Sample records for cpg island cgi

  1. GaussianCpG: a Gaussian model for detection of CpG island in human genome sequences.

    PubMed

    Yu, Ning; Guo, Xuan; Zelikovsky, Alexander; Pan, Yi

    2017-05-24

    As crucial markers in identifying biological elements and processes in mammalian genomes, CpG islands (CGI) play important roles in DNA methylation, gene regulation, epigenetic inheritance, gene mutation, chromosome inactivation and nuclesome retention. The generally accepted criteria of CGI rely on: (a) %G+C content is ≥ 50%, (b) the ratio of the observed CpG content and the expected CpG content is ≥ 0.6, and (c) the general length of CGI is greater than 200 nucleotides. Most existing computational methods for the prediction of CpG island are programmed on these rules. However, many experimentally verified CpG islands deviate from these artificial criteria. Experiments indicate that in many cases %G+C is < 50%, CpG obs /CpG exp varies, and the length of CGI ranges from eight nucleotides to a few thousand of nucleotides. It implies that CGI detection is not just a straightly statistical task and some unrevealed rules probably are hidden. A novel Gaussian model, GaussianCpG, is developed for detection of CpG islands on human genome. We analyze the energy distribution over genomic primary structure for each CpG site and adopt the parameters from statistics of Human genome. The evaluation results show that the new model can predict CpG islands efficiently by balancing both sensitivity and specificity over known human CGI data sets. Compared with other models, GaussianCpG can achieve better performance in CGI detection. Our Gaussian model aims to simplify the complex interaction between nucleotides. The model is computed not by the linear statistical method but by the Gaussian energy distribution and accumulation. The parameters of Gaussian function are not arbitrarily designated but deliberately chosen by optimizing the biological statistics. By using the pseudopotential analysis on CpG islands, the novel model is validated on both the real and artificial data sets.

  2. The CpG island searcher: a new WWW resource.

    PubMed

    Takai, Daiya; Jones, Peter A

    2003-01-01

    Clusters of CpG dinucleotides in GC rich regions of the genome called "CpG islands" frequently occur in the 5' ends of genes. Methylation of CpG islands plays a role in transcriptional silencing in higher organisms in certain situations. We have established a CpG-island-extraction algorithm, which we previously developed [Takai and Jones, 2002], on a web site which has a simple user interface to identify CpG islands from submitted sequences of up to 50kb. The web site determines the locations of CpG islands using parameters (lower limit of %GC, ObsCpG/ExpCpG, length) set by the user, to display the value of parameters on each CpG island, and provides a graphical map of CpG dinucleotide distribution and borders of CpG islands. A command-line version of the CpG islands searcher has also been developed for larger sequences. The CpG Island Searcher was applied to the latest sequence and mapping information of human chromosomes 20, 21 and 22, and a total of 2345 CpG islands were extracted and 534 (23%) of them contained first coding exons and 650 (28%) contained other exons. The CpG Island Searcher is available on the World Wide Web at http://www.cpgislands.com or http://www.uscnorris.com/cpgislands/cpg.cgi.

  3. Developmentally Programmed 3′ CpG Island Methylation Confers Tissue- and Cell-Type-Specific Transcriptional Activation

    PubMed Central

    Yu, Da-Hai; Ware, Carol; Waterland, Robert A.; Zhang, Jiexin; Chen, Miao-Hsueh; Gadkari, Manasi; Kunde-Ramamoorthy, Govindarajan; Nosavanh, Lagina M.

    2013-01-01

    During development, a small but significant number of CpG islands (CGIs) become methylated. The timing of developmentally programmed CGI methylation and associated mechanisms of transcriptional regulation during cellular differentiation, however, remain poorly characterized. Here, we used genome-wide DNA methylation microarrays to identify epigenetic changes during human embryonic stem cell (hESC) differentiation. We discovered a group of CGIs associated with developmental genes that gain methylation after hESCs differentiate. Conversely, erasure of methylation was observed at the identified CGIs during subsequent reprogramming to induced pluripotent stem cells (iPSCs), further supporting a functional role for the CGI methylation. Both global gene expression profiling and quantitative reverse transcription-PCR (RT-PCR) validation indicated opposing effects of CGI methylation in transcriptional regulation during differentiation, with promoter CGI methylation repressing and 3′ CGI methylation activating transcription. By studying diverse human tissues and mouse models, we further confirmed that developmentally programmed 3′ CGI methylation confers tissue- and cell-type-specific gene activation in vivo. Importantly, luciferase reporter assays provided evidence that 3′ CGI methylation regulates transcriptional activation via a CTCF-dependent enhancer-blocking mechanism. These findings expand the classic view of mammalian CGI methylation as a mechanism for transcriptional silencing and indicate a functional role for 3′ CGI methylation in developmental gene regulation. PMID:23459939

  4. Methylation variable position profiles of hMLH1 promoter CpG islands in human sporadic colorectal carcinoma.

    PubMed

    Huang, Qing; Huang, Jun-Fu; Zhang, Bo; Baum, Larry; Fu, Wei-Ling

    2012-03-01

    Aberrant hypermethylation of CpG islands (CGIs) in hMLH1 promoter regions has been well known to play an important role in the tumorigenesis of human sporadic colorectal carcinoma (SCRC). In this study, bisulfite sequencing was performed to analyze the methylation variable positions (MVPs) profiles of hMLH1 promoter CGIs in 30 clinical SCRC patients, and further analysis was carried out to evaluate the associations between the CGI methylation and the clinicopathological features in SCRC. Among the 2 CGIs in the hMLH1 promoter, that is, CGI-I and CGI-II, 20% (6/30) and 13% (4/30) of the patients had methylated CGI-I and CGI-II, respectively. Suppressed expression of hMLH1was significantly correlated with methylation of CGI-I but not CGI-II. Further analysis of the MVP profiles of CGI-I showed that most of the MVPs were hypermethylated and others were poorly methylated or unmethylated. The profiles could be classified into at least 4 groups based on the methylation status of 3 MVPs at positions 21 to 23 in CGI-I. All 6 patients with methylated CGI-I belonged to group I. This result suggests that the above 3 MVPs in CGI-I should be a targeted region to further analyze the epigenetic features of hMLH1 in human SCRC. Our results further suggest that MVP profiling is useful for identifying the aberrantly methylated CGIs associated with suppressed gene expression.

  5. Genome-wide CpG island methylation and intergenic demethylation propensities vary among different tumor sites.

    PubMed

    Lee, Seung-Tae; Wiemels, Joseph L

    2016-02-18

    The epigenetic landscape of cancer includes both focal hypermethylation and broader hypomethylation in a genome-wide manner. By means of a comprehensive genomic analysis on 6637 tissues of 21 tumor types, we here show that the degrees of overall methylation in CpG island (CGI) and demethylation in intergenic regions, defined as 'backbone', largely vary among different tumors. Depending on tumor type, both CGI methylation and backbone demethylation are often associated with clinical, epidemiological and biological features such as age, sex, smoking history, anatomic location, histological type and grade, stage, molecular subtype and biological pathways. We found connections between CGI methylation and hypermutability, microsatellite instability, IDH1 mutation, 19p gain and polycomb features, and backbone demethylation with chromosomal instability, NSD1 and TP53 mutations, 5q and 19p loss and long repressive domains. These broad epigenetic patterns add a new dimension to our understanding of tumor biology and its clinical implications. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  6. Profiling CpG island field methylation in both morphologically normal and neoplastic human colonic mucosa.

    PubMed

    Belshaw, N J; Elliott, G O; Foxall, R J; Dainty, J R; Pal, N; Coupe, A; Garg, D; Bradburn, D M; Mathers, J C; Johnson, I T

    2008-07-08

    Aberrant CpG island (CGI) methylation occurs early in colorectal neoplasia. Quantitative methylation-specific PCR profiling applied to biopsies was used to quantify low levels of CGI methylation of 18 genes in the morphologically normal colonic mucosa of neoplasia-free subjects, adenomatous polyp patients, cancer patients and their tumours. Multivariate statistical analyses distinguished tumour from mucosa with a sensitivity of 78.9% and a specificity of 100% (P=3 x 10(-7)). In morphologically normal mucosa, age-dependent CGI methylation was observed for APC, AXIN2, DKK1, HPP1, N33, p16, SFRP1, SFRP2 and SFRP4 genes, and significant differences in CGI methylation levels were detected between groups. Multinomial logistic regression models based on the CGI methylation profiles from normal mucosa correctly identified 78.9% of cancer patients and 87.9% of non-cancer (neoplasia-free+polyp) patients (P=4.93 x 10(-7)) using APC, HPP1, p16, SFRP4, WIF1 and ESR1 methylation as the most informative variables. Similarly, CGI methylation of SFRP4, SFRP5 and WIF1 correctly identified 61.5% of polyp patients and 78.9% of neoplasia-free subjects (P=0.0167). The apparently normal mucosal field of patients presenting with neoplasia has evidently undergone significant epigenetic modification. Methylation of the genes selected by the models may play a role in the earliest stages of the development of colorectal neoplasia.

  7. Bisulfite-independent analysis of CpG island methylation enables genome-scale stratification of single cells

    PubMed Central

    Han, Lin; Wu, Hua-Jun; Zhu, Haiying; Kim, Kun-Yong; Marjani, Sadie L.; Riester, Markus; Euskirchen, Ghia; Zi, Xiaoyuan; Yang, Jennifer; Han, Jasper; Snyder, Michael; Park, In-Hyun; Irizarry, Rafael; Weissman, Sherman M.

    2017-01-01

    Abstract Conventional DNA bisulfite sequencing has been extended to single cell level, but the coverage consistency is insufficient for parallel comparison. Here we report a novel method for genome-wide CpG island (CGI) methylation sequencing for single cells (scCGI-seq), combining methylation-sensitive restriction enzyme digestion and multiple displacement amplification for selective detection of methylated CGIs. We applied this method to analyzing single cells from two types of hematopoietic cells, K562 and GM12878 and small populations of fibroblasts and induced pluripotent stem cells. The method detected 21 798 CGIs (76% of all CGIs) per cell, and the number of CGIs consistently detected from all 16 profiled single cells was 20 864 (72.7%), with 12 961 promoters covered. This coverage represents a substantial improvement over results obtained using single cell reduced representation bisulfite sequencing, with a 66-fold increase in the fraction of consistently profiled CGIs across individual cells. Single cells of the same type were more similar to each other than to other types, but also displayed epigenetic heterogeneity. The method was further validated by comparing the CpG methylation pattern, methylation profile of CGIs/promoters and repeat regions and 41 classes of known regulatory markers to the ENCODE data. Although not every minor methylation differences between cells are detectable, scCGI-seq provides a solid tool for unsupervised stratification of a heterogeneous cell population. PMID:28126923

  8. A CpG island methylator phenotype in acute myeloid leukemia independent of IDH mutations and associated with a favorable outcome.

    PubMed

    Kelly, A D; Kroeger, H; Yamazaki, J; Taby, R; Neumann, F; Yu, S; Lee, J T; Patel, B; Li, Y; He, R; Liang, S; Lu, Y; Cesaroni, M; Pierce, S A; Kornblau, S M; Bueso-Ramos, C E; Ravandi, F; Kantarjian, H M; Jelinek, J; Issa, J-Pj

    2017-10-01

    Genetic changes are infrequent in acute myeloid leukemia (AML) compared with other malignancies and often involve epigenetic regulators, suggesting that an altered epigenome may underlie AML biology and outcomes. In 96 AML cases including 65 pilot samples selected for cured/not-cured, we found higher CpG island (CGI) promoter methylation in cured patients. Expanded genome-wide digital restriction enzyme analysis of methylation data revealed a CGI methylator phenotype independent of IDH1/2 mutations we term AML-CGI methylator phenotype (CIMP) (A-CIMP + ). A-CIMP was associated with longer overall survival (OS) in this data set (median OS, years: A-CIMP + =not reached, CIMP - =1.17; P=0.08). For validation we used 194 samples from The Cancer Genome Atlas interrogated with Illumina 450k methylation arrays where we confirmed longer OS in A-CIMP (median OS, years: A-CIMP + =2.34, A-CIMP - =1.00; P=0.01). Hypermethylation in A-CIMP + favored CGIs (OR: CGI/non-CGI=5.21), and while A-CIMP + was enriched in CEBPA (P=0.002) and WT1 mutations (P=0.02), 70% of cases lacked either mutation. Hypermethylated genes in A-CIMP + function in pluripotency maintenance, and a gene expression signature of A-CIMP was associated with outcomes in multiple data sets. We conclude that CIMP in AML cannot be explained solely by gene mutations (for example, IDH1/2, TET2), and that curability in A-CIMP + AML should be validated prospectively.

  9. Bisulfite-independent analysis of CpG island methylation enables genome-scale stratification of single cells.

    PubMed

    Han, Lin; Wu, Hua-Jun; Zhu, Haiying; Kim, Kun-Yong; Marjani, Sadie L; Riester, Markus; Euskirchen, Ghia; Zi, Xiaoyuan; Yang, Jennifer; Han, Jasper; Snyder, Michael; Park, In-Hyun; Irizarry, Rafael; Weissman, Sherman M; Michor, Franziska; Fan, Rong; Pan, Xinghua

    2017-06-02

    Conventional DNA bisulfite sequencing has been extended to single cell level, but the coverage consistency is insufficient for parallel comparison. Here we report a novel method for genome-wide CpG island (CGI) methylation sequencing for single cells (scCGI-seq), combining methylation-sensitive restriction enzyme digestion and multiple displacement amplification for selective detection of methylated CGIs. We applied this method to analyzing single cells from two types of hematopoietic cells, K562 and GM12878 and small populations of fibroblasts and induced pluripotent stem cells. The method detected 21 798 CGIs (76% of all CGIs) per cell, and the number of CGIs consistently detected from all 16 profiled single cells was 20 864 (72.7%), with 12 961 promoters covered. This coverage represents a substantial improvement over results obtained using single cell reduced representation bisulfite sequencing, with a 66-fold increase in the fraction of consistently profiled CGIs across individual cells. Single cells of the same type were more similar to each other than to other types, but also displayed epigenetic heterogeneity. The method was further validated by comparing the CpG methylation pattern, methylation profile of CGIs/promoters and repeat regions and 41 classes of known regulatory markers to the ENCODE data. Although not every minor methylation differences between cells are detectable, scCGI-seq provides a solid tool for unsupervised stratification of a heterogeneous cell population. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  10. Rare k-mer DNA: Identification of sequence motifs and prediction of CpG island and promoter.

    PubMed

    Mohamed Hashim, Ezzeddin Kamil; Abdullah, Rosni

    2015-12-21

    Empirical analysis on k-mer DNA has been proven as an effective tool in finding unique patterns in DNA sequences which can lead to the discovery of potential sequence motifs. In an extensive study of empirical k-mer DNA on hundreds of organisms, the researchers found unique multi-modal k-mer spectra occur in the genomes of organisms from the tetrapod clade only which includes all mammals. The multi-modality is caused by the formation of the two lowest modes where k-mers under them are referred as the rare k-mers. The suppression of the two lowest modes (or the rare k-mers) can be attributed to the CG dinucleotide inclusions in them. Apart from that, the rare k-mers are selectively distributed in certain genomic features of CpG Island (CGI), promoter, 5' UTR, and exon. We correlated the rare k-mers with hundreds of annotated features using several bioinformatic tools, performed further intrinsic rare k-mer analyses within the correlated features, and modeled the elucidated rare k-mer clustering feature into a classifier to predict the correlated CGI and promoter features. Our correlation results show that rare k-mers are highly associated with several annotated features of CGI, promoter, 5' UTR, and open chromatin regions. Our intrinsic results show that rare k-mers have several unique topological, compositional, and clustering properties in CGI and promoter features. Finally, the performances of our RWC (rare-word clustering) method in predicting the CGI and promoter features are ranked among the top three, in eight of the CGI and promoter evaluations, among eight of the benchmarked datasets. Crown Copyright © 2015. Published by Elsevier Ltd. All rights reserved.

  11. Unique patterns of CpG island methylation in inflammatory bowel disease-associated colorectal cancers

    PubMed Central

    Olaru, Alexandru V.; Cheng, Yulan; Agarwal, Rachana; Yang, Jian; David, Stefan; Abraham, John M.; Yu, Wayne; Lazarev, Mark; Brant, Steven R.; Marohn, Michael R.; Hutcheon, David F.; Harpaz, Noam; Meltzer, Stephen J.; Mori, Yuriko

    2011-01-01

    Objective CpG island (CGI) hypermethylation at discrete loci is a prevalent cancer-promoting abnormality in sporadic colorectal carcinomas (S-CRCs). We investigated genome-wide CGI methylation in inflammatory bowel disease (IBD)-associated CRCs (IBD-CRCs). Design Methylation microarray analyses were conducted on 7 IBD-CRCs, 17 S-CRCs, and 8 normal control colonic tissues from patients without CRC or IBD. CGI methylator phenotype (CIMP), a surrogate marker for widespread cancer-specific CGI hypermethylation, was examined in 30 IBD-CRCs and 43 S-CRCs. Results The genome-wide CGI methylation pattern of IBD-CRCs was CIMP status-dependent. Based on methylation array data profiling of all autosomal loci, CIMP+ IBD-CRCs grouped together with S-CRCs, while CIMP− IBD-CRCs grouped together with control tissues. CIMP− IBD-CRCs demonstrated less methylation than did age-matched CIMP− S-CRCs at all autosomal CGIs (z-score −0.17 vs. 0.09, p=3×10−3) and CRC-associated hypermethylation target CGIs (z-score −0.43 vs. 0.68, p=1×10-4). Age-associated hypermethylation target CGIs were significantly overrepresented in CGIs that were hypermethylated in S-CRCs (p=1×10−192), but not in CGIs that were hypermethylated in IBD-CRCs (p=0.11). In contrast, KRAS mutation prevalence were similar between IBD-CRCs and S-CRCs. Notably, CIMP+ prevalence was significantly higher in older than in younger IBD-CRC cases (4.2% vs. 50.0%, p=0.02), but not in S-CRC cases (16.7% vs. 9.7%, p=0.92). Conclusions Cancer-specific CGI hypermethylation and age-associated CGI hypermethylation are diminished in IBD-CRCs relative to S-CRCs, while KRAS mutation rate is comparable between these cancers. CGI hypermethylation appears to play only a minor role in IBD-associated carcinogenesis. We speculate that aging, rather than inflammation per se, promotes CIMP+ CRCs in IBD patients. PMID:21830278

  12. Identification of regions correlating MGMT promoter methylation and gene expression in glioblastomas

    PubMed Central

    Everhard, Sibille; Tost, Jörg; Abdalaoui, Hafida El; Crinière, Emmanuelle; Busato, Florence; Marie, Yannick; Gut, Ivo G.; Sanson, Marc; Mokhtari, Karima; Laigle-Donadey, Florence; Hoang-Xuan, Khê; Delattre, Jean-Yves; Thillet, Joëlle

    2009-01-01

    The O6-methylguanine-DNA methyltransferase gene (MGMT) is methylated in several cancers, including gliomas. However, the functional role of cysteine-phosphate-guanine (CpG) island (CGI) methylation in MGMT silencing is still controversial. The aim of this study was to investigate whether MGMT CGI methylation correlates inversely with RNA expression of MGMT in glioblastomas and to determine the CpG region whose methylation best reflects the level of expression. The methylation level of CpG sites that are potentially related to expression was investigated in 54 glioblastomas by pyrosequencing, a highly quantitative method, and analyzed with respect to their MGMT mRNA expression status. Three groups of patients were identified according to the methylation pattern of all 52 analyzed CpG sites. Overall, an 85% rate of concordance was observed between methylation and expression (p < 0.0001). When analyzing each CpG separately, six CpG sites were highly correlated with expression (p < 0.0001), and two CpG regions could be used as surrogate markers for RNA expression in 81.5% of the patients. This study indicates that there is good statistical agreement between MGMT methylation and expression, and that some CpG regions better reflect MGMT expression than do others. However, if transcriptional repression is the key mechanism in explaining the higher chemosensitivity of MGMT-methylated tumors, a substantial rate of discordance should lead clinicians to be cautious when deciding on a therapeutic strategy based on MGMT methylation status alone. PMID:19224763

  13. Identification of regions correlating MGMT promoter methylation and gene expression in glioblastomas.

    PubMed

    Everhard, Sibille; Tost, Jörg; El Abdalaoui, Hafida; Crinière, Emmanuelle; Busato, Florence; Marie, Yannick; Gut, Ivo G; Sanson, Marc; Mokhtari, Karima; Laigle-Donadey, Florence; Hoang-Xuan, Khê; Delattre, Jean-Yves; Thillet, Joëlle

    2009-08-01

    The O(6)-methylguanine-DNA methyltransferase gene (MGMT) is methylated in several cancers, including gliomas. However, the functional role of cysteine-phosphate-guanine (CpG) island (CGI) methylation in MGMT silencing is still controversial. The aim of this study was to investigate whether MGMT CGI methylation correlates inversely with RNA expression of MGMT in glioblastomas and to determine the CpG region whose methylation best reflects the level of expression. The methylation level of CpG sites that are potentially related to expression was investigated in 54 glioblastomas by pyrosequencing, a highly quantitative method, and analyzed with respect to their MGMT mRNA expression status. Three groups of patients were identified according to the methylation pattern of all 52 analyzed CpG sites. Overall, an 85% rate of concordance was observed between methylation and expression (p < 0.0001). When analyzing each CpG separately, six CpG sites were highly correlated with expression (p < 0.0001), and two CpG regions could be used as surrogate markers for RNA expression in 81.5% of the patients. This study indicates that there is good statistical agreement between MGMT methylation and expression, and that some CpG regions better reflect MGMT expression than do others. However, if transcriptional repression is the key mechanism in explaining the higher chemosensitivity of MGMT-methylated tumors, a substantial rate of discordance should lead clinicians to be cautious when deciding on a therapeutic strategy based on MGMT methylation status alone.

  14. A CpG island methylator phenotype in acute myeloid leukemia independent of IDH mutations and associated with a favorable outcome

    PubMed Central

    Kelly, Andrew D.; Kroeger, Heike; Yamazaki, Jumpei; Taby, Rodolphe; Neumann, Frank; Yu, Sijia; Lee, Justin T.; Patel, Bela; Li, Yuesheng; He, Rong; Liang, Shoudan; Lu, Yue; Cesaroni, Matteo; Pierce, Sherry A.; Kornblau, Steven M.; Bueso-Ramos, Carlos E.; Ravandi, Farhad; Kantarjian, Hagop M.; Jelinek, Jaroslav; Issa, Jean-Pierre J.

    2016-01-01

    Genetic changes are infrequent in acute myeloid leukemia (AML) compared to other malignancies and often involve epigenetic regulators, suggesting that an altered epigenome may underlie AML biology and outcomes. In 96 AML cases including 65 pilot samples selected for cured/not-cured, we found higher CpG island (CGI) promoter methylation in cured patients. Expanded genome-wide digital restriction enzyme analysis of methylation (DREAM) data revealed a CGI methylator phenotype independent of IDH1/2 mutations we term AML-CIMP (A-CIMP+). A-CIMP was associated with longer overall survival (OS) in this dataset (median OS, years: A-CIMP+ = Not reached, A-CIMP− =1.17; P=0.08). For validation we used 194 samples from The Cancer Genome Atlas interrogated with Illumina 450k methylation arrays where we confirmed longer OS in A-CIMP (median OS, years: A-CIMP+ =2.34, A-CIMP− =1.00; P=0.01). Hypermethylation in A-CIMP favored CGIs (OR: CGI/non-CGI=5.21), and while A-CIMP was enriched in CEBPA (P=0.002) and WT1 mutations (P=0.02), 70% of cases lacked either mutation. Hypermethylated genes in A-CIMP function in pluripotency maintenance, and a gene expression signature of A-CIMP was associated with outcomes in multiple datasets. We conclude that CIMP in AML cannot be explained solely by gene mutations (e.g. IDH1/2, TET2), and that curability in A-CIMP+ AML should be validated prospectively. PMID:28074068

  15. Protection of CpG islands from DNA methylation is DNA-encoded and evolutionarily conserved

    PubMed Central

    Long, Hannah K.; King, Hamish W.; Patient, Roger K.; Odom, Duncan T.; Klose, Robert J.

    2016-01-01

    DNA methylation is a repressive epigenetic modification that covers vertebrate genomes. Regions known as CpG islands (CGIs), which are refractory to DNA methylation, are often associated with gene promoters and play central roles in gene regulation. Yet how CGIs in their normal genomic context evade the DNA methylation machinery and whether these mechanisms are evolutionarily conserved remains enigmatic. To address these fundamental questions we exploited a transchromosomic animal model and genomic approaches to understand how the hypomethylated state is formed in vivo and to discover whether mechanisms governing CGI formation are evolutionarily conserved. Strikingly, insertion of a human chromosome into mouse revealed that promoter-associated CGIs are refractory to DNA methylation regardless of host species, demonstrating that DNA sequence plays a central role in specifying the hypomethylated state through evolutionarily conserved mechanisms. In contrast, elements distal to gene promoters exhibited more variable methylation between host species, uncovering a widespread dependence on nucleotide frequency and occupancy of DNA-binding transcription factors in shaping the DNA methylation landscape away from gene promoters. This was exemplified by young CpG rich lineage-restricted repeat sequences that evaded DNA methylation in the absence of co-evolved mechanisms targeting methylation to these sequences, and species specific DNA binding events that protected against DNA methylation in CpG poor regions. Finally, transplantation of mouse chromosomal fragments into the evolutionarily distant zebrafish uncovered the existence of a mechanistically conserved and DNA-encoded logic which shapes CGI formation across vertebrate species. PMID:27084945

  16. Orphan and gene related CpG Islands follow power-law-like distributions in several genomes: evidence of function-related and taxonomy-related modes of distribution.

    PubMed

    Tsiagkas, Giannis; Nikolaou, Christoforos; Almirantis, Yannis

    2014-12-01

    CpG Islands (CGIs) are compositionally defined short genomic stretches, which have been studied in the human, mouse, chicken and later in several other genomes. Initially, they were assigned the role of transcriptional regulation of protein-coding genes, especially the house-keeping ones, while more recently there is found evidence that they are involved in several other functions as well, which might include regulation of the expression of RNA genes, DNA replication etc. Here, an investigation of their distributional characteristics in a variety of genomes is undertaken for both whole CGI populations as well as for CGI subsets that lie away from known genes (gene-unrelated or "orphan" CGIs). In both cases power-law-like linearity in double logarithmic scale is found. An evolutionary model, initially put forward for the explanation of a similar pattern found in gene populations is implemented. It includes segmental duplication events and eliminations of most of the duplicated CGIs, while a moderate rate of non-duplicated CGI eliminations is also applied in some cases. Simulations reproduce all the main features of the observed inter-CGI chromosomal size distributions. Our results on power-law-like linearity found in orphan CGI populations suggest that the observed distributional pattern is independent of the analogous pattern that protein coding segments were reported to follow. The power-law-like patterns in the genomic distributions of CGIs described herein are found to be compatible with several other features of the composition, abundance or functional role of CGIs reported in the current literature across several genomes, on the basis of the proposed evolutionary model. Copyright © 2014 Elsevier Ltd. All rights reserved.

  17. Conserved Role of Intragenic DNA Methylation in Regulating Alternative Promoters

    PubMed Central

    Maunakea, Alika K.; Nagarajan, Raman P.; Bilenky, Mikhail; Ballinger, Tracy J.; D’Souza, Cletus; Fouse, Shaun D.; Johnson, Brett E.; Hong, Chibo; Nielsen, Cydney; Zhao, Yongjun; Turecki, Gustavo; Delaney, Allen; Varhol, Richard; Thiessen, Nina; Shchors, Ksenya; Heine, Vivi M.; Rowitch, David H.; Xing, Xiaoyun; Fiore, Chris; Schillebeeckx, Maximiliaan; Jones, Steven J.M.; Haussler, David; Marra, Marco A.; Hirst, Martin; Wang, Ting; Costello, Joseph F.

    2014-01-01

    While the methylation of DNA in 5′ promoters suppresses gene expression, the role of DNA methylation in gene bodies is unclear1–5. In mammals, tissue- and cell type-specific methylation is present in a small percentage of 5′ CpG island (CGI) promoters, while a far greater proportion occurs across gene bodies, coinciding with highly conserved sequences5–10. Tissue-specific intragenic methylation might reduce,3 or, paradoxically, enhance transcription elongation efficiency1,2,4,5. Capped analysis of gene expression (CAGE) experiments also indicate that transcription commonly initiates within and between genes11–15. To investigate the role of intragenic methylation, we generated a map of DNA methylation from human brain encompassing 24.7 million of the 28 million CpG sites. From the dense, high-resolution coverage of CpG islands, the majority of methylated CpG islands were revealed to be in intragenic and intergenic regions, while less than 3% of CpG islands in 5′ promoters were methylated. The CpG islands in all three locations overlapped with RNA markers of transcription initiation, and unmethylated CpG islands also overlapped significantly with trimethylation of H3K4, a histone modification enriched at promoters16. The general and CpG-island-specific patterns of methylation are conserved in mouse tissues. An in-depth investigation of the human SHANK3 locus17,18 and its mouse homologue demonstrated that this tissue-specific DNA methylation regulates intragenic promoter activity in vitro and in vivo. These methylation-regulated, alternative transcripts are expressed in a tissue and cell type-specific manner, and are expressed differentially within a single cell type from distinct brain regions. These results support a major role for intragenic methylation in regulating cell context-specific alternative promoters in gene bodies. PMID:20613842

  18. Protection of CpG islands from DNA methylation is DNA-encoded and evolutionarily conserved.

    PubMed

    Long, Hannah K; King, Hamish W; Patient, Roger K; Odom, Duncan T; Klose, Robert J

    2016-08-19

    DNA methylation is a repressive epigenetic modification that covers vertebrate genomes. Regions known as CpG islands (CGIs), which are refractory to DNA methylation, are often associated with gene promoters and play central roles in gene regulation. Yet how CGIs in their normal genomic context evade the DNA methylation machinery and whether these mechanisms are evolutionarily conserved remains enigmatic. To address these fundamental questions we exploited a transchromosomic animal model and genomic approaches to understand how the hypomethylated state is formed in vivo and to discover whether mechanisms governing CGI formation are evolutionarily conserved. Strikingly, insertion of a human chromosome into mouse revealed that promoter-associated CGIs are refractory to DNA methylation regardless of host species, demonstrating that DNA sequence plays a central role in specifying the hypomethylated state through evolutionarily conserved mechanisms. In contrast, elements distal to gene promoters exhibited more variable methylation between host species, uncovering a widespread dependence on nucleotide frequency and occupancy of DNA-binding transcription factors in shaping the DNA methylation landscape away from gene promoters. This was exemplified by young CpG rich lineage-restricted repeat sequences that evaded DNA methylation in the absence of co-evolved mechanisms targeting methylation to these sequences, and species specific DNA binding events that protected against DNA methylation in CpG poor regions. Finally, transplantation of mouse chromosomal fragments into the evolutionarily distant zebrafish uncovered the existence of a mechanistically conserved and DNA-encoded logic which shapes CGI formation across vertebrate species. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  19. Profile analysis and prediction of tissue-specific CpG island methylation classes

    PubMed Central

    2009-01-01

    Background The computational prediction of DNA methylation has become an important topic in the recent years due to its role in the epigenetic control of normal and cancer-related processes. While previous prediction approaches focused merely on differences between methylated and unmethylated DNA sequences, recent experimental results have shown the presence of much more complex patterns of methylation across tissues and time in the human genome. These patterns are only partially described by a binary model of DNA methylation. In this work we propose a novel approach, based on profile analysis of tissue-specific methylation that uncovers significant differences in the sequences of CpG islands (CGIs) that predispose them to a tissue- specific methylation pattern. Results We defined CGI methylation profiles that separate not only between constitutively methylated and unmethylated CGIs, but also identify CGIs showing a differential degree of methylation across tissues and cell-types or a lack of methylation exclusively in sperm. These profiles are clearly distinguished by a number of CGI attributes including their evolutionary conservation, their significance, as well as the evolutionary evidence of prior methylation. Additionally, we assess profile functionality with respect to the different compartments of protein coding genes and their possible use in the prediction of DNA methylation. Conclusion Our approach provides new insights into the biological features that determine if a CGI has a functional role in the epigenetic control of gene expression and the features associated with CGI methylation susceptibility. Moreover, we show that the ability to predict CGI methylation is based primarily on the quality of the biological information used and the relationships uncovered between different sources of knowledge. The strategy presented here is able to predict, besides the constitutively methylated and unmethylated classes, two more tissue specific methylation classes conserving the accuracy provided by leading binary methylation classification methods. PMID:19383127

  20. Allele-specific DNA methylation and its interplay with repressive histone marks at promoter-mutant TERT genes

    PubMed Central

    Stern, Josh Lewis; Paucek, Richard D.; Huang, Franklin W.; Ghandi, Mahmoud; Nwumeh, Ronald; Costello, James C.; Cech, Thomas R.

    2017-01-01

    SUMMARY A mutation in the promoter of the Telomerase Reverse Transcriptase (TERT) gene is the most frequent noncoding mutation in cancer. The mutation drives unusual monoallelic expression of TERT, allowing immortalization. Here we find that DNA methylation of the TERT CpG Island (CGI) is also allele-specific in multiple cancers. The expressed allele is hypomethylated, which is opposite to cancers without TERT promoter mutations. The continued presence of Polycomb repressive complex 2 (PRC2) on the inactive allele suggests that histone marks of repressed chromatin may be causally linked to high DNA methylation. Consistent with this hypothesis, TERT promoter DNA containing 5-methyl-CpG has much increased affinity for PRC2 in vitro. Thus, CpG methylation and histone marks appear to collaborate to maintain the two TERT alleles in different epigenetic states in TERT promoter-mutant cancers. Finally, in several cancers DNA methylation levels at the TERT CGI correlate with altered patient survival. PMID:29281820

  1. Allele-Specific DNA Methylation and Its Interplay with Repressive Histone Marks at Promoter-Mutant TERT Genes.

    PubMed

    Stern, Josh Lewis; Paucek, Richard D; Huang, Franklin W; Ghandi, Mahmoud; Nwumeh, Ronald; Costello, James C; Cech, Thomas R

    2017-12-26

    A mutation in the promoter of the Telomerase Reverse Transcriptase (TERT) gene is the most frequent noncoding mutation in cancer. The mutation drives unusual monoallelic expression of TERT, allowing immortalization. Here, we find that DNA methylation of the TERT CpG island (CGI) is also allele-specific in multiple cancers. The expressed allele is hypomethylated, which is opposite to cancers without TERT promoter mutations. The continued presence of Polycomb repressive complex 2 (PRC2) on the inactive allele suggests that histone marks of repressed chromatin may be causally linked to high DNA methylation. Consistent with this hypothesis, TERT promoter DNA containing 5-methyl-CpG has much increased affinity for PRC2 in vitro. Thus, CpG methylation and histone marks appear to collaborate to maintain the two TERT alleles in different epigenetic states in TERT promoter mutant cancers. Finally, in several cancers, DNA methylation levels at the TERT CGI correlate with altered patient survival. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  2. Combination of methylated-DNA precipitation and methylation-sensitive restriction enzymes (COMPARE-MS) for the rapid, sensitive and quantitative detection of DNA methylation.

    PubMed

    Yegnasubramanian, Srinivasan; Lin, Xiaohui; Haffner, Michael C; DeMarzo, Angelo M; Nelson, William G

    2006-02-09

    Hypermethylation of CpG island (CGI) sequences is a nearly universal somatic genome alteration in cancer. Rapid and sensitive detection of DNA hypermethylation would aid in cancer diagnosis and risk stratification. We present a novel technique, called COMPARE-MS, that can rapidly and quantitatively detect CGI hypermethylation with high sensitivity and specificity in hundreds of samples simultaneously. To quantitate CGI hypermethylation, COMPARE-MS uses real-time PCR of DNA that was first digested by methylation-sensitive restriction enzymes and then precipitated by methyl-binding domain polypeptides immobilized on a magnetic solid matrix. We show that COMPARE-MS could detect five genome equivalents of methylated CGIs in a 1000- to 10,000-fold excess of unmethylated DNA. COMPARE-MS was used to rapidly quantitate hypermethylation at multiple CGIs in >155 prostate tissues, including benign and malignant prostate specimens, and prostate cell lines. This analysis showed that GSTP1, MDR1 and PTGS2 CGI hypermethylation as determined by COMPARE-MS could differentiate between malignant and benign prostate with sensitivities >95% and specificities approaching 100%. This novel technology could significantly improve our ability to detect CGI hypermethylation.

  3. Quantitative profiling of CpG island methylation in human stool for colorectal cancer detection.

    PubMed

    Elliott, Giles O; Johnson, Ian T; Scarll, Jane; Dainty, Jack; Williams, Elizabeth A; Garg, D; Coupe, Amanda; Bradburn, David M; Mathers, John C; Belshaw, Nigel J

    2013-01-01

    The aims of this study were to investigate the use of quantitative CGI methylation data from stool DNA to classify colon cancer patients and to relate stool CGI methylation levels to those found in corresponding tissue samples. We applied a quantitative methylation-specific PCR assay to determine CGI methylation levels of six genes, previously shown to be aberrantly methylated during colorectal carcinogenesis. Assays were performed on DNA from biopsies of "normal" mucosa and stool samples from 57 patients classified as disease-free, adenoma, or cancer by endoscopy, and in tumour tissue from cancer patients. Additionally, CGI methylation was analysed in stool DNA from an asymptomatic population of individuals covering a broad age range (mean = 47 ± 24 years) CGI methylation levels in stool DNA were significantly higher than in DNA from macroscopically normal mucosa, and a significant correlation between stool and mucosa was observed for ESR1 only. Multivariate statistical analyses using the methylation levels of each CGI in stool DNA as a continuous variable revealed a highly significant (p = 0.003) classification of cancer vs. non-cancer (adenoma + disease-free) patients (sensitivity = 65 %, specificity = 81 %). CGI methylation profiling of stool DNA successfully identified patients with cancer despite the methylation status of CGIs in stool DNA not generally reflecting those in DNA from the colonic mucosa.

  4. Supra-physiological folic acid concentrations induce aberrant DNA methylation in normal human cells in vitro.

    PubMed

    Charles, Michelle A; Johnson, Ian T; Belshaw, Nigel J

    2012-07-01

    The micronutrients folate and selenium may modulate DNA methylation patterns by affecting intracellular levels of the methyl donor S-adenosylmethionine (SAM) and/or the product of methylation reactions S-adenosylhomocysteine (SAH). WI-38 fibroblasts and FHC colon epithelial cells were cultured in the presence of two forms of folate or four forms of selenium at physiologically-relevant doses, and their effects on LINE-1 methylation, gene-specific CpG island (CGI) methylation and intracellular SAM:SAH were determined. At physiologically-relevant doses the forms of folate or selenium had no effect on LINE-1 or CGI methylation, nor on intracellular SAM:SAH. However the commercial cell culture media used for the selenium studies, containing supra-physiological concentrations of folic acid, induced LINE-1 hypomethylation, CGI hypermethylation and decreased intracellular SAM:SAH in both cell lines. We conclude that the exposure of normal human cells to supra-physiological folic acid concentrations present in commercial cell culture media perturbs the intracellular SAM:SAH ratio and induces aberrant DNA methylation.

  5. Genome-wide methylation patterns provide insight into differences in breast tumor biology between American women of African and European ancestry

    PubMed Central

    Ambrosone, Christine B.; Young, Allyson C.; Sucheston, Lara E.; Wang, Dan; Li, Yan; Liu, Song; Tang, Li; Hu, Quang; Freudenheim, Jo L.; Shields, Peter G.; Morrison, Carl D.; Demissie, Kitaw; Higgins, Michael J.

    2014-01-01

    American women of African ancestry (AA) are more likely than European-Americans (EA) to be diagnosed with aggressive, estrogen receptor (ER) negative breast tumors; mechanisms underlying these disparities are poorly understood. We conducted a genome wide (450K loci) methylation analysis to determine if there were differences in DNA methylation patterns between tumors from AA and EA women and if these differences were similar for both ER positive and ER negative breast cancer. Methylation levels at CpG loci within CpG islands (CGI)s and CGI-shores were significantly higher in tumors (n=138) than in reduction mammoplasty samples (n=124). In hierarchical cluster analysis, there was separation between tumor and normal samples, and in tumors, there was delineation by ER status, but not by ancestry. However, differential methylation analysis identified 157 CpG loci with a mean β value difference of at least 0.17 between races, with almost twice as many differences in ER-negative tumors compared to ER-positive cancers. This first genome-wide methylation study to address disparities indicates that there are likely differing etiologic pathways for the development of ER negative breast cancer between AA and EA women. Further investigation of the genes most differentially methylated by race in ER negative tumors can guide new approaches for cancer prevention and targeted therapies, and elucidate the biologic basis of breast cancer disparities. PMID:24368439

  6. DNA Methylation Status of the Estrogen Receptor α Gene in Canine Mammary Tumors.

    PubMed

    Brandão, Yara de Oliveira; Toledo, Mariana Busato; Chequin, Andressa; Cristo, Thierry Grima; Sousa, Renato Silva; Ramos, Edneia Amancio Souza; Klassen, Giseli

    2018-01-01

    Estrogen receptor α (ERα) has an important role in mammary carcinogenesis, prognosis, and treatment. In human and canine mammary cancer, the most aggressive tumors show loss of ERα expression, which in human breast cancer has been attributed to methylation of the cytosine followed by guanine (CpG) island within the estrogen receptor α gene ( ESR1) promoter. This study aimed to investigate the role of ESR1 CpG island (CGI) methylation in ERα expression in canine mammary tumors. Twenty-one canine mammary samples were sorted into three groups: malignant tumor (n = 9), benign tumor (n = 8), and normal gland (n = 4). Immunohistochemical analysis and reverse-transcription quantitative real-time PCR were performed to assess ERα expression and ESR1 mRNA levels. The methylation status was determined using sodium-bisulfite-treated DNA sequencing. All normal mammary glands and benign tumors showed high ERα expression (score range, 5-8). Six of the nine malignant tumors did not show ERα expression (score 0), two had score 2, and one had score 4. Lower ERα ( P < .005) and ESR1 mRNA levels ( P < .005) were found in malignant mammary tumors than in the other two groups. Canine ESR1 has an intragenic and non-promoter-associated CGI, different from humans. No significant variation in methylation percentage was observed among the groups, suggesting that ESR1 is not regulated by DNA methylation, unlike that in humans. This difference should be considered in further research using ERα as a biomarker for mammary tumors in canine studies on ERα-targeting therapy.

  7. KDM2B links the Polycomb Repressive Complex 1 (PRC1) to recognition of CpG islands

    PubMed Central

    Farcas, Anca M; Blackledge, Neil P; Sudbery, Ian; Long, Hannah K; McGouran, Joanna F; Rose, Nathan R; Lee, Sheena; Sims, David; Cerase, Andrea; Sheahan, Thomas W; Koseki, Haruhiko; Brockdorff, Neil; Ponting, Chris P; Kessler, Benedikt M; Klose, Robert J

    2012-01-01

    CpG islands (CGIs) are associated with most mammalian gene promoters. A subset of CGIs act as polycomb response elements (PREs) and are recognized by the polycomb silencing systems to regulate expression of genes involved in early development. How CGIs function mechanistically as nucleation sites for polycomb repressive complexes remains unknown. Here we discover that KDM2B (FBXL10) specifically recognizes non-methylated DNA in CGIs and recruits the polycomb repressive complex 1 (PRC1). This contributes to histone H2A lysine 119 ubiquitylation (H2AK119ub1) and gene repression. Unexpectedly, we also find that CGIs are occupied by low levels of PRC1 throughout the genome, suggesting that the KDM2B-PRC1 complex may sample CGI-associated genes for susceptibility to polycomb-mediated silencing. These observations demonstrate an unexpected and direct link between recognition of CGIs by KDM2B and targeting of the polycomb repressive system. This provides the basis for a new model describing the functionality of CGIs as mammalian PREs. DOI: http://dx.doi.org/10.7554/eLife.00205.001 PMID:23256043

  8. DNA methylation of intragenic CpG islands depends on their transcriptional activity during differentiation and disease

    PubMed Central

    Jeziorska, Danuta M.; Murray, Robert J. S.; De Gobbi, Marco; Gaentzsch, Ricarda; Garrick, David; Ayyub, Helena; Chen, Taiping; Li, En; Telenius, Jelena; Lynch, Magnus; Graham, Bryony; Smith, Andrew J. H.; Lund, Jonathan N.; Hughes, Jim R.; Higgs, Douglas R.

    2017-01-01

    The human genome contains ∼30,000 CpG islands (CGIs). While CGIs associated with promoters nearly always remain unmethylated, many of the ∼9,000 CGIs lying within gene bodies become methylated during development and differentiation. Both promoter and intragenic CGIs may also become abnormally methylated as a result of genome rearrangements and in malignancy. The epigenetic mechanisms by which some CGIs become methylated but others, in the same cell, remain unmethylated in these situations are poorly understood. Analyzing specific loci and using a genome-wide analysis, we show that transcription running across CGIs, associated with specific chromatin modifications, is required for DNA methyltransferase 3B (DNMT3B)-mediated DNA methylation of many naturally occurring intragenic CGIs. Importantly, we also show that a subgroup of intragenic CGIs is not sensitive to this process of transcription-mediated methylation and that this correlates with their individual intrinsic capacity to initiate transcription in vivo. We propose a general model of how transcription could act as a primary determinant of the patterns of CGI methylation in normal development and differentiation, and in human disease. PMID:28827334

  9. Enhanced sensitivity of CpG island search and primer design based on predicted CpG island position.

    PubMed

    Park, Hyun-Chul; Ahn, Eu-Ree; Jung, Ju Yeon; Park, Ji-Hye; Lee, Jee Won; Lim, Si-Keun; Kim, Won

    2018-05-01

    DNA methylation has important biological roles, such as gene expression regulation, as well as practical applications in forensics, such as in body fluid identification and age estimation. DNA methylation often occurs in the CpG site, and methylation within the CpG islands affects various cellular functions and is related to tissue-specific identification. Several programs have been developed to identify CpG islands; however, the size, location, and number of predicted CpG islands are not identical due to different search algorithms. In addition, they only provide structural information for predicted CpG islands without experimental information, such as primer design. We developed an analysis pipeline package, CpGPNP, to integrate CpG island prediction and primer design. CpGPNP predicts CpG islands more accurately and sensitively than other programs, and designs primers easily based on the predicted CpG island locations. The primer design function included standard, bisulfite, and methylation-specific PCR to identify the methylation of particular CpG sites. In this study, we performed CpG island prediction on all chromosomes and compared CpG island search performance of CpGPNP with other CpG island prediction programs. In addition, we compared the position of primers designed for a specific region within the predicted CpG island using other bisulfite PCR primer programs. The primers designed by CpGPNP were used to experimentally verify the amplification of the target region of markers for body fluid identification and age estimation. CpGPNP is freely available at http://forensicdna.kr/cpgpnp/. Copyright © 2018 Elsevier B.V. All rights reserved.

  10. CpG island mapping by epigenome prediction.

    PubMed

    Bock, Christoph; Walter, Jörn; Paulsen, Martina; Lengauer, Thomas

    2007-06-01

    CpG islands were originally identified by epigenetic and functional properties, namely, absence of DNA methylation and frequent promoter association. However, this concept was quickly replaced by simple DNA sequence criteria, which allowed for genome-wide annotation of CpG islands in the absence of large-scale epigenetic datasets. Although widely used, the current CpG island criteria incur significant disadvantages: (1) reliance on arbitrary threshold parameters that bear little biological justification, (2) failure to account for widespread heterogeneity among CpG islands, and (3) apparent lack of specificity when applied to the human genome. This study is driven by the idea that a quantitative score of "CpG island strength" that incorporates epigenetic and functional aspects can help resolve these issues. We construct an epigenome prediction pipeline that links the DNA sequence of CpG islands to their epigenetic states, including DNA methylation, histone modifications, and chromatin accessibility. By training support vector machines on epigenetic data for CpG islands on human Chromosomes 21 and 22, we identify informative DNA attributes that correlate with open versus compact chromatin structures. These DNA attributes are used to predict the epigenetic states of all CpG islands genome-wide. Combining predictions for multiple epigenetic features, we estimate the inherent CpG island strength for each CpG island in the human genome, i.e., its inherent tendency to exhibit an open and transcriptionally competent chromatin structure. We extensively validate our results on independent datasets, showing that the CpG island strength predictions are applicable and informative across different tissues and cell types, and we derive improved maps of predicted "bona fide" CpG islands. The mapping of CpG islands by epigenome prediction is conceptually superior to identifying CpG islands by widely used sequence criteria since it links CpG island detection to their characteristic epigenetic and functional states. And it is superior to purely experimental epigenome mapping for CpG island detection since it abstracts from specific properties that are limited to a single cell type or tissue. In addition, using computational epigenetics methods we could identify high correlation between the epigenome and characteristics of the DNA sequence, a finding which emphasizes the need for a better understanding of the mechanistic links between genome and epigenome.

  11. Predicting aberrant CpG island methylation

    PubMed Central

    Feltus, F. A.; Lee, E. K.; Costello, J. F.; Plass, C.; Vertino, P. M.

    2003-01-01

    Epigenetic silencing associated with aberrant methylation of promoter region CpG islands is one mechanism leading to loss of tumor suppressor function in human cancer. Profiling of CpG island methylation indicates that some genes are more frequently methylated than others, and that each tumor type is associated with a unique set of methylated genes. However, little is known about why certain genes succumb to this aberrant event. To address this question, we used Restriction Landmark Genome Scanning to analyze the susceptibility of 1,749 unselected CpG islands to de novo methylation driven by overexpression of DNA cytosine-5-methyltransferase 1 (DNMT1). We found that although the overall incidence of CpG island methylation was increased in cells overexpressing DNMT1, not all loci were equally affected. The majority of CpG islands (69.9%) were resistant to de novo methylation, regardless of DNMT1 overexpression. In contrast, we identified a subset of methylation-prone CpG islands (3.8%) that were consistently hypermethylated in multiple DNMT1 overexpressing clones. Methylation-prone and methylation-resistant CpG islands were not significantly different with respect to size, C+G content, CpG frequency, chromosomal location, or promoter association. We used DNA pattern recognition and supervised learning techniques to derive a classification function based on the frequency of seven novel sequence patterns that was capable of discriminating methylation-prone from methylation-resistant CpG islands with 82% accuracy. The data indicate that CpG islands differ in their intrinsic susceptibility to de novo methylation, and suggest that the propensity for a CpG island to become aberrantly methylated can be predicted based on its sequence context. PMID:14519846

  12. Predicting aberrant CpG island methylation.

    PubMed

    Feltus, F A; Lee, E K; Costello, J F; Plass, C; Vertino, P M

    2003-10-14

    Epigenetic silencing associated with aberrant methylation of promoter region CpG islands is one mechanism leading to loss of tumor suppressor function in human cancer. Profiling of CpG island methylation indicates that some genes are more frequently methylated than others, and that each tumor type is associated with a unique set of methylated genes. However, little is known about why certain genes succumb to this aberrant event. To address this question, we used Restriction Landmark Genome Scanning to analyze the susceptibility of 1,749 unselected CpG islands to de novo methylation driven by overexpression of DNA cytosine-5-methyltransferase 1 (DNMT1). We found that although the overall incidence of CpG island methylation was increased in cells overexpressing DNMT1, not all loci were equally affected. The majority of CpG islands (69.9%) were resistant to de novo methylation, regardless of DNMT1 overexpression. In contrast, we identified a subset of methylation-prone CpG islands (3.8%) that were consistently hypermethylated in multiple DNMT1 overexpressing clones. Methylation-prone and methylation-resistant CpG islands were not significantly different with respect to size, C+G content, CpG frequency, chromosomal location, or promoter association. We used DNA pattern recognition and supervised learning techniques to derive a classification function based on the frequency of seven novel sequence patterns that was capable of discriminating methylation-prone from methylation-resistant CpG islands with 82% accuracy. The data indicate that CpG islands differ in their intrinsic susceptibility to de novo methylation, and suggest that the propensity for a CpG island to become aberrantly methylated can be predicted based on its sequence context.

  13. A Hybrid Approach for CpG Island Detection in the Human Genome.

    PubMed

    Yang, Cheng-Hong; Lin, Yu-Da; Chiang, Yi-Cheng; Chuang, Li-Yeh

    2016-01-01

    CpG islands have been demonstrated to influence local chromatin structures and simplify the regulation of gene activity. However, the accurate and rapid determination of CpG islands for whole DNA sequences remains experimentally and computationally challenging. A novel procedure is proposed to detect CpG islands by combining clustering technology with the sliding-window method (PSO-based). Clustering technology is used to detect the locations of all possible CpG islands and process the data, thus effectively obviating the need for the extensive and unnecessary processing of DNA fragments, and thus improving the efficiency of sliding-window based particle swarm optimization (PSO) search. This proposed approach, named ClusterPSO, provides versatile and highly-sensitive detection of CpG islands in the human genome. In addition, the detection efficiency of ClusterPSO is compared with eight CpG island detection methods in the human genome. Comparison of the detection efficiency for the CpG islands in human genome, including sensitivity, specificity, accuracy, performance coefficient (PC), and correlation coefficient (CC), ClusterPSO revealed superior detection ability among all of the test methods. Moreover, the combination of clustering technology and PSO method can successfully overcome their respective drawbacks while maintaining their advantages. Thus, clustering technology could be hybridized with the optimization algorithm method to optimize CpG island detection. The prediction accuracy of ClusterPSO was quite high, indicating the combination of CpGcluster and PSO has several advantages over CpGcluster and PSO alone. In addition, ClusterPSO significantly reduced implementation time.

  14. Prediction of CpG-island function: CpG clustering vs. sliding-window methods

    PubMed Central

    2010-01-01

    Background Unmethylated stretches of CpG dinucleotides (CpG islands) are an outstanding property of mammal genomes. Conventionally, these regions are detected by sliding window approaches using %G + C, CpG observed/expected ratio and length thresholds as main parameters. Recently, clustering methods directly detect clusters of CpG dinucleotides as a statistical property of the genome sequence. Results We compare sliding-window to clustering (i.e. CpGcluster) predictions by applying new ways to detect putative functionality of CpG islands. Analyzing the co-localization with several genomic regions as a function of window size vs. statistical significance (p-value), CpGcluster shows a higher overlap with promoter regions and highly conserved elements, at the same time showing less overlap with Alu retrotransposons. The major difference in the prediction was found for short islands (CpG islets), often exclusively predicted by CpGcluster. Many of these islets seem to be functional, as they are unmethylated, highly conserved and/or located within the promoter region. Finally, we show that window-based islands can spuriously overlap several, differentially regulated promoters as well as different methylation domains, which might indicate a wrong merge of several CpG islands into a single, very long island. The shorter CpGcluster islands seem to be much more specific when concerning the overlap with alternative transcription start sites or the detection of homogenous methylation domains. Conclusions The main difference between sliding-window approaches and clustering methods is the length of the predicted islands. Short islands, often differentially methylated, are almost exclusively predicted by CpGcluster. This suggests that CpGcluster may be the algorithm of choice to explore the function of these short, but putatively functional CpG islands. PMID:20500903

  15. FBXL19 recruits CDK-Mediator to CpG islands of developmental genes priming them for activation during lineage commitment

    PubMed Central

    Dimitrova, Emilia; Nakayama, Manabu; Koseki, Yoko; Konietzny, Rebecca; Kessler, Benedikt M; Koseki, Haruhiko

    2018-01-01

    CpG islands are gene regulatory elements associated with the majority of mammalian promoters, yet how they regulate gene expression remains poorly understood. Here, we identify FBXL19 as a CpG island-binding protein in mouse embryonic stem (ES) cells and show that it associates with the CDK-Mediator complex. We discover that FBXL19 recruits CDK-Mediator to CpG island-associated promoters of non-transcribed developmental genes to prime these genes for activation during cell lineage commitment. We further show that recognition of CpG islands by FBXL19 is essential for mouse development. Together this reveals a new CpG island-centric mechanism for CDK-Mediator recruitment to developmental gene promoters in ES cells and a requirement for CDK-Mediator in priming these developmental genes for activation during cell lineage commitment. PMID:29809150

  16. Epigenetic conservation at gene regulatory elements revealed by non-methylated DNA profiling in seven vertebrates

    PubMed Central

    Long, Hannah K; Sims, David; Heger, Andreas; Blackledge, Neil P; Kutter, Claudia; Wright, Megan L; Grützner, Frank; Odom, Duncan T; Patient, Roger; Ponting, Chris P; Klose, Robert J

    2013-01-01

    Two-thirds of gene promoters in mammals are associated with regions of non-methylated DNA, called CpG islands (CGIs), which counteract the repressive effects of DNA methylation on chromatin. In cold-blooded vertebrates, computational CGI predictions often reside away from gene promoters, suggesting a major divergence in gene promoter architecture across vertebrates. By experimentally identifying non-methylated DNA in the genomes of seven diverse vertebrates, we instead reveal that non-methylated islands (NMIs) of DNA are a central feature of vertebrate gene promoters. Furthermore, NMIs are present at orthologous genes across vast evolutionary distances, revealing a surprising level of conservation in this epigenetic feature. By profiling NMIs in different tissues and developmental stages we uncover a unifying set of features that are central to the function of NMIs in vertebrates. Together these findings demonstrate an ancient logic for NMI usage at gene promoters and reveal an unprecedented level of epigenetic conservation across vertebrate evolution. DOI: http://dx.doi.org/10.7554/eLife.00348.001 PMID:23467541

  17. DNA motifs associated with aberrant CpG island methylation.

    PubMed

    Feltus, F Alex; Lee, Eva K; Costello, Joseph F; Plass, Christoph; Vertino, Paula M

    2006-05-01

    Epigenetic silencing involving the aberrant methylation of promoter region CpG islands is widely recognized as a tumor suppressor silencing mechanism in cancer. However, the molecular pathways underlying aberrant DNA methylation remain elusive. Recently we showed that, on a genome-wide level, CpG island loci differ in their intrinsic susceptibility to aberrant methylation and that this susceptibility can be predicted based on underlying sequence context. These data suggest that there are sequence/structural features that contribute to the protection from or susceptibility to aberrant methylation. Here we use motif elicitation coupled with classification techniques to identify DNA sequence motifs that selectively define methylation-prone or methylation-resistant CpG islands. Motifs common to 28 methylation-prone or 47 methylation-resistant CpG island-containing genomic fragments were determined using the MEME and MAST algorithms (). The five most discriminatory motifs derived from methylation-prone sequences were found to be associated with CpG islands in general and were nonrandomly distributed throughout the genome. In contrast, the eight most discriminatory motifs derived from the methylation-resistant CpG islands were randomly distributed throughout the genome. Interestingly, this latter group tended to associate with Alu and other repetitive sequences. Used together, the frequency of occurrence of these motifs successfully discriminated methylation-prone and methylation-resistant CpG island groups with an accuracy of 87% after 10-fold cross-validation. The motifs identified here are candidate methylation-targeting or methylation-protection DNA sequences.

  18. Methylation detection oligonucleotide microarray analysis: a high-resolution method for detection of CpG island methylation

    PubMed Central

    Kamalakaran, Sitharthan; Kendall, Jude; Zhao, Xiaoyue; Tang, Chunlao; Khan, Sohail; Ravi, Kandasamy; Auletta, Theresa; Riggs, Michael; Wang, Yun; Helland, Åslaug; Naume, Bjørn; Dimitrova, Nevenka; Børresen-Dale, Anne-Lise; Hicks, Jim; Lucito, Robert

    2009-01-01

    Methylation of CpG islands associated with genes can affect the expression of the proximal gene, and methylation of non-associated CpG islands correlates to genomic instability. This epigenetic modification has been shown to be important in many pathologies, from development and disease to cancer. We report the development of a novel high-resolution microarray that detects the methylation status of over 25 000 CpG islands in the human genome. Experiments were performed to demonstrate low system noise in the methodology and that the array probes have a high signal to noise ratio. Methylation measurements between different cell lines were validated demonstrating the accuracy of measurement. We then identified alterations in CpG islands, both those associated with gene promoters, as well as non-promoter-associated islands in a set of breast and ovarian tumors. We demonstrate that this methodology accurately identifies methylation profiles in cancer and in principle it can differentiate any CpG methylation alterations and can be adapted to analyze other species. PMID:19474344

  19. The role of DNA methylation in directing the functional organization of the cancer epigenome.

    PubMed

    Lay, Fides D; Liu, Yaping; Kelly, Theresa K; Witt, Heather; Farnham, Peggy J; Jones, Peter A; Berman, Benjamin P

    2015-04-01

    The holistic role of DNA methylation in the organization of the cancer epigenome is not well understood. Here we perform a comprehensive, high-resolution analysis of chromatin structure to compare the landscapes of HCT116 colon cancer cells and a DNA methylation-deficient derivative. The NOMe-seq accessibility assay unexpectedly revealed symmetrical and transcription-independent nucleosomal phasing across active, poised, and inactive genomic elements. DNA methylation abolished this phasing primarily at enhancers and CpG island (CGI) promoters, with little effect on insulators and non-CGI promoters. Abolishment of DNA methylation led to the context-specific reestablishment of the poised and active states of normal colon cells, which were marked in methylation-deficient cells by distinct H3K27 modifications and the presence of either well-phased nucleosomes or nucleosome-depleted regions, respectively. At higher-order genomic scales, we found that long, H3K9me3-marked domains had lower accessibility, consistent with a more compact chromatin structure. Taken together, our results demonstrate the nuanced and context-dependent role of DNA methylation in the functional, multiscale organization of cancer epigenomes. © 2015 Lay et al.; Published by Cold Spring Harbor Laboratory Press.

  20. Comprehensive analysis of CpG islands in human chromosomes 21 and 22

    NASA Astrophysics Data System (ADS)

    Takai, Daiya; Jones, Peter A.

    2002-03-01

    CpG islands are useful markers for genes in organisms containing 5-methylcytosine in their genomes. In addition, CpG islands located in the promoter regions of genes can play important roles in gene silencing during processes such as X-chromosome inactivation, imprinting, and silencing of intragenomic parasites. The generally accepted definition of what constitutes a CpG island was proposed in 1987 by Gardiner-Garden and Frommer [Gardiner-Garden, M. & Frommer, M. (1987) J. Mol. Biol. 196, 261-282] as being a 200-bp stretch of DNA with a C+G content of 50% and an observed CpG/expected CpG in excess of 0.6. Any definition of a CpG island is somewhat arbitrary, and this one, which was derived before the sequencing of mammalian genomes, will include many sequences that are not necessarily associated with controlling regions of genes but rather are associated with intragenomic parasites. We have therefore used the complete genomic sequences of human chromosomes 21 and 22 to examine the properties of CpG islands in different sequence classes by using a search algorithm that we have developed. Regions of DNA of greater than 500 bp with a G+C equal to or greater than 55% and observed CpG/expected CpG of 0.65 were more likely to be associated with the 5' regions of genes and this definition excluded most Alu-repetitive elements. We also used genome sequences to show strong CpG suppression in the human genome and slight suppression in Drosophila melanogaster and Saccharomyces cerevisiae. This finding is compatible with the recent detection of 5-methylcytosine in Drosophila, and might suggest that S. cerevisiae has, or once had, CpG methylation.

  1. CpG island methylator phenotype in colorectal cancer

    PubMed Central

    Toyota, Minoru; Ahuja, Nita; Ohe-Toyota, Mutsumi; Herman, James G.; Baylin, Stephen B.; Issa, Jean-Pierre J.

    1999-01-01

    Aberrant methylation of promoter region CpG islands is associated with transcriptional inactivation of tumor-suppressor genes in neoplasia. To understand global patterns of CpG island methylation in colorectal cancer, we have used a recently developed technique called methylated CpG island amplification to examine 30 newly cloned differentially methylated DNA sequences. Of these 30 clones, 19 (63%) were progressively methylated in an age-dependent manner in normal colon, 7 (23%) were methylated in a cancer-specific manner, and 4 (13%) were methylated only in cell lines. Thus, a majority of CpG islands methylated in colon cancer are also methylated in a subset of normal colonic cells during the process of aging. In contrast, methylation of the cancer-specific clones was found exclusively in a subset of colorectal cancers, which appear to display a CpG island methylator phenotype (CIMP). CIMP+ tumors also have a high incidence of p16 and THBS1 methylation, and they include the majority of sporadic colorectal cancers with microsatellite instability related to hMLH1 methylation. We thus define a pathway in colorectal cancer that appears to be responsible for the majority of sporadic tumors with mismatch repair deficiency. PMID:10411935

  2. DNA Methylation of Gene Expression in Acanthamoeba castellanii Encystation.

    PubMed

    Moon, Eun-Kyung; Hong, Yeonchul; Lee, Hae-Ahm; Quan, Fu-Shi; Kong, Hyun-Hee

    2017-04-01

    Encystation mediating cyst specific cysteine proteinase (CSCP) of Acanthamoeba castellanii is expressed remarkably during encystation. However, the molecular mechanism involved in the regulation of CSCP gene expression remains unclear. In this study, we focused on epigenetic regulation of gene expression during encystation of Acanthamoeba . To evaluate methylation as a potential mechanism involved in the regulation of CSCP expression, we first investigated the correlation between promoter methylation status of CSCP gene and its expression. A 2,878 bp of promoter sequence of CSCP gene was amplified by PCR. Three CpG islands (island 1-3) were detected in this sequence using bioinformatics tools. Methylation of CpG island in trophozoites and cysts was measured by bisulfite sequence PCR. CSCP promoter methylation of CpG island 1 (1,633 bp) was found in 8.2% of trophozoites and 7.3% of cysts. Methylation of CpG island 2 (625 bp) was observed in 4.2% of trophozoites and 5.8% of cysts. Methylation of CpG island 3 (367 bp) in trophozoites and cysts was both 3.6%. These results suggest that DNA methylation system is present in CSCP gene expression of Acanthamoeba . In addition, the expression of encystation mediating CSCP is correlated with promoter CpG island 1 hypomethylation.

  3. CpG island methylator phenotype-low (CIMP-low) colorectal cancer shows not only few methylated CIMP-high-specific CpG islands, but also low-level methylation at individual loci.

    PubMed

    Kawasaki, Takako; Ohnishi, Mutsuko; Nosho, Katsuhiko; Suemoto, Yuko; Kirkner, Gregory J; Meyerhardt, Jeffrey A; Fuchs, Charles S; Ogino, Shuji

    2008-03-01

    The CpG island methylator phenotype (CIMP or CIMP-high) with widespread promoter methylation is a distinct phenotype in colorectal cancer. However, the concept of CIMP-low with less extensive CpG island methylation is still evolving. Our aim is to examine whether density of methylation in individual CpG islands was different between CIMP-low and CIMP-high tumors. Utilizing MethyLight technology and 889 population-based colorectal cancers, we quantified DNA methylation (methylation index, percentage of methylated reference) at 14 CpG islands, including 8 CIMP-high-specific loci (CACNA1G, CDKN2A (p16), CRABP1, IGF2, MLH1, NEUROG1, RUNX3 and SOCS1). Methylation positivity in each locus was defined as methylation index>4. Low-level methylation (methylation index>0, <20) in each CIMP-high-specific locus was significantly more common in 340 CIMP-low tumors (1/8-5/8 methylation-positive loci) than 133 CIMP-high tumors (> or =6/8 methylation-positive loci) and 416 CIMP-0 tumors (0/8 methylation-positive loci) (P< or =0.002). In the other six loci (CHFR, HIC1, IGFBP3, MGMT, MINT31 and WRN), which were not highly specific for CIMP-high, low-level methylation, was not persistently more prevalent in CIMP-low tumors. In conclusion, compared to CIMP-high and CIMP-0 tumors, CIMP-low colorectal cancers show not only few methylated CIMP-high-specific CpG islands, but also more frequent low-level methylation at individual loci. Our data may provide supporting evidence for a difference in pathogenesis of DNA methylation between CIMP-low and CIMP-high tumors.

  4. Epigenetic Variation in Monozygotic Twins: A Genome-Wide Analysis of DNA Methylation in Buccal Cells

    PubMed Central

    van Dongen, Jenny; Ehli, Erik A.; Slieker, Roderick C.; Bartels, Meike; Weber, Zachary M.; Davies, Gareth E.; Slagboom, P. Eline; Heijmans, Bastiaan T.; Boomsma, Dorret I.

    2014-01-01

    DNA methylation is one of the most extensively studied epigenetic marks in humans. Yet, it is largely unknown what causes variation in DNA methylation between individuals. The comparison of DNA methylation profiles of monozygotic (MZ) twins offers a unique experimental design to examine the extent to which such variation is related to individual-specific environmental influences and stochastic events or to familial factors (DNA sequence and shared environment). We measured genome-wide DNA methylation in buccal samples from ten MZ pairs (age 8–19) using the Illumina 450k array and examined twin correlations for methylation level at 420,921 CpGs after QC. After selecting CpGs showing the most variation in the methylation level between subjects, the mean genome-wide correlation (rho) was 0.54. The correlation was higher, on average, for CpGs within CpG islands (CGIs), compared to CGI shores, shelves and non-CGI regions, particularly at hypomethylated CpGs. This finding suggests that individual-specific environmental and stochastic influences account for more variation in DNA methylation in CpG-poor regions. Our findings also indicate that it is worthwhile to examine heritable and shared environmental influences on buccal DNA methylation in larger studies that also include dizygotic twins. PMID:24802513

  5. Genome-Wide Methylome Analyses Reveal Novel Epigenetic Regulation Patterns in Schizophrenia and Bipolar Disorder

    PubMed Central

    Li, Yongsheng; Camarillo, Cynthia; Xu, Juan; Arana, Tania Bedard; Xiao, Yun; Zhao, Zheng; Chen, Hong; Ramirez, Mercedes; Zavala, Juan; Escamilla, Michael A.; Armas, Regina; Mendoza, Ricardo; Ontiveros, Alfonso; Nicolini, Humberto; Jerez Magaña, Alvaro Antonio; Rubin, Lewis P.; Li, Xia; Xu, Chun

    2015-01-01

    Schizophrenia (SZ) and bipolar disorder (BP) are complex genetic disorders. Their appearance is also likely informed by as yet only partially described epigenetic contributions. Using a sequencing-based method for genome-wide analysis, we quantitatively compared the blood DNA methylation landscapes in SZ and BP subjects to control, both in an understudied population, Hispanics along the US-Mexico border. Remarkably, we identified thousands of differentially methylated regions for SZ and BP preferentially located in promoters 3′-UTRs and 5′-UTRs of genes. Distinct patterns of aberrant methylation of promoter sequences were located surrounding transcription start sites. In these instances, aberrant methylation occurred in CpG islands (CGIs) as well as in flanking regions as well as in CGI sparse promoters. Pathway analysis of genes displaying these distinct aberrant promoter methylation patterns showed enhancement of epigenetic changes in numerous genes previously related to psychiatric disorders and neurodevelopment. Integration of gene expression data further suggests that in SZ aberrant promoter methylation is significantly associated with altered gene transcription. In particular, we found significant associations between (1) promoter CGIs hypermethylation with gene repression and (2) CGI 3′-shore hypomethylation with increased gene expression. Finally, we constructed a specific methylation analysis platform that facilitates viewing and comparing aberrant genome methylation in human neuropsychiatric disorders. PMID:25734057

  6. Frequent silencing of the candidate tumor suppressor TRIM58 by promoter methylation in early-stage lung adenocarcinoma

    PubMed Central

    Naruto, Takuya; Kohmoto, Tomohiro; Watabnabe, Miki; Tsuboi, Mitsuhiro; Takizawa, Hiromitsu; Kondo, Kazuya; Tangoku, Akira; Imoto, Issei

    2017-01-01

    In this study, we aimed to identify novel drivers that would be epigenetically altered through aberrant methylation in early-stage lung adenocarcinoma (LADC), regardless of the presence or absence of tobacco smoking-induced epigenetic field defects. Through genome-wide screening for aberrantly methylated CpG islands (CGIs) in 12 clinically uniform, stage-I LADC cases affecting six non-smokers and six smokers, we identified candidate tumor-suppressor genes (TSGs) inactivated by hypermethylation. Through systematic expression analyses of those candidates in panels of additional tumor samples and cell lines treated or not treated with 5-aza-deoxycitidine followed by validation analyses of cancer-specific silencing by CGI hypermethylation using a public database, we identified TRIM58 as the most prominent candidate for TSG. TRIM58 was robustly silenced by hypermethylation even in early-stage primary LADC, and the restoration of TRIM58 expression in LADC cell lines inhibited cell growth in vitro and in vivo in anchorage-dependent and -independent manners. Our findings suggest that aberrant inactivation of TRIM58 consequent to CGI hypermethylation might stimulate the early carcinogenesis of LADC regardless of smoking status; furthermore, TRIM58 methylation might be a possible early diagnostic and epigenetic therapeutic target in LADC. PMID:27926516

  7. Frequent silencing of the candidate tumor suppressor TRIM58 by promoter methylation in early-stage lung adenocarcinoma.

    PubMed

    Kajiura, Koichiro; Masuda, Kiyoshi; Naruto, Takuya; Kohmoto, Tomohiro; Watabnabe, Miki; Tsuboi, Mitsuhiro; Takizawa, Hiromitsu; Kondo, Kazuya; Tangoku, Akira; Imoto, Issei

    2017-01-10

    In this study, we aimed to identify novel drivers that would be epigenetically altered through aberrant methylation in early-stage lung adenocarcinoma (LADC), regardless of the presence or absence of tobacco smoking-induced epigenetic field defects. Through genome-wide screening for aberrantly methylated CpG islands (CGIs) in 12 clinically uniform, stage-I LADC cases affecting six non-smokers and six smokers, we identified candidate tumor-suppressor genes (TSGs) inactivated by hypermethylation. Through systematic expression analyses of those candidates in panels of additional tumor samples and cell lines treated or not treated with 5-aza-deoxycitidine followed by validation analyses of cancer-specific silencing by CGI hypermethylation using a public database, we identified TRIM58 as the most prominent candidate for TSG. TRIM58 was robustly silenced by hypermethylation even in early-stage primary LADC, and the restoration of TRIM58 expression in LADC cell lines inhibited cell growth in vitro and in vivo in anchorage-dependent and -independent manners. Our findings suggest that aberrant inactivation of TRIM58 consequent to CGI hypermethylation might stimulate the early carcinogenesis of LADC regardless of smoking status; furthermore, TRIM58 methylation might be a possible early diagnostic and epigenetic therapeutic target in LADC.

  8. Survival differences of CIMP subtypes integrated with CNA information in human breast cancer.

    PubMed

    Wang, Huihan; Yan, Weili; Zhang, Shumei; Gu, Yue; Wang, Yihan; Wei, Yanjun; Liu, Hongbo; Wang, Fang; Wu, Qiong; Zhang, Yan

    2017-07-25

    CpG island methylator phenotype of breast cancer is associated with widespread aberrant methylation at specified CpG islands and distinct patient outcomes. However, the influence of copy number contributing to the prognosis of tumors with different CpG island methylator phenotypes is still unclear. We analyzed both genetic (copy number) and epigenetic alterations in 765 breast cancers from The Cancer Genome Atlas data portal and got a panel of 15 biomarkers for copy number and methylation status evaluation. The gene panel identified two groups corresponding to distinct copy number profiles. In status of mere-loss copy number, patients were faced with a greater risk if they presented a higher CpG islands methylation pattern in biomarker panels. But for samples presenting merely-gained copy number, higher methylation level of CpG islands was associated with improved viability. In all, the integration of copy number alteration and methylation information enhanced the classification power on prognosis. Moreover, we found the molecular subtypes of breast cancer presented different distributions in two CpG island methylation phenotypes. Generated by the same set of human methylation 450K data, additional copy number information could provide insights into survival prediction of cancers with less heterogeneity and might help to determine the biomarkers for diagnosis and treatment for breast cancer patients in a more personalized approach.

  9. Survival differences of CIMP subtypes integrated with CNA information in human breast cancer

    PubMed Central

    Wang, Huihan; Yan, Weili; Zhang, Shumei; Gu, Yue; Wang, Yihan; Wei, Yanjun; Liu, Hongbo; Wang, Fang; Wu, Qiong; Zhang, Yan

    2017-01-01

    CpG island methylator phenotype of breast cancer is associated with widespread aberrant methylation at specified CpG islands and distinct patient outcomes. However, the influence of copy number contributing to the prognosis of tumors with different CpG island methylator phenotypes is still unclear. We analyzed both genetic (copy number) and epigenetic alterations in 765 breast cancers from The Cancer Genome Atlas data portal and got a panel of 15 biomarkers for copy number and methylation status evaluation. The gene panel identified two groups corresponding to distinct copy number profiles. In status of mere-loss copy number, patients were faced with a greater risk if they presented a higher CpG islands methylation pattern in biomarker panels. But for samples presenting merely-gained copy number, higher methylation level of CpG islands was associated with improved viability. In all, the integration of copy number alteration and methylation information enhanced the classification power on prognosis. Moreover, we found the molecular subtypes of breast cancer presented different distributions in two CpG island methylation phenotypes. Generated by the same set of human methylation 450K data, additional copy number information could provide insights into survival prediction of cancers with less heterogeneity and might help to determine the biomarkers for diagnosis and treatment for breast cancer patients in a more personalized approach. PMID:28415743

  10. Compositional searching of CpG islands in the human genome

    NASA Astrophysics Data System (ADS)

    Luque-Escamilla, Pedro Luis; Martínez-Aroza, José; Oliver, José L.; Gómez-Lopera, Juan Francisco; Román-Roldán, Ramón

    2005-06-01

    We report on an entropic edge detector based on the local calculation of the Jensen-Shannon divergence with application to the search for CpG islands. CpG islands are pieces of the genome related to gene expression and cell differentiation, and thus to cancer formation. Searching for these CpG islands is a major task in genetics and bioinformatics. Some algorithms have been proposed in the literature, based on moving statistics in a sliding window, but its size may greatly influence the results. The local use of Jensen-Shannon divergence is a completely different strategy: the nucleotide composition inside the islands is different from that in their environment, so a statistical distance—the Jensen-Shannon divergence—between the composition of two adjacent windows may be used as a measure of their dissimilarity. Sliding this double window over the entire sequence allows us to segment it compositionally. The fusion of those segments into greater ones that satisfy certain identification criteria must be achieved in order to obtain the definitive results. We find that the local use of Jensen-Shannon divergence is very suitable in processing DNA sequences for searching for compositionally different structures such as CpG islands, as compared to other algorithms in literature.

  11. Use of DNA from human stools to detect aberrant CpG island methylation of genes implicated in colorectal cancer.

    PubMed

    Belshaw, Nigel J; Elliott, Giles O; Williams, Elizabeth A; Bradburn, David M; Mills, Sarah J; Mathers, John C; Johnson, Ian T

    2004-09-01

    Hypermethylation of cytosine residues in the CpG islands of tumor suppressor genes is a key mechanism of colorectal carcinogenesis. Detection and quantification of CpG island methylation in human DNA isolated from stools might provide a novel strategy for the detection and investigation of colorectal neoplasia. To explore the feasibility of this approach, colorectal biopsies and fecal samples were obtained from 32 patients attending for colonoscopy or surgery, who were found to have adenomatous polyps, colorectal cancer, or no evidence of neoplasia. A further 18 fecal samples were obtained from healthy volunteers, with no bowel symptoms. Isolated DNA was modified with sodium bisulfite and analyzed by methylation-specific PCR and combined bisulfite restriction analysis for CpG island methylation of ESR1, MGMT, HPP1, p16(INK4a), APC, and MLH1. CpG island methylation was readily detectable in both mucosal and fecal DNA with methylation-specific PCR. Using combined bisulfite restriction analysis, it was established that, in volunteers from whom biopsies were available, the levels of methylation at two CpG sites within ESR1 assayed using fecal DNA were significantly correlated with methylation in DNA from colorectal mucosa. Thus, noninvasive techniques can be used to obtain quantitative information about the level of CpG island methylation in human colorectal mucosa. The methods described here could be applied to a much expanded range of genes and may be valuable both for screening purposes and to provide greater insight into the functional consequences of epigenetic changes in the colorectal mucosa of free-living individuals.

  12. Deep sequencing reveals distinct patterns of DNA methylation in prostate cancer.

    PubMed

    Kim, Jung H; Dhanasekaran, Saravana M; Prensner, John R; Cao, Xuhong; Robinson, Daniel; Kalyana-Sundaram, Shanker; Huang, Christina; Shankar, Sunita; Jing, Xiaojun; Iyer, Matthew; Hu, Ming; Sam, Lee; Grasso, Catherine; Maher, Christopher A; Palanisamy, Nallasivam; Mehra, Rohit; Kominsky, Hal D; Siddiqui, Javed; Yu, Jindan; Qin, Zhaohui S; Chinnaiyan, Arul M

    2011-07-01

    Beginning with precursor lesions, aberrant DNA methylation marks the entire spectrum of prostate cancer progression. We mapped the global DNA methylation patterns in select prostate tissues and cell lines using MethylPlex-next-generation sequencing (M-NGS). Hidden Markov model-based next-generation sequence analysis identified ∼68,000 methylated regions per sample. While global CpG island (CGI) methylation was not differential between benign adjacent and cancer samples, overall promoter CGI methylation significantly increased from ~12.6% in benign samples to 19.3% and 21.8% in localized and metastatic cancer tissues, respectively (P-value < 2 × 10(-16)). We found distinct patterns of promoter methylation around transcription start sites, where methylation occurred not only on the CGIs, but also on flanking regions and CGI sparse promoters. Among the 6691 methylated promoters in prostate tissues, 2481 differentially methylated regions (DMRs) are cancer-specific, including numerous novel DMRs. A novel cancer-specific DMR in the WFDC2 promoter showed frequent methylation in cancer (17/22 tissues, 6/6 cell lines), but not in the benign tissues (0/10) and normal PrEC cells. Integration of LNCaP DNA methylation and H3K4me3 data suggested an epigenetic mechanism for alternate transcription start site utilization, and these modifications segregated into distinct regions when present on the same promoter. Finally, we observed differences in repeat element methylation, particularly LINE-1, between ERG gene fusion-positive and -negative cancers, and we confirmed this observation using pyrosequencing on a tissue panel. This comprehensive methylome map will further our understanding of epigenetic regulation in prostate cancer progression.

  13. Frequent silencing of RASSF1A by DNA methylation in thymic neuroendocrine tumours.

    PubMed

    Kajiura, Koichiro; Takizawa, Hiromitsu; Morimoto, Yuki; Masuda, Kiyoshi; Tsuboi, Mitsuhiro; Kishibuchi, Reina; Wusiman, Nuliamina; Sawada, Toru; Kawakita, Naoya; Toba, Hiroaki; Yoshida, Mitsuteru; Kawakami, Yukikiyo; Naruto, Takuya; Imoto, Issei; Tangoku, Akira; Kondo, Kazuya

    2017-09-01

    Aberrant methylation of promoter CpG islands (CGIs) of tumour suppressor genes is a common epigenetic mechanism underlying cancer pathogenesis. The methylation patterns of thymic tumours have not been studied in detail since such tumours are rare. Herein, we sought to identify genes that could serve as epigenetic targets for thymic neuroendocrine tumour (NET) therapy. Genome-wide screening for aberrantly methylated CGIs was performed in three NET samples, seven thymic carcinoma (TC) samples, and eight type-B3 thymoma samples. The methylation status of thymic epithelial tumours (TETs) samples was validated by pyrosequencing in a larger cohort. The expression status was analysed by quantitative polymerase chain reaction (PCR) and immunohistochemistry. We identified a CGI on a novel gene, RASSF1A, which was strongly hypermethylated in NET, but not in thymic carcinoma or B3 thymoma. RASSF1A was identified as a candidate gene statistically and bibliographically, as it showed frequent CGI hypermethylation in NET by genome-wide screening. Pyrosequencing confirmed significant hypermethylation of a RASSF1A CGI in NET. Low-grade NET tissue was more strongly methylated than high-grade NET. Quantitative PCR and immunohistochemical staining revealed that RASSF1A mRNA and protein expression levels were negatively regulated by DNA methylation. RASSF1A is a tumour suppressor gene epigenetically dysregulated in NET. Aberrant methylation of RASSF1A has been reported in various tumours, but this is the first report of RASSF1A hypermethylation in TETs. RASSF1A may represent an epigenetic therapeutic target in thymic NET. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Nucleosome dynamics and maintenance of epigenetic states of CpG islands

    NASA Astrophysics Data System (ADS)

    Sneppen, Kim; Dodd, Ian B.

    2016-06-01

    Methylation of mammalian DNA occurs primarily at CG dinucleotides. These CpG sites are located nonrandomly in the genome, tending to occur within high density clusters of CpGs (islands) or within large regions of low CpG density. Cluster methylation tends to be bimodal, being dominantly unmethylated or mostly methylated. For CpG clusters near promoters, low methylation is associated with transcriptional activity, while high methylation is associated with gene silencing. Alternative CpG methylation states are thought to be stable and heritable, conferring localized epigenetic memory that allows transient signals to create long-lived gene expression states. Positive feedback where methylated CpG sites recruit enzymes that methylate nearby CpGs, can produce heritable bistability but does not easily explain that as clusters increase in size or density they change from being primarily methylated to primarily unmethylated. Here, we show that an interaction between the methylation state of a cluster and its occupancy by nucleosomes provides a mechanism to generate these features and explain genome wide systematics of CpG islands.

  15. Methylation profiling identified novel differentially methylated markers including OPCML and FLRT2 in prostate cancer.

    PubMed

    Wu, Yu; Davison, Jerry; Qu, Xiaoyu; Morrissey, Colm; Storer, Barry; Brown, Lisha; Vessella, Robert; Nelson, Peter; Fang, Min

    2016-04-02

    To develop new methods to distinguish indolent from aggressive prostate cancers (PCa), we utilized comprehensive high-throughput array-based relative methylation (CHARM) assay to identify differentially methylated regions (DMRs) throughout the genome, including both CpG island (CGI) and non-CGI regions in PCa patients based on Gleason grade. Initially, 26 samples, including 8 each of low [Gleason score (GS) 6] and high (GS ≥7) grade PCa samples and 10 matched normal prostate tissues, were analyzed as a discovery cohort. We identified 3,567 DMRs between normal and cancer tissues, and 913 DMRs distinguishing low from high-grade cancers. Most of these DMRs were located at CGI shores. The top 5 candidate DMRs from the low vs. high Gleason comparison, including OPCML, ELAVL2, EXT1, IRX5, and FLRT2, were validated by pyrosequencing using the discovery cohort. OPCML and FLRT2 were further validated in an independent cohort consisting of 20 low-Gleason and 33 high-Gleason tissues. We then compared patients with biochemical recurrence (n=70) vs. those without (n=86) in a third cohort, and they showed no difference in methylation at these DMR loci. When GS 3+4 cases and GS 4+3 cases were compared, OPCML-DMR methylation showed a trend of lower methylation in the recurrence group (n=30) than in the no-recurrence (n=52) group. We conclude that whole-genome methylation profiling with CHARM revealed distinct patterns of differential DNA methylation between normal prostate and PCa tissues, as well as between different risk groups of PCa as defined by Gleason scores. A panel of selected DMRs may serve as novel surrogate biomarkers for Gleason score in PCa.

  16. Links between DNA methylation and nucleosome occupancy in the human genome.

    PubMed

    Collings, Clayton K; Anderson, John N

    2017-01-01

    DNA methylation is an epigenetic modification that is enriched in heterochromatin but depleted at active promoters and enhancers. However, the debate on whether or not DNA methylation is a reliable indicator of high nucleosome occupancy has not been settled. For example, the methylation levels of DNA flanking CTCF sites are higher in linker DNA than in nucleosomal DNA, while other studies have shown that the nucleosome core is the preferred site of methylation. In this study, we make progress toward understanding these conflicting phenomena by implementing a bioinformatics approach that combines MNase-seq and NOMe-seq data and by comprehensively profiling DNA methylation and nucleosome occupancy throughout the human genome. The results demonstrated that increasing methylated CpG density is correlated with nucleosome occupancy in the total genome and within nearly all subgenomic regions. Features with elevated methylated CpG density such as exons, SINE-Alu sequences, H3K36-trimethylated peaks, and methylated CpG islands are among the highest nucleosome occupied elements in the genome, while some of the lowest occupancies are displayed by unmethylated CpG islands and unmethylated transcription factor binding sites. Additionally, outside of CpG islands, the density of CpGs within nucleosomes was shown to be important for the nucleosomal location of DNA methylation with low CpG frequencies favoring linker methylation and high CpG frequencies favoring core particle methylation. Prominent exceptions to the correlations between methylated CpG density and nucleosome occupancy include CpG islands marked by H3K27me3 and CpG-poor heterochromatin marked by H3K9me3, and these modifications, along with DNA methylation, distinguish the major silencing mechanisms of the human epigenome. Thus, the relationship between DNA methylation and nucleosome occupancy is influenced by the density of methylated CpG dinucleotides and by other epigenomic components in chromatin.

  17. Silencing of GSTP1 gene by CpG island DNA hypermethylation in HBV-associated hepatocellular carcinomas.

    PubMed

    Zhong, Sheng; Tang, Mandy W; Yeo, Winnie; Liu, Cuiling; Lo, Y M Dennis; Johnson, Philip J

    2002-04-01

    Glutathione S-transferases, enzymes that defend cells against damage mediated by oxidant and electrophilic carcinogens, may be critical determinants of cancer pathogenesis. In this report, we assess the role of epigenetic silencing of the GSTP1 gene, a gene encoding the pi-class glutathione S-transferase, in the pathogenesis of hepatitis B virus (HBV)-associated hepatocellular carcinomas (HCC). The cell lines Hep3B, HepG2, and a cohort of 43 HBV-associated HCC tissue specimens and corresponding nontumor tissues were subjected to analysis for GSTP1 epigenetic alteration and expression. GSTP1 "CpG" island DNA hypermethylation in the liver cell lines, and the tissue specimens were determined by methylation-specific PCR and correlated with expression of the gene using reverse-transcription PCR, immunoblotting, and immunohistochemistry. GSTP1 CpG island DNA hypermethylation was detected in 28 of 43 (65.1%) HCC tissues and 4 of 40 (10%) corresponding nontumor tissues. GSTP1 protein was absent in those cases showing hypermethylation of the gene. Similarly, DNA from Hep3B and HepG2 cell lines displayed complete GSTP1 hypermethylation in the CpG island, and they failed to express GSTP1 mRNA and the corresponding protein product. Treatment of the cell lines with the DNA methyltransferase inhibitor 5-aza-deoxycytidine reversed the hypermethylation, and restored GSTP1 mRNA and polypeptide expression. These data indicate that epigenetic silencing of GSTP1 gene expression by CpG island DNA hypermethylation is common in human HBV-associated HCC. In addition, somatic GSTP1 inactivation via CpG island hypermethylation may contribute to the pathogenesis of this malignancy.

  18. Bayesian inference supports a location and neighbour-dependent model of DNA methylation propagation at the MGMT gene promoter in lung tumours.

    PubMed

    Bonello, Nicolas; Sampson, James; Burn, John; Wilson, Ian J; McGrown, Gail; Margison, Geoff P; Thorncroft, Mary; Crossbie, Philip; Povey, Andrew C; Santibanez-Koref, Mauro; Walters, Kevin

    2013-11-07

    We exploit model-based Bayesian inference methodologies to analyse lung tumour-derived methylation data from a CpG island in the O6-methylguanine-DNA methyltransferase (MGMT) promoter. Interest is in modelling the changes in methylation patterns in a CpG island in the first exon of the promoter during lung tumour development. We propose four competils of methylation state propagation based on two mechanisms. The first is the location-dependence mechanism in which the probability of a gain or loss of methylation at a CpG within the promoter depends upon its location in the CpG sequence. The second mechanism is that of neighbour-dependence in which gain or loss of methylation at a CpG depends upon the methylation status of the immediately preceding CpG. Our data comprises the methylation status at 12 CpGs near the 5' end of the CpG island in two lung tumour samples for both alleles of a nearby polymorphism. We use approximate Bayesian computation, a computationally intensive rejection-sampling algorithm to infer model parameters and compare models without the need to evaluate the likelihood function. We compare the four proposed models using two criteria: the approximate Bayes factors and the distribution of the Euclidean distance between the summary statistics of the observed and simulated datasets. Our model-based analysis demonstrates compelling evidence for both location and neighbour dependence in the process of aberrant DNA methylation of this MGMT promoter CpG island in lung tumours. We find equivocal evidence to support the hypothesis that the methylation patterns of the two alleles evolve independently. © 2013 Published by Elsevier Ltd. All rights reserved.

  19. Quantitative, high-resolution epigenetic profiling of CpG loci identifies associations with cord blood plasma homocysteine and birth weight in humans

    PubMed Central

    Ismail, Khaled MK; Haworth, Kim E; Mein, Charles; Carroll, William D

    2011-01-01

    Supplementation with folic acid during pregnancy is known to reduce the risk of neural tube defects and low birth weight. It is thought that folate and other one-carbon intermediates might secure these clinical effects via DNA methylation. We examined the effects of folate on the human methylome using quantitative interrogation of 27,578 CpG loci associated with 14,496 genes at single-nucleotide resolution across 12 fetal cord blood samples. Consistent with previous studies, the majority of CpG dinucleotides located within CpG islands exhibited hypomethylation while those outside CpG islands showed mid-high methylation. However, for the first time in human samples, unbiased analysis of methylation across samples revealed a significant correlation of methylation patterns with plasma homocysteine, LINE-1 methylation and birth weight centile. Additionally, CpG methylation significantly correlated with either birth weight or LINE-1 methylation were predominantly located in CpG islands. These data indicate that levels of folate-associated intermediates in cord blood reflect their influence and consequences for the fetal epigenome and potentially on pregnancy outcome. In these cases, their influence might be exerted during late gestation or reflect those present during the peri-conceptual period. PMID:20864804

  20. Multi-step aberrant CpG island hyper-methylation is associated with the progression of adult T-cell leukemia/lymphoma.

    PubMed

    Sato, Hiaki; Oka, Takashi; Shinnou, Yoko; Kondo, Takami; Washio, Kana; Takano, Masayuki; Takata, Katsuyoshi; Morito, Toshiaki; Huang, Xingang; Tamura, Maiko; Kitamura, Yuta; Ohara, Nobuya; Ouchida, Mamoru; Ohshima, Koichi; Shimizu, Kenji; Tanimoto, Mitsune; Takahashi, Kiyoshi; Matsuoka, Masao; Utsunomiya, Atae; Yoshino, Tadashi

    2010-01-01

    Aberrant CpG island methylation contributes to the pathogenesis of various malignancies. However, little is known about the association of epigenetic abnormalities with multistep tumorigenic events in adult T cell leukemia/lymphoma (ATLL). To determine whether epigenetic abnormalities induce the progression of ATLL, we analyzed the methylation profiles of the SHP1, p15, p16, p73, HCAD, DAPK, hMLH-1, and MGMT genes by methylation specific PCR assay in 65 cases with ATLL patients. The number of CpG island methylated genes increased with disease progression and aberrant hypermethylation in specific genes was detected even in HTLV-1 carriers and correlated with progression to ATLL. The CpG island methylator phenotype (CIMP) was observed most frequently in lymphoma type ATLL and was also closely associated with the progression and crisis of ATLL. The high number of methylated genes and increase of CIMP incidence were shown to be unfavorable prognostic factors and correlated with a shorter overall survival by Kaplan-Meyer analysis. The present findings strongly suggest that the multistep accumulation of aberrant CpG methylation in specific target genes and the presence of CIMP are deeply involved in the crisis, progression, and prognosis of ATLL, as well as indicate the value of CpG methylation and CIMP for new diagnostic and prognostic biomarkers.

  1. Multi-Step Aberrant CpG Island Hyper-Methylation Is Associated with the Progression of Adult T–Cell Leukemia/Lymphoma

    PubMed Central

    Sato, Hiaki; Oka, Takashi; Shinnou, Yoko; Kondo, Takami; Washio, Kana; Takano, Masayuki; Takata, Katsuyoshi; Morito, Toshiaki; Huang, Xingang; Tamura, Maiko; Kitamura, Yuta; Ohara, Nobuya; Ouchida, Mamoru; Ohshima, Koichi; Shimizu, Kenji; Tanimoto, Mitsune; Takahashi, Kiyoshi; Matsuoka, Masao; Utsunomiya, Atae; Yoshino, Tadashi

    2010-01-01

    Aberrant CpG island methylation contributes to the pathogenesis of various malignancies. However, little is known about the association of epigenetic abnormalities with multistep tumorigenic events in adult T cell leukemia/lymphoma (ATLL). To determine whether epigenetic abnormalities induce the progression of ATLL, we analyzed the methylation profiles of the SHP1, p15, p16, p73, HCAD, DAPK, hMLH-1, and MGMT genes by methylation specific PCR assay in 65 cases with ATLL patients. The number of CpG island methylated genes increased with disease progression and aberrant hypermethylation in specific genes was detected even in HTLV-1 carriers and correlated with progression to ATLL. The CpG island methylator phenotype (CIMP) was observed most frequently in lymphoma type ATLL and was also closely associated with the progression and crisis of ATLL. The high number of methylated genes and increase of CIMP incidence were shown to be unfavorable prognostic factors and correlated with a shorter overall survival by Kaplan-Meyer analysis. The present findings strongly suggest that the multistep accumulation of aberrant CpG methylation in specific target genes and the presence of CIMP are deeply involved in the crisis, progression, and prognosis of ATLL, as well as indicate the value of CpG methylation and CIMP for new diagnostic and prognostic biomarkers. PMID:20019193

  2. DNA methylation profiles of donor nuclei cells and tissues of cloned bovine fetuses.

    PubMed

    Kremenskoy, Maksym; Kremenska, Yuliya; Suzuki, Masako; Imai, Kei; Takahashi, Seiya; Hashizume, Kazuyoshi; Yagi, Shintaro; Shiota, Kunio

    2006-04-01

    Methylation of DNA in CpG islands plays an important role during fetal development and differentiation because CpG islands are preferentially located in upstream regions of mammalian genomic DNA, including the transcription start site of housekeeping genes and are also associated with tissue-specific genes. Somatic nuclear transfer (NT) technology has been used to generate live clones in numerous mammalian species, but only a low percentage of nuclear transferred animals develop to term. Abnormal epigenetic changes in the CpG islands of donor nuclei after nuclear transfer could contribute to a high rate of abortion during early gestation and increase perinatal death. These changes have yet to be explored. Thus, we investigated the genome-wide DNA methylation profiles of CpG islands in nuclei donor cells and NT animals. Using Restriction Landmark Genomic Scanning (RLGS), we showed, for the first time, the epigenetic profile formation of tissues from NT bovine fetuses produced from cumulus cells. From approximately 2600 unmethylated NotI sites visualized on the RLGS profile, at least 35 NotI sites showed different methylation statuses. Moreover, we proved that fetal and placental tissues from artificially inseminated and cloned cattle have tissue-specific differences in the genome-wide methylation profiles of the CpG islands. We also found that possible abnormalities occurred in the fetal brain and placental tissues of cloned animals.

  3. A distinct group of CpG islands shows differential DNA methylation between replicas of the same cell line in vitro

    PubMed Central

    2013-01-01

    Background CpG dinucleotide-rich genomic DNA regions, known as CpG islands (CGIs), can be methylated at their cytosine residues as an epigenetic mark that is stably inherited during cell mitosis. Differentially methylated regions (DMRs) are genomic regions showing different degrees of DNA methylation in multiple samples. In this study, we focused our attention on CGIs showing different DNA methylation between two culture replicas of the same cell line. Results We used methylation data of 35 cell lines from the Encyclopedia of DNA Elements (ENCODE) consortium to identify CpG islands that were differentially methylated between replicas of the same cell line and denoted them Inter Replicas Differentially Methylated CpG islands (IRDM-CGIs). We identified a group of IRDM-CGIs that was consistently shared by different cell lines, and denoted it common IRDM-CGIs. X chromosome CGIs were overrepresented among common IRDM-CGIs. Autosomal IRDM-CGIs were preferentially located in gene bodies and intergenic regions had a lower G + C content, a smaller mean length, and a reduced CpG percentage. Functional analysis of the genes associated with autosomal IRDM-CGIs showed that many of them are involved in DNA binding and development. Conclusions Our results show that several specific functional and structural features characterize common IRDM-CGIs. They may represent a specific subset of CGIs that are more prone to being differentially methylated for their intrinsic characteristics. PMID:24106769

  4. Polycomb-like proteins link the PRC2 complex to CpG islands

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, Haojie; Liefke, Robert; Jiang, Junyi

    The Polycomb repressive complex 2 (PRC2) mainly mediates transcriptional repression1,2 and has essential roles in various biological processes including the maintenance of cell identity and proper differentiation. Polycomb-like (PCL) proteins, such as PHF1, MTF2 and PHF19, are PRC2-associated factors that form sub-complexes with PRC2 core components3, and have been proposed to modulate the enzymatic activity of PRC2 or the recruitment of PRC2 to specific genomic loci4,5,6,7,8,9,10,11,12,13. Mammalian PRC2-binding sites are enriched in CG content, which correlates with CpG islands that display a low level of DNA methylation14. However, the mechanism of PRC2 recruitment to CpG islands is not fully understood.more » Here we solve the crystal structures of the N-terminal domains of PHF1 and MTF2 with bound CpG-containing DNAs in the presence of H3K36me3-containing histone peptides. We show that the extended homologous regions of both proteins fold into a winged-helix structure, which specifically binds to the unmethylated CpG motif but in a completely different manner from the canonical winged-helix DNA recognition motif. We also show that the PCL extended homologous domains are required for efficient recruitment of PRC2 to CpG island-containing promoters in mouse embryonic stem cells. Our research provides the first, to our knowledge, direct evidence to demonstrate that PCL proteins are crucial for PRC2 recruitment to CpG islands, and further clarifies the roles of these proteins in transcriptional regulation in vivo.« less

  5. CpG island methylation profile in non-invasive oral rinse samples is predictive of oral and pharyngeal carcinoma.

    PubMed

    Langevin, Scott M; Eliot, Melissa; Butler, Rondi A; Cheong, Agnes; Zhang, Xiang; McClean, Michael D; Koestler, Devin C; Kelsey, Karl T

    2015-01-01

    There are currently no screening tests in routine use for oral and pharyngeal cancer beyond visual inspection and palpation, which are provided on an opportunistic basis, indicating a need for development of novel methods for early detection, particularly in high-risk populations. We sought to address this need through comprehensive interrogation of CpG island methylation in oral rinse samples. We used the Infinium HumanMethylation450 BeadArray to interrogate DNA methylation in oral rinse samples collected from 154 patients with incident oral or pharyngeal carcinoma prior to treatment and 72 cancer-free control subjects. Subjects were randomly allocated to either a training or a testing set. For each subject, average methylation was calculated for each CpG island represented on the array. We applied a semi-supervised recursively partitioned mixture model to the CpG island methylation data to identify a classifier for prediction of case status in the training set. We then applied the resultant classifier to the testing set for validation and to assess the predictive accuracy. We identified a methylation classifier comprised of 22 CpG islands, which predicted oral and pharyngeal carcinoma with a high degree of accuracy (AUC = 0.92, 95 % CI 0.86, 0.98). This novel methylation panel is a strong predictor of oral and pharyngeal carcinoma case status in oral rinse samples and may have utility in early detection and post-treatment follow-up.

  6. Unique DNA methylome profiles in CpG island methylator phenotype colon cancers

    PubMed Central

    Xu, Yaomin; Hu, Bo; Choi, Ae-Jin; Gopalan, Banu; Lee, Byron H.; Kalady, Matthew F.; Church, James M.; Ting, Angela H.

    2012-01-01

    A subset of colorectal cancers was postulated to have the CpG island methylator phenotype (CIMP), a higher propensity for CpG island DNA methylation. The validity of CIMP, its molecular basis, and its prognostic value remain highly controversial. Using MBD-isolated genome sequencing, we mapped and compared genome-wide DNA methylation profiles of normal, non-CIMP, and CIMP colon specimens. Multidimensional scaling analysis revealed that each specimen could be clearly classified as normal, non-CIMP, and CIMP, thus signifying that these three groups have distinctly different global methylation patterns. We discovered 3780 sites in various genomic contexts that were hypermethylated in both non-CIMP and CIMP colon cancers when compared with normal colon. An additional 2026 sites were found to be hypermethylated in CIMP tumors only; and importantly, 80% of these sites were located in CpG islands. These data demonstrate on a genome-wide level that the additional hypermethylation seen in CIMP tumors occurs almost exclusively at CpG islands and support definitively that these tumors were appropriately named. When these sites were examined more closely, we found that 25% were adjacent to sites that were also hypermethylated in non-CIMP tumors. Thus, CIMP is also characterized by more extensive methylation of sites that are already prone to be hypermethylated in colon cancer. These observations indicate that CIMP tumors have specific defects in controlling both DNA methylation seeding and spreading and serve as an important first step in delineating molecular mechanisms that control these processes. PMID:21990380

  7. Methylation oligonucleotide microarray: a novel tool to analyze methylation patterns

    NASA Astrophysics Data System (ADS)

    Hou, Peng; Ji, Meiju; He, Nongyao; Lu, Zuhong

    2003-04-01

    A new technique to analyze methylation patterns in several adjacent CpG sites was developed and reported here. We selected a 336bp segment of the 5"-untranslated region and the first exon of the p16Ink4a gene, which include the most densely packed CpG fragment of the islands containing 32 CpG dinucleotides, as the investigated target. The probes that include all types of methylation patterns were designed to fabricate a DNA microarray to determine the methylation patterns of seven adjacent CpG dinucleotides sites. High accuracy and reproducibility were observed in several parallel experiments. The results led us to the conclusion that the methylation oligonucleotide microarray can be applied as a novel and powerful tool to map methylation patterns and changes in multiple CpG island loci in a variety of tumors.

  8. Hypermethylation of the Human Glutathione S-Transferase-π Gene (GSTP1) CpG Island Is Present in a Subset of Proliferative Inflammatory Atrophy Lesions but Not in Normal or Hyperplastic Epithelium of the Prostate

    PubMed Central

    Nakayama, Masashi; Bennett, Christina J.; Hicks, Jessica L.; Epstein, Jonathan I.; Platz, Elizabeth A.; Nelson, William G.; De Marzo, Angelo M.

    2003-01-01

    Somatic inactivation of the glutathione S-transferase-π gene (GSTP1) via CpG island hypermethylation occurs early during prostate carcinogenesis, present in ∼70% of high-grade prostatic intraepithelial neoplasia (high-grade PIN) lesions and more than 90% of adenocarcinomas. Recently, there has been a resurgence of the concept that foci of prostatic atrophy (referred to as proliferative inflammatory atrophy or PIA) may be precursor lesions for the development of prostate cancer and/or high-grade PIN. Many of the cells within PIA lesions contain elevated levels of GSTP1, glutathione S-transferase-α (GSTA1), and cyclooxygenase-II proteins, suggesting a stress response. Because not all PIA cells are positive for GSTP1 protein, we hypothesized that some of the cells within these regions acquire GSTP1 CpG island hypermethylation, increasing the chance of progression to high-grade PIN and/or adenocarcinoma. Separate regions (n =199) from 27 formalin-fixed paraffin-embedded prostates were microdissected by laser-capture microdissection (Arcturus PixCell II). These regions included normal epithelium (n = 48), hyperplasticepithelium from benign prostatic hyperplasia nodules (n = 22), PIA (n = 64), high-grade PIN (n = 32), and adenocarcinoma (n = 33). Genomic DNA was isolated and assessed for GSTP1 CpG island hypermethylation by methylation-specific polymerase chain reaction. GSTP1 CpG island hypermethylation was not detected in normal epithelium (0 of 48) or in hyperplastic epithelium (0 of 22), but was found in 4 of 64 (6.3%) PIA lesions. The difference in the frequency of GSTP1 CpG island hypermethylation between normal or hyperplastic epithelium and PIA was statistically significant (P = 0.049). Similar to studies using nonmicrodissected cases, hypermethylation was found in 22 of 32 (68.8%) high-grade PIN lesions and in 30 of 33 (90.9%) adenocarcinoma lesions. Unlike normal or hyperplastic epithelium, GSTP1 CpG island hypermethylation can be detected in some PIA lesions. These data support the hypothesis that atrophic epithelium in a subset of PIA lesions may lead to high-grade PIN and/or adenocarcinoma. Because these atrophic lesions are so prevalent and extensive, even though only a small subset contains this somatic DNA alteration, the clinical impact may be substantial. PMID:12937133

  9. Modulation of transcription factor binding and epigenetic regulation of the MLH1 CpG island and shore by polymorphism rs1800734 in colorectal cancer

    PubMed Central

    Savio, Andrea J.; Bapat, Bharati

    2017-01-01

    ABSTRACT The MLH1 promoter polymorphism rs1800734 is associated with MLH1 CpG island hypermethylation and expression loss in colorectal cancer (CRC). Conversely, variant rs1800734 is associated with MLH1 shore, but not island, hypomethylation in peripheral blood mononuclear cell DNA. To explore these distinct patterns, MLH1 CpG island and shore methylation was assessed in CRC cell lines stratified by rs1800734 genotype. Cell lines containing the variant A allele demonstrated MLH1 shore hypomethylation compared to wild type (GG). There was significant enrichment of transcription factor AP4 at the MLH1 promoter in GG and GA cell lines, but not the AA cell line, by chromatin immunoprecipitation studies. Preferential binding to the G allele was confirmed by sequencing in the GA cell line. The enhancer-associated histone modification H3K4me1 was enriched at the MLH1 shore; however, H3K27ac was not, indicating the shore is an inactive enhancer. These results demonstrate the role of variant rs1800734 in altering transcription factor binding as well as epigenetics at regions beyond the MLH1 CpG island in which it is located. PMID:28304185

  10. Modulation of transcription factor binding and epigenetic regulation of the MLH1 CpG island and shore by polymorphism rs1800734 in colorectal cancer.

    PubMed

    Savio, Andrea J; Bapat, Bharati

    2017-06-03

    The MLH1 promoter polymorphism rs1800734 is associated with MLH1 CpG island hypermethylation and expression loss in colorectal cancer (CRC). Conversely, variant rs1800734 is associated with MLH1 shore, but not island, hypomethylation in peripheral blood mononuclear cell DNA. To explore these distinct patterns, MLH1 CpG island and shore methylation was assessed in CRC cell lines stratified by rs1800734 genotype. Cell lines containing the variant A allele demonstrated MLH1 shore hypomethylation compared to wild type (GG). There was significant enrichment of transcription factor AP4 at the MLH1 promoter in GG and GA cell lines, but not the AA cell line, by chromatin immunoprecipitation studies. Preferential binding to the G allele was confirmed by sequencing in the GA cell line. The enhancer-associated histone modification H3K4me1 was enriched at the MLH1 shore; however, H3K27ac was not, indicating the shore is an inactive enhancer. These results demonstrate the role of variant rs1800734 in altering transcription factor binding as well as epigenetics at regions beyond the MLH1 CpG island in which it is located.

  11. Identification of the physiological promoter for spinocerebellar ataxia 2 gene reveals a CpG island for promoter activity situated into the exon 1 of this gene and provides data about the origin of the nonmethylated state of these types of islands.

    PubMed

    Aguiar, J; Santurlidis, S; Nowok, J; Alexander, C; Rudnicki, D; Gispert, S; Schulz, W; Auburger, G

    1999-01-19

    In order to further use the spinocerebellar ataxia 2 (SCA2) promoter for transgenic mice models of "CAG repeat" neurodegeneration, different fragments of this 5' end were ligated into pGL3-Luc plasmid to obtain the better promoter-activity of the physiological promoter for SCA2. Base-par composition of the SCA2-5' region, and promoter prediction algorithms such as TSSW and TSSG, together with the high firefly luciferase expression after 48 hours of transient transfection in mammalian cells lines, showed a typical CpG island for promoter-activity. The promoter activity was specifically localized into the exon 1 of the SCA2 gene. The higher expression of firefly luciferase in the embryonal F9 cells by the use of SCA2 promoter, rather than by the use of CMV promoter may be related with the origin of the nonmethylated CpG island during the early embryogenesis. Analysis of the 5' region from HD gene revealed to a CpG island, which could be containing the physiological promoter for this gene. Copyright 1999 Academic Press.

  12. Genome-wide screen of ovary-specific DNA methylation in polycystic ovary syndrome.

    PubMed

    Yu, Ying-Ying; Sun, Cui-Xiang; Liu, Yin-Kun; Li, Yan; Wang, Li; Zhang, Wei

    2015-07-01

    To compare genome-wide DNA methylation profiles in ovary tissue from women with polycystic ovary syndrome (PCOS) and healthy controls. Case-control study matched for age and body mass index. University-affiliated hospital. Ten women with PCOS who underwent ovarian drilling to induce ovulation and 10 healthy women who were undergoing laparoscopic sterilization, hysterectomy for benign conditions, diagnostic laparoscopy for pelvic pain, or oophorectomy for nonovarian indications. None. Genome-wide DNA methylation patterns determined by immunoprecipitation and microarray (MeDIP-chip) analysis. The methylation levels were statistically significantly higher in CpG island shores (CGI shores), which lie outside of core promoter regions, and lower within gene bodies in women with PCOS relative to the controls. In addition, high CpG content promoters were the most frequently hypermethylated promoters in PCOS ovaries but were more often hypomethylated in controls. Second, 872 CGIs, specifically methylated in PCOS, represented 342 genes that could be associated with various molecular functions, including protein binding, hormone activity, and transcription regulator activity. Finally, methylation differences were validated in seven genes by methylation-specific polymerase chain reaction. These genes correlated to several functional families related to the pathogenesis of PCOS and may be potential biomarkers for this disease. Our results demonstrated that epigenetic modification differs between PCOS and normal ovaries, which may help to further understand the pathophysiology of this disease. Copyright © 2015 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  13. Chemical genomic screening for methylation-silenced genes in gastric cancer cell lines using 5-aza-2'-deoxycytidine treatment and oligonucleotide microarray.

    PubMed

    Yamashita, Satoshi; Tsujino, Yoshimi; Moriguchi, Kazuki; Tatematsu, Masae; Ushijima, Toshikazu

    2006-01-01

    To identify novel methylation-silenced genes in gastric cancers, we carried out a chemical genomic screening, a genome-wide search for genes upregulated by treatment with a demethylating agent, 5-aza-2'-deoxycytidine (5-aza-dC). After 5-aza-dC treatment of a gastric cancer cell line (AGS) 579 genes were upregulated 16-fold or more, using an oligonucleotide microarray with 39,000 genes. From these genes, we selected 44 known genes on autosomes whose silencing in gastric cancer has not been reported. Thirty-two of these had CpG islands (CGI) in their putative promoter regions, and all of the CGI were methylated in AGS, giving an estimated number of 421+/-75 (95% confidence interval) methylation-silenced genes. Additionally, we analyzed the methylation status of 16 potential tumor-related genes with promoter CGI that were upregulated four-fold or more, and 14 of these were methylated in AGS. Methylation status of the 32 randomly selected and 16 potential tumor-related genes was analyzed in 10 primary gastric cancers, and 42 genes (ABHD9, ADFP, ALDH1A3, ANXA5, AREG, BDNF, BMP7, CAV1, CDH2, CLDN3, CTSL, EEF1A2, F2R, FADS1, FSD1, FST, FYN, GPR54, GREM1, IGFBP3, IGFBP7, IRS2, KISS1, MARK1, MLF1, MSX1, MTSS1, NT5E, PAX6, PLAGL1, PLAU, PPIC, RBP4, RORA, SCRN1, TBX3, TFAP2C, TNFSF9, ULBP2, WIF1, ZNF177 and ZNF559) were methylated in at least one primary gastric cancer. A metastasis suppressor gene, MTSS1, was located in a genomic region with frequent loss of heterozygosity (8q22), and was expressed abundantly in the normal gastric mucosa, suggesting its role in gastric carcinogenesis. (Cancer Sci 2006; 97: 64 -71). (Cancer Sci 2006; 97: 64 -71).

  14. Correlation of CpG Island Methylation of the Cytochrome P450 2E1/2D6 Genes with Liver Injury Induced by Anti-Tuberculosis Drugs: A Nested Case-Control Study.

    PubMed

    Zhang, Jinling; Zhu, Xuebin; Li, Yuhong; Zhu, Lingyan; Li, Shiming; Zheng, Guoying; Ren, Qi; Xiao, Yonghong; Feng, Fumin

    2016-08-01

    This study investigated the role of CpG island methylation of the CYP2E1 and CYP2D6 genes in liver injury induced by anti-TB drugs from an epigenetic perspective in a Chinese cohort. A 1:1 matched nested case-control study design was applied. Pulmonary tuberculosis (TB) patients, who underwent standard anti-TB therapy and developed liver injury were defined as cases, while those who did not develop liver injury were defined as control. The two groups were matched in terms of sex, treatment regimen, and age. In 114 pairs of cases, CpG island methylation levels of the CYP2E1 and CYP2D6 genes in plasma cell-free DNA were found to be significantly correlated with the occurrence of anti-TB drug-induced liver injury (ADLI), with odds ratio (OR) values of 2.429 and 3.500, respectively (p < 0.01). Moreover, through multivariate logistic regression analysis, CpG island methylation of the CYP2E1 and CYP2D6 genes in plasma cell-free DNA were found to be significantly correlated with the occurrence of ADLI, with adjusted OR values of 4.390 (95% confidence interval (CI): 1.982-9.724) and 9.193 (95% CI: 3.624-25.888), respectively (p < 0.001). These results suggest that aberrantly elevated methylation of CpG islands of the CYP2E1 and CYP2D6 genes in plasma cell-free DNA may increase the risk of ADLI in Chinese TB patients.

  15. Prognostic implication of the CpG island methylator phenotype in colorectal cancers depends on tumour location

    PubMed Central

    Bae, J M; Kim, J H; Cho, N-Y; Kim, T-Y; Kang, G H

    2013-01-01

    Background: Colorectal cancer (CRC) is usually categorised as proximal or distal CRC. Recently, many researchers have tried to determine the molecular heterogeneity of CRCs along bowel subsites. However, the differential effects of the CpG island methylator phenotype (CIMP) and microsatellite instability (MSI) on the clinical outcome according to tumour location are not well-known. Methods: We analysed clinicopathologic and molecular characteristics, including CIMP, MSI, KRAS and BRAF mutations, in 734 CRCs according to bowel subsites. And the prognostic value of CIMP and MSI was analysed according to tumour location. Results: We found a linear increase of female predominance, T, N category, stage, differentiation, absence of luminal necrosis, tumour -infiltrating lymphocytes, Crohn's-like lymphoid reaction, serration and mucin production from the rectum to caecum. CpG island methylator phenotype -high and MSI-high gradually increased from the rectum to caecum. CpG island methylator phenotype is a poor prognostic factor of overall survival (hazard ratio (HR): 4.13, 95% confidence interval (CI): 1.27–13.46) and disease-free survival (HR: 2.90, 95% CI: 1.04–8.08) in rectal cancers. Conclusion: Clinicopathologic and molecular profiles of CRCs gradually change along bowel subsites, and the prognostic implication of CIMP is different according to tumour location. PMID:23900220

  16. CpG island methylator phenotype (CIMP) in cancer: causes and implications.

    PubMed

    Teodoridis, Jens M; Hardie, Catriona; Brown, Robert

    2008-09-18

    Strong evidence exists for a subgroup of tumours, from a variety of tissue types, exhibiting concordant tumour specific DNA methylation: the "CpG island methylator phenotype" (CIMP). Occurrence of CIMP is associated with a range of genetic and environmental factors, although the molecular causes are not well-understood. Both increased expression and aberrant targeting of DNA methyltransferases (DNMTs) could contribute to the occurrence of CIMP. One under-explored area is the possibility that DNA damage may induce or select for CIMP during carcinogenesis or treatment of tumours with chemotherapy. DNA damaging agents can induce DNA damage at guanine rich regions throughout the genome, including CpG islands. This DNA damage can result in stalled DNA synthesis, which will lead to localised increased DNMT1 concentration and therefore potentially increased DNA methylation at these sites. Chemotherapy can select for cells which have increased tolerance to DNA damage due to increased lesion bypass, in some cases by mechanisms which involve inactivation of genes by CpG island methylation. CIMP has been associated with worse patient prognosis, probably due to increased epigenetic plasticity. Therefore, further clinical testing of the diagnostic and prognostic value of the current CIMP markers, as well as increasing our understanding of the molecular causes underlying CIMP are required.

  17. MLH1 Region Polymorphisms Show a Significant Association with CpG Island Shore Methylation in a Large Cohort of Healthy Individuals

    PubMed Central

    Savio, Andrea J.; Lemire, Mathieu; Mrkonjic, Miralem; Gallinger, Steven; Zanke, Brent W.; Hudson, Thomas J.; Bapat, Bharati

    2012-01-01

    Single nucleotide polymorphisms (SNPs) are the most common form of genetic variation. We previously demonstrated that SNPs (rs1800734, rs749072, and rs13098279) in the MLH1 gene region are associated with MLH1 promoter island methylation, loss of MLH1 protein expression, and microsatellite instability (MSI) in colorectal cancer (CRC) patients. Recent studies have identified less CpG-dense “shore” regions flanking many CpG islands. These shores often exhibit distinct methylation profiles between different tissues and matched normal versus tumor cells of patients. To date, most epigenetic studies have focused on somatic methylation events occurring within solid tumors; less is known of the contributions of peripheral blood cell (PBC) methylation to processes such as aging and tumorigenesis. To address whether MLH1 methylation in PBCs is correlated with tumorigenesis we utilized the Illumina 450 K microarrays to measure methylation in PBC DNA of 846 healthy controls and 252 CRC patients from Ontario, Canada. Analysis of a region of chromosome 3p21 spanning the MLH1 locus in healthy controls revealed that a CpG island shore 1 kb upstream of the MLH1 gene exhibits different methylation profiles when stratified by SNP genotypes (rs1800734, rs749072, and rs13098279). Individuals with wild-type genotypes incur significantly higher PBC shore methylation than heterozygous or homozygous variant carriers (p<1.1×10−6; ANOVA). This trend is also seen in CRC cases (p<0.096; ANOVA). Shore methylation also decreases significantly with increasing age in cases and controls. This is the first study of its kind to integrate PBC methylation at a CpG island shore with SNP genotype status in CRC cases and controls. These results indicate that CpG island shore methylation in PBCs may be influenced by genotype as well as the normal aging process. PMID:23240038

  18. Epigenetic Regulation of Bovine Spermatogenic Cell-Specific Gene Boule

    PubMed Central

    Luo, Hua; Xu, Hongtao; Pan, Zengxiang; Xie, Zhuang; Li, Qifa

    2015-01-01

    Non-primate mammals have two deleted azoospermia (DAZ) family genes, DAZL and Boule; genes in this family encode RNA-binding proteins essential for male fertility in diverse animals. Testicular DAZL transcription is regulated by epigenetic factors such as DNA methylation. However, nothing is known about the epigenetic regulation of Boule. Here, we explored the role of DNA methylation in the regulation of the bovine Boule (bBoule) gene. We found that a long CpG island (CGI) in the bBoule promoter was hypermethylated in the testes of cattle-yak hybrids with low bBoule expression, whereas cattle had relatively low methylation levels (P < 0.01), and there was no difference in the methylation level in the short CGI of the gene body between cattle and cattle-yak hybrids (P > 0.05). We identified a 107 bp proximal core promoter region of bBoule. Intriguingly, the differences in the methylation level between cattle and cattle-yak hybrids were larger in the core promoter than outside the core promoter. An in vitro methylation assay showed that the core promoter activity of bBoule decreased significantly after M.SssI methylase treatment (P < 0.01). We also observed dramatically increased bBoule transcription in bovine mammary epithelial cells (BMECs) after treatment with the methyltransferase inhibitor 5-Aza-dC. Taken together, our results establish that methylation status of the core promoter might be involved in testicular bBoule transcription, and may provide new insight into the epigenetic regulation of DAZ family genes and clinical insights regarding male infertility. PMID:26030766

  19. Determining coding CpG islands by identifying regions significant for pattern statistics on Markov chains.

    PubMed

    Singer, Meromit; Engström, Alexander; Schönhuth, Alexander; Pachter, Lior

    2011-09-23

    Recent experimental and computational work confirms that CpGs can be unmethylated inside coding exons, thereby showing that codons may be subjected to both genomic and epigenomic constraint. It is therefore of interest to identify coding CpG islands (CCGIs) that are regions inside exons enriched for CpGs. The difficulty in identifying such islands is that coding exons exhibit sequence biases determined by codon usage and constraints that must be taken into account. We present a method for finding CCGIs that showcases a novel approach we have developed for identifying regions of interest that are significant (with respect to a Markov chain) for the counts of any pattern. Our method begins with the exact computation of tail probabilities for the number of CpGs in all regions contained in coding exons, and then applies a greedy algorithm for selecting islands from among the regions. We show that the greedy algorithm provably optimizes a biologically motivated criterion for selecting islands while controlling the false discovery rate. We applied this approach to the human genome (hg18) and annotated CpG islands in coding exons. The statistical criterion we apply to evaluating islands reduces the number of false positives in existing annotations, while our approach to defining islands reveals significant numbers of undiscovered CCGIs in coding exons. Many of these appear to be examples of functional epigenetic specialization in coding exons.

  20. Intensive hypermethylation of the CpG island of Ras association domain family 1A in hepatitis B virus-associated hepatocellular carcinomas.

    PubMed

    Zhong, Sheng; Yeo, Winnie; Tang, Mandy W; Wong, Nathalie; Lai, Paul B S; Johnson, Phillip J

    2003-08-15

    The human Ras association domain family 1A gene (RASSF1A) is a newly isolated tumor suppressor gene. In this study, we analyzed the methylation status of the promoter region of RASSF1A using bisulfite sequencing and PCR-RFLP in four liver cancer cell lines (Hep3B, HepG(2), SK-HEP-1, and Huh-7) and a cohort of 43 hepatitis B virus-associated hepatocellular carcinoma (HCC) tissues and their corresponding nontumor tissue specimens. The methylation of the CpG islands in the RASSF1A promoter was not detected in 4 samples of normal liver tissue or 10 samples of peripheral blood mononuclear cells from normal subjects. However, the CpG islands were completely methylated, and transcription of the RASSF1A was silenced in the four cell lines. Treatment with the DNA methylation inhibitor 5-aza-2'-deoxycytidine reactivated the expression of RASSF1A in the Hep3B and HepG2 cells. In 41 of 43 (95%) HCC specimens studied, the promoter region of RASSF1A was intensively methylated at its CpG sites. Although heterogeneous methylation was also detected in 16 of the 23 (70%) corresponding nontumorous tissues analyzed, the level of methylation was significantly lower than in the corresponding tumor tissues. HCC has the highest incidence of promoter methylation of RASSF1A among all malignancies yet reported suggesting that hypermethylation of the CpG island promoter of RASSF1A may play an important pathological role in this tumor.

  1. Deletion and aberrant CpG island methylation of Caspase 8 gene in medulloblastoma.

    PubMed

    Gonzalez-Gomez, Pilar; Bello, M Josefa; Inda, M Mar; Alonso, M Eva; Arjona, Dolores; Amiñoso, Cinthia; Lopez-Marin, Isabel; de Campos, Jose M; Sarasa, Jose L; Castresana, Javier S; Rey, Juan A

    2004-09-01

    Aberrant methylation of promoter CpG islands in human genes is an alternative genetic inactivation mechanism that contributes to the development of human tumors. Nevertheless, few studies have analyzed methylation in medulloblastomas. We determined the frequency of aberrant CpG island methylation for Caspase 8 (CASP8) in a group of 24 medulloblastomas arising in 8 adult and 16 pediatric patients. Complete methylation of CASP8 was found in 15 tumors (62%) and one case displayed hemimethylation. Three samples amplified neither of the two primer sets for methylated or unmethylated alleles, suggesting that genomic deletion occurred in the 5' flanking region of CASP8. Our findings suggest that methylation commonly contributes to CASP8 silencing in medulloblastomas and that homozygous deletion or severe sequence changes involving the promoter region may be another mechanism leading to CASP8 inactivation in this neoplasm.

  2. Quantitative Evaluation of MMP-9 and TIMP-1 Promoter Methylation in Chronic Periodontitis.

    PubMed

    Li, Xiting; Lu, Jiaxuan; Teng, Wei; Zhao, Chuanjiang; Ye, Xiaolei

    2018-03-01

    In this study, we investigated the promoter DNA methylation (DNAm) status of the MMP-9 and TIMP-1 genes in patients with chronic periodontitis to evaluate disease progression. Using pyrosequencing technology, DNAm levels of MMP-9 and TIMP-1 CpG islands were measured in 88 chronic periodontitis patients and 15 healthy controls. We found a positive correlation between methylation levels of MMP-9 CpG islands and the severity of chronic periodontitis. Methylated CpG islands were also closely associated with the duration of chronic periodontitis. Moreover, female patients exhibited lower methylation levels of MMP-9 but higher methylation levels of TIMP-1 compared with male patients, and the methylation levels of TIMP-1 gradually decreased with age. The findings of gender disparity in the DNAm of MMP-9 and TIMP-1 genes provide novel insights into chronic periodontitis.

  3. Extensive sequence-influenced DNA methylation polymorphism in the human genome

    PubMed Central

    2010-01-01

    Background Epigenetic polymorphisms are a potential source of human diversity, but their frequency and relationship to genetic polymorphisms are unclear. DNA methylation, an epigenetic mark that is a covalent modification of the DNA itself, plays an important role in the regulation of gene expression. Most studies of DNA methylation in mammalian cells have focused on CpG methylation present in CpG islands (areas of concentrated CpGs often found near promoters), but there are also interesting patterns of CpG methylation found outside of CpG islands. Results We compared DNA methylation patterns on both alleles between many pairs (and larger groups) of related and unrelated individuals. Direct observation and simulation experiments revealed that around 10% of common single nucleotide polymorphisms (SNPs) reside in regions with differences in the propensity for local DNA methylation between the two alleles. We further showed that for the most common form of SNP, a polymorphism at a CpG dinucleotide, the presence of the CpG at the SNP positively affected local DNA methylation in cis. Conclusions Taken together with the known effect of DNA methylation on mutation rate, our results suggest an interesting interdependence between genetics and epigenetics underlying diversity in the human genome. PMID:20497546

  4. Prognostication of patients with clear cell renal cell carcinomas based on quantification of DNA methylation levels of CpG island methylator phenotype marker genes.

    PubMed

    Tian, Ying; Arai, Eri; Gotoh, Masahiro; Komiyama, Motokiyo; Fujimoto, Hiroyuki; Kanai, Yae

    2014-10-20

    The CpG island methylator phenotype (CIMP) of clear cell renal cell carcinomas (ccRCCs) is characterized by accumulation of DNA methylation at CpG islands and poorer patient outcome. The aim of this study was to establish criteria for prognostication of patients with ccRCCs using the ccRCC-specific CIMP marker genes. DNA methylation levels at 299 CpG sites in the 14 CIMP marker genes were evaluated quantitatively in tissue specimens of 88 CIMP-negative and 14 CIMP-positive ccRCCs in a learning cohort using the MassARRAY system. An additional 100 ccRCCs were also analyzed as a validation cohort. Receiver operating characteristic curve analysis showed that area under the curve values for the 23 CpG units including the 32 CpG sites in the 7 CIMP-marker genes, i.e. FAM150A, ZNF540, ZNF671, ZNF154, PRAC, TRH and SLC13A5, for discrimination of CIMP-positive from CIMP-negative ccRCCs were larger than 0.95. Criteria combining the 23 CpG units discriminated CIMP-positive from CIMP-negative ccRCCs with 100% sensitivity and specificity in the learning cohort. Cancer-free and overall survival rates of patients with CIMP-positive ccRCCs diagnosed using the criteria combining the 23 CpG units in a validation cohort were significantly lower than those of patients with CIMP-negative ccRCCs (P = 1.41 × 10-5 and 2.43 × 10-13, respectively). Patients with CIMP-positive ccRCCs in the validation cohort had a higher likelihood of disease-related death (hazard ratio, 75.8; 95% confidence interval, 7.81 to 735; P = 1.89 × 10-4) than those with CIMP-negative ccRCCs. The established criteria are able to reproducibly diagnose CIMP-positive ccRCCs and may be useful for personalized medicine for patients with ccRCCs.

  5. Gene silencing of Nox4 by CpG island methylation during hepatocarcinogenesis in rats

    PubMed Central

    López-Álvarez, Guadalupe S.; Wojdacz, Tomasz K.; García-Cuellar, Claudia M.; Monroy-Ramírez, Hugo C.; Rodríguez-Segura, Miguel A.; Pacheco-Rivera, Ruth A.; Valencia-Antúnez, Carlos A.; Cervantes-Anaya, Nancy; Soto-Reyes, Ernesto; Vásquez-Garzón, Verónica R.; Sánchez-Pérez, Yesennia; Villa-Treviño, Saúl

    2017-01-01

    ABSTRACT The association between the downregulation of genes and DNA methylation in their CpG islands has been extensively studied as a mechanism that favors carcinogenesis. The objective of this study was to analyze the methylation of a set of genes selected based on their microarray expression profiles during the process of hepatocarcinogenesis. Rats were euthanized at: 24 h, 7, 11, 16 and 30 days and 5, 9, 12 and 18 months post-treatment. We evaluated the methylation status in the CpG islands of four deregulated genes (Casp3, Cldn1, Pex11a and Nox4) using methylation-sensitive high-resolution melting technology for the samples obtained from different stages of hepatocarcinogenesis. We did not observe methylation in Casp3, Cldn1 or Pex11a. However, Nox4 exhibited altered methylation patterns, reaching a maximum of 10%, even during the early stages of hepatocarcinogenesis. We observed downregulation of mRNA and protein of Nox4 (97.5% and 40%, respectively) after the first carcinogenic stimulus relative to the untreated samples. Our results suggest that Nox4 downregulation is associated with DNA methylation of the CpG island in its promoter. We propose that methylation is a mechanism that can silence the expression of Nox4, which could contribute to the acquisition of neoplastic characteristics during hepatocarcinogenesis in rats. PMID:27895046

  6. Distinct genetic profiles in colorectal tumors with or without the CpG island methylator phenotype

    PubMed Central

    Toyota, Minoru; Ohe-Toyota, Mutsumi; Ahuja, Nita; Issa, Jean-Pierre J.

    2000-01-01

    Colorectal cancers (CRCs) are characterized by multiple genetic (mutations) and epigenetic (CpG island methylation) alterations, but it is not known whether these evolve independently through stochastic processes. We have recently described a novel pathway termed CpG island methylator phenotype (CIMP) in CRC, which is characterized by the simultaneous methylation of multiple CpG islands, including several known genes, such as p16, hMLH1, and THBS1. We have now studied mutations in K-RAS, p53, DPC4, and TGFβRII in a panel of colorectal tumors with or without CIMP. We find that CIMP defines two groups of tumors with significantly different genetic lesions: frequent K-RAS mutations were found in CIMP+ CRCs (28/41, 68%) compared with CIMP− cases (14/47, 30%, P = 0.0005). By contrast, p53 mutations were found in 24% (10/41) of CIMP+ CRCs vs. 60% (30/46) of CIMP− cases (P = 0.002). Both of these differences were independent of microsatellite instability. These interactions between CIMP, K-RAS mutations, and p53 mutations were preserved in colorectal adenomas, suggesting that they occur early in carcinogenesis. The distinct combinations of epigenetic and genetic alterations in each group suggest that activation of oncogenes and inactivation of tumor suppressor genes is related to the underlying mechanism of generating molecular diversity in cancer, rather than simply accumulate stochastically during cancer development. PMID:10639144

  7. Early demethylation of non-CpG, CpC-rich, elements in the myogenin 5′-flanking region

    PubMed Central

    Fuso, Andrea; Ferraguti, Giampiero; Grandoni, Francesco; Ruggeri, Raffaella; Scarpa, Sigfrido; Strom, Roberto

    2010-01-01

    The dynamic changes and structural patterns of DNA methylation of genes without CpG islands are poorly characterized. The relevance of CpG to the non-CpG methylation equilibrium in transcriptional repression is unknown. In this work, we analyzed the DNA methylation pattern of the 5′-flanking of the myogenin gene, a positive regulator of muscle differentiation with no CpG island and low CpG density, in both C2C12 muscle satellite cells and embryonic muscle. Embryonic brain was studied as a non-expressing tissue. High levels of both CpG and non-CpG methylation were observed in non-expressing experimental conditions. Both CpG and non-CpG methylation rapidly dropped during muscle differentiation and myogenin transcriptional activation with active demethylation dynamics. Non-CpG demethylation occurred more rapidly than CpG demethylation. Demethylation spread from initially highly methylated short CpC-rich elements to a virtually unmethylated status. These short elements have a high CpC content and density, share some motifs and largely coincide with putative recognition sequences of some differentiation-related transcription factors. Our findings point to a dynamically controlled equilibrium between CpG and non-CpG active demethylation in the transcriptional control of tissue-specific genes. The short CpC-rich elements are new structural features of the methylation machinery, whose functions may include priming the complete demethylation of a transcriptionally crucial DNA region. PMID:20935518

  8. Targeted-bisulfite sequence analysis of the methylation of CpG islands in genes encoding PNPLA3, SAMM50, and PARVB of patients with non-alcoholic fatty liver disease.

    PubMed

    Kitamoto, Takuya; Kitamoto, Aya; Ogawa, Yuji; Honda, Yasushi; Imajo, Kento; Saito, Satoru; Yoneda, Masato; Nakamura, Takahiro; Nakajima, Atsushi; Hotta, Kikuko

    2015-08-01

    The pathogenesis of non-alcoholic fatty liver disease (NAFLD) is affected by epigenetic factors as well as by genetic variation. We performed targeted-bisulfite sequencing to determine the levels of DNA methylation of 4 CpG islands (CpG99, CpG71, CpG26, and CpG101) in the regulatory regions of PNPLA3, SAMM50, PARVB variant 1, and PARVB variant 2, respectively. We compared the levels of methylation of DNA in the livers of the first and second sets of patients with mild (fibrosis stages 0 and 1) or advanced (fibrosis stages 2 to 4) NAFLD and in those of patients with mild (F0 to F2) or advanced (F3 and F4) chronic hepatitis C infection. The hepatic mRNA levels of PNPLA3, SAMM50, and PARVB were measured using qPCR. CpG26, which resides in the regulatory region of PARVB variant 1, was markedly hypomethylated in the livers of patients with advanced NAFLD. Conversely, CpG99 in the regulatory region of PNPLA3 was substantially hypermethylated in these patients. These differences in DNA methylation were replicated in a second set of patients with NAFLD or chronic hepatitis C. PNPLA3 mRNA levels in the liver of the same section of a biopsy specimen used for genomic DNA preparation were lower in patients with advanced NAFLD compared with those with mild NAFLD and correlated inversely with CpG99 methylation in liver DNA. Moreover, the levels of CpG99 methylation and PNPLA3 mRNA were affected by the rs738409 genotype. Hypomethylation of CpG26 and hypermethylation of CpG99 may contribute to the severity of fibrosis in patients with NAFLD or chronic hepatitis C infection. Copyright © 2015 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved.

  9. Identification of Gene Networks Associated with Acute Myeloid Leukemia by Comparative Molecular Methylation and Expression Profiling

    PubMed Central

    Dellett, Margaret; O’Hagan, Kathleen Ann; Colyer, Hilary Ann Alexandra; Mills, Ken I.

    2010-01-01

    Around 80% of acute myeloid leukemia (AML) patients achieve a complete remission, however many will relapse and ultimately die of their disease. The association between karyotype and prognosis has been studied extensively and identified patient cohorts as having favourable [e.g. t(8; 21), inv (16)/t(16; 16), t(15; 17)], intermediate [e.g. cytogenetically normal (NK-AML)] or adverse risk [e.g. complex karyotypes]. Previous studies have shown that gene expression profiling signatures can classify the sub-types of AML, although few reports have shown a similar feature by using methylation markers. The global methylation patterns in 19 diagnostic AML samples were investigated using the Methylated CpG Island Amplification Microarray (MCAM) method and CpG island microarrays containing 12,000 CpG sites. The first analysis, comparing favourable and intermediate cytogenetic risk groups, revealed significantly differentially methylated CpG sites (594 CpG islands) between the two subgroups. Mutations in the NPM1 gene occur at a high frequency (40%) within the NK-AML subgroup and are associated with a more favourable prognosis in these patients. A second analysis comparing the NPM1 mutant and wild-type research study subjects again identified distinct methylation profiles between these two subgroups. Network and pathway analysis revealed possible molecular mechanisms associated with the different risk and/or mutation sub-groups. This may result in a better classification of the risk groups, improved monitoring targets, or the identification of novel molecular therapies. PMID:24179384

  10. Improved Prediction of Non-methylated Islands in Vertebrates Highlights Different Characteristic Sequence Patterns

    PubMed Central

    Vingron, Martin

    2016-01-01

    Non-methylated islands (NMIs) of DNA are genomic regions that are important for gene regulation and development. A recent study of genome-wide non-methylation data in vertebrates by Long et al. (eLife 2013;2:e00348) has shown that many experimentally identified non-methylated regions do not overlap with classically defined CpG islands which are computationally predicted using simple DNA sequence features. This is especially true in cold-blooded vertebrates such as Danio rerio (zebrafish). In order to investigate how predictive DNA sequence is of a region’s methylation status, we applied a supervised learning approach using a spectrum kernel support vector machine, to see if a more complex model and supervised learning can be used to improve non-methylated island prediction and to understand the sequence properties of these regions. We demonstrate that DNA sequence is highly predictive of methylation status, and that in contrast to existing CpG island prediction methods our method is able to provide more useful predictions of NMIs genome-wide in all vertebrate organisms that were studied. Our results also show that in cold-blooded vertebrates (Anolis carolinensis, Xenopus tropicalis and Danio rerio) where genome-wide classical CpG island predictions consist primarily of false positives, longer primarily AT-rich DNA sequence features are able to identify these regions much more accurately. PMID:27984582

  11. CpG islands: algorithms and applications in methylation studies.

    PubMed

    Zhao, Zhongming; Han, Leng

    2009-05-15

    Methylation occurs frequently at 5'-cytosine of the CpG dinucleotides in vertebrate genomes; however, this epigenetic feature is rarely observed in CpG islands (CGIs) or CpG clusters in the promoter regions of genes. Aberrant methylation of the promoter-associated CGIs might influence gene expression and cause carcinogenesis. Because of the functional importance, multiple algorithms have been available for identifying CGIs in a genome or a sequence. They can be categorized into the traditional algorithms (e.g., Gardiner-Garden and Frommer (1987), Takai and Jones (2002), and CpGPRoD (2002)) or statistical property based algorithms (CpGcluster (2006) and CG cluster (2007)). We reviewed the features of these algorithms and evaluated their performance on identifying functional CGIs using genome-wide methylation data. Moreover, identification of CGIs is an initial step in many recent studies for predicting methylation status as well as in the design of methylation detection platforms. We reviewed the benchmarks and features used in these studies.

  12. Analysis of RET promoter CpG island methylation using methylation-specific PCR (MSP), pyrosequencing, and methylation-sensitive high-resolution melting (MS-HRM): impact on stage II colon cancer patient outcome.

    PubMed

    Draht, Muriel X G; Smits, Kim M; Jooste, Valérie; Tournier, Benjamin; Vervoort, Martijn; Ramaekers, Chantal; Chapusot, Caroline; Weijenberg, Matty P; van Engeland, Manon; Melotte, Veerle

    2016-01-01

    Already since the 1990s, promoter CpG island methylation markers have been considered promising diagnostic, prognostic, and predictive cancer biomarkers. However, so far, only a limited number of DNA methylation markers have been introduced into clinical practice. One reason why the vast majority of methylation markers do not translate into clinical applications is lack of independent validation of methylation markers, often caused by differences in methylation analysis techniques. We recently described RET promoter CpG island methylation as a potential prognostic marker in stage II colorectal cancer (CRC) patients of two independent series. In the current study, we analyzed the RET promoter CpG island methylation of 241 stage II colon cancer patients by direct methylation-specific PCR (MSP), nested-MSP, pyrosequencing, and methylation-sensitive high-resolution melting (MS-HRM). All primers were designed as close as possible to the same genomic region. In order to investigate the effect of different DNA methylation assays on patient outcome, we assessed the clinical sensitivity and specificity as well as the association of RET methylation with overall survival for three and five years of follow-up. Using direct-MSP and nested-MSP, 12.0 % (25/209) and 29.6 % (71/240) of the patients showed RET promoter CpG island methylation. Methylation frequencies detected by pyrosequencing were related to the threshold for positivity that defined RET methylation. Methylation frequencies obtained by pyrosequencing (threshold for positivity at 20 %) and MS-HRM were 13.3 % (32/240) and 13.8 % (33/239), respectively. The pyrosequencing threshold for positivity of 20 % showed the best correlation with MS-HRM and direct-MSP results. Nested-MSP detected RET promoter CpG island methylation in deceased patients with a higher sensitivity (33.1 %) compared to direct-MSP (10.7 %), pyrosequencing (14.4 %), and MS-HRM (15.4 %). While RET methylation frequencies detected by nested-MSP, pyrosequencing, and MS-HRM varied, the prognostic effect seemed similar (HR 1.74, 95 % CI 0.97-3.15; HR 1.85, 95 % CI 0.93-3.86; HR 1.83, 95 % CI 0.92-3.65, respectively). Our results show that upon optimizing and aligning four RET methylation assays with regard to primer location and sensitivity, differences in methylation frequencies and clinical sensitivities are observed; however, the effect on the marker's prognostic outcome is minimal.

  13. The dynamic DNA methylation landscape of the mutL homolog 1 shore is altered by MLH1-93G>A polymorphism in normal tissues and colorectal cancer.

    PubMed

    Savio, Andrea J; Mrkonjic, Miralem; Lemire, Mathieu; Gallinger, Steven; Knight, Julia A; Bapat, Bharat

    2017-01-01

    Colorectal cancers (CRCs) undergo distinct genetic and epigenetic alterations. Expression of mutL homolog 1 ( MLH1 ), a mismatch repair gene that corrects DNA replication errors, is lost in up to 15% of sporadic tumours due to mutation or, more commonly, due to DNA methylation of its promoter CpG island. A single nucleotide polymorphism (SNP) in the CpG island of MLH1 ( MLH1 -93G>A or rs1800734) is associated with CpG island hypermethylation and decreased MLH1 expression in CRC tumours. Further, in peripheral blood mononuclear cell (PBMC) DNA of both CRC cases and non-cancer controls, the variant allele of rs1800734 is associated with hypomethylation at the MLH1 shore, a region upstream of its CpG island that is less dense in CpG sites . To determine whether this genotype-epigenotype association is present in other tissue types, including colorectal tumours, we assessed DNA methylation in matched normal colorectal tissue, tumour, and PBMC DNA from 349 population-based CRC cases recruited from the Ontario Familial Colorectal Cancer Registry. Using the semi-quantitative real-time PCR-based MethyLight assay, MLH1 shore methylation was significantly higher in tumour tissue than normal colon or PBMCs ( P  < 0.01). When shore methylation levels were stratified by SNP genotype, normal colorectal DNA and PBMC DNA were significantly hypomethylated in association with variant SNP genotype ( P  < 0.05). However, this association was lost in tumour DNA. Among distinct stages of CRC, metastatic stage IV CRC tumours incurred significant hypomethylation compared to stage I-III cases, irrespective of genotype status. Shore methylation of MLH1 was not associated with MSI status or promoter CpG island hypermethylation, regardless of genotype. To confirm these results, bisulfite sequencing was performed in matched tumour and normal colorectal specimens from six CRC cases, including two cases per genotype (wildtype, heterozygous, and homozygous variant). Bisulfite sequencing results corroborated the methylation patterns found by MethyLight, with significant hypomethylation in normal colorectal tissue of variant SNP allele carriers. These results indicate that the normal tissue types tested (colorectum and PBMC) experience dynamic genotype-associated epigenetic alterations at the MLH1 shore, whereas tumour DNA incurs aberrant hypermethylation compared to normal DNA.

  14. DNA methylation analysis of phenotype specific stratified Indian population.

    PubMed

    Rotti, Harish; Mallya, Sandeep; Kabekkodu, Shama Prasada; Chakrabarty, Sanjiban; Bhale, Sameer; Bharadwaj, Ramachandra; Bhat, Balakrishna K; Dedge, Amrish P; Dhumal, Vikram Ram; Gangadharan, G G; Gopinath, Puthiya M; Govindaraj, Periyasamy; Joshi, Kalpana S; Kondaiah, Paturu; Nair, Sreekumaran; Nair, S N Venugopalan; Nayak, Jayakrishna; Prasanna, B V; Shintre, Pooja; Sule, Mayura; Thangaraj, Kumarasamy; Patwardhan, Bhushan; Valiathan, Marthanda Varma Sankaran; Satyamoorthy, Kapaettu

    2015-05-08

    DNA methylation and its perturbations are an established attribute to a wide spectrum of phenotypic variations and disease conditions. Indian traditional system practices personalized medicine through indigenous concept of distinctly descriptive physiological, psychological and anatomical features known as prakriti. Here we attempted to establish DNA methylation differences in these three prakriti phenotypes. Following structured and objective measurement of 3416 subjects, whole blood DNA of 147 healthy male individuals belonging to defined prakriti (Vata, Pitta and Kapha) between the age group of 20-30years were subjected to methylated DNA immunoprecipitation (MeDIP) and microarray analysis. After data analysis, prakriti specific signatures were validated through bisulfite DNA sequencing. Differentially methylated regions in CpG islands and shores were significantly enriched in promoters/UTRs and gene body regions. Phenotypes characterized by higher metabolism (Pitta prakriti) in individuals showed distinct promoter (34) and gene body methylation (204), followed by Vata prakriti which correlates to motion showed DNA methylation in 52 promoters and 139 CpG islands and finally individuals with structural attributes (Kapha prakriti) with 23 and 19 promoters and CpG islands respectively. Bisulfite DNA sequencing of prakriti specific multiple CpG sites in promoters and 5'-UTR such as; LHX1 (Vata prakriti), SOX11 (Pitta prakriti) and CDH22 (Kapha prakriti) were validated. Kapha prakriti specific CDH22 5'-UTR CpG methylation was also found to be associated with higher body mass index (BMI). Differential DNA methylation signatures in three distinct prakriti phenotypes demonstrate the epigenetic basis of Indian traditional human classification which may have relevance to personalized medicine.

  15. Computational Approaches to Identify Promoters and cis-Regulatory Elements in Plant Genomes1

    PubMed Central

    Rombauts, Stephane; Florquin, Kobe; Lescot, Magali; Marchal, Kathleen; Rouzé, Pierre; Van de Peer, Yves

    2003-01-01

    The identification of promoters and their regulatory elements is one of the major challenges in bioinformatics and integrates comparative, structural, and functional genomics. Many different approaches have been developed to detect conserved motifs in a set of genes that are either coregulated or orthologous. However, although recent approaches seem promising, in general, unambiguous identification of regulatory elements is not straightforward. The delineation of promoters is even harder, due to its complex nature, and in silico promoter prediction is still in its infancy. Here, we review the different approaches that have been developed for identifying promoters and their regulatory elements. We discuss the detection of cis-acting regulatory elements using word-counting or probabilistic methods (so-called “search by signal” methods) and the delineation of promoters by considering both sequence content and structural features (“search by content” methods). As an example of search by content, we explored in greater detail the association of promoters with CpG islands. However, due to differences in sequence content, the parameters used to detect CpG islands in humans and other vertebrates cannot be used for plants. Therefore, a preliminary attempt was made to define parameters that could possibly define CpG and CpNpG islands in Arabidopsis, by exploring the compositional landscape around the transcriptional start site. To this end, a data set of more than 5,000 gene sequences was built, including the promoter region, the 5′-untranslated region, and the first introns and coding exons. Preliminary analysis shows that promoter location based on the detection of potential CpG/CpNpG islands in the Arabidopsis genome is not straightforward. Nevertheless, because the landscape of CpG/CpNpG islands differs considerably between promoters and introns on the one side and exons (whether coding or not) on the other, more sophisticated approaches can probably be developed for the successful detection of “putative” CpG and CpNpG islands in plants. PMID:12857799

  16. DNA methylation in the APOE genomic region is associated with cognitive function in African Americans.

    PubMed

    Liu, Jiaxuan; Zhao, Wei; Ware, Erin B; Turner, Stephen T; Mosley, Thomas H; Smith, Jennifer A

    2018-05-08

    Genetic variations in apolipoprotein E (APOE) and proximal genes (PVRL2, TOMM40, and APOC1) are associated with cognitive function and dementia, particularly Alzheimer's disease. Epigenetic mechanisms such as DNA methylation play a central role in the regulation of gene expression. Recent studies have found evidence that DNA methylation may contribute to the pathogenesis of dementia, but its association with cognitive function in populations without dementia remains unclear. We assessed DNA methylation levels of 48 CpG sites in the APOE genomic region in peripheral blood leukocytes collected from 289 African Americans (mean age = 67 years) from the Genetic Epidemiology Network of Arteriopathy (GENOA) study. Using linear regression, we examined the relationship between methylation in the APOE genomic region and multiple cognitive measures including learning, memory, processing speed, concentration, language and global cognitive function. We identified eight CpG sites in three genes (PVRL2, TOMM40, and APOE) that showed an inverse association between methylation level and delayed recall, a measure of memory, after adjusting for age and sex (False Discovery Rate q-value < 0.1). All eight CpGs are located in either CpG islands (CGIs) or CGI shelves, and six of them are in promoter regions. Education and APOE ε4 carrier status significantly modified the effect of methylation in cg08583001 (PVRL2) and cg22024783 (TOMM40), respectively. Together, methylation of the eight CpGs explained an additional 8.7% of the variance in delayed recall, after adjustment for age, sex, education, and APOE ε4 carrier status. Methylation was not significantly associated with any other cognitive measures. Our results suggest that methylation levels at multiple CpGs in the APOE genomic region are inversely associated with delayed recall during normal cognitive aging, even after accounting for known genetic predictors for cognition. Our findings highlight the important role of epigenetic mechanisms in influencing cognitive performance, and suggest that changes in blood methylation may be an early indicator of individuals at risk for dementia as well as potential targets for intervention in asymptomatic populations.

  17. Phenotype-specific CpG island methylation events in a murine model of prostate cancer.

    PubMed

    Camoriano, Marta; Kinney, Shannon R Morey; Moser, Michael T; Foster, Barbara A; Mohler, James L; Trump, Donald L; Karpf, Adam R; Smiraglia, Dominic J

    2008-06-01

    Aberrant DNA methylation plays a significant role in nearly all human cancers and may contribute to disease progression to advanced phenotypes. Study of advanced prostate cancer phenotypes in the human disease is hampered by limited availability of tissues. We therefore took advantage of the Transgenic Adenocarcinoma of Mouse Prostate (TRAMP) model to study whether three different phenotypes of TRAMP tumors (PRIM, late-stage primary tumors; AIP, androgen-independent primary tumors; and MET, metastases) displayed specific patterns of CpG island hypermethylation using Restriction Landmark Genomic Scanning. Each tumor phenotype displayed numerous hypermethylation events, with the most homogeneous methylation pattern in AIP and the most heterogeneous pattern in MET. Several loci displayed a phenotype-specific methylation pattern; the most striking pattern being loci methylated at high frequency in PRIM and AIP but rarely in MET. Examination of the mRNA expression of three genes, BC058385, Goosecoid, and Neurexin 2, which exhibited nonpromoter methylation, revealed increased expression associated with downstream methylation. Only methylated samples showed mRNA expression, in which tumor phenotype was a key factor determining the level of expression. The CpG island in the human orthologue of BC058385 was methylated in human AIP but not in primary androgen-stimulated prostate cancer or benign prostate. The clinical data show a proof-of-principle that the TRAMP model can be used to identify targets of aberrant CpG island methylation relevant to human disease. In conclusion, phenotype-specific hypermethylation events were associated with the overexpression of different genes and may provide new markers of prostate tumorigenesis.

  18. Global Epigenetic Changes May Underlie Ethnic Differences and susceptibility to Prostate Cancer

    DTIC Science & Technology

    2012-09-01

    tissues; in the prostate, hypermethylation of the GSTP1 CpG has been detected in PIA lesions [8]. DNA methylation occurs at CpG sites in the human...that the GSTP1 CpG island was frequently hypermethylated in PCa, more than 40 genes have been reported to be targets of DNA hypermethylation-associated...One study demonstrated that GSTP1 hypermethylation was significantly higher in PCa samples from AA men in comparison with EA and Asians [12]. Another

  19. The left end of rat L1 (L1Rn, long interspersed repeated) DNA which is a CpG island can function as a promoter.

    PubMed Central

    Nur, I; Pascale, E; Furano, A V

    1988-01-01

    Here we report that the 600 bp promoter-like region at the left end of a newly isolated and characterized rat L1 DNA element can activate the prokaryotic chloramphenicol acyltransferase gene in a rat cell line. Activation only occurs when the promoter region is oriented to the transferase gene as it is to the L1 protein encoding sequences and is 75% inhibited by methylation of just 5 of the 22 CpGs present in the promoter. The G + C rich promoter contains enough CpGs to qualify it as a CpG island, but in contrast to other CpG islands, genomic L1 promoters are fully methylated in both somatic cell and sperm DNA as judged by restriction enzyme analysis. Partial demethylation of the genomic promoters by treatment with 5-azacytidine failed to produce discrete L1 transcripts. The relationship of methylation to the evolutionary history and fate of the rat L1 promoter is discussed. Images PMID:2459662

  20. Fundamental differences in promoter CpG island DNA hypermethylation between human cancer and genetically engineered mouse models of cancer.

    PubMed

    Diede, Scott J; Yao, Zizhen; Keyes, C Chip; Tyler, Ashlee E; Dey, Joyoti; Hackett, Christopher S; Elsaesser, Katrina; Kemp, Christopher J; Neiman, Paul E; Weiss, William A; Olson, James M; Tapscott, Stephen J

    2013-12-01

    Genetic and epigenetic alterations are essential for the initiation and progression of human cancer. We previously reported that primary human medulloblastomas showed extensive cancer-specific CpG island DNA hypermethylation in critical developmental pathways. To determine whether genetically engineered mouse models (GEMMs) of medulloblastoma have comparable epigenetic changes, we assessed genome-wide DNA methylation in three mouse models of medulloblastoma. In contrast to human samples, very few loci with cancer-specific DNA hypermethylation were detected, and in almost all cases the degree of methylation was relatively modest compared with the dense hypermethylation in the human cancers. To determine if this finding was common to other GEMMs, we examined a Burkitt lymphoma and breast cancer model and did not detect promoter CpG island DNA hypermethylation, suggesting that human cancers and at least some GEMMs are fundamentally different with respect to this epigenetic modification. These findings provide an opportunity to both better understand the mechanism of aberrant DNA methylation in human cancer and construct better GEMMs to serve as preclinical platforms for therapy development.

  1. CpG Island Methylator Phenotype-High Colorectal Cancers and Their Prognostic Implications and Relationships with the Serrated Neoplasia Pathway.

    PubMed

    Rhee, Ye-Young; Kim, Kyung-Ju; Kang, Gyeong Hoon

    2017-01-15

    The concept of a CpG island methylator phenotype (CIMP) was first introduced by Toyota and Issa to describe a subset of colorectal cancers (CRCs) with concurrent hypermethylation of multiple CpG island loci. The concept of CIMP as a molecular carcinogenesis mechanism was consolidated by the identification of the serrated neoplasia pathway, in which CIMP participates in the initiation and progression of serrated adenomas. Distinct clinicopathological and molecular features of CIMP-high (CIMP-H) CRCs have been characterized, including proximal colon location, older age of onset, female preponderance, and frequent associations of high-level microsatellite instability and BRAF mutations. CIMP-H CRCs arise in sessile or traditional serrated adenomas and thus tend to display the morphological characteristics of serrated adenomas, including epithelial serration, vesicular nuclei, and abundant cytoplasm. Both the frequent association of CIMP and poor prognosis and different responses of CRCs to adjuvant therapy depending on CIMP status indicate clinical implications. In this review, we present an overview of the literature documenting the relevant findings of CIMP-H CRCs and their relationships with the serrated neoplasia pathway.

  2. Identification of the human homolog of the imprinted mouse Air non-coding RNA

    PubMed Central

    Yotova, Iveta Y.; Vlatkovic, Irena M.; Pauler, Florian M.; Warczok, Katarzyna E.; Ambros, Peter F.; Oshimura, Mitsuo; Theussl, Hans-Christian; Gessler, Manfred; Wagner, Erwin F.; Barlow, Denise P.

    2010-01-01

    Genomic imprinting is widely conserved amongst placental mammals. Imprinted expression of IGF2R, however, differs between mice and humans. In mice, Igf2r imprinted expression is seen in all fetal and adult tissues. In humans, adult tissues lack IGF2R imprinted expression, but it is found in fetal tissues and Wilms' tumors where it is polymorphic and only seen in a small proportion of tested samples. Mouse Igf2r imprinted expression is controlled by the Air (Airn) ncRNA whose promoter lies in an intronic maternally-methylated CpG island. The human IGF2R gene carries a homologous intronic maternally-methylated CpG island of unknown function. Here, we use transfection and transgenic studies to show that the human IGF2R intronic CpG island is a ncRNA promoter. We also identify the same ncRNA at the endogenous human locus in 16–40% of Wilms' tumors. Thus, the human IGF2R gene shows evolutionary conservation of key features that control imprinted expression in the mouse. PMID:18789384

  3. [Comparative analysis of methylation profiles in tissues of oral leukoplakia and oral squamous cell carcinoma].

    PubMed

    Fu, J; Su, Y; Liu, Y; Zhang, X Y

    2018-04-09

    Objective: To compare the methylation profiles in tissues of oral leukoplakia (OLK) and oral squamous cell carcinoma (OSCC) with healthy tissues of oral mucosa, in order to identify the role of DNA methylation played in tumorigenesis. Methods: DNA samples extracted from tissues of 4 healthy oral mucosa, 4 OSCC and 4 OLK collected from patients of the Department of Oral Medicine, Capital Medical University School of Stomatology were examined and compared using Methylation 450 Bead Chip. The genes associated with differentially methylated CpG sites were selected for gene ontology (GO) analysis and Kyoto encyclopedia of genes and genomes (KEGG) pathway enrichment. Results: Multiple differentially methylated CpG sites were identified by using the above mentioned assay. Hypermethylation constitutes 86.18% (23 290/27 025) of methylation changes in OLK and hypomethylation accounts for 13.82% (3 734/27 025) of methylation changes. Both hypermethylated and hypomethylated CpG sites were markedly increased in OSCC tissue compared with OLK tissue. The majority of differentially methylated CpG sites were located outside CpG islands, with approximately one-fourth in CpG shores flanking the islands, which were considered highly important for gene regulation and tumorigenesis. Pathway analysis revealed that differentially methylated CpG sites in both OLK and OSCC patients shared the same pathway enrichments, most of which were correlated with carcinogenesis and cancer progression (e.g., DNA repair, cell cycle, and apoptosis). Conclusions: In the present study, methylation-associated alterations affect almost all pathways in the cellular network in both OLK and OSCC. OLK and OSCC shared similar methylation changes whether in pathways or genes, indicating that epigenetically they might have the same molecular basis for disease progression.

  4. CpG Island Methylator Phenotype-High Colorectal Cancers and Their Prognostic Implications and Relationships with the Serrated Neoplasia Pathway

    PubMed Central

    Rhee, Ye-Young; Kim, Kyung-Ju; Kang, Gyeong Hoon

    2017-01-01

    The concept of a CpG island methylator phenotype (CIMP) was first introduced by Toyota and Issa to describe a subset of colorectal cancers (CRCs) with concurrent hypermethylation of multiple CpG island loci. The concept of CIMP as a molecular carcinogenesis mechanism was consolidated by the identification of the serrated neoplasia pathway, in which CIMP participates in the initiation and progression of serrated adenomas. Distinct clinicopathological and molecular features of CIMP-high (CIMP-H) CRCs have been characterized, including proximal colon location, older age of onset, female preponderance, and frequent associations of high-level microsatellite instability and BRAF mutations. CIMP-H CRCs arise in sessile or traditional serrated adenomas and thus tend to display the morphological characteristics of serrated adenomas, including epithelial serration, vesicular nuclei, and abundant cytoplasm. Both the frequent association of CIMP and poor prognosis and different responses of CRCs to adjuvant therapy depending on CIMP status indicate clinical implications. In this review, we present an overview of the literature documenting the relevant findings of CIMP-H CRCs and their relationships with the serrated neoplasia pathway. PMID:27885175

  5. MMASS: an optimized array-based method for assessing CpG island methylation.

    PubMed

    Ibrahim, Ashraf E K; Thorne, Natalie P; Baird, Katie; Barbosa-Morais, Nuno L; Tavaré, Simon; Collins, V Peter; Wyllie, Andrew H; Arends, Mark J; Brenton, James D

    2006-01-01

    We describe an optimized microarray method for identifying genome-wide CpG island methylation called microarray-based methylation assessment of single samples (MMASS) which directly compares methylated to unmethylated sequences within a single sample. To improve previous methods we used bioinformatic analysis to predict an optimized combination of methylation-sensitive enzymes that had the highest utility for CpG-island probes and different methods to produce unmethylated representations of test DNA for more sensitive detection of differential methylation by hybridization. Subtraction or methylation-dependent digestion with McrBC was used with optimized (MMASS-v2) or previously described (MMASS-v1, MMASS-sub) methylation-sensitive enzyme combinations and compared with a published McrBC method. Comparison was performed using DNA from the cell line HCT116. We show that the distribution of methylation microarray data is inherently skewed and requires exogenous spiked controls for normalization and that analysis of digestion of methylated and unmethylated control sequences together with linear fit models of replicate data showed superior statistical power for the MMASS-v2 method. Comparison with previous methylation data for HCT116 and validation of CpG islands from PXMP4, SFRP2, DCC, RARB and TSEN2 confirmed the accuracy of MMASS-v2 results. The MMASS-v2 method offers improved sensitivity and statistical power for high-throughput microarray identification of differential methylation.

  6. Epigenomic alterations define lethal CIMP-positive ependymomas of infancy

    PubMed Central

    Mack, S. C.; Witt, H.; Piro, R. M.; Gu, L.; Zuyderduyn, S.; Stütz, A. M.; Wang, X.; Gallo, M.; Garzia, L.; Zayne, K.; Zhang, X.; Ramaswamy, V.; Jäger, N.; Jones, D. T. W.; Sill, M.; Pugh, T. J.; Ryzhova, M.; Wani, K. M.; Shih, D. J. H.; Head, R.; Remke, M.; Bailey, S. D.; Zichner, T.; Faria, C. C.; Barszczyk, M.; Stark, S.; Seker-Cin, H.; Hutter, S.; Johann, P.; Bender, S.; Hovestadt, V.; Tzaridis, T.; Dubuc, A. M.; Northcott, P. A.; Peacock, J.; Bertrand, K. C.; Agnihotri, S.; Cavalli, F. M. G.; Clarke, I.; Nethery-Brokx, K.; Creasy, C. L.; Verma, S. K.; Koster, J.; Wu, X.; Yao, Y.; Milde, T.; Sin-Chan, P.; Zuccaro, J.; Lau, L.; Pereira, S.; Castelo-Branco, P.; Hirst, M.; Marra, M. A.; Roberts, S. S.; Fults, D.; Massimi, L.; Cho, Y. J.; Van Meter, T.; Grajkowska, W.; Lach, B.; Kulozik, A. E.; von Deimling, A.; Witt, O.; Scherer, S. W.; Fan, X.; Muraszko, K. M.; Kool, M.; Pomeroy, S. L.; Gupta, N.; Phillips, J.; Huang, A.; Tabori, U.; Hawkins, C.; Malkin, D.; Kongkham, P. N.; Weiss, W. A.; Jabado, N.; Rutka, J. T.; Bouffet, E.; Korbel, J. O.; Lupien, M.; Aldape, K. D.; Bader, G. D.; Eils, R.; Lichter, P.; Dirks, P. B.; Pfister, S. M.; Korshunov, A.; Taylor, M. D.

    2014-01-01

    Ependymomas are common childhood brain tumours that occur throughout the nervous system, but are most common in the paediatric hindbrain. Current standard therapy comprises surgery and radiation, but not cytotoxic chemotherapy as it does not further increase survival. Whole-genome and whole-exome sequencing of 47 hindbrain ependymomas reveals an extremely low mutation rate, and zero significant recurrent somatic single nucleotide variants. Although devoid of recurrent single nucleotide variants and focal copy number aberrations, poor-prognosis hindbrain ependymomas exhibit a CpG island methylator phenotype. Transcriptional silencing driven by CpG methylation converges exclusively on targets of the Polycomb repressive complex 2 which represses expression of differentiation genes through trimethylation of H3K27. CpG island methylator phenotype-positive hindbrain ependymomas are responsive to clinical drugs that target either DNA or H3K27 methylation both in vitro and in vivo. We conclude that epigenetic modifiers are the first rational therapeutic candidates for this deadly malignancy, which is epigenetically deregulated but genetically bland. PMID:24553142

  7. Epigenomic alterations define lethal CIMP-positive ependymomas of infancy.

    PubMed

    Mack, S C; Witt, H; Piro, R M; Gu, L; Zuyderduyn, S; Stütz, A M; Wang, X; Gallo, M; Garzia, L; Zayne, K; Zhang, X; Ramaswamy, V; Jäger, N; Jones, D T W; Sill, M; Pugh, T J; Ryzhova, M; Wani, K M; Shih, D J H; Head, R; Remke, M; Bailey, S D; Zichner, T; Faria, C C; Barszczyk, M; Stark, S; Seker-Cin, H; Hutter, S; Johann, P; Bender, S; Hovestadt, V; Tzaridis, T; Dubuc, A M; Northcott, P A; Peacock, J; Bertrand, K C; Agnihotri, S; Cavalli, F M G; Clarke, I; Nethery-Brokx, K; Creasy, C L; Verma, S K; Koster, J; Wu, X; Yao, Y; Milde, T; Sin-Chan, P; Zuccaro, J; Lau, L; Pereira, S; Castelo-Branco, P; Hirst, M; Marra, M A; Roberts, S S; Fults, D; Massimi, L; Cho, Y J; Van Meter, T; Grajkowska, W; Lach, B; Kulozik, A E; von Deimling, A; Witt, O; Scherer, S W; Fan, X; Muraszko, K M; Kool, M; Pomeroy, S L; Gupta, N; Phillips, J; Huang, A; Tabori, U; Hawkins, C; Malkin, D; Kongkham, P N; Weiss, W A; Jabado, N; Rutka, J T; Bouffet, E; Korbel, J O; Lupien, M; Aldape, K D; Bader, G D; Eils, R; Lichter, P; Dirks, P B; Pfister, S M; Korshunov, A; Taylor, M D

    2014-02-27

    Ependymomas are common childhood brain tumours that occur throughout the nervous system, but are most common in the paediatric hindbrain. Current standard therapy comprises surgery and radiation, but not cytotoxic chemotherapy as it does not further increase survival. Whole-genome and whole-exome sequencing of 47 hindbrain ependymomas reveals an extremely low mutation rate, and zero significant recurrent somatic single nucleotide variants. Although devoid of recurrent single nucleotide variants and focal copy number aberrations, poor-prognosis hindbrain ependymomas exhibit a CpG island methylator phenotype. Transcriptional silencing driven by CpG methylation converges exclusively on targets of the Polycomb repressive complex 2 which represses expression of differentiation genes through trimethylation of H3K27. CpG island methylator phenotype-positive hindbrain ependymomas are responsive to clinical drugs that target either DNA or H3K27 methylation both in vitro and in vivo. We conclude that epigenetic modifiers are the first rational therapeutic candidates for this deadly malignancy, which is epigenetically deregulated but genetically bland.

  8. Integrated data analysis reveals potential drivers and pathways disrupted by DNA methylation in papillary thyroid carcinomas.

    PubMed

    Beltrami, Caroline Moraes; Dos Reis, Mariana Bisarro; Barros-Filho, Mateus Camargo; Marchi, Fabio Albuquerque; Kuasne, Hellen; Pinto, Clóvis Antônio Lopes; Ambatipudi, Srikant; Herceg, Zdenko; Kowalski, Luiz Paulo; Rogatto, Silvia Regina

    2017-01-01

    Papillary thyroid carcinoma (PTC) is a common endocrine neoplasm with a recent increase in incidence in many countries. Although PTC has been explored by gene expression and DNA methylation studies, the regulatory mechanisms of the methylation on the gene expression was poorly clarified. In this study, DNA methylation profile (Illumina HumanMethylation 450K) of 41 PTC paired with non-neoplastic adjacent tissues (NT) was carried out to identify and contribute to the elucidation of the role of novel genic and intergenic regions beyond those described in the promoter and CpG islands (CGI). An integrative and cross-validation analysis were performed aiming to identify molecular drivers and pathways that are PTC-related. The comparisons between PTC and NT revealed 4995 methylated probes (88% hypomethylated in PTC) and 1446 differentially expressed transcripts cross-validated by the The Cancer Genome Atlas data. The majority of these probes was found in non-promoters regions, distant from CGI and enriched by enhancers. The integrative analysis between gene expression and DNA methylation revealed 185 and 38 genes (mainly in the promoter and body regions, respectively) with negative and positive correlation, respectively. Genes showing negative correlation underlined FGF and retinoic acid signaling as critical canonical pathways disrupted by DNA methylation in PTC. BRAF mutation was detected in 68% (28 of 41) of the tumors, which presented a higher level of demethylation (95% hypomethylated probes) compared with BRAF wild-type tumors. A similar integrative analysis uncovered 40 of 254 differentially expressed genes, which are potentially regulated by DNA methylation in BRAF V600E-positive tumors. The methylation and expression pattern of six selected genes ( ERBB3 , FGF1 , FGFR2 , GABRB2 , HMGA2 , and RDH5 ) were confirmed as altered by pyrosequencing and RT-qPCR. DNA methylation loss in non-promoter, poor CGI and enhancer-enriched regions was a significant event in PTC, especially in tumors harboring BRAF V600E. In addition to the promoter region, gene body and 3'UTR methylation have also the potential to influence the gene expression levels (both, repressing and inducing). The integrative analysis revealed genes potentially regulated by DNA methylation pointing out potential drivers and biomarkers related to PTC development.

  9. A DNA methylation fingerprint of 1628 human samples

    PubMed Central

    Fernandez, Agustin F.; Assenov, Yassen; Martin-Subero, Jose Ignacio; Balint, Balazs; Siebert, Reiner; Taniguchi, Hiroaki; Yamamoto, Hiroyuki; Hidalgo, Manuel; Tan, Aik-Choon; Galm, Oliver; Ferrer, Isidre; Sanchez-Cespedes, Montse; Villanueva, Alberto; Carmona, Javier; Sanchez-Mut, Jose V.; Berdasco, Maria; Moreno, Victor; Capella, Gabriel; Monk, David; Ballestar, Esteban; Ropero, Santiago; Martinez, Ramon; Sanchez-Carbayo, Marta; Prosper, Felipe; Agirre, Xabier; Fraga, Mario F.; Graña, Osvaldo; Perez-Jurado, Luis; Mora, Jaume; Puig, Susana; Prat, Jaime; Badimon, Lina; Puca, Annibale A.; Meltzer, Stephen J.; Lengauer, Thomas; Bridgewater, John; Bock, Christoph; Esteller, Manel

    2012-01-01

    Most of the studies characterizing DNA methylation patterns have been restricted to particular genomic loci in a limited number of human samples and pathological conditions. Herein, we present a compromise between an extremely comprehensive study of a human sample population with an intermediate level of resolution of CpGs at the genomic level. We obtained a DNA methylation fingerprint of 1628 human samples in which we interrogated 1505 CpG sites. The DNA methylation patterns revealed show this epigenetic mark to be critical in tissue-type definition and stemness, particularly around transcription start sites that are not within a CpG island. For disease, the generated DNA methylation fingerprints show that, during tumorigenesis, human cancer cells underwent a progressive gain of promoter CpG-island hypermethylation and a loss of CpG methylation in non-CpG-island promoters. Although transformed cells are those in which DNA methylation disruption is more obvious, we observed that other common human diseases, such as neurological and autoimmune disorders, had their own distinct DNA methylation profiles. Most importantly, we provide proof of principle that the DNA methylation fingerprints obtained might be useful for translational purposes by showing that we are able to identify the tumor type origin of cancers of unknown primary origin (CUPs). Thus, the DNA methylation patterns identified across the largest spectrum of samples, tissues, and diseases reported to date constitute a baseline for developing higher-resolution DNA methylation maps and provide important clues concerning the contribution of CpG methylation to tissue identity and its changes in the most prevalent human diseases. PMID:21613409

  10. Nullomers and High Order Nullomers in Genomic Sequences

    PubMed Central

    Vergni, Davide; Santoni, Daniele

    2016-01-01

    A nullomer is an oligomer that does not occur as a subsequence in a given DNA sequence, i.e. it is an absent word of that sequence. The importance of nullomers in several applications, from drug discovery to forensic practice, is now debated in the literature. Here, we investigated the nature of nullomers, whether their absence in genomes has just a statistical explanation or it is a peculiar feature of genomic sequences. We introduced an extension of the notion of nullomer, namely high order nullomers, which are nullomers whose mutated sequences are still nullomers. We studied different aspects of them: comparison with nullomers of random sequences, CpG distribution and mean helical rise. In agreement with previous results we found that the number of nullomers in the human genome is much larger than expected by chance. Nevertheless antithetical results were found when considering a random DNA sequence preserving dinucleotide frequencies. The analysis of CpG frequencies in nullomers and high order nullomers revealed, as expected, a high CpG content but it also highlighted a strong dependence of CpG frequencies on the dinucleotide position, suggesting that nullomers have their own peculiar structure and are not simply sequences whose CpG frequency is biased. Furthermore, phylogenetic trees were built on eleven species based on both the similarities between the dinucleotide frequencies and the number of nullomers two species share, showing that nullomers are fairly conserved among close species. Finally the study of mean helical rise of nullomers sequences revealed significantly high mean rise values, reinforcing the hypothesis that those sequences have some peculiar structural features. The obtained results show that nullomers are the consequence of the peculiar structure of DNA (also including biased CpG frequency and CpGs islands), so that the hypermutability model, also taking into account CpG islands, seems to be not sufficient to explain nullomer phenomenon. Finally, high order nullomers could emphasize those features that already make simple nullomers useful in several applications. PMID:27906971

  11. CpG island methylator phenotype in adenocarcinomas from the digestive tract: Methods, conclusions, and controversies

    PubMed Central

    Sánchez-Vega, Francisco; Gotea, Valer; Chen, Yun-Ching; Elnitski, Laura

    2017-01-01

    Over the last two decades, cancer-related alterations in DNA methylation that regulate transcription have been reported for a variety of tumors of the gastrointestinal tract. Due to its relevance for translational research, great emphasis has been placed on the analysis and molecular characterization of the CpG island methylator phenotype (CIMP), defined as widespread hypermethylation of CpG islands in clinically distinct subsets of cancer patients. Here, we present an overview of previous work in this field and also explore some open questions using cross-platform data for esophageal, gastric, and colorectal adenocarcinomas from The Cancer Genome Atlas. We provide a data-driven, pan-gastrointestinal stratification of individual samples based on CIMP status and we investigate correlations with oncogenic alterations, including somatic mutations and epigenetic silencing of tumor suppressor genes. Besides known events in CIMP such as BRAF V600E mutation, CDKN2A silencing or MLH1 inactivation, we discuss the potential role of emerging actors such as Wnt pathway deregulation through truncating mutations in RNF43 and epigenetic silencing of WIF1. Our results highlight the existence of molecular similarities that are superimposed over a larger backbone of tissue-specific features and can be exploited to reduce heterogeneity of response in clinical trials. PMID:28344746

  12. The evolution of CpG density and lifespan in conserved primate and mammalian promoters

    PubMed Central

    McLain, Adam T.

    2018-01-01

    Gene promoters are evolutionarily conserved across holozoans and enriched in CpG sites, the target for DNA methylation. As animals age, the epigenetic pattern of DNA methylation degrades, with highly methylated CpG sites gradually becoming demethylated while CpG islands increase in methylation. Across vertebrates, aging is a trait that varies among species. We used this variation to determine whether promoter CpG density correlates with species’ maximum lifespan. Human promoter sequences were used to identify conserved regions in 131 mammals and a subset of 28 primate genomes. We identified approximately 1000 gene promoters (5% of the total), that significantly correlated CpG density with lifespan. The correlations were performed via the phylogenetic least squares method to account for trait similarity by common descent using phylogenetic branch lengths. Gene set enrichment analysis revealed no significantly enriched pathways or processes, consistent with the hypothesis that aging is not under positive selection. However, within both mammals and primates, 95% of the promoters showed a positive correlation between increasing CpG density and species lifespan, and two thirds were shared between the primate subset and mammalian datasets. Thus, these genes may require greater buffering capacity against age-related dysregulation of DNA methylation in longer-lived species. PMID:29661983

  13. Effects of Interaction Between DRD4 Methylation and Prenatal Maternal Stress on Methylphenidate-Induced Changes in Continuous Performance Test Performance in Youth with Attention-Deficit/Hyperactivity Disorder.

    PubMed

    Kim, Johanna Inhyang; Kim, Jae-Won; Shin, Inkyung; Kim, Bung-Nyun

    2018-06-15

    Environmental factors may interact with genetic factors via the epigenetic process, and this interaction can contribute to inter-individual variability in the treatment response. The purpose of this study was to investigate the interaction effects between dopamine receptor D4 (DRD4) methylation and prenatal maternal stress on the methylphenidate (MPH) response of youth with attention-deficit/hyperactivity disorder (ADHD). This study was an 8-week open-label trial of MPH that included 74 ADHD youth. We investigated the associations between MPH treatment response, which was defined as a score ≤2 on the Clinical Global Impressions-Improvement (CGI-I) scale, and the methylation of 28 cytosine-guanine dinucleotide (CpG) sites of DRD4. Additionally, the interaction effects between DRD4 methylation and prenatal maternal stress on changes in Continuous Performance Test (CPT) scores after MPH treatment were investigated. Although there were no significant sites that showed significant association with treatment response, there was a significant interaction effect of the methylation of CpG7 and prenatal maternal stress on changes in omission errors of the CPT following treatment (p = 0.0001). The present findings indicate that the interaction between methylation of CpG7 of DRD4 and prenatal maternal stress may be predictive of the treatment response to MPH in youth with ADHD.

  14. Immortalization of T-cells is accompanied by gradual changes in CpG methylation resulting in a profile resembling a subset of T-cell leukemias.

    PubMed

    Degerman, Sofie; Landfors, Mattias; Siwicki, Jan Konrad; Revie, John; Borssén, Magnus; Evelönn, Emma; Forestier, Erik; Chrzanowska, Krystyna H; Rydén, Patrik; Keith, W Nicol; Roos, Göran

    2014-07-01

    We have previously described gene expression changes during spontaneous immortalization of T-cells, thereby identifying cellular processes important for cell growth crisis escape and unlimited proliferation. Here, we analyze the same model to investigate the role of genome-wide methylation in the immortalization process at different time points pre-crisis and post-crisis using high-resolution arrays. We show that over time in culture there is an overall accumulation of methylation alterations, with preferential increased methylation close to transcription start sites (TSSs), islands, and shore regions. Methylation and gene expression alterations did not correlate for the majority of genes, but for the fraction that correlated, gain of methylation close to TSS was associated with decreased gene expression. Interestingly, the pattern of CpG site methylation observed in immortal T-cell cultures was similar to clinical T-cell acute lymphoblastic leukemia (T-ALL) samples classified as CpG island methylator phenotype positive. These sites were highly overrepresented by polycomb target genes and involved in developmental, cell adhesion, and cell signaling processes. The presence of non-random methylation events in in vitro immortalized T-cell cultures and diagnostic T-ALL samples indicates altered methylation of CpG sites with a possible role in malignant hematopoiesis. Copyright © 2014 Neoplasia Press, Inc. Published by Elsevier Inc. All rights reserved.

  15. Clinical Significance of MLH1 Methylation and CpG Island Methylator Phenotype as Prognostic Markers in Patients with Gastric Cancer

    PubMed Central

    Shigeyasu, Kunitoshi; Nagasaka, Takeshi; Mori, Yoshiko; Yokomichi, Naosuke; Kawai, Takashi; Fuji, Tomokazu; Kimura, Keisuke; Umeda, Yuzo; Kagawa, Shunsuke; Goel, Ajay; Fujiwara, Toshiyoshi

    2015-01-01

    Background To improve the outcome of patients suffering from gastric cancer, a better understanding of underlying genetic and epigenetic events in this malignancy is required. Although CpG island methylator phenotype (CIMP) and microsatellite instability (MSI) have been shown to play pivotal roles in gastric cancer pathogenesis, the clinical significance of these events on survival outcomes in patients with gastric cancer remains unknown. Methods This study included a patient cohort with pathologically confirmed gastric cancer who had surgical resections. A cohort of 68 gastric cancers was analyzed. CIMP and MSI statuses were determined by analyzing promoter CpG island methylation status of 28 genes/loci, and genomic instability at 10 microsatellite markers, respectively. A Cox’s proportional hazards model was performed for multivariate analysis including age, stage, tumor differentiation, KRAS mutation status, and combined CIMP/MLH1 methylation status in relation to overall survival (OS). Results By multivariate analysis, longer OS was significantly correlated with lower pathologic stage (P = 0.0088), better tumor differentiation (P = 0.0267) and CIMP-high and MLH1 3' methylated status (P = 0.0312). Stratification of CIMP status with regards to MLH1 methylation status further enabled prediction of gastric cancer prognosis. Conclusions CIMP and/or MLH1 methylation status may have a potential to be prognostic biomarkers for patients with gastric cancer. PMID:26121593

  16. Vitamin D receptor gene methylation is associated with ethnicity, tuberculosis and TaqI polymorphism

    PubMed Central

    Andraos, Charlene; Koorsen, Gerrit; Knight, Julian C; Bornman, Liza

    2014-01-01

    The Vitamin D Receptor (VDR) gene encodes a transcription factor which, on activation by vitamin D, modulates diverse biological processes including calcium homeostasis and immune function. Genetic variation involving VDR shows striking differences in allele frequency between populations and has been associated with disease susceptibility including tuberculosis and autoimmunity, although results have often been conflicting. We hypothesized that methylation of VDR may be population specific and that the combination of differential methylation and genetic variation may characterise TB predisposition. We use bisulphite conversion and/or pyrosequencing to analyse the methylation status of 17 CpGs of VDR and to genotype 7 SNPs in the 3′ CpG Island (CGI 1060), including the commonly studied SNPs ApaI (rs7975232) and TaqI (rs731236). We show that for lymphoblastoid cell lines from two ethnically diverse populations (Yoruba from HapMap, n=30 and Caucasians, n=30) together with TB cases (n=32) and controls (n=29) from the Venda population of South Africa there are methylation variable positions (MVPs) in the 3′ end that significantly distinguish ethnicity (9/17 CpGs) and TB status (3/17 CpGs). Moreover methylation status shows complex association with TaqI genotype highlighting the need to consider both genetic and epigenetic variants in genetic studies of VDR association with disease. PMID:21168462

  17. CpG Island Methylation in Colorectal Cancer: Past, Present and Future

    PubMed Central

    Curtin, Karen; Slattery, Martha L.; Samowitz, Wade S.

    2011-01-01

    The concept of a CpG island methylator phenotype, or CIMP, quickly became the focus of several colorectal cancer studies describing its clinical and pathological features after its introduction in 1999 by Toyota and colleagues. Further characterization of CIMP in tumors lead to widespread acceptance of the concept, as expressed by Shen and Issa in their 2005 editorial, “CIMP, at last.” Since that time, extensive research efforts have brought great insights into the epidemiology and prognosis of CIMP+ tumors and other epigenetic mechanisms underlying tumorigenesis. With the advances in technology and subsequent cataloging of the human methylome in cancer and normal tissue, new directions in research to understand CIMP and its role in complex biological systems yield hope for future epigenetically based diagnostics and treatments. PMID:21559209

  18. Influence of the Prader-Willi syndrome imprinting center on the DNA methylation landscape in the mouse brain

    PubMed Central

    Brant, Jason O; Riva, Alberto; Resnick, James L; Yang, Thomas P

    2014-01-01

    Reduced representation bisulfite sequencing (RRBS) was used to analyze DNA methylation patterns across the mouse brain genome in mice carrying a deletion of the Prader-Willi syndrome imprinting center (PWS-IC) on either the maternally- or paternally-inherited chromosome. Within the ∼3.7 Mb imprinted Angelman/Prader-Willi syndrome (AS/PWS) domain, 254 CpG sites were interrogated for changes in methylation due to PWS-IC deletion. Paternally-inherited deletion of the PWS-IC increased methylation levels ∼2-fold at each CpG site (compared to wild-type controls) at differentially methylated regions (DMRs) associated with 5′ CpG island promoters of paternally-expressed genes; these methylation changes extended, to a variable degree, into the adjacent CpG island shores. Maternal PWS-IC deletion yielded little or no changes in methylation at these DMRs, and methylation of CpG sites outside of promoter DMRs also was unchanged upon maternal or paternal PWS-IC deletion. Using stringent ascertainment criteria, ∼750,000 additional CpG sites were also interrogated across the entire mouse genome. This analysis identified 26 loci outside of the imprinted AS/PWS domain showing altered DNA methylation levels of ≥25% upon PWS-IC deletion. Curiously, altered methylation at 9 of these loci was a consequence of maternal PWS-IC deletion (maternal PWS-IC deletion by itself is not known to be associated with a phenotype in either humans or mice), and 10 of these loci exhibited the same changes in methylation irrespective of the parental origin of the PWS-IC deletion. These results suggest that the PWS-IC may affect DNA methylation at these loci by directly interacting with them, or may affect methylation at these loci through indirect downstream effects due to PWS-IC deletion. They further suggest the PWS-IC may have a previously uncharacterized function outside of the imprinted AS/PWS domain. PMID:25482058

  19. Influence of the Prader-Willi syndrome imprinting center on the DNA methylation landscape in the mouse brain.

    PubMed

    Brant, Jason O; Riva, Alberto; Resnick, James L; Yang, Thomas P

    2014-11-01

    Reduced representation bisulfite sequencing (RRBS) was used to analyze DNA methylation patterns across the mouse brain genome in mice carrying a deletion of the Prader-Willi syndrome imprinting center (PWS-IC) on either the maternally- or paternally-inherited chromosome. Within the ~3.7 Mb imprinted Angelman/Prader-Willi syndrome (AS/PWS) domain, 254 CpG sites were interrogated for changes in methylation due to PWS-IC deletion. Paternally-inherited deletion of the PWS-IC increased methylation levels ~2-fold at each CpG site (compared to wild-type controls) at differentially methylated regions (DMRs) associated with 5' CpG island promoters of paternally-expressed genes; these methylation changes extended, to a variable degree, into the adjacent CpG island shores. Maternal PWS-IC deletion yielded little or no changes in methylation at these DMRs, and methylation of CpG sites outside of promoter DMRs also was unchanged upon maternal or paternal PWS-IC deletion. Using stringent ascertainment criteria, ~750,000 additional CpG sites were also interrogated across the entire mouse genome. This analysis identified 26 loci outside of the imprinted AS/PWS domain showing altered DNA methylation levels of ≥25% upon PWS-IC deletion. Curiously, altered methylation at 9 of these loci was a consequence of maternal PWS-IC deletion (maternal PWS-IC deletion by itself is not known to be associated with a phenotype in either humans or mice), and 10 of these loci exhibited the same changes in methylation irrespective of the parental origin of the PWS-IC deletion. These results suggest that the PWS-IC may affect DNA methylation at these loci by directly interacting with them, or may affect methylation at these loci through indirect downstream effects due to PWS-IC deletion. They further suggest the PWS-IC may have a previously uncharacterized function outside of the imprinted AS/PWS domain.

  20. DNA methylome profiling identifies novel methylated genes in African American patients with colorectal neoplasia.

    PubMed

    Ashktorab, Hassan; Daremipouran, M; Goel, Ajay; Varma, Sudhir; Leavitt, R; Sun, Xueguang; Brim, Hassan

    2014-04-01

    The identification of genes that are differentially methylated in colorectal cancer (CRC) has potential value for both diagnostic and therapeutic interventions specifically in high-risk populations such as African Americans (AAs). However, DNA methylation patterns in CRC, especially in AAs, have not been systematically explored and remain poorly understood. Here, we performed DNA methylome profiling to identify the methylation status of CpG islands within candidate genes involved in critical pathways important in the initiation and development of CRC. We used reduced representation bisulfite sequencing (RRBS) in colorectal cancer and adenoma tissues that were compared with DNA methylome from a healthy AA subject's colon tissue and peripheral blood DNA. The identified methylation markers were validated in fresh frozen CRC tissues and corresponding normal tissues from AA patients diagnosed with CRC at Howard University Hospital. We identified and validated the methylation status of 355 CpG sites located within 16 gene promoter regions associated with CpG islands. Fifty CpG sites located within CpG islands-in genes ATXN7L1 (2), BMP3 (7), EID3 (15), GAS7 (1), GPR75 (24), and TNFAIP2 (1)-were significantly hypermethylated in tumor vs. normal tissues (P<0.05). The methylation status of BMP3, EID3, GAS7, and GPR75 was confirmed in an independent, validation cohort. Ingenuity pathway analysis mapped three of these markers (GAS7, BMP3 and GPR) in the insulin and TGF-β1 network-the two key pathways in CRC. In addition to hypermethylated genes, our analysis also revealed that LINE-1 repeat elements were progressively hypomethylated in the normal-adenoma-cancer sequence. We conclude that DNA methylome profiling based on RRBS is an effective method for screening aberrantly methylated genes in CRC. While previous studies focused on the limited identification of hypermethylated genes, ours is the first study to systematically and comprehensively identify novel hypermethylated genes, as well as hypomethylated LINE-1 sequences, which may serve as potential biomarkers for CRC in African Americans. Our discovered biomarkers were intimately linked to the insulin/TGF-B1 pathway, further strengthening the association of diabetic disorders with colon oncogenic transformation.

  1. Global Epigenetic Changes May Underlie Ethnic Differences and Susceptibility to Prostate Cancer

    DTIC Science & Technology

    2013-09-01

    malignancy and can often be found in non-cancerous tissues; in the prostate, hypermethylation of the GSTP1 CpG has been detected in PIA lesions [8]. DNA...methylcytosine (5-meC; [9, 10]). Since the recognition that the GSTP1 CpG island was frequently hypermethylated in PCa, more than 40 genes have been reported to...has also been identified for several genes. One study demonstrated that GSTP1 hypermethylation was significantly higher in PCa samples from AA men

  2. Altered DNA Methylation and Expression Profiles of 8-Oxoguanine DNA Glycosylase 1 in Lens Tissue from Age-related Cataract Patients.

    PubMed

    Wang, Yong; Li, Fei; Zhang, Guowei; Kang, Lihua; Qin, Bai; Guan, Huaijin

    2015-01-01

    Oxidative stress and DNA damage contribute to the pathogenesis of age-related cataract (ARC). Most oxidative DNA lesions are repaired via the base excision repair (BER) proteins including 8-oxoguanine DNA glycosylase 1 (OGG1). This study examined DNA methylation of CpG islands upstream of OGG1 and their relation to the gene expression in lens cortex from ARC patients. The clinical case-control study consisted of 15 cortical type of ARC patients and 15 age-matched non-ARC controls who received transparent lens extraction due to vitreoretinal diseases. OGG1 expression in lens cortex was analyzed by qRT-PCR and Western blot. The localization and the proportion of cells positive for OGG1 were determined by immunofluorescence. Bisulfite-sequencing PCR (BSP) was performed to evaluate the methylation status of CpG islands near OGG1 in DNA extracted from lens cortex. To test relationship between the methylation and the expression of the gene of interest, 5-Aza-2'-deoxycytidine (5-Aza-dC) was used to induce demethylation of cultured human lens epithelium B-3 (HLE B-3). To test the role of OGG1 in the repair of cellular damage, HLE B-3 was transfected with OGG1 vector, followed by ultraviolet radiation b (UVB) exposure to induce apoptosis. The mRNA and protein levels of OGG1 were significantly reduced in the lens cortex of ARC. Immunofluorescence showed that the proportion of OGG1-positive cells decreased significantly in ARC cortex in comparison with the control. The CpG island in first exon of OGG1 displayed hypermethylation in the DNA extracted from the lens cortex of ARC. Treatment of HLEB-3 cells with 5-Aza-dC upregulated OGG1 expression. UVB-induced apoptosis was attenuated after transfection with OGG1. A reduced OGG1 expression was correlated with hypermethylation of a CpG island of OGG1 in lens cortex of ARC. The role of epigenetic change in OGG1 gene in the susceptibility to oxidative stress induced cortical ARC is warranted to further study.

  3. Pan-cancer stratification of solid human epithelial tumors and cancer cell lines reveals commonalities and tissue-specific features of the CpG island methylator phenotype.

    PubMed

    Sánchez-Vega, Francisco; Gotea, Valer; Margolin, Gennady; Elnitski, Laura

    2015-01-01

    The term CpG island methylator phenotype (CIMP) has been used to describe widespread DNA hypermethylation at CpG-rich genomic regions affecting clinically distinct subsets of cancer patients. Even though there have been numerous studies of CIMP in individual cancer types, a uniform analysis across tissues is still lacking. We analyze genome-wide patterns of CpG island hypermethylation in 5,253 solid epithelial tumors from 15 cancer types from TCGA and 23 cancer cell lines from ENCODE. We identify differentially methylated loci that define CIMP+ and CIMP- samples, and we use unsupervised clustering to provide a robust molecular stratification of tumor methylomes for 12 cancer types and all cancer cell lines. With a minimal set of 89 discriminative loci, we demonstrate accurate pan-cancer separation of the 12 CIMP+/- subpopulations, based on their average levels of methylation. Tumor samples in different CIMP subclasses show distinctive correlations with gene expression profiles and recurrence of somatic mutations, copy number variations, and epigenetic silencing. Enrichment analyses indicate shared canonical pathways and upstream regulators for CIMP-targeted regions across cancer types. Furthermore, genomic alterations showing consistent associations with CIMP+/- status include genes involved in DNA repair, chromatin remodeling genes, and several histone methyltransferases. Associations of CIMP status with specific clinical features, including overall survival in several cancer types, highlight the importance of the CIMP+/- designation for individual tumor evaluation and personalized medicine. We present a comprehensive computational study of CIMP that reveals pan-cancer commonalities and tissue-specific differences underlying concurrent hypermethylation of CpG islands across tumors. Our stratification of solid tumors and cancer cell lines based on CIMP status is data-driven and agnostic to tumor type by design, which protects against known biases that have hindered classic methods previously used to define CIMP. The results that we provide can be used to refine existing molecular subtypes of cancer into more homogeneously behaving subgroups, potentially leading to more uniform responses in clinical trials.

  4. Cadmium exposure and the epigenome

    PubMed Central

    Sanders, Alison P; Smeester, Lisa; Rojas, Daniel; DeBussycher, Tristan; Wu, Michael C; Wright, Fred A; Zhou, Yi-Hui; Laine, Jessica E; Rager, Julia E; Swamy, Geeta K; Ashley-Koch, Allison; Lynn Miranda, Marie; Fry, Rebecca C

    2014-01-01

    Cadmium (Cd) is prevalent in the environment yet understudied as a developmental toxicant. Cd partially crosses the placental barrier from mother to fetus and is linked to detrimental effects in newborns. Here we examine the relationship between levels of Cd during pregnancy and 5-methylcytosine (5mC) levels in leukocyte DNA collected from 17 mother-newborn pairs. The methylation of cytosines is an epigenetic mechanism known to impact transcriptional signaling and influence health endpoints. A methylated cytosine-guanine (CpG) island recovery assay was used to assess over 4.6 million sites spanning 16,421 CpG islands. Exposure to Cd was classified for each mother-newborn pair according to maternal blood levels and compared with levels of cotinine. Subsets of genes were identified that showed altered DNA methylation levels in their promoter regions in fetal DNA associated with levels of Cd (n = 61), cotinine (n = 366), or both (n = 30). Likewise, in maternal DNA, differentially methylated genes were identified that were associated with Cd (n = 92) or cotinine (n = 134) levels. While the gene sets were largely distinct between maternal and fetal DNA, functional similarities at the biological pathway level were identified including an enrichment of genes that encode for proteins that control transcriptional regulation and apoptosis. Furthermore, conserved DNA motifs with sequence similarity to specific transcription factor binding sites were identified within the CpG islands of the gene sets. This study provides evidence for distinct patterns of DNA methylation or “footprints” in fetal and maternal DNA associated with exposure to Cd. PMID:24169490

  5. Paradoxical Role of DNA Methylation in Activation of FoxA2 Gene Expression during Endoderm Development*

    PubMed Central

    Bahar Halpern, Keren; Vana, Tal; Walker, Michael D.

    2014-01-01

    The transcription factor FoxA2 is a master regulator of endoderm development and pancreatic beta cell gene expression. To elucidate the mechanisms underlying the activation of the FoxA2 gene during differentiation, we have compared the epigenetic status of undifferentiated human embryonic stem cells (hESCs), hESC-derived early endoderm stage cells (CXCR4+ cells), and pancreatic islet cells. Unexpectedly, a CpG island in the promoter region of the FoxA2 gene displayed paradoxically high levels of DNA methylation in expressing tissues (CXCR4+, islets) and low levels in nonexpressing tissues. This CpG island region was found to repress reporter gene expression and bind the Polycomb group protein SUZ12 and the DNA methyltransferase (DNMT)3b preferentially in undifferentiated hESCs as compared with CXCR4+ or islets cells. Consistent with this, activation of FoxA2 gene expression, but not CXCR4 or SOX17, was strongly inhibited by 5-aza-2′-deoxycytidine and by knockdown of DNMT3b. We hypothesize that in nonexpressing tissues, the lack of DNA methylation allows the binding of DNA methyltransferases and repressing proteins, such as Polycomb group proteins; upon differentiation, DNMT activation leads to CpG island methylation, causing loss of repressor protein binding. These results suggest a novel and unexpected role for DNA methylation in the activation of FoxA2 gene expression during differentiation. PMID:25016019

  6. DNA methylation and exposure to ambient air pollution in two prospective cohorts.

    PubMed

    Plusquin, Michelle; Guida, Florence; Polidoro, Silvia; Vermeulen, Roel; Raaschou-Nielsen, Ole; Campanella, Gianluca; Hoek, Gerard; Kyrtopoulos, Soterios A; Georgiadis, Panagiotis; Naccarati, Alessio; Sacerdote, Carlotta; Krogh, Vittorio; Bas Bueno-de-Mesquita, H; Monique Verschuren, W M; Sayols-Baixeras, Sergi; Panni, Tommaso; Peters, Annette; Hebels, Dennie G A J; Kleinjans, Jos; Vineis, Paolo; Chadeau-Hyam, Marc

    2017-11-01

    Long-term exposure to air pollution has been associated with several adverse health effects including cardiovascular, respiratory diseases and cancers. However, underlying molecular alterations remain to be further investigated. The aim of this study is to investigate the effects of long-term exposure to air pollutants on (a) average DNA methylation at functional regions and, (b) individual differentially methylated CpG sites. An assumption is that omic measurements, including the methylome, are more sensitive to low doses than hard health outcomes. This study included blood-derived DNA methylation (Illumina-HM450 methylation) for 454 Italian and 159 Dutch participants from the European Prospective Investigation into Cancer and Nutrition (EPIC). Long-term air pollution exposure levels, including NO 2 , NO x , PM 2.5 , PM coarse , PM 10 , PM 2.5 absorbance (soot) were estimated using models developed within the ESCAPE project, and back-extrapolated to the time of sampling when possible. We meta-analysed the associations between the air pollutants and global DNA methylation, methylation in functional regions and epigenome-wide methylation. CpG sites found differentially methylated with air pollution were further investigated for functional interpretation in an independent population (EnviroGenoMarkers project), where (N=613) participants had both methylation and gene expression data available. Exposure to NO 2 was associated with a significant global somatic hypomethylation (p-value=0.014). Hypomethylation of CpG island's shores and shelves and gene bodies was significantly associated with higher exposures to NO 2 and NO x . Meta-analysing the epigenome-wide findings of the 2 cohorts did not show genome-wide significant associations at single CpG site level. However, several significant CpG were found if the analyses were separated by countries. By regressing gene expression levels against methylation levels of the exposure-related CpG sites, we identified several significant CpG-transcript pairs and highlighted 5 enriched pathways for NO 2 and 9 for NO x mainly related to the immune system and its regulation. Our findings support results on global hypomethylation associated with air pollution, and suggest that the shores and shelves of CpG islands and gene bodies are mostly affected by higher exposure to NO 2 and NO x . Functional differences in the immune system were suggested by transcriptome analyses. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  7. The CpG island methylator phenotype (CIMP) in colorectal cancer

    PubMed Central

    Mojarad, Ehsan Nazemalhosseini; Kuppen, Peter JK; Aghdaei, Hamid Asadzadeh

    2013-01-01

    It is clear that colorectal cancer (CRC) develops through multiple genetic and epigenetic pathways. These pathways may be determined on the basis of three molecular features: (i) mutations in DNA mismatch repair genes, leading to a DNA microsatellite instability (MSI) phenotype, (ii) mutations in APC and other genes that activate Wnt pathway, characterized by chromosomal instability (CIN) phenotype, and (iii) global genome hypermethylation, resulting in switch off of tumor suppressor genes, indicated as CpG island methylator phenotype (CIMP). Each of these pathways is characterized by specific pathological features, mechanisms of carcinogenesis and process of tumor development. The molecular aspects of these pathways have been used clinically in the diagnosis, screening and management of patients with colorectal cancer. In this review we especially describe various aspects of CIMP, one of the important and rather recently discovered pathways that lead to colorectal cancer. PMID:24834258

  8. The CpG island methylator phenotype (CIMP) in colorectal cancer.

    PubMed

    Nazemalhosseini Mojarad, Ehsan; Kuppen, Peter Jk; Aghdaei, Hamid Asadzadeh; Zali, Mohammad Reza

    2013-01-01

    It is clear that colorectal cancer (CRC) develops through multiple genetic and epigenetic pathways. These pathways may be determined on the basis of three molecular features: (i) mutations in DNA mismatch repair genes, leading to a DNA microsatellite instability (MSI) phenotype, (ii) mutations in APC and other genes that activate Wnt pathway, characterized by chromosomal instability (CIN) phenotype, and (iii) global genome hypermethylation, resulting in switch off of tumor suppressor genes, indicated as CpG island methylator phenotype (CIMP). Each of these pathways is characterized by specific pathological features, mechanisms of carcinogenesis and process of tumor development. The molecular aspects of these pathways have been used clinically in the diagnosis, screening and management of patients with colorectal cancer. In this review we especially describe various aspects of CIMP, one of the important and rather recently discovered pathways that lead to colorectal cancer.

  9. A novel isoform of TET1 that lacks a CXXC domain is overexpressed in cancer

    PubMed Central

    Good, Charly R.; Madzo, Jozef; Patel, Bela; Maegawa, Shinji; Engel, Nora; Jelinek, Jaroslav

    2017-01-01

    Abstract TET1 oxidizes methylated cytosine into 5-hydroxymethylcytosine (5hmC), resulting in regulation of DNA methylation and gene expression. Full length TET1 (TET1FL) has a CXXC domain that binds to unmethylated CpG islands (CGIs). This CXXC domain allows TET1 to protect CGIs from aberrant methylation, but it also limits its ability to regulate genes outside of CGIs. Here, we report a novel isoform of TET1 (TET1ALT) that has a unique transcription start site from an alternate promoter in intron 2, yielding a protein with a unique translation start site. Importantly, TET1ALT lacks the CXXC domain but retains the catalytic domain. TET1ALT is repressed in embryonic stem cells (ESCs) but becomes activated in embryonic and adult tissues while TET1FL is expressed in ESCs, but repressed in adult tissues. Overexpression of TET1ALT shows production of 5hmC with distinct (and weaker) effects on DNA methylation or gene expression when compared to TET1FL. TET1ALT is aberrantly activated in multiple cancer types including breast, uterine and glioblastoma, and TET1 activation is associated with a worse overall survival in breast, uterine and ovarian cancers. Our data suggest that the predominantly activated isoform of TET1 in cancer cells does not protect from CGI methylation and likely mediates dynamic site-specific demethylation outside of CGIs. PMID:28531272

  10. MSH6 G39E Polymorphism and CpG Island Methylator Phenotype in Colon Cancer

    PubMed Central

    Curtin, Karen; Samowitz, Wade S.; Wolff, Roger K.; Caan, Bette J.; Ulrich, Cornelia M.; Potter, John D.; Slattery, Martha L.

    2010-01-01

    The MSH6 G39E germline polymorphism is not associated with an increased risk of either microsatellite stable or unstable sporadic colorectal cancer. Other than microsatellite instability, however, most genetic and epigenetic changes of tumors associated with this common variant have not been studied. The objective of our investigation was to evaluate associations between the MSH6 G39E (116G>A) polymorphism and CpG island methylator phenotype (CIMP) and BRAF V600E mutations in tumors from a sample of 1048 individuals with colon cancer and 1964 controls from Utah, Northern California, and Minnesota. The G39E polymorphism (rs1042821) was determined by the five prime nuclease assay. CIMP was determined by methylation-specific polymerase chain reaction (PCR) of CpG islands in MLH1, methylated in tumors (MINT)1, MINT2, MINT31, and CDKN2A. The BRAF V600E mutation was determined by sequencing exon 15. In microsatellite stable tumors, homozygous carriers of the G39E polymorphism had an increased risk of CIMP+ colon cancer (odds ratio (OR) 2.2, 95% confidence interval (CI) 1.1, 4.2) and BRAF V600E mutation (OR 3.1, 95% CI 1.01, 9.7) in a case–control comparison. This finding was not observed in unstable tumors; however, power may have been low to detect an association. Age at diagnosis, family history, and alcohol use did not interact with MSH6 G39E and CIMP. The MSH6 G39E germline polymorphism may be associated with CIMP+ colon cancer. PMID:19582761

  11. DNA Methylation of T1R1 Gene in the Vegetarian Adaptation of Grass Carp Ctenopharyngodon idella.

    PubMed

    Cai, Wenjing; He, Shan; Liang, Xu-Fang; Yuan, Xiaochen

    2018-05-02

    Although previous studies have indicated importance of taste receptors in food habits formation in mammals, little is known about those in fish. Grass carp is an excellent model for studying vegetarian adaptation, as it shows food habit transition from carnivore to herbivore. In the present study, pseudogenization or frameshift mutations of the umami receptors that hypothesized related to dietary switch in vertebrates, were not found in grass carp, suggesting other mechanisms for vegetarian adaptation in grass carp. T1R1 and T1R3 strongly responded to L-Arg and L-Lys, differing from those of zebrafish and medaka, contributing to high species specificity in amino acid preferences and diet selection of grass carp. After food habit transition of grass carp, DNA methylation levels were higher in CPG1 and CPG3 islands of upstream control region of T1R1 gene. Luciferase activity assay of upstream regulatory region of T1R1 (-2500-0 bp) without CPG1 or CPG3 indicated that CPG1 and CPG3 might be involved in transcriptional regulation of T1R1 gene. Subsequently, high DNA methylation decreased expression of T1R1 in intestinal tract. It could be a new mechanism to explain, at least partially, the vegetarian adaptation of grass carp by regulation of expression of umami receptor via epigenetic modification.

  12. Mapping the zebrafish brain methylome using reduced representation bisulfite sequencing

    PubMed Central

    Chatterjee, Aniruddha; Ozaki, Yuichi; Stockwell, Peter A; Horsfield, Julia A; Morison, Ian M; Nakagawa, Shinichi

    2013-01-01

    Reduced representation bisulfite sequencing (RRBS) has been used to profile DNA methylation patterns in mammalian genomes such as human, mouse and rat. The methylome of the zebrafish, an important animal model, has not yet been characterized at base-pair resolution using RRBS. Therefore, we evaluated the technique of RRBS in this model organism by generating four single-nucleotide resolution DNA methylomes of adult zebrafish brain. We performed several simulations to show the distribution of fragments and enrichment of CpGs in different in silico reduced representation genomes of zebrafish. Four RRBS brain libraries generated 98 million sequenced reads and had higher frequencies of multiple mapping than equivalent human RRBS libraries. The zebrafish methylome indicates there is higher global DNA methylation in the zebrafish genome compared with its equivalent human methylome. This observation was confirmed by RRBS of zebrafish liver. High coverage CpG dinucleotides are enriched in CpG island shores more than in the CpG island core. We found that 45% of the mapped CpGs reside in gene bodies, and 7% in gene promoters. This analysis provides a roadmap for generating reproducible base-pair level methylomes for zebrafish using RRBS and our results provide the first evidence that RRBS is a suitable technique for global methylation analysis in zebrafish. PMID:23975027

  13. Nightshift work and genome-wide DNA methylation.

    PubMed

    Bhatti, Parveen; Zhang, Yuzheng; Song, Xiaoling; Makar, Karen W; Sather, Cassandra L; Kelsey, Karl T; Houseman, E Andres; Wang, Pei

    2015-02-01

    The negative health effects of shift work, including carcinogenesis, may be mediated by changes in DNA methylation, particularly in the circadian genes. Using the Infinium HumanMethylation450 Bead Array (Illumina, San Diego, CA), we compared genome-wide methylation between 65 actively working dayshift workers and 59 actively working nightshift workers in the healthcare industry. A total of 473 800 loci, including 391 loci across the 12 core circadian genes, were analyzed to identify methylation markers associated with shift work status using linear regression models adjusted for gender, age, body mass index, race, smoking status and leukocyte cell profile as measured by flow cytometry. Analyses at the level of gene, CpG island and gene region were also conducted. To account for multiple comparisons, we controlled the false discovery rate (FDR ≤0.05). Significant differences between nightshift and dayshift workers were found at 16 135 of 473 800 loci, across 3769 of 20 164 genes, across 7173 of 22 721 CpG islands and across 5508 of 51 843 gene regions. For each significant loci, gene, CpG island or gene region, average methylation was consistently found to be decreased among nightshift workers compared to dayshift workers. Twenty-one loci located in the circadian genes were also found to be significantly hypomethylated among nightshift workers. The largest differences were observed for three loci located in the gene body of PER3. A total of nine significant loci were found in the CSNK1E gene, most of which were located in a CpG island and near the transcription start site of the gene. Methylation changes in these circadian genes may lead to altered expression of these genes which has been associated with cancer in previous studies. Gene ontology enrichment analysis revealed that among the significantly hypomethylated genes, processes related to host defense and immunity were represented. Our results indicate that the health effects of shift work may be mediated by hypomethylation of a wide variety of genes, including those related to circadian rhythms. While these findings need to be followed-up among a considerably expanded group of shift workers, the data generated by this study supports the need for future targeted research into the potential impacts of shift work on specific carcinogenic mechanisms.

  14. Prediction of epigenetically regulated genes in breast cancer cell lines.

    PubMed

    Loss, Leandro A; Sadanandam, Anguraj; Durinck, Steffen; Nautiyal, Shivani; Flaucher, Diane; Carlton, Victoria E H; Moorhead, Martin; Lu, Yontao; Gray, Joe W; Faham, Malek; Spellman, Paul; Parvin, Bahram

    2010-06-04

    Methylation of CpG islands within the DNA promoter regions is one mechanism that leads to aberrant gene expression in cancer. In particular, the abnormal methylation of CpG islands may silence associated genes. Therefore, using high-throughput microarrays to measure CpG island methylation will lead to better understanding of tumor pathobiology and progression, while revealing potentially new biomarkers. We have examined a recently developed high-throughput technology for measuring genome-wide methylation patterns called mTACL. Here, we propose a computational pipeline for integrating gene expression and CpG island methylation profiles to identify epigenetically regulated genes for a panel of 45 breast cancer cell lines, which is widely used in the Integrative Cancer Biology Program (ICBP). The pipeline (i) reduces the dimensionality of the methylation data, (ii) associates the reduced methylation data with gene expression data, and (iii) ranks methylation-expression associations according to their epigenetic regulation. Dimensionality reduction is performed in two steps: (i) methylation sites are grouped across the genome to identify regions of interest, and (ii) methylation profiles are clustered within each region. Associations between the clustered methylation and the gene expression data sets generate candidate matches within a fixed neighborhood around each gene. Finally, the methylation-expression associations are ranked through a logistic regression, and their significance is quantified through permutation analysis. Our two-step dimensionality reduction compressed 90% of the original data, reducing 137,688 methylation sites to 14,505 clusters. Methylation-expression associations produced 18,312 correspondences, which were used to further analyze epigenetic regulation. Logistic regression was used to identify 58 genes from these correspondences that showed a statistically significant negative correlation between methylation profiles and gene expression in the panel of breast cancer cell lines. Subnetwork enrichment of these genes has identified 35 common regulators with 6 or more predicted markers. In addition to identifying epigenetically regulated genes, we show evidence of differentially expressed methylation patterns between the basal and luminal subtypes. Our results indicate that the proposed computational protocol is a viable platform for identifying epigenetically regulated genes. Our protocol has generated a list of predictors including COL1A2, TOP2A, TFF1, and VAV3, genes whose key roles in epigenetic regulation is documented in the literature. Subnetwork enrichment of these predicted markers further suggests that epigenetic regulation of individual genes occurs in a coordinated fashion and through common regulators.

  15. The Genomic Impact of DNA CpG Methylation on Gene Expression; Relationships in Prostate Cancer.

    PubMed

    Long, Mark D; Smiraglia, Dominic J; Campbell, Moray J

    2017-02-14

    The process of DNA CpG methylation has been extensively investigated for over 50 years and revealed associations between changing methylation status of CpG islands and gene expression. As a result, DNA CpG methylation is implicated in the control of gene expression in developmental and homeostasis processes, as well as being a cancer-driver mechanism. The development of genome-wide technologies and sophisticated statistical analytical approaches has ushered in an era of widespread analyses, for example in the cancer arena, of the relationships between altered DNA CpG methylation, gene expression, and tumor status. The remarkable increase in the volume of such genomic data, for example, through investigators from the Cancer Genome Atlas (TCGA), has allowed dissection of the relationships between DNA CpG methylation density and distribution, gene expression, and tumor outcome. In this manner, it is now possible to test that the genome-wide correlations are measurable between changes in DNA CpG methylation and gene expression. Perhaps surprisingly is that these associations can only be detected for hundreds, but not thousands, of genes, and the direction of the correlations are both positive and negative. This, perhaps, suggests that CpG methylation events in cancer systems can act as disease drivers but the effects are possibly more restricted than suspected. Additionally, the positive and negative correlations suggest direct and indirect events and an incomplete understanding. Within the prostate cancer TCGA cohort, we examined the relationships between expression of genes that control DNA methylation, known targets of DNA methylation and tumor status. This revealed that genes that control the synthesis of S -adenosyl-l-methionine (SAM) associate with altered expression of DNA methylation targets in a subset of aggressive tumors.

  16. Profiling DNA methylome landscapes of mammalian cells with single-cell reduced-representation bisulfite sequencing.

    PubMed

    Guo, Hongshan; Zhu, Ping; Guo, Fan; Li, Xianlong; Wu, Xinglong; Fan, Xiaoying; Wen, Lu; Tang, Fuchou

    2015-05-01

    The heterogeneity of DNA methylation within a population of cells necessitates DNA methylome profiling at single-cell resolution. Recently, we developed a single-cell reduced-representation bisulfite sequencing (scRRBS) technique in which we modified the original RRBS method by integrating all the experimental steps before PCR amplification into a single-tube reaction. These modifications enable scRRBS to provide digitized methylation information on ∼1 million CpG sites within an individual diploid mouse or human cell at single-base resolution. Compared with the single-cell bisulfite sequencing (scBS) technique, scRRBS covers fewer CpG sites, but it provides better coverage for CpG islands (CGIs), which are likely to be the most informative elements for DNA methylation. The entire procedure takes ∼3 weeks, and it requires strong molecular biology skills.

  17. Methylation analysis of p16, SLIT2, SCARA5, and Runx3 genes in hepatocellular carcinoma

    PubMed Central

    Sun, Gaofeng; Zhang, Chen; Feng, Min; Liu, Wensheng; Xie, Huifang; Qin, Qin; Zhao, E.; Wan, Li

    2017-01-01

    Abstract This study is to investigate the methylation status of multiple tumor suppressor 1 (p16), secreted glycoprotein 2 (SLIT2), scavenger receptor class A, member 5 putative (SCARA5), and human runt-related transcription factor 3 (Runx3) genes in the peripheral blood of hepatocellular carcinoma (HCC). This is a case–control study. The peripheral blood samples were collected from 25 HCC patients, 25 patients with high risk of HCC (defined as “internal control group”), and 25 healthy individuals (defined as “external control group”), respectively. Then the methylation status of p16, SLIT2, SCARA5, and Runx3 genes in the blood samples were analyzed by pyrosequencing. The relationship between the methylation and the clinical features of HCC patients were evaluated. The methylation levels in the 7 CpG loci of p16 gene in HCC patients were low and without statistically significant difference (P > .05) compared to the control groups. Although the methylation levels of CpG3 and CpG4 in SLIT2 gene loci were higher than those of the control groups, there was no statistically significant difference (P > .05). However, the methylation rate of CpG2 locus in SCARA5 gene in HCC patients was significantly higher (P < .05). And the methylation rates of CpG1, CpG2, CpG3, CpG4, CpG5, and CpG8 in Runx3 gene in HCC patients were significantly different to that of control groups (P < .05). We also have analyzed the correlations between the CpG islands methylation of Runx3 or SCARA5 genes and the age, gender, hepatitis B, liver cirrhosis, alpha fetal protein, or hepatitis B surface antigen (HBsAg) of the HCC patients, which all showed no significant correlations (P > .05). The methylation status of SCARA5 and Runx3 genes are abnormal in HCC patients, which may further be used as molecular markers for early auxiliary diagnosis of liver cancer. PMID:29019900

  18. CpG Methylation Analysis—Current Status of Clinical Assays and Potential Applications in Molecular Diagnostics

    PubMed Central

    Sepulveda, Antonia R.; Jones, Dan; Ogino, Shuji; Samowitz, Wade; Gulley, Margaret L.; Edwards, Robin; Levenson, Victor; Pratt, Victoria M.; Yang, Bin; Nafa, Khedoudja; Yan, Liying; Vitazka, Patrick

    2009-01-01

    Methylation of CpG islands in gene promoter regions is a major molecular mechanism of gene silencing and underlies both cancer development and progression. In molecular oncology, testing for the CpG methylation of tissue DNA has emerged as a clinically useful tool for tumor detection, outcome prediction, and treatment selection, as well as for assessing the efficacy of treatment with the use of demethylating agents and monitoring for tumor recurrence. In addition, because CpG methylation occurs early in pre-neoplastic tissues, methylation tests may be useful as markers of cancer risk in patients with either infectious or inflammatory conditions. The Methylation Working Group of the Clinical Practice Committee of the Association of Molecular Pathology has reviewed the current state of clinical testing in this area. We report here our summary of both the advantages and disadvantages of various methods, as well as the needs for standardization and reporting. We then conclude by summarizing the most promising areas for future clinical testing in cancer molecular diagnostics. PMID:19541921

  19. DNA methylation profiles of long- and short-term glioblastoma survivors

    PubMed Central

    Shinawi, Thoraia; Hill, Victoria K.; Krex, Dietmar; Schackert, Gabriele; Gentle, Dean; Morris, Mark R.; Wei, Wenbin; Cruickshank, Garth; Maher, Eamonn R.; Latif, Farida

    2013-01-01

    Glioblastoma (GBM) is the most common and malignant type of primary brain tumor in adults and prognosis of most GBM patients is poor. However, a small percentage of patients show a long term survival of 36 mo or longer after diagnosis. Epigenetic profiles can provide molecular markers for patient prognosis: recently, a G-CIMP positive phenotype associated with IDH1 mutations has been described for GBMs with good prognosis. In the present analysis we performed genome-wide DNA methylation profiling of short-term survivors (STS; overall survival < 1 y) and long-term survivors (LTS; overall survival > 3 y) by utilizing the HumanMethylation450K BeadChips to assess quantitative methylation at > 480,000 CpG sites. Cluster analysis has shown that a subset of LTS showed a G-CIMP positive phenotype that was tightly associated with IDH1 mutation status and was confirmed by analysis of the G-CIMP signature genes. Using high stringency criteria for differential hypermethylation between non-cancer brain and tumor samples, we identified 2,638 hypermethylated CpG loci (890 genes) in STS GBMs, 3,101 hypermethylated CpG loci (1,062 genes) in LTS (wild type IDH1) and 11,293 hypermethylated CpG loci in LTS (mutated for IDH1), reflecting the CIMP positive phenotype. The location of differentially hypermethylated CpG loci with respect to CpG content, neighborhood context and functional genomic distribution was similar in our sample set, with the majority of CpG loci residing in CpG islands and in gene promoters. Our preliminary study also identified a set of CpG loci differentially hypermethylated between STS and LTS cases, including members of the homeobox gene family (HOXD8, HOXD13 and HOXC4), the transcription factors NR2F2 and TFAP2A, and Dickkopf 2, a negative regulator of the wnt/β-catenin signaling pathway. PMID:23291739

  20. Length of paternal lifespan is manifested in the DNA methylome of their nonagenarian progeny

    PubMed Central

    Marttila, Saara; Kananen, Laura; Jylhävä, Juulia; Nevalainen, Tapio; Hervonen, Antti; Jylhä, Marja; Hurme, Mikko

    2015-01-01

    The heritability of lifespan is 20-30%, but only a few genes associated with longevity have been identified. To explain this discrepancy, the inheritance of epigenetic features, such as DNA methylation, have been proposed to contribute to the heritability of lifespan. We investigated whether parental lifespan is associated with DNA methylation profile in nonagenarians. A regression model, adjusted for differences in blood cell proportions, identified 659 CpG sites where the level of methylation was associated with paternal lifespan. However, no association was observed between maternal lifespan and DNA methylation. The 659 CpG sites associated with paternal lifespan were enriched outside of CpG islands and were located in genes associated with development and morphogenesis, as well as cell signaling. The largest difference in the level of methylation between the progeny of the shortest-lived and longest-lived fathers was identified for CpG sites mapping to CXXC5. In addition, the level of methylation in three Notch-genes (NOTCH1, NOTCH3 and NOTCH4) was also associated with paternal lifespan. There are implications for the inheritance of acquired traits via epigenetic mechanisms in mammals. Here we describe DNA methylation features that are associated with paternal lifespan, and we speculate that the identified CpG sites may represent intergenerational epigenetic inheritance. PMID:26436701

  1. Epigenetic profiling of cutaneous T-cell lymphoma: promoter hypermethylation of multiple tumor suppressor genes including BCL7a, PTPRG, and p73.

    PubMed

    van Doorn, Remco; Zoutman, Willem H; Dijkman, Remco; de Menezes, Renee X; Commandeur, Suzan; Mulder, Aat A; van der Velden, Pieter A; Vermeer, Maarten H; Willemze, Rein; Yan, Pearlly S; Huang, Tim H; Tensen, Cornelis P

    2005-06-10

    To analyze the occurrence of promoter hypermethylation in primary cutaneous T-cell lymphoma (CTCL) on a genome-wide scale, focusing on epigenetic alterations with pathogenetic significance. DNA isolated from biopsy specimens of 28 patients with CTCL, including aggressive CTCL entities (transformed mycosis fungoides and CD30-negative large T-cell lymphoma) and an indolent entity (CD30-positive large T-cell lymphoma), were investigated. For genome-wide DNA methylation screening, differential methylation hybridization using CpG island microarrays was applied, which allows simultaneous detection of the methylation status of 8640 CpG islands. Bisulfite sequence analysis was applied for confirmation and detection of hypermethylation of eight selected tumor suppressor genes. The DNA methylation patterns of CTCLs emerging from differential methylation hybridization analysis included 35 CpG islands hypermethylated in at least four of the 28 studied CTCL samples when compared with benign T-cell samples. Hypermethylation of the putative tumor suppressor genes BCL7a (in 48% of CTCL samples), PTPRG (27%), and thrombospondin 4 (52%) was confirmed and demonstrated to be associated with transcriptional downregulation. BCL7a was hypermethylated at a higher frequency in aggressive (64%) than in indolent (14%) CTCL entities. In addition, the promoters of the selected tumor suppressor genes p73 (48%), p16 (33%), CHFR (19%), p15 (10%), and TMS1 (10%) were hypermethylated in CTCL. Malignant T cells of patients with CTCL display widespread promoter hypermethylation associated with inactivation of several tumor suppressor genes involved in DNA repair, cell cycle, and apoptosis signaling pathways. In view of this, CTCL may be amenable to treatment with demethylating agents.

  2. VEZF1 Elements Mediate Protection from DNA Methylation

    PubMed Central

    Strogantsev, Ruslan; Gaszner, Miklos; Hair, Alan; Felsenfeld, Gary; West, Adam G.

    2010-01-01

    There is growing consensus that genome organization and long-range gene regulation involves partitioning of the genome into domains of distinct epigenetic chromatin states. Chromatin insulator or barrier elements are key components of these processes as they can establish boundaries between chromatin states. The ability of elements such as the paradigm β-globin HS4 insulator to block the range of enhancers or the spread of repressive histone modifications is well established. Here we have addressed the hypothesis that a barrier element in vertebrates should be capable of defending a gene from silencing by DNA methylation. Using an established stable reporter gene system, we find that HS4 acts specifically to protect a gene promoter from de novo DNA methylation. Notably, protection from methylation can occur in the absence of histone acetylation or transcription. There is a division of labor at HS4; the sequences that mediate protection from methylation are separable from those that mediate CTCF-dependent enhancer blocking and USF-dependent histone modification recruitment. The zinc finger protein VEZF1 was purified as the factor that specifically interacts with the methylation protection elements. VEZF1 is a candidate CpG island protection factor as the G-rich sequences bound by VEZF1 are frequently found at CpG island promoters. Indeed, we show that VEZF1 elements are sufficient to mediate demethylation and protection of the APRT CpG island promoter from DNA methylation. We propose that many barrier elements in vertebrates will prevent DNA methylation in addition to blocking the propagation of repressive histone modifications, as either process is sufficient to direct the establishment of an epigenetically stable silent chromatin state. PMID:20062523

  3. The CpG island encompassing the promoter and first exon of human DNMT3L gene is a PcG/TrX response element (PRE).

    PubMed

    Basu, Amitava; Dasari, Vasanthi; Mishra, Rakesh K; Khosla, Sanjeev

    2014-01-01

    DNMT3L, a member of DNA methyltransferases family, is present only in mammals. As it provides specificity to the action of de novo methyltransferases, DNMT3A and DNMT3B and interacts with histone H3, DNMT3L has been invoked as the molecule that can read the histone code and translate it into DNA methylation. It plays an important role in the initiation of genomic imprints during gametogenesis and in nuclear reprogramming. With important functions attributed to it, it is imperative that the DNMT3L expression is tightly controlled. Previously, we had identified a CpG island within the human DNMT3L promoter and first exon that showed loss of DNA methylation in cancer samples. Here we show that this Differentially Methylated CpG island within DNMT3L (DNMT3L DMC) acts to repress transcription, is a Polycomb/Trithorax Response Element (PRE) and interacts with both PRC1 and PRC2 Polycomb repressive complexes. In addition, it adopts inactive chromatin conformation and is associated with other inactive chromatin-specific proteins like SUV39H1 and HP1. The presence of DNMT3L DMC also influences the adjacent promoter to adopt repressive histone post-translational modifications. Due to its association with multiple layers of repressive epigenetic modifications, we believe that PRE within the DNMT3L DMC is responsible for the tight regulation of DNMT3L expression and the aberrant epigenetic modifications of this region leading to DNMT3L overexpression could be the reason of nuclear programming during carcinogenesis.

  4. Association between folate levels and CpG island hypermethylation in normal colorectal mucosa

    PubMed Central

    Wallace, Kristin; Grau, Maria V.; Levine, Joan A.; Shen, Lanlan; Hamdan, Randala; Chen, Xinli; Gui, Jiang; Haile, Robert W.; Barry, Elizabeth L.; Ahnen, Dennis; McKeown-Eyssen, Gail; Baron, John A.; Issa, Jean Pierre J.

    2010-01-01

    Background Gene-specific promoter methylation of several genes occurs in aging normal tissues and may predispose to tumorigenesis. In the present study, we investigate the association among blood folate levels, and dietary and lifestyle factors with CpG island methylation in normal colorectal mucosa. Methods Subjects were enrolled in a multi-center chemoprevention trial of aspirin or folic acid for the prevention of large bowel adenomas. We collected 1000 biopsies from 389 patients, 501 samples from the right colon and 499 from the rectum at the follow-up colonoscopy. We measured DNA methylation of estrogen receptor alpha (ERα) and secreted frizzled related protein-1 (SFRP1) using bisulfite pyrosequencing. We used Generalized Estimating Equations regression analysis to examine the association between methylation and selected variables. Results For both ERα and SFRP1, percent methylation was significantly higher in the rectum compared to the right colon (p = 0.001). For each 10 years of age, we observed a 1.7 % increase in methylation level for ERα and a 2.9 % increase for SFRP1 (P < 0.0001). African Americans had a significantly lower level of ERα and SFRP1 methylation compared to Caucasians and Hispanics. Higher RBC folate levels were associated with higher levels of both ERα (p=0.03) and SFRP1 methylation (p=0.01). Conclusions Our results suggest that CpG island methylation in normal colorectal mucosa is related to advancing age, race, rectal location, and RBC folate levels. These data have important implications regarding the safety of supplementary folate administration in healthy adults given the hypothesis that methylation in normal mucosa may predispose to colorectal neoplasia. PMID:21149331

  5. Expression of metastasis suppressor gene AES driven by a Yin Yang (YY) element in a CpG island promoter and transcription factor YY2.

    PubMed

    Kakizaki, Fumihiko; Sonoshita, Masahiro; Miyoshi, Hiroyuki; Itatani, Yoshiro; Ito, Shinji; Kawada, Kenji; Sakai, Yoshiharu; Taketo, M Mark

    2016-11-01

    We recently found that the product of the AES gene functions as a metastasis suppressor of colorectal cancer (CRC) in both humans and mice. Expression of amino-terminal enhancer of split (AES) protein is significantly decreased in liver metastatic lesions compared with primary colon tumors. To investigate its downregulation mechanism in metastases, we searched for transcriptional regulators of AES in human CRC and found that its expression is reduced mainly by transcriptional dysregulation and, in some cases, by additional haploidization of its coding gene. The AES promoter-enhancer is in a typical CpG island, and contains a Yin-Yang transcription factor recognition sequence (YY element). In human epithelial cells of normal colon and primary tumors, transcription factor YY2, a member of the YY family, binds directly to the YY element, and stimulates expression of AES. In a transplantation mouse model of liver metastases, however, expression of Yy2 (and therefore of Aes) is downregulated. In human CRC metastases to the liver, the levels of AES protein are correlated with those of YY2. In addition, we noticed copy-number reduction for the AES coding gene in chromosome 19p13.3 in 12% (5/42) of human CRC cell lines. We excluded other mechanisms such as point or indel mutations in the coding or regulatory regions of the AES gene, CpG methylation in the AES promoter enhancer, expression of microRNAs, and chromatin histone modifications. These results indicate that Aes may belong to a novel family of metastasis suppressors with a CpG-island promoter enhancer, and it is regulated transcriptionally. © 2016 The Authors. Cancer Science published by John Wiley & Sons Australia, Ltd on behalf of Japanese Cancer Association.

  6. Genetic polymorphisms in one-carbon metabolism: associations with CpG island methylator phenotype (CIMP) in colon cancer and the modifying effects of diet

    PubMed Central

    Curtin, Karen; Slattery, Martha L.; Ulrich, Cornelia M.; Bigler, Jeannette; Levin, Theodore R.; Wolff, Roger K.; Albertsen, Hans; Potter, John D.; Samowitz, Wade S.

    2008-01-01

    This study investigated associations between CpG island methylator phenotype (CIMP) colon cancer and genetic polymorphisms relevant to one-carbon metabolism and thus, potentially the provision of methyl groups and risk of colon cancer. Data from a large, population-based case–control study (916 incident colon cancer cases and 1972 matched controls) were used. Candidate polymorphisms in methylenetetrahydrofolate reductase (MTHFR), thymidylate synthase (TS), transcobalamin II (TCNII), methionine synthase (MTR), reduced folate carrier (RFC), methylene-tetrahydrofolate dehydrogenase 1 (MTHFD1), dihydrofolate reductase (DHFR) and alcohol dehydrogenase 3 (ADH3) were evaluated. CIMP− or CIMP+ phenotype was based on five CpG island markers: MINT1, MINT2, MINT31, p16 and MLH1. The influence of specific dietary factors (folate, methionine, vitamin B12 and alcohol) on these associations was also analyzed. We hypothesized that polymorphisms involved in the provision of methyl groups would be associated with CIMP+ tumors (two or more of five markers methylated), potentially modified by diet. Few associations specific to CIMP+ tumors were observed overall, which does not support the hypothesis that the provision of methyl groups is important in defining a methylator phenotype. However, our data suggest that genetic polymorphisms in MTHFR 1298A > C, interacting with diet, may be involved in the development of highly CpG-methylated colon cancers. AC and CC genotypes in conjunction with a high-risk dietary pattern (low folate and methionine intake and high alcohol use) were associated with CIMP+ (OR = 2.1, 95% CI = 1.3–3.4 versus AA/high risk; P-interaction = 0.03). These results provide only limited support for a role of polymorphisms in one-carbon metabolism in the etiology of CIMP colon cancer. PMID:17449906

  7. No association of CpG island methylator phenotype and colorectal cancer survival: population-based study.

    PubMed

    Jia, Min; Jansen, Lina; Walter, Viola; Tagscherer, Katrin; Roth, Wilfried; Herpel, Esther; Kloor, Matthias; Bläker, Hendrik; Chang-Claude, Jenny; Brenner, Hermann; Hoffmeister, Michael

    2016-11-22

    Previous studies have shown adverse effects of CpG island methylator phenotype (CIMP) on colorectal cancer (CRC) prognosis. However, sample sizes were often limited and only few studies were able to adjust for relevant molecular features associated with CIMP. The aim of this study was to investigate the impact of CIMP on CRC survival in a large population-based study with comprehensive adjustment. The CIMP status and other molecular tumour features were analysed in 1385 CRC patients diagnosed between 2003 and 2010. Detailed information were obtained from standardised personal interviews and medical records. During follow-up (median: 4.9 years), we assessed vital status, cause of death and therapy details. Cox proportional hazard regression models were used to estimate adjusted hazard ratios (HRs) and 95% confidence intervals (CIs) of survival after CRC. The CIMP-H occurred more frequently in patients with older age, female gender, cancer in the proximal colon, BRAF mutation and microsatellite instability-high (MSI-H). However, CIMP status was not associated with CRC prognosis in CRC patients (HR=1.00; 95% CI=0.72-1.40 for overall survival; HR=0.96; 95% CI=0.65-1.41 for disease-specific survival) or in any of the subgroups. Although CIMP status was associated with the presence of MSI-H and BRAF mutation, the prognostic effects of MSI-H (HR=0.49; 95% CI=0.27-0.90) and BRAF mutation (HR=1.78; 95% CI=1.10-2.84) were independent of CIMP status. Similar benefit of chemotherapy was found for CRC outcomes in both the CIMP-low/negative group and the CIMP-high group. CpG island methylator phenotype was not associated with CRC prognosis after adjusting for other important clinical factors and associated mutations.

  8. Association between the CpG island methylator phenotype and its prognostic significance in primary pulmonary adenocarcinoma.

    PubMed

    Koh, Young Wha; Chun, Sung-Min; Park, Young-Soo; Song, Joon Seon; Lee, Geon Kook; Khang, Shin Kwang; Jang, Se Jin

    2016-08-01

    Aberrant methylation of promoter CpG islands is one of the most important inactivation mechanisms for tumor suppressor and tumor-related genes. Previous studies using genome-wide DNA methylation microarray analysis have suggested the existence of a CpG island methylator phenotype (CIMP) in lung adenocarcinomas. Although the biological behavior of these tumors varies according to tumor stage, no large-scale study has examined the CIMP in lung adenocarcinoma patients according to tumor stage. Furthermore, there have been no reported results regarding the clinical significance of each of the six CIMP markers. To examine the CIMP in patients with pulmonary adenocarcinoma after a surgical resection, we performed methylation analysis of six genes (CCNA1, ACAN, GFRA1, EDARADD, MGC45800, and p16 (INK4A)) in 230 pulmonary adenocarcinoma cases using the SEQUENOM MassARRAY platform. Fifty-four patients (28 %, 54/191) were in the CIMP-high (CIMP-H) group associated with high nodal stage (P = 0.007), the presence of micropapillary or solid histology (P = 0.003), and the absence of an epidermal growth factor receptor (EGFR) mutation (P = 0.002). By multivariate analysis, CIMP was an independent prognostic marker for overall survival (OS) and disease-specific survival (P = 0.03 and P = 0.43, respectively). In the stage I subgroups alone, CIMP-H patients had lower OS rates than the CIMP-low (CIMP-L) group (P = 0.041). Of the six CIMP markers, ACAN alone was significantly associated with patient survival. CIMP predicted the risk of progression independently of clinicopathological variables and enables the stratification of pulmonary adenocarcinoma patients, particularly among stage I cases.

  9. Genetic polymorphisms in one-carbon metabolism: associations with CpG island methylator phenotype (CIMP) in colon cancer and the modifying effects of diet.

    PubMed

    Curtin, Karen; Slattery, Martha L; Ulrich, Cornelia M; Bigler, Jeannette; Levin, Theodore R; Wolff, Roger K; Albertsen, Hans; Potter, John D; Samowitz, Wade S

    2007-08-01

    This study investigated associations between CpG island methylator phenotype (CIMP) colon cancer and genetic polymorphisms relevant to one-carbon metabolism and thus, potentially the provision of methyl groups and risk of colon cancer. Data from a large, population-based case-control study (916 incident colon cancer cases and 1,972 matched controls) were used. Candidate polymorphisms in methylenetetrahydrofolate reductase (MTHFR), thymidylate synthase (TS), transcobalamin II (TCNII), methionine synthase (MTR), reduced folate carrier (RFC), methylenetetrahydrofolate dehydrogenase 1 (MTHFD1), dihydrofolate reductase (DHFR) and alcohol dehydrogenase 3 (ADH3) were evaluated. CIMP- or CIMP+ phenotype was based on five CpG island markers: MINT1, MINT2, MINT31, p16 and MLH1. The influence of specific dietary factors (folate, methionine, vitamin B(12) and alcohol) on these associations was also analyzed. We hypothesized that polymorphisms involved in the provision of methyl groups would be associated with CIMP+ tumors (two or more of five markers methylated), potentially modified by diet. Few associations specific to CIMP+ tumors were observed overall, which does not support the hypothesis that the provision of methyl groups is important in defining a methylator phenotype. However, our data suggest that genetic polymorphisms in MTHFR 1,298A > C, interacting with diet, may be involved in the development of highly CpG-methylated colon cancers. AC and CC genotypes in conjunction with a high-risk dietary pattern (low folate and methionine intake and high alcohol use) were associated with CIMP+ (OR = 2.1, 95% CI = 1.3-3.4 versus AA/high risk; P-interaction = 0.03). These results provide only limited support for a role of polymorphisms in one-carbon metabolism in the etiology of CIMP colon cancer.

  10. Genetics and epigenetics of small bowel adenocarcinoma: the interactions of CIN, MSI, and CIMP.

    PubMed

    Warth, Arne; Kloor, Matthias; Schirmacher, Peter; Bläker, Hendrik

    2011-04-01

    Characterization of tumor genetics and epigenetics allows to stratify a tumor entity according to molecular pathways and may shed light on the interactions of different types of DNA alterations during tumorigenesis. Small intestinal adenocarcinoma is rare, and to date the interrelation of genomic instability and epigenetics has not been investigated in this tumor type. We therefore analyzed 37 primary small bowel carcinomas with known microsatellite instability and KRAS status for chromosomal instability using comparative genomic hybridization, for the presence of aberrant methylation (CpG island methylation phenotype) by methylation-specific polymerase chain reaction, and for BRAF mutations. Chromosomal instability was detected in 22 of 37 (59%) tumors (3 of 9 microsatellite instable, and 19 of 28 microsatellite stable carcinomas). Nine carcinomas (24%) were microsatellite and chromosomally stable. High-level DNA methylation was found in 16% of chromosomal instable tumors and in 44% of both microsatellite instable and microsatellite and chromosomally stable carcinomas. KRAS was mutated in 55, 0, and 10% of chromosomal instable, microsatellite instable, and microsatellite and chromosomally stable tumors, respectively whereas the frequencies of BRAF mutations were 6% for chromosomal instable and 22% for both microsatellite instable and microsatellite and chromosomally stable carcinomas. In conclusion, in this study we show that chromosomal instable carcinomas of the small intestine are distinguished from microsatellite instable and microsatellite and chromosomally stable tumors by a high frequency of KRAS mutations, low frequencies of CpG island methylation phenotype, and BRAF mutations. In microsatellite instable and microsatellite and chromosomally stable cancers, CpG island methylation phenotype and BRAF/KRAS mutations are similarly distributed, indicating common mechanisms of tumor initiation or progression in their molecular pathogenesis.

  11. Development of TRAIL Resistance by Radiation-Induced Hypermethylation of DR4 CpG Island in Recurrent Laryngeal Squamous Cell Carcinoma

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lee, Jong Cheol; Department of Biomedical Research Center, Ulsan University Hospital, University of Ulsan College of Medicine, Ulsan; Lee, Won Hyeok

    2014-04-01

    Purpose: There are limited therapeutic options for patients with recurrent head and neck cancer after radiation therapy failure. To assess the use of tumor necrosis factor–related apoptosis-inducing ligand (TRAIL) as a salvage chemotherapeutic agent for recurrent cancer after radiation failure, we investigated the effect of clinically relevant cumulative irradiation on TRAIL-induced apoptosis. Methods and Materials: Using a previously established HN3 cell line from a laryngeal carcinoma patient, we generated a chronically irradiated HN3R isogenic cell line. Viability and apoptosis in HN3 and HN3R cells treated with TRAIL were analyzed with MTS and PI/annexin V-FITC assays. Western blotting and flow cytometry weremore » used to determine the underlying mechanism of TRAIL resistance. DR4 expression was semiquantitatively scored in a tissue microarray with 107 laryngeal cancer specimens. Methylation-specific polymerase chain reaction and bisulfite sequencing for DR4 were performed for genomic DNA isolated from each cell line. Results: HN3R cells were more resistant than HN3 cells to TRAIL-induced apoptosis because of significantly reduced levels of the DR4 receptor. The DR4 staining score in 37 salvage surgical specimens after radiation failure was lower in 70 surgical specimens without radiation treatment (3.03 ± 2.75 vs 5.46 ± 3.30, respectively; P<.001). HN3R cells had a methylated DR4 CpG island that was partially demethylated by the DNA demethylating agent 5-aza-2′-deoxycytidine. Conclusion: Epigenetic silencing of the TRAIL receptor by hypermethylation of a DR4 CpG island might be an underlying mechanism for TRAIL resistance in recurrent laryngeal carcinoma treated with radiation.« less

  12. The cancer-promoting gene fatty acid-binding protein 5 (FABP5) is epigenetically regulated during human prostate carcinogenesis.

    PubMed

    Kawaguchi, Koichiro; Kinameri, Ayumi; Suzuki, Shunsuke; Senga, Shogo; Ke, Youqiang; Fujii, Hiroshi

    2016-02-15

    FABPs (fatty-acid-binding proteins) are a family of low-molecular-mass intracellular lipid-binding proteins consisting of ten isoforms. FABPs are involved in binding and storing hydrophobic ligands such as long-chain fatty acids, as well as transporting these ligands to the appropriate compartments in the cell. FABP5 is overexpressed in multiple types of tumours. Furthermore, up-regulation of FABP5 is strongly associated with poor survival in triple-negative breast cancer. However, the mechanisms underlying the specific up-regulation of the FABP5 gene in these cancers remain poorly characterized. In the present study, we determined that FABP5 has a typical CpG island around its promoter region. The DNA methylation status of the CpG island in the FABP5 promoter of benign prostate cells (PNT2), prostate cancer cells (PC-3, DU-145, 22Rv1 and LNCaP) and human normal or tumour tissue was assessed by bisulfite sequencing analysis, and then confirmed by COBRA (combined bisulfite restriction analysis) and qAMP (quantitative analysis of DNA methylation using real-time PCR). These results demonstrated that overexpression of FABP5 in prostate cancer cells can be attributed to hypomethylation of the CpG island in its promoter region, along with up-regulation of the direct trans-acting factors Sp1 (specificity protein 1) and c-Myc. Together, these mechanisms result in the transcriptional activation of FABP5 expression during human prostate carcinogenesis. Importantly, silencing of Sp1, c-Myc or FABP5 expression led to a significant decrease in cell proliferation, indicating that up-regulation of FABP5 expression by Sp1 and c-Myc is critical for the proliferation of prostate cancer cells. © 2016 Authors; published by Portland Press Limited.

  13. High-throughput engineering of a mammalian genome reveals building principles of methylation states at CG rich regions.

    PubMed

    Krebs, Arnaud R; Dessus-Babus, Sophie; Burger, Lukas; Schübeler, Dirk

    2014-09-26

    The majority of mammalian promoters are CpG islands; regions of high CG density that require protection from DNA methylation to be functional. Importantly, how sequence architecture mediates this unmethylated state remains unclear. To address this question in a comprehensive manner, we developed a method to interrogate methylation states of hundreds of sequence variants inserted at the same genomic site in mouse embryonic stem cells. Using this assay, we were able to quantify the contribution of various sequence motifs towards the resulting DNA methylation state. Modeling of this comprehensive dataset revealed that CG density alone is a minor determinant of their unmethylated state. Instead, these data argue for a principal role for transcription factor binding sites, a prediction confirmed by testing synthetic mutant libraries. Taken together, these findings establish the hierarchy between the two cis-encoded mechanisms that define the DNA methylation state and thus the transcriptional competence of CpG islands.

  14. PCFT/SLC46A1 promoter methylation and restoration of gene expression in human leukemia cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gonen, Nitzan; Bram, Eran E.; Assaraf, Yehuda G.

    2008-11-28

    The proton-coupled folate transporter (PCFT/SLC46A1) displays optimal and prominent folate and antifolate transport activity at acidic pH in human carcinoma cells but poor activity in leukemia cells. Consistently herein, human leukemia cell lines expressed poor PCFT transcript levels, whereas various carcinoma cell lines showed substantial PCFT gene expression. We identified a CpG island with high density at nucleotides -200 through +100 and explored its role in PCFT promoter silencing. Leukemia cells with barely detectable PCFT transcripts consistently harbored 85-100% methylation of this CpG island, whereas no methylation was found in carcinoma cells. Treatment with 5-Aza-2'-deoxycytidine which induced demethylation but notmore » with the histone deacetylase inhibitor trichostatin A, restored 50-fold PCFT expression only in leukemia cells. These findings constitute the first demonstration of the dominant epigenetic silencing of the PCFT gene in leukemia cells. The potential translational implications of the restoration of PCFT expression in chemotherapy of leukemia are discussed.« less

  15. MethPrimer: designing primers for methylation PCRs.

    PubMed

    Li, Long-Cheng; Dahiya, Rajvir

    2002-11-01

    DNA methylation is an epigenetic mechanism of gene regulation. Bisulfite- conversion-based PCR methods, such as bisulfite sequencing PCR (BSP) and methylation specific PCR (MSP), remain the most commonly used techniques for methylation mapping. Existing primer design programs developed for standard PCR cannot handle primer design for bisulfite-conversion-based PCRs due to changes in DNA sequence context caused by bisulfite treatment and many special constraints both on the primers and the region to be amplified for such experiments. Therefore, the present study was designed to develop a program for such applications. MethPrimer, based on Primer 3, is a program for designing PCR primers for methylation mapping. It first takes a DNA sequence as its input and searches the sequence for potential CpG islands. Primers are then picked around the predicted CpG islands or around regions specified by users. MethPrimer can design primers for BSP and MSP. Results of primer selection are delivered through a web browser in text and in graphic view.

  16. Integrative DNA methylation and gene expression analysis to assess the universality of the CpG island methylator phenotype.

    PubMed

    Moarii, Matahi; Reyal, Fabien; Vert, Jean-Philippe

    2015-10-13

    The CpG island methylator phenotype (CIMP) was first characterized in colorectal cancer but since has been extensively studied in several other tumor types such as breast, bladder, lung, and gastric. CIMP is of clinical importance as it has been reported to be associated with prognosis or response to treatment. However, the identification of a universal molecular basis to define CIMP across tumors has remained elusive. We perform a genome-wide methylation analysis of over 2000 tumor samples from 5 cancer sites to assess the existence of a CIMP with common molecular basis across cancers. We then show that the CIMP phenotype is associated with specific gene expression variations. However, we do not find a common genetic signature in all tissues associated with CIMP. Our results suggest the existence of a universal epigenetic and transcriptomic signature that defines the CIMP across several tumor types but does not indicate the existence of a common genetic signature of CIMP.

  17. Polycomb Responds to Low Levels of Transcription.

    PubMed

    Berrozpe, Georgina; Bryant, Gene O; Warpinski, Katherine; Spagna, Dan; Narayan, Santosh; Shah, Shivangi; Ptashne, Mark

    2017-07-25

    How is Polycomb (Pc), a eukaryotic negative regulator of transcription, targeted to specific mammalian genes? Our genome-wide analysis of the Pc mark H3K27me3 in murine cells revealed that Pc is preferentially associated with CpG island promoters of genes that are transcribed at a low level and less so with promoters of genes that are either silent or more highly expressed. Studies of the CpG island promoter of the Kit gene demonstrate that Pc is largely absent when the gene is silent in myeloid cells, as well as when the gene is highly expressed in mast cells. Manipulations that increase transcription in the former case, and reduce it in the latter, increase Pc occupancy. The average negative effect of Pc, we infer, is about 2-fold. We suggest possible biological roles for such negative effects and propose a mechanism by which Pc might be recruited to weakly transcribed genes. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  18. Regulation of a mammalian gene bearing a CpG island promoter and a distal enhancer.

    PubMed

    Berrozpe, Georgina; Bryant, Gene O; Warpinski, Katherine; Ptashne, Mark

    2013-08-15

    A quantitative nucleosome occupancy assay revealed rules for nucleosome disposition in yeast and showed how disposition affects regulation of the GAL genes. Here, we show how those findings apply to the control of Kit, a mammalian gene. The Kit promoter lies in a CpG island, and its enhancer (active in mast cells) lies some 150 kb upstream. Nucleosomes form with especially high avidities at the Kit promoter, a reaction that, we surmise, ensures extremely low basal expression. In mast cells, transcriptional activators displace nucleosomes that are less tightly formed at the Kit enhancer. In turn, the active enhancer replaces a single Kit promoter nucleosome with the transcriptional machinery, thereby inducing transcription over 1,000-fold. As at the yeast GAL genes, the inhibitory effects of nucleosomes facilitate high factors of induction by mammalian activators working in the absence of specific repressors. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  19. Role for DNA methylation in the regulation of miR-200c and miR-141 expression in normal and cancer cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vrba, Lukas; Jensen, Taylor J.; Garbe, James C.

    2009-12-23

    BACKGROUND: The microRNA-200 family participates in the maintenance of an epithelial phenotype and loss of its expression can result in epithelial to mesenchymal transition (EMT). Furthermore, the loss of expression of miR-200 family members is linked to an aggressive cancer phenotype. Regulation of the miR-200 family expression in normal and cancer cells is not fully understood. METHODOLOGY/ PRINCIPAL FINDINGS: Epigenetic mechanisms participate in the control of miR-200c and miR-141 expression in both normal and cancer cells. A CpG island near the predicted mir-200c/mir-141 transcription start site shows a striking correlation between miR-200c and miR-141 expression and DNA methylation in bothmore » normal and cancer cells, as determined by MassARRAY technology. The CpG island is unmethylated in human miR-200/miR-141 expressing epithelial cells and in miR-200c/miR-141 positive tumor cells. The CpG island is heavily methylated in human miR-200c/miR-141 negative fibroblasts and miR-200c/miR-141 negative tumor cells. Mouse cells show a similar inverse correlation between DNA methylation and miR-200c expression. Enrichment of permissive histone modifications, H3 acetylation and H3K4 trimethylation, is seen in normal miR-200c/miR-141-positive epithelial cells, as determined by chromatin immunoprecipitation coupled to real-time PCR. In contrast, repressive H3K9 dimethylation marks are present in normal miR-200c/miR-141-negative fibroblasts and miR-200c/miR-141 negative cancer cells and the permissive histone modifications are absent. The epigenetic modifier drug, 5-aza-2'-deoxycytidine, reactivates miR-200c/miR-141 expression showing that epigenetic mechanisms play a functional role in their transcriptional control. CONCLUSIONS/ SIGNIFICANCE: We report that DNA methylation plays a role in the normal cell type-specific expression of miR-200c and miR-141 and this role appears evolutionarily conserved, since similar results were obtained in mouse. Aberrant DNA methylation of the miR-200c/141 CpG island is closely linked to their inappropriate silencing in cancer cells. Since the miR-200c cluster plays a significant role in EMT, our results suggest an important role for DNA methylation in the control of phenotypic conversions in normal cells.« less

  20. Prediction of epigenetically regulated genes in breast cancer cell lines

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Loss, Leandro A; Sadanandam, Anguraj; Durinck, Steffen

    Methylation of CpG islands within the DNA promoter regions is one mechanism that leads to aberrant gene expression in cancer. In particular, the abnormal methylation of CpG islands may silence associated genes. Therefore, using high-throughput microarrays to measure CpG island methylation will lead to better understanding of tumor pathobiology and progression, while revealing potentially new biomarkers. We have examined a recently developed high-throughput technology for measuring genome-wide methylation patterns called mTACL. Here, we propose a computational pipeline for integrating gene expression and CpG island methylation profles to identify epigenetically regulated genes for a panel of 45 breast cancer cell lines,more » which is widely used in the Integrative Cancer Biology Program (ICBP). The pipeline (i) reduces the dimensionality of the methylation data, (ii) associates the reduced methylation data with gene expression data, and (iii) ranks methylation-expression associations according to their epigenetic regulation. Dimensionality reduction is performed in two steps: (i) methylation sites are grouped across the genome to identify regions of interest, and (ii) methylation profles are clustered within each region. Associations between the clustered methylation and the gene expression data sets generate candidate matches within a fxed neighborhood around each gene. Finally, the methylation-expression associations are ranked through a logistic regression, and their significance is quantified through permutation analysis. Our two-step dimensionality reduction compressed 90% of the original data, reducing 137,688 methylation sites to 14,505 clusters. Methylation-expression associations produced 18,312 correspondences, which were used to further analyze epigenetic regulation. Logistic regression was used to identify 58 genes from these correspondences that showed a statistically signifcant negative correlation between methylation profles and gene expression in the panel of breast cancer cell lines. Subnetwork enrichment of these genes has identifed 35 common regulators with 6 or more predicted markers. In addition to identifying epigenetically regulated genes, we show evidence of differentially expressed methylation patterns between the basal and luminal subtypes. Our results indicate that the proposed computational protocol is a viable platform for identifying epigenetically regulated genes. Our protocol has generated a list of predictors including COL1A2, TOP2A, TFF1, and VAV3, genes whose key roles in epigenetic regulation is documented in the literature. Subnetwork enrichment of these predicted markers further suggests that epigenetic regulation of individual genes occurs in a coordinated fashion and through common regulators.« less

  1. Parvovirus B19 DNA CpG Dinucleotide Methylation and Epigenetic Regulation of Viral Expression

    PubMed Central

    Bonvicini, Francesca; Manaresi, Elisabetta; Di Furio, Francesca; De Falco, Luisa; Gallinella, Giorgio

    2012-01-01

    CpG DNA methylation is one of the main epigenetic modifications playing a role in the control of gene expression. For DNA viruses whose genome has the ability to integrate in the host genome or to maintain as a latent episome, a correlation has been found between the extent of DNA methylation and viral quiescence. No information is available for Parvovirus B19, a human pathogenic virus, which is capable of both lytic and persistent infections. Within Parvovirus B19 genome, the inverted terminal regions display all the characteristic signatures of a genomic CpG island; therefore we hypothesised a role of CpG dinucleotide methylation in the regulation of viral genome expression. The analysis of CpG dinucleotide methylation of Parvovirus B19 DNA was carried out by an aptly designed quantitative real-time PCR assay on bisulfite-modified DNA. The effects of CpG methylation on the regulation of viral genome expression were first investigated by transfection of either unmethylated or in vitro methylated viral DNA in a model cell line, showing that methylation of viral DNA was correlated to lower expression levels of the viral genome. Then, in the course of in vitro infections in different cellular environments, it was observed that absence of viral expression and genome replication were both correlated to increasing levels of CpG methylation of viral DNA. Finally, the presence of CpG methylation was documented in viral DNA present in bioptic samples, indicating the occurrence and a possible role of this epigenetic modification in the course of natural infections. The presence of an epigenetic level of regulation of viral genome expression, possibly correlated to the silencing of the viral genome and contributing to the maintenance of the virus in tissues, can be relevant to the balance and outcome of the different types of infection associated to Parvovirus B19. PMID:22413013

  2. Identification and characterization of putative methylation targets in the MAOA locus using bioinformatic approaches.

    PubMed

    Shumay, Elena; Fowler, Joanna S

    2010-05-16

    Monoamine oxidase A (MAO A) is an enzyme that catalyzes the oxidation of neurotransmitter amines. A functional polymorphism in the human MAOA gene (high- and low-MAOA) has been associated with distinct behavioral phenotypes. To investigate directly the biological mechanism whereby this polymorphism influences brain function, we recently measured the activity of the MAO A enzyme in healthy volunteers. When found no relationship between the individual's brain MAO A level and the MAOA genotype, we postulated that there are additional regulatory mechanisms that control the MAOA expression. Given that DNA methylation is linked to the regulation of gene expression, we hypothesized that epigenetic mechanisms factor into the MAOA expression. Our underplaying assumption was that the differences in an individual's genotype play a key role in the epigenetic potential of the MAOA locus and, consequently, determine the individual's level of MAO A activity in the brain. As a first step towards experimental validation of the hypothesis, we performed a comprehensive bioinformatic analysis aiming to interrogate genomic features and attributes of the MAOA locus that might modulate its epigenetic sensitivity. Major findings of our analysis are the following: (1) the extended MAOA regulatory region contains two CpG islands (CGIs), one of which overlaps with the canonical MAOA promoter and the other is located further upstream; both CGIs exhibit sensitivity to differential methylation. (2) The uVNTR's effect on the MAOA's transcriptional activity might have epigenetic nature: this polymorphic region resides within the MAOA's CGI and itself contains CpGs, thus, the number of repeating increments effectively changes the number of methylatable cytosines in the MAOA promoter. An array of in silico analyses (the nucleosome positioning, the physical properties of the local DNA, the clustering of transcription-factor binding sites) together with experimental data on histone modifications and Pol 2 sites and data from the RefSeq mRNA library suggest that the MAOA gene might have an alternative promoter. Based on our findings, we propose a regulatory mechanism for the human MAOA according to which the MAOA expression in vivo is executed by the generation of tissue-specific transcripts initiated from the alternative promoters (both CGI-associated) where transcriptional activation of a particular promoter is under epigenetic control.

  3. Non-specific filtering of beta-distributed data.

    PubMed

    Wang, Xinhui; Laird, Peter W; Hinoue, Toshinori; Groshen, Susan; Siegmund, Kimberly D

    2014-06-19

    Non-specific feature selection is a dimension reduction procedure performed prior to cluster analysis of high dimensional molecular data. Not all measured features are expected to show biological variation, so only the most varying are selected for analysis. In DNA methylation studies, DNA methylation is measured as a proportion, bounded between 0 and 1, with variance a function of the mean. Filtering on standard deviation biases the selection of probes to those with mean values near 0.5. We explore the effect this has on clustering, and develop alternate filter methods that utilize a variance stabilizing transformation for Beta distributed data and do not share this bias. We compared results for 11 different non-specific filters on eight Infinium HumanMethylation data sets, selected to span a variety of biological conditions. We found that for data sets having a small fraction of samples showing abnormal methylation of a subset of normally unmethylated CpGs, a characteristic of the CpG island methylator phenotype in cancer, a novel filter statistic that utilized a variance-stabilizing transformation for Beta distributed data outperformed the common filter of using standard deviation of the DNA methylation proportion, or its log-transformed M-value, in its ability to detect the cancer subtype in a cluster analysis. However, the standard deviation filter always performed among the best for distinguishing subgroups of normal tissue. The novel filter and standard deviation filter tended to favour features in different genome contexts; for the same data set, the novel filter always selected more features from CpG island promoters and the standard deviation filter always selected more features from non-CpG island intergenic regions. Interestingly, despite selecting largely non-overlapping sets of features, the two filters did find sample subsets that overlapped for some real data sets. We found two different filter statistics that tended to prioritize features with different characteristics, each performed well for identifying clusters of cancer and non-cancer tissue, and identifying a cancer CpG island hypermethylation phenotype. Since cluster analysis is for discovery, we would suggest trying both filters on any new data sets, evaluating the overlap of features selected and clusters discovered.

  4. Minding the Cyber-Physical Gap: Model-Based Analysis and Mitigation of Systemic Perception-Induced Failure.

    PubMed

    Mordecai, Yaniv; Dori, Dov

    2017-07-17

    The cyber-physical gap (CPG) is the difference between the 'real' state of the world and the way the system perceives it. This discrepancy often stems from the limitations of sensing and data collection technologies and capabilities, and is inevitable at some degree in any cyber-physical system (CPS). Ignoring or misrepresenting such limitations during system modeling, specification, design, and analysis can potentially result in systemic misconceptions, disrupted functionality and performance, system failure, severe damage, and potential detrimental impacts on the system and its environment. We propose CPG-Aware Modeling & Engineering (CPGAME), a conceptual model-based approach to capturing, explaining, and mitigating the CPG. CPGAME enhances the systems engineer's ability to cope with CPGs, mitigate them by design, and prevent erroneous decisions and actions. We demonstrate CPGAME by applying it for modeling and analysis of the 1979 Three Miles Island 2 nuclear accident, and show how its meltdown could be mitigated. We use ISO-19450:2015-Object Process Methodology as our conceptual modeling framework.

  5. Tet-mediated imprinting erasure in H19 locus following reprogramming of spermatogonial stem cells to induced pluripotent stem cells

    USDA-ARS?s Scientific Manuscript database

    Selective methylation of CpG islands at imprinting control regions (ICR) determines the monoparental expression of a subset of genes. The imprinting marks are protected from global demethylation taking place during pre-implantation development before being reset in primordial germ cells. However, it...

  6. New insights into replication origin characteristics in metazoans

    PubMed Central

    Puy, Aurore; Rialle, Stéphanie; Kaplan, Noam; Segal, Eran

    2012-01-01

    We recently reported the identification and characterization of DNA replication origins (Oris) in metazoan cell lines. Here, we describe additional bioinformatic analyses showing that the previously identified GC-rich sequence elements form origin G-rich repeated elements (OGREs) that are present in 67% to 90% of the DNA replication origins from Drosophila to human cells, respectively. Our analyses also show that initiation of DNA synthesis takes place precisely at 160 bp (Drosophila) and 280 bp (mouse) from the OGRE. We also found that in most CpG islands, an OGRE is positioned in opposite orientation on each of the two DNA strands and detected two sites of initiation of DNA synthesis upstream or downstream of each OGRE. Conversely, Oris not associated with CpG islands have a single initiation site. OGRE density along chromosomes correlated with previously published replication timing data. Ori sequences centered on the OGRE are also predicted to have high intrinsic nucleosome occupancy. Finally, OGREs predict G-quadruplex structures at Oris that might be structural elements controlling the choice or activation of replication origins. PMID:22373526

  7. Identification of secretaglobin Scgb2a1 as a target for developmental reprogramming by BPA in the rat prostate.

    PubMed

    Wong, Rebecca Lee Yean; Wang, Quan; Treviño, Lindsey S; Bosland, Maarten C; Chen, Jing; Medvedovic, Mario; Prins, Gail S; Kannan, Kurunthachalam; Ho, Shuk-Mei; Walker, Cheryl Lyn

    2015-01-01

    Secretoglobins are a superfamily of secreted proteins thought to participate in inflammation, tissue repair, and tumorigenesis. Secretoglobin family 2A member 1 (Scgb2a1) is a component of prostatein, a major androgen-binding protein secreted by the rat prostate. Using a rat model for developmental reprogramming of susceptibility to prostate carcinogenesis, we identified, by RNA-seq, that Scgb2a1 is significantly upregulated (>100-fold) in the prostate of adult rats neonatally exposed to bisphenol A (BPA), with increased gene expression confirmed by quantitative RT-PCR and chromatin immunoprecipitation for histone H3 lysine 9 acetylation. Bisulfite analysis of both CpG islands located within 10 kb of the Scgb2a1 promoter identified significant hypomethylation of the CpG island upstream of the transcription start site of this gene in the reprogrammed prostate. These data suggest that expression of Scgb2a1 in the adult prostate could be epigenetically reprogrammed by BPA exposure during prostate development, with potential implications for cancer risk and response to chemotherapeutics associated with prostatein binding.

  8. Genome-wide DNA Methylation Profiling of CpG Islands in Hypospadias

    PubMed Central

    Choudhry, Shweta; Deshpande, Archana; Qiao, Liang; Beckman, Kenneth; Sen, Saunak; Baskin, Laurence S.

    2013-01-01

    Purpose Hypospadias is one of the most frequent genital malformations in the male newborn, and results from abnormal penile and urethral development. The etiology of hypospadias remains largely unknown despite intensive investigations. Fetal androgens have a crucial role in genital differentiation. Recent studies have suggested that molecular mechanisms that underlie the effects of androgens on the fetus may involve disruption of epigenetic programming of gene expression during development. We assessed whether epigenetic modification of DNA methylation is associated with hypospadias in a case-control study of 12 hypospadias and 8 control subjects. Materials and Methods Genome-wide DNA methylation profiling was performed on the study subjects using the Illumina Infinium® HumanMethylation450 Bead-Chip, which enables the direct investigation of methylation status of more than 485,000 individual CpG sites throughout the genome. The methylation level at each CpG site was compared between cases and controls using the t test and logistic regression. Results We identified 14 CpG sites that were associated with hypospadias with p <0.00001. These CpG sites were in or near the SCARB1, MYBPH, SORBS1, LAMA4, HOXD11, MYO1D, EGFL7, C10orf41, LMAN1L and SULF1 genes. Two CpG sites in SCARB1 and MYBPH genes remained statistically significant after correction for multiple testing (p = 2.61×10−09, pcorrected = 0.008; p = 3.06×10−08, pcorrected = 0.02, respectively). Conclusions To our knowledge this is the first study to investigate hypospadias using a unique and novel epigenetic approach. Our findings suggest DNA methylation patterns are useful in identifying new genes such as SCARB1 and MYBPH that may be involved in the etiology of hypospadias. PMID:22906644

  9. Transcriptome Analysis of an Insecticide Resistant Housefly Strain: Insights about SNPs and Regulatory Elements in Cytochrome P450 Genes.

    PubMed

    Mahmood, Khalid; Højland, Dorte H; Asp, Torben; Kristensen, Michael

    2016-01-01

    Insecticide resistance in the housefly, Musca domestica, has been investigated for more than 60 years. It will enter a new era after the recent publication of the housefly genome and the development of multiple next generation sequencing technologies. The genetic background of the xenobiotic response can now be investigated in greater detail. Here, we investigate the 454-pyrosequencing transcriptome of the spinosad-resistant 791spin strain in relation to the housefly genome with focus on P450 genes. The de novo assembly of clean reads gave 35,834 contigs consisting of 21,780 sequences of the spinosad resistant strain. The 3,648 sequences were annotated with an enzyme code EC number and were mapped to 124 KEGG pathways with metabolic processes as most highly represented pathway. One hundred and twenty contigs were annotated as P450s covering 44 different P450 genes of housefly. Eight differentially expressed P450s genes were identified and investigated for SNPs, CpG islands and common regulatory motifs in promoter and coding regions. Functional annotation clustering of metabolic related genes and motif analysis of P450s revealed their association with epigenetic, transcription and gene expression related functions. The sequence variation analysis resulted in 12 SNPs and eight of them found in cyp6d1. There is variation in location, size and frequency of CpG islands and specific motifs were also identified in these P450s. Moreover, identified motifs were associated to GO terms and transcription factors using bioinformatic tools. Transcriptome data of a spinosad resistant strain provide together with genome data fundamental support for future research to understand evolution of resistance in houseflies. Here, we report for the first time the SNPs, CpG islands and common regulatory motifs in differentially expressed P450s. Taken together our findings will serve as a stepping stone to advance understanding of the mechanism and role of P450s in xenobiotic detoxification.

  10. EG-13GENOME-WIDE METHYLATION ANALYSIS IDENTIFIES GENOMIC DNA DEMETHYLATION DURING MALIGNANT PROGRESSION OF GLIOMAS

    PubMed Central

    Saito, Kuniaki; Mukasa, Akitake; Nagae, Genta; Aihara, Koki; Otani, Ryohei; Takayanagi, Shunsaku; Omata, Mayu; Tanaka, Shota; Shibahara, Junji; Takahashi, Miwako; Momose, Toshimitsu; Shimamura, Teppei; Miyano, Satoru; Narita, Yoshitaka; Ueki, Keisuke; Nishikawa, Ryo; Nagane, Motoo; Aburatani, Hiroyuki; Saito, Nobuhito

    2014-01-01

    Low-grade gliomas often undergo malignant progression, and these transformations are a leading cause of death in patients with low-grade gliomas. However, the molecular mechanisms underlying malignant tumor progression are still not well understood. Recent evidence indicates that epigenetic deregulation is an important cause of gliomagenesis; therefore, we examined the impact of epigenetic changes during malignant progression of low-grade gliomas. Specifically, we used the Illumina Infinium Human Methylation 450K BeadChip to perform genome-wide DNA methylation analysis of 120 gliomas and four normal brains. This study sample included 25 matched-pairs of initial low-grade gliomas and recurrent tumors (temporal heterogeneity) and 20 of the 25 recurring tumors recurred as malignant progressions, and one matched-pair of newly emerging malignant lesions and pre-existing lesions (spatial heterogeneity). Analyses of methylation profiles demonstrated that most low-grade gliomas in our sample (43/51; 84%) had a CpG island methylator phenotype (G-CIMP). Remarkably, approximately 50% of secondary glioblastomas that had progressed from low-grade tumors with the G-CIMP status exhibited a characteristic partial demethylation of genomic DNA during malignant progression, but other recurrent gliomas showed no apparent change in DNA methylation pattern. Interestingly, we found that most loci that were demethylated during malignant progression were located outside of CpG islands. The information of histone modifications patterns in normal human astrocytes and embryonal stem cells also showed that the ratio of active marks at the site corresponding to DNA demethylated loci in G-CIMP-demethylated tumors was significantly lower; this finding indicated that most demethylated loci in G-CIMP-demethylated tumors were likely transcriptionally inactive. A small number of the genes that were upregulated and had demethylated CpG islands were associated with cell cycle-related pathway. In summary, we demonstrated that characteristic DNA demethylation occurred during malignant progression of a subset of low-grade gliomas. The mechanisms underlying and consequences of such DNA demethylation should be studied further.

  11. Are clinicopathological features of colorectal cancers with methylation in half of CpG island methylator phenotype panel markers different from those of CpG island methylator phenotype-high colorectal cancers?

    PubMed

    Bae, Jeong Mo; Rhee, Ye-Young; Kim, Kyung Ju; Wen, Xianyu; Song, Young Seok; Cho, Nam-Yun; Kim, Jung Ho; Kang, Gyeong Hoon

    2016-01-01

    CpG island methylator phenotype (CIMP)-high (CIMP-H) colorectal cancer (CRC) is defined when a tumor shows methylation at greater than or equal to 60% of CIMP panel markers. Although CRCs with methylation at 50% of panel markers are classified as CIMP-low/CIMP-0 tumors, little is known regarding the clinicopathological and molecular features of CRCs with methylation at 4/8 panel markers (4/8 methylated markers) and whether they are akin to CIMP-H or CIMP-low/CIMP-0 CRCs in terms of their clinicopathological or molecular features. A total of 1164 cases of surgically resected CRC were analyzed for their methylation status in 8 CIMP panel markers, and the frequencies of various clinicopathological and molecular features were compared between CRCs with 0/8, 1/8 to 3/8, 4/8, and 5/8 to 8/8 methylated markers. CRCs with 4/8 methylated markers were closer to CRCs with 5/8 to 8/8 methylated markers in terms of sex distribution, mucin production, serration, nodal metastasis, CK7 expression, CK20 loss, and CDX2 loss frequencies and overall survival rate. CRCs with methylation at 4/8 markers were closer to CRCs with 1/8 to 3/8 methylated markers in terms of less frequent right colon location and poor differentiation. CRCs with 4/8 methylated markers showed the shortest overall survival time compared with CRCs with 0/8, 1/8 to 3/8, 4/8, or 5/8 to 8/8 methylated markers. In terms of clinicopathological and molecular features, CRCs with 4/8 methylated markers appeared to be closer to CIMP-H than to CIMP-low/CIMP-0 and would thus be better classified as CIMP-H if the CRCs require classification into either CIMP-H or CIMP-low/CIMP-0. Copyright © 2015 Elsevier Inc. All rights reserved.

  12. B vitamins, methionine and alcohol intake and risk of colon cancer in relation to BRAF mutation and CpG island methylator phenotype (CIMP).

    PubMed

    Schernhammer, Eva S; Giovannucci, Edward; Baba, Yoshifumi; Fuchs, Charles S; Ogino, Shuji

    2011-01-01

    One-carbon metabolism appears to play an important role in DNA methylation reaction. Evidence suggests that a low intake of B vitamins or high alcohol consumption increases colorectal cancer risk. How one-carbon nutrients affect the CpG island methylator phenotype (CIMP) or BRAF mutation status in colon cancer remains uncertain. Utilizing incident colon cancers in a large prospective cohort of women (the Nurses' Health Study), we determined BRAF status (N = 386) and CIMP status (N = 375) by 8 CIMP-specific markers [CACNA1G, CDKN2A (p16), CRABP1, IGF2, MLH1, NEUROG1, RUNX3, and SOCS1], and 8 other CpG islands (CHFR, HIC1, IGFBP3, MGMT, MINT-1, MINT-31, p14, and WRN). We examined the relationship between intake of one-carbon nutrients and alcohol and colon cancer risk, by BRAF mutation or CIMP status. Higher folate intake was associated with a trend towards low risk of CIMP-low/0 tumors [total folate intake ≥400 µg/day vs. <200 µg/day; the multivariate relative risk = 0.73; 95% CI = 0.53-1.02], whereas total folate intake had no influence on CIMP-high tumor risks (P(heterogeneity) = 0.73). Neither vitamin B(6), methionine or alcohol intake appeared to differentially influence risks for CIMP-high and CIMP-low/0 tumors. Using the 16-marker CIMP panel did not substantially alter our results. B vitamins, methionine or alcohol intake did not affect colon cancer risk differentially by BRAF status. This molecular pathological epidemiology study suggests that low level intake of folate may be associated with an increased risk of CIMP-low/0 colon tumors, but not that of CIMP-high tumors. However, the difference between CIMP-high and CIMP-low/0 cancer risks was not statistically significant, and additional studies are necessary to confirm these observations.

  13. No association of CpG island methylator phenotype and colorectal cancer survival: population-based study

    PubMed Central

    Jia, Min; Jansen, Lina; Walter, Viola; Tagscherer, Katrin; Roth, Wilfried; Herpel, Esther; Kloor, Matthias; Bläker, Hendrik; Chang-Claude, Jenny; Brenner, Hermann; Hoffmeister, Michael

    2016-01-01

    Background: Previous studies have shown adverse effects of CpG island methylator phenotype (CIMP) on colorectal cancer (CRC) prognosis. However, sample sizes were often limited and only few studies were able to adjust for relevant molecular features associated with CIMP. The aim of this study was to investigate the impact of CIMP on CRC survival in a large population-based study with comprehensive adjustment. Methods: The CIMP status and other molecular tumour features were analysed in 1385 CRC patients diagnosed between 2003 and 2010. Detailed information were obtained from standardised personal interviews and medical records. During follow-up (median: 4.9 years), we assessed vital status, cause of death and therapy details. Cox proportional hazard regression models were used to estimate adjusted hazard ratios (HRs) and 95% confidence intervals (CIs) of survival after CRC. Results: The CIMP-H occurred more frequently in patients with older age, female gender, cancer in the proximal colon, BRAF mutation and microsatellite instability-high (MSI-H). However, CIMP status was not associated with CRC prognosis in CRC patients (HR=1.00; 95% CI=0.72–1.40 for overall survival; HR=0.96; 95% CI=0.65–1.41 for disease-specific survival) or in any of the subgroups. Although CIMP status was associated with the presence of MSI-H and BRAF mutation, the prognostic effects of MSI-H (HR=0.49; 95% CI=0.27–0.90) and BRAF mutation (HR=1.78; 95% CI=1.10–2.84) were independent of CIMP status. Similar benefit of chemotherapy was found for CRC outcomes in both the CIMP-low/negative group and the CIMP-high group. Conclusions: CpG island methylator phenotype was not associated with CRC prognosis after adjusting for other important clinical factors and associated mutations. PMID:27811854

  14. Association of the Colorectal CpG Island Methylator Phenotype with molecular features, risk factors and family history

    PubMed Central

    Long, Tiffany I.; Buchanan, Daniel D.; Walters, Rhiannon; Clendenning, Mark; Rosty, Christophe; Joshi, Amit D.; Stern, Mariana C.; LeMarchand, Loic; Lindor, Noralane M.; Daftary, Darshana; Gallinger, Steven; Selander, Teresa; Bapat, Bharati; Newcomb, Polly A.; Campbell, Peter T.; Casey, Graham; Ahnen, Dennis J.; Baron, John A.; Haile, Robert W.; Hopper, John L.; Young, Joanne P.; Laird, Peter W.; Siegmund, Kimberly D.

    2015-01-01

    Background The CpG Island Methylator Phenotype (CIMP) represents a subset of colorectal cancers (CRCs) characterized by widespread aberrant DNA hypermethylation at select CpG islands. The risk factors and environmental exposures contributing to etiologic heterogeneity between CIMP and non-CIMP tumors are not known. Methods We measured the CIMP status of 3,119 primary population-based CRC tumors from the multinational Colon Cancer Family Registry. Etiologic heterogeneity was assessed by a case-case study comparing risk factor frequency of CRC cases with CIMP and non-CIMP tumors using logistic regression to estimate the case-case odds ratio (ccOR). Results We found associations between tumor CIMP status and MSI-H (ccOR=7.6), BRAF V600E mutation (ccOR=59.8), proximal tumor site (ccOR=9) (all p<0.0001), female sex (ccOR=1.8; 95% CI=1.5-2.1), older age (ccOR=4.0 comparing over 70 years vs under 50; 95% CI=3.0-5.5) and family history of CRC (ccOR=0.6, 95% CI=0.5-0.7). While use of NSAIDs varied by tumor CIMP status for both males and females (p=0.0001 and p=0.02, respectively), use of multi-vitamin or calcium supplements did not. Only for female CRCs was CIMP status associated with increased pack-years of smoking (trend p < 0.001) and body mass index (BMI) (trend p = 0.03). Conclusions The frequency of several CRC risk factors varied by CIMP status, and the associations of smoking and obesity with tumor subtype were evident only for females. Impact Differences in the associations of a unique DNA methylation-based subgroup of CRC with important lifestyle and environmental exposures increase understanding of the molecular pathologic epidemiology of this heavily methylated subset of CRCs. PMID:25587051

  15. Association of the colorectal CpG island methylator phenotype with molecular features, risk factors, and family history.

    PubMed

    Weisenberger, Daniel J; Levine, A Joan; Long, Tiffany I; Buchanan, Daniel D; Walters, Rhiannon; Clendenning, Mark; Rosty, Christophe; Joshi, Amit D; Stern, Mariana C; LeMarchand, Loic; Lindor, Noralane M; Daftary, Darshana; Gallinger, Steven; Selander, Teresa; Bapat, Bharati; Newcomb, Polly A; Campbell, Peter T; Casey, Graham; Ahnen, Dennis J; Baron, John A; Haile, Robert W; Hopper, John L; Young, Joanne P; Laird, Peter W; Siegmund, Kimberly D

    2015-03-01

    The CpG island methylator phenotype (CIMP) represents a subset of colorectal cancers characterized by widespread aberrant DNA hypermethylation at select CpG islands. The risk factors and environmental exposures contributing to etiologic heterogeneity between CIMP and non-CIMP tumors are not known. We measured the CIMP status of 3,119 primary population-based colorectal cancer tumors from the multinational Colon Cancer Family Registry. Etiologic heterogeneity was assessed by a case-case study comparing risk factor frequency of colorectal cancer cases with CIMP and non-CIMP tumors using logistic regression to estimate the case-case odds ratio (ccOR). We found associations between tumor CIMP status and MSI-H (ccOR = 7.6), BRAF V600E mutation (ccOR = 59.8), proximal tumor site (ccOR = 9; all P < 0.0001), female sex [ccOR = 1.8; 95% confidence interval (CI), 1.5-2.1], older age (ccOR = 4.0 comparing over 70 years vs. under 50; 95% CI, 3.0-5.5), and family history of CRC (ccOR = 0.6; 95% CI, 0.5-0.7). While use of NSAIDs varied by tumor CIMP status for both males and females (P = 0.0001 and P = 0.02, respectively), use of multivitamin or calcium supplements did not. Only for female colorectal cancer was CIMP status associated with increased pack-years of smoking (Ptrend < 0.001) and body mass index (BMI; Ptrend = 0.03). The frequency of several colorectal cancer risk factors varied by CIMP status, and the associations of smoking and obesity with tumor subtype were evident only for females. Differences in the associations of a unique DNA methylation-based subgroup of colorectal cancer with important lifestyle and environmental exposures increase understanding of the molecular pathologic epidemiology of this heavily methylated subset of colorectal cancer. Cancer Epidemiol Biomarkers Prev; 24(3); 512-9. ©2015 AACR. ©2015 American Association for Cancer Research.

  16. Combined DNA methylation and gene expression profiling in gastrointestinal stromal tumors reveals hypomethylation of SPP1 as an independent prognostic factor.

    PubMed

    Haller, Florian; Zhang, Jitao David; Moskalev, Evgeny A; Braun, Alexander; Otto, Claudia; Geddert, Helene; Riazalhosseini, Yasser; Ward, Aoife; Balwierz, Aleksandra; Schaefer, Inga-Marie; Cameron, Silke; Ghadimi, B Michael; Agaimy, Abbas; Fletcher, Jonathan A; Hoheisel, Jörg; Hartmann, Arndt; Werner, Martin; Wiemann, Stefan; Sahin, Ozgür

    2015-03-01

    Gastrointestinal stromal tumors (GISTs) have distinct gene expression patterns according to localization, genotype and aggressiveness. DNA methylation at CpG dinucleotides is an important mechanism for regulation of gene expression. We performed targeted DNA methylation analysis of 1.505 CpG loci in 807 cancer-related genes in a cohort of 76 GISTs, combined with genome-wide mRNA expression analysis in 22 GISTs, to identify signatures associated with clinicopathological parameters and prognosis. Principal component analysis revealed distinct DNA methylation patterns associated with anatomical localization, genotype, mitotic counts and clinical follow-up. Methylation of a single CpG dinucleotide in the non-CpG island promoter of SPP1 was significantly correlated with shorter disease-free survival. Hypomethylation of this CpG was an independent prognostic parameter in a multivariate analysis compared to anatomical localization, genotype, tumor size and mitotic counts in a cohort of 141 GISTs with clinical follow-up. The epigenetic regulation of SPP1 was confirmed in vitro, and the functional impact of SPP1 protein on tumorigenesis-related signaling pathways was demonstrated. In summary, SPP1 promoter methylation is a novel and independent prognostic parameter in GISTs, and might be helpful in estimating the aggressiveness of GISTs from the intermediate-risk category. © 2014 UICC.

  17. Experimental murine myopia induces collagen type Iα1 (COL1A1) DNA methylation and altered COL1A1 messenger RNA expression in sclera

    PubMed Central

    Zhou, Xiangtian; Ji, Fengtao; An, Jianhong; Zhao, Fuxin; Shi, Fanjun; Huang, Furong; Li, Yuan; Jiao, Shiming; Yan, Dongsheng; Chen, Xiaoyan; Chen, JiangFan

    2012-01-01

    Purpose To investigate whether myopia development is associated with changes of scleral DNA methylation in cytosine-phosphate-guanine (CpG) sites in the collagen 1A1 (COL1A1) promoter and messenger RNA (mRNA) levels following murine form deprivation myopia. Methods Fifty-seven C57BL/6 mice (postnatal day 23) were randomly assigned to four groups: (1) monocular form deprivation (MD) in which a diffuser lens was placed over one eye for 28 days; (2) normal controls without MD; (3) MD recovery in which the diffuser lens was removed for seven days; and (4) MD recovery normal controls. The DNA methylation pattern in COL1A1 promoter and exon 1 was determined by bisulfite DNA sequencing, and the COL1A1 mRNA level in sclera was determined by quantitative PCR. Results MD was found to induce myopia in the treated eyes. Six CpG sites in the promoter and exon 1 region of COL1A1 were methylated with significantly higher frequency in the treated eyes than normal control eyes (p<0.05), with CpG island methylation in MD-contralateral eyes being intermediate. Consistent with the CpG methylation, scleral COL1A1 mRNA was reduced by 57% in the MD-treated eyes compared to normal controls (p<0.05). After seven days of MD recovery, CpG methylation was significantly reduced (p=0.01). The methylation patterns returned to near normal level in five CpG sites, but the sixth was hypomethylated compared to normal controls. Conclusions In parallel with the development of myopia and the reduced COL1A1 mRNA, the frequency of methylation in CpG sites of the COL1A1 promoter/exon 1 increased during MD and returned to near normal during recovery. Thus, hypermethylation of CpG sites in the promoter/exon 1 of COL1A1 may underlie reduced collagen synthesis at the transcriptional level in myopic scleras. PMID:22690110

  18. Genome-Wide DNA Methylation Analysis of Human Pancreatic Islets from Type 2 Diabetic and Non-Diabetic Donors Identifies Candidate Genes That Influence Insulin Secretion

    PubMed Central

    Dayeh, Tasnim; Volkov, Petr; Salö, Sofia; Hall, Elin; Nilsson, Emma; Olsson, Anders H.; Kirkpatrick, Clare L.; Wollheim, Claes B.; Eliasson, Lena; Rönn, Tina; Bacos, Karl; Ling, Charlotte

    2014-01-01

    Impaired insulin secretion is a hallmark of type 2 diabetes (T2D). Epigenetics may affect disease susceptibility. To describe the human methylome in pancreatic islets and determine the epigenetic basis of T2D, we analyzed DNA methylation of 479,927 CpG sites and the transcriptome in pancreatic islets from T2D and non-diabetic donors. We provide a detailed map of the global DNA methylation pattern in human islets, β- and α-cells. Genomic regions close to the transcription start site showed low degrees of methylation and regions further away from the transcription start site such as the gene body, 3′UTR and intergenic regions showed a higher degree of methylation. While CpG islands were hypomethylated, the surrounding 2 kb shores showed an intermediate degree of methylation, whereas regions further away (shelves and open sea) were hypermethylated in human islets, β- and α-cells. We identified 1,649 CpG sites and 853 genes, including TCF7L2, FTO and KCNQ1, with differential DNA methylation in T2D islets after correction for multiple testing. The majority of the differentially methylated CpG sites had an intermediate degree of methylation and were underrepresented in CpG islands (∼7%) and overrepresented in the open sea (∼60%). 102 of the differentially methylated genes, including CDKN1A, PDE7B, SEPT9 and EXOC3L2, were differentially expressed in T2D islets. Methylation of CDKN1A and PDE7B promoters in vitro suppressed their transcriptional activity. Functional analyses demonstrated that identified candidate genes affect pancreatic β- and α-cells as Exoc3l silencing reduced exocytosis and overexpression of Cdkn1a, Pde7b and Sept9 perturbed insulin and glucagon secretion in clonal β- and α-cells, respectively. Together, our data can serve as a reference methylome in human islets. We provide new target genes with altered DNA methylation and expression in human T2D islets that contribute to perturbed insulin and glucagon secretion. These results highlight the importance of epigenetics in the pathogenesis of T2D. PMID:24603685

  19. CpG island methylation phenotype (CIMP) in oral cancer: associated with a marked inflammatory response and less aggressive tumour biology.

    PubMed

    Shaw, Richard J; Hall, Gillian L; Lowe, Derek; Bowers, Naomi L; Liloglou, Triantafillos; Field, John K; Woolgar, Julia A; Risk, Janet M

    2007-10-01

    Studies in several tumour sites highlight the significance of the CpG island methylation phenotype (CIMP), with distinct features of histology, biological aggression and outcome. We utilise pyrosequencing techniques of quantitative methylation analysis to investigate the presence of CIMP in oral squamous cell carcinoma (OSCC) for the first time, and evaluate its correlation with allelic imbalance, pathology and clinical behaviour. Tumour tissue, control tissue and PBLs were obtained from 74 patients with oral squamous cell carcinoma. Pyrosequencing was used to analyse methylation patterns in 75-200 bp regions of the CpG rich gene promoters of 10 genes with a broad range of cellular functions. Allelic imbalance was investigated using a multiplexed panel of 11 microsatellite markers. Corresponding variables, histopathological staging and grading were correlated with these genetic and epigenetic aberrations. A cluster of tumours with a greater degree of promoter methylation than would be predicted by chance alone (P=0.001) were designated CIMP+ve. This group had less aggressive tumour biology in terms of tumour thickness (p=0.015) and nodal metastasis (P=0.012), this being apparently independent of tumour diameter. Further, it seems that these CIMP+ve tumours excited a greater host inflammatory response (P=0.019). The exact mechanisms underlying CIMP remain obscure but the association with a greater inflammatory host response supports existing theories relating these features in other tumour sites. As CIMP has significant associations with other well documented prognostic indicators, it may prove beneficial to include methylation analyses in molecular risk modelling of tumours.

  20. Methylation of avpr1a in the cortex of wild prairie voles: effects of CpG position and polymorphism

    PubMed Central

    Maguire, S. M.; Phelps, S. M.

    2017-01-01

    DNA methylation can cause stable changes in neuronal gene expression, but we know little about its role in individual differences in the wild. In this study, we focus on the vasopressin 1a receptor (avpr1a), a gene extensively implicated in vertebrate social behaviour, and explore natural variation in DNA methylation, genetic polymorphism and neuronal gene expression among 30 wild prairie voles (Microtus ochrogaster). Examination of CpG density across 8 kb of the locus revealed two distinct CpG islands overlapping promoter and first exon, characterized by few CpG polymorphisms. We used a targeted bisulfite sequencing approach to measure DNA methylation across approximately 3 kb of avpr1a in the retrosplenial cortex, a brain region implicated in male space use and sexual fidelity. We find dramatic variation in methylation across the avrp1a locus, with pronounced diversity near the exon–intron boundary and in a genetically variable putative enhancer within the intron. Among our wild voles, differences in cortical avpr1a expression correlate with DNA methylation in this putative enhancer, but not with the methylation status of the promoter. We also find an unusually high number of polymorphic CpG sites (polyCpGs) in this focal enhancer. One polyCpG within this enhancer (polyCpG 2170) may drive variation in expression either by disrupting transcription factor binding motifs or by changing local DNA methylation and chromatin silencing. Our results contradict some assumptions made within behavioural epigenetics, but are remarkably concordant with genome-wide studies of gene regulation. PMID:28280564

  1. Minding the Cyber-Physical Gap: Model-Based Analysis and Mitigation of Systemic Perception-Induced Failure

    PubMed Central

    2017-01-01

    The cyber-physical gap (CPG) is the difference between the ‘real’ state of the world and the way the system perceives it. This discrepancy often stems from the limitations of sensing and data collection technologies and capabilities, and is inevitable at some degree in any cyber-physical system (CPS). Ignoring or misrepresenting such limitations during system modeling, specification, design, and analysis can potentially result in systemic misconceptions, disrupted functionality and performance, system failure, severe damage, and potential detrimental impacts on the system and its environment. We propose CPG-Aware Modeling & Engineering (CPGAME), a conceptual model-based approach to capturing, explaining, and mitigating the CPG. CPGAME enhances the systems engineer’s ability to cope with CPGs, mitigate them by design, and prevent erroneous decisions and actions. We demonstrate CPGAME by applying it for modeling and analysis of the 1979 Three Miles Island 2 nuclear accident, and show how its meltdown could be mitigated. We use ISO-19450:2015—Object Process Methodology as our conceptual modeling framework. PMID:28714910

  2. Greig syndrome: Analysis of the GL13 gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Grzeschik, K.H.; Gessler, M.; Heid, C.

    1994-09-01

    Disruption of the zinc finger gene GL13 by translocation events has been implicated as the cause for cephalopolysyndactyly syndrome (GCPS) in several patients. To characterize this genomic region on human chromosome 7p13, we have isolated a YAC contig of more than 1000 kb including the GL13 gene. About 550 kb from this area were subdivided into a cosmid contig with a two- to ten-fold clone coverage. In this region the cloned GL13 cDNA appears to correspond to at least 14 exons spread over a distance of 280 kb. A CpG island defined by two NotI sites and several BssHII andmore » KspI sites is located in a genomic fragment covering the most proximal exon of the cloned GL13 cDNA. Further upstream, five segments conserved between man and mouse were found. In the mouse this region has been characterized as the transgene integration site resulting in the add phenotype. Both the CpG islands and the conserved regions are likely candidates to search for GL13 promoter and control elements. Intron-exon boundaries and breakpoints of the translocation events within the gene region of patients were identified and characterized.« less

  3. Differential methylation of tissue- and cancer-specific CpG island shores distinguishes human induced pluripotent stem cells, embryonic stem cells and fibroblasts

    PubMed Central

    Doi, Akiko; Park, In-Hyun; Wen, Bo; Murakami, Peter; Aryee, Martin J; Irizarry, Rafael; Herb, Brian; Ladd-Acosta, Christine; Rho, Junsung; Loewer, Sabine; Miller, Justine; Schlaeger, Thorsten; Daley, George Q; Feinberg, Andrew P

    2010-01-01

    Induced pluripotent stem (iPS) cells are derived by epigenetic reprogramming, but their DNA methylation patterns have not yet been analyzed on a genome-wide scale. Here, we find substantial hypermethylation and hypomethylation of cytosine-phosphate-guanine (CpG) island shores in nine human iPS cell lines as compared to their parental fibroblasts. The differentially methylated regions (DMRs) in the reprogrammed cells (denoted R-DMRs) were significantly enriched in tissue-specific (T-DMRs; 2.6-fold, P < 10−4) and cancer-specific DMRs (C-DMRs; 3.6-fold, P < 10−4). Notably, even though the iPS cells are derived from fibroblasts, their R-DMRs can distinguish between normal brain, liver and spleen cells and between colon cancer and normal colon cells. Thus, many DMRs are broadly involved in tissue differentiation, epigenetic reprogramming and cancer. We observed colocalization of hypomethylated R-DMRs with hypermethylated C-DMRs and bivalent chromatin marks, and colocalization of hypermethylated R-DMRs with hypomethylated C-DMRs and the absence of bivalent marks, suggesting two mechanisms for epigenetic reprogramming in iPS cells and cancer. PMID:19881528

  4. Environment, diet and CpG island methylation: epigenetic signals in gastrointestinal neoplasia.

    PubMed

    Johnson, Ian T; Belshaw, Nigel J

    2008-04-01

    The epithelial surfaces of the mammalian alimentary tract are characterised by very high rates of cell proliferation and DNA synthesis, and in humans they are highly susceptible to cancer. The role of somatic mutations as drivers of carcinogenesis in the alimentary tract is well established, but the importance of gene silencing by epigenetic mechanisms is increasingly recognised. Methylation of CpG islands is an important component of the epigenetic code that regulates gene expression during development and normal cellular differentiation, and a number of genes are well known to become abnormally methylated during the development of tumours of the oesophagus, stomach and colorectum. Aberrant patterns of DNA methylation develop as a result of pathological processes such as chronic inflammation, and in response to various dietary factors, including imbalances in the supply of methyl donors, particularly folates, and exposure to DNA methyltransferase inhibitors, which include polyphenols and possibly isothiocyanates from plant foods. However the importance of these environmental interactions in human health and disease remains to be established. Recent moves to modify the exposure of human populations to folate, by mandatory supplementation of cereal foods, emphasise the importance of understanding the susceptibility of the human epigenome to dietary and other environmental effects.

  5. CpG island methylator phenotype and its association with malignancy in sporadic duodenal adenomas.

    PubMed

    Sun, Lifeng; Guzzetta, Angela A; Fu, Tao; Chen, Jinming; Jeschke, Jana; Kwak, Ruby; Vatapalli, Rajita; Baylin, Stephen B; Iacobuzio-Donahue, Christine A; Wolfgang, Christopher L; Ahuja, Nita

    2014-05-01

    CpG island methylator phenotype (CIMP) has been found in multiple precancerous and cancerous lesions, including colorectal adenomas, colorectal cancers, and duodenal adenocarcinomas. There are no reports in the literature of a relationship between CIMP status and clinicopathologic features of sporadic duodenal adenomas. This study sought to elucidate the role of methylation in duodenal adenomas and correlate it with KRAS and BRAF mutations. CIMP+ (with more than 2 markers methylated) was seen in 33.3% of duodenal adenomas; 61% of these CIMP+ adenomas were CIMP-high (with more than 3 markers methylated). Furthermore, CIMP+ status significantly correlated with older age of patients, larger size and villous type of tumor, coexistent dysplasia and periampullary location. MLH1 methylation was seen in 11.1% of duodenal adenomas and was significantly associated with CIMP+ tumors, while p16 methylation was an infrequent event. KRAS mutations were frequent and seen in 26.3% of adenomas; however, no BRAF mutations were detected. Furthermore, CIMP-high status was associated with larger size and villous type of tumor and race (non-white). These results suggest that CIMP+ duodenal adenomas may have a higher risk for developing malignancy and may require more aggressive management and surveillance.

  6. CpG island methylator phenotype and its association with malignancy in sporadic duodenal adenomas

    PubMed Central

    Sun, Lifeng; Guzzetta, Angela A; Fu, Tao; Chen, Jinming; Jeschke, Jana; Kwak, Ruby; Vatapalli, Rajita; Baylin, Stephen B; Iacobuzio-Donahue, Christine A; Wolfgang, Christopher L; Ahuja, Nita

    2014-01-01

    CpG island methylator phenotype (CIMP) has been found in multiple precancerous and cancerous lesions, including colorectal adenomas, colorectal cancers, and duodenal adenocarcinomas. There are no reports in the literature of a relationship between CIMP status and clinicopathologic features of sporadic duodenal adenomas. This study sought to elucidate the role of methylation in duodenal adenomas and correlate it with KRAS and BRAF mutations. CIMP+ (with more than 2 markers methylated) was seen in 33.3% of duodenal adenomas; 61% of these CIMP+ adenomas were CIMP-high (with more than 3 markers methylated). Furthermore, CIMP+ status significantly correlated with older age of patients, larger size and villous type of tumor, coexistent dysplasia and periampullary location. MLH1 methylation was seen in 11.1% of duodenal adenomas and was significantly associated with CIMP+ tumors, while p16 methylation was an infrequent event. KRAS mutations were frequent and seen in 26.3% of adenomas; however, no BRAF mutations were detected. Furthermore, CIMP-high status was associated with larger size and villous type of tumor and race (non-white). These results suggest that CIMP+ duodenal adenomas may have a higher risk for developing malignancy and may require more aggressive management and surveillance. PMID:24518818

  7. A 1.8-Mb YAC contig in Xp11.23: identification of CpG islands and physical mapping of CA repeats in a region of high gene density.

    PubMed

    Coleman, M P; Németh, A H; Campbell, L; Raut, C P; Weissenbach, J; Davies, K E

    1994-05-15

    The genes ARAF1, SYN1, TIMP, and PFC are clustered within 70 kb of one another, and, as reported in the accompanying paper (J. Knight et al., 1994, Genomics 21: 180-187), at least four more genes map within 400 kb: a cluster of Krüppel-type zinc finger genes (including ZNF21, ZNF41, and ZNF81) and ELK-1, a member of the ets oncogene superfamily. This gene-rich region is of particular interest because of the large number of disease genes mapping to Xp11.23: at least three eye diseases (retinitis pigmentosa type 2, congenital stationary night blindness CSNB1, and Aland Island eye disease), Wiskott-Aldrich syndrome, X-linked nephrolithiasis, and a translocation breakpoint associated with synovial sarcoma. We have constructed a 1.8-Mb YAC contig in this region, confirming the link between TIMP and OATL1 reported by Knight et al. (1994) and extending the map in the distal direction. To investigate the likelihood that more genes are located within this region, we have carried out detailed mapping of rare-cutter restriction sites in these YACs and identified seven CpG islands. At least six of these islands are located over 50 kb from any known gene locations, suggesting that the region contains at least this many as yet unidentified genes. We have also mapped the physical locations of six highly polymorphic CA repeats within the contig, thus integrating the physical, genetic, and transcriptional maps of the region and facilitating the mapping and identification of disease genes.(ABSTRACT TRUNCATED AT 250 WORDS)

  8. Deregulation of RB1 expression by loss of imprinting in human hepatocellular carcinoma.

    PubMed

    Anwar, Sumadi Lukman; Krech, Till; Hasemeier, Britta; Schipper, Elisa; Schweitzer, Nora; Vogel, Arndt; Kreipe, Hans; Lehmann, Ulrich

    2014-08-01

    The tumour suppressor gene RB1 is frequently silenced in many different types of human cancer, including hepatocellular carcinoma (HCC). However, mutations of the RB1 gene are relatively rare in HCC. A systematic screen for the identification of imprinted genes deregulated in human HCC revealed that RB1 shows imprint abnormalities in a high proportion of primary patient samples. Altogether, 40% of the HCC specimens (16/40) showed hyper- or hypomethylation at the CpG island in intron 2 of the RB1 gene. Re-analysis of publicly available genome-wide DNA methylation data confirmed these findings in two independent HCC cohorts. Loss of correct DNA methylation patterns at the RB1 locus leads to the aberrant expression of an alternative RB1-E2B transcript, as measured by quantitative real-time PCR. Demethylation at the intron 2 CpG island by DNMT1 knock-down or aza-deoxycytidine (DAC) treatment stimulated expression of the RB1-E2B transcript, accompanied by diminished RB1 main transcript expression. No aberrant DNA methylation was found at the RB1 locus in hepatocellular adenoma (HCA, n = 10), focal nodular hyperplasia (FNH, n = 5) and their corresponding adjacent liver tissue specimens. Deregulated RB1 expression due to hyper- or hypomethylation in intron 2 of the RB1 gene is found in tumours without loss of heterozygosity and is associated with a decrease in overall survival (p = 0.032) if caused by hypermethylation of CpG85. This unequivocally demonstrates that loss of imprinting represents an important additional mechanism for RB1 pathway inactivation in human HCC, complementing well-described molecular defects. Copyright © 2014 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

  9. Magnifying narrow-band imaging of gastric mucosal morphology predicts the H. pylori-related epigenetic field defect.

    PubMed

    Tahara, Tomomitsu; Yamazaki, Jumpei; Tahara, Sayumi; Okubo, Masaaki; Kawamura, Tomohiko; Horiguchi, Noriyuki; Ishizuka, Takamitsu; Nagasaka, Mitsuo; Nakagawa, Yoshihito; Shibata, Tomoyuki; Kuroda, Makoto; Ohmiya, Naoki

    2017-06-08

    DNA methylation is associated with "field defect" in the gastric mucosa. To characterize "field defect" morphologically, we examined DNA methylation of non-neoplastic gastric mucosa in relation to their morphology seen by narrow-band imaging (NBI) with magnifying endoscopy. Magnifying NBI of non-neoplastic gastric body was classified as follows: normal-small and round pits with uniform subepithelial capillary networks; type 1-a little enlarged round pits with indistinct subepithelial capillary networks; type 2-remarkably enlarged pits with irregular vessels; and type 3-clearly demarcated oval or tubulovillous pits with bulky coiled or wavy vessels. Methylation of nine candidate genes (MYOD1, SLC16A12, GDNF, IGF2, MIR 124A1, CDH1, PRDM5, RORA and MLF1) were determined by bisulfite pyrosequencing. Infinium HumanMethylation450 array was used to characterize the methylation of >450,000 CpG sites. Mean Z score methylation of nine genes positively correlated with the changes of mucosal patterns from normal to types 1, 2, and 3 (P < 0.0001). Genome-wide analysis showed that development of mucosal patterns correlated with methylation accumulation especially at CpG islands. Genes with promoter CpG islands that were gradually methylated with the development of mucosal patterns significantly enriched the genes involved in zinc-related pathways. The results indicates that gastric mucosal morphology predicts a "field defect" in this tissue type. Accumulation of DNA methylation is associated with "field defect" in the non-neoplastic gastric mucosa. Endoscopic identification of "field defect" has important implications for preventing gastric cancer. Our results suggest that magnifying NBI of gastric mucosal morphology predicts a "field defect" in the gastric mucosa.

  10. Association of mitofusin 2 methylation and essential hypertension: a case-control study in a Chinese population.

    PubMed

    Jin, Fei; Li, Xiao; Wang, Zuoguang; Liu, Ya; Liu, Jielin; Sun, Dongdong; Jin, Yongxin; Wang, Shiqi; Wen, Shaojun; Wei, Yongxiang

    2018-06-07

    Mitofusin 2 (Mfn2), a gene that negatively regulates the proliferation of vascular smooth muscle cells (VSMCs), is expressed at low levels in the VSMCs of hypertensive patients. DNA methylation can inhibit gene expression. The purpose of this study was to investigate the relationship between Mfn2 methylation and essential hypertension (EH). After bioinformatics analysis, five EH patients and five normal control (NC) subjects were selected for methylation chip screening. Then, bisulfite DNA sequencing was used to analyze the methylation status of differentially methylated fragments of Mfn2 in 40 EH patients and 36 NC subjects. Mfn2 mRNA expression in the blood was detected by RT-qPCR. There were three CpG islands in the full length Mfn2 DNA sequence and some transcription factor binding sites in these regions, including Sp1, Ap2, GATA box, NF-κB, etc. The chip screening showed that only the third CpG island had a significantly high degree of methylation. Subsequent verification experiments found that the EH group had a significantly lower C base rate of methylation than the NC group (2.5% vs. 44.44%, P < 0.0001), but a similar CpG methylation rate (P > 0.05). RT-qPCR detection showed that the level of Mfn2 mRNA expression was significantly lower in the EH group than in the NC group (P = 0.013). Further association analysis showed that the level of Mfn2 methylation was associated with systolic blood pressure and diastolic blood pressure (r = -0.902, r = -0.713, respectively) but not the other indexes. The DNA methylation level of Mfn2 was significantly lower in hypertensive patients than in control subjects, which may be an independent risk factor for EH.

  11. Analysis of the association between CIMP and BRAF in colorectal cancer by DNA methylation profiling.

    PubMed

    Hinoue, Toshinori; Weisenberger, Daniel J; Pan, Fei; Campan, Mihaela; Kim, Myungjin; Young, Joanne; Whitehall, Vicki L; Leggett, Barbara A; Laird, Peter W

    2009-12-21

    A CpG island methylator phenotype (CIMP) is displayed by a distinct subset of colorectal cancers with a high frequency of DNA hypermethylation in a specific group of CpG islands. Recent studies have shown that an activating mutation of BRAF (BRAF(V600E)) is tightly associated with CIMP, raising the question of whether BRAF(V600E) plays a causal role in the development of CIMP or whether CIMP provides a favorable environment for the acquisition of BRAF(V600E). We employed Illumina GoldenGate DNA methylation technology, which interrogates 1,505 CpG sites in 807 different genes, to further study this association. We first examined whether expression of BRAF(V600E) causes DNA hypermethylation by stably expressing BRAF(V600E) in the CIMP-negative, BRAF wild-type COLO 320DM colorectal cancer cell line. We determined 100 CIMP-associated CpG sites and examined changes in DNA methylation in eight stably transfected clones over multiple passages. We found that BRAF(V600E) is not sufficient to induce CIMP in our system. Secondly, considering the alternative possibility, we identified genes whose DNA hypermethylation was closely linked to BRAF(V600E) and CIMP in 235 primary colorectal tumors. Interestingly, genes that showed the most significant link include those that mediate various signaling pathways implicated in colorectal tumorigenesis, such as BMP3 and BMP6 (BMP signaling), EPHA3, KIT, and FLT1 (receptor tyrosine kinases) and SMO (Hedgehog signaling). Furthermore, we identified CIMP-dependent DNA hypermethylation of IGFBP7, which has been shown to mediate BRAF(V600E)-induced cellular senescence and apoptosis. Promoter DNA hypermethylation of IGFBP7 was associated with silencing of the gene. CIMP-specific inactivation of BRAF(V600E)-induced senescence and apoptosis pathways by IGFBP7 DNA hypermethylation might create a favorable context for the acquisition of BRAF(V600E) in CIMP+ colorectal cancer. Our data will be useful for future investigations toward understanding CIMP in colorectal cancer and gaining insights into the role of aberrant DNA hypermethylation in colorectal tumorigenesis.

  12. CpA/CpG methylation of CiMDA5 possesses tight association with the resistance against GCRV and negatively regulates mRNA expression in grass carp, Ctenopharyngodon idella.

    PubMed

    Shang, Xueying; Su, Jianguo; Wan, Quanyuan; Su, Juanjuan

    2015-01-01

    Melanoma differentiation-associated gene 5 (MDA5) plays a crucial role in recognizing intracellular viral infection, activating the interferon regulatory factor pathways as well as inducing antiviral response. While the antiviral regulatory mechanism of MDA5 remains unclear. In the present study, CiMDA5 (Ctenopharyngodon idella MDA5) against grass carp reovirus (GCRV) would be initially revealed from the perspective of DNA methylation, a pivotal epigenetic modification. Two CpG islands (CGIs) were predicted located in the first exon of CiMDA5, of which the first CpG island was 427 bp in length possessed 29 candidate CpG loci and 34 CpA loci, and the second one was 130 bp in length involving 7 CpG loci as well as 10 CpA loci. By bisulfite sequencing PCR (BSP), the methylation statuses were detected in spleen of 70 individuals divided into resistant/susceptible groups post challenge experiment, and the resistance-association analysis was performed with Chi-square test. Quantitative real-time RT-PCR (qRT-PCR) was carried out to explore the relationship between DNA methylation and gene expression in CiMDA5. Results indicated that the methylation levels of CpA/CpG sites at +200, +202, +204, +207 nt, which consisted of a putative densely methylated element (DME), were significantly higher in the susceptible group than those in the resistant group. Meanwhile, the average transcription of CiMDA5 was down-regulated in the susceptible individuals compared with the resistant individuals. Evidently, the DNA methylation may be the negative modulator of CiMDA5 antiviral expression. Collectively, the methylation levels of CiMDA5 demonstrated the tight association with the resistance against GCRV and the negative-regulated roles in mRNA expression. This study first discovered the resistance-associated gene modulated by DNA methylation in teleost, preliminary revealed the underlying regulatory mechanism of CiMDA5 transcription against GCRV as well as laid a theoretical foundation on molecular nosogenesis of hemorrhagic diseases in C. idella. Copyright © 2014 Elsevier Ltd. All rights reserved.

  13. Methylomics of gene expression in human monocytes

    PubMed Central

    Liu, Yongmei; Ding, Jingzhong; Reynolds, Lindsay M.; Lohman, Kurt; Register, Thomas C.; De La Fuente, Alberto; Howard, Timothy D.; Hawkins, Greg A.; Cui, Wei; Morris, Jessica; Smith, Shelly G.; Barr, R. Graham; Kaufman, Joel D.; Burke, Gregory L.; Post, Wendy; Shea, Steven; Mccall, Charles E.; Siscovick, David; Jacobs, David R.; Tracy, Russell P.; Herrington, David M.; Hoeschele, Ina

    2013-01-01

    DNA methylation is one of several epigenetic mechanisms that contribute to the regulation of gene expression; however, the extent to which methylation of CpG dinucleotides correlates with gene expression at the genome-wide level is still largely unknown. Using purified primary monocytes from subjects in a large community-based cohort (n = 1264), we characterized methylation (>485 000 CpG sites) and mRNA expression (>48K transcripts) and carried out genome-wide association analyses of 8370 expression phenotypes. We identified 11 203 potential cis-acting CpG loci whose degree of methylation was associated with gene expression (eMS) at a false discovery rate threshold of 0.001. Most of the associations were consistent in effect size and direction of effect across sex and three ethnicities. Contrary to expectation, these eMS were not predominately enriched in promoter regions, or CpG islands, but rather in the 3′ UTR, gene bodies, CpG shores or ‘offshore’ sites, and both positive and negative correlations between methylation and expression were observed across all locations. eMS were enriched for regions predicted to be regulatory by ENCODE (Encyclopedia of DNA Elements) data in multiple cell types, particularly enhancers. One of the strongest association signals detected (P < 2.2 × 10−308) was a methylation probe (cg17005068) in the promoter/enhancer region of the glutathione S-transferase theta 1 gene (GSTT1, encoding the detoxification enzyme) with GSTT1 mRNA expression. Our study provides a detailed description of the epigenetic architecture in human monocytes and its relationship to gene expression. These data may help prioritize interrogation of biologically relevant methylation loci and provide new insights into the epigenetic basis of human health and diseases. PMID:23900078

  14. Combined epigenetic and intraspecific variation of the DRD4 and SERT genes influence novelty seeking behavior in great tit Parus major

    PubMed Central

    Riyahi, Sepand; Sánchez-Delgado, Marta; Calafell, Francesc; Monk, David; Senar, Juan Carlos

    2015-01-01

    DNA methylation is one of the main epigenetic mechanisms that can regulate gene expression and is an important means for creating phenotypic variation. In the present study, we performed methylation profiling of 2 candidate genes for personality traits, namely DRD4 and SERT, in the great tit Parus major to ascertain whether personality traits and behavior within different habitats have evolved with the aid of epigenetic variation. We applied bisulphite PCR and strand-specific sequencing to determine the methylation profile of the CpG dinucleotides in the DRD4 and SERT promoters and also in the CpG island overlapping DRD4 exon 3. Furthermore, we performed pyrosequencing to quantify the total methylation levels at each CpG location. Our results indicated that methylation was ∼1–4% higher in urban than in forest birds, for all loci and tissues analyzed, suggesting that this epigenetic modification is influenced by environmental conditions. Screening of genomic DNA sequence revealed that the SERT promoter is CpG poor region. The methylation at a single CpG dinucleotide located 288 bp from the transcription start site was related to exploration score in urban birds. In addition, the genotypes of the SERT polymorphism SNP234 located within the minimal promoter were significantly correlated with novelty seeking behavior in captivity, with the allele increasing this behavior being more frequent in urban birds. As a conclusion, it seems that both genetic and methylation variability of the SERT gene have an important role in shaping personality traits in great tits, whereas genetic and methylation variation at the DRD4 gene is not strongly involved in behavior and personality traits. PMID:25933062

  15. Transcriptome Analysis of an Insecticide Resistant Housefly Strain: Insights about SNPs and Regulatory Elements in Cytochrome P450 Genes

    PubMed Central

    Asp, Torben; Kristensen, Michael

    2016-01-01

    Background Insecticide resistance in the housefly, Musca domestica, has been investigated for more than 60 years. It will enter a new era after the recent publication of the housefly genome and the development of multiple next generation sequencing technologies. The genetic background of the xenobiotic response can now be investigated in greater detail. Here, we investigate the 454-pyrosequencing transcriptome of the spinosad-resistant 791spin strain in relation to the housefly genome with focus on P450 genes. Results The de novo assembly of clean reads gave 35,834 contigs consisting of 21,780 sequences of the spinosad resistant strain. The 3,648 sequences were annotated with an enzyme code EC number and were mapped to 124 KEGG pathways with metabolic processes as most highly represented pathway. One hundred and twenty contigs were annotated as P450s covering 44 different P450 genes of housefly. Eight differentially expressed P450s genes were identified and investigated for SNPs, CpG islands and common regulatory motifs in promoter and coding regions. Functional annotation clustering of metabolic related genes and motif analysis of P450s revealed their association with epigenetic, transcription and gene expression related functions. The sequence variation analysis resulted in 12 SNPs and eight of them found in cyp6d1. There is variation in location, size and frequency of CpG islands and specific motifs were also identified in these P450s. Moreover, identified motifs were associated to GO terms and transcription factors using bioinformatic tools. Conclusion Transcriptome data of a spinosad resistant strain provide together with genome data fundamental support for future research to understand evolution of resistance in houseflies. Here, we report for the first time the SNPs, CpG islands and common regulatory motifs in differentially expressed P450s. Taken together our findings will serve as a stepping stone to advance understanding of the mechanism and role of P450s in xenobiotic detoxification. PMID:27019205

  16. Promoter CpG island methylation in ion transport mechanisms and associated dietary intakes jointly influence the risk of clear-cell renal cell cancer.

    PubMed

    Deckers, Ivette Ag; van Engeland, Manon; van den Brandt, Piet A; Van Neste, Leander; Soetekouw, Patricia Mmb; Aarts, Maureen Jb; Baldewijns, Marcella Mll; Keszei, András P; Schouten, Leo J

    2017-04-01

    Sodium intake, but not potassium or fluid intake, has been associated with higher renal cell cancer (RCC) risk. However, risk factors may differ by molecular subtypes of the tumour. In renal physiology, electrolyte and water homeostasis is facilitated by ion transport mechanisms (ITM). Aberrant regulation of ITM genes, for example by promoter CpG island methylation, may modify associations between sodium, potassium and fluid intake and RCC risk. We identified ARHGDIG , ATP1A1 , SCNN1B and SLC8A3 as ITM genes exhibiting RCC-specific promoter methylation and down-regulation. Methylation-specific polymerase chain reaction (PCR) was used to analyse promoter CpG island methylation in tumour DNA of 453 RCC cases from the Netherlands Cohort Study ( n = 120 852) after 20.3 years of follow-up. Diet was measured at baseline using food-frequency questionnaires. Cox regression analyses were restricted to clear-cell (cc)RCC ( n = 306) and stratified by tumours with no, low (1 gene) and high (≥ 2 genes) methylation. Sodium intake (high vs low) increased ccRCC risk particularly in tumours with a high methylation index: hazard ratio (HR) [95% confidence interval (CI)]: 2.04 (1.16-3.58), whereas heterogeneity across the methylation index was not significant ( P -heterogeneity = 0.26). Potassium intake was differentially associated with ccRCC risk ( P -heterogeneity = 0.008); the risk for high (vs low) potassium intake was low for unmethylated tumours [HR (95% CI): 0.60 (0.36-1.01)], but high for tumours with a high methylation index [HR (95% CI): 1.60 (0.96-2.65)]. Risks similarly differed for fluid intake, though not significantly ( P -heterogeneity = 0.54). Our findings suggest for the first time that dietary intakes are differentially associated with ccRCC risk according to molecular subtypes defined by ITM gene-specific promoter methylation. © The Author 2016; all rights reserved. Published by Oxford University Press on behalf of the International Epidemiological Association

  17. Mechanistic insights into induction of vitellogenin gene expression by estrogens in Sydney rock oysters, Saccostrea glomerata.

    PubMed

    Tran, Thi Kim Anh; MacFarlane, Geoff R; Kong, Richard Yuen Chong; O'Connor, Wayne A; Yu, Richard Man Kit

    2016-05-01

    Marine molluscs, such as oysters, respond to estrogenic compounds with the induction of the egg yolk protein precursor, vitellogenin (Vtg), availing a biomarker for estrogenic pollution. Despite this application, the precise molecular mechanism through which estrogens exert their action to induce molluscan vitellogenesis is unknown. As a first step to address this question, we cloned a gene encoding Vtg from the Sydney rock oyster Saccostrea glomerata (sgVtg). Using primers designed from a partial sgVtg cDNA sequence available in Genbank, a full-length sgVtg cDNA of 8498bp was obtained by 5'- and 3'-RACE. The open reading frame (ORF) of sgVtg was determined to be 7980bp, which is substantially longer than the orthologs of other oyster species. Its deduced protein sequence shares the highest homology at the N- and C-terminal regions with other molluscan Vtgs. The full-length genomic DNA sequence of sgVtg was obtained by genomic PCR and genome walking targeting the gene body and flanking regions, respectively. The genomic sequence spans 20kb and consists of 30 exons and 29 introns. Computer analysis identified three closely spaced half-estrogen responsive elements (EREs) in the promoter region and a 210-bp CpG island 62bp downstream of the transcription start site. Upregulation of sgVtg mRNA expression was observed in the ovaries following in vitro (explants) and in vivo (tank) exposure to 17β-estradiol (E2). Notably, treatment with an estrogen receptor (ER) antagonist in vitro abolished the upregulation, suggesting a requirement for an estrogen-dependent receptor for transcriptional activation. DNA methylation of the 5' CpG island was analysed using bisulfite genomic sequencing of the in vivo exposed ovaries. The CpG island was found to be hypomethylated (with 0-3% methylcytosines) in both control and E2-exposed oysters. However, no significant differential methylation or any correlation between methylation and sgVtg expression levels was observed. Overall, the results support the possible involvement of an ERE-containing promoter and an estrogen-activated receptor in estrogen signalling in marine molluscs. Copyright © 2016 Elsevier B.V. All rights reserved.

  18. Genome-wide methylation analysis identifies a core set of hypermethylated genes in CIMP-H colorectal cancer.

    PubMed

    McInnes, Tyler; Zou, Donghui; Rao, Dasari S; Munro, Francesca M; Phillips, Vicky L; McCall, John L; Black, Michael A; Reeve, Anthony E; Guilford, Parry J

    2017-03-28

    Aberrant DNA methylation profiles are a characteristic of all known cancer types, epitomized by the CpG island methylator phenotype (CIMP) in colorectal cancer (CRC). Hypermethylation has been observed at CpG islands throughout the genome, but it is unclear which factors determine whether an individual island becomes methylated in cancer. DNA methylation in CRC was analysed using the Illumina HumanMethylation450K array. Differentially methylated loci were identified using Significance Analysis of Microarrays (SAM) and the Wilcoxon Signed Rank (WSR) test. Unsupervised hierarchical clustering was used to identify methylation subtypes in CRC. In this study we characterized the DNA methylation profiles of 94 CRC tissues and their matched normal counterparts. Consistent with previous studies, unsupervized hierarchical clustering of genome-wide methylation data identified three subtypes within the tumour samples, designated CIMP-H, CIMP-L and CIMP-N, that showed high, low and very low methylation levels, respectively. Differential methylation between normal and tumour samples was analysed at the individual CpG level, and at the gene level. The distribution of hypermethylation in CIMP-N tumours showed high inter-tumour variability and appeared to be highly stochastic in nature, whereas CIMP-H tumours exhibited consistent hypermethylation at a subset of genes, in addition to a highly variable background of hypermethylated genes. EYA4, TFPI2 and TLX1 were hypermethylated in more than 90% of all tumours examined. One-hundred thirty-two genes were hypermethylated in 100% of CIMP-H tumours studied and these were highly enriched for functions relating to skeletal system development (Bonferroni adjusted p value =2.88E-15), segment specification (adjusted p value =9.62E-11), embryonic development (adjusted p value =1.52E-04), mesoderm development (adjusted p value =1.14E-20), and ectoderm development (adjusted p value =7.94E-16). Our genome-wide characterization of DNA methylation in colorectal cancer has identified 132 genes hypermethylated in 100% of CIMP-H samples. Three genes, EYA4, TLX1 and TFPI2 are hypermethylated in >90% of all tumour samples, regardless of CIMP subtype.

  19. Epigenome-wide cross-tissue predictive modeling and comparison of cord blood and placental methylation in a birth cohort

    PubMed Central

    De Carli, Margherita M; Baccarelli, Andrea A; Trevisi, Letizia; Pantic, Ivan; Brennan, Kasey JM; Hacker, Michele R; Loudon, Holly; Brunst, Kelly J; Wright, Robert O; Wright, Rosalind J; Just, Allan C

    2017-01-01

    Aim: We compared predictive modeling approaches to estimate placental methylation using cord blood methylation. Materials & methods: We performed locus-specific methylation prediction using both linear regression and support vector machine models with 174 matched pairs of 450k arrays. Results: At most CpG sites, both approaches gave poor predictions in spite of a misleading improvement in array-wide correlation. CpG islands and gene promoters, but not enhancers, were the genomic contexts where the correlation between measured and predicted placental methylation levels achieved higher values. We provide a list of 714 sites where both models achieved an R2 ≥0.75. Conclusion: The present study indicates the need for caution in interpreting cross-tissue predictions. Few methylation sites can be predicted between cord blood and placenta. PMID:28234020

  20. Methylation Patterns of SOX3, SOX9, and WNT4 Genes in Gonads of Dogs with XX (SRY-Negative) Disorder of Sexual Development.

    PubMed

    Salamon, Sylwia; Flisikowski, Krzysztof; Switonski, Marek

    2017-01-01

    Ovotesticular or testicular disorder of sexual development in dogs with female karyotype and lack of SRY (XX DSD) is a common sexual anomaly diagnosed in numerous breeds. The molecular background, however, remains unclear, and epigenetic mechanisms, including DNA methylation, have not been studied. The aim of our study was comparative methylation analysis of CpG islands in promoters of candidate genes for XX DSD: SOX9, SOX3, and WNT4. Methylation studies were performed on DNA extracted from formalin-fixed/paraffin-embedded or frozen gonads from 2 dogs with ovotesticular and 2 dogs with testicular XX DSD as well as control females (n = 4) and males (n = 2). Bisulfite-converted DNA was used for CpG methylation analysis using quantitative pyrosequencing. Promoter regions of SOX9 and WNT4 showed similar CpG methylation in each group, ranging from 0 to 5.5% and from 39 to 74%, respectively. The SOX3 promoter showed significantly higher methylation in the ovotesticular XX DSD cases and the testicular XX DSD and control males, suggesting that SOX3 methylation may play a role in canine XX DSD pathogenesis. © 2017 S. Karger AG, Basel.

  1. Analysis of estrogen receptor β gene methylation in autistic males in a Chinese Han population.

    PubMed

    Wang, Xuelai; Liang, Shuang; Sun, Yi; Li, Haixin; Endo, Fumio; Nakao, Mitsuyoshi; Saitoh, Noriko; Wu, Lijie

    2017-08-01

    Autism spectrum disorder (ASD) is a neurodevelopment disorder with abnormalities of social interaction, communication and repetitive behaviors. The higher prevalence of ASD in men implies a potential relationship between sex hormones and ASD etiology. The ESR2 gene encodes estrogen receptor beta (ESR2) and plays an important role during brain development. A relationship between ESR2 and ASD has been suggested by studies on single nucleotide polymorphisms and mRNA and protein expression levels in ASD patients. Here, we explored the possible epigenetic regulation of the ESR2 gene in autism. We collected genomic DNA from the peripheral blood of Chinese Han males with autism and age-matched normal males and measured DNA methylation of CpG islands in the ESR2 gene, which consisted of 41 CpG sites among the proximal promoter region and an untranslated exon, by bisulfite sequencing. We also investigated a relationship between DNA methylation and phenotypic features of autism, as assessed by the Children Autism Rating Scale. We found little overall difference in the DNA methylation of the ESR2 5'-flanking region in individuals with autism compared with normal individuals. However, detailed analyses revealed that eight specific CpG sites were hypermethylated in autistic individuals and that four specific CpG sites were positively associated with the severity of autistic symptoms. Our study indicates that the epigenetic dysregulation of ESR2 may govern the development of autism.

  2. Tumors with unmethylated MLH1 and the CpG island methylator phenotype are associated with a poor prognosis in stage II colorectal cancer patients

    PubMed Central

    Fu, Tao; Liu, Yanliang; Li, Kai; Wan, Weiwei; Pappou, Emmanouil P.; Iacobuzio-Donahue, Christine A.; Kerner, Zachary; Baylin, Stephen B.; Wolfgang, Christopher L.; Ahuja, Nita

    2016-01-01

    We previously developed a novel tumor subtype classification model for duodenal adenocarcinomas based on a combination of the CpG island methylator phenotype (CIMP) and MLH1 methylation status. Here, we tested the prognostic value of this model in stage II colorectal cancer (CRC) patients. Tumors were assigned to CIMP+/MLH1-unmethylated (MLH1-U), CIMP+/MLH1-methylated (MLH1-M), CIMP−/MLH1-U, or CIMP−/MLH1-M groups. Age, tumor location, lymphovascular invasion, and mucin production differed among the four patient subgroups, and CIMP+/MLH1-U tumors were more likely to have lymphovascular invasion and mucin production. Kaplan-Meier analyses revealed differences in both disease-free survival (DFS) and overall survival (OS) among the four groups. In a multivariate analysis, CIMP/MLH1 methylation status was predictive of both DFS and OS, and DFS and OS were shortest in CIMP+/MLH1-U stage II CRC patients. These results suggest that tumor subtype classification based on the combination of CIMP and MLH1 methylation status is informative in stage II CRC patients, and that CIMP+/MLH1-U tumors exhibit aggressive features and are associated with poor clinical outcomes. PMID:27880934

  3. Tumors with unmethylated MLH1 and the CpG island methylator phenotype are associated with a poor prognosis in stage II colorectal cancer patients.

    PubMed

    Fu, Tao; Liu, Yanliang; Li, Kai; Wan, Weiwei; Pappou, Emmanouil P; Iacobuzio-Donahue, Christine A; Kerner, Zachary; Baylin, Stephen B; Wolfgang, Christopher L; Ahuja, Nita

    2016-12-27

    We previously developed a novel tumor subtype classification model for duodenal adenocarcinomas based on a combination of the CpG island methylator phenotype (CIMP) and MLH1 methylation status. Here, we tested the prognostic value of this model in stage II colorectal cancer (CRC) patients. Tumors were assigned to CIMP+/MLH1-unmethylated (MLH1-U), CIMP+/MLH1-methylated (MLH1-M), CIMP-/MLH1-U, or CIMP-/MLH1-M groups. Age, tumor location, lymphovascular invasion, and mucin production differed among the four patient subgroups, and CIMP+/MLH1-U tumors were more likely to have lymphovascular invasion and mucin production. Kaplan-Meier analyses revealed differences in both disease-free survival (DFS) and overall survival (OS) among the four groups. In a multivariate analysis, CIMP/MLH1 methylation status was predictive of both DFS and OS, and DFS and OS were shortest in CIMP+/MLH1-U stage II CRC patients. These results suggest that tumor subtype classification based on the combination of CIMP and MLH1 methylation status is informative in stage II CRC patients, and that CIMP+/MLH1-U tumors exhibit aggressive features and are associated with poor clinical outcomes.

  4. Epigenetic Regulation of Werner Syndrome Gene in Age-Related Cataract

    PubMed Central

    Guan, Huaijin

    2015-01-01

    Purpose. To examine the promoter methylation and histone modification of WRN (Werner syndrome gene), a DNA repair gene, and their relationship with the gene expression in age-related cataract (ARC) lens. Methods. We collected the lenses after cataract surgery from 117ARC patients and 39 age-matched non-ARC. WRN expression, DNA methylation and histone modification around the CpG island were assessed. The methylation status of Human-lens-epithelium cell (HLEB-3) was chemically altered to observe the relationship between methylation and expression of WRN. Results. The WRN expression was significantly decreased in the ARC anterior lens capsules comparing with the control. The CpG island of WRN promoter in the ARC anterior lens capsules displayed hypermethylation comparing with the controls. The WRN promoter was almost fully methylated in the cortex of ARC and control lens. Acetylated H3 was lower while methylated H3-K9 was higher in ARC anterior lens capsules than that of the controls. The expression of WRN in HLEB-3 increased after demethylation of the cells. Conclusions. A hypermethylation in WRN promoter and altered histone modification in anterior lens capsules might contribute to the ARC mechanism. The data suggest an association of altered DNA repair capability in lens with ARC pathogenesis. PMID:26509079

  5. Discovering high-resolution patterns of differential DNA methylation that correlate with gene expression changes

    PubMed Central

    VanderKraats, Nathan D.; Hiken, Jeffrey F.; Decker, Keith F.; Edwards, John R.

    2013-01-01

    Methylation of the CpG-rich region (CpG island) overlapping a gene’s promoter is a generally accepted mechanism for silencing expression. While recent technological advances have enabled measurement of DNA methylation and expression changes genome-wide, only modest correlations between differential methylation at gene promoters and expression have been found. We hypothesize that stronger associations are not observed because existing analysis methods oversimplify their representation of the data and do not capture the diversity of existing methylation patterns. Recently, other patterns such as CpG island shore methylation and long partially hypomethylated domains have also been linked with gene silencing. Here, we detail a new approach for discovering differential methylation patterns associated with expression change using genome-wide high-resolution methylation data: we represent differential methylation as an interpolated curve, or signature, and then identify groups of genes with similarly shaped signatures and corresponding expression changes. Our technique uncovers a diverse set of patterns that are conserved across embryonic stem cell and cancer data sets. Overall, we find strong associations between these methylation patterns and expression. We further show that an extension of our method also outperforms other approaches by generating a longer list of genes with higher quality associations between differential methylation and expression. PMID:23748561

  6. Pathogenesis and Management of Serrated Polyps: Current Status and Future Directions

    PubMed Central

    Anderson, Joseph C.

    2014-01-01

    Hyperplastic or serrated polyps were once believed to have little to no clinical significance. A subset of these polyps are now considered to be precursors to colorectal cancers (CRC) in the serrated pathway that may account for at least 15% of all tumors. The serrated pathway is distinct from the two other CRC pathways and involves an epigenetic hypermethylation mechanism of CpG islands within promoter regions of tumor suppressor genes. This process results in the formation of CpG island methylator phenotype tumors. Serrated polyps are divided into hyperplastic polyps, sessile serrated adenomas/polyps (SSA/Ps), and traditional serrated adenomas (TSAs). The SSA/P and the TSA have the potential for dysplasia and subsequent malignant transformation. The SSA/Ps are more common and are more likely to be flat than TSAs. Their flat morphology may make them difficult to detect and thus explain the variation in detection rates among endoscopists. Challenges for endoscopists also include the difficulty in pathological interpretation as well surveillance of these lesions. Furthermore, serrated polyps may be inadequately resected by endoscopists. Thus, it is not surprising that the serrated pathway has been linked with interval cancers. This review will provide the physician or clinician with the knowledge to manage patients with serrated polyps. PMID:25368744

  7. α-Synuclein Sequesters Dnmt1 from the Nucleus

    PubMed Central

    Desplats, Paula; Spencer, Brian; Coffee, Elizabeth; Patel, Pruthul; Michael, Sarah; Patrick, Christina; Adame, Anthony; Rockenstein, Edward; Masliah, Eliezer

    2011-01-01

    DNA methylation is a major epigenetic modification that regulates gene expression. Dnmt1, the maintenance DNA methylation enzyme, is abundantly expressed in the adult brain and is mainly located in the nuclear compartment, where it has access to chromatin. Hypomethylation of CpG islands at intron 1 of the SNCA gene has recently been reported to result in overexpression of α-synuclein in Parkinson disease (PD) and related disorders. We therefore investigated the mechanisms underlying altered DNA methylation in PD and dementia with Lewy bodies (DLB). We present evidence of reduction of nuclear Dnmt1 levels in human postmortem brain samples from PD and DLB patients as well as in the brains of α-synuclein transgenic mice models. Furthermore, sequestration of Dnmt1 in the cytoplasm results in global DNA hypomethylation in human and mouse brains, involving CpG islands upstream of SNCA, SEPW1, and PRKAR2A genes. We report that association of Dnmt1 and α-synuclein might mediate aberrant subcellular localization of Dnmt1. Nuclear Dnmt1 levels were partially rescued by overexpression of Dnmt1 in neuronal cell cultures and in α-synuclein transgenic mice brains. Our results underscore a novel mechanism for epigenetic dysregulation in Lewy body diseases, which might underlie the decrease in DNA methylation reported for PD and DLB. PMID:21296890

  8. Overexpression of hTERT increases stem-like properties and decreases spontaneous differentiation in human mesenchymal stem cell lines

    PubMed Central

    2010-01-01

    To overcome loss of stem-like properties and spontaneous differentiation those hinder the expansion and application of human mesenchymal stem cells (hMSCs), we have clonally isolated permanent and stable human MSC lines by ectopic overexpression of primary cell cultures of hMSCs with HPV 16 E6E7 and human telomerase reverse transcriptase (hTERT) genes. These cells were found to have a differentiation potential far beyond the ordinary hMSCs. They expressed trophoectoderm and germline specific markers upon differentiation with BMP4 and retinoic acid, respectively. Furthermore, they displayed higher osteogenic and neural differentiation efficiency than primary hMSCs or hMSCs expressed HPV16 E6E7 alone with a decrease in methylation level as proven by a global CpG island methylation profile analysis. Notably, the demethylated CpG islands were highly associated with development and differentiation associated genes. Principal component analysis further pointed out the expression profile of the cells converged toward embryonic stem cells. These data demonstrate these cells not only are a useful tool for the studies of cell differentiation both for the mesenchymal and neurogenic lineages, but also provide a valuable source of cells for cell therapy studies in animal models of skeletal and neurological disorders. PMID:20670406

  9. Glioma CpG island methylator phenotype (G-CIMP): biological and clinical implications.

    PubMed

    Malta, Tathiane M; de Souza, Camila F; Sabedot, Thais S; Silva, Tiago C; Mosella, Maritza S; Kalkanis, Steven N; Snyder, James; Castro, Ana Valeria B; Noushmehr, Houtan

    2018-04-09

    Gliomas are a heterogeneous group of brain tumors with distinct biological and clinical properties. Despite advances in surgical techniques and clinical regimens, treatment of high-grade glioma remains challenging and carries dismal rates of therapeutic success and overall survival. Challenges include the molecular complexity of gliomas, as well as inconsistencies in histopathological grading, resulting in an inaccurate prediction of disease progression and failure in the use of standard therapy. The updated 2016 World Health Organization (WHO) classification of tumors of the central nervous system reflects a refinement of tumor diagnostics by integrating the genotypic and phenotypic features, thereby narrowing the defined subgroups. The new classification recommends molecular diagnosis of isocitrate dehydrogenase (IDH) mutational status in gliomas. IDH-mutant gliomas manifest the cytosine-phosphate-guanine (CpG) island methylator phenotype (G-CIMP). Notably, the recent identification of clinically relevant subsets of G-CIMP tumors (G-CIMP-high and G-CIMP-low) provides a further refinement in glioma classification that is independent of grade and histology. This scheme may be useful for predicting patient outcome and may be translated into effective therapeutic strategies tailored to each patient. In this review, we highlight the evolution of our understanding of the G-CIMP subsets and how recent advances in characterizing the genome and epigenome of gliomas may influence future basic and translational research.

  10. Epigenetics and Breast Cancers

    PubMed Central

    Vo, An T.; Millis, Richard M.

    2012-01-01

    Several of the active compounds in foods, poisons, drugs, and industrial chemicals may, by epigenetic mechanisms, increase or decrease the risk of breast cancers. Enzymes that are involved in DNA methylation and histone modifications have been shown to be altered in several types of breast and other cancers resulting in abnormal patterns of methylation and/or acetylation. Hypermethylation at the CpG islands found in estrogen response element (ERE) promoters occurs in conjunction with ligand-bonded alpha subunit estrogen receptor (Erα) dimers wherein the ligand ERα dimer complex acts as a transcription factor and binds to the ERE promoter. Ligands could be 17-β-estradiol (E2), phytoestrogens, heterocyclic amines, and many other identified food additives and heavy metals. The dimer recruits DNA methyltransferases which catalyze the transfer of methyl groups from S-adenosyl-L-methionine (SAM) to 5′-cytosine on CpG islands. Other enzymes are recruited to the region by ligand-ERα dimers which activate DNA demethylases to act simultaneously to increase gene expression of protooncogenes and growth-promoting genes. Ligand-ERα dimers also recruit histone acetyltransferase to the ERE promoter region. Histone demethylases such as JMJD2B and histone methyltransferases are enzymes which demethylate lysine residues on histones H3 and/or H4. This makes the chromatin accessible for transcription factors and enzymes. PMID:22567014

  11. Association between promoter hypermethylation of the DACT2 gene and tumor stages in breast cancer.

    PubMed

    Marusa Borgonio-Cuadra, Veronica; Miranda-Duarte, Antonio; Rojas-Toledo, Xochitl; Garcia-Hernandez, Normand; Alfredo Sierra-Ramirez, Jose; Cardenas-Garcia, Maura; Elena Hernandez-Caballero, Marta

    2018-01-01

    Aberrant methylation of CpG islands in the promoter is a hallmark of cancer, leading to transcriptional silencing of tumor suppressor genes. The aim of this work was to evaluate the promoter methylation status of the DACT2 gene in breast cancer (BC) tissue and to analyze its possible effect on tumor type or grade. CpG island from the DACT2 promoter in region -240 to -14 from transcriptional start site (TSS) were obtained. Through the use of sodium bisulfite DNA conversion analysis, followed by detection with MSP (methylation specific PCR), we analyzed 79 BC and 15 adjacent healthy samples. T he c ases a nalyzed w ere i n s tage I ( 2.5%), I I (38%), or III (59.5%). The most frequent tumor type was invasive ductal carcinoma (71.4%). Methylation analysis comparing tumor tissues with adjacent non-cancerous tissues showed statistical significance. Methylation was observed in 32.9% (26/79) of the samples; no methylation was found in adjacent healthy tissue. DACT2 methylation was associated with tumor stage I-II (p=0.03) and stage III (p=0.004). An association was found of DACT2 promoter methylation with advanced tumor stages. This gene has been suggested as a potential biomarker, however, more investigation is required to validate this function.

  12. Methylation Status of the Follistatin Gene at Different Development Stages of Japanese Flounder (Paralichthys olivaceus)

    NASA Astrophysics Data System (ADS)

    Huang, Yajuan; Hu, Nan; Si, Yufeng; Li, Siping; Wu, Shuxian; Zhang, Meizhao; Wen, Haishen; Li, Jifang; Li, Yun; He, Feng

    2018-06-01

    Follistatin (Fst) is a hyperplasia factor that plays a crucial role in muscle development. DNA methylation, a significant process, regulates gene expression. The aim of our study is to examine the DNA methylation and expression patterns of Fst gene at five different development stages of Japanese flounder (stage A, 7 dph; stage B, 90 dph; stage C, about 180 dph; stage D, about 24 months; stage E, about 36 months). The muscle tissue of Japanese flounder was obtained at different development stages in this experiment. DNA methylation levels in the promoter and exon 2 of Fst were determined by bisulfite sequencing, and the relative expression of the Fst gene at the five stages was measured by quantitative PCR. The results showed that the lowest methylation level was at stage A and the highest methylation level was at stage B. Moreover, the highest expression level of the Fst gene was observed at stage A. The mRNA abundance was negatively correlated with DNA methylation level. Three CpG islands in the promoter region and three CpG islands in exon 2 of Fst were found in the binding sequence of the putative transcription factor. These results offered a theoretical basis for the mechanism of Fst gene regulation to muscle development at different development stages.

  13. Integrated Multiregional Analysis Proposing a New Model of Colorectal Cancer Evolution.

    PubMed

    Uchi, Ryutaro; Takahashi, Yusuke; Niida, Atsushi; Shimamura, Teppei; Hirata, Hidenari; Sugimachi, Keishi; Sawada, Genta; Iwaya, Takeshi; Kurashige, Junji; Shinden, Yoshiaki; Iguchi, Tomohiro; Eguchi, Hidetoshi; Chiba, Kenichi; Shiraishi, Yuichi; Nagae, Genta; Yoshida, Kenichi; Nagata, Yasunobu; Haeno, Hiroshi; Yamamoto, Hirofumi; Ishii, Hideshi; Doki, Yuichiro; Iinuma, Hisae; Sasaki, Shin; Nagayama, Satoshi; Yamada, Kazutaka; Yachida, Shinichi; Kato, Mamoru; Shibata, Tatsuhiro; Oki, Eiji; Saeki, Hiroshi; Shirabe, Ken; Oda, Yoshinao; Maehara, Yoshihiko; Komune, Shizuo; Mori, Masaki; Suzuki, Yutaka; Yamamoto, Ken; Aburatani, Hiroyuki; Ogawa, Seishi; Miyano, Satoru; Mimori, Koshi

    2016-02-01

    Understanding intratumor heterogeneity is clinically important because it could cause therapeutic failure by fostering evolutionary adaptation. To this end, we profiled the genome and epigenome in multiple regions within each of nine colorectal tumors. Extensive intertumor heterogeneity is observed, from which we inferred the evolutionary history of the tumors. First, clonally shared alterations appeared, in which C>T transitions at CpG site and CpG island hypermethylation were relatively enriched. Correlation between mutation counts and patients' ages suggests that the early-acquired alterations resulted from aging. In the late phase, a parental clone was branched into numerous subclones. Known driver alterations were observed frequently in the early-acquired alterations, but rarely in the late-acquired alterations. Consistently, our computational simulation of the branching evolution suggests that extensive intratumor heterogeneity could be generated by neutral evolution. Collectively, we propose a new model of colorectal cancer evolution, which is useful for understanding and confronting this heterogeneous disease.

  14. Homozygous deletions at 3p12 in breast and lung cancer.

    PubMed

    Sundaresan, V; Chung, G; Heppell-Parton, A; Xiong, J; Grundy, C; Roberts, I; James, L; Cahn, A; Bench, A; Douglas, J; Minna, J; Sekido, Y; Lerman, M; Latif, F; Bergh, J; Li, H; Lowe, N; Ogilvie, D; Rabbitts, P

    1998-10-01

    We have constructed a physical map of the region homozygously deleted in the U2020 cell line at 3p12, including the location of putative CpG islands. Adjacent to one of these islands, we have identified and cloned a new gene (DUTT1) and used probes from this gene to detect two other homozygous deletions occurring in lung and breast carcinomas: the smallest deletion is within the gene itself and would result in a truncated protein. The DUTT1 gene is a member of the neural cell adhesion molecule family, although its widespread expression suggests it plays a less specialized role compared to other members of the family.

  15. DNA methylation of the BRD2 promoter is associated with juvenile myoclonic epilepsy in Caucasians.

    PubMed

    Pathak, Shilpa; Miller, James; Morris, Emily C; Stewart, William C L; Greenberg, David A

    2018-05-01

    Juvenile myoclonic epilepsy (JME) is a common adolescent-onset genetic generalized epilepsy (GGE) syndrome. Multiple linkage and association studies have found that BRD2 influences the expression of JME. The BRD2-JME connection is further corroborated by our murine model; Brd2 haploinsufficiency produces characteristics that typify the clinical hallmarks of JME. Neither we, nor several large-scale studies of JME, found JME-related BRD2 coding mutations. Therefore, we investigated noncoding BRD2 regions, seeking the origin of BRD2's JME influence. BRD2's promoter harbors a JME-associated single nucleotide polymorphism (rs3918149) and a CpG (C-phosphate-G dinucleotides) island (CpG76), making it a potential "hotspot" for JME-associated epigenetic variants. Methylating promoter CpG sites causes gene silencing, often resulting in reduced gene expression. We tested for differences in DNA methylation at CpG76 in 3 different subgroups: (1) JME patients versus their unaffected family members, (2) JME versus patients with other forms of GGE, and (3) Caucasian versus non-Caucasian JME patients. We used DNA pyrosequencing to analyze the methylation status of 10 BRD2 promoter CpG sites in lymphoblastoid cells from JME patients of Caucasian and non-Caucasian origin, unaffected family members, and also non-JME GGE patients. We also measured global methylation levels and DNA methyl transferase 1 (DNMT1) transcript expression in JME families by standard methods. CpG76 is highly methylated in JME patients compared to unaffected family members. In families with non-JME GGE, we found no relationship between promoter methylation and epilepsy. In non-Caucasian JME families, promoter methylation was mostly not associated with epilepsy. This makes the BRD2 promoter a JME-specific, ethnicity-specific, differentially methylated region. Global methylation was constant across groups. BRD2 promoter methylation in JME, and the lack of methylation in unaffected relatives, in non-JME GGE patients, and in non-Caucasian JME, demonstrate that methylation specificity is a possible seizure susceptibility motif in JME risk and suggests JME therapeutics targeting BRD2. Wiley Periodicals, Inc. © 2018 International League Against Epilepsy.

  16. New Approaches for Prostate Cancer Combination Therapy

    DTIC Science & Technology

    2009-04-01

    promoter methylation have been frequently observed in several types of human cancer (60, 61). In conclusion, the ability of NSAIDs to induce apoptosis...drug. Clin Pharmacokinet 1999; 36:115–26. 31. Yin MJ, Yamamoto Y, Gaynor RB. The anti- inflammatory agents aspirin and salicylate inhibit the activity...expression of the growth inhibitory gene GADD45g, in human pituitary adenomas, is asso- ciated with CpG island methylation . Oncogene 2004;23: 936–44. 61

  17. Conserved DNA methylation patterns in healthy blood cells and extensive changes in leukemia measured by a new quantitative technique

    PubMed Central

    Jelinek, Jaroslav; Liang, Shoudan; Lu, Yue; He, Rong; Ramagli, Louis S.; Shpall, Elizabeth J.; Estecio, Marcos R.H.; Issa, Jean-Pierre J.

    2012-01-01

    Genome wide analysis of DNA methylation provides important information in a variety of diseases, including cancer. Here, we describe a simple method, Digital Restriction Enzyme Analysis of Methylation (DREAM), based on next generation sequencing analysis of methylation-specific signatures created by sequential digestion of genomic DNA with SmaI and XmaI enzymes. DREAM provides information on 150,000 unique CpG sites, of which 39,000 are in CpG islands and 30,000 are at transcription start sites of 13,000 RefSeq genes. We analyzed DNA methylation in healthy white blood cells and found methylation patterns to be remarkably uniform. Inter individual differences > 30% were observed only at 227 of 28,331 (0.8%) of autosomal CpG sites. Similarly, > 30% differences were observed at only 59 sites when we comparing the cord and adult blood. These conserved methylation patterns contrasted with extensive changes affecting 18–40% of CpG sites in a patient with acute myeloid leukemia and in two leukemia cell lines. The method is cost effective, quantitative (r2 = 0.93 when compared with bisulfite pyrosequencing) and reproducible (r2 = 0.997). Using 100-fold coverage, DREAM can detect differences in methylation greater than 10% or 30% with a false positive rate below 0.05 or 0.001, respectively. DREAM can be useful in quantifying epigenetic effects of environment and nutrition, correlating developmental epigenetic variation with phenotypes, understanding epigenetics of cancer and chronic diseases, measuring the effects of drugs on DNA methylation or deriving new biological insights into mammalian genomes. PMID:23075513

  18. Western environment/lifestyle is associated with increased genome methylation and decreased gene expression in Chinese immigrants living in Australia.

    PubMed

    Zhang, Guicheng; Wang, Kui; Schultz, Ennee; Khoo, Siew-Kim; Zhang, Xiaopeng; Annamalay, Alicia; Laing, Ingrid A; Hales, Belinda J; Goldblatt, Jack; Le Souëf, Peter N

    2016-01-01

    Several human diseases and conditions are disproportionally distributed in the world with a significant "Western-developed" vs. "Eastern-developing" gradient. We compared genome-wide DNA methylation of peripheral blood mononuclear cells in 25 newly arrived Chinese immigrants living in a Western environment for less than 6 months ("Newly arrived") with 23 Chinese immigrants living in the Western environment for more than two years ("Long-term") with a mean of 8.7 years, using the Infinium HumanMethylation450 BeadChip. In a sub-group of both subject groups (n = 12 each) we also investigated genome-wide gene expression using a Human HT-12 v4 expression beadChip. There were 62.5% probes among the total number of 382,250 valid CpG sites with greater mean Beta (β) in "Long-term" than in "Newly arrived". In the regions of CpG islands and gene promoters, compared with the CpG sites in all other regions, lower percentages of CpG sites with mean methylation levels in "Long-term" greater than "Newly arrived" were observed, but still >50%. The increase of methylation was associated with a general decrease of gene expression in Chinese immigrants living in the Western environment for a longer period of time. After adjusting for age, gender and other confounding factors the findings remained. Chinese immigrants living in Australia for a longer period of time have increased overall genome methylation and decreased overall gene expression compared with newly arrived immigrants. © 2015 Wiley Periodicals, Inc.

  19. Hypermethylation of MST1 in IgG4-related autoimmune pancreatitis and rheumatoid arthritis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fukuhara, Takataro; Tomiyama, Takashi; Yasuda, Kaneki

    The serine/threonine kinase Mst1 plays important roles in the control of immune cell trafficking, proliferation, and differentiation. Previously, we reported that Mst1 was required for thymocyte selection and regulatory T-cell functions, thereby the prevention of autoimmunity in mice. In humans, MST1 null mutations cause T-cell immunodeficiency and hypergammaglobulinemia with autoantibody production. RASSF5C(RAPL) is an activator of MST1 and it is frequently methylated in some tumors. Herein, we investigated methylation of the promoter regions of MST1 and RASSF5C(RAPL) in leukocytes from patients with IgG4-related autoimmune pancreatitis (AIP) and rheumatoid arthritis (RA). Increased number of CpG methylation in the 5′ region ofmore » MST1 was detected in AIP patients with extrapancreatic lesions, whereas AIP patients without extrapancreatic lesions were similar to controls. In RA patients, we detected a slight increased CpG methylation in MST1, although the overall number of methylation sites was lower than that of AIP patients with extrapancreatic lesions. There were no significant changes of the methylation levels of the CpG islands in the 5′ region of RASSF5C(RAPL) in leukocytes from AIP and RA patients. Consistently, we found a significantly down-regulated expression of MST1 in regulatory T cells of AIP patients. Our results suggest that the decreased expression of MST1 in regulatory T cells due to hypermethylation of the promoter contributes to the pathogenesis of IgG4-related AIP. - Highlights: • Mst1 controls immune cells trafficking, cell proliferation and differentiation. • Autoimmune pancreatitis (AIP) is an idiopathic pancreatitis affecting multiple organs. • Decreased MST1 expression and increased CpG methylation of promoter of MST1 in AIP. • Slight increased CpG methylation of MST1 in rheumatoid arthritis patients. • MST1 contributes pathogenesis of IgG4-related AIP.« less

  20. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Palsamy, Periyasamy; Ayaki, Masahiko; Elanchezhian, Rajan

    Highlights: Black-Right-Pointing-Pointer We found significant Keap1 promoter demethylation in diabetic cataractous lenses. Black-Right-Pointing-Pointer Demethylation of Keap1 gene upregulated the expression of Keap1 mRNA and protein. Black-Right-Pointing-Pointer Elevated levels of Keap1 are known to decrease the levels of Nrf2. Black-Right-Pointing-Pointer Thereby, the levels of antioxidant enzymes are suppressed by decreased Nrf2 level. -- Abstract: Age-related cataracts (ARCs) are the major cause of visual impairments worldwide, and diabetic adults tend to have an earlier onset of ARCs. Although age is the strongest risk factor for cataracts, little is known how age plays a role in the development of ARCs. It is knownmore » that oxidative stress in the lens increases with age and more so in the lenses of diabetics. One of the central adaptive responses against the oxidative stresses is the activation of the nuclear transcriptional factor, NF-E2-related factor 2 (Nrf2), which then activates more than 20 different antioxidative enzymes. Kelch-like ECH associated protein 1 (Keap1) targets and binds to Nrf2 for proteosomal degradation. We hypothesized that hyperglycemia will lead to a dysfunction of the Nrf2-dependent antioxidative protection in the lens of diabetics. We studied the methylation status of the CpG islands in 15 clear and 21 diabetic cataractous lenses. Our results showed significant levels of demethylated DNA in the Keap1 promoter in the cataractous lenses from diabetic patients. In contrast, highly methylated DNA was found in the clear lens and tumorized human lens epithelial cell (HLEC) lines (SRA01/04). HLECs treated with a demethylation agent, 5-aza-2 Prime deoxycytidine (5-Aza), had a 10-fold higher levels of Keap1 mRNA, 3-fold increased levels of Keap1 protein, produced higher levels of ROS, and increased cell death. Our results indicated that demethylation of the CpG islands in the Keap1 promoter will activate the expression of Keap1 protein, which then increases the targeting of Nrf2 for proteosomal degradation. Decreased Nrf2 activity represses the transcription of many antioxidant enzyme genes and alters the redox-balance towards lens oxidation. Thus, the failure of antioxidant protection due to demethylation of the CpG islands in the Keap1 promoter is linked to the diabetic cataracts and possibly ARCs.« less

  1. Phase II study of nab-paclitaxel in refractory small bowel adenocarcinoma and CpG island methylator phenotype (CIMP)-high colorectal cancer.

    PubMed

    Overman, M J; Adam, L; Raghav, K; Wang, J; Kee, B; Fogelman, D; Eng, C; Vilar, E; Shroff, R; Dasari, A; Wolff, R; Morris, J; Karunasena, E; Pisanic, R; Azad, N; Kopetz, S

    2018-01-01

    Hypermethylation of promoter CpG islands [CpG island methylator phenotype (CIMP)] represents a unique pathway for the development of colorectal cancer (CRC), characterized by lack of chromosomal instability and a low rate of adenomatous polyposis coli (APC) mutations, which have both been correlated with taxane resistance. Similarly, small bowel adenocarcinoma (SBA), a rare tumor, also has a low rate of APC mutations. This phase II study evaluated taxane sensitivity in SBA and CIMP-high CRC. The primary objective was Response Evaluation Criteria in Solid Tumors version 1.1 response rate. Eligibility included Eastern Cooperative Oncology Group performance status 0/1, refractory disease, and SBA or CIMP-high metastatic CRC. Nab-paclitaxel was initially administered at a dose of 260 mg/m2 every 3 weeks but was reduced to 220 mg/m2 owing to toxicity. A total of 21 patients with CIMP-high CRC and 13 with SBA were enrolled from November 2012 to October 2014. The efficacy-assessable population (patients who received at least three doses of the treatment) comprised 15 CIMP-high CRC patients and 10 SBA patients. Common grade 3 or 4 toxicities were fatigue (12%), neutropenia (9%), febrile neutropenia (9%), dehydration (6%), and thrombocytopenia (6%). No responses were seen in the CIMP-high CRC cohort and two partial responses were seen in the SBA cohort. Median progression-free survival was significantly greater in the SBA cohort than in the CIMP-high CRC cohort (3.2 months compared with 2.1 months, P = 0.03). Neither APC mutation status nor CHFR methylation status correlated with efficacy in the CIMP-high CRC cohort. In vivo testing of paclitaxel in an SBA patient-derived xenograft validated the activity of taxanes in this disease type. Although preclinical studies suggested taxane sensitivity was associated with chromosomal stability and wild-type APC, we found that nab-paclitaxel was inactive in CIMP-high metastatic CRC. Nab-paclitaxel may represent a novel therapeutic option for SBA. © The Author 2017. Published by Oxford University Press on behalf of the European Society for Medical Oncology. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  2. Sequential DNA methylation changes are associated with DNMT3B overexpression in colorectal neoplastic progression.

    PubMed

    Ibrahim, Ashraf E K; Arends, Mark J; Silva, Ana-Luisa; Wyllie, Andrew H; Greger, Liliana; Ito, Yoko; Vowler, Sarah L; Huang, Tim H-M; Tavaré, Simon; Murrell, Adele; Brenton, James D

    2011-04-01

    Although aberrant methylation of key genes in the progression of colorectal neoplasia has been reported, no model-based analysis of the incremental changes through the intermediate adenoma stage has been described. In addition, the biological drivers for these methylation changes have yet to be defined. Linear mixed-effects modelling was used in this study to understand the onset and patterns of the methylation changes of SFRP2, IGF2 DMR0, H19, LINE-1 and a CpG island methylator phenotype (CIMP) marker panel, and they were correlated with DNA methyltransferase 3B (DNMT3B) levels of expression in a sample set representative of colorectal neoplastic progression. Methylation of the above CpG islands was measured using quantitative pyrosequencing assays in 261 tissue samples. This included a prospective collection of 44 colectomy specimens with concurrent normal mucosa, adenoma and invasive cancer tissues. Tissue microarrays from a subset of 64 cases were used for immunohistochemical analysis of DNMT3B expression. It is shown that the onset and pattern of methylation changes during colorectal neoplastic progression are locus dependent. The CIMP marker RUNX3 was the earliest CpG island showing significant change, followed by the CIMP markers NEUROG1 and CACNA1G at the hyperplastic polyp stage. SFRP2 and IGF2 DMR0 showed significant methylation changes at the adenomatous polyp stage, followed by the CIMP markers CDKN2A and hMLH1 at the adenocarcinoma stage. DNMT3B levels of immunohistochemical expression increased significantly (p < 0.001) from normal to hyperplastic and from adenomatous polyps to carcinoma samples. DNMT3B expression correlated positively with SFRP2 methylation (r = 0.42, p < 0.001, 95% CI 0.25 to 0.56), but correlated negatively with IGF2 DMR0 methylation (r = 0.26, p = 0.01, 95% CI -0.45 to -0.05). A subset of the CIMP panel (NEUROG1, CACNA1G and CDKN2A) positively correlated with DNMT3B levels of expression (p < 0.05). Hierarchical epigenetic alterations occur at transition points during colorectal neoplastic progression. These cumulative changes are closely correlated with a gain of DNMT3B expression, suggesting a causal relationship.

  3. Factors affecting the persistence of drug-induced reprogramming of the cancer methylome

    PubMed Central

    Bell, Joshua S. K.; Kagey, Jacob D.; Barwick, Benjamin G.; Dwivedi, Bhakti; McCabe, Michael T.; Kowalski, Jeanne; Vertino, Paula M.

    2016-01-01

    ABSTRACT Aberrant DNA methylation is a critical feature of cancer. Epigenetic therapy seeks to reverse these changes to restore normal gene expression. DNA demethylating agents, including 5-aza-2′-deoxycytidine (DAC), are currently used to treat certain leukemias, and can sensitize solid tumors to chemotherapy and immunotherapy. However, it has been difficult to pin the clinical efficacy of these agents to specific demethylation events, and the factors that contribute to the durability of response remain largely unknown. Here we examined the genome-wide kinetics of DAC-induced DNA demethylation and subsequent remethylation after drug withdrawal in breast cancer cells. We find that CpGs differ in both their susceptibility to demethylation and propensity for remethylation after drug removal. DAC-induced demethylation was most apparent at CpGs with higher initial methylation levels and further from CpG islands. Once demethylated, such sites exhibited varied remethylation potentials. The most rapidly remethylating CpGs regained >75% of their starting methylation within a month of drug withdrawal. These sites had higher pretreatment methylation levels, were enriched in gene bodies, marked by H3K36me3, and tended to be methylated in normal breast cells. In contrast, a more resistant class of CpG sites failed to regain even 20% of their initial methylation after 3 months. These sites had lower pretreatment methylation levels, were within or near CpG islands, marked by H3K79me2 or H3K4me2/3, and were overrepresented in sites that become aberrantly hypermethylated in breast cancers. Thus, whereas DAC-induced demethylation affects both endogenous and aberrantly methylated sites, tumor-specific hypermethylation is more slowly regained, even as normal methylation promptly recovers. Taken together, these data suggest that the durability of DAC response is linked to its selective ability to stably reset at least a portion of the cancer methylome. PMID:27082926

  4. Comparison of CpG island methylator phenotype (CIMP) frequency in colon cancer using different probe- and gene-specific scoring alternatives on recommended multi-gene panels.

    PubMed

    Berg, Marianne; Hagland, Hanne R; Søreide, Kjetil

    2014-01-01

    In colorectal cancer a distinct subgroup of tumours demonstrate the CpG island methylator phenotype (CIMP). However, a consensus of how to score CIMP is not reached, and variation in definition may influence the reported CIMP prevalence in tumours. Thus, we sought to compare currently suggested definitions and cut-offs for methylation markers and how they influence CIMP classification in colon cancer. Methylation-specific multiplex ligation-dependent probe amplification (MS-MLPA), with subsequent fragment analysis, was used to investigate methylation of tumour samples. In total, 31 CpG sites, located in 8 different genes (RUNX3, MLH1, NEUROG1, CDKN2A, IGF2, CRABP1, SOCS1 and CACNA1G) were investigated in 64 distinct colon cancers and 2 colon cancer cell lines. The Ogino gene panel includes all 8 genes, in addition to the Weisenberger panel of which only 5 of the 8 genes included were investigated. In total, 18 alternative combinations of scoring of CIMP positivity on probe-, gene-, and panel-level were analysed and compared. For 47 samples (71%), the CIMP status was constant and independent of criteria used for scoring; 34 samples were constantly scored as CIMP negative, and 13 (20%) consistently scored as CIMP positive. Only four of 31 probes (13%) investigated showed no difference in the numbers of positive samples using the different cut-offs. Within the panels a trend was observed that increasing the gene-level stringency resulted in a larger difference in CIMP positive samples than increasing the probe-level stringency. A significant difference between positive samples using 'the most stringent' as compared to 'the least stringent' criteria (20% vs 46%, respectively; p<0.005) was demonstrated. A statistical significant variation in the frequency of CIMP depending on the cut-offs and genes included in a panel was found, with twice as many positives samples by least compared to most stringent definition used.

  5. MGMT methylation analysis of glioblastoma on the Infinium methylation BeadChip identifies two distinct CpG regions associated with gene silencing and outcome, yielding a prediction model for comparisons across datasets, tumor grades, and CIMP-status.

    PubMed

    Bady, Pierre; Sciuscio, Davide; Diserens, Annie-Claire; Bloch, Jocelyne; van den Bent, Martin J; Marosi, Christine; Dietrich, Pierre-Yves; Weller, Michael; Mariani, Luigi; Heppner, Frank L; Mcdonald, David R; Lacombe, Denis; Stupp, Roger; Delorenzi, Mauro; Hegi, Monika E

    2012-10-01

    The methylation status of the O(6)-methylguanine-DNA methyltransferase (MGMT) gene is an important predictive biomarker for benefit from alkylating agent therapy in glioblastoma. Recent studies in anaplastic glioma suggest a prognostic value for MGMT methylation. Investigation of pathogenetic and epigenetic features of this intriguingly distinct behavior requires accurate MGMT classification to assess high throughput molecular databases. Promoter methylation-mediated gene silencing is strongly dependent on the location of the methylated CpGs, complicating classification. Using the HumanMethylation450 (HM-450K) BeadChip interrogating 176 CpGs annotated for the MGMT gene, with 14 located in the promoter, two distinct regions in the CpG island of the promoter were identified with high importance for gene silencing and outcome prediction. A logistic regression model (MGMT-STP27) comprising probes cg12434587 [corrected] and cg12981137 provided good classification properties and prognostic value (kappa = 0.85; log-rank p < 0.001) using a training-set of 63 glioblastomas from homogenously treated patients, for whom MGMT methylation was previously shown to be predictive for outcome based on classification by methylation-specific PCR. MGMT-STP27 was successfully validated in an independent cohort of chemo-radiotherapy-treated glioblastoma patients (n = 50; kappa = 0.88; outcome, log-rank p < 0.001). Lower prevalence of MGMT methylation among CpG island methylator phenotype (CIMP) positive tumors was found in glioblastomas from The Cancer Genome Atlas than in low grade and anaplastic glioma cohorts, while in CIMP-negative gliomas MGMT was classified as methylated in approximately 50 % regardless of tumor grade. The proposed MGMT-STP27 prediction model allows mining of datasets derived on the HM-450K or HM-27K BeadChip to explore effects of distinct epigenetic context of MGMT methylation suspected to modulate treatment resistance in different tumor types.

  6. Allele-Specific, Age-Dependent and BMI-Associated DNA Methylation of Human MCHR1

    PubMed Central

    Stepanow, Stefanie; Reichwald, Kathrin; Huse, Klaus; Gausmann, Ulrike; Nebel, Almut; Rosenstiel, Philip; Wabitsch, Martin; Fischer-Posovszky, Pamela; Platzer, Matthias

    2011-01-01

    Background Melanin-concentrating hormone receptor 1 (MCHR1) plays a significant role in regulation of energy balance, food intake, physical activity and body weight in humans and rodents. Several association studies for human obesity showed contrary results concerning the SNPs rs133072 (G/A) and rs133073 (T/C), which localize to the first exon of MCHR1. The variations constitute two main haplotypes (GT, AC). Both SNPs affect CpG dinucleotides, whereby each haplotype contains a potential methylation site at one of the two SNP positions. In addition, 15 CpGs in close vicinity of these SNPs constitute a weak CpG island. Here, we studied whether DNA methylation in this sequence context may contribute to population- and age-specific effects of MCHR1 alleles in obesity. Principal Findings We analyzed DNA methylation of a 315 bp region of MCHR1 encompassing rs133072 and rs133073 and the CpG island in blood samples of 49 individuals by bisulfite sequencing. The AC haplotype shows a significantly higher methylation level than the GT haplotype. This allele-specific methylation is age-dependent. In young individuals (20–30 years) the difference in DNA methylation between haplotypes is significant; whereas in individuals older than 60 years it is not detectable. Interestingly, the GT allele shows a decrease in methylation status with increasing BMI, whereas the methylation of the AC allele is not associated with this phenotype. Heterozygous lymphoblastoid cell lines show the same pattern of allele-specific DNA methylation. The cell line, which exhibits the highest difference in methylation levels between both haplotypes, also shows allele-specific transcription of MCHR1, which can be abolished by treatment with the DNA methylase inhibitor 5-aza-2′-deoxycytidine. Conclusions We show that DNA methylation at MCHR1 is allele-specific, age-dependent, BMI-associated and affects transcription. Conceivably, this epigenetic regulation contributes to the age- and/or population specific effects reported for MCHR1 in several human obesity studies. PMID:21637341

  7. Regulation of the ITGA2 gene by epigenetic mechanisms in prostate cancer.

    PubMed

    Chin, Suyin Paulynn; Marthick, James R; West, Alison C; Short, Annabel K; Chuckowree, Jyoti; Polanowski, Andrea M; Thomson, Russell J; Holloway, Adele F; Dickinson, Joanne L

    2015-05-01

    Integrin alpha2 beta1 (α2 β1 ) plays an integral role in tumour cell invasion, metastasis and angiogenesis, and altered expression of the receptor has been linked to tumour prognosis in several solid tumours. However, the relationship is complex, with both increased and decreased expression associated with different stages of tumour metastases in several tumour types. The ITGA2 gene, which codes for the α2 subunit, was examined to investigate whether a large CpG island associated with its promoter region is involved in the differential expression of ITGA2 observed in prostate cancer. Bisulphite sequencing of the ITGA2 promoter was used to assess methylation in formalin-fixed paraffin-embedded (FFPE) prostate tumour specimens and prostate cancer cell lines, PC3, 22Rv1 and LNCaP. Changes in ITGA2 mRNA expression were measured using quantitative PCR. ITGA2 functionality was interrogated using cell migration scratch assays and siRNA knockdown experiments. Bisulphite sequencing revealed strikingly decreased methylation at key CpG sites within the promoter of tumour samples, when compared with normal prostate tissue. Altered methylation of this CpG island is also associated with differences in expression in the non-invasive LNCaP, and the highly metastatic PC3 and 22Rv1 prostate cancer cell lines. Further bisulphite sequencing confirmed that selected CpGs were highly methylated in LNCaP cells, whilst only low levels of methylation were observed in PC3 and 22Rv1 cells, correlating with ITGA2 transcript levels. Examination of the increased expression of ITGA2 was shown to influence migratory potential via scratch assay in PC3, 22Rv1 and LNCaP cells, and was confirmed by siRNA knockdown experiments. Taken together, our data supports the assertion that epigenetic modification of the ITGA2 promoter is a mechanism by which ITGA2 expression is regulated. © 2015 Wiley Periodicals, Inc.

  8. Inhibition of mutant IDH1 decreases D-2-HG levels without affecting tumorigenic properties of chondrosarcoma cell lines.

    PubMed

    Suijker, Johnny; Oosting, Jan; Koornneef, Annemarie; Struys, Eduard A; Salomons, Gajja S; Schaap, Frank G; Waaijer, Cathelijn J F; Wijers-Koster, Pauline M; Briaire-de Bruijn, Inge H; Haazen, Lizette; Riester, Scott M; Dudakovic, Amel; Danen, Erik; Cleton-Jansen, Anne-Marie; van Wijnen, Andre J; Bovée, Judith V M G

    2015-05-20

    Mutations in isocitrate dehydrogenase 1 (IDH1) and IDH2 are found in a subset of benign and malignant cartilage tumors, gliomas and leukaemias. The mutant enzyme causes the production of D-2-hydroxyglutarate (D-2-HG), affecting CpG island and histone methylation. While mutations in IDH1/2 are early events in benign cartilage tumors, we evaluated whether these mutations play a role in malignant chondrosarcomas. Compared to IDH1/2 wildtype cell lines, chondrosarcoma cell lines harboring an endogenous IDH1 (n=3) or IDH2 mutation (n=2) showed up to a 100-fold increase in intracellular and extracellular D-2-HG levels. Specific inhibition of mutant IDH1 using AGI-5198 decreased levels of D-2-HG in a dose dependent manner. After 72 hours of treatment one out of three mutant IDH1 cell lines showed a moderate decrease in viability , while D-2-HG levels decreased >90%. Likewise, prolonged treatment (up to 20 passages) did not affect proliferation and migration. Furthermore, global gene expression, CpG island methylation as well as histone H3K4, -9, and -27 trimethylation levels remained unchanged. Thus, while IDH1/2 mutations cause enchondroma, malignant progression towards central chondrosarcoma renders chondrosarcoma growth independent of these mutations. Thus, monotherapy based on inhibition of mutant IDH1 appears insufficient for treatment of inoperable or metastasized chondrosarcoma patients.

  9. Procainamide Is a Specific Inhibitor of DNA Methyltransferase 1*

    PubMed Central

    Lee, Byron H.; Yegnasubramanian, Srinivasan; Lin, Xiaohui; Nelson, William G.

    2007-01-01

    CpG island hypermethylation occurs in most cases of cancer, typically resulting in the transcriptional silencing of critical cancer genes. Procainamide has been shown to inhibit DNA methyltransferase activity and reactivate silenced gene expression in cancer cells by reversing CpG island hypermethylation. We report here that procainamide specifically inhibits the hemimethylase activity of DNA methyltransferase 1 (DNMT1), the mammalian enzyme thought to be responsible for maintaining DNA methylation patterns during replication. At micromolar concentrations, procainamide was found to be a partial competitive inhibitor of DNMT1, reducing the affinity of the enzyme for its two substrates, hemimethylated DNA and S-adenosyl-l-methionine. By doing so, procainamide significantly decreased the processivity of DNMT1 on hemimethylated DNA. Procainamide was not a potent inhibitor of the de novo methyltransferases DNMT3a and DNMT3b2. As further evidence of the specificity of procainamide for DNMT1, procainamide failed to lower genomic 5-methyl-2′-deoxycytidine levels in HCT116 colorectal cancer cells when DNMT1 was genetically deleted but significantly reduced genomic 5-methyl-2′-deoxycyti-dine content in parental HCT116 cells and in HCT116 cells where DNMT3b was genetically deleted. Because many reports have strongly linked DNMT1 with epigenetic alterations in carcinogenesis, procainamide may be a useful drug in the prevention of cancer. PMID:16230360

  10. Predictive value of CpG island methylator phenotype for tumor recurrence in hepatitis B virus-associated hepatocellular carcinoma following liver transplantation

    PubMed Central

    2010-01-01

    Background CpG island methylator phenotype (CIMP), in which multiple genes concordantly methylated, has been demonstrated to be associated with progression, recurrence, as well as overall survival in some types of cancer. Methods We examined the promoter methylation status of seven genes including P16, CDH1, GSTP1, DAPK, XAF1, SOCS1 and SYK in 65 cases of HCC treated with LT by methylation-specific PCR. CIMP+ was defined as having three or more genes that are concordantly methylated. The relationship between CIMP status and clinicopathological parameters, as well as tumor recurrence was further analyzed. Results CIMP+ was more frequent in HCC with AFP > 400 ng/ml than those with AFP ≤ 400 ng/ml (P = 0.017). In addition, patients with CIMP+ were prone to have multiple tumor numbers than those with CIMP- (P = 0.007). Patients with CIMP+ tumors had significantly worse recurrence-free survival (RFS) than patients with CIMP-tumors by Kaplan-Meier estimates (P = 0.004). Multivariate analysis also revealed that CIMP status might be a novel independent prognostic factor of RFS for HCC patients treated with LT (HR: 3.581; 95% CI: 1.473-8.710, P = 0.005). Conclusion Our results suggested that CIMP could serve as a new prognostic biomarker to predict the risk of tumor recurrence in HCC after transplantation. PMID:20678188

  11. Induction of anti-aging gene klotho with a small chemical compound that demethylates CpG islands

    PubMed Central

    Jung, Dongju; Xu, Yuechi; Sun, Zhongjie

    2017-01-01

    Klotho (KL) is described as an anti-aging gene because mutation of Kl gene leads to multiple pre-mature aging phenotypes and shortens lifespan in mice. Growing evidence suggests that an increase in KL expression may be beneficial for age-related diseases such as arteriosclerosis and diabetes. It remains largely unknown, however, how Kl expression could be induced. Here we discovered novel molecular mechanism for induction of Kl expression with a small molecule ‘Compound H’, N-(2-chlorophenyl)-1H-indole-3-caboxamide. Compound H was originally identified through a high-throughput screening of small molecules for identifying Kl inducers. However, how Compound H induces Kl expression has never been investigated. We found that Compound H increased Kl expression via demethylation in CpG islands of the Kl gene. The demethylation was accomplished by activating demethylases rather than inhibiting methylases. Due to demethylation, Compound H enhanced binding of transcription factors, Pax4 and Kid3, to the promoter of the Kl gene. Pax4 and Kid3 regulated Kl promoter activity positively and negatively, respectively. Thus, our results show that demethylation is an important molecular mechanism that mediates Compound H-induced Kl expression. Further investigation is warranted to determine whether Compound H demethylates the Kl gene in vivo and whether it can serve as a therapeutic agent for repressing or delaying the onset of age-related diseases. PMID:28657902

  12. Aberrant methylation of DACT1 and DACT2 are associated with tumor progression and poor prognosis in esophageal squamous cell carcinoma.

    PubMed

    Guo, Yan-Li; Shan, Bao-En; Guo, Wei; Dong, Zhi-Ming; Zhou, Zhen; Shen, Su-Peng; Guo, Xin; Liang, Jia; Kuang, Gang

    2017-01-11

    The DACT (Dishevelled-associated antagonist of β-catenin) family of scaffold proteins may play important roles in tumorigenesis. However, the epigenetic changes of DACT1, 2, 3 and their effect on esophageal squamous cell carcinoma (ESCC) have not been investigated so far. The aim of this study was to investigate the promoter methylation and expression of DACT family, in order to elucidate more information on the role of DACT with regard to the progression and prognosis of ESCC. MSP and BGS methods were respectively applied to examine the methylation status of DACT; RT-PCR, Western blot and immunohistochemistry methods were respectively used to determine the mRNA and protein expression of DACT; MTT, Colony-formation and Wound-healing assay were performed to assess the effect of DACT1 and DACT2 on proliferation and migration of esophageal cancer cells. Frequent reduced expression of DACT1, DACT2 and DACT3 were found in esophageal cancer cell lines and the expression levels of DACT1 and DACT2 were reversed by 5-Aza-Dc. Decreased mRNA and protein expression of DACT1 and DACT2 were observed in ESCC tumor tissues and were associated with the methylation status of transcription start site (TSS) region. The hypermethylation of CpG islands (CGI) shore region in DACT1 was observed both in tumor and corresponding adjacent tissues but wasn't related to the transcriptional inhibition of DACT1. The methylation status of TSS region in DACT1 and DACT2 and the protein expression of DACT2 were independently associated with ESCC patients' prognosis. The TSS region hypermethylation may be one of the main mechanisms for reduced expression of DACT1 and DACT2 in ESCC. The simultaneous methylation of DACT1 and DACT2 may play important roles in progression of ESCC and may serve as prognostic methylation biomarkers for ESCC patients.

  13. Performances of Different Fragment Sizes for Reduced Representation Bisulfite Sequencing in Pigs.

    PubMed

    Yuan, Xiao-Long; Zhang, Zhe; Pan, Rong-Yang; Gao, Ning; Deng, Xi; Li, Bin; Zhang, Hao; Sangild, Per Torp; Li, Jia-Qi

    2017-01-01

    Reduced representation bisulfite sequencing (RRBS) has been widely used to profile genome-scale DNA methylation in mammalian genomes. However, the applications and technical performances of RRBS with different fragment sizes have not been systematically reported in pigs, which serve as one of the important biomedical models for humans. The aims of this study were to evaluate capacities of RRBS libraries with different fragment sizes to characterize the porcine genome. We found that the Msp I-digested segments between 40 and 220 bp harbored a high distribution peak at 74 bp, which were highly overlapped with the repetitive elements and might reduce the unique mapping alignment. The RRBS library of 110-220 bp fragment size had the highest unique mapping alignment and the lowest multiple alignment. The cost-effectiveness of the 40-110 bp, 110-220 bp and 40-220 bp fragment sizes might decrease when the dataset size was more than 70, 50 and 110 million reads for these three fragment sizes, respectively. Given a 50-million dataset size, the average sequencing depth of the detected CpG sites in the 110-220 bp fragment size appeared to be deeper than in the 40-110 bp and 40-220 bp fragment sizes, and these detected CpG sties differently located in gene- and CpG island-related regions. In this study, our results demonstrated that selections of fragment sizes could affect the numbers and sequencing depth of detected CpG sites as well as the cost-efficiency. No single solution of RRBS is optimal in all circumstances for investigating genome-scale DNA methylation. This work provides the useful knowledge on designing and executing RRBS for investigating the genome-wide DNA methylation in tissues from pigs.

  14. Preclinical Studies of Induced Pluripotent Stem Cell-Derived Astrocyte Transplantation in ALS

    DTIC Science & Technology

    2014-12-01

    fast-frozen in liquid nitrogen. RNAwas iso- lated using TRIzol, followed by DNase treatment and RNA cleanup using RNeasy columns (Qiagen, Hilden, Germany...J Neurochem 2001;79:737–746. 34 Doi A, Park IH, Wen B et al. Differential methylation of tissue- and cancer-specific CpG island shores distinguishes...2008, Sreedharan et al., 2008, Kwiatkowski et al., 2009, Vance et al., 2009, Johnson et al., 2010, Maruyama et al., 2010, DeJesus-Hernandez et al

  15. Integrated Multiregional Analysis Proposing a New Model of Colorectal Cancer Evolution

    PubMed Central

    Niida, Atsushi; Shimamura, Teppei; Hirata, Hidenari; Sugimachi, Keishi; Sawada, Genta; Iwaya, Takeshi; Kurashige, Junji; Shinden, Yoshiaki; Iguchi, Tomohiro; Eguchi, Hidetoshi; Chiba, Kenichi; Shiraishi, Yuichi; Nagae, Genta; Yoshida, Kenichi; Nagata, Yasunobu; Haeno, Hiroshi; Yamamoto, Hirofumi; Ishii, Hideshi; Doki, Yuichiro; Iinuma, Hisae; Sasaki, Shin; Nagayama, Satoshi; Yamada, Kazutaka; Yachida, Shinichi; Kato, Mamoru; Shibata, Tatsuhiro; Oki, Eiji; Saeki, Hiroshi; Shirabe, Ken; Oda, Yoshinao; Maehara, Yoshihiko; Komune, Shizuo; Mori, Masaki; Suzuki, Yutaka; Yamamoto, Ken; Aburatani, Hiroyuki; Ogawa, Seishi; Miyano, Satoru; Mimori, Koshi

    2016-01-01

    Understanding intratumor heterogeneity is clinically important because it could cause therapeutic failure by fostering evolutionary adaptation. To this end, we profiled the genome and epigenome in multiple regions within each of nine colorectal tumors. Extensive intertumor heterogeneity is observed, from which we inferred the evolutionary history of the tumors. First, clonally shared alterations appeared, in which C>T transitions at CpG site and CpG island hypermethylation were relatively enriched. Correlation between mutation counts and patients’ ages suggests that the early-acquired alterations resulted from aging. In the late phase, a parental clone was branched into numerous subclones. Known driver alterations were observed frequently in the early-acquired alterations, but rarely in the late-acquired alterations. Consistently, our computational simulation of the branching evolution suggests that extensive intratumor heterogeneity could be generated by neutral evolution. Collectively, we propose a new model of colorectal cancer evolution, which is useful for understanding and confronting this heterogeneous disease. PMID:26890883

  16. Sex differences in DNA methylation and expression in zebrafish brain: a test of an extended 'male sex drive' hypothesis.

    PubMed

    Chatterjee, Aniruddha; Lagisz, Malgorzata; Rodger, Euan J; Zhen, Li; Stockwell, Peter A; Duncan, Elizabeth J; Horsfield, Julia A; Jeyakani, Justin; Mathavan, Sinnakaruppan; Ozaki, Yuichi; Nakagawa, Shinichi

    2016-09-30

    The sex drive hypothesis predicts that stronger selection on male traits has resulted in masculinization of the genome. Here we test whether such masculinizing effects can be detected at the level of the transcriptome and methylome in the adult zebrafish brain. Although methylation is globally similar, we identified 914 specific differentially methylated CpGs (DMCs) between males and females (435 were hypermethylated and 479 were hypomethylated in males compared to females). These DMCs were prevalent in gene body, intergenic regions and CpG island shores. We also discovered 15 distinct CpG clusters with striking sex-specific DNA methylation differences. In contrast, at transcriptome level, more female-biased genes than male-biased genes were expressed, giving little support for the male sex drive hypothesis. Our study provides genome-wide methylome and transcriptome assessment and sheds light on sex-specific epigenetic patterns and in zebrafish for the first time. Copyright © 2016 Elsevier B.V. All rights reserved.

  17. TET1 Depletion Induces Aberrant CpG Methylation in Colorectal Cancer Cells

    PubMed Central

    Yamamoto, Eiichiro; Harada, Taku; Aoki, Hironori; Maruyama, Reo; Toyota, Mutsumi; Sasaki, Yasushi; Sugai, Tamotsu; Tokino, Takashi; Nakase, Hiroshi

    2016-01-01

    Aberrant DNA methylation is commonly observed in colorectal cancer (CRC), but the underlying mechanism is not fully understood. 5-hydroxymethylcytosine levels and TET1 expression are both reduced in CRC, while epigenetic silencing of TET1 is reportedly associated with the CpG island methylator phenotype. In the present study, we aimed to clarify the relationship between loss of TET1 and aberrant DNA methylation in CRC. Stable TET1 knockdown clones were established using Colo320DM cells, which express high levels of TET1, and HCT116 cells, which express TET1 at a level similar to that in normal colonic tissue. Infinium HumanMethylation450 BeadChip assays revealed increased levels of 5-methylcytosine at more than 10,000 CpG sites in TET1-depleted Colo320DM cells. Changes in DNA methylation were observed at various positions within the genome, including promoters, gene bodies and intergenic regions, and the altered methylation affected expression of a subset of genes. By contrast, TET1 knockdown did not significantly affect DNA methylation in HCT116 cells. However, TET1 depletion was associated with attenuated effects of 5-aza-2’-deoxycytidine on gene expression profiles in both cell lines. These results suggest that loss of TET1 may induce aberrant DNA methylation and may attenuate the effect of 5-aza-2’-deoxycytidine in CRC cells. PMID:27977763

  18. Aging as an Epigenetic Phenomenon

    PubMed Central

    Ashapkin, Vasily V.; Kutueva, Lyudmila I.; Vanyushin, Boris F.

    2017-01-01

    Introduction: Hypermethylation of genes associated with promoter CpG islands, and hypomethylation of CpG poor genes, repeat sequences, transposable elements and intergenic genome sections occur during aging in mammals. Methylation levels of certain CpG sites display strict correlation to age and could be used as “epigenetic clock” to predict biological age. Multi-substrate deacetylases SIRT1 and SIRT6 affect aging via locus-specific modulations of chromatin structure and activity of multiple regulatory proteins involved in aging. Random errors in DNA methylation and other epigenetic marks during aging increase the transcriptional noise, and thus lead to enhanced phenotypic variation between cells of the same tissue. Such variation could cause progressive organ dysfunction observed in aged individuals. Multiple experimental data show that induction of NF-κB regulated gene sets occurs in various tissues of aged mammals. Upregulation of multiple miRNAs occurs at mid age leading to downregulation of enzymes and regulatory proteins involved in basic cellular functions, such as DNA repair, oxidative phosphorylation, intermediate metabolism, and others. Conclusion: Strong evidence shows that all epigenetic systems contribute to the lifespan control in various organisms. Similar to other cell systems, epigenome is prone to gradual degradation due to the genome damage, stressful agents, and other aging factors. But unlike mutations and other kinds of the genome damage, age-related epigenetic changes could be fully or partially reversed to a “young” state. PMID:29081695

  19. Methylation Analysis of the BMPR2 Gene Promoter Region in Patients With Pulmonary Arterial Hypertension.

    PubMed

    Pousada, Guillermo; Baloira, Adolfo; Valverde, Diana

    2016-06-01

    Pulmonary arterial hypertension is characterizated by obstruction of the pulmonary arteries. The gene mainly related to pathology is the bone morphogenetic protein receptor type II (BMPR2). The aim of this study was to analyze the methylation pattern of the BMPR2 promoter region in patients and controls. We used Methyl Primer Express(®) v.1.0 and MatInspector softwares to analyze this region. Genomic DNA obtained from the peripheral blood of patients and controls was modified with sodium bisulphite. Methylation was analyzed using methylation-specific PCR. DNA treated with CpG methyltransferase was used as a positive control for methylation and H1299 cell culture DNA was used as positive control for gene expression. We identified a CpG island, which may have been methylated, in the BMPR2 promoter region, in addition to NIT-2 (global-acting regulatory protein), sex-determining region Y) and heat shock factor transcription factor binding sites. We found no evidence of methylation in patients and controls. No methylated CpG sites were identified in H1299 cells expressing the BMPR2 gene. The BMPR2 promoter region is the most suitable for study because of the high number of transcription factor binding sites that could alter gene function. No evidence of methylation was detected in this region in patients and controls. Copyright © 2015 SEPAR. Published by Elsevier Espana. All rights reserved.

  20. Density characterization of radiochromic film through source axis distance (SAD) technique in linac with slab phantom for radiotherapy applications

    NASA Astrophysics Data System (ADS)

    Hariani, Yousida; Haris, Bambang

    2017-05-01

    Characterization of radiochromic film density is accomplished through Source Axis Distance (SAD) technique in a slab phantom Linac with various depths and breadths of field. Type of the film used is gafchromic RTQA2. The dose of radiation exposure of the film may cause changes in the film density. This research aims to determine the relation between the density and the dose depth through the characteristic of curves to identify the depth of the dose and particular breadth of the field as a reference for the dose of radiotherapy patients. The result shows that the higher the dose is absorbed, the darker the film will be, yet the lower the density is obtained. The dose depth is determined by measuring the amount of dose received at various depths and breadths of field using film that is placed on the slab phantom with 6 MV linac radiation and dose of 300 cGy. The variation of the depth at 1.5 cm; 4 cm; 6 cm; 8 cm; 10 cm, the field size at 4 × 4 cm2, and the dose depth at 359.7 cGy; 315.3 cGy; 281.4 cGy; 241.2 cGy; 220.5 cGy were settled. The field size 6 × 6 cm2 takes the dose depth 354.6 cGy; 314.1 cGy; 282.6 cGy; 244.5 cGy; 224.7 cGy. The field size 8 × 8 cm2 takes the dose depth 351.6 cGy; 313 cGy; 283.8 cGy; 247.2 cGy; 228 cGy. The field size 10 × 10 cm2 takes the dose depth 348.9 cGy; 342.6 cGy; 248.4 cGy; 249.6 cGy; 231 cGy.

  1. PlantPAN 2.0: an update of plant promoter analysis navigator for reconstructing transcriptional regulatory networks in plants.

    PubMed

    Chow, Chi-Nga; Zheng, Han-Qin; Wu, Nai-Yun; Chien, Chia-Hung; Huang, Hsien-Da; Lee, Tzong-Yi; Chiang-Hsieh, Yi-Fan; Hou, Ping-Fu; Yang, Tien-Yi; Chang, Wen-Chi

    2016-01-04

    Transcription factors (TFs) are sequence-specific DNA-binding proteins acting as critical regulators of gene expression. The Plant Promoter Analysis Navigator (PlantPAN; http://PlantPAN2.itps.ncku.edu.tw) provides an informative resource for detecting transcription factor binding sites (TFBSs), corresponding TFs, and other important regulatory elements (CpG islands and tandem repeats) in a promoter or a set of plant promoters. Additionally, TFBSs, CpG islands, and tandem repeats in the conserve regions between similar gene promoters are also identified. The current PlantPAN release (version 2.0) contains 16 960 TFs and 1143 TF binding site matrices among 76 plant species. In addition to updating of the annotation information, adding experimentally verified TF matrices, and making improvements in the visualization of transcriptional regulatory networks, several new features and functions are incorporated. These features include: (i) comprehensive curation of TF information (response conditions, target genes, and sequence logos of binding motifs, etc.), (ii) co-expression profiles of TFs and their target genes under various conditions, (iii) protein-protein interactions among TFs and their co-factors, (iv) TF-target networks, and (v) downstream promoter elements. Furthermore, a dynamic transcriptional regulatory network under various conditions is provided in PlantPAN 2.0. The PlantPAN 2.0 is a systematic platform for plant promoter analysis and reconstructing transcriptional regulatory networks. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  2. Genome-wide mapping and analysis of active promoters in mouse embryonic stem cells and adult organs

    PubMed Central

    Barrera, Leah O.; Li, Zirong; Smith, Andrew D.; Arden, Karen C.; Cavenee, Webster K.; Zhang, Michael Q.; Green, Roland D.; Ren, Bing

    2008-01-01

    By integrating genome-wide maps of RNA polymerase II (Polr2a) binding with gene expression data and H3ac and H3K4me3 profiles, we characterized promoters with enriched activity in mouse embryonic stem cells (mES) as well as adult brain, heart, kidney, and liver. We identified ∼24,000 promoters across these samples, including 16,976 annotated mRNA 5′ ends and 5153 additional sites validating cap-analysis of gene expression (CAGE) 5′ end data. We showed that promoters with CpG islands are typically non-tissue specific, with the majority associated with Polr2a and the active chromatin modifications in nearly all the tissues examined. By contrast, the promoters without CpG islands are generally associated with Polr2a and the active chromatin marks in a tissue-dependent way. We defined 4396 tissue-specific promoters by adapting a quantitative index of tissue-specificity based on Polr2a occupancy. While there is a general correspondence between Polr2a occupancy and active chromatin modifications at the tissue-specific promoters, a subset of them appear to be persistently marked by active chromatin modifications in the absence of detectable Polr2a binding, highlighting the complexity of the functional relationship between chromatin modification and gene expression. Our results provide a resource for exploring promoter Polr2a binding and epigenetic states across pluripotent and differentiated cell types in mammals. PMID:18042645

  3. Prognostic and Predictive Value of CpG Island Methylator Phenotype in Patients with Locally Advanced Nonmetastatic Sporadic Colorectal Cancer

    PubMed Central

    Long, Yadong; Xu, Ye; Guan, Zuqing; Lian, Peng; Peng, Junjie

    2014-01-01

    Purpose. In the present study, the prognostic significance of CpG island methylator phenotype (CIMP) in stage II/III sporadic colorectal cancer was evaluated using a five-gene panel. Methods. Fifty stage II/III colorectal cancer patients who received radical resection were included in this study. Promoter methylation of p14ARF, hMLH1, p16INK4a, MGMT, and MINT1 was determined by methylation specific polymerase chain reaction (MSP). CIMP positive was defined as hypermethylation of three or more of the five genes. Impact factors on disease-free survival (DFS) and overall survival (OS) were analyzed using Kaplan-Meier method (log-rank test) and adjusted Cox proportional hazards model. Results. Twenty-four percent (12/50) of patients were characterized as CIMP positive. Univariate analysis showed stage III (P = 0.049) and CIMP positive (P = 0.014) patients who had significantly inferior DFS. In Cox regression analysis, CIMP positive epigenotype was independently related with poor DFS with HR = 2.935 and 95% CI: 1.193–7.220 (P = 0.019). In patients with CIMP positive tumor, those receiving adjuvant chemotherapy had a poor DFS than those without adjuvant chemotherapy (P = 0.023). Conclusions. CIMP positive was significantly correlated with decreased DFS in stage II/III colorectal cancer. Patients with CIMP positive locally advanced sporadic colorectal cancers may not benefit from 5-fluorouracil based adjuvant chemotherapy. PMID:24822060

  4. CpG Island Methylator Phenotype and Prognosis of Colorectal Cancer in Northeast China

    PubMed Central

    Li, Xia; Hu, Fulan; Yao, Xiaoping; Zhang, Zuoming; Wang, Fan; Sun, Guizhi; Cui, Bin-Bin; Dong, Xinshu; Zhao, Yashuang

    2014-01-01

    Purpose. To investigate the association between CpG island methylator phenotype (CIMP) and the overall survival of sporadic colorectal cancer (CRC) in Northeast China. Methods. 282 sporadic CRC patients were recruited in this study. We selected MLH1, MGMT, p16, APC, MINT1, MINT31, and RUNX3 as the CIMP panel markers. The promoter methylation was assessed by methylation sensitive high resolution melting (MS-HRM). Proportional hazards-regression models were fitted with computing hazard ratios (HR) and the corresponding 95% confidence intervals (95% CI). Results. 12.77% (36/282) of patients were CIMP-0, 74.1% (209/282) of patients were CIMP-L, and 13.12% (37/282) of patients were CIMP-H. The five-year survival of the 282 CRC patients was 58%. There was significant association between APC gene promoter methylation and CRC overall survival (HR = 1.61; 95% CI: 1.05–2.46; P = 0.03). CIMP-H was significantly associated with worse prognosis compared to CIMP-0 (HR = 3.06; 95% CI: 1.19–7.89; P = 0.02) and CIMP-L (HR = 1.97; 95% CI: 1.11–3.48; P = 0.02), respectively. While comparing with the combine of CIMP-L and CIMP-0 (CIMP-L/0), CIMP-H also presented a worse prognosis (HR = 2.31; 95% CI: 1.02–5.24; P = 0.04). Conclusion. CIMP-H may be a predictor of a poor prognosis of CRC in Northeast China patients. PMID:25243122

  5. CpG Island Methylator Phenotype-Low (CIMP-Low) in Colorectal Cancer: Possible Associations with Male Sex and KRAS Mutations

    PubMed Central

    Ogino, Shuji; Kawasaki, Takako; Kirkner, Gregory J.; Loda, Massimo; Fuchs, Charles S.

    2006-01-01

    The CpG island methylator phenotype (CIMP or CIMP-high) with extensive promoter methylation seems to be a distinct epigenotype of colorectal cancer. However, no study has comprehensively examined features of colorectal cancer with less extensive promoter methylation (designated as “CIMP-low”). Using real-time polymerase chain reaction (MethyLight), we quantified DNA methylation in five CIMP-specific gene promoters [CACNA1G, CDKN2A (p16), CRABP1, MLH1, and NEUROG1] in 840 relatively unbiased, population-based colorectal cancer samples, obtained from two large prospective cohort studies. CIMP-low (defined as 1/5 to 3/5 methylated promoters) colorectal cancers were significantly more common among men (38 versus 30% in women, P = 0.01) and among KRAS-mutated tumors (44 versus 30% in KRAS/BRAF wild-type tumors, P = 0.0003; 19% in BRAF-mutated tumors, P < 0.0001). In addition, KRAS mutations were significantly more common in CIMP-low tumors (47%) than in CIMP-high tumors (with ≥4/5 methylated promoters, 12%, P < 0.0001) and CