA sequencing. EV71 and CVA16, the major etiological agents of HFMD, were detected in 38.4% (38/99) and 35.4% (35/99) of HEV-A species-positive cases, respectively. Based on the phylogenetic analysis of the VP1 gene, EV71 strains identified in this study belong to subgenotype C4, and CVA16 strains herein were classified into clusters B2a and B2b within the genotype B2. Taking into consideration other published data, we conclude that the genetic characteristics of enteroviruses in China reflect the pattern of the endemic circulation of the subgenotype C4 to EV71 and clusters B2a and B2b within genotype B2 to CVA16, which have been continuously circulating in China since 1997. This observation indicates that the genetic characteristics of enteroviruses in China seem to depend on their special geographical and climatical features allowing them to be sustained with little external effect.

  7. Development of a multiplex polymerase chain reaction assay for simultaneous identification of human enterovirus 71 and coxsackievirus A16

    PubMed Central

    Thao, Nguyen Thi Thanh; Ngoc, Nguyen Thi Kim; Tú, Phan Văn; Thúy, Trần Thi; Cardosa, Mary Jane; McMinn, Peter Charles; Phuektes, Patchara

    2010-01-01

    Human enterovirus 71 (HEV71) and coxsackievirus A16 (CVA16) are two major aetiological agents of hand, foot and mouth disease (HFMD) in children. Recently there have been several large outbreaks of HFMD in Vietnam and the Asia-Pacific region. In this study, a multiplex RT-PCR assay was developed in order to detect simultaneously HEV71, CVA16 and other human enteroviruses. Enterovirus detection was performed with a mixture of three pairs of oligonucleotide primers: one pair of published primers for amplifying all known enterovirus genomes and two new primer pairs specific for detection of the VP1 genes of HEV71 and CVA16. Enterovirus isolates, CVA16 and HEV71 strains identified previously from patients with HFMD were examined to evaluate the sensitivity and specificity of the multiplex RT-PCR assay. The assay was then applied to the direct detection of these viruses in clinical specimens obtained from HFMD cases identified at Children's Hospital Number 2, Ho Chi Minh City, Vietnam. The multiplex RT-PCR assay showed 100% specificity in screening for enteroviruses and in identifying HEV71 and CVA16. Similar results were obtained when using the multiplex RT-PCR assay to screen for enteroviruses and to identify HEV71 and CVA16 in clinical specimens obtained from HFMD cases identified at the hospital. This multiplex RT-PCR assay is a rapid, sensitive and specific assay for the diagnosis of HEV71 or CVA16 infection in cases of HFMD and is also potentially useful for molecular epidemiological investigations. PMID:20863857

  8. Toll-Like Receptor 3 Is Critical for Coxsackievirus B4-Induced Type 1 Diabetes in Female NOD Mice

    PubMed Central

    Thuma, Jean R.; Courreges, Maria C.; Benencia, Fabian; James, Calvin B.L.; Malgor, Ramiro; Kantake, Noriko; Mudd, William; Denlinger, Nathan; Nolan, Bret; Wen, Li; Schwartz, Frank L.

    2015-01-01

    Group B coxsackieviruses (CVBs) are involved in triggering some cases of type 1 diabetes mellitus (T1DM). However, the molecular mechanism(s) responsible for this remain elusive. Toll-like receptor 3 (TLR3), a receptor that recognizes viral double-stranded RNA, is hypothesized to play a role in virus-induced T1DM, although this hypothesis is yet to be substantiated. The objective of this study was to directly investigate the role of TLR3 in CVB-triggered T1DM in nonobese diabetic (NOD) mice, a mouse model of human T1DM that is widely used to study both spontaneous autoimmune and viral-induced T1DM. As such, we infected female wild-type (TLR3+/+) and TLR3 knockout (TLR3−/−) NOD mice with CVB4 and compared the incidence of diabetes in CVB4-infected mice with that of uninfected counterparts. We also evaluated the islets of uninfected and CVB4-infected wild-type and TLR3 knockout NOD mice by immunohistochemistry and insulitis scoring. TLR3 knockout mice were markedly protected from CVB4-induced diabetes compared with CVB4-infected wild-type mice. CVB4-induced T-lymphocyte-mediated insulitis was also significantly less severe in TLR3 knockout mice compared with wild-type mice. No differences in insulitis were observed between uninfected animals, either wild-type or TLR3 knockout mice. These data demonstrate for the first time that TLR3 is 1) critical for CVB4-induced T1DM, and 2) modulates CVB4-induced insulitis in genetically prone NOD mice. PMID:25422874

  9. Characterization of genome sequences and clinical features of coxsackievirus A6 strains collected in Hyogo, Japan in 1999-2013.

    PubMed

    Ogi, Miki; Yano, Yoshihiko; Chikahira, Masatsugu; Takai, Denshi; Oshibe, Tomohiro; Arashiro, Takeshi; Hanaoka, Nozomu; Fujimoto, Tsuguto; Hayashi, Yoshitake

    2017-02-22

    Coxsackievirus A6 (CV-A6) is an enterovirus, which is known to cause herpangina. However, since 2009 it has frequently been isolated from children with hand, foot, and mouth disease (HFMD). In Japan, CV-A6 has been linked to HFMD outbreaks in 2011 and 2013. In this study, the full-length genome sequencing of CV-A6 strains were analyzed to identify the association with clinical manifestations. Five thousand six hundred and twelve children with suspected enterovirus infection (0-17 years old) between 1999 and 2013 in Hyogo Prefecture, Japan, were enrolled. Enterovirus infection was confirmed with reverse transcriptase-PCR in 753 children (791 samples), 127 of whom (133 samples) were positive for CV-A6 based on the direct sequencing of the VP4 region. The complete genomes of CV-A6 from 22 positive patients with different clinical manifestations were investigated. A phylogenetic analysis divided these 22 strains into two clusters based on the VP1 region; cluster I contained strains collected in 1999-2009 and mostly related to herpangina, and cluster II contained strains collected in 2011-2013 and related to HFMD outbreak. Based on the full-length polyprotein analysis, the amino acid differences between the strains in cluster I and II were 97.7 ± 0.28%. Amino acid differences were detected in 17 positions within the polyprotein. Strains collected in 1999-2009 and those in 2011-2013 were separately clustered by phylogenetic analysis based on 5'UTR and 3Dpol region, as well as VP1 region. In conclusion, HFMD outbreaks by CV-A6 were recently frequent in Japan and the accumulation of genomic change might be associated with the clinical course.

  10. Molecular epidemiology of enterovirus 71, coxsackievirus A16 and A6 associated with hand, foot and mouth disease in Spain.

    PubMed

    Cabrerizo, M; Tarragó, D; Muñoz-Almagro, C; Del Amo, E; Domínguez-Gil, M; Eiros, J M; López-Miragaya, I; Pérez, C; Reina, J; Otero, A; González, I; Echevarría, J E; Trallero, G

    2014-03-01

    Hand, foot and mouth disease (HFMD) is a childhood illness frequently caused by genotypes belonging to the enterovirus A species, including coxsackievirus (CV)-A16 and enterovirus (EV)-71. Between 2010 and 2012, several outbreaks and sporadic cases of HFMD occurred in different regions of Spain. The objective of the present study was to describe the enterovirus epidemiology associated with HFMD in the country. A total of 80 patients with HFMD or atypical rash were included. Detection and typing of the enteroviruses were performed directly in clinical samples using molecular methods. Enteroviruses were detected in 53 of the patients (66%). CV-A6 was the most frequent genotype, followed by CV-A16 and EV-71, but other minority types were also identified. Interestingly, during almost all of 2010, CV-A16 was the only causative agent of HFMD but by the end of the year and during 2011, CV-A6 became predominant, while CV-A16 was not detected. In 2012, however, both CV-A6 and CV-A16 circulated. EV-71 was associated with HFMD symptoms only in three cases during 2012. All Spanish CV-A6 sequences segregated into one major genetic cluster together with other European and Asian strains isolated between 2008 and 2011, most forming a particular clade. Spanish EV-71 strains belonged to subgenogroup C2, as did most of the European sequences circulated. In conclusion, the recent increase of HFMD cases in Spain and other European countries has been due to a larger incidence of circulating species A enteroviruses, mainly CV-A6 and CV-A16, and the emergence of new genetic variants of these viruses.

  11. Activation of macrophages by an exopolysaccharide isolated from Antarctic Psychrobacter sp. B-3

    NASA Astrophysics Data System (ADS)

    Yu, Leiye; Sun, Guojie; Wei, Jingfang; Wang, Yingze; Du, Chao; Li, Jiang

    2016-09-01

    An exopolysaccharide (EPS) was isolated and purified from an Antarctic psychrophilic bacterium B-3, identified as Psychrobacter sp., and the activation of RAW264.7 cells by B-3 EPS was investigated. The results show that B-3 EPS, over a certain concentration range, promoted cell viability, nitric oxide production, tumor necrosis factor (TNF)α secretion, and phagocytic ability. Furthermore, TAK-242, an inhibitor of the toll-like receptor 4 (TLR4) significantly reduced nitric oxide production by these cells after stimulation with B-3 EPS. Moreover, B-3 EPS induced p65 phosphorylation and IκBα degradation in these cells. In conclusion, B-3 EPS might have activated RAW264.7 cells by combining with TLR4 on cell surface and triggering activation of NF-κB signaling pathways, implying that this EPS could activate macrophages and regulate initial immune response.

  12. 26 CFR 1.410(b)-3 - Employees and former employees who benefit under a plan.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 26 Internal Revenue 5 2010-04-01 2010-04-01 false Employees and former employees who benefit under a plan. 1.410(b)-3 Section 1.410(b)-3 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) INCOME TAX (CONTINUED) INCOME TAXES Pension, Profit-Sharing, Stock Bonus Plans, Etc. § 1.410(b)-3 Employees and former...

  13. 26 CFR 31.3121(b)(3)-1T - Family employment (temporary).

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 26 Internal Revenue 15 2012-04-01 2012-04-01 false Family employment (temporary). 31.3121(b)(3)-1T... § 31.3121(b)(3)-1T Family employment (temporary). (a) For further guidance, see § 31.3121(b)(3)-1(a... employ of a partnership are not within the exception unless the requisite family relationship exists...

  14. 26 CFR 31.3121(b)(3)-1T - Family employment (temporary).

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 26 Internal Revenue 15 2014-04-01 2014-04-01 false Family employment (temporary). 31.3121(b)(3)-1T... § 31.3121(b)(3)-1T Family employment (temporary). (a) For further guidance, see § 31.3121(b)(3)-1(a... employ of a partnership are not within the exception unless the requisite family relationship exists...

  15. 26 CFR 31.3121(b)(3)-1T - Family employment (temporary).

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 26 Internal Revenue 15 2013-04-01 2013-04-01 false Family employment (temporary). 31.3121(b)(3)-1T... § 31.3121(b)(3)-1T Family employment (temporary). (a) For further guidance, see § 31.3121(b)(3)-1(a... employ of a partnership are not within the exception unless the requisite family relationship exists...

  16. tRNA-dependent peptide bond formation by the transferase PacB in biosynthesis of the pacidamycin group of pentapeptidyl nucleoside antibiotics.

    PubMed

    Zhang, Wenjun; Ntai, Ioanna; Kelleher, Neil L; Walsh, Christopher T

    2011-07-26

    Pacidamycins are a family of uridyl tetra/pentapeptide antibiotics with antipseudomonal activities through inhibition of the translocase MraY in bacterial cell wall assembly. The biosynthetic gene cluster for pacidamycins has recently been identified through genome mining of the producer Streptomyces coeruleorubidus, and the highly dissociated nonribosomal peptide assembly line for the uridyl tetrapeptide scaffold of pacidamycin has been characterized. In this work a hypothetical protein PacB, conserved in known uridyl peptide antibiotics gene clusters, has been characterized by both genetic deletion and enzymatic analysis of the purified protein. PacB catalyzes the transfer of the alanyl residue from alanyl-tRNA to the N terminus of the tetrapeptide intermediate yielding a pentapeptide on the thio-templated nonribosomal peptide synthetase (NRPS) assembly line protein PacH. PacB thus represents a new group of tRNA-dependent peptide bond-forming enzymes in secondary metabolite biosynthesis in addition to the recently identified cyclodipeptide synthases. The characterization of PacB completes the assembly line reconstitution of pacidamycin pentapeptide antibiotic scaffolds, bridging the primary and secondary metabolic pathways by hijacking an aminoacyl-tRNA to the antibiotic biosynthetic pathway.

  17. Point mutations in the West Nile virus (Flaviviridae; Flavivirus) RNA-dependent RNA polymerase alter viral fitness in a host-dependent manner in vitro and in vivo.

    PubMed

    Van Slyke, Greta A; Ciota, Alexander T; Willsey, Graham G; Jaeger, Joachim; Shi, Pei-Yong; Kramer, Laura D

    2012-05-25

    The West Nile virus (WNV) genome contains a single RNA-dependent RNA polymerase (RdRp) gene, which is responsible for replication of the viral genome and, as such, is an important target for antiviral therapy. Viral RdRps are known to lack proofreading capabilities and as a result viruses such as WNV exist as a mixture of viral genotypes within an infection, enabling the virus to readily emerge and adapt to new host environments. To test the consequences of subtle structural alterations remote from the RdRp active-site, the following single point mutations were engineered in the WNV NS5 RdRp coding region: T363N, A365N, and T537I; these mutations were selected in an effort to stabilize the secondary structural elements near the rNTP binding pocket of the RdRp. Mutant viruses were tested in vitro on Vero, C6/36, Culex tarsalis and DF-1 cell types and in vivo in one day old chickens and Culex pipiens mosquitoes. Plaque morphology was affected by each mutation and growth and RNA replication kinetics were altered as well. Our results demonstrate that subtle alteration of the RdRp protein away from the active site can have a significant overall biological effect on WNV fitness, and that this effect can be host-dependent.

  18. The dominant-negative inhibition of double-stranded RNA-dependent protein kinase PKR increases the efficacy of Rift Valley fever virus MP-12 vaccine.

    PubMed

    Lihoradova, Olga; Kalveram, Birte; Indran, Sabarish V; Lokugamage, Nandadeva; Juelich, Terry L; Hill, Terence E; Tseng, Chien-Te K; Gong, Bin; Fukushi, Shuetsu; Morikawa, Shigeru; Freiberg, Alexander N; Ikegami, Tetsuro

    2012-07-01

    Rift Valley fever virus (RVFV), belonging to the genus Phlebovirus, family Bunyaviridae, is endemic to sub-Saharan Africa and causes a high rate of abortion in ruminants and hemorrhagic fever, encephalitis, or blindness in humans. MP-12 is the only RVFV strain excluded from the select-agent rule and handled at a biosafety level 2 (BSL2) laboratory. MP-12 encodes a functional major virulence factor, the NSs protein, which contributes to its residual virulence in pregnant ewes. We found that 100% of mice subcutaneously vaccinated with recombinant MP-12 (rMP12)-murine PKRN167 (mPKRN167), which encodes a dominant-negative form of mouse double-stranded RNA (dsRNA)-dependent protein kinase (PKR) in place of NSs, were protected from wild-type (wt) RVFV challenge, while 72% of mice vaccinated with MP-12 were protected after challenge. rMP12-mPKRN167 induced alpha interferon (IFN-α) in sera, accumulated RVFV antigens in dendritic cells at the local draining lymph nodes, and developed high levels of neutralizing antibodies, while parental MP-12 induced neither IFN-α nor viral-antigen accumulation at the draining lymph node yet induced a high level of neutralizing antibodies. The present study suggests that the expression of a dominant-negative PKR increases the immunogenicity and efficacy of live-attenuated RVFV vaccine, which will lead to rational design of safe and highly immunogenic RVFV vaccines for livestock and humans.

  19. The Dominant-Negative Inhibition of Double-Stranded RNA-Dependent Protein Kinase PKR Increases the Efficacy of Rift Valley Fever Virus MP-12 Vaccine

    PubMed Central

    Lihoradova, Olga; Kalveram, Birte; Indran, Sabarish V.; Lokugamage, Nandadeva; Juelich, Terry L.; Hill, Terence E.; Tseng, Chien-Te K.; Gong, Bin; Fukushi, Shuetsu; Morikawa, Shigeru; Freiberg, Alexander N.

    2012-01-01

    Rift Valley fever virus (RVFV), belonging to the genus Phlebovirus, family Bunyaviridae, is endemic to sub-Saharan Africa and causes a high rate of abortion in ruminants and hemorrhagic fever, encephalitis, or blindness in humans. MP-12 is the only RVFV strain excluded from the select-agent rule and handled at a biosafety level 2 (BSL2) laboratory. MP-12 encodes a functional major virulence factor, the NSs protein, which contributes to its residual virulence in pregnant ewes. We found that 100% of mice subcutaneously vaccinated with recombinant MP-12 (rMP12)-murine PKRN167 (mPKRN167), which encodes a dominant-negative form of mouse double-stranded RNA (dsRNA)-dependent protein kinase (PKR) in place of NSs, were protected from wild-type (wt) RVFV challenge, while 72% of mice vaccinated with MP-12 were protected after challenge. rMP12-mPKRN167 induced alpha interferon (IFN-α) in sera, accumulated RVFV antigens in dendritic cells at the local draining lymph nodes, and developed high levels of neutralizing antibodies, while parental MP-12 induced neither IFN-α nor viral-antigen accumulation at the draining lymph node yet induced a high level of neutralizing antibodies. The present study suggests that the expression of a dominant-negative PKR increases the immunogenicity and efficacy of live-attenuated RVFV vaccine, which will lead to rational design of safe and highly immunogenic RVFV vaccines for livestock and humans. PMID:22573861

  20. The Crystal Structure of the RNA-Dependent RNA Polymerase from Human Rhinovirus: A Dual Function Target for Common Cold Antiviral Therapy

    SciTech Connect

    Love, Robert A.; Maegley, Karen A.; Yu, Xiu; Ferre, RoseAnn; Lingardo, Laura K.; Diehl, Wade; Parge, Hans E.; Dragovich, Peter S.; Fuhrman, Shella A.

    2010-11-16

    Human rhinoviruses (HRV), the predominant members of the Picornaviridae family of positive-strand RNA viruses, are the major causative agents of the common cold. Given the lack of effective treatments for rhinoviral infections, virally encoded proteins have become attractive therapeutic targets. The HRV genome encodes an RNA-dependent RNA polymerase (RdRp) denoted 3D{sup pol}, which is responsible for replicating the viral genome and for synthesizing a protein primer used in the replication. Here the crystal structures for three viral serotypes (1B, 14, and 16) of HRV 3D{sup pol} have been determined. The three structures are very similar to one another, and to the closely related poliovirus (PV) 3D{sup pol} enzyme. Because the reported PV crystal structure shows significant disorder, HRV 3D{sup pol} provides the first complete view of a picornaviral RdRp. The folding topology of HRV 3D{sup pol} also resembles that of RdRps from hepatitis C virus (HCV) and rabbit hemorrhagic disease virus (RHDV) despite very low sequence homology.

  1. EGO-1, a Putative RNA-Dependent RNA Polymerase, Is Required for Heterochromatin Assembly on Unpaired DNA during C. elegans Meiosis

    PubMed Central

    Maine, Eleanor M.; Hauth, Jessica; Ratliff, Thomas; Vought, Valarie E.; She, Xingyu; Kelly, William G.

    2014-01-01

    Summary During meiosis in C. elegans, unpaired chromosomes and chromosomal regions accumulate high levels of histone H3 lysine 9 dimethylation (H3K9me2), a modification associated with facultative heterochromatin assembly and the resulting transcriptional silencing [1, 2]. Meiotic silencing of unpaired DNA may be a widely conserved genome defense mechanism [3–5]. The mechanisms of meiotic silencing remain unclear, although both transcriptional and posttranscriptional processes are implicated [3–5]. Cellular RNA-dependent RNA polymerases (RdRPs) function in development and RNA-mediated silencing in many species [3, 6, 7] and in heterochromatin assembly in S. pombe [3, 8]. There are four C. elegans RdRPs, including two with known germline functions. EGO-1 is required for fertility and robust germline RNAi [9–11]. RRF-3 acts genetically to repress RNAi and is required for normal meiosis and spermatogenesis at elevated temperatures [12] (S. L’Hernault, personal communication). Among C. elegans RdRPs, we find that only EGO-1 is required for H3K9me2 enrichment on unpaired chromosomal regions during meiosis. This H3K9me2 enrichment does not require Dicer or Drosha nuclease or any of several other proteins required for RNAi. ego-1 interacts genetically with him-17, another regulator of chromatin and meiosis [13], to promote germ-line development. We conclude that EGO-1 is an essential component of meiotic silencing in C. elegans. PMID:16271877

  2. Distinct RNA-dependent RNA polymerases are required for RNAi triggered by double-stranded RNA versus truncated transgenes in Paramecium tetraurelia

    PubMed Central

    Marker, Simone; Le Mouël, Anne; Meyer, Eric; Simon, Martin

    2010-01-01

    In many eukaryotes, RNA-dependent RNA polymerases (RdRPs) play key roles in the RNAi pathway. They have been implicated in the recognition and processing of aberrant transcripts triggering the process, and in amplification of the silencing response. We have tested the functions of RdRP genes from the ciliate Paramecium tetraurelia in experimentally induced and endogenous mechanisms of gene silencing. In this organism, RNAi can be triggered either by high-copy, truncated transgenes or by directly feeding cells with double-stranded RNA (dsRNA). Surprisingly, dsRNA-induced silencing depends on the putatively functional RDR1 and RDR2 genes, which are required for the accumulation of both primary siRNAs and a distinct class of small RNAs suggestive of secondary siRNAs. In contrast, a third gene with a highly divergent catalytic domain, RDR3, is required for siRNA accumulation when RNAi is triggered by truncated transgenes. Our data further implicate RDR3 in the accumulation of previously described endogenous siRNAs and in the regulation of the surface antigen gene family. While only one of these genes is normally expressed in any clonal cell line, the knockdown of RDR3 leads to co-expression of multiple antigens. These results provide evidence for a functional specialization of Paramecium RdRP genes in distinct RNAi pathways operating during vegetative growth. PMID:20200046

  3. Silencing the tobacco gene for RNA-dependent RNA polymerase 1 and infection by potato virus Y cause remodeling of cellular organelles.

    PubMed

    Rakhshandehroo, Farshad; Rezaee, Saeed; Palukaitis, Peter

    2017-10-01

    RNA-dependent RNA polymerase 1 (RDR1) has been shown to be involved in DNA methylation, RNA silencing and regulating expression of other genes. RDR1 gene expression is stimulated by infection with potato virus Y° (PVY). Transgenic Nicotiana tabacum plants silenced for RDR1 gene expression showed morphological changes in mesophyll cells, associated with remodeling of the nuclei, chloroplasts and mitochondria. RDR1 silencing led to decreased nuclear size, increased heterochromatin content and aggregation, decreased numbers of chloroplasts, plus changes in shape, internal structures and integrity of chloroplasts and mitochondria. RDR1-silenced transgenic plants showed increased PVY accumulation and ultrastructural remodeling was intensified in both chloroplasts and mitochondria of PVY-infected, RDR1-silenced plants. By contrast, heterochromatin condensation was reduced by PVY infection, and in non-transgenic plants the nuclei were translucent and lacked morphology after PVY infection. Thus, RDR1 regulates gene expression leading to remodeling of chromosomes, and PVY infection counteracts these effects on chromosomal remodeling. Copyright © 2017 Elsevier Inc. All rights reserved.

  4. Use of DNA, RNA, and Chimeric Templates by a Viral RNA-Dependent RNA Polymerase: Evolutionary Implications for the Transition from the RNA to the DNA World

    PubMed Central

    Siegel, Robert W.; Bellon, Laurent; Beigelman, Leonid; Kao, C. Cheng

    1999-01-01

    All polynucleotide polymerases have a similar structure and mechanism of catalysis, consistent with their evolution from one progenitor polymerase. Viral RNA-dependent RNA polymerases (RdRp) are expected to have properties comparable to those from this progenitor and therefore may offer insight into the commonalities of all classes of polymerases. We examined RNA synthesis by the brome mosaic virus RdRp on DNA, RNA, and hybrid templates and found that precise initiation of RNA synthesis can take place from all of these templates. Furthermore, initiation can take place from either internal or penultimate initiation sites. Using a template competition assay, we found that the BMV RdRp interacts with DNA only three- to fourfold less well than it interacts with RNA. Moreover, a DNA molecule with a ribonucleotide at position −11 relative to the initiation nucleotide was able to interact with RdRp at levels comparable to that observed with RNA. These results suggest that relatively few conditions were needed for an ancestral RdRp to replicate DNA genomes. PMID:10400735

  5. Pepino mosaic virus RNA-Dependent RNA Polymerase POL Domain Is a Hypersensitive Response-Like Elicitor Shared by Necrotic and Mild Isolates.

    PubMed

    Sempere, Raquel N; Gómez-Aix, Cristina; Ruíz-Ramón, Fabiola; Gómez, Pedro; Hasiów-Jaroszewska, Beata; Sánchez-Pina, María Amelia; Aranda, Miguel A

    2016-04-01

    Pepino mosaic virus (PepMV) is an emerging pathogen that represents a serious threat to tomato production worldwide. PepMV-induced diseases manifest with a wide range of symptoms, including systemic necrosis. Our results showed that PepMV accumulation depends on the virus isolate, tomato cultivar, and environmental conditions, and associates with the development of necrosis. Substitution of lysine for glutamic acid at position 67 in the triple gene block 3 (TGB3) protein, previously described as a necrosis determinant, led to increased virus accumulation and was necessary but not sufficient to induce systemic necrosis. Systemic necrosis both in tomato and Nicotiana benthamiana shared hypersensitive response (HR) features, allowing the assessment of the role of different genomic regions on necrosis induction. Overexpression of both TGB3 and the polymerase domain (POL) of the RNA-dependent RNA polymerase (RdRp) resulted in necrosis, although only local expression of POL triggered HR-like symptoms. Our results also indicated that the necrosis-eliciting activity of POL resides in its highly conserved "palm" domain, and that necrosis was jasmonic acid-dependent but not salicylic acid-dependent. Altogether, our data suggest that the RdRp-POL domain plays an important role in PepMV necrosis induction, with necrosis development depending on the virus accumulation level, which can be modulated by the nature of TGB3, host genotype and environmental conditions.

  6. Heat shock represses rRNA synthesis by inactivation of TIF-IA and lncRNA-dependent changes in nucleosome positioning

    PubMed Central

    Zhao, Zhongliang; Dammert, Marcel A.; Hoppe, Sven; Bierhoff, Holger; Grummt, Ingrid

    2016-01-01

    Attenuation of ribosome biogenesis in suboptimal growth environments is crucial for cellular homeostasis and genetic integrity. Here, we show that shutdown of rRNA synthesis in response to elevated temperature is brought about by mechanisms that target both the RNA polymerase I (Pol I) transcription machinery and the epigenetic signature of the rDNA promoter. Upon heat shock, the basal transcription factor TIF-IA is inactivated by inhibition of CK2-dependent phosphorylations at Ser170/172. Attenuation of pre-rRNA synthesis in response to heat stress is accompanied by upregulation of PAPAS, a long non-coding RNA (lncRNA) that is transcribed in antisense orientation to pre-rRNA. PAPAS interacts with CHD4, the adenosine triphosphatase subunit of NuRD, leading to deacetylation of histones and movement of the promoter-bound nucleosome into a position that is refractory to transcription initiation. The results exemplify how stress-induced inactivation of TIF-IA and lncRNA-dependent changes of chromatin structure ensure repression of rRNA synthesis in response to thermo-stress. PMID:27257073

  7. RNA-Dependent RNA Polymerase (NIb) of the Potyviruses Is an Avirulence Factor for the Broad-Spectrum Resistance Gene Pvr4 in Capsicum annuum cv. CM334

    PubMed Central

    Seo, Seungyeon; Lee, Joo Hyun; Choi, Doil

    2015-01-01

    Potyviruses are one of the most destructive viral pathogens of Solanaceae plants. In Capsicum annuum landrace CM334, a broad-spectrum gene, Pvr4 is known to be involved in resistance against multiple potyviruses, including Pepper mottle virus (PepMoV), Pepper severe mosaic virus (PepSMV), and Potato virus Y (PVY). However, a potyvirus avirulence factor against Pvr4 has not been identified. To identify the avirulence factor corresponding to Pvr4 in potyviruses, we performed Agrobacterium-mediated transient expressions of potyvirus protein coding regions in potyvirus-resistant (Pvr4) and -susceptible (pvr4) pepper plants. Hypersensitive response (HR) was observed only when a RNA-dependent RNA polymerase (NIb) of PepMoV, PepSMV, or PVY was expressed in Pvr4-bearing pepper leaves in a genotype-specific manner. In contrast, HR was not observed when the NIb of Tobacco etch virus (TEV), a virulent potyvirus, was expressed in Pvr4-bearing pepper leaves. Our results clearly demonstrate that NIbs of PepMoV, PepSMV, and PVY serve as avirulence factors for Pvr4 in pepper plants. PMID:25760376

  8. Development of a challenge-protective vaccine concept by modification of the viral RNA-dependent RNA polymerase of canine distemper virus.

    PubMed

    Silin, D; Lyubomska, O; Ludlow, M; Duprex, W P; Rima, B K

    2007-12-01

    We demonstrate that insertion of the open reading frame of enhanced green fluorescent protein (EGFP) into the coding sequence for the second hinge region of the viral L (large) protein (RNA-dependent RNA polymerase) attenuates a wild-type canine distemper virus. Moreover, we show that single intranasal immunization with this recombinant virus provides significant protection against challenge with the virulent parental virus. Protection against wild-type challenge was gained either after recovery of cellular immunity postimmunization or after development of neutralizing antibodies. Insertion of EGFP seems to result in overattenuation of the virus, while our previous experiments demonstrated that the insertion of an epitope tag into a similar position did not affect L protein function. Thus, a desirable level of attenuation could be reached by manipulating the length of the insert (in the second hinge region of the L protein), providing additional tools for optimization of controlled attenuation. This strategy for controlled attenuation may be useful for a "quick response" in vaccine development against well-known and "new" viral infections and could be combined efficiently with other strategies of vaccine development and delivery systems.

  9. Chikungunya virus nsP4 RNA-dependent RNA polymerase core domain displays detergent-sensitive primer extension and terminal adenylyltransferase activities.

    PubMed

    Chen, Ming Wei; Tan, Yaw Bia; Zheng, Jie; Zhao, Yongqian; Lim, Bee Ting; Cornvik, Tobias; Lescar, Julien; Ng, Lisa Fong Poh; Luo, Dahai

    2017-04-05

    Chikungunya virus (CHIKV) is an important arboviral infectious agent in tropical and subtropical regions, often causing persistent and debilitating disease. The viral enzyme non-structural protein 4 (nsP4), as RNA-dependent RNA polymerase (RdRP), catalyzes the formation of negative-sense, genomic and subgenomic viral RNAs. Here we report a truncated nsP4 construct that is soluble, stable and purified recombinantly from Escherichia coli. Sequence analyses and homology modelling indicate that all necessary RdRP elements are included. Hydrogen/deuterium exchange with mass spectrometry was used to analyze solvent accessibility and flexibility of subdomains. Fluorophore-conjugated RNA ligands were designed and screened by using fluorescence anisotropy to select a suitable substrate for RdRP assays. Assay trials revealed that nsP4 core domain is conditionally active upon choice of detergent species, and carries out both primed extension and terminal adenylyltransferase activities. The polymerization assay can be further developed to screen for antiviral compounds in vitro.

  10. Different molecular mechanisms of inhibition of bovine viral diarrhea virus and hepatitis C virus RNA-dependent RNA polymerases by a novel benzimidazole.

    PubMed

    Asthana, Shailendra; Shukla, Saumya; Vargiu, Attilio V; Ceccarelli, Matteo; Ruggerone, Paolo; Paglietti, Giuseppe; Marongiu, Maria E; Blois, Sylvain; Giliberti, Gabriele; La Colla, Paolo

    2013-05-28

    The virus-encoded RNA-dependent RNA polymerase (RdRp) has emerged as a primary target in the search for selective inhibitors of Flaviviridae. Recently, we reported on the selective inhibition, in cell-based assays, of both BVDV (EC50 = 0.80 ± 0.06 μM) and HCV (EC50 = 1.11 ± 0.15 μM) by 2-{1-[2-(2,4-dimethoxyphenyl)-1H-benzimidazol-5-yl]ethylidene}hydrazinecarbothioamide (227G). Here we show that, in enzyme assays with recombinant enzymes, 227G inhibits, in a dose-dependent manner, the RdRp of both BVDV (IC50 = 0.0020 ± 0.0004 μM) and HCV (IC50 = 0.40 ± 0.04 μM). Furthermore, we report on the selection and molecular analysis of a BVDV-resistant mutant, characterized by the presence of the I261M mutation. By applying a multilevel computational approach, we identified different 227G binding sites on the two RdRps. They were further validated by the good agreement between the calculated affinities and those extrapolated from IC50 values. Our findings suggest different molecular mechanisms of inhibition of the HCV and BVDV RdRps by 227G and indicate the importance of understanding ligand-enzyme interactions at the molecular level for the rational design of new and more potent leads.

  11. Cytoplasmic viral RNA-dependent RNA polymerase disrupts the intracellular splicing machinery by entering the nucleus and interfering with Prp8.

    PubMed

    Liu, Yen-Chin; Kuo, Rei-Lin; Lin, Jing-Yi; Huang, Peng-Nien; Huang, Yi; Liu, Hsuan; Arnold, Jamine J; Chen, Shu-Jen; Wang, Robert Yung-Liang; Cameron, Craig E; Shih, Shin-Ru

    2014-06-01

    The primary role of cytoplasmic viral RNA-dependent RNA polymerase (RdRp) is viral genome replication in the cellular cytoplasm. However, picornaviral RdRp denoted 3D polymerase (3D(pol)) also enters the host nucleus, where its function remains unclear. In this study, we describe a novel mechanism of viral attack in which 3D(pol) enters the nucleus through the nuclear localization signal (NLS) and targets the pre-mRNA processing factor 8 (Prp8) to block pre-mRNA splicing and mRNA synthesis. The fingers domain of 3D(pol) associates with the C-terminal region of Prp8, which contains the Jab1/MPN domain, and interferes in the second catalytic step, resulting in the accumulation of the lariat form of the splicing intermediate. Endogenous pre-mRNAs trapped by the Prp8-3D(pol) complex in enterovirus-infected cells were identified and classed into groups associated with cell growth, proliferation, and differentiation. Our results suggest that picornaviral RdRp disrupts pre-mRNA splicing processes, that differs from viral protease shutting off cellular transcription and translation which contributes to the pathogenesis of viral infection.

  12. Endogenous short RNAs generated by Dicer 2 and RNA-dependent RNA polymerase 1 regulate mRNAs in the basal fungus Mucor circinelloides

    SciTech Connect

    Grigoriev, Igor; Nicolas, Francisco; Moxon, Simon; Haro, Juan de; Calo, Silvia; Torres-Martinez, Santiago; Moulton, Vincent; Ruiz-Vazquez, Rosa; Dalmay, Tamas

    2011-09-01

    Endogenous short RNAs (esRNAs) play diverse roles in eukaryotes and usually are produced from double-stranded RNA (dsRNA) by Dicer. esRNAs are grouped into different classes based on biogenesis and function but not all classes are present in all three eukaryotic kingdoms. The esRNA register of fungi is poorly described compared to other eukaryotes and it is not clear what esRNA classes are present in this kingdom and whether they regulate the expression of protein coding genes. However, evidence that some dicer mutant fungi display altered phenotypes suggests that esRNAs play an important role in fungi. Here, we show that the basal fungus Mucor circinelloides produces new classes of esRNAs that map to exons and regulate the expression of many protein coding genes. The largest class of these exonic-siRNAs (ex-siRNAs) are generated by RNA-dependent RNA Polymerase 1 (RdRP1) and dicer-like 2 (DCL2) and target the mRNAs of protein coding genes from which they were produced. Our results expand the range of esRNAs in eukaryotes and reveal a new role for esRNAs in fungi

  13. Cytoplasmic Viral RNA-Dependent RNA Polymerase Disrupts the Intracellular Splicing Machinery by Entering the Nucleus and Interfering with Prp8

    PubMed Central

    Liu, Yen-Chin; Kuo, Rei-Lin; Lin, Jing-Yi; Huang, Peng-Nien; Huang, Yi; Liu, Hsuan; Arnold, Jamine J.; Chen, Shu-Jen; Wang, Robert Yung-Liang; Cameron, Craig E.; Shih, Shin-Ru

    2014-01-01

    The primary role of cytoplasmic viral RNA-dependent RNA polymerase (RdRp) is viral genome replication in the cellular cytoplasm. However, picornaviral RdRp denoted 3D polymerase (3Dpol) also enters the host nucleus, where its function remains unclear. In this study, we describe a novel mechanism of viral attack in which 3Dpol enters the nucleus through the nuclear localization signal (NLS) and targets the pre-mRNA processing factor 8 (Prp8) to block pre-mRNA splicing and mRNA synthesis. The fingers domain of 3Dpol associates with the C-terminal region of Prp8, which contains the Jab1/MPN domain, and interferes in the second catalytic step, resulting in the accumulation of the lariat form of the splicing intermediate. Endogenous pre-mRNAs trapped by the Prp8-3Dpol complex in enterovirus-infected cells were identified and classed into groups associated with cell growth, proliferation, and differentiation. Our results suggest that picornaviral RdRp disrupts pre-mRNA splicing processes, that differs from viral protease shutting off cellular transcription and translation which contributes to the pathogenesis of viral infection. PMID:24968230

  14. Probing the binding of procyanidin B3 to trypsin and pepsin: A multi-technique approach.

    PubMed

    Li, Xiangrong; Geng, Mingjiang

    2016-04-01

    Proanthocyanidins are a mixture of monomers, oligomers, and polymers of flavan-3-ols that are widely distributed in the plant kingdom. One of the most widely studied proanthocyanidins is procyanidin B3. In this study, the binding of procyanidin B3 to trypsin and pepsin was investigated using spectrofluorimetry, equilibrium microdialysis, circular dichroism (CD) spectroscopy and molecular modeling. Fluorescence experiments indicate procyanidin B3 quenches the fluorescence of trypsin/pepsin through a static process. Thermodynamic analysis reveals that procyanidin B3 binds to trypsin/pepsin is synergistically driven by enthalpy and entropy, and the major driving forces are hydrophobic, hydrogen bonding, and electrostatic interactions. Procyanidin B3 binds trypsin in a more firmly way than pepsin, and one molecule of procyanidin B3 combines with one molecule of trypsin/pepsin. The binding parameters obtained from equilibrium microdialysis are consistent with the results obtained from fluorescence spectroscopy. Synchronous fluorescence spectroscopy and CD spectroscopy show that procyanidin B3 may induce microenvironmental and conformational changes of trypsin and pepsin. Molecular modeling displays the specific binding site of procyanidin B3 on trypsin and pepsin. The study provides an accurate and full basic data for clarifying the binding mechanisms of procyanidin B3 with trypsin and pepsin and is helpful for understanding its biological activity in vivo.

  15. Probing the binding of procyanidin B3 to human serum albumin by isothermal titration calorimetry

    NASA Astrophysics Data System (ADS)

    Li, Xiangrong; Yan, Yunhui

    2015-02-01

    Proanthocyanidins are a mixture of monomers, oligomers, and polymers of flavan-3-ols that are widely distributed in the plant kingdom. One of the most widely studied proanthocyanidins is procyanidin B3. In this study, the interaction between procyanidin B3 and human serum albumin (HSA) was investigated using isothermal titration calorimetry (ITC). Thermodynamic investigations reveal that the hydrogen bond and van der Waals force are the major binding forces in the binding of procyanidin B3 to HSA. The binding of procyanidin B3 to HSA is driven by favorable enthalpy and unfavorable entropy. The obtained binding constant for procyanidin B3 with HSA is in the intermediate range and the equilibrium fraction of unbound procyanidin B3 fu > 90% at the physiological concentration of HSA shows that procyanidin B3 can be stored and transported from the circulatory system to reach its target site. The stoichiometric binding number n approximately equals to 1, suggesting that one molecule of procyanidin B3 combines with one molecule of HSA and no more procyanidin B3 binding to HSA occurs at the concentration used in this study.

  16. Microchip capillary electrophoresis with laser-induced fluorescence combined with one-step duplex reverse-transcription polymerase chain reaction for the rapid detection of Enterovirus 71 and Coxsackievirus A16 in throat swab specimens.

    PubMed

    Jia, Ruan; Chengjun, Sun; Heng, Chen; Chen, Zhou; Yuanqian, Li; Yongxin, Li

    2015-07-01

    Enterovirus 71 and Coxsackievirus A16 are the main pathogens causing hand-foot-mouth disease. In this paper, microchip capillary electrophoresis with laser-induced fluorescence combined with one-step duplex reverse transcript-polymerase chain reaction has been developed for the detection of Enterovirus 71 and Coxsackievirus A16 in throat swab specimens. The specific reverse transcription-polymerase chain reaction amplicons labeled with SYBR Orange were separated by microchip capillary electrophoresis and detected by laser induced fluorescence detector within 7 min. The intraday and interday relative standard deviation of migration time for DNA Marker was in the range of 1.36-2.94 and 2.78-3.96%, respectively. The detection limits were as low as 2.06 × 10(3) copies/mL for Enterovirus 71 and 5 × 10(3) copies/mL for Coxsackievirus A16. No cross-reactivity was observed with rotavirus, astrovirus, norovirus, and adenovirus, which showed good specificity of the method. This assay was validated using 100 throat swab specimens that were detected by real-time reverse-transcript polymerase chain reaction in parallel and the two methods produced the same results. This study provided a rapid, sensitive and specific method for the detection of Enterovirus 71 and Coxsackievirus A16, which make a contribution to significant time and cost saving for the identification and treatment of patients. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. An IFIH1 gene polymorphism associated with risk for autoimmunity regulates canonical antiviral defence pathways in Coxsackievirus infected human pancreatic islets

    PubMed Central

    Domsgen, Erna; Lind, Katharina; Kong, Lingjia; Hühn, Michael H.; Rasool, Omid; van Kuppeveld, Frank; Korsgren, Olle; Lahesmaa, Riitta; Flodström-Tullberg, Malin

    2016-01-01

    The IFIH1 gene encodes the pattern recognition receptor MDA5. A common polymorphism in IFIH1 (rs1990760, A946T) confers increased risk for autoimmune disease, including type 1-diabetes (T1D). Coxsackievirus infections are linked to T1D and cause beta-cell damage in vitro. Here we demonstrate that the rs1990760 polymorphism regulates the interferon (IFN) signature expressed by human pancreatic islets following Coxsackievirus infection. A strong IFN signature was associated with high expression of IFNλ1 and IFNλ2, linking rs1990760 to the expression of type III IFNs. In the high-responding genotype, IRF-1 expression correlated with that of type III IFN, suggesting a positive-feedback on type III IFN transcription. In summary, our study uncovers an influence of rs1990760 on the canonical effector function of MDA5 in response to an acute infection of primary human parenchymal cells with a clinically relevant virus linked to human T1D. It also highlights a previously unrecognized connection between the rs1990760 polymorphism and the expression level of type III IFNs. PMID:28000722

  18. Primary neurons become less susceptible to coxsackievirus B5 following maturation: the correlation with the decreased level of CAR expression on cell surface.

    PubMed

    Ahn, Jeonghyun; Jee, Youngmee; Seo, Ilseon; Yoon, Seung Yong; Kim, DongHou; Kim, Yoo Kyum; Lee, Heuiran

    2008-03-01

    Coxsackievirus B (CVB) is one of the major pathogens of aseptic meningitis and meningioencephalitis, particularly in newborn infants. To analyze the influence of neural maturation on susceptibility to CVB infection, we prepared immature and mature neurons from 16-day-old BALB/c embryonic cortex. In contrast to immature neurons, mature neurons were less susceptible to CVB5 infection, as indicated by the decrease of cytopathic features. In mature neurons, progeny virus production was significantly hindered, and virus capsid protein VP1 synthesis and virus genome amplification were concomitantly reduced. In addition, the expression of coxsackievirus and adenovirus receptor (CAR), the major receptor of CVB5, was down-regulated in mature neurons. The antibody treatment specific to CAR significantly attenuated CVB5 susceptibility of immature neurons. These findings demonstrate that mature neurons become less susceptible to CVB by the decrease of CAR level. Thus, the data strongly support the idea that the level of virus receptor in neurons is one of the crucial determinants in the age-dependency of CVB virulence in central nervous system.

  19. A novel recombinant lineage’s contribution to the outbreak of coxsackievirus A6-associated hand, foot and mouth disease in Shanghai, China, 2012-2013

    PubMed Central

    Feng, Xiaobo; Guan, Wencai; Guo, Yifeng; Yu, Huiju; Zhang, Xiaoling; Cheng, Ruhong; Wang, Zhen; Zhang, Zhen; Zhang, Jia; Li, Huaguo; Zhuang, Yin; Zhang, Hui; Lu, Zhiyong; Li, Ming; Yu, Hong; Bao, Yixiao; Hu, Yunwen; Yao, Zhirong

    2015-01-01

    Since late 2012, coxsackievirus A6 (CVA6) has gradually become the predominant pathogen responsible for hand-foot-mouth disease (HFMD) in several provinces of China. A total of 626 patients diagnosed with HFMD in Shanghai, China from January 2012 to September 2013 were enrolled in this study. Of these, 292 CVA6 infected cases were subjected to clinical analyses. Whole-genome sequencing, recombination and phylogenetic analyses were also performed. A recombinant CVA6 monophyletic lineage was found during an outbreak of CVA6-associated HFMDs in Shanghai, China in November 2012, and accounted for 21.9% (64/292) of the CVA6 strains during the study period. Recombination analyses showed that the 2C gene of the novel CVA6 virus was probably derived from a coxsackievirus A4 (CVA4) strain circulating in the population. Clinical observation showed that this recombinant CVA6 virus led to a more generalized rash than did the non-recombinant CVA6 virus. This newly emerged CVA6 lineage was associated with a considerable proportion of HFMD cases from 2012 to 2013 in Shanghai, and poses a potential threat to public health. PMID:26121916

  20. Complete Genomic Sequence of Bacteriophage B3, a Mu-Like Phage of Pseudomonas aeruginosa†

    PubMed Central

    Braid, Michael D.; Silhavy, Jennifer L.; Kitts, Christopher L.; Cano, Raul J.; Howe, Martha M.

    2004-01-01

    Bacteriophage B3 is a transposable phage of Pseudomonas aeruginosa. In this report, we present the complete DNA sequence and annotation of the B3 genome. DNA sequence analysis revealed that the B3 genome is 38,439 bp long with a G+C content of 63.3%. The genome contains 59 proposed open reading frames (ORFs) organized into at least three operons. Of these ORFs, the predicted proteins from 41 ORFs (68%) display significant similarity to other phage or bacterial proteins. Many of the predicted B3 proteins are homologous to those encoded by the early genes and head genes of Mu and Mu-like prophages found in sequenced bacterial genomes. Only two of the predicted B3 tail proteins are homologous to other well-characterized phage tail proteins; however, several Mu-like prophages and transposable phage D3112 encode approximately 10 highly similar proteins in their predicted tail gene regions. Comparison of the B3 genomic organization with that of Mu revealed evidence of multiple genetic rearrangements, the most notable being the inversion of the proposed B3 immunity/early gene region, the loss of Mu-like tail genes, and an extreme leftward shift of the B3 DNA modification gene cluster. These differences illustrate and support the widely held view that tailed phages are genetic mosaics arising by the exchange of functional modules within a diverse genetic pool. PMID:15375138

  1. 26 CFR 31.3121(b)(3)-1 - Family employment.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 26 Internal Revenue 15 2010-04-01 2010-04-01 false Family employment. 31.3121(b)(3)-1 Section 31... § 31.3121(b)(3)-1 Family employment. (a) Certain services are excepted from employment because of the existence of a family relationship between the employee and the individual employing him. The exceptions...

  2. 26 CFR 31.3121(b)(3)-1 - Family employment.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... the family relationship, there is a further requirement that the son or daughter shall be under the... 26 Internal Revenue 15 2011-04-01 2011-04-01 false Family employment. 31.3121(b)(3)-1 Section 31... § 31.3121(b)(3)-1 Family employment. (a) Certain services are excepted from employment because of...

  3. Genetic loss of SH2B3 in acute lymphoblastic leukemia

    PubMed Central

    Perez-Garcia, Arianne; Ambesi-Impiombato, Alberto; Hadler, Michael; Rigo, Isaura; LeDuc, Charles A.; Kelly, Kara; Jalas, Chaim; Paietta, Elisabeth; Racevskis, Janis; Rowe, Jacob M.; Tallman, Martin S.; Paganin, Maddalena; Basso, Giuseppe; Tong, Wei; Chung, Wendy K.

    2013-01-01

    The SH2B adaptor protein 3 (SH2B3) gene encodes a negative regulator of cytokine signaling with a critical role in the homeostasis of hematopoietic stem cells and lymphoid progenitors. Here, we report the identification of germline homozygous SH2B3 mutations in 2 siblings affected with developmental delay and autoimmunity, one in whom B-precursor acute lymphoblastic leukemia (ALL) developed. Mechanistically, loss of SH2B3 increases Janus kinase-signal transducer and activator of transcription signaling, promotes lymphoid cell proliferation, and accelerates leukemia development in a mouse model of NOTCH1-induced ALL. Moreover, extended mutation analysis showed homozygous somatic mutations in SH2B3 in 2 of 167 ALLs analyzed. Overall, these results demonstrate a Knudson tumor suppressor role for SH2B3 in the pathogenesis of ALL and highlight a possible link between genetic predisposition factors in the pathogenesis of autoimmunity and leukemogenesis. PMID:23908464

  4. The Cellular TAR RNA Binding Protein, TRBP, Promotes HIV-1 Replication Primarily by Inhibiting the Activation of Double-Stranded RNA-Dependent Kinase PKR▿

    PubMed Central

    Sanghvi, Viraj R.; Steel, Laura F.

    2011-01-01

    The TAR RNA binding protein, TRBP, is a cellular double-stranded RNA (dsRNA) binding protein that can promote the replication of HIV-1 through interactions with the viral TAR element as well as with cellular proteins that affect the efficiency of translation of viral transcripts. The structured TAR element, present on all viral transcripts, can impede efficient translation either by sterically blocking access of translation initiation factors to the 5′-cap or by activating the dsRNA-dependent kinase, PKR. Several mechanisms by which TRBP can facilitate translation of viral transcripts have been proposed, including the binding and unwinding of TAR and the suppression of PKR activation. Further, TRBP has been identified as a cofactor of Dicer in the processing of microRNAs (miRNAs), and sequestration of TRBP by TAR in infected cells has been proposed as a viral countermeasure to potential host cell RNA interference-based antiviral activities. Here, we have addressed the relative importance of these various roles for TRBP in HIV-1 replication. Using Jurkat T cells, primary human CD4+ T cells, and additional cultured cell lines, we show that depletion of TRBP has no effect on viral replication when PKR activation is otherwise blocked. Moreover, the presence of TAR-containing mRNAs does not affect the efficacy of cellular miRNA silencing pathways. These results establish that TRBP, when expressed at physiological levels, promotes HIV-1 replication mainly by suppressing the PKR-mediated antiviral response, while its contribution to HIV-1 replication through PKR-independent pathways is minimal. PMID:21937648

  5. StralSV: assessment of sequence variability within similar 3D structures and application to polio RNA-dependent RNA polymerase

    SciTech Connect

    Zemla, A; Lang, D; Kostova, T; Andino, R; Zhou, C

    2010-11-29

    Most of the currently used methods for protein function prediction rely on sequence-based comparisons between a query protein and those for which a functional annotation is provided. A serious limitation of sequence similarity-based approaches for identifying residue conservation among proteins is the low confidence in assigning residue-residue correspondences among proteins when the level of sequence identity between the compared proteins is poor. Multiple sequence alignment methods are more satisfactory - still, they cannot provide reliable results at low levels of sequence identity. Our goal in the current work was to develop an algorithm that could overcome these difficulties and facilitate the identification of structurally (and possibly functionally) relevant residue-residue correspondences between compared protein structures. Here we present StralSV, a new algorithm for detecting closely related structure fragments and quantifying residue frequency from tight local structure alignments. We apply StralSV in a study of the RNA-dependent RNA polymerase of poliovirus and demonstrate that the algorithm can be used to determine regions of the protein that are relatively unique or that shared structural similarity with structures that are distantly related. By quantifying residue frequencies among many residue-residue pairs extracted from local alignments, one can infer potential structural or functional importance of specific residues that are determined to be highly conserved or that deviate from a consensus. We further demonstrate that considerable detailed structural and phylogenetic information can be derived from StralSV analyses. StralSV is a new structure-based algorithm for identifying and aligning structure fragments that have similarity to a reference protein. StralSV analysis can be used to quantify residue-residue correspondences and identify residues that may be of particular structural or functional importance, as well as unusual or unexpected

  6. Crystal structure, mutational analysis and RNA-dependent ATPase activity of the yeast DEAD-box pre-mRNA splicing factor Prp28

    SciTech Connect

    Jacewicz, Agata; Schwer, Beate; Smith, Paul; Shuman, Stewart

    2014-10-10

    Yeast Prp28 is a DEAD-box pre-mRNA splicing factor implicated in displacing U1 snRNP from the 5' splice site. Here we report that the 588-aa Prp28 protein consists of a trypsin-sensitive 126-aa N-terminal segment (of which aa 1–89 are dispensable for Prp28 function in vivo) fused to a trypsin-resistant C-terminal catalytic domain. Purified recombinant Prp28 and Prp28-(127–588) have an intrinsic RNA-dependent ATPase activity, albeit with a low turnover number. The crystal structure of Prp28-(127–588) comprises two RecA-like domains splayed widely apart. AMPPNP•Mg2+ is engaged by the proximal domain, with proper and specific contacts from Phe194 and Gln201 (Q motif) to the adenine nucleobase. The triphosphate moiety of AMPPNP•Mg2+ is not poised for catalysis in the open domain conformation. Guided by the Prp28•AMPPNP structure, and that of the Drosophila Vasa•AMPPNP•Mg2+•RNA complex, we targeted 20 positions in Prp28 for alanine scanning. ATP-site components Asp341 and Glu342 (motif II) and Arg527 and Arg530 (motif VI) and RNA-site constituent Arg476 (motif Va) are essential for Prp28 activity in vivo. Synthetic lethality of double-alanine mutations highlighted functionally redundant contacts in the ATP-binding (Phe194-Gln201, Gln201-Asp502) and RNA-binding (Arg264-Arg320) sites. As a result, overexpression of defective ATP-site mutants, but not defective RNA-site mutants, elicited severe dominant-negative growth defects.

  7. The relationship between the plant-encoded RNA-dependent RNA polymerase 1 and alternative oxidase in tomato basal defense against Tobacco mosaic virus.

    PubMed

    Liao, Yang-Wen-Ke; Liu, Ya-Ru; Liang, Jia-Yang; Wang, Wen-Ping; Zhou, Jie; Xia, Xiao-Jian; Zhou, Yan-Hong; Yu, Jing-Quan; Shi, Kai

    2015-03-01

    Salicylic acid (SA) plays a critical role in plant defense against pathogen attack. The SA-induced viral defense in plants is distinct from the pathways mediating bacterial and fungal defense, which is pathogenesis-related protein-independent but involves an RNA-dependent RNA polymerase 1 (RDR1)-mediated RNA silencing mechanism and/or an alternative oxidase (AOX)-associated defense pathway. However, the relationship between these two viral defense-related pathways remains unclear. In this study, Tobacco mosaic virus (TMV) inoculation onto Solanum lycopersicum (tomato) leaves induced a rapid induction of the SlAOX1a transcript level as well as the total and CN-resistant respiration at 0.5 dpi, followed by an increase in SlRDR1 gene expression at 1 dpi in the upper uninoculated leaves. Silencing SlRDR1 using virus-induced gene silencing system significantly reduced SlRDR1 expression and tomato defense against TMV but had no evident effect on SlAOX1a transcription. Conversely, silencing SlAOX1a not only effectively reduced the AOX1a transcript level, but also blocked the TMV-induced SlRDR1 expression and decreased the basal defense against TMV. Furthermore, the application of an exogenous AOX activator on empty vector-silenced control plants greatly induced the accumulation of SlRDR1 and SlAOX1a transcript and reduced TMV viral RNA accumulation, but failed to have such effects on SlRDR1-silenced plants. Moreover, RDR1-overexpressed transgenic Nicotiana benthamiana plants enhanced defense against TMV than the empty vector-transformed plants, but these effects were not affected by the exogenous AOX activator or inhibitor. These results indicate that RDR1 is involved in the AOX-mediated defense pathway against TMV infection and plays a crucial role in enhancing RNA silencing to limit virus systemic spread.

  8. Crystal structure, mutational analysis and RNA-dependent ATPase activity of the yeast DEAD-box pre-mRNA splicing factor Prp28

    DOE PAGES

    Jacewicz, Agata; Schwer, Beate; Smith, Paul; ...

    2014-10-10

    Yeast Prp28 is a DEAD-box pre-mRNA splicing factor implicated in displacing U1 snRNP from the 5' splice site. Here we report that the 588-aa Prp28 protein consists of a trypsin-sensitive 126-aa N-terminal segment (of which aa 1–89 are dispensable for Prp28 function in vivo) fused to a trypsin-resistant C-terminal catalytic domain. Purified recombinant Prp28 and Prp28-(127–588) have an intrinsic RNA-dependent ATPase activity, albeit with a low turnover number. The crystal structure of Prp28-(127–588) comprises two RecA-like domains splayed widely apart. AMPPNP•Mg2+ is engaged by the proximal domain, with proper and specific contacts from Phe194 and Gln201 (Q motif) to themore » adenine nucleobase. The triphosphate moiety of AMPPNP•Mg2+ is not poised for catalysis in the open domain conformation. Guided by the Prp28•AMPPNP structure, and that of the Drosophila Vasa•AMPPNP•Mg2+•RNA complex, we targeted 20 positions in Prp28 for alanine scanning. ATP-site components Asp341 and Glu342 (motif II) and Arg527 and Arg530 (motif VI) and RNA-site constituent Arg476 (motif Va) are essential for Prp28 activity in vivo. Synthetic lethality of double-alanine mutations highlighted functionally redundant contacts in the ATP-binding (Phe194-Gln201, Gln201-Asp502) and RNA-binding (Arg264-Arg320) sites. As a result, overexpression of defective ATP-site mutants, but not defective RNA-site mutants, elicited severe dominant-negative growth defects.« less

  9. Structural and Biochemical Analyses on the RNA-dependent RNA Polymerase of Influenza Virus for Development of Novel Anti-influenza Agents.

    PubMed

    Hatakeyama, Dai

    2017-01-01

     The PA, PB1, and PB2 subunits, components of the RNA-dependent RNA polymerase of influenza A virus, and the nucleoprotein (NP) interact with the genomic RNA of influenza viruses and form ribonucleoproteins. Especially, the PB2 subunit binds to the host RNA cap [7-methylguanosine triphosphate (m(7)GTP)] and supports the endonuclease activity of PA to "snatch" the cap from host pre-mRNAs. In this study, we describe a novel Val/Arg/Gly (VRG) site in the PB2 cap-binding domain, which is necessary for interaction with acetyl-CoA found in eukaryotic histone acetyltransferases (HATs). In vitro experiments revealed that the recombinant PB2 cap-binding domain that includes the VRG site interacts with acetyl-CoA; moreover, it was found that this interaction could be blocked by CoA and various HAT inhibitors. Interestingly, m(7)GTP also inhibited this interaction, suggesting that the same active pocket is capable of interacting with acetyl-CoA and m(7)GTP. To elucidate the importance of the VRG site on PB2 function and viral replication, we constructed a PB2 recombinant protein and recombinant viruses including several patterns of amino acid mutations in the VRG site. Substitutions of 2 or 3 amino acid residues of the VRG site to alanine significantly reduced PB2's binding ability to acetyl-CoA and its RNA polymerase activity. Recombinant viruses containing the same mutations could not be replicated in cultured cells. These results indicate that the PB2 VRG sequence is a functional site that is essential for acetyl-CoA interaction, RNA polymerase activity, and viral replication. I will also discuss some novel functions of NP in this review.

  10. RNA-Dependent RNA Polymerase 1 from Nicotiana tabacum Suppresses RNA Silencing and Enhances Viral Infection in Nicotiana benthamiana[W

    PubMed Central

    Ying, Xiao-Bao; Dong, Li; Zhu, Hui; Duan, Cheng-Guo; Du, Quan-Sheng; Lv, Dian-Qiu; Fang, Yuan-Yuan; Garcia, Juan Antonio; Fang, Rong-Xiang; Guo, Hui-Shan

    2010-01-01

    Endogenous eukaryotic RNA-dependent RNA polymerases (RDRs) produce double-stranded RNA intermediates in diverse processes of small RNA synthesis in RNA silencing pathways. RDR6 is required in plants for posttranscriptional gene silencing induced by sense transgenes (S-PTGS) and has an important role in amplification of antiviral silencing. Whereas RDR1 is also involved in antiviral defense in plants, this does not necessarily proceed through triggering silencing. In this study, we show that Nicotiana benthamiana transformed with RDR1 from Nicotiana tabacum (Nt-RDR1 plants) exhibits hypersusceptibility to Plum pox potyvirus and other viruses, resembling RDR6-silenced (RDR6i) N. benthamiana. Analysis of transient induction of RNA silencing in N. benthamiana Nt-RDR1 and RDR6i plants revealed that Nt-RDR1 possesses silencing suppression activity. We found that Nt-RDR1 does not interfere with RDR6-dependent siRNA accumulation but turns out to suppress RDR6-dependent S-PTGS. Our results, together with previously published data, suggest that RDR1 might have a dual role, contributing, on one hand, to salicylic acid–mediated antiviral defense, and suppressing, on the other hand, the RDR6-mediated antiviral RNA silencing. We propose a scenario in which the natural loss-of-function variant of RDR1 in N. benthamiana may be the outcome of selective pressure to maintain a high RDR6-dependent antiviral defense, which would be required to face the hypersensitivity of this plant to a large number of viruses. PMID:20400679

  11. Double-stranded RNA-dependent protein kinase is required for bone calcification in MC3T3-E1 cells in vitro.

    PubMed

    Yoshida, Kaya; Okamura, Hirohiko; Amorim, Bruna Rabelo; Ozaki, Akiko; Tanaka, Hiroaki; Morimoto, Hiroyuki; Haneji, Tatsuji

    2005-11-15

    In this study, we demonstrated that double-stranded RNA-dependent protein kinase (PKR) is required for the calcification of osteoblasts via the signal transducers and activators of transcription 1alpha (STAT1alpha) signaling in vitro. A dominant-negative mutant PKR cDNA, in which the amino acid lysine at 296 was replaced with arginine and which does not have catalytic activity, was transfected into mouse osteoblastic MC3T3-E1 cells; thereby, we established cells that stably expressed the PKR mutant gene (PKR-K/R). Phosphorylation of PKR was not stimulated by polyinosic-polycytidylic acid in the mutant cells. The PKR-K/R mutant cells exhibited up-regulated cell growth and had low alkaline phosphatase (ALP) activity. The PKR-K/R mutant cells were not able to form bone nodules in vitro. In the PKR-K/R mutant cells, runt-related gene 2 (Runx2)-mediated transcription decreased compared with the levels in the control cells. The expression of STAT1alpha protein increased and the protein was translocated to the nucleus in the PKR-K/R mutant cells. When the expression of STAT1alpha protein in PKR mutant cells was suppressed using RNAi, the activity of Runx2-mediated transcription recovered to the control level. Our results indicate that PKR is a stimulator of Runx2 transcription and is a negative modulator of STAT1alpha expression. Our findings also suggest that PKR plays important roles in the differentiation and calcification of osteoblasts by modulating STAT1alpha and/or Runx2 expression.

  12. The genome sequence of Streptomyces lividans 66 reveals a novel tRNA-dependent peptide biosynthetic system within a metal-related genomic island.

    PubMed

    Cruz-Morales, Pablo; Vijgenboom, Erik; Iruegas-Bocardo, Fernanda; Girard, Geneviève; Yáñez-Guerra, Luis Alfonso; Ramos-Aboites, Hilda E; Pernodet, Jean-Luc; Anné, Jozef; van Wezel, Gilles P; Barona-Gómez, Francisco

    2013-01-01

    The complete genome sequence of the original isolate of the model actinomycete Streptomyces lividans 66, also referred to as 1326, was deciphered after a combination of next-generation sequencing platforms and a hybrid assembly pipeline. Comparative analysis of the genomes of S. lividans 66 and closely related strains, including S. coelicolor M145 and S. lividans TK24, was used to identify strain-specific genes. The genetic diversity identified included a large genomic island with a mosaic structure, present in S. lividans 66 but not in the strain TK24. Sequence analyses showed that this genomic island has an anomalous (G + C) content, suggesting recent acquisition and that it is rich in metal-related genes. Sequences previously linked to a mobile conjugative element, termed plasmid SLP3 and defined here as a 94 kb region, could also be identified within this locus. Transcriptional analysis of the response of S. lividans 66 to copper was used to corroborate a role of this large genomic island, including two SLP3-borne "cryptic" peptide biosynthetic gene clusters, in metal homeostasis. Notably, one of these predicted biosynthetic systems includes an unprecedented nonribosomal peptide synthetase--tRNA-dependent transferase biosynthetic hybrid organization. This observation implies the recruitment of members of the leucyl/phenylalanyl-tRNA-protein transferase family to catalyze peptide bond formation within the biosynthesis of natural products. Thus, the genome sequence of S. lividans 66 not only explains long-standing genetic and phenotypic differences but also opens the door for further in-depth comparative genomic analyses of model Streptomyces strains, as well as for the discovery of novel natural products following genome-mining approaches.

  13. The Genome Sequence of Streptomyces lividans 66 Reveals a Novel tRNA-Dependent Peptide Biosynthetic System within a Metal-Related Genomic Island

    PubMed Central

    Cruz-Morales, Pablo; Vijgenboom, Erik; Iruegas-Bocardo, Fernanda; Girard, Geneviève; Yáñez-Guerra, Luis Alfonso; Ramos-Aboites, Hilda E.; Pernodet, Jean-Luc; Anné, Jozef; van Wezel, Gilles P.; Barona-Gómez, Francisco

    2013-01-01

    The complete genome sequence of the original isolate of the model actinomycete Streptomyces lividans 66, also referred to as 1326, was deciphered after a combination of next-generation sequencing platforms and a hybrid assembly pipeline. Comparative analysis of the genomes of S. lividans 66 and closely related strains, including S. coelicolor M145 and S. lividans TK24, was used to identify strain-specific genes. The genetic diversity identified included a large genomic island with a mosaic structure, present in S. lividans 66 but not in the strain TK24. Sequence analyses showed that this genomic island has an anomalous (G + C) content, suggesting recent acquisition and that it is rich in metal-related genes. Sequences previously linked to a mobile conjugative element, termed plasmid SLP3 and defined here as a 94 kb region, could also be identified within this locus. Transcriptional analysis of the response of S. lividans 66 to copper was used to corroborate a role of this large genomic island, including two SLP3-borne “cryptic” peptide biosynthetic gene clusters, in metal homeostasis. Notably, one of these predicted biosynthetic systems includes an unprecedented nonribosomal peptide synthetase—tRNA-dependent transferase biosynthetic hybrid organization. This observation implies the recruitment of members of the leucyl/phenylalanyl-tRNA-protein transferase family to catalyze peptide bond formation within the biosynthesis of natural products. Thus, the genome sequence of S. lividans 66 not only explains long-standing genetic and phenotypic differences but also opens the door for further in-depth comparative genomic analyses of model Streptomyces strains, as well as for the discovery of novel natural products following genome-mining approaches. PMID:23709624

  14. In vitro characterization of 6S RNA release-defective mutants uncovers features of pRNA-dependent release from RNA polymerase in E. coli

    PubMed Central

    Oviedo Ovando, Mariana; Shephard, Lindsay; Unrau, Peter J.

    2014-01-01

    6S RNA is a noncoding RNA that inhibits bacterial transcription by sequestering RNA polymerase holoenzyme (Eσ70) in low-nutrient conditions. This transcriptional block can be relieved by the synthesis of a short product RNA (pRNA) using the 6S RNA as a template. Here, we selected a range of 6S RNA release-defective mutants from a high diversity in vitro pool. Studying the release-defective variant R9-33 uncovered complex interactions between three regions of the 6S RNA. As expected, mutating the transcriptional start site (TSS) slowed and partially inhibited release. Surprisingly, additional mutations near the TSS were found that rescued this effect. Likewise, three mutations in the top strand of the large open bubble (LOB) could considerably slow release but were rescued by the addition of upstream mutations found between a highly conserved “-35” motif and the LOB. Combining the three top strand LOB mutations with mutations near the TSS, however, was particularly effective at preventing release, and this effect could be further enhanced by inclusion of the upstream mutations. Overexpressing R9-33 and a series of milder release-defective mutants in Escherichia coli resulted in a delayed entry into exponential phase together with a decrease in cell survival that correlated well with the severity of the in vitro phenotypes. The complex crosstalk observed between distinct regions of the 6S RNA supports a scrunching type model of 6S RNA release, where at least three regions of the 6S RNA must interact with Eσ70 in a cooperative manner so as to ensure effective pRNA-dependent release. PMID:24681966

  15. Crystal Structure of Enterovirus 71 RNA-Dependent RNA Polymerase Complexed with Its Protein Primer VPg: Implication for a trans Mechanism of VPg Uridylylation

    PubMed Central

    Chen, Cheng; Wang, Yaxin; Shan, Chao; Sun, Yuna; Xu, Peng; Zhou, Honggang; Yang, Cheng; Shi, Pei-Yong; Rao, Zihe

    2013-01-01

    Picornavirus RNA replication is initiated by VPg uridylylation, during which the hydroxyl group of the third tyrosine residue of the virally encoded protein VPg is covalently linked to two UMP molecules by RNA-dependent RNA polymerase (RdRp; also known as 3Dpol). We previously identified site 311, located at the base of the palm domain of the enterovirus 71 (EV71) RdRp, to be the site for EV71 VPg binding and uridylylation. Here we report the crystal structure of EV71 3Dpol complexed with VPg. VPg was anchored at the bottom of the palm domain of the 3Dpol molecule and exhibited an extended V-shape conformation. The corresponding interface on 3Dpol was mainly formed by residues within site 311 and other residues in the palm and finger domains. Mutations of the amino acids of 3Dpol involved in the VPg interaction (3DL319A, 3DD320A, and 3DY335A) significantly disrupted VPg binding to 3Dpol, resulting in defective VPg uridylylation. In contrast, these mutations did not affect the RNA elongation activity of 3Dpol. In the context of viral genomic RNA, mutations that abolished VPg uridylylation activity were lethal for EV71 replication. Further in vitro analysis showed that the uridylylation activity was restored by mixing VPg-binding-defective and catalysis-defective mutants, indicating a trans mechanism for EV71 VPg uridylylation. Our results, together with previous results of other studies, demonstrate that different picornaviruses use distinct binding sites for VPg uridylylation. PMID:23487447

  16. Development of robust in vitro RNA-dependent RNA polymerase assay as a possible platform for antiviral drug testing against dengue.

    PubMed

    Amraiz, Deeba; Zaidi, Najam-Us-Sahar Sadaf; Fatima, Munazza

    2016-10-01

    NS5 is the largest and most conserved protein among the four dengue virus (DENV) serotypes. It has been the target of interest for antiviral drug development due to its major role in replication. NS5 consists of two domains, the N-terminal methyltransferase domain and C-terminal catalytic RNA-dependent RNA polymerase (RdRp) domain. It is an unstable protein and is prone to inactivation upon prolonged incubation at room temperature, thus affecting the inhibitor screening assays. In the current study, we expressed and purified DENV RdRp alone in Esherichia coli (E. coli) cells. The N-terminally His-tagged construct of DENV RdRp was transformed into E. coli expression strain BL-21 (DE3) pLysS cells. Protein expression was induced with isopropyl-β-D-thiogalactopyranoside (IPTG) at a final concentration of 0.4mM. The induced cultures were then grown for 20h at 18°C and cells were harvested by centrifugation at 6000xg for 15min at 4°C. The recombinant protein was purified using HisTrap affinity column (Ni-NTA) and then the sample was subjected to size exclusion chromatography, which successfully removed the degradation product obtained during the previous purification step. The in vitro polymerase activity of RdRp was successfully demonstrated using homopolymeric polycytidylic acid (poly(rC)) RNA template. This study describes the high level production of enzymatically active DENV RdRp protein which can be used to develop assays for testing large number of compounds in a high-throughput manner. RdRp has the de novo initiation activity and the in vitro polymerase assays for the protein provide a platform for highly robust and efficient antiviral compound screening systems. Copyright © 2016 Elsevier Inc. All rights reserved.

  17. Plasma DCLK1 is a marker of hepatocellular carcinoma (HCC): Targeting DCLK1 prevents HCC tumor xenograft growth via a microRNA-dependent mechanism

    PubMed Central

    May, Randal; Qu, Dongfeng; Ali, Naushad; Fazili, Javid; Weygant, Nathaniel; Chandrakesan, Parthasarathy; Ding, Kai; Lightfoot, Stanley A.; Houchen, Courtney W.

    2015-01-01

    Tumor stem cell marker Doublecortin-like kinase1 (DCLK1) is upregulated in several solid tumors. The role of DCLK1 in hepatocellular carcinoma (HCC) is unclear. We immunostained tissues from human livers with HCC, cirrhosis controls (CC), and non-cirrhosis controls (NCC) for DCLK1. Western blot and ELISA analyses for DCLK1 were performed with stored plasma samples. We observed increased immunoreactive DCLK1 in epithelia and stroma in HCC and CCs compared with NCCs, and observed a marked increase in plasma DCLK1 from patients with HCC compared with CC and NCC. Analysis of the Cancer Genome Atlas’ HCC dataset revealed that DCLK1 is overexpressed in HCC tumors relative to adjacent normal tissues. High DCLK1-expressing cells had more epithelial-mesenchymal transition (EMT). Various tumor suppressor miRNAs were also downregulated in HCC tumors. We evaluated the effects of DCLK1 knockdown on Huh7.5-derived tumor xenograft growth. This was associated with growth arrest and a marked downregulation of cMYC, and EMT transcription factors ZEB1, ZEB2, SNAIL, and SLUG via let-7a and miR-200 miRNA-dependent mechanisms. Furthermore, upregulation of miR-143/145, a corresponding decrease in pluripotency factors OCT4, NANOG, KLF4, and LIN28, and a reduction of let-7a, miR-143/145, and miR-200-specific luciferase activity was observed. These findings suggest that the detection of elevated plasma DCLK1 may provide a cost-effective, less invasive tool for confirmation of clinical signs of cirrhosis, and a potential companion diagnostic marker for patients with cirrhosis and HCC. Our results support evaluating DCLK1 as a biomarker for detection and as a therapeutic target for eradicating HCC. PMID:26468984

  18. Protein-Binding Function of RNA-Dependent Protein Kinase Promotes Proliferation through TRAF2/RIP1/NF-κB/c-Myc Pathway in Pancreatic β cells

    PubMed Central

    Gao, LiLi; Tang, Wei; Ding, ZhengZheng; Wang, DingYu; Qi, XiaoQiang; Wu, HuiWen; Guo, Jun

    2015-01-01

    Double-stranded RNA-dependent protein kinase (PKR), an intracellular pathogen recognition receptor, is involved both in insulin resistance in peripheral tissues and in downregulation of pancreatic β-cell function in a kinase-dependent manner, indicating PKR as a core component in the progression of type 2 diabetes. PKR also acts as an adaptor protein via its protein-binding domain. Here, the PKR protein-binding function promoted β-cell proliferation without its kinase activity, which is associated with enhanced physical interaction with tumor necrosis factor receptor-associated factor 2 (TRAF2) and TRAF6. In addition, the transcription of the nuclear factor kappa-light-chain-enhancer of activated B cell (NF-κB)-dependent survival gene c-Myc was upregulated significantly and is necessary for proliferation. Upregulation of the PKR protein-binding function induced the NF-κB pathway, as observed by dose-dependent degradation of IκBα, induced nuclear translocation of p65 and elevated NF-κB-dependent reporter gene expression. NF-κB-dependent reporter activity and β-cell proliferation both were suppressed by TRAF2-siRNA, but not by TRAF6-siRNA. TRAF2-siRNA blocked the ubiquitination of receptor-interacting serine/threonine-protein kinase 1 (RIP1) induced by PKR protein binding. Furthermore, RIP1-siRNA inhibited β-cell proliferation. Proinflammatory cytokines (TNFα) and glucolipitoxicity also promoted the physical interaction of PKR with TRAF2. Collectively, these data indicate a pivotal role for PKR’s protein-binding function on the proliferation of pancreatic β cells through TRAF2/RIP1/NF-κB/c-Myc pathways. Therapeutic opportunities for type 2 diabetes may arise when its kinase catalytic function, but not its protein-binding function, is downregulated. PMID:25715336

  19. Induction of Apoptosis by Double-Stranded-RNA-Dependent Protein Kinase (PKR) Involves the α Subunit of Eukaryotic Translation Initiation Factor 2 and NF-κB

    PubMed Central

    Gil, Jesús; Alcamí, José; Esteban, Mariano

    1999-01-01

    The double-stranded (ds) RNA-dependent protein kinase (PKR) is a key mediator of antiviral effects of interferon (IFN) and an active player in apoptosis induced by different stimuli. The translation initiation factor eIF-2α (α subunit of eukaryotic translation initiation factor 2) and IκBα, the inhibitor of the transcription factor NF-κB, have been proposed as downstream mediators of PKR effects. To evaluate the involvement of NF-κB and eIF-2α in the induction of apoptosis by PKR, we have used vaccinia virus (VV) recombinants that inducibly express PKR concomitantly with a dominant negative mutant of eIF-2α or a repressor form of IκBα. We found that while expression of PKR by a VV vector resulted in extensive inhibition of protein synthesis and induction of apoptosis, coexpression of PKR with a dominant negative mutant of eIF-2α (Ser-51→Ala) reversed both the PKR-mediated translational block and PKR-induced apoptosis. Coexpression of PKR with a repressor form of IκBα (Ser-32,36-Ala) also leads to the inhibition of apoptosis by abolishing NF-κB induction, while translation remains blocked. Treating cells with two different proteasome inhibitors which block IκBα degradation, prevented PKR-induced apoptosis, supporting results from coexpression studies. Biochemical analysis and transient assays revealed that PKR expression by a VV vector induced NF-κB binding and transactivation. In addition, upregulation of Fas mRNA transcription occurred during PKR activation. Our findings provide direct evidence for the involvement of eIF-2α and NF-κB in the induction of apoptosis by PKR. PMID:10373514

  20. Loss of RNA-dependent RNA polymerase 2 (RDR2) function causes widespread and unexpected changes in the expression of transposons, genes, and 24-nt small RNAs.

    PubMed

    Jia, Yi; Lisch, Damon R; Ohtsu, Kazuhiro; Scanlon, Michael J; Nettleton, Daniel; Schnable, Patrick S

    2009-11-01

    Transposable elements (TEs) comprise a substantial portion of many eukaryotic genomes and are typically transcriptionally silenced. RNA-dependent RNA polymerase 2 (RDR2) is a component of the RNA-directed DNA methylation (RdDM) silencing pathway. In maize, loss of mediator of paramutation1 (mop1) encoded RDR2 function results in reactivation of transcriptionally silenced Mu transposons and a substantial reduction in the accumulation of 24 nt short-interfering RNAs (siRNAs) that recruit RNA silencing components. An RNA-seq experiment conducted on shoot apical meristems (SAMs) revealed that, as expected based on a model in which RDR2 generates 24 nt siRNAs that suppress expression, most differentially expressed DNA TEs (78%) were up-regulated in the mop1 mutant. In contrast, most differentially expressed retrotransposons (68%) were down-regulated. This striking difference suggests that distinct silencing mechanisms are applied to different silencing templates. In addition, >6,000 genes (24% of analyzed genes), including nearly 80% (286/361) of genes in chromatin modification pathways, were differentially expressed. Overall, two-thirds of differentially regulated genes were down-regulated in the mop1 mutant. This finding suggests that RDR2 plays a significant role in regulating the expression of not only transposons, but also of genes. A re-analysis of existing small RNA data identified both RDR2-sensitive and RDR2-resistant species of 24 nt siRNAs that we hypothesize may at least partially explain the complex changes in the expression of genes and transposons observed in the mop1 mutant.

  1. Molecular evolutionary history of Sugarcane yellow leaf virus based on sequence analysis of RNA-dependent RNA polymerase and putative aphid transmission factor-coding genes.

    PubMed

    ElSayed, Abdelaleim Ismail; Boulila, Moncef; Rott, Philippe

    2014-06-01

    RNA-dependent RNA polymerase (RdRp) encoded by ORF2 and putative aphid transmission factor (PATF) encoded by ORF5 of Sugarcane yellow leaf virus (SCYLV) were detected in six sugarcane cultivars affected by yellow leaf using RT-PCR and real-time RT-PCR assays. Expression of both genes varied among infected plants, but overall expression of RdRp was higher than expression of PATF. Cultivar H87-4094 from Hawaii yielded the highest transcript levels of RdRp, whereas cultivar C1051-73 from Cuba exhibited the lowest levels. Sequence comparisons among 25 SCYLV isolates from various geographical locations revealed an amino acid similarity of 72.1-99.4 and 84.7-99.8 % for the RdRp and PATF genes, respectively. The 25 SCYLV isolates were separated into three (RdRp) and two (PATF) phylogenetic groups using the MEGA6 program that does not account for genetic recombination. However, the SCYLV genome contained potential recombination signals in the RdRp and PATF coding genes based on the GARD genetic algorithm. Use of this later program resulted in the reconstruction of phylogenies on the left as well as on the right sides of the putative recombination breaking points, and the 25 SCYLV isolates were distributed into three distinct phylogenetic groups based on either RdRp or PATF sequences. As a result, recombination reshuffled the affiliation of the accessions to the different clusters. Analysis of selection pressures exerted on RdRp and PATF encoded proteins revealed that ORF 2 and ORF 5 underwent predominantly purifying selection. However, a few sites were also under positive selection as assessed by various models such as FEL, IFEL, REL, FUBAR, MEME, GA-Branch, and PRIME.

  2. ErbB3/HER3 intracellular domain is competent to bind ATP and catalyze autophosphorylation

    SciTech Connect

    Shi, Fumin; Telesco, Shannon E.; Liu, Yingting; Radhakrishnan, Ravi; Lemmon, Mark A.

    2010-06-21

    ErbB3/HER3 is one of four members of the human epidermal growth factor receptor (EGFR/HER) or ErbB receptor tyrosine kinase family. ErbB3 binds neuregulins via its extracellular region and signals primarily by heterodimerizing with ErbB2/HER2/Neu. A recently appreciated role for ErbB3 in resistance of tumor cells to EGFR/ErbB2-targeted therapeutics has made it a focus of attention. However, efforts to inactivate ErbB3 therapeutically in parallel with other ErbB receptors are challenging because its intracellular kinase domain is thought