CpG methylation increases the DNA binding of 9-aminoacridine carboxamide Pt analogues.

PubMed

Kava, Hieronimus W; Murray, Vincent

2016-10-01

This study investigated the effect of CpG methylation on the DNA binding of cisplatin analogues with an attached aminoacridine intercalator. DNA-targeted 9-aminoacridine carboxamide Pt complexes are known to bind at 5'-CpG sequences. Their binding to methylated and non-methylated 5'-CpG sequences was determined and compared with cisplatin. The damage profiles of each platinum compound were quantified via a polymerase stop assay with fluorescently labelled primers and capillary electrophoresis. Methylation at 5'-CpG was shown to significantly increase the binding intensity for the 9-aminoacridine carboxamide compounds, whereas no significant increase was found for cisplatin. 5'-CpG methylation had the largest effect on the 9-ethanolamine-acridine carboxamide Pt complex, followed by the 9-aminoacridine carboxamide Pt complex and the 7-fluoro complex. The methylation state of a cell's genome is important in maintaining normal gene expression, and is often aberrantly altered in cancer cells. An analogue of cisplatin which differentially targets methylated DNA may be able to improve its therapeutic activity, or alter its range of targets and evade the chemoresistance which hampers cisplatin efficacy in clinical use. Copyright © 2016 Elsevier Ltd. All rights reserved.

Effect of amino groups of mesoporous silica nanoparticles on CpG oligodexynucleotide delivery

NASA Astrophysics Data System (ADS)

Xu, Yi; Claiden, Peter; Zhu, Yufang; Morita, Hiromi; Hanagata, Nobutaka

2015-08-01

In this study, we proposed to modify mesoporous silica nanoparticles (MSNs) with 3-aminopropyltriethoxysilane (NH2-TES), aminoethylaminopropyltriethoxysilane (2NH2-TES) and 3-[2-(2-aminoethylamino)ethylamino] propyl-trimethoxysilane (3NH2-TES) for binding of cytosine-phosphate-guanosine oligodexynucleotides (CpG ODN), and investigated the effect of different amino groups of MSNs on the CpG ODN delivery. Serum stability, in vitro cytotoxicity, and cytokine interleukin-6 (IL-6) induction by MSN-NH2/CpG, MSN-2NH2/CpG and MSN-3NH2/CpG complexes were investigated in detail. The results showed that three kinds of aminated-MSN-based CpG ODN delivery systems had no cytotoxicity to RAW264.7 cells, and binding of CpG ODN to MSN-NH2, MSN-2NH2 and MSN-3NH2 nanoparticles enhanced the serum stability of CpG ODN due to protection by the nanoparticles. However, three aminated MSN-based CpG ODN delivery systems exhibited different CpG ODN delivery efficiency, and MSN-NH2/CpG complexes had the highest ability to induce IL-6 secretion.

Dissection of the methyl-CpG binding domain from the chromosomal protein MeCP2.

PubMed Central

Nan, X; Meehan, R R; Bird, A

1993-01-01

MeCP2 is a chromosomal protein which binds to DNA that is methylated at CpG. In situ immunofluorescence in mouse cells has shown that the protein is most concentrated in pericentromeric heterochromatin, suggesting that MeCP2 may play a role in the formation of inert chromatin. Here we have isolated a minimal methyl-CpG binding domain (MBD) from MeCP2. MBD is 85 amino acids in length, and binds exclusively to DNA that contains one or more symmetrically methylated CpGs. MBD has negligable non-specific affinity for DNA, confirming that non-specific and methyl-CpG specific binding domains of MeCP2 are distinct. In vitro footprinting indicates that MBD binding can protect a 12 nucleotide region surrounding a methyl-CpG pair, with an approximate dissociation constant of 10(-9) M. Images PMID:8177735

Immunostimulatory Properties of Lipid Modified CpG Oligonucleotides.

PubMed

Yu, Chunsong; An, Myunggi; Li, Meng; Liu, Haipeng

2017-08-07

Innate immune responses recognizing pathogen associated molecular patterns play important roles in adaptive immunity. As such, ligands which mimic the conserved products of microbial and activate innate immunity are widely used as adjuvants for vaccines. Synthetic single strand oligodeoxynucleotides (ODNs) containing unmethylated cytosine-guanine (CpG) motifs which bind Toll-like receptor 9 (TLR9) are powerful molecular adjuvants, potentiating both humoral and cellular responses. However, CpG ODN's in vitro potency has not been translated to in vivo settings primarily due to issues associated with delivery and toxicity. A major challenge in clinical application of CpG ODN is the efficient delivery to lymph nodes, the anatomic sites where all the immune responses are initiated. Targeting CpG to the key antigen presenting cells (APC) is essential for its application as a vaccine adjuvant, as it not only enhances CpG's efficacy, but also greatly reduces the systemic toxicity. We recently discovered an "albumin-hitchhiking" approach by which CpG ODNs were conjugated to a lipophilic lipid tail and follow subcutaneous injection, accumulated in lymph nodes by binding and transporting with endogenous albumin. This molecular approach targets CpG to antigen presenting cells in the draining lymph nodes via an endogenous albumin-mediated mechanism and simultaneously improves both the efficacy and safety of CpG as a vaccine adjuvant. Since CpG ODNs can be divided into structurally distinct classes, and each class of CpG ODN activates different types of immune cells and triggers different types of immunostimulatory activities, it is important to thoroughly evaluate the efficacy of this "albumin-hitchhiking" strategy in each class of CpG. Here we compare the immunostimulatory activities of three classes of lipid conjugated CpG ODNs in vitro and in vivo. Three representative sequences of lipid modified CpG ODNs were synthesized and their stimulatory effects as a vaccine adjuvant were evaluated. Our results showed that in vitro, lipid modified class A CpG exhibited enhanced stimulatory activities toward TLR transfected reporter cells or bone-marrow derived dendritic cells, whereas lipid-modification of class B or C CpG reduces the activation of TLR9 by 2-3 fold, as compared with unmodified class B and class C CpG, respectively. However, in vivo coadministration of ovalbumin (OVA) protein antigen mixed with lipid-conjugated class B or C CpG ODNs, but not class A CpGs induced dramatically increased OVA-specific humoral and cytotoxic CD8 + T cells responses compared with OVA mixed with unmodified CpGs. Further, lipid-modification greatly reduces the toxicity associated with CpG by minimizing the systemic dissemination. Taken together, these results demonstrated that amphiphilic modification of three classes of CpG motifs differentially affected and modulated the immunostimulatory activities in vitro and in vivo. Our study highlights the importance of in vivo lymph node targeting of CpG ODNs in fulfilling their use as vaccine adjuvants, providing implications for the rational design of molecular adjuvant for subunit vaccines.

Identification of a boron nitride nanosphere-binding peptide for the intracellular delivery of CpG oligodeoxynucleotides

NASA Astrophysics Data System (ADS)

Zhang, Huijie; Yamazaki, Tomohiko; Zhi, Chunyi; Hanagata, Nobutaka

2012-09-01

CpG oligonucleotides (CpG ODNs) interact with Toll-like receptor 9 (TLR9), which results in the induction of immunostimulatory cytokines. We delivered CpG ODNs intracellularly using boron nitride nanospheres (BNNS). To enhance the loading capacity of CpG ODNs on BNNS, we used a phage display technique to identify a 12-amino acid peptide designated as BP7, with specific affinity for BNNS, and used it as a linker to load CpG ODNs on BNNS. The tyrosine residue (Y) at the eighth position from the N-terminus played a crucial role in the affinity of BP7 to BNNS. BNNS that bound BP7 (BNNS-BP7) were taken up by cells and showed no cytotoxicity, and CpG ODNs were successfully crosslinked with BP7 to create BP7-CpG ODN conjugates. Using BP7 as a linker, the loading efficiency of CpG ODNs on BNNS increased 5-fold compared to the direct binding of CpG ODNs to BNNS. Furthermore, the BP7-CpG ODN conjugate-loaded BNNS had a greater capacity to induce interleukin-6 (IL-6) and tumor necrosis factor-alpha (TNF-α) production from peripheral blood mononuclear cells (PBMCs) than that of CpG ODNs directly loaded on BNNS. The higher amount of cytokine induction by BP7-CpG ODN conjugate-loaded BNNS may be attributed to a higher loading capacity and stronger binding to BNNS of the linker BP7. The greater functionality of BP7-conjugated CpG ODNs on BNNS expands the potential of BNNS for drug delivery applications.CpG oligonucleotides (CpG ODNs) interact with Toll-like receptor 9 (TLR9), which results in the induction of immunostimulatory cytokines. We delivered CpG ODNs intracellularly using boron nitride nanospheres (BNNS). To enhance the loading capacity of CpG ODNs on BNNS, we used a phage display technique to identify a 12-amino acid peptide designated as BP7, with specific affinity for BNNS, and used it as a linker to load CpG ODNs on BNNS. The tyrosine residue (Y) at the eighth position from the N-terminus played a crucial role in the affinity of BP7 to BNNS. BNNS that bound BP7 (BNNS-BP7) were taken up by cells and showed no cytotoxicity, and CpG ODNs were successfully crosslinked with BP7 to create BP7-CpG ODN conjugates. Using BP7 as a linker, the loading efficiency of CpG ODNs on BNNS increased 5-fold compared to the direct binding of CpG ODNs to BNNS. Furthermore, the BP7-CpG ODN conjugate-loaded BNNS had a greater capacity to induce interleukin-6 (IL-6) and tumor necrosis factor-alpha (TNF-α) production from peripheral blood mononuclear cells (PBMCs) than that of CpG ODNs directly loaded on BNNS. The higher amount of cytokine induction by BP7-CpG ODN conjugate-loaded BNNS may be attributed to a higher loading capacity and stronger binding to BNNS of the linker BP7. The greater functionality of BP7-conjugated CpG ODNs on BNNS expands the potential of BNNS for drug delivery applications. Electronic supplementary information (ESI) available. See DOI: 10.1039/c2nr31189e

A cross-study analysis of prenatal exposures to environmental contaminants and the epigenome: support for stress-responsive transcription factor occupancy as a mediator of gene-specific CpG methylation patterning

PubMed Central

Martin, Elizabeth M.; Fry, Rebecca C.

2016-01-01

Abstract A biological mechanism by which exposure to environmental contaminants results in gene-specific CpG methylation patterning is currently unknown. We hypothesize that gene-specific CpG methylation is related to environmentally perturbed transcription factor occupancy. To test this hypothesis, a database of 396 genes with altered CpG methylation either in cord blood leukocytes or placental tissue was compiled from 14 studies representing assessments of six environmental contaminants. Subsequently, an in silico approach was used to identify transcription factor binding sites enriched among the genes with altered CpG methylation in relationship to the suite of environmental contaminants. For each study, the sequences of the promoter regions (representing −1000 to +500 bp from the transcription start site) of all genes with altered CpG methylation were analyzed for enrichment of transcription factor binding sites. Binding sites for a total of 56 unique transcription factors were identified to be enriched within the promoter regions of the genes. Binding sites for the Kidney-Enriched Krupple-like Factor 15, a known responder to endogenous stress, were enriched ( P  < 0.001–0.041) among the genes with altered CpG methylation associated for five of the six environmental contaminants. These data support the transcription factor occupancy theory as a potential mechanism underlying environmentally-induced gene-specific CpG methylation. PMID:27066266

PlantPAN 2.0: an update of plant promoter analysis navigator for reconstructing transcriptional regulatory networks in plants.

PubMed

Chow, Chi-Nga; Zheng, Han-Qin; Wu, Nai-Yun; Chien, Chia-Hung; Huang, Hsien-Da; Lee, Tzong-Yi; Chiang-Hsieh, Yi-Fan; Hou, Ping-Fu; Yang, Tien-Yi; Chang, Wen-Chi

2016-01-04

Transcription factors (TFs) are sequence-specific DNA-binding proteins acting as critical regulators of gene expression. The Plant Promoter Analysis Navigator (PlantPAN; http://PlantPAN2.itps.ncku.edu.tw) provides an informative resource for detecting transcription factor binding sites (TFBSs), corresponding TFs, and other important regulatory elements (CpG islands and tandem repeats) in a promoter or a set of plant promoters. Additionally, TFBSs, CpG islands, and tandem repeats in the conserve regions between similar gene promoters are also identified. The current PlantPAN release (version 2.0) contains 16 960 TFs and 1143 TF binding site matrices among 76 plant species. In addition to updating of the annotation information, adding experimentally verified TF matrices, and making improvements in the visualization of transcriptional regulatory networks, several new features and functions are incorporated. These features include: (i) comprehensive curation of TF information (response conditions, target genes, and sequence logos of binding motifs, etc.), (ii) co-expression profiles of TFs and their target genes under various conditions, (iii) protein-protein interactions among TFs and their co-factors, (iv) TF-target networks, and (v) downstream promoter elements. Furthermore, a dynamic transcriptional regulatory network under various conditions is provided in PlantPAN 2.0. The PlantPAN 2.0 is a systematic platform for plant promoter analysis and reconstructing transcriptional regulatory networks. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Methylation Analysis of the BMPR2 Gene Promoter Region in Patients With Pulmonary Arterial Hypertension.

PubMed

Pousada, Guillermo; Baloira, Adolfo; Valverde, Diana

2016-06-01

Pulmonary arterial hypertension is characterizated by obstruction of the pulmonary arteries. The gene mainly related to pathology is the bone morphogenetic protein receptor type II (BMPR2). The aim of this study was to analyze the methylation pattern of the BMPR2 promoter region in patients and controls. We used Methyl Primer Express(®) v.1.0 and MatInspector softwares to analyze this region. Genomic DNA obtained from the peripheral blood of patients and controls was modified with sodium bisulphite. Methylation was analyzed using methylation-specific PCR. DNA treated with CpG methyltransferase was used as a positive control for methylation and H1299 cell culture DNA was used as positive control for gene expression. We identified a CpG island, which may have been methylated, in the BMPR2 promoter region, in addition to NIT-2 (global-acting regulatory protein), sex-determining region Y) and heat shock factor transcription factor binding sites. We found no evidence of methylation in patients and controls. No methylated CpG sites were identified in H1299 cells expressing the BMPR2 gene. The BMPR2 promoter region is the most suitable for study because of the high number of transcription factor binding sites that could alter gene function. No evidence of methylation was detected in this region in patients and controls. Copyright © 2015 SEPAR. Published by Elsevier Espana. All rights reserved.

Fatty acid binding protein 3 (fabp3) is associated with insulin, lipids and cardiovascular phenotypes of the metabolic syndrome through epigenetic modifications in a Northern European family population.

PubMed

Zhang, Yi; Kent, Jack W; Lee, Adam; Cerjak, Diana; Ali, Omar; Diasio, Robert; Olivier, Michael; Blangero, John; Carless, Melanie A; Kissebah, Ahmed H

2013-03-19

Fatty acid-binding proteins (FABPs) play regulatory roles at the nexus of lipid metabolism and signaling. Dyslipidemia in clinical manifestation frequently co-occurs with obesity, insulin resistance and hypertension in the Metabolic Syndrome (MetS). Animal studies have suggested FABPs play regulatory roles in expressing MetS phenotypes. In our family cohort of Northern European descent, transcript levels in peripheral white blood cells (PWBCs) of a key FABPs, FABP3, is correlated with the MetS leading components. However, evidence supporting the functions of FABPs in humans using genetic approaches has been scarce, suggesting FABPs may be under epigenetic regulation. The objective of this study was to test the hypothesis that CpG methylation status of a key regulator of lipid homeostasis, FABP3, is a quantitative trait associated with status of MetS phenotypes in humans. We used a mass-spec based quantitative method, EpiTYPER®, to profile a CpG island that extends from the promoter to the first exon of the FABP3 gene in our family-based cohort of Northern European descent (n=517). We then conducted statistical analysis of the quantitative relationship of CpG methylation and MetS measures following the variance-component association model. Heritability of each methylation and the effect of age and sex on CpG methylation were also assessed in our families. We find that methylation levels of individual CpG units and the regional average are heritable and significantly influenced by age and sex. Regional methylation was strongly associated with plasma total cholesterol (p=0.00028) and suggestively associated with LDL-cholesterol (p=0.00495). Methylation at individual units was significantly associated with insulin sensitivity, lipid particle sizing and diastolic blood pressure (p<0.0028, corrected for multiple testing for each trait). Peripheral white blood cell (PWBC) expression of FABP3 in a separate group of subjects (n=128) negatively correlated with adverse profiles of metabolism (βWHR=-0.72; βLDL-c=-0.53) while positively correlated with plasma adiponectin (β=0.24). Further, we show that differential methylation of FABP3 affects binding activity with nuclear proteins from heart tissue. This region that we found under methylation regulation overlaps with a region actively modified by histone codes in the newly available ENCODE data. Our findings suggest that DNA methylation of FABP3 strongly influences MetS, and this may have important implications for cardiovascular disease.

Genome-wide site-specific differential methylation in the blood of individuals with Klinefelter Syndrome

PubMed Central

Wan, Emily S.; Qiu, Weiliang; Morrow, Jarrett; Beaty, Terri H.; Hetmanski, Jacqueline; Make, Barry J.; Lomas, David A.; Silverman, Edwin K.; DeMeo, Dawn L.

2015-01-01

Klinefelter syndrome (KS) (47 XXY) is a common sex-chromosome aneuploidy with an estimated prevalence of 1 in every 660 male births. Investigations into the associations between DNA methylation and the highly variable clinical manifestations of KS have largely focused on the supernumerary X chromosome; systematic investigations of the epigenome have been limited. We obtained genome-wide DNA methylation data from peripheral blood using the Illumina HumanMethylation450K platform in 5 KS (47 XXY), 102 male (46 XY), and 113 female (46 XX) control subjects participating in the chronic obstructive pulmonary disease (COPD) Gene Study. Empirical Bayes-mediated models were used to test for differential methylation by KS status. CpG sites with a false-discovery rate <0.05 from the first-generation HumanMethylation27K platform were further examined in an independent replication cohort of 2 KS subjects, 590 male, and 495 female controls drawn from the International COPD Genetics Network (ICGN). Differential methylation at sites throughout the genome were identified, including 86 CpG sites that were differentially methylated in KS subjects relative to both male and female controls. CpG sites annotated to the HEN1 methyltransferase homolog 1 (HENMT1), calcyclin-binding protein (CACYBP), and GTPase-activating protein (SH3 domain)-binding protein 1 (G3BP1) genes were among the “KS-specific” loci that were replicated in ICGN. We therefore conclude that site-specific differential methylation exists throughout the genome in KS. The functional impact and clinical relevance of these differentially methylated loci should be explored in future studies. PMID:25988574

Identification of secretaglobin Scgb2a1 as a target for developmental reprogramming by BPA in the rat prostate.

PubMed

Wong, Rebecca Lee Yean; Wang, Quan; Treviño, Lindsey S; Bosland, Maarten C; Chen, Jing; Medvedovic, Mario; Prins, Gail S; Kannan, Kurunthachalam; Ho, Shuk-Mei; Walker, Cheryl Lyn

2015-01-01

Secretoglobins are a superfamily of secreted proteins thought to participate in inflammation, tissue repair, and tumorigenesis. Secretoglobin family 2A member 1 (Scgb2a1) is a component of prostatein, a major androgen-binding protein secreted by the rat prostate. Using a rat model for developmental reprogramming of susceptibility to prostate carcinogenesis, we identified, by RNA-seq, that Scgb2a1 is significantly upregulated (>100-fold) in the prostate of adult rats neonatally exposed to bisphenol A (BPA), with increased gene expression confirmed by quantitative RT-PCR and chromatin immunoprecipitation for histone H3 lysine 9 acetylation. Bisulfite analysis of both CpG islands located within 10 kb of the Scgb2a1 promoter identified significant hypomethylation of the CpG island upstream of the transcription start site of this gene in the reprogrammed prostate. These data suggest that expression of Scgb2a1 in the adult prostate could be epigenetically reprogrammed by BPA exposure during prostate development, with potential implications for cancer risk and response to chemotherapeutics associated with prostatein binding.

Mecp2 deficiency leads to altered Htr2c pre-mRNA editing and HTR2C isoform distribution in mouse hippocampus and cerebellum

USDA-ARS?s Scientific Manuscript database

Rett Syndrome (RTT) is a neurodevelopmental disorder caused by mutations in MECP2, a methyl-CpG binding protein and transcriptional repressor. CpG methylation plays an important role in genomic imprinting since imprinted genes are regulated by regions of differentially methylated CpGs (or ICs). A ...

Detecting cooperative sequences in the binding of RNA Polymerase-II

NASA Astrophysics Data System (ADS)

Glass, Kimberly; Rozenberg, Julian; Girvan, Michelle; Losert, Wolfgang; Ott, Ed; Vinson, Charles

2008-03-01

Regulation of the expression level of genes is a key biological process controlled largely by the 1000 base pair (bp) sequence preceding each gene (the promoter region). Within that region transcription factor binding sites (TFBS), 5-10 bp long sequences, act individually or cooperate together in the recruitment of, and therefore subsequent gene transcription by, RNA Polymerase-II (RNAP). We have measured the binding of RNAP to promoters on a genome-wide basis using Chromatin Immunoprecipitation (ChIP-on-Chip) microarray assays. Using all 8-base pair long sequences as a test set, we have identified the DNA sequences that are enriched in promoters with high RNAP binding values. We are able to demonstrate that virtually all sequences enriched in such promoters contain a CpG dinucleotide, indicating that TFBS that contain the CpG dinucleotide are involved in RNAP binding to promoters. Further analysis shows that the presence of pairs of CpG containing sequences cooperate to enhance the binding of RNAP to the promoter.

CPG2 Recruits Endophilin B2 to the Cytoskeleton for Activity-Dependent Endocytosis of Synaptic Glutamate Receptors.

PubMed

Loebrich, Sven; Benoit, Marc Robert; Konopka, Jaclyn Aleksandra; Cottrell, Jeffrey Richard; Gibson, Joanne; Nedivi, Elly

2016-02-08

Internalization of glutamate receptors at the postsynaptic membrane via clathrin-mediated endocytosis (CME) is a key mechanism for regulating synaptic strength. A role for the F-actin cytoskeleton in CME is well established, and recently, PKA-dependent association of candidate plasticity gene 2 (CPG2) with the spine-cytoskeleton has been shown to mediate synaptic glutamate receptor internalization. Yet, how the endocytic machinery is physically coupled to the actin cytoskeleton to facilitate glutamate receptor internalization has not been demonstrated. Moreover, there has been no distinction of endocytic-machinery components that are specific to activity-dependent versus constitutive glutamate receptor internalization. Here, we show that CPG2, through a direct physical interaction, recruits endophilin B2 (EndoB2) to F-actin, thus anchoring the endocytic machinery to the spine cytoskeleton and facilitating glutamate receptor internalization. Regulation of CPG2 binding to the actin cytoskeleton by protein kinase A directly impacts recruitment of EndoB2 and clathrin. Specific disruption of EndoB2 or the CPG2-EndoB2 interaction impairs activity-dependent, but not constitutive, internalization of both NMDA- and AMPA-type glutamate receptors. These results demonstrate that, through direct interactions with F-actin and EndoB2, CPG2 physically bridges the spine cytoskeleton and the endocytic machinery, and this tripartite association is critical specifically for activity-dependent CME of synaptic glutamate receptors. Copyright © 2016 Elsevier Ltd. All rights reserved.

CpG methylation at the USF binding site mediates cell-specific transcription of human ascorbate transporter SVCT2 exon 1a

PubMed Central

Qiao, Huan; May, James M.

2013-01-01

SVCT2 is the major transporter mediating vitamin C uptake in most organs. Its expression is driven by two promoters (CpG-poor exon 1a promoter and CpG-rich exon 1b promoter). In this work we mapped discrete elements within the proximal CpG-poor promoter responsible for the exon 1a transcription. We identified two E boxes for USF binding and one Y box for NF-Y binding. We further show that the formation of an NFY/USF complex on the exon 1a promoter amplifies each other's ability to bind to the promoter in a cooperativity-dependent manner and is absolutely required for the full activity of the exon 1a promoter. The analysis of the CpG site located at the upstream USF binding site in the promoter showed a strong correlation between expression and demethylation. It was also shown that the exon 1a transcription was induced in cell culture treated with demethylating agent decitabine. The specific methylation of this CpG site impaired both the binding of USF and the formation of the functional NF-Y/USF complex as well as promoter activity, suggesting its importance for the cell-specific transcription. Thus CpG methylation at the upstream USF binding site functions in establishing and maintaining cell-specific transcription from the CpG-poor SVCT2 exon 1a promoter. PMID:21770893

Organization, chromosomal localization and promoter analysis of the gene encoding human acidic fibroblast growth factor intracellular binding protein.

PubMed Central

Kolpakova, E; Frengen, E; Stokke, T; Olsnes, S

2000-01-01

Acidic fibroblast growth factor (aFGF) intracellular binding protein (FIBP) is a protein found mainly in the nucleus that might be involved in the intracellular function of aFGF. Here we present a comparative analysis of the deduced amino acid sequences of human, murine and Drosophila FIBP analogues and demonstrate that FIBP is an evolutionarily conserved protein. The human gene spans more than 5 kb, comprising ten exons and nine introns, and maps to chromosome 11q13.1. Two slightly different splice variants found in different tissues were isolated and characterized. Sequence analysis of the region surrounding the translation start revealed a CpG island, a classical feature of widely expressed genes. Functional studies of the promoter region with a luciferase reporter system suggested a strong transcriptional activity residing within 600 bp of the 5' flanking region. PMID:11104667

Radiolabelling of glycosylated MFE-23::CPG2 fusion protein (MFECP1) with 99mTc for quantitation of tumour antibody-enzyme localisation in antibody-directed enzyme pro-drug therapy (ADEPT).

PubMed

Francis, R J; Mather, S J; Chester, K; Sharma, S K; Bhatia, J; Pedley, R B; Waibel, R; Green, A J; Begent, R H J

2004-08-01

MFECP1 is a glycosylated recombinant fusion protein composed of MFE-23, a high-affinity anti-carcinoembryonic antigen (CEA) single chain Fv (scFv), fused to the enzyme carboxypeptidase G2 (CPG2), and has been constructed for use in antibody-directed enzyme pro-drug therapy (ADEPT). Radiolabelling of glycosylated MFECP1 with technetium-99m was developed for the purpose of determining tumour localisation of MFECP1 in a phase I ADEPT clinical study. The method used was 99mTc-carbonyl [99mTc(H2O)3(CO)3]+ (abbreviated to TcCO) mediated labelling of 99mTc to the hexahistidine (His) tag of MFECP1. MFECP1 fusion protein was labelled with TcCO under a variety of conditions, and this was shown to be a relatively simple and robust method. Tissue biodistribution was assessed in a CEA-expressing LS174T (human colon carcinoma) nude mouse xenograft model. Tissues were taken at 1, 4 and 6 h for assessment of distribution of radioactivity and for measurement of CPG2 enzyme levels. The amount of radioactivity retained by the tumour proved to be an accurate estimation of actual measured enzyme activity, indicating that this radiolabelling method does not appear to damage the antibody-antigen binding or the enzyme activity of MFECP1. However, correlation between CPG2 enzyme activity and measured radioactivity in liver, spleen and kidney was poor, indicating retention of radioactivity in non-tumour sites but loss of enzyme activity. The high retention of technetium radioisotope in normal tissues may limit the clinical applicability of this radiolabelling method for MFECP1; however, these results suggest that this technique does have applicability for measuring the biodistribution of His-tagged recombinant proteins.

Regulation of glutamate receptor internalization by the spine cytoskeleton is mediated by its PKA-dependent association with CPG2

PubMed Central

Loebrich, Sven; Djukic, Biljana; Tong, Zachary J.; Cottrell, Jeffrey R.; Turrigiano, Gina G.; Nedivi, Elly

2013-01-01

A key neuronal mechanism for adjusting excitatory synaptic strength is clathrin-mediated endocytosis of postsynaptic glutamate receptors (GluRs). The actin cytoskeleton is critical for clathrin-mediated endocytosis, yet we lack a mechanistic understanding of its interaction with the endocytic process and how it may be regulated. Here we show that F-actin in dendritic spines physically binds the synaptic nuclear envelope 1 gene product candidate plasticity gene 2 (CPG2) in a PKA-dependent manner, and that this association is required for synaptic GluR internalization. Mutating two PKA sites on CPG2 disrupts its cytoskeletal association, attenuating GluR endocytosis and affecting the efficacy of synaptic transmission in vivo. These results identify CPG2 as an F-actin binding partner that functionally mediates interaction of the spine cytoskeleton with postsynaptic endocytosis. Further, the regulation of CPG2/F-actin association by PKA provides a gateway for cellular control of synaptic receptor internalization through second messenger signaling pathways. Recent identification of human synaptic nuclear envelope 1 as a risk locus for bipolar disorder suggests that CPG2 could play a role in synaptic dysfunction underlying neuropsychiatric disease. PMID:24191017

The Replication Focus Targeting Sequence (RFTS) Domain Is a DNA-competitive Inhibitor of Dnmt1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Syeda, Farisa; Fagan, Rebecca L.; Wean, Matthew

Dnmt1 (DNA methyltransferase 1) is the principal enzyme responsible for maintenance of cytosine methylation at CpG dinucleotides in the mammalian genome. The N-terminal replication focus targeting sequence (RFTS) domain of Dnmt1 has been implicated in subcellular localization, protein association, and catalytic function. However, progress in understanding its function has been limited by the lack of assays for and a structure of this domain. Here, we show that the naked DNA- and polynucleosome-binding activities of Dnmt1 are inhibited by the RFTS domain, which functions by virtue of binding the catalytic domain to the exclusion of DNA. Kinetic analysis with a fluorogenicmore » DNA substrate established the RFTS domain as a 600-fold inhibitor of Dnmt1 enzymatic activity. The crystal structure of the RFTS domain reveals a novel fold and supports a mechanism in which an RFTS-targeted Dnmt1-binding protein, such as Uhrf1, may activate Dnmt1 for DNA binding.« less

Neonatal Persistent Exposure to 6-Propyl-2-thiouracil, a Thyroid-Disrupting Chemical, Differentially Modulates Expression of Hepatic Catalase and C/EBP-β in Adult Rats.

PubMed

Bunker, Suresh Kumar; Dandapat, Jagneshwar; Sahoo, Sunil Kumar; Roy, Anita; Chainy, Gagan B N

2016-02-01

Persistent exposure of rats to 6-propyl-2-thiouracil (PTU) from birth resulted in decreases in plasma thyroid hormone (TH) levels and hepatic expression of catalase and CCAAT enhancer binding protein β (C/EBP-β). Catalase promoter region (-185 to +52) that contains binding sites for C/EBP-β showed an augmentation in the methylation level along with a change in methylation pattern of CpG islands in response to PTU treatment. PTU withdrawal on 30 days of birth restored TH levels and C/EBP-β to control rats in adulthood. Although catalase expression was restored to some extent in adult rats in response to PTU withdrawal, a permanent change in its promoter CpG methylation pattern was recorded. The results suggest that downregulation of adult hepatic catalase gene in response to persistent neonatal PTU exposure may not solely be attributed to thyroid-disrupting properties of PTU. It is possible that besides thyroid-disrupting behavior, PTU may impair expression of hepatic catalase by altering methylation pattern of its promoter. © 2015 Wiley Periodicals, Inc.

CpG oligodeoxynucleotide nanomedicines for the prophylaxis or treatment of cancers, infectious diseases, and allergies.

PubMed

Hanagata, Nobutaka

2017-01-01

Unmethylated cytosine-guanine dinucleotide-containing oligodeoxynucleotides (CpG ODNs), which are synthetic agonists of Toll-like receptor 9 (TLR9), activate humoral and cellular immunity and are being developed as vaccine adjuvants to prevent or treat cancers, infectious diseases, and allergies. Free CpG ODNs have been used in many clinical trials implemented to verify their effects. However, recent research has reported that self-assembled CpG ODNs, protein/peptide-CpG ODN conjugates, and nanomaterial-CpG ODN complexes demonstrate higher adjuvant effects than free CpG ODNs, owing to their improved uptake efficiency into cells expressing TLR9. Moreover, protein/peptide-CpG ODN conjugates and nanomaterial-CpG ODN complexes are able to deliver CpG ODNs and antigens (or allergens) to the same types of cells, which enables a higher degree of prophylaxis or therapeutic effect. In this review, the author describes recent trends in the research and development of CpG ODN nanomedicines containing self-assembled CpG ODNs, protein/peptide-CpG ODN conjugates, and nanomaterial-CpG ODN complexes, focusing mainly on the results of preclinical and clinical studies.

Epigenetic dysregulation of interleukin 8 (CXCL8) hypersecretion in cystic fibrosis airway epithelial cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Poghosyan, Anna, E-mail: pannagos@yahoo.com; Patel, Jamie K.; Clifford, Rachel L.

Airway epithelial cells in cystic fibrosis (CF) overexpress Interleukin 8 (CXCL8) through poorly defined mechanisms. CXCL8 transcription is dependent on coordinated binding of CCAAT/enhancer binding protein (C/EBP)β, nuclear factor (NF)-κB, and activator protein (AP)-1 to the promoter. Here we show abnormal epigenetic regulation is responsible for CXCL8 overexpression in CF cells. Under basal conditions CF cells had increased bromodomain (Brd)3 and Brd4 recruitment and enhanced NF-κB and C/EBPβ binding to the CXCL8 promoter compared to non-CF cells due to trimethylation of histone H3 at lysine 4 (H3K4me3) and DNA hypomethylation at CpG6. IL-1β increased NF-κB, C/EBPβ and Brd4 binding. Furthermore, inhibitors ofmore » bromodomain and extra-terminal domain family (BET) proteins reduced CXCL8 production in CF cells suggesting a therapeutic target for the BET pathway. -- Highlights: •A regulatory mechanism of CXCL8 transcriptional control in CF airways is proposed. •There was an increased binding of NF-κB and C/EBPβ transcription factors. •There was enhanced recruitment of BET proteins to the CXCL8 promoter. •Epigenetic modifications are responsible for the aberrant CXCL8 transcription.« less

In vitro CpG methylation increases the transformation efficiency of Borrelia burgdorferi strains harboring the endogenous linear plasmid lp56.

PubMed

Chen, Qiang; Fischer, Joshua R; Benoit, Vivian M; Dufour, Nicholas P; Youderian, Philip; Leong, John M

2008-12-01

Borrelia burgdorferi is the causative agent of Lyme disease, the most common vector-borne illness in the Northern hemisphere. Low-passage-number infectious strains of B. burgdorferi exhibit extremely low transformation efficiencies-so low, in fact, as to hinder the genetic study of putative virulence factors. Two putative restriction-modification (R-M) systems, BBE02 contained on linear plasmid 25 (lp25) and BBQ67 contained on lp56, have been postulated to contribute to this poor transformability. Restriction barriers posed by other bacteria have been overcome by the in vitro methylation of DNA prior to transformation. To test whether a methylation-sensitive restriction system contributes to poor B. burgdorferi transformability, shuttle plasmids were treated with the CpG methylase M.SssI prior to the electroporation of a variety of strains harboring different putative R-M systems. We found that for B. burgdorferi strains that harbor lp56, in vitro methylation increased transformation by at least 1 order of magnitude. These results suggest that in vitro CpG methylation protects exogenous DNA from degradation by an lp56-contained R-M system, presumably BBQ67. The utility of in vitro methylation for the genetic manipulation of B. burgdorferi was exemplified by the ease of plasmid complementation of a B. burgdorferi B31 A3 BBK32 kanamycin-resistant (B31 A3 BBK32::Kan(r)) mutant, deficient in the expression of the fibronectin- and glycosaminoglycan (GAG)-binding adhesin BBK32. Consistent with the observation that several surface proteins may promote GAG binding, the B. burgdorferi B31 A3 BBK32::Kan(r) mutant demonstrated no defect in the ability to bind purified GAGs or GAGs expressed on the surfaces of cultured cells.

Genome-Wide DNA Methylation Analysis and Epigenetic Variations Associated with Congenital Aortic Valve Stenosis (AVS).

PubMed

Radhakrishna, Uppala; Albayrak, Samet; Alpay-Savasan, Zeynep; Zeb, Amna; Turkoglu, Onur; Sobolewski, Paul; Bahado-Singh, Ray O

2016-01-01

Congenital heart defect (CHD) is the most common cause of death from congenital anomaly. Among several candidate epigenetic mechanisms, DNA methylation may play an important role in the etiology of CHDs. We conducted a genome-wide DNA methylation analysis using an Illumina Infinium 450k human methylation assay in a cohort of 24 newborns who had aortic valve stenosis (AVS), with gestational-age matched controls. The study identified significantly-altered CpG methylation at 59 sites in 52 genes in AVS subjects as compared to controls (either hypermethylated or demethylated). Gene Ontology analysis identified biological processes and functions for these genes including positive regulation of receptor-mediated endocytosis. Consistent with prior clinical data, the molecular function categories as determined using DAVID identified low-density lipoprotein receptor binding, lipoprotein receptor binding and identical protein binding to be over-represented in the AVS group. A significant epigenetic change in the APOA5 and PCSK9 genes known to be involved in AVS was also observed. A large number CpG methylation sites individually demonstrated good to excellent diagnostic accuracy for the prediction of AVS status, thus raising possibility of molecular screening markers for this disorder. Using epigenetic analysis we were able to identify genes significantly involved in the pathogenesis of AVS.

Genome-Wide DNA Methylation Analysis and Epigenetic Variations Associated with Congenital Aortic Valve Stenosis (AVS)

PubMed Central

Radhakrishna, Uppala; Albayrak, Samet; Alpay-Savasan, Zeynep; Zeb, Amna; Turkoglu, Onur; Sobolewski, Paul; Bahado-Singh, Ray O.

2016-01-01

Congenital heart defect (CHD) is the most common cause of death from congenital anomaly. Among several candidate epigenetic mechanisms, DNA methylation may play an important role in the etiology of CHDs. We conducted a genome-wide DNA methylation analysis using an Illumina Infinium 450k human methylation assay in a cohort of 24 newborns who had aortic valve stenosis (AVS), with gestational-age matched controls. The study identified significantly-altered CpG methylation at 59 sites in 52 genes in AVS subjects as compared to controls (either hypermethylated or demethylated). Gene Ontology analysis identified biological processes and functions for these genes including positive regulation of receptor-mediated endocytosis. Consistent with prior clinical data, the molecular function categories as determined using DAVID identified low-density lipoprotein receptor binding, lipoprotein receptor binding and identical protein binding to be over-represented in the AVS group. A significant epigenetic change in the APOA5 and PCSK9 genes known to be involved in AVS was also observed. A large number CpG methylation sites individually demonstrated good to excellent diagnostic accuracy for the prediction of AVS status, thus raising possibility of molecular screening markers for this disorder. Using epigenetic analysis we were able to identify genes significantly involved in the pathogenesis of AVS. PMID:27152866

DNA cytosine methylation in the bovine leukemia virus promoter is associated with latency in a lymphoma-derived B-cell line: potential involvement of direct inhibition of cAMP-responsive element (CRE)-binding protein/CRE modulator/activation transcription factor binding.

PubMed

Pierard, Valérie; Guiguen, Allan; Colin, Laurence; Wijmeersch, Gaëlle; Vanhulle, Caroline; Van Driessche, Benoît; Dekoninck, Ann; Blazkova, Jana; Cardona, Christelle; Merimi, Makram; Vierendeel, Valérie; Calomme, Claire; Nguyên, Thi Liên-Anh; Nuttinck, Michèle; Twizere, Jean-Claude; Kettmann, Richard; Portetelle, Daniel; Burny, Arsène; Hirsch, Ivan; Rohr, Olivier; Van Lint, Carine

2010-06-18

Bovine leukemia virus (BLV) proviral latency represents a viral strategy to escape the host immune system and allow tumor development. Besides the previously demonstrated role of histone deacetylation in the epigenetic repression of BLV expression, we showed here that BLV promoter activity was induced by several DNA methylation inhibitors (such as 5-aza-2'-deoxycytidine) and that overexpressed DNMT1 and DNMT3A, but not DNMT3B, down-regulated BLV promoter activity. Importantly, cytosine hypermethylation in the 5'-long terminal repeat (LTR) U3 and R regions was associated with true latency in the lymphoma-derived B-cell line L267 but not with defective latency in YR2 cells. Moreover, the virus-encoded transactivator Tax(BLV) decreased DNA methyltransferase expression levels, which could explain the lower level of cytosine methylation observed in the L267(LTaxSN) 5'-LTR compared with the L267 5'-LTR. Interestingly, DNA methylation inhibitors and Tax(BLV) synergistically activated BLV promoter transcriptional activity in a cAMP-responsive element (CRE)-dependent manner. Mechanistically, methylation at the -154 or -129 CpG position (relative to the transcription start site) impaired in vitro binding of CRE-binding protein (CREB) transcription factors to their respective CRE sites. Methylation at -129 CpG alone was sufficient to decrease BLV promoter-driven reporter gene expression by 2-fold. We demonstrated in vivo the recruitment of CREB/CRE modulator (CREM) and to a lesser extent activating transcription factor-1 (ATF-1) to the hypomethylated CRE region of the YR2 5'-LTR, whereas we detected no CREB/CREM/ATF recruitment to the hypermethylated corresponding region in the L267 cells. Altogether, these findings suggest that site-specific DNA methylation of the BLV promoter represses viral transcription by directly inhibiting transcription factor binding, thereby contributing to true proviral latency.

Recombinant domains III of Tick-Borne Encephalitis Virus envelope protein in combination with dextran and CpGs induce immune response and partial protectiveness against TBE virus infection in mice.

PubMed

Ershova, Anna S; Gra, Olga A; Lyaschuk, Alexander M; Grunina, Tatyana M; Tkachuk, Artem P; Bartov, Mikhail S; Savina, Darya M; Sergienko, Olga V; Galushkina, Zoya M; Gudov, Vladimir P; Kozlovskaya, Liubov I; Kholodilov, Ivan S; Gmyl, Larissa V; Karganova, Galina G; Lunin, Vladimir G; Karyagina, Anna S; Gintsburg, Alexander L

2016-10-07

E protein of tick-borne encephalitis virus (TBEV) and other flaviviruses is located on the surface of the viral particle. Domain III of this protein seems to be a promising component of subunit vaccines for prophylaxis of TBE and kits for diagnostics of TBEV. Three variants of recombinant TBEV E protein domain III of European, Siberian and Far Eastern subtypes fused with dextran-binding domain of Leuconostoc citreum KM20 were expressed in E. coli and purified. The native structure of domain III was confirmed by ELISA antibody kit and sera of patients with tick-borne encephalitis. Immunogenic and protective properties of the preparation comprising these recombinant proteins immobilized on a dextran carrier with CpG oligonucleotides as an adjuvant were investigated on the mice model. All 3 variants of recombinant proteins immobilized on dextran demonstrate specific interaction with antibodies from the sera of TBE patients. Thus, constructed recombinant proteins seem to be promising for TBE diagnostics. The formulation comprising the 3 variants of recombinant antigens immobilized on dextran and CpG oligonucleotides, induces the production of neutralizing antibodies against TBEV of different subtypes and demonstrates partial protectivity against TBEV infection. Studied proteins interact with the sera of TBE patients, and, in combination with dextran and CPGs, demonstrate immunogenicity and limited protectivity on mice compared with reference "Tick-E-Vac" vaccine.

CpG oligodeoxynucleotides augment the murine immune response to the Yersinia pestis F1-V vaccine in bubonic and pneumonic models of plague.

PubMed

Amemiya, Kei; Meyers, Jennifer L; Rogers, Taralyn E; Fast, Randy L; Bassett, Anthony D; Worsham, Patricia L; Powell, Bradford S; Norris, Sarah L; Krieg, Arthur M; Adamovicz, Jeffrey J

2009-04-06

The current U.S. Department of Defense candidate plague vaccine is a fusion between two Yersinia pestis proteins: the F1 capsular protein, and the low calcium response (Lcr) V-protein. We hypothesized that an immunomodulator, such as CpG oligodeoxynucleotide (ODN)s, could augment the immune response to the plague F1-V vaccine in a mouse model for plague. CpG ODNs significantly augmented the antibody response and efficacy of a single dose of the plague vaccine in murine bubonic and pneumonic models of plague. In the latter study, we also found an overall significant augmentation the immune response to the individual subunits of the plague vaccine by CpG ODN 2006. In a long-term, prime-boost study, CpG ODN induced a significant early augmentation of the IgG response to the vaccine. The presence of CpG ODN induced a significant increase in the IgG2a subclass response to the vaccine up to 5 months after the boost. Our studies showed that CpG ODNs significantly augmented the IgG antibody response to the plague vaccine, which increased the probability of survival in murine models of plague (P<0.0001).

Modulation of transcription factor binding and epigenetic regulation of the MLH1 CpG island and shore by polymorphism rs1800734 in colorectal cancer

PubMed Central

Savio, Andrea J.; Bapat, Bharati

2017-01-01

ABSTRACT The MLH1 promoter polymorphism rs1800734 is associated with MLH1 CpG island hypermethylation and expression loss in colorectal cancer (CRC). Conversely, variant rs1800734 is associated with MLH1 shore, but not island, hypomethylation in peripheral blood mononuclear cell DNA. To explore these distinct patterns, MLH1 CpG island and shore methylation was assessed in CRC cell lines stratified by rs1800734 genotype. Cell lines containing the variant A allele demonstrated MLH1 shore hypomethylation compared to wild type (GG). There was significant enrichment of transcription factor AP4 at the MLH1 promoter in GG and GA cell lines, but not the AA cell line, by chromatin immunoprecipitation studies. Preferential binding to the G allele was confirmed by sequencing in the GA cell line. The enhancer-associated histone modification H3K4me1 was enriched at the MLH1 shore; however, H3K27ac was not, indicating the shore is an inactive enhancer. These results demonstrate the role of variant rs1800734 in altering transcription factor binding as well as epigenetics at regions beyond the MLH1 CpG island in which it is located. PMID:28304185

Modulation of transcription factor binding and epigenetic regulation of the MLH1 CpG island and shore by polymorphism rs1800734 in colorectal cancer.

PubMed

Savio, Andrea J; Bapat, Bharati

2017-06-03

The MLH1 promoter polymorphism rs1800734 is associated with MLH1 CpG island hypermethylation and expression loss in colorectal cancer (CRC). Conversely, variant rs1800734 is associated with MLH1 shore, but not island, hypomethylation in peripheral blood mononuclear cell DNA. To explore these distinct patterns, MLH1 CpG island and shore methylation was assessed in CRC cell lines stratified by rs1800734 genotype. Cell lines containing the variant A allele demonstrated MLH1 shore hypomethylation compared to wild type (GG). There was significant enrichment of transcription factor AP4 at the MLH1 promoter in GG and GA cell lines, but not the AA cell line, by chromatin immunoprecipitation studies. Preferential binding to the G allele was confirmed by sequencing in the GA cell line. The enhancer-associated histone modification H3K4me1 was enriched at the MLH1 shore; however, H3K27ac was not, indicating the shore is an inactive enhancer. These results demonstrate the role of variant rs1800734 in altering transcription factor binding as well as epigenetics at regions beyond the MLH1 CpG island in which it is located.

Association between Promoter Methylation of Gene ERCC3 and Benzene Hematotoxicity.

PubMed

Zheng, Min; Lin, Feiliang; Hou, Fenxia; Li, Guilan; Zhu, Caiying; Xu, Peiyu; Xing, Caihong; Wang, Qianfei

2017-08-16

Benzene is a primary industrial chemical and a ubiquitous environmental pollutant. ERCC3 is a key player in nucleotide excision repair. Recent studies suggested that site-specific methylation is a possible mechanism of the transcriptional dysregulation by blocking transcription factors binding. We previously found that the average promoter methylation level of ERCC3 was increased in benzene-exposed workers. In order to test whether specific CpG sites of ERCC3 play an important role in benzene-induced epigenetic changes and whether the specific methylation patterns are associated with benzene hematotoxicity, we analyzed the promoter methylation levels of individual CpG sites, transcription factor binding motif and the correlation between aberrant CpG methylation and hematotoxicity in 76 benzene-exposed workers and 24 unexposed controls in China. Out of all the CpGs analyzed, two CpG units located 43 bp upstream and 99 bp downstream of the transcription start site of ERCC3 (CpG 2-4 and CpG 17-18, respectively), showed the most pronounced increase in methylation levels in benzene-exposed workers, compared with unexposed controls (Mean ± SD: 5.86 ± 2.77% vs. 4.92 ± 1.53%, p = 0.032; 8.45 ± 4.09% vs. 6.79 ± 2.50%, p = 0.024, respectively). Using the JASPAR CORE Database, we found that CpG 2-4 and CpG 17-18 were bound by three putative transcription factors (TFAP2A, E2F4 and MZF1). Furthermore, the methylation levels for CpG 2-4 were correlated negatively with the percentage of neutrophils ( β = -0.676, p = 0.005) in benzene-exposed workers. This study demonstrates that CpG-specific DNA methylation in the ERCC3 promoter region may be involved in benzene-induced epigenetic modification and it may contribute to benzene-induced hematotoxicity.

Association between Promoter Methylation of Gene ERCC3 and Benzene Hematotoxicity

PubMed Central

Lin, Feiliang; Hou, Fenxia; Li, Guilan; Zhu, Caiying; Xu, Peiyu; Xing, Caihong; Wang, Qianfei

2017-01-01

Benzene is a primary industrial chemical and a ubiquitous environmental pollutant. ERCC3 is a key player in nucleotide excision repair. Recent studies suggested that site-specific methylation is a possible mechanism of the transcriptional dysregulation by blocking transcription factors binding. We previously found that the average promoter methylation level of ERCC3 was increased in benzene-exposed workers. In order to test whether specific CpG sites of ERCC3 play an important role in benzene-induced epigenetic changes and whether the specific methylation patterns are associated with benzene hematotoxicity, we analyzed the promoter methylation levels of individual CpG sites, transcription factor binding motif and the correlation between aberrant CpG methylation and hematotoxicity in 76 benzene-exposed workers and 24 unexposed controls in China. Out of all the CpGs analyzed, two CpG units located 43 bp upstream and 99 bp downstream of the transcription start site of ERCC3 (CpG 2–4 and CpG 17–18, respectively), showed the most pronounced increase in methylation levels in benzene-exposed workers, compared with unexposed controls (Mean ± SD: 5.86 ± 2.77% vs. 4.92 ± 1.53%, p = 0.032; 8.45 ± 4.09% vs. 6.79 ± 2.50%, p = 0.024, respectively). Using the JASPAR CORE Database, we found that CpG 2–4 and CpG 17–18 were bound by three putative transcription factors (TFAP2A, E2F4 and MZF1). Furthermore, the methylation levels for CpG 2–4 were correlated negatively with the percentage of neutrophils (β = −0.676, p = 0.005) in benzene-exposed workers. This study demonstrates that CpG-specific DNA methylation in the ERCC3 promoter region may be involved in benzene-induced epigenetic modification and it may contribute to benzene-induced hematotoxicity. PMID:28813025

Topical CpG Adjuvantation of a Protein-Based Vaccine Induces Protective Immunity to Listeria monocytogenes

PubMed Central

Cheng, Wing Ki; Wee, Kathleen; Kollmann, Tobias R.

2014-01-01

Robust CD8+ T cell responses are essential for immune protection against intracellular pathogens. Using parenteral administration of ovalbumin (OVA) protein as a model antigen, the effect of the Toll-like receptor 9 (TLR9) agonist, CpG oligodeoxynucleotide (ODN) 1826, as an adjuvant delivered either topically, subcutaneously, or intramuscularly on antigen-specific CD8+ T cell responses in a mouse model was evaluated. Topical CpG adjuvant increased the frequency of OVA-specific CD8+ T cells in the peripheral blood and in the spleen. The more effective strategy to administer topical CpG adjuvant to enhance CD8+ T cell responses was single-dose administration at the time of antigen injection with a prime-boost regimen. Topical CpG adjuvant conferred both rapid and long-lasting protection against systemic challenge with recombinant Listeria monocytogenes expressing the cytotoxic T lymphocyte (CTL) epitope of OVA257–264 (strain Lm-OVA) in a TLR9-dependent manner. Topical CpG adjuvant induced a higher proportion of CD8+ effector memory T cells than parenteral administration of the adjuvant. Although traditional vaccination strategies involve coformulation of antigen and adjuvant, split administration using topical adjuvant is effective and has advantages of safety and flexibility. Split administration of topical CpG ODN 1826 with parenteral protein antigen is superior to other administration strategies in enhancing both acute and memory protective CD8+ T cell immune responses to subcutaneous protein vaccines. This vaccination strategy induces rapid and persistent protective immune responses against the intracellular organism L. monocytogenes. PMID:24391136

Effect of dietary betaine supplementation on lipogenesis gene expression and CpG methylation of lipoprotein lipase gene in broilers.

PubMed

Xing, Jinyi; Kang, Li; Jiang, Yunliang

2011-03-01

Experiments were conducted to investigate the effect of betaine supplementation on mRNA expression levels of lipogenesis genes and CpG methylation of lipoprotein lipase gene (LPL) in broilers. From 22 days of age, 78 broilers were feed basal diet without betaine and basal diet supplemented with 0.1% betaine, respectively, and at 56 and 66 days of age, the traits of 15 chickens (7 males and 8 females) of each group were recorded and abdominal fat pads were collected. The mRNA expression levels of several lipogenesis gene were analyzed by semi-quantitative RT-PCR and real-time quantitative RT-PCR (qPCR), respectively. The CpG methylation profile at the promoter region of LPL gene in 66-day-old broilers was determined by bisulfite sequencing. The average daily gain and percent abdominal fat traits were slightly improved in 56-day-old and 66-day-old broilers after dietary supplementation of betaine to diet. After adding 0.1% betaine to diet, the mRNA levels of fatty acid synthase (FAS) and adipocyte-type fatty acid-binding protein genes in abdominal adipose were significantly decreased in 56-day-old broilers, and those of LPL and FAS genes in abdominal adipose were significantly decreased in 66-day-old broilers comparing with the control group (P < 0.05 and P < 0.001). Moreover, in 66-day-old broilers fed 0.1% betaine diet, a different CpG methylation pattern was observed: the CpG dinucleotides of 1st, 6th, 7th, 8th and from 10th to 50th were less methylated; however, those of 2nd, 5th and 9th were more heavily methylated. The results suggest that transcription of some lipogenesis genes was decreased by betaine supplementation and betaine may decrease LPL mRNA expression by altering CpG methylation pattern on LPL promoter region.

The Antimalarial Artemisinin Synergizes with Antibiotics To Protect against Lethal Live Escherichia coli Challenge by Decreasing Proinflammatory Cytokine Release

PubMed Central

Wang, Jun; Zhou, Hong; Zheng, Jiang; Cheng, Juan; Liu, Wei; Ding, Guofu; Wang, Liangxi; Luo, Ping; Lu, Yongling; Cao, Hongwei; Yu, Shuangjiang; Li, Bin; Zhang, Lezhi

2006-01-01

In the present study artemisinin (ART) was found to have potent anti-inflammatory effects in animal models of sepsis induced by CpG-containing oligodeoxy-nucleotides (CpG ODN), lipopolysaccharide (LPS), heat-killed Escherichia coli 35218 or live E. coli. Furthermore, we found that ART protected mice from a lethal challenge by CpG ODN, LPS, or heat-killed E. coli in a dose-dependent manner and that the protection was related to a reduction in serum tumor necrosis factor alpha (TNF-α). More significantly, the administration of ART together with ampicillin or unasyn (a complex of ampicillin and sulbactam) decreased mortality from 100 to 66.7% or 33.3%, respectively, in mice subjected to a lethal live E. coli challenge. Together with the observation that ART alone does not inhibit bacterial growth, this result suggests that ART protection is achieved as a result of its anti-inflammatory activity rather than an antimicrobial effect. In RAW264.7 cells, pretreatment with ART potently inhibited TNF-α and interleukin-6 release induced by CpG ODN, LPS, or heat-killed E. coli in a dose- and time-dependent manner. Experiments utilizing affinity sensor technology revealed no direct binding of ART with CpG ODN or LPS. Flow cytometry further showed that ART did not alter binding of CpG ODN to cell surfaces or the internalization of CpG ODN. In addition, upregulated levels of TLR9 and TLR4 mRNA were not attenuated by ART treatment. ART treatment did, however, block the NF-κB activation induced by CpG ODN, LPS, or heat-killed E. coli. These findings provide compelling evidence that ART may be an important potential drug for sepsis treatment. PMID:16801421

Transcriptional Regulation of Brain-Derived Neurotrophic Factor (BDNF) by Methyl CpG Binding Protein 2 (MeCP2): a Novel Mechanism for Re-Myelination and/or Myelin Repair Involved in the Treatment of Multiple Sclerosis (MS).

PubMed

KhorshidAhmad, Tina; Acosta, Crystal; Cortes, Claudia; Lakowski, Ted M; Gangadaran, Surendiran; Namaka, Michael

2016-03-01

Multiple sclerosis (MS) is a chronic progressive, neurological disease characterized by the targeted immune system-mediated destruction of central nervous system (CNS) myelin. Autoreactive CD4+ T helper cells have a key role in orchestrating MS-induced myelin damage. Once activated, circulating Th1-cells secrete a variety of inflammatory cytokines that foster the breakdown of blood-brain barrier (BBB) eventually infiltrating into the CNS. Inside the CNS, they become reactivated upon exposure to the myelin structural proteins and continue to produce inflammatory cytokines such as tumor necrosis factor α (TNFα) that leads to direct activation of antibodies and macrophages that are involved in the phagocytosis of myelin. Proliferating oligodendrocyte precursors (OPs) migrating to the lesion sites are capable of acute remyelination but unable to completely repair or restore the immune system-mediated myelin damage. This results in various permanent clinical neurological disabilities such as cognitive dysfunction, fatigue, bowel/bladder abnormalities, and neuropathic pain. At present, there is no cure for MS. Recent remyelination and/or myelin repair strategies have focused on the role of the neurotrophin brain-derived neurotrophic factor (BDNF) and its upstream transcriptional repressor methyl CpG binding protein (MeCP2). Research in the field of epigenetic therapeutics involving histone deacetylase (HDAC) inhibitors and lysine acetyl transferase (KAT) inhibitors is being explored to repress the detrimental effects of MeCP2. This review will address the role of MeCP2 and BDNF in remyelination and/or myelin repair and the potential of HDAC and KAT inhibitors as novel therapeutic interventions for MS.

Induction of multispecific Th-1 type immune response against HCV in mice by protein immunization using CpG and Montanide ISA 720 as adjuvants

PubMed Central

Qiu, Qi; Wang, Richard Yuan-Hu; Jiao, Xuanmao; Jin, Bo; Sugauchi, Fuminaka; Grandinetti, Teresa; Alter, Harvey J.; Shih, J. Wai-Kuo

2017-01-01

Recent studies demonstrate that Th1-type immune responses against a broad spectrum of hepatitis C virus (HCV) gene products are crucial to the resolution of acute HCV infection. We investigated new vaccine approaches to augment the strength of HCV-specific Th1-type immune responses. ELISPOT assay revealed that single or multiple protein immunization using both CpG ODN and Montanide ISA 720 as adjuvants induced much stronger IFN-γ-producing Th1 responses against core, NS3 and NS5b targets than did the formulation without these adjuvants. Protein vaccination using CpG ODN and Montanide ISA 720 as adjuvants also greatly enhanced humoral responses to HCV core, E1/E2 and NS3. When specific IgG isotypes were assayed, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants produced higher titers of IgG2a dominant antibodies than did protein immunization alone, indicating a more Th1-biasedpathway. This increase in IgG2a is consistent with the induction of Th1 cells secreting IFN-γ demonstrated by ELISPOT assay. In conclusion, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants greatly enhanced cellular (Th1 type) as well as humoral immune responses against HCV in Balb/c mice. The use of adjuvants appears critical to the induction of Th1 immune responses during HCV vaccination with recombinant proteins. PMID:18675871

Induction of multispecific Th-1 type immune response against HCV in mice by protein immunization using CpG and Montanide ISA 720 as adjuvants.

PubMed

Qiu, Qi; Wang, Richard Yuan-Hu; Jiao, Xuanmao; Jin, Bo; Sugauchi, Fuminaka; Grandinetti, Teresa; Alter, Harvey J; Shih, J Wai-Kuo

2008-10-09

Recent studies demonstrate that Th1-type immune responses against a broad spectrum of hepatitis C virus (HCV) gene products are crucial to the resolution of acute HCV infection. We investigated new vaccine approaches to augment the strength of HCV-specific Th1-type immune responses. ELISPOT assay revealed that single or multiple protein immunization using both CpG ODN and Montanide ISA 720 as adjuvants induced much stronger IFN-gamma-producing Th1 responses against core, NS3 and NS5b targets than did the formulation without these adjuvants. Protein vaccination using CpG ODN and Montanide ISA 720 as adjuvants also greatly enhanced humoral responses to HCV core, E1/E2 and NS3. When specific IgG isotypes were assayed, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants produced higher titers of IgG2a dominant antibodies than did protein immunization alone, indicating a more Th1-biased pathway. This increase in IgG2a is consistent with the induction of Th1 cells secreting IFN-gamma demonstrated by ELISPOT assay. In conclusion, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants greatly enhanced cellular (Th1 type) as well as humoral immune responses against HCV in Balb/c mice. The use of adjuvants appears critical to the induction of Th1 immune responses during HCV vaccination with recombinant proteins.

Mechanism of Mitochondrial Transcription Factor A Attenuation of CpG-Induced Antibody Production

PubMed Central

Saifee, Jessica F.; Torres, Raul M.; Janoff, Edward N.

2016-01-01

Mitochondrial transcription factor A (TFAM) had previously been shown to act as a damage associated molecular pattern with the ability to enhance CpG-A phosphorothioate oligodeoxynucleotide (ODN)-mediated stimulation of IFNα production from human plasmacytoid dendritic cells. Examination of the mechanism by which TFAM might influence CpG ODN mediated innate immune responses revealed that TFAM binds directly, tightly and selectively to the structurally related CpG-A, -B, and -C ODN. TFAM also modulated the ability of the CpG-B or -C to stimulate the production of antibodies from human B cells. TFAM showed a dose-dependent modulation of CpG-B, and -C -induced antibody production from human B cells in vitro, with enhancement of high dose and inhibition of low doses of CpG stimulation. This effect was linked to the ability of TFAM to directly inhibit the binding of CpG ODNs to B cells, in a manner consistent with the relative binding affinities of TFAM for the ODNs. These data suggest that TFAM alters the free concentration of the CpG available to stimulate B cells by sequestering this ODN in a TFAM-CpG complex. Thus, TFAM has the potential to decrease the pathogenic consequences of exposure to natural CpG-like hypomethylated DNA in vivo, as well as such as that found in traumatic injury, infection, autoimmune disease and during pregnancy. PMID:27280778

[SINEs in mammalian genomes can serve as additional signals in formation of facultative heterochromatin].

PubMed

Usmanova, N M; Kazakov, V I; Tomilin, N V

2008-01-01

Using computer-based methods we determined the global distribution of short interspersed nuclear elements (SINEs) in the human and mouse X chromosomes. It has been shown that this distributions is similar to the distributions of CpG islands and genes but is different from the distribution of LINE1 elements. Since SINEs (human Alu and mouse B2) may have binding sites for Polycomb protein YY1, we suggest that these repeats can serve as additional signals ("boosters") in Polycomb-dependent silencing of gene rich segments during X inactivation.

Structural impact of complete CpG methylation within target DNA on specific complex formation of the inducible transcription factor Egr-1.

PubMed

Zandarashvili, Levani; White, Mark A; Esadze, Alexandre; Iwahara, Junji

2015-07-08

The inducible transcription factor Egr-1 binds specifically to 9-bp target sequences containing two CpG sites that can potentially be methylated at four cytosine bases. Although it appears that complete CpG methylation would make an unfavorable steric clash in the previous crystal structures of the complexes with unmethylated or partially methylated DNA, our affinity data suggest that DNA recognition by Egr-1 is insensitive to CpG methylation. We have determined, at a 1.4-Å resolution, the crystal structure of the Egr-1 zinc-finger complex with completely methylated target DNA. Structural comparison of the three different methylation states reveals why Egr-1 can recognize the target sequences regardless of CpG methylation. Copyright © 2015 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

A CpG Oligonucleotide Can Protect Mice from a Low Aerosol Challenge Dose of Burkholderia mallei

PubMed Central

Waag, David M.; McCluskie, Michael J.; Zhang, Ningli; Krieg, Arthur M.

2006-01-01

Treatment with an oligodeoxynucleotide (ODN) containing CPG motifs (CpG ODN 7909) was found to protect BALB/c mice from lung infection or death after aerosol challenge with Burkholderia mallei. Protection was associated with enhanced levels of gamma interferon (IFN-γ)-inducible protein 10, interleukin-12 (IL-12), IFN-γ, and IL-6. Preexposure therapy with CpG ODNs may protect victims of a biological attack from glanders. PMID:16495571

A CpG oligonucleotide can protect mice from a low aerosol challenge dose of Burkholderia mallei.

PubMed

Waag, David M; McCluskie, Michael J; Zhang, Ningli; Krieg, Arthur M

2006-03-01

Treatment with an oligodeoxynucleotide (ODN) containing CPG motifs (CpG ODN 7909) was found to protect BALB/c mice from lung infection or death after aerosol challenge with Burkholderia mallei. Protection was associated with enhanced levels of gamma interferon (IFN-gamma)-inducible protein 10, interleukin-12 (IL-12), IFN-gamma, and IL-6. Preexposure therapy with CpG ODNs may protect victims of a biological attack from glanders.

Re-visiting protein-centric two-tier classification of existing DNA-protein complexes

PubMed Central

2012-01-01

Background Precise DNA-protein interactions play most important and vital role in maintaining the normal physiological functioning of the cell, as it controls many high fidelity cellular processes. Detailed study of the nature of these interactions has paved the way for understanding the mechanisms behind the biological processes in which they are involved. Earlier in 2000, a systematic classification of DNA-protein complexes based on the structural analysis of the proteins was proposed at two tiers, namely groups and families. With the advancement in the number and resolution of structures of DNA-protein complexes deposited in the Protein Data Bank, it is important to revisit the existing classification. Results On the basis of the sequence analysis of DNA binding proteins, we have built upon the protein centric, two-tier classification of DNA-protein complexes by adding new members to existing families and making new families and groups. While classifying the new complexes, we also realised the emergence of new groups and families. The new group observed was where β-propeller was seen to interact with DNA. There were 34 SCOP folds which were observed to be present in the complexes of both old and new classifications, whereas 28 folds are present exclusively in the new complexes. Some new families noticed were NarL transcription factor, Z-α DNA binding proteins, Forkhead transcription factor, AP2 protein, Methyl CpG binding protein etc. Conclusions Our results suggest that with the increasing number of availability of DNA-protein complexes in Protein Data Bank, the number of families in the classification increased by approximately three fold. The folds present exclusively in newly classified complexes is suggestive of inclusion of proteins with new function in new classification, the most populated of which are the folds responsible for DNA damage repair. The proposed re-visited classification can be used to perform genome-wide surveys in the genomes of interest for the presence of DNA-binding proteins. Further analysis of these complexes can aid in developing algorithms for identifying DNA-binding proteins and their family members from mere sequence information. PMID:22800292

Re-visiting protein-centric two-tier classification of existing DNA-protein complexes.

PubMed

Malhotra, Sony; Sowdhamini, Ramanathan

2012-07-16

Precise DNA-protein interactions play most important and vital role in maintaining the normal physiological functioning of the cell, as it controls many high fidelity cellular processes. Detailed study of the nature of these interactions has paved the way for understanding the mechanisms behind the biological processes in which they are involved. Earlier in 2000, a systematic classification of DNA-protein complexes based on the structural analysis of the proteins was proposed at two tiers, namely groups and families. With the advancement in the number and resolution of structures of DNA-protein complexes deposited in the Protein Data Bank, it is important to revisit the existing classification. On the basis of the sequence analysis of DNA binding proteins, we have built upon the protein centric, two-tier classification of DNA-protein complexes by adding new members to existing families and making new families and groups. While classifying the new complexes, we also realised the emergence of new groups and families. The new group observed was where β-propeller was seen to interact with DNA. There were 34 SCOP folds which were observed to be present in the complexes of both old and new classifications, whereas 28 folds are present exclusively in the new complexes. Some new families noticed were NarL transcription factor, Z-α DNA binding proteins, Forkhead transcription factor, AP2 protein, Methyl CpG binding protein etc. Our results suggest that with the increasing number of availability of DNA-protein complexes in Protein Data Bank, the number of families in the classification increased by approximately three fold. The folds present exclusively in newly classified complexes is suggestive of inclusion of proteins with new function in new classification, the most populated of which are the folds responsible for DNA damage repair. The proposed re-visited classification can be used to perform genome-wide surveys in the genomes of interest for the presence of DNA-binding proteins. Further analysis of these complexes can aid in developing algorithms for identifying DNA-binding proteins and their family members from mere sequence information.

Epigenetic modifications during sex change repress gonadotropin stimulation of cyp19a1a in a teleost ricefield eel (Monopterus albus).

PubMed

Zhang, Yang; Zhang, Shen; Liu, Zhixin; Zhang, Lihong; Zhang, Weimin

2013-08-01

In vertebrates, cytochrome P450 aromatase, encoded by cyp19a1, converts androgens to estrogens and plays important roles in gonadal differentiation and development. The present study examines whether epigenetic mechanisms are involved in cyp19a1a expression and subsequent gonadal development in the hermaphroditic ricefield eel. The expression of the ricefield eel cyp19a1a was stimulated by gonadotropin via the cAMP pathway in the ovary but not the ovotestis or testis. The CpG within the cAMP response element (CRE) of the cyp19a1a promoter was hypermethylated in the ovotestis and testis compared with the ovary. The methylation levels of CpG sites around CRE in the distal region (region II) and around steroidogenic factor 1/adrenal 4 binding protein sites and TATA box in the proximal region (region I) were inversely correlated with cyp19a1a expression during the natural sex change from female to male. In vitro DNA methylation decreased the basal and forskolin-induced activities of cyp19a1a promoter. Chromatin immunoprecipitation assays indicated that histone 3 (Lys9) in both regions I and II of the cyp19a1a promoter were deacetylated and trimethylated in the testis, and in contrast to the ovary, phosphorylated CRE-binding protein failed to bind to these regions. Lastly, the DNA methylation inhibitor 5-aza-2'-deoxycytidine reversed the natural sex change of ricefield eels. These results suggested that epigenetic mechanisms involving DNA methylation and histone deacetylation and methylation may abrogate the stimulation of cyp19a1a by gonadotropins in a male-specific fashion. This may be a mechanism widely used to drive natural sex change in teleosts as well as gonadal differentiation in other vertebrates.

Effects of CPG ODN on biological behavior of PANC-1 and expression of TLR9 in pancreatic cancer.

PubMed

Wu, Han-Qing; Wang, Bo; Zhu, Shi-Kai; Tian, Yuan; Zhang, Jing-Hui; Wu, He-Shui

2011-02-28

To determine the expression of toll-like receptor 9 (TLR9) in pancreatic tumor and the effects of cytosine phosphate-guanosine oligodeoxynucleotides 2216 (CPG ODN2216) on biological behavior of pancreatic carcinoma cell line PANC-1 and explore their clinical significance. The immunohistochemistry and Western blot were used to determine the expression of TLR9 protein in pancreatic cancer tissues, and immunofluorescence staining was performed to detect the TLR9 protein expression in pancreatic carcinoma cell line PANC-1. To assess the effects of CPG ODN2216 on the invasive property of Panc-1 cells, in vitro cell adhesion, wound-healing scrape, and invasion and cell colony formation were evaluated. TLR9 was highly expressed in pancreatic cancer tissues and PANC-1 cells. The percentage of positive cells expressing TLR9 protein in human pancreatic tissues, paracancerous tissues and normal tissues were 73.3%, 33.3% and 20.0%, respectively, and the protein expression level of TLR9 was gradually descending (P < 0.05). In vitro tests in wound-healing scrape, cell adhesion, colony formation and matrigel invasion showed that the adhesion and motility of PANC-1 cells in CPG ODN 2216 treatment group were significantly lower than in the control group (P < 0.05). The cell growth assay showed that the proliferative ability of PANC-1 cells in treatment group was significantly decreased and CPG ODN2216 had an inhibitive effect in the growth of Panc-1 cells in a dose and time-dependent manner (P < 0.05). The gene of TLR9 is correlated with the invasive and metastatic potential of human pancreatic carcinoma, and CPG ODN2216 induces the inhibition of migration and invasion of Panc-1 cells.

Expression of metastasis suppressor gene AES driven by a Yin Yang (YY) element in a CpG island promoter and transcription factor YY2.

PubMed

Kakizaki, Fumihiko; Sonoshita, Masahiro; Miyoshi, Hiroyuki; Itatani, Yoshiro; Ito, Shinji; Kawada, Kenji; Sakai, Yoshiharu; Taketo, M Mark

2016-11-01

We recently found that the product of the AES gene functions as a metastasis suppressor of colorectal cancer (CRC) in both humans and mice. Expression of amino-terminal enhancer of split (AES) protein is significantly decreased in liver metastatic lesions compared with primary colon tumors. To investigate its downregulation mechanism in metastases, we searched for transcriptional regulators of AES in human CRC and found that its expression is reduced mainly by transcriptional dysregulation and, in some cases, by additional haploidization of its coding gene. The AES promoter-enhancer is in a typical CpG island, and contains a Yin-Yang transcription factor recognition sequence (YY element). In human epithelial cells of normal colon and primary tumors, transcription factor YY2, a member of the YY family, binds directly to the YY element, and stimulates expression of AES. In a transplantation mouse model of liver metastases, however, expression of Yy2 (and therefore of Aes) is downregulated. In human CRC metastases to the liver, the levels of AES protein are correlated with those of YY2. In addition, we noticed copy-number reduction for the AES coding gene in chromosome 19p13.3 in 12% (5/42) of human CRC cell lines. We excluded other mechanisms such as point or indel mutations in the coding or regulatory regions of the AES gene, CpG methylation in the AES promoter enhancer, expression of microRNAs, and chromatin histone modifications. These results indicate that Aes may belong to a novel family of metastasis suppressors with a CpG-island promoter enhancer, and it is regulated transcriptionally. © 2016 The Authors. Cancer Science published by John Wiley & Sons Australia, Ltd on behalf of Japanese Cancer Association.

MPT-51/CpG DNA vaccine protects mice against Mycobacterium tuberculosis.

PubMed

Silva, Bruna Daniella de Souza; da Silva, Ediane Batista; do Nascimento, Ivan Pereira; Dos Reis, Michelle Cristina Guerreiro; Kipnis, André; Junqueira-Kipnis, Ana Paula

2009-07-16

Tuberculosis (TB) is a severe infectious disease that kills approximately two million people worldwide every year. Because BCG protection is variable and does not protects adults, there is a great need for a new vaccine against TB that does not represent a risk for immunocompromised patients and that is also capable of protecting adult individuals. MPT-51 is a protein found in the genome of mycobacteria and binds to the fibronectin of the extracellular matrix, which may have a role in host tissue attachment and virulence. In order to test the usefulness of MPT-51 as a subunit vaccine, BALB/c were vaccinated and challenged with Mycobacterium tuberculosis. The infection of BALB/c with M. tuberculosis increased the number of IFN-gamma(+) T lymphocytes specific to MPT-51 in the spleen and lungs. Inoculation with rMPT-51/FIA and with rMPT-51/CpG DNA in non-infected BALB/c increased the amounts of IFN-gamma(+) T lymphocytes. Inoculation with rMPT-51/FIA also induced a humoral response specific to MPT-51. CFU counts of lung tissues done 60 days after infection showed a reduction of about 2 log in the bacteria load in the group of animals inoculated with rMPT-51/CpG DNA. These results make MPT-51 a valuable component to be further evaluated in the development of other subunit vaccines.

DNA Methylation in the Neuropeptide S Receptor 1 (NPSR1) Promoter in Relation to Asthma and Environmental Factors

PubMed Central

Reinius, Lovisa E.; Gref, Anna; Sääf, Annika; Acevedo, Nathalie; Joerink, Maaike; Kupczyk, Maciej; D'Amato, Mauro; Bergström, Anna; Melén, Erik; Scheynius, Annika; Dahlén, Sven-Erik; Pershagen, Göran; Söderhäll, Cilla; Kere, Juha

2013-01-01

Asthma and allergy are complex disorders influenced by both inheritance and environment, a relationship that might be further clarified by epigenetics. Neuropeptide S Receptor 1 (NPSR1) has been associated with asthma and allergy and a study suggested modulation of the genetic risk by environmental factors. We aimed to study DNA methylation in the promoter region of NPSR1 in relation to asthma and environmental exposures. Electrophoretic Mobility Shift Assay (EMSA) was used to investigate potential functional roles of both genotypes and methylation status in the NPSR1 promoter. DNA methylation was analysed using EpiTYPER in blood samples from two well-characterized cohorts; the BIOAIR study of severe asthma in adults and the Swedish birth cohort BAMSE. We observed that DNA methylation and genetic variants in the promoter influenced the binding of nuclear proteins to DNA, suggesting functional relevance. Significant, although small, differences in methylation were related to both adult severe asthma (p = 0.0001) and childhood allergic asthma (p = 0.01). Furthermore, DNA methylation was associated with exposures such as current smoking in adults for two CpG sites (p = 0.005 and 0.04), parental smoking during infancy in the children (p = 0.02) and in which month the sample was taken (p = 0.01). In summary, DNA methylation levels in the promoter of NPSR1 showed small but significant associations with asthma, both in adults and in children, and to related traits such as allergy and certain environmental exposures. Both genetic variation and the methylated state of CpG sites seem to have an effect on the binding of nuclear proteins in the regulatory region of NPSR1 suggesting complex regulation of this gene in asthma and allergy. PMID:23372674

Physiologic TLR9-CpG-DNA interaction is essential for the homeostasis of the intestinal immune system.

PubMed

Hofmann, Claudia; Dunger, Nadja; Doser, Kristina; Lippert, Elisabeth; Siller, Sebastian; Edinger, Matthias; Falk, Werner; Obermeier, Florian

2014-01-01

Cytosine-guanosine dinucleotide (CpG) motifs are immunostimulatory components of bacterial DNA and activators of innate immunity through Toll-like receptor 9 (TLR9). Administration of CpG oligodeoxynucleotides before the onset of experimental colitis prevents intestinal inflammation by enforcement of regulatory mechanisms. It was investigated whether physiologic CpG/TLR9 interactions are critical for the homeostasis of the intestinal immune system. Mesenteric lymph node cell and lamina propria mononuclear cell (LPMC) populations from BALB/c wild-type (wt) or TLR9 mice were assessed by flow cytometry and proteome profiling. Cytokine secretion was determined and nuclear extracts were analyzed for nuclear factor kappa B (NF-κB) and cAMP response-element binding protein activity. To assess the colitogenic potential of intestinal T cells, CD4-enriched cells from LPMC of wt or TLR9 donor mice were injected intraperitoneally in recipient CB-17 SCID mice. TLR9 deficiency was accompanied by slight changes in cellular composition and phosphorylation of signaling proteins of mesenteric lymph node cell and LPMC. LPMC from TLR9 mice displayed an increased proinflammatory phenotype compared with wt LPMC. NF-κB activity in cells from TLR9 mice was enhanced, whereas cAMP response-element binding activity was reduced compared with wt. Transfer of lamina propria CD4-enriched T cells from TLR9 mice induced severe colitis, whereas wt lamina propria CD4-enriched T cells displayed an attenuated phenotype. Lack of physiologic CpG/TLR9 interaction impairs the function of the intestinal immune system indicated by enhanced proinflammatory properties. Thus, physiologic CpG/TLR interaction is essential for homeostasis of the intestinal immune system as it is required for the induction of counterregulating anti-inflammatory mechanisms.

High-resolution analysis of CpG methylation and in vivo protein-DNA interactions at the alternative Epstein-Barr virus latency promoters Qp and Cp in the nasopharyngeal carcinoma cell line C666-1.

PubMed

Bakos, Agnes; Banati, Ferenc; Koroknai, Anita; Takacs, Maria; Salamon, Daniel; Minarovits-Kormuta, Susanna; Schwarzmann, Fritz; Wolf, Hans; Niller, Hans Helmut; Minarovits, Janos

2007-10-01

Transcripts for the Epstein-Barr virus (EBV) encoded nuclear antigens (EBNAs) are initiated at alternative promoters (Wp, Cp, for EBNA 1-6 transcripts and Qp, for EBNA 1 transcripts only) located in the BamHI W, C or Q fragment of the viral genome. To understand the host-cell dependent expression of EBNAs in EBV-associated tumors (lymphomas and carcinomas) and in vitro transformed cell lines, it is necessary to analyse the regulatory mechanisms governing the activity of the alternative promoters of EBNA transcripts. Such studies focused mainly on lymphoid cell lines carrying latent EBV genomes, due to the lack of EBV-associated carcinoma cell lines maintaining latent EBV genomes during cultivation in tissue culture. We took advantage of the unique nasopharyngeal carcinoma cell line, C666-1, harboring EBV genomes, and undertook a detailed analysis of CpG methylation patterns and in vivo protein-DNA interactions at the latency promoters Qp and Cp. We found that the active, unmethylated Qp was marked with strong footprints of cellular transcription factors and the viral protein EBNA 1. In contrast, we could not detect binding of relevant transcription factors to the methylated, silent Cp. We concluded that the epigenetic marks at Qp and Cp in C666-1 cells of epithelial origin resemble those of group I Burkitt's lymphoma cell lines.

pH-Responsive Nanoparticle Vaccines for Dual-Delivery of Antigens and Immunostimulatory Oligonucleotides

PubMed Central

Wilson, John T.; Keller, Salka; Manganiello, Matthew J.; Cheng, Connie; Lee, Chen-Chang; Opara, Chinonso; Convertine, Anthony; Stayton, Patrick S.

2013-01-01

Protein subunit vaccines offer important potential advantages over live vaccine vectors, but generally elicit weaker and shorter-lived cellular immune responses. Here we investigate the use of pH-responsive, endosomolytic polymer nanoparticles that were originally developed for RNA delivery as vaccine delivery vehicles for enhancing cellular and humoral immune responses. Micellar nanoparticles were assembled from amphiphilic diblock copolymers composed of an ampholytic core-forming block and a re-designed polycationic corona block doped with thiol-reactive pyridyl disulfide groups to enable dual-delivery of antigens and immunostimulatory CpG oligodeoxynucleotide (CpG ODN) adjuvants. Polymers assembled into 23 nm particles with simultaneous packaging of CpG ODN and a thiolated protein antigen, ovalbumin (ova). Conjugation of ova to nanoparticles significantly enhanced antigen cross-presentation in vitro relative to free ova or an unconjugated, physical mixture of the parent compounds. Subcutaneous vaccination of mice with ova-nanoparticle conjugates elicited a significantly higher CD8+ T cell response (0.5% IFN-ɣ+ of CD8+) compared to mice vaccinated with free ova or a physical mixture of the two components. Significantly, immunization with ova-nanoparticle conjugates electrostatically complexed with CpG ODN (dual-delivery) enhanced CD8+ T cell responses (3.4% IFN-ɣ+ of CD8+) 7-, 18-, and 8-fold relative to immunization with conjugates, ova administered with free CpG, or a formulation containing free ova and CpG complexed to micelles, respectively. Similarly, dual-delivery carriers significantly increased CD4+IFN-ɣ+ (Th1) responses, and elicited a balanced IgG1/IgG2c antibody response. Intradermal administration further augmented cellular immune responses, with dual-delivery carriers inducing ~7% antigen-specific CD8+ T cells. This work demonstrates the ability of pH-responsive, endosomolytic nanoparticles to actively promote antigen cross-presentation and augment cellular and humoral immune responses via dual-delivery of protein antigens and CpG ODN. Hence, pH-responsive polymeric nanoparticles offer promise as a delivery platform for protein subunit vaccines. PMID:23590591

DNA methylation and transcription in a distal region upstream from the bovine AlphaS1 casein gene after once or twice daily milking.

PubMed

Nguyen, Minh; Boutinaud, Marion; Pétridou, Barbara; Gabory, Anne; Pannetier, Maëlle; Chat, Sophie; Bouet, Stephan; Jouneau, Luc; Jaffrezic, Florence; Laloë, Denis; Klopp, Christophe; Brun, Nicolas; Kress, Clémence; Jammes, Hélène; Charlier, Madia; Devinoy, Eve

2014-01-01

Once daily milking (ODM) induces a reduction in milk production when compared to twice daily milking (TDM). Unilateral ODM of one udder half and TDM of the other half, enables the study of underlying mechanisms independently of inter-individual variability (same genetic background) and of environmental factors. Our results show that in first-calf heifers three CpG, located 10 kb upstream from the CSN1S1 gene were methylated to 33, 34 and 28%, respectively, after TDM but these levels were higher after ODM, 38, 38 and 33%, respectively. These methylation levels were much lower than those observed in the mammary gland during pregnancy (57, 59 and 50%, respectively) or in the liver (74, 78 and 61%, respectively). The methylation level of a fourth CpG (CpG4), located close by (29% during TDM) was not altered after ODM. CpG4 methylation reached 39.7% and 59.5%, during pregnancy or in the liver, respectively. CpG4 is located within a weak STAT5 binding element, arranged in tandem with a second high affinity STAT5 element. STAT5 binding is only marginally modulated by CpG4 methylation, but it may be altered by the methylation levels of the three other CpG nearby. Our results therefore shed light on mechanisms that help to explain how milk production is almost, but not fully, restored when TDM is resumed (15.1 ± 0.2 kg/day instead of 16.2 ± 0.2 kg/day, p<0.01). The STAT5 elements are 100 bp away from a region transcribed in the antisense orientation, in the mammary gland during lactation, but not during pregnancy or in other reproductive organs (ovary or testes). We now need to clarify whether the transcription of this novel RNA is a consequence of STAT5 interacting with the CSN1S1 distal region, or whether it plays a role in the chromatin structure of this region.

Complex relationship between mismatch repair proteins and MBD4 during immunoglobulin class switch recombination.

PubMed

Grigera, Fernando; Bellacosa, Alfonso; Kenter, Amy L

2013-01-01

Mismatch repair (MMR) safeguards against genomic instability and is required for efficient Ig class switch recombination (CSR). Methyl CpG binding domain protein 4 (MBD4) binds to MutL homologue 1 (MLH1) and controls the post-transcriptional level of several MMR proteins, including MutS homologue 2 (MSH2). We show that in WT B cells activated for CSR, MBD4 is induced and interacts with MMR proteins, thereby implying a role for MBD4 in CSR. However, CSR is in the normal range in Mbd4 deficient mice deleted for exons 2-5 despite concomitant reduction of MSH2. We show by comparison in Msh2(+/-) B cells that a two-fold reduction of MSH2 and MBD4 proteins is correlated with impaired CSR. It is therefore surprising that CSR occurs at normal frequencies in the Mbd4 deficient B cells where MSH2 is reduced. We find that a variant Mbd4 transcript spanning exons 1,6-8 is expressed in Mbd4 deficient B cells. This transcript can be ectopically expressed and produces a truncated MBD4 peptide. Thus, the 3' end of the Mbd4 locus is not silent in Mbd4 deficient B cells and may contribute to CSR. Our findings highlight a complex relationship between MBD4 and MMR proteins in B cells and a potential reconsideration of their role in CSR.

Cadmium exposure and the epigenome

PubMed Central

Sanders, Alison P; Smeester, Lisa; Rojas, Daniel; DeBussycher, Tristan; Wu, Michael C; Wright, Fred A; Zhou, Yi-Hui; Laine, Jessica E; Rager, Julia E; Swamy, Geeta K; Ashley-Koch, Allison; Lynn Miranda, Marie; Fry, Rebecca C

2014-01-01

Cadmium (Cd) is prevalent in the environment yet understudied as a developmental toxicant. Cd partially crosses the placental barrier from mother to fetus and is linked to detrimental effects in newborns. Here we examine the relationship between levels of Cd during pregnancy and 5-methylcytosine (5mC) levels in leukocyte DNA collected from 17 mother-newborn pairs. The methylation of cytosines is an epigenetic mechanism known to impact transcriptional signaling and influence health endpoints. A methylated cytosine-guanine (CpG) island recovery assay was used to assess over 4.6 million sites spanning 16,421 CpG islands. Exposure to Cd was classified for each mother-newborn pair according to maternal blood levels and compared with levels of cotinine. Subsets of genes were identified that showed altered DNA methylation levels in their promoter regions in fetal DNA associated with levels of Cd (n = 61), cotinine (n = 366), or both (n = 30). Likewise, in maternal DNA, differentially methylated genes were identified that were associated with Cd (n = 92) or cotinine (n = 134) levels. While the gene sets were largely distinct between maternal and fetal DNA, functional similarities at the biological pathway level were identified including an enrichment of genes that encode for proteins that control transcriptional regulation and apoptosis. Furthermore, conserved DNA motifs with sequence similarity to specific transcription factor binding sites were identified within the CpG islands of the gene sets. This study provides evidence for distinct patterns of DNA methylation or “footprints” in fetal and maternal DNA associated with exposure to Cd. PMID:24169490

Comprehensive analysis of genome-wide DNA methylation across human polycystic ovary syndrome ovary granulosa cell.

PubMed

Xu, Jiawei; Bao, Xiao; Peng, Zhaofeng; Wang, Linlin; Du, Linqing; Niu, Wenbin; Sun, Yingpu

2016-05-10

Polycystic ovary syndrome (PCOS) affects approximately 7% of the reproductive-age women. A growing body of evidence indicated that epigenetic mechanisms contributed to the development of PCOS. The role of DNA modification in human PCOS ovary granulosa cell is still unknown in PCOS progression. Global DNA methylation and hydroxymethylation were detected between PCOS' and controls' granulosa cell. Genome-wide DNA methylation was profiled to investigate the putative function of DNA methylaiton. Selected genes expressions were analyzed between PCOS' and controls' granulosa cell. Our results showed that the granulosa cell global DNA methylation of PCOS patients was significant higher than the controls'. The global DNA hydroxymethylation showed low level and no statistical difference between PCOS and control. 6936 differentially methylated CpG sites were identified between control and PCOS-obesity. 12245 differential methylated CpG sites were detected between control and PCOS-nonobesity group. 5202 methylated CpG sites were significantly differential between PCOS-obesity and PCOS-nonobesity group. Our results showed that DNA methylation not hydroxymethylation altered genome-wide in PCOS granulosa cell. The different methylation genes were enriched in development protein, transcription factor activity, alternative splicing, sequence-specific DNA binding and embryonic morphogenesis. YWHAQ, NCF2, DHRS9 and SCNA were up-regulation in PCOS-obesity patients with no significance different between control and PCOS-nonobesity patients, which may be activated by lower DNA methylaiton. Global and genome-wide DNA methylation alteration may contribute to different genes expression and PCOS clinical pathology.

TLR9-ERK-mTOR signaling is critical for autophagic cell death induced by CpG oligodeoxynucleotide 107 combined with irradiation in glioma cells

PubMed Central

Li, Xiaoli; Cen, Yanyan; Cai, Yongqing; Liu, Tao; Liu, Huan; Cao, Guanqun; Liu, Dan; Li, Bin; Peng, Wei; Zou, Jintao; Pang, Xueli; Zheng, Jiang; Zhou, Hong

2016-01-01

Synthetic oligodeoxynucleotides containing unmethylated CpG dinucleotides (CpG ODN) function as potential radiosensitizers for glioma treatment, although the underlying mechanism is unclear. It was observed that CpG ODN107, when combined with irradiation, did not induce apoptosis. Herein, the effect of CpG ODN107 + irradiation on autophagy and the related signaling pathways was investigated. In vitro, CpG ODN107 + irradiation induced autophagosome formation, increased the ratio of LC3 II/LC3 I, beclin 1 and decreased p62 expression in U87 cells. Meanwhile, CpG ODN107 also increased LC3 II/LC3 I expression in U251 and CHG-5 cells. In vivo, CpG ODN107 combined with local radiotherapy induced autophagosome formation in orthotopic transplantation tumor. Investigation of the molecular mechanisms demonstrated that CpG ODN107 + irradiation increased the levels of TLR9 and p-ERK, and decreased the level of p-mTOR in glioma cells. Further, TLR9-specific siRNA could affect the expressions of p-ERK and autophagy-related proteins in glioma cells. Taken together, CpG ODN107 combined with irradiation could induce autophagic cell death, and this effect was closely related to the TLR9-ERK-mTOR signaling pathway in glioma cells, providing new insights into the investigation mechanism of CpG ODN. PMID:27251306

Functional characterization of the human phosphodiesterase 7A1 promoter.

PubMed Central

Torras-Llort, Mònica; Azorín, Fernando

2003-01-01

In this paper, the human phosphodiesterase 7A1 (h PDE7A1 ) promoter region was identified and functionally characterized. Transient transfection experiments indicated that a 2.9 kb fragment of the h PDE7A1 5'-flanking region, to position -2907, has strong promoter activity in Jurkat T-cells. Deletion analysis showed that the proximal region, up to position -988, contains major cis -regulatory elements of the h PDE7A1 promoter. This minimal promoter region contains a regulatory CpG island which is essential for promoter activity. The CpG island contains three potential cAMP-response-element-binding protein (CREB)-binding sites that, as judged by in vivo dimethyl sulphate (DMS) footprinting, are occupied in Jurkat T-cells. Moreover, over-expression of CREB results in increased promoter activity, but, on the other hand, promoter activity decreases when a dominant-negative form of CREB (KCREB) is over-expressed. In vivo DMS footprinting strongly indicates that other transcription factors, such Ets-2, nuclear factor of activated T-cells 1 (NFAT-1) and nuclear factor kappaB (NF-kappaB), might also contribute to the regulation of h PDE7A1 promoter. Finally, h PDE7A1 promoter was found to be induced by treatment with PMA, but not by treatment with dibutyryl cAMP or forskolin. These results provide insights into the factors and mechanisms that regulate expression of the h PDE7A gene. PMID:12737631

Molecular characterization and transcriptional analysis of the female-enriched chondroitin proteoglycan 2 of Toxocara canis.

PubMed

Ma, G X; Zhou, R Q; Hu, L; Luo, Y L; Luo, Y F; Zhu, H H

2018-03-01

Toxocara canis is an important but neglected zoonotic parasite, and is the causative agent of human toxocariasis. Chondroitin proteoglycans are biological macromolecules, widely distributed in extracellular matrices, with a great diversity of functions in mammals. However, there is limited information regarding chondroitin proteoglycans in nematode parasites. In the present study, a female-enriched chondroitin proteoglycan 2 gene of T. canis (Tc-cpg-2) was cloned and characterized. Quantitative real-time polymerase chain reaction (qRT-PCR) was employed to measure the transcription levels of Tc-cpg-2 among tissues of male and female adult worms. A 485-amino-acid (aa) polypeptide was predicted from a continuous 1458-nuleotide open reading frame and designated as TcCPG2, which contains a 21-aa signal peptide. Conserved domain searching indicated three chitin-binding peritrophin-A (CBM_14) domains in the amino acid sequence of TcCPG2. Multiple alignment with the inferred amino acid sequences of Caenorhabditis elegans and Ascaris suum showed that CBM_14 domains were well conserved among these species. Phylogenetic analysis suggested that TcCPG2 was closely related to the sequence of chondroitin proteoglycan 2 of A. suum. Interestingly, a high level of Tc-cpg-2 was detected in female germline tissues, particularly in the oviduct, suggesting potential roles of this gene in reproduction (e.g. oogenesis and embryogenesis) of adult T. canis. The functional roles of Tc-cpg-2 in reproduction and development in this parasite and related parasitic nematodes warrant further functional studies.

Links between DNA methylation and nucleosome occupancy in the human genome.

PubMed

Collings, Clayton K; Anderson, John N

2017-01-01

DNA methylation is an epigenetic modification that is enriched in heterochromatin but depleted at active promoters and enhancers. However, the debate on whether or not DNA methylation is a reliable indicator of high nucleosome occupancy has not been settled. For example, the methylation levels of DNA flanking CTCF sites are higher in linker DNA than in nucleosomal DNA, while other studies have shown that the nucleosome core is the preferred site of methylation. In this study, we make progress toward understanding these conflicting phenomena by implementing a bioinformatics approach that combines MNase-seq and NOMe-seq data and by comprehensively profiling DNA methylation and nucleosome occupancy throughout the human genome. The results demonstrated that increasing methylated CpG density is correlated with nucleosome occupancy in the total genome and within nearly all subgenomic regions. Features with elevated methylated CpG density such as exons, SINE-Alu sequences, H3K36-trimethylated peaks, and methylated CpG islands are among the highest nucleosome occupied elements in the genome, while some of the lowest occupancies are displayed by unmethylated CpG islands and unmethylated transcription factor binding sites. Additionally, outside of CpG islands, the density of CpGs within nucleosomes was shown to be important for the nucleosomal location of DNA methylation with low CpG frequencies favoring linker methylation and high CpG frequencies favoring core particle methylation. Prominent exceptions to the correlations between methylated CpG density and nucleosome occupancy include CpG islands marked by H3K27me3 and CpG-poor heterochromatin marked by H3K9me3, and these modifications, along with DNA methylation, distinguish the major silencing mechanisms of the human epigenome. Thus, the relationship between DNA methylation and nucleosome occupancy is influenced by the density of methylated CpG dinucleotides and by other epigenomic components in chromatin.

Protection of CpG islands from DNA methylation is DNA-encoded and evolutionarily conserved

PubMed Central

Long, Hannah K.; King, Hamish W.; Patient, Roger K.; Odom, Duncan T.; Klose, Robert J.

2016-01-01

DNA methylation is a repressive epigenetic modification that covers vertebrate genomes. Regions known as CpG islands (CGIs), which are refractory to DNA methylation, are often associated with gene promoters and play central roles in gene regulation. Yet how CGIs in their normal genomic context evade the DNA methylation machinery and whether these mechanisms are evolutionarily conserved remains enigmatic. To address these fundamental questions we exploited a transchromosomic animal model and genomic approaches to understand how the hypomethylated state is formed in vivo and to discover whether mechanisms governing CGI formation are evolutionarily conserved. Strikingly, insertion of a human chromosome into mouse revealed that promoter-associated CGIs are refractory to DNA methylation regardless of host species, demonstrating that DNA sequence plays a central role in specifying the hypomethylated state through evolutionarily conserved mechanisms. In contrast, elements distal to gene promoters exhibited more variable methylation between host species, uncovering a widespread dependence on nucleotide frequency and occupancy of DNA-binding transcription factors in shaping the DNA methylation landscape away from gene promoters. This was exemplified by young CpG rich lineage-restricted repeat sequences that evaded DNA methylation in the absence of co-evolved mechanisms targeting methylation to these sequences, and species specific DNA binding events that protected against DNA methylation in CpG poor regions. Finally, transplantation of mouse chromosomal fragments into the evolutionarily distant zebrafish uncovered the existence of a mechanistically conserved and DNA-encoded logic which shapes CGI formation across vertebrate species. PMID:27084945

Integrating prior knowledge in multiple testing under dependence with applications to detecting differential DNA methylation.

PubMed

Kuan, Pei Fen; Chiang, Derek Y

2012-09-01

DNA methylation has emerged as an important hallmark of epigenetics. Numerous platforms including tiling arrays and next generation sequencing, and experimental protocols are available for profiling DNA methylation. Similar to other tiling array data, DNA methylation data shares the characteristics of inherent correlation structure among nearby probes. However, unlike gene expression or protein DNA binding data, the varying CpG density which gives rise to CpG island, shore and shelf definition provides exogenous information in detecting differential methylation. This article aims to introduce a robust testing and probe ranking procedure based on a nonhomogeneous hidden Markov model that incorporates the above-mentioned features for detecting differential methylation. We revisit the seminal work of Sun and Cai (2009, Journal of the Royal Statistical Society: Series B (Statistical Methodology)71, 393-424) and propose modeling the nonnull using a nonparametric symmetric distribution in two-sided hypothesis testing. We show that this model improves probe ranking and is robust to model misspecification based on extensive simulation studies. We further illustrate that our proposed framework achieves good operating characteristics as compared to commonly used methods in real DNA methylation data that aims to detect differential methylation sites. © 2012, The International Biometric Society.

Complex Relationship between Mismatch Repair Proteins and MBD4 during Immunoglobulin Class Switch Recombination

PubMed Central

Grigera, Fernando; Bellacosa, Alfonso; Kenter, Amy L.

2013-01-01

Mismatch repair (MMR) safeguards against genomic instability and is required for efficient Ig class switch recombination (CSR). Methyl CpG binding domain protein 4 (MBD4) binds to MutL homologue 1 (MLH1) and controls the post-transcriptional level of several MMR proteins, including MutS homologue 2 (MSH2). We show that in WT B cells activated for CSR, MBD4 is induced and interacts with MMR proteins, thereby implying a role for MBD4 in CSR. However, CSR is in the normal range in Mbd4 deficient mice deleted for exons 2–5 despite concomitant reduction of MSH2. We show by comparison in Msh2+/− B cells that a two-fold reduction of MSH2 and MBD4 proteins is correlated with impaired CSR. It is therefore surprising that CSR occurs at normal frequencies in the Mbd4 deficient B cells where MSH2 is reduced. We find that a variant Mbd4 transcript spanning exons 1,6–8 is expressed in Mbd4 deficient B cells. This transcript can be ectopically expressed and produces a truncated MBD4 peptide. Thus, the 3′ end of the Mbd4 locus is not silent in Mbd4 deficient B cells and may contribute to CSR. Our findings highlight a complex relationship between MBD4 and MMR proteins in B cells and a potential reconsideration of their role in CSR. PMID:24205214

DOE Office of Scientific and Technical Information (OSTI.GOV)

Palsamy, Periyasamy; Ayaki, Masahiko; Elanchezhian, Rajan

Highlights: Black-Right-Pointing-Pointer We found significant Keap1 promoter demethylation in diabetic cataractous lenses. Black-Right-Pointing-Pointer Demethylation of Keap1 gene upregulated the expression of Keap1 mRNA and protein. Black-Right-Pointing-Pointer Elevated levels of Keap1 are known to decrease the levels of Nrf2. Black-Right-Pointing-Pointer Thereby, the levels of antioxidant enzymes are suppressed by decreased Nrf2 level. -- Abstract: Age-related cataracts (ARCs) are the major cause of visual impairments worldwide, and diabetic adults tend to have an earlier onset of ARCs. Although age is the strongest risk factor for cataracts, little is known how age plays a role in the development of ARCs. It is knownmore » that oxidative stress in the lens increases with age and more so in the lenses of diabetics. One of the central adaptive responses against the oxidative stresses is the activation of the nuclear transcriptional factor, NF-E2-related factor 2 (Nrf2), which then activates more than 20 different antioxidative enzymes. Kelch-like ECH associated protein 1 (Keap1) targets and binds to Nrf2 for proteosomal degradation. We hypothesized that hyperglycemia will lead to a dysfunction of the Nrf2-dependent antioxidative protection in the lens of diabetics. We studied the methylation status of the CpG islands in 15 clear and 21 diabetic cataractous lenses. Our results showed significant levels of demethylated DNA in the Keap1 promoter in the cataractous lenses from diabetic patients. In contrast, highly methylated DNA was found in the clear lens and tumorized human lens epithelial cell (HLEC) lines (SRA01/04). HLECs treated with a demethylation agent, 5-aza-2 Prime deoxycytidine (5-Aza), had a 10-fold higher levels of Keap1 mRNA, 3-fold increased levels of Keap1 protein, produced higher levels of ROS, and increased cell death. Our results indicated that demethylation of the CpG islands in the Keap1 promoter will activate the expression of Keap1 protein, which then increases the targeting of Nrf2 for proteosomal degradation. Decreased Nrf2 activity represses the transcription of many antioxidant enzyme genes and alters the redox-balance towards lens oxidation. Thus, the failure of antioxidant protection due to demethylation of the CpG islands in the Keap1 promoter is linked to the diabetic cataracts and possibly ARCs.« less

The effects of cytosine methylation on general transcription factors

NASA Astrophysics Data System (ADS)

Jin, Jianshi; Lian, Tengfei; Gu, Chan; Yu, Kai; Gao, Yi Qin; Su, Xiao-Dong

2016-07-01

DNA methylation on CpG sites is the most common epigenetic modification. Recently, methylation in a non-CpG context was found to occur widely on genomic DNA. Moreover, methylation of non-CpG sites is a highly controlled process, and its level may vary during cellular development. To study non-CpG methylation effects on DNA/protein interactions, we have chosen three human transcription factors (TFs): glucocorticoid receptor (GR), brain and muscle ARNT-like 1 (BMAL1) - circadian locomotor output cycles kaput (CLOCK) and estrogen receptor (ER) with methylated or unmethylated DNA binding sequences, using single-molecule and isothermal titration calorimetry assays. The results demonstrated that these TFs interact with methylated DNA with different effects compared with their cognate DNA sequences. The effects of non-CpG methylation on transcriptional regulation were validated by cell-based luciferase assay at protein level. The mechanisms of non-CpG methylation influencing DNA-protein interactions were investigated by crystallographic analyses and molecular dynamics simulation. With BisChIP-seq assays in HEK-293T cells, we found that GR can recognize highly methylated sites within chromatin in cells. Therefore, we conclude that non-CpG methylation of DNA can provide a mechanism for regulating gene expression through directly affecting the binding of TFs.

Cooperative DNA binding and protein/DNA fiber formation increases the activity of the Dnmt3a DNA methyltransferase.

PubMed

Emperle, Max; Rajavelu, Arumugam; Reinhardt, Richard; Jurkowska, Renata Z; Jeltsch, Albert

2014-10-24

The Dnmt3a DNA methyltransferase has been shown to bind cooperatively to DNA and to form large multimeric protein/DNA fibers. However, it has also been reported to methylate DNA in a processive manner, a property that is incompatible with protein/DNA fiber formation. We show here that the DNA methylation rate of Dnmt3a increases more than linearly with increasing enzyme concentration on a long DNA substrate, but not on a short 30-mer oligonucleotide substrate. We also show that addition of a catalytically inactive Dnmt3a mutant, which carries an amino acid exchange in the catalytic center, increases the DNA methylation rate by wild type Dnmt3a on the long substrate but not on the short one. In agreement with this finding, preincubation experiments indicate that stable protein/DNA fibers are formed on the long, but not on the short substrate. In addition, methylation experiments with substrates containing one or two CpG sites did not provide evidence for a processive mechanism over a wide range of enzyme concentrations. These data clearly indicate that Dnmt3a binds to DNA in a cooperative reaction and that the formation of stable protein/DNA fibers increases the DNA methylation rate. Fiber formation occurs at low μm concentrations of Dnmt3a, which are in the range of Dnmt3a concentrations in the nucleus of embryonic stem cells. Understanding the mechanism of Dnmt3a is of vital importance because Dnmt3a is a hotspot of somatic cancer mutations one of which has been implicated in changing Dnmt3a processivity. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

Potential role of DNA methylation as a facilitator of target search processes for transcription factors through interplay with methyl-CpG-binding proteins

PubMed Central

Kemme, Catherine A.; Marquez, Rolando; Luu, Ross H.

2017-01-01

Abstract Eukaryotic genomes contain numerous non-functional high-affinity sequences for transcription factors. These sequences potentially serve as natural decoys that sequester transcription factors. We have previously shown that the presence of sequences similar to the target sequence could substantially impede association of the transcription factor Egr-1 with its targets. In this study, using a stopped-flow fluorescence method, we examined the kinetic impact of DNA methylation of decoys on the search process of the Egr-1 zinc-finger protein. We analyzed its association with an unmethylated target site on fluorescence-labeled DNA in the presence of competitor DNA duplexes, including Egr-1 decoys. DNA methylation of decoys alone did not affect target search kinetics. In the presence of the MeCP2 methyl-CpG-binding domain (MBD), however, DNA methylation of decoys substantially (∼10-30-fold) accelerated the target search process of the Egr-1 zinc-finger protein. This acceleration did not occur when the target was also methylated. These results suggest that when decoys are methylated, MBD proteins can block them and thereby allow Egr-1 to avoid sequestration in non-functional locations. This effect may occur in vivo for DNA methylation outside CpG islands (CGIs) and could facilitate localization of some transcription factors within regulatory CGIs, where DNA methylation is rare. PMID:28486614

Mucosal adjuvanticity of fibronectin-binding peptide (FBP) fused with Echinococcus multilocularis tetraspanin 3: systemic and local antibody responses.

PubMed

Dang, Zhisheng; Feng, Jinchao; Yagi, Kinpei; Sugimoto, Chihiro; Li, Wei; Oku, Yuzaburo

2012-01-01

Studies have shown that a bacterial fibronectin attachment protein (FAP) is able to stimulate strong systemic and mucosal antibody responses when it is used alone or co-administrated with other antigens (Ags). Thus, it has been suggested to be a promising adjuvant candidate for the development of efficient vaccines. However, the co-administered Ags and FAP were cloned, expressed and purified individually to date. In a recent study, we first evaluated the adjuvanticity of a fibronectin-binding peptide (FBP, 24 amino acids) of Mycobacterium avium FAP fused with Echinococcus multilocularis tetraspanin 3 (Em-TSP3) by detecting systemic and local antibody responses in intranasally (i.n.) immunized BALB/c mice. Em-TSP3 and FBP fragments were linked with a GSGGSG linker and expressed as a single fusion protein (Em-TSP3-FBP) using the pBAD/Thio-TOPO expression vector. BALB/c mice were immunized i.n. with recombinant Em-TSP3-FBP (rEm-TSP3-FBP) and rEm-TSP3+CpG and the systemic and local antibody responses were detected by ELISA. The results showed that both rEm-TSP3-FBP and rEm-TSP3+CpG evoked strong serum IgG (p<0.001) and IgG1 responses (p<0.001), whereas only the latter induced a high level IgG2α production (p<0.001), compared to that of rEm-TSP3 alone without any adjuvant. There were no significant differences in IgG and IgG1 production between the groups. Low level of serum IgA and IgM were detected in both groups. The tendency of Th1 and Th2 cell immune responses were assessed via detecting the IgG1/IgG2α ratio after the second and third immunizations. The results indicated that i.n. immunization with rEm-TSP3-FBP resulted in an increased IgG1/IgG2α ratio (a Th2 tendency), while rEm-TSP3+CpG caused a rapid Th1 response that later shifted to a Th2 response. Immunization with rEm-TSP3-FBP provoked significantly stronger IgA antibody responses in intestine (p<0.05), lung (p<0.001) and spleen (p<0.001) compared to those by rEm-TSP3+CpG. Significantly high level IgA antibodies were detected in nasal cavity (p<0.05) and liver (p<0.05) samples from both groups when compared to rEm-TSP3 alone without any adjuvant, with no significant difference between them. I.n. administration of rEm-TSP3-FBP can induce strong systemic and mucosal antibody responses in immunized BALB/c mice, suggesting that fusion of Em-TSP3 with FBP is a novel, prospective strategy for developing safe and efficient human mucosal vaccines against alveolar echinococcosis (AE).

Protection of CpG islands from DNA methylation is DNA-encoded and evolutionarily conserved.

PubMed

Long, Hannah K; King, Hamish W; Patient, Roger K; Odom, Duncan T; Klose, Robert J

2016-08-19

DNA methylation is a repressive epigenetic modification that covers vertebrate genomes. Regions known as CpG islands (CGIs), which are refractory to DNA methylation, are often associated with gene promoters and play central roles in gene regulation. Yet how CGIs in their normal genomic context evade the DNA methylation machinery and whether these mechanisms are evolutionarily conserved remains enigmatic. To address these fundamental questions we exploited a transchromosomic animal model and genomic approaches to understand how the hypomethylated state is formed in vivo and to discover whether mechanisms governing CGI formation are evolutionarily conserved. Strikingly, insertion of a human chromosome into mouse revealed that promoter-associated CGIs are refractory to DNA methylation regardless of host species, demonstrating that DNA sequence plays a central role in specifying the hypomethylated state through evolutionarily conserved mechanisms. In contrast, elements distal to gene promoters exhibited more variable methylation between host species, uncovering a widespread dependence on nucleotide frequency and occupancy of DNA-binding transcription factors in shaping the DNA methylation landscape away from gene promoters. This was exemplified by young CpG rich lineage-restricted repeat sequences that evaded DNA methylation in the absence of co-evolved mechanisms targeting methylation to these sequences, and species specific DNA binding events that protected against DNA methylation in CpG poor regions. Finally, transplantation of mouse chromosomal fragments into the evolutionarily distant zebrafish uncovered the existence of a mechanistically conserved and DNA-encoded logic which shapes CGI formation across vertebrate species. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

A distinct group of CpG islands shows differential DNA methylation between replicas of the same cell line in vitro

PubMed Central

2013-01-01

Background CpG dinucleotide-rich genomic DNA regions, known as CpG islands (CGIs), can be methylated at their cytosine residues as an epigenetic mark that is stably inherited during cell mitosis. Differentially methylated regions (DMRs) are genomic regions showing different degrees of DNA methylation in multiple samples. In this study, we focused our attention on CGIs showing different DNA methylation between two culture replicas of the same cell line. Results We used methylation data of 35 cell lines from the Encyclopedia of DNA Elements (ENCODE) consortium to identify CpG islands that were differentially methylated between replicas of the same cell line and denoted them Inter Replicas Differentially Methylated CpG islands (IRDM-CGIs). We identified a group of IRDM-CGIs that was consistently shared by different cell lines, and denoted it common IRDM-CGIs. X chromosome CGIs were overrepresented among common IRDM-CGIs. Autosomal IRDM-CGIs were preferentially located in gene bodies and intergenic regions had a lower G + C content, a smaller mean length, and a reduced CpG percentage. Functional analysis of the genes associated with autosomal IRDM-CGIs showed that many of them are involved in DNA binding and development. Conclusions Our results show that several specific functional and structural features characterize common IRDM-CGIs. They may represent a specific subset of CGIs that are more prone to being differentially methylated for their intrinsic characteristics. PMID:24106769

Differentiation and injury-repair signals modulate the interaction of E2F and pRB proteins with novel target genes in keratinocytes.

PubMed

Chang, Wing Y; Andrews, Joseph; Carter, David E; Dagnino, Lina

2006-08-01

E2F transcription factors are central to epidermal morphogenesis and regeneration after injury. The precise nature of E2F target genes involved in epidermal formation and repair has yet to be determined. Identification of these genes is essential to understand how E2F proteins regulate fundamental aspects of epidermal homeostasis and transformation. We have conducted a genome-wide screen using CpG island microarray analysis to identify novel promoters bound by E2F3 and E2F5 in human keratinocytes. We further characterized several of these genes, and determined that multiple E2F and retinoblastoma (pRb) family proteins associate with them in exponentially proliferating cells. We also assessed the effect on E2F and pRb binding to those genes in response to differentiation induced by bone morphogenetic protein-6 (BMP-6), or to activation of repair mechanisms induced by transforming growth factor-beta (TGF-beta). These studies demonstrate promoter- and cytokine-specific changes in binding profiles of E2F and/or pRb family proteins. For example, E2F1, 3, 4 and p107 were recruited to the N-myc promoter in cells treated with BMP-6, whereas E2F1, 3, 4, 5, p107 and p130 were bound to this promoter in the presence of TGF-beta. Functionally, these different interactions resulted in transcriptional repression by BMP-6 and TGF-beta of the N-myc gene, via mechanisms that involved E2F binding to the promoter and association with pRb-family proteins. Thus, multiple combinations of E2F and pRb family proteins may associate with and transcriptionally regulate a given target promoter in response to differentiation and injury-repair stimuli in epidermal keratinocytes.

Silencing of GSTP1 gene by CpG island DNA hypermethylation in HBV-associated hepatocellular carcinomas.

PubMed

Zhong, Sheng; Tang, Mandy W; Yeo, Winnie; Liu, Cuiling; Lo, Y M Dennis; Johnson, Philip J

2002-04-01

Glutathione S-transferases, enzymes that defend cells against damage mediated by oxidant and electrophilic carcinogens, may be critical determinants of cancer pathogenesis. In this report, we assess the role of epigenetic silencing of the GSTP1 gene, a gene encoding the pi-class glutathione S-transferase, in the pathogenesis of hepatitis B virus (HBV)-associated hepatocellular carcinomas (HCC). The cell lines Hep3B, HepG2, and a cohort of 43 HBV-associated HCC tissue specimens and corresponding nontumor tissues were subjected to analysis for GSTP1 epigenetic alteration and expression. GSTP1 "CpG" island DNA hypermethylation in the liver cell lines, and the tissue specimens were determined by methylation-specific PCR and correlated with expression of the gene using reverse-transcription PCR, immunoblotting, and immunohistochemistry. GSTP1 CpG island DNA hypermethylation was detected in 28 of 43 (65.1%) HCC tissues and 4 of 40 (10%) corresponding nontumor tissues. GSTP1 protein was absent in those cases showing hypermethylation of the gene. Similarly, DNA from Hep3B and HepG2 cell lines displayed complete GSTP1 hypermethylation in the CpG island, and they failed to express GSTP1 mRNA and the corresponding protein product. Treatment of the cell lines with the DNA methyltransferase inhibitor 5-aza-deoxycytidine reversed the hypermethylation, and restored GSTP1 mRNA and polypeptide expression. These data indicate that epigenetic silencing of GSTP1 gene expression by CpG island DNA hypermethylation is common in human HBV-associated HCC. In addition, somatic GSTP1 inactivation via CpG island hypermethylation may contribute to the pathogenesis of this malignancy.

Potential interaction between the GARS-AIRS-GART Gene and CP2/LBP-1c/LSF transcription factor in Down syndrome-related Alzheimer disease.

PubMed

Banerjee, Disha; Nandagopal, Krishnadas

2007-12-01

(1) GARS-AIRS-GART is an important candidate gene in studies of Down syndrome (DS)-related Alzheimer's disease (AD), due to its chromosomal localization (21q22.1) in the Down syndrome critical region, involvement in de novo purine biosynthesis, and over-expression in DS brain. The aim of this study was to identify factor(s) likely to enhance transcription of GARS-AIRS-GART in DS-related AD. (2) Based on a bio-informatics approach, the PromoterInspector, Promoter Scan II, and EBI toolbox CpG plot software programs were used to identify GARS-AIRS-GART sequences important for gene transcription. Transcription factor binding motifs within these regions were mapped with the help of the MatInspector and TFSEARCH programs. Factors implicated in neurodevelopment or neurodegeneration were the focus of attention, and mining of human (T1Dbase) and murine (GNF) expression databases revealed information on the regional distribution of these factors and their relative abundance vis-a-vis GARS-AIRS-GART. (3) The Leader-binding protein 1-c (LBP-1c/CP2/LSF) emerged as a promising candidate from these studies, as MatInspector and TFSEARCH analyses revealed a total of four CP2 binding sites with potential for functional interaction(s) within the promoter and CpG islands of GARS-AIRS-GART. Furthermore, two of these sites harbor sequences for methylation-sensitive restriction enzymes, which suggest that methylation status may, in part, regulate CP2-mediated transcription of GARS-AIRS-GART. A search of T1Dbase and GNF expression databases reveals co-expression of CP2 and GARS-AIRS-GART in brain regions relevant to DS-related AD. (4) The virtual screen identified CP2/LBP-1c/LSF as a factor that likely mediates enhanced transcription of GARS-AIRS-GART in DS-related AD.

Epigenome-wide association study of metabolic syndrome in African-American adults.

PubMed

Akinyemiju, Tomi; Do, Anh N; Patki, Amit; Aslibekyan, Stella; Zhi, Degui; Hidalgo, Bertha; Tiwari, Hemant K; Absher, Devin; Geng, Xin; Arnett, Donna K; Irvin, Marguerite R

2018-01-01

The high prevalence of obesity among US adults has resulted in significant increases in associated metabolic disorders such as diabetes, dyslipidemia, and high blood pressure. Together, these disorders constitute metabolic syndrome, a clinically defined condition highly prevalent among African-Americans. Identifying epigenetic alterations associated with metabolic syndrome may provide additional information regarding etiology beyond current evidence from genome-wide association studies. Data on metabolic syndrome and DNA methylation was assessed on 614 African-Americans from the Hypertension Genetic Epidemiology Network (HyperGEN) study. Metabolic syndrome was defined using the joint harmonized criteria, and DNA methylation was assessed using the Illumina HumanMethylation450K Bead Chip assay on DNA extracted from buffy coat. Linear mixed effects regression models were used to examine the association between CpG methylation at > 450,000 CpG sites and metabolic syndrome adjusted for study covariates. Replication using DNA from a separate sample of 69 African-Americans, as well as meta-analysis combining both cohorts, was conducted. Two differentially methylated CpG sites in the IGF2BP1 gene on chromosome 17 (cg06638433; p value = 3.10 × 10 - 7 ) and the ABCG1 gene on chromosome 21 (cg06500161; p value = 2.60 × 10 - 8 ) were identified. Results for the ABCG1 gene remained statistically significant in the replication dataset and meta-analysis. Metabolic syndrome was consistently associated with increased methylation in the ABCG1 gene in the discovery and replication datasets, a gene that encodes a protein in the ATP-binding cassette transporter family and is involved in intra- and extra-cellular signaling and lipid transport.

Levels of DNA Methylation Vary at CpG Sites across the BRCA1 Promoter, and Differ According to Triple Negative and "BRCA-Like" Status, in Both Blood and Tumour DNA.

PubMed

Daniels, Sarah L; Burghel, George J; Chambers, Philip; Al-Baba, Shadi; Connley, Daniel D; Brock, Ian W; Cramp, Helen E; Dotsenko, Olena; Wilks, Octavia; Wyld, Lynda; Cross, Simon S; Cox, Angela

2016-01-01

Triple negative breast cancer is typically an aggressive and difficult to treat subtype. It is often associated with loss of function of the BRCA1 gene, either through mutation, loss of heterozygosity or methylation. This study aimed to measure methylation of the BRCA1 gene promoter at individual CpG sites in blood, tumour and normal breast tissue, to assess whether levels were correlated between different tissues, and with triple negative receptor status, histopathological scoring for BRCA-like features and BRCA1 protein expression. Blood DNA methylation levels were significantly correlated with tumour methylation at 9 of 11 CpG sites examined (p<0.0007). The levels of tumour DNA methylation were significantly higher in triple negative tumours, and in tumours with high BRCA-like histopathological scores (10 of 11 CpG sites; p<0.01 and p<0.007 respectively). Similar results were observed in blood DNA (6 of 11 CpG sites; p<0.03 and 7 of 11 CpG sites; p<0.02 respectively). This study provides insight into the pattern of CpG methylation across the BRCA1 promoter, and supports previous studies suggesting that tumours with BRCA1 promoter methylation have similar features to those with BRCA1 mutations, and therefore may be suitable for the same targeted therapies.

Potential role of DNA methylation as a facilitator of target search processes for transcription factors through interplay with methyl-CpG-binding proteins.

PubMed

Kemme, Catherine A; Marquez, Rolando; Luu, Ross H; Iwahara, Junji

2017-07-27

Eukaryotic genomes contain numerous non-functional high-affinity sequences for transcription factors. These sequences potentially serve as natural decoys that sequester transcription factors. We have previously shown that the presence of sequences similar to the target sequence could substantially impede association of the transcription factor Egr-1 with its targets. In this study, using a stopped-flow fluorescence method, we examined the kinetic impact of DNA methylation of decoys on the search process of the Egr-1 zinc-finger protein. We analyzed its association with an unmethylated target site on fluorescence-labeled DNA in the presence of competitor DNA duplexes, including Egr-1 decoys. DNA methylation of decoys alone did not affect target search kinetics. In the presence of the MeCP2 methyl-CpG-binding domain (MBD), however, DNA methylation of decoys substantially (∼10-30-fold) accelerated the target search process of the Egr-1 zinc-finger protein. This acceleration did not occur when the target was also methylated. These results suggest that when decoys are methylated, MBD proteins can block them and thereby allow Egr-1 to avoid sequestration in non-functional locations. This effect may occur in vivo for DNA methylation outside CpG islands (CGIs) and could facilitate localization of some transcription factors within regulatory CGIs, where DNA methylation is rare. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

TAIL1: an isthmin-like gene, containing type 1 thrombospondin-repeat and AMOP domain, mapped to ARVD1 critical region.

PubMed

Rossi, Valeria; Beffagna, Giorgia; Rampazzo, Alessandra; Bauce, Barbara; Danieli, Gian Antonio

2004-06-23

Isthmins represent a novel family of vertebrate secreted proteins containing one copy of the thrombospondin type 1 repeat (TSR), which in mammals is shared by several proteins with diverse biological functions, including cell adhesion, angiogenesis, and patterning of developing nervous system. We have determined the genomic organization of human TAIL1 (thrombospondin and AMOP containing isthmin-like 1), a novel isthmin-like gene encoding a protein that contains a TSR and a C-terminal AMOP domain (adhesion-associated domain in MUC4 and other proteins), characteristic of extracellular proteins involved in adhesion processes. TAIL1 gene encompasses more than 24.4 kb. Analysis of the DNA sequence surrounding the putative transcriptional start region revealed a TATA-less promoter located in a CpG island. Several consensus binding sites for the transcription factors Sp1 and MZF-1 were identified in this promoter region. In humans, TAIL1 gene is located on chromosome 14q24.3 within ARVD1 (arrhythmogenic right ventricular dysplasia/cardiomyopathy, type 1) critical region; preliminary evidence suggests that it is expressed in several tissues, showing multiple alternative splicing.

Co-Localization of the Oncogenic Transcription Factor MYCN and the DNA Methyl Binding Protein MeCP2 at Genomic Sites in Neuroblastoma

PubMed Central

Murphy, Derek M.; Buckley, Patrick G.; Das, Sudipto; Watters, Karen M.; Bryan, Kenneth; Stallings, Raymond L.

2011-01-01

Background MYCN is a transcription factor that is expressed during the development of the neural crest and its dysregulation plays a major role in the pathogenesis of pediatric cancers such as neuroblastoma, medulloblastoma and rhabdomyosarcoma. MeCP2 is a CpG methyl binding protein which has been associated with a number of cancers and developmental disorders, particularly Rett syndrome. Methods and Findings Using an integrative global genomics approach involving chromatin immunoprecipitation applied to microarrays, we have determined that MYCN and MeCP2 co-localize to gene promoter regions, as well as inter/intragenic sites, within the neuroblastoma genome (MYCN amplified Kelly cells) at high frequency (70.2% of MYCN sites were also positive for MeCP2). Intriguingly, the frequency of co-localization was significantly less at promoter regions exhibiting substantial hypermethylation (8.7%), as determined by methylated DNA immunoprecipitation (MeDIP) applied to the same microarrays. Co-immunoprecipitation of MYCN using an anti-MeCP2 antibody indicated that a MYCN/MeCP2 interaction occurs at protein level. mRNA expression profiling revealed that the median expression of genes with promoters bound by MYCN was significantly higher than for genes bound by MeCP2, and that genes bound by both proteins had intermediate expression. Pathway analysis was carried out for genes bound by MYCN, MeCP2 or MYCN/MeCP2, revealing higher order functions. Conclusions Our results indicate that MYCN and MeCP2 protein interact and co-localize to similar genomic sites at very high frequency, and that the patterns of binding of these proteins can be associated with significant differences in transcriptional activity. Although it is not yet known if this interaction contributes to neuroblastoma disease pathogenesis, it is intriguing that the interaction occurs at the promoter regions of several genes important for the development of neuroblastoma, including ALK, AURKA and BDNF. PMID:21731748

Co-localization of the oncogenic transcription factor MYCN and the DNA methyl binding protein MeCP2 at genomic sites in neuroblastoma.

PubMed

Murphy, Derek M; Buckley, Patrick G; Das, Sudipto; Watters, Karen M; Bryan, Kenneth; Stallings, Raymond L

2011-01-01

MYCN is a transcription factor that is expressed during the development of the neural crest and its dysregulation plays a major role in the pathogenesis of pediatric cancers such as neuroblastoma, medulloblastoma and rhabdomyosarcoma. MeCP2 is a CpG methyl binding protein which has been associated with a number of cancers and developmental disorders, particularly Rett syndrome. Using an integrative global genomics approach involving chromatin immunoprecipitation applied to microarrays, we have determined that MYCN and MeCP2 co-localize to gene promoter regions, as well as inter/intragenic sites, within the neuroblastoma genome (MYCN amplified Kelly cells) at high frequency (70.2% of MYCN sites were also positive for MeCP2). Intriguingly, the frequency of co-localization was significantly less at promoter regions exhibiting substantial hypermethylation (8.7%), as determined by methylated DNA immunoprecipitation (MeDIP) applied to the same microarrays. Co-immunoprecipitation of MYCN using an anti-MeCP2 antibody indicated that a MYCN/MeCP2 interaction occurs at protein level. mRNA expression profiling revealed that the median expression of genes with promoters bound by MYCN was significantly higher than for genes bound by MeCP2, and that genes bound by both proteins had intermediate expression. Pathway analysis was carried out for genes bound by MYCN, MeCP2 or MYCN/MeCP2, revealing higher order functions. Our results indicate that MYCN and MeCP2 protein interact and co-localize to similar genomic sites at very high frequency, and that the patterns of binding of these proteins can be associated with significant differences in transcriptional activity. Although it is not yet known if this interaction contributes to neuroblastoma disease pathogenesis, it is intriguing that the interaction occurs at the promoter regions of several genes important for the development of neuroblastoma, including ALK, AURKA and BDNF.

ABCB1 regulation through LRPPRC is influenced by the methylation status of the GC -100 box in its promoter

PubMed Central

Corrêa, Stephany; Binato, Renata; Du Rocher, Bárbara; Ferreira, Gerson; Cappelletti, Paola; Soares-Lima, Sheila; Pinto, Luis Felipe; Mencalha, André; Abdelhay, Eliana

2014-01-01

One of the potential mechanisms of imatinib mesylate (IM) resistance in chronic myeloid leukemia (CML) is increased level of P-glycoprotein (Pgp). Pgp is an efflux pump capable of activating the multidrug resistance (MDR) phenotype. The gene encoding Pgp (ABCB1) has several binding sites in its promoter region, along with CpG islands and GC boxes, involved in its epigenetic control. In previous work, we performed a proteomic study to identify proteins involved in IM cross-resistance in acute leukemia. Among these proteins, we identified LRPPRC as a potential regulator of ABCB1 transcription via an invMED1 binding site in ABCB1. Interestingly, this invMED1 binding site overlaps with the GC -100 box. In this work, we investigated the potential role of LRPPRC in the regulation of ABCB1 transcriptional activity in CML resistance. In addition, we evaluated the potential connection between this regulation and the methylation status of the ABCB1 promoter in its GC -100 box. Our results show that LRPPRC binds prominently to the ABCB1 promoter in Lucena cells, an IM-resistant cell line. Luciferase assays showed that ABCB1 transcription is positively regulated by LRPPRC upon its knockdown. Pyrosequencing analysis showed that the ABCB1 promoter is differentially methylated at its GC -100 box in K562 cells compared with Lucena cells, and in CML patients with different response to IM. Chromatin immunoprecipitation and Pgp expression after DNA demethylation treatment showed that LRPPRC binding is affected by the methylation status of ABCB1 GC -100 box. Taken together, our findings indicate that LRPPRC is a transcription factor related to ABCB1 expression and highlight the importance of epigenetic regulation in CML resistance. PMID:25089713

ABCB1 regulation through LRPPRC is influenced by the methylation status of the GC -100 box in its promoter.

PubMed

Corrêa, Stephany; Binato, Renata; Du Rocher, Bárbara; Ferreira, Gerson; Cappelletti, Paola; Soares-Lima, Sheila; Pinto, Luis Felipe; Mencalha, André; Abdelhay, Eliana

2014-08-01

One of the potential mechanisms of imatinib mesylate (IM) resistance in chronic myeloid leukemia (CML) is increased level of P-glycoprotein (Pgp). Pgp is an efflux pump capable of activating the multidrug resistance (MDR) phenotype. The gene encoding Pgp (ABCB1) has several binding sites in its promoter region, along with CpG islands and GC boxes, involved in its epigenetic control. In previous work, we performed a proteomic study to identify proteins involved in IM cross-resistance in acute leukemia. Among these proteins, we identified LRPPRC as a potential regulator of ABCB1 transcription via an invMED1 binding site in ABCB1. Interestingly, this invMED1 binding site overlaps with the GC -100 box. In this work, we investigated the potential role of LRPPRC in the regulation of ABCB1 transcriptional activity in CML resistance. In addition, we evaluated the potential connection between this regulation and the methylation status of the ABCB1 promoter in its GC -100 box. Our results show that LRPPRC binds prominently to the ABCB1 promoter in Lucena cells, an IM-resistant cell line. Luciferase assays showed that ABCB1 transcription is positively regulated by LRPPRC upon its knockdown. Pyrosequencing analysis showed that the ABCB1 promoter is differentially methylated at its GC -100 box in K562 cells compared with Lucena cells, and in CML patients with different response to IM. Chromatin immunoprecipitation and Pgp expression after DNA demethylation treatment showed that LRPPRC binding is affected by the methylation status of ABCB1 GC -100 box. Taken together, our findings indicate that LRPPRC is a transcription factor related to ABCB1 expression and highlight the importance of epigenetic regulation in CML resistance.

Tissue expression analysis, cloning and characterization of the 5'-regulatory region of the bovine FABP3 gene.

PubMed

Li, Anning; Wu, Lijuan; Wang, Xiaoyu; Xin, Yaping; Zan, Linsen

2016-09-01

Fatty acid binding protein 3 (FABP3) is a member of the FABP family which bind fatty acids and have an important role in fatty acid metabolism. A large number of studies have shown that the genetic polymorphisms of FABP3 are positively correlated with intramuscular fat (IMF) content in domestic animals, however, the function and transcriptional characteristics of FABP3 in cattle remain unclear. Real-time PCR analysis revealed that bovine FABP3 was highly expressed in cardiac tissue. The 5'-regulatory region of bovine FABP3 was cloned and its transcription initiation sites were identified. Sequence analysis showed that many transcriptional factor binding sites including TATA-box and CCAAT-box were present on the 5'-flanking region of bovine FABP3, and four CpG islands were found on nucleotides from -891 to +118. Seven serial deletion constructs of the 5'-regulatory region evaluated in dual-luciferase reporter assay indicated that its core promoter was 384 base pairs upstream from the transcription initiation site. The transcriptional factor binding sites RXRα, KLF15, CREB and Sp1 were conserved in the core promoter of cattle, sheep, pigs and dogs. These results provide further understanding of the function and regulation mechanism of bovine FABP3.

Eicosapentaenoic acid induces DNA demethylation in carcinoma cells through a TET1-dependent mechanism.

PubMed

Ceccarelli, Veronica; Valentini, Virginia; Ronchetti, Simona; Cannarile, Lorenza; Billi, Monia; Riccardi, Carlo; Ottini, Laura; Talesa, Vincenzo Nicola; Grignani, Francesco; Vecchini, Alba

2018-05-14

In cancer cells, global genomic hypomethylation is found together with localized hypermethylation of CpG islands within the promoters and regulatory regions of silenced tumor suppressor genes. Demethylating agents may reverse hypermethylation, thus promoting gene re-expression. Unfortunately, demethylating strategies are not efficient in solid tumor cells. DNA demethylation is mediated by ten-eleven translocation enzymes (TETs). They sequentially convert 5-methylcytosine (5mC) to 5-hydroxymethylcytosine (5hmC), which is associated with active transcription; 5-formylcytosine; and finally, 5-carboxylcytosine. Although α-linolenic acid, eicosapentaenoic acid (EPA), and docosahexaenoic acid, the major n-3 polyunsaturated fatty acids, have anti-cancer effects, their action, as DNA-demethylating agents, has never been investigated in solid tumor cells. Here, we report that EPA demethylates DNA in hepatocarcinoma cells. EPA rapidly increases 5hmC on DNA, inducing p21 Waf1/Cip1 gene expression, which slows cancer cell-cycle progression. We show that the underlying molecular mechanism involves TET1. EPA simultaneously binds peroxisome proliferator-activated receptor γ (PPARγ) and retinoid X receptor α (RXRα), thus promoting their heterodimer and inducing a PPARγ-TET1 interaction. They generate a TET1-PPARγ-RXRα protein complex, which binds to a hypermethylated CpG island on the p21 gene, where TET1 converts 5mC to 5hmC. In an apparent shuttling motion, PPARγ and RXRα leave the DNA, whereas TET1 associates stably. Overall, EPA directly regulates DNA methylation levels, permitting TET1 to exert its anti-tumoral function.-Ceccarelli, V., Valentini, V., Ronchetti, S., Cannarile, L., Billi, M., Riccardi, C., Ottini, L., Talesa, V. N., Grignani, F., Vecchini, A., Eicosapentaenoic acid induces DNA demethylation in carcinoma cells through a TET1-dependent mechanism.

Nuclear translocation of Acinetobacter baumannii transposase induces DNA methylation of CpG regions in the promoters of E-cadherin gene.

PubMed

Moon, Dong Chan; Choi, Chul Hee; Lee, Su Man; Lee, Jung Hwa; Kim, Seung Il; Kim, Dong Sun; Lee, Je Chul

2012-01-01

Nuclear targeting of bacterial proteins has emerged as a pathogenic mechanism whereby bacterial proteins induce host cell pathology. In this study, we examined nuclear targeting of Acinetobacter baumannii transposase (Tnp) and subsequent epigenetic changes in host cells. Tnp of A. baumannii ATCC 17978 possesses nuclear localization signals (NLSs), (225)RKRKRK(230). Transient expression of A. baumannii Tnp fused with green fluorescent protein (GFP) resulted in the nuclear localization of these proteins in COS-7 cells, whereas the truncated Tnp without NLSs fused with GFP were exclusively localized in the cytoplasm. A. baumannii Tnp was found in outer membrane vesicles, which delivered this protein to the nucleus of host cells. Nuclear expression of A. baumannii Tnp fused with GFP in A549 cells induced DNA methylation of CpG regions in the promoters of E-cadherin (CDH1) gene, whereas the cytoplasmic localization of the truncated Tnp without NLSs fused with GFP did not induce DNA methylation. DNA methylation in the promoters of E-cadherin gene induced by nuclear targeting of A. baumannii Tnp resulted in down-regulation of gene expression. In conclusion, our data show that nuclear traffic of A. baumannii Tnp induces DNA methylation of CpG regions in the promoters of E-cadherin gene, which subsequently down-regulates gene expression. This study provides a new insight into the epigenetic control of host genes by bacterial proteins.

Improved Prefusion Stability, Optimized Codon Usage, and Augmented Virion Packaging Enhance the Immunogenicity of Respiratory Syncytial Virus Fusion Protein in a Vectored-Vaccine Candidate

PubMed Central

Liang, Bo; Ngwuta, Joan O.; Surman, Sonja; Kabatova, Barbora; Liu, Xiang; Lingemann, Matthias; Liu, Xueqiao; Yang, Lijuan; Herbert, Richard; Swerczek, Joanna; Chen, Man; Moin, Syed M.; Kumar, Azad; McLellan, Jason S.; Kwong, Peter D.; Graham, Barney S.; Collins, Peter L.

2017-01-01

ABSTRACT Respiratory syncytial virus (RSV) is the most important viral agent of severe pediatric respiratory tract disease worldwide, but it lacks a licensed vaccine or suitable antiviral drug. A live attenuated chimeric bovine/human parainfluenza virus type 3 (rB/HPIV3) was developed previously as a vector expressing RSV fusion (F) protein to confer bivalent protection against RSV and HPIV3. In a previous clinical trial in virus-naive children, rB/HPIV3 was well tolerated but the immunogenicity of wild-type RSV F was unsatisfactory. We previously modified RSV F with a designed disulfide bond (DS) to increase stability in the prefusion (pre-F) conformation and to be efficiently packaged in the vector virion. Here, we further stabilized pre-F by adding both disulfide and cavity-filling mutations (DS-Cav1), and we also modified RSV F codon usage to have a lower CpG content and a higher level of expression. This RSV F open reading frame was evaluated in rB/HPIV3 in three forms: (i) pre-F without vector-packaging signal, (ii) pre-F with vector-packaging signal, and (iii) secreted pre-F ectodomain trimer. Despite being efficiently expressed, the secreted pre-F was poorly immunogenic. DS-Cav1 stabilized pre-F, with or without packaging, induced higher titers of pre-F specific antibodies in hamsters, and improved the quality of RSV-neutralizing serum antibodies. Codon-optimized RSV F containing fewer CpG dinucleotides had higher F expression, replicated more efficiently in vivo, and was more immunogenic. The combination of DS-Cav1 pre-F stabilization, optimized codon usage, reduced CpG content, and vector packaging significantly improved vector immunogenicity and protective efficacy against RSV. This provides an improved vectored RSV vaccine candidate suitable for pediatric clinical evaluation. IMPORTANCE RSV and HPIV3 are the first and second leading viral causes of severe pediatric respiratory disease worldwide. Licensed vaccines or suitable antiviral drugs are not available. We are developing a chimeric rB/HPIV3 vector expressing RSV F as a bivalent RSV/HPIV3 vaccine and have been evaluating means to increase RSV F immunogenicity. In this study, we evaluated the effects of improved stabilization of F in the pre-F conformation and of codon optimization resulting in reduced CpG content and greater pre-F expression. Reduced CpG content dampened the interferon response to infection, promoting higher replication and increased F expression. We demonstrate that improved pre-F stabilization and strategic manipulation of codon usage, together with efficient pre-F packaging into vector virions, significantly increased F immunogenicity in the bivalent RSV/HPIV3 vaccine. The improved immunogenicity included induction of increased titers of high-quality complement-independent antibodies with greater pre-F site Ø binding and greater protection against RSV challenge. PMID:28539444

Inhibitory and modulatory inputs to the vocal central pattern generator of a teleost fish

PubMed Central

Rosner, Elisabeth; Rohmann, Kevin N.; Bass, Andrew H.

2018-01-01

Abstract Vocalization is a behavioral feature that is shared among multiple vertebrate lineages, including fish. The temporal patterning of vocal communication signals is set, in part, by central pattern generators (CPGs). Toadfishes are well‐established models for CPG coding of vocalization at the hindbrain level. The vocal CPG comprises three topographically separate nuclei: pre‐pacemaker, pacemaker, motor. While the connectivity between these nuclei is well understood, their neurochemical profile remains largely unexplored. The highly vocal Gulf toadfish, Opsanus beta, has been the subject of previous behavioral, neuroanatomical and neurophysiological studies. Combining transneuronal neurobiotin‐labeling with immunohistochemistry, we map the distribution of inhibitory neurotransmitters and neuromodulators along with gap junctions in the vocal CPG of this species. Dense GABAergic and glycinergic label is found throughout the CPG, with labeled somata immediately adjacent to or within CPG nuclei, including a distinct subset of pacemaker neurons co‐labeled with neurobiotin and glycine. Neurobiotin‐labeled motor and pacemaker neurons are densely co‐labeled with the gap junction protein connexin 35/36, supporting the hypothesis that transneuronal neurobiotin‐labeling occurs, at least in part, via gap junction coupling. Serotonergic and catecholaminergic label is also robust within the entire vocal CPG, with additional cholinergic label in pacemaker and prepacemaker nuclei. Likely sources of these putative modulatory inputs are neurons within or immediately adjacent to vocal CPG neurons. Together with prior neurophysiological investigations, the results reveal potential mechanisms for generating multiple classes of social context‐dependent vocalizations with widely divergent temporal and spectral properties. PMID:29424431

Levels of DNA Methylation Vary at CpG Sites across the BRCA1 Promoter, and Differ According to Triple Negative and “BRCA-Like” Status, in Both Blood and Tumour DNA

PubMed Central

Burghel, George J.; Chambers, Philip; Al-Baba, Shadi; Connley, Daniel D.; Brock, Ian W.; Cramp, Helen E.; Dotsenko, Olena; Wilks, Octavia; Wyld, Lynda; Cross, Simon S.; Cox, Angela

2016-01-01

Triple negative breast cancer is typically an aggressive and difficult to treat subtype. It is often associated with loss of function of the BRCA1 gene, either through mutation, loss of heterozygosity or methylation. This study aimed to measure methylation of the BRCA1 gene promoter at individual CpG sites in blood, tumour and normal breast tissue, to assess whether levels were correlated between different tissues, and with triple negative receptor status, histopathological scoring for BRCA-like features and BRCA1 protein expression. Blood DNA methylation levels were significantly correlated with tumour methylation at 9 of 11 CpG sites examined (p<0.0007). The levels of tumour DNA methylation were significantly higher in triple negative tumours, and in tumours with high BRCA-like histopathological scores (10 of 11 CpG sites; p<0.01 and p<0.007 respectively). Similar results were observed in blood DNA (6 of 11 CpG sites; p<0.03 and 7 of 11 CpG sites; p<0.02 respectively). This study provides insight into the pattern of CpG methylation across the BRCA1 promoter, and supports previous studies suggesting that tumours with BRCA1 promoter methylation have similar features to those with BRCA1 mutations, and therefore may be suitable for the same targeted therapies. PMID:27463681

Methylation analysis of p16, SLIT2, SCARA5, and Runx3 genes in hepatocellular carcinoma

PubMed Central

Sun, Gaofeng; Zhang, Chen; Feng, Min; Liu, Wensheng; Xie, Huifang; Qin, Qin; Zhao, E.; Wan, Li

2017-01-01

Abstract This study is to investigate the methylation status of multiple tumor suppressor 1 (p16), secreted glycoprotein 2 (SLIT2), scavenger receptor class A, member 5 putative (SCARA5), and human runt-related transcription factor 3 (Runx3) genes in the peripheral blood of hepatocellular carcinoma (HCC). This is a case–control study. The peripheral blood samples were collected from 25 HCC patients, 25 patients with high risk of HCC (defined as “internal control group”), and 25 healthy individuals (defined as “external control group”), respectively. Then the methylation status of p16, SLIT2, SCARA5, and Runx3 genes in the blood samples were analyzed by pyrosequencing. The relationship between the methylation and the clinical features of HCC patients were evaluated. The methylation levels in the 7 CpG loci of p16 gene in HCC patients were low and without statistically significant difference (P > .05) compared to the control groups. Although the methylation levels of CpG3 and CpG4 in SLIT2 gene loci were higher than those of the control groups, there was no statistically significant difference (P > .05). However, the methylation rate of CpG2 locus in SCARA5 gene in HCC patients was significantly higher (P < .05). And the methylation rates of CpG1, CpG2, CpG3, CpG4, CpG5, and CpG8 in Runx3 gene in HCC patients were significantly different to that of control groups (P < .05). We also have analyzed the correlations between the CpG islands methylation of Runx3 or SCARA5 genes and the age, gender, hepatitis B, liver cirrhosis, alpha fetal protein, or hepatitis B surface antigen (HBsAg) of the HCC patients, which all showed no significant correlations (P > .05). The methylation status of SCARA5 and Runx3 genes are abnormal in HCC patients, which may further be used as molecular markers for early auxiliary diagnosis of liver cancer. PMID:29019900

NLRP7 affects trophoblast lineage differentiation, binds to overexpressed YY1 and alters CpG methylation

USDA-ARS?s Scientific Manuscript database

Maternal-effect mutations in NLRP7 cause rare biparentally inherited hydatidiform moles (BiHMs), abnormal pregnancies containing hypertrophic vesicular trophoblast but no embryo. BiHM trophoblasts display abnormal DNA methylation patterns affecting maternally methylated germline differentially methy...

Whole Genome DNA Methylation Analysis of Obstructive Sleep Apnea: IL1R2, NPR2, AR, SP140 Methylation and Clinical Phenotype.

PubMed

Chen, Yung-Che; Chen, Ting-Wen; Su, Mao-Chang; Chen, Chung-Jen; Chen, Kuang-Den; Liou, Chia-Wei; Tang, Petrus; Wang, Ting-Ya; Chang, Jen-Chieh; Wang, Chin-Chou; Lin, Hsin-Ching; Chin, Chien-Hung; Huang, Kuo-Tung; Lin, Meng-Chih; Hsiao, Chang-Chun

2016-04-01

We hypothesized that DNA methylation patterns may contribute to disease severity or the development of hypertension and excessive daytime sleepiness (EDS) in patients with obstructive sleep apnea (OSA). Illumina's (San Diego, CA, USA) DNA methylation 27-K assay was used to identify differentially methylated loci (DML). DNA methylation levels were validated by pyrosequencing. A discovery cohort of 15 patients with OSA and 6 healthy subjects, and a validation cohort of 72 patients with sleep disordered breathing (SDB). Microarray analysis identified 636 DMLs in patients with OSA versus healthy subjects, and 327 DMLs in patients with OSA and hypertension versus those without hypertension. In the validation cohort, no significant difference in DNA methylation levels of six selected genes was found between the primary snoring subjects and OSA patients (primary outcome). However, a secondary outcome analysis showed that interleukin-1 receptor 2 (IL1R2) promoter methylation (-114 cytosine followed by guanine dinucleotide sequence [CpG] site) was decreased and IL1R2 protein levels were increased in the patients with SDB with an oxygen desaturation index > 30. Androgen receptor (AR) promoter methylation (-531 CpG site) and AR protein levels were both increased in the patients with SDB with an oxygen desaturation index > 30. Natriuretic peptide receptor 2 (NPR2) promoter methylation (-608/-618 CpG sites) were decreased, whereas levels of both NPR2 and serum C type natriuretic peptide protein were increased in the SDB patients with EDS. Speckled protein 140 (SP140) promoter methylation (-194 CpG site) was increased, and SP140 protein levels were decreased in the patients with SDB and EDS. IL1R2 hypomethylation and AR hypermethylation may constitute an important determinant of disease severity, whereas NPR2 hypomethylation and SP140 hypermethylation may provide a biomarker for vulnerability to EDS in OSA. A commentary on this article appears in this issue on page 723. © 2016 Associated Professional Sleep Societies, LLC.

A novel CDKL5 mutation in a Japanese patient with atypical Rett syndrome.

PubMed

Christianto, Antonius; Katayama, Syouichi; Kameshita, Isamu; Inazu, Tetsuya

2016-08-01

Rett syndrome (RTT) is a severe X-linked dominant inheritance disorder with a wide spectrum of clinical manifestations. Mutations in Methyl CpG binding protein 2 (MECP2), Cyclin dependent kinase-like 5 (CDKL5) and Forkhead box G1 (FOXG1) have been associated with classic and/or variant RTT. This study was conducted to identify the responsible gene(s) in atypical RTT patient, and to examine the effect of the mutation on protein function. DNA sequence analysis showed a novel heterozygous mutation in CDKL5 identified as c.530A>G which resulted in an amino acid substitution at position 177, from tyrosine to cysteine. Genotyping analysis indicated that the mutation was not merely a single nucleotide polymorphism (SNP). We also revealed that patient's blood lymphocytes had random X-chromosome inactivation (XCI) pattern. Further examination by bioinformatics analysis demonstrated the mutation caused damage or deleterious in its protein. In addition, we demonstrated in vitro kinase assay of mutant protein showed impairment of its activity. Taken together, the results suggested the mutant CDKL5 was responsible for the disease. Copyright © 2016 Elsevier B.V. All rights reserved.

Histone Variants and Composition in the Developing Brain: Should MeCP2 Care?

PubMed

Zago, Valentina; Pinar-CabezaDeVaca, Cristina; Vincent, John B; Ausio, Juan

2017-01-01

Specific compositional chromatin features distinguish brain/neuronal chromatin from that of other tissues and are critical to this organ and cell type development and neuroplasticity. These features include a significant turnover of the major constitutive chromosomal proteins, including the (canonical) replication-dependent histones, the replication-independent replacement histone variants, as well as the chromatin associated transcriptional regulator MeCP2 (methyl CpG binding protein 2). Alterations of histones and MeCP2 have already been implicated in many brain disorders. Despite the relevance of histone variants to chromatin structure and function, only recently has some exciting literature started to re-emerge that directly relates them to neuron plasticity and cognition. However, the amount of information available on the functional role of these histones is still very limited. The purpose of this review is to focus attention to this important group of chromatin proteins, which, in the brain, possess overlapping structural and functional roles with the highly abundant presence of MeCP2. There is an imperative need to understand how all these proteins communicate with each other, and future research will hopefully provide us with answers.

Development of an ultrahigh-temperature process for the enzymatic hydrolysis of lactose. IV. Immobilization of two thermostable beta-glycosidases and optimization of a packed-bed reactor for lactose conversion.

PubMed

Petzelbauer, Inge; Kuhn, Bernhard; Splechtna, Barbara; Kulbe, Klaus D; Nidetzky, Bernd

2002-03-20

Recombinant hyperthermostable beta-glycosidases from the archaea Sulfolobus solfataricus (Ss beta Gly) and Pyrococcus furiosus (CelB) were covalently attached onto the insoluble carriers chitosan, controlled pore glass (CPG), and Eupergit C. For each enzyme/carrier pair, the protein-binding capacity, the immobilization yield, the pH profiles for activity and stability, the activity/temperature profile, and the kinetic constants for lactose hydrolysis at 70 degrees C were determined. Eupergit C was best among the carriers in regard to retention of native-like activity and stability of Ss beta Gly and CelB over the pH range 3.0-7.5. Its protein binding capacity of approximately 0.003 (on a mass basis) was one-third times that of CPG, while immobilization yields were typically 80% in each case. Activation energies for lactose conversion by the immobilized enzymes at pH 5.5 were in the range 50-60 kJ/mol. This is compared to values of approximately 75 kJ/mol for the free enzymes. Immobilization expands the useful pH range for CelB and Ss beta Gly by approximately 1.5 pH units toward pH 3.5 and pH 4.5, respectively. A packed-bed enzyme reactor was developed for the continuous conversion of lactose in different media, including whey and milk, and operated over extended reaction times of up to 14 days. The productivities of the Eupergit C-immobilized enzyme reactor were determined at dilution rates between 1 and 12 h(-1), and using 45 and 170 g/L initial lactose. Results of kinetic modeling for the same reactor, assuming plug flow and steady state, suggest the presence of mass-transfer limitation of the reaction rate under the conditions used. Formation of galacto-oligosaccharides in the continuous packed-bed reactor and in the batch reactor using free enzyme was closely similar in regard to yield and individual saccharide components produced. Copyright 2002 John Wiley & Sons, Inc. Biotechnol Bioeng 77: 619-631, 2002; DOI 10.1002/bit.10110

The AhR and NF-κB/Rel Proteins Mediate the Inhibitory Effect of 2,3,7,8-Tetrachlorodibenzo-p-Dioxin on the 3′ Immunoglobulin Heavy Chain Regulatory Region

PubMed Central

Salisbury, Richard L.; Sulentic, Courtney E. W.

2015-01-01

Transcriptional regulation of the murine immunoglobulin (Ig) heavy chain gene (Igh) involves several regulatory elements including the 3′Igh regulatory region (3′IghRR), which is composed of at least 4 enhancers (hs3A, hs1.2, hs3B, and hs4). The hs1.2 and hs4 enhancers exhibit the greatest transcriptional activity and contain binding sites for several transcription factors including nuclear factor kappaB/Rel (NF-κB/Rel) proteins and the aryl hydrocarbon receptor (AhR). Interestingly, the environmental immunosuppressant 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD), which potently inhibits antibody secretion, also profoundly inhibits 3′IghRR and hs1.2 enhancer activation induced by the B-lymphocyte activator lipopolysaccharide (LPS), but enhances LPS-induced activation of the hs4 enhancer. Within the hs1.2 and hs4 enhancers, the AhR binding site is in close proximity or overlaps an NF-κB/Rel binding site suggesting a potential reciprocal modulation of the 3′IghRR by AhR and NF-κB/Rel. The objective of the current study was to evaluate the role of NF-κB/Rel and the AhR on the 3′IghRR and its enhancers using the AhR ligand TCDD, the AhR antagonist CH223191, and toll-like receptor agonists LPS, Resiquimod (R848), or cytosine-phosphate-guanine-oligodeoxynucleotides (CpG). Utilizing the CH12.LX B-lymphocyte cell line and variants expressing either a 3′IghRR-regulated transgene reporter or an inducible IκBα (inhibitor kappa B-alpha protein) superrepressor (IκBαAA), we demonstrate an AhR- and NF-κB/Rel-dependent modulation of 3′IghRR and hs4 activity. Additionally, in mouse splenocytes or CH12.LX cells, binding within the hs1.2 and hs4 enhancer of the AhR and the NF-κB/Rel proteins RelA and RelB was differentially altered by the cotreatment of LPS and TCDD. These results suggest that the AhR and NF-κB/Rel protein binding profile within the 3′IghRR mediates the inhibitory effects of TCDD on Ig expression and therefore antibody levels. PMID:26377645

Complete Chloroplast Genome of Pinus massoniana (Pinaceae): Gene Rearrangements, Loss of ndh Genes, and Short Inverted Repeats Contraction, Expansion.

PubMed

Ni, ZhouXian; Ye, YouJu; Bai, Tiandao; Xu, Meng; Xu, Li-An

2017-09-11

The chloroplast genome (CPG) of Pinus massoniana belonging to the genus Pinus (Pinaceae), which is a primary source of turpentine, was sequenced and analyzed in terms of gene rearrangements, ndh genes loss, and the contraction and expansion of short inverted repeats (IRs). P. massoniana CPG has a typical quadripartite structure that includes large single copy (LSC) (65,563 bp), small single copy (SSC) (53,230 bp) and two IRs (IRa and IRb, 485 bp). The 108 unique genes were identified, including 73 protein-coding genes, 31 tRNAs, and 4 rRNAs. Most of the 81 simple sequence repeats (SSRs) identified in CPG were mononucleotides motifs of A/T types and located in non-coding regions. Comparisons with related species revealed an inversion (21,556 bp) in the LSC region; P. massoniana CPG lacks all 11 intact ndh genes (four ndh genes lost completely; the five remained truncated as pseudogenes; and the other two ndh genes remain as pseudogenes because of short insertions or deletions). A pair of short IRs was found instead of large IRs, and size variations among pine species were observed, which resulted from short insertions or deletions and non-synchronized variations between "IRa" and "IRb". The results of phylogenetic analyses based on whole CPG sequences of 16 conifers indicated that the whole CPG sequences could be used as a powerful tool in phylogenetic analyses.

MeCP2 deficiency in Rett syndrome causes epigenetic aberrations at the PWS/AS imprinting center that affects UBE3A expression.

PubMed

Makedonski, Kirill; Abuhatzira, Liron; Kaufman, Yotam; Razin, Aharon; Shemer, Ruth

2005-04-15

Rett syndrome (RS) is a severe and progressive neurodevelopmental disorder caused by heterozygous mutations in the X-linked methyl CpG binding protein 2 (MeCP2) gene. MeCP2 is a nuclear protein that binds specifically to methylated DNA and functions as a general transcription repressor in the context of chromatin remodeling complexes. RS shares clinical features with those of Angelman syndrome (AS), an imprinting neurodevelopmental disorder. In AS patients, the maternally expressed copy of UBE3A that codes for the ubiquitin protein ligase 3A (E6-AP) is repressed. The similar phenotype of these two syndromes led us to hypothesize that part of the RS phenotype is due to MeCP2-associated silencing of UBE3A. Indeed, UBE3A mRNA and protein are shown here to be significantly reduced in human and mouse MECP2 deficient brains. This reduced UBE3A level was associated with biallelic production of the UBE3A antisense RNA. In addition, MeCP2 deficiency resulted in elevated histone H3 acetylation and H3(K4) methylation and reduced H3(K9) methylation at the PWS/AS imprinting center, with no effect on DNA methylation or SNRPN expression. We conclude, therefore, that MeCP2 deficiency causes epigenetic aberrations at the PWS imprinting center. These changes in histone modifications result in loss of imprinting of the UBE3A antisense gene in the brain, increase in UBE3A antisense RNA level and, consequently reduction in UBE3A production.

Methyl-Cytosine-Driven Structural Changes Enhance Adduction Kinetics of an Exon 7 fragment of the p53 Gene

NASA Astrophysics Data System (ADS)

Malla, Spundana; Kadimisetty, Karteek; Fu, You-Jun; Choudhary, Dharamainder; Schenkman, John B.; Rusling, James F.

2017-01-01

Methylation of cytosine (C) at C-phosphate-guanine (CpG) sites enhances reactivity of DNA towards electrophiles. Mutations at CpG sites on the p53 tumor suppressor gene that can result from these adductions are in turn correlated with specific cancers. Here we describe the first restriction-enzyme-assisted LC-MS/MS sequencing study of the influence of methyl cytosines (MeC) on kinetics of p53 gene adduction by model metabolite benzo[a]pyrene-7,8-dihydrodiol-9,10-epoxide (BPDE), using methodology applicable to correlate gene damage sites for drug and pollutant metabolites with mutation sites. This method allows direct kinetic measurements by LC-MS/MS sequencing for oligonucleotides longer than 20 base pairs (bp). We used MeC and non-MeC (C) versions of a 32 bp exon 7 fragment of the p53 gene. Methylation of 19 cytosines increased the rate constant 3-fold for adduction on G at the major reactive CpG in codon 248 vs. the non-MeC fragment. Rate constants for non-CpG codons 244 and 243 were not influenced significantly by MeC. Conformational and hydrophobicity changes in the MeC-p53 exon 7 fragment revealed by CD spectra and molecular modeling increase the BPDE binding constant to G in codon 248 consistent with a pathway in which preceding reactant binding greatly facilitates the rate of covalent SN2 coupling.

Targeted DNA demethylation in human cells by fusion of a plant 5-methylcytosine DNA glycosylase to a sequence-specific DNA binding domain

PubMed Central

Parrilla-Doblas, Jara Teresa; Ariza, Rafael R.; Roldán-Arjona, Teresa

2017-01-01

ABSTRACT DNA methylation is a crucial epigenetic mark associated to gene silencing, and its targeted removal is a major goal of epigenetic editing. In animal cells, DNA demethylation involves iterative 5mC oxidation by TET enzymes followed by replication-dependent dilution and/or replication-independent DNA repair of its oxidized derivatives. In contrast, plants use specific DNA glycosylases that directly excise 5mC and initiate its substitution for unmethylated C in a base excision repair process. In this work, we have fused the catalytic domain of Arabidopsis ROS1 5mC DNA glycosylase (ROS1_CD) to the DNA binding domain of yeast GAL4 (GBD). We show that the resultant GBD-ROS1_CD fusion protein binds specifically a GBD-targeted DNA sequence in vitro. We also found that transient in vivo expression of GBD-ROS1_CD in human cells specifically reactivates transcription of a methylation-silenced reporter gene, and that such reactivation requires both ROS1_CD catalytic activity and GBD binding capacity. Finally, we show that reactivation induced by GBD-ROS1_CD is accompanied by decreased methylation levels at several CpG sites of the targeted promoter. All together, these results show that plant 5mC DNA glycosylases can be used for targeted active DNA demethylation in human cells. PMID:28277978

In Ovo injection of betaine affects hepatic cholesterol metabolism through epigenetic gene regulation in newly hatched chicks.

PubMed

Hu, Yun; Sun, Qinwei; Li, Xiaoliang; Wang, Min; Cai, Demin; Li, Xi; Zhao, Ruqian

2015-01-01

Betaine is reported to regulate hepatic cholesterol metabolism in mammals. Chicken eggs contain considerable amount of betaine, yet it remains unknown whether and how betaine in the egg affects hepatic cholesterol metabolism in chicks. In this study, eggs were injected with betaine at 2.5 mg/egg and the hepatic cholesterol metabolism was investigated in newly hatched chicks. Betaine did not affect body weight or liver weight, but significantly increased the serum concentration (P < 0.05) and the hepatic content (P < 0.01) of cholesterol. Accordingly, the cholesterol biosynthetic enzyme HMGCR was up-regulated (P < 0.05 for both mRNA and protein), while CYP7A1 which converts cholesterol to bile acids was down-regulated (P < 0.05 for mRNA and P = 0.07 for protein). Moreover, hepatic protein content of the sterol-regulatory element binding protein 1 which regulates cholesterol and lipid biosynthesis, and the mRNA abundance of ATP binding cassette sub-family A member 1 (ABCA1) which mediates cholesterol counter transport were significantly (P < 0.05) increased in betaine-treated chicks. Meanwhile, hepatic protein contents of DNA methyltransferases 1 and adenosylhomocysteinase-like 1 were increased (P < 0.05), which was associated with global genomic DNA hypermethylation (P < 0.05) and diminished gene repression mark histone H3 lysine 27 trimethylation (P < 0.05). Furthermore, CpG methylation level on gene promoters was found to be increased (P < 0.05) for CYP7A1 yet decreased (P < 0.05) for ABCA1. These results indicate that in ovo betaine injection regulates hepatic cholesterol metabolism in chicks through epigenetic mechanisms including DNA and histone methylations.

In Ovo Injection of Betaine Affects Hepatic Cholesterol Metabolism through Epigenetic Gene Regulation in Newly Hatched Chicks

PubMed Central

Hu, Yun; Sun, Qinwei; Li, Xiaoliang; Wang, Min; Cai, Demin; Li, Xi; Zhao, Ruqian

2015-01-01

Betaine is reported to regulate hepatic cholesterol metabolism in mammals. Chicken eggs contain considerable amount of betaine, yet it remains unknown whether and how betaine in the egg affects hepatic cholesterol metabolism in chicks. In this study, eggs were injected with betaine at 2.5 mg/egg and the hepatic cholesterol metabolism was investigated in newly hatched chicks. Betaine did not affect body weight or liver weight, but significantly increased the serum concentration (P < 0.05) and the hepatic content (P < 0.01) of cholesterol. Accordingly, the cholesterol biosynthetic enzyme HMGCR was up-regulated (P < 0.05 for both mRNA and protein), while CYP7A1 which converts cholesterol to bile acids was down-regulated (P < 0.05 for mRNA and P = 0.07 for protein). Moreover, hepatic protein content of the sterol-regulatory element binding protein 1 which regulates cholesterol and lipid biosynthesis, and the mRNA abundance of ATP binding cassette sub-family A member 1 (ABCA1) which mediates cholesterol counter transport were significantly (P < 0.05) increased in betaine-treated chicks. Meanwhile, hepatic protein contents of DNA methyltransferases 1 and adenosylhomocysteinase-like 1 were increased (P < 0.05), which was associated with global genomic DNA hypermethylation (P < 0.05) and diminished gene repression mark histone H3 lysine 27 trimethylation (P < 0.05). Furthermore, CpG methylation level on gene promoters was found to be increased (P < 0.05) for CYP7A1 yet decreased (P < 0.05) for ABCA1. These results indicate that in ovo betaine injection regulates hepatic cholesterol metabolism in chicks through epigenetic mechanisms including DNA and histone methylations. PMID:25860502

HIV Gag protein conjugated to a Toll-like receptor 7/8 agonist improves the magnitude and quality of Th1 and CD8+ T cell responses in nonhuman primates

NASA Astrophysics Data System (ADS)

Wille-Reece, Ulrike; Flynn, Barbara J.; Loré, Karin; Koup, Richard A.; Kedl, Ross M.; Mattapallil, Joseph J.; Weiss, Walter R.; Roederer, Mario; Seder, Robert A.

2005-10-01

Induction and maintenance of antibody and T cell responses will be critical for developing a successful vaccine against HIV. A rational approach for generating such responses is to design vaccines or adjuvants that have the capacity to activate specific antigen-presenting cells. In this regard, dendritic cells (DCs) are the most potent antigen-presenting cells for generating primary T cell responses. Here, we report that Toll-like receptor (TLR) agonists and ligands that activate DCs in vitro influence the magnitude and quality of the cellular immune response in nonhuman primates (NHPs) when administered with HIV Gag protein. NHPs immunized with HIV Gag protein and a TLR7/8 agonist or a TLR9 ligand [CpG oligodeoxynucleotides (CpG ODN)] had significantly increased Gag-specific T helper 1 and antibody responses, compared with animals immunized with HIV Gag protein alone. Importantly, conjugating the HIV Gag protein to the TLR7/8 agonist (Gag-TLR7/8 conjugate) dramatically enhanced the magnitude and altered the quality of the T helper 1 response, compared with animals immunized with HIV Gag protein and the TLR7/8 agonist or CpG ODN. Furthermore, immunization with the Gag-TLR7/8 conjugate vaccine elicited Gag-specific CD8+ T responses. Collectively, our results show that conjugating HIV Gag protein to a TLR7/8 agonist is an effective way to elicit broad-based adaptive immunity in NHPs. This type of vaccine formulation should have utility in preventive or therapeutic vaccines in which humoral and cellular immunity is required. vaccine | dendritic cell | cross-presentation | cellular immunity

Comparative analysis of DNA methylation polymorphism in drought sensitive (HPKC2) and tolerant (HPK4) genotypes of horse Gram (Macrotyloma uniflorum).

PubMed

Bhardwaj, Jyoti; Mahajan, Monika; Yadav, Sudesh Kumar

2013-08-01

DNA methylation is known as an epigenetic modification that affects gene expression in plants. Variation in CpG methylation behavior was studied in two natural horse gram (Macrotyloma uniflorum [Lam.] Verdc.) genotypes, HPKC2 (drought-sensitive) and HPK4 (drought-tolerant). The methylation pattern in both genotypes was studied through methylation-sensitive amplified polymorphism. The results revealed that methylation was higher in HPKC2 (10.1%) than in HPK4 (8.6%). Sequencing demonstrated sequence homology with the DRE binding factor (cbf1), the POZ/BTB protein, and the Ty1-copia retrotransposon among some of the polymorphic fragments showing alteration in methylation behavior. Differences in DNA methylation patterns could explain the differential drought tolerance and the epigenetic signature of these two horse gram genotypes.

Methylation of avpr1a in the cortex of wild prairie voles: effects of CpG position and polymorphism

PubMed Central

Maguire, S. M.; Phelps, S. M.

2017-01-01

DNA methylation can cause stable changes in neuronal gene expression, but we know little about its role in individual differences in the wild. In this study, we focus on the vasopressin 1a receptor (avpr1a), a gene extensively implicated in vertebrate social behaviour, and explore natural variation in DNA methylation, genetic polymorphism and neuronal gene expression among 30 wild prairie voles (Microtus ochrogaster). Examination of CpG density across 8 kb of the locus revealed two distinct CpG islands overlapping promoter and first exon, characterized by few CpG polymorphisms. We used a targeted bisulfite sequencing approach to measure DNA methylation across approximately 3 kb of avpr1a in the retrosplenial cortex, a brain region implicated in male space use and sexual fidelity. We find dramatic variation in methylation across the avrp1a locus, with pronounced diversity near the exon–intron boundary and in a genetically variable putative enhancer within the intron. Among our wild voles, differences in cortical avpr1a expression correlate with DNA methylation in this putative enhancer, but not with the methylation status of the promoter. We also find an unusually high number of polymorphic CpG sites (polyCpGs) in this focal enhancer. One polyCpG within this enhancer (polyCpG 2170) may drive variation in expression either by disrupting transcription factor binding motifs or by changing local DNA methylation and chromatin silencing. Our results contradict some assumptions made within behavioural epigenetics, but are remarkably concordant with genome-wide studies of gene regulation. PMID:28280564

Region of interest methylation analysis: a comparison of MSP with MS-HRM and direct BSP.

PubMed

Akika, Reem; Awada, Zainab; Mogharbil, Nahed; Zgheib, Nathalie K

2017-07-01

The aim of this study was to compare and contrast three DNA methylation methods of a specific region of interest (ROI): methylation-specific PCR (MSP), methylation-sensitive high resolution melting (MS-HRM) and direct bisulfite sequencing (BSP). The methylation of a CpG area in the promoter region of Estrogen receptor alpha (ESR1) was evaluated by these three methods with samples and standards of different methylation percentages. MSP data were neither reproducible nor sensitive, and the assay was not specific due to non-specific binding of primers. MS-HRM was highly reproducible and a step forward into categorizing the methylation status of the samples as percent ranges. Direct BSP was the most informative method regarding methylation percentage of each CpG site. Though not perfect, it was reproducible and sensitive. We recommend the use of either method depending on the research question and target amplicon, and provided that the designed primers and expected amplicons are within recommendations. If the research question targets a limited number of CpG sites and simple yes/no results are enough, MSP may be attempted. For short amplicons that are crowded with CpG sites and of single melting domain, MS-HRM may be the method of choice though it only indicates the overall methylation percentage of the entire amplicon. Although the assay is highly reproducible, being semi-quantitative makes it of lesser interest to study ROI methylation of samples with little methylation differences. Direct BSP is a step forward as it gives information about the methylation percentage at each CpG site.

Hypermethylation of the Human Glutathione S-Transferase-π Gene (GSTP1) CpG Island Is Present in a Subset of Proliferative Inflammatory Atrophy Lesions but Not in Normal or Hyperplastic Epithelium of the Prostate

PubMed Central

Nakayama, Masashi; Bennett, Christina J.; Hicks, Jessica L.; Epstein, Jonathan I.; Platz, Elizabeth A.; Nelson, William G.; De Marzo, Angelo M.

2003-01-01

Somatic inactivation of the glutathione S-transferase-π gene (GSTP1) via CpG island hypermethylation occurs early during prostate carcinogenesis, present in ∼70% of high-grade prostatic intraepithelial neoplasia (high-grade PIN) lesions and more than 90% of adenocarcinomas. Recently, there has been a resurgence of the concept that foci of prostatic atrophy (referred to as proliferative inflammatory atrophy or PIA) may be precursor lesions for the development of prostate cancer and/or high-grade PIN. Many of the cells within PIA lesions contain elevated levels of GSTP1, glutathione S-transferase-α (GSTA1), and cyclooxygenase-II proteins, suggesting a stress response. Because not all PIA cells are positive for GSTP1 protein, we hypothesized that some of the cells within these regions acquire GSTP1 CpG island hypermethylation, increasing the chance of progression to high-grade PIN and/or adenocarcinoma. Separate regions (n =199) from 27 formalin-fixed paraffin-embedded prostates were microdissected by laser-capture microdissection (Arcturus PixCell II). These regions included normal epithelium (n = 48), hyperplasticepithelium from benign prostatic hyperplasia nodules (n = 22), PIA (n = 64), high-grade PIN (n = 32), and adenocarcinoma (n = 33). Genomic DNA was isolated and assessed for GSTP1 CpG island hypermethylation by methylation-specific polymerase chain reaction. GSTP1 CpG island hypermethylation was not detected in normal epithelium (0 of 48) or in hyperplastic epithelium (0 of 22), but was found in 4 of 64 (6.3%) PIA lesions. The difference in the frequency of GSTP1 CpG island hypermethylation between normal or hyperplastic epithelium and PIA was statistically significant (P = 0.049). Similar to studies using nonmicrodissected cases, hypermethylation was found in 22 of 32 (68.8%) high-grade PIN lesions and in 30 of 33 (90.9%) adenocarcinoma lesions. Unlike normal or hyperplastic epithelium, GSTP1 CpG island hypermethylation can be detected in some PIA lesions. These data support the hypothesis that atrophic epithelium in a subset of PIA lesions may lead to high-grade PIN and/or adenocarcinoma. Because these atrophic lesions are so prevalent and extensive, even though only a small subset contains this somatic DNA alteration, the clinical impact may be substantial. PMID:12937133

Phase 1 testing of detoxified LPS/group B meningococcal outer membrane protein vaccine with and without synthetic CPG 7909 adjuvant for the prevention and treatment of sepsis.

PubMed

Cross, Alan S; Greenberg, Nancy; Billington, Melissa; Zhang, Lei; DeFilippi, Christopher; May, Ryan C; Bajwa, Kanwaldeep K

2015-11-27

Gram-negative bacteria (GNB) are a leading cause of nosocomial infection and sepsis. Increasing multi-antibiotic resistance has left clinicians with fewer therapeutic options. Antibodies to GNB lipopolysaccharide (LPS, or endotoxin) have reduced morbidity and mortality as a result of infection and are not subject to the resistance mechanisms deployed by bacteria against antibiotics. In this phase 1 study, we administered a vaccine that elicits antibodies against a highly conserved portion of LPS with and without a CpG oligodeoxynucleotide (ODN) TLR9 agonist as adjuvant. A vaccine composed of the detoxified LPS (dLPS) from E. coli O111:B4 (J5 mutant) non-covalently complexed to group B meningococcal outer membrane protein (OMP). Twenty healthy adult subjects received three doses at 0, 29 and 59 days of antigen (10 μg dLPS) with or without CPG 7909 (250 or 500 μg). Subjects were evaluated for local and systemic adverse effects and laboratory findings. Anti-J5 LPS IgG and IgM antibody levels were measured by electrochemiluminesence. Due to premature study termination, not all subjects received all three doses. All vaccine formulations were well-tolerated with no local or systemic events of greater than moderate severity. The vaccine alone group achieved a ≥ 4-fold "responder" response in IgG and IgM antibody in only one of 6 subjects. In contrast, the vaccine plus CPG 7909 groups appeared to have earlier and more sustained (to 180 days) responses, greater mean-fold increases, and a higher proportion of "responders" achieving ≥ 4-fold increases over baseline. Although the study was halted before all enrolled subjects received all three doses, the J5dLPS/OMP vaccine, with or without CpG adjuvant, was safe and well-tolerated. The inclusion of CpG increased the number of subjects with a ≥ 4-fold antibody response, evident even after the second of three planned doses. A vaccine comprising J5dLPS/OMP antigen with CpG adjuvant merits further investigation. ClinicalTrials.gov Identifier: NCT01164514. Copyright © 2015 Elsevier Ltd. All rights reserved.

Identification and expression analysis of cobia (Rachycentron canadum) Toll-like receptor 9 gene.

PubMed

Byadgi, Omkar; Puteri, Dinda; Lee, Yan-Horn; Lee, Jai-Wei; Cheng, Ta-Chih

2014-02-01

Cobia culture is hindered by bacterial infection (Photobacterium damselae subsp. piscicida) and in order to study the effect of P. damselae subsp. piscicida challenge and CpG ODN stimulation on cobia Toll like receptor 9 (RCTLR9), we used PCR to clone RCTLR9 gene and qRT-PCR to quantify gene expression. The results indicated that RCTLR9 cDNA contains 3141 bp. It encodes 1047 amino acids containing 16 typical structures of leucine-rich repeats (LRRs) including an LRRTYP, LRRCT and a motif involved in PAMP binding was identified at position 240-253 amino acid. Broad expression of RCTLR9 was found in larval, juvenile and adult stages irrespective of the tissues. In larval stage, RCTLR9 mRNA expression decreased at 5 d and then increased at 10 dph. At juvenile stage cobia, the expression was significantly high (p < 0.05) in spleen and intestine compared to gill, kidney, liver and skin. However, at adult stage, the significant high expression was found in gill and intestine. Cobia challenged with P. damselae subsp. piscicida showed significant increase in RCTLR9 expression at 24 h post challenge in intestine, spleen and liver, while in kidney the expression was peak at 12 h and later it decreased at 24 h. The highest expression was 40 fold increase in spleen and the lowest expression was ∼3.6 fold increase in liver. Cobia stimulated with CpG oligonucleotides showed that the induction of these genes was CpG ODN type and time dependent. In spleen and liver, CpG ODNs 1668 and 2006 injected group showed high expression of RCTLR9, IL-1β, chemokine CC compared to other groups. Meanwhile, CpG ODN 2006 has induced high expression of IgM. The CpG ODNs 2395 have induced significant high expression of Mx in spleen and liver. These results demonstrates the potential of using CpG ODN to enhance cobia resistance to P. damselae subsp. piscicida infection and use as an adjuvant in vaccine development. Copyright © 2013 Elsevier Ltd. All rights reserved.

Childhood maltreatment and methylation of FK506 binding protein 5 gene (FKBP5).

PubMed

Tyrka, Audrey R; Ridout, Kathryn K; Parade, Stephanie H; Paquette, Alison; Marsit, Carmen J; Seifer, Ronald

2015-11-01

A growing body of evidence suggests that alterations of the stress response system may be a mechanism by which childhood maltreatment alters risk for psychopathology. FK506 binding protein 51 (FKBP5) binds to the glucocorticoid receptor and alters its ability to respond to stress signaling. The aim of the present study was to examine methylation of the FKBP5 gene (FKBP5), and the role of an FKBP5 genetic variant, in relation to childhood maltreatment in a sample of impoverished preschool-aged children. One hundred seventy-four families participated in this study, including 69 with child welfare documentation of moderate to severe maltreatment in the past 6 months. The children, who ranged in age from 3 to 5 years, were racially and ethnically diverse. Structured record review and interviews in the home were used to assess a history of maltreatment, other traumas, and contextual life stressors; and a composite variable assessed the number exposures to these adversities. Methylation of two sites in intron 7 of FKBP5 was measured via sodium bisulfite pyrosequencing. Maltreated children had significantly lower levels of methylation at both CpG sites (p < .05). Lifetime contextual stress exposure showed a trend for lower levels of methylation at one of the sites, and a trend for an interaction with the FKBP5 polymorphism. A composite adversity variable was associated with lower levels of methylation at one of the sites as well (p < .05). FKBP5 alters glucocorticoid receptor responsiveness, and FKBP5 gene methylation may be a mechanism of the biobehavioral effects of adverse exposures in young children.

Comprehensive Analysis of Contributions from Protein Conformational Stability and Major Histocompatibility Complex Class II-Peptide Binding Affinity to CD4+ Epitope Immunogenicity in HIV-1 Envelope Glycoprotein

PubMed Central

Li, Tingfeng; Steede, N. Kalaya; Nguyen, Hong-Nam P.; Freytag, Lucy C.; McLachlan, James B.; Mettu, Ramgopal R.; Robinson, James E.

2014-01-01

ABSTRACT Helper T-cell epitope dominance in human immunodeficiency virus type 1 (HIV-1) envelope glycoprotein gp120 is not adequately explained by peptide binding to major histocompatibility complex (MHC) proteins. Antigen processing potentially influences epitope dominance, but few, if any, studies have attempted to reconcile the influences of antigen processing and MHC protein binding for all helper T-cell epitopes of an antigen. Epitopes of gp120 identified in both humans and mice occur on the C-terminal flanks of flexible segments that are likely to be proteolytic cleavage sites. In this study, the influence of gp120 conformation on the dominance pattern in gp120 from HIV strain 89.6 was examined in CBA mice, whose MHC class II protein has one of the most well defined peptide-binding preferences. Only one of six dominant epitopes contained the most conserved element of the I-Ak binding motif, an aspartic acid. Destabilization of the gp120 conformation by deletion of single disulfide bonds preferentially enhanced responses to the cryptic I-Ak motif-containing sequences, as reported by T-cell proliferation or cytokine secretion. Conversely, inclusion of CpG in the adjuvant with gp120 enhanced responses to the dominant CD4+ T-cell epitopes. The gp120 destabilization affected secretion of some cytokines more than others, suggesting that antigen conformation could modulate T-cell functions through mechanisms of antigen processing. IMPORTANCE CD4+ helper T cells play an essential role in protection against HIV and other pathogens. Thus, the sites of helper T-cell recognition, the dominant epitopes, are targets for vaccine design; and the corresponding T cells may provide markers for monitoring infection and immunity. However, T-cell epitopes are difficult to identify and predict. It is also unclear whether CD4+ T cells specific for one epitope are more protective than T cells specific for other epitopes. This work shows that the three-dimensional (3D) structure of an HIV protein partially determines which epitopes are dominant, most likely by controlling the breakdown of HIV into peptides. Moreover, some types of signals from CD4+ T cells are affected by the HIV protein 3D structure; and thus the protectiveness of a particular peptide vaccine could be related to its location in the 3D structure. PMID:24920818

Intraperitoneal prophylaxis with CpG oligodeoxynucleotides protects neutropenic mice against intracerebral Escherichia coli K1 infection.

PubMed

Ribes, Sandra; Meister, Tanja; Ott, Martina; Redlich, Sandra; Janova, Hana; Hanisch, Uwe-Karsten; Nessler, Stefan; Nau, Roland

2014-01-23

Prophylaxis with unmethylated cytosine phosphate guanidine (CpG) oligodeoxynucleotides (ODN) protects against several systemic experimental infections. Escherichia coli is a major cause of Gram-negative neonatal bacterial meningitis and also causes meningitis and meningoencephalitis in older and immunocompromised patients. Wild-type (wt) and Toll-like receptor 9 (TLR9)-deficient mice were rendered neutropenic by intraperitoneal administration of the anti-Ly-6G monoclonal antibody. Immunocompetent and neutropenic mice received intraperitoneal CpG ODN or vehicle 72 h prior to induction of E. coli K1 meningoencephalitis. Pre-treatment with CpG ODN significantly increased survival of neutropenic wt mice from 33% to 75% (P = 0.0003) but did not protect neutropenic TLR9-/- mice. The protective effect of CpG ODN was associated with an enhanced production of interleukin (IL)-12/IL-23p40 with sustained increased levels in serum and spleen at least for 17 days after conditioning compared to buffer-treated animals. CpG-treated neutropenic wt mice showed reduced bacterial concentrations and increased recruitment of Ly6ChighCCR2+ monocytes in brain and spleen 42 h after infection. The levels of macrophage inflammatory protein 1α (MIP-1α) and interferon gamma (IFN-γ) in spleen were higher 42 h after infection in CpG-treated compared to buffer-treated neutropenic animals. In immunocompetent mice, prophylaxis with CpG ODN did not significantly increase survival compared to the buffer group (60% vs. 45%, P = 0.2). These findings suggest that systemic administration of CpG ODN may help to prevent bacterial CNS infections in immunocompromised individuals.

Induction of Cyclooxygenase-2 Expression by Hepatitis B Virus Depends on Demethylation-associated Recruitment of Transcription Factors to the Promoter

PubMed Central

2011-01-01

Background The hepatitis B virus (HBV) is a major etiological factor of inflammation and damage to the liver resulting in hepatocellular carcinoma. Transcription factors play important roles in the disordered gene expression and liver injury caused by HBV. However, the molecular mechanisms behind this observation have not been defined. Results In this study, we observed that circulating prostaglandin (PGE) 2 synthesis was increased in patients with chronic hepatitis B infection, and detected elevated cyclooxygenase (COX)-2 expression in HBV- and HBx-expressing liver cells. Likewise, the association of HBx with C/EBPβ contributed to the induction of COX-2. The COX-2 promoter was hypomethylated in HBV-positive cells, and specific demethylation of CpG dinucleotides within each of the two NF-AT sites in the COX-2 promoter resulted in the increased binding affinity of NF-AT to the cognate sites in the promoter, followed by increased COX-2 expression and PGE2 accumulation. The DNA methylatransferase DNMT3B played a key role in the methylation of the COX-2 promoter, and its decreased binding to the promoter was responsible for the regional demethylation of CpG sites, and for the increased binding of transcription factors in HBV-positive cells. Conclusion Our results indicate that upregulation of COX-2 by HBV and HBx is mediated by both demethylation events and recruitment of multiple transcription factors binding to the promoter. PMID:21401943

Enhanced early innate and T cell-mediated responses in subjects immunized with Anthrax Vaccine Adsorbed Plus CPG 7909 (AV7909).

PubMed

Minang, Jacob T; Inglefield, Jon R; Harris, Andrea M; Lathey, Janet L; Alleva, David G; Sweeney, Diane L; Hopkins, Robert J; Lacy, Michael J; Bernton, Edward W

2014-11-28

NuThrax™ (Anthrax Vaccine Adsorbed with CPG 7909 Adjuvant) (AV7909) is in development. Samples obtained in a phase Ib clinical trial were tested to confirm biomarkers of innate immunity and evaluate effects of CPG 7909 (PF-03512676) on adaptive immunity. Subjects received two intramuscular doses of commercial BioThrax(®) (Anthrax Vaccine Adsorbed, AVA), or two intramuscular doses of one of four formulations of AV7909. IP-10, IL-6, and C-reactive protein (CRP) levels were elevated 24-48 h after administration of AV7909 formulations, returning to baseline by Day 7. AVA (no CPG 7909) resulted in elevated IL-6 and CRP, but not IP-10. Another marker of CpG, transiently decreased absolute lymphocyte counts (ALCs), correlated with transiently increased IP-10. Cellular recall responses to anthrax protective antigen (PA) or PA peptides were assessed by IFN-γ ELISpot assay performed on cryopreserved PBMCs obtained from subjects prior to immunization and 7 days following the second immunization (study day 21). One-half of subjects that received AV7909 with low-dose (0.25mg/dose) CPG 7909 possessed positive Day 21 T cell responses to PA. In contrast, positive T cell responses occurred at an 11% average rate (1/9) for AVA-treated subjects. Differences in cellular responses due to dose level of CPG 7909 were not associated with differences in humoral anti-PA IgG responses, which were elevated for recipients of AV7909 compared to recipients of AVA. Serum markers at 24 or 48 h (i.e. % ALC decrease, or increase in IL-6, IP-10, or CRP) correlated with the humoral (antibody) responses 1 month later, but did not correlate with cellular ELISpot responses. In summary, biomarkers of early responses to CPG 7909 were confirmed, and adding a CpG adjuvant to a vaccine administered twice resulted in increased T cell effects relative to vaccine alone. Changes in early biomarkers correlated with subsequent adaptive humoral immunity but not cellular immunity. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.

CpG Oligodeoxynucleotide and Montanide ISA 51 Adjuvant Combination Enhanced the Protective Efficacy of a Subunit Malaria Vaccine

PubMed Central

Kumar, Sanjai; Jones, Trevor R.; Oakley, Miranda S.; Zheng, Hong; Kuppusamy, Shanmuga P.; Taye, Alem; Krieg, Arthur M.; Stowers, Anthony W.; Kaslow, David C.; Hoffman, Stephen L.

2004-01-01

Unmethylated CpG dinucleotide motifs present in bacterial genomes or synthetic oligodeoxynucleotides (ODNs) serve as strong immunostimulatory agents in mice, monkeys and humans. We determined the adjuvant effect of murine CpG ODN 1826 on the immunogenicity and protective efficacy of the Saccharomyces cerevisiae-expressed 19-kDa C-terminal region of merozoite surface protein 1 (yMSP119) of the murine malaria parasite Plasmodium yoelii. We found that in C57BL/6 mice, following sporozoite challenge, the degree of protective immunity against malaria induced by yMSP119 in a formulation of Montanide ISA 51 (ISA) plus CpG ODN 1826 was similar or superior to that conferred by yMSP119 emulsified in complete Freund's adjuvant (CFA/incomplete Freund's adjuvant). In total, among mice immunized with yMSP119, 22 of 32 (68.7%) with ISA plus CpG 1826, 0 of 4 (0%) with CFA/incomplete Freund’s adjuvant, 0 of 4 (0%) with CpG 1826 mixed with ISA (no yMSP119), and 0 of 11 (0%) with CpG 1826 alone were completely protected against development of erythrocytic stage infection after sporozoite challenge. The adjuvant effect of CpG ODN 1826 was manifested as both significantly improved complete protection from malaria (defined as the absence of detectable erythrocytic form parasites) (P = 0.007, chi square) and reduced parasite burden in infected mice. In vivo depletions of interleukin-12 and gamma interferon cytokines and CD4+ and CD8+ T cells in vaccinated mice had no significant effect on immunity. On the other hand, immunoglobulin G (IgG) isotype levels appeared to correlate with protection. Inclusion of CpG ODN 1826 in the yMSP119 plus ISA vaccine contributed towards the induction of higher levels of IgG2a and IgG2b (Th1 type) antibodies, suggesting that CpG ODN 1826 caused a shift towards a Th1 type of immune response that could be responsible for the higher degree of protective immunity. Our results indicate that this potent adjuvant formulation should be further evaluated for use in clinical trials of recombinant malarial vaccine candidates. PMID:14742540

A phenolic glycoside from Flacourtia indica induces heme mediated oxidative stress in Plasmodium falciparum and attenuates malaria pathogenesis in mice.

PubMed

Singh, Shiv Vardan; Manhas, Ashan; Singh, Suriya P; Mishra, Sonali; Tiwari, Nimisha; Kumar, Parmanand; Shanker, Karuna; Srivastava, Kumkum; Sashidhara, Koneni V; Pal, Anirban

2017-07-01

Flacourtia indica is especially popular among the various communities of many African countries where it is being used traditionally for the treatment of malaria. In our previous report, we have identified some phenolic glycosides from the aerial parts of F. indica as promising antiplasmodial agents under in vitro conditions. Antimalarial bioprospection of F. indica derived phenolic glycoside in Swiss mice (in vivo) with special emphasis on its mode of action. Chloroquine sensitive strain of Plasmodium falciparum was routinely cultured and used for the in vitro studies. The in vivo antimalarial potential of phenolic glycoside was evaluated against P. berghei in Swiss mice through an array of parameters viz., hematological, biochemical, chemo-suppression and mean survival time. 2-(6-benzoyl-β-d-glucopyranosyloxy)-7-(1α, 2α, 6α-trihydroxy-3-oxocyclohex-4-enoyl)-5-hydroxybenzyl alcohol (CPG), a phenolic glycoside isolated from the aerial parts of F. indica was found to exhibit promising antiplasmodial activity by arresting the P. falciparum growth at the trophozoite stage. Spectroscopic investigations reveal that CPG possesses a strong binding affinity with free heme moieties. In addition, these interactions lead to the inhibition of heme polymerization in malaria parasite, augmenting oxidative stress, and delaying the rapid growth of parasite. Under in-vivo condition, CPG exhibited significant antimalarial activity against P. berghei at 50 and 75mg/kg body weight through chemo-suppression of parasitemia and ameliorating the parasite induced inflammatory and oxidative (hepatic) imbalance in the experimental mice. CPG was found to be a potential antimalarial constituent of F. indica with an explored mechanism of action, which also offers the editing choices for developing CPG based antimalarial chemotypes. Copyright © 2017 Elsevier GmbH. All rights reserved.

TLR9 Ligands Induce S100A8 in Macrophages via a STAT3-Dependent Pathway which Requires IL-10 and PGE2

PubMed Central

Hsu, Kenneth; Chung, Yuen Ming; Endoh, Yasumi; Geczy, Carolyn L.

2014-01-01

S100A8 and S100A9 are highly-expressed calcium-binding proteins in neutrophils and monocytes, and in subsets of macrophages in inflammatory lesions. Unmethylated CpG motifs found in bacterial and viral DNA are potent activators of innate immunity via Toll-like receptor 9 (TLR9). S100A8, but not S100A9, mRNA and protein was directly induced by CpG-DNA in murine and human macrophages. Induction in murine macrophages peaked at 16 h. CpG-DNA-induced S100A8 required de novo protein synthesis; IL-10 and Prostaglandin E2 (PGE2) synergistically enhanced expression and promoted earlier gene induction. Inhibitors of endogenous IL-10, PGE2, and the E prostanoid (EP) 4 receptor strongly suppressed S100A8 expression, particularly when combined. Thus, S100A8 induction by E. coli DNA required both IL-10 and PGE2/EP4 signaling. The MAPKs, PI3K and JAK pathways were essential, whereas ERK1/2 appeared to play a direct role. S100A8 induction by CpG-DNA was controlled at the transcriptional level. The promoter region responsible for activation, either directly, or indirectly via IL-10 and PGE2, was located within a −178 to −34-bp region and required STAT3 binding. Because of the robust links connecting IL-10 and PGE2 with an anti-inflammatory macrophage phenotype, the induction profile of S100A8 strongly indicates a role for this protein in resolution of inflammation. PMID:25098409

TLR9 ligands induce S100A8 in macrophages via a STAT3-dependent pathway which requires IL-10 and PGE2.

PubMed

Hsu, Kenneth; Chung, Yuen Ming; Endoh, Yasumi; Geczy, Carolyn L

2014-01-01

S100A8 and S100A9 are highly-expressed calcium-binding proteins in neutrophils and monocytes, and in subsets of macrophages in inflammatory lesions. Unmethylated CpG motifs found in bacterial and viral DNA are potent activators of innate immunity via Toll-like receptor 9 (TLR9). S100A8, but not S100A9, mRNA and protein was directly induced by CpG-DNA in murine and human macrophages. Induction in murine macrophages peaked at 16 h. CpG-DNA-induced S100A8 required de novo protein synthesis; IL-10 and Prostaglandin E2 (PGE2) synergistically enhanced expression and promoted earlier gene induction. Inhibitors of endogenous IL-10, PGE2, and the E prostanoid (EP) 4 receptor strongly suppressed S100A8 expression, particularly when combined. Thus, S100A8 induction by E. coli DNA required both IL-10 and PGE2/EP4 signaling. The MAPKs, PI3K and JAK pathways were essential, whereas ERK1/2 appeared to play a direct role. S100A8 induction by CpG-DNA was controlled at the transcriptional level. The promoter region responsible for activation, either directly, or indirectly via IL-10 and PGE2, was located within a -178 to -34-bp region and required STAT3 binding. Because of the robust links connecting IL-10 and PGE2 with an anti-inflammatory macrophage phenotype, the induction profile of S100A8 strongly indicates a role for this protein in resolution of inflammation.

Porphyromonas gingivalis and related bacteria: from colonial pigmentation to the type IX secretion system and gliding motility

PubMed Central

Nakayama, K

2015-01-01

Porphyromonas gingivalis is a gram-negative, non-motile, anaerobic bacterium implicated as a major pathogen in periodontal disease. P. gingivalis grows as black-pigmented colonies on blood agar, and many bacteriologists have shown interest in this property. Studies of colonial pigmentation have revealed a number of important findings, including an association with the highly active extracellular and surface proteinases called gingipains that are found in P. gingivalis. The Por secretion system, a novel type IX secretion system (T9SS), has been implicated in gingipain secretion in studies using non-pigmented mutants. In addition, many potent virulence proteins, including the metallocarboxypeptidase CPG70, 35 kDa hemin-binding protein HBP35, peptidylarginine deiminase PAD and Lys-specific serine endopeptidase PepK, are secreted through the T9SS. These findings have not been limited to P. gingivalis but have been extended to other bacteria belonging to the phylum Bacteroidetes. Many Bacteroidetes species possess the T9SS, which is associated with gliding motility for some of these bacteria. PMID:25546073

Impact of polyunsaturated and saturated fat overfeeding on the DNA-methylation pattern in human adipose tissue: a randomized controlled trial.

PubMed

Perfilyev, Alexander; Dahlman, Ingrid; Gillberg, Linn; Rosqvist, Fredrik; Iggman, David; Volkov, Petr; Nilsson, Emma; Risérus, Ulf; Ling, Charlotte

2017-04-01

Background: Dietary fat composition can affect ectopic lipid accumulation and, thereby, insulin resistance. Diets that are high in saturated fatty acids (SFAs) or polyunsaturated fatty acids (PUFAs) have different metabolic responses. Objective: We investigated whether the epigenome of human adipose tissue is affected differently by dietary fat composition and general overfeeding in a randomized trial. Design: We studied the effects of 7 wk of excessive SFA ( n = 17) or PUFA ( n = 14) intake (+750 kcal/d) on the DNA methylation of ∼450,000 sites in human subcutaneous adipose tissue. Both diets resulted in similar body weight increases. We also combined the data from the 2 groups to examine the overall effect of overfeeding on the DNA methylation in adipose tissue. Results: The DNA methylation of 4875 Cytosine-phosphate-guanine (CpG) sites was affected differently between the 2 diets. Furthermore, both the SFA and PUFA diets increased the mean degree of DNA methylation in adipose tissue, particularly in promoter regions. However, although the mean methylation was changed in 1797 genes [e.g., alpha-ketoglutarate dependent dioxygenase ( FTO ), interleukin 6 ( IL6 ), insulin receptor ( INSR ), neuronal growth regulator 1 ( NEGR1 ), and proopiomelanocortin ( POMC )] by PUFAs, only 125 genes [e.g., adiponectin, C1Q and collagen domain containing ( ADIPOQ )] were changed by SFA overfeeding. In addition, the SFA diet significantly altered the expression of 28 transcripts [e.g., acyl-CoA oxidase 1 ( ACOX1 ) and FAT atypical cadherin 1 ( FAT1 )], whereas the PUFA diet did not significantly affect gene expression. When the data from the 2 diet groups were combined, the mean methylation of 1444 genes, including fatty acid binding protein 1 ( FABP1 ), fatty acid binding protein 2 ( FABP2 ), melanocortin 2 receptor ( MC2R ), MC3R , PPARG coactivator 1 α ( PPARGC1A ), and tumor necrosis factor ( TNF ), was changed in adipose tissue by overfeeding. Moreover, the baseline DNA methylation of 12 CpG sites that was annotated to 9 genes [e.g., mitogen-activated protein kinase 7 ( MAPK7 ), melanin concentrating hormone receptor 1 ( MCHR1 ), and splicing factor SWAP homolog ( SFRS8 )] was associated with the degree of weight increase in response to extra energy intake. Conclusions: SFA overfeeding and PUFA overfeeding induce distinct epigenetic changes in human adipose tissue. In addition, we present data that suggest that baseline DNA methylation can predict weight increase in response to overfeeding in humans. This trial was registered at clinicaltrials.gov as NCT01427140. © 2017 American Society for Nutrition.

Cell Context Dependent p53 Genome-Wide Binding Patterns and Enrichment at Repeats

DOE PAGES

Botcheva, Krassimira; McCorkle, Sean R.

2014-11-21

The p53 ability to elicit stress specific and cell type specific responses is well recognized, but how that specificity is established remains to be defined. Whether upon activation p53 binds to its genomic targets in a cell type and stress type dependent manner is still an open question. Here we show that the p53 binding to the human genome is selective and cell context-dependent. We mapped the genomic binding sites for the endogenous wild type p53 protein in the human cancer cell line HCT116 and compared them to those we previously determined in the normal cell line IMR90. We reportmore » distinct p53 genome-wide binding landscapes in two different cell lines, analyzed under the same treatment and experimental conditions, using the same ChIP-seq approach. This is evidence for cell context dependent p53 genomic binding. The observed differences affect the p53 binding sites distribution with respect to major genomic and epigenomic elements (promoter regions, CpG islands and repeats). We correlated the high-confidence p53 ChIP-seq peaks positions with the annotated human repeats (UCSC Human Genome Browser) and observed both common and cell line specific trends. In HCT116, the p53 binding was specifically enriched at LINE repeats, compared to IMR90 cells. The p53 genome-wide binding patterns in HCT116 and IMR90 likely reflect the different epigenetic landscapes in these two cell lines, resulting from cancer-associated changes (accumulated in HCT116) superimposed on tissue specific differences (HCT116 has epithelial, while IMR90 has mesenchymal origin). In conclusion, our data support the model for p53 binding to the human genome in a highly selective manner, mobilizing distinct sets of genes, contributing to distinct pathways.« less

Genome-wide screen of ovary-specific DNA methylation in polycystic ovary syndrome.

PubMed

Yu, Ying-Ying; Sun, Cui-Xiang; Liu, Yin-Kun; Li, Yan; Wang, Li; Zhang, Wei

2015-07-01

To compare genome-wide DNA methylation profiles in ovary tissue from women with polycystic ovary syndrome (PCOS) and healthy controls. Case-control study matched for age and body mass index. University-affiliated hospital. Ten women with PCOS who underwent ovarian drilling to induce ovulation and 10 healthy women who were undergoing laparoscopic sterilization, hysterectomy for benign conditions, diagnostic laparoscopy for pelvic pain, or oophorectomy for nonovarian indications. None. Genome-wide DNA methylation patterns determined by immunoprecipitation and microarray (MeDIP-chip) analysis. The methylation levels were statistically significantly higher in CpG island shores (CGI shores), which lie outside of core promoter regions, and lower within gene bodies in women with PCOS relative to the controls. In addition, high CpG content promoters were the most frequently hypermethylated promoters in PCOS ovaries but were more often hypomethylated in controls. Second, 872 CGIs, specifically methylated in PCOS, represented 342 genes that could be associated with various molecular functions, including protein binding, hormone activity, and transcription regulator activity. Finally, methylation differences were validated in seven genes by methylation-specific polymerase chain reaction. These genes correlated to several functional families related to the pathogenesis of PCOS and may be potential biomarkers for this disease. Our results demonstrated that epigenetic modification differs between PCOS and normal ovaries, which may help to further understand the pathophysiology of this disease. Copyright © 2015 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

Regulation of the mouse Treacher Collins syndrome homolog (Tcof1) promoter through differential repression of constitutive expression.

PubMed

Shows, Kathryn H; Shiang, Rita

2008-11-01

Treacher Collins syndrome is an autosomal-dominant mandibulofacial dysostosis caused by haploinsufficiency of the TCOF1 gene product treacle. Mouse Tcof1 protein is approximately 61% identical and 71% similar to treacle, and heterozygous knockout of Tcof1 causes craniofacial malformation. Tcof1 expression is high in developing neural crest, but much lower in other tissues. To investigate this dual regulation, highly conserved regions upstream of TCOF1 homologs were tested through deletion and mutation reporter assays, and conserved predicted transcription factor binding sites were assessed through chromatin binding studies. Assays were performed in mouse P19 embryonic carcinoma cells and in HEK293 cells to determine differential activation in cell types at different stages of differentiation. Binding of Cebpb, Zfp161, and Sp1 transcription factors was specific to the Tcof1 regulatory region in P19 cells. The Zfp161 binding site demonstrated P19 cell-specific repression, while the Sp1/Sp3 candidate site demonstrated HEK293 cell-specific activation. Moreover, presence of c-myb and Zfp161 transcripts was specific to P19 cells. A minimal promoter fragment from -253 to +43 bp directs constitutive expression in both cell types, and dual regulation of Tcof1 appears to be through differential repression of this minimal promoter. The CpG island at the transcription start site remains unmethylated in P19 cells, 11.5 dpc mouse embryonic tissue, and adult mouse ear, which supports constitutive activation of the Tcof1 promoter.

Amyloid protein-mediated differential DNA methylation status regulates gene expression in Alzheimer's disease model cell line

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sung, Hye Youn; Choi, Eun Nam; Ahn Jo, Sangmee

2011-11-04

Highlights: Black-Right-Pointing-Pointer Genome-wide DNA methylation pattern in Alzheimer's disease model cell line. Black-Right-Pointing-Pointer Integrated analysis of CpG methylation and mRNA expression profiles. Black-Right-Pointing-Pointer Identify three Swedish mutant target genes; CTIF, NXT2 and DDR2 gene. Black-Right-Pointing-Pointer The effect of Swedish mutation on alteration of DNA methylation and gene expression. -- Abstract: The Swedish mutation of amyloid precursor protein (APP-sw) has been reported to dramatically increase beta amyloid production through aberrant cleavage at the beta secretase site, causing early-onset Alzheimer's disease (AD). DNA methylation has been reported to be associated with AD pathogenesis, but the underlying molecular mechanism of APP-sw-mediated epigenetic alterationsmore » in AD pathogenesis remains largely unknown. We analyzed genome-wide interplay between promoter CpG DNA methylation and gene expression in an APP-sw-expressing AD model cell line. To identify genes whose expression was regulated by DNA methylation status, we performed integrated analysis of CpG methylation and mRNA expression profiles, and identified three target genes of the APP-sw mutant; hypomethylated CTIF (CBP80/CBP20-dependent translation initiation factor) and NXT2 (nuclear exporting factor 2), and hypermethylated DDR2 (discoidin domain receptor 2). Treatment with the demethylating agent 5-aza-2 Prime -deoxycytidine restored mRNA expression of these three genes, implying methylation-dependent transcriptional regulation. The profound alteration in the methylation status was detected at the -435, -295, and -271 CpG sites of CTIF, and at the -505 to -341 region in the promoter of DDR2. In the promoter region of NXT2, only one CpG site located at -432 was differentially unmethylated in APP-sw cells. Thus, we demonstrated the effect of the APP-sw mutation on alteration of DNA methylation and subsequent gene expression. This epigenetic regulatory mechanism may contribute to the pathogenesis of AD.« less

Cell Cycle-Dependent Recruitment of Polycomb Proteins to the ASNS Promoter Counteracts C/ebp-Mediated Transcriptional Activation in Bombyx mori

PubMed Central

Li, Zhiqing; Cheng, Daojun; Mon, Hiroaki; Zhu, Li; Xu, Jian; Tatsuke, Tsuneyuki; Lee, Jae Man; Xia, Qingyou; Kusakabe, Takahiro

2013-01-01

Epigenetic modifiers and transcription factors contribute to developmentally programmed gene expression. Here, we establish a functional link between epigenetic regulation by Polycomb group (PcG) proteins and transcriptional regulation by C/ebp that orchestrates the correct expression of Bombyx mori asparagine synthetase (BmASNS), a gene involved in the biosynthesis of asparagine. We show that the cis-regulatory elements of YY1-binding motifs and the CpG island present on the BmASNS promoter are required for the recruitment of PcG proteins and the subsequent deposition of the epigenetic repression mark H3K27me3. RNAi-mediated knockdown of PcG genes leads to derepression of the BmASNS gene via the recruitment of activators, including BmC/ebp, to the promoter. Intriguingly, we find that PcG proteins and BmC/ebp can dynamically modulate the transcriptional output of the BmASNS target in a cell cycle-dependent manner. It will be essential to suppress BmASNS expression by PcG proteins at the G2/M phase of the cell cycle in the presence of BmC/ebp activator. Thus, our results provide a novel insight into the molecular mechanism underlying the recruitment and regulation of the PcG system at a discrete gene locus in Bombyx mori. PMID:23382816

Adjuvant guided polarization of the immune humoral response against a protective multicomponent antigenic protein (Q) from Leishmania infantum. A CpG + Q mix protects Balb/c mice from infection.

PubMed

Parody, N; Soto, M; Requena, J M; Alonso, C

2004-01-01

It has been shown that vaccination with three doses of the Leishmania infantum poly-protein Q containing five genetically fused antigenic determinants from the Lip2a, Lip2b, H2A and P0 proteins, mixed with BCG induces clearance of parasites in 9 out of 10 Leishmania infantum-infected Beagle dogs, in addition to clinical protection. In the present paper we analysed the immunogenic potential of the poly-protein Q and the specificity and polarization of the response against the antigenic determinants of Q when mixed with various adjuvants. The data showed that the Q protein had high intrinsic immunogenic potential and that it was able to induce a long-lasting IgG response. The IgM immunogenic potential of the poly-protein was mainly due to the LiP2a and LiP2b determinants, whereas the IgG immunogenic potential was mainly due to the LiP2a component. It was observed that the protein itself elicited a mixed IgG2a/IgG1 response and that the determinants of Q were endowed with different IgG2a/IgG1 potential. It was also observed that the adjuvants did not influence the intensity or specificity of the IgM response but that they modulated the intensity, the specificity and the polarization of the IgG response against the determinants of Q. CpG-ODN motifs or double-stranded DNA plasmids containing CpG motifs when mixed with Q induced a predominant IgG2a response mainly observed at early stages post-immunization. The data showed that a CpG + Q mix induced significant protection against L. infantum infection in Balb/c mice.

CpG Methylation Analysis of HPV16 in Laser Capture Microdissected Archival Tissue and Whole Tissue Sections from High Grade Anal Squamous Intraepithelial Lesions: A Potential Disease Biomarker

PubMed Central

Molano, Monica; Tabrizi, Sepehr N.; Garland, Suzanne M.; Roberts, Jennifer M.; Machalek, Dorothy A.; Phillips, Samuel; Chandler, David; Hillman, Richard J.; Grulich, Andrew E.; Jin, Fengyi; Poynten, I. Mary; Templeton, David J.; Cornall, Alyssa M.

2016-01-01

Incidence and mortality rates of anal cancer are increasing globally. More than 90% of anal squamous cell carcinomas (ASCC) are associated with human papillomavirus (HPV). Studies on HPV-related anogenital lesions have shown that patterns of methylation of viral and cellular DNA targets could potentially be developed as disease biomarkers. Lesion-specific DNA isolated from formalin-fixed paraffin-embedded (FFPE) tissues from existing or prospective patient cohorts may constitute a valuable resource for methylation analysis. However, low concentrations of DNA make these samples technically challenging to analyse using existing methods. We therefore set out to develop a sensitive and reproducible nested PCR-pyrosequencing based method to accurately quantify methylation at 10 CpG sites within the E2BS1, E2BS2,3,4 and Sp1 binding sites in the viral upstream regulatory region of HPV16 genome. Methylation analyses using primary and nested PCR-pyrosequencing on 52 FFPE tissue [26 paired whole tissue sections (WTS) and laser capture microdissected (LCM) tissues] from patients with anal squamous intraepithelial lesions was performed. Using nested PCR, methylation results were obtained for the E2BS1, E2BS2,3,4 and Sp1 binding sites in 86.4% of the WTS and 81.8% of the LCM samples. Methylation patterns were strongly correlated within median values of matched pairs of WTS and LCM sections, but overall methylation was higher in LCM samples at different CpG sites. High grade lesions showed low methylation levels in the E2BS1 and E2BS2 regions, with increased methylation detected in the E2BS,3,4/Sp1 regions, showing the highest methylation at CpG site 37. The method developed is highly sensitive in samples with low amounts of DNA and demonstrated to be suitable for archival samples. Our data shows a possible role of specific methylation in the HPV16 URR for detection of HSIL. PMID:27529629

CpG Methylation Analysis of HPV16 in Laser Capture Microdissected Archival Tissue and Whole Tissue Sections from High Grade Anal Squamous Intraepithelial Lesions: A Potential Disease Biomarker.

PubMed

Molano, Monica; Tabrizi, Sepehr N; Garland, Suzanne M; Roberts, Jennifer M; Machalek, Dorothy A; Phillips, Samuel; Chandler, David; Hillman, Richard J; Grulich, Andrew E; Jin, Fengyi; Poynten, I Mary; Templeton, David J; Cornall, Alyssa M

2016-01-01

Incidence and mortality rates of anal cancer are increasing globally. More than 90% of anal squamous cell carcinomas (ASCC) are associated with human papillomavirus (HPV). Studies on HPV-related anogenital lesions have shown that patterns of methylation of viral and cellular DNA targets could potentially be developed as disease biomarkers. Lesion-specific DNA isolated from formalin-fixed paraffin-embedded (FFPE) tissues from existing or prospective patient cohorts may constitute a valuable resource for methylation analysis. However, low concentrations of DNA make these samples technically challenging to analyse using existing methods. We therefore set out to develop a sensitive and reproducible nested PCR-pyrosequencing based method to accurately quantify methylation at 10 CpG sites within the E2BS1, E2BS2,3,4 and Sp1 binding sites in the viral upstream regulatory region of HPV16 genome. Methylation analyses using primary and nested PCR-pyrosequencing on 52 FFPE tissue [26 paired whole tissue sections (WTS) and laser capture microdissected (LCM) tissues] from patients with anal squamous intraepithelial lesions was performed. Using nested PCR, methylation results were obtained for the E2BS1, E2BS2,3,4 and Sp1 binding sites in 86.4% of the WTS and 81.8% of the LCM samples. Methylation patterns were strongly correlated within median values of matched pairs of WTS and LCM sections, but overall methylation was higher in LCM samples at different CpG sites. High grade lesions showed low methylation levels in the E2BS1 and E2BS2 regions, with increased methylation detected in the E2BS,3,4/Sp1 regions, showing the highest methylation at CpG site 37. The method developed is highly sensitive in samples with low amounts of DNA and demonstrated to be suitable for archival samples. Our data shows a possible role of specific methylation in the HPV16 URR for detection of HSIL.

REST–Mediated Recruitment of Polycomb Repressor Complexes in Mammalian Cells

PubMed Central

Landt, Eskild; Agrawal-Singh, Shuchi; Bak, Mads; Tommerup, Niels; Rappsilber, Juri; Södersten, Erik; Hansen, Klaus

2012-01-01

Polycomb Repressive Complex (PRC) 1 and PRC2 regulate genes involved in differentiation and development. However, the mechanism for how PRC1 and PRC2 are recruited to genes in mammalian cells is unclear. Here we present evidence for an interaction between the transcription factor REST, PRC1, and PRC2 and show that RNF2 and REST co-regulate a number of neuronal genes in human teratocarcinoma cells (NT2-D1). Using NT2-D1 cells as a model of neuronal differentiation, we furthermore showed that retinoic-acid stimulation led to displacement of PRC1 at REST binding sites, reduced H3K27Me3, and increased gene expression. Genome-wide analysis of Polycomb binding in Rest−/− and Eed−/− mouse embryonic stem (mES) cells showed that Rest was required for PRC1 recruitment to a subset of Polycomb regulated neuronal genes. Furthermore, we found that PRC1 can be recruited to Rest binding sites independently of CpG islands and the H3K27Me3 mark. Surprisingly, PRC2 was frequently increased around Rest binding sites located in CpG-rich regions in the Rest−/− mES cells, indicating a more complex interplay where Rest also can limit PRC2 recruitment. Therefore, we propose that Rest has context-dependent functions for PRC1- and PRC2- recruitment, which allows this transcription factor to act both as a recruiter of Polycomb as well as a limiting factor for PRC2 recruitment at CpG islands. PMID:22396653

dbCPG: A web resource for cancer predisposition genes.

PubMed

Wei, Ran; Yao, Yao; Yang, Wu; Zheng, Chun-Hou; Zhao, Min; Xia, Junfeng

2016-06-21

Cancer predisposition genes (CPGs) are genes in which inherited mutations confer highly or moderately increased risks of developing cancer. Identification of these genes and understanding the biological mechanisms that underlie them is crucial for the prevention, early diagnosis, and optimized management of cancer. Over the past decades, great efforts have been made to identify CPGs through multiple strategies. However, information on these CPGs and their molecular functions is scattered. To address this issue and provide a comprehensive resource for researchers, we developed the Cancer Predisposition Gene Database (dbCPG, Database URL: http://bioinfo.ahu.edu.cn:8080/dbCPG/index.jsp), the first literature-based gene resource for exploring human CPGs. It contains 827 human (724 protein-coding, 23 non-coding, and 80 unknown type genes), 637 rats, and 658 mouse CPGs. Furthermore, data mining was performed to gain insights into the understanding of the CPGs data, including functional annotation, gene prioritization, network analysis of prioritized genes and overlap analysis across multiple cancer types. A user-friendly web interface with multiple browse, search, and upload functions was also developed to facilitate access to the latest information on CPGs. Taken together, the dbCPG database provides a comprehensive data resource for further studies of cancer predisposition genes.

Distinctive Klf4 mutants determine preference for DNA methylation status

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hashimoto, Hideharu; Wang, Dongxue; Steves, Alyse N.

Reprogramming of mammalian genome methylation is critically important but poorly understood. Klf4, a transcription factor directing reprogramming, contains a DNA binding domain with three consecutive C2H2 zinc fingers. Klf4 recognizes CpG or TpG within a specific sequence. Mouse Klf4 DNA binding domain has roughly equal affinity for methylated CpG or TpG, and slightly lower affinity for unmodified CpG. The structural basis for this key preference is unclear, though the side chain of Glu446 is known to contact the methyl group of 5-methylcytosine (5mC) or thymine (5-methyluracil). We examined the role of Glu446 by mutagenesis. Substituting Glu446 with aspartate (E446D) resultedmore » in preference for unmodified cytosine, due to decreased affinity for 5mC. In contrast, substituting Glu446 with proline (E446P) increased affinity for 5mC by two orders of magnitude. Structural analysis revealed hydrophobic interaction between the proline's aliphatic cyclic structure and the 5-methyl group of the pyrimidine (5mC or T). As in wild-type Klf4 (E446), the proline at position 446 does not interact directly with either the 5mC N4 nitrogen or the thymine O4 oxygen. In contrast, the unmethylated cytosine's exocyclic N4 amino group (NH2) and its ring carbon C5 atom hydrogen bond directly with the aspartate carboxylate of the E446D variant. Both of these interactions would provide a preference for cytosine over thymine, and the latter one could explain the E446D preference for unmethylated cytosine. Finally, we evaluated the ability of these Klf4 mutants to regulate transcription of methylated and unmethylated promoters in a luciferase reporter assay.« less

Cell cloning-based transcriptome analysis in Rett patients: relevance to the pathogenesis of Rett syndrome of new human MeCP2 target genes.

PubMed

Nectoux, J; Fichou, Y; Rosas-Vargas, H; Cagnard, N; Bahi-Buisson, N; Nusbaum, P; Letourneur, F; Chelly, J; Bienvenu, T

2010-07-01

More than 90% of Rett syndrome (RTT) patients have heterozygous mutations in the X-linked methyl-CpG binding protein 2 (MECP2) gene that encodes the methyl-CpG-binding protein 2, a transcriptional modulator. Because MECP2 is subjected to X chromosome inactivation (XCI), girls with RTT either express the wild-type or mutant allele in each individual cell. To test the consequences of MECP2 mutations resulting from a genome-wide transcriptional dysregulation and to identify its target genes in a system that circumvents the functional mosaicism resulting from XCI, we carried out gene expression profiling of clonal populations derived from fibroblast primary cultures expressing exclusively either the wild-type or the mutant MECP2 allele. Clonal cultures were obtained from skin biopsy of three RTT patients carrying either a non-sense or a frameshift MECP2 mutation. For each patient, gene expression profiles of wild-type and mutant clones were compared by oligonucleotide expression microarray analysis. Firstly, clustering analysis classified the RTT patients according to their genetic background and MECP2 mutation. Secondly, expression profiling by microarray analysis and quantitative RT-PCR indicated four up-regulated genes and five down-regulated genes significantly dysregulated in all our statistical analysis, including excellent potential candidate genes for the understanding of the pathophysiology of this neurodevelopmental disease. Thirdly, chromatin immunoprecipitation analysis confirmed MeCP2 binding to respective CpG islands in three out of four up-regulated candidate genes and sequencing of bisulphite-converted DNA indicated that MeCP2 preferentially binds to methylated-DNA sequences. Most importantly, the finding that at least two of these genes (BMCC1 and RNF182) were shown to be involved in cell survival and/or apoptosis may suggest that impaired MeCP2 function could alter the survival of neurons thus compromising brain function without inducing cell death.

Genome-wide DNA methylation profiling identifies ALDH1A3 promoter methylation as a prognostic predictor in G-CIMP- primary glioblastoma.

PubMed

Zhang, Wei; Yan, Wei; You, Gan; Bao, Zhaoshi; Wang, Yongzhi; Liu, Yanwei; You, Yongping; Jiang, Tao

2013-01-01

To date, the aberrations in the DNA methylation patterns that are associated with different prognoses of G-CIMP- primary GBMs remain to be elucidated. Here, DNA methylation profiling of primary GBM tissues from 13 long-term survivors (LTS; overall survival ⩾18months) and 20 short-term survivors (STS; overall survival ⩽9months) was performed. Then G-CIMP+ samples were excluded. The differentially expressed CpG loci were identified between residual 18 STS and 9 LTS G-CIMP- samples. Methylation levels of 11 CpG loci (10genes) were statistically significantly lower, and 43 CpG loci (40genes) were statistically significantly higher in the tumor tissues of LTS than those of STS G-CIMP- samples (P<0.01). Of the 43 CpG loci that were hypermethylated in LTS G-CIMP- samples, 3 CpG loci localized in the promoter of ALDH1A3. Furthermore, using an independent validation cohort containing 37 primary GBM samples without IDH1 mutation and MGMT promoter methylation, the hypermethylation status of ALDH1A3 promoter predicted a better prognosis with an accompanied low expression of ALDH1A3 protein. Taken together, our results defined prognosis-related methylation signatures systematically for the first time in G-CIMP- primary GBMs. ALDH1A3 promoter methylation conferred a favorable prognosis in G-CIMP- primary GBMs. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

Neurotoxic Doses of Chronic Methamphetamine Trigger Retrotransposition of the Identifier Element in Rat Dorsal Dentate Gyrus

PubMed Central

Moszczynska, Anna; Burghardt, Kyle J.; Yu, Dongyue

2017-01-01

Short interspersed elements (SINEs) are typically silenced by DNA hypermethylation in somatic cells, but can retrotranspose in proliferating cells during adult neurogenesis. Hypomethylation caused by disease pathology or genotoxic stress leads to genomic instability of SINEs. The goal of the present investigation was to determine whether neurotoxic doses of binge or chronic methamphetamine (METH) trigger retrotransposition of the identifier (ID) element, a member of the rat SINE family, in the dentate gyrus genomic DNA. Adult male Sprague-Dawley rats were treated with saline or high doses of binge or chronic METH and sacrificed at three different time points thereafter. DNA methylation analysis, immunohistochemistry and next-generation sequencing (NGS) were performed on the dorsal dentate gyrus samples. Binge METH triggered hypomethylation, while chronic METH triggered hypermethylation of the CpG-2 site. Both METH regimens were associated with increased intensities in poly(A)-binding protein 1 (PABP1, a SINE regulatory protein)-like immunohistochemical staining in the dentate gyrus. The amplification of several ID element sequences was significantly higher in the chronic METH group than in the control group a week after METH, and they mapped to genes coding for proteins regulating cell growth and proliferation, transcription, protein function as well as for a variety of transporters. The results suggest that chronic METH induces ID element retrotransposition in the dorsal dentate gyrus and may affect hippocampal neurogenesis. PMID:28272323

The Human ARF Cell Cycle Regulatory Gene Promoter Is a CpG Island Which Can Be Silenced by DNA Methylation and Down-Regulated by Wild-Type p53

PubMed Central

Robertson, Keith D.; Jones, Peter A.

1998-01-01

The INK4a/ARF locus encodes two proteins involved in tumor suppression in a manner virtually unique in mammalian cells. Distinct first exons, driven from separate promoters, splice onto a common exon 2 and 3 but utilize different reading frames to produce two completely distinct proteins, both of which play roles in cell cycle control. INK4a, a critical element of the retinoblastoma gene pathway, binds to and inhibits the activities of CDK4 and CDK6, while ARF, a critical element of the p53 pathway, increases the level of functional p53 via interaction with MDM2. Here we clone and characterize the promoter of the human ARF gene and show that it is a CpG island characteristic of a housekeeping gene which contains numerous Sp1 sites. Both ARF and INK4a are coordinately expressed in cells except when their promoter regions become de novo methylated. In one of these situations, ARF transcription could be reactivated by treatment with the DNA methylation inhibitor 5-aza-2′-deoxycytidine, and the reactivation kinetics of ARF and INK4a were found to differ slightly in a cell line in which both genes were silenced by methylation. The ARF promoter was also found to be highly responsive to E2F1 expression, in keeping with previous results at the RNA level. Lastly, transcription from the ARF promoter was down-regulated by wild-type p53 expression, and the magnitude of the effect correlated with the status of the endogenous p53 gene. This finding points to the existence of an autoregulatory feedback loop between p53, MDM2, and ARF, aimed at keeping p53 levels in check. PMID:9774662

Preferential epigenetic programming of estrogen response after in utero xenoestrogen (bisphenol-A) exposure

PubMed Central

Jorgensen, Elisa M.; Alderman, Myles H.; Taylor, Hugh S.

2016-01-01

Bisphenol-A (BPA) is an environmentally ubiquitous estrogen-like endocrine-disrupting compound. Exposure to BPA in utero has been linked to female reproductive disorders, including endometrial hyperplasia and breast cancer. Estrogens are an etiological factor in many of these conditions. We sought to determine whether in utero exposure to BPA altered the global CpG methylation pattern of the uterine genome, subsequent gene expression, and estrogen response. Pregnant mice were exposed to an environmentally relevant dose of BPA or DMSO control. Uterine DNA and RNA were examined by using methylated DNA immunoprecipitation methylation microarray, expression microarray, and quantitative PCR. In utero BPA exposure altered the global CpG methylation profile of the uterine genome and subsequent gene expression. The effect on gene expression was not apparent until sexual maturation, which suggested that estrogen response was the primary alteration. Indeed, prenatal BPA exposure preferentially altered adult estrogen-responsive gene expression. Changes in estrogen response were accompanied by altered methylation that preferentially affected estrogen receptor-α (ERα)–binding genes. The majority of genes that demonstrated both altered expression and ERα binding had decreased methylation. BPA selectively altered the normal developmental programming of estrogen-responsive genes via modification of the genes that bind ERα. Gene–environment interactions driven by early life xenoestrogen exposure likely contributes to increased risk of estrogen-related disease in adults.—Jorgensen, E. M., Alderman, M. H., III, Taylor, H. S. Preferential epigenetic programming of estrogen response after in utero xenoestrogen (bisphenol-A) exposure. PMID:27312807

Genome-wide mapping and analysis of active promoters in mouse embryonic stem cells and adult organs

PubMed Central

Barrera, Leah O.; Li, Zirong; Smith, Andrew D.; Arden, Karen C.; Cavenee, Webster K.; Zhang, Michael Q.; Green, Roland D.; Ren, Bing

2008-01-01

By integrating genome-wide maps of RNA polymerase II (Polr2a) binding with gene expression data and H3ac and H3K4me3 profiles, we characterized promoters with enriched activity in mouse embryonic stem cells (mES) as well as adult brain, heart, kidney, and liver. We identified ∼24,000 promoters across these samples, including 16,976 annotated mRNA 5′ ends and 5153 additional sites validating cap-analysis of gene expression (CAGE) 5′ end data. We showed that promoters with CpG islands are typically non-tissue specific, with the majority associated with Polr2a and the active chromatin modifications in nearly all the tissues examined. By contrast, the promoters without CpG islands are generally associated with Polr2a and the active chromatin marks in a tissue-dependent way. We defined 4396 tissue-specific promoters by adapting a quantitative index of tissue-specificity based on Polr2a occupancy. While there is a general correspondence between Polr2a occupancy and active chromatin modifications at the tissue-specific promoters, a subset of them appear to be persistently marked by active chromatin modifications in the absence of detectable Polr2a binding, highlighting the complexity of the functional relationship between chromatin modification and gene expression. Our results provide a resource for exploring promoter Polr2a binding and epigenetic states across pluripotent and differentiated cell types in mammals. PMID:18042645

Regulation of the Mouse Treacher Collins Syndrome Homolog (Tcof1) Promoter Through Differential Repression of Constitutive Expression

PubMed Central

Shiang, Rita

2008-01-01

Treacher Collins syndrome is an autosomal-dominant mandibulofacial dysostosis caused by haploinsufficiency of the TCOF1 gene product treacle. Mouse Tcof1 protein is approximately 61% identical and 71% similar to treacle, and heterozygous knockout of Tcof1 causes craniofacial malformation. Tcof1 expression is high in developing neural crest, but much lower in other tissues. To investigate this dual regulation, highly conserved regions upstream of TCOF1 homologs were tested through deletion and mutation reporter assays, and conserved predicted transcription factor binding sites were assessed through chromatin binding studies. Assays were performed in mouse P19 embryonic carcinoma cells and in HEK293 cells to determine differential activation in cell types at different stages of differentiation. Binding of Cebpb, Zfp161, and Sp1 transcription factors was specific to the Tcof1 regulatory region in P19 cells. The Zfp161 binding site demonstrated P19 cell–specific repression, while the Sp1/Sp3 candidate site demonstrated HEK293 cell–specific activation. Moreover, presence of c-myb and Zfp161 transcripts was specific to P19 cells. A minimal promoter fragment from −253 to +43 bp directs constitutive expression in both cell types, and dual regulation of Tcof1 appears to be through differential repression of this minimal promoter. The CpG island at the transcription start site remains unmethylated in P19 cells, 11.5 dpc mouse embryonic tissue, and adult mouse ear, which supports constitutive activation of the Tcof1 promoter. PMID:18771418

CpG methylation of HPV 16 LCR at E2 binding site proximal to P97 is associated with cervical cancer in presence of intact E2.

PubMed

Bhattacharjee, Bornali; Sengupta, Sharmila

2006-10-25

Human papillomavirus type 16 (HPV-16) E2 protein negatively regulates transcription of the E6 and E7 genes. This study was done to test the hypothesis that methylation of the HPV 16 long control region (LCR) is overrepresented among cervical cancer (CaCx) cases compared to cytologically normal controls harboring intact E2 gene. Methylation of the E2 binding site (E2BS-I), proximal to the P97 promoter, was assessed by HpaII/ MspI restriction digestion while McrBC digestion was used to assess LCR-E6 (7289-540) for 57 CaCx samples and 15 normal controls. E2BS-I methylation was found to be significantly higher (56.14%) in cases compared to (20%) controls [OR(age-adjusted) (95% CI): 4.53 (1.05-19.43) p=0.042]. The difference between cases (54.39%) and controls (40%) with respect to LCR-E6 methylation status [OR(age-adjusted) (95% CI): 1.77(0.5-6.3); p=0.38] was not significant. Sequencing of a randomly selected set of 13 methylated malignant samples revealed absence or rare presence, of methylation at CpGs 7579, 7535, 7683 and 7862 respectively. Methylation was found to be more at CpGs within E2 binding sites proximal to the P97 promoter. These results indicate the involvement of E2 binding site methylation in presence of intact E2, leading to loss of E2 repressor activity in CaCx.

Aldosterone alters the chromatin structure of the murine endothelin-1 gene.

PubMed

Welch, Amanda K; Jeanette Lynch, I; Gumz, Michelle L; Cain, Brian D; Wingo, Charles S

2016-08-15

Aldosterone increases sodium reabsorption in the renal collecting duct and systemic blood pressure. Paradoxically, aldosterone also induces transcription of the endothelin-1 (Edn1) gene to increase protein (ET-1) levels, which inhibits sodium reabsorption. Here we investigated changes in the chromatin structure of the Edn1 gene of collecting duct cell lines in response to aldosterone treatment. The Edn1 gene has a CpG island that encompasses the transcription start site and four sites in the 5' regulatory region previously linked to transcriptional regulation. The chromatin structure of the Edn1 gene was investigated using a quantitative PCR-based DNaseI hypersensitivity assay in murine hepatocyte (AML12), renal cortical collecting duct (mpkCCDC14), outer medullary collecting duct1 (OMCD1), and inner medullary collecting duct-3 (IMCD-3) cell lines. The CpG island was uniformly accessible. One calcium-responsive NFAT element remained at low chromatin accessibility in all cell lines under all conditions tested. However, the second calcium responsive NFAT element located at -1563bp upstream became markedly more accessible in IMCD-3 cells exposed to aldosterone. Importantly, one established aldosterone hormone response element HRE at -671bp relative to the transcription start site was highly accessible, and another HRE (-551bp) became more accessible in aldosterone-treated IMCD-3 and OMCD1 cells. The evidence supports a model in which aldosterone activation of the mineralocorticoid receptor (MR) results in the MR-hormone complex binding at HRE at -671bp to open chromatin structure around other regulatory elements in the Edn1 gene. Published by Elsevier Inc.

dbCPG: A web resource for cancer predisposition genes

PubMed Central

Wei, Ran; Yao, Yao; Yang, Wu; Zheng, Chun-Hou; Zhao, Min; Xia, Junfeng

2016-01-01

Cancer predisposition genes (CPGs) are genes in which inherited mutations confer highly or moderately increased risks of developing cancer. Identification of these genes and understanding the biological mechanisms that underlie them is crucial for the prevention, early diagnosis, and optimized management of cancer. Over the past decades, great efforts have been made to identify CPGs through multiple strategies. However, information on these CPGs and their molecular functions is scattered. To address this issue and provide a comprehensive resource for researchers, we developed the Cancer Predisposition Gene Database (dbCPG, Database URL: http://bioinfo.ahu.edu.cn:8080/dbCPG/index.jsp), the first literature-based gene resource for exploring human CPGs. It contains 827 human (724 protein-coding, 23 non-coding, and 80 unknown type genes), 637 rats, and 658 mouse CPGs. Furthermore, data mining was performed to gain insights into the understanding of the CPGs data, including functional annotation, gene prioritization, network analysis of prioritized genes and overlap analysis across multiple cancer types. A user-friendly web interface with multiple browse, search, and upload functions was also developed to facilitate access to the latest information on CPGs. Taken together, the dbCPG database provides a comprehensive data resource for further studies of cancer predisposition genes. PMID:27192119

Promoter DNA methylation regulates progranulin expression and is altered in FTLD

PubMed Central

2013-01-01

Background Frontotemporal lobar degeneration (FTLD) is a heterogeneous group of neurodegenerative diseases associated with personality changes and progressive dementia. Loss-of-function mutations in the growth factor progranulin (GRN) cause autosomal dominant FTLD, but so far the pathomechanism of sporadic FTLD is unclear. Results We analyzed whether DNA methylation in the GRN core promoter restricts GRN expression and, thus, might promote FTLD in the absence of GRN mutations. GRN expression in human lymphoblast cell lines is negatively correlated with methylation at several CpG units within the GRN promoter. Chronic treatment with the DNA methyltransferase inhibitor 5-aza-2′-deoxycytidine (DAC) strongly induces GRN mRNA and protein levels. In a reporter assay, CpG methylation blocks transcriptional activity of the GRN core promoter. In brains of FTLD patients several CpG units in the GRN promoter are significantly hypermethylated compared to age-matched healthy controls, Alzheimer and Parkinson patients. These CpG motifs are critical for GRN promoter activity in reporter assays. Furthermore, DNA methyltransferase 3a (DNMT3a) is upregulated in FTLD patients and overexpression of DNMT3a reduces GRN promoter activity and expression. Conclusion These data suggest that altered DNA methylation is a novel pathomechanism for FTLD that is potentially amenable to targeted pharmacotherapy. PMID:24252647

Combined DNA methylation and gene expression profiling in gastrointestinal stromal tumors reveals hypomethylation of SPP1 as an independent prognostic factor.

PubMed

Haller, Florian; Zhang, Jitao David; Moskalev, Evgeny A; Braun, Alexander; Otto, Claudia; Geddert, Helene; Riazalhosseini, Yasser; Ward, Aoife; Balwierz, Aleksandra; Schaefer, Inga-Marie; Cameron, Silke; Ghadimi, B Michael; Agaimy, Abbas; Fletcher, Jonathan A; Hoheisel, Jörg; Hartmann, Arndt; Werner, Martin; Wiemann, Stefan; Sahin, Ozgür

2015-03-01

Gastrointestinal stromal tumors (GISTs) have distinct gene expression patterns according to localization, genotype and aggressiveness. DNA methylation at CpG dinucleotides is an important mechanism for regulation of gene expression. We performed targeted DNA methylation analysis of 1.505 CpG loci in 807 cancer-related genes in a cohort of 76 GISTs, combined with genome-wide mRNA expression analysis in 22 GISTs, to identify signatures associated with clinicopathological parameters and prognosis. Principal component analysis revealed distinct DNA methylation patterns associated with anatomical localization, genotype, mitotic counts and clinical follow-up. Methylation of a single CpG dinucleotide in the non-CpG island promoter of SPP1 was significantly correlated with shorter disease-free survival. Hypomethylation of this CpG was an independent prognostic parameter in a multivariate analysis compared to anatomical localization, genotype, tumor size and mitotic counts in a cohort of 141 GISTs with clinical follow-up. The epigenetic regulation of SPP1 was confirmed in vitro, and the functional impact of SPP1 protein on tumorigenesis-related signaling pathways was demonstrated. In summary, SPP1 promoter methylation is a novel and independent prognostic parameter in GISTs, and might be helpful in estimating the aggressiveness of GISTs from the intermediate-risk category. © 2014 UICC.

Enhanced mucosal immune responses induced by a combined candidate mucosal vaccine based on Hepatitis A virus and Hepatitis E virus structural proteins linked to tuftsin.

PubMed

Gao, Yan; Su, Qiudong; Yi, Yao; Jia, Zhiyuan; Wang, Hao; Lu, Xuexin; Qiu, Feng; Bi, Shengli

2015-01-01

Hepatitis A virus (HAV) and Hepatitis E virus (HEV) are the most common causes of infectious hepatitis. These viruses are spread largely by the fecal-oral route and lead to clinically important disease in developing countries. To evaluate the potential of targeting hepatitis A and E infection simultaneously, a combined mucosal candidate vaccine was developed with the partial open reading frame 2 (ORF2) sequence (aa 368-607) of HEV (HE-ORF2) and partial virus protein 1 (VP1) sequence (aa 1-198) of HAV (HA-VP1), which included the viral neutralization epitopes. Tuftsin is an immunostimulatory peptide which can enhance the immunogenicity of a protein by targeting it to macrophages and dendritic cells. Here, we developed a novel combined protein vaccine by conjugating tuftsin to HE-ORF2 and HA-VP1 and used synthetic CpG oligodeoxynucleotides (ODNs) as the adjuvant. Subsequent experiments in BALB/c mice demonstrated that tuftsin enhanced the serum-specific IgG and IgA antibodies against HEV and HAV at the intestinal, vaginal and pulmonary interface when delivered intranasally. Moreover, mice from the intranasally immunized tuftsin group (HE-ORF2-tuftsin + HA-VP1-tuftsin + CpG) showed higher levels of IFN-γ-secreting splenocytes (Th1 response) and ratio of CD4+/CD8+ T cells than those of the no-tuftsin group (HE-ORF2 + HA-VP1 + CpG). Thus, the tuftsin group generated stronger humoral and cellular immune responses compared with the no-tuftsin group. Moreover, enhanced responses to the combined protein vaccine were obtained by intranasal immunization compared with intramuscular injection. By integrating HE-ORF2, HA-VP1 and tuftsin in a vaccine, this study validated an important concept for further development of a combined mucosal vaccine against hepatitis A and E infection.

Cyclical Dynamics and Control of a Neuromechanical System

DTIC Science & Technology

2012-01-01

of the membrane potentials and synaptic conductances of neurons in the CPG model, or the lengths, velocities, and calcium concentrations in a muscle...empirical data. • We found that muscle is strongly self-stabilizing when activated cyclically, possibly because of the nonlinearity in how calcium binds and...only its natural calcium dynamics and length, velocity, and tension relationships, is strongly self-stabilizing. I plan to submit these results as an

Evaluation of Different Oligonucleotide Base Substitutions at CpG Binding sites in Multiplex Bisulfite-PCR sequencing.

PubMed

Lu, Jennifer; Ru, Kelin; Candiloro, Ida; Dobrovic, Alexander; Korbie, Darren; Trau, Matt

2017-03-22

Multiplex bisulfite-PCR sequencing is a convenient and scalable method for the quantitative determination of the methylation state of target DNA regions. A challenge of this application is the presence of CpGs in the same region where primers are being placed. A common solution to the presence of CpGs within a primer-binding region is to substitute a base degeneracy at the cytosine position. However, the efficacy of different substitutions and the extent to which bias towards methylated or unmethylated templates may occur has never been evaluated in bisulfite multiplex sequencing applications. In response, we examined the performance of four different primer substitutions at the cytosine position of CpG's contained within the PCR primers. In this study, deoxyinosine-, 5-nitroindole-, mixed-base primers and primers with an abasic site were evaluated across a series of methylated controls. Primers that contained mixed- or deoxyinosine- base modifications performed most robustly. Mixed-base primers were further selected to determine the conditions that induce bias towards methylated templates. This identified an optimized set of conditions where the methylated state of bisulfite DNA templates can be accurately assessed using mixed-base primers, and expands the scope of bisulfite resequencing assays when working with challenging templates.

Whole Genome DNA Methylation Analysis of Obstructive Sleep Apnea: IL1R2, NPR2, AR, SP140 Methylation and Clinical Phenotype

PubMed Central

Chen, Yung-Che; Chen, Ting-Wen; Su, Mao-Chang; Chen, Chung-Jen; Chen, Kuang-Den; Liou, Chia-Wei; Tang, Petrus; Wang, Ting-Ya; Chang, Jen-Chieh; Wang, Chin-Chou; Lin, Hsin-Ching; Chin, Chien-Hung; Huang, Kuo-Tung; Lin, Meng-Chih; Hsiao, Chang-Chun

2016-01-01

Study Objectives: We hypothesized that DNA methylation patterns may contribute to disease severity or the development of hypertension and excessive daytime sleepiness (EDS) in patients with obstructive sleep apnea (OSA). Methods: Illumina's (San Diego, CA, USA) DNA methylation 27-K assay was used to identify differentially methylated loci (DML). DNA methylation levels were validated by pyrosequencing. A discovery cohort of 15 patients with OSA and 6 healthy subjects, and a validation cohort of 72 patients with sleep disordered breathing (SDB). Results: Microarray analysis identified 636 DMLs in patients with OSA versus healthy subjects, and 327 DMLs in patients with OSA and hypertension versus those without hypertension. In the validation cohort, no significant difference in DNA methylation levels of six selected genes was found between the primary snoring subjects and OSA patients (primary outcome). However, a secondary outcome analysis showed that interleukin-1 receptor 2 (IL1R2) promoter methylation (−114 cytosine followed by guanine dinucleotide sequence [CpG] site) was decreased and IL1R2 protein levels were increased in the patients with SDB with an oxygen desaturation index > 30. Androgen receptor (AR) promoter methylation (−531 CpG site) and AR protein levels were both increased in the patients with SDB with an oxygen desaturation index > 30. Natriuretic peptide receptor 2 (NPR2) promoter methylation (−608/−618 CpG sites) were decreased, whereas levels of both NPR2 and serum C type natriuretic peptide protein were increased in the SDB patients with EDS. Speckled protein 140 (SP140) promoter methylation (−194 CpG site) was increased, and SP140 protein levels were decreased in the patients with SDB and EDS. Conclusions: IL1R2 hypomethylation and AR hypermethylation may constitute an important determinant of disease severity, whereas NPR2 hypomethylation and SP140 hypermethylation may provide a biomarker for vulnerability to EDS in OSA. Commentary: A commentary on this article appears in this issue on page 723. Citation: Chen YC, Chen TW, Su MC, Chen CJ, Chen KD, Liou CW, Tang P, Wang TY, Chang JC, Wang CC, Lin HC, Chin CH, Huang KT, Lin MC, Hsiao CC. Whole genome DNA methylation analysis of obstructive sleep apnea: IL1R2, NPR2, AR, SP140 methylation and clinical phenotype. SLEEP 2016;39(4):743–755. PMID:26888452

A recombinant fusion protein and DNA vaccines against foot-and-mouth disease virus type Asia 1 infection in guinea pigs.

PubMed

Zhang, Q; Zhu, M W; Yang, Y Q; Shao, M; Zhang, Z Y; Lan, H Y; Yan, W Y; Wu, J J; Zheng, Z X

2003-01-01

On the basis of amino acid (aa) sequence of the tandem repeat 133-158-20-34-133-158 which consisted of aa 133-158 of VP1 and aa 20-34 of VP4 of Foot-and-mouth disease virus (FMDV) type Asia 1 a recombinant prokaryotic expression vector pAS1-P encoding a fusion protein and eukaryotic expression vectors pAS1-E and pAS1-EdeltaCpG-ODN representing DNA vaccines were constructed. Guinea pigs immunized with these vaccines showed both neutralizing antibody and T cell proliferation responses. FMDV challenge tests for the first time showed that the recombinant fusion protein and pAS1-E and pAS1-EdeltaCpG-ODN vaccines protected 86%, 60% and 43% of guinea pigs from FMDV type Asia1 challenge, respectively. The results also indicated that the immune response of animals treated with the vector pAS1-E containing an oligodeoxynucleotide (ODN), which consisted of immunostimulatory cytosine-phosphate-guanosine (CpG) motifs, was augmented by CpG ODN.

Analysis of a Cholera Toxin B Subunit (CTB) and Human Mucin 1 (MUC1) Conjugate Protein in a MUC1 Tolerant Mouse Model

PubMed Central

Pinkhasov, Julia; Alvarez, M. Lucrecia; Pathangey, Latha B.; Tinder, Teresa L.; Mason, Hugh S.; Walmsley, Amanda M.; Gendler, Sandra J.; Mukherjee, Pinku

2011-01-01

Since epithelial mucin 1 (MUC1) is associated with several adenocarcinomas at mucosal sites, it is pertinent to test the efficacy of a mucosally targeted vaccine formulation. The B subunit of the Vibrio cholerae cholera toxin (CTB) has great potential to act as a mucosal carrier for subunit vaccines. In the present study we evaluated whether a MUC1 tandem repeat (TR) peptide chemically linked to CTB would break self-antigen tolerance in the transgenic MUC1 tolerant mouse model (MUC1.Tg) through oral or parenteral immunizations. We report that oral immunization with the CTB-MUC1 conjugate along with mucosal adjuvant, unmethylated CpG oligodeoxynucleotide (ODN) and interleukin-12 (IL-12), did not break self-antigen tolerance in MUC1.Tg mice, but induced a strong humoral response in wild-type C57BL/6 mice. However, self-antigen tolerance in the MUC1.Tg mouse model was broken after parenteral immunizations with different doses of the CTB-MUC1 conjugate protein and with the adjuvant CpG ODN co-delivered with CTB-MUC1. Importantly, mice immunized systemically with CpG ODN alone and with CTB-MUC1 exhibited decreased tumor burden when challenged with a mammary gland tumor cell line that expresses human MUC1. PMID:20824430

Analysis of a cholera toxin B subunit (CTB) and human mucin 1 (MUC1) conjugate protein in a MUC1-tolerant mouse model.

PubMed

Pinkhasov, Julia; Alvarez, M Lucrecia; Pathangey, Latha B; Tinder, Teresa L; Mason, Hugh S; Walmsley, Amanda M; Gendler, Sandra J; Mukherjee, Pinku

2010-12-01

Since epithelial mucin 1 (MUC1) is associated with several adenocarcinomas at the mucosal sites, it is pertinent to test the efficacy of a mucosally targeted vaccine formulation. The B subunit of the Vibrio cholerae cholera toxin (CTB) has great potential to act as a mucosal carrier for subunit vaccines. In the present study we evaluated whether a MUC1 tandem repeat (TR) peptide chemically linked to CTB would break self-antigen tolerance in the transgenic MUC1-tolerant mouse model (MUC1.Tg) through oral or parenteral immunizations. We report that oral immunization with the CTB-MUC1 conjugate along with mucosal adjuvant, unmethylated CpG oligodeoxynucleotide (ODN) and interleukin-12 (IL-12) did not break self-antigen tolerance in MUC1.Tg mice, but induced a strong humoral response in wild-type C57BL/6 mice. However, self-antigen tolerance in the MUC1.Tg mouse model was broken after parenteral immunizations with different doses of the CTB-MUC1 conjugate protein and with the adjuvant CpG ODN co-delivered with CTB-MUC1. Importantly, mice immunized systemically with CpG ODN alone and with CTB-MUC1 exhibited decreased tumor burden when challenged with a mammary gland tumor cell line that expresses human MUC1.

Aging as an Epigenetic Phenomenon

PubMed Central

Ashapkin, Vasily V.; Kutueva, Lyudmila I.; Vanyushin, Boris F.

2017-01-01

Introduction: Hypermethylation of genes associated with promoter CpG islands, and hypomethylation of CpG poor genes, repeat sequences, transposable elements and intergenic genome sections occur during aging in mammals. Methylation levels of certain CpG sites display strict correlation to age and could be used as “epigenetic clock” to predict biological age. Multi-substrate deacetylases SIRT1 and SIRT6 affect aging via locus-specific modulations of chromatin structure and activity of multiple regulatory proteins involved in aging. Random errors in DNA methylation and other epigenetic marks during aging increase the transcriptional noise, and thus lead to enhanced phenotypic variation between cells of the same tissue. Such variation could cause progressive organ dysfunction observed in aged individuals. Multiple experimental data show that induction of NF-κB regulated gene sets occurs in various tissues of aged mammals. Upregulation of multiple miRNAs occurs at mid age leading to downregulation of enzymes and regulatory proteins involved in basic cellular functions, such as DNA repair, oxidative phosphorylation, intermediate metabolism, and others. Conclusion: Strong evidence shows that all epigenetic systems contribute to the lifespan control in various organisms. Similar to other cell systems, epigenome is prone to gradual degradation due to the genome damage, stressful agents, and other aging factors. But unlike mutations and other kinds of the genome damage, age-related epigenetic changes could be fully or partially reversed to a “young” state. PMID:29081695

Dendritic Cell-Based Immunotherapy of Breast Cancer: Modulation by CpG DNA

DTIC Science & Technology

2005-09-01

tumor-associated antigens and bacterial DNA oligodeoxynucleotides containing unmethylated CpG sequences (CpG DNA) further augment the immune priming...associated antigens by cytotoxic T lymphocytes, and bacterial DNA oligodeoxy- nucleotides containing unmethylated CpG sequences (CpG DNA) can further...further amplify their immunostimulatory capacity and bacterial DNA oligodeoxynucleotides (ODN) containing unmethylated CpG sequences (CpG DNA) provide such

Liposomal SLA co-incorporated with PO CpG ODNs or PS CpG ODNs induce the same protection against the murine model of leishmaniasis.

PubMed

Shargh, Vahid Heravi; Jaafari, Mahmoud Reza; Khamesipour, Ali; Jaafari, Iman; Jalali, Seyed Amir; Abbasi, Azam; Badiee, Ali

2012-06-06

First generation Leishmania vaccines consisting of whole killed parasites with or without adjuvants have reached phase 3 trial and failed to show enough efficacy mainly due to the lack of an appropriate adjuvant. In this study, the nuclease-resistant phosphorothioate CpG oligodeoxynucleotides (PS CpG) or nuclease-sensitive phosphodiester CpG ODNs (PO CpG) were used as adjuvants to enhance immunogenicity and rate of protection against leishmaniasis. Due to the susceptibility of PO CpG to nuclease degradation, an efficient liposomal delivery system was developed to protect them from degradation. 1, 2-dioleoyl-3-trimethylammonium-propane (DOTAP) as a cationic lipid was used because of its unique adjuvanticity and electrostatic interaction with negatively charged CpG ODNs. To evaluate the role of liposomal formulation in protection rate and enhanced immune response, BALB/c mice were immunized subcutaneously with liposomal soluble Leishmania antigens (SLA) co-incorporated with PO CpG (Lip-SLA-PO CpG), Lip-SLA-PS CpG, SLA+PO CpG, SLA+PS CpG, SLA or buffer. As criteria for protection, footpad swelling at the site of challenge, parasite loads, the levels of IFN-γ and IL-4, and the IgG subtypes were evaluated. The groups of mice receiving Lip-SLA-PO CpG or Lip-SLA-PS CpG showed a high protection rate compared with the control groups. In addition, there was no significant difference in immune response generation between mice immunized with PS CpG and the group receiving PO CpG when incorporated into the liposomes. The results suggested that liposomal form of PO CpG might be used instead of PS CpG in future vaccine formulations as an efficient adjuvant. Copyright © 2012 Elsevier Ltd. All rights reserved.

Effects of perinatal fluoride exposure on the expressions of miR-124 and miR-132 in hippocampus of mouse pups.

PubMed

Wang, Jixiang; Zhang, Yuliang; Guo, Zhenzhen; Li, Rui; Xue, Xingchen; Sun, Zilong; Niu, Ruiyan

2018-04-01

To investigate the effects of perinatal fluoride exposure on learning and memory ability of mouse offspring, ICR female mice were received different doses of sodium fluoride (0, 25, 50, 100 mg/L NaF) from pregnant day 7 to lactational day 21. Pups were exposed to fluoride through the cord blood and breast milk. Open field test showed that compared to the control group, perinatal fluoride exposure significantly decreased the number of entries into the center zone in 100 mg/L NaF group. In the eight-arm maze test, the number of working memory errors, reference memory errors, and the total arm entries were significantly increased in fluoride treatment groups, compared to the control group. Additionally, 100 mg/L NaF significantly elevated the expression levels of miR-124, miR-132, and DiGeorge syndrome chromosomal region 8 (DGCR8) in hippocampus of mouse pups at postnatal day (PND) 21. Contrarily, methyl CpG binding protein 2 (MeCP2) were dramatically reduced in 50 and 100 mg/L NaF groups, while cAMP-response element binding protein (CREB) mRNA level was significantly decreased in all fluoride groups. These findings suggested that the impairment of learning and memory in mouse offspring induced by perinatal fluoride exposure may partly result from the enhanced miR-124 and miR-132 and the alterations of their target genes. Copyright © 2018 Elsevier Ltd. All rights reserved.

Early-life lead exposure results in dose- and sex-specific effects on weight and epigenetic gene regulation in weanling mice

PubMed Central

Faulk, Christopher; Barks, Amanda; Liu, Kevin; Goodrich, Jaclyn M; Dolinoy, Dana C

2013-01-01

Aims Epidemiological and animal data suggest that the development of adult chronic conditions is influenced by early-life exposure-induced changes to the epigenome. This study investigates the effects of perinatal lead (Pb) exposure on DNA methylation and bodyweight in weanling mice. Materials & methods Viable yellow agouti (Avy) mouse dams were exposed to 0, 2.1, 16 and 32 ppm Pb acetate before conception through weaning. Epigenetic effects were evaluated by scoring coat color of Avy/a offspring and quantitative bisulfite sequencing of two retrotransposon-driven (Avy and CDK5 activator-binding protein intracisternal A particle element) and two imprinted (Igf2 and Igf2r) loci in tail DNA. Results Maternal blood Pb levels were below the limit of detection in controls, and 4.1, 25.1 and 32.1 μg/dl for each dose, respectively. Pb exposure was associated with a trend of increased wean bodyweight in males (p = 0.03) and altered coat color in Avy/a offspring. DNA methylation at Avy and the CDK5 activator-binding protein intracisternal A-particle element was significantly different from controls following a cubic trend (p = 0.04; p = 0.01), with male-specific effects at the Avy locus. Imprinted genes did not shift in methylation across exposures. Conclusion Dose- and sex-specific responses in bodyweight and DNA methylation indicate that Pb acts on the epigenome in a locus-specific fashion, dependent on the genomic feature hosting the CpG site of interest, and that sex is a factor in epigenetic response. PMID:24059796

The CpG island searcher: a new WWW resource.

PubMed

Takai, Daiya; Jones, Peter A

2003-01-01

Clusters of CpG dinucleotides in GC rich regions of the genome called "CpG islands" frequently occur in the 5' ends of genes. Methylation of CpG islands plays a role in transcriptional silencing in higher organisms in certain situations. We have established a CpG-island-extraction algorithm, which we previously developed [Takai and Jones, 2002], on a web site which has a simple user interface to identify CpG islands from submitted sequences of up to 50kb. The web site determines the locations of CpG islands using parameters (lower limit of %GC, ObsCpG/ExpCpG, length) set by the user, to display the value of parameters on each CpG island, and provides a graphical map of CpG dinucleotide distribution and borders of CpG islands. A command-line version of the CpG islands searcher has also been developed for larger sequences. The CpG Island Searcher was applied to the latest sequence and mapping information of human chromosomes 20, 21 and 22, and a total of 2345 CpG islands were extracted and 534 (23%) of them contained first coding exons and 650 (28%) contained other exons. The CpG Island Searcher is available on the World Wide Web at http://www.cpgislands.com or http://www.uscnorris.com/cpgislands/cpg.cgi.

Prenatal arsenic exposure and the epigenome: identifying sites of 5-methylcytosine alterations that predict functional changes in gene expression in newborn cord blood and subsequent birth outcomes.

PubMed

Rojas, Daniel; Rager, Julia E; Smeester, Lisa; Bailey, Kathryn A; Drobná, Zuzana; Rubio-Andrade, Marisela; Stýblo, Miroslav; García-Vargas, Gonzalo; Fry, Rebecca C

2015-01-01

Prenatal exposure to inorganic arsenic (iAs) is detrimental to the health of newborns and increases the risk of disease development later in life. Here we examined a subset of newborn cord blood leukocyte samples collected from subjects enrolled in the Biomarkers of Exposure to ARsenic (BEAR) pregnancy cohort in Gómez Palacio, Mexico, who were exposed to a range of drinking water arsenic concentrations (0.456-236 µg/l). Changes in iAs-associated DNA 5-methylcytosine methylation were assessed across 424,935 CpG sites representing 18,761 genes and compared with corresponding mRNA expression levels and birth outcomes. In the context of arsenic exposure, a total of 2919 genes were identified with iAs-associated differences in DNA methylation. Site-specific analyses identified DNA methylation changes that were most predictive of gene expression levels where CpG methylation within CpG islands positioned within the first exon, the 5' untranslated region and 200 bp upstream of the transcription start site yielded the most significant association with gene expression levels. A set of 16 genes was identified with correlated iAs-associated changes in DNA methylation and mRNA expression and all were highly enriched for binding sites of the early growth response (EGR) and CCCTC-binding factor (CTCF) transcription factors. Furthermore, DNA methylation levels of 7 of these genes were associated with differences in birth outcomes including gestational age and head circumference.These data highlight the complex interplay between DNA methylation, functional changes in gene expression and health outcomes and underscore the need for functional analyses coupled to epigenetic assessments. © The Author 2014. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Gene silencing of Nox4 by CpG island methylation during hepatocarcinogenesis in rats

PubMed Central

López-Álvarez, Guadalupe S.; Wojdacz, Tomasz K.; García-Cuellar, Claudia M.; Monroy-Ramírez, Hugo C.; Rodríguez-Segura, Miguel A.; Pacheco-Rivera, Ruth A.; Valencia-Antúnez, Carlos A.; Cervantes-Anaya, Nancy; Soto-Reyes, Ernesto; Vásquez-Garzón, Verónica R.; Sánchez-Pérez, Yesennia; Villa-Treviño, Saúl

2017-01-01

ABSTRACT The association between the downregulation of genes and DNA methylation in their CpG islands has been extensively studied as a mechanism that favors carcinogenesis. The objective of this study was to analyze the methylation of a set of genes selected based on their microarray expression profiles during the process of hepatocarcinogenesis. Rats were euthanized at: 24 h, 7, 11, 16 and 30 days and 5, 9, 12 and 18 months post-treatment. We evaluated the methylation status in the CpG islands of four deregulated genes (Casp3, Cldn1, Pex11a and Nox4) using methylation-sensitive high-resolution melting technology for the samples obtained from different stages of hepatocarcinogenesis. We did not observe methylation in Casp3, Cldn1 or Pex11a. However, Nox4 exhibited altered methylation patterns, reaching a maximum of 10%, even during the early stages of hepatocarcinogenesis. We observed downregulation of mRNA and protein of Nox4 (97.5% and 40%, respectively) after the first carcinogenic stimulus relative to the untreated samples. Our results suggest that Nox4 downregulation is associated with DNA methylation of the CpG island in its promoter. We propose that methylation is a mechanism that can silence the expression of Nox4, which could contribute to the acquisition of neoplastic characteristics during hepatocarcinogenesis in rats. PMID:27895046

The Composite of Bone Marrow Concentrate and PRP as an Alternative to Autologous Bone Grafting

PubMed Central

Hakimi, Mohssen; Grassmann, Jan-Peter; Betsch, Marcel; Schneppendahl, Johannes; Gehrmann, Sebastian; Hakimi, Ahmad-Reza; Kröpil, Patric; Sager, Martin; Herten, Monika; Wild, Michael; Windolf, Joachim; Jungbluth, Pascal

2014-01-01

One possible alternative to the application of autologous bone grafts represents the use of autologous bone marrow concentrate (BMC). The purpose of our study was to evaluate the potency of autologous platelet-rich plasma (PRP) in combination with BMC. In 32 mini-pigs a metaphyseal critical-size defect was surgically created at the proximal tibia. The animals were allocated to four treatment groups of eight animals each (1. BMC+CPG group, 2. BMC+CPG+PRP group, 3. autograft group, 4. CPG group). In the BMC+CPG group the defect was filled with autologous BMC in combination with calcium phosphate granules (CPG), whereas in the BMC+CPG+PRP group the defect was filled with the composite of autologous BMC, CPG and autologous PRP. In the autograft group the defect was filled with autologous cancellous graft, whereas in the CPG group the defect was filled with CPG solely. After 6 weeks radiological and histomorphometrical analysis showed significantly more new bone formation in the BMC+CPG+PRP group compared to the BMC+CPG group and the CPG group. There were no significant differences between the BMC+CPG+PRP group and the autograft group. In the PRP platelets were enriched significantly about 4.7-fold compared to native blood. In BMC the count of mononuclear cells increased significantly (3.5-fold) compared to the bone marrow aspirate. This study demonstrates that the composite of BMC+CPG+PRP leads to a significantly higher bone regeneration of critical-size defects at the proximal tibia in mini-pigs than the use of BMC+CPG without PRP. Furthermore, within the limits of the present study the composite BMC+CPG+PRP represents a comparable alternative to autologous bone grafting. PMID:24950251

Gold nanoparticle–M2e conjugate coformulated with CpG induces protective immunity against influenza A virus

PubMed Central

Tao, Wenqian; Ziemer, Katherine S; Gill, Harvinder S

2014-01-01

Aim: This study aimed to develop a novel influenza A vaccine by conjugating the highly conserved extracellular region of the matrix 2 protein (M2e) of influenza A virus to gold nanoparticles (AuNPs) and to test the vaccine in a mouse influenza challenge model. Materials & methods: Citrate-reduced AuNPs (diameter: 12 nm) were synthesized, and characterized by transmission electron microscopy and dynamic light scattering. M2e was conjugated to AuNPs through thiol–gold interactions to form M2e–AuNP conjugates. Particle stability was confirmed by UV–visible spectra, and M2e conjugation was further characterized by x-ray photoelectron spectroscopy. Mice were immunized with M2e–AuNPs with or without CpG (cytosine-guanine rich oligonucleotide) as an adjuvant with appropriate control groups. Sera was collected and M2e-specific immunoglobulin (IgG) was measured, and immunized mice were challenged with PR8-H1N1 influenza virus. Results: M2e-capped AuNPs could be lyophilized and stably resuspended in water. Intranasal vaccination of mice with M2e–AuNP conjugates induced M2e-specific IgG serum antibodies, which significantly increased upon addition of soluble CpG as adjuvant. Upon challenge with lethal PR8, mice vaccinated with M2e-AuNP conjugates were only partially protected, while mice that received soluble CpG as adjuvant in addition to M2e–AuNP were fully protected. Conclusion: Overall, this study demonstrates the potential of using the M2e–AuNP conjugates with CpG as an adjuvant as a platform for developing an influenza A vaccine. PMID:23829488

DNA methylation signatures of chronic low-grade inflammation are associated with complex diseases.

PubMed

Ligthart, Symen; Marzi, Carola; Aslibekyan, Stella; Mendelson, Michael M; Conneely, Karen N; Tanaka, Toshiko; Colicino, Elena; Waite, Lindsay L; Joehanes, Roby; Guan, Weihua; Brody, Jennifer A; Elks, Cathy; Marioni, Riccardo; Jhun, Min A; Agha, Golareh; Bressler, Jan; Ward-Caviness, Cavin K; Chen, Brian H; Huan, Tianxiao; Bakulski, Kelly; Salfati, Elias L; Fiorito, Giovanni; Wahl, Simone; Schramm, Katharina; Sha, Jin; Hernandez, Dena G; Just, Allan C; Smith, Jennifer A; Sotoodehnia, Nona; Pilling, Luke C; Pankow, James S; Tsao, Phil S; Liu, Chunyu; Zhao, Wei; Guarrera, Simonetta; Michopoulos, Vasiliki J; Smith, Alicia K; Peters, Marjolein J; Melzer, David; Vokonas, Pantel; Fornage, Myriam; Prokisch, Holger; Bis, Joshua C; Chu, Audrey Y; Herder, Christian; Grallert, Harald; Yao, Chen; Shah, Sonia; McRae, Allan F; Lin, Honghuang; Horvath, Steve; Fallin, Daniele; Hofman, Albert; Wareham, Nicholas J; Wiggins, Kerri L; Feinberg, Andrew P; Starr, John M; Visscher, Peter M; Murabito, Joanne M; Kardia, Sharon L R; Absher, Devin M; Binder, Elisabeth B; Singleton, Andrew B; Bandinelli, Stefania; Peters, Annette; Waldenberger, Melanie; Matullo, Giuseppe; Schwartz, Joel D; Demerath, Ellen W; Uitterlinden, André G; van Meurs, Joyce B J; Franco, Oscar H; Chen, Yii-Der Ida; Levy, Daniel; Turner, Stephen T; Deary, Ian J; Ressler, Kerry J; Dupuis, Josée; Ferrucci, Luigi; Ong, Ken K; Assimes, Themistocles L; Boerwinkle, Eric; Koenig, Wolfgang; Arnett, Donna K; Baccarelli, Andrea A; Benjamin, Emelia J; Dehghan, Abbas

2016-12-12

Chronic low-grade inflammation reflects a subclinical immune response implicated in the pathogenesis of complex diseases. Identifying genetic loci where DNA methylation is associated with chronic low-grade inflammation may reveal novel pathways or therapeutic targets for inflammation. We performed a meta-analysis of epigenome-wide association studies (EWAS) of serum C-reactive protein (CRP), which is a sensitive marker of low-grade inflammation, in a large European population (n = 8863) and trans-ethnic replication in African Americans (n = 4111). We found differential methylation at 218 CpG sites to be associated with CRP (P < 1.15 × 10 -7 ) in the discovery panel of European ancestry and replicated (P < 2.29 × 10 -4 ) 58 CpG sites (45 unique loci) among African Americans. To further characterize the molecular and clinical relevance of the findings, we examined the association with gene expression, genetic sequence variants, and clinical outcomes. DNA methylation at nine (16%) CpG sites was associated with whole blood gene expression in cis (P < 8.47 × 10 -5 ), ten (17%) CpG sites were associated with a nearby genetic variant (P < 2.50 × 10 -3 ), and 51 (88%) were also associated with at least one related cardiometabolic entity (P < 9.58 × 10 -5 ). An additive weighted score of replicated CpG sites accounted for up to 6% inter-individual variation (R2) of age-adjusted and sex-adjusted CRP, independent of known CRP-related genetic variants. We have completed an EWAS of chronic low-grade inflammation and identified many novel genetic loci underlying inflammation that may serve as targets for the development of novel therapeutic interventions for inflammation.

The correlation between pulmonary fibrosis and methylation of peripheral Smad3 in cases of pigeon breeder's lung in a Chinese Uygur population.

PubMed

Wu, Chao; Ding, Wei; Li, Qifeng; Wang, Wenyi; Deng, Mingqin; Jin, Rong; Pang, Baosen; Yang, Xiaohong

2017-06-27

Smad3 is a key protein in the transforming growth factor-beta (TGF-β)/Smad signaling pathway, which is involved in fibrosis in many organs. We investigated the relationship between Smad3 gene methylation and pulmonary fibrosis in pigeon breeder's lung (PBL). Twenty Uygur PBL patients with pulmonary fibrosis in Kashi between October 2015 and March 2016 were enrolled. Twenty PBL-free pigeon breeders and 20 healthy non-pigeon breeders enrolled during the same period constituted the negative and normal control groups, respectively. Participants' data and peripheral blood samples were collected, and three Smad3 CpG loci were examined. Distributions of CpG_2 and CpG_4 methylation rates did not differ across groups, whereas distributions of CpG_3 methylation rates were significantly different among the three groups. The CpG_3 methylation rate was significantly lower in the patient group than in the negative control group. Smad3 mRNA expression was significantly higher in the patient group than in the negative control group but did not differ between the two control groups. TGF-βlevels were significantly higher in the patient group than in either control group (both P<0.01). Smad3 gene methylation and Smad3 mRNA expression were negatively correlated, with a correlation coefficient of -0.84. The number of pigeons bred during the preceding three months was positively correlated with Smad3 mRNA expression, with a correlation coefficient of 0.77. Smad3 gene hypomethylation might promote pulmonary fibrosis in Uygur PBL patients via increased Smad3 mRNA expression. Smad3 methylation, Smad3 mRNA expression and TGF-β level were correlated with the number of pigeons bred by patients.

Exploiting Semantic Web Technologies to Develop OWL-Based Clinical Practice Guideline Execution Engines.

PubMed

Jafarpour, Borna; Abidi, Samina Raza; Abidi, Syed Sibte Raza

2016-01-01

Computerizing paper-based CPG and then executing them can provide evidence-informed decision support to physicians at the point of care. Semantic web technologies especially web ontology language (OWL) ontologies have been profusely used to represent computerized CPG. Using semantic web reasoning capabilities to execute OWL-based computerized CPG unties them from a specific custom-built CPG execution engine and increases their shareability as any OWL reasoner and triple store can be utilized for CPG execution. However, existing semantic web reasoning-based CPG execution engines suffer from lack of ability to execute CPG with high levels of expressivity, high cognitive load of computerization of paper-based CPG and updating their computerized versions. In order to address these limitations, we have developed three CPG execution engines based on OWL 1 DL, OWL 2 DL and OWL 2 DL + semantic web rule language (SWRL). OWL 1 DL serves as the base execution engine capable of executing a wide range of CPG constructs, however for executing highly complex CPG the OWL 2 DL and OWL 2 DL + SWRL offer additional executional capabilities. We evaluated the technical performance and medical correctness of our execution engines using a range of CPG. Technical evaluations show the efficiency of our CPG execution engines in terms of CPU time and validity of the generated recommendation in comparison to existing CPG execution engines. Medical evaluations by domain experts show the validity of the CPG-mediated therapy plans in terms of relevance, safety, and ordering for a wide range of patient scenarios.

Identification of the CIMP-like subtype and aberrant methylation of members of the chromosomal segregation and spindle assembly pathways in esophageal adenocarcinoma.

PubMed

Krause, Lutz; Nones, Katia; Loffler, Kelly A; Nancarrow, Derek; Oey, Harald; Tang, Yue Hang; Wayte, Nicola J; Patch, Ann Marie; Patel, Kalpana; Brosda, Sandra; Manning, Suzanne; Lampe, Guy; Clouston, Andrew; Thomas, Janine; Stoye, Jens; Hussey, Damian J; Watson, David I; Lord, Reginald V; Phillips, Wayne A; Gotley, David; Smithers, B Mark; Whiteman, David C; Hayward, Nicholas K; Grimmond, Sean M; Waddell, Nicola; Barbour, Andrew P

2016-04-01

The incidence of esophageal adenocarcinoma (EAC) has risen significantly over recent decades. Although survival has improved, cure rates remain poor, with <20% of patients surviving 5 years. This is the first study to explore methylome, transcriptome and ENCODE data to characterize the role of methylation in EAC. We investigate the genome-wide methylation profile of 250 samples including 125 EAC, 19 Barrett's esophagus (BE), 85 squamous esophagus and 21 normal stomach. Transcriptome data of 70 samples (48 EAC, 4 BE and 18 squamous esophagus) were used to identify changes in methylation associated with gene expression. BE and EAC showed similar methylation profiles, which differed from squamous tissue. Hypermethylated sites in EAC and BE were mainly located in CpG-rich promoters. A total of 18575 CpG sites associated with 5538 genes were differentially methylated, 63% of these genes showed significant correlation between methylation and mRNA expression levels. Pathways involved in tumorigenesis including cell adhesion, TGF and WNT signaling showed enrichment for genes aberrantly methylated. Genes involved in chromosomal segregation and spindle formation were aberrantly methylated. Given the recent evidence that chromothripsis may be a driver mechanism in EAC, the role of epigenetic perturbation of these pathways should be further investigated. The methylation profiles revealed two EAC subtypes, one associated with widespread CpG island hypermethylation overlapping H3K27me3 marks and binding sites of the Polycomb proteins. These subtypes were supported by an independent set of 89 esophageal cancer samples. The most hypermethylated tumors showed worse patient survival. © The Author 2016. Published by Oxford University Press.

Promoter methylation assay of SASH1 gene in hepatocellular carcinoma.

PubMed

Peng, Liu; Wei, He; Liren, Li

2014-01-01

To analyse the relationship between the expression of SASH1 and its methylation level in human hepatocellular carcinoma. Expression levels of SASH1 were examined with real-time PCR (RT-PCR) in tissues and cells, and methylation analysis was performed with MassArray. The expression levels of SASH1 were strongly reduced in liver cancer tissues compared with adjacent normal tissues. Quantitative methylation analysis by MassArray revealed different CpG sites in SASH1 promoter shared similar methylation pattern between liver cancer tissues and adjacent normal tissues and the CpG sites of significant difference in methylation level were found as follows: CpG_3, CpG_17, CpG_21.22, CpG_25, CpG_26.27, CpG_28, CpG_34.35.36 and CpG_51.52. Moreover, 5-aza-2'-deoxycytidine treatment of Hep-G2 cell line caused significant elevation of SASH1 mRNA. Based on these data, we propose that increase of DNA methylation degree in the promoter region of SASH1 gene, particularly CpG_26.27 sites, possibly repressed SASH1 expression in liver cancer.

The left end of rat L1 (L1Rn, long interspersed repeated) DNA which is a CpG island can function as a promoter.

PubMed Central

Nur, I; Pascale, E; Furano, A V

1988-01-01

Here we report that the 600 bp promoter-like region at the left end of a newly isolated and characterized rat L1 DNA element can activate the prokaryotic chloramphenicol acyltransferase gene in a rat cell line. Activation only occurs when the promoter region is oriented to the transferase gene as it is to the L1 protein encoding sequences and is 75% inhibited by methylation of just 5 of the 22 CpGs present in the promoter. The G + C rich promoter contains enough CpGs to qualify it as a CpG island, but in contrast to other CpG islands, genomic L1 promoters are fully methylated in both somatic cell and sperm DNA as judged by restriction enzyme analysis. Partial demethylation of the genomic promoters by treatment with 5-azacytidine failed to produce discrete L1 transcripts. The relationship of methylation to the evolutionary history and fate of the rat L1 promoter is discussed. Images PMID:2459662

‘Protected DNA Probes’ capable of strong hybridization without removal of base protecting groups

PubMed Central

Ohkubo, Akihiro; Kasuya, Rintaro; Sakamoto, Kazushi; Miyata, Kenichi; Taguchi, Haruhiko; Nagasawa, Hiroshi; Tsukahara, Toshifumi; Watanobe, Takuma; Maki, Yoshiyuki; Seio, Kohji; Sekine, Mitsuo

2008-01-01

We propose a new strategy called the ‘Protected DNA Probes (PDP) method’ in which appropriately protected bases selectively bind to the complementary bases without the removal of their base protecting groups. Previously, we reported that 4-N-acetylcytosine oligonucleotides (ac4C) exhibited a higher hybridization affinity for ssDNA than the unmodified oligonucleotides. For the PDP strategy, we created a modified adenine base and synthesized an N-acylated deoxyadenosine mimic having 6-N-acetyl-8-aza-7-deazaadenine (ac6az8c7A). It was found that PDP containing ac4C and ac6az8c7A exhibited higher affinity for the complementary ssDNA than the corresponding unmodified DNA probes and showed similar base recognition ability. Moreover, it should be noted that this PDP strategy could guarantee highly efficient synthesis of DNA probes on controlled pore glass (CPG) with high purity and thereby could eliminate the time-consuming procedures for isolating DNA probes. This strategy could also avoid undesired base-mediated elimination of DNA probes from CPG under basic conditions such as concentrated ammonia solution prescribed for removal of base protecting groups in the previous standard approach. Here, several successful applications of this strategy to single nucleotide polymorphism detection are also described in detail using PDPs immobilized on glass plates and those prepared on CPG plates, suggesting its potential usefulness. PMID:18272535

Enhanced sensitivity of CpG island search and primer design based on predicted CpG island position.

PubMed

Park, Hyun-Chul; Ahn, Eu-Ree; Jung, Ju Yeon; Park, Ji-Hye; Lee, Jee Won; Lim, Si-Keun; Kim, Won

2018-05-01

DNA methylation has important biological roles, such as gene expression regulation, as well as practical applications in forensics, such as in body fluid identification and age estimation. DNA methylation often occurs in the CpG site, and methylation within the CpG islands affects various cellular functions and is related to tissue-specific identification. Several programs have been developed to identify CpG islands; however, the size, location, and number of predicted CpG islands are not identical due to different search algorithms. In addition, they only provide structural information for predicted CpG islands without experimental information, such as primer design. We developed an analysis pipeline package, CpGPNP, to integrate CpG island prediction and primer design. CpGPNP predicts CpG islands more accurately and sensitively than other programs, and designs primers easily based on the predicted CpG island locations. The primer design function included standard, bisulfite, and methylation-specific PCR to identify the methylation of particular CpG sites. In this study, we performed CpG island prediction on all chromosomes and compared CpG island search performance of CpGPNP with other CpG island prediction programs. In addition, we compared the position of primers designed for a specific region within the predicted CpG island using other bisulfite PCR primer programs. The primers designed by CpGPNP were used to experimentally verify the amplification of the target region of markers for body fluid identification and age estimation. CpGPNP is freely available at http://forensicdna.kr/cpgpnp/. Copyright © 2018 Elsevier B.V. All rights reserved.

Murine Polyomavirus Virus-Like Particles Carrying Full-Length Human PSA Protect BALB/c Mice from Outgrowth of a PSA Expressing Tumor

PubMed Central

Eriksson, Mathilda; Andreasson, Kalle; Weidmann, Joachim; Lundberg, Kajsa; Tegerstedt, Karin

2011-01-01

Virus-like particles (VLPs) consist of capsid proteins from viruses and have been shown to be usable as carriers of protein and peptide antigens for immune therapy. In this study, we have produced and assayed murine polyomavirus (MPyV) VLPs carrying the entire human Prostate Specific Antigen (PSA) (PSA-MPyVLPs) for their potential use for immune therapy in a mouse model system. BALB/c mice immunized with PSA-MPyVLPs were only marginally protected against outgrowth of a PSA-expressing tumor. To improve protection, PSA-MPyVLPs were co-injected with adjuvant CpG, either alone or loaded onto murine dendritic cells (DCs). Immunization with PSA-MPyVLPs loaded onto DCs in the presence of CpG was shown to efficiently protect mice from tumor outgrowth. In addition, cellular and humoral immune responses after immunization were examined. PSA-specific CD4+ and CD8+ cells were demonstrated, but no PSA-specific IgG antibodies. Vaccination with DCs loaded with PSA-MPyVLPs induced an eight-fold lower titre of anti-VLP antibodies than vaccination with PSA-MPyVLPs alone. In conclusion, immunization of BALB/c mice with PSA-MPyVLPs, loaded onto DCs and co-injected with CpG, induces an efficient PSA-specific tumor protective immune response, including both CD4+ and CD8+ cells with a low induction of anti-VLP antibodies. PMID:21858228

High-throughput engineering of a mammalian genome reveals building principles of methylation states at CG rich regions.

PubMed

Krebs, Arnaud R; Dessus-Babus, Sophie; Burger, Lukas; Schübeler, Dirk

2014-09-26

The majority of mammalian promoters are CpG islands; regions of high CG density that require protection from DNA methylation to be functional. Importantly, how sequence architecture mediates this unmethylated state remains unclear. To address this question in a comprehensive manner, we developed a method to interrogate methylation states of hundreds of sequence variants inserted at the same genomic site in mouse embryonic stem cells. Using this assay, we were able to quantify the contribution of various sequence motifs towards the resulting DNA methylation state. Modeling of this comprehensive dataset revealed that CG density alone is a minor determinant of their unmethylated state. Instead, these data argue for a principal role for transcription factor binding sites, a prediction confirmed by testing synthetic mutant libraries. Taken together, these findings establish the hierarchy between the two cis-encoded mechanisms that define the DNA methylation state and thus the transcriptional competence of CpG islands.

Healthcare professionals' and policy makers' views on implementing a clinical practice guideline of hypertension management: a qualitative study.

PubMed

Lee, Ping Yein; Liew, Su May; Abdullah, Adina; Abdullah, Nurdiana; Ng, Chirk Jenn; Hanafi, Nik Sherina; Chia, Yook Chin; Lai, Pauline S M; Wong, Stalia S L; Khoo, Ee Ming

2015-01-01

Most studies have reported barriers to guideline usage mainly from doctors' perspective; few have reported the perspective of other stakeholders. This study aimed to determine the views and barriers to adherence of a national clinical practice guideline (CPG) on management of hypertension from the perspectives of policymakers, doctors and allied healthcare professionals. This study used a qualitative approach with purposive sampling. Seven in depth interviews and six focus group discussions were conducted with 35 healthcare professionals (policy makers, doctors, pharmacists and nurses) at a teaching hospital in Kuala Lumpur, Malaysia, between February and June 2013. All interviews were audio-recorded, transcribed verbatim and checked. Thematic approach was used to analyse the data. Two main themes and three sub-themes emerged from this study. The main themes were (1) variation in the use of CPG and (2) barriers to adherence to CPG. The three sub-themes for barriers were issues inherent to the CPG, systems and policy that is not supportive of CPG use, and attitudes and behaviour of stakeholders. The main users of the CPG were the primary care doctors. Pharmacists only partially use the guidelines, while nurses and policy makers were not using the CPG at all. Participants had suggested few strategies to improve usage and adherence to CPG. First, update the CPG regularly and keep its content simple with specific sections for allied health workers. Second, use technology to facilitate CPG accessibility and provide protected time for implementation of CPG recommendations. Third, incorporate local CPG in professional training, link CPG adherence to key performance indicators and provide incentives for its use. Barriers to the use of CPG hypertension management span across all stakeholders. The development and implementation of CPG focused mainly on doctors with lack of involvement of other healthcare stakeholders. Guidelines should be made simple, current, reliable, accessible, inclusive of all stakeholders and with good policy support.

Thermometric sensing of peroxide in organic media. Application to monitor the stability of RBP-retinol-HRP complex.

PubMed

Ramanathan, K; Jönsson, B R; Danielsson, B

2000-08-01

The stability of horseradish peroxidase (HRP) in aqueous and organic solvents is applied to develop a simple thermometric procedure to detect the binding of retinoic acid-HRP conjugate to retinol binding protein (RBP). Butanone peroxide (BP) in organic phase and hydrogen peroxide in aqueous phase is detected thermometrically on a HRP column, immobilized by cross-linking with glutaraldehyde on controlled pore glass (CPG). Acetone, acetonitrile, methanol, and 2-butanol are used for detection of BP, in the flow injection analysis (FIA) mode. A linear range between 1 and 50 mM BP is obtained in all the organic solvents with a precision of 5-7% (CV%). The magnitude and nature of the thermometric response is significantly different in each organic solvent. The stability of HRP in the organic phase is used to study the stability of a retinoic acid-HRP conjugate bound to immobilized RBP. The response of HRP (to 20 mM BP) in the retinoic acid-HRP conjugate is used as an indicator of the stability of the RBP-retinoic acid-HRP complex, after challenges with various organic/aqueous solvents. Both immobilized HRP and RBP are stable at least for 6 months. The effect of o-phenylene diamine on the thermometric response of HRP is also investigated. A scheme for the design of a thermometric retinol (vitamin A) biosensor is proposed.

A Knowledge-Modeling Approach to Integrate Multiple Clinical Practice Guidelines to Provide Evidence-Based Clinical Decision Support for Managing Comorbid Conditions.

PubMed

Abidi, Samina

2017-10-26

Clinical management of comorbidities is a challenge, especially in a clinical decision support setting, as it requires the safe and efficient reconciliation of multiple disease-specific clinical procedures to formulate a comorbid therapeutic plan that is both effective and safe for the patient. In this paper we pursue the integration of multiple disease-specific Clinical Practice Guidelines (CPG) in order to manage co-morbidities within a computerized Clinical Decision Support System (CDSS). We present a CPG integration framework-termed as COMET (Comorbidity Ontological Modeling & ExecuTion) that manifests a knowledge management approach to model, computerize and integrate multiple CPG to yield a comorbid CPG knowledge model that upon execution can provide evidence-based recommendations for handling comorbid patients. COMET exploits semantic web technologies to achieve (a) CPG knowledge synthesis to translate a paper-based CPG to disease-specific clinical pathways (CP) that include specialized co-morbidity management procedures based on input from domain experts; (b) CPG knowledge modeling to computerize the disease-specific CP using a Comorbidity CPG ontology; (c) CPG knowledge integration by aligning multiple ontologically-modeled CP to develop a unified comorbid CPG knowledge model; and (e) CPG knowledge execution using reasoning engines to derive CPG-mediated recommendations for managing patients with comorbidities. We present a web-accessible COMET CDSS that provides family physicians with CPG-mediated comorbidity decision support to manage Atrial Fibrillation and Chronic Heart Failure. We present our qualitative and quantitative analysis of the knowledge content and usability of COMET CDSS.

Exposure to Soy Protein Isolate From Conception Fails to Induce Epigenetic Changes in Viable Yellow Agouti (Avy/a) Mice, But Partially Blocks Hepatosteatosis and Altered Body Composition in Mice and Rats

USDA-ARS?s Scientific Manuscript database

Both beneficial and adverse health effects have been attributed to soy food consumption. Epigenetic programming through hypermethlylation of CpG sites on promoter regions may be a potential mechanism. Virgin a/a female and Avy/a male mice were fed AIN-93G diets made with either casein or soy protein...

Analysis of estrogen receptor β gene methylation in autistic males in a Chinese Han population.

PubMed

Wang, Xuelai; Liang, Shuang; Sun, Yi; Li, Haixin; Endo, Fumio; Nakao, Mitsuyoshi; Saitoh, Noriko; Wu, Lijie

2017-08-01

Autism spectrum disorder (ASD) is a neurodevelopment disorder with abnormalities of social interaction, communication and repetitive behaviors. The higher prevalence of ASD in men implies a potential relationship between sex hormones and ASD etiology. The ESR2 gene encodes estrogen receptor beta (ESR2) and plays an important role during brain development. A relationship between ESR2 and ASD has been suggested by studies on single nucleotide polymorphisms and mRNA and protein expression levels in ASD patients. Here, we explored the possible epigenetic regulation of the ESR2 gene in autism. We collected genomic DNA from the peripheral blood of Chinese Han males with autism and age-matched normal males and measured DNA methylation of CpG islands in the ESR2 gene, which consisted of 41 CpG sites among the proximal promoter region and an untranslated exon, by bisulfite sequencing. We also investigated a relationship between DNA methylation and phenotypic features of autism, as assessed by the Children Autism Rating Scale. We found little overall difference in the DNA methylation of the ESR2 5'-flanking region in individuals with autism compared with normal individuals. However, detailed analyses revealed that eight specific CpG sites were hypermethylated in autistic individuals and that four specific CpG sites were positively associated with the severity of autistic symptoms. Our study indicates that the epigenetic dysregulation of ESR2 may govern the development of autism.

Cationic liposomes containing soluble Leishmania antigens (SLA) plus CpG ODNs induce protection against murine model of leishmaniasis.

PubMed

Heravi Shargh, Vahid; Jaafari, Mahmoud Reza; Khamesipour, Ali; Jalali, Seyed Amir; Firouzmand, Hengameh; Abbasi, Azam; Badiee, Ali

2012-07-01

Development of an effective vaccine against leishmaniasis is possible due to the fact that individuals cured from cutaneous leishmaniasis (CL) are protected from further infection. First generation Leishmania vaccines consisting of whole killed parasites reached to phase 3 clinical trials but failed to show enough efficacies mainly due to the lack of an appropriate adjuvant. In this study, an efficient liposomal protein-based vaccine against Leishmania major infection was developed using soluble Leishmania antigens (SLA) as a first generation vaccine and cytidine phosphate guanosine oligodeoxynucleotides (CpG ODNs) as an immunostimulatory adjuvant. 1, 2-Dioleoyl-3-trimethylammonium-propane was used as a cationic lipid to prepare the liposomes due to its intrinsic adjuvanticity. BALB/c mice were immunized subcutaneously (SC), three times in 2-week intervals, with Lip-SLA-CpG, Lip-SLA, SLA + CpG, SLA, or HEPES buffer. As criteria for protection, footpad swelling at the site of challenge and spleen parasite loads were assessed, and the immune responses were evaluated by determination of IFN-γ and IL-4 levels of cultured splenocytes, and IgG subtypes. The group of mice that received Lip-SLA-CpG showed a significantly smaller footpad swelling, lower spleen parasite burden, higher IgG2a antibody, and lower IL-4 level compared to the control groups. It is concluded that cationic liposomes containing SLA and CpG ODNs are appropriate to induce Th1 type of immune response and protection against leishmaniasis.

Methylation of HPA axis related genes in men with hypersexual disorder.

PubMed

Jokinen, Jussi; Boström, Adrian E; Chatzittofis, Andreas; Ciuculete, Diana M; Öberg, Katarina Görts; Flanagan, John N; Arver, Stefan; Schiöth, Helgi B

2017-06-01

Hypersexual Disorder (HD) defined as non-paraphilic sexual desire disorder with components of compulsivity, impulsivity and behavioral addiction, and proposed as a diagnosis in the DSM 5, shares some overlapping features with substance use disorder including common neurotransmitter systems and dysregulated hypothalamic-pituitary-adrenal (HPA) axis function. In this study, comprising 67 HD male patients and 39 male healthy volunteers, we aimed to identify HPA-axis coupled CpG-sites, in which modifications of the epigenetic profile are associated with hypersexuality. The genome-wide methylation pattern was measured in whole blood using the Illumina Infinium Methylation EPIC BeadChip, measuring the methylation state of over 850K CpG sites. Prior to analysis, the global DNA methylation pattern was pre-processed according to standard protocols and adjusted for white blood cell type heterogeneity. We included CpG sites located within 2000bp of the transcriptional start site of the following HPA-axis coupled genes: Corticotropin releasing hormone (CRH), corticotropin releasing hormone binding protein (CRHBP), corticotropin releasing hormone receptor 1 (CRHR1), corticotropin releasing hormone receptor 2 (CRHR2), FKBP5 and the glucocorticoid receptor (NR3C1). We performed multiple linear regression models of methylation M-values to a categorical variable of hypersexuality, adjusting for depression, dexamethasone non-suppression status, Childhood Trauma Questionnaire total score and plasma levels of TNF-alpha and IL-6. Of 76 tested individual CpG sites, four were nominally significant (p<0.05), associated with the genes CRH, CRHR2 and NR3C1. Cg23409074-located 48bp upstream of the transcription start site of the CRH gene - was significantly hypomethylated in hypersexual patients after corrections for multiple testing using the FDR-method. Methylation levels of cg23409074 were positively correlated with gene expression of the CRH gene in an independent cohort of 11 healthy male subjects. The methylation levels at the identified CRH site, cg23409074, were significantly correlated between blood and four different brain regions. CRH is an important integrator of neuroendocrine stress responses in the brain, with a key role in the addiction processes. Our results show epigenetic changes in the CRH gene related to hypersexual disorder in men. Copyright © 2017 Elsevier Ltd. All rights reserved.

Changes in the DNA methylation profile of the rat H19 gene upstream region during development and transgenic hepatocarcinogenesis and its role in the imprinted transcriptional regulation of the H19 gene.

PubMed

Manoharan, Herbert; Babcock, Karlee; Pitot, Henry C

2004-09-01

Monoallelic expression of the imprinted H19 and insulin-like growth factor-2 (Igf2) genes depends on the hypomethylation of the maternal allele and hypermethylation of the paternal allele of the H19 upstream region. Previous studies from our laboratory on liver carcinogenesis in the F1 hybrid of Fischer 344 (F344) and Sprague-Dawley Alb SV40 T Ag transgenic rat (SD) strains revealed the biallelic expression of H19 in hepatomas. We undertook a comparative study of the DNA methylation status of the upstream region of H19 in fetal, adult, and neoplastic liver. Bisulfite DNA sequencing analysis of a 3.745-kb DNA segment extending from 2950 to 6695 bp of the H19 upstream region revealed marked variations in the methylation patterns in fetal, adult, and neoplastic liver. In the fetal liver, equal proportions of hyper- and hypomethylated strands revealed the differentially methylated status of the parental alleles, but in neoplastic liver a pronounced change in the pattern of methylation was observed with a distinct change to hypomethylation in the short segments between 2984 and 3301 bp, 6033-6123 bp, and 6518-6548 bp. These results indicated that methylation of all cytosines in this region may contribute to the imprinting status of the rat H19 gene. This phenomenon of differential methylation-related epigenetic alteration in the key cis-regulatory domains of the H19 promoter influences switching to biallelic expression in hepatocellular carcinogenesis. Similar to mouse and human, we showed that the zinc-finger CCTCC binding factor (CTCF) binds to the unmethylated CTCF binding site in the upstream region to influence monoallelic imprinted expression in fetal liver. CTCF does not appear to be rate limiting in fetal, normal, and neoplastic liver. 3' to the CTCF binding sites, another DNA region exhibits methylation of CpG's in both DNA strands in adult liver, retention of the imprint in fetal liver, and complete demethylation in neoplastic liver. In this region is also a putative binding site for a basic helix-loop-helix leucine-zipper transcription factor, TFEB. The differential CpG methylation seen in the adult that involves the TFEB binding site may explain the lack of expression of the H19 gene in adult normal liver. Furthermore, these findings demonstrate that the loss of imprinting of the H19 gene in hepatic neoplasms of the SD Alb SV40 T Ag transgenic rat is directly correlated with and probably the result of differential methylation of CpG dinucleotides in two distinct regions of the gene that are within 4 kb 5' of the transcription start site. Cytogenetic analysis of hepatocytes in the transgenic animal prior to the appearance of nodules or neoplasms indicates a role of such loss of imprinting in the very early period of neoplastic development, possibly the transition from the stage of promotion to that of progression. Copyright 2004 Wiley-Liss, Inc.

Discovery and characterization of Isofistularin-3, a marine brominated alkaloid, as a new DNA demethylating agent inducing cell cycle arrest and sensitization to TRAIL in cancer cells

PubMed Central

Florean, Cristina; Schnekenburger, Michael; Lee, Jin-Young; Kim, Kyung Rok; Mazumder, Aloran; Song, Sungmi; Kim, Jae-Myun; Grandjenette, Cindy; Kim, Jeoung-Gyun; Yoon, Ah-Young; Dicato, Mario; Kim, Kyu-Won; Christov, Christo; Han, Byung-Woo; Proksch, Peter; Diederich, Marc

2016-01-01

We characterized the brominated alkaloid Isofistularin-3 (Iso-3), from the marine sponge Aplysina aerophoba, as a new DNA methyltransferase (DNMT)1 inhibitor. Docking analysis confirmed our in vitro DNMT inhibition data and revealed binding of Iso-3 within the DNA binding site of DNMT1. Subsequent increased expression of tumor suppressor gene aryl hydrocarbon receptor (AHR) could be correlated to decreased methylation of CpG sites within the essential Sp1 regulatory region of its promoter. Iso-3 induced growth arrest of cancer cells in G0/G1 concomitant with increased p21 and p27 expression and reduced cyclin E1, PCNA and c-myc levels. Reduced proliferation was accompanied by morphological changes typical of autophagy revealed by fluorescent and transmission electron microscopy and validated by LC3I-II conversion. Furthermore, Iso-3 strongly synergized with tumor-necrosis-factor related apoptosis inducing ligand (TRAIL) in RAJI [combination index (CI) = 0.22] and U-937 cells (CI = 0.21) and increased TRAIL-induced apoptosis via a mechanism involving reduction of survivin expression but not of Bcl-2 family proteins nor X-linked inhibitor of apoptosis protein (XIAP). Iso-3 treatment decreased FLIPL expression and triggered activation of endoplasmatic reticulum (ER) stress with increased GRP78 expression, eventually inducing TRAIL receptor death receptor (DR)5 surface expression. Importantly, as a potential candidate for further anticancer drug development, Iso-3 reduced the viability, colony and in vivo tumor forming potential without affecting the viability of PBMCs from healthy donors or zebrafish development. PMID:27006469

Discovery and characterization of Isofistularin-3, a marine brominated alkaloid, as a new DNA demethylating agent inducing cell cycle arrest and sensitization to TRAIL in cancer cells.

PubMed

Florean, Cristina; Schnekenburger, Michael; Lee, Jin-Young; Kim, Kyung Rok; Mazumder, Aloran; Song, Sungmi; Kim, Jae-Myun; Grandjenette, Cindy; Kim, Jeoung-Gyun; Yoon, Ah-Young; Dicato, Mario; Kim, Kyu-Won; Christov, Christo; Han, Byung-Woo; Proksch, Peter; Diederich, Marc

2016-04-26

We characterized the brominated alkaloid Isofistularin-3 (Iso-3), from the marine sponge Aplysina aerophoba, as a new DNA methyltransferase (DNMT)1 inhibitor. Docking analysis confirmed our in vitro DNMT inhibition data and revealed binding of Iso-3 within the DNA binding site of DNMT1. Subsequent increased expression of tumor suppressor gene aryl hydrocarbon receptor (AHR) could be correlated to decreased methylation of CpG sites within the essential Sp1 regulatory region of its promoter. Iso-3 induced growth arrest of cancer cells in G0/G1 concomitant with increased p21 and p27 expression and reduced cyclin E1, PCNA and c-myc levels. Reduced proliferation was accompanied by morphological changes typical of autophagy revealed by fluorescent and transmission electron microscopy and validated by LC3I-II conversion. Furthermore, Iso-3 strongly synergized with tumor-necrosis-factor related apoptosis inducing ligand (TRAIL) in RAJI [combination index (CI) = 0.22] and U-937 cells (CI = 0.21) and increased TRAIL-induced apoptosis via a mechanism involving reduction of survivin expression but not of Bcl-2 family proteins nor X-linked inhibitor of apoptosis protein (XIAP). Iso-3 treatment decreased FLIPL expression and triggered activation of endoplasmatic reticulum (ER) stress with increased GRP78 expression, eventually inducing TRAIL receptor death receptor (DR)5 surface expression. Importantly, as a potential candidate for further anticancer drug development, Iso-3 reduced the viability, colony and in vivo tumor forming potential without affecting the viability of PBMCs from healthy donors or zebrafish development.

CpG island mapping by epigenome prediction.

PubMed

Bock, Christoph; Walter, Jörn; Paulsen, Martina; Lengauer, Thomas

2007-06-01

CpG islands were originally identified by epigenetic and functional properties, namely, absence of DNA methylation and frequent promoter association. However, this concept was quickly replaced by simple DNA sequence criteria, which allowed for genome-wide annotation of CpG islands in the absence of large-scale epigenetic datasets. Although widely used, the current CpG island criteria incur significant disadvantages: (1) reliance on arbitrary threshold parameters that bear little biological justification, (2) failure to account for widespread heterogeneity among CpG islands, and (3) apparent lack of specificity when applied to the human genome. This study is driven by the idea that a quantitative score of "CpG island strength" that incorporates epigenetic and functional aspects can help resolve these issues. We construct an epigenome prediction pipeline that links the DNA sequence of CpG islands to their epigenetic states, including DNA methylation, histone modifications, and chromatin accessibility. By training support vector machines on epigenetic data for CpG islands on human Chromosomes 21 and 22, we identify informative DNA attributes that correlate with open versus compact chromatin structures. These DNA attributes are used to predict the epigenetic states of all CpG islands genome-wide. Combining predictions for multiple epigenetic features, we estimate the inherent CpG island strength for each CpG island in the human genome, i.e., its inherent tendency to exhibit an open and transcriptionally competent chromatin structure. We extensively validate our results on independent datasets, showing that the CpG island strength predictions are applicable and informative across different tissues and cell types, and we derive improved maps of predicted "bona fide" CpG islands. The mapping of CpG islands by epigenome prediction is conceptually superior to identifying CpG islands by widely used sequence criteria since it links CpG island detection to their characteristic epigenetic and functional states. And it is superior to purely experimental epigenome mapping for CpG island detection since it abstracts from specific properties that are limited to a single cell type or tissue. In addition, using computational epigenetics methods we could identify high correlation between the epigenome and characteristics of the DNA sequence, a finding which emphasizes the need for a better understanding of the mechanistic links between genome and epigenome.

Methylation levels of the "long interspersed nucleotide element-1" repetitive sequences predict survival of melanoma patients.

PubMed

Sigalotti, Luca; Fratta, Elisabetta; Bidoli, Ettore; Covre, Alessia; Parisi, Giulia; Colizzi, Francesca; Coral, Sandra; Massarut, Samuele; Kirkwood, John M; Maio, Michele

2011-05-26

The prognosis of cutaneous melanoma (CM) differs for patients with identical clinico-pathological stage, and no molecular markers discriminating the prognosis of stage III individuals have been established. Genome-wide alterations in DNA methylation are a common event in cancer. This study aimed to define the prognostic value of genomic DNA methylation levels in stage III CM patients. Overall level of genomic DNA methylation was measured using bisulfite pyrosequencing at three CpG sites (CpG1, CpG2, CpG3) of the Long Interspersed Nucleotide Element-1 (LINE-1) sequences in short-term CM cultures from 42 stage IIIC patients. The impact of LINE-1 methylation on overall survival (OS) was assessed using Cox regression and Kaplan-Meier analysis. Hypomethylation (i.e., methylation below median) at CpG2 and CpG3 sites significantly associated with improved prognosis of CM, CpG3 showing the strongest association. Patients with hypomethylated CpG3 had increased OS (P = 0.01, log-rank = 6.39) by Kaplan-Meyer analysis. Median OS of patients with hypomethylated or hypermethylated CpG3 were 31.9 and 11.5 months, respectively. The 5 year OS for patients with hypomethylated CpG3 was 48% compared to 7% for patients with hypermethylated sequences. Among the variables examined by Cox regression analysis, LINE-1 methylation at CpG2 and CpG3 was the only predictor of OS (Hazard Ratio = 2.63, for hypermethylated CpG3; 95% Confidence Interval: 1.21-5.69; P = 0.01). LINE-1 methylation is identified as a molecular marker of prognosis for CM patients in stage IIIC. Evaluation of LINE-1 promises to represent a key tool for driving the most appropriate clinical management of stage III CM patients.

Whole-Genome and Epigenomic Landscapes of Etiologically Distinct Subtypes of Cholangiocarcinoma

PubMed Central

Jusakul, Apinya; Cutcutache, Ioana; Yong, Chern Han; Lim, Jing Quan; Huang, Mi Ni; Padmanabhan, Nisha; Nellore, Vishwa; Kongpetch, Sarinya; Ng, Alvin Wei Tian; Ng, Ley Moy; Choo, Su Pin; Myint, Swe Swe; Thanan, Raynoo; Nagarajan, Sanjanaa; Lim, Weng Khong; Ng, Cedric Chuan Young; Boot, Arnoud; Liu, Mo; Ong, Choon Kiat; Rajasegaran, Vikneswari; Lie, Stefanus; Lim, Alvin Soon Tiong; Lim, Tse Hui; Tan, Jing; Loh, Jia Liang; McPherson, John R.; Khuntikeo, Narong; Bhudhisawasdi, Vajaraphongsa; Yongvanit, Puangrat; Wongkham, Sopit; Totoki, Yasushi; Nakamura, Hiromi; Arai, Yasuhito; Yamasaki, Satoshi; Chow, Pierce Kah-Hoe; Chung, Alexander Yaw Fui; Ooi, London Lucien Peng Jin; Lim, Kiat Hon; Dima, Simona; Duda, Dan G.; Popescu, Irinel; Broet, Philippe; Hsieh, Sen-Yung; Yu, Ming-Chin; Scarpa, Aldo; Lai, Jiaming; Luo, Di-Xian; Carvalho, André Lopes; Vettore, André Luiz; Rhee, Hyungjin; Park, Young Nyun; Alexandrov, Ludmil B.; Gordân, Raluca; Rozen, Steven G.; Shibata, Tatsuhiro; Pairojkul, Chawalit; Teh, Bin Tean; Tan, Patrick

2017-01-01

Cholangiocarcinoma (CCA) is a hepatobiliary malignancy exhibiting high incidence in countries with endemic liver-fluke infection. We analysed 489 CCAs from 10 countries, combining whole-genome (71 cases), targeted/exome, copy-number, gene expression, and DNA methylation information. Integrative clustering defined four CCA clusters – Fluke-Positive CCAs (Clusters 1/2) are enriched in ERBB2 amplifications and TP53 mutations, conversely Fluke-Negative CCAs (Clusters 3/4) exhibit high copy-number alterations and PD-1/PD-L2 expression, or epigenetic mutations (IDH1/2, BAP1) and FGFR/PRKA-related gene rearrangements. Whole-genome analysis highlighted FGFR2 3′UTR deletion as a mechanism of FGFR2 upregulation. Integration of non-coding promoter mutations with protein-DNA binding profiles demonstrates pervasive modulation of H3K27me3-associated sites in CCA. Clusters 1 and 4 exhibit distinct DNA hypermethylation patterns targeting either CpG islands or shores – mutation signature and subclonality analysis suggests that these reflect different mutational pathways. Our results exemplify how genetics, epigenetics and environmental carcinogens can interplay across different geographies to generate distinct molecular subtypes of cancer. PMID:28667006

Alcohol exposure during development: Impact on the epigenome.

PubMed

Perkins, Amy; Lehmann, Claudia; Lawrence, R Charles; Kelly, Sandra J

2013-10-01

Fetal alcohol spectrum disorders represent a wide range of symptoms associated with in utero alcohol exposure. Animal models of FASD have been useful in determining the specific neurological consequences of developmental alcohol exposure, but the mechanisms of those consequences are unclear. Long-lasting changes to the epigenome are proposed as a mechanism of alcohol-induced teratogenesis in the hippocampus. The current study utilized a three-trimester rodent model of FASD to examine changes to some of the enzymatic regulators of the epigenome in adolescence. Combined pre- and post-natal alcohol exposureresulted in a significant increase in DNA methyltransferase activity (DNMT), without affecting histone deacetylase activity (HDAC). Developmental alcohol exposure also caused a change in gene expression of regulators of the epigenome, in particular, DNMT1, DNMT3a, and methyl CpG binding protein 2 (MeCP2). The modifications of the activity and expression of epigenetic regulators in the hippocampus of rodents perinatally exposed to alcohol suggest that alcohol's impact on the epigenome and its regulators may be one of the underlying mechanisms of alcohol teratogenesis. Copyright © 2013 ISDN. Published by Elsevier Ltd. All rights reserved.

Alcohol exposure during development: Impact on the epigenome

PubMed Central

Perkins, Amy; Lehmann, Claudia; Lawrence, R. Charles; Kelly, Sandra J.

2013-01-01

Fetal Alcohol Spectrum Disorders represent a wide range of symptoms associated with in utero alcohol exposure. Animal models of FASD have been useful in determining the specific neurological consequences of developmental alcohol exposure, but the mechanisms of those consequences are unclear. Long-lasting changes to the epigenome are proposed as a mechanism of alcohol-induced teratogenesis in the hippocampus. The current study utilized a three-trimester rodent model of FASD to examine changes to some of the enzymatic regulators of the epigenome in adolescence. Combined pre- and post-natal alcohol exposure resulted in a significant increase in DNA methyltransferase activity (DNMT), without affecting histone deacetylase activity (HDAC). Developmental alcohol exposure also caused a change in gene expression of regulators of the epigenome, in particular, DNMT1, DNMT3a, and methyl CpG binding protein 2 (MeCP2). The modifications of the activity and expression of epigenetic regulators in the hippocampus of rodents perinatally exposed to alcohol suggest that alcohol’s impact on the epigenome and its regulators may be one of the underlying mechanisms of alcohol teratogenesis. PMID:23542005

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jusakul, Apinya; Cutcutache, Ioana; Yong, Chern Han

Cholangiocarcinoma (CCA) is a hepatobiliary malignancy exhibiting high incidence in countries with endemic liver-fluke infection. We analysed 489 CCAs from 10 countries, combining whole-genome (71 cases), targeted/exome, copy-number, gene expression, and DNA methylation information. Integrative clustering defined four CCA clusters - Fluke- Positive CCAs (Clusters 1/2) are enriched in ERBB2 amplifications and TP53 mutations, conversely Fluke-Negative CCAs (Clusters 3/4) exhibit high copy-number alterations and PD-1/PD-L2 expression, or epigenetic mutations (IDH1/2, BAP1) and FGFR/PRKA-related gene rearrangements. Whole-genome analysis highlighted FGFR2 3’UTR deletion as a mechanism of FGFR2 upregulation. Integration of non-coding promoter mutations with protein-DNA binding profiles demonstrates pervasive modulation ofmore » H3K27me3-associated sites in CCA. Clusters 1 and 4 exhibit distinct DNA hypermethylation patterns targeting either CpG islands or shores - mutation signature and subclonality analysis suggests that these reflect different mutational pathways. Lastly, our results exemplify how genetics, epigenetics and environmental carcinogens can interplay across different geographies to generate distinct molecular subtypes of cancer.« less

Degradable polymeric nano-films and particles as delivery platforms for vaccines and immunotherapeutics

NASA Astrophysics Data System (ADS)

Su, Xingfang

Degradable polymeric materials provide opportunities for the development of improved vaccines and immunotherapies by acting as platforms that facilitate the delivery of molecules to appropriate tissue and cellular locations to achieve therapeutic outcomes. To this end, we have designed and characterized nano-films and particles employing a hydrolytically degradable polymer for the delivery of vaccine antigens and immunotherapeutics. We first describe protein- and oligonucleotide-loaded layer-by-layer (LbL)-assembled multilayer thin films constructed based on electrostatic interactions between a cationic poly(beta-amino ester) (PBAE, denoted Poly-1) with a model protein antigen, ovalbumin (OVA), and/or immunostimulatory CpG oligonucleotides for transcutaneous delivery. Linear growth of nanoscale Poly-I/OVA bilayers was observed. Dried OVA protein-loaded films rapidly deconstructed when rehydrated in saline solutions, releasing OVA as non-aggregated/non-degraded protein, suggesting that the structure of biomolecules integrated into these multilayer films are preserved during release. Using confocal fluorescence microscopy and an in vivo murine ear skin model, we demonstrated delivery of OVA from LbL films into barrier-disrupted skin, uptake of the protein by skin-resident antigen-presenting cells (Langerhans cells), and transport of the antigen to the skin-draining lymph nodes. Dual incorporation of OVA and CpG oligonucleotides into the nanolayers of LbL films enabled dual release of the antigen and adjuvant with distinct kinetics for each component; OVA was rapidly released while CpG was released in a relatively sustained manner. Applied as skin patches, these films delivered OVA and CpG to Langerhans Cells in the skin. To our knowledge, this is the first demonstration of LbL films applied for the delivery of biomolecules into skin. This approach provides a new route for storage of vaccines and other immunotherapeutics in a solid-state thin film for subsequent delivery into the immunologically-rich milieu of the skin. In parallel, we also developed biodegradable core-shell nanoparticles with a PBAE core enveloped by a phospholipid bilayer shell for cytosolic delivery, with a view towards delivery of messenger RNA (mRNA)-based vaccines. The pH-responsive PBAE component was chosen to promote endosome disruption, while the lipid surface layer was selected to minimize toxicity of the polycation core. mRNA was efficiently adsorbed via electrostatic interactions onto the surface of these net positively charged nanoparticles. In vitro, mRNA-loaded particle uptake by dendritic cells led to mRNA delivery into the cytosol with low cytotoxicity, followed by translation of the encoded protein in these difficult-to-transfect cells at a frequency of ˜30%. Particles also promoted cytosolic uptake of co-delivered anti-tumor toxins in tumor cells resulting in synergistic killing, demonstrating potential for cancer therapy. In vivo, particles loaded with mRNA administered intranasally or intratracheally in mice led to the enhanced expression of the reporter protein luciferase compared to naked mRNA This system may thus be promising for noninvasive delivery of mRNA-based vaccines. (Copies available exclusively from MIT Libraries, libraries.mit.edu/docs - docs mit.edu)

DNA Methylation Influences Chlorogenic Acid Biosynthesis in Lonicera japonica by Mediating LjbZIP8 to Regulate Phenylalanine Ammonia-Lyase 2 Expression.

PubMed

Zha, Liangping; Liu, Shuang; Liu, Juan; Jiang, Chao; Yu, Shulin; Yuan, Yuan; Yang, Jian; Wang, Yaolong; Huang, Luqi

2017-01-01

The content of active compounds differ in buds and flowers of Lonicera japonica (FLJ) and L. japonica var. chinensis (rFLJ). Chlorogenic acid (CGAs) were major active compounds of L. japonica and regarded as measurements for quality evaluation. However, little is known concerning the formation of active compounds at the molecular level. We quantified the major CGAs in FLJ and rFLJ, and found the concentrations of CGAs were higher in the buds of rFLJ than those of FLJ. Further analysis of CpG methylation of CGAs biosynthesis genes showed differences between FLJ and rFLJ in the 5'-UTR of phenylalanine ammonia-lyase 2 ( PAL2 ). We identified 11 LjbZIP proteins and 24 rLjbZIP proteins with conserved basic leucine zipper domains, subcellular localization, and electrophoretic mobility shift assay showed that the transcription factor LjbZIP8 is a nuclear-localized protein that specifically binds to the G-box element of the LjPAL2 5'-UTR. Additionally, a transactivation assay and LjbZIP8 overexpression in transgenic tobacco indicated that LjbZIP8 could function as a repressor of transcription. Finally, treatment with 5-azacytidine decreased the transcription level of LjPAL2 and CGAs content in FLJ leaves. These results raise the possibility that DNA methylation might influence the recruitment of LjbZIP8, regulating PAL2 expression level and CGAs content in L. japonica .

DNA Methylation Influences Chlorogenic Acid Biosynthesis in Lonicera japonica by Mediating LjbZIP8 to Regulate Phenylalanine Ammonia-Lyase 2 Expression

PubMed Central

Zha, Liangping; Liu, Shuang; Liu, Juan; Jiang, Chao; Yu, Shulin; Yuan, Yuan; Yang, Jian; Wang, Yaolong; Huang, Luqi

2017-01-01

The content of active compounds differ in buds and flowers of Lonicera japonica (FLJ) and L. japonica var. chinensis (rFLJ). Chlorogenic acid (CGAs) were major active compounds of L. japonica and regarded as measurements for quality evaluation. However, little is known concerning the formation of active compounds at the molecular level. We quantified the major CGAs in FLJ and rFLJ, and found the concentrations of CGAs were higher in the buds of rFLJ than those of FLJ. Further analysis of CpG methylation of CGAs biosynthesis genes showed differences between FLJ and rFLJ in the 5′-UTR of phenylalanine ammonia-lyase 2 (PAL2). We identified 11 LjbZIP proteins and 24 rLjbZIP proteins with conserved basic leucine zipper domains, subcellular localization, and electrophoretic mobility shift assay showed that the transcription factor LjbZIP8 is a nuclear-localized protein that specifically binds to the G-box element of the LjPAL2 5′-UTR. Additionally, a transactivation assay and LjbZIP8 overexpression in transgenic tobacco indicated that LjbZIP8 could function as a repressor of transcription. Finally, treatment with 5-azacytidine decreased the transcription level of LjPAL2 and CGAs content in FLJ leaves. These results raise the possibility that DNA methylation might influence the recruitment of LjbZIP8, regulating PAL2 expression level and CGAs content in L. japonica. PMID:28740500

Murine J774 Macrophages Recognize LPS/IFN-g, Non-CpG DNA or Two-CpG DNA-containing Sequences as Immunologically Distinct

PubMed Central

Crosby, Lynn; Casey, Warren; Morgan, Kevin; Ni, Hong; Yoon, Lawrence; Easton, Marilyn; Misukonis, Mary; Burleson, Gary; Ghosh, Dipak K.

2010-01-01

Specific bacterial lipopolysaccharides (LPS), IFN-γ, and unmethylated cytosine or guanosine-phosphorothioate containing DNAs (CpG) activate host immunity, influencing infectious responses. Macrophages detect, inactivate and destroy infectious particles, and synthetic CpG sequences invoke similar responses of the innate immune system. Previously, murine macrophage J774 cells treated with CpG induced the expression of nitric oxide synthase 2 (NOS2) and cyclo-oxygenase 2 (COX2) mRNA and protein. In this study murine J774 macrophages were exposed to vehicle, interferon γ + lipopolysaccharide (IFN-g/LPS), non-CpG (SAK1), or two-CpG sequence-containing DNA (SAK2) for 0–18 hr and gene expression changes measured. A large number of immunostimulatory and inflammatory changes were observed. SAK2 was a stronger activator of TNFα- and chemokine expression-related changes than LPS/IFN-g. Up regulation included tumor necrosis factor receptor superfamily genes (TNFRSF’s), IL-1 receptor signaling via stress-activated protein kinase (SAPK), NF-κB activation, hemopoietic maturation factors and sonic hedgehog/wingless integration site (SHH/Wnt) pathway genes. Genes of the TGF-β pathway were down regulated. In contrast, LPS/IFN-g -treated cells showed increased levels for TGF-β signaling genes, which may be linked to the observed up regulation of numerous collagens and down regulation of Wnt pathway genes. SAK1 produced distinct changes from LPS/IFN-g or SAK2. Therefore, J774 macrophages recognize LPS/IFN-g, non-CpG DNA or two-CpG DNA-containing sequences as immunologically distinct. PMID:20097302

DNA methylation Landscape of body size variation in sheep.

PubMed

Cao, Jiaxue; Wei, Caihong; Liu, Dongming; Wang, Huihua; Wu, Mingming; Xie, Zhiyuan; Capellini, Terence D; Zhang, Li; Zhao, Fuping; Li, Li; Zhong, Tao; Wang, Linjie; Lu, Jian; Liu, Ruizao; Zhang, Shifang; Du, Yongfei; Zhang, Hongping; Du, Lixin

2015-10-16

Sub-populations of Chinese Mongolian sheep exhibit significant variance in body mass. In the present study, we sequenced the whole genome DNA methylation in these breeds to detect whether DNA methylation plays a role in determining the body mass of sheep by Methylated DNA immunoprecipitation - sequencing method. A high quality methylation map of Chinese Mongolian sheep was obtained in this study. We identified 399 different methylated regions located in 93 human orthologs, which were previously reported as body size related genes in human genome-wide association studies. We tested three regions in LTBP1, and DNA methylation of two CpG sites showed significant correlation with its RNA expression. Additionally, a particular set of differentially methylated windows enriched in the "development process" (GO: 0032502) was identified as potential candidates for association with body mass variation. Next, we validated small part of these windows in 5 genes; DNA methylation of SMAD1, TSC1 and AKT1 showed significant difference across breeds, and six CpG were significantly correlated with RNA expression. Interestingly, two CpG sites showed significant correlation with TSC1 protein expression. This study provides a thorough understanding of body size variation in sheep from an epigenetic perspective.

Construction and characterization of normalized cDNA libraries by 454 pyrosequencing and estimation of DNA methylation levels in three distantly related termite species.

PubMed

Hayashi, Yoshinobu; Shigenobu, Shuji; Watanabe, Dai; Toga, Kouhei; Saiki, Ryota; Shimada, Keisuke; Bourguignon, Thomas; Lo, Nathan; Hojo, Masaru; Maekawa, Kiyoto; Miura, Toru

2013-01-01

In termites, division of labor among castes, categories of individuals that perform specialized tasks, increases colony-level productivity and is the key to their ecological success. Although molecular studies on caste polymorphism have been performed in termites, we are far from a comprehensive understanding of the molecular basis of this phenomenon. To facilitate future molecular studies, we aimed to construct expressed sequence tag (EST) libraries covering wide ranges of gene repertoires in three representative termite species, Hodotermopsis sjostedti, Reticulitermes speratus and Nasutitermes takasagoensis. We generated normalized cDNA libraries from whole bodies, except for guts containing microbes, of almost all castes, sexes and developmental stages and sequenced them with the 454 GS FLX titanium system. We obtained >1.2 million quality-filtered reads yielding >400 million bases for each of the three species. Isotigs, which are analogous to individual transcripts, and singletons were produced by assembling the reads and annotated using public databases. Genes related to juvenile hormone, which plays crucial roles in caste differentiation of termites, were identified from the EST libraries by BLAST search. To explore the potential for DNA methylation, which plays an important role in caste differentiation of honeybees, tBLASTn searches for DNA methyltransferases (dnmt1, dnmt2 and dnmt3) and methyl-CpG binding domain (mbd) were performed against the EST libraries. All four of these genes were found in the H. sjostedti library, while all except dnmt3 were found in R. speratus and N. takasagoensis. The ratio of the observed to the expected CpG content (CpG O/E), which is a proxy for DNA methylation level, was calculated for the coding sequences predicted from the isotigs and singletons. In all of the three species, the majority of coding sequences showed depletion of CpG O/E (less than 1), and the distributions of CpG O/E were bimodal, suggesting the presence of DNA methylation.

Construction and Characterization of Normalized cDNA Libraries by 454 Pyrosequencing and Estimation of DNA Methylation Levels in Three Distantly Related Termite Species

PubMed Central

Hayashi, Yoshinobu; Shigenobu, Shuji; Watanabe, Dai; Toga, Kouhei; Saiki, Ryota; Shimada, Keisuke; Bourguignon, Thomas; Lo, Nathan; Hojo, Masaru; Maekawa, Kiyoto; Miura, Toru

2013-01-01

In termites, division of labor among castes, categories of individuals that perform specialized tasks, increases colony-level productivity and is the key to their ecological success. Although molecular studies on caste polymorphism have been performed in termites, we are far from a comprehensive understanding of the molecular basis of this phenomenon. To facilitate future molecular studies, we aimed to construct expressed sequence tag (EST) libraries covering wide ranges of gene repertoires in three representative termite species, Hodotermopsis sjostedti , Reticulitermessperatus and Nasutitermestakasagoensis . We generated normalized cDNA libraries from whole bodies, except for guts containing microbes, of almost all castes, sexes and developmental stages and sequenced them with the 454 GS FLX titanium system. We obtained >1.2 million quality-filtered reads yielding >400 million bases for each of the three species. Isotigs, which are analogous to individual transcripts, and singletons were produced by assembling the reads and annotated using public databases. Genes related to juvenile hormone, which plays crucial roles in caste differentiation of termites, were identified from the EST libraries by BLAST search. To explore the potential for DNA methylation, which plays an important role in caste differentiation of honeybees, tBLASTn searches for DNA methyltransferases (dnmt1, dnmt2 and dnmt3) and methyl-CpG binding domain (mbd) were performed against the EST libraries. All four of these genes were found in the H . sjostedti library, while all except dnmt3 were found in R . speratus and N . takasagoensis . The ratio of the observed to the expected CpG content (CpG O/E), which is a proxy for DNA methylation level, was calculated for the coding sequences predicted from the isotigs and singletons. In all of the three species, the majority of coding sequences showed depletion of CpG O/E (less than 1), and the distributions of CpG O/E were bimodal, suggesting the presence of DNA methylation. PMID:24098800

In Vivo Genome-Wide Expression Study on Human Circulating B Cells Suggests a Novel ESR1 and MAPK3 Network for Postmenopausal Osteoporosis

PubMed Central

Xiao, Peng; Chen, Yuan; Jiang, Hui; Liu, Yao-Zhong; Pan, Feng; Yang, Tie-Lin; Tang, Zi-Hui; Larsen, Jennifer A; Lappe, Joan M; Recker, Robert R; Deng, Hong-Wen

2008-01-01

Introduction Osteoporosis is characterized by low BMD. Studies have shown that B cells may participate in osteoclastogenesis through expression of osteoclast-related factors, such as RANKL, transforming growth factor β (TGFB), and osteoprotegerin (OPG). However, the in vivo significance of B cells in human bone metabolism and osteoporosis is still largely unknown, particularly at the systematic gene expression level. Materials and Methods In this study, Affymetrix HG-U133A GeneChip arrays were used to identify genes differentially expressed in B cells between 10 low and 10 high BMD postmenopausal women. Significance of differential expression was tested by t-test and adjusted for multiple testing with the Benjamini and Hochberg (BH) procedure (adjusted p ≤ 0.05). Results Twenty-nine genes were downregulated in the low versus high BMD group. These genes were further analyzed using Ingenuity Pathways Analysis (Ingenuity Systems). A network involving estrogen receptor 1 (ESR1) and mitogen activated protein kinase 3 (MAPK3) was identified. Real-time RT-PCR confirmed differential expression of eight genes, including ESR1, MAPK3, methyl CpG binding protein 2 (MECP2), proline-serine-threonine phosphatase interacting protein 1 (PSTPIP1), Scr-like-adaptor (SLA), serine/threonine kinase 11 (STK11), WNK lysine-deficient protein kinase 1 (WNK1), and zinc finger protein 446 (ZNF446). Conclusions This is the first in vivo genome-wide expression study on human B cells in relation to osteoporosis. Our results highlight the significance of B cells in the etiology of osteoporosis and suggest a novel mechanism for postmenopausal osteoporosis (i.e., that downregulation of ESR1 and MAPK3 in B cells regulates secretion of factors, leading to increased osteoclastogenesis or decreased osteoblastogenesis). PMID:18433299

Evaluation of novel adjuvant Eimeria profilin complex on intestinal host immune responses against live E. acervulina challenge infection

USDA-ARS?s Scientific Manuscript database

The effects of two novel adjuvants, QCDC (Quil A/cholesterol/DDA/Carbopol) and QCDCRT (QCDC/Bay R1005/cytosine-phosphate-guanosine oligodeoxynucleotides, CpG) emulsified with profilin, a conserved Eimeria recombinant protein, against avian coccidiosis were determined in broiler chickens. Chickens we...

MLH1 Region Polymorphisms Show a Significant Association with CpG Island Shore Methylation in a Large Cohort of Healthy Individuals

PubMed Central

Savio, Andrea J.; Lemire, Mathieu; Mrkonjic, Miralem; Gallinger, Steven; Zanke, Brent W.; Hudson, Thomas J.; Bapat, Bharati

2012-01-01

Single nucleotide polymorphisms (SNPs) are the most common form of genetic variation. We previously demonstrated that SNPs (rs1800734, rs749072, and rs13098279) in the MLH1 gene region are associated with MLH1 promoter island methylation, loss of MLH1 protein expression, and microsatellite instability (MSI) in colorectal cancer (CRC) patients. Recent studies have identified less CpG-dense “shore” regions flanking many CpG islands. These shores often exhibit distinct methylation profiles between different tissues and matched normal versus tumor cells of patients. To date, most epigenetic studies have focused on somatic methylation events occurring within solid tumors; less is known of the contributions of peripheral blood cell (PBC) methylation to processes such as aging and tumorigenesis. To address whether MLH1 methylation in PBCs is correlated with tumorigenesis we utilized the Illumina 450 K microarrays to measure methylation in PBC DNA of 846 healthy controls and 252 CRC patients from Ontario, Canada. Analysis of a region of chromosome 3p21 spanning the MLH1 locus in healthy controls revealed that a CpG island shore 1 kb upstream of the MLH1 gene exhibits different methylation profiles when stratified by SNP genotypes (rs1800734, rs749072, and rs13098279). Individuals with wild-type genotypes incur significantly higher PBC shore methylation than heterozygous or homozygous variant carriers (p<1.1×10−6; ANOVA). This trend is also seen in CRC cases (p<0.096; ANOVA). Shore methylation also decreases significantly with increasing age in cases and controls. This is the first study of its kind to integrate PBC methylation at a CpG island shore with SNP genotype status in CRC cases and controls. These results indicate that CpG island shore methylation in PBCs may be influenced by genotype as well as the normal aging process. PMID:23240038

CpG- and LPS-activated MAPK signaling in in vitro cultured salmon (Salmo salar) mononuclear phagocytes.

PubMed

Iliev, Dimitar B; Hansen, Tom; Jørgensen, Sven Martin; Krasnov, Aleksei; Jørgensen, Jorunn B

2013-10-01

The Mitogen-activated protein kinases (MAPK) are involved in transmitting intracellular signals downstream of diverse cell surface receptors and mediate the response to ligands such as growth factors, hormones and cytokines. In addition, MAPK are critically involved in the innate immune response to pathogen-derived substances, commonly referred to as pathogen-associated molecular patterns (PAMPs), such as bacterial lipopolysaccharide (LPS) and bacterial DNA rich in CpG dinucleotides. Currently, a great deal of knowledge is available about the involvement of MAPK in the innate immune response to PAMPs in mammals; however, little is known about the role of the different MAPK classes in the immune response to PAMPs in lower vertebrates. In the current study, p38 phosphorylation was induced by CpG oligonucleotides (ODNs) and LPS in primary salmon mononuclear phagocytes. Pre-treatment of the cells with a p38 inhibitor (SB203580) blocked the PAMP-induced p38 activity and suppressed the upregulation of most of the CpG- and LPS-induced transcripts highlighting the role of this kinase in the salmon innate immune response to PAMPs. In contrast to p38, the phosphorylation of extracellular signal-regulated kinase (ERK), a MAPK involved primarily in response to mitogens, was high in resting cells and, surprisingly, incubation with both CpG and control ODNs downregulated the phospho-ERK levels independently of p38 activation. The basal phospho-ERK level and the CpG-inducible p38 phosphorylation were greatly influenced by the length of in vitro incubation. The basal phospho-ERK level increased gradually throughout a 5-day culture period and was PI3K-dependent as demonstrated by its sensitivity to Wortmannin suggesting it is influenced by growth factors. Overall these data indicate that both basal and PAMP-induced activity of MAPKs might be greatly influenced by the differentiation status of salmon mononuclear phagocytes. Copyright © 2013. Published by Elsevier Ltd.

Predicting aberrant CpG island methylation

PubMed Central

Feltus, F. A.; Lee, E. K.; Costello, J. F.; Plass, C.; Vertino, P. M.

2003-01-01

Epigenetic silencing associated with aberrant methylation of promoter region CpG islands is one mechanism leading to loss of tumor suppressor function in human cancer. Profiling of CpG island methylation indicates that some genes are more frequently methylated than others, and that each tumor type is associated with a unique set of methylated genes. However, little is known about why certain genes succumb to this aberrant event. To address this question, we used Restriction Landmark Genome Scanning to analyze the susceptibility of 1,749 unselected CpG islands to de novo methylation driven by overexpression of DNA cytosine-5-methyltransferase 1 (DNMT1). We found that although the overall incidence of CpG island methylation was increased in cells overexpressing DNMT1, not all loci were equally affected. The majority of CpG islands (69.9%) were resistant to de novo methylation, regardless of DNMT1 overexpression. In contrast, we identified a subset of methylation-prone CpG islands (3.8%) that were consistently hypermethylated in multiple DNMT1 overexpressing clones. Methylation-prone and methylation-resistant CpG islands were not significantly different with respect to size, C+G content, CpG frequency, chromosomal location, or promoter association. We used DNA pattern recognition and supervised learning techniques to derive a classification function based on the frequency of seven novel sequence patterns that was capable of discriminating methylation-prone from methylation-resistant CpG islands with 82% accuracy. The data indicate that CpG islands differ in their intrinsic susceptibility to de novo methylation, and suggest that the propensity for a CpG island to become aberrantly methylated can be predicted based on its sequence context. PMID:14519846

Predicting aberrant CpG island methylation.

PubMed

Feltus, F A; Lee, E K; Costello, J F; Plass, C; Vertino, P M

2003-10-14

Epigenetic silencing associated with aberrant methylation of promoter region CpG islands is one mechanism leading to loss of tumor suppressor function in human cancer. Profiling of CpG island methylation indicates that some genes are more frequently methylated than others, and that each tumor type is associated with a unique set of methylated genes. However, little is known about why certain genes succumb to this aberrant event. To address this question, we used Restriction Landmark Genome Scanning to analyze the susceptibility of 1,749 unselected CpG islands to de novo methylation driven by overexpression of DNA cytosine-5-methyltransferase 1 (DNMT1). We found that although the overall incidence of CpG island methylation was increased in cells overexpressing DNMT1, not all loci were equally affected. The majority of CpG islands (69.9%) were resistant to de novo methylation, regardless of DNMT1 overexpression. In contrast, we identified a subset of methylation-prone CpG islands (3.8%) that were consistently hypermethylated in multiple DNMT1 overexpressing clones. Methylation-prone and methylation-resistant CpG islands were not significantly different with respect to size, C+G content, CpG frequency, chromosomal location, or promoter association. We used DNA pattern recognition and supervised learning techniques to derive a classification function based on the frequency of seven novel sequence patterns that was capable of discriminating methylation-prone from methylation-resistant CpG islands with 82% accuracy. The data indicate that CpG islands differ in their intrinsic susceptibility to de novo methylation, and suggest that the propensity for a CpG island to become aberrantly methylated can be predicted based on its sequence context.

Implementation of antibiotic use guidelines for fresh traumatic wound at Siriraj Hospital.

PubMed

Sirijatuphat, Rujipas; Choochan, Tanatchon; Siritongtaworn, Preecha; Sripojtham, Vipaporn; Thamlikitkul, Visanu

2015-03-01

To determine the effectiveness of implementing a clinical practice guideline (CPG) on antibiotic use for adults with fresh traumatic wounds who attended the trauma center at Siriraj Hospital, Bangkok. A prospective study of 600 adult patients who had fresh traumatic wounds (≤ 6 hours) was conducted at Siriraj Trauma Center from March 2013 to March 2014. The CPG was introduced to physicians, nurses and medical students by posting the CPG at the patient care areas of the trauma center. The outcomes were an appropriate classification of wounds according to the CPG recommendations, prevalence of antibiotic prescribing, incidence of wound infection and compliance with the CPG. Clean-contaminated wounds that did not need antibiotic treatment and clean-contaminated and contaminated wounds that required antibiotics were observed in 63.2, 6.7, and 30.1% ofthe patients, respectively. Antibiotics were given to 512 patients (85.3%). Infections occurred in six patients (1.0%). Antibiotic prescription according to CPG recommendations was observed for 243 patients (40.5%). The prevalence of antibiotic use in the CPG-compliant group (65.8%) was significantly less than that in the CPG-noncompliant group (98.6%) (p < 0.001). The patients in the CPG-compliant group had more contaminated wounds than those in the CPG-noncompliant group (51.4 vs. 15.7%, p < 0.001). The incidences of wound infection were very low in both groups and not significantly different (1.2 vs. 0.8%, p = 0.690). Antibiotic prophylaxis was necessary in less than 36.8% of adults with fresh traumatic wounds who attended Siriraj Trauma Center Compliance to CPG implementation using simple intervention seemed to be low. Adhering to CPG recommendations for antibiotic prophylaxis in adults with fresh traumatic wounds can reduce the unnecessary prescribing of antibiotics without increasing the rate of wound infection.

Depletion of CpG Dinucleotides in Papillomaviruses and Polyomaviruses: A Role for Divergent Evolutionary Pressures.

PubMed

Upadhyay, Mohita; Vivekanandan, Perumal

2015-01-01

Papillomaviruses and polyomaviruses are small ds-DNA viruses infecting a wide-range of vertebrate hosts. Evidence supporting co-evolution of the virus with the host does not fully explain the evolutionary path of papillomaviruses and polyomaviruses. Studies analyzing CpG dinucleotide frequencies in virus genomes have provided interesting insights on virus evolution. CpG dinucleotide depletion has not been extensively studied among papillomaviruses and polyomaviruses. We sought to analyze the relative abundance of dinucleotides and the relative roles of evolutionary pressures in papillomaviruses and polyomaviruses. We studied 127 full-length sequences from papillomaviruses and 56 full-length sequences from polyomaviruses. We analyzed the relative abundance of dinucleotides, effective codon number (ENC), differences in synonymous codon usage. We examined the association, if any, between the extent of CpG dinucleotide depletion and the evolutionary lineage of the infected host. We also investigated the contribution of mutational pressure and translational selection to the evolution of papillomaviruses and polyomaviruses. All papillomaviruses and polyomaviruses are CpG depleted. Interestingly, the evolutionary lineage of the infected host determines the extent of CpG depletion among papillomaviruses and polyomaviruses. CpG dinucleotide depletion was more pronounced among papillomaviruses and polyomaviruses infecting human and other mammals as compared to those infecting birds. Our findings demonstrate that CpG depletion among papillomaviruses is linked to mutational pressure; while CpG depletion among polyomaviruses is linked to translational selection. We also present evidence that suggests methylation of CpG dinucleotides may explain, at least in part, the depletion of CpG dinucleotides among papillomaviruses but not polyomaviruses. The extent of CpG depletion among papillomaviruses and polyomaviruses is linked to the evolutionary lineage of the infected host. Our results highlight the existence of divergent evolutionary pressures leading to CpG dinucleotide depletion among small ds-DNA viruses infecting vertebrate hosts.

Methylation levels of the "long interspersed nucleotide element-1" repetitive sequences predict survival of melanoma patients

PubMed Central

2011-01-01

Background The prognosis of cutaneous melanoma (CM) differs for patients with identical clinico-pathological stage, and no molecular markers discriminating the prognosis of stage III individuals have been established. Genome-wide alterations in DNA methylation are a common event in cancer. This study aimed to define the prognostic value of genomic DNA methylation levels in stage III CM patients. Methods Overall level of genomic DNA methylation was measured using bisulfite pyrosequencing at three CpG sites (CpG1, CpG2, CpG3) of the Long Interspersed Nucleotide Element-1 (LINE-1) sequences in short-term CM cultures from 42 stage IIIC patients. The impact of LINE-1 methylation on overall survival (OS) was assessed using Cox regression and Kaplan-Meier analysis. Results Hypomethylation (i.e., methylation below median) at CpG2 and CpG3 sites significantly associated with improved prognosis of CM, CpG3 showing the strongest association. Patients with hypomethylated CpG3 had increased OS (P = 0.01, log-rank = 6.39) by Kaplan-Meyer analysis. Median OS of patients with hypomethylated or hypermethylated CpG3 were 31.9 and 11.5 months, respectively. The 5 year OS for patients with hypomethylated CpG3 was 48% compared to 7% for patients with hypermethylated sequences. Among the variables examined by Cox regression analysis, LINE-1 methylation at CpG2 and CpG3 was the only predictor of OS (Hazard Ratio = 2.63, for hypermethylated CpG3; 95% Confidence Interval: 1.21-5.69; P = 0.01). Conclusion LINE-1 methylation is identified as a molecular marker of prognosis for CM patients in stage IIIC. Evaluation of LINE-1 promises to represent a key tool for driving the most appropriate clinical management of stage III CM patients. PMID:21615918

Chitosan-coated boron nitride nanospheres enhance delivery of CpG oligodeoxynucleotides and induction of cytokines

PubMed Central

Zhang, Huijie; Chen, Song; Zhi, Chunyi; Yamazaki, Tomohiko; Hanagata, Nobutaka

2013-01-01

Background Cytosine-phosphate-guanine (CpG) oligodeoxynucleotides activate Toll-like receptor 9, leading to induction of proinflammatory cytokines, which play an important role in induction and maintenance of innate and adaptive immune responses. Previously, we have used boron nitride nanospheres (BNNS) as a carrier for delivery of unmodified CpG oligodeoxynucleotides to activate Toll-like receptor 9. However, because CpG oligodeoxynucleotides and BNNS are both negatively charged, electrostatic repulsion between them is likely to reduce the loading of CpG oligodeoxynucleotides onto BNNS. Therefore, the efficiency of uptake of CpG oligodeoxynucleotides is also limited and does not result in induction of a robust cytokine response. To ameliorate these problems, we developed a CpG oligodeoxynucleotide delivery system using chitosan-coated BNNS as a carrier. Methods To facilitate attachment of CpG oligodeoxynucleotides onto the BNNS and improve their loading capacity, we prepared positively charged BNNS by coating them with chitosan preparations of three different molecular weights and used them as carriers for delivery of CpG oligodeoxynucleotides. Results The zeta potentials of the BNNS-CS complexes were positive, and chitosan coating improved their dispersity and stability in aqueous solution compared with BNNS. The positive charge of the BNNS-CS complexes greatly improved the loading capacity and cellular uptake efficiency of CpG oligodeoxynucleotides. The loading capacity of the CpG oligodeoxynucleotides depended on the molecular weight of chitosan, which affected the positive charge density on the surface of the BNNS. CpG oligodeoxynucleotides loaded onto BNNS-CS complexes significantly enhanced production of interleukin-6 and tumor necrosis factor-α by peripheral blood mononuclear cells compared with CpG oligodeoxynucleotides directly loaded onto BNNS, or when Lipofectamine™ 2000 was used as the carrier. The molecular weight of the chitosan used to coat the BNNS affected the magnitude of cytokine induction by varying the strength of condensation of the CpG oligodeoxynucleotides. Conclusion Although the loading capacity of BNNS coated with low molecular weight chitosan preparations was the lowest of all the preparations, they induced the highest levels of cytokines. PMID:23674892

Altered DNA Methylation and Expression Profiles of 8-Oxoguanine DNA Glycosylase 1 in Lens Tissue from Age-related Cataract Patients.

PubMed

Wang, Yong; Li, Fei; Zhang, Guowei; Kang, Lihua; Qin, Bai; Guan, Huaijin

2015-01-01

Oxidative stress and DNA damage contribute to the pathogenesis of age-related cataract (ARC). Most oxidative DNA lesions are repaired via the base excision repair (BER) proteins including 8-oxoguanine DNA glycosylase 1 (OGG1). This study examined DNA methylation of CpG islands upstream of OGG1 and their relation to the gene expression in lens cortex from ARC patients. The clinical case-control study consisted of 15 cortical type of ARC patients and 15 age-matched non-ARC controls who received transparent lens extraction due to vitreoretinal diseases. OGG1 expression in lens cortex was analyzed by qRT-PCR and Western blot. The localization and the proportion of cells positive for OGG1 were determined by immunofluorescence. Bisulfite-sequencing PCR (BSP) was performed to evaluate the methylation status of CpG islands near OGG1 in DNA extracted from lens cortex. To test relationship between the methylation and the expression of the gene of interest, 5-Aza-2'-deoxycytidine (5-Aza-dC) was used to induce demethylation of cultured human lens epithelium B-3 (HLE B-3). To test the role of OGG1 in the repair of cellular damage, HLE B-3 was transfected with OGG1 vector, followed by ultraviolet radiation b (UVB) exposure to induce apoptosis. The mRNA and protein levels of OGG1 were significantly reduced in the lens cortex of ARC. Immunofluorescence showed that the proportion of OGG1-positive cells decreased significantly in ARC cortex in comparison with the control. The CpG island in first exon of OGG1 displayed hypermethylation in the DNA extracted from the lens cortex of ARC. Treatment of HLEB-3 cells with 5-Aza-dC upregulated OGG1 expression. UVB-induced apoptosis was attenuated after transfection with OGG1. A reduced OGG1 expression was correlated with hypermethylation of a CpG island of OGG1 in lens cortex of ARC. The role of epigenetic change in OGG1 gene in the susceptibility to oxidative stress induced cortical ARC is warranted to further study.

An automated graphics tool for comparative genomics: the Coulson plot generator

PubMed Central

2013-01-01

Background Comparative analysis is an essential component to biology. When applied to genomics for example, analysis may require comparisons between the predicted presence and absence of genes in a group of genomes under consideration. Frequently, genes can be grouped into small categories based on functional criteria, for example membership of a multimeric complex, participation in a metabolic or signaling pathway or shared sequence features and/or paralogy. These patterns of retention and loss are highly informative for the prediction of function, and hence possible biological context, and can provide great insights into the evolutionary history of cellular functions. However, representation of such information in a standard spreadsheet is a poor visual means from which to extract patterns within a dataset. Results We devised the Coulson Plot, a new graphical representation that exploits a matrix of pie charts to display comparative genomics data. Each pie is used to describe a complex or process from a separate taxon, and is divided into sectors corresponding to the number of proteins (subunits) in a complex/process. The predicted presence or absence of proteins in each complex are delineated by occupancy of a given sector; this format is visually highly accessible and makes pattern recognition rapid and reliable. A key to the identity of each subunit, plus hierarchical naming of taxa and coloring are included. A java-based application, the Coulson plot generator (CPG) automates graphic production, with a tab or comma-delineated text file as input and generating an editable portable document format or svg file. Conclusions CPG software may be used to rapidly convert spreadsheet data to a graphical matrix pie chart format. The representation essentially retains all of the information from the spreadsheet but presents a graphically rich format making comparisons and identification of patterns significantly clearer. While the Coulson plot format is highly useful in comparative genomics, its original purpose, the software can be used to visualize any dataset where entity occupancy is compared between different classes. Availability CPG software is available at sourceforge http://sourceforge.net/projects/coulson and http://dl.dropbox.com/u/6701906/Web/Sites/Labsite/CPG.html PMID:23621955

CpG DNA in the prevention and treatment of infections.

PubMed

Dalpke, Alexander; Zimmermann, Stefan; Heeg, Klaus

2002-01-01

Microbial infection is sensed by Toll-like receptors (TLRs) on innate immune cells. Among the ten so far defined TLRs, TLR9 and its ligand are peculiar. TLR9 recognises bacterial DNA characterised by the abundance of unmethylated CpG dinucleotides, which distinguish bacterial DNA (CpG DNA) from mammalian DNA. Moreover, TLR9 shows a restricted cellular and subcellular pattern of expression. In contrast to other TLR agonists, CpG DNA is superior in activation of dendritic dells and induction of costimulatory cytokines such as interleukin (IL)-12 and IL-18. This qualifies CpG DNA as a Th1-promoting adjuvant. During infection, recognition of CpG DNA of intracellular pathogens skews and fine-tunes the ongoing immune response and induces long-lasting Th1 milieus. Thus, CpG DNA might play an important role in driving the immune system to a Th1 profile, preventing undesired Th2 milieus that might favour induction of allergic responses. Since CpG DNA can be synthesised with high purity and sequence fidelity, synthetic CpG DNA will become an important agent for Th1 instruction and be an effective adjuvant during vaccination.

Emergent central pattern generator behavior in chemical coupled two-compartment models with time delay

NASA Astrophysics Data System (ADS)

Li, Shanshan; Zhang, Guoshan; Wang, Jiang; Chen, Yingyuan; Deng, Bin

2018-02-01

This paper proposes that modified two-compartment Pinsky-Rinzel (PR) neural model can be used to develop the simple form of central pattern generator (CPG). The CPG is called as 'half-central oscillator', which constructed by two inhibitory chemical coupled PR neurons with time delay. Some key properties of PR neural model related to CPG are studied and proved to meet the requirements of CPG. Using the simple CPG network, we first study the relationship between rhythmical output and key factors, including ambient noise, sensory feedback signals, morphological character of single neuron as well as the coupling delay time. We demonstrate that, appropriate intensity noise can enhance synchronization between two coupled neurons. Different output rhythm of CPG network can be entrained by sensory feedback signals. We also show that the morphology of single neuron has strong effect on the output rhythm. The phase synchronization indexes decrease with the increase of morphology parameter's difference. Through adjusting coupled delay time, we can get absolutely phase synchronization and antiphase state of CPG. Those results of simulation show the feasibility of PR neural model as a valid CPG as well as the emergent behaviors of the particularly CPG.

Combinations of various CpG motifs cloned into plasmid backbone modulate and enhance protective immunity of viral replicon DNA anthrax vaccines.

PubMed

Yu, Yun-Zhou; Ma, Yao; Xu, Wen-Hui; Wang, Shuang; Sun, Zhi-Wei

2015-08-01

DNA vaccines are generally weak stimulators of the immune system. Fortunately, their efficacy can be improved using a viral replicon vector or by the addition of immunostimulatory CpG motifs, although the design of these engineered DNA vectors requires optimization. Our results clearly suggest that multiple copies of three types of CpG motifs or combinations of various types of CpG motifs cloned into a viral replicon vector backbone with strong immunostimulatory activities on human PBMC are efficient adjuvants for these DNA vaccines to modulate and enhance protective immunity against anthrax, although modifications with these different CpG forms in vivo elicited inconsistent immune response profiles. Modification with more copies of CpG motifs elicited more potent adjuvant effects leading to the generation of enhanced immunity, which indicated a CpG motif dose-dependent enhancement of antigen-specific immune responses. Notably, the enhanced and/or synchronous adjuvant effects were observed in modification with combinations of two different types of CpG motifs, which provides not only a contribution to the knowledge base on the adjuvant activities of CpG motifs combinations but also implications for the rational design of optimal DNA vaccines with combinations of CpG motifs as "built-in" adjuvants. We describe an efficient strategy to design and optimize DNA vaccines by the addition of combined immunostimulatory CpG motifs in a viral replicon DNA plasmid to produce strong immune responses, which indicates that the CpG-modified viral replicon DNA plasmid may be desirable for use as vector of DNA vaccines.

Polyethyleneimine-functionalized boron nitride nanospheres as efficient carriers for enhancing the immunostimulatory effect of CpG oligodeoxynucleotides

PubMed Central

Zhang, Huijie; Feng, Shini; Yan, Ting; Zhi, Chunyi; Gao, Xiao-Dong; Hanagata, Nobutaka

2015-01-01

CpG oligodeoxynucleotides (ODNs) stimulate innate and adaptive immune responses. Thus, these molecules are promising therapeutic agents and vaccine adjuvants against various diseases. In this study, we developed a novel CpG ODNs delivery system based on polyethyleneimine (PEI)-functionalized boron nitride nanospheres (BNNS). PEI was coated on the surface of BNNS via electrostatic interactions. The prepared BNNS–PEI complexes had positive zeta potential and exhibited enhanced dispersity and stability in aqueous solution. In vitro cytotoxicity assays revealed that the BNNS–PEI complexes with concentrations up to 100 μg/mL exhibited no obvious cytotoxicity. Furthermore, the positively charged surface of the BNNS–PEI complexes greatly improved the loading capacity and cellular uptake efficiency of CpG ODNs. Class B CpG ODNs loaded on the BNNS–PEI complexes enhanced the production of interleukin-6 and tumor necrosis factor-α from peripheral blood mononuclear cells compared with CpG ODNs directly loaded on BNNS. Contrary to the free CpG ODNs or CpG ODNs directly loaded on BNNS, class B CpG ODNs loaded on the BNNS–PEI complexes induced interferon-α simultaneously. PEI coating may have changed the physical form of class B CpG ODNs on BNNS, which further affected their interaction with Toll-like receptor 9 and induced interferon-α. Therefore, BNNS–PEI complexes can be used to enhance the immunostimulatory effect and therapeutic activity of CpG ODNs and the treatment of diseases requiring interleukin-6, tumor necrosis factor-α, and interferon-α. PMID:26346655

Polyethyleneimine-functionalized boron nitride nanospheres as efficient carriers for enhancing the immunostimulatory effect of CpG oligodeoxynucleotides.

PubMed

Zhang, Huijie; Feng, Shini; Yan, Ting; Zhi, Chunyi; Gao, Xiao-Dong; Hanagata, Nobutaka

2015-01-01

CpG oligodeoxynucleotides (ODNs) stimulate innate and adaptive immune responses. Thus, these molecules are promising therapeutic agents and vaccine adjuvants against various diseases. In this study, we developed a novel CpG ODNs delivery system based on polyethyleneimine (PEI)-functionalized boron nitride nanospheres (BNNS). PEI was coated on the surface of BNNS via electrostatic interactions. The prepared BNNS-PEI complexes had positive zeta potential and exhibited enhanced dispersity and stability in aqueous solution. In vitro cytotoxicity assays revealed that the BNNS-PEI complexes with concentrations up to 100 μg/mL exhibited no obvious cytotoxicity. Furthermore, the positively charged surface of the BNNS-PEI complexes greatly improved the loading capacity and cellular uptake efficiency of CpG ODNs. Class B CpG ODNs loaded on the BNNS-PEI complexes enhanced the production of interleukin-6 and tumor necrosis factor-α from peripheral blood mononuclear cells compared with CpG ODNs directly loaded on BNNS. Contrary to the free CpG ODNs or CpG ODNs directly loaded on BNNS, class B CpG ODNs loaded on the BNNS-PEI complexes induced interferon-α simultaneously. PEI coating may have changed the physical form of class B CpG ODNs on BNNS, which further affected their interaction with Toll-like receptor 9 and induced interferon-α. Therefore, BNNS-PEI complexes can be used to enhance the immunostimulatory effect and therapeutic activity of CpG ODNs and the treatment of diseases requiring interleukin-6, tumor necrosis factor-α, and interferon-α.

Local Delivery of the Toll-Like Receptor 9 Ligand CpG Downregulates Host Immune and Inflammatory Responses, Ameliorating Established Leishmania (Viannia) panamensis Chronic Infection

PubMed Central

Fernández, Olga L.; Rodriguez-Pinto, Daniel; Castilho, Tiago M.; Corral Caridad, Maria J.; Goldsmith-Pestana, Karen; Saravia, Nancy Gore; McMahon-Pratt, Diane

2017-01-01

ABSTRACT Infection by Leishmania (Viannia) panamensis, the predominant etiologic agent for cutaneous leishmaniasis in Colombia, is characterized by a chronic mixed inflammatory response. Current treatment options are plagued by toxicity, lengthy treatment regimens, and growing evidence of drug resistance. Immunotherapy, modulating the immune system to mount a protective response, may provide an alternate therapeutic approach. We investigated the ability of the Toll-like receptor 9 (TLR9) ligand CpG to modulate established disease in the L. (V.) panamensis mouse model. Treatment of established infection with a high dose (50 μg) of CpG ameliorated disease and lowered parasite burden. Interestingly, immediately after treatment there was a significant increase in transforming growth factor β (TGF-β) and concomitantly an increase in T regulatory cell (Treg) function. Although a general reduction in cell-mediated immune cytokine and chemokine (gamma interferon [IFN-γ], interleukin 10 [IL-10], IL-13, IL-6, granulocyte-macrophage colony-stimulating factor [GM-CSF], IL-4, and MIP-1α) responses of the treated mice was observed, certain chemokines (RANTES, monocyte chemoattractant protein 1[MCP-1], and IP-10) were increased. Further, in peripheral blood mononuclear cells (PBMCs) from patients with cutaneous leishmaniasis, CpG treatment similarly exhibited a dose-response effect on the production of IFN-γ, IL-17, IL-10, and IL-13, with reductions observed at higher doses. To further understand the underlying mechanisms and cell populations driving the CpG mediated response, we examined the ex vivo dose effects mediated by the TLR9+ cell populations (dendritic cells, macrophages, and B cells) found to accumulate labeled CpG in vivo. Notably, B cells altered the production of IL-17, IL-13, and IFN-γ, supporting a role for B cells functioning as antigen-presenting cells (APCs) and/or regulatory cells during infection. Interestingly, B cells have been previously demonstrated as a primary type of APC in patients infected with L. (V.) panamensis and thus may be useful targets of immunotherapy. Collectively, our results show that CpG-induced immune regulation leads to a dampening of the host immune response and healing in the mouse model, and it may provide an alternate approach to treatment of cutaneous leishmaniasis caused by L. (V.) panamensis. PMID:28052994

Neuromodulation intrinsic to the central pattern generator for escape swimming in Tritonia.

PubMed

Katz, P S

1998-11-16

Extrinsic neuromodulatory inputs to central pattern generators (CPGs) can alter the properties and synaptic interactions of neurons in those circuits and thereby modify the output of the CPG. Recent work in a number of systems has now demonstrated that neurons intrinsic to CPG can also evoke neuromodulatory actions on other members of the CPG. Such "intrinsic neuromodulation" plays a role in controlling the CPG underlying the escape swim response of the nudibrach mollusc, Tritonia diomedea. The dorsal swim interneurons (DSIs) are a bilaterally represented set of three serotonergic neurons that participate in the generation of the rhythmic swim motor program. Serotonin released from these CPG neurons functions both as a fast neurotransmitter and as a slower neuromodulator. In its modulatory role, serotonin enhances the release of neurotransmitter from another CPG neuron, C2, and also increases C2 excitability by decreasing spike frequency adaptation. These neuromodulatory actions intrinsic to the CPG may be important for the initial self-configuration of the system into a function CPG and for experience-dependent changes in the output such as behavioral sensitization and habituation.

Effect of CpG dinucleotides within IgH switch region repeats on immunoglobulin class switch recombination.

PubMed

Zhang, Zheng Z; Hsieh, Chih-Lin; Okitsu, Cindy Yen; Han, Li; Yu, Kefei; Lieber, Michael R

2015-08-01

Immunoglobulin (Ig) heavy chains undergo class switch recombination (CSR) to change the heavy chain isotype from IgM to IgG, A or E. The switch regions are several kilobases long, repetitive, and G-rich on the nontemplate strand. They are also relatively depleted of CpG (also called CG) sites for unknown reasons. Here we use synthetic switch regions at the IgH switch alpha (Sα) locus to test the effect of CpG sites and to try to understand why the IgH switch sequences evolved to be relatively depleted of CpG. We find that even just two CpG sites within an 80 bp synthetic switch repeat iterated 15 times (total switch region length of 1200 bp containing 30 CpG sites) are sufficient to dramatically reduce both Ig CSR and transcription through the switch region from the upstream Iα sterile transcript promoter, which is the promoter that directs transcripts through the Sα region. De novo DNA methylation occurs at the four CpG sites in and around the Iα promoter when each 80 bp Iα switch repeat contains the two CpG sites. Thus, a relatively low density of CpG sites within the switch repeats can induce upstream CpG methylation at the IgH alpha locus, and cause a substantial decrease in transcription from the sterile transcript promoter. This effect is likely the reason that switch regions evolved to contain very few CpG sites. We discuss these findings as they relate to DNA methylation and to Ig CSR. Copyright © 2015 Elsevier Ltd. All rights reserved.

Targeted-bisulfite sequence analysis of the methylation of CpG islands in genes encoding PNPLA3, SAMM50, and PARVB of patients with non-alcoholic fatty liver disease.

PubMed

Kitamoto, Takuya; Kitamoto, Aya; Ogawa, Yuji; Honda, Yasushi; Imajo, Kento; Saito, Satoru; Yoneda, Masato; Nakamura, Takahiro; Nakajima, Atsushi; Hotta, Kikuko

2015-08-01

The pathogenesis of non-alcoholic fatty liver disease (NAFLD) is affected by epigenetic factors as well as by genetic variation. We performed targeted-bisulfite sequencing to determine the levels of DNA methylation of 4 CpG islands (CpG99, CpG71, CpG26, and CpG101) in the regulatory regions of PNPLA3, SAMM50, PARVB variant 1, and PARVB variant 2, respectively. We compared the levels of methylation of DNA in the livers of the first and second sets of patients with mild (fibrosis stages 0 and 1) or advanced (fibrosis stages 2 to 4) NAFLD and in those of patients with mild (F0 to F2) or advanced (F3 and F4) chronic hepatitis C infection. The hepatic mRNA levels of PNPLA3, SAMM50, and PARVB were measured using qPCR. CpG26, which resides in the regulatory region of PARVB variant 1, was markedly hypomethylated in the livers of patients with advanced NAFLD. Conversely, CpG99 in the regulatory region of PNPLA3 was substantially hypermethylated in these patients. These differences in DNA methylation were replicated in a second set of patients with NAFLD or chronic hepatitis C. PNPLA3 mRNA levels in the liver of the same section of a biopsy specimen used for genomic DNA preparation were lower in patients with advanced NAFLD compared with those with mild NAFLD and correlated inversely with CpG99 methylation in liver DNA. Moreover, the levels of CpG99 methylation and PNPLA3 mRNA were affected by the rs738409 genotype. Hypomethylation of CpG26 and hypermethylation of CpG99 may contribute to the severity of fibrosis in patients with NAFLD or chronic hepatitis C infection. Copyright © 2015 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved.

Interleukin-12- and Gamma Interferon-Dependent Protection against Malaria Conferred by CpG Oligodeoxynucleotide in Mice

PubMed Central

Gramzinski, Robert A.; Doolan, Denise L.; Sedegah, Martha; Davis, Heather L.; Krieg, Arthur M.; Hoffman, Stephen L.

2001-01-01

Unmethylated CpG dinucleotides in bacterial DNA or synthetic oligodeoxynucleotides (ODNs) cause B-cell proliferation and immunoglobulin secretion, monocyte cytokine secretion, and activation of natural killer (NK) cell lytic activity and gamma interferon (IFN-γ) secretion in vivo and in vitro. The potent Th1-like immune activation by CpG ODNs suggests a possible utility for enhancing innate immunity against infectious pathogens. We therefore investigated whether the innate immune response could protect against malaria. Treatment of mice with CpG ODN 1826 (TCCATGACGTTCCTGACGTT, with the CpG dinucleotides underlined) or 1585 (ggGGTCAACGTTGAgggggG, with g representing diester linkages and phosphorothioate linkages being to the right of lowercase letters) in the absence of antigen 1 to 2 days prior to challenge with Plasmodium yoelii sporozoites conferred sterile protection against infection. A higher level of protection was consistently induced by CpG ODN 1826 compared with CpG ODN 1585. The protective effects of both CpG ODNs were dependent on interleukin-12, as well as IFN-γ. Moreover, CD8+ T cells (but not CD4+ T cells), NK cells, and nitric oxide were implicated in the CpG ODN 1585-induced protection. These data establish that the protective mechanism induced by administration of CpG ODN 1585 in the absence of parasite antigen is similar in nature to the mechanism induced by immunization with radiation-attenuated P. yoelii sporozoites or with plasmid DNA encoding preerythrocytic-stage P. yoelii antigens. We were unable to confirm whether CD8+ T cells, NK cells, or nitric oxide were required for the CpG ODN 1826-induced protection, but this may reflect differences in the potency of the ODNs rather than a real difference in the mechanism of action of the two ODNs. This is the first report that stimulation of the innate immune system by CpG immunostimulatory motifs can confer sterile protection against malaria. PMID:11179339

GaussianCpG: a Gaussian model for detection of CpG island in human genome sequences.

PubMed

Yu, Ning; Guo, Xuan; Zelikovsky, Alexander; Pan, Yi

2017-05-24

As crucial markers in identifying biological elements and processes in mammalian genomes, CpG islands (CGI) play important roles in DNA methylation, gene regulation, epigenetic inheritance, gene mutation, chromosome inactivation and nuclesome retention. The generally accepted criteria of CGI rely on: (a) %G+C content is ≥ 50%, (b) the ratio of the observed CpG content and the expected CpG content is ≥ 0.6, and (c) the general length of CGI is greater than 200 nucleotides. Most existing computational methods for the prediction of CpG island are programmed on these rules. However, many experimentally verified CpG islands deviate from these artificial criteria. Experiments indicate that in many cases %G+C is < 50%, CpG obs /CpG exp varies, and the length of CGI ranges from eight nucleotides to a few thousand of nucleotides. It implies that CGI detection is not just a straightly statistical task and some unrevealed rules probably are hidden. A novel Gaussian model, GaussianCpG, is developed for detection of CpG islands on human genome. We analyze the energy distribution over genomic primary structure for each CpG site and adopt the parameters from statistics of Human genome. The evaluation results show that the new model can predict CpG islands efficiently by balancing both sensitivity and specificity over known human CGI data sets. Compared with other models, GaussianCpG can achieve better performance in CGI detection. Our Gaussian model aims to simplify the complex interaction between nucleotides. The model is computed not by the linear statistical method but by the Gaussian energy distribution and accumulation. The parameters of Gaussian function are not arbitrarily designated but deliberately chosen by optimizing the biological statistics. By using the pseudopotential analysis on CpG islands, the novel model is validated on both the real and artificial data sets.

Nucleic acid binding drugs. Part XIII. Molecular motion in a drug-nucleic acid model system: thermal motion analysis of a proflavine-dinucleoside crystal structure.

PubMed Central

Aggarwal, A K; Neidle, S

1985-01-01

The high-resolution crystal structure of the intercalation complex between proflavine and cytidylyl-3',5'-guanosine (CpG) has been studied by thermalmotion analysis. This has provided information on the translational and librational motions of individual groups in the complex. Many of these motions are similar to, though of larger magnitude than in uncomplexed dinucleosides. Pronounced librational effects were observed along the base pairs and in the plane of the drug chromophore. PMID:4034394

Immunogenic properties of a recombinant fusion protein containing the C-terminal 19 kDa of Plasmodium falciparum merozoite surface protein-1 and the innate immunity agonist FliC flagellin of Salmonella typhimurium.

PubMed

Bargieri, Daniel Y; Leite, Juliana A; Lopes, Stefanie C P; Sbrogio-Almeida, Maria Elisabete; Braga, Catarina J M; Ferreira, Luis C S; Soares, Irene S; Costa, Fabio T M; Rodrigues, Mauricio M

2010-04-01

In a recent study, we demonstrated the immunogenic properties of a new malaria vaccine polypeptide based on a 19 kDa C-terminal fragment of the merozoite surface protein-1 (MSP1(19)) from Plasmodium vivax and an innate immunity agonist, the Salmonella enterica serovar Typhimurium flagellin (FliC). Herein, we tested whether the same strategy, based on the MSP1(19) component of the deadly malaria parasite Plasmodium falciparum, could also generate a fusion polypeptide with enhanced immunogenicity. The His(6)FliC-MSP1(19) fusion protein was expressed from a recombinant Escherichia coli and showed preserved in vitro TLR5-binding activity. In contrast to animals injected with His(6)MSP1(19), mice subcutaneously immunised with the recombinant His(6)FliC-MSP1(19) developed strong MSP1(19)-specific systemic antibody responses with a prevailing IgG1 subclass. Incorporation of other adjuvants, such as CpG ODN 1826, complete and incomplete Freund's adjuvants or Quil-A, improved the IgG responses after the second, but not the third, immunising dose. It also resulted in a more balanced IgG subclass response, as evaluated by the IgG1/IgG2c ratio, and higher cell-mediated immune response, as determined by the detection of antigen-specific interferon-gamma secretion by immune spleen cells. MSP1(19)-specific antibodies recognised not only the recombinant protein, but also the native protein expressed on the surface of P. falciparum parasites. Finally, sera from rabbits immunised with the fusion protein alone inhibited the in vitro growth of three different P. falciparum strains. In summary, these results extend our previous observations and further demonstrate that fusion of the innate immunity agonist FliC to Plasmodium antigens is a promising alternative to improve their immunogenicity. (c) 2010 Elsevier Ltd. All rights reserved.

The SANT domain of human MI-ER1 interacts with Sp1 to interfere with GC box recognition and repress transcription from its own promoter.

PubMed

Ding, Zhihu; Gillespie, Laura L; Mercer, F Corinne; Paterno, Gary D

2004-07-02

To gain insight into the regulation of hmi-er1 expression, we cloned a human genomic DNA fragment containing one of the two hmi-er1 promoters and consisting of 1460 bp upstream of the translation initiation codon of hMI-ER1. Computer-assisted sequence analysis revealed that the hmi-er1 promoter region contains a CpG island but lacks an identifiable TATA element, initiator sequence and downstream promoter element. This genomic DNA was able to direct transcription of a luciferase reporter gene in a variety of human cell lines, and the minimal promoter was shown to be located within-68/+144 bp. Several putative Sp1 binding sites were identified, and we show that Sp1 can bind to the hmi-er1 minimal promoter and increase transcription, suggesting that the level of hmi-er1 expression may depend on the availability of Sp1 protein. Functional analysis revealed that hMI-ER1 represses Sp1-activated transcription from the minimal promoter by a histone deacetylase-independent mechanism. Chromatin immunoprecipitation analysis demonstrated that both Sp1 and hMI-ER1 are associated with the chromatin of the hmi-er1 promoter and that overexpression of hMI-ER1 in cell lines that allow Tet-On-inducible expression resulted in loss of detectable Sp1 from the endogenous hmi-er1 promoter. The mechanism by which this occurs does not involve binding of hMI-ER1 to cis-acting elements. Instead, we show that hMI-ER1 physically associates with Sp1 and that endogenous complexes containing the two proteins could be detected in vivo. Furthermore, hMI-ER1 specifically interferes with binding of Sp1 to the hmi-er1 minimal promoter as well as to an Sp1 consensus oligonucleotide. Deletion analysis revealed that this interaction occurs through a region containing the SANT domain of hMI-ER1. Together, these data reveal a functional role for the SANT domain in the action of co-repressor regulatory factors and suggest that the association of hMI-ER1 with Sp1 represents a novel mechanism for the negative regulation of Sp1 target promoters.

Experimental Autoimmune Encephalomyelitis (EAE)-Induced Elevated Expression of the E1 Isoform of Methyl CpG Binding Protein 2 (MeCP2E1): Implications in Multiple Sclerosis (MS)-Induced Neurological Disability and Associated Myelin Damage.

PubMed

Khorshid Ahmad, Tina; Zhou, Ting; AlTaweel, Khaled; Cortes, Claudia; Lillico, Ryan; Lakowski, Ted Martin; Gozda, Kiana; Namaka, Michael Peter

2017-06-12

Multiple sclerosis (MS) is a chronic neurological disease characterized by the destruction of central nervous system (CNS) myelin. At present, there is no cure for MS due to the inability to repair damaged myelin. Although the neurotrophin brain derived neurotrophic factor (BDNF) has a beneficial role in myelin repair, these effects may be hampered by the over-expression of a transcriptional repressor isoform of methyl CpG binding protein 2 (MeCP2) called MeCP2E1. We hypothesize that following experimental autoimmune encephalomyelitis (EAE)-induced myelin damage, the immune system induction of the pathogenic MeCP2E1 isoform hampers the myelin repair process by repressing BDNF expression. Using an EAE model of MS, we identify the temporal gene and protein expression changes of MeCP2E1, MeCP2E2 and BDNF. The expression changes of these key biological targets were then correlated with the temporal changes in neurological disability scores (NDS) over the entire disease course. Our results indicate that MeCP2E1 mRNA levels are elevated in EAE animals relative to naïve control (NC) and active control (AC) animals during all time points of disease progression. Our results suggest that the EAE-induced elevations in MeCP2E1 expression contribute to the repressed BDNF production in the spinal cord (SC). The sub-optimal levels of BDNF result in sustained NDS and associated myelin damage throughout the entire disease course. Conversely, we observed no significant differences in the expression patterns displayed for the MeCP2E2 isoform amongst our experimental groups. However, our results demonstrate that baseline protein expression ratios between the MeCP2E1 versus MeCP2E2 isoforms in the SC are higher than those identified within the dorsal root ganglia (DRG). Thus, the DRG represents a more conducive environment than that of the SC for BDNF production and transport to the CNS to assist in myelin repair. Henceforth, the sub-optimal BDNF levels we report in the SC may arise from the elevated MeCP2E1 vs. MeCP2E2 ratio in the SC that creates a more hostile environment thereby preventing local BDNF production. At the level of transcript, we demonstrate that EAE-induces the pathological enhanced expression of MeCP2E1 that contributes to enhanced NDS during the entire disease course. Thus, the pathological induction of the MeCP2E1 isoform contributes to the disruption of the normal homeostatic signaling equilibrium network that exists between cytokines, neurotrophins and chemokines that regulate the myelin repair process by repressing BDNF. Our research suggests that the elevated ratio of MeCP2E1 relative to MeCP2E2 may be a useful diagnostic marker that clinicians can utilize to determine the degree of neurological disability with associated myelin damage. The elevated MeCP2E1 vs. MeCP2E2 ratios (E1/E2) in the SC prevent BDNF from reaching optimal levels required for myelin repair. Thus, the lower E1/E2 ratios in the DRG, allow the DRG to serve as a weak secondary compensatory mechanism for enhanced production and delivery of BDNF to the SC to try to assist in myelin repair.

Research on DNA methylation of human osteosarcoma cell MGMT and its relationship with cell resistance to alkylating agents.

PubMed

Guo, Jun; Cui, Qiu; Jiang, WeiHao; Liu, Cheng; Li, DingFeng; Zeng, Yanjun

2013-08-01

The objective of this study was to explore the O(6)-methylguanine-DNA methyltransferase (MGMT) gene methylation status and its protein expression, as well as the effects of demethylating agent 5-Aza-2'-deoxycytidine (5-Aza-CdR) on MGMT gene expression and its resistance to alkylating agents, and to elucidate MGMT expression mechanism and significance in osteosarcoma. The human osteosarcoma cell lines Saos-2 and MG-63 were collected and treated with 5-Aza-CdR for 6 days. The cells not treated with 5-Aza-CdR were set as a negative control. The genomic DNA was extracted from the Saos-2 and MG-63 cells using methylation-specific PCR to detect the promoter CpG island methylation status of the MGMT gene. Cell sensitivity to alkylating agents before and after drug administration was detected by the MTT method. The variation in MGMT gene mRNA and protein was detected by reverse transcription PCR (RT-PCR) and Western blotting. The MGMT promoter gene of normal Saos-2 cells was methylated, with reduced MGMT mRNA and protein expression; the MGMT mRNA and protein expression of Saos-2 cells treated with 5-Aza-CdR was obviously enhanced, and its sensitivity to alkylating agents was reversed. Meanwhile, with promoter CpG island unmethylation of the MGMT gene, MGMT protein was expressed in the normal MG-63 cells and the MG-63 cells treated with 5-Aza-CdR, and both showed resistance to alkylating agents. The methylation status of the MGMT gene promoter in human osteosarcoma cells reflected the cells' ability to induce MGMT protein expression and can be used as a molecular marker to project the sensitivity of cancer tissues to alkylating agent drugs.

Carbon nanotubes enhance CpG uptake and potentiate antiglioma immunity.

PubMed

Zhao, Dongchang; Alizadeh, Darya; Zhang, Leying; Liu, Wei; Farrukh, Omar; Manuel, Edwin; Diamond, Don J; Badie, Behnam

2011-02-15

Stimulation of toll-like receptor-9 (TLR9) by CpG oligodeoxynucleotides (CpG) has been shown to counteract the immunosuppressive microenvironment and to inhibit tumor growth in glioma models. Because TLR9 is located intracellularly, we hypothesized that methods that enhance its internalization may also potentiate its immunostimulatory response. The goal of this study was to evaluate carbon nanotubes (CNT) as a CpG delivery vehicle in brain tumor models. Functionalized single-walled CNTs were conjugated with CpG (CNT-CpG) and evaluated in vitro and in mice bearing intracranial GL261 gliomas. Flow cytometry was used to assess CNT-CpG uptake and antiglioma immune response. Tumor growth was measured by bioluminescent imaging, histology, and animal survival. CNT-CpG was nontoxic and enhanced CpG uptake both in vitro and intracranial gliomas. CNT-mediated CpG delivery also potentiated proinflammatory cytokine production by primary monocytes. Interestingly, a single intracranial injection of low-dose CNT-CpG (but not free CpG or blank CNT) eradicated intracranial GL261 gliomas in half of tumor-bearing mice. Moreover, surviving animals exhibited durable tumor-free remission (>3 months), and were protected from intracranial tumor rechallenge, demonstrating induction of long-term antitumor immunity. These findings suggest that CNTs can potentiate CpG immunopotency by enhancing its delivery into tumor-associated inflammatory cells. ©2010 AACR.

CpG Dinucleotide Frequencies Reveal the Role of Host Methylation Capabilities in Parvovirus Evolution

PubMed Central

Upadhyay, Mohita; Samal, Jasmine; Kandpal, Manish; Vasaikar, Suhas; Biswas, Banhi; Gomes, James

2013-01-01

Parvoviruses are rapidly evolving viruses that infect a wide range of hosts, including vertebrates and invertebrates. Extensive methylation of the parvovirus genome has been recently demonstrated. A global pattern of methylation of CpG dinucleotides is seen in vertebrate genomes, compared to “fractional” methylation patterns in invertebrate genomes. It remains unknown if the loss of CpG dinucleotides occurs in all viruses of a given DNA virus family that infect host species spanning across vertebrates and invertebrates. We investigated the link between the extent of CpG dinucleotide depletion among autonomous parvoviruses and the evolutionary lineage of the infected host. We demonstrate major differences in the relative abundance of CpG dinucleotides among autonomous parvoviruses which share similar genome organization and common ancestry, depending on the infected host species. Parvoviruses infecting vertebrate hosts had significantly lower relative abundance of CpG dinucleotides than parvoviruses infecting invertebrate hosts. The strong correlation of CpG dinucleotide depletion with the gain in TpG/CpA dinucleotides and the loss of TpA dinucleotides among parvoviruses suggests a major role for CpG methylation in the evolution of parvoviruses. Our data present evidence that links the relative abundance of CpG dinucleotides in parvoviruses to the methylation capabilities of the infected host. In sum, our findings support a novel perspective of host-driven evolution among autonomous parvoviruses. PMID:24109231

Nanoparticle conjugation enhances the immunomodulatory effects of intranasally delivered CpG in house dust mite-allergic mice

DOE PAGES

Ballester, Marie; Jeanbart, Laura; de Titta, Alexandre; ...

2015-09-21

An emerging strategy in preventing and treating airway allergy consists of modulating the immune response induced against allergens in the lungs. CpG oligodeoxynucleotides have been investigated in airway allergy studies, but even if promising, efficacy requires further substantiation. We investigated the effect of pulmonary delivery of nanoparticle (NP)-conjugated CpG on lung immunity and found that NP-CpG led to enhanced recruitment of activated dendritic cells and to Th1 immunity compared to free CpG. We then evaluated if pulmonary delivery of NP-CpG could prevent and treat house dust mite-induced allergy by modulating immunity directly in lungs. When CpG was administered as immunomodulatorymore » therapy prior to allergen sensitization, we found that NP-CpG significantly reduced eosinophilia, IgE levels, mucus production and Th2 cytokines, while free CpG had only a moderate effect on these parameters. In a therapeutic setting where CpG was administered after allergen sensitization, we found that although both free CpG and NP-CpG reduced eosinophilia and IgE levels to the same extent, NP conjugation of CpG significantly enhanced reduction of Th2 cytokines in lungs of allergic mice. Taken together, these data highlight benefits of NP conjugation and the relevance of NP-CpG as allergen-free therapy to modulate lung immunity and treat airway allergy.« less

Carbon Nanotubes Enhance CpG Uptake and Potentiate Anti-Glioma Immunity

PubMed Central

Zhao, Dongchang; Alizadeh, Darya; Zhang, Leying; Liu, Wei; Farrukh, Omar; Manuel, Edwin; Diamond, Don J.; Badie, Behnam

2010-01-01

Purpose Stimulation of toll-like receptor-9 (TLR9) by CpG oligodeoxynucleotides (CpG) has been shown to counteract the immunosuppressive microenvironment and to inhibit tumor growth in glioma models. Since TLR9 is located intracellularly, we hypothesized that methods that enhance its internalization may also potentiate its immunostimulatory response. The goal of this study was to evaluate carbon nanotubes (CNTs) as a CpG delivery vehicle in brain tumor models. Experimental Design Functionalized single-walled CNTs were conjugated with CpG (CNT-CpG) and evaluated in vitro and in mice bearing intracranial GL261 gliomas. Flow cytometry was used to assess CNT-CpG uptake and anti-glioma immune response. Tumor growth was measured by bioluminescent imaging, histology, and animal survival. Results CNT-CpG was nontoxic and enhanced CpG uptake both in vitro and intracranial gliomas. CNT-mediated CpG delivery also potentiated pro-inflammatory cytokine production by primary monocytes. Interestingly, a single intracranial injection of low-dose CNT-CpG (but not free CpG or blank CNT) eradicated intracranial GL261 gliomas in half of tumor-bearing mice. Moreover, surviving animals exhibited durable tumor-free remission (> 3 months), and were protected from intracranial tumor rechallenge, demonstrating induction of long-term anti-tumor immunity. Conclusions These findings suggest that CNTs can potentiate CpG immunopotency by enhancing its delivery into tumor-associated inflammatory cells. PMID:21088258

CpG dinucleotide frequencies reveal the role of host methylation capabilities in parvovirus evolution.

PubMed

Upadhyay, Mohita; Samal, Jasmine; Kandpal, Manish; Vasaikar, Suhas; Biswas, Banhi; Gomes, James; Vivekanandan, Perumal

2013-12-01

Parvoviruses are rapidly evolving viruses that infect a wide range of hosts, including vertebrates and invertebrates. Extensive methylation of the parvovirus genome has been recently demonstrated. A global pattern of methylation of CpG dinucleotides is seen in vertebrate genomes, compared to "fractional" methylation patterns in invertebrate genomes. It remains unknown if the loss of CpG dinucleotides occurs in all viruses of a given DNA virus family that infect host species spanning across vertebrates and invertebrates. We investigated the link between the extent of CpG dinucleotide depletion among autonomous parvoviruses and the evolutionary lineage of the infected host. We demonstrate major differences in the relative abundance of CpG dinucleotides among autonomous parvoviruses which share similar genome organization and common ancestry, depending on the infected host species. Parvoviruses infecting vertebrate hosts had significantly lower relative abundance of CpG dinucleotides than parvoviruses infecting invertebrate hosts. The strong correlation of CpG dinucleotide depletion with the gain in TpG/CpA dinucleotides and the loss of TpA dinucleotides among parvoviruses suggests a major role for CpG methylation in the evolution of parvoviruses. Our data present evidence that links the relative abundance of CpG dinucleotides in parvoviruses to the methylation capabilities of the infected host. In sum, our findings support a novel perspective of host-driven evolution among autonomous parvoviruses.

Immunostimulatory Oligodeoxynucleotides Containing the CpG Motif are Effective as Immune Adjuvants in Tumor Antigen Immunization

NASA Astrophysics Data System (ADS)

Weiner, George J.; Liu, Hsin-Ming; Wooldridge, James E.; Dahle, Christopher E.; Krieg, Arthur M.

1997-09-01

Recent advances in our understanding of the immune response are allowing for the logical design of new approaches to cancer immunization. One area of interest is the development of new immune adjuvants. Immunostimulatory oligodeoxynucleotides containing the CpG motif (CpG ODN) can induce production of a wide variety of cytokines and activate B cells, monocytes, dendritic cells, and NK cells. Using the 38C13 B cell lymphoma model, we assessed whether CpG ODN can function as immune adjuvants in tumor antigen immunization. The idiotype served as the tumor antigen. Select CpG ODN were as effective as complete Freund's adjuvant at inducing an antigen-specific antibody response but were associated with less toxicity. These CpG ODN induced a higher titer of antigen-specific IgG2a than did complete Freund's adjuvant, suggesting an enhanced TH1 response. Mice immunized with CpG ODN as an adjuvant were protected from tumor challenge to a degree similar to that seen in mice immunized with complete Freund's adjuvant. We conclude that CpG ODN are effective as immune adjuvants and are attractive as part of a tumor immunization strategy.

DNA containing CpG motifs induces angiogenesis

NASA Astrophysics Data System (ADS)

Zheng, Mei; Klinman, Dennis M.; Gierynska, Malgorzata; Rouse, Barry T.

2002-06-01

New blood vessel formation in the cornea is an essential step in the pathogenesis of a blinding immunoinflammatory reaction caused by ocular infection with herpes simplex virus (HSV). By using a murine corneal micropocket assay, we found that HSV DNA (which contains a significant excess of potentially bioactive "CpG" motifs when compared with mammalian DNA) induces angiogenesis. Moreover, synthetic oligodeoxynucleotides containing CpG motifs attract inflammatory cells and stimulate the release of vascular endothelial growth factor (VEGF), which in turn triggers new blood vessel formation. In vitro, CpG DNA induces the J774A.1 murine macrophage cell line to produce VEGF. In vivo CpG-induced angiogenesis was blocked by the administration of anti-mVEGF Ab or the inclusion of "neutralizing" oligodeoxynucleotides that specifically oppose the stimulatory activity of CpG DNA. These findings establish that DNA containing bioactive CpG motifs induces angiogenesis, and suggest that CpG motifs in HSV DNA may contribute to the blinding lesions of stromal keratitis.

[Quality and compliance with Clinical Practice Guidelines of Chronic Noncommunicable Diseases in primary care].

PubMed

Poblano-Verástegui, Ofelia; Vieyra-Romero, Waldo I; Galván-García, Ángel F; Fernández-Elorriaga, María; Rodríguez-Martínez, Antonia I; Saturno-Hernández, Pedro J

2017-01-01

To assess the quality and compliance of clinical practice guidelines (CPG) applicable to chronic non-communicable diseases (CNCD) in primary healthcare (CS), and views of staff on the barriers, facilitators and their use. 18 valued CPG with AGREEII, 3 are selected to develop indicators and assess compliance using lot quality acceptance sample (LQAS, standard 75 / 95% threshold 40 / 75% respectively, α:0. 05, β:0. 10) on 5 CS. 70 professionals surveyed about knowledge and use of CPG. Average quality of the CPG was 57.2%; low rating in domains: "Applicability" (<25%), "Stakeholder involvement" (43.5%) and "Rigour of development" (55.0%). Compliance in CS ranges from 39 to 53.4%. Professionals show uneven knowledge of CPG; 44 to 45% (according to CPG), they declare that they are not used, they identify as main barriers the lack of training, and their difficult accessibility and management. The quality and implementation of evaluated CPG is deficient constituting an opportunity of improvement in health services.

DNA-inorganic hybrid nanovaccine for cancer immunotherapy

NASA Astrophysics Data System (ADS)

Zhu, Guizhi; Liu, Yijing; Yang, Xiangyu; Kim, Young-Hwa; Zhang, Huimin; Jia, Rui; Liao, Hsien-Shun; Jin, Albert; Lin, Jing; Aronova, Maria; Leapman, Richard; Nie, Zhihong; Niu, Gang; Chen, Xiaoyuan

2016-03-01

Cancer evolves to evade or compromise the surveillance of the immune system, and cancer immunotherapy aims to harness the immune system in order to inhibit cancer development. Unmethylated CpG dinucleotide-containing oligonucleotides (CpG), a class of potent adjuvants that activate the toll-like receptor 9 (TLR9) located in the endolysosome of many antigen-presenting cells (APCs), are promising for cancer immunotherapy. However, clinical application of synthetic CpG confronts many challenges such as suboptimal delivery into APCs, unfavorable pharmacokinetics caused by limited biostability and short in vivo half-life, and side effects associated with leaking of CpG into the systemic circulation. Here we present DNA-inorganic hybrid nanovaccines (hNVs) for efficient uptake into APCs, prolonged tumor retention, and potent immunostimulation and cancer immunotherapy. hNVs were self-assembled from concatemer CpG analogs and magnesium pyrophosphate (Mg2PPi). Mg2PPi renders hNVs resistant to nuclease degradation and thermal denaturation, both of which are demanding characteristics for effective vaccination and the storage and transportation of vaccines. Fluorophore-labeled hNVs were tracked to be efficiently internalized into the endolysosomes of APCs, where Mg2PPi was dissolved in an acidic environment and thus CpG analogs were exposed to hNVs. Internalized hNVs in APCs led to (1) elevated secretion of proinflammatory factors, and (2) elevated expression of co-stimulatory factors. Compared with molecular CpG, hNVs dramatically prolonged the tissue retention of CpG analogs and reduced splenomegaly, a common side effect of CpG. In a melanoma mouse model, two injections of hNVs significantly inhibited the tumor growth and outperformed the molecular CpG. These results suggest hNVs are promising for cancer immunotherapy.Cancer evolves to evade or compromise the surveillance of the immune system, and cancer immunotherapy aims to harness the immune system in order to inhibit cancer development. Unmethylated CpG dinucleotide-containing oligonucleotides (CpG), a class of potent adjuvants that activate the toll-like receptor 9 (TLR9) located in the endolysosome of many antigen-presenting cells (APCs), are promising for cancer immunotherapy. However, clinical application of synthetic CpG confronts many challenges such as suboptimal delivery into APCs, unfavorable pharmacokinetics caused by limited biostability and short in vivo half-life, and side effects associated with leaking of CpG into the systemic circulation. Here we present DNA-inorganic hybrid nanovaccines (hNVs) for efficient uptake into APCs, prolonged tumor retention, and potent immunostimulation and cancer immunotherapy. hNVs were self-assembled from concatemer CpG analogs and magnesium pyrophosphate (Mg2PPi). Mg2PPi renders hNVs resistant to nuclease degradation and thermal denaturation, both of which are demanding characteristics for effective vaccination and the storage and transportation of vaccines. Fluorophore-labeled hNVs were tracked to be efficiently internalized into the endolysosomes of APCs, where Mg2PPi was dissolved in an acidic environment and thus CpG analogs were exposed to hNVs. Internalized hNVs in APCs led to (1) elevated secretion of proinflammatory factors, and (2) elevated expression of co-stimulatory factors. Compared with molecular CpG, hNVs dramatically prolonged the tissue retention of CpG analogs and reduced splenomegaly, a common side effect of CpG. In a melanoma mouse model, two injections of hNVs significantly inhibited the tumor growth and outperformed the molecular CpG. These results suggest hNVs are promising for cancer immunotherapy. Electronic supplementary information (ESI) available: ESI materials and methods, characterization of hNVs. See DOI: 10.1039/c5nr08821f

Reduced DNA methylation of FKBP5 in Cushing's syndrome.

PubMed

Resmini, Eugenia; Santos, Alicia; Aulinas, Anna; Webb, Susan M; Vives-Gilabert, Yolanda; Cox, Olivia; Wand, Gary; Lee, Richard S

2016-12-01

FKBP5 encodes a co-chaperone of HSP90 protein that regulates intracellular glucocorticoid receptor sensitivity. When it is bound to the glucocorticoid receptor complex, cortisol binds with lower affinity to glucocorticoid receptor. Cushing's syndrome is associated with memory deficits, smaller hippocampal volumes, and wide range of cognitive impairments. We aimed at evaluating blood DNA methylation of FKBP5 and its relationship with memory and hippocampal volumes in Cushing's syndrome patients. Polymorphism rs1360780 in FKBP5 has also been assessed to determine whether genetic variations can also govern CpG methylation. Thirty-two Cushing's syndrome patients and 32 matched controls underwent memory tests, 3-Tesla MRI of the brain, and DNA extraction from total leukocytes. DNA samples were bisulfite treated, PCR amplified, and pyrosequenced to assess a total of 41CpG-dinucleotides in the introns 1, 2, 5, and 7 of FKBP5. Significantly lower intronic FKBP5 DNA methylation in CS patients compared to controls was observed in ten CpG-dinucleotides. DNA methylation at these CpGs correlated with left and right HV (Intron-2-Region-2-CpG-3: LHV, r = 0.73, p = 0.02; RHV, r = 0.58, p = 0.03). Cured and active CS patients showed both lower methylation of intron 2 (92.37, 91.8, and 93.34 %, respectively, p = 0.03 for both) and of intron 7 (77.08, 73.74, and 79.71 %, respectively, p = 0.02 and p < 0.01) than controls. Twenty-two subjects had the CC genotype, 34 had the TC genotype, and eight had the TT genotype. Lower average DNA methylation in intron 7 was observed in the TT subjects compared to CC (72.5vs. 79.5 %, p = 0.02) and to TC (72.5 vs. 79.0 %, p = 0.03). Our data demonstrate, for the first time, a reduction of intronic DNA methylation of FKBP5 in CS patients.

Toll-like receptors 9 and 3 as essential components of innate immune defense against mouse cytomegalovirus infection.

PubMed

Tabeta, Koichi; Georgel, Philippe; Janssen, Edith; Du, Xin; Hoebe, Kasper; Crozat, Karine; Mudd, Suzanne; Shamel, Louis; Sovath, Sosathya; Goode, Jason; Alexopoulou, Lena; Flavell, Richard A; Beutler, Bruce

2004-03-09

Several subsets of dendritic cells have been shown to produce type I IFN in response to viral infections, thereby assisting the natural killer cell-dependent response that eliminates the pathogen. Type I IFN production can be induced both by unmethylated CpG-oligodeoxynucleotide and by double-stranded RNA. Here, we describe a codominant CpG-ODN unresponsive phenotype that results from an N-ethyl-N-nitrosourea-induced missense mutation in the Tlr9 gene (Tlr9(CpG1)). Mice homozygous for the Tlr9(CpG1) allele are highly susceptible to mouse cytomegalovirus infection and show impaired infection-induced secretion of IFN-alpha/beta and natural killer cell activation. We also demonstrate that both the Toll-like receptor (TLR) 9 --> MyD88 and TLR3 --> Trif signaling pathways are activated in vivo on viral inoculation, and that each pathway contributes to innate defense against systemic viral infection. Whereas both pathways lead to type I IFN production, neither pathway offers full protection against mouse cytomegalovirus infection in the absence of the other. The Tlr9(CpG1) mutation alters a leucine-rich repeat motif and lies within a receptor domain that is conserved within the evolutionary cluster encompassing TLRs 7, 8, and 9. In other TLRs, including three mouse-specific TLRs described in this paper, the affected region is not represented. The phenotypic effect of the Tlr9(CpG1) allele thus points to a critical role for TLR9 in viral sensing and identifies a vulnerable amino acid within the ectodomain of three TLR proteins, essential for a ligand response.

A dinucleotide motif in oligonucleotides shows potent immunomodulatory activity and overrides species-specific recognition observed with CpG motif.

PubMed

Kandimalla, Ekambar R; Bhagat, Lakshmi; Zhu, Fu-Gang; Yu, Dong; Cong, Yan-Ping; Wang, Daqing; Tang, Jimmy X; Tang, Jin-Yan; Knetter, Cathrine F; Lien, Egil; Agrawal, Sudhir

2003-11-25

Bacterial and synthetic DNAs containing CpG dinucleotides in specific sequence contexts activate the vertebrate immune system through Toll-like receptor 9 (TLR9). In the present study, we used a synthetic nucleoside with a bicyclic heterobase [1-(2'-deoxy-beta-d-ribofuranosyl)-2-oxo-7-deaza-8-methyl-purine; R] to replace the C in CpG, resulting in an RpG dinucleotide. The RpG dinucleotide was incorporated in mouse- and human-specific motifs in oligodeoxynucleotides (oligos) and 3'-3-linked oligos, referred to as immunomers. Oligos containing the RpG motif induced cytokine secretion in mouse spleen-cell cultures. Immunomers containing RpG dinucleotides showed activity in transfected-HEK293 cells stably expressing mouse TLR9, suggesting direct involvement of TLR9 in the recognition of RpG motif. In J774 macrophages, RpG motifs activated NF-kappa B and mitogen-activated protein kinase pathways. Immunomers containing the RpG dinucleotide induced high levels of IL-12 and IFN-gamma, but lower IL-6 in time- and concentration-dependent fashion in mouse spleen-cell cultures costimulated with IL-2. Importantly, immunomers containing GTRGTT and GARGTT motifs were recognized to a similar extent by both mouse and human immune systems. Additionally, both mouse- and human-specific RpG immunomers potently stimulated proliferation of peripheral blood mononuclear cells obtained from diverse vertebrate species, including monkey, pig, horse, sheep, goat, rat, and chicken. An immunomer containing GTRGTT motif prevented conalbumin-induced and ragweed allergen-induced allergic inflammation in mice. We show that a synthetic bicyclic nucleotide is recognized in the C position of a CpG dinucleotide by immune cells from diverse vertebrate species without bias for flanking sequences, suggesting a divergent nucleotide motif recognition pattern of TLR9.

Exposure to welding fumes is associated with hypomethylation of the F2RL3 gene: a cardiovascular disease marker

PubMed Central

Hossain, Mohammad B; Li, Huiqi; Hedmer, Maria; Tinnerberg, Håkan; Albin, Maria; Broberg, Karin

2015-01-01

Background Welders are at risk for cardiovascular disease. Recent studies linked tobacco smoke exposure to hypomethylation of the F2RL3 (coagulation factor II (thrombin) receptor-like 3) gene, a marker for cardiovascular disease prognosis and mortality. However, whether welding fumes cause hypomethylation of F2RL3 remains unknown. Methods We investigated 101 welders (median span of working as a welder: 7 years) and 127 unexposed controls (non-welders with no obvious exposure to respirable dust at work), age range 23–60 years, all currently non-smoking, in Sweden. The participants were interviewed about their work history, lifestyle factors and diseases. Personal sampling of respirable dust was performed for the welders. DNA methylation of F2RL3 in blood was assessed by pyrosequencing of four CpG sites, CpG_2 (corresponds to cg03636183) to CpG_5, in F2RL3. Multivariable linear regression analysis was used to assess the association between exposure to welding fumes and F2RL3 methylation. Results Welders had 2.6% lower methylation of CpG_5 than controls (p<0.001). Higher concentrations of measured respirable dust among the welders were associated with hypomethylation of CpG_2, CpG_4 and CpG_5 (β=−0.49 to −1.4, p<0.012); p<0.029 adjusted for age, previous smoking, passive smoking, education, current residence and respirator use. Increasing the number of years working as a welder was associated with hypomethylation of CpG_4 (linear regression analysis, β=−0.11, p=0.039, adjusted for previous smoking). Previous tobacco smokers had 1.5–4.7% (p<0.014) lower methylation of 3 of the 4 CpG sites in F2RL3 (CpG_2, CpG_4 and CpG_5) compared to never-smokers. A non-significant lower risk of cardiovascular disease with more methylation was observed for all CpG sites. Conclusions Welding fumes exposure and previous smoking were associated with F2RL3 hypomethylation. This finding links low-to-moderate exposure to welding fumes to adverse effects on the cardiovascular system, and suggests a potential mechanistic pathway for this link, via epigenetic effects on F2RL3 expression. PMID:26395445

Association of the CpG Methylation Pattern of the Proximal Insulin Gene Promoter with Type 1 Diabetes

PubMed Central

Fradin, Delphine; Le Fur, Sophie; Mille, Clémence; Naoui, Nadia; Groves, Chris; Zelenika, Diana; McCarthy, Mark I.; Lathrop, Mark; Bougnères, Pierre

2012-01-01

The insulin (INS) region is the second most important locus associated with Type 1 Diabetes (T1D). The study of the DNA methylation pattern of the 7 CpGs proximal to the TSS in the INS gene promoter revealed that T1D patients have a lower level of methylation of CpG -19, -135 and -234 (p = 2.10−16) and a higher methylation of CpG -180 than controls, while methylation was comparable for CpG -69, -102, -206. The magnitude of the hypomethylation relative to a control population was 8–15% of the corresponding levels in controls and was correlated in CpGs -19 and -135 (r = 0.77) and CpG -135 and -234 (r = 0.65). 70/485 (14%) of T1D patients had a simultaneous decrease in methylation of CpG -19, -135, -234 versus none in 317 controls. CpG methylation did not correlate with glycated hemoglobin or with T1D duration. The methylation of CpG -69, -102, -180, -206, but not CpG -19, -135, -234 was strongly influenced by the cis-genotype at rs689, a SNP known to show a strong association with T1D. We hypothesize that part of this genetic association could in fact be mediated at the statistical and functional level by the underlying changes in neighboring CpG methylation. Our observation of a CpG-specific, locus-specific methylation pattern, although it can provide an epigenetic biomarker of a multifactorial disease, does not indicate whether the reported epigenetic pattern preexists or follows the establishment of T1D. To explore the effect of chronic hyperglycemia on CpG methylation, we studied non obese patients with type 2 diabetes (T2D) who were found to have decreased CpG-19 methylation versus age-matched controls, similar to T1D (p = 2.10−6) but increased CpG-234 methylation (p = 5.10−8), the opposite of T1D. The causality and natural history of the different epigenetic changes associated with T1D or T2D remain to be determined. PMID:22567146

Apo-9′-Fucoxanthinone, Isolated from Sargassum muticum, Inhibits CpG-Induced Inflammatory Response by Attenuating the Mitogen-Activated Protein Kinase Pathway

PubMed Central

Chae, Doobyeong; Manzoor, Zahid; Kim, Sung Chun; Kim, Sohyun; Oh, Tae-Heon; Yoo, Eun-Sook; Kang, Hee-Kyoung; Hyun, Jin-Won; Lee, Nam Ho; Ko, Mi-Hee; Koh, Young-Sang

2013-01-01

Sargassum muticum (S. muticum) is a brown edible alga and widely distributed in Korea. This report was designed to evaluate the anti-inflammatory properties of apo-9′-fucoxanthinone (APO-9′) isolated from S. muticum on pro-inflammatory cytokine production. S. muticum extract (SME) exhibited significant inhibitory effects on pro-inflammatory cytokine production in bone marrow-derived macrophages (BMDMs) and dendritic cells (BMDCs). APO-9′ pre-treatment in the CpG DNA-stimulated BMDMs and BMDCs showed a strong dose-dependent inhibitory effect on interleukin (IL)-12 p40, IL-6 and tumor necrosis factor (TNF)-α production with IC50 values ranging from 5.31 to 13.79. It exhibited a strong inhibitory effect on the phosphorylation of ERK1/2 and on activator protein (AP)-1 reporter activity. APO-9′ pre-treatment exhibited significant inhibition of CpG DNA-induced production of inducible nitric oxide synthase. Taken together, these data suggest that SME and APO-9′ have a significant anti-inflammatory property and warrant further studies concerning the potentials of SME and APO-9′ for medicinal use. PMID:23985898

CpG PatternFinder: a Windows-based utility program for easy and rapid identification of the CpG methylation status of DNA.

PubMed

Xu, Yi-Hua; Manoharan, Herbert T; Pitot, Henry C

2007-09-01

The bisulfite genomic sequencing technique is one of the most widely used techniques to study sequence-specific DNA methylation because of its unambiguous ability to reveal DNA methylation status to the order of a single nucleotide. One characteristic feature of the bisulfite genomic sequencing technique is that a number of sample sequence files will be produced from a single DNA sample. The PCR products of bisulfite-treated DNA samples cannot be sequenced directly because they are heterogeneous in nature; therefore they should be cloned into suitable plasmids and then sequenced. This procedure generates an enormous number of sample DNA sequence files as well as adding extra bases belonging to the plasmids to the sequence, which will cause problems in the final sequence comparison. Finding the methylation status for each CpG in each sample sequence is not an easy job. As a result CpG PatternFinder was developed for this purpose. The main functions of the CpG PatternFinder are: (i) to analyze the reference sequence to obtain CpG and non-CpG-C residue position information. (ii) To tailor sample sequence files (delete insertions and mark deletions from the sample sequence files) based on a configuration of ClustalW multiple alignment. (iii) To align sample sequence files with a reference file to obtain bisulfite conversion efficiency and CpG methylation status. And, (iv) to produce graphics, highlighted aligned sequence text and a summary report which can be easily exported to Microsoft Office suite. CpG PatternFinder is designed to operate cooperatively with BioEdit, a freeware on the internet. It can handle up to 100 files of sample DNA sequences simultaneously, and the total CpG pattern analysis process can be finished in minutes. CpG PatternFinder is an ideal software tool for DNA methylation studies to determine the differential methylation pattern in a large number of individuals in a population. Previously we developed the CpG Analyzer program; CpG PatternFinder is our further effort to create software tools for DNA methylation studies.

[Comparative evaluation of clinical practice guidelines for the treatment of schizophrenia].

PubMed

Delessert, D; Pomini, V; Grasset, F; Baumann, P

2008-01-01

Many clinical practice guidelines (CPG) have been published in reply to the development of the concept of "evidence-based medicine" (EBM) and as a solution to the difficulty of synthesizing and selecting relevant medical literature. Taking into account the expansion of new CPG, the question of choice arises: which CPG to consider in a given clinical situation? It is of primary importance to evaluate the quality of the CPG, but until recently, there has been no standardized tool of evaluation or comparison of the quality of the CPG. An instrument of evaluation of the quality of the CPG, called "AGREE" for appraisal of guidelines for research and evaluation was validated in 2002. The six principal CPG concerning the treatment of schizophrenia are compared with the help of the "AGREE" instrument: (1) "the Agence nationale pour le développement de l'évaluation médicale (ANDEM) recommendations"; (2) "The American Psychiatric Association (APA) practice guideline for the treatment of patients with schizophrenia"; (3) "The quick reference guide of APA practice guideline for the treatment of patients with schizophrenia"; (4) "The schizophrenia patient outcomes research team (PORT) treatment recommendations"; (5) "The Texas medication algorithm project (T-MAP)" and (6) "The expert consensus guideline for the treatment of schizophrenia". The results of our study were then compared with those of a similar investigation published in 2005, structured on 24 CPG tackling the treatment of schizophrenia. The "AGREE" tool was also used by two investigators in their study. In general, the scores of the two studies differed little and the two global evaluations of the CPG converged; however, each of the six CPG is perfectible. The rigour of elaboration of the six CPG was in general average. The consideration of the opinion of potential users was incomplete, and an effort made in the presentation of the recommendations would facilitate their clinical use. Moreover, there was little consideration by the authors regarding the applicability of the recommendations. Globally, two CPG are considered as strongly recommended: "the quick reference guide of the APA practice guideline for the treatment of patients with schizophrenia" and "the T-MAP".

Clinical practice guidelines (CPGs) reduce costs in the management of isolated splenic injuries at pediatric trauma centers.

PubMed

Gutierrez, Ivan M; Zurakowski, David; Chen, Qiaoli; Mooney, David P

2013-02-01

The American Pediatric Surgical Association Trauma Committee proposed the use of a clinical practice guideline (CPG) for the non-operative management of isolated splenic injuries in 1998. An analysis was conducted to determine the financial impact of CPGs on the management of these injuries. The Pediatric Health Information System database, which contains data from 44 children's hospitals, was used to identify children who sustained a graded isolated splenic injury between June 2005 and June 2010. Demographics, length of stay (LOS), readmission rates, and laboratory, imaging, procedural, and total cost data were determined for all hospitals verified as a pediatric trauma center by the American College of Surgeons and/or designated by their local authority. Comparisons were made between facilities self-identifying as having a splenic injury management CPG and those without a CPG. Children (1,154) with isolated splenic injuries (grades 1-4) were cared for in 26 pediatric trauma centers: 20 with a CPG and 6 without (non-CPG). Median costs were significantly lower at CPG than non-CPG centers for imaging (US $163 vs. US $641, P < .001), laboratory (US $629 vs. US $1,044, P < .001), and total hospital stay (US $9,868 vs. US $10,830, P < .001). The median LOS for CPG and non-CPG centers were similar (3 vs. 2 days, P = .38), as were readmission rates within 90 days (3.1 vs. 5.1 %, P = .21). Multiple linear regression indicated that LOS (P < .001) and utilization of a CPG (P = .007) are significant independent predictors of total cost. Utilization of a CPG to manage children with isolated splenic injuries at a pediatric trauma center results in significantly reduced imaging, laboratory, and total hospital costs independent of patient age, gender, grade, and LOS.

Performance of Different Analytical Software Packages in Quantification of DNA Methylation by Pyrosequencing.

PubMed

Grasso, Chiara; Trevisan, Morena; Fiano, Valentina; Tarallo, Valentina; De Marco, Laura; Sacerdote, Carlotta; Richiardi, Lorenzo; Merletti, Franco; Gillio-Tos, Anna

2016-01-01

Pyrosequencing has emerged as an alternative method of nucleic acid sequencing, well suited for many applications which aim to characterize single nucleotide polymorphisms, mutations, microbial types and CpG methylation in the target DNA. The commercially available pyrosequencing systems can harbor two different types of software which allow analysis in AQ or CpG mode, respectively, both widely employed for DNA methylation analysis. Aim of the study was to assess the performance for DNA methylation analysis at CpG sites of the two pyrosequencing software which allow analysis in AQ or CpG mode, respectively. Despite CpG mode having been specifically generated for CpG methylation quantification, many investigations on this topic have been carried out with AQ mode. As proof of equivalent performance of the two software for this type of analysis is not available, the focus of this paper was to evaluate if the two modes currently used for CpG methylation assessment by pyrosequencing may give overlapping results. We compared the performance of the two software in quantifying DNA methylation in the promoter of selected genes (GSTP1, MGMT, LINE-1) by testing two case series which include DNA from paraffin embedded prostate cancer tissues (PC study, N = 36) and DNA from blood fractions of healthy people (DD study, N = 28), respectively. We found discrepancy in the two pyrosequencing software-based quality assignment of DNA methylation assays. Compared to the software for analysis in the AQ mode, less permissive criteria are supported by the Pyro Q-CpG software, which enables analysis in CpG mode. CpG mode warns the operators about potential unsatisfactory performance of the assay and ensures a more accurate quantitative evaluation of DNA methylation at CpG sites. The implementation of CpG mode is strongly advisable in order to improve the reliability of the methylation analysis results achievable by pyrosequencing.

Comprehensive analysis of CpG islands in human chromosomes 21 and 22

NASA Astrophysics Data System (ADS)

Takai, Daiya; Jones, Peter A.

2002-03-01

CpG islands are useful markers for genes in organisms containing 5-methylcytosine in their genomes. In addition, CpG islands located in the promoter regions of genes can play important roles in gene silencing during processes such as X-chromosome inactivation, imprinting, and silencing of intragenomic parasites. The generally accepted definition of what constitutes a CpG island was proposed in 1987 by Gardiner-Garden and Frommer [Gardiner-Garden, M. & Frommer, M. (1987) J. Mol. Biol. 196, 261-282] as being a 200-bp stretch of DNA with a C+G content of 50% and an observed CpG/expected CpG in excess of 0.6. Any definition of a CpG island is somewhat arbitrary, and this one, which was derived before the sequencing of mammalian genomes, will include many sequences that are not necessarily associated with controlling regions of genes but rather are associated with intragenomic parasites. We have therefore used the complete genomic sequences of human chromosomes 21 and 22 to examine the properties of CpG islands in different sequence classes by using a search algorithm that we have developed. Regions of DNA of greater than 500 bp with a G+C equal to or greater than 55% and observed CpG/expected CpG of 0.65 were more likely to be associated with the 5' regions of genes and this definition excluded most Alu-repetitive elements. We also used genome sequences to show strong CpG suppression in the human genome and slight suppression in Drosophila melanogaster and Saccharomyces cerevisiae. This finding is compatible with the recent detection of 5-methylcytosine in Drosophila, and might suggest that S. cerevisiae has, or once had, CpG methylation.

Treatment of Tobacco Dependence, a Critical Gap in Czech Clinical Practice Guidelines.

PubMed

Zvolská, Kamila; Fraser, Keely; Zvolský, Miroslav; Králíková, Eva

2017-06-01

Tobacco related comorbidities and treatment of dependence are relevant to clinicians of all disciplines. Clinicians should provide a brief intervention about tobacco use with smokers at each clinical contact (success rate of 5-10 %). Intensive treatment (success rate >30%) should be available to those who need it. Brief intervention is not yet standard clinical practice. Our aim was to assess clinical practice guidelines (CPG) of selected medical professional societies to determine whether or not tobacco dependence treatment recommendations were included. Between October and December 2013, we conducted a keyword search of CPG for 20 medical professional societies in the Czech Republic. We searched for the keywords "smoking", "tobacco" and "nicotine addiction" in 91 CPG documents, which were freely available on the websites of selected professional societies. We focused specifically on CPG relating to cardiovascular and respiratory diseases as well as cancer. We excluded any CPG focused on acute conditions, diagnostics only, laboratory methods, or administration. There was no mention of smoking in 27.7% (26/94) of CPG documents. Only 16% (15/94) of CPG documents listed smoking as a risk factor. 42.5% (40/94) mentioned smoking related phrases (e.g. "smoking ban"). Only 13.8% (13/94) of CPG included a section on tobacco dependence, referenced tobacco dependence treatment guidelines or mentioned specialized treatment centres where smokers can be referred. Nearly one third of CPG related to cardiovascular and respiratory diseases as well as cancer made no mention of smoking. Despite the clinical significance of smoking, the majority of CPG did not adequately address tobacco dependence and its treatment. Copyright© by the National Institute of Public Health, Prague 2017

DNA-inorganic hybrid nanovaccine for cancer immunotherapy.

PubMed

Zhu, Guizhi; Liu, Yijing; Yang, Xiangyu; Kim, Young-Hwa; Zhang, Huimin; Jia, Rui; Liao, Hsien-Shun; Jin, Albert; Lin, Jing; Aronova, Maria; Leapman, Richard; Nie, Zhihong; Niu, Gang; Chen, Xiaoyuan

2016-03-28

Cancer evolves to evade or compromise the surveillance of the immune system, and cancer immunotherapy aims to harness the immune system in order to inhibit cancer development. Unmethylated CpG dinucleotide-containing oligonucleotides (CpG), a class of potent adjuvants that activate the toll-like receptor 9 (TLR9) located in the endolysosome of many antigen-presenting cells (APCs), are promising for cancer immunotherapy. However, clinical application of synthetic CpG confronts many challenges such as suboptimal delivery into APCs, unfavorable pharmacokinetics caused by limited biostability and short in vivo half-life, and side effects associated with leaking of CpG into the systemic circulation. Here we present DNA-inorganic hybrid nanovaccines (hNVs) for efficient uptake into APCs, prolonged tumor retention, and potent immunostimulation and cancer immunotherapy. hNVs were self-assembled from concatemer CpG analogs and magnesium pyrophosphate (Mg2PPi). Mg2PPi renders hNVs resistant to nuclease degradation and thermal denaturation, both of which are demanding characteristics for effective vaccination and the storage and transportation of vaccines. Fluorophore-labeled hNVs were tracked to be efficiently internalized into the endolysosomes of APCs, where Mg2PPi was dissolved in an acidic environment and thus CpG analogs were exposed to hNVs. Internalized hNVs in APCs led to (1) elevated secretion of proinflammatory factors, and (2) elevated expression of co-stimulatory factors. Compared with molecular CpG, hNVs dramatically prolonged the tissue retention of CpG analogs and reduced splenomegaly, a common side effect of CpG. In a melanoma mouse model, two injections of hNVs significantly inhibited the tumor growth and outperformed the molecular CpG. These results suggest hNVs are promising for cancer immunotherapy.

A Hybrid Approach for CpG Island Detection in the Human Genome.

PubMed

Yang, Cheng-Hong; Lin, Yu-Da; Chiang, Yi-Cheng; Chuang, Li-Yeh

2016-01-01

CpG islands have been demonstrated to influence local chromatin structures and simplify the regulation of gene activity. However, the accurate and rapid determination of CpG islands for whole DNA sequences remains experimentally and computationally challenging. A novel procedure is proposed to detect CpG islands by combining clustering technology with the sliding-window method (PSO-based). Clustering technology is used to detect the locations of all possible CpG islands and process the data, thus effectively obviating the need for the extensive and unnecessary processing of DNA fragments, and thus improving the efficiency of sliding-window based particle swarm optimization (PSO) search. This proposed approach, named ClusterPSO, provides versatile and highly-sensitive detection of CpG islands in the human genome. In addition, the detection efficiency of ClusterPSO is compared with eight CpG island detection methods in the human genome. Comparison of the detection efficiency for the CpG islands in human genome, including sensitivity, specificity, accuracy, performance coefficient (PC), and correlation coefficient (CC), ClusterPSO revealed superior detection ability among all of the test methods. Moreover, the combination of clustering technology and PSO method can successfully overcome their respective drawbacks while maintaining their advantages. Thus, clustering technology could be hybridized with the optimization algorithm method to optimize CpG island detection. The prediction accuracy of ClusterPSO was quite high, indicating the combination of CpGcluster and PSO has several advantages over CpGcluster and PSO alone. In addition, ClusterPSO significantly reduced implementation time.

The effect of TLR9 agonist CpG oligodeoxynucleotides on the intestinal immune response of cobia (Rachycentron canadum).

PubMed

Byadgi, Omkar; Puteri, Dinda; Lee, Jai-Wei; Chang, Tsung-Chou; Lee, Yan-Horn; Chu, Chun-Yen; Cheng, Ta-Chih

2014-01-01

Cytosine-guanine oligodeoxynucleotide (CpG ODN) motifs of bacterial DNA are recognized through toll-like receptor 9 (TLR9) and are potent activators of innate immunity. However, the interaction between TLR9 and CpG ODN in aquatic species has not been well characterized. Hence, cobia TLR9 isoform B (RCTLR9B) was cloned and its expression and induction in intestine were investigated. RCTLR9B cDNA consists of 3113bp encoding 1009 amino acids containing three regions, leucine rich repeats, transmembrane domain, and toll/interleukin-1 receptor (TIR) domain. Intraperitoneal injection of CpG ODN 2395 upregulated RCTLR9 A and B and MyD88 and also induced the expressions of Mx, chemokine CC, and interleukin IL-1 β . Cobia intraperitoneally injected with CpG ODN 1668 and 2395 had increased survival rates after challenge with Photobacterium damselae subsp. piscicida. In addition, formulation of CpG ODN with formalin-killed bacteria (FKB) and aluminum hydroxide gel significantly increased expressions of RCTLR9 A (50 folds) and B (30 folds) isoforms at 10 dpi (CpG ODN 1668) and MyD88 (21 folds) at 6 dpv (CpG ODN 2395). Subsequently, IL-1 β increased at 6 dpv in 1668 group. No histopathological damage and inflammatory responses were observed in the injected cobia. Altogether, these results facilitate CpG ODNs as an adjuvant to increase bacterial disease resistance and efficacy of vaccines in cobia.

The Effect of TLR9 Agonist CpG Oligodeoxynucleotides on the Intestinal Immune Response of Cobia (Rachycentron canadum)

PubMed Central

Byadgi, Omkar; Puteri, Dinda; Lee, Jai-Wei; Chang, Tsung-Chou; Lee, Yan-Horn; Chu, Chun-Yen; Cheng, Ta-Chih

2014-01-01

Cytosine-guanine oligodeoxynucleotide (CpG ODN) motifs of bacterial DNA are recognized through toll-like receptor 9 (TLR9) and are potent activators of innate immunity. However, the interaction between TLR9 and CpG ODN in aquatic species has not been well characterized. Hence, cobia TLR9 isoform B (RCTLR9B) was cloned and its expression and induction in intestine were investigated. RCTLR9B cDNA consists of 3113bp encoding 1009 amino acids containing three regions, leucine rich repeats, transmembrane domain, and toll/interleukin-1 receptor (TIR) domain. Intraperitoneal injection of CpG ODN 2395 upregulated RCTLR9 A and B and MyD88 and also induced the expressions of Mx, chemokine CC, and interleukin IL-1β. Cobia intraperitoneally injected with CpG ODN 1668 and 2395 had increased survival rates after challenge with Photobacterium damselae subsp. piscicida. In addition, formulation of CpG ODN with formalin-killed bacteria (FKB) and aluminum hydroxide gel significantly increased expressions of RCTLR9 A (50 folds) and B (30 folds) isoforms at 10 dpi (CpG ODN 1668) and MyD88 (21 folds) at 6 dpv (CpG ODN 2395). Subsequently, IL-1β increased at 6 dpv in 1668 group. No histopathological damage and inflammatory responses were observed in the injected cobia. Altogether, these results facilitate CpG ODNs as an adjuvant to increase bacterial disease resistance and efficacy of vaccines in cobia. PMID:24991578

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ballester, Marie; Jeanbart, Laura; de Titta, Alexandre

An emerging strategy in preventing and treating airway allergy consists of modulating the immune response induced against allergens in the lungs. CpG oligodeoxynucleotides have been investigated in airway allergy studies, but even if promising, efficacy requires further substantiation. We investigated the effect of pulmonary delivery of nanoparticle (NP)-conjugated CpG on lung immunity and found that NP-CpG led to enhanced recruitment of activated dendritic cells and to Th1 immunity compared to free CpG. We then evaluated if pulmonary delivery of NP-CpG could prevent and treat house dust mite-induced allergy by modulating immunity directly in lungs. When CpG was administered as immunomodulatorymore » therapy prior to allergen sensitization, we found that NP-CpG significantly reduced eosinophilia, IgE levels, mucus production and Th2 cytokines, while free CpG had only a moderate effect on these parameters. In a therapeutic setting where CpG was administered after allergen sensitization, we found that although both free CpG and NP-CpG reduced eosinophilia and IgE levels to the same extent, NP conjugation of CpG significantly enhanced reduction of Th2 cytokines in lungs of allergic mice. Taken together, these data highlight benefits of NP conjugation and the relevance of NP-CpG as allergen-free therapy to modulate lung immunity and treat airway allergy.« less

Epigenetic Segregation of Microbial Genomes from Complex Samples Using Restriction Endonucleases HpaII and McrB.

PubMed

Liu, Guohong; Weston, Christopher Q; Pham, Long K; Waltz, Shannon; Barnes, Helen; King, Paula; Sphar, Dan; Yamamoto, Robert T; Forsyth, R Allyn

2016-01-01

We describe continuing work to develop restriction endonucleases as tools to enrich targeted genomes of interest from diverse populations. Two approaches were developed in parallel to segregate genomic DNA based on cytosine methylation. First, the methyl-sensitive endonuclease HpaII was used to bind non-CG methylated DNA. Second, a truncated fragment of McrB was used to bind CpG methylated DNA. Enrichment levels of microbial genomes can exceed 100-fold with HpaII allowing improved genomic detection and coverage of otherwise trace microbial genomes from sputum. Additionally, we observe interesting enrichment results that correlate with the methylation states not only of bacteria, but of fungi, viruses, a protist and plants. The methods presented here offer promise for testing biological samples for pathogens and global analysis of population methylomes.

Genome-wide determination of on-target and off-target characteristics for RNA-guided DNA methylation by dCas9 methyltransferases

PubMed Central

Lin, Lin; Liu, Yong; Xu, Fengping; Huang, Jinrong; Daugaard, Tina Fuglsang; Petersen, Trine Skov; Hansen, Bettina; Ye, Lingfei; Zhou, Qing; Fang, Fang; Yang, Ling; Li, Shengting; Fløe, Lasse; Jensen, Kristopher Torp; Shrock, Ellen; Chen, Fang; Yang, Huanming; Wang, Jian; Liu, Xin; Xu, Xun; Bolund, Lars; Nielsen, Anders Lade; Luo, Yonglun

2018-01-01

Abstract Background Fusion of DNA methyltransferase domains to the nuclease-deficient clustered regularly interspaced short palindromic repeat (CRISPR) associated protein 9 (dCas9) has been used for epigenome editing, but the specificities of these dCas9 methyltransferases have not been fully investigated. Findings We generated CRISPR-guided DNA methyltransferases by fusing the catalytic domain of DNMT3A or DNMT3B to the C terminus of the dCas9 protein from Streptococcus pyogenes and validated its on-target and global off-target characteristics. Using targeted quantitative bisulfite pyrosequencing, we prove that dCas9-BFP-DNMT3A and dCas9-BFP-DNMT3B can efficiently methylate the CpG dinucleotides flanking its target sites at different genomic loci (uPA and TGFBR3) in human embryonic kidney cells (HEK293T). Furthermore, we conducted whole genome bisulfite sequencing (WGBS) to address the specificity of our dCas9 methyltransferases. WGBS revealed that although dCas9-BFP-DNMT3A and dCas9-BFP-DNMT3B did not cause global methylation changes, a substantial number (more than 1000) of the off-target differentially methylated regions (DMRs) were identified. The off-target DMRs, which were hypermethylated in cells expressing dCas9 methyltransferase and guide RNAs, were predominantly found in promoter regions, 5΄ untranslated regions, CpG islands, and DNase I hypersensitivity sites, whereas unexpected hypomethylated off-target DMRs were significantly enriched in repeated sequences. Through chromatin immunoprecipitation with massive parallel DNA sequencing analysis, we further revealed that these off-target DMRs were weakly correlated with dCas9 off-target binding sites. Using quantitative polymerase chain reaction, RNA sequencing, and fluorescence reporter cells, we also found that dCas9-BFP-DNMT3A and dCas9-BFP-DNMT3B can mediate transient inhibition of gene expression, which might be caused by dCas9-mediated de novo DNA methylation as well as interference with transcription. Conclusion Our results prove that dCas9 methyltransferases cause efficient RNA-guided methylation of specific endogenous CpGs. However, there is significant off-target methylation indicating that further improvements of the specificity of CRISPR-dCas9 based DNA methylation modifiers are required. PMID:29635374

Genome-wide determination of on-target and off-target characteristics for RNA-guided DNA methylation by dCas9 methyltransferases.

PubMed

Lin, Lin; Liu, Yong; Xu, Fengping; Huang, Jinrong; Daugaard, Tina Fuglsang; Petersen, Trine Skov; Hansen, Bettina; Ye, Lingfei; Zhou, Qing; Fang, Fang; Yang, Ling; Li, Shengting; Fløe, Lasse; Jensen, Kristopher Torp; Shrock, Ellen; Chen, Fang; Yang, Huanming; Wang, Jian; Liu, Xin; Xu, Xun; Bolund, Lars; Nielsen, Anders Lade; Luo, Yonglun

2018-03-01

Fusion of DNA methyltransferase domains to the nuclease-deficient clustered regularly interspaced short palindromic repeat (CRISPR) associated protein 9 (dCas9) has been used for epigenome editing, but the specificities of these dCas9 methyltransferases have not been fully investigated. We generated CRISPR-guided DNA methyltransferases by fusing the catalytic domain of DNMT3A or DNMT3B to the C terminus of the dCas9 protein from Streptococcus pyogenes and validated its on-target and global off-target characteristics. Using targeted quantitative bisulfite pyrosequencing, we prove that dCas9-BFP-DNMT3A and dCas9-BFP-DNMT3B can efficiently methylate the CpG dinucleotides flanking its target sites at different genomic loci (uPA and TGFBR3) in human embryonic kidney cells (HEK293T). Furthermore, we conducted whole genome bisulfite sequencing (WGBS) to address the specificity of our dCas9 methyltransferases. WGBS revealed that although dCas9-BFP-DNMT3A and dCas9-BFP-DNMT3B did not cause global methylation changes, a substantial number (more than 1000) of the off-target differentially methylated regions (DMRs) were identified. The off-target DMRs, which were hypermethylated in cells expressing dCas9 methyltransferase and guide RNAs, were predominantly found in promoter regions, 5΄ untranslated regions, CpG islands, and DNase I hypersensitivity sites, whereas unexpected hypomethylated off-target DMRs were significantly enriched in repeated sequences. Through chromatin immunoprecipitation with massive parallel DNA sequencing analysis, we further revealed that these off-target DMRs were weakly correlated with dCas9 off-target binding sites. Using quantitative polymerase chain reaction, RNA sequencing, and fluorescence reporter cells, we also found that dCas9-BFP-DNMT3A and dCas9-BFP-DNMT3B can mediate transient inhibition of gene expression, which might be caused by dCas9-mediated de novo DNA methylation as well as interference with transcription. Our results prove that dCas9 methyltransferases cause efficient RNA-guided methylation of specific endogenous CpGs. However, there is significant off-target methylation indicating that further improvements of the specificity of CRISPR-dCas9 based DNA methylation modifiers are required.

The novel 19q13 KRAB zinc-finger tumour suppressor ZNF382 is frequently methylated in oesophageal squamous cell carcinoma and antagonises Wnt/β-catenin signalling.

PubMed

Zhang, Chong; Xiang, Tingxiu; Li, Shuman; Ye, Lin; Feng, Yixiao; Pei, Lijiao; Li, Lili; Wang, Xiangyu; Sun, Ran; Tao, Qian; Ren, Guosheng

2018-05-14

Zinc finger proteins (ZFPs) are the largest transcription factor family in mammals. About one-third of ZFPs are Krüppel-associated box domain (KRAB)-ZFPs and involved in the regulation of cell differentiation/proliferation/apoptosis and neoplastic transformation. We recently identified ZNF382 as a novel KRAB-ZFP epigenetically inactivated in multiple cancers due to frequent promoter CpG methylation. However, its epigenetic alterations, biological functions/mechanism and clinical significance in oesophageal squamous cell carcinoma (ESCC) are still unknown. Here, we demonstrate that ZNF382 expression was suppressed in ESCC due to aberrant promoter methylation, but highly expressed in normal oesophagus tissues. ZNF382 promoter methylation is correlated with ESCC differentiation levels. Restoration of ZNF382 expression in silenced ESCC cells suppressed tumour cell proliferation and metastasis through inducing cell apoptosis. Importantly, ZNF382 suppressed Wnt/β-catenin signalling and downstream target gene expression, likely through binding directly to FZD1 and DVL2 promoters. In summary, our findings demonstrate that ZNF382 functions as a bona fide tumour suppressor inhibiting ESCC pathogenesis through inhibiting the Wnt/β-catenin signalling pathway.

Whole-Genome and Epigenomic Landscapes of Etiologically Distinct Subtypes of Cholangiocarcinoma

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jusakul, Apinya; Cutcutache, Ioana; Yong, Chern Han

Cholangiocarcinoma (CCA) is a hepatobiliary malignancy exhibiting high incidence in countries with endemic liver-fluke infection. We analysed 489 CCAs from 10 countries, combining whole-genome (71 cases), targeted/exome, copy-number, gene expression, and DNA methylation information. Integrative clustering defined four CCA clusters - Fluke- Positive CCAs (Clusters 1/2) are enriched in ERBB2 amplifications and TP53 mutations, conversely Fluke-Negative CCAs (Clusters 3/4) exhibit high copy-number alterations and PD-1/PD-L2 expression, or epigenetic mutations (IDH1/2, BAP1) and FGFR/PRKA-related gene rearrangements. Whole-genome analysis highlighted FGFR2 3’UTR deletion as a mechanism of FGFR2 upregulation. Integration of non-coding promoter mutations with protein-DNA binding profiles demonstrates pervasive modulation ofmore » H3K27me3-associated sites in CCA. Clusters 1 and 4 exhibit distinct DNA hypermethylation patterns targeting either CpG islands or shores - mutation signature and subclonality analysis suggests that these reflect different mutational pathways. Lastly, our results exemplify how genetics, epigenetics and environmental carcinogens can interplay across different geographies to generate distinct molecular subtypes of cancer.« less

Whole-Genome and Epigenomic Landscapes of Etiologically Distinct Subtypes of Cholangiocarcinoma

DOE PAGES

Jusakul, Apinya; Cutcutache, Ioana; Yong, Chern Han; ...

2017-06-30

Cholangiocarcinoma (CCA) is a hepatobiliary malignancy exhibiting high incidence in countries with endemic liver-fluke infection. We analysed 489 CCAs from 10 countries, combining whole-genome (71 cases), targeted/exome, copy-number, gene expression, and DNA methylation information. Integrative clustering defined four CCA clusters - Fluke- Positive CCAs (Clusters 1/2) are enriched in ERBB2 amplifications and TP53 mutations, conversely Fluke-Negative CCAs (Clusters 3/4) exhibit high copy-number alterations and PD-1/PD-L2 expression, or epigenetic mutations (IDH1/2, BAP1) and FGFR/PRKA-related gene rearrangements. Whole-genome analysis highlighted FGFR2 3’UTR deletion as a mechanism of FGFR2 upregulation. Integration of non-coding promoter mutations with protein-DNA binding profiles demonstrates pervasive modulation ofmore » H3K27me3-associated sites in CCA. Clusters 1 and 4 exhibit distinct DNA hypermethylation patterns targeting either CpG islands or shores - mutation signature and subclonality analysis suggests that these reflect different mutational pathways. Lastly, our results exemplify how genetics, epigenetics and environmental carcinogens can interplay across different geographies to generate distinct molecular subtypes of cancer.« less

Pattern generating and reflex-like processes controlling aiming movements in the presence of inertia, damping and gravity. A theoretical note.

PubMed

Kalveram, K T

1991-01-01

A model is proposed, in which goal-directed movements of the forearm are controlled by a central pattern generator (CPG) initiated for exactly one period, and by reflex-analogous processes. Movement width is proportional to the amplitude factor of the CPG's output, and to the square of the CPG's period length. The period duration can be freely selected, thus enabling the CPG to accommodate its time scale to the period of others CPG's. Parameters which influence movement accuracy can be adjusted by means of closed control loop, which are discrete with respect to time: The time unit corresponds to the period of the CPG. For instance, momentum adjustment balances the CPG in such a manner that the velocity of the arm becomes zero on termination of the period, while gain adjustment serves to attain a correct movement length in the presence of an inertial load. Friction, stiffness and gravitational force are neutralized by additional reflex-type processes, interpretable as positive feedback loops with adjustable gain factors, using position and velocity signals.

Nucleosome dynamics and maintenance of epigenetic states of CpG islands

NASA Astrophysics Data System (ADS)

Sneppen, Kim; Dodd, Ian B.

2016-06-01

Methylation of mammalian DNA occurs primarily at CG dinucleotides. These CpG sites are located nonrandomly in the genome, tending to occur within high density clusters of CpGs (islands) or within large regions of low CpG density. Cluster methylation tends to be bimodal, being dominantly unmethylated or mostly methylated. For CpG clusters near promoters, low methylation is associated with transcriptional activity, while high methylation is associated with gene silencing. Alternative CpG methylation states are thought to be stable and heritable, conferring localized epigenetic memory that allows transient signals to create long-lived gene expression states. Positive feedback where methylated CpG sites recruit enzymes that methylate nearby CpGs, can produce heritable bistability but does not easily explain that as clusters increase in size or density they change from being primarily methylated to primarily unmethylated. Here, we show that an interaction between the methylation state of a cluster and its occupancy by nucleosomes provides a mechanism to generate these features and explain genome wide systematics of CpG islands.

Distinct p53 genomic binding patterns in normal and cancer-derived human cells

PubMed Central

McCorkle, Sean R; McCombie, WR; Dunn, John J

2011-01-01

Here, we report genome-wide analysis of the tumor suppressor p53 binding sites in normal human cells. 743 high-confidence ChIP-seq peaks representing putative genomic binding sites were identified in normal IMR90 fibroblasts using a reference chromatin sample. More than 40% were located within 2 kb of a transcription start site (TSS), a distribution similar to that documented for individually studied, functional p53 binding sites and, to date, not observed by previous p53 genome-wide studies. Nearly half of the high-confidence binding sites in the IMR90 cells reside in CpG islands in marked contrast to sites reported in cancer-derived cells. The distinct genomic features of the IMR90 binding sites do not reflect a distinct preference for specific sequences, since the de novo developed p53 motif based on our study is similar to those reported by genome-wide studies of cancer cells. More likely, the different chromatin landscape in normal, compared with cancer-derived cells, influences p53 binding via modulating availability of the sites. We compared the IMR90 ChIP-seq peaks to the recently published IMR90 methylome1 and demonstrated that they are enriched at hypomethylated DNA. Our study represents the first genome-wide, de novo mapping of p53 binding sites in normal human cells and reveals that p53 binding sites reside in distinct genomic landscapes in normal and cancer-derived human cells. PMID:22127205

Discovery and Development of Synthetic and Natural Biomaterials for Protein Therapeutics and Medical Device Applications

NASA Astrophysics Data System (ADS)

Keefe, Andrew J.

Controlling nonspecific protein interactions is important for applications from medical devices to protein therapeutics. The presented work is a compilation of efforts aimed at using zwitterionic (ionic yet charge neutral) polymers to modify and stabilize the surface of sensitive biomedical and biological materials. Traditionally, when modifying the surface of a material, the stability of the underlying substrate. The materials modified in this dissertation are unique due to their unconventional amorphous characteristics which provide additional challenges. These are poly(dimethyl siloxane) (PDMS) rubber, and proteins. These materials may seem dissimilar, but both have amorphous surfaces, that do not respond well to chemical modification. PDMS is a biomaterial extensively used in medical device manufacturing, but experiences unacceptably high levels of non-specific protein fouling when used with biological samples. To reduce protein fouling, surface modification is often needed. Unfortunately conventional surface modification methods, such as Poly(ethylene glycol) (PEG) coatings, do not work for PDMS due to its amorphous state. Herein, we demonstrate how a superhydrophilic zwitterionic material, poly(carboxybetaine methacrylate) (pCBMA), can provide a highly stable nonfouling coating with long term stability due to the sharp the contrast in hydrophobicity between pCBMA and PDMS. Biological materials, such as proteins, also require stabilization to improve shelf life, circulation time, and bioactivity. Conjugation of proteins with PEG is often used to increase protein stability, but has a detrimental effect on bioactivity. Here we have shown that pCBMA conjugation improves stability in a similar fashion to PEG, but also retains, or even improves, binding affinity due to enhanced protein-substrate hydrophobic interactions. Recognizing that pCBMA chemically resembles the combination of lysine (K) and glutamic acid (E) amino acids, we have shown how zwitterionic nonfouling peptides can be genetically engineered onto a protein to form recombinant protein-polymer conjugates. This technique avoids the need to post-modify proteins, that is often expensive and time consuming in protein manufacturing. Finally, we have developed two new peptide screening methods that were able to select for nonfouling peptide sequences. The selection for nonfouling sequences is not possible using traditional methods (phage display, yeast display, bacterial display and resin display) due to the presence of background interference. In our first nonfouling peptide screening method, we measured the fouling properties of peptides that were immobilized on the surface of solid glass beads. Peptides first needed to be rationally designed, and then subsequently evaluated for protein binding. Using this method, we were able to screen of 10's of sequences. Our second nonfouling peptide screening method is able to screen thousands of peptide sequences using a combinatorially generated peptide library. This was accomplished using controlled pore glass (CPG) beads as substrates to develop one-bead-one-compound (OBOC) peptide libraries. The choice of a porous substrate made it possible to synthesize enough peptide material to allow for peptide sequencing from a single bead using mass spectrometry techniques.

Exposure to welding fumes is associated with hypomethylation of the F2RL3 gene: a cardiovascular disease marker.

PubMed

Hossain, Mohammad B; Li, Huiqi; Hedmer, Maria; Tinnerberg, Håkan; Albin, Maria; Broberg, Karin

2015-12-01

Welders are at risk for cardiovascular disease. Recent studies linked tobacco smoke exposure to hypomethylation of the F2RL3 (coagulation factor II (thrombin) receptor-like 3) gene, a marker for cardiovascular disease prognosis and mortality. However, whether welding fumes cause hypomethylation of F2RL3 remains unknown. We investigated 101 welders (median span of working as a welder: 7 years) and 127 unexposed controls (non-welders with no obvious exposure to respirable dust at work), age range 23-60 years, all currently non-smoking, in Sweden. The participants were interviewed about their work history, lifestyle factors and diseases. Personal sampling of respirable dust was performed for the welders. DNA methylation of F2RL3 in blood was assessed by pyrosequencing of four CpG sites, CpG_2 (corresponds to cg03636183) to CpG_5, in F2RL3. Multivariable linear regression analysis was used to assess the association between exposure to welding fumes and F2RL3 methylation. Welders had 2.6% lower methylation of CpG_5 than controls (p<0.001). Higher concentrations of measured respirable dust among the welders were associated with hypomethylation of CpG_2, CpG_4 and CpG_5 (β=-0.49 to -1.4, p<0.012); p<0.029 adjusted for age, previous smoking, passive smoking, education, current residence and respirator use. Increasing the number of years working as a welder was associated with hypomethylation of CpG_4 (linear regression analysis, β=-0.11, p=0.039, adjusted for previous smoking). Previous tobacco smokers had 1.5-4.7% (p<0.014) lower methylation of 3 of the 4 CpG sites in F2RL3 (CpG_2, CpG_4 and CpG_5) compared to never-smokers. A non-significant lower risk of cardiovascular disease with more methylation was observed for all CpG sites. Welding fumes exposure and previous smoking were associated with F2RL3 hypomethylation. This finding links low-to-moderate exposure to welding fumes to adverse effects on the cardiovascular system, and suggests a potential mechanistic pathway for this link, via epigenetic effects on F2RL3 expression. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

Antibody classes & subclasses induced by mucosal immunization of mice with Streptococcus pyogenes M6 protein & oligodeoxynucleotides containing CpG motifs.

PubMed

Teloni, R; von Hunolstein, C; Mariotti, S; Donati, S; Orefici, G; Nisini, R

2004-05-01

Type-specific antibodies against M protein are critical for human protection as they enhance phagocytosis and are protective. An ideal vaccine for the protection against Streptococcus pyogenes would warrant mucosal immunity, but mucosally administered M-protein has been shown to be poorly immunogenic in animals. We used a recombinant M type 6 protein to immunize mice in the presence of synthetic oligodeoxynucleotides containing CpG motifs (immunostimulatory sequences: ISS) or cholera toxin (CT) to explore its possible usage in a mucosal vaccine. Mice were immunized by intranasal (in) or intradermal (id) administration with four doses at weekly intervals of M6-protein (10 microg/mouse) with or without adjuvant (ISS, 10 microg/mouse or CT, 0,5 microg/mouse). M6 specific antibodies were measured by enzyme linked immunosorbent assay using class and subclass specific monoclonal antibodies. The use of ISS induced an impressive anti M-protein serum IgG response but when id administered was not detectable in the absence of adjuvant. When used in, M-protein in the presence of both ISS and CT induced anti M-protein IgA in the bronchoalveolar lavage, as well as specific IgG in the serum. IgG were able to react with serotype M6 strains of S. pyogenes. The level of antibodies obtained by immunizing mice in with M-protein and CT was higher in comparison to M-protein and ISS. The analysis of anti-M protein specific IgG subclasses showed high levels of IgG1, IgG2a and IgG2b, and low levels of IgG3 when ISS were used as adjuvant. Thus, in the presence of ISS, the ratio IgG2a/IgG1 and (IgG2a+IgG3)/IgG1 >1 indicated a type 1-like response obtained both in mucosally or systemically vaccinated mice. Our study offers a reproducible model of anti-M protein vaccination that could be applied to test new antigenic formulations to induce an anti-group A Streptococcus (GAS) vaccination suitable for protection against the different diseases caused by this bacterium.

Lack of chart reminder effectiveness on family medicine resident JNC-VI and NCEP III guideline knowledge and attitudes.

PubMed

Echlin, Paul S; Upshur, Ross E G; Markova, Tsveti P

2004-07-05

The literature demonstrates that medical residents and practicing physicians have an attitudinal-behavioral discordance concerning their positive attitudes towards clinical practice guidelines (CPG), and the implementation of these guidelines into clinical practice patterns. A pilot study was performed to determine if change in a previously identified CPG compliance factor (accessibility) would produce a significant increase in family medicine resident knowledge and attitude toward the guidelines. The primary study intervention involved placing a summary of the Sixth Report of the Joint National Committee on Prevention, Detection, Evaluation, and Treatment of High Blood Pressure (JNC VI) and the National Cholesterol Education Program Expert Panel on Detection, Evaluation, and Treatment of High Blood Cholesterol in Adults (NCEP III) CPGs in all patient (>18 yr.) charts for a period of three months. The JNC VI and NCEP III CPGs were also distributed to each Wayne State family medicine resident, and a copy of each CPG was placed in the preceptor's area of the involved clinics. Identical pre- and post- intervention questionnaires were administered to all residents concerning CPG knowledge and attitude. Post-intervention analysis failed to demonstrate a significant difference in CPG knowledge. A statistically significant post-intervention difference was found in only on attitude question. The barriers to CPG compliance were identified as 1) lack of CPG instruction; 2) lack of critical appraisal ability; 3) insufficient time; 4) lack of CPG accessibility; and 5) lack of faculty modeling. This study demonstrated no significant post intervention changes in CPG knowledge, and only one question that reflected attitude change. Wider resident access to dedicated clinic time, increased faculty modeling, and the implementation of an electronic record/reminder system that uses a team-based approach are compliance factors that should be considered for further investigation. The interpretation of CPG non-compliance will benefit from a causal matrix focused on physician knowledge, attitudes, and behavior. Recent findings in resident knowledge-behavior discordance may direct the future investigation of physician CPG non-compliance away from generalized barrier research, and toward the development of information that maximizes the sense of individual practitioner urgency and certainty.

TLR9 expression is required for the development of cigarette smoke-induced emphysema in mice

PubMed Central

Foronjy, Robert F.; Salathe, Matthias A.; Dabo, Abdoulaye J.; Baumlin, Nathalie; Cummins, Neville; Eden, Edward

2016-01-01

The expression of Toll-like receptor (TLR)-9, a pathogen recognition receptor that recognizes unmethylated CpG sequences in microbial DNA molecules, is linked to the pathogenesis of several lung diseases. TLR9 expression and signaling was investigated in animal and cell models of chronic obstructive pulmonary disease (COPD). We observed enhanced TLR9 expression in mouse lungs following exposure to cigarette smoke. Tlr9−/− mice were resistant to cigarette smoke-induced loss of lung function as determined by mean linear intercept, total lung capacity, lung compliance, and tissue elastance analysis. Tlr9 expression also regulated smoke-mediated immune cell recruitment to the lung; apoptosis; expression of granulocyte-colony stimulating factor (G-CSF), the CXCL5 protein, and matrix metalloproteinase-2 (MMP-2); and protein tyrosine phosphatase 1B (PTP1B) activity in the lung. PTP1B, a phosphatase with anti-inflammatory abilities, was identified as binding to TLR9. In vivo delivery of a TLR9 agonist enhanced TLR9 binding to PTP1B, which inactivated PTP1B. Ptp1b−/− mice had elevated lung concentrations of G-CSF, CXCL5, and MMP-2, and tissue expression of type-1 interferon following TLR9 agonist administration, compared with wild-type mice. TLR9 responses were further determined in fully differentiated normal human bronchial epithelial (NHBE) cells isolated from nonsmoker, smoker, and COPD donors, and then cultured at air liquid interface. NHBE cells from smokers and patients with COPD expressed more TLR9 and secreted greater levels of G-CSF, IL-6, CXCL5, IL-1β, and MMP-2 upon TLR9 ligand stimulation compared with cells from nonsmoker donors. Although TLR9 combats infection, our results indicate that TLR9 induction can affect lung function by inactivating PTP1B and upregulating expression of proinflammatory cytokines. PMID:27288485

Association of mitofusin 2 methylation and essential hypertension: a case-control study in a Chinese population.

PubMed

Jin, Fei; Li, Xiao; Wang, Zuoguang; Liu, Ya; Liu, Jielin; Sun, Dongdong; Jin, Yongxin; Wang, Shiqi; Wen, Shaojun; Wei, Yongxiang

2018-06-07

Mitofusin 2 (Mfn2), a gene that negatively regulates the proliferation of vascular smooth muscle cells (VSMCs), is expressed at low levels in the VSMCs of hypertensive patients. DNA methylation can inhibit gene expression. The purpose of this study was to investigate the relationship between Mfn2 methylation and essential hypertension (EH). After bioinformatics analysis, five EH patients and five normal control (NC) subjects were selected for methylation chip screening. Then, bisulfite DNA sequencing was used to analyze the methylation status of differentially methylated fragments of Mfn2 in 40 EH patients and 36 NC subjects. Mfn2 mRNA expression in the blood was detected by RT-qPCR. There were three CpG islands in the full length Mfn2 DNA sequence and some transcription factor binding sites in these regions, including Sp1, Ap2, GATA box, NF-κB, etc. The chip screening showed that only the third CpG island had a significantly high degree of methylation. Subsequent verification experiments found that the EH group had a significantly lower C base rate of methylation than the NC group (2.5% vs. 44.44%, P < 0.0001), but a similar CpG methylation rate (P > 0.05). RT-qPCR detection showed that the level of Mfn2 mRNA expression was significantly lower in the EH group than in the NC group (P = 0.013). Further association analysis showed that the level of Mfn2 methylation was associated with systolic blood pressure and diastolic blood pressure (r = -0.902, r = -0.713, respectively) but not the other indexes. The DNA methylation level of Mfn2 was significantly lower in hypertensive patients than in control subjects, which may be an independent risk factor for EH.

Clinical practice guideline for Sjögren's syndrome 2017.

PubMed

Sumida, Takayuki; Azuma, Naoto; Moriyama, Masafumi; Takahashi, Hiroyuki; Asashima, Hiromitsu; Honda, Fumika; Abe, Saori; Ono, Yuko; Hirota, Tomoya; Hirata, Shintaro; Tanaka, Yoshiya; Shimizu, Toshimasa; Nakamura, Hideki; Kawakami, Atsushi; Sano, Hajime; Ogawa, Yoko; Tsubota, Kazuo; Ryo, Koufuchi; Saito, Ichiro; Tanaka, Akihiko; Nakamura, Seiji; Takamura, Etsuko; Tanaka, Masao; Suzuki, Katsuya; Takeuchi, Tsutomu; Yamakawa, Noriyuki; Mimori, Tsuneyo; Ohta, Akiko; Nishiyama, Susumu; Yoshihara, Toshio; Suzuki, Yasunori; Kawano, Mitsuhiro; Tomiita, Minako; Tsuboi, Hiroto

2018-05-01

The objective of this study is to develop clinical practice guideline (CPG) for Sjögren's syndrome (SS) based on recently available clinical and therapeutic evidences. The CPG committee for SS was organized by the Research Team for Autoimmune Diseases, Research Program for Intractable Disease of the Ministry of Health, Labor and Welfare (MHLW), Japan. The committee completed a systematic review of evidences for several clinical questions and developed CPG for SS 2017 according to the procedure proposed by the Medical Information Network Distribution Service (Minds). The recommendations and their strength were checked by the modified Delphi method. The CPG for SS 2017 has been officially approved by both Japan College of Rheumatology and the Japanese Society for SS. The CPG committee set 38 clinical questions for clinical symptoms, signs, treatment, and management of SS in pediatric, adult and pregnant patients, using the PICO (P: patients, problem, population, I: interventions, C: comparisons, controls, comparators, O: outcomes) format. A summary of evidence, development of recommendation, recommendation, and strength for these 38 clinical questions are presented in the CPG. The CPG for SS 2017 should contribute to improvement and standardization of diagnosis and treatment of SS.

Substantial reduction in hospital stay of children and adolescents with diabetic ketoacidosis after implementation of Clinical Practice Guidelines in a university hospital in Saudi Arabia.

PubMed

Al Nemri, Abdulrahman; Amer, Yasser Sami; Gasim, Hala; Osman, Mohamed Elfaki; Aleyadhy, Ayman; Al Otaibi, Hessah; Iqbal, Shaikh Mohammed; Aljurayyan, Nasir Abdullah; Assiri, Asaad M; Babiker, Amir; Mohamed, Sarar

2017-02-01

We aimed to determine the effect of Clinical Practice Guideline (CPG) implementation on length of hospital stay of children and adolescents with diabetic ketoacidosis (DKA). This was a 6-year (2008-2014) case-control retrospective study conducted at King Khalid University Hospital, Riyadh, that compared patients with DKA managed using CPG with those treated before CPG implementation. There were 63 episodes of DKA in 41 patients managed using CPG compared with 40 episodes in 33 patients treated before implementation of CPG. Baseline characteristics of the 2 groups were similar (age, sex, newly diagnosed patients, recurrent DKA, DKA severity, and mean glycosylated hemoglobin). The mean length of hospital stay (±SD) was 68.6 ± 53.1 hours after implementation of CPG compared with 107.4 ± 65.6 hours before implementation (P < .001). The reduction in length of hospital stay equals to 1700 bed days saved per year per 1000 patients. Implementation of CPG for DKA decreased the length of hospital stay. © 2016 John Wiley & Sons, Ltd.

Newly identified CpG ODNs, M5-30 and M6-395, stimulate mouse immune cells to secrete TNF-alpha and enhance Th1-mediated immunity.

PubMed

Choi, Sun-Shim; Chung, Eunkyung; Jung, Yu-Jin

2010-08-01

Bacterial CpG motifs are known to induce both innate and adaptive immunity in infected hosts via toll-like receptor 9 (TLR9). Because small oligonucleotides (ODNs) mimicking bacterial CpG motifs are easily synthesized, they have found use as immunomodulatory agents in a number of disease models. We have developed a novel bioinformatics approach to identify effective CpG ODN sequences and evaluate their function as TLR9 ligands in a murine system. Among the CpG ODNs we identified, M5-30 and M6-395 showed significant ability to stimulate TNF-alpha and IFN-gamma production in a mouse macrophage cell line and mouse splenocytes, respectively. We also found that these CpG ODNs activated cells through the canonical NF-kappa B signaling pathway. Moreover, both CpG ODNs were able to induce Th1-mediated immunity in Mycobacterium tuberculosis (Mtb)-infected mice. Our results demonstrate that M5-30 and M6-395 function as TLR9-specific ligands, making them useful in the study of TLR9 functionality and signaling in mice.

A ChIP-chip approach reveals a novel role for transcription factor IRF1 in the DNA damage response.

PubMed

Frontini, Mattia; Vijayakumar, Meeraa; Garvin, Alexander; Clarke, Nicole

2009-03-01

IRF1 is a transcription factor that regulates key processes in the immune system and in tumour suppression. To gain further insight into IRF1's role in these processes, we searched for new target genes by performing chromatin immunoprecipitation coupled to a CpG island microarray (ChIP-chip). Using this approach we identified 202 new IRF1-binding sites with high confidence. Functional categorization of the target genes revealed a surprising cadre of new roles that can be linked to IRF1. One of the major functional categories was the DNA damage response pathway. In order to further validate our findings, we show that IRF1 can regulate the mRNA expression of a number of the DNA damage response genes in our list. In particular, we demonstrate that the mRNA and protein levels of the DNA repair protein BRIP1 [Fanconi anemia gene J (FANC J)] are upregulated after IRF1 over-expression. We also demonstrate that knockdown of IRF1 by siRNA results in loss of BRIP1 expression, abrogation of BRIP1 foci after DNA interstrand crosslink (ICL) damage and hypersensitivity to the DNA crosslinking agent, melphalan; a characteristic phenotype of FANC J cells. Taken together, our data provides a more complete understanding of the regulatory networks controlled by IRF1 and reveals a novel role for IRF1 in regulating the ICL DNA damage response.

A ChIP–chip approach reveals a novel role for transcription factor IRF1 in the DNA damage response

PubMed Central

Frontini, Mattia; Vijayakumar, Meeraa; Garvin, Alexander; Clarke, Nicole

2009-01-01

IRF1 is a transcription factor that regulates key processes in the immune system and in tumour suppression. To gain further insight into IRF1's role in these processes, we searched for new target genes by performing chromatin immunoprecipitation coupled to a CpG island microarray (ChIP–chip). Using this approach we identified 202 new IRF1-binding sites with high confidence. Functional categorization of the target genes revealed a surprising cadre of new roles that can be linked to IRF1. One of the major functional categories was the DNA damage response pathway. In order to further validate our findings, we show that IRF1 can regulate the mRNA expression of a number of the DNA damage response genes in our list. In particular, we demonstrate that the mRNA and protein levels of the DNA repair protein BRIP1 [Fanconi anemia gene J (FANC J)] are upregulated after IRF1 over-expression. We also demonstrate that knockdown of IRF1 by siRNA results in loss of BRIP1 expression, abrogation of BRIP1 foci after DNA interstrand crosslink (ICL) damage and hypersensitivity to the DNA crosslinking agent, melphalan; a characteristic phenotype of FANC J cells. Taken together, our data provides a more complete understanding of the regulatory networks controlled by IRF1 and reveals a novel role for IRF1 in regulating the ICL DNA damage response. PMID:19129219

Prediction of CpG-island function: CpG clustering vs. sliding-window methods

PubMed Central

2010-01-01

Background Unmethylated stretches of CpG dinucleotides (CpG islands) are an outstanding property of mammal genomes. Conventionally, these regions are detected by sliding window approaches using %G + C, CpG observed/expected ratio and length thresholds as main parameters. Recently, clustering methods directly detect clusters of CpG dinucleotides as a statistical property of the genome sequence. Results We compare sliding-window to clustering (i.e. CpGcluster) predictions by applying new ways to detect putative functionality of CpG islands. Analyzing the co-localization with several genomic regions as a function of window size vs. statistical significance (p-value), CpGcluster shows a higher overlap with promoter regions and highly conserved elements, at the same time showing less overlap with Alu retrotransposons. The major difference in the prediction was found for short islands (CpG islets), often exclusively predicted by CpGcluster. Many of these islets seem to be functional, as they are unmethylated, highly conserved and/or located within the promoter region. Finally, we show that window-based islands can spuriously overlap several, differentially regulated promoters as well as different methylation domains, which might indicate a wrong merge of several CpG islands into a single, very long island. The shorter CpGcluster islands seem to be much more specific when concerning the overlap with alternative transcription start sites or the detection of homogenous methylation domains. Conclusions The main difference between sliding-window approaches and clustering methods is the length of the predicted islands. Short islands, often differentially methylated, are almost exclusively predicted by CpGcluster. This suggests that CpGcluster may be the algorithm of choice to explore the function of these short, but putatively functional CpG islands. PMID:20500903

[Web Visit Patterns for the Clinical Practice Guidelines for Management of Depressive Disorder and Alcohol Abuse-Dependence].

PubMed

Suárez-Obando, Fernando; Restrepo, Carlos Gómez

Clinical practice guidelines (CPG) are a set of recommendations for professionals, patients, and families, in order to make decisions about health care. The CPG respond to the need for concise, accurate, practical, and up to date information. In the field of mental health, Colombia has developed three GPC; alcohol (GPC-OH), depression (GPC-TDA), and schizophrenia. To describe the Web Portal traffic related to psychiatry guidelines, with emphasis on the number of visits, distribution throughout Colombian cities, and estimating user behaviour patterns. An evaluation was made of the traffic at the Clinical Practice Guidelines Web Portal of the Ministry of Health and Social Protection between 2013 and 2015 (two years of observation since the inauguration of the Portal). Out of the 45 GPC published on the website, the CPG-OH represented 1.21% of all page views of the Portal. CPG-TDA reached 1.52% (accumulated percentage of 2.73%), being the eighth most consulted guideline, with CPG-OH being number 16. The highest mean monthly number of visits for this group of guideliness was for the CPG-OH for health professionals (353 visits/month), and the lowest was for the CPG-AD for patients and relatives (24 single visits/month). Bogotá D.C. was the city where health carers accessed the guidelines more often. The guidelines for patients and relatives were consulted more in Villavicencio, Cúcuta, Manizales, Pereira, and Pasto. The web portal partially fulfills the purpose of circulating the CPG in Colombia. The visits to the CPG of mental health is quite low, and requires better dissemination strategies that allow the use of information and communication technology. Copyright © 2016 Asociación Colombiana de Psiquiatría. Publicado por Elsevier España. All rights reserved.

Intratumoral delivery of CpG-conjugated anti-MUC1 antibody enhances NK cell anti-tumor activity.

PubMed

Schettini, Jorge; Kidiyoor, Amritha; Besmer, Dahlia M; Tinder, Teresa L; Roy, Lopamudra Das; Lustgarten, Joseph; Gendler, Sandra J; Mukherjee, Pinku

2012-11-01

Monoclonal antibodies (mAbs) against tumor-associated antigens are useful anticancer agents. Antibody-dependent cellular cytotoxicity (ADCC) is one of the major mechanisms responsible for initiating natural killer cell (NK)-mediated killing of tumors. However, the regulation of ADCC via NK cells is poorly understood. We have investigated the cytolytic activity of NK cells against pancreatic cancer cells that were coated with an antibody directed against the human tumor antigen, Mucin-1 designated HMFG-2, either alone or conjugated to CpG oligodeoxynucleotide (CpG ODN). Conjugated antibodies were tested for their ability to elicit ADCC in vitro and in vivo against pancreatic cancer cells. NK cells cultured in the presence of immobilized CpG ODN, HMFG-2 Ab, or CpG ODN-conjugated HMFG-2 Ab were able to up-regulate perforin similarly. Interestingly, a significant higher ADCC was observed when CpG ODN-conjugated HMFG-2-coated tumor cells were co-cultured with NK cells compared to unconjugated HMFG-2 Ab or CpG ODN alone. Moreover, MyD88-deficient NK cells can perform ADCC in vitro. Furthermore, intratumoral injections of CpG ODN-conjugated HMFG-2 induced a significant reduction in tumor burden in vivo in an established model of pancreatic tumor in nude mice compared to CpG ODN or the HMFG-2 alone. Depletion of macrophages or NK cells before treatment confirmed that both cells were required for the anti-tumor response in vivo. Results also suggest that CpG ODN and HMFG-2 Ab could be sensed by NK cells on the mAb-coated tumor cells triggering enhanced ADCC in vitro and in vivo.

Intratumoral delivery of CpG-conjugated anti-MUC1 antibody enhances NK cell anti-tumor activity

PubMed Central

Schettini, Jorge; Kidiyoor, Amritha; Besmer, Dahlia M.; Tinder, Teresa L.; Roy, Lopamudra Das; Lustgarten, Joseph; Gendler, Sandra J.

2013-01-01

Monoclonal antibodies (mAbs) against tumor-associated antigens are useful anticancer agents. Antibody-dependent cellular cytotoxicity (ADCC) is one of the major mechanisms responsible for initiating natural killer cell (NK)-mediated killing of tumors. However, the regulation of ADCC via NK cells is poorly understood. We have investigated the cytolytic activity of NK cells against pancreatic cancer cells that were coated with an antibody directed against the human tumor antigen, Mucin-1 designated HMFG-2, either alone or conjugated to CpG oligodeoxynucleotide (CpG ODN). Conjugated antibodies were tested for their ability to elicit ADCC in vitro and in vivo against pancreatic cancer cells. NK cells cultured in the presence of immobilized CpG ODN, HMFG-2 Ab, or CpG ODN-conjugated HMFG-2 Ab were able to up-regulate perforin similarly. Interestingly, a significant higher ADCC was observed when CpG ODN-conjugated HMFG-2-coated tumor cells were co-cultured with NK cells compared to unconjugated HMFG-2 Ab or CpG ODN alone. Moreover, MyD88-deficient NK cells can perform ADCC in vitro. Furthermore, intratumoral injections of CpG ODN-conjugated HMFG-2 induced a significant reduction in tumor burden in vivo in an established model of pancreatic tumor in nude mice compared to CpG ODN or the HMFG-2 alone. Depletion of macrophages or NK cells before treatment confirmed that both cells were required for the anti-tumor response in vivo. Results also suggest that CpG ODN and HMFG-2 Ab could be sensed by NK cells on the mAb-coated tumor cells triggering enhanced ADCC in vitro and in vivo. PMID:22543528

Cytosine-phosphate-guanine oligodeoxynucleotides containing GACGTT motifs enhance the immune responses elicited by keyhole limpet hemocyanin antigen in dairy cattle.

PubMed

Chu, Chun-Yen; Lee, Shang-Chun; Liu, Shyh-Shyan; Lin, Yu-Ming; Shen, Perng-Chi; Yu, Chi; Lee, Kuo-Hua; Zhao, Xin; Lee, Jai-Wei

2011-10-01

Adjuvants are important components of vaccine formulations. Effective adjuvants line innate and adaptive immunity by signaling through pathogen recognition receptors. Synthetic cytosine-phosphate-guanine (CpG) oligodeoxynucleotides (ODNs) have been shown to have potentials as adjuvants for vaccines. However, the immunostimulatory effect of CpG is species-specific and depends on the sequence of CpG motifs. A CpG ODN (2135), containing 3 identical copies of GTCGTT motif, was previously reported to have the strongest effects on bovine peripheral blood mononuclear cells (PBMC). Based on the sequence of 2135, we replaced the GTCGTT motif with 11 other sequences containing CG and investigated their effects on bovine lymphocyte proliferation. Results showed that the CpG ODNs containing 3 copies of GACGTT motif had the highest lymphocyte stimulation index (7.91±1.18), which was significantly (P<0.05) higher than that of 2135 (4.25±0.56). The CpG ODNs containing 3 copies of GACGTT motif also significantly increased the mRNA expression of interferon (IFN)-α, interleukin (IL)-12, and IL-21 in bovine PBMC. When dairy cows were immunized with the keyhole limpet hemocyanin (KLH) antigen formulated with CpG ODNs containing 3 copies of GACGTT, production of KLH-specific antibodies in serum and in milk whey was significantly (P<0.05) enhanced. IFN-γ in whole blood stimulated by KLH was also significantly (P<0.05) increased in cows immunized with KLH plus CpG ODNs. Our results indicate that CpG ODNs containing 3 copies of the GACGTT motifs is a potential adjuvant for bovine vaccines.

Assessing the efficacy of Duddingtonia flagrans chlamydospores per gram of faeces to control Haemonchus contortus larvae.

PubMed

Ojeda-Robertos, Nadia Florencia; Torres-Acosta, Juan Felipe de Jesus; Aguilar-Caballero, Armando Jacinto; Ayala-Burgos, Armín; Cob-Galera, Ligia Amira; Sandoval-Castro, Carlos Alfredo; Barrientos-Medina, Roberto Carlos; de Gives, Pedro Mendoza

2008-12-20

The aims were (a) to quantify the number of Duddingtonia flagrans chlamydospores per gram of faeces (CPG) recovered from sheep administered with different oral doses and, (b) to describe the relationship between CPG and eggs per gram of faeces (EPG) on the efficacy to reduce Haemonchus contortus infective larvae. Three doses of chlamydospores per kg BW were orally administered during seven days: (T1) non treated control group, (T2) 1 x 10(6), (T3) 2.5 x 10(6) and (T4) 5 x 10(6). Three lambs, infected with H. contortus, were used per group. Faeces were obtained from the rectum of each lamb during the fungal administration period (days 0-6) and for six days after that period. Four coproculture replicates were made from each animal in days 2, 4, 6, 8 and 10. A higher chlamydospore dose produced higher CPG in faeces (p < 0.05), but a clear dose dependent effect was not found either in the larvae reduction or in the CPG:EPG ratio. When ratios were re-analyzed, independently of the treatment groups of origin, a better efficacy was obtained with a ratio from 5 to 10 CPG:EPG and a higher ratio (> 10 per egg) showed a lower reduction efficacy (p < 0.05). The binomial analysis showed that for each unit of increment in CPG:EPG ratio there was a reduction of larvae number until a point (between 5 and 10 CPG:EPG) where no further reduction was detected. The surface response test indicated that the number of larvae was reduced by CPG until possible saturation. The highest CPG:EPG ratios did not necessarily improve efficacy of D. flagrans.

Structural characterization of the FKHR gene and its rearrangement in alveolar rhabdomyosarcoma.

PubMed

Davis, R J; Bennicelli, J L; Macina, R A; Nycum, L M; Biegel, J A; Barr, F G

1995-12-01

The FKHR gene, which contains a forkhead DNA-binding motif, is fused to either PAX3 or PAX7 by the t(2;13) or t(1;13) translocation in alveolar rhabdomyosarcoma,respectively. These tumors express chimeric transcripts encoding the N-terminal portion of either PAX protein fused to the C-terminal portion of FKHR. To understand the structural basis and functional consequences of these translocations, we characterized the wild-type FKHR gene and its rearrangement in alveolar rhabdomyosarcomas. By isolating and analyzing phage, cosmid and YAC clones, we determined that FKHR consists of three exons spanning 140 kb and that several highly similar loci are present in other genomic regions. Exon 1 encodes the N-terminus of the forkhead domain and is embedded within demethylated CpG island. RNA analyses reveal FKHR transcripts initiate from a TATA-less promoter within this island. Exon 2 encodes the C-terminus of the forkhead domain and a transcription activation domain, whereas exon 3 encodes a large 3' untranslated region. The intron 1-exon 2 boundary precisely matches the FHKR fusion point in the chimeric transcripts found in alveolar rhabdomyosarcomas. Using pulsed-field and fluorescence in situ hybridization analyses, we demonstrate that the 130kb FKHR intron 1 is rearranged in t(2;13)-containing alveolar rhabdomyosarcomas. Our findings indicate that FKHR intron 1 provides a large target for DNA rearrangemnt. Rearrangement of this intron with PAX3 produces two important functional consequences: in-frame fusion of N-terminal PAX3 sequences to the FKHR transcriptional activation domain and disruption of the FKHR DNA binding domain.

Recurrent nonsense mutations in the growth hormone receptor from patients with Laron dwarfism.

PubMed Central

Amselem, S; Sobrier, M L; Duquesnoy, P; Rappaport, R; Postel-Vinay, M C; Gourmelen, M; Dallapiccola, B; Goossens, M

1991-01-01

In addition to its classical effects on growth, growth hormone (GH) has been shown to have a number of other actions, all of which are initiated by an interaction with specific high affinity receptors present in a variety of tissues. Purification of a rabbit liver protein via its ability to bind GH has allowed the isolation of a cDNA encoding a putative human growth hormone receptor that belongs to a new class of transmembrane receptors. We have previously shown that this putative growth hormone receptor gene is genetically linked to Laron dwarfism, a rare autosomal recessive syndrome caused by target resistance to GH. Nevertheless, the inability to express the corresponding full-length coding sequence and the lack of a test for growth-promoting function have hampered a direct confirmation of its role in growth. We have now identified three nonsense mutations within this growth hormone receptor gene, lying at positions corresponding to the amino terminal extremity and causing a truncation of the molecule, thereby deleting a large portion of both the GH binding domain and the full transmembrane and intracellular domains. Three independent patients with Laron dwarfism born of consanguineous parents were homozygous for these defects. Two defects were identical and consisted of a CG to TG transition. Not only do these results confirm the growth-promoting activity of this receptor but they also suggest that CpG doublets may represent hot spots for mutations in the growth hormone receptor gene that are responsible for hereditary dwarfism. Images PMID:1999489

Low-level expression of human ACAT2 gene in monocytic cells is regulated by the C/EBP transcription factors

PubMed Central

Guo, Dongqing; Lu, Ming; Hu, Xihan; Xu, Jiajia; Hu, Guangjing; Zhu, Ming; Zhang, Xiaowei; Li, Qin; Chang, Catherine C. Y.; Chang, Tayuan; Song, Baoliang; Xiong, Ying; Li, Boliang

2016-01-01

Acyl-coenzyme A:cholesterol acyltransferases (ACATs) are the exclusive intracellular enzymes that catalyze the formation of cholesteryl/steryl esters (CE/SE). In our previous work, we found that the high-level expression of human ACAT2 gene with the CpG hypomethylation of its whole promoter was synergistically regulated by two transcription factors Cdx2 and HNF1α in the intestine and fetal liver. Here, we first observed that the specific CpG-hypomethylated promoter was correlated with the low expression of human ACAT2 gene in monocytic cell line THP-1. Then, two CCAAT/enhancer binding protein (C/EBP) elements within the activation domain in the specific CpG-hypomethylation promoter region were identified, and the expression of ACAT2 in THP-1 cells was evidently decreased when the C/EBP transcription factors were knock-downed using RNAi technology. Furthermore, ChIP assay confirmed that C/EBPs directly bind to their elements for low-level expression of human ACAT2 gene in THP-1 cells. Significantly, the increased expressions of ACAT2 and C/EBPs were also found in macrophages differentiated from both ATRA-treated THP-1 cells and cultured human blood monocytes. These results demonstrate that the low-level expression of human ACAT2 gene with specific CpG-hypomethylated promoter is regulated by the C/EBP transcription factors in monocytic cells, and imply that the lowly expressed ACAT2 catalyzes the synthesis of certain CE/SE that are assembled into lipoproteins for the secretion. PMID:27688151

Ssb1 and Ssb2 cooperate to regulate mouse hematopoietic stem and progenitor cells by resolving replicative stress.

PubMed

Shi, Wei; Vu, Therese; Boucher, Didier; Biernacka, Anna; Nde, Jules; Pandita, Raj K; Straube, Jasmin; Boyle, Glen M; Al-Ejeh, Fares; Nag, Purba; Jeffery, Jessie; Harris, Janelle L; Bain, Amanda L; Grzelak, Marta; Skrzypczak, Magdalena; Mitra, Abhishek; Dojer, Norbert; Crosetto, Nicola; Cloonan, Nicole; Becherel, Olivier J; Finnie, John; Skaar, Jeffrey R; Walkley, Carl R; Pandita, Tej K; Rowicka, Maga; Ginalski, Krzysztof; Lane, Steven W; Khanna, Kum Kum

2017-05-04

Hematopoietic stem and progenitor cells (HSPCs) are vulnerable to endogenous damage and defects in DNA repair can limit their function. The 2 single-stranded DNA (ssDNA) binding proteins SSB1 and SSB2 are crucial regulators of the DNA damage response; however, their overlapping roles during normal physiology are incompletely understood. We generated mice in which both Ssb1 and Ssb2 were constitutively or conditionally deleted. Constitutive Ssb1/Ssb2 double knockout (DKO) caused early embryonic lethality, whereas conditional Ssb1/Ssb2 double knockout (cDKO) in adult mice resulted in acute lethality due to bone marrow failure and intestinal atrophy featuring stem and progenitor cell depletion, a phenotype unexpected from the previously reported single knockout models of Ssb1 or Ssb2 Mechanistically, cDKO HSPCs showed altered replication fork dynamics, massive accumulation of DNA damage, genome-wide double-strand breaks enriched at Ssb-binding regions and CpG islands, together with the accumulation of R -loops and cytosolic ssDNA. Transcriptional profiling of cDKO HSPCs revealed the activation of p53 and interferon (IFN) pathways, which enforced cell cycling in quiescent HSPCs, resulting in their apoptotic death. The rapid cell death phenotype was reproducible in in vitro cultured cDKO-hematopoietic stem cells, which were significantly rescued by nucleotide supplementation or after depletion of p53. Collectively, Ssb1 and Ssb2 control crucial aspects of HSPC function, including proliferation and survival in vivo by resolving replicative stress to maintain genomic stability. © 2017 by The American Society of Hematology.

Ssb1 and Ssb2 cooperate to regulate mouse hematopoietic stem and progenitor cells by resolving replicative stress

PubMed Central

Vu, Therese; Boucher, Didier; Biernacka, Anna; Nde, Jules; Pandita, Raj K.; Straube, Jasmin; Boyle, Glen M.; Al-Ejeh, Fares; Jeffery, Jessie; Harris, Janelle L.; Bain, Amanda L.; Grzelak, Marta; Skrzypczak, Magdalena; Mitra, Abhishek; Dojer, Norbert; Crosetto, Nicola; Cloonan, Nicole; Becherel, Olivier J.; Finnie, John; Skaar, Jeffrey R.; Walkley, Carl R.; Pandita, Tej K.; Rowicka, Maga; Ginalski, Krzysztof

2017-01-01

Hematopoietic stem and progenitor cells (HSPCs) are vulnerable to endogenous damage and defects in DNA repair can limit their function. The 2 single-stranded DNA (ssDNA) binding proteins SSB1 and SSB2 are crucial regulators of the DNA damage response; however, their overlapping roles during normal physiology are incompletely understood. We generated mice in which both Ssb1 and Ssb2 were constitutively or conditionally deleted. Constitutive Ssb1/Ssb2 double knockout (DKO) caused early embryonic lethality, whereas conditional Ssb1/Ssb2 double knockout (cDKO) in adult mice resulted in acute lethality due to bone marrow failure and intestinal atrophy featuring stem and progenitor cell depletion, a phenotype unexpected from the previously reported single knockout models of Ssb1 or Ssb2. Mechanistically, cDKO HSPCs showed altered replication fork dynamics, massive accumulation of DNA damage, genome-wide double-strand breaks enriched at Ssb-binding regions and CpG islands, together with the accumulation of R-loops and cytosolic ssDNA. Transcriptional profiling of cDKO HSPCs revealed the activation of p53 and interferon (IFN) pathways, which enforced cell cycling in quiescent HSPCs, resulting in their apoptotic death. The rapid cell death phenotype was reproducible in in vitro cultured cDKO-hematopoietic stem cells, which were significantly rescued by nucleotide supplementation or after depletion of p53. Collectively, Ssb1 and Ssb2 control crucial aspects of HSPC function, including proliferation and survival in vivo by resolving replicative stress to maintain genomic stability. PMID:28270450

Interaction of DRD4 Methylation and Phthalate Metabolites Affects Continuous Performance Test Performance in ADHD.

PubMed

Kim, Johanna Inhyang; Kim, Jae-Won; Shin, Inkyung; Kim, Bung-Nyun

2018-05-01

We investigated the interaction effect between the methylation of dopamine receptor D4 (DRD4) and phthalate exposure in ADHD on continuous performance test (CPT) variables. Urine concentrations of mono-(2-ethyl-5-hydroxyhexyl) phthalate (MEHHP), mono-(2-ethyl-5-oxohexyl) phthalate (MEOHP), and mono-n-butyl phthalate (MBP) were tested. The methylation status was analyzed for CpG sites of DRD4. Multivariable linear regression models were applied to investigate the interaction effects of methylation and phthalate levels. There was a significant interaction effect of the methylation of CpG26 and CpG28 with the MEHHP level on omission errors in ADHD patients, but not in controls. The post hoc analysis revealed a significant correlation between the MEHHP concentration and omission errors in the methylated group, but not in the unmethylated group. The interaction between the methylation status of CpG sites of DRD4, particularly CpG26 and CpG28, and phthalate metabolite levels affects the attention level in ADHD patients.

DNA motifs associated with aberrant CpG island methylation.

PubMed

Feltus, F Alex; Lee, Eva K; Costello, Joseph F; Plass, Christoph; Vertino, Paula M

2006-05-01

Epigenetic silencing involving the aberrant methylation of promoter region CpG islands is widely recognized as a tumor suppressor silencing mechanism in cancer. However, the molecular pathways underlying aberrant DNA methylation remain elusive. Recently we showed that, on a genome-wide level, CpG island loci differ in their intrinsic susceptibility to aberrant methylation and that this susceptibility can be predicted based on underlying sequence context. These data suggest that there are sequence/structural features that contribute to the protection from or susceptibility to aberrant methylation. Here we use motif elicitation coupled with classification techniques to identify DNA sequence motifs that selectively define methylation-prone or methylation-resistant CpG islands. Motifs common to 28 methylation-prone or 47 methylation-resistant CpG island-containing genomic fragments were determined using the MEME and MAST algorithms (). The five most discriminatory motifs derived from methylation-prone sequences were found to be associated with CpG islands in general and were nonrandomly distributed throughout the genome. In contrast, the eight most discriminatory motifs derived from the methylation-resistant CpG islands were randomly distributed throughout the genome. Interestingly, this latter group tended to associate with Alu and other repetitive sequences. Used together, the frequency of occurrence of these motifs successfully discriminated methylation-prone and methylation-resistant CpG island groups with an accuracy of 87% after 10-fold cross-validation. The motifs identified here are candidate methylation-targeting or methylation-protection DNA sequences.

Characterization of Immune Responses to an Inactivated Avian Influenza Virus Vaccine Adjuvanted with Nanoparticles Containing CpG ODN.

PubMed

Singh, Shirene M; Alkie, Tamiru N; Abdelaziz, Khaled Taha; Hodgins, Douglas C; Novy, Anastasia; Nagy, Éva; Sharif, Shayan

2016-06-01

Avian influenza virus (AIV), a mucosal pathogen, gains entry into host chickens through respiratory and gastrointestinal routes. Most commercial AIV vaccines for poultry consist of inactivated, whole virus with adjuvant, delivered by parenteral administration. Recent advances in vaccine development have led to the application of nanoparticle emulsion delivery systems, such as poly (d,l-lactic-co-glycolic acid) (PLGA) nanoparticles to enhance antigen-specific immune responses. In chickens, the Toll-like receptor 21 ligand, CpG oligodeoxynucleotides (ODNs), have been demonstrated to be immunostimulatory. The objective of this study was to compare the adjuvant potential of CpG ODN 2007 encapsulated in PLGA nanoparticles with nonencapsulated CpG ODN 2007 when combined with a formalin-inactivated H9N2 virus, through intramuscular and aerosol delivery routes. Chickens were vaccinated at days 7 and 21 posthatch for the intramuscular route and at days 7, 21, and 35 for the aerosol route. Antibody-mediated responses were evaluated weekly in sera and lacrimal secretions in specific pathogen-free chickens. The results indicate that nonencapsulated CpG ODN 2007 in inactivated AIV vaccines administered by the intramuscular route generated higher antibody responses compared to the encapsulated CpG ODN 2007 formulation by the same route. Additionally, encapsulated CpG ODN 2007 in AIV vaccines administered by the aerosol route elicited higher mucosal responses compared to nonencapsulated CpG ODN 2007. Future studies may be aimed at evaluating protective immune responses induced with PLGA encapsulation of AIV and adjuvants.

Identification of regions correlating MGMT promoter methylation and gene expression in glioblastomas

PubMed Central

Everhard, Sibille; Tost, Jörg; Abdalaoui, Hafida El; Crinière, Emmanuelle; Busato, Florence; Marie, Yannick; Gut, Ivo G.; Sanson, Marc; Mokhtari, Karima; Laigle-Donadey, Florence; Hoang-Xuan, Khê; Delattre, Jean-Yves; Thillet, Joëlle

2009-01-01

The O6-methylguanine-DNA methyltransferase gene (MGMT) is methylated in several cancers, including gliomas. However, the functional role of cysteine-phosphate-guanine (CpG) island (CGI) methylation in MGMT silencing is still controversial. The aim of this study was to investigate whether MGMT CGI methylation correlates inversely with RNA expression of MGMT in glioblastomas and to determine the CpG region whose methylation best reflects the level of expression. The methylation level of CpG sites that are potentially related to expression was investigated in 54 glioblastomas by pyrosequencing, a highly quantitative method, and analyzed with respect to their MGMT mRNA expression status. Three groups of patients were identified according to the methylation pattern of all 52 analyzed CpG sites. Overall, an 85% rate of concordance was observed between methylation and expression (p < 0.0001). When analyzing each CpG separately, six CpG sites were highly correlated with expression (p < 0.0001), and two CpG regions could be used as surrogate markers for RNA expression in 81.5% of the patients. This study indicates that there is good statistical agreement between MGMT methylation and expression, and that some CpG regions better reflect MGMT expression than do others. However, if transcriptional repression is the key mechanism in explaining the higher chemosensitivity of MGMT-methylated tumors, a substantial rate of discordance should lead clinicians to be cautious when deciding on a therapeutic strategy based on MGMT methylation status alone. PMID:19224763

Identification of regions correlating MGMT promoter methylation and gene expression in glioblastomas.

PubMed

Everhard, Sibille; Tost, Jörg; El Abdalaoui, Hafida; Crinière, Emmanuelle; Busato, Florence; Marie, Yannick; Gut, Ivo G; Sanson, Marc; Mokhtari, Karima; Laigle-Donadey, Florence; Hoang-Xuan, Khê; Delattre, Jean-Yves; Thillet, Joëlle

2009-08-01

The O(6)-methylguanine-DNA methyltransferase gene (MGMT) is methylated in several cancers, including gliomas. However, the functional role of cysteine-phosphate-guanine (CpG) island (CGI) methylation in MGMT silencing is still controversial. The aim of this study was to investigate whether MGMT CGI methylation correlates inversely with RNA expression of MGMT in glioblastomas and to determine the CpG region whose methylation best reflects the level of expression. The methylation level of CpG sites that are potentially related to expression was investigated in 54 glioblastomas by pyrosequencing, a highly quantitative method, and analyzed with respect to their MGMT mRNA expression status. Three groups of patients were identified according to the methylation pattern of all 52 analyzed CpG sites. Overall, an 85% rate of concordance was observed between methylation and expression (p < 0.0001). When analyzing each CpG separately, six CpG sites were highly correlated with expression (p < 0.0001), and two CpG regions could be used as surrogate markers for RNA expression in 81.5% of the patients. This study indicates that there is good statistical agreement between MGMT methylation and expression, and that some CpG regions better reflect MGMT expression than do others. However, if transcriptional repression is the key mechanism in explaining the higher chemosensitivity of MGMT-methylated tumors, a substantial rate of discordance should lead clinicians to be cautious when deciding on a therapeutic strategy based on MGMT methylation status alone.

Early demethylation of non-CpG, CpC-rich, elements in the myogenin 5′-flanking region

PubMed Central

Fuso, Andrea; Ferraguti, Giampiero; Grandoni, Francesco; Ruggeri, Raffaella; Scarpa, Sigfrido; Strom, Roberto

2010-01-01

The dynamic changes and structural patterns of DNA methylation of genes without CpG islands are poorly characterized. The relevance of CpG to the non-CpG methylation equilibrium in transcriptional repression is unknown. In this work, we analyzed the DNA methylation pattern of the 5′-flanking of the myogenin gene, a positive regulator of muscle differentiation with no CpG island and low CpG density, in both C2C12 muscle satellite cells and embryonic muscle. Embryonic brain was studied as a non-expressing tissue. High levels of both CpG and non-CpG methylation were observed in non-expressing experimental conditions. Both CpG and non-CpG methylation rapidly dropped during muscle differentiation and myogenin transcriptional activation with active demethylation dynamics. Non-CpG demethylation occurred more rapidly than CpG demethylation. Demethylation spread from initially highly methylated short CpC-rich elements to a virtually unmethylated status. These short elements have a high CpC content and density, share some motifs and largely coincide with putative recognition sequences of some differentiation-related transcription factors. Our findings point to a dynamically controlled equilibrium between CpG and non-CpG active demethylation in the transcriptional control of tissue-specific genes. The short CpC-rich elements are new structural features of the methylation machinery, whose functions may include priming the complete demethylation of a transcriptionally crucial DNA region. PMID:20935518

PU.1 is a major transcriptional activator of the tumour suppressor gene LIMD1

PubMed Central

Foxler, Daniel E.; James, Victoria; Shelton, Samuel J.; Vallim, Thomas Q. de A.; Shaw, Peter E.; Sharp, Tyson V.

2011-01-01

LIMD1 is a tumour suppressor gene (TSG) down regulated in ∼80% of lung cancers with loss also demonstrated in breast and head and neck squamous cell carcinomas. LIMD1 is also a candidate TSG in childhood acute lymphoblastic leukaemia. Mechanistically, LIMD1 interacts with pRB, repressing E2F-driven transcription as well as being a critical component of microRNA-mediated gene silencing. In this study we show a CpG island within the LIMD1 promoter contains a conserved binding motif for the transcription factor PU.1. Mutation of the PU.1 consensus reduced promoter driven transcription by 90%. ChIP and EMSA analysis demonstrated that PU.1 specifically binds to the LIMD1 promoter. siRNA depletion of PU.1 significantly reduced endogenous LIMD1 expression, demonstrating that PU.1 is a major transcriptional activator of LIMD1. PMID:21402070

Nuclear Matrix Proteins in Disparity of Prostate Cancer

DTIC Science & Technology

2012-07-01

BCL6 promoter (PMID 20733034) in B cell lymphoma cells and suggested that methylation of these CpG sites have a positive role on BCL6 transcription. In...the nuclei of several human cancers, including, adenocarcinoma of the pancreas, hepatocellular carcinoma, gastric carcinoma, and head and neck...snap-frozen in liquid nitrogen, and stored at - 80ºC until processing. In addition, histopathological sections were made from the rest of the

A molluscan model system in the search for the engram.

PubMed

Lukowiak, Ken; Sangha, Susan; Scheibenstock, Andi; Parvez, Kashif; McComb, Chloe; Rosenegger, David; Varshney, Nishi; Sadamoto, Hisayo

2003-01-01

A 3-neuron central pattern generator, whose sufficiency and necessity has been directly demonstrated, mediates aerial respiratory behaviour in the pond snail, Lymnaea stagnalis. This behaviour can be operantly conditioned, and this associative learning is consolidated into long-lasting memory. Depending on the operant conditioning training procedure used the learning can be consolidated into intermediate term (ITM) or long-term memory (LTM). ITM persists for only 2-3 h, whilst LTM persists for days to weeks. LTM is dependent on both altered gene activity and new protein synthesis while ITM is only dependent on new protein synthesis. We have now directly established that one of the 3-CPG neurons, RPeD1, is a site of LTM formation and storage. We did this by ablating the soma of RPeD1 and leaving behind a functional primary neurite capable of mediating the necessary synaptic interactions to drive aerial respiratory behaviour by the 3-neuron CPG. However, following soma ablation the neuronal circuit is only capable of mediating learning and ITM. LTM can no longer be demonstrated. However, if RPeD1's soma is ablated after LTM consolidation memory is still present. Thus the soma is not needed for the retention of LTM. Using a similar strategy it may be possible to block forgetting.

75 FR 13555 - Compliance Policy Guide Sec. 540.375 Canned Salmon - Adulteration Involving Decomposition (CPG...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-03-22

...] (Formerly Docket No. 1998N-0046) Compliance Policy Guide Sec. 540.375 Canned Salmon -- Adulteration... of Compliance Policy Guide Sec. 540.375 Canned Salmon -- Adulteration Involving Decomposition (CPG... relating to decomposition in fish and fishery products, including canned salmon, is provided in CPG Sec...

Distinct Effects of Monophosphoryl Lipid A, Oligodeoxynucleotide CpG, and Combination Adjuvants on Modulating Innate and Adaptive Immune Responses to Influenza Vaccination.

PubMed

Ko, Eun-Ju; Lee, Young-Tae; Lee, Youri; Kim, Ki-Hye; Kang, Sang-Moo

2017-10-01

Monophosphoryl lipid A (MPL) and oligodeoxynucleotide CpG are toll-like receptor (TLR) 4 and 9 agonist, respectively. Here, we investigated the effects of MPL, CpG, and combination adjuvants on stimulating in vitro dendritic cells (DCs), in vivo innate and adaptive immune responses, and protective efficacy of influenza vaccination. Combination of MPL and CpG was found to exhibit distinct effects on stimulating DCs in vitro to secrete IL-12p70 and tumor necrosis factor (TNF)-α and proliferate allogeneic CD8 T cells. Prime immunization of mice with inactivated split influenza vaccine in the presence of low dose MPL+CpG adjuvants increased the induction of virus-specific IgG and IgG2a isotype antibodies. MPL and CpG adjuvants contribute to improving the efficacy of prime influenza vaccination against lethal influenza challenge as determined by body weight monitoring, lung function, viral titers, and histology. A combination of MPL and CpG adjuvants was effective in improving vaccine efficacy as well as in reducing inflammatory immune responses locally and in inducing cellular immune responses upon lethal influenza virus challenge. This study demonstrates unique adjuvant effects of MPL, CpG, and combination adjuvants on modulating innate and adaptive immune responses to influenza prime vaccination.

Quantitative, high-resolution epigenetic profiling of CpG loci identifies associations with cord blood plasma homocysteine and birth weight in humans

PubMed Central

Ismail, Khaled MK; Haworth, Kim E; Mein, Charles; Carroll, William D

2011-01-01

Supplementation with folic acid during pregnancy is known to reduce the risk of neural tube defects and low birth weight. It is thought that folate and other one-carbon intermediates might secure these clinical effects via DNA methylation. We examined the effects of folate on the human methylome using quantitative interrogation of 27,578 CpG loci associated with 14,496 genes at single-nucleotide resolution across 12 fetal cord blood samples. Consistent with previous studies, the majority of CpG dinucleotides located within CpG islands exhibited hypomethylation while those outside CpG islands showed mid-high methylation. However, for the first time in human samples, unbiased analysis of methylation across samples revealed a significant correlation of methylation patterns with plasma homocysteine, LINE-1 methylation and birth weight centile. Additionally, CpG methylation significantly correlated with either birth weight or LINE-1 methylation were predominantly located in CpG islands. These data indicate that levels of folate-associated intermediates in cord blood reflect their influence and consequences for the fetal epigenome and potentially on pregnancy outcome. In these cases, their influence might be exerted during late gestation or reflect those present during the peri-conceptual period. PMID:20864804

Role of Replication and CpG Methylation in Fragile X Syndrome CGG Deletions in Primate Cells

PubMed Central

Nichol Edamura, Kerrie; Leonard, Michelle R.; Pearson, Christopher E.

2005-01-01

Instability of the fragile X CGG repeat involves both maternally derived expansions and deletions in the gametes of full-mutation males. It has also been suggested that the absence of aberrant CpG methylation may enhance repeat deletions through an unknown process. The effect of CGG tract length, DNA replication direction, location of replication initiation, and CpG methylation upon CGG stability were investigated using an SV40 primate replication system. Replication-dependant deletions with 53 CGG repeats were observed when replication was initiated proximal to the repeat, with CGG as the lagging-strand template. When we initiated replication further from the repeat, while maintaining CGG as the lagging-strand template or using CCG as the lagging-strand template, significant instability was not observed. CpG methylation of the unstable template stabilized the repeat, decreasing both the frequency and the magnitude of deletion events. Furthermore, CpG methylation slowed the efficiency of replication for all templates. Interestingly, replication forks displayed no evidence of a block at the CGG repeat tract, regardless of replication direction or CpG methylation status. Templates with 20 CGG repeats were stable under all circumstances. These results reveal that CGG deletions occur during replication and are sensitive to replication-fork dynamics, tract length, and CpG methylation. PMID:15625623

Topical CpG enhances the response of murine malignant melanoma to dacarbazine.

PubMed

Najar, Hossain M; Dutz, Jan P

2008-09-01

Malignant melanoma is a potentially fatal skin cancer that is increasing in incidence. Standard chemoimmunotherapy consisting of dacarbazine (DTIC) given with IFN-alpha has had disappointing results. We describe a chemoimmunotherapy protocol for cutaneous melanoma that combines the administration of DTIC with the topical application of CpG oligodinucleotide (ODN). Subcutaneous B16 melanoma tumors in C57BL/6 mice were treated with intraperitoneal injections of DTIC followed by the topical application of CpG-ODN over the tumors. This therapeutic approach abrogated the growth of established tumors and significantly enhanced survival. Topical CpG application was more effective than intratumoral CpG. Cell depletion studies indicated that the antitumor effect was dependent on both CD4(+) and CD8(+) cells but not on natural killer (NK) cells. Tumor-specific cytotoxic T-lymphocyte activity was generated in treated animals and was highest in topically treated animals. Immunohistochemical analysis revealed that DTIC, but not CpG, enhanced tumor cell apoptosis. Further, topical CpG induced an expansion of a B220(+)CD8(+) subset of dendritic cells and a subset of NK1.1(+) CD11c(+) cells within the tumors. By enhancing both tumor cell death and local immune activation, DTIC/topical CpG chemoimmunotherapy induced an effective T-cell-dependent host-immune response against melanoma.

The evolution of CpG density and lifespan in conserved primate and mammalian promoters

PubMed Central

McLain, Adam T.

2018-01-01

Gene promoters are evolutionarily conserved across holozoans and enriched in CpG sites, the target for DNA methylation. As animals age, the epigenetic pattern of DNA methylation degrades, with highly methylated CpG sites gradually becoming demethylated while CpG islands increase in methylation. Across vertebrates, aging is a trait that varies among species. We used this variation to determine whether promoter CpG density correlates with species’ maximum lifespan. Human promoter sequences were used to identify conserved regions in 131 mammals and a subset of 28 primate genomes. We identified approximately 1000 gene promoters (5% of the total), that significantly correlated CpG density with lifespan. The correlations were performed via the phylogenetic least squares method to account for trait similarity by common descent using phylogenetic branch lengths. Gene set enrichment analysis revealed no significantly enriched pathways or processes, consistent with the hypothesis that aging is not under positive selection. However, within both mammals and primates, 95% of the promoters showed a positive correlation between increasing CpG density and species lifespan, and two thirds were shared between the primate subset and mammalian datasets. Thus, these genes may require greater buffering capacity against age-related dysregulation of DNA methylation in longer-lived species. PMID:29661983

The Adjuvant LT-K63 Can Restore Delayed Maturation of Follicular Dendritic Cells and Poor Persistence of Both Protein- and Polysaccharide-Specific Antibody-Secreting Cells in Neonatal Mice

PubMed Central

Bjarnarson, Stefania P.; Adarna, Brenda C.; Benonisson, Hreinn; Del Giudice, Giuseppe

2012-01-01

Ab responses in early life are low and short-lived; therefore, induction of protective immunity requires repeated vaccinations. One of the major limitations in early-life immunity is delayed maturation of follicular dendritic cells (FDCs), which play a central role in mediating the germinal center (GC) reaction leading to production of Ab-secreting cells (AbSCs). We assessed whether a nontoxic mutant of Escherichia coli heat-labile enterotoxin (LT-K63) and CpG1826 as model adjuvants could accelerate FDC maturation and immune response in neonatal mice, using a pneumococcal polysaccharide of serotype 1 conjugated to tetanus toxoid (Pnc1-TT) as a model vaccine. In neonatal NMRI mice, a single dose of Pnc1-TT coadministered with LT-K63 enhanced Pnc1-TT–induced GC reaction. In contrast, CpG1826 had no effect. Accordingly, LT-K63, but not CpG1826, accelerated the maturation of FDC networks, detected by FDC-M2+ staining, characteristic for adult-like FDCs. This coincided with migration of MOMA-1+ macrophages into the GCs that can enhance GC reaction and B cell activation. The FDC-M2+ FDC networks colocalized with enhanced expression of TNF-α, which is critical for the maintenance of mature FDCs and is poorly expressed in neonates. The accelerated maturation of FDC networks correlated with increased frequency and prolonged persistence of polysaccharide- and protein-specific IgG+ AbSCs in spleen and bone marrow. Our data show for the first time, to our knowledge, that an adjuvant (LT-K63) can overcome delayed maturation of FDCs in neonates, enhance the GC reaction, and prolong the persistence of vaccine-specific AbSCs in the BM. These properties are attractive for parenteral vaccination in early life. PMID:22753937

BindML/BindML+: Detecting Protein-Protein Interaction Interface Propensity from Amino Acid Substitution Patterns.

PubMed

Wei, Qing; La, David; Kihara, Daisuke

2017-01-01

Prediction of protein-protein interaction sites in a protein structure provides important information for elucidating the mechanism of protein function and can also be useful in guiding a modeling or design procedures of protein complex structures. Since prediction methods essentially assess the propensity of amino acids that are likely to be part of a protein docking interface, they can help in designing protein-protein interactions. Here, we introduce BindML and BindML+ protein-protein interaction sites prediction methods. BindML predicts protein-protein interaction sites by identifying mutation patterns found in known protein-protein complexes using phylogenetic substitution models. BindML+ is an extension of BindML for distinguishing permanent and transient types of protein-protein interaction sites. We developed an interactive web-server that provides a convenient interface to assist in structural visualization of protein-protein interactions site predictions. The input data for the web-server are a tertiary structure of interest. BindML and BindML+ are available at http://kiharalab.org/bindml/ and http://kiharalab.org/bindml/plus/ .

Imparting albumin-binding affinity to a human protein by mimicking the contact surface of a bacterial binding protein.

PubMed

Oshiro, Satoshi; Honda, Shinya

2014-04-18

Attachment of a bacterial albumin-binding protein module is an attractive strategy for extending the plasma residence time of protein therapeutics. However, a protein fused with such a bacterial module could induce unfavorable immune reactions. To address this, we designed an alternative binding protein by imparting albumin-binding affinity to a human protein using molecular surface grafting. The result was a series of human-derived 6 helix-bundle proteins, one of which specifically binds to human serum albumin (HSA) with adequate affinity (KD = 100 nM). The proteins were designed by transferring key binding residues of a bacterial albumin-binding module, Finegoldia magna protein G-related albumin-binding domain (GA) module, onto the human protein scaffold. Despite 13-15 mutations, the designed proteins maintain the original secondary structure by virtue of careful grafting based on structural informatics. Competitive binding assays and thermodynamic analyses of the best binders show that the binding mode resembles that of the GA module, suggesting that the contacting surface of the GA module is mimicked well on the designed protein. These results indicate that the designed protein may act as an alternative low-risk binding module to HSA. Furthermore, molecular surface grafting in combination with structural informatics is an effective approach for avoiding deleterious mutations on a target protein and for imparting the binding function of one protein onto another.

Leveraging workflow control patterns in the domain of clinical practice guidelines.

PubMed

Kaiser, Katharina; Marcos, Mar

2016-02-10

Clinical practice guidelines (CPGs) include recommendations describing appropriate care for the management of patients with a specific clinical condition. A number of representation languages have been developed to support executable CPGs, with associated authoring/editing tools. Even with tool assistance, authoring of CPG models is a labor-intensive task. We aim at facilitating the early stages of CPG modeling task. In this context, we propose to support the authoring of CPG models based on a set of suitable procedural patterns described in an implementation-independent notation that can be then semi-automatically transformed into one of the alternative executable CPG languages. We have started with the workflow control patterns which have been identified in the fields of workflow systems and business process management. We have analyzed the suitability of these patterns by means of a qualitative analysis of CPG texts. Following our analysis we have implemented a selection of workflow patterns in the Asbru and PROforma CPG languages. As implementation-independent notation for the description of patterns we have chosen BPMN 2.0. Finally, we have developed XSLT transformations to convert the BPMN 2.0 version of the patterns into the Asbru and PROforma languages. We showed that although a significant number of workflow control patterns are suitable to describe CPG procedural knowledge, not all of them are applicable in the context of CPGs due to their focus on single-patient care. Moreover, CPGs may require additional patterns not included in the set of workflow control patterns. We also showed that nearly all the CPG-suitable patterns can be conveniently implemented in the Asbru and PROforma languages. Finally, we demonstrated that individual patterns can be semi-automatically transformed from a process specification in BPMN 2.0 to executable implementations in these languages. We propose a pattern and transformation-based approach for the development of CPG models. Such an approach can form the basis of a valid framework for the authoring of CPG models. The identification of adequate patterns and the implementation of transformations to convert patterns from a process specification into different executable implementations are the first necessary steps for our approach.

Functional assignment to JEV proteins using SVM.

PubMed

Sahoo, Ganesh Chandra; Dikhit, Manas Ranjan; Das, Pradeep

2008-01-01

Identification of different protein functions facilitates a mechanistic understanding of Japanese encephalitis virus (JEV) infection and opens novel means for drug development. Support vector machines (SVM), useful for predicting the functional class of distantly related proteins, is employed to ascribe a possible functional class to Japanese encephalitis virus protein. Our study from SVMProt and available JE virus sequences suggests that structural and nonstructural proteins of JEV genome possibly belong to diverse protein functions, are expected to occur in the life cycle of JE virus. Protein functions common to both structural and non-structural proteins are iron-binding, metal-binding, lipid-binding, copper-binding, transmembrane, outer membrane, channels/Pores - Pore-forming toxins (proteins and peptides) group of proteins. Non-structural proteins perform functions like actin binding, zinc-binding, calcium-binding, hydrolases, Carbon-Oxygen Lyases, P-type ATPase, proteins belonging to major facilitator family (MFS), secreting main terminal branch (MTB) family, phosphotransfer-driven group translocators and ATP-binding cassette (ABC) family group of proteins. Whereas structural proteins besides belonging to same structural group of proteins (capsid, structural, envelope), they also perform functions like nuclear receptor, antibiotic resistance, RNA-binding, DNA-binding, magnesium-binding, isomerase (intra-molecular), oxidoreductase and participate in type II (general) secretory pathway (IISP).

Functional assignment to JEV proteins using SVM

PubMed Central

Sahoo, Ganesh Chandra; Dikhit, Manas Ranjan; Das, Pradeep

2008-01-01

Identification of different protein functions facilitates a mechanistic understanding of Japanese encephalitis virus (JEV) infection and opens novel means for drug development. Support vector machines (SVM), useful for predicting the functional class of distantly related proteins, is employed to ascribe a possible functional class to Japanese encephalitis virus protein. Our study from SVMProt and available JE virus sequences suggests that structural and nonstructural proteins of JEV genome possibly belong to diverse protein functions, are expected to occur in the life cycle of JE virus. Protein functions common to both structural and non-structural proteins are iron-binding, metal-binding, lipid-binding, copper-binding, transmembrane, outer membrane, channels/Pores - Pore-forming toxins (proteins and peptides) group of proteins. Non-structural proteins perform functions like actin binding, zinc-binding, calcium-binding, hydrolases, Carbon-Oxygen Lyases, P-type ATPase, proteins belonging to major facilitator family (MFS), secreting main terminal branch (MTB) family, phosphotransfer-driven group translocators and ATP-binding cassette (ABC) family group of proteins. Whereas structural proteins besides belonging to same structural group of proteins (capsid, structural, envelope), they also perform functions like nuclear receptor, antibiotic resistance, RNA-binding, DNA-binding, magnesium-binding, isomerase (intra-molecular), oxidoreductase and participate in type II (general) secretory pathway (IISP). PMID:19052658

In ovo CpG DNA delivery increases innate and adaptive immune cells in respiratory, gastrointestinal and immune systems post-hatch correlating with lower infectious laryngotracheitis virus infection.

PubMed

Abdul-Cader, Mohamed Sarjoon; Amarasinghe, Aruna; Palomino-Tapia, Victor; Ahmed-Hassan, Hanaa; Bakhtawar, Khawaja; Nagy, Eva; Sharif, Shayan; Gomis, Susantha; Abdul-Careem, Mohamed Faizal

2018-01-01

Cytosine-guanosine deoxynucleotides (CpG) DNA can be delivered in ovo at embryo day (ED)18 for the stimulation of toll-like receptor (TLR)21 signaling pathway that ultimately protects chickens against a number of bacterial and viral infections. There is a dearth of information understanding the mechanisms of protection induced by in ovo delivered CpG DNA. The objective of this study was to determine the immune cell changes post-hatch following in ovo delivery of the TLR21 ligand, CpG DNA. In order to quantify changes of percentage of KUL01+, IgM+ B, cluster of differentiation (CD)4+ and CD8α+ cells, trachea, lung, duodenum, large intestine, spleen and bursa of Fabricius were collected on day 1 post-hatch. We found increased recruitments of KUL01+ cells, in organs of these body systems post-hatch following in ovo delivery of CpG DNA. Although IgM+ B cells, CD4+ and CD8α+ cells were increased in lungs and immune system organs, these cells were not quantifiable from the trachea, duodenum and large intestine immediately following the hatch. Furthermore, when CpG DNA is delivered in ovo and subsequently infected with infectious laryngotracheitis virus (ILTV) post-hatch on day 1, CpG DNA reduces morbidity and mortality resulting from ILTV infection. This study provides insights into the mechanisms of host responses elicited following in ovo delivery of CpG DNA in avian species.

Rolling Thunder -- Integration of the Solo 161 Stirling engine with the CPG-460 solar concentrator at Ft. Huachuca

DOE Office of Scientific and Technical Information (OSTI.GOV)

Diver, R.B.; Moss, T.A.; Goldberg, V.

Project Rolling Thunder is a dish/Stirling demonstration project at Ft. Huachuca, a US Army fort in southeastern Arizona (Huachuca means rolling thunder in Apache). It has been supported by the Strategic Environmental Research and Development Program (SERDP), a cooperative program between the Department of Defense (DoD) and the Department of Energy (DOE). As part of a 1992 SERDP project, Cummins Power Generation, Inc. (CPG) installed a CPG 7 kW(c) dish/Stirling system at the Joint Interoperability Test Command (JITC) in Ft. Huachuca, Arizona. The primary objective of the SERDP Dish/Stirling for DoD Applications project was to demonstrate a CPG 7-kW(c) dish/Stirlingmore » system at a military facility. Unfortunately, Cummins Engine Company decided to divest its solar operations. As a direct result of Ft. Huachuca`s interest in the Cummins dish/Stirling technology, Sandia explored the possibility of installing a SOLO 161 Stirling power conversion unit (PCU) on the Ft. Huachuca CPG-460. In January 1997, a decision was made to retrofit a SOLO 161 Stirling engine on the CPG-460 at Ft. Huachuca. Project Rolling Thunder. The SOLO 161 Demonstration at Ft. Huachuca has been a challenge. Although, the SOLO 161 PCU has operated nearly flawlessly and the CPG-460 has been, for the most part, a solid and reliable component, integration of the SOLO PCU with the CPG-460 has required significant attention. In this paper, the integration issues and technical approaches of project Rolling Thunder are presented. Lessons of the project are also discussed.« less

Guideline-Driven Care Improves Outcomes in Patients with Traumatic Rib Fractures.

PubMed

Flarity, Kathleen; Rhodes, Whitney C; Berson, Andrew J; Leininger, Brian E; Reckard, Paul E; Riley, Keyan D; Shahan, Charles P; Schroeppel, Thomas J

2017-09-01

There is no established national standard for rib fracture management. A clinical practice guideline (CPG) for rib fractures, including monitoring of pulmonary function, early initiation of aggressive loco-regional analgesia, and early identification of deteriorating respiratory function, was implemented in 2013. The objective of the study was to evaluate the effect of the CPG on hospital length of stay. Hospital length of stay (LOS) was compared for adult patients admitted to the hospital with rib fracture(s) two years before and two years after CPG implementation. A separate analysis was done for the patients admitted to the intensive care unit (ICU). Over the 48-month study period, 571 patients met inclusion criteria for the study. Pre-CPG and CPG study groups were well matched with few differences. Multivariable regression did not demonstrate a difference in LOS (B = -0.838; P = 0.095) in the total study cohort. In the ICU cohort (n = 274), patients in the CPG group were older (57 vs 52 years; P = 0.023) and had more rib fractures (4 vs 3; P = 0.003). Multivariable regression identified a significant decrease in LOS for those patients admitted in the CPG period (B = -2.29; P = 0.019). Despite being significantly older with more rib fractures in the ICU cohort, patients admitted after implementation of the CPG had a significantly reduced LOS on multivariable analysis, reducing LOS by over two days. This structured intervention can limit narcotic usage, improve pulmonary function, and decrease LOS in the most injured patients with chest trauma.

Energetic study of cardioplegic hearts under ischaemia/reperfusion and [Ca(2+)] changes in cardiomyocytes of guinea-pig: mitochondrial role.

PubMed

Ragone, M I; Torres, N S; Consolini, A E

2013-02-01

To study the role of mitochondria in the recovery of guinea-pig hearts exposed to high-K(+)-cardioplegia (CPG) and ischaemia/reperfusion (I/R) METHODS: We measured contractility and heat release in perfused guinea-pig hearts and cytosolic and mitochondrial Ca(2+) by epifluorescence and confocal microscopy in isolated cardiomyocytes loaded with Fluo-4 or Rhod-2. In hearts, CPG increased the postischaemic contractile recovery, and this was potentiated by the mNCX blocker clonazepam and the mKATP opener diazoxide, which also prevented the fall in muscle economy. Moreover, CPG prevented the stunning induced by ouabain, which was reduced by clonazepam. In cardiomyocytes, CPG increased fluorescent signals of cytosolic and mitochondrial Ca(2+), while the addition of a mNCX blocker (CGP37157) increased cytosolic but reduced mitochondrial [Ca(2+)]. Ouabain in CPG increased cytosolic Ca(2+) and resting heat, but the addition of CGP37157 reduced them, as well as mitochondrial Ca(2+). CPG, diazoxide and clonazepam improve postischaemic recovery, respectively, by increasing the Ca(2+) cycling and by reducing the mitochondrial Ca(2+) uptake either by uniporter or by mNCX. The mitochondria compete with the leaky sarcoplasmic reticulum (SR) as sink of Ca(2+) in guinea-pig hearts, affecting the postischaemic contractility. CPG also prevented the ouabain-induced dysfunction by avoiding the Ca(2+) overload. Ouabain reduced the synergism between CPG and clonazepam suggesting that [Na(+)]i and SR load influence the mNCX role. © 2012 The Authors Acta Physiologica © 2012 Scandinavian Physiological Society.

75 FR 60761 - Government-Owned Inventions; Availability for Licensing

Federal Register 2010, 2011, 2012, 2013, 2014

2010-10-01

... cells conjugated to a K-type CpG oligodeoxynucleotide (ODN) to a subject. Methods for treating a tumor... therapeutically effective amount of apoptotic tumor cells conjugated to a K-type CpG oligodeoxynucleotide (ODN) to... the prevention of cancer and other indications Use of CpG oligonucleotides for prophylaxis and/or...

78 FR 46594 - Prospective Grant of Start-up Exclusive License: Topical Antibiotic With Immune Stimulating...

Federal Register 2010, 2011, 2012, 2013, 2014

2013-08-01

... Speed Wound Healing; and Use of CpG Oligodeoxynucleotides To Induce Epithelial Cell Growth AGENCY... CpG Oligodeoxynucleotides to Induce Epithelial Cell Growth'' to Tollgene having a place of business... 37 CFR part 404. These technologies relate to relate to use of CpG oligodeoxynucleotides (ODNs) to...

Promoter methylation assay of SASH1 gene in breast cancer.

PubMed

Sheyu, Lin; Hui, Liu; Junyu, Zhang; Jiawei, Xu; Honglian, Wang; Qing, Sang; Hengwei, Zhang; Xuhui, Guo; Qinghe, Xing; Lin, He

2013-01-01

To analyze the relationship between the expression of SASH1 and its methylation level of SASH1 gene promoter in human breast cancer. Expression levels of SASH1 were examined in breast cancer tissues and adjacent normal tissues with immunohistochemistry and with real time PCR (RT-PCR) methylation analysis was performed with MassArray. Immunohistochemistry showed that SASH1 expression was strongly reduced in breast cancer compared with adjacent normal tissues. Quantitative methylation analysis by MassArray revealed that CpG sites in SASH1 promoter shared similar methylation pattern in tumor tissue and adjacent normal tissue. The CpG sites with significant difference in methylation level were CpG_26.27 and CpG_54.55. Moreover, 5-aza-2'-deoxycytidine (5-Aza-dc) treatment of tumor cell line MDA-MB-231 caused significant elevation of SASH1 mRNA. Based on these data, we propose that increase of DNA methylation level in the promoter region of gene SASH1, particularly CpG_26.27 or CpG_54.55 sites, possibly repressed SASH1 expression in breast cancer.

Methylation detection oligonucleotide microarray analysis: a high-resolution method for detection of CpG island methylation

PubMed Central

Kamalakaran, Sitharthan; Kendall, Jude; Zhao, Xiaoyue; Tang, Chunlao; Khan, Sohail; Ravi, Kandasamy; Auletta, Theresa; Riggs, Michael; Wang, Yun; Helland, Åslaug; Naume, Bjørn; Dimitrova, Nevenka; Børresen-Dale, Anne-Lise; Hicks, Jim; Lucito, Robert

2009-01-01

Methylation of CpG islands associated with genes can affect the expression of the proximal gene, and methylation of non-associated CpG islands correlates to genomic instability. This epigenetic modification has been shown to be important in many pathologies, from development and disease to cancer. We report the development of a novel high-resolution microarray that detects the methylation status of over 25 000 CpG islands in the human genome. Experiments were performed to demonstrate low system noise in the methodology and that the array probes have a high signal to noise ratio. Methylation measurements between different cell lines were validated demonstrating the accuracy of measurement. We then identified alterations in CpG islands, both those associated with gene promoters, as well as non-promoter-associated islands in a set of breast and ovarian tumors. We demonstrate that this methodology accurately identifies methylation profiles in cancer and in principle it can differentiate any CpG methylation alterations and can be adapted to analyze other species. PMID:19474344

Comprehensive analysis of MGMT promoter methylation: correlation with MGMT expression and clinical response in GBM.

PubMed

Shah, Nameeta; Lin, Biaoyang; Sibenaller, Zita; Ryken, Timothy; Lee, Hwahyung; Yoon, Jae-Geun; Rostad, Steven; Foltz, Greg

2011-01-07

O⁶-methylguanine DNA-methyltransferase (MGMT) promoter methylation has been identified as a potential prognostic marker for glioblastoma patients. The relationship between the exact site of promoter methylation and its effect on gene silencing, and the patient's subsequent response to therapy, is still being defined. The aim of this study was to comprehensively characterize cytosine-guanine (CpG) dinucleotide methylation across the entire MGMT promoter and to correlate individual CpG site methylation patterns to mRNA expression, protein expression, and progression-free survival. To best identify the specific MGMT promoter region most predictive of gene silencing and response to therapy, we determined the methylation status of all 97 CpG sites in the MGMT promoter in tumor samples from 70 GBM patients using quantitative bisulfite sequencing. We next identified the CpG site specific and regional methylation patterns most predictive of gene silencing and improved progression-free survival. Using this data, we propose a new classification scheme utilizing methylation data from across the entire promoter and show that an analysis based on this approach, which we call 3R classification, is predictive of progression-free survival (HR  = 5.23, 95% CI [2.089-13.097], p<0.0001). To adapt this approach to the clinical setting, we used a methylation-specific multiplex ligation-dependent probe amplification (MS-MLPA) test based on the 3R classification and show that this test is both feasible in the clinical setting and predictive of progression free survival (HR  = 3.076, 95% CI [1.301-7.27], p = 0.007). We discuss the potential advantages of a test based on this promoter-wide analysis and compare it to the commonly used methylation-specific PCR test. Further prospective validation of these two methods in a large independent patient cohort will be needed to confirm the added value of promoter wide analysis of MGMT methylation in the clinical setting.

Epicutaneous immunization with ovalbumin and CpG induces TH1/TH17 cytokines, which regulate IgE and IgG2a production

PubMed Central

Majewska-Szczepanik, Monika; Askenase, Philip W.; Lobo, Francis M.; Marcińska, Katarzyna; Wen, Li; Szczepanik, Marian

2017-01-01

Background Subcutaneous allergen-specific immunotherapy is a standard route for the immunotherapy of allergic diseases. It modulates the course of allergy and can generate long-term remission. However, subcutaneous allergen-specific immunotherapy can also induce anaphylaxis in some patients, and therefore additional routes of administration should be investigated to improve the safety and tolerability of immunotherapy. Objective We sought to determine whether epicutaneous treatment with antigen in the presence of a Toll-like receptor 9 agonist can suppress TH2-mediated responses in an antigen-specific manner. Methods Epicutaneous immunization was performed by applying a skin patch soaked with ovalbumin (OVA) plus CpG, and its suppressor activity was determined by using the mouse model of atopic dermatitis. Finally, adoptive cell transfers were implemented to characterize the regulatory cells that are induced by epicutaneous immunization. Results Epicutaneous immunization with OVA and CpG reduces the production of OVA-specific IgE and increases the synthesis of OVA-specific IgG2a antibodies in an antigen-specific manner. Moreover, eosinophil peroxidase activity in the skin and production of IL-4, IL-5, IL-10, and IL-13 are suppressed. The observed reduction of IgE synthesis is transferable with T-cell receptor (TCR) αβ+CD4+CD25− cells, whereas IgG2a production is dependent on both TCRαβ+ and TCRγδ+ T cells. Further experiments show that the described phenomenon is myeloid differentiation primary response 88, IFN-γ, and IL-17A dependent. Finally, the results suggest that epicutaneous immunization with OVA and CpG decreases the synthesis of OVA-specific IgE and skin eosinophil peroxidase activity in mice with ongoing skin allergy. Conclusion Epicutaneous application of protein antigen in the presence of adjuvant could be an attractive needle-free and self-administered immunotherapy for allergic diseases. PMID:26810716

Modification of Epigenetic Patterns in Low Birth Weight Children: Importance of Hypomethylation of the ACE Gene Promoter

PubMed Central

Rangel, Marina; dos Santos, Jéssica Cassilla; Ortiz, Paula Helena Lima; Hirata, Mario; Jasiulionis, Miriam Galvonas; Araujo, Ronaldo C.; Ierardi, Daniela Filippini; Franco, Maria do Carmo

2014-01-01

There is a growing body of evidence that epigenetic alterations are involved in the pathological mechanisms of many chronic disorders linked to fetal programming. Angiotensin-converting enzyme (ACE) appears as one candidate gene that brings new insights into the epigenetic control and later development of diseases. In this view, we have postulated that epigenetic modifications in the ACE gene might show different interactions between birth weight (BW), blood pressure levels, plasma ACE activity and ACE I/D polymorphism. To explore this hypothesis, we performed a cross-sectional study to evaluate the DNA methylation of 3 CpG sites using pyrosequencing within the ACE gene promoter of peripheral blood leukocytes from 45 LBW children compared with 70 NBW children. Our results have revealed that LBW children have lower methylation levels (P<0.001) in parallel with a higher ACE activity (P = 0.001). Adjusting for prematurity, gender, age, body mass index, and family history of cardiovascular disease did not alter these findings. We have also performed analyses of individual CpG sites. The frequency of DNA methylation was significantly different at two CpG sites (site 1: nucleotide position +555; and site 3: nucleotide position +563). In addition, we have found a significant inverse correlation between degree of DNA methylation and both ACE activity (P<0.001) and systolic blood pressure levels (P<0.001). We also observed that the methylation level was significantly lower in LBW children who are carriers of the DD genotype compared to NBW children with DD genotype (P<0.024). In conclusion, we are able to demonstrate that the hypomethylation in the 3 CpG sites of ACE gene promoter is associated with LBW in 6 to 12 year-old children. The magnitude of these epigenetic changes appears to be clinically important, which is supported by the observation that discrete changes in DNA methylation can affect systolic blood pressure and ACE protein activity levels. PMID:25170764

Modification of epigenetic patterns in low birth weight children: importance of hypomethylation of the ACE gene promoter.

PubMed

Rangel, Marina; dos Santos, Jéssica Cassilla; Ortiz, Paula Helena Lima; Hirata, Mario; Jasiulionis, Miriam Galvonas; Araujo, Ronaldo C; Ierardi, Daniela Filippini; Franco, Maria do Carmo

2014-01-01

There is a growing body of evidence that epigenetic alterations are involved in the pathological mechanisms of many chronic disorders linked to fetal programming. Angiotensin-converting enzyme (ACE) appears as one candidate gene that brings new insights into the epigenetic control and later development of diseases. In this view, we have postulated that epigenetic modifications in the ACE gene might show different interactions between birth weight (BW), blood pressure levels, plasma ACE activity and ACE I/D polymorphism. To explore this hypothesis, we performed a cross-sectional study to evaluate the DNA methylation of 3 CpG sites using pyrosequencing within the ACE gene promoter of peripheral blood leukocytes from 45 LBW children compared with 70 NBW children. Our results have revealed that LBW children have lower methylation levels (P<0.001) in parallel with a higher ACE activity (P = 0.001). Adjusting for prematurity, gender, age, body mass index, and family history of cardiovascular disease did not alter these findings. We have also performed analyses of individual CpG sites. The frequency of DNA methylation was significantly different at two CpG sites (site 1: nucleotide position +555; and site 3: nucleotide position +563). In addition, we have found a significant inverse correlation between degree of DNA methylation and both ACE activity (P<0.001) and systolic blood pressure levels (P<0.001). We also observed that the methylation level was significantly lower in LBW children who are carriers of the DD genotype compared to NBW children with DD genotype (P<0.024). In conclusion, we are able to demonstrate that the hypomethylation in the 3 CpG sites of ACE gene promoter is associated with LBW in 6 to 12 year-old children. The magnitude of these epigenetic changes appears to be clinically important, which is supported by the observation that discrete changes in DNA methylation can affect systolic blood pressure and ACE protein activity levels.

Comprehensive Analysis of MGMT Promoter Methylation: Correlation with MGMT Expression and Clinical Response in GBM

PubMed Central

Shah, Nameeta; Lin, Biaoyang; Sibenaller, Zita; Ryken, Timothy; Lee, Hwahyung; Yoon, Jae-Geun; Rostad, Steven; Foltz, Greg

2011-01-01

O6-methylguanine DNA-methyltransferase (MGMT) promoter methylation has been identified as a potential prognostic marker for glioblastoma patients. The relationship between the exact site of promoter methylation and its effect on gene silencing, and the patient's subsequent response to therapy, is still being defined. The aim of this study was to comprehensively characterize cytosine-guanine (CpG) dinucleotide methylation across the entire MGMT promoter and to correlate individual CpG site methylation patterns to mRNA expression, protein expression, and progression-free survival. To best identify the specific MGMT promoter region most predictive of gene silencing and response to therapy, we determined the methylation status of all 97 CpG sites in the MGMT promoter in tumor samples from 70 GBM patients using quantitative bisulfite sequencing. We next identified the CpG site specific and regional methylation patterns most predictive of gene silencing and improved progression-free survival. Using this data, we propose a new classification scheme utilizing methylation data from across the entire promoter and show that an analysis based on this approach, which we call 3R classification, is predictive of progression-free survival (HR  = 5.23, 95% CI [2.089–13.097], p<0.0001). To adapt this approach to the clinical setting, we used a methylation-specific multiplex ligation-dependent probe amplification (MS-MLPA) test based on the 3R classification and show that this test is both feasible in the clinical setting and predictive of progression free survival (HR  = 3.076, 95% CI [1.301–7.27], p = 0.007). We discuss the potential advantages of a test based on this promoter-wide analysis and compare it to the commonly used methylation-specific PCR test. Further prospective validation of these two methods in a large independent patient cohort will be needed to confirm the added value of promoter wide analysis of MGMT methylation in the clinical setting. PMID:21249131

Genetic and epigenetic regulation of YKL-40 in childhood.

PubMed

Guerra, Stefano; Melén, Erik; Sunyer, Jordi; Xu, Cheng-Jian; Lavi, Iris; Benet, Marta; Bustamante, Mariona; Carsin, Anne-Elie; Dobaño, Carlota; Guxens, Mònica; Tischer, Christina; Vrijheid, Martine; Kull, Inger; Bergström, Anna; Kumar, Ashish; Söderhäll, Cilla; Gehring, Ulrike; Dijkstra, Dorieke J; van der Vlies, Pieter; Wickman, Magnus; Bousquet, Jean; Postma, Dirkje S; Anto, Josep M; Koppelman, Gerard H

2018-03-01

Circulating levels of the chitinase-like protein YKL-40 are influenced by genetic variation in its encoding gene (chitinase 3-like 1 [CHI3L1]) and are increased in patients with several diseases, including asthma. Epigenetic regulation of circulating YKL-40 early in life is unknown. We sought to determine (1) whether methylation levels at CHI3L1 CpG sites mediate the association of CHI3L1 single nucleotide polymorphisms (SNPs) with YKL-40 levels in the blood and (2) whether these biomarkers (CHI3L1 SNPs, methylation profiles, and YKL-40 levels) are associated with asthma in early childhood. We used data from up to 2405 participants from the Spanish Infancia y Medio Ambiente; the Swedish Barn/Children, Allergy, Milieu, Stockholm, Epidemiological survey; and the Dutch Prevention and Incidence of Asthma and Mite Allergy birth cohorts. Associations between 68 CHI3L1 SNPs, methylation levels at 14 CHI3L1 CpG sites in whole-blood DNA, and circulating YKL-40 levels at 4 years of age were tested by using correlation analysis, multivariable regression, and mediation analysis. Each of these biomarkers was also tested for association with asthma at 4 years of age by using multivariable logistic regression. YKL-40 levels were significantly associated with 7 SNPs and with methylation at 5 CpG sites. Consistent associations between these 7 SNPs (particularly rs10399931 and rs4950928) and 5 CpG sites were observed. Alleles linked to lower YKL-40 levels were associated with higher methylation levels. Participants with high YKL-40 levels (defined as the highest YKL-40 tertile) had increased odds for asthma compared with subjects with low YKL-40 levels (meta-analyzed adjusted odds ratio, 1.90 [95% CI, 1.08-3.36]). In contrast, neither SNPs nor methylation levels at CpG sites in CHI3L1 were associated with asthma. The effects of CHI3L1 genetic variation on circulating YKL-40 levels are partly mediated by methylation profiles. In our study YKL-40 levels, but not CHI3L1 SNPs or methylation levels, were associated with childhood asthma. Copyright © 2017 American Academy of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

21 CFR 866.5765 - Retinol-binding protein immunological test system.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Retinol-binding protein immunological test system....5765 Retinol-binding protein immunological test system. (a) Identification. A retinol-binding protein... the retinol-binding protein that binds and transports vitamin A in serum and urine. Measurement of...

21 CFR 866.5765 - Retinol-binding protein immunological test system.

Code of Federal Regulations, 2012 CFR

2012-04-01

... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Retinol-binding protein immunological test system....5765 Retinol-binding protein immunological test system. (a) Identification. A retinol-binding protein... the retinol-binding protein that binds and transports vitamin A in serum and urine. Measurement of...

21 CFR 866.5765 - Retinol-binding protein immunological test system.

Code of Federal Regulations, 2014 CFR

2014-04-01

... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Retinol-binding protein immunological test system....5765 Retinol-binding protein immunological test system. (a) Identification. A retinol-binding protein... the retinol-binding protein that binds and transports vitamin A in serum and urine. Measurement of...

21 CFR 866.5765 - Retinol-binding protein immunological test system.

Code of Federal Regulations, 2013 CFR

2013-04-01

... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Retinol-binding protein immunological test system....5765 Retinol-binding protein immunological test system. (a) Identification. A retinol-binding protein... the retinol-binding protein that binds and transports vitamin A in serum and urine. Measurement of...

The Use of Chlorhexidine/n-Propyl Gallate (CPG) as an Ambient-Temperature Urine Preservative

NASA Technical Reports Server (NTRS)

Nillen, Jeannie L.; Smith, Scott M.

2003-01-01

A safe, effective ambient temperature urine preservative, chlorhexidine/n-propyl gallate (CPG), has been formulated for use during spacefli ght that reduces the effects of oxidation and bacterial contamination on sample integrity while maintaining urine pH. The ability of this preservative to maintain stability of nine key analytes was evaluated for a period of one year. CPG effectively maintained stability of a mmonia, total nitrogen, 3-methylhistidine, chloride, sodium, potassiu m, and urea; however, creatinine and osmolality were not preserved by CPG. These data indicate that CPG offers prolonged room-temperature storage for multiple urine analytes, reducing the requirements for f rozen urine storage on future spaceflights. Iii medical applications on Earth, this technology can allow urine samples to be collected in remote settings and eliminate the need to ship frozen samples.

Reinforcement learning for a biped robot based on a CPG-actor-critic method.

PubMed

Nakamura, Yutaka; Mori, Takeshi; Sato, Masa-aki; Ishii, Shin

2007-08-01

Animals' rhythmic movements, such as locomotion, are considered to be controlled by neural circuits called central pattern generators (CPGs), which generate oscillatory signals. Motivated by this biological mechanism, studies have been conducted on the rhythmic movements controlled by CPG. As an autonomous learning framework for a CPG controller, we propose in this article a reinforcement learning method we call the "CPG-actor-critic" method. This method introduces a new architecture to the actor, and its training is roughly based on a stochastic policy gradient algorithm presented recently. We apply this method to an automatic acquisition problem of control for a biped robot. Computer simulations show that training of the CPG can be successfully performed by our method, thus allowing the biped robot to not only walk stably but also adapt to environmental changes.

Methylation oligonucleotide microarray: a novel tool to analyze methylation patterns

NASA Astrophysics Data System (ADS)

Hou, Peng; Ji, Meiju; He, Nongyao; Lu, Zuhong

2003-04-01

A new technique to analyze methylation patterns in several adjacent CpG sites was developed and reported here. We selected a 336bp segment of the 5"-untranslated region and the first exon of the p16Ink4a gene, which include the most densely packed CpG fragment of the islands containing 32 CpG dinucleotides, as the investigated target. The probes that include all types of methylation patterns were designed to fabricate a DNA microarray to determine the methylation patterns of seven adjacent CpG dinucleotides sites. High accuracy and reproducibility were observed in several parallel experiments. The results led us to the conclusion that the methylation oligonucleotide microarray can be applied as a novel and powerful tool to map methylation patterns and changes in multiple CpG island loci in a variety of tumors.

DNA methylation profiles of long- and short-term glioblastoma survivors

PubMed Central

Shinawi, Thoraia; Hill, Victoria K.; Krex, Dietmar; Schackert, Gabriele; Gentle, Dean; Morris, Mark R.; Wei, Wenbin; Cruickshank, Garth; Maher, Eamonn R.; Latif, Farida

2013-01-01

Glioblastoma (GBM) is the most common and malignant type of primary brain tumor in adults and prognosis of most GBM patients is poor. However, a small percentage of patients show a long term survival of 36 mo or longer after diagnosis. Epigenetic profiles can provide molecular markers for patient prognosis: recently, a G-CIMP positive phenotype associated with IDH1 mutations has been described for GBMs with good prognosis. In the present analysis we performed genome-wide DNA methylation profiling of short-term survivors (STS; overall survival < 1 y) and long-term survivors (LTS; overall survival > 3 y) by utilizing the HumanMethylation450K BeadChips to assess quantitative methylation at > 480,000 CpG sites. Cluster analysis has shown that a subset of LTS showed a G-CIMP positive phenotype that was tightly associated with IDH1 mutation status and was confirmed by analysis of the G-CIMP signature genes. Using high stringency criteria for differential hypermethylation between non-cancer brain and tumor samples, we identified 2,638 hypermethylated CpG loci (890 genes) in STS GBMs, 3,101 hypermethylated CpG loci (1,062 genes) in LTS (wild type IDH1) and 11,293 hypermethylated CpG loci in LTS (mutated for IDH1), reflecting the CIMP positive phenotype. The location of differentially hypermethylated CpG loci with respect to CpG content, neighborhood context and functional genomic distribution was similar in our sample set, with the majority of CpG loci residing in CpG islands and in gene promoters. Our preliminary study also identified a set of CpG loci differentially hypermethylated between STS and LTS cases, including members of the homeobox gene family (HOXD8, HOXD13 and HOXC4), the transcription factors NR2F2 and TFAP2A, and Dickkopf 2, a negative regulator of the wnt/β-catenin signaling pathway. PMID:23291739

Vitamin D dose response is underestimated by Endocrine Society's Clinical Practice Guideline.

PubMed

McKenna, Malachi J; Murray, Barbara F

2013-06-01

The recommended daily intakes of vitamin D according to the recent Clinical Practice Guideline (CPG) of the Endocrine Society are three- to fivefold higher than the Institute of Medicine (IOM) report. We speculated that these differences could be explained by different mathematical approaches to the vitamin D dose response. Studies were selected if the daily dose was ≤2000 IU/day, the duration exceeded 3 months, and 25-hydroxyvitamin D (25OHD) concentrations were measured at baseline and post-therapy. The rate constant was estimated according to the CPG approach. The achieved 25OHD result was estimated according to the following: i) the regression equation approach of the IOM; ii) the regression approach of the Vitamin D Supplementation in Older Subjects (ViDOS) study; and iii) the CPG approach using a rate constant of 2.5 (CPG2.5) and a rate constant of 5.0 (CPG5.0). The difference between the expected and the observed 25OHD result was expressed as a percentage of observed and analyzed for significance against a value of 0% for the four groups. Forty-one studies were analyzed. The mean (95% CI) rate constant was 5.3 (4.4-6.2) nmol/l per 100 IU per day, on average twofold higher than the CPG rate constant. The mean (95% CI) for the difference between the expected and observed expressed as a percentage of observed was as follows: i) IOM, -7 (-16,+2)% (t=1.64, P=0.110); ii) ViDOS, +2 (-8,+12)% (t=0.40, P=0.69); iii) CPG2.5, -21 (-27,-15)% (t=7.2, P<0.0001); and iv) CPG5.0+3 (-4,+10)% (t=0.91, P=0.366). The CPG 'rule of thumb' should be doubled to 5.0 nmol/l (2.0 ng/ml) per 100 IU per day, adopting a more risk-averse position.

CpG methylation patterns and decitabine treatment response in acute myeloid leukemia cells and normal hematopoietic precursors

PubMed Central

Negrotto, Soledad; Ng, Kwok Peng; Jankowska, Ania M.; Bodo, Juraj; Gopalan, Banu; Guinta, Kathryn; Mulloy, James C.; Hsi, Eric; Maciejewski, Jaroslaw; Saunthararajah, Yogen

2011-01-01

The DNA hypomethylating drug decitabine maintains normal hematopoietic stem cell (HSC) self-renewal but induces terminal differentiation in acute myeloid leukemia (AML) cells. The basis for these contrasting cell-fates, and for selective CpG hypomethylation by decitabine, is poorly understood. Promoter CpGs, with methylation measured by microarray, were classified by the direction of methylation change with normal myeloid maturation. In AML cells, the methylation pattern at maturation-responsive CpG suggested at least partial maturation. Consistent with partial maturation, in gene expression analyses, AML cells expressed high levels of the key lineage-specifying factor CEBPA, but relatively low levels of the key late-differentiation driver CEBPE. In methylation analysis by mass-spectrometry, CEBPE promoter CpG that are usually hypomethylated during granulocyte maturation were significantly hypermethylated in AML cells. Decitabine treatment induced cellular differentiation of AML cells, and the largest methylation decreases were at CpG that are hypomethylated with myeloid maturation, including CEBPE promoter CpG. In contrast, decitabine-treated normal HSC retained immature morphology, and methylation significantly decreased at CpG that are less methylated in immature cells. High expression of lineage-specifying factor and aberrant epigenetic repression of some key late-differentiation genes distinguishes AML cells from normal HSC and could explain the contrasting differentiation and methylation responses to decitabine. PMID:21836612

Distinct Effects of Monophosphoryl Lipid A, Oligodeoxynucleotide CpG, and Combination Adjuvants on Modulating Innate and Adaptive Immune Responses to Influenza Vaccination

PubMed Central

Ko, Eun-Ju; Lee, Young-Tae; Lee, Youri; Kim, Ki-Hye

2017-01-01

Monophosphoryl lipid A (MPL) and oligodeoxynucleotide CpG are toll-like receptor (TLR) 4 and 9 agonist, respectively. Here, we investigated the effects of MPL, CpG, and combination adjuvants on stimulating in vitro dendritic cells (DCs), in vivo innate and adaptive immune responses, and protective efficacy of influenza vaccination. Combination of MPL and CpG was found to exhibit distinct effects on stimulating DCs in vitro to secrete IL-12p70 and tumor necrosis factor (TNF)-α and proliferate allogeneic CD8 T cells. Prime immunization of mice with inactivated split influenza vaccine in the presence of low dose MPL+CpG adjuvants increased the induction of virus-specific IgG and IgG2a isotype antibodies. MPL and CpG adjuvants contribute to improving the efficacy of prime influenza vaccination against lethal influenza challenge as determined by body weight monitoring, lung function, viral titers, and histology. A combination of MPL and CpG adjuvants was effective in improving vaccine efficacy as well as in reducing inflammatory immune responses locally and in inducing cellular immune responses upon lethal influenza virus challenge. This study demonstrates unique adjuvant effects of MPL, CpG, and combination adjuvants on modulating innate and adaptive immune responses to influenza prime vaccination. PMID:29093654

Dopamine receptor D4 promoter hypermethylation increases the risk of drug addiction.

PubMed

Ji, Huihui; Xu, Xuting; Liu, Guili; Liu, Huifen; Wang, Qinwen; Shen, Wenwen; Li, Longhui; Xie, Xiaohu; Hu, Haochang; Xu, Lei; Zhou, Wenhua; Duan, Shiwei

2018-02-01

Heroin and methylamphetamine (METH) are two addictive drugs that cause serious problems for society. Dopamine receptor D4 (DRD4), a key receptor in the dopaminergic system, may facilitate the development of drug addiction. The aim of the present study was to investigate the association between the promoter methylation level of DRD4 gene and drug addiction. Bisulfite pyrosequencing technology was used to measure the methylation levels of DRD4 promoter in 60 drug addicts and 52 matched controls. Significantly higher levels of DRD4 CpG1 and CpG4 methylation were detected in METH and heroin drug addicts compared with controls (P<0.05). Male METH addicts exhibited significantly higher DRD4 CpG1, CpG2 and CpG4 methylation levels compared with sex-matched controls (P<0.05). In heroin addicts, a positive correlation was observed between depression-dejection and DRD4 CpG5 methylation (r=0.537, P=0.039) whereas there was a negative correlation between drug usage frequency and CpG1 methylation (r=-0.632, P=0.011). In METH addicts, methylation levels were not significantly associated with depression-dejection and drug usage frequency. In addition, luciferase assays demonstrated that the target sequence of the DRD4 promoter upregulates gene expression. The results of the present study suggest that DNA methylation of DRD4 may be responsible for the pathophysiology of drug addiction.

Thioredoxin binding protein (TBP)-2/Txnip and α-arrestin proteins in cancer and diabetes mellitus.

PubMed

Masutani, Hiroshi; Yoshihara, Eiji; Masaki, So; Chen, Zhe; Yodoi, Junji

2012-01-01

Thioredoxin binding protein -2/ thioredoxin interacting protein is an α-arrestin protein that has attracted much attention as a multifunctional regulator. Thioredoxin binding protein -2 expression is downregulated in tumor cells and the level of thioredoxin binding protein is correlated with clinical stage of cancer. Mice with mutations or knockout of the thioredoxin binding protein -2 gene are much more susceptible to carcinogenesis than wild-type mice, indicating a role for thioredoxin binding protein -2 in cancer suppression. Studies have also revealed roles for thioredoxin binding protein -2 in metabolic control. Enhancement of thioredoxin binding protein -2 expression causes impairment of insulin sensitivity and glucose-induced insulin secretion, and β-cell apoptosis. These changes are important characteristics of type 2 diabetes mellitus. Thioredoxin binding protein -2 regulates transcription of metabolic regulating genes. Thioredoxin binding protein -2-like inducible membrane protein/ arrestin domain containing 3 regulates endocytosis of receptors such as the β(2)-adrenergic receptor. The α-arrestin family possesses PPXY motifs and may function as an adaptor/scaffold for NEDD family ubiquitin ligases. Elucidation of the molecular mechanisms of α-arrestin proteins would provide a new pharmacological basis for developing approaches against cancer and type 2 diabetes mellitus.

A Single Rainbow Trout Cobalamin-binding Protein Stands in for Three Human Binders

PubMed Central

Greibe, Eva; Fedosov, Sergey; Sorensen, Boe S.; Højrup, Peter; Poulsen, Steen S.; Nexo, Ebba

2012-01-01

Cobalamin uptake and transport in mammals are mediated by three cobalamin-binding proteins: haptocorrin, intrinsic factor, and transcobalamin. The nature of cobalamin-binding proteins in lower vertebrates remains to be elucidated. The aim of this study was to characterize the cobalamin-binding proteins of the rainbow trout (Oncorhynchus mykiss) and to compare their properties with those of the three human cobalamin-binding proteins. High cobalamin-binding capacity was found in trout stomach (210 pmol/g), roe (400 pmol/g), roe fluid (390 nmol/liter), and plasma (2500 nmol/liter). In all cases, it appeared to be the same protein based on analysis of partial sequences and immunological responses. The trout cobalamin-binding protein was purified from roe fluid, sequenced, and further characterized. Like haptocorrin, the trout cobalamin-binding protein was stable at low pH and had a high binding affinity for the cobalamin analog cobinamide. Like haptocorrin and transcobalamin, the trout cobalamin-binding protein was present in plasma and recognized ligands with altered nucleotide moiety. Like intrinsic factors, the trout cobalamin-binding protein was present in the stomach and resisted degradation by trypsin and chymotrypsin. It also resembled intrinsic factor in the composition of conserved residues in the primary cobalamin-binding site in the C terminus. The trout cobalamin-binding protein was glycosylated and displayed spectral properties comparable with those of haptocorrin and intrinsic factor. In conclusion, only one soluble cobalamin-binding protein was identified in the rainbow trout, a protein that structurally behaves like an intermediate between the three human cobalamin-binding proteins. PMID:22872637

PTPRT regulates the interaction of Syntaxin-binding protein 1 with Syntaxin 1 through dephosphorylation of specific tyrosine residue

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lim, So-Hee; Moon, Jeonghee; Lee, Myungkyu

2013-09-13

Highlights: •PTPRT is a brain-specific, expressed, protein tyrosine phosphatase. •PTPRT regulated the interaction of Syntaxin-binding protein 1 with Syntaxin 1. •PTPRT dephosphorylated the specific tyrosine residue of Syntaxin-binding protein 1. •Dephosphorylation of Syntaxin-binding protein 1 enhanced the interaction with Syntaxin 1. •PTPRT appears to regulate the fusion of synaptic vesicle through dephosphorylation. -- Abstract: PTPRT (protein tyrosine phosphatase receptor T), a brain-specific tyrosine phosphatase, has been found to regulate synaptic formation and development of hippocampal neurons, but its regulation mechanism is not yet fully understood. Here, Syntaxin-binding protein 1, a key component of synaptic vesicle fusion machinery, was identified asmore » a possible interaction partner and an endogenous substrate of PTPRT. PTPRT interacted with Syntaxin-binding protein 1 in rat synaptosome, and co-localized with Syntaxin-binding protein 1 in cultured hippocampal neurons. PTPRT dephosphorylated tyrosine 145 located around the linker between domain 1 and 2 of Syntaxin-binding protein 1. Syntaxin-binding protein 1 directly binds to Syntaxin 1, a t-SNARE (soluble N-ethylmaleimide-sensitive factor attachment protein receptor) protein, and plays a role as catalysts of SNARE complex formation. Syntaxin-binding protein 1 mutant mimicking non-phosphorylation (Y145F) enhanced the interaction with Syntaxin 1 compared to wild type, and therefore, dephosphorylation of Syntaxin-binding protein 1 appeared to be important for SNARE-complex formation. In conclusion, PTPRT could regulate the interaction of Syntaxin-binding protein 1 with Syntaxin 1, and as a result, the synaptic vesicle fusion appeared to be controlled through dephosphorylation of Syntaxin-binding protein 1.« less

Non-linear patterns in age-related DNA methylation may reflect CD4+ T cell differentiation

PubMed Central

Johnson, Nicholas D.; Wiener, Howard W.; Smith, Alicia K.; Nishitani, Shota; Absher, Devin M.; Arnett, Donna K.; Aslibekyan, Stella; Conneely, Karen N.

2017-01-01

ABSTRACT DNA methylation (DNAm) is an important epigenetic process involved in the regulation of gene expression. While many studies have identified thousands of loci associated with age, few have differentiated between linear and non-linear DNAm trends with age. Non-linear trends could indicate early- or late-life gene regulatory processes. Using data from the Illumina 450K array on 336 human peripheral blood samples, we identified 21 CpG sites that associated with age (P<1.03E-7) and exhibited changing rates of DNAm change with age (P<1.94E-6). For 2 of these CpG sites (cg07955995 and cg22285878), DNAm increased with age at an increasing rate, indicating that differential DNAm was greatest among elderly individuals. We observed significant replication for both CpG sites (P<5.0E-8) in a second set of peripheral blood samples. In 8 of 9 additional data sets comprising samples of monocytes, T cell subtypes, and brain tissue, we observed a pattern directionally consistent with DNAm increasing with age at an increasing rate, which was nominally significant in the 3 largest data sets (4.3E-15

Epigenetic inactivation of CHFR in human tumors

PubMed Central

Toyota, Minoru; Sasaki, Yasushi; Satoh, Ayumi; Ogi, Kazuhiro; Kikuchi, Takefumi; Suzuki, Hiromu; Mita, Hiroaki; Tanaka, Nobuyuki; Itoh, Fumio; Issa, Jean-Pierre J.; Jair, Kam-Wing; Schuebel, Kornel E.; Imai, Kohzoh; Tokino, Takashi

2003-01-01

Cell-cycle checkpoints controlling the orderly progression through mitosis are frequently disrupted in human cancers. One such checkpoint, entry into metaphase, is regulated by the CHFR gene encoding a protein possessing forkhead-associated and RING finger domains as well as ubiquitin–ligase activity. Although defects in this checkpoint have been described, the molecular basis and prevalence of CHFR inactivation in human tumors are still not fully understood. To address this question, we analyzed the pattern of CHFR expression in a number of human cancer cell lines and primary tumors. We found CpG methylation-dependent silencing of CHFR expression in 45% of cancer cell lines, 40% of primary colorectal cancers, 53% of colorectal adenomas, and 30% of primary head and neck cancers. Expression of CHFR was precisely correlated with both CpG methylation and deacetylation of histones H3 and H4 in the CpG-rich regulatory region. Moreover, CpG methylation and thus silencing of CHFR depended on the activities of two DNA methyltransferases, DNMT1 and DNMT3b, as their genetic inactivation restored CHFR expression. Finally, cells with CHFR methylation had an intrinsically high mitotic index when treated with microtubule inhibitor. This means that cells in which CHFR was epigenetically inactivated constitute loss-of-function alleles for mitotic checkpoint control. Taken together, these findings shed light on a pathway by which mitotic checkpoint is bypassed in cancer cells and suggest that inactivation of checkpoint genes is much more widespread than previously suspected. PMID:12810945

Monoclonal antibodies to human vitamin D-binding protein.

PubMed Central

Pierce, E A; Dame, M C; Bouillon, R; Van Baelen, H; DeLuca, H F

1985-01-01

Monoclonal antibodies to vitamin D-binding protein isolated from human serum have been produced. The antibodies obtained have been shown to be specific for human vitamin D-binding protein by three independent assays. The antibodies recognize human vitamin D-binding protein specifically in an enzyme-linked immunosorbent assay. Human vitamin D-binding protein is detected specifically in both pure and crude samples by a radiometric immunosorbent assay (RISA) and by an immunoprecipitation assay. The anti-human vitamin D-binding protein antibodies cross-react with monkey and pig vitamin D-binding protein, but not with vitamin D-binding protein from rat, mouse, or chicken, as determined by the RISA and immunoprecipitation assays. Images PMID:3936035

Reconstruction of Toll-like receptor 9-mediated responses in HEK-Blue hTLR9 cells by transfection of human macrophage scavenger receptor 1 gene.

PubMed

Ohtsuki, Shozo; Takahashi, Yuki; Inoue, Takao; Takakura, Yoshinobu; Nishikawa, Makiya

2017-10-20

We used human Toll-like receptor 9 (hTLR9)-expressing HEK-Blue hTLR9 cells, which release secreted embryonic alkaline phosphatase (SEAP) upon response to CpG DNA, to evaluate the immunological properties of nucleic acid drug candidates. Our preliminary studies showed that phosphodiester CpG DNA hardly induced any SEAP secretion in HEK-Blue hTLR9 cells. In the current study, therefore, we developed HEK-Blue hTLR9 cells transduced with human macrophage scavenger receptor-1 (hMSR1), a cell-surface DNA receptor, and determined whether HEK-Blue hTLR9/hMSR1 cells respond to phosphorothioate (PS) CpG DNA and phosphodiester (PO) CpG DNA. We selected PS CpG2006, a single-stranded PO CpG DNA (ssCpG), and a tetrapod-like structured DNA (tetrapodna) containing ssCpG (tetraCpG) as model TLR9 ligands. Alexa Fluor 488-labeled ligands were used for flow cytometry. Unlike the mock-transfected HEK-Blue hTLR9 cells, the HEK-Blue hTLR9/hMSR1 cells efficiently took up all three CpG DNAs. SEAP release was almost proportional to the uptake. Treatment of HEK-Blue hTLR9/hMSR1 cells with an anti-hMSR1 antibody significantly reduced the uptake of ssCpG and tetraCpG. Collectively, reconstruction of TLR9-mediated responses to CpG DNA in HEK-Blue hTLR9 cells can be used to evaluate the toxicity of nucleic acid drug candidates with diverse physicochemical properties.

Extended Plasticity of Visual Cortex in Dark-Reared Animals May Result from Prolonged Expression of cpg15-Like Genes

PubMed Central

Lee, Wei-Chung Allen; Nedivi, Elly

2011-01-01

cpg15 is an activity-regulated gene that encodes a membrane-bound ligand that coordinately regulates growth of apposing dendritic and axonal arbors and the maturation of their synapses. These properties make it an attractive candidate for participating in plasticity of the mammalian visual system. Here we compare cpg15 expression during normal development of the rat visual system with that seen in response to dark rearing, monocular blockade of retinal action potentials, or monocular deprivation. Our results show that the onset of cpg15 expression in the visual cortex is coincident with eye opening, and it increases until the peak of the critical period at postnatal day 28 (P28). This early expression is independent of both retinal activity and visual experience. After P28, a component of cpg15 expression in the visual cortex, lateral geniculate nucleus (LGN), and superior colliculus (SC) develops a progressively stronger dependence on retinally driven action potentials. Dark rearing does not affect cpg15 mRNA expression in the LGN and SC at any age, but it does significantly affect its expression in the visual cortex from the peak of the critical period and into adulthood. In dark-reared rats, the peak level of cpg15 expression in the visual cortex at P28 is lower than in controls. Rather than showing the normal decline with maturation, these levels are maintained in dark-reared animals. We suggest that the prolonged plasticity in the visual cortex that is seen in dark-reared animals may result from failure to downregulate genes such as cpg15 that could promote structural remodeling and synaptic maturation. PMID:11880509

Evidence-based clinical practice guideline for adult Still's disease.

PubMed

Mimura, Toshihide; Kondo, Yuya; Ohta, Akihide; Iwamoto, Masahiro; Ota, Akiko; Okamoto, Nami; Kawaguchi, Yasushi; Kono, Hajime; Takasaki, Yoshinari; Takei, Shuji; Nishimoto, Norihiro; Fujimoto, Manabu; Asanuma, Yu Funakubo; Mimori, Akio; Okiyama, Naoko; Kaneko, Shunta; Takahashi, Hiroyuki; Yokosawa, Masahiro; Sumida, Takayuki

2018-05-09

Using an expert- and data-driven methodology, we have constructed the first clinical practice guidelines (CPGs) for adult Still's disease (ASD) after complete systematic review (SR) of the literature based upon the Medical Information Network Distribution Service (Minds) procedure. The CPG committee for ASD organized by the Research Team for Autoimmune Diseases, the Research Program for Intractable Disease of the Japanese Ministry of Health, Labour, and Welfare has developed CPG for ASD 2017, according to the procedure proposed by Minds. The CPG development process includes (1) clarification of the purpose of CPG, (2) organization of the steering committee, (3) organization of the CPG committee and secretariat, (4) defining the scope (setting of clinical questions (CQs)), (5) SR, (6) development of recommendations, (7) drafting the CPG, (8) external evaluation and public comments, and (9) release. Because we wanted to construct CPG for ASD to encompass both adult-onset Still's disease (AOSD) and adult patients with systemic juvenile idiopathic arthritis (sJIA), we also included SR data from sJIA in this study. Twenty-six CQs were selected and roughly divided into the following items: (1) clinical findings (CQs 1-4), (2) laboratory findings (CQs 5-8), (3) complications (CQs 9-13), (4) treatment with oral medicine (CQs 14-19), (5) treatment with biological reagents (CQs 20-23), and (6) treatments for sJIA (CQs 25-26). Recommendations and the strength of the recommendations for these CQs were decided by a modified Delphi method. We have developed the first published CPG for ASD including AOSD and sJIA, which includes 26 CQs and recommendations. This guideline will help rheumatologists, non-specialized physicians, other healthcare providers, medical and health-related students, and patients and their family members to understand and treat ASD.

Provider Adherence to Implementation of Clinical Practice Guidelines for Neurogenic Bowel in Adults With Spinal Cord Injury

PubMed Central

Goetz, Lance L; Nelson, Audrey L; Guihan, Marylou; Bosshart, Helen T; Harrow, Jeffrey J; Gerhart, Kevin D; Krasnicka, Barbara; Burns, Stephen P

2005-01-01

Background/Objectives: Clinical Practice Guidelines (CPGs) have been published on a number of topics in spinal cord injury (SCI) medicine. Research in the general medical literature shows that the distribution of CPGs has a minimal effect on physician practice without targeted implementation strategies. The purpose of this study was to determine (a) whether dissemination of an SCI CPG improved the likelihood that patients would receive CPG recommended care and (b) whether adherence to CPG recommendations could be improved through a targeted implementation strategy. Specifically, this study addressed the “Neurogenic Bowel Management in Adults with Spinal Cord Injury” Clinical Practice Guideline published in March 1998 by the Consortium for Spinal Cord Medicine Methods: CPG adherence was determined from medical record review at 6 Veterans Affairs SCI centers for 3 time periods: before guideline publication (T1), after guideline publication but before CPG implementation (T2), and after targeted CPG implementation (T3). Specific implementation strategies to enhance guideline adherence were chosen to address the barriers identified by SCI providers in focus groups before the intervention. Results: Overall adherence to recommendations related to neurogenic bowel did not change between T1 and T2 (P = not significant) but increased significantly between T2 and T3 (P < 0.001) for 3 of 6 guideline recommendations. For the other 3 guideline recommendations, adherence rates were noted to be high at T1. Conclusions: While publication of the CPG alone did not alter rates of provider adherence, the use of a targeted implementation plan resulted in increases in adherence rates with some (3 of 6) CPG recommendations for neurogenic bowel management. PMID:16869086

The Genomic Impact of DNA CpG Methylation on Gene Expression; Relationships in Prostate Cancer.

PubMed

Long, Mark D; Smiraglia, Dominic J; Campbell, Moray J

2017-02-14

The process of DNA CpG methylation has been extensively investigated for over 50 years and revealed associations between changing methylation status of CpG islands and gene expression. As a result, DNA CpG methylation is implicated in the control of gene expression in developmental and homeostasis processes, as well as being a cancer-driver mechanism. The development of genome-wide technologies and sophisticated statistical analytical approaches has ushered in an era of widespread analyses, for example in the cancer arena, of the relationships between altered DNA CpG methylation, gene expression, and tumor status. The remarkable increase in the volume of such genomic data, for example, through investigators from the Cancer Genome Atlas (TCGA), has allowed dissection of the relationships between DNA CpG methylation density and distribution, gene expression, and tumor outcome. In this manner, it is now possible to test that the genome-wide correlations are measurable between changes in DNA CpG methylation and gene expression. Perhaps surprisingly is that these associations can only be detected for hundreds, but not thousands, of genes, and the direction of the correlations are both positive and negative. This, perhaps, suggests that CpG methylation events in cancer systems can act as disease drivers but the effects are possibly more restricted than suspected. Additionally, the positive and negative correlations suggest direct and indirect events and an incomplete understanding. Within the prostate cancer TCGA cohort, we examined the relationships between expression of genes that control DNA methylation, known targets of DNA methylation and tumor status. This revealed that genes that control the synthesis of S -adenosyl-l-methionine (SAM) associate with altered expression of DNA methylation targets in a subset of aggressive tumors.

Bayesian inference supports a location and neighbour-dependent model of DNA methylation propagation at the MGMT gene promoter in lung tumours.

PubMed

Bonello, Nicolas; Sampson, James; Burn, John; Wilson, Ian J; McGrown, Gail; Margison, Geoff P; Thorncroft, Mary; Crossbie, Philip; Povey, Andrew C; Santibanez-Koref, Mauro; Walters, Kevin

2013-11-07

We exploit model-based Bayesian inference methodologies to analyse lung tumour-derived methylation data from a CpG island in the O6-methylguanine-DNA methyltransferase (MGMT) promoter. Interest is in modelling the changes in methylation patterns in a CpG island in the first exon of the promoter during lung tumour development. We propose four competils of methylation state propagation based on two mechanisms. The first is the location-dependence mechanism in which the probability of a gain or loss of methylation at a CpG within the promoter depends upon its location in the CpG sequence. The second mechanism is that of neighbour-dependence in which gain or loss of methylation at a CpG depends upon the methylation status of the immediately preceding CpG. Our data comprises the methylation status at 12 CpGs near the 5' end of the CpG island in two lung tumour samples for both alleles of a nearby polymorphism. We use approximate Bayesian computation, a computationally intensive rejection-sampling algorithm to infer model parameters and compare models without the need to evaluate the likelihood function. We compare the four proposed models using two criteria: the approximate Bayes factors and the distribution of the Euclidean distance between the summary statistics of the observed and simulated datasets. Our model-based analysis demonstrates compelling evidence for both location and neighbour dependence in the process of aberrant DNA methylation of this MGMT promoter CpG island in lung tumours. We find equivocal evidence to support the hypothesis that the methylation patterns of the two alleles evolve independently. © 2013 Published by Elsevier Ltd. All rights reserved.

Phosphatidic acid binding proteins display differential binding as a function of membrane curvature stress and chemical properties.

PubMed

Putta, Priya; Rankenberg, Johanna; Korver, Ruud A; van Wijk, Ringo; Munnik, Teun; Testerink, Christa; Kooijman, Edgar E

2016-11-01

Phosphatidic acid (PA) is a crucial membrane phospholipid involved in de novo lipid synthesis and numerous intracellular signaling cascades. The signaling function of PA is mediated by peripheral membrane proteins that specifically recognize PA. While numerous PA-binding proteins are known, much less is known about what drives specificity of PA-protein binding. Previously, we have described the ionization properties of PA, summarized in the electrostatic-hydrogen bond switch, as one aspect that drives the specific binding of PA by PA-binding proteins. Here we focus on membrane curvature stress induced by phosphatidylethanolamine and show that many PA-binding proteins display enhanced binding as a function of negative curvature stress. This result is corroborated by the observation that positive curvature stress, induced by lyso phosphatidylcholine, abolishes PA binding of target proteins. We show, for the first time, that a novel plant PA-binding protein, Arabidopsis Epsin-like Clathrin Adaptor 1 (ECA1) displays curvature-dependence in its binding to PA. Other established PA targets examined in this study include, the plant proteins TGD2, and PDK1, the yeast proteins Opi1 and Spo20, and, the mammalian protein Raf-1 kinase and the C2 domain of the mammalian phosphatidylserine binding protein Lact as control. Based on our observations, we propose that liposome binding assays are the preferred method to investigate lipid binding compared to the popular lipid overlay assays where membrane environment is lost. The use of complex lipid mixtures is important to elucidate further aspects of PA binding proteins. Copyright © 2016. Published by Elsevier B.V.

A terahertz EO detector with large dynamical range, high modulation depth and signal-noise ratio

NASA Astrophysics Data System (ADS)

Pan, Xinjian; Cai, Yi; Zeng, Xuanke; Zheng, Shuiqin; Li, Jingzhen; Xu, Shixiang

2017-05-01

The paper presents a novel design for terahertz (THz) free-space time domain electro-optic (EO) detection where the static birefringent phases of the two balanced arms are set close to zero but opposite to each other. Our theoretical and numerical analyses show this design has much stronger ability to cancel the optical background noise than both THz ellipsometer and traditional crossed polarizer geometry (CPG). Its optical modulation depth is about twice as high as that of traditional CPG, but about ten times as high as that of THz ellipsometer. As for the dynamical range, our improved design is comparable to the THz ellipsometer but obviously larger than the traditional CPG. Some experiments for comparing our improved CPG with traditional CPG agree well with the corresponding theoretical predictions. Our experiments also show that the splitting ratio of the used non-polarization beam splitter is critical for the performance of our design.

CpG oligodeoxyribonucleotides protect mice from Burkholderia pseudomallei but not Francisella tularensis Schu S4 aerosols

PubMed Central

2010-01-01

Studies have shown that CpG oligodeoxyribonucleotides (ODN) protect mice from various bacterial pathogens, including Burkholderia pseudomallei and Francisella tularensis live vaccine strain (LVS), when administered before parenteral challenge. Given the potential to develop CpG ODN as a pre-treatment for multiple bacterial biological warfare agents, we examined survival, histopathology, and cytokine data from CpG ODN-treated C57BL/6 mice to determine whether previously-reported protection extended to aerosolized B. pseudomallei 1026b and highly virulent F. tularensis Schu S4 infections. We found that, although CpG ODN protected mice from aerosolized B. pseudomallei challenges, the immunostimulant failed to benefit the animals exposed to F. tularensis Schu S4 aerosols. Our results, which contrast with earlier F. tularensis LVS studies, highlight potential differences in Francisella species pathogenesis and underscore the need to evaluate immunotherapies against human pathogenic species. PMID:20181102

CpG oligodeoxyribonucleotides protect mice from Burkholderia pseudomallei but not Francisella tularensis Schu S4 aerosols.

PubMed

Rozak, David A; Gelhaus, Herbert C; Smith, Mark; Zadeh, Mojgan; Huzella, Louis; Waag, David; Adamovicz, Jeffrey J

2010-02-05

Studies have shown that CpG oligodeoxyribonucleotides (ODN) protect mice from various bacterial pathogens, including Burkholderia pseudomallei and Francisella tularensis live vaccine strain (LVS), when administered before parenteral challenge. Given the potential to develop CpG ODN as a pre-treatment for multiple bacterial biological warfare agents, we examined survival, histopathology, and cytokine data from CpG ODN-treated C57BL/6 mice to determine whether previously-reported protection extended to aerosolized B. pseudomallei 1026b and highly virulent F. tularensis Schu S4 infections. We found that, although CpG ODN protected mice from aerosolized B. pseudomallei challenges, the immunostimulant failed to benefit the animals exposed to F. tularensis Schu S4 aerosols. Our results, which contrast with earlier F. tularensis LVS studies, highlight potential differences in Francisella species pathogenesis and underscore the need to evaluate immunotherapies against human pathogenic species.

SMCHD1 regulates a limited set of gene clusters on autosomal chromosomes.

PubMed

Mason, Amanda G; Slieker, Roderick C; Balog, Judit; Lemmers, Richard J L F; Wong, Chao-Jen; Yao, Zizhen; Lim, Jong-Won; Filippova, Galina N; Ne, Enrico; Tawil, Rabi; Heijmans, Bas T; Tapscott, Stephen J; van der Maarel, Silvère M

2017-06-06

Facioscapulohumeral muscular dystrophy (FSHD) is in most cases caused by a contraction of the D4Z4 macrosatellite repeat on chromosome 4 (FSHD1) or by mutations in the SMCHD1 or DNMT3B gene (FSHD2). Both situations result in the incomplete epigenetic repression of the D4Z4-encoded retrogene DUX4 in somatic cells, leading to the aberrant expression of DUX4 in the skeletal muscle. In mice, Smchd1 regulates chromatin repression at different loci, having a role in CpG methylation establishment and/or maintenance. To investigate the global effects of harboring heterozygous SMCHD1 mutations on DNA methylation in humans, we combined 450k methylation analysis on mononuclear monocytes from female heterozygous SMCHD1 mutation carriers and unaffected controls with reduced representation bisulfite sequencing (RRBS) on FSHD2 and control myoblast cell lines. Candidate loci were then evaluated for SMCHD1 binding using ChIP-qPCR and expression was evaluated using RT-qPCR. We identified a limited number of clustered autosomal loci with CpG hypomethylation in SMCHD1 mutation carriers: the protocadherin (PCDH) cluster on chromosome 5, the transfer RNA (tRNA) and 5S rRNA clusters on chromosome 1, the HOXB and HOXD clusters on chromosomes 17 and 2, respectively, and the D4Z4 repeats on chromosomes 4 and 10. Furthermore, minor increases in RNA expression were seen in FSHD2 myoblasts for some of the PCDHβ cluster isoforms, tRNA isoforms, and a HOXB isoform in comparison to controls, in addition to the previously reported effects on DUX4 expression. SMCHD1 was bound at DNAseI hypersensitivity sites known to regulate the PCDHβ cluster and at the chromosome 1 tRNA cluster, with decreased binding in SMCHD1 mutation carriers at the PCDHβ cluster sites. Our study is the first to investigate the global methylation effects in humans resulting from heterozygous mutations in SMCHD1. Our results suggest that SMCHD1 acts as a repressor on a limited set of autosomal gene clusters, as an observed reduction in methylation associates with a loss of SMCHD1 binding and increased expression for some of the loci.

Disturbance of cardiac gene expression and cardiomyocyte structure predisposes Mecp2-null mice to arrhythmias

PubMed Central

Hara, Munetsugu; Takahashi, Tomoyuki; Mitsumasu, Chiaki; Igata, Sachiyo; Takano, Makoto; Minami, Tomoko; Yasukawa, Hideo; Okayama, Satoko; Nakamura, Keiichiro; Okabe, Yasunori; Tanaka, Eiichiro; Takemura, Genzou; Kosai, Ken-ichiro; Yamashita, Yushiro; Matsuishi, Toyojiro

2015-01-01

Methyl-CpG-binding protein 2 (MeCP2) is an epigenetic regulator of gene expression that is essential for normal brain development. Mutations in MeCP2 lead to disrupted neuronal function and can cause Rett syndrome (RTT), a neurodevelopmental disorder. Previous studies reported cardiac dysfunction, including arrhythmias in both RTT patients and animal models of RTT. In addition, recent studies indicate that MeCP2 may be involved in cardiac development and dysfunction, but its role in the developing and adult heart remains unknown. In this study, we found that Mecp2-null ESCs could differentiate into cardiomyocytes, but the development and further differentiation of cardiovascular progenitors were significantly affected in MeCP2 deficiency. In addition, we revealed that loss of MeCP2 led to dysregulation of endogenous cardiac genes and myocardial structural alterations, although Mecp2-null mice did not exhibit obvious cardiac functional abnormalities. Furthermore, we detected methylation of the CpG islands in the Tbx5 locus, and showed that MeCP2 could target these sequences. Taken together, these results suggest that MeCP2 is an important regulator of the gene-expression program responsible for maintaining normal cardiac development and cardiomyocyte structure. PMID:26073556

Epigenetics and Breast Cancers

PubMed Central

Vo, An T.; Millis, Richard M.

2012-01-01

Several of the active compounds in foods, poisons, drugs, and industrial chemicals may, by epigenetic mechanisms, increase or decrease the risk of breast cancers. Enzymes that are involved in DNA methylation and histone modifications have been shown to be altered in several types of breast and other cancers resulting in abnormal patterns of methylation and/or acetylation. Hypermethylation at the CpG islands found in estrogen response element (ERE) promoters occurs in conjunction with ligand-bonded alpha subunit estrogen receptor (Erα) dimers wherein the ligand ERα dimer complex acts as a transcription factor and binds to the ERE promoter. Ligands could be 17-β-estradiol (E2), phytoestrogens, heterocyclic amines, and many other identified food additives and heavy metals. The dimer recruits DNA methyltransferases which catalyze the transfer of methyl groups from S-adenosyl-L-methionine (SAM) to 5′-cytosine on CpG islands. Other enzymes are recruited to the region by ligand-ERα dimers which activate DNA demethylases to act simultaneously to increase gene expression of protooncogenes and growth-promoting genes. Ligand-ERα dimers also recruit histone acetyltransferase to the ERE promoter region. Histone demethylases such as JMJD2B and histone methyltransferases are enzymes which demethylate lysine residues on histones H3 and/or H4. This makes the chromatin accessible for transcription factors and enzymes. PMID:22567014

Methylation Status of the Follistatin Gene at Different Development Stages of Japanese Flounder (Paralichthys olivaceus)

NASA Astrophysics Data System (ADS)

Huang, Yajuan; Hu, Nan; Si, Yufeng; Li, Siping; Wu, Shuxian; Zhang, Meizhao; Wen, Haishen; Li, Jifang; Li, Yun; He, Feng

2018-06-01

Follistatin (Fst) is a hyperplasia factor that plays a crucial role in muscle development. DNA methylation, a significant process, regulates gene expression. The aim of our study is to examine the DNA methylation and expression patterns of Fst gene at five different development stages of Japanese flounder (stage A, 7 dph; stage B, 90 dph; stage C, about 180 dph; stage D, about 24 months; stage E, about 36 months). The muscle tissue of Japanese flounder was obtained at different development stages in this experiment. DNA methylation levels in the promoter and exon 2 of Fst were determined by bisulfite sequencing, and the relative expression of the Fst gene at the five stages was measured by quantitative PCR. The results showed that the lowest methylation level was at stage A and the highest methylation level was at stage B. Moreover, the highest expression level of the Fst gene was observed at stage A. The mRNA abundance was negatively correlated with DNA methylation level. Three CpG islands in the promoter region and three CpG islands in exon 2 of Fst were found in the binding sequence of the putative transcription factor. These results offered a theoretical basis for the mechanism of Fst gene regulation to muscle development at different development stages.

DNA methylation analysis of paediatric low-grade astrocytomas identifies a tumour-specific hypomethylation signature in pilocytic astrocytomas.

PubMed

Jeyapalan, Jennie N; Doctor, Gabriel T; Jones, Tania A; Alberman, Samuel N; Tep, Alexander; Haria, Chirag M; Schwalbe, Edward C; Morley, Isabel C F; Hill, Alfred A; LeCain, Magdalena; Ottaviani, Diego; Clifford, Steven C; Qaddoumi, Ibrahim; Tatevossian, Ruth G; Ellison, David W; Sheer, Denise

2016-05-27

Low-grade gliomas (LGGs) account for about a third of all brain tumours in children. We conducted a detailed study of DNA methylation and gene expression to improve our understanding of the biology of pilocytic and diffuse astrocytomas. Pilocytic astrocytomas were found to have a distinctive signature at 315 CpG sites, of which 312 were hypomethylated and 3 were hypermethylated. Genomic analysis revealed that 182 of these sites are within annotated enhancers. The signature was not present in diffuse astrocytomas, or in published profiles of other brain tumours and normal brain tissue. The AP-1 transcription factor was predicted to bind within 200 bp of a subset of the 315 differentially methylated CpG sites; the AP-1 factors, FOS and FOSL1 were found to be up-regulated in pilocytic astrocytomas. We also analysed splice variants of the AP-1 target gene, CCND1, which encodes cell cycle regulator cyclin D1. CCND1a was found to be highly expressed in both pilocytic and diffuse astrocytomas, but diffuse astrocytomas have far higher expression of the oncogenic variant, CCND1b. These findings highlight novel genetic and epigenetic differences between pilocytic and diffuse astrocytoma, in addition to well-described alterations involving BRAF, MYB and FGFR1.

Thioredoxin binding protein (TBP)-2/Txnip and α-arrestin proteins in cancer and diabetes mellitus

PubMed Central

Masutani, Hiroshi; Yoshihara, Eiji; Masaki, So; Chen, Zhe; Yodoi, Junji

2012-01-01

Thioredoxin binding protein −2/ thioredoxin interacting protein is an α-arrestin protein that has attracted much attention as a multifunctional regulator. Thioredoxin binding protein −2 expression is downregulated in tumor cells and the level of thioredoxin binding protein is correlated with clinical stage of cancer. Mice with mutations or knockout of the thioredoxin binding protein −2 gene are much more susceptible to carcinogenesis than wild-type mice, indicating a role for thioredoxin binding protein −2 in cancer suppression. Studies have also revealed roles for thioredoxin binding protein −2 in metabolic control. Enhancement of thioredoxin binding protein −2 expression causes impairment of insulin sensitivity and glucose-induced insulin secretion, and β-cell apoptosis. These changes are important characteristics of type 2 diabetes mellitus. Thioredoxin binding protein −2 regulates transcription of metabolic regulating genes. Thioredoxin binding protein −2-like inducible membrane protein/ arrestin domain containing 3 regulates endocytosis of receptors such as the β2-adrenergic receptor. The α-arrestin family possesses PPXY motifs and may function as an adaptor/scaffold for NEDD family ubiquitin ligases. Elucidation of the molecular mechanisms of α-arrestin proteins would provide a new pharmacological basis for developing approaches against cancer and type 2 diabetes mellitus. PMID:22247597

Discovery of binding proteins for a protein target using protein-protein docking-based virtual screening.

PubMed

Zhang, Changsheng; Tang, Bo; Wang, Qian; Lai, Luhua

2014-10-01

Target structure-based virtual screening, which employs protein-small molecule docking to identify potential ligands, has been widely used in small-molecule drug discovery. In the present study, we used a protein-protein docking program to identify proteins that bind to a specific target protein. In the testing phase, an all-to-all protein-protein docking run on a large dataset was performed. The three-dimensional rigid docking program SDOCK was used to examine protein-protein docking on all protein pairs in the dataset. Both the binding affinity and features of the binding energy landscape were considered in the scoring function in order to distinguish positive binding pairs from negative binding pairs. Thus, the lowest docking score, the average Z-score, and convergency of the low-score solutions were incorporated in the analysis. The hybrid scoring function was optimized in the all-to-all docking test. The docking method and the hybrid scoring function were then used to screen for proteins that bind to tumor necrosis factor-α (TNFα), which is a well-known therapeutic target for rheumatoid arthritis and other autoimmune diseases. A protein library containing 677 proteins was used for the screen. Proteins with scores among the top 20% were further examined. Sixteen proteins from the top-ranking 67 proteins were selected for experimental study. Two of these proteins showed significant binding to TNFα in an in vitro binding study. The results of the present study demonstrate the power and potential application of protein-protein docking for the discovery of novel binding proteins for specific protein targets. © 2014 Wiley Periodicals, Inc.

Extensive sequence-influenced DNA methylation polymorphism in the human genome

PubMed Central

2010-01-01

Background Epigenetic polymorphisms are a potential source of human diversity, but their frequency and relationship to genetic polymorphisms are unclear. DNA methylation, an epigenetic mark that is a covalent modification of the DNA itself, plays an important role in the regulation of gene expression. Most studies of DNA methylation in mammalian cells have focused on CpG methylation present in CpG islands (areas of concentrated CpGs often found near promoters), but there are also interesting patterns of CpG methylation found outside of CpG islands. Results We compared DNA methylation patterns on both alleles between many pairs (and larger groups) of related and unrelated individuals. Direct observation and simulation experiments revealed that around 10% of common single nucleotide polymorphisms (SNPs) reside in regions with differences in the propensity for local DNA methylation between the two alleles. We further showed that for the most common form of SNP, a polymorphism at a CpG dinucleotide, the presence of the CpG at the SNP positively affected local DNA methylation in cis. Conclusions Taken together with the known effect of DNA methylation on mutation rate, our results suggest an interesting interdependence between genetics and epigenetics underlying diversity in the human genome. PMID:20497546

DNA activates human immune cells through a CpG sequence-dependent manner

PubMed Central

Bauer, M; Heeg, K; Wagner, H; Lipford, G B

1999-01-01

While bacterial DNA and cytosine–guanosine-dinucleotide-containing oligonucleotides (CpG ODN) are well described activators of murine immune cells, their effect on human cells is inconclusive. We investigated their properties on human peripheral blood mononuclear cells (PBMC) and subsets thereof, such as purified monocytes, T and B cells. Here we demonstrate that bacterial DNA and CpG ODN induce proliferation of B cells, while other subpopulations, such as monocytes and T cells, did not proliferate. PBMC mixed cell cultures, as well as purified monocytes, produced interleukin-6 (IL-6), IL-12 and tumour necrosis factor-α upon stimulation with bacterial DNA; however, only IL-6 and IL-12 secretion became induced upon CpG ODN stimulation. We conclude that monocytes, but not B or T cells, represent the prime source of cytokines. Monocytes up-regulated expression of antigen-presenting, major histocompatibility complex class I and class II molecules in response to CpG DNA. In addition, both monocytes and B cells up-regulate costimulatory CD86 and CD40 molecules. The activation by CpG ODN depended on sequence motifs containing the core dinucleotide CG since destruction of the motif strongly reduced immunostimulatory potential. PMID:10457226

[Evaluation of the quality of clinical practice guidelines published in the Annales de Biologie Clinique with the help of the EFLM checklist].

PubMed

Wils, Julien; Fonfrède, Michèle; Augereau, Christine; Watine, Joseph

2014-01-01

Several tools are available to help evaluate the quality of clinical practice guidelines (CPG). The AGREE instrument (Appraisal of guidelines for research & evaluation) is the most consensual tool but it has been designed to assess CPG methodology only. The European federation of laboratory medicine (EFLM) recently designed a check-list dedicated to laboratory medicine which is supposed to be comprehensive and which therefore makes it possible to evaluate more thoroughly the quality of CPG in laboratory medicine. In the present work we test the comprehensiveness of this check-list on a sample of CPG written in French and published in Annales de biologie clinique (ABC). Thus we show that some work remains to be achieved before a truly comprehensive check-list is designed. We also show that there is some room for improvement for the CPG published in ABC, for example regarding the fact that some of these CPG do not provide any information about allowed durations of transport and of storage of biological samples before analysis, or about standards of minimal analytical performance, or about the sensitivities or the specificities of the recommended tests.

Immunotherapeutic potential of CpG oligodeoxynucleotides in veterinary species.

PubMed

Manuja, Anju; Manuja, Balvinder K; Kaushik, Jyoti; Singha, Harisankar; Singh, Raj Kumar

2013-10-01

Innate immunity plays a critical role in host defense against infectious diseases by discriminating between self and infectious non-self. The recognition of infectious non-self involves germ-line encoded pattern recognition receptors (PRRs) that recognize pathogen-associated molecular patterns (PAMPs). The PAMPs are the components of pathogenic microbes which include not only the cell wall constituents but also the unmethylated 2'-deoxy-ribo-cytosine-phosphate-guanosine (CpG) motifs. These CpG motifs present within bacterial and viral DNA are recognized by toll-like receptor 9 (TLR9), and signaling by this receptor triggers a proinflammatory cytokine response which, in turn, influences both innate and adaptive immune responses. The activation of TLR9 with synthetic CpG oligodeoxynucleotides (ODNs) induces powerful Th1-like immune responses. It has been shown to provide protection against infectious diseases, allergy and cancer in laboratory animal models and some domestic animal species. With better understanding of the basic biology and immune mechanisms, it would be possible to exploit the potential of CpG motifs for animal welfare. The research developments in the area of CpG and TLR9 and the potential applications in animal health have been reviewed in this article.

Towards autonomous locomotion: CPG-based control of smooth 3D slithering gait transition of a snake-like robot.

PubMed

Bing, Zhenshan; Cheng, Long; Chen, Guang; Röhrbein, Florian; Huang, Kai; Knoll, Alois

2017-04-04

Snake-like robots with 3D locomotion ability have significant advantages of adaptive travelling in diverse complex terrain over traditional legged or wheeled mobile robots. Despite numerous developed gaits, these snake-like robots suffer from unsmooth gait transitions by changing the locomotion speed, direction, and body shape, which would potentially cause undesired movement and abnormal torque. Hence, there exists a knowledge gap for snake-like robots to achieve autonomous locomotion. To address this problem, this paper presents the smooth slithering gait transition control based on a lightweight central pattern generator (CPG) model for snake-like robots. First, based on the convergence behavior of the gradient system, a lightweight CPG model with fast computing time was designed and compared with other widely adopted CPG models. Then, by reshaping the body into a more stable geometry, the slithering gait was modified, and studied based on the proposed CPG model, including the gait transition of locomotion speed, moving direction, and body shape. In contrast to sinusoid-based method, extensive simulations and prototype experiments finally demonstrated that smooth slithering gait transition can be effectively achieved using the proposed CPG-based control method without generating undesired locomotion and abnormal torque.

CpG island methylator phenotype in colorectal cancer

PubMed Central

Toyota, Minoru; Ahuja, Nita; Ohe-Toyota, Mutsumi; Herman, James G.; Baylin, Stephen B.; Issa, Jean-Pierre J.

1999-01-01

Aberrant methylation of promoter region CpG islands is associated with transcriptional inactivation of tumor-suppressor genes in neoplasia. To understand global patterns of CpG island methylation in colorectal cancer, we have used a recently developed technique called methylated CpG island amplification to examine 30 newly cloned differentially methylated DNA sequences. Of these 30 clones, 19 (63%) were progressively methylated in an age-dependent manner in normal colon, 7 (23%) were methylated in a cancer-specific manner, and 4 (13%) were methylated only in cell lines. Thus, a majority of CpG islands methylated in colon cancer are also methylated in a subset of normal colonic cells during the process of aging. In contrast, methylation of the cancer-specific clones was found exclusively in a subset of colorectal cancers, which appear to display a CpG island methylator phenotype (CIMP). CIMP+ tumors also have a high incidence of p16 and THBS1 methylation, and they include the majority of sporadic colorectal cancers with microsatellite instability related to hMLH1 methylation. We thus define a pathway in colorectal cancer that appears to be responsible for the majority of sporadic tumors with mismatch repair deficiency. PMID:10411935

Functional assignment of solute-binding proteins of ABC transporters using a fluorescence-based thermal shift assay.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Giulliani, S. E.; Frank, A. E.; Collart, F. R.

2008-12-08

We have used a fluorescence-based thermal shift (FTS) assay to identify amino acids that bind to solute-binding proteins in the bacterial ABC transporter family. The assay was validated with a set of six proteins with known binding specificity and was consistently able to map proteins with their known binding ligands. The assay also identified additional candidate binding ligands for several of the amino acid-binding proteins in the validation set. We extended this approach to additional targets and demonstrated the ability of the FTS assay to unambiguously identify preferential binding for several homologues of amino acid-binding proteins with known specificity andmore » to functionally annotate proteins of unknown binding specificity. The assay is implemented in a microwell plate format and provides a rapid approach to validate an anticipated function or to screen proteins of unknown function. The ABC-type transporter family is ubiquitous and transports a variety of biological compounds, but the current annotation of the ligand-binding proteins is limited to mostly generic descriptions of function. The results illustrate the feasibility of the FTS assay to improve the functional annotation of binding proteins associated with ABC-type transporters and suggest this approach that can also be extended to other protein families.« less

Activation of the Alternative NFκB Pathway Improves Disease Symptoms in a Model of Sjogren's Syndrome

PubMed Central

Gilboa-Geffen, Adi; Wolf, Yochai; Hanin, Geula; Melamed-Book, Naomi; Pick, Marjorie; Bennett, Estelle R.; Greenberg, David S.; Lester, Susan; Rischmueller, Maureen; Soreq, Hermona

2011-01-01

The purpose of our study was to understand if Toll-like receptor 9 (TLR9) activation could contribute to the control of inflammation in Sjogren's syndrome. To this end, we manipulated TLR9 signaling in non-obese diabetic (NOD) and TLR9−/− mice using agonistic CpG oligonucleotide aptamers, TLR9 inhibitors, and the in-house oligonucleotide BL-7040. We then measured salivation, inflammatory response markers, and expression of proteins downstream to NF-κB activation pathways. Finally, we labeled proteins of interest in salivary gland biopsies from Sjogren's syndrome patients, compared to Sicca syndrome controls. We show that in NOD mice BL-7040 activates TLR9 to induce an alternative NF-κB activation mode resulting in increased salivation, elevated anti-inflammatory response in salivary glands, and reduced peripheral AChE activity. These effects were more prominent and also suppressible by TLR9 inhibitors in NOD mice, but TLR9−/− mice were resistant to the salivation-promoting effects of CpG oligonucleotides and BL-7040. Last, salivary glands from Sjogren's disease patients showed increased inflammatory and decreased anti-inflammatory biomarkers, in addition to decreased levels of alternative NF-κB pathway proteins. In summary, we have demonstrated that activation of TLR9 by BL-7040 leads to non-canonical activation of NF-κB, promoting salivary functioning and down-regulating inflammation. We propose that BL-7040 could be beneficial in treating Sjogren's syndrome and may be applicable to additional autoimmune syndromes. PMID:22174879

Allele-specific locus binding and genome editing by CRISPR at the p16INK4a locus.

PubMed

Fujita, Toshitsugu; Yuno, Miyuki; Fujii, Hodaka

2016-07-28

The clustered regularly interspaced short palindromic repeats (CRISPR) system has been adopted for a wide range of biological applications including genome editing. In some cases, dissection of genome functions requires allele-specific genome editing, but the use of CRISPR for this purpose has not been studied in detail. In this study, using the p16INK4a gene in HCT116 as a model locus, we investigated whether chromatin states, such as CpG methylation, or a single-nucleotide gap form in a target site can be exploited for allele-specific locus binding and genome editing by CRISPR in vivo. First, we showed that allele-specific locus binding and genome editing could be achieved by targeting allele-specific CpG-methylated regions, which was successful for one, but not all guide RNAs. In this regard, molecular basis underlying the success remains elusive at this stage. Next, we demonstrated that an allele-specific single-nucleotide gap form could be employed for allele-specific locus binding and genome editing by CRISPR, although it was important to avoid CRISPR tolerance of a single nucleotide mismatch brought about by mismatched base skipping. Our results provide information that might be useful for applications of CRISPR in studies of allele-specific functions in the genomes.

Expression regulation by a methyl-CpG binding domain in an E. coli based, cell-free TX-TL system

NASA Astrophysics Data System (ADS)

Schenkelberger, M.; Shanak, S.; Finkler, M.; Worst, E. G.; Noireaux, V.; Helms, V.; Ott, A.

2017-04-01

Cytosine methylation plays an important role in the epigenetic regulation of eukaryotic gene expression. The methyl-CpG binding domain (MBD) is common to a family of eukaryotic transcriptional regulators. How MBD, a stretch of about 80 amino acids, recognizes CpGs in a methylation dependent manner, and as a function of sequence, is only partly understood. Here we show, using an Escherichia coli cell-free expression system, that MBD from the human transcriptional regulator MeCP2 performs as a specific, methylation-dependent repressor in conjunction with the BDNF (brain-derived neurotrophic factor) promoter sequence. Mutation of either base flanking the central CpG pair changes the expression level of the target gene. However, the relative degree of repression as a function of MBD concentration remains unaltered. Molecular dynamics simulations that address the DNA B fiber ratio and the handedness reveal cooperative transitions in the promoter DNA upon MBD binding that correlate well with our experimental observations. We suggest that not only steric hindrance, but also conformational changes of the BDNF promoter as a result of MBD binding are required for MBD to act as a specific inhibitory element. Our work demonstrates that the prokaryotic transcription machinery can reproduce features of epigenetic mammalian transcriptional regulatory elements.

Food proteins and maturation of small intestinal microvillus membranes (MVM). I. Binding characteristics of cow's milk proteins and concanavalin A to MVM from newborn and adult rats.

PubMed

Stern, M; Gellermann, B

1988-01-01

To study maturational changes of food protein and lectin binding to rat small intestinal microvillus membranes (MVM), MVM were prepared from newborn and adult animals by a modified CaCl2 precipitation technique. Radiolabeled cow's milk proteins [alpha-lactalbumin, alpha-casein, beta-lactoglobulin, bovine serum albumin (BSA)] and the lectin concanavalin A (Con A) were used for incubations. Binding assays were done using miniature ultracentrifugation for separation of unbound material. Binding of Con A to MVM from newborn and adult rats was strong, specific, and saturable. Binding of Con A was inhibited by cold Con A and by the sugar ligand polymer mannan. Adult MVM bound more Con A than newborn preparations. Unlike Con A, binding of cow's milk proteins by MVM was weak, nonspecific, and noninhibitable. Newborn MVM bound more cow's milk proteins than adult controls. This was true for all the proteins tested (p less than 0.001). Binding rose with decreased molecular weight of cow's milk proteins, but molecular weight was not the only determining factor for binding. Trypsin treatment of MVM caused a marked increase of BSA binding in adult but not in newborn preparations. This finding indicated the importance of protein components of MVM for cow's milk protein binding. Maturational changes in protein-lipid interactions and membrane fluidity possibly influence nonspecific cow's milk protein binding to MVM. Differences in binding between newborns and adults were not directly related to maturational shifts in membrane glycosylation that are indicated by differential Con A binding. Increased cow's milk protein binding in newborn individuals might increase the potential risk to develop an adverse reaction to food proteins.

Validation of DAB2IP methylation and its relative significance in predicting outcome in renal cell carcinoma

PubMed Central

Zhao, Liang-Yun; Kapur, Payal; Wu, Kai-Jie; Wang, Bin; Yu, Yan-Hong; Liao, Bing; He, Da-Lin; Chen, Wei; Margulis, Vitaly; Hsieh, Jer-Tsong; Luo, Jun-Hang

2016-01-01

We have recently reported tumor suppressive role of DAB2IP in RCC development. In this study, We identified one CpG methylation biomarker (DAB2IP CpG1) located UTSS of DAB2IP that was associated with poor overall survival in a cohort of 318 ccRCC patients from the Cancer Genome Atlas (TCGA). We further validated the prognostic accuracy of DAB2IP CpG methylation by pyrosequencing quantitative methylation assay in 224 ccRCC patients from multiple Chinese centers (MCHC set), and 239 patients from University of Texas Southwestern Medical Center at Dallas (UTSW set) by using FFPE samples. DAB2IP CpG1 can predict the overall survival of patients in TCGA, MCHC, and UTSW sets independent of patient age, Fuhrman grade and TNM stage (all p<0.05). DAB2IP CpG1 successfully categorized patients into high-risk and low-risk groups with significant differences of clinical outcome in respective clinical subsets, regardless of age, sex, grade, stage, or race (HR: 1.63-7.83; all p<0.05). The detection of DAB2IP CpG1 methylation was minimally affected by ITH in ccRCC. DAB2IP mRNA expression was regulated by DNA methylation in vitro. DAB2IP CpG1 methylation is a practical and repeatable biomarker for ccRCC, which can provide prognostic value that complements the current staging system. PMID:27129174

CpG Distribution and Methylation Pattern in Porcine Parvovirus

PubMed Central

Tóth, Renáta; Mészáros, István; Stefancsik, Rajmund; Bartha, Dániel; Bálint, Ádám; Zádori, Zoltán

2013-01-01

Based on GC content and the observed/expected CpG ratio (oCpGr), we found three major groups among the members of subfamily Parvovirinae: Group I parvoviruses with low GC content and low oCpGr values, Group II with low GC content and high oCpGr values and Group III with high GC content and high oCpGr values. Porcine parvovirus belongs to Group I and it features an ascendant CpG distribution by position in its coding regions similarly to the majority of the parvoviruses. The entire PPV genome remains hypomethylated during the viral lifecycle independently from the tissue of origin. In vitro CpG methylation of the genome has a modest inhibitory effect on PPV replication. The in vitro hypermethylation disappears from the replicating PPV genome suggesting that beside the maintenance DNMT1 the de novo DNMT3a and DNMT3b DNA methyltransferases can’t methylate replicating PPV DNA effectively either, despite that the PPV infection does not seem to influence the expression, translation or localization of the DNA methylases. SNP analysis revealed high mutability of the CpG sites in the PPV genome, while introduction of 29 extra CpG sites into the genome has no significant biological effects on PPV replication in vitro. These experiments raise the possibility that beyond natural selection mutational pressure may also significantly contribute to the low level of the CpG sites in the PPV genome. PMID:24392033

Mechanism of the G-protein mimetic nanobody binding to a muscarinic G-protein-coupled receptor.

PubMed

Miao, Yinglong; McCammon, J Andrew

2018-03-20

Protein-protein binding is key in cellular signaling processes. Molecular dynamics (MD) simulations of protein-protein binding, however, are challenging due to limited timescales. In particular, binding of the medically important G-protein-coupled receptors (GPCRs) with intracellular signaling proteins has not been simulated with MD to date. Here, we report a successful simulation of the binding of a G-protein mimetic nanobody to the M 2 muscarinic GPCR using the robust Gaussian accelerated MD (GaMD) method. Through long-timescale GaMD simulations over 4,500 ns, the nanobody was observed to bind the receptor intracellular G-protein-coupling site, with a minimum rmsd of 2.48 Å in the nanobody core domain compared with the X-ray structure. Binding of the nanobody allosterically closed the orthosteric ligand-binding pocket, being consistent with the recent experimental finding. In the absence of nanobody binding, the receptor orthosteric pocket sampled open and fully open conformations. The GaMD simulations revealed two low-energy intermediate states during nanobody binding to the M 2 receptor. The flexible receptor intracellular loops contribute remarkable electrostatic, polar, and hydrophobic residue interactions in recognition and binding of the nanobody. These simulations provided important insights into the mechanism of GPCR-nanobody binding and demonstrated the applicability of GaMD in modeling dynamic protein-protein interactions.

A tool for calculating binding-site residues on proteins from PDB structures.

PubMed

Hu, Jing; Yan, Changhui

2009-08-03

In the research on protein functional sites, researchers often need to identify binding-site residues on a protein. A commonly used strategy is to find a complex structure from the Protein Data Bank (PDB) that consists of the protein of interest and its interacting partner(s) and calculate binding-site residues based on the complex structure. However, since a protein may participate in multiple interactions, the binding-site residues calculated based on one complex structure usually do not reveal all binding sites on a protein. Thus, this requires researchers to find all PDB complexes that contain the protein of interest and combine the binding-site information gleaned from them. This process is very time-consuming. Especially, combing binding-site information obtained from different PDB structures requires tedious work to align protein sequences. The process becomes overwhelmingly difficult when researchers have a large set of proteins to analyze, which is usually the case in practice. In this study, we have developed a tool for calculating binding-site residues on proteins, TCBRP http://yanbioinformatics.cs.usu.edu:8080/ppbindingsubmit. For an input protein, TCBRP can quickly find all binding-site residues on the protein by automatically combining the information obtained from all PDB structures that consist of the protein of interest. Additionally, TCBRP presents the binding-site residues in different categories according to the interaction type. TCBRP also allows researchers to set the definition of binding-site residues. The developed tool is very useful for the research on protein binding site analysis and prediction.

Interaction entropy for protein-protein binding

NASA Astrophysics Data System (ADS)

Sun, Zhaoxi; Yan, Yu N.; Yang, Maoyou; Zhang, John Z. H.

2017-03-01

Protein-protein interactions are at the heart of signal transduction and are central to the function of protein machine in biology. The highly specific protein-protein binding is quantitatively characterized by the binding free energy whose accurate calculation from the first principle is a grand challenge in computational biology. In this paper, we show how the interaction entropy approach, which was recently proposed for protein-ligand binding free energy calculation, can be applied to computing the entropic contribution to the protein-protein binding free energy. Explicit theoretical derivation of the interaction entropy approach for protein-protein interaction system is given in detail from the basic definition. Extensive computational studies for a dozen realistic protein-protein interaction systems are carried out using the present approach and comparisons of the results for these protein-protein systems with those from the standard normal mode method are presented. Analysis of the present method for application in protein-protein binding as well as the limitation of the method in numerical computation is discussed. Our study and analysis of the results provided useful information for extracting correct entropic contribution in protein-protein binding from molecular dynamics simulations.

Interaction entropy for protein-protein binding.

PubMed

Sun, Zhaoxi; Yan, Yu N; Yang, Maoyou; Zhang, John Z H

2017-03-28

Protein-protein interactions are at the heart of signal transduction and are central to the function of protein machine in biology. The highly specific protein-protein binding is quantitatively characterized by the binding free energy whose accurate calculation from the first principle is a grand challenge in computational biology. In this paper, we show how the interactionentropy approach, which was recently proposed for protein-ligand binding free energy calculation, can be applied to computing the entropic contribution to the protein-protein binding free energy. Explicit theoretical derivation of the interactionentropy approach for protein-protein interaction system is given in detail from the basic definition. Extensive computational studies for a dozen realistic protein-protein interaction systems are carried out using the present approach and comparisons of the results for these protein-protein systems with those from the standard normal mode method are presented. Analysis of the present method for application in protein-protein binding as well as the limitation of the method in numerical computation is discussed. Our study and analysis of the results provided useful information for extracting correct entropic contribution in protein-protein binding from molecular dynamics simulations.

Paxillin associates with poly(A)-binding protein 1 at the dense endoplasmic reticulum and the leading edge of migrating cells.

PubMed

Woods, Alison J; Roberts, Marnie S; Choudhary, Jyoti; Barry, Simon T; Mazaki, Yuichi; Sabe, Hisataka; Morley, Simon J; Critchley, David R; Norman, Jim C

2002-02-22

Using mass spectrometry we have identified proteins which co-immunoprecipitate with paxillin, an adaptor protein implicated in the integrin-mediated signaling pathways of cell motility. A major component of paxillin immunoprecipitates was poly(A)-binding protein 1, a 70-kDa mRNA-binding protein. Poly(A)-binding protein 1 associated with both the alpha and beta isoforms of paxillin, and this was unaffected by RNase treatment consistent with a protein-protein interaction. The NH(2)-terminal region of paxillin (residues 54-313) associated directly with poly(A)-binding protein 1 in cell lysates, and with His-poly(A)-binding protein 1 immobilized in microtiter wells. Binding was specific, saturable and of high affinity (K(d) of approximately 10 nm). Cell fractionation studies showed that at steady state, the bulk of paxillin and poly(A)-binding protein 1 was present in the "dense" polyribosome-associated endoplasmic reticulum. However, inhibition of nuclear export with leptomycin B caused paxillin and poly(A)-binding protein 1 to accumulate in the nucleus, indicating that they shuttle between the nuclear and cytoplasmic compartments. When cells migrate, poly(A)-binding protein 1 colocalized with paxillin-beta at the tips of lamellipodia. Our results suggest a new mechanism whereby a paxillin x poly(A)-binding protein 1 complex facilitates transport of mRNA from the nucleus to sites of protein synthesis at the endoplasmic reticulum and the leading lamella during cell migration.

Comparison of the Folding Mechanism of Highly Homologous Proteins in the Lipid-binding Protein Family

EPA Science Inventory

The folding mechanism of two closely related proteins in the intracellular lipid binding protein family, human bile acid binding protein (hBABP) and rat bile acid binding protein (rBABP) were examined. These proteins are 77% identical (93% similar) in sequence Both of these singl...

Effects of salts on protein-surface interactions: applications for column chromatography.

PubMed

Tsumoto, Kouhei; Ejima, Daisuke; Senczuk, Anna M; Kita, Yoshiko; Arakawa, Tsutomu

2007-07-01

Development of protein pharmaceuticals depends on the availability of high quality proteins. Various column chromatographies are used to purify proteins and characterize the purity and properties of the proteins. Most column chromatographies require salts, whether inorganic or organic, for binding, elution or simply better recovery and resolution. The salts modulate affinity of the proteins for particular columns and nonspecific protein-protein or protein-surface interactions, depending on the type and concentration of the salts, in both specific and nonspecific manners. Salts also affect the binding capacity of the column, which determines the size of the column to be used. Binding capacity, whether equilibrium or dynamic (under an approximation of a slow flow rate), depends on the binding constant, protein concentration and the number of the binding site on the column as well as nonspecific binding. This review attempts to summarize the mechanism of the salt effects on binding affinity and capacity for various column chromatographies and on nonspecific protein-protein or protein-surface interactions. Understanding such salt effects should also be useful in preventing nonspecific protein binding to various containers. Copyright 2007 Wiley-Liss, Inc.

Promoter/repressor system of Lactobacillus plantarum phage og1e: characterization of the promoters pR49-pR-pL and overproduction of the cro-like protein cng in Escherichia coli.

PubMed

Kakikawa, M; Watanabe, N; Funawatashi, T; Oki, M; Yasukawa, H; Taketo, A; Kodaira, K I

1998-07-30

The Lactobacillus plantarum phage og1e (42259bp) has two repressor-like genes cng and cpg oriented oppositely, accompanied by three potential promoters pR, pL and pR49, and seven operator-like sequences (GATAC-boxes) (Kodaira et al., 1997). In this study, the og1e putative promoters were introduced into the Escherichia coli promoter-detecting plasmid pKK232-8. In E. coli CK111, pR (pKPR1), pL (pKPL1) and pR49 (pKPR49) exhibited distinct CAT activities. When pKPR1 or pKPL1 was coexistent with a compatible plasmid pACYC184 carrying pR-cng (pA4PRCN1), the CAT activity was decreased significantly. On the other hand, cng directed a protein (Cng) of 10.1 kDa in E. coli under the control of T7 promoter. Gel mobility-shift assays demonstrated that Cng binds specifically to a DNA region containing the GATAC-boxes. In addition, primer extension analyses demonstrated that the two sequences pR and pL act as a promoter in L. plantarum as well as in E. coli. These results suggested that the potential promoters pR and pL probably function for the lytic and lysogenic pathways, respectively, and Cng may act as a repressor presumably through the GATAC-boxes as operators.

Fanconi Anemia Core Complex Gene Promoters Harbor Conserved Transcription Regulatory Elements

PubMed Central

Meier, Daniel; Schindler, Detlev

2011-01-01

The Fanconi anemia (FA) gene family is a recent addition to the complex network of proteins that respond to and repair certain types of DNA damage in the human genome. Since little is known about the regulation of this novel group of genes at the DNA level, we characterized the promoters of the eight genes (FANCA, B, C, E, F, G, L and M) that compose the FA core complex. The promoters of these genes show the characteristic attributes of housekeeping genes, such as a high GC content and CpG islands, a lack of TATA boxes and a low conservation. The promoters functioned in a monodirectional way and were, in their most active regions, comparable in strength to the SV40 promoter in our reporter plasmids. They were also marked by a distinctive transcriptional start site (TSS). In the 5′ region of each promoter, we identified a region that was able to negatively regulate the promoter activity in HeLa and HEK 293 cells in isolation. The central and 3′ regions of the promoter sequences harbor binding sites for several common and rare transcription factors, including STAT, SMAD, E2F, AP1 and YY1, which indicates that there may be cross-connections to several established regulatory pathways. Electrophoretic mobility shift assays and siRNA experiments confirmed the shared regulatory responses between the prominent members of the TGF-β and JAK/STAT pathways and members of the FA core complex. Although the promoters are not well conserved, they share region and sequence specific regulatory motifs and transcription factor binding sites (TBFs), and we identified a bi-partite nature to these promoters. These results support a hypothesis based on the co-evolution of the FA core complex genes that was expanded to include their promoters. PMID:21826217

Fanconi anemia core complex gene promoters harbor conserved transcription regulatory elements.

PubMed

Meier, Daniel; Schindler, Detlev

2011-01-01

The Fanconi anemia (FA) gene family is a recent addition to the complex network of proteins that respond to and repair certain types of DNA damage in the human genome. Since little is known about the regulation of this novel group of genes at the DNA level, we characterized the promoters of the eight genes (FANCA, B, C, E, F, G, L and M) that compose the FA core complex. The promoters of these genes show the characteristic attributes of housekeeping genes, such as a high GC content and CpG islands, a lack of TATA boxes and a low conservation. The promoters functioned in a monodirectional way and were, in their most active regions, comparable in strength to the SV40 promoter in our reporter plasmids. They were also marked by a distinctive transcriptional start site (TSS). In the 5' region of each promoter, we identified a region that was able to negatively regulate the promoter activity in HeLa and HEK 293 cells in isolation. The central and 3' regions of the promoter sequences harbor binding sites for several common and rare transcription factors, including STAT, SMAD, E2F, AP1 and YY1, which indicates that there may be cross-connections to several established regulatory pathways. Electrophoretic mobility shift assays and siRNA experiments confirmed the shared regulatory responses between the prominent members of the TGF-β and JAK/STAT pathways and members of the FA core complex. Although the promoters are not well conserved, they share region and sequence specific regulatory motifs and transcription factor binding sites (TBFs), and we identified a bi-partite nature to these promoters. These results support a hypothesis based on the co-evolution of the FA core complex genes that was expanded to include their promoters.

Bisphenol A-Associated Alterations in the Expression and Epigenetic Regulation of Genes Encoding Xenobiotic Metabolizing Enzymes in Human Fetal Liver

PubMed Central

Nahar, Muna S.; Kim, Jung H.; Sartor, Maureen A.; Dolinoy, Dana C.

2014-01-01

Alterations in xenobiotic metabolizing enzyme (XME) expression across the life course, along with genetic, nutritional, and environmental regulation, can influence how organisms respond to toxic insults. In this study, we investigated the hypothesis that in utero exposure to the endocrine active compound, bisphenol A (BPA), influences expression and epigenetic regulation of phase I and II XME genes during development. Using healthy 1st to 2nd trimester human fetal liver specimens quantified for internal BPA levels, we examined XME gene expression using PCR Array (n =8) and RNA-sequencing (n =12) platforms. Of the greater than 160 XME genes assayed, 2 phase I and 12 phase II genes exhibited significantly reduced expression with higher BPA levels, including isoforms from the carboxylesterase, catechol O-methyltransferase, glutathione S-transferase, sulfotransferase, and UDP-glucuronosyltransferase families. When the promoters of these candidate genes were evaluated in silico, putative binding sites for the E-twenty-six (ETS) and activator protein1 (AP1) related transcription factor families were identified and unique to 97% of all candidate transcripts. Interestingly, many ETS binding sites contain cytosine-guanine dinucleotides (CpGs) within their consensus sequences. Thus, quantitative analysis of CpG methylation of three candidate genes was conducted across n =50 samples. Higher BPA levels were associated with increased site-specific methylation at COMT (P <0.005) and increased average methylation at SULT2A1 (P <0.020) promoters. While toxicological studies have traditionally focused on high-dose effects and hormonal receptor mediated regulation, our findings suggest the importance of low-dose effects and nonclassical mechanisms of endocrine disruption during development. PMID:24214726

Comparative and evolutionary studies of vertebrate ALDH1A-like genes and proteins.

PubMed

Holmes, Roger S

2015-06-05

Vertebrate ALDH1A-like genes encode cytosolic enzymes capable of metabolizing all-trans-retinaldehyde to retinoic acid which is a molecular 'signal' guiding vertebrate development and adipogenesis. Bioinformatic analyses of vertebrate and invertebrate genomes were undertaken using known ALDH1A1, ALDH1A2 and ALDH1A3 amino acid sequences. Comparative analyses of the corresponding human genes provided evidence for distinct modes of gene regulation and expression with putative transcription factor binding sites (TFBS), CpG islands and micro-RNA binding sites identified for the human genes. ALDH1A-like sequences were identified for all mammalian, bird, lizard and frog genomes examined, whereas fish genomes displayed a more restricted distribution pattern for ALDH1A1 and ALDH1A3 genes. The ALDH1A1 gene was absent in many bony fish genomes examined, with the ALDH1A3 gene also absent in the medaka and tilapia genomes. Multiple ALDH1A1-like genes were identified in mouse, rat and marsupial genomes. Vertebrate ALDH1A1, ALDH1A2 and ALDH1A3 subunit sequences were highly conserved throughout vertebrate evolution. Comparative amino acid substitution rates showed that mammalian ALDH1A2 sequences were more highly conserved than for the ALDH1A1 and ALDH1A3 sequences. Phylogenetic studies supported an hypothesis for ALDH1A2 as a likely primordial gene originating in invertebrate genomes and undergoing sequential gene duplication to generate two additional genes, ALDH1A1 and ALDH1A3, in most vertebrate genomes. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Comprehensive analysis of CpG island methylator phenotype (CIMP)-high, -low, and -negative colorectal cancers based on protein marker expression and molecular features.

PubMed

Zlobec, Inti; Bihl, Michel; Foerster, Anja; Rufle, Alex; Lugli, Alessandro

2011-11-01

CpG island methylator phenotype (CIMP) is being investigated for its role in the molecular and prognostic classification of colorectal cancer patients but is also emerging as a factor with the potential to influence clinical decision-making. We report a comprehensive analysis of clinico-pathological and molecular features (KRAS, BRAF and microsatellite instability, MSI) as well as of selected tumour- and host-related protein markers characterizing CIMP-high (CIMP-H), -low, and -negative colorectal cancers. Immunohistochemical analysis for 48 protein markers and molecular analysis of CIMP (CIMP-H: ≥ 4/5 methylated genes), MSI (MSI-H: ≥ 2 instable genes), KRAS, and BRAF were performed on 337 colorectal cancers. Simple and multiple regression analysis and receiver operating characteristic (ROC) curve analysis were performed. CIMP-H was found in 24 cases (7.1%) and linked (p < 0.0001) to more proximal tumour location, BRAF mutation, MSI-H, MGMT methylation (p = 0.022), advanced pT classification (p = 0.03), mucinous histology (p = 0.069), and less frequent KRAS mutation (p = 0.067) compared to CIMP-low or -negative cases. Of the 48 protein markers, decreased levels of RKIP (p = 0.0056), EphB2 (p = 0.0045), CK20 (p = 0.002), and Cdx2 (p < 0.0001) and increased numbers of CD8+ intra-epithelial lymphocytes (p < 0.0001) were related to CIMP-H, independently of MSI status. In addition to the expected clinico-pathological and molecular associations, CIMP-H colorectal cancers are characterized by a loss of protein markers associated with differentiation, and metastasis suppression, and have increased CD8+ T-lymphocytes regardless of MSI status. In particular, Cdx2 loss seems to strongly predict CIMP-H in both microsatellite-stable (MSS) and MSI-H colorectal cancers. Cdx2 is proposed as a surrogate marker for CIMP-H. Copyright © 2011 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

The bovine viral diarrhea virus E2 protein formulated with a novel adjuvant induces strong, balanced immune responses and provides protection from viral challenge in cattle.

PubMed

Snider, Marlene; Garg, Ravendra; Brownlie, Robert; van den Hurk, Jan V; van Drunen Littel-van den Hurk, Sylvia

2014-11-28

Bovine viral diarrhea virus (BVDV) is still one of the most serious pathogens in cattle, meriting the development of improved vaccines. Recently, we developed a new adjuvant consisting of poly[di(sodium carboxylatoethylphenoxy)]-phosphazene (PCEP), either CpG ODN or poly(I:C), and an immune defense regulator (IDR) peptide. As this adjuvant has been shown to mediate the induction of robust, balanced immune responses, it was evaluated in an E2 subunit vaccine against BVDV in lambs and calves. The BVDV type 2 E2 protein was produced at high levels in a mammalian expression system and purified. When formulated with either CpG ODN or poly(I:C), together with IDR and PCEP, the E2 protein elicited high antibody titers and production of IFN-γ secreting cells in lambs. As the immune responses were stronger when poly(I:C) was used, the E2 protein with poly(I:C), IDR and PCEP was subsequently tested in cattle. Robust virus neutralizing antibodies as well as cell-mediated immune responses, including CD8(+) cytotoxic T cell (CTL) responses, were induced. The fact that CTL responses were demonstrated in calves vaccinated with an E2 protein subunit vaccine indicates that this adjuvant formulation promotes cross-presentation. Furthermore, upon challenge with a high dose of virulent BVDV-2, the vaccinated calves showed almost no temperature response, weight loss, leukopenia or virus replication, in contrast to the control animals, which had severe clinical disease. These data suggest that this E2 subunit formulation induces significant protection from BVDV-2 challenge, and thus is a promising BVDV vaccine candidate; in addition, the adjuvant platform has applications in bovine vaccines in general. Copyright © 2014 Elsevier Ltd. All rights reserved.

Protective immunity against Megalocytivirus infection in rock bream (Oplegnathus fasciatus) following CpG ODN administration.

PubMed

Jung, Myung-Hwa; Lee, Jehee; Ortega-Villaizan, M; Perez, Luis; Jung, Sung-Ju

2017-06-27

Rock bream iridovirus (RBIV) disease in rock bream (Oplegnathus fasciatus) remains an unsolved problem in Korea aquaculture farms. CpG ODNs are known as immunostimulant, can improve the innate immune system of fish providing resistance to diseases. In this study, we evaluated the potential of CpG ODNs to induce anti-viral status protecting rock bream from different RBIV infection conditions. We found that, when administered into rock bream, CpG ODN 1668 induces better antiviral immune responses compared to other 5 CpG ODNs (2216, 1826, 2133, 2395 and 1720). All CpG ODN 1668 administered fish (1/5µg) at 2days before infection (1.1×10 7 ) held at 26°C died even though mortality was delayed from 8days (1µg) and 4days (5µg). Similarly, CpG ODN 1668 administered (5µg) at 2days before infection (1.2×10 6 ) held at 23/20°C had 100% mortality; the mortality was delayed from 9days (23°C) and 11days (20°C). Moreover, when CpG ODN 1668 administered (1/5/10µg) at 2/4/7days before infection or virus concentration was decreased to 1.1×10 4 and held at 20°C had mortality rates of 20/60/30% (2days), 30/40/60% (4days) and 60/60/20% (7days), respectively, for the respective administration dose, through 100 dpi. To investigate the development of a protective immune response, survivors were re-infected with RBIV (1.1×10 7 ) at 100 and 400 dpi, respectively. While 100% of the previously unexposed fish died, 100% of the previously infected fish survived. The high survival rate of fish following re-challenge with RBIV indicates that protective immunity was established in the surviving rock bream. Our results showed the possibility of developing preventive measures against RBIV using CpG ODN 1668 by reducing RBIV replication speed (i.e. water temperature of 20°C and infection dose of 1.1×10 4 ). Copyright © 2017 Elsevier Ltd. All rights reserved.

Possible Mediation by Methylation in Acute Inflammation Following Personal Exposure to Fine Particulate Air Pollution

PubMed Central

Wang, Cuicui; Chen, Renjie; Shi, Min; Cai, Jing; Shi, Jingjin; Yang, Changyuan; Li, Huichu; Lin, Zhijing; Meng, Xia; Liu, Cong; Niu, Yue; Xia, Yongjie; Zhao, Zhuohui; Kan, Haidong; Weinberg, Clarice R

2018-01-01

Abstract Air pollution may increase cardiovascular and respiratory risk through inflammatory pathways, but evidence for acute effects has been weak and indirect. Between December 2014 and July 2015, we enrolled 36 healthy, nonsmoking college students for a panel study in Shanghai, China, a city with highly variable levels of air pollution. We measured personal exposure to particulate matter with an aerodynamic diameter less than or equal to 2.5 μm (PM2.5) continuously for 72 hours preceding each of 4 clinical visits that included phlebotomy. We measured 4 inflammation proteins and DNA methylation at nearby regulatory cytosine-phosphate-guanine (CpG) loci. We applied linear mixed-effect models to examine associations over various lag times. When results suggested mediation, we evaluated methylation as mediator. Increased PM2.5 concentration was positively associated with all 4 inflammation proteins and negatively associated with DNA methylation at regulatory loci for tumor necrosis factor alpha (TNF-α) and soluble intercellular adhesion molecule-1. A 10-μg/m3 increase in average PM2.5 during the 24 hours preceding blood draw corresponded to a 4.4% increase in TNF-α and a statistically significant decrease in methylation at one of the two studied candidate CpG loci for TNF-α. Epigenetics may play an important role in mediating effects of PM2.5 on inflammatory pathways. PMID:29020142

Selective enrichment of metal-binding proteins based on magnetic core/shell microspheres functionalized with metal cations.

PubMed

Fang, Caiyun; Zhang, Lei; Zhang, Xiaoqin; Lu, Haojie

2015-06-21

Metal binding proteins play many important roles in a broad range of biological processes. Characterization of metal binding proteins is important for understanding their structure and biological functions, thus leading to a clear understanding of metal associated diseases. The present study is the first to investigate the effectiveness of magnetic microspheres functionalized with metal cations (Ca(2+), Cu(2+), Zn(2+) and Fe(3+)) as the absorbent matrix in IMAC technology to enrich metal containing/binding proteins. The putative metal binding proteins in rat liver were then globally characterized by using this strategy which is very easy to handle and can capture a number of metal binding proteins effectively. In total, 185 putative metal binding proteins were identified from rat liver including some known less abundant and membrane-bound metal binding proteins such as Plcg1, Acsl5, etc. The identified proteins are involved in many important processes including binding, catalytic activity, translation elongation factor activity, electron carrier activity, and so on.

Tighter Ligand Binding Can Compensate for Impaired Stability of an RNA-Binding Protein.

PubMed

Wallis, Christopher P; Richman, Tara R; Filipovska, Aleksandra; Rackham, Oliver

2018-06-15

It has been widely shown that ligand-binding residues, by virtue of their orientation, charge, and solvent exposure, often have a net destabilizing effect on proteins that is offset by stability conferring residues elsewhere in the protein. This structure-function trade-off can constrain possible adaptive evolutionary changes of function and may hamper protein engineering efforts to design proteins with new functions. Here, we present evidence from a large randomized mutant library screen that, in the case of PUF RNA-binding proteins, this structural relationship may be inverted and that active-site mutations that increase protein activity are also able to compensate for impaired stability. We show that certain mutations in RNA-protein binding residues are not necessarily destabilizing and that increased ligand-binding can rescue an insoluble, unstable PUF protein. We hypothesize that these mutations restabilize the protein via thermodynamic coupling of protein folding and RNA binding.

Clinical evaluation of CpG oligonucleotides as adjuvants for vaccines targeting infectious diseases and cancer

PubMed Central

Scheiermann, Julia; Klinman, Dennis M.

2014-01-01

Synthetic oligonucleotides (ODN) that express unmethylated “CpG motifs” trigger cells that express Toll-like receptor 9. In humans this includes plasmacytoid dendritic cells and B cells. CpG ODN induce an innate immune response characterized by the production of Th1 and pro-inflammatory cytokines. Their utility as vaccine adjuvants was evaluated in a number of clinical trials. Results indicate that CpG ODN improve antigen presentation and the generation of vaccine-specific cellular and humoral responses. This work provides an up-to-date overview of the utility of CpG ODN as adjuvants for vaccines targeting infectious agents and cancer. PMID:24975812

Transcultural Endocrinology: Adapting Type-2 Diabetes Guidelines on a Global Scale.

PubMed

Nieto-Martínez, Ramfis; González-Rivas, Juan P; Florez, Hermes; Mechanick, Jeffrey I

2016-12-01

Type-2 diabetes (T2D) needs to be prevented and treated effectively to reduce its burden and consequences. White papers, such as evidence-based clinical practice guidelines (CPG) and their more portable versions, clinical practice algorithms and clinical checklists, may improve clinical decision-making and diabetes outcomes. However, CPG are underused and poorly validated. Protocols that translate and implement these CPG are needed. This review presents the global dimension of T2D, details the importance of white papers in the transculturalization process, compares relevant international CPG, analyzes cultural variables, and summarizes translation strategies that can improve care. Specific protocols and algorithmic tools are provided. Copyright © 2016 Elsevier Inc. All rights reserved.

Transcutaneous immunization with tetanus toxoid and mutants of Escherichia coli heat-labile enterotoxin as adjuvants elicits strong protective antibody responses.

PubMed

Tierney, Rob; Beignon, Anne-Sophie; Rappuoli, Rino; Muller, Sylviane; Sesardic, Dorothea; Partidos, Charalambos D

2003-09-01

In this study, the adjuvanticity of 2 nontoxic derivatives (LTK63 and LTR72) of heat-labile enterotoxin of Escherichia coli (LT) was evaluated and was compared with that of a cytosine phosphodiester-guanine (CpG) motif, after transcutaneous immunization with tetanus toxoid (TT). TT plus LTR72 elicited the strongest antibody responses, compared with those elicited by the other vaccines (TT, TT plus LTK63, TT plus CpG, and TT plus LTK63 plus CpG); it neutralized the toxin and conferred full protection after passive transfer in mice. Preexisting immunity to LT mutants did not adversely affect their adjuvant potency. Both LTK63 and LTR72 promoted the induction of IgG1 antibodies. In contrast, mice receiving either CpG motif alone or CpG motif plus LTK63 produced strong IgG2a anti-TT antibody responses. Overall, these findings demonstrate that mutants of enterotoxins with reduced toxicity are effective adjuvants for transcutaneous immunization.

On the Role of Sensory Feedbacks in Rowat–Selverston CPG to Improve Robot Legged Locomotion

PubMed Central

Amrollah, Elmira; Henaff, Patrick

2010-01-01

This paper presents the use of Rowat and Selverston-type of central pattern generator (CPG) to control locomotion. It focuses on the role of afferent exteroceptive and proprioceptive signals in the dynamic phase synchronization in CPG legged robots. The sensori-motor neural network architecture is evaluated to control a two-joint planar robot leg that slips on a rail. Then, the closed loop between the CPG and the mechanical system allows to study the modulation of rhythmic patterns and the effect of the sensing loop via sensory neurons during the locomotion task. Firstly simulations show that the proposed architecture easily allows to modulate rhythmic patterns of the leg, and therefore the velocity of the robot. Secondly, simulations show that sensori-feedbacks from foot/ground contact of the leg make the hip velocity smoother and larger. The results show that the Rowat–Selverston-type CPG with sensory feedbacks is an effective choice for building adaptive neural CPGs for legged robots. PMID:21228904

[The effect of entrapment of CpG sequence with cationic PLG nanoparticles on the immune responses of mice to pig paratyphoid vaccine].

PubMed

Wu, Mei; Shi, Ling; Liu, Shigui; Li, Jiangling; Wu, Kaiyuan; Wang, Lihuan; Shen, Yi; Liu, Kun; Zheng, Yong; Zhang, Xinshen; Gao, Rong

2005-10-01

Cationic PLG nanoparticles and liposome were prepared and used as package molecules to pack up pUC18-CpG. The effects of the packed pUC18-CpG on the cellular and humoral immune responses were detected in the mice that were inoculated with pig paratyphoid vaccine. The results showed that compared with the control, the amount of IgG and the titre of specific antibody were significantly increased in the sera of mice immunized with the CpG plasmid entrapped by cationic PLG nanoparticles; the proliferation and induced IL-2 bioactivity of lymphocytes were significantly enhanced in the spleen of the immunized mice; the stimulatory effect of cationic PLG nanoparticles was similar to or stronger than that of cationic liposome. These indicated that cationic PLG nanoparticle could be employed as an effective package molecule to promote the immunostimulatory effect of pUC18-CpG.

Sequence-Based Prediction of RNA-Binding Residues in Proteins.

PubMed

Walia, Rasna R; El-Manzalawy, Yasser; Honavar, Vasant G; Dobbs, Drena

2017-01-01

Identifying individual residues in the interfaces of protein-RNA complexes is important for understanding the molecular determinants of protein-RNA recognition and has many potential applications. Recent technical advances have led to several high-throughput experimental methods for identifying partners in protein-RNA complexes, but determining RNA-binding residues in proteins is still expensive and time-consuming. This chapter focuses on available computational methods for identifying which amino acids in an RNA-binding protein participate directly in contacting RNA. Step-by-step protocols for using three different web-based servers to predict RNA-binding residues are described. In addition, currently available web servers and software tools for predicting RNA-binding sites, as well as databases that contain valuable information about known protein-RNA complexes, RNA-binding motifs in proteins, and protein-binding recognition sites in RNA are provided. We emphasize sequence-based methods that can reliably identify interfacial residues without the requirement for structural information regarding either the RNA-binding protein or its RNA partner.

DNA Methylation of Gene Expression in Acanthamoeba castellanii Encystation.

PubMed

Moon, Eun-Kyung; Hong, Yeonchul; Lee, Hae-Ahm; Quan, Fu-Shi; Kong, Hyun-Hee

2017-04-01

Encystation mediating cyst specific cysteine proteinase (CSCP) of Acanthamoeba castellanii is expressed remarkably during encystation. However, the molecular mechanism involved in the regulation of CSCP gene expression remains unclear. In this study, we focused on epigenetic regulation of gene expression during encystation of Acanthamoeba . To evaluate methylation as a potential mechanism involved in the regulation of CSCP expression, we first investigated the correlation between promoter methylation status of CSCP gene and its expression. A 2,878 bp of promoter sequence of CSCP gene was amplified by PCR. Three CpG islands (island 1-3) were detected in this sequence using bioinformatics tools. Methylation of CpG island in trophozoites and cysts was measured by bisulfite sequence PCR. CSCP promoter methylation of CpG island 1 (1,633 bp) was found in 8.2% of trophozoites and 7.3% of cysts. Methylation of CpG island 2 (625 bp) was observed in 4.2% of trophozoites and 5.8% of cysts. Methylation of CpG island 3 (367 bp) in trophozoites and cysts was both 3.6%. These results suggest that DNA methylation system is present in CSCP gene expression of Acanthamoeba . In addition, the expression of encystation mediating CSCP is correlated with promoter CpG island 1 hypomethylation.

SECRET domain of variola virus CrmB protein can be a member of poxviral type II chemokine-binding proteins family

PubMed Central

2010-01-01

Background Variola virus (VARV) the causative agent of smallpox, eradicated in 1980, have wide spectrum of immunomodulatory proteins to evade host immunity. Recently additional biological activity was discovered for VARV CrmB protein, known to bind and inhibit tumour necrosis factor (TNF) through its N-terminal domain homologous to cellular TNF receptors. Besides binding TNF, this protein was also shown to bind with high affinity several chemokines which recruit B- and T-lymphocytes and dendritic cells to sites of viral entry and replication. Ability to bind chemokines was shown to be associated with unique C-terminal domain of CrmB protein. This domain named SECRET (Smallpox virus-Encoded Chemokine Receptor) is unrelated to the host proteins and lacks significant homology with other known viral chemokine-binding proteins or any other known protein. Findings De novo modelling of VARV-CrmB SECRET domain spatial structure revealed its apparent structural homology with cowpox virus CC-chemokine binding protein (vCCI) and vaccinia virus A41 protein, despite low sequence identity between these three proteins. Potential ligand-binding surface of modelled VARV-CrmB SECRET domain was also predicted to bear prominent electronegative charge which is characteristic to known orthopoxviral chemokine-binding proteins. Conclusions Our results suggest that SECRET should be included into the family of poxviral type II chemokine-binding proteins and that it might have been evolved from the vCCI-like predecessor protein. PMID:20979600

SECRET domain of variola virus CrmB protein can be a member of poxviral type II chemokine-binding proteins family.

PubMed

Antonets, Denis V; Nepomnyashchikh, Tatyana S; Shchelkunov, Sergei N

2010-10-27

Variola virus (VARV) the causative agent of smallpox, eradicated in 1980, have wide spectrum of immunomodulatory proteins to evade host immunity. Recently additional biological activity was discovered for VARV CrmB protein, known to bind and inhibit tumour necrosis factor (TNF) through its N-terminal domain homologous to cellular TNF receptors. Besides binding TNF, this protein was also shown to bind with high affinity several chemokines which recruit B- and T-lymphocytes and dendritic cells to sites of viral entry and replication. Ability to bind chemokines was shown to be associated with unique C-terminal domain of CrmB protein. This domain named SECRET (Smallpox virus-Encoded Chemokine Receptor) is unrelated to the host proteins and lacks significant homology with other known viral chemokine-binding proteins or any other known protein. De novo modelling of VARV-CrmB SECRET domain spatial structure revealed its apparent structural homology with cowpox virus CC-chemokine binding protein (vCCI) and vaccinia virus A41 protein, despite low sequence identity between these three proteins. Potential ligand-binding surface of modelled VARV-CrmB SECRET domain was also predicted to bear prominent electronegative charge which is characteristic to known orthopoxviral chemokine-binding proteins. Our results suggest that SECRET should be included into the family of poxviral type II chemokine-binding proteins and that it might have been evolved from the vCCI-like predecessor protein.

Determining Membrane Protein-Lipid Binding Thermodynamics Using Native Mass Spectrometry.

PubMed

Cong, Xiao; Liu, Yang; Liu, Wen; Liang, Xiaowen; Russell, David H; Laganowsky, Arthur

2016-04-06

Membrane proteins are embedded in the biological membrane where the chemically diverse lipid environment can modulate their structure and function. However, the thermodynamics governing the molecular recognition and interaction of lipids with membrane proteins is poorly understood. Here, we report a method using native mass spectrometry (MS), to determine thermodynamics of individual ligand binding events to proteins. Unlike conventional methods, native MS can resolve individual ligand binding events and, coupled with an apparatus to control the temperature, determine binding thermodynamic parameters, such as for protein-lipid interactions. We validated our approach using three soluble protein-ligand systems (maltose binding protein, lysozyme, and nitrogen regulatory protein) and obtained similar results to those using isothermal titration calorimetry and surface plasmon resonance. We also determined for the first time the thermodynamics of individual lipid binding to the ammonia channel (AmtB), an integral membrane protein from Escherichia coli. Remarkably, we observed distinct thermodynamic signatures for the binding of different lipids and entropy-enthalpy compensation for binding lipids of variable chain length. Additionally, using a mutant form of AmtB that abolishes a specific phosphatidylglycerol (PG) binding site, we observed distinct changes in the thermodynamic signatures for binding PG, implying these signatures can identify key residues involved in specific lipid binding and potentially differentiate between specific lipid binding sites.

Synergy of anti-CD40, CpG and MPL in activation of mouse macrophages

PubMed Central

Shi, Yongyu; Felder, Mildred A.R.; Sondel, Paul M.; Rakhmilevich, Alexander L.

2015-01-01

Activation of macrophages is a prerequisite for their antitumor effects. Several reagents, including agonistic anti-CD40 monoclonal antibody (anti-CD40), CpG oligodeoxynucleotides (CpG) and monophosphoryl lipid A (MPL), can stimulate activation of macrophages. Our previous studies showed synergy between anti-CD40 and CpG and between anti-CD40 and MPL in macrophage activation and antitumor efficacy in mice. In the present study, we asked whether there was synergy among these three reagents. The activation of adherent peritoneal exudate cells (PEC) obtained from mice injected with anti-CD40 and then treated with CpG and/or MPL in vitro was determined by their ability to suppress proliferation of tumor cells and to produce various cytokines and chemokines in vitro. Cell sorting and histology followed by functional testing showed that macrophages were the main cell population in PEC activated by CD40 ligation in vivo. A combination of anti-CD40, CpG or MPL activated PEC to suppress proliferation of B16 cells and produce nitric oxide far greater than the single reagents or any of the double combinations of these reagents. In addition, the combination of all three reagents activated PEC to secrete IL-12, IFN-γ and MCP-1 to a greater degree than any single reagent or any two combined reagents. These results demonstrate that macrophages can be synergistically activated by anti-CD40, CpG and MPL, suggesting that this novel combined approach might be further investigated as potential cancer therapy. PMID:25829245

Synergy of anti-CD40, CpG and MPL in activation of mouse macrophages.

PubMed

Shi, Yongyu; Felder, Mildred A R; Sondel, Paul M; Rakhmilevich, Alexander L

2015-08-01

Activation of macrophages is a prerequisite for their antitumor effects. Several reagents, including agonistic anti-CD40 monoclonal antibody (anti-CD40), CpG oligodeoxynucleotides (CpG) and monophosphoryl lipid A (MPL), can stimulate activation of macrophages. Our previous studies showed synergy between anti-CD40 and CpG and between anti-CD40 and MPL in macrophage activation and antitumor efficacy in mice. In the present study, we asked whether there was synergy among these three reagents. The activation of adherent peritoneal exudate cells (PEC) obtained from mice injected with anti-CD40 and then treated with CpG and/or MPL in vitro was determined by their ability to suppress proliferation of tumor cells and to produce various cytokines and chemokines in vitro. Cell sorting and histology followed by functional testing showed that macrophages were the main cell population in PEC activated by CD40 ligation in vivo. A combination of anti-CD40, CpG or MPL activated PEC to suppress proliferation of B16 cells and produce nitric oxide far greater than the single reagents or any of the double combinations of these reagents. In addition, the combination of all three reagents activated PEC to secrete IL-12, IFN-γ and MCP-1 to a greater degree than any single reagent or any two combined reagents. These results demonstrate that macrophages can be synergistically activated by anti-CD40, CpG and MPL, suggesting that this novel combined approach might be further investigated as potential cancer therapy. Copyright © 2015 Elsevier Ltd. All rights reserved.

Use of DNA from human stools to detect aberrant CpG island methylation of genes implicated in colorectal cancer.

PubMed

Belshaw, Nigel J; Elliott, Giles O; Williams, Elizabeth A; Bradburn, David M; Mills, Sarah J; Mathers, John C; Johnson, Ian T

2004-09-01

Hypermethylation of cytosine residues in the CpG islands of tumor suppressor genes is a key mechanism of colorectal carcinogenesis. Detection and quantification of CpG island methylation in human DNA isolated from stools might provide a novel strategy for the detection and investigation of colorectal neoplasia. To explore the feasibility of this approach, colorectal biopsies and fecal samples were obtained from 32 patients attending for colonoscopy or surgery, who were found to have adenomatous polyps, colorectal cancer, or no evidence of neoplasia. A further 18 fecal samples were obtained from healthy volunteers, with no bowel symptoms. Isolated DNA was modified with sodium bisulfite and analyzed by methylation-specific PCR and combined bisulfite restriction analysis for CpG island methylation of ESR1, MGMT, HPP1, p16(INK4a), APC, and MLH1. CpG island methylation was readily detectable in both mucosal and fecal DNA with methylation-specific PCR. Using combined bisulfite restriction analysis, it was established that, in volunteers from whom biopsies were available, the levels of methylation at two CpG sites within ESR1 assayed using fecal DNA were significantly correlated with methylation in DNA from colorectal mucosa. Thus, noninvasive techniques can be used to obtain quantitative information about the level of CpG island methylation in human colorectal mucosa. The methods described here could be applied to a much expanded range of genes and may be valuable both for screening purposes and to provide greater insight into the functional consequences of epigenetic changes in the colorectal mucosa of free-living individuals.

Proteome-wide Identification of Novel Ceramide-binding Proteins by Yeast Surface cDNA Display and Deep Sequencing.

PubMed

Bidlingmaier, Scott; Ha, Kevin; Lee, Nam-Kyung; Su, Yang; Liu, Bin

2016-04-01

Although the bioactive sphingolipid ceramide is an important cell signaling molecule, relatively few direct ceramide-interacting proteins are known. We used an approach combining yeast surface cDNA display and deep sequencing technology to identify novel proteins binding directly to ceramide. We identified 234 candidate ceramide-binding protein fragments and validated binding for 20. Most (17) bound selectively to ceramide, although a few (3) bound to other lipids as well. Several novel ceramide-binding domains were discovered, including the EF-hand calcium-binding motif, the heat shock chaperonin-binding motif STI1, the SCP2 sterol-binding domain, and the tetratricopeptide repeat region motif. Interestingly, four of the verified ceramide-binding proteins (HPCA, HPCAL1, NCS1, and VSNL1) and an additional three candidate ceramide-binding proteins (NCALD, HPCAL4, and KCNIP3) belong to the neuronal calcium sensor family of EF hand-containing proteins. We used mutagenesis to map the ceramide-binding site in HPCA and to create a mutant HPCA that does not bind to ceramide. We demonstrated selective binding to ceramide by mammalian cell-produced wild type but not mutant HPCA. Intriguingly, we also identified a fragment from prostaglandin D2synthase that binds preferentially to ceramide 1-phosphate. The wide variety of proteins and domains capable of binding to ceramide suggests that many of the signaling functions of ceramide may be regulated by direct binding to these proteins. Based on the deep sequencing data, we estimate that our yeast surface cDNA display library covers ∼60% of the human proteome and our selection/deep sequencing protocol can identify target-interacting protein fragments that are present at extremely low frequency in the starting library. Thus, the yeast surface cDNA display/deep sequencing approach is a rapid, comprehensive, and flexible method for the analysis of protein-ligand interactions, particularly for the study of non-protein ligands. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Marked enhancement of the immune response to BioThrax® (Anthrax Vaccine Adsorbed) by the TLR9 agonist CPG 7909 in healthy volunteers.

PubMed

Rynkiewicz, Dianna; Rathkopf, Melinda; Sim, Iain; Waytes, A Thomas; Hopkins, Robert J; Giri, Lallan; DeMuria, Deborah; Ransom, Janet; Quinn, James; Nabors, Gary S; Nielsen, Carl J

2011-08-26

Immunization with BioThrax(®) (Anthrax Vaccine Adsorbed) is a safe and effective means of preventing anthrax. Animal studies have demonstrated that the addition of CpG DNA adjuvants to BioThrax can markedly increase the immunogenicity of the vaccine, increasing both serum anti-protective antigen (PA) antibody and anthrax toxin-neutralizing antibody (TNA) concentrations. The immune response to CpG-adjuvanted BioThrax in animals was not only stronger, but was also more rapid and led to higher levels of protection in spore challenge models. The B-class CpG DNA adjuvant CPG 7909, a 24-base synthetic, single-strand oligodeoxynucleotide, was evaluated for its safety profile and adjuvant properties in a Phase 1 clinical trial. A double-blind study was performed in which 69 healthy subjects, age 18-45 years, were randomized to receive three doses of either: (1) BioThrax alone, (2) 1 mg of CPG 7909 alone or (3) BioThrax plus 1 mg of CPG 7909, all given intramuscularly on study days 0, 14 and 28. Subjects were monitored for IgG to PA by ELISA and for TNA titers through study day 56 and for safety through month 6. CPG 7909 increased the antibody response by 6-8-fold at peak, and accelerated the response by 3 weeks compared to the response seen in subjects vaccinated with BioThrax alone. No serious adverse events related to study agents were reported, and the combination was considered to be reasonably well tolerated. The marked acceleration and enhancement of the immune response seen by combining BioThrax and CPG 7909 offers the potential to shorten the course of immunization and reduce the time to protection, and may be particularly useful in the setting of post-exposure prophylaxis. Copyright © 2011 Elsevier Ltd. All rights reserved.

Maternal treatment with a high dose of CpG ODN during gestation alters fetal craniofacial and distal limb development in C57BL/6 mice.

PubMed

Prater, M Renee; Johnson, Victor J; Germolec, Dori R; Luster, Michael I; Holladay, Steven D

2006-01-16

Synthetic oligodeoxynucleotides (ODN) containing CpG motifs, characteristic of bacterial DNA, are currently being evaluated as vaccine adjuvants for inducing protective immunity. Recently, there is increasing pressure to vaccinate pregnant women against maternally transmitted diseases including AIDS and tetanus, as well as against potential bio-weapons such as anthrax. CpG vaccines are effective because they trigger transient increases in T(H)1 cytokine production. Recent literature suggests, however, that a shift toward a T(H)1 cytokine profile during pregnancy may increase the risk of fetal morphologic defects. On this basis, we hypothesized that exposure to CpG motifs during pregnancy could result in T(H)1 inflammation leading to adverse effects on fetal development. To address this hypothesis, pregnant C57BL/6 mice were injected with CpG ODN (0-300 microg/dam) and maternal and fetal outcomes were determined. Injection of dams with the highest dose of CpG ODN resulted in markedly increased fetal resorptions and craniofacial/limb defects, while lower doses had little, if any effects. Histological examination of placentas revealed cellular necrosis with mixed inflammation and calcification in the spongiotrophoblast layer and dysregulation of labyrinthine vascular development. Concomitant elevations in maternal serum cytokine levels were observed including interleukin (IL)-2, IL-10 and IL-12. Treatment with 300 microg of non-CpG ODN did not cause any adverse effects. The 300 microg dose of CpG ODN used in the present study is 30-fold higher than the highest dose that has been administered to humans during clinical trials. These results suggest that the induction of T(H)1 cytokines during pregnancy by CpG motifs may potentially increase the risk of fetal loss and morphologic defects in mice, at least at high doses, and support the need for further investigation of teratogenesis that may result from exposure to vaccine adjuvants designed to produce T(H)1 cytokine profile shifts.

Prognostication of patients with clear cell renal cell carcinomas based on quantification of DNA methylation levels of CpG island methylator phenotype marker genes.

PubMed

Tian, Ying; Arai, Eri; Gotoh, Masahiro; Komiyama, Motokiyo; Fujimoto, Hiroyuki; Kanai, Yae

2014-10-20

The CpG island methylator phenotype (CIMP) of clear cell renal cell carcinomas (ccRCCs) is characterized by accumulation of DNA methylation at CpG islands and poorer patient outcome. The aim of this study was to establish criteria for prognostication of patients with ccRCCs using the ccRCC-specific CIMP marker genes. DNA methylation levels at 299 CpG sites in the 14 CIMP marker genes were evaluated quantitatively in tissue specimens of 88 CIMP-negative and 14 CIMP-positive ccRCCs in a learning cohort using the MassARRAY system. An additional 100 ccRCCs were also analyzed as a validation cohort. Receiver operating characteristic curve analysis showed that area under the curve values for the 23 CpG units including the 32 CpG sites in the 7 CIMP-marker genes, i.e. FAM150A, ZNF540, ZNF671, ZNF154, PRAC, TRH and SLC13A5, for discrimination of CIMP-positive from CIMP-negative ccRCCs were larger than 0.95. Criteria combining the 23 CpG units discriminated CIMP-positive from CIMP-negative ccRCCs with 100% sensitivity and specificity in the learning cohort. Cancer-free and overall survival rates of patients with CIMP-positive ccRCCs diagnosed using the criteria combining the 23 CpG units in a validation cohort were significantly lower than those of patients with CIMP-negative ccRCCs (P = 1.41 × 10-5 and 2.43 × 10-13, respectively). Patients with CIMP-positive ccRCCs in the validation cohort had a higher likelihood of disease-related death (hazard ratio, 75.8; 95% confidence interval, 7.81 to 735; P = 1.89 × 10-4) than those with CIMP-negative ccRCCs. The established criteria are able to reproducibly diagnose CIMP-positive ccRCCs and may be useful for personalized medicine for patients with ccRCCs.

Parvovirus B19 DNA CpG Dinucleotide Methylation and Epigenetic Regulation of Viral Expression

PubMed Central

Bonvicini, Francesca; Manaresi, Elisabetta; Di Furio, Francesca; De Falco, Luisa; Gallinella, Giorgio

2012-01-01

CpG DNA methylation is one of the main epigenetic modifications playing a role in the control of gene expression. For DNA viruses whose genome has the ability to integrate in the host genome or to maintain as a latent episome, a correlation has been found between the extent of DNA methylation and viral quiescence. No information is available for Parvovirus B19, a human pathogenic virus, which is capable of both lytic and persistent infections. Within Parvovirus B19 genome, the inverted terminal regions display all the characteristic signatures of a genomic CpG island; therefore we hypothesised a role of CpG dinucleotide methylation in the regulation of viral genome expression. The analysis of CpG dinucleotide methylation of Parvovirus B19 DNA was carried out by an aptly designed quantitative real-time PCR assay on bisulfite-modified DNA. The effects of CpG methylation on the regulation of viral genome expression were first investigated by transfection of either unmethylated or in vitro methylated viral DNA in a model cell line, showing that methylation of viral DNA was correlated to lower expression levels of the viral genome. Then, in the course of in vitro infections in different cellular environments, it was observed that absence of viral expression and genome replication were both correlated to increasing levels of CpG methylation of viral DNA. Finally, the presence of CpG methylation was documented in viral DNA present in bioptic samples, indicating the occurrence and a possible role of this epigenetic modification in the course of natural infections. The presence of an epigenetic level of regulation of viral genome expression, possibly correlated to the silencing of the viral genome and contributing to the maintenance of the virus in tissues, can be relevant to the balance and outcome of the different types of infection associated to Parvovirus B19. PMID:22413013

[Determination of plasma protein binding rate of arctiin and arctigenin with ultrafiltration].

PubMed

Han, Xue-Ying; Wang, Wei; Tan, Ri-Qiu; Dou, De-Qiang

2013-02-01

To determine the plasma protein binding rate of arctiin and arctigenin. The ultrafiltration combined with HPLC was employed to determine the plasma protein binding rate of arctiin and arctigenin as well as rat plasma and healthy human plasma proteins. The plasma protein binding rate of arctiin with rat plasma at the concentrations of 64. 29, 32.14, 16.07 mg x L(-1) were (71.2 +/- 2.0)%, (73.4 +/- 0.61)%, (78.2 +/- 1.9)%, respectively; while the plasma protein binding rate of arctiin with healthy human plasma at the above concentrations were (64.8 +/- 3.1)%, (64.5 +/- 2.5)%, (77.5 +/- 1.7)%, respectively. The plasma protein binding rate of arctigenin with rat plasma at the concentrations of 77.42, 38.71, 19.36 mg x L(-1) were (96.7 +/- 0.41)%, (96.8 +/- 1.6)%, (97.3 +/- 0.46)%, respectively; while the plasma protein binding rate of arctigenin with normal human plasma at the above concentrations were (94.7 +/- 3.1)%, (96.8 +/- 1.6)%, (97.9 +/- 1.3)%, respectively. The binding rate of arctiin with rat plasma protein was moderate, which is slightly higher than the binding rate of arctiin with healthy human plasma protein. The plasma protein binding rates of arctigenin with both rat plasma and healthy human plasma are very high.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Caberoy, Nora B.; Zhou, Yixiong; Alvarado, Gabriela

To efficiently elucidate the biological roles of phosphatidylserine (PS), we developed open-reading-frame (ORF) phage display to identify PS-binding proteins. The procedure of phage panning was optimized with a phage clone expressing MFG-E8, a well-known PS-binding protein. Three rounds of phage panning with ORF phage display cDNA library resulted in {approx}300-fold enrichment in PS-binding activity. A total of 17 PS-binding phage clones were identified. Unlike phage display with conventional cDNA libraries, all 17 PS-binding clones were ORFs encoding 13 real proteins. Sequence analysis revealed that all identified PS-specific phage clones had dimeric basic amino acid residues. GST fusion proteins were expressedmore » for 3 PS-binding proteins and verified for their binding activity to PS liposomes, but not phosphatidylcholine liposomes. These results elucidated previously unknown PS-binding proteins and demonstrated that ORF phage display is a versatile technology capable of efficiently identifying binding proteins for non-protein molecules like PS.« less

Isolation and characterizations of oxalate-binding proteins in the kidney

DOE Office of Scientific and Technical Information (OSTI.GOV)

Roop-ngam, Piyachat; Chaiyarit, Sakdithep; Pongsakul, Nutkridta

Highlights: Black-Right-Pointing-Pointer The first large-scale characterizations of oxalate-binding kidney proteins. Black-Right-Pointing-Pointer The recently developed oxalate-conjugated EAH Sepharose 4B beads were applied. Black-Right-Pointing-Pointer 38 forms of 26 unique oxalate-binding kidney proteins were identified. Black-Right-Pointing-Pointer 25/26 (96%) of identified proteins had 'L-x(3,5)-R-x(2)-[AGILPV]' domain. -- Abstract: Oxalate-binding proteins are thought to serve as potential modulators of kidney stone formation. However, only few oxalate-binding proteins have been identified from previous studies. Our present study, therefore, aimed for large-scale identification of oxalate-binding proteins in porcine kidney using an oxalate-affinity column containing oxalate-conjugated EAH Sepharose 4B beads for purification followed by two-dimensional gel electrophoresis (2-DE) tomore » resolve the recovered proteins. Comparing with those obtained from the controlled column containing uncoupled EAH-Sepharose 4B (to subtract the background of non-specific bindings), a total of 38 protein spots were defined as oxalate-binding proteins. These protein spots were successfully identified by quadrupole time-of-flight mass spectrometry (MS) and/or tandem MS (MS/MS) as 26 unique proteins, including several nuclear proteins, mitochondrial proteins, oxidative stress regulatory proteins, metabolic enzymes and others. Identification of oxalate-binding domain using the PRATT tool revealed 'L-x(3,5)-R-x(2)-[AGILPV]' as a functional domain responsible for oxalate-binding in 25 of 26 (96%) unique identified proteins. We report herein, for the first time, large-scale identification and characterizations of oxalate-binding proteins in the kidney. The presence of positively charged arginine residue in the middle of this functional domain suggested its significance for binding to the negatively charged oxalate. These data will enhance future stone research, particularly on stone modulators.« less

Identification of body fluid-specific DNA methylation markers for use in forensic science.

PubMed

Park, Jong-Lyul; Kwon, Oh-Hyung; Kim, Jong Hwan; Yoo, Hyang-Sook; Lee, Han-Chul; Woo, Kwang-Man; Kim, Seon-Young; Lee, Seung-Hwan; Kim, Yong Sung

2014-11-01

DNA methylation, which occurs at the 5'-position of the cytosine in CpG dinucleotides, has great potential for forensic identification of body fluids, because tissue-specific patterns of DNA methylation have been demonstrated, and DNA is less prone to degradation than proteins or RNA. Previous studies have reported several body fluid-specific DNA methylation markers, but DNA methylation differences are sometimes low in saliva and vaginal secretions. Moreover, specific DNA methylation markers in four types of body fluids (blood, saliva, semen, and vaginal secretions) have not been investigated with genome-wide profiling. Here, we investigated novel DNA methylation markers for identification of body fluids for use in forensic science using the Illumina HumanMethylation 450K bead array, which contains over 450,000 CpG sites. Using methylome data from 16 samples of blood, saliva, semen, and vaginal secretions, we first selected 2986 hypermethylated or hypomethylated regions that were specific for each type of body fluid. We then selected eight CpG sites as novel, forensically relevant DNA methylation markers: cg06379435 and cg08792630 for blood, cg26107890 and cg20691722 for saliva, cg23521140 and cg17610929 for semen, and cg01774894 and cg14991487 for vaginal secretions. These eight selected markers were evaluated in 80 body fluid samples using pyrosequencing, and all showed high sensitivity and specificity for identification of the target body fluid. We suggest that these eight DNA methylation markers may be good candidates for developing an effective molecular assay for identification of body fluids in forensic science. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Inhalation of diesel exhaust and allergen alters human bronchial epithelium DNA methylation.

PubMed

Clifford, Rachel L; Jones, Meaghan J; MacIsaac, Julia L; McEwen, Lisa M; Goodman, Sarah J; Mostafavi, Sara; Kobor, Michael S; Carlsten, Chris

2017-01-01

Allergic disease affects 30% to 40% of the world's population, and its development is determined by the interplay between environmental and inherited factors. Air pollution, primarily consisting of diesel exhaust emissions, has increased at a similar rate to allergic disease. Exposure to diesel exhaust may play a role in the development and progression of allergic disease, in particular allergic respiratory disease. One potential mechanism underlying the connection between air pollution and increased allergic disease incidence is DNA methylation, an epigenetic process with the capacity to integrate gene-environment interactions. We sought to investigate the effect of allergen and diesel exhaust exposure on bronchial epithelial DNA methylation. We performed a randomized crossover-controlled exposure study to allergen and diesel exhaust in humans, and measured single-site (CpG) resolution global DNA methylation in bronchial epithelial cells. Exposure to allergen alone, diesel exhaust alone, or allergen and diesel exhaust together (coexposure) led to significant changes in 7 CpG sites at 48 hours. However, when the same lung was exposed to allergen and diesel exhaust but separated by approximately 4 weeks, significant changes in more than 500 sites were observed. Furthermore, sites of differential methylation differed depending on which exposure was experienced first. Functional analysis of differentially methylated CpG sites found genes involved in transcription factor activity, protein metabolism, cell adhesion, and vascular development, among others. These findings suggest that specific exposures can prime the lung for changes in DNA methylation induced by a subsequent insult. Copyright © 2016 American Academy of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

Obesity and menopause modify the epigenomic profile of breast cancer.

PubMed

Crujeiras, Ana B; Diaz-Lagares, Angel; Stefansson, Olafur A; Macias-Gonzalez, Manuel; Sandoval, Juan; Cueva, Juan; Lopez-Lopez, Rafael; Moran, Sebastian; Jonasson, Jon G; Tryggvadottir, Laufey; Olafsdottir, Elinborg; Tinahones, Francisco J; Carreira, Marcos C; Casanueva, Felipe F; Esteller, Manel

2017-07-01

Obesity is a high risk factor for breast cancer. This relationship could be marked by a specific methylome. The current work was aimed to explore the impact of obesity and menopausal status on variation in breast cancer methylomes. Data from Infinium 450K array-based methylomes of 64 breast tumors were coupled with information on BMI and menopausal status. Additionally, DNA methylation results were validated in 18 non-tumor and 81 tumor breast samples. Breast tumors arising in either pre- or postmenopausal women stratified by BMI or menopausal status alone were not associated with a specific DNA methylation pattern. Intriguingly, the DNA methylation pattern identified in association with the high-risk group (postmenopausal women with high BMI (>25) and premenopausal women with normal or low BMI < 25) exclusively characterized by hypermethylation of 1287 CpG sites as compared with the low-risk group. These CpG sites included the promoter region of fourteen protein-coding genes of which CpG methylation over the ZNF577 promoter region represents the top scoring associated event. In an independent cohort, the ZNF577 promoter methylation remained statistically significant in association with the high-risk group. Additionally, the impact of ZNF577 promoter methylation on mRNA expression levels was demonstrated in breast cancer cell lines after treatment with a demethylating agent (5-azacytidine). In conclusion, the epigenome of breast tumors is affected by a complex interaction between BMI and menopausal status. The ZNF577 methylation quantification is clearly relevant for the development of novel biomarkers of precision therapy in breast cancer. © 2017 Society for Endocrinology.

Structural Analysis of Semi-specific Oligosaccharide Recognition by a Cellulose-binding Protein of Thermotoga maritima Reveals Adaptations for Functional Diversification of the Oligopeptide Periplasmic Binding Protein Fold

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cuneo, Matthew J.; Beese, Lorena S.; Hellinga, Homme W.

Periplasmic binding proteins (PBPs) constitute a protein superfamily that binds a wide variety of ligands. In prokaryotes, PBPs function as receptors for ATP-binding cassette or tripartite ATP-independent transporters and chemotaxis systems. In many instances, PBPs bind their cognate ligands with exquisite specificity, distinguishing, for example, between sugar epimers or structurally similar anions. By contrast, oligopeptide-binding proteins bind their ligands through interactions with the peptide backbone but do not distinguish between different side chains. The extremophile Thermotoga maritima possesses a remarkable array of carbohydrate-processing metabolic systems, including the hydrolysis of cellulosic polymers. Here, we present the crystal structure of a T.more » maritima cellobiose-binding protein (tm0031) that is homologous to oligopeptide-binding proteins. T. maritima cellobiose-binding protein binds a variety of lengths of {beta}(1 {yields} 4)-linked glucose oligomers, ranging from two rings (cellobiose) to five (cellopentaose). The structure reveals that binding is semi-specific. The disaccharide at the nonreducing end binds specifically; the other rings are located in a large solvent-filled groove, where the reducing end makes several contacts with the protein, thereby imposing an upper limit of the oligosaccharides that are recognized. Semi-specific recognition, in which a molecular class rather than individual species is selected, provides an efficient solution for the uptake of complex mixtures.« less

SONAR Discovers RNA-Binding Proteins from Analysis of Large-Scale Protein-Protein Interactomes.

PubMed

Brannan, Kristopher W; Jin, Wenhao; Huelga, Stephanie C; Banks, Charles A S; Gilmore, Joshua M; Florens, Laurence; Washburn, Michael P; Van Nostrand, Eric L; Pratt, Gabriel A; Schwinn, Marie K; Daniels, Danette L; Yeo, Gene W

2016-10-20

RNA metabolism is controlled by an expanding, yet incomplete, catalog of RNA-binding proteins (RBPs), many of which lack characterized RNA binding domains. Approaches to expand the RBP repertoire to discover non-canonical RBPs are currently needed. Here, HaloTag fusion pull down of 12 nuclear and cytoplasmic RBPs followed by quantitative mass spectrometry (MS) demonstrates that proteins interacting with multiple RBPs in an RNA-dependent manner are enriched for RBPs. This motivated SONAR, a computational approach that predicts RNA binding activity by analyzing large-scale affinity precipitation-MS protein-protein interactomes. Without relying on sequence or structure information, SONAR identifies 1,923 human, 489 fly, and 745 yeast RBPs, including over 100 human candidate RBPs that contain zinc finger domains. Enhanced CLIP confirms RNA binding activity and identifies transcriptome-wide RNA binding sites for SONAR-predicted RBPs, revealing unexpected RNA binding activity for disease-relevant proteins and DNA binding proteins. Copyright © 2016 Elsevier Inc. All rights reserved.

Developmental regulation of collagenase-3 mRNA in normal, differentiating osteoblasts through the activator protein-1 and the runt domain binding sites

NASA Technical Reports Server (NTRS)

Winchester, S. K.; Selvamurugan, N.; D'Alonzo, R. C.; Partridge, N. C.

2000-01-01

Collagenase-3 mRNA is initially detectable when osteoblasts cease proliferation, increasing during differentiation and mineralization. We showed that this developmental expression is due to an increase in collagenase-3 gene transcription. Mutation of either the activator protein-1 or the runt domain binding site decreased collagenase-3 promoter activity, demonstrating that these sites are responsible for collagenase-3 gene transcription. The activator protein-1 and runt domain binding sites bind members of the activator protein-1 and core-binding factor family of transcription factors, respectively. We identified core-binding factor a1 binding to the runt domain binding site and JunD in addition to a Fos-related antigen binding to the activator protein-1 site. Overexpression of both c-Fos and c-Jun in osteoblasts or core-binding factor a1 increased collagenase-3 promoter activity. Furthermore, overexpression of c-Fos, c-Jun, and core-binding factor a1 synergistically increased collagenase-3 promoter activity. Mutation of either the activator protein-1 or the runt domain binding site resulted in the inability of c-Fos and c-Jun or core-binding factor a1 to increase collagenase-3 promoter activity, suggesting that there is cooperative interaction between the sites and the proteins. Overexpression of Fra-2 and JunD repressed core-binding factor a1-induced collagenase-3 promoter activity. Our results suggest that members of the activator protein-1 and core-binding factor families, binding to the activator protein-1 and runt domain binding sites are responsible for the developmental regulation of collagenase-3 gene expression in osteoblasts.

A CpG Oligonucleotide Can Protect Mice From a Low Aerosol Challenge Dose of Burkholderia mallei

DTIC Science & Technology

2006-03-01

may protect victims of a biological attack from glanders . Burkholderia mallei , the causative agent of glanders , natu- rally infects equines, but it can...attack from glanders . 15. SUBJECT TERMS Burkholderia mallei , glanders , oligonucleotides, CpG motif, efficacy, laboratory animals, mice 16...Society for Microbiology. All Rights Reserved. A CpG Oligonucleotide Can Protect Mice from a Low Aerosol Challenge Dose of Burkholderia mallei David M

[Similarity of cycloprolylglycine to piracetam in antihypoxic and neuroprotective effects].

PubMed

Kolisnikova, K N; Gudasheva, T A; Nazarova, G A; Antipov, T A; Voronina, T A; Seredenin, S B

2012-01-01

The antihypoxic activity of the endogenous cyclic dipeptide cycloprolylglycine (CPG) has been studied on a model of normobaric hypoxia with hypercapnia and its neuroprotective activity has been studied on a model of human neuroblastoma SH-SY5Y cell damage by 6-hydroxydopamine. It is established that CPG exhibits the antihypoxic activity at doses of 0.5 and 1.0 mg/kg (i.p.) on outbred and BALB/c mice, but not on C57B1/6 mice. The neuroprotective activity of CPG was detected in 10(-5) - 10(-8) M concentration range only when the treatment was carried out 24h before toxin introduction. The obtained data confirm the hypothesis that piracetam is a mimetic of the endogenous CPG neuropeptide.

CpG oligodeoxynucleotides containing GACGTT motifs enhance the immune responses elicited by a goose parvovirus vaccine in ducks.

PubMed

Lee, Jai-Wei; Lin, Yu-Ming; Yen, Ting-Ying; Yang, Wen-Jen; Chu, Chun-Yen

2010-11-23

Recombinant parvovirus VP2 (rVP2) was formulated with different types of adjuvant, including aluminum adjuvant and CpG oligodeoxynucleotides (ODNs), and the immunological responses after vaccination in ducks were examined. In comparison with the control group, production of rVP2-specific antibodies, expression of cytokines in peripheral blood mononuclear cells (PBMC) stimulated by rVP2, and percentage of CD4(+)/CD8(+) cells in PBMC were significantly increased in ducks immunized with rVP2 formulated with CpG ODNs containing 3 copies of GACGTT motif. CpG ODNs with GACGTT motifs might be used to improve the efficacy of vaccines for ducks. Copyright © 2010 Elsevier Ltd. All rights reserved.

Identification of AOSC-binding proteins in neurons

NASA Astrophysics Data System (ADS)

Liu, Ming; Nie, Qin; Xin, Xianliang; Geng, Meiyu

2008-11-01

Acidic oligosaccharide sugar chain (AOSC), a D-mannuronic acid oligosaccharide, derived from brown algae polysaccharide, has been completed Phase I clinical trial in China as an anti-Alzheimer’s Disease (AD) drug candidate. The identification of AOSC-binding protein(s) in neurons is very important for understanding its action mechanism. To determine the binding protein(s) of AOSC in neurons mediating its anti-AD activities, confocal microscopy, affinity chromatography, and liquid chromatography-tandem mass spectrometry (LC-MS/MS) analysis were used. Confocal microscopy analysis shows that AOSC binds to SH-SY5Y cells in concentration-, time-, and temperature-dependent fashions. The AOSC binding proteins were purified by affinity chromatography and identified by LC-MS/MS analysis. The results showed that there are 349 proteins binding AOSC, including clathrin, adaptor protein-2 (AP-2) and amyloid precursor protein (APP). These results suggest that the binding/entrance of AOSC to neurons is probably responsible for anti-AD activities.

Sexual epigenetic dimorphism in the human placenta: implications for susceptibility during the prenatal period.

PubMed

Martin, Elizabeth; Smeester, Lisa; Bommarito, Paige A; Grace, Matthew R; Boggess, Kim; Kuban, Karl; Karagas, Margaret R; Marsit, Carmen J; O'Shea, T Michael; Fry, Rebecca C

2017-03-01

Sex-based differences in response to adverse prenatal environments and infant outcomes have been observed, yet the underlying mechanisms for this are unclear. The placental epigenome may be a driver of these differences. Placental DNA methylation was assessed at more than 480,000 CpG sites from male and female infants enrolled in the extremely low gestational age newborns cohort (ELGAN) and validated in a separate US-based cohort. The impact of gestational age on placental DNA methylation was further examined using the New Hampshire Birth Cohort Study for a total of n = 467 placentas. A total of n = 2745 CpG sites, representing n = 587 genes, were identified as differentially methylated (p < 1 × 10 -7 ). The majority (n = 582 or 99%) of these were conserved among the New Hampshire Birth Cohort. The identified genes encode proteins related to immune function, growth/transcription factor signaling and transport across cell membranes. These data highlight sex-dependent epigenetic patterning in the placenta and provide insight into differences in infant outcomes and responses to the perinatal environment.

Human gingival fibroblasts express functional chemokine receptor CXCR6.

PubMed

Hosokawa, Y; Hosokawa, I; Ozaki, K; Nakae, H; Matsuo, T

2009-06-01

We have reported that CXCL16, a recently discovered transmembrane chemokine, is expressed in human gingival fibroblasts (HGF). However, it is not known whether HGF express CXCR6, the receptor for CXCL16, or CXCL16 affects HGF biology. We have shown that HGF expressed CXCR6 by reverse transcription-polymerase chain reaction and flow cytometric analysis. Moreover, we elucidated that tumour necrosis factor (TNF)-alpha and cytosine-guanine dinucleotide (CpG) DNA (Toll-like receptor-9 ligand) treatment enhanced CXCR6 expression by HGF. Interleukin (IL)-4, IL-13 and CpG DNA up-regulated CXCR6 expression by TNF-alpha-stimulated HGF. On the other hand, IL-1beta and interferon-gamma inhibited CXCR6 expression on TNF-alpha-treated HGF. CXCL16 treatment induced HGF proliferation and phosphorylation of extracellular regulated kinase (ERK) and protein kinase B (AKT) in HGF. In conclusion, HGF expressed CXCR6 functionally, because CXCL16 induced HGF proliferation and ERK and AKT phosphorylation in HGF. These results indicate that CXCL16 may play an important role in the pathogenesis and remodelling in periodontally diseased tissues.

Genetic and Epigenetic Inactivation of Kruppel-like Factor 4 in Medulloblastoma1

PubMed Central

Nakahara, Yukiko; Northcott, Paul A; Li, Meihua; Kongkham, Paul N; Smith, Christian; Yan, Hai; Croul, Sidney; Ra, Young-Shin; Eberhart, Charles; Huang, Annie; Bigner, Darell; Grajkowska, Wesia; Van Meter, Timothy; Rutka, James T; Taylor, Michael D

2010-01-01

Although medulloblastoma is the most common pediatric malignant brain tumor, its molecular underpinnings are largely unknown. We have identified rare, recurrent homozygous deletions of Kruppel-like Factor 4 (KLF4) in medulloblastoma using high-resolution single nucleotide polymorphism arrays, digital karyotyping, and genomic real-time polymerase chain reaction (PCR). Furthermore, we show that there is loss of physiological KLF4 expression in more than 40% of primary medulloblastomas both at the RNA and protein levels. Medulloblastoma cell lines drastically increase the expression of KLF4 in response to the demethylating agent 5-azacytidine and demonstrate dense methylation of the promoter CpG island by bisulfite sequencing. Methylation-specific PCR targeting the KLF4 promoter demonstrates CpG methylation in approximately 16% of primary medulloblastomas. Reexpression of KLF4 in the D283 medulloblastoma cell line results in significant growth suppression both in vitro and in vivo. We conclude that KLF4 is inactivated by either genetic or epigenetic mechanisms in a large subset of medulloblastomas and that it likely functions as a tumor suppressor gene in the pathogenesis of medulloblastoma. PMID:20072650

Prediction of Carbohydrate Binding Sites on Protein Surfaces with 3-Dimensional Probability Density Distributions of Interacting Atoms

PubMed Central

Tsai, Keng-Chang; Jian, Jhih-Wei; Yang, Ei-Wen; Hsu, Po-Chiang; Peng, Hung-Pin; Chen, Ching-Tai; Chen, Jun-Bo; Chang, Jeng-Yih; Hsu, Wen-Lian; Yang, An-Suei

2012-01-01

Non-covalent protein-carbohydrate interactions mediate molecular targeting in many biological processes. Prediction of non-covalent carbohydrate binding sites on protein surfaces not only provides insights into the functions of the query proteins; information on key carbohydrate-binding residues could suggest site-directed mutagenesis experiments, design therapeutics targeting carbohydrate-binding proteins, and provide guidance in engineering protein-carbohydrate interactions. In this work, we show that non-covalent carbohydrate binding sites on protein surfaces can be predicted with relatively high accuracy when the query protein structures are known. The prediction capabilities were based on a novel encoding scheme of the three-dimensional probability density maps describing the distributions of 36 non-covalent interacting atom types around protein surfaces. One machine learning model was trained for each of the 30 protein atom types. The machine learning algorithms predicted tentative carbohydrate binding sites on query proteins by recognizing the characteristic interacting atom distribution patterns specific for carbohydrate binding sites from known protein structures. The prediction results for all protein atom types were integrated into surface patches as tentative carbohydrate binding sites based on normalized prediction confidence level. The prediction capabilities of the predictors were benchmarked by a 10-fold cross validation on 497 non-redundant proteins with known carbohydrate binding sites. The predictors were further tested on an independent test set with 108 proteins. The residue-based Matthews correlation coefficient (MCC) for the independent test was 0.45, with prediction precision and sensitivity (or recall) of 0.45 and 0.49 respectively. In addition, 111 unbound carbohydrate-binding protein structures for which the structures were determined in the absence of the carbohydrate ligands were predicted with the trained predictors. The overall prediction MCC was 0.49. Independent tests on anti-carbohydrate antibodies showed that the carbohydrate antigen binding sites were predicted with comparable accuracy. These results demonstrate that the predictors are among the best in carbohydrate binding site predictions to date. PMID:22848404

Reversal of Estrogen Receptor Beta Epigenetic Gene Silencing in Prostatic Adenocarcinoma by Soy Protein-Derived Isoflavonoid Supplementation

DTIC Science & Technology

2009-06-01

et al. Ethnic group-related differences in CpG hypermethylation of the GSTP1 gene promoter among African-American, Caucasian and Asian patients...methylation of multiple genes in carcinogenesis of the prostate. Int J Cancer 106, 382-7 (2003). 127. Jeronimo, C. et al. Quantitation of GSTP1 ...Quantitative GSTP1 hypermethylation in bodily fluids of patients with prostate cancer. Urology 60, 1131-5 (2002). 129. Tokumaru, Y. et al. Optimal

Patterns of DNA Methylation Across the Leptin Core Promoter in Four Diverse Asian and North American Populations.

PubMed

Mosher, M J; Melton, P E; Stapleton, P; Schanfield, M S; Crawford, M H

2016-04-01

DNA methylation is the most widely studied of epigenetic mechanisms, with environmental effects recorded through patterned attachments of methyl groups along the DNA that are capable of modifying gene expression without altering the DNA sequencing. The degree to which these patterns of DNA methylation are heritable, the expected range of normality across populations, and the phenotypic relevance of pattern variation remain unclear. Genes regulating metabolic pathways appear to be vulnerable to ongoing nutritional programming over the life course, as dietary nutrients are significant environmental determinants of DNA methylation, supplying both the methyl groups and energy to generate the methylation process. Here we examine methylation patterns along a region of the metabolic gene leptin (LEP). LEP's putative functions include regulation of energy homeostasis, with its signals affecting energy intake and expenditure, adipogenesis and energy storage, lipid and glucose metabolism, bone metabolism, and reproductive endocrine function. A pattern of differential methylation across CpG sites of the LEP core promoter has been previously identified; however, any consistency of pattern or its phenotypic significance is not fully elucidated among populations. Using DNA extracted from unfractionated white blood cells of peripheral blood samples, our pilot study, divided into two parts, examined the significance of variation in DNA methylation patterns along the leptin core promoter in four populations (phase 1) and used biomarkers reflecting leptin's functional process in two of those populations, western Buryat of Siberia and the Mennonite of central Kansas, to investigate the relevance of the ethnic variation identified in the DNA methylation (phase 2). LEP's core promoter region contains both the binding site for C/EBPα (CCAAT/enhancer binding protein alpha), which tempers the final step in adipocyte maturity and capacity to synthesize leptin, and the TATA motif controlling leptin synthesis. Previous studies report that increased methylation in this region is correlated to decreased gene expression, suggesting tissue-specific methylation variation at this region ( Melzner et al. 2002 ). We hypothesized that evidence of nutritional epigenetic programming would be identified through variation in patterns of DNA methylation and that functional relevance of that variation among populations would be identified through biomarkers that reflect leptin's metabolic signals: serum leptin levels, lipoproteins of the lipid transport system, and anthropometric measures. In phase 1, our combined analyses of 313 individuals documented a distinct and consistent overall pattern of differential DNA methylation across seven CpG sites of LEP core promoter in all ethnicities and both sexes. This pattern replicates those identified in previous studies, suggesting a conserved core promoter region across populations. Phase 2 analyses of two of the four populations (n = 239), correlating methylation at the C/EBPα transcription binding site (TBS) with metabolic and anthropometric biomarkers reflecting LEP roles, showed that stature, which reflects bone growth and remodeling, was significantly and inversely correlated with the percentage of DNA methylation at this site in both sexes. We suggest that variation in DNA methylation along the LEP core promoter plays a substantial role in energy signals affecting both adipogenesis and bone metabolism.

Exploring DNA-binding Proteins with In Vivo Chemical Cross-linking and Mass Spectrometry

PubMed Central

Qiu, Haibo; Wang, Yinsheng

2009-01-01

DNA-binding proteins are very important constituents of proteomes of all species and play crucial roles in transcription, DNA replication, recombination, repair and other activities associated with DNA. Although a number of DNA-binding proteins have been identified, many proteins involved in gene regulation and DNA repair are likely still unknown because of their dynamic and/or weak interactions with DNA. In this report, we described an approach for the comprehensive identification of DNA-binding proteins with in vivo formaldehyde cross-linking and LC-MS/MS. DNA-binding proteins could be purified via the isolation of DNA-protein complexes and released from the complexes by reversing the cross-linking. By using this method, we were able to identify more than one hundred DNA-binding proteins, such as proteins involved in transcription, gene regulation, DNA replication and repair, and a large number of proteins which are potentially associated with DNA and DNA-binding proteins. This method should be generally applicable to the investigation of other nucleic acid-binding proteins, and hold great potential in the comprehensive study of gene regulation, DNA damage response and repair, as well as many other critical biological processes at proteomic level. PMID:19714816

Adrenocortical nuclear progesterone-binding protein: Identification by photoaffinity labeling and evidence for deoxyribonucleic acid binding and stimulation by adrenocorticotropin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Demura, T.; Driscoll, W.J.; Lee, Y.C.

1991-01-01

Nuclei of the guinea pig adrenal cortex contain a protein that specifically binds progesterone and that, biochemically, is clearly distinct from the classical progesterone receptor. The adrenocortical nuclear progesterone-binding protein has now been purified more than 2000-fold by steroid-affinity chromatography with a 75% yield. The purified protein preparation demonstrated three major bands on sodium dodecyl sulfate-polyacrylamide gel of 79K, 74K, and 50K. To determine which of the three might represent the progesterone-binding protein, steroid photoaffinity labeling was performed which resulted in the specific and exclusive labeling of a 50K band. Thus, the adrenocortical nuclear progesterone-binding protein appears to be distinctmore » from the classical progesterone receptor not only biochemically, but also on the basis of molecular size. To test whether the adrenocortical nuclear progesterone-binding protein can be hormonally stimulated, guinea pigs were treated with ACTH. The chronic administration of ACTH caused a 4- to 6-fold increase in the specific progesterone binding capacity without a change in the binding affinity. There appeared to be no significant difference in nuclear progesterone binding between the zona fasciculata and zona reticularis. This finding suggests a mediating role for the progesterone-binding protein in ACTH action. In addition, the nuclear progesterone-binding protein bound to nonspecific DNA sequences, further suggesting a possible transcriptional regulatory role.« less

Fibroblast growth factor regulates insulin-like growth factor-binding protein production by vascular smooth muscle cells.

PubMed

Ververis, J; Ku, L; Delafontaine, P

1994-02-01

Insulin-like growth factor I is an important mitogen for vascular smooth muscle cells, and its effects are regulated by several binding proteins. Western ligand blotting of conditioned medium from rat aortic smooth muscle cells detected a 24 kDa binding protein and a 28 kDa glycosylated variant of this protein, consistent with insulin-like growth factor binding protein-4 by size. Low amounts of a glycosylated 38 to 42 kDa doublet (consistent with binding protein-3) and a 31 kDa non-glycosylated protein also were present. Basic fibroblast growth factor markedly increased secretion of the 24 kDa binding protein and its 28 kDa glycosylated variant. This effect was dose- and time-dependent and was inhibited by co-incubation with cycloheximide. Crosslinking of [125I]-insulin-like growth factor I to cell monolayers revealed no surface-associated binding proteins, either basally or after agonist treatment. Induction of binding protein production by fibroblast growth factor at sites of vascular injury may be important in vascular proliferative responses in vivo.

Specificity in substrate binding by protein folding catalysts: tyrosine and tryptophan residues are the recognition motifs for the binding of peptides to the pancreas-specific protein disulfide isomerase PDIp.

PubMed Central

Ruddock, L. W.; Freedman, R. B.; Klappa, P.

2000-01-01

Using a cross-linking approach, we recently demonstrated that radiolabeled peptides or misfolded proteins specifically interact in vitro with two luminal proteins in crude extracts from pancreas microsomes. The proteins were the folding catalysts protein disulfide isomerase (PDI) and PDIp, a glycosylated, PDI-related protein, expressed exclusively in the pancreas. In this study, we explore the specificity of these proteins in binding peptides and related ligands and show that tyrosine and tryptophan residues in peptides are the recognition motifs for their binding by PDIp. This peptide-binding specificity may reflect the selectivity of PDIp in binding regions of unfolded polypeptide during catalysis of protein folding. PMID:10794419

Dominant Alcohol-Protein Interaction via Hydration-Enabled Enthalpy-Driven Binding Mechanism

PubMed Central

Chong, Yuan; Kleinhammes, Alfred; Tang, Pei; Xu, Yan; Wu, Yue

2015-01-01

Water plays an important role in weak associations of small drug molecules with proteins. Intense focus has been on binding-induced structural changes in the water network surrounding protein binding sites, especially their contributions to binding thermodynamics. However, water is also tightly coupled to protein conformations and dynamics, and so far little is known about the influence of water-protein interactions on ligand binding. Alcohols are a type of low-affinity drugs, and it remains unclear how water affects alcohol-protein interactions. Here, we present alcohol adsorption isotherms under controlled protein hydration using in-situ NMR detection. As functions of hydration level, Gibbs free energy, enthalpy, and entropy of binding were determined from the temperature dependence of isotherms. Two types of alcohol binding were found. The dominant type is low-affinity nonspecific binding, which is strongly dependent on temperature and the level of hydration. At low hydration levels, this nonspecific binding only occurs above a threshold of alcohol vapor pressure. An increased hydration level reduces this threshold, with it finally disappearing at a hydration level of h~0.2 (g water/g protein), gradually shifting alcohol binding from an entropy-driven to an enthalpy-driven process. Water at charged and polar groups on the protein surface was found to be particularly important in enabling this binding. Although further increase in hydration has smaller effects on the changes of binding enthalpy and entropy, it results in significant negative change in Gibbs free energy due to unmatched enthalpy-entropy compensation. These results show the crucial role of water-protein interplay in alcohol binding. PMID:25856773

Factor H binds to the hypervariable region of many Streptococcus pyogenes M proteins but does not promote phagocytosis resistance or acute virulence.

PubMed

Gustafsson, Mattias C U; Lannergård, Jonas; Nilsson, O Rickard; Kristensen, Bodil M; Olsen, John E; Harris, Claire L; Ufret-Vincenty, Rafael L; Stålhammar-Carlemalm, Margaretha; Lindahl, Gunnar

2013-01-01

Many pathogens express a surface protein that binds the human complement regulator factor H (FH), as first described for Streptococcus pyogenes and the antiphagocytic M6 protein. It is commonly assumed that FH recruited to an M protein enhances virulence by protecting the bacteria against complement deposition and phagocytosis, but the role of FH-binding in S. pyogenes pathogenesis has remained unclear and controversial. Here, we studied seven purified M proteins for ability to bind FH and found that FH binds to the M5, M6 and M18 proteins but not the M1, M3, M4 and M22 proteins. Extensive immunochemical analysis indicated that FH binds solely to the hypervariable region (HVR) of an M protein, suggesting that selection has favored the ability of certain HVRs to bind FH. These FH-binding HVRs could be studied as isolated polypeptides that retain ability to bind FH, implying that an FH-binding HVR represents a distinct ligand-binding domain. The isolated HVRs specifically interacted with FH among all human serum proteins, interacted with the same region in FH and showed species specificity, but exhibited little or no antigenic cross-reactivity. Although these findings suggested that FH recruited to an M protein promotes virulence, studies in transgenic mice did not demonstrate a role for bound FH during acute infection. Moreover, phagocytosis tests indicated that ability to bind FH is neither sufficient nor necessary for S. pyogenes to resist killing in whole human blood. While these data shed new light on the HVR of M proteins, they suggest that FH-binding may affect S. pyogenes virulence by mechanisms not assessed in currently used model systems.

Factor H Binds to the Hypervariable Region of Many Streptococcus pyogenes M Proteins but Does Not Promote Phagocytosis Resistance or Acute Virulence

PubMed Central

Kristensen, Bodil M.; Olsen, John E.; Harris, Claire L.; Ufret-Vincenty, Rafael L.; Stålhammar-Carlemalm, Margaretha; Lindahl, Gunnar

2013-01-01

Many pathogens express a surface protein that binds the human complement regulator factor H (FH), as first described for Streptococcus pyogenes and the antiphagocytic M6 protein. It is commonly assumed that FH recruited to an M protein enhances virulence by protecting the bacteria against complement deposition and phagocytosis, but the role of FH-binding in S. pyogenes pathogenesis has remained unclear and controversial. Here, we studied seven purified M proteins for ability to bind FH and found that FH binds to the M5, M6 and M18 proteins but not the M1, M3, M4 and M22 proteins. Extensive immunochemical analysis indicated that FH binds solely to the hypervariable region (HVR) of an M protein, suggesting that selection has favored the ability of certain HVRs to bind FH. These FH-binding HVRs could be studied as isolated polypeptides that retain ability to bind FH, implying that an FH-binding HVR represents a distinct ligand-binding domain. The isolated HVRs specifically interacted with FH among all human serum proteins, interacted with the same region in FH and showed species specificity, but exhibited little or no antigenic cross-reactivity. Although these findings suggested that FH recruited to an M protein promotes virulence, studies in transgenic mice did not demonstrate a role for bound FH during acute infection. Moreover, phagocytosis tests indicated that ability to bind FH is neither sufficient nor necessary for S. pyogenes to resist killing in whole human blood. While these data shed new light on the HVR of M proteins, they suggest that FH-binding may affect S. pyogenes virulence by mechanisms not assessed in currently used model systems. PMID:23637608

Combined study of genetic and epigenetic biomarker risperidone treatment efficacy in Chinese Han schizophrenia patients

PubMed Central

Shi, Y; Li, M; Song, C; Xu, Q; Huo, R; Shen, L; Xing, Q; Cui, D; Li, W; Zhao, J; He, L; Qin, S

2017-01-01

Nowadays, risperidone is an atypical antipsychotic drug that has been increasingly used for treatment and maintenance therapy in schizophrenia. However, partially affected by genetic or environmental factors, there is significant difference in treatment outcomes among patients. In this study, we aimed to interpret the difference between good and poor responders treated with risperidone in both genetic and epigenetic levels in 288 mainland Chinese patients. We recruited a Henan cohort including 98 patients as initial discovery group and then confirmed our results in Shanghai cohort. In genetic studies, we found 10 candidate single-nucleotide polymorphisms (SNPs) and 2 rare variants in Henan cohort by next-generation sequencing of 100 risperidone-response-related genes. After replication in Shanghai cohort by massarray platform, ultimately, rs6706232 and rs4818 were significantly associated with risperidone response in the two cohort meta-analysis (P=0.024 and 0.04, respectively). Besides, we also selected another reported 17 candidate SNPs associated with risperidone drug response to replicate in our mainland Chinese samples, while, we found no significant SNPs after Bonferroni correction. In epigenetic studies, we investigated the methylation status in promoters or gene-coding region of risperidone drug response-related genes including CYP3A4, CYP2D6, ABCB1, HTR2A, DRD2. Totally we found seven significant CpG sites in the meta-analysis with Bonferroni-corrected PCYP3A4_CpG_-36=0.0014, PCYP3A4_CpG_-258=0.0013, PCYP3A4_CpG_-296=0.0014, PCYP3A4_CpG_-367:-372:-374=0.028, PCYP2D6_CpG_193=0.012, PCYP2D6_CpG_242:244:250=0.00076 and PCYP2D6_CpG_284=0.034, respectively. As genetic and epigenetic factors may interactively affect drug response, we finally carried out a multivariant interaction analysis with multifactor dimensionality reduction and discovered a significant four-locus model (CYP3A4_CpG_-82:-86 +rs6280+rs1800497+rs6265, P=0.038) affecting drug response. These findings could partially explain different risperidone response outcome in Chinese population in a systematic level. PMID:28696411

Mechanistic insights into induction of vitellogenin gene expression by estrogens in Sydney rock oysters, Saccostrea glomerata.

PubMed

Tran, Thi Kim Anh; MacFarlane, Geoff R; Kong, Richard Yuen Chong; O'Connor, Wayne A; Yu, Richard Man Kit

2016-05-01

Marine molluscs, such as oysters, respond to estrogenic compounds with the induction of the egg yolk protein precursor, vitellogenin (Vtg), availing a biomarker for estrogenic pollution. Despite this application, the precise molecular mechanism through which estrogens exert their action to induce molluscan vitellogenesis is unknown. As a first step to address this question, we cloned a gene encoding Vtg from the Sydney rock oyster Saccostrea glomerata (sgVtg). Using primers designed from a partial sgVtg cDNA sequence available in Genbank, a full-length sgVtg cDNA of 8498bp was obtained by 5'- and 3'-RACE. The open reading frame (ORF) of sgVtg was determined to be 7980bp, which is substantially longer than the orthologs of other oyster species. Its deduced protein sequence shares the highest homology at the N- and C-terminal regions with other molluscan Vtgs. The full-length genomic DNA sequence of sgVtg was obtained by genomic PCR and genome walking targeting the gene body and flanking regions, respectively. The genomic sequence spans 20kb and consists of 30 exons and 29 introns. Computer analysis identified three closely spaced half-estrogen responsive elements (EREs) in the promoter region and a 210-bp CpG island 62bp downstream of the transcription start site. Upregulation of sgVtg mRNA expression was observed in the ovaries following in vitro (explants) and in vivo (tank) exposure to 17β-estradiol (E2). Notably, treatment with an estrogen receptor (ER) antagonist in vitro abolished the upregulation, suggesting a requirement for an estrogen-dependent receptor for transcriptional activation. DNA methylation of the 5' CpG island was analysed using bisulfite genomic sequencing of the in vivo exposed ovaries. The CpG island was found to be hypomethylated (with 0-3% methylcytosines) in both control and E2-exposed oysters. However, no significant differential methylation or any correlation between methylation and sgVtg expression levels was observed. Overall, the results support the possible involvement of an ERE-containing promoter and an estrogen-activated receptor in estrogen signalling in marine molluscs. Copyright © 2016 Elsevier B.V. All rights reserved.

[Glutamate-binding membrane proteins from human platelets].

PubMed

Gurevich, V S; Popov, Iu G; Gorodinskiĭ, A I; Dambinova, S A

1991-09-01

Solubilization of the total membrane fraction of human platelets in a 2% solution of sodium deoxycholate and subsequent affinity chromatography on glutamate agarose resulted in two protein fractions possessing a glutamate-binding activity. As can be evidenced from radioligand binding data, the first fraction contains two types of binding sites (Kd1 = 1 microM, Bmax 1 = 100 pmol/mg of protein; Kd2 = 9.3 microMm Bmax2 = 395 pmol/mg of protein). The second fraction has only one type of binding sites (Kd = 1 microM, Bmax = = 110 pmol/mg of protein). SDS-PAAG electrophoresis revealed the presence in the first fraction of proteins with Mr of 14, 24, 56 and 155 kDa, whereas the second fraction was found to contain 14, 46, 71 and 155 kDa proteins. Solid phase immunoenzymatic analysis using poly- and monoclonal specific antibodies against mammalian brain glutamate-binding proteins revealed a marked immunochemical similarity of the isolated protein fractions with human brain synaptic membrane glutamate-binding proteins.

Improvement of the Immunogenicity of Porcine Circovirus Type 2 DNA Vaccine by Recombinant ORF2 Gene and CpG Motifs.

PubMed

Li, Jun; Shi, Jian-Li; Wu, Xiao-Yan; Fu, Fang; Yu, Jiang; Yuan, Xiao-Yuan; Peng, Zhe; Cong, Xiao-Yan; Xu, Shao-Jian; Sun, Wen-Bo; Cheng, Kai-Hui; Du, Yi-Jun; Wu, Jia-Qiang; Wang, Jin-Bao; Huang, Bao-Hua

2015-06-01

Nowadays, adjuvant is still important for boosting immunity and improving resistance in animals. In order to boost the immunity of porcine circovirus type 2 (PCV2) DNA vaccine, CpG motifs were inserted. In this study, the dose-effect was studied, and the immunity of PCV2 DNA vaccines by recombinant open reading frame 2 (ORF2) gene and CpG motifs was evaluated. Three-week-old Changbai piglets were inoculated intramuscularly with 200 μg, 400 μg, and 800 μg DNA vaccines containing 14 and 18 CpG motifs, respectively. Average gain and rectum temperature were recorded everyday during the experiments. Blood was collected from the piglets after vaccination to detect the changes of specific antibodies, interleukin-2, and immune cells every week. Tissues were collected for histopathology and polymerase chain reaction. The results indicated that compared to those of the control piglets, all concentrations of two DNA vaccines could induce PCV2-specific antibodies. A cellular immunity test showed that PCV2-specific lymphocytes proliferated the number of TH, TC, and CD3+ positive T-cells raised in the blood of DNA vaccine immune groups. There was no distinct pathological damage and viremia occurring in pigs that were inoculated with DNA vaccines, but there was some minor pathological damage in the control group. The results demonstrated that CpG motifs as an adjuvant could boost the humoral and cellular immunity of pigs to PCV2, especially in terms of cellular immunity. Comparing two DNA vaccines that were constructed, the one containing 18 CpG motifs was more effective. This is the first report that CpG motifs as an adjuvant insert to the PCV2 DNA vaccine could boost immunity.

Potential for diagnosis versus therapy monitoring of attention deficit hyperactivity disorder: a new epigenetic biomarker interacting with both genotype and auto-immunity.

PubMed

Adriani, Walter; Romano, Emilia; Pucci, Mariangela; Pascale, Esterina; Cerniglia, Luca; Cimino, Silvia; Tambelli, Renata; Curatolo, Paolo; Granstrem, Oleg; Maccarrone, Mauro; Laviola, Giovanni; D'Addario, Claudio

2018-02-01

In view of the need for easily accessible biomarkers, we evaluated in ADHD children the epigenetic status of the 5'-untranslated region (UTR) in the SLC6A3 gene, coding for human dopamine transporter (DAT). We analysed buccal swabs and sera from 30 children who met DSM-IV-TR criteria for ADHD, assigned to treatment according to severity. Methylation levels at six-selected CpG sites (among which, a CGGCGGCGG and a CGCG motif), alone or in combination with serum titers in auto-antibodies against dopamine transporter (DAT aAbs), were analysed for correlation with CGAS scores (by clinicians) and Conners' scales (by parents), collected at recruitment and after 6 weeks. In addition, we characterized the DAT genotype, i.e., the variable number tandem repeat (VNTR) polymorphisms at the 3'-UTR of the gene. DAT methylation levels were greatly reduced in ADHD patients compared to control, healthy children. Within patients carrying at least one DAT 9 allele (DAT 9/x), methylation at positions CpG2 and/or CpG6 correlated with recovery, as evident from delta-CGAS scores as well as delta Conners' scales ('inattentive' and 'hyperactive' subscales). Moreover, hypermethylation at CpG1 position denoted severity, specifically for those patients carrying a DAT 10/10 genotype. Intriguingly, high serum DAT-aAbs titers appeared to corroborate indications from high CpG1 versus high CpG2/CpG6 levels, likewise denoting severity versus recovery in DAT 10/10 versus 9/x patients, respectively. These profiles suggest that DAT 5'UTR epigenetics plus serum aAbs can serve as suitable biomarkers, to confirm ADHD diagnosis and/or to predict the efficacy of treatment.

Perception, attitude, and satisfaction of paediatric physicians and nurses towards clinical practice guidelines at a university teaching hospital.

PubMed

Amer, Yasser Sami; Al Nemri, Abdulrahman; Osman, Mohamed Elfaki; Saeed, Elshazaly; Assiri, Asaad Mohamed; Mohamed, Sarar

2018-04-03

To explore perception, attitude, and satisfaction of paediatric clinicians, trainees, and nurses at King Khalid University Hospital towards clinical practice guidelines (CPGs) including the locally adapted diabetic ketoacidosis CPG (DKA-CPG). A cross-sectional survey was distributed to 260 doctors and nurses working in the paediatrics department. The response rate was 95.4%. The respondents had a positive perception and attitude towards general CPGs and specifically for the DKA-CPG; 98.7% thought CPGs were useful sources of advice, improved safety, and decreased risk, and reduced variation in practice. A total of 99.2% thought CPGs were good clinical tools, 98.3% satisfied with, had confidence in well-developed CPGs, and would recommend them to their colleagues to use, and 94.6% agreed they were cost-effective. The preferred format for CPGs was paper (46.6%) and electronic (42.9%). The DKA-CPG helped in managing patients and respondents were all satisfied and had confidence with it (100%). The rationale and objectives of the DKA-CPG were clear for 99.25%; 98.5% thought the layout was clear and well organized and user-friendly (96.2%). Compared with nurses, physicians had a higher perception towards CPGs in general (P < .05) and the DKA-CPG (P < .05). The paediatric doctors, and nurses have a great perception and satisfaction and positive attitude towards CPGs in general, towards the paediatric diabetic ketoacidosis CPG in particular, which in turn had a positive impact on the acceptability and implementation of the CPGs. These findings could help in sustaining a safe and high-quality health care environment through implementation of evidence-based CPGs. © 2018 John Wiley & Sons, Ltd.

CpG island methylator phenotype-low (CIMP-low) colorectal cancer shows not only few methylated CIMP-high-specific CpG islands, but also low-level methylation at individual loci.

PubMed

Kawasaki, Takako; Ohnishi, Mutsuko; Nosho, Katsuhiko; Suemoto, Yuko; Kirkner, Gregory J; Meyerhardt, Jeffrey A; Fuchs, Charles S; Ogino, Shuji

2008-03-01

The CpG island methylator phenotype (CIMP or CIMP-high) with widespread promoter methylation is a distinct phenotype in colorectal cancer. However, the concept of CIMP-low with less extensive CpG island methylation is still evolving. Our aim is to examine whether density of methylation in individual CpG islands was different between CIMP-low and CIMP-high tumors. Utilizing MethyLight technology and 889 population-based colorectal cancers, we quantified DNA methylation (methylation index, percentage of methylated reference) at 14 CpG islands, including 8 CIMP-high-specific loci (CACNA1G, CDKN2A (p16), CRABP1, IGF2, MLH1, NEUROG1, RUNX3 and SOCS1). Methylation positivity in each locus was defined as methylation index>4. Low-level methylation (methylation index>0, <20) in each CIMP-high-specific locus was significantly more common in 340 CIMP-low tumors (1/8-5/8 methylation-positive loci) than 133 CIMP-high tumors (> or =6/8 methylation-positive loci) and 416 CIMP-0 tumors (0/8 methylation-positive loci) (P< or =0.002). In the other six loci (CHFR, HIC1, IGFBP3, MGMT, MINT31 and WRN), which were not highly specific for CIMP-high, low-level methylation, was not persistently more prevalent in CIMP-low tumors. In conclusion, compared to CIMP-high and CIMP-0 tumors, CIMP-low colorectal cancers show not only few methylated CIMP-high-specific CpG islands, but also more frequent low-level methylation at individual loci. Our data may provide supporting evidence for a difference in pathogenesis of DNA methylation between CIMP-low and CIMP-high tumors.

[Comparative analysis of methylation profiles in tissues of oral leukoplakia and oral squamous cell carcinoma].

PubMed

Fu, J; Su, Y; Liu, Y; Zhang, X Y

2018-04-09

Objective: To compare the methylation profiles in tissues of oral leukoplakia (OLK) and oral squamous cell carcinoma (OSCC) with healthy tissues of oral mucosa, in order to identify the role of DNA methylation played in tumorigenesis. Methods: DNA samples extracted from tissues of 4 healthy oral mucosa, 4 OSCC and 4 OLK collected from patients of the Department of Oral Medicine, Capital Medical University School of Stomatology were examined and compared using Methylation 450 Bead Chip. The genes associated with differentially methylated CpG sites were selected for gene ontology (GO) analysis and Kyoto encyclopedia of genes and genomes (KEGG) pathway enrichment. Results: Multiple differentially methylated CpG sites were identified by using the above mentioned assay. Hypermethylation constitutes 86.18% (23 290/27 025) of methylation changes in OLK and hypomethylation accounts for 13.82% (3 734/27 025) of methylation changes. Both hypermethylated and hypomethylated CpG sites were markedly increased in OSCC tissue compared with OLK tissue. The majority of differentially methylated CpG sites were located outside CpG islands, with approximately one-fourth in CpG shores flanking the islands, which were considered highly important for gene regulation and tumorigenesis. Pathway analysis revealed that differentially methylated CpG sites in both OLK and OSCC patients shared the same pathway enrichments, most of which were correlated with carcinogenesis and cancer progression (e.g., DNA repair, cell cycle, and apoptosis). Conclusions: In the present study, methylation-associated alterations affect almost all pathways in the cellular network in both OLK and OSCC. OLK and OSCC shared similar methylation changes whether in pathways or genes, indicating that epigenetically they might have the same molecular basis for disease progression.

Stress-induced gene expression and behavior are controlled by DNA methylation and methyl donor availability in the dentate gyrus

PubMed Central

Saunderson, Emily A.; Spiers, Helen; Gutierrez-Mecinas, Maria; Trollope, Alexandra F.; Shaikh, Abeera; Mill, Jonathan; Reul, Johannes M. H. M.

2016-01-01

Stressful events evoke long-term changes in behavioral responses; however, the underlying mechanisms in the brain are not well understood. Previous work has shown that epigenetic changes and immediate-early gene (IEG) induction in stress-activated dentate gyrus (DG) granule neurons play a crucial role in these behavioral responses. Here, we show that an acute stressful challenge [i.e., forced swimming (FS)] results in DNA demethylation at specific CpG (5′-cytosine–phosphate–guanine-3′) sites close to the c-Fos (FBJ murine osteosarcoma viral oncogene homolog) transcriptional start site and within the gene promoter region of Egr-1 (early growth response protein 1) specifically in the DG. Administration of the (endogenous) methyl donor S-adenosyl methionine (SAM) did not affect CpG methylation and IEG gene expression at baseline. However, administration of SAM before the FS challenge resulted in an enhanced CpG methylation at the IEG loci and suppression of IEG induction specifically in the DG and an impaired behavioral immobility response 24 h later. The stressor also specifically increased the expression of the de novo DNA methyltransferase Dnmt3a [DNA (cytosine-5-)-methyltransferase 3 alpha] in this hippocampus region. Moreover, stress resulted in an increased association of Dnmt3a enzyme with the affected CpG loci within the IEG genes. No effects of SAM were observed on stress-evoked histone modifications, including H3S10p-K14ac (histone H3, phosphorylated serine 10 and acetylated lysine-14), H3K4me3 (histone H3, trimethylated lysine-4), H3K9me3 (histone H3, trimethylated lysine-9), and H3K27me3 (histone H3, trimethylated lysine-27). We conclude that the DNA methylation status of IEGs plays a crucial role in FS-induced IEG induction in DG granule neurons and associated behavioral responses. In addition, the concentration of available methyl donor, possibly in conjunction with Dnmt3a, is critical for the responsiveness of dentate neurons to environmental stimuli in terms of gene expression and behavior. PMID:27078100

Multi-step aberrant CpG island hyper-methylation is associated with the progression of adult T-cell leukemia/lymphoma.

PubMed

Sato, Hiaki; Oka, Takashi; Shinnou, Yoko; Kondo, Takami; Washio, Kana; Takano, Masayuki; Takata, Katsuyoshi; Morito, Toshiaki; Huang, Xingang; Tamura, Maiko; Kitamura, Yuta; Ohara, Nobuya; Ouchida, Mamoru; Ohshima, Koichi; Shimizu, Kenji; Tanimoto, Mitsune; Takahashi, Kiyoshi; Matsuoka, Masao; Utsunomiya, Atae; Yoshino, Tadashi

2010-01-01

Aberrant CpG island methylation contributes to the pathogenesis of various malignancies. However, little is known about the association of epigenetic abnormalities with multistep tumorigenic events in adult T cell leukemia/lymphoma (ATLL). To determine whether epigenetic abnormalities induce the progression of ATLL, we analyzed the methylation profiles of the SHP1, p15, p16, p73, HCAD, DAPK, hMLH-1, and MGMT genes by methylation specific PCR assay in 65 cases with ATLL patients. The number of CpG island methylated genes increased with disease progression and aberrant hypermethylation in specific genes was detected even in HTLV-1 carriers and correlated with progression to ATLL. The CpG island methylator phenotype (CIMP) was observed most frequently in lymphoma type ATLL and was also closely associated with the progression and crisis of ATLL. The high number of methylated genes and increase of CIMP incidence were shown to be unfavorable prognostic factors and correlated with a shorter overall survival by Kaplan-Meyer analysis. The present findings strongly suggest that the multistep accumulation of aberrant CpG methylation in specific target genes and the presence of CIMP are deeply involved in the crisis, progression, and prognosis of ATLL, as well as indicate the value of CpG methylation and CIMP for new diagnostic and prognostic biomarkers.

Multi-Step Aberrant CpG Island Hyper-Methylation Is Associated with the Progression of Adult T–Cell Leukemia/Lymphoma

PubMed Central

Sato, Hiaki; Oka, Takashi; Shinnou, Yoko; Kondo, Takami; Washio, Kana; Takano, Masayuki; Takata, Katsuyoshi; Morito, Toshiaki; Huang, Xingang; Tamura, Maiko; Kitamura, Yuta; Ohara, Nobuya; Ouchida, Mamoru; Ohshima, Koichi; Shimizu, Kenji; Tanimoto, Mitsune; Takahashi, Kiyoshi; Matsuoka, Masao; Utsunomiya, Atae; Yoshino, Tadashi

2010-01-01

Aberrant CpG island methylation contributes to the pathogenesis of various malignancies. However, little is known about the association of epigenetic abnormalities with multistep tumorigenic events in adult T cell leukemia/lymphoma (ATLL). To determine whether epigenetic abnormalities induce the progression of ATLL, we analyzed the methylation profiles of the SHP1, p15, p16, p73, HCAD, DAPK, hMLH-1, and MGMT genes by methylation specific PCR assay in 65 cases with ATLL patients. The number of CpG island methylated genes increased with disease progression and aberrant hypermethylation in specific genes was detected even in HTLV-1 carriers and correlated with progression to ATLL. The CpG island methylator phenotype (CIMP) was observed most frequently in lymphoma type ATLL and was also closely associated with the progression and crisis of ATLL. The high number of methylated genes and increase of CIMP incidence were shown to be unfavorable prognostic factors and correlated with a shorter overall survival by Kaplan-Meyer analysis. The present findings strongly suggest that the multistep accumulation of aberrant CpG methylation in specific target genes and the presence of CIMP are deeply involved in the crisis, progression, and prognosis of ATLL, as well as indicate the value of CpG methylation and CIMP for new diagnostic and prognostic biomarkers. PMID:20019193

Immunostimulatory CpG on Carbon Nanotubes Selectively Inhibits Migration of Brain Tumor Cells.

PubMed

Alizadeh, Darya; White, Ethan E; Sanchez, Teresa C; Liu, Shunan; Zhang, Leying; Badie, Behnam; Berlin, Jacob M

2018-05-16

Even when treated with aggressive current therapies, patients with glioblastoma usually survive less than two years and exhibit a high rate of recurrence. CpG is an oligonucleotide that activates the innate immune system via Toll-like receptor 9 (TLR9) activation. Injection of CpG into glioblastoma tumors showed promise as an immunotherapy in mouse models but proved disappointing in human trials. One aspect of glioma that is not addressed by CpG therapy alone is the highly invasive nature of glioma cells, which is associated with resistance to radiation and chemotherapy. Here, we demonstrate that single-walled carbon nanotubes noncovalently functionalized with CpG (SWNT/CpG), which retain the immunostimulatory property of the CpG, selectively inhibit the migration of glioma cells and not macrophages without affecting cell viability or proliferation. SWNT/CpG also selectively decreased NF-κB activation in glioma cells, while activating macrophages by induction of the TLR9/NF-κB pathway, as we have previously reported. The migration inhibition of glioma cells was correlated with selective reduction of intracellular levels of reactive oxygen species (ROS), suggesting that an antioxidant-based mechanism mediates the observed effects. To the best of our knowledge, SWNT/CpG is the first nanomaterial that inhibits the migration of cancer cells while stimulating the immune system.

Survival differences of CIMP subtypes integrated with CNA information in human breast cancer.

PubMed

Wang, Huihan; Yan, Weili; Zhang, Shumei; Gu, Yue; Wang, Yihan; Wei, Yanjun; Liu, Hongbo; Wang, Fang; Wu, Qiong; Zhang, Yan

2017-07-25

CpG island methylator phenotype of breast cancer is associated with widespread aberrant methylation at specified CpG islands and distinct patient outcomes. However, the influence of copy number contributing to the prognosis of tumors with different CpG island methylator phenotypes is still unclear. We analyzed both genetic (copy number) and epigenetic alterations in 765 breast cancers from The Cancer Genome Atlas data portal and got a panel of 15 biomarkers for copy number and methylation status evaluation. The gene panel identified two groups corresponding to distinct copy number profiles. In status of mere-loss copy number, patients were faced with a greater risk if they presented a higher CpG islands methylation pattern in biomarker panels. But for samples presenting merely-gained copy number, higher methylation level of CpG islands was associated with improved viability. In all, the integration of copy number alteration and methylation information enhanced the classification power on prognosis. Moreover, we found the molecular subtypes of breast cancer presented different distributions in two CpG island methylation phenotypes. Generated by the same set of human methylation 450K data, additional copy number information could provide insights into survival prediction of cancers with less heterogeneity and might help to determine the biomarkers for diagnosis and treatment for breast cancer patients in a more personalized approach.

Survival differences of CIMP subtypes integrated with CNA information in human breast cancer

PubMed Central

Wang, Huihan; Yan, Weili; Zhang, Shumei; Gu, Yue; Wang, Yihan; Wei, Yanjun; Liu, Hongbo; Wang, Fang; Wu, Qiong; Zhang, Yan

2017-01-01

CpG island methylator phenotype of breast cancer is associated with widespread aberrant methylation at specified CpG islands and distinct patient outcomes. However, the influence of copy number contributing to the prognosis of tumors with different CpG island methylator phenotypes is still unclear. We analyzed both genetic (copy number) and epigenetic alterations in 765 breast cancers from The Cancer Genome Atlas data portal and got a panel of 15 biomarkers for copy number and methylation status evaluation. The gene panel identified two groups corresponding to distinct copy number profiles. In status of mere-loss copy number, patients were faced with a greater risk if they presented a higher CpG islands methylation pattern in biomarker panels. But for samples presenting merely-gained copy number, higher methylation level of CpG islands was associated with improved viability. In all, the integration of copy number alteration and methylation information enhanced the classification power on prognosis. Moreover, we found the molecular subtypes of breast cancer presented different distributions in two CpG island methylation phenotypes. Generated by the same set of human methylation 450K data, additional copy number information could provide insights into survival prediction of cancers with less heterogeneity and might help to determine the biomarkers for diagnosis and treatment for breast cancer patients in a more personalized approach. PMID:28415743

DNA Methylation of T1R1 Gene in the Vegetarian Adaptation of Grass Carp Ctenopharyngodon idella.

PubMed

Cai, Wenjing; He, Shan; Liang, Xu-Fang; Yuan, Xiaochen

2018-05-02

Although previous studies have indicated importance of taste receptors in food habits formation in mammals, little is known about those in fish. Grass carp is an excellent model for studying vegetarian adaptation, as it shows food habit transition from carnivore to herbivore. In the present study, pseudogenization or frameshift mutations of the umami receptors that hypothesized related to dietary switch in vertebrates, were not found in grass carp, suggesting other mechanisms for vegetarian adaptation in grass carp. T1R1 and T1R3 strongly responded to L-Arg and L-Lys, differing from those of zebrafish and medaka, contributing to high species specificity in amino acid preferences and diet selection of grass carp. After food habit transition of grass carp, DNA methylation levels were higher in CPG1 and CPG3 islands of upstream control region of T1R1 gene. Luciferase activity assay of upstream regulatory region of T1R1 (-2500-0 bp) without CPG1 or CPG3 indicated that CPG1 and CPG3 might be involved in transcriptional regulation of T1R1 gene. Subsequently, high DNA methylation decreased expression of T1R1 in intestinal tract. It could be a new mechanism to explain, at least partially, the vegetarian adaptation of grass carp by regulation of expression of umami receptor via epigenetic modification.

Hyperdiversity of Genes Encoding Integral Light-Harvesting Proteins in the Dinoflagellate Symbiodinium sp

PubMed Central

Boldt, Lynda; Yellowlees, David; Leggat, William

2012-01-01

The superfamily of light-harvesting complex (LHC) proteins is comprised of proteins with diverse functions in light-harvesting and photoprotection. LHC proteins bind chlorophyll (Chl) and carotenoids and include a family of LHCs that bind Chl a and c. Dinophytes (dinoflagellates) are predominantly Chl c binding algal taxa, bind peridinin or fucoxanthin as the primary carotenoid, and can possess a number of LHC subfamilies. Here we report 11 LHC sequences for the chlorophyll a-chlorophyll c 2-peridinin protein complex (acpPC) subfamily isolated from Symbiodinium sp. C3, an ecologically important peridinin binding dinoflagellate taxa. Phylogenetic analysis of these proteins suggests the acpPC subfamily forms at least three clades within the Chl a/c binding LHC family; Clade 1 clusters with rhodophyte, cryptophyte and peridinin binding dinoflagellate sequences, Clade 2 with peridinin binding dinoflagellate sequences only and Clades 3 with heterokontophytes, fucoxanthin and peridinin binding dinoflagellate sequences. PMID:23112815

Protein Binding: Do We Ever Learn?▿

PubMed Central

Zeitlinger, Markus A.; Derendorf, Hartmut; Mouton, Johan W.; Cars, Otto; Craig, William A.; Andes, David; Theuretzbacher, Ursula

2011-01-01

Although the influence of protein binding (PB) on antibacterial activity has been reported for many antibiotics and over many years, there is currently no standardization for pharmacodynamic models that account for the impact of protein binding of antimicrobial agents in vitro. This might explain the somewhat contradictory results obtained from different studies. Simple in vitro models which compare the MIC obtained in protein-free standard medium versus a protein-rich medium are prone to methodological pitfalls and may lead to flawed conclusions. Within in vitro test systems, a range of test conditions, including source of protein, concentration of the tested antibiotic, temperature, pH, electrolytes, and supplements may influence the impact of protein binding. As new antibiotics with a high degree of protein binding are in clinical development, attention and action directed toward the optimization and standardization of testing the impact of protein binding on the activity of antibiotics in vitro become even more urgent. In addition, the quantitative relationship between the effects of protein binding in vitro and in vivo needs to be established, since the physiological conditions differ. General recommendations for testing the impact of protein binding in vitro are suggested. PMID:21537013

A new strategy based on SmRho protein loaded chitosan nanoparticles as a candidate oral vaccine against schistosomiasis.

PubMed

Oliveira, Carolina R; Rezende, Cíntia M F; Silva, Marina R; Pêgo, Ana Paula; Borges, Olga; Goes, Alfredo M

2012-01-01

Schistosomiasis is one of the most important neglected tropical diseases and an effective control is unlikely in the absence of improved sanitation and vaccination. A new approach of oral vaccination with alginate coated chitosan nanoparticles appears interesting because their great stability and the ease of target accessibility, besides of chitosan and alginate immunostimulatory properties. Here we propose a candidate vaccine based on the combination of chitosan-based nanoparticles containing the antigen SmRho and coated with sodium alginate. Our results showed an efficient performance of protein loading of nanoparticles before and after coating with alginate. Characterization of the resulting nanoparticles reported a size around 430 nm and a negative zeta potential. In vitro release studies of protein showed great stability of coated nanoparticles in simulated gastric fluid (SGF) and simulated intestinal fluid (SIF). Further in vivo studies was performed with different formulations of chitosan nanoparticles and it showed that oral immunization was not able to induce high levels of antibodies, otherwise intramuscular immunization induced high levels of both subtypes IgG1 and IgG2a SmRho specific antibodies. Mice immunized with nanoparticles associated to CpG showed significant modulation of granuloma reaction. Mice from all groups immunized orally with nanoparticles presented significant levels of protection against infection challenge with S. mansoni worms, suggesting an important role of chitosan in inducing a protective immune response. Finally, mice immunized with nanoparticles associated with the antigen SmRho plus CpG had 38% of the granuloma area reduced and also presented 48% of protection against of S. mansoni infection. Taken together, this results support this new strategy as an efficient delivery system and a potential vaccine against schistosomiasis.

Genomic Methylation Inhibits Expression of Hepatitis B Virus Envelope Protein in Transgenic Mice: A Non-Infectious Mouse Model to Study Silencing of HBV Surface Antigen Genes.

PubMed

Graumann, Franziska; Churin, Yuri; Tschuschner, Annette; Reifenberg, Kurt; Glebe, Dieter; Roderfeld, Martin; Roeb, Elke

2015-01-01

The Hepatitis B virus genome persists in the nucleus of virus infected hepatocytes where it serves as template for viral mRNA synthesis. Epigenetic modifications, including methylation of the CpG islands contribute to the regulation of viral gene expression. The present study investigates the effects of spontaneous age dependent loss of hepatitis B surface protein- (HBs) expression due to HBV-genome specific methylation as well as its proximate positive effects in HBs transgenic mice. Liver and serum of HBs transgenic mice aged 5-33 weeks were analyzed by Western blot, immunohistochemistry, serum analysis, PCR, and qRT-PCR. From the third month of age hepatic loss of HBs was observed in 20% of transgenic mice. The size of HBs-free area and the relative number of animals with these effects increased with age and struck about 55% of animals aged 33 weeks. Loss of HBs-expression was strongly correlated with amelioration of serum parameters ALT and AST. In addition lower HBs-expression went on with decreased ER-stress. The loss of surface protein expression started on transcriptional level and appeared to be regulated epigenetically by DNA methylation. The amount of the HBs-expression correlated negatively with methylation of HBV DNA in the mouse genome. Our data suggest that methylation of specific CpG sites controls gene expression even in HBs-transgenic mice with truncated HBV genome. More important, the loss of HBs expression and intracellular aggregation ameliorated cell stress and liver integrity. Thus, targeted modulation of HBs expression may offer new therapeutic approaches. Furthermore, HBs-transgenic mice depict a non-infectious mouse model to study one possible mechanism of HBs gene silencing by hypermethylation.

Structural motif screening reveals a novel, conserved carbohydrate-binding surface in the pathogenesis-related protein PR-5d.

PubMed

Doxey, Andrew C; Cheng, Zhenyu; Moffatt, Barbara A; McConkey, Brendan J

2010-08-03

Aromatic amino acids play a critical role in protein-glycan interactions. Clusters of surface aromatic residues and their features may therefore be useful in distinguishing glycan-binding sites as well as predicting novel glycan-binding proteins. In this work, a structural bioinformatics approach was used to screen the Protein Data Bank (PDB) for coplanar aromatic motifs similar to those found in known glycan-binding proteins. The proteins identified in the screen were significantly associated with carbohydrate-related functions according to gene ontology (GO) enrichment analysis, and predicted motifs were found frequently within novel folds and glycan-binding sites not included in the training set. In addition to numerous binding sites predicted in structural genomics proteins of unknown function, one novel prediction was a surface motif (W34/W36/W192) in the tobacco pathogenesis-related protein, PR-5d. Phylogenetic analysis revealed that the surface motif is exclusive to a subfamily of PR-5 proteins from the Solanaceae family of plants, and is absent completely in more distant homologs. To confirm PR-5d's insoluble-polysaccharide binding activity, a cellulose-pulldown assay of tobacco proteins was performed and PR-5d was identified in the cellulose-binding fraction by mass spectrometry. Based on the combined results, we propose that the putative binding site in PR-5d may be an evolutionary adaptation of Solanaceae plants including potato, tomato, and tobacco, towards defense against cellulose-containing pathogens such as species of the deadly oomycete genus, Phytophthora. More generally, the results demonstrate that coplanar aromatic clusters on protein surfaces are a structural signature of glycan-binding proteins, and can be used to computationally predict novel glycan-binding proteins from 3 D structure.

A crucial role for plasmacytoid dendritic cells in antiviral protection by CpG ODN–based vaginal microbicide

PubMed Central

Shen, Hong; Iwasaki, Akiko

2006-01-01

Topical microbicides represent a promising new approach to preventing HIV and other sexually transmitted infections. TLR agonists are ideal candidates for microbicides, as they trigger a multitude of antiviral genes effective against a broad range of viruses. Although vaginal application of CpG oligodeoxynucleotides (ODNs) and poly I:C has been shown to protect mice from genital herpes infection, the mechanism by which these agents provide protection remains unclear. Here, we show that plasmacytoid DCs (pDCs) are required for CpG ODN–mediated protection against lethal vaginal challenge with herpes simplex virus type 2 (HSV-2). Moreover, we demonstrate that cells of both the hematopoietic and stromal compartments must respond to CpG ODN via TLR9 and to type I IFNs through IFN-αβ receptor (IFN-αβR) for protection. Thus, crosstalk between pDCs and vaginal stromal cells provides for optimal microbicide efficacy. Our results imply that temporally and spatially controlled targeting of CpG ODN to pDCs and epithelial cells can potentially maximize their effectiveness as microbicides while minimizing the associated inflammatory responses. PMID:16878177

The contribution of a central pattern generator in a reflex-based neuromuscular model

PubMed Central

Dzeladini, Florin; van den Kieboom, Jesse; Ijspeert, Auke

2014-01-01

Although the concept of central pattern generators (CPGs) controlling locomotion in vertebrates is widely accepted, the presence of specialized CPGs in human locomotion is still a matter of debate. An interesting numerical model developed in the 90s’ demonstrated the important role CPGs could play in human locomotion, both in terms of stability against perturbations, and in terms of speed control. Recently, a reflex-based neuro-musculo-skeletal model has been proposed, showing a level of stability to perturbations similar to the previous model, without any CPG components. Although exhibiting striking similarities with human gaits, the lack of CPG makes the control of speed/step length in the model difficult. In this paper, we hypothesize that a CPG component will offer a meaningful way of controlling the locomotion speed. After introducing the CPG component in the reflex model, and taking advantage of the resulting properties, a simple model for gait modulation is presented. The results highlight the advantages of a CPG as feedforward component in terms of gait modulation. PMID:25018712

Ion-binding properties of Calnuc, Ca2+ versus Mg2+--Calnuc adopts additional and unusual Ca2+-binding sites upon interaction with G-protein.

PubMed

Kanuru, Madhavi; Samuel, Jebakumar J; Balivada, Lavanya M; Aradhyam, Gopala K

2009-05-01

Calnuc is a novel, highly modular, EF-hand containing, Ca(2+)-binding, Golgi resident protein whose functions are not clear. Using amino acid sequences, we demonstrate that Calnuc is a highly conserved protein among various organisms, from Ciona intestinalis to humans. Maximum homology among all sequences is found in the region that binds to G-proteins. In humans, it is known to be expressed in a variety of tissues, and it interacts with several important protein partners. Among other proteins, Calnuc is known to interact with heterotrimeric G-proteins, specifically with the alpha-subunit. Herein, we report the structural implications of Ca(2+) and Mg(2+) binding, and illustrate that Calnuc functions as a downstream effector for G-protein alpha-subunit. Our results show that Ca(2+) binds with an affinity of 7 mum and causes structural changes. Although Mg(2+) binds to Calnuc with very weak affinity, the structural changes that it causes are further enhanced by Ca(2+) binding. Furthermore, isothermal titration calorimetry results show that Calnuc and the G-protein bind with an affinity of 13 nm. We also predict a probable function for Calnuc, that of maintaining Ca(2+) homeostasis in the cell. Using Stains-all and terbium as Ca(2+) mimic probes, we demonstrate that the Ca(2+)-binding ability of Calnuc is governed by the activity-based conformational state of the G-protein. We propose that Calnuc adopts structural sites similar to the ones seen in proteins such as annexins, c2 domains or chromogrannin A, and therefore binds more calcium ions upon binding to Gialpha. With the number of organelle-targeted G-protein-coupled receptors increasing, intracellular communication mediated by G-proteins could become a new paradigm. In this regard, we propose that Calnuc could be involved in the downstream signaling of G-proteins.

In Situ Protein Binding Assay Using Fc-Fusion Proteins.

PubMed

Padmanabhan, Nirmala; Siddiqui, Tabrez J

2017-01-01

This protocol describes an in situ protein-protein interaction assay between tagged recombinant proteins and cell-surface expressed synaptic proteins. The assay is arguably more sensitive than other traditional protein binding assays such as co-immunoprecipitation and pull-downs and provides a visual readout for binding. This assay has been widely used to determine the dissociation constant of binding of trans-synaptic adhesion proteins. The step-wise description in the protocol should facilitate the adoption of this method in other laboratories.

Fc-Binding Ligands of Immunoglobulin G: An Overview of High Affinity Proteins and Peptides

PubMed Central

Choe, Weonu; Durgannavar, Trishaladevi A.; Chung, Sang J.

2016-01-01

The rapidly increasing application of antibodies has inspired the development of several novel methods to isolate and target antibodies using smart biomaterials that mimic the binding of Fc-receptors to antibodies. The Fc-binding domain of antibodies is the primary binding site for e.g., effector proteins and secondary antibodies, whereas antigens bind to the Fab region. Protein A, G, and L, surface proteins expressed by pathogenic bacteria, are well known to bind immunoglobulin and have been widely exploited in antibody purification strategies. Several difficulties are encountered when bacterial proteins are used in antibody research and application. One of the major obstacles hampering the use of bacterial proteins is sample contamination with trace amounts of these proteins, which can invoke an immune response in the host. Many research groups actively develop synthetic ligands that are able to selectively and strongly bind to antibodies. Among the reported ligands, peptides that bind to the Fc-domain of antibodies are attractive tools in antibody research. Besides their use as high affinity ligands in antibody purification chromatography, Fc-binding peptides are applied e.g., to localize antibodies on nanomaterials and to increase the half-life of proteins in serum. In this review, recent developments of Fc-binding peptides are presented and their binding characteristics and diverse applications are discussed. PMID:28774114

21 CFR 866.5765 - Retinol-binding protein immunological test system.

Code of Federal Regulations, 2010 CFR

2010-04-01

... SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Immunological Test Systems § 866.5765 Retinol-binding protein immunological test system. (a) Identification. A retinol-binding protein... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Retinol-binding protein immunological test system...

Spatiotemporal clustering of the epigenome reveals rules of dynamic gene regulation

PubMed Central

Yu, Pengfei; Xiao, Shu; Xin, Xiaoyun; Song, Chun-Xiao; Huang, Wei; McDee, Darina; Tanaka, Tetsuya; Wang, Ting; He, Chuan; Zhong, Sheng

2013-01-01

Spatial organization of different epigenomic marks was used to infer functions of the epigenome. It remains unclear what can be learned from the temporal changes of the epigenome. Here, we developed a probabilistic model to cluster genomic sequences based on the similarity of temporal changes of multiple epigenomic marks during a cellular differentiation process. We differentiated mouse embryonic stem (ES) cells into mesendoderm cells. At three time points during this differentiation process, we used high-throughput sequencing to measure seven histone modifications and variants—H3K4me1/2/3, H3K27ac, H3K27me3, H3K36me3, and H2A.Z; two DNA modifications—5-mC and 5-hmC; and transcribed mRNAs and noncoding RNAs (ncRNAs). Genomic sequences were clustered based on the spatiotemporal epigenomic information. These clusters not only clearly distinguished gene bodies, promoters, and enhancers, but also were predictive of bidirectional promoters, miRNA promoters, and piRNAs. This suggests specific epigenomic patterns exist on piRNA genes much earlier than germ cell development. Temporal changes of H3K4me2, unmethylated CpG, and H2A.Z were predictive of 5-hmC changes, suggesting unmethylated CpG and H3K4me2 as potential upstream signals guiding TETs to specific sequences. Several rules on combinatorial epigenomic changes and their effects on mRNA expression and ncRNA expression were derived, including a simple rule governing the relationship between 5-hmC and gene expression levels. A Sox17 enhancer containing a FOXA2 binding site and a Foxa2 enhancer containing a SOX17 binding site were identified, suggesting a positive feedback loop between the two mesendoderm transcription factors. These data illustrate the power of using epigenome dynamics to investigate regulatory functions. PMID:23033340

The AIRE -230Y Polymorphism Affects AIRE Transcriptional Activity: Potential Influence on AIRE Function in the Thymus.

PubMed

Lovewell, Thomas R J; McDonagh, Andrew J; Messenger, Andrew G; Azzouz, Mimoun; Tazi-Ahnini, Rachid

2015-01-01

The autoimmune regulator (AIRE) is expressed in the thymus, particularly in thymic medullary epithelial cells (mTECs), and is required for the ectopic expression of a diverse range of peripheral tissue antigens by mTECs, facilitating their ability to perform negative selection of auto-reactive immature T-cells. The expression profile of peripheral tissue antigens is affected not only by AIRE deficiency but also with variation of AIRE activity in the thymus. Therefore we screened 591bp upstream of the AIRE transcription start site including AIRE minimal promoter for single nucleotide polymorphism (SNPs) and identified two SNPs -655R (rs117557896) and -230Y (rs751032) respectively. To study the effect of these variations on AIRE promoter activity we generated a Flp-In host cell line which was stably transfected with a single copy of the reporter vector. Relative promoter activity was estimated by comparing the luciferase specific activity for lysates of the different reporter AIRE promoter-reporter gene constructs including AIRE-655G AIRE-230C, AIRE-655G AIRE-230T and AIRE-655A AIRE-230C. The analysis showed that the commonest haplotype AIRE-655G AIRE-230C has the highest luciferase specific activity (p<0.001). Whereas AIRE-655G AIRE-230T has a luciferase specific activity value that approaches null. Both AIRE promoter polymorphic sites have one allele that forms a CpG methylation site which we determined can be methylated in methylation assays using the M.SssI CpG methyltransferase. AIRE-230Y is in a conserved region of the promoter and is adjacent to a predicted WT1 transcription factor binding site, suggesting that AIRE-230Y affects AIRE expression by influencing the binding of biochemical factors to this region. Our findings show that AIRE-655GAIRE-230T haplotype could dramatically alter AIRE transcription and so have an effect on the process of negative selection and affect susceptibility to autoimmune conditions.

Lipid-binding proteins modulate ligand-dependent trans-activation by peroxisome proliferator-activated receptors and localize to the nucleus as well as the cytoplasm.

PubMed

Helledie, T; Antonius, M; Sorensen, R V; Hertzel, A V; Bernlohr, D A; Kølvraa, S; Kristiansen, K; Mandrup, S

2000-11-01

Peroxisome proliferator-activated receptors (PPARs) are activated by a variety of fatty acids, eicosanoids, and hypolipidemic and insulin-sensitizing drugs. Many of these compounds bind avidly to members of a family of small lipid-binding proteins, the fatty acid-binding proteins (FABPs). Fatty acids are activated to CoA esters, which bind with high affinity to the acyl-CoA-binding protein (ACBP). Thus, the availability of known and potential PPAR ligands may be regulated by lipid-binding proteins. In this report we show by transient transfection of CV-1 cells that coexpression of ACBP and adipocyte lipid-binding protein (ALBP) exerts a ligand- and PPAR subtype-specific attenuation of PPAR-mediated trans-activation, suggesting that lipid-binding proteins, when expressed at high levels, may function as negative regulators of PPAR activation by certain ligands. Expression of ACBP, ALBP, and keratinocyte lipid-binding protein (KLBP) is induced during adipocyte differentiation, a process during which PPARgamma plays a prominent role. We present evidence that endogenous ACBP, ALBP, and KLBP not only localize to the cytoplasm but also exhibit a prominent nuclear localization in 3T3-L1 adipocytes. In addition, forced expression of ACBP, ALBP, and KLBP in CV-1 cells resulted in a substantial accumulation of all three proteins in the nucleus. These results suggest that lipid-binding proteins, contrary to the general assumption, may exert their action in the nucleus as well as in the cytoplasm.

Unconventional RNA-binding proteins: an uncharted zone in RNA biology.

PubMed

Albihlal, Waleed S; Gerber, André P

2018-06-16

RNA-binding proteins play essential roles in the post-transcriptional regulation of gene expression. While hundreds of RNA-binding proteins can be predicted computationally, the recent introduction of proteome-wide approaches has dramatically expanded the repertoire of proteins interacting with RNA. Besides canonical RNA-binding proteins that contain characteristic RNA-binding domains, many proteins that lack such domains but have other well-characterised cellular functions were identified; including metabolic enzymes, heat shock proteins, kinases, as well as transcription factors and chromatin-associated proteins. In the context of these recently published RNA-protein interactome datasets obtained from yeast, nematodes, flies, plants and mammalian cells, we discuss examples for seemingly evolutionary conserved "unconventional" RNA-binding proteins that act in central carbon metabolism, stress response or regulation of transcription. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

The hepta-beta-glucoside elicitor-binding proteins from legumes represent a putative receptor family.

PubMed

Mithöfer, A; Fliegmann, J; Neuhaus-Url, G; Schwarz, H; Ebel, J

2000-08-01

The ability of legumes to recognize and respond to beta-glucan elicitors by synthesizing phytoalexins is consistent with the existence of a membrane-bound beta-glucan-binding site. Related proteins of approximately 75 kDa and the corresponding mRNAs were detected in various species of legumes which respond to beta-glucans. The cDNAs for the beta-glucan-binding proteins of bean and soybean were cloned. The deduced 75-kDa proteins are predominantly hydrophilic and constitute a unique class of glucan-binding proteins with no currently recognizable functional domains. Heterologous expression of the soybean beta-glucan-binding protein in tomato cells resulted in the generation of a high-affinity binding site for the elicitor-active hepta-beta-glucoside conjugate (Kd = 4.5 nM). Ligand competition experiments with the recombinant binding sites demonstrated similar ligand specificities when compared with soybean. In both soybean and transgenic tomato, membrane-bound, active forms of the glucan-binding proteins coexist with immunologically detectable, soluble but inactive forms of the proteins. Reconstitution of a soluble protein fraction into lipid vesicles regained beta-glucoside-binding activity but with lower affinity (Kd = 130 nM). We conclude that the beta-glucan elicitor receptors of legumes are composed of the 75 kDa glucan-binding proteins as the critical components for ligand-recognition, and of an as yet unknown membrane anchor constituting the plasma membrane-associated receptor complex.

Isolation from genomic DNA of sequences binding specific regulatory proteins by the acceleration of protein electrophoretic mobility upon DNA binding.

PubMed

Subrahmanyam, S; Cronan, J E

1999-01-21

We report an efficient and flexible in vitro method for the isolation of genomic DNA sequences that are the binding targets of a given DNA binding protein. This method takes advantage of the fact that binding of a protein to a DNA molecule generally increases the rate of migration of the protein in nondenaturing gel electrophoresis. By the use of a radioactively labeled DNA-binding protein and nonradioactive DNA coupled with PCR amplification from gel slices, we show that specific binding sites can be isolated from Escherichia coli genomic DNA. We have applied this method to isolate a binding site for FadR, a global regulator of fatty acid metabolism in E. coli. We have also isolated a second binding site for BirA, the biotin operon repressor/biotin ligase, from the E. coli genome that has a very low binding efficiency compared with the bio operator region.

Epigenetic Control of Gonadal Aromatase (cyp19a1) in Temperature-Dependent Sex Determination of Red-Eared Slider Turtles

PubMed Central

Matsumoto, Yuiko; Buemio, Alvin; Chu, Randy; Vafaee, Mozhgon; Crews, David

2013-01-01

In the red-eared slider turtle (Trachemys scripta), a species with temperature-dependent sex determination (TSD), the expression of the aromatase gene during gonad development is strictly limited to the female-producing temperature. The underlying mechanism remains unknown. In this study, we identified the upstream 5′-flanking region of the aromatase gene, gonad-specific promoter, and the temperature-dependent DNA methylation signatures during gonad development in the red-eared slider turtle. The 5′-flanking region of the slider aromatase exhibited sequence similarities to the aromatase genes of the American alligator, chicken, quail, and zebra finch. A putative TATA box was located 31 bp upstream of the gonad-specific transcription start site. DNA methylation at the CpG sites between the putative binding sites of the fork head domain factor (FOX) and vertebrate steroidogenic factor 1 (SF1) and adjacent TATA box in the promoter region were significantly lower in embryonic gonads at the female-producing temperature compared the male-producing temperature. A shift from male- to female-, but not from female- to male-, producing temperature changed the level of DNA methylation in gonads. Taken together these results indicate that the temperature, particularly female-producing temperature, allows demethylation at the specific CpG sites of the promoter region which leads the temperature-specific expression of aromatase during gonad development. PMID:23762231

Induction of anti-aging gene klotho with a small chemical compound that demethylates CpG islands

PubMed Central

Jung, Dongju; Xu, Yuechi; Sun, Zhongjie

2017-01-01

Klotho (KL) is described as an anti-aging gene because mutation of Kl gene leads to multiple pre-mature aging phenotypes and shortens lifespan in mice. Growing evidence suggests that an increase in KL expression may be beneficial for age-related diseases such as arteriosclerosis and diabetes. It remains largely unknown, however, how Kl expression could be induced. Here we discovered novel molecular mechanism for induction of Kl expression with a small molecule ‘Compound H’, N-(2-chlorophenyl)-1H-indole-3-caboxamide. Compound H was originally identified through a high-throughput screening of small molecules for identifying Kl inducers. However, how Compound H induces Kl expression has never been investigated. We found that Compound H increased Kl expression via demethylation in CpG islands of the Kl gene. The demethylation was accomplished by activating demethylases rather than inhibiting methylases. Due to demethylation, Compound H enhanced binding of transcription factors, Pax4 and Kid3, to the promoter of the Kl gene. Pax4 and Kid3 regulated Kl promoter activity positively and negatively, respectively. Thus, our results show that demethylation is an important molecular mechanism that mediates Compound H-induced Kl expression. Further investigation is warranted to determine whether Compound H demethylates the Kl gene in vivo and whether it can serve as a therapeutic agent for repressing or delaying the onset of age-related diseases. PMID:28657902

Engineered proteins as specific binding reagents.

PubMed

Binz, H Kaspar; Plückthun, Andreas

2005-08-01

Over the past 30 years, monoclonal antibodies have become the standard binding proteins and currently find applications in research, diagnostics and therapy. Yet, monoclonal antibodies now face strong competition from synthetic antibody libraries in combination with powerful library selection technologies. More recently, an increased understanding of other natural binding proteins together with advances in protein engineering, selection and evolution technologies has also triggered the exploration of numerous other protein architectures for the generation of designed binding molecules. Valuable protein-binding scaffolds have been obtained and represent promising alternatives to antibodies for biotechnological and, potentially, clinical applications.

Odorant-binding proteins from a primitive termite.

PubMed

Ishida, Yuko; Chiang, Vicky P; Haverty, Michael I; Leal, Walter S

2002-09-01

Hitherto, odorant-binding proteins (OBPs) have been identified from insects belonging to more highly evolved insect orders (Lepidoptera, Coleoptera, Diptera, Hymenoptera, and Hemiptera), whereas only chemosensory proteins have been identified from more primitive species, such as orthopteran and phasmid species. Here, we report for the first time the isolation and cloning of odorant-binding proteins from a primitive termite species, the dampwood termite. Zootermopsis nevadensis nevadensis (Isoptera: Termopsidae). A major antennae-specific protein was detected by native PAGE along with four other minor proteins, which were also absent in the extract from control tissues (hindlegs). Multiple cDNA cloning led to the full characterization of the major antennae-specific protein (ZnevOBP1) and to the identification of two other antennae-specific cDNAs, encoding putative odorant-binding proteins (ZnevOBP2 and ZnevOBP3). N-terminal amino acid sequencing of the minor antennal bands and cDNA cloning showed that olfaction in Z. n. nevadensis may involve multiple odorant-binding proteins. Database searches suggest that the OBPs from this primitive termite are homologues of the pheromone-binding proteins from scarab beetles and antennal-binding proteins from moths.

Roles of Copper-Binding Proteins in Breast Cancer.

PubMed

Blockhuys, Stéphanie; Wittung-Stafshede, Pernilla

2017-04-20

Copper ions are needed in several steps of cancer progression. However, the underlying mechanisms, and involved copper-binding proteins, are mainly elusive. Since most copper ions in the body (in and outside cells) are protein-bound, it is important to investigate what copper-binding proteins participate and, for these, how they are loaded with copper by copper transport proteins. Mechanistic information for how some copper-binding proteins, such as extracellular lysyl oxidase (LOX), play roles in cancer have been elucidated but there is still much to learn from a biophysical molecular viewpoint. Here we provide a summary of copper-binding proteins and discuss ones reported to have roles in cancer. We specifically focus on how copper-binding proteins such as mediator of cell motility 1 (MEMO1), LOX, LOX-like proteins, and secreted protein acidic and rich in cysteine (SPARC) modulate breast cancer from molecular and clinical aspects. Because of the importance of copper for invasion/migration processes, which are key components of cancer metastasis, further insights into the actions of copper-binding proteins may provide new targets to combat cancer.

Special AT-rich sequence binding protein 1 promotes tumor growth and metastasis of esophageal squamous cell carcinoma.

PubMed

Ma, Jun; Wu, Kaiming; Zhao, Zhenxian; Miao, Rong; Xu, Zhe

2017-03-01

Esophageal squamous cell carcinoma is one of the most aggressive malignancies worldwide. Special AT-rich sequence binding protein 1 is a nuclear matrix attachment region binding protein which participates in higher order chromatin organization and tissue-specific gene expression. However, the role of special AT-rich sequence binding protein 1 in esophageal squamous cell carcinoma remains unknown. In this study, western blot and quantitative real-time polymerase chain reaction analysis were performed to identify differentially expressed special AT-rich sequence binding protein 1 in a series of esophageal squamous cell carcinoma tissue samples. The effects of special AT-rich sequence binding protein 1 silencing by two short-hairpin RNAs on cell proliferation, migration, and invasion were assessed by the CCK-8 assay and transwell assays in esophageal squamous cell carcinoma in vitro. Special AT-rich sequence binding protein 1 was significantly upregulated in esophageal squamous cell carcinoma tissue samples and cell lines. Silencing of special AT-rich sequence binding protein 1 inhibited the proliferation of KYSE450 and EC9706 cells which have a relatively high level of special AT-rich sequence binding protein 1, and the ability of migration and invasion of KYSE450 and EC9706 cells was distinctly suppressed. Special AT-rich sequence binding protein 1 could be a potential target for the treatment of esophageal squamous cell carcinoma and inhibition of special AT-rich sequence binding protein 1 may provide a new strategy for the prevention of esophageal squamous cell carcinoma invasion and metastasis.

A pollen-specific novel calmodulin-binding protein with tetratricopeptide repeats

NASA Technical Reports Server (NTRS)

Safadi, F.; Reddy, V. S.; Reddy, A. S.

2000-01-01

Calcium is essential for pollen germination and pollen tube growth. A large body of information has established a link between elevation of cytosolic Ca(2+) at the pollen tube tip and its growth. Since the action of Ca(2+) is primarily mediated by Ca(2+)-binding proteins such as calmodulin (CaM), identification of CaM-binding proteins in pollen should provide insights into the mechanisms by which Ca(2+) regulates pollen germination and tube growth. In this study, a CaM-binding protein from maize pollen (maize pollen calmodulin-binding protein, MPCBP) was isolated in a protein-protein interaction-based screening using (35)S-labeled CaM as a probe. MPCBP has a molecular mass of about 72 kDa and contains three tetratricopeptide repeats (TPR) suggesting that it is a member of the TPR family of proteins. MPCBP protein shares a high sequence identity with two hypothetical TPR-containing proteins from Arabidopsis. Using gel overlay assays and CaM-Sepharose binding, we show that the bacterially expressed MPCBP binds to bovine CaM and three CaM isoforms from Arabidopsis in a Ca(2+)-dependent manner. To map the CaM-binding domain several truncated versions of the MPCBP were expressed in bacteria and tested for their ability to bind CaM. Based on these studies, the CaM-binding domain was mapped to an 18-amino acid stretch between the first and second TPR regions. Gel and fluorescence shift assays performed with CaM and a CaM-binding synthetic peptide further confirmed MPCBP binding to CaM. Western, Northern, and reverse transcriptase-polymerase chain reaction analysis have shown that MPCBP expression is specific to pollen. MPCBP was detected in both soluble and microsomal proteins. Immunoblots showed the presence of MPCBP in mature and germinating pollen. Pollen-specific expression of MPCBP, its CaM-binding properties, and the presence of TPR motifs suggest a role for this protein in Ca(2+)-regulated events during pollen germination and growth.

Computational analysis of protein-protein interfaces involving an alpha helix: insights for terphenyl-like molecules binding.

PubMed

Isvoran, Adriana; Craciun, Dana; Martiny, Virginie; Sperandio, Olivier; Miteva, Maria A

2013-06-14

Protein-Protein Interactions (PPIs) are key for many cellular processes. The characterization of PPI interfaces and the prediction of putative ligand binding sites and hot spot residues are essential to design efficient small-molecule modulators of PPI. Terphenyl and its derivatives are small organic molecules known to mimic one face of protein-binding alpha-helical peptides. In this work we focus on several PPIs mediated by alpha-helical peptides. We performed computational sequence- and structure-based analyses in order to evaluate several key physicochemical and surface properties of proteins known to interact with alpha-helical peptides and/or terphenyl and its derivatives. Sequence-based analysis revealed low sequence identity between some of the analyzed proteins binding alpha-helical peptides. Structure-based analysis was performed to calculate the volume, the fractal dimension roughness and the hydrophobicity of the binding regions. Besides the overall hydrophobic character of the binding pockets, some specificities were detected. We showed that the hydrophobicity is not uniformly distributed in different alpha-helix binding pockets that can help to identify key hydrophobic hot spots. The presence of hydrophobic cavities at the protein surface with a more complex shape than the entire protein surface seems to be an important property related to the ability of proteins to bind alpha-helical peptides and low molecular weight mimetics. Characterization of similarities and specificities of PPI binding sites can be helpful for further development of small molecules targeting alpha-helix binding proteins.

Erythropoietin binding protein from mammalian serum

DOEpatents

Clemons, Gisela K.

1997-01-01

Purified mammalian erythropoietin binding-protein is disclosed, and its isolation, identification, characterization, purification, and immunoassay are described. The erythropoietin binding protein can be used for regulation of erythropoiesis by regulating levels and half-life of erythropoietin. A diagnostic kit for determination of level of erythropoietin binding protein is also described.

Erythropoietin binding protein from mammalian serum

DOEpatents

Clemons, G.K.

1997-04-29

Purified mammalian erythropoietin binding-protein is disclosed, and its isolation, identification, characterization, purification, and immunoassay are described. The erythropoietin binding protein can be used for regulation of erythropoiesis by regulating levels and half-life of erythropoietin. A diagnostic kit for determination of level of erythropoietin binding protein is also described. 11 figs.

Impact of germline and somatic missense variations on drug binding sites.

PubMed

Yan, C; Pattabiraman, N; Goecks, J; Lam, P; Nayak, A; Pan, Y; Torcivia-Rodriguez, J; Voskanian, A; Wan, Q; Mazumder, R

2017-03-01

Advancements in next-generation sequencing (NGS) technologies are generating a vast amount of data. This exacerbates the current challenge of translating NGS data into actionable clinical interpretations. We have comprehensively combined germline and somatic nonsynonymous single-nucleotide variations (nsSNVs) that affect drug binding sites in order to investigate their prevalence. The integrated data thus generated in conjunction with exome or whole-genome sequencing can be used to identify patients who may not respond to a specific drug because of alterations in drug binding efficacy due to nsSNVs in the target protein's gene. To identify the nsSNVs that may affect drug binding, protein-drug complex structures were retrieved from Protein Data Bank (PDB) followed by identification of amino acids in the protein-drug binding sites using an occluded surface method. Then, the germline and somatic mutations were mapped to these amino acids to identify which of these alter protein-drug binding sites. Using this method we identified 12 993 amino acid-drug binding sites across 253 unique proteins bound to 235 unique drugs. The integration of amino acid-drug binding sites data with both germline and somatic nsSNVs data sets revealed 3133 nsSNVs affecting amino acid-drug binding sites. In addition, a comprehensive drug target discovery was conducted based on protein structure similarity and conservation of amino acid-drug binding sites. Using this method, 81 paralogs were identified that could serve as alternative drug targets. In addition, non-human mammalian proteins bound to drugs were used to identify 142 homologs in humans that can potentially bind to drugs. In the current protein-drug pairs that contain somatic mutations within their binding site, we identified 85 proteins with significant differential gene expression changes associated with specific cancer types. Information on protein-drug binding predicted drug target proteins and prevalence of both somatic and germline nsSNVs that disrupt these binding sites can provide valuable knowledge for personalized medicine treatment. A web portal is available where nsSNVs from individual patient can be checked by scanning against DrugVar to determine whether any of the SNVs affect the binding of any drug in the database.

Patterns and plasticity in RNA-protein interactions enable recruitment of multiple proteins through a single site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Valley, Cary T.; Porter, Douglas F.; Qiu, Chen

2012-06-28

mRNA control hinges on the specificity and affinity of proteins for their RNA binding sites. Regulatory proteins must bind their own sites and reject even closely related noncognate sites. In the PUF [Pumilio and fem-3 binding factor (FBF)] family of RNA binding proteins, individual proteins discriminate differences in the length and sequence of binding sites, allowing each PUF to bind a distinct battery of mRNAs. Here, we show that despite these differences, the pattern of RNA interactions is conserved among PUF proteins: the two ends of the PUF protein make critical contacts with the two ends of the RNA sites.more » Despite this conserved 'two-handed' pattern of recognition, the RNA sequence is flexible. Among the binding sites of yeast Puf4p, RNA sequence dictates the pattern in which RNA bases are flipped away from the binding surface of the protein. Small differences in RNA sequence allow new modes of control, recruiting Puf5p in addition to Puf4p to a single site. This embedded information adds a new layer of biological meaning to the connections between RNA targets and PUF proteins.« less

The Intrinsically Disordered Regions of the Drosophila melanogaster Hox Protein Ultrabithorax Select Interacting Proteins Based on Partner Topology

PubMed Central

Hsiao, Hao-Ching; Gonzalez, Kim L.; Catanese, Daniel J.; Jordy, Kristopher E.; Matthews, Kathleen S.; Bondos, Sarah E.

2014-01-01

Interactions between structured proteins require a complementary topology and surface chemistry to form sufficient contacts for stable binding. However, approximately one third of protein interactions are estimated to involve intrinsically disordered regions of proteins. The dynamic nature of disordered regions before and, in some cases, after binding calls into question the role of partner topology in forming protein interactions. To understand how intrinsically disordered proteins identify the correct interacting partner proteins, we evaluated interactions formed by the Drosophila melanogaster Hox transcription factor Ultrabithorax (Ubx), which contains both structured and disordered regions. Ubx binding proteins are enriched in specific folds: 23 of its 39 partners include one of 7 folds, out of the 1195 folds recognized by SCOP. For the proteins harboring the two most populated folds, DNA-RNA binding 3-helical bundles and α-α superhelices, the regions of the partner proteins that exhibit these preferred folds are sufficient for Ubx binding. Three disorder-containing regions in Ubx are required to bind these partners. These regions are either alternatively spliced or multiply phosphorylated, providing a mechanism for cellular processes to regulate Ubx-partner interactions. Indeed, partner topology correlates with the ability of individual partner proteins to bind Ubx spliceoforms. Partners bind different disordered regions within Ubx to varying extents, creating the potential for competition between partners and cooperative binding by partners. The ability of partners to bind regions of Ubx that activate transcription and regulate DNA binding provides a mechanism for partners to modulate transcription regulation by Ubx, and suggests that one role of disorder in Ubx is to coordinate multiple molecular functions in response to tissue-specific cues. PMID:25286318

Global Epigenetic Changes May Underlie Ethnic Differences and susceptibility to Prostate Cancer

DTIC Science & Technology

2012-09-01

tissues; in the prostate, hypermethylation of the GSTP1 CpG has been detected in PIA lesions [8]. DNA methylation occurs at CpG sites in the human...that the GSTP1 CpG island was frequently hypermethylated in PCa, more than 40 genes have been reported to be targets of DNA hypermethylation-associated...One study demonstrated that GSTP1 hypermethylation was significantly higher in PCa samples from AA men in comparison with EA and Asians [12]. Another

Nuclear proteins that bind the human gamma-globin gene promoter: alterations in binding produced by point mutations associated with hereditary persistence of fetal hemoglobin.

PubMed Central

Gumucio, D L; Rood, K L; Gray, T A; Riordan, M F; Sartor, C I; Collins, F S

1988-01-01

The molecular mechanisms responsible for the human fetal-to-adult hemoglobin switch have not yet been elucidated. Point mutations identified in the promoter regions of gamma-globin genes from individuals with nondeletion hereditary persistence of fetal hemoglobin (HPFH) may mark cis-acting sequences important for this switch, and the trans-acting factors which interact with these sequences may be integral parts in the puzzle of gamma-globin gene regulation. We have used gel retardation and footprinting strategies to define nuclear proteins which bind to the normal gamma-globin promoter and to determine the effect of HPFH mutations on the binding of a subset of these proteins. We have identified five proteins in human erythroleukemia cells (K562 and HEL) which bind to the proximal promoter region of the normal gamma-globin gene. One factor, gamma CAAT, binds the duplicated CCAAT box sequences; the -117 HPFH mutation increases the affinity of interaction between gamma CAAT and its cognate site. Two proteins, gamma CAC1 and gamma CAC2, bind the CACCC sequence. These proteins require divalent cations for binding. The -175 HPFH mutation interferes with the binding of a fourth protein, gamma OBP, which binds an octamer sequence (ATGCAAAT) in the normal gamma-globin promoter. The HPFH phenotype of the -175 mutation indicates that the octamer-binding protein may play a negative regulatory role in this setting. A fifth protein, EF gamma a, binds to sequences which overlap the octamer-binding site. The erythroid-specific distribution of EF gamma a and its close approximation to an apparent repressor-binding site suggest that it may be important in gamma-globin regulation. Images PMID:2468996

CXCL4 is a novel nickel-binding protein and augments nickel allergy.

PubMed

Kuroishi, T; Bando, K; Tanaka, Y; Shishido, K; Kinbara, M; Ogawa, T; Muramoto, K; Endo, Y; Sugawara, S

2017-08-01

Nickel (Ni) is the most frequent metal allergen and induces a TH 1 -dependent type-IV allergy. Although Ni 2+ is considered to bind to endogenous proteins, it currently remains unclear whether these Ni-binding proteins are involved in Ni allergy in vivo. We previously reported the adjuvant effects of lipopolysaccharide (LPS) in a Ni allergy mouse model. As LPS induces a number of inflammatory mediators, we hypothesized that Ni-binding protein(s) are also induced by LPS. The objective of this study was to purify and identify Ni-binding protein(s) from serum taken from LPS-injected mice (referred as LPS serum) and examined the augmenting effects of these Ni-binding protein(s) on Ni allergy in an in vivo model. BALB/cA mice were sensitized with an i.p. injection of NiCl 2 and LPS. Ten days after sensitization, mice were challenged with NiCl 2 by an i.d. injection into ear pinnae. Ni-binding protein(s) were purified by Ni-affinity column chromatography and gel filtration. Lipopolysaccharide serum, but not serum taken from saline-injected mice, augmented ear swelling induced by Ni-allergic inflammation. Ni-binding, but not non-binding fraction, purified from LPS serum augmented Ni-allergic inflammation. Mass spectrometry and Western blotting detected CXCL4 in the active fraction. A batch analysis with Ni-sepharose and a surface plasmon resonance analysis revealed direct binding between CXCL4 and Ni 2+ . Recombinant CXCL4 augmented Ni-allergic inflammation and exerted adjuvant effects at the sensitization phase. These results indicate that CXCL4 is a novel Ni-binding protein that augments Ni allergy at the elicitation and sensitization phases. This is the first study to demonstrate that the Ni-binding protein augments Ni allergy in vivo. © 2017 John Wiley & Sons Ltd.

Binding Linkage in a Telomere DNA–Protein Complex at the Ends of Oxytricha nova Chromosomes

PubMed Central

Buczek, Pawel; Orr, Rochelle S.; Pyper, Sean R.; Shum, Mili; Ota, Emily Kimmel Irene; Gerum, Shawn E.; Horvath, Martin P.

2005-01-01

Alpha and beta protein subunits of the telomere end binding protein from Oxytricha nova (OnTEBP) combine with telomere single strand DNA to form a protective cap at the ends of chromosomes. We tested how protein–protein interactions seen in the co-crystal structure relate to DNA binding through use of fusion proteins engineered as different combinations of domains and subunits derived from OnTEBP. Joining alpha and beta resulted in a protein that bound single strand telomere DNA with high affinity (KD-DNA=1.4 nM). Another fusion protein, constructed without the C-terminal protein–protein interaction domain of alpha, bound DNA with 200-fold diminished affinity (KD-DNA=290 nM) even though the DNA-binding domains of alpha and beta were joined through a peptide linker. Adding back the alpha C-terminal domain as a separate protein restored high-affinity DNA binding. The binding behaviors of these fusion proteins and the native protein subunits are consistent with cooperative linkage between protein-association and DNA-binding equilibria. Linking DNA–protein stability to protein–protein contacts at a remote site may provide a trigger point for DNA–protein disassembly during telomere replication when the single strand telomere DNA must exchange between a very stable OnTEBP complex and telomerase. PMID:15967465

Technical advance: identification of plant actin-binding proteins by F-actin affinity chromatography

NASA Technical Reports Server (NTRS)

Hu, S.; Brady, S. R.; Kovar, D. R.; Staiger, C. J.; Clark, G. B.; Roux, S. J.; Muday, G. K.

2000-01-01

Proteins that interact with the actin cytoskeleton often modulate the dynamics or organization of the cytoskeleton or use the cytoskeleton to control their localization. In plants, very few actin-binding proteins have been identified and most are thought to modulate cytoskeleton function. To identify actin-binding proteins that are unique to plants, the development of new biochemical procedures will be critical. Affinity columns using actin monomers (globular actin, G-actin) or actin filaments (filamentous actin, F-actin) have been used to identify actin-binding proteins from a wide variety of organisms. Monomeric actin from zucchini (Cucurbita pepo L.) hypocotyl tissue was purified to electrophoretic homogeneity and shown to be native and competent for polymerization to actin filaments. G-actin, F-actin and bovine serum albumin affinity columns were prepared and used to separate samples enriched in either soluble or membrane-associated actin-binding proteins. Extracts of soluble actin-binding proteins yield distinct patterns when eluted from the G-actin and F-actin columns, respectively, leading to the identification of a putative F-actin-binding protein of approximately 40 kDa. When plasma membrane-associated proteins were applied to these columns, two abundant polypeptides eluted selectively from the F-actin column and cross-reacted with antiserum against pea annexins. Additionally, a protein that binds auxin transport inhibitors, the naphthylphthalamic acid binding protein, which has been previously suggested to associate with the actin cytoskeleton, was eluted in a single peak from the F-actin column. These experiments provide a new approach that may help to identify novel actin-binding proteins from plants.

Technical advance: identification of plant actin-binding proteins by F-actin affinity chromatography.

PubMed

Hu, S; Brady, S R; Kovar, D R; Staiger, C J; Clark, G B; Roux, S J; Muday, G K

2000-10-01

Proteins that interact with the actin cytoskeleton often modulate the dynamics or organization of the cytoskeleton or use the cytoskeleton to control their localization. In plants, very few actin-binding proteins have been identified and most are thought to modulate cytoskeleton function. To identify actin-binding proteins that are unique to plants, the development of new biochemical procedures will be critical. Affinity columns using actin monomers (globular actin, G-actin) or actin filaments (filamentous actin, F-actin) have been used to identify actin-binding proteins from a wide variety of organisms. Monomeric actin from zucchini (Cucurbita pepo L.) hypocotyl tissue was purified to electrophoretic homogeneity and shown to be native and competent for polymerization to actin filaments. G-actin, F-actin and bovine serum albumin affinity columns were prepared and used to separate samples enriched in either soluble or membrane-associated actin-binding proteins. Extracts of soluble actin-binding proteins yield distinct patterns when eluted from the G-actin and F-actin columns, respectively, leading to the identification of a putative F-actin-binding protein of approximately 40 kDa. When plasma membrane-associated proteins were applied to these columns, two abundant polypeptides eluted selectively from the F-actin column and cross-reacted with antiserum against pea annexins. Additionally, a protein that binds auxin transport inhibitors, the naphthylphthalamic acid binding protein, which has been previously suggested to associate with the actin cytoskeleton, was eluted in a single peak from the F-actin column. These experiments provide a new approach that may help to identify novel actin-binding proteins from plants.

Methylation of the PMEPA1 gene, a negative regulator of the androgen receptor in prostate cancer.

PubMed

Sharad, Shashwat; Ravindranath, Lakshmi; Haffner, Michael C; Li, Hua; Yan, Wusheng; Sesterhenn, Isabell A; Chen, Yongmei; Ali, Amina; Srinivasan, Alagarsamy; McLeod, David G; Yegnasubramanian, Srinivasan; Srivastava, Shiv; Dobi, Albert; Petrovics, Gyorgy

2014-06-01

The prostate transmembrane protein androgen induced 1 (PMEPA1) gene is highly expressed in prostate epithelial cells and is a direct transcriptional target for the androgen receptor (AR). AR protein levels are controlled by the AR-PMEPA1 negative feedback loop through NEDD4-E3 ligase. Reduced expression of PMEPA1 observed in prostate tumors, suggests that loss of PMEPA1 may play critical roles in prostate tumorigenesis. This study focuses on epigenetic mechanisms of reduced PMEPA1 expression in the cancer of the prostate (CaP). Benign (n = 77) and matched malignant (n = 77) prostate epithelial cells were laser capture micro-dissected from optimum cutting temperature embedded frozen prostate sections from 42 Caucasian American (CA) and 35 African American (AA) cases. Purified DNA specimens were analyzed for CpG methylation of the PMEPA1 gene. PMEPA1 mRNA expression levels were evaluated by qRT-PCR. Analysis of PMEPA1 methylation and mRNA expression in the same tumor cell populations indicated a significant inverse correlation between mRNA expression and methylation in CaP (P = 0.0115). We noted higher frequency of CpG methylation within the evaluated first intronic region of the PMEPA1 gene in prostate tumors of CA men as compared with AA. In CaP cell lines, PMEPA1 expression was induced and AR protein levels were diminished in response to treatment with the DNA methyltransferase inhibitor, 5-aza-2'-deoxycytidine (decitabine). Cell culture-based studies demonstrated that decitabine restores PMEPA1 expression in AR-positive CaP cell lines. This report reveals the potential role of PMEPA1 gene methylation in the regulation of AR stability. Thus, downregulation of PMEPA1 may result in increased AR protein levels and function in CaP cells, contributing to prostate tumorigenesis.

Methylation of the PMEPA1 gene, a negative regulator of the androgen receptor in prostate cancer

PubMed Central

Sharad, Shashwat; Ravindranath, Lakshmi; Haffner, Michael C; Li, Hua; Yan, Wusheng; Sesterhenn, Isabell A; Chen, Yongmei; Ali, Amina; Srinivasan, Alagarsamy; McLeod, David G; Yegnasubramanian, Srinivasan; Srivastava, Shiv; Dobi, Albert; Petrovics, Gyorgy

2014-01-01

The prostate transmembrane protein androgen induced 1 (PMEPA1) gene is highly expressed in prostate epithelial cells and is a direct transcriptional target for the androgen receptor (AR). AR protein levels are controlled by the AR-PMEPA1 negative feedback loop through NEDD4-E3 ligase. Reduced expression of PMEPA1 observed in prostate tumors, suggests that loss of PMEPA1 may play critical roles in prostate tumorigenesis. This study focuses on epigenetic mechanisms of reduced PMEPA1 expression in the cancer of the prostate (CaP). Benign (n = 77) and matched malignant (n = 77) prostate epithelial cells were laser capture micro-dissected from optimum cutting temperature embedded frozen prostate sections from 42 Caucasian American (CA) and 35 African American (AA) cases. Purified DNA specimens were analyzed for CpG methylation of the PMEPA1 gene. PMEPA1 mRNA expression levels were evaluated by qRT-PCR. Analysis of PMEPA1 methylation and mRNA expression in the same tumor cell populations indicated a significant inverse correlation between mRNA expression and methylation in CaP (P = 0.0115). We noted higher frequency of CpG methylation within the evaluated first intronic region of the PMEPA1 gene in prostate tumors of CA men as compared with AA. In CaP cell lines, PMEPA1 expression was induced and AR protein levels were diminished in response to treatment with the DNA methyltransferase inhibitor, 5-aza-2'-deoxycytidine (decitabine). Cell culture-based studies demonstrated that decitabine restores PMEPA1 expression in AR-positive CaP cell lines. This report reveals the potential role of PMEPA1 gene methylation in the regulation of AR stability. Thus, downregulation of PMEPA1 may result in increased AR protein levels and function in CaP cells, contributing to prostate tumorigenesis. PMID:24694733

DNA methylation levels at chromosome 8q24 in peripheral blood are associated with 8q24 cancer susceptibility loci.

PubMed

Barry, Kathryn Hughes; Moore, Lee E; Sampson, Joshua; Yan, Liying; Meyer, Ann; Oler, Andrew J; Chung, Charles C; Wang, Zhaoming; Yeager, Meredith; Amundadottir, Laufey; Berndt, Sonja I

2014-12-01

Chromosome 8q24 has emerged as an important region for genetic susceptibility to various cancers, but little is known about the contribution of DNA methylation at 8q24. To evaluate variability in DNA methylation levels at 8q24 and the relationship with cancer susceptibility single nucleotide polymorphisms (SNPs) in this region, we quantified DNA methylation levels in peripheral blood at 145 CpG sites nearby 8q24 cancer susceptibility SNPs or MYC using pyrosequencing among 80 Caucasian men in the Prostate, Lung, Colorectal, and Ovarian Cancer Screening Trial. For the 60 CpG sites meeting quality control, which also demonstrated temporal stability over a 5-year period, we calculated pairwise Spearman correlations for DNA methylation levels at each CpG site with 42 8q24 cancer susceptibility SNPs. To account for multiple testing, we adjusted P values into q values reflecting the false discovery rate (FDR). In contrast to the MYC CpG sites, most sites nearby the SNPs demonstrated good reproducibility, high methylation levels, and moderate-high between-individual variation. We observed 10 statistically significant (FDR < 0.05) CpG site-SNP correlations. These included correlations between an intergenic CpG site at Chr8:128393157 and the prostate cancer SNP rs16902094 (ρ = -0.54; P = 9.7 × 10(-7); q = 0.002), a PRNCR1 CpG site at Chr8:128167809 and the prostate cancer SNP rs1456315 (ρ = 0.52; P = 1.4 × 10(-6); q = 0.002), and two POU5F1B CpG sites and several prostate/colorectal cancer SNPs (for Chr8:128498051 and rs6983267, ρ = 0.46; P = 2.0 × 10(-5); q = 0.01). This is the first report of correlations between blood DNA methylation levels and cancer susceptibility SNPs at 8q24, suggesting that DNA methylation at this important susceptibility locus may contribute to cancer risk. ©2014 American Association for Cancer Research.

Experimental murine myopia induces collagen type Iα1 (COL1A1) DNA methylation and altered COL1A1 messenger RNA expression in sclera

PubMed Central

Zhou, Xiangtian; Ji, Fengtao; An, Jianhong; Zhao, Fuxin; Shi, Fanjun; Huang, Furong; Li, Yuan; Jiao, Shiming; Yan, Dongsheng; Chen, Xiaoyan; Chen, JiangFan

2012-01-01

Purpose To investigate whether myopia development is associated with changes of scleral DNA methylation in cytosine-phosphate-guanine (CpG) sites in the collagen 1A1 (COL1A1) promoter and messenger RNA (mRNA) levels following murine form deprivation myopia. Methods Fifty-seven C57BL/6 mice (postnatal day 23) were randomly assigned to four groups: (1) monocular form deprivation (MD) in which a diffuser lens was placed over one eye for 28 days; (2) normal controls without MD; (3) MD recovery in which the diffuser lens was removed for seven days; and (4) MD recovery normal controls. The DNA methylation pattern in COL1A1 promoter and exon 1 was determined by bisulfite DNA sequencing, and the COL1A1 mRNA level in sclera was determined by quantitative PCR. Results MD was found to induce myopia in the treated eyes. Six CpG sites in the promoter and exon 1 region of COL1A1 were methylated with significantly higher frequency in the treated eyes than normal control eyes (p<0.05), with CpG island methylation in MD-contralateral eyes being intermediate. Consistent with the CpG methylation, scleral COL1A1 mRNA was reduced by 57% in the MD-treated eyes compared to normal controls (p<0.05). After seven days of MD recovery, CpG methylation was significantly reduced (p=0.01). The methylation patterns returned to near normal level in five CpG sites, but the sixth was hypomethylated compared to normal controls. Conclusions In parallel with the development of myopia and the reduced COL1A1 mRNA, the frequency of methylation in CpG sites of the COL1A1 promoter/exon 1 increased during MD and returned to near normal during recovery. Thus, hypermethylation of CpG sites in the promoter/exon 1 of COL1A1 may underlie reduced collagen synthesis at the transcriptional level in myopic scleras. PMID:22690110

Primary care clinical practice guidelines in South Africa: qualitative study exploring perspectives of national stakeholders.

PubMed

Kredo, Tamara; Abrams, Amber; Young, Taryn; Louw, Quinette; Volmink, Jimmy; Daniels, Karen

2017-08-29

Clinical practice guidelines (CPGs) are common tools in policy and clinical practice informing clinical decisions at the bedside, governance of health facilities, health insurer and government spending, and patient choices. South Africa's health sector is transitioning to a national health insurance system, aiming to build on other primary health care initiatives to transform the previously segregated, inequitable services. Within these plans CPGs are an integral tool for delivering standardised and cost effective care. Currently, there is no accepted standard approach to developing, adapting or implementing CPGs efficiently or effectively in South Africa. We explored the current players; drivers; and the context and processes of primary care CPG development from the perspective of stakeholders operating at national level. We used a qualitative approach. Sampling was initially purposeful, followed by snowballing and further sampling to reach representivity of primary care service providers. Individual in-depth interviews were recorded and transcribed verbatim. We used thematic content analysis to analyse the data. We conducted 37 in-depth interviews from June 2014-July 2015. We found CPG development and implementation were hampered by lack of human and funding resources for technical and methodological work; fragmentation between groups, and between national and provincial health sectors; and lack of agreed systems for CPG development and implementation. Some CPG contributors steadfastly work to improve processes aiming to enhance communication, use of evidence, and transparency to ensure credible guidance is produced. Many interviewed had shared values, and were driven to address inequity, however, resource gaps were perceived to create an enabling environment for commercial interests or personal agendas to drive the CPG development process. Our findings identified strengths and gaps in CPG development processes, and a need for national standards to guide CPG development and implementation. Based on our findings and suggestions from participants, a possible way forward would be for South Africa to have a centrally coordinated CPG unit to address these needs and aspects of fragmentation by devising processes that support collaboration, transparency and credibility across sectors and disciplines. Such an initiative will require adequate resourcing to build capacity and ensure support for the delivery of high quality CPGs for South African primary care.

Hydrocarbon pyrolysis reactor experimentation and modeling for the production of solar absorbing carbon nanoparticles

NASA Astrophysics Data System (ADS)

Frederickson, Lee Thomas

Much of combustion research focuses on reducing soot particulates in emissions. However, current research at San Diego State University (SDSU) Combustion and Solar Energy Laboratory (CSEL) is underway to develop a high temperature solar receiver which will utilize carbon nanoparticles as a solar absorption medium. To produce carbon nanoparticles for the small particle heat exchange receiver (SPHER), a lab-scale carbon particle generator (CPG) has been built and tested. The CPG is a heated ceramic tube reactor with a set point wall temperature of 1100-1300°C operating at 5-6 bar pressure. Natural gas and nitrogen are fed to the CPG where natural gas undergoes pyrolysis resulting in carbon particles. The gas-particle mixture is met downstream with dilution air and sent to the lab scale solar receiver. To predict soot yield and general trends in CPG performance, a model has been setup in Reaction Design CHEMKIN-PRO software. One of the primary goals of this research is to accurately measure particle properties. Mean particle diameter, size distribution, and index of refraction are calculated using Scanning Electron Microscopy (SEM) and a Diesel Particulate Scatterometer (DPS). Filter samples taken during experimentation are analyzed to obtain a particle size distribution with SEM images processed in ImageJ software. These results are compared with the DPS, which calculates the particle size distribution and the index of refraction from light scattering using Mie theory. For testing with the lab scale receiver, a particle diameter range of 200-500 nm is desired. Test conditions are varied to understand effects of operating parameters on particle size and the ability to obtain the size range. Analysis of particle loading is the other important metric for this research. Particle loading is measured downstream of the CPG outlet and dilution air mixing point. The air-particle mixture flows through an extinction tube where opacity of the mixture is measured with a 532 nm laser and detector. Beer's law is then used to calculate particle loading. The CPG needs to produce a certain particle loading for a corresponding receiver test. By obtaining the particle loading in the system, the reaction conversion to solid carbon in the CPG can be calculated to measure the efficiency of the CPG. To predict trends in reaction conversion and particle size from experimentation, the CHEMKIN-PRO computer model for the CPG is run for various flow rates and wall temperature profiles. These predictions were a reason for testing at higher wall set point temperatures. Based on these research goals, it was shown that the CPG consistently produces a mean particle diameter of 200-400 nm at the conditions tested, fitting perfectly inside the desired range. This led to successful lab scale SPHER testing which produced a 10-point efficiency increase and 150°C temperature difference with particles present. Also, at 3 g/s dilution air flow rate, an efficiency of 80% at an outlet temperature above 800°C was obtained. Promise was shown at higher CPG experimental temperatures to produce higher reaction conversion, both experimentally and in the model. However, based on wall temperature data taken during experimentation, it is apparent that the CPG needs to have multiple heating zones with separate temperature controllers in order to have an isothermal zone rather than a parabolic temperature profile. As for the computer model, it predicted much higher reaction conversion at higher temperature. The mass fraction of fuel in the inlet stream was shown to not affect conversion while increasing residence time led to increasing conversion. Particle size distribution in the model was far off and showed a bimodal distribution for one of the statistical methods. Using the results from experimentation and modeling, a preliminary CPG design is presented that will operate in a 5MWth receiver system.

Structure, Function, and Evolution of Biogenic Amine-binding Proteins in Soft Ticks

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mans, Ben J.; Ribeiro, Jose M.C.; Andersen, John F.

2008-08-19

Two highly abundant lipocalins, monomine and monotonin, have been isolated from the salivary gland of the soft tick Argas monolakensis and shown to bind histamine and 5-hydroxytryptamine (5-HT), respectively. The crystal structures of monomine and a paralog of monotonin were determined in the presence of ligands to compare the determinants of ligand binding. Both the structures and binding measurements indicate that the proteins have a single binding site rather than the two sites previously described for the female-specific histamine-binding protein (FS-HBP), the histamine-binding lipocalin of the tick Rhipicephalus appendiculatus. The binding sites of monomine and monotonin are similar to themore » lower, low affinity site of FS-HBP. The interaction of the protein with the aliphatic amine group of the ligand is very similar for the all of the proteins, whereas specificity is determined by interactions with the aromatic portion of the ligand. Interestingly, protein interaction with the imidazole ring of histamine differs significantly between the low affinity binding site of FS-HBP and monomine, suggesting that histamine binding has evolved independently in the two lineages. From the conserved features of these proteins, a tick lipocalin biogenic amine-binding motif could be derived that was used to predict biogenic amine-binding function in other tick lipocalins. Heterologous expression of genes from salivary gland libraries led to the discovery of biogenic amine-binding proteins in soft (Ornithodoros) and hard (Ixodes) tick genera. The data generated were used to reconstruct the most probable evolutionary pathway for the evolution of biogenic amine-binding in tick lipocalins.« less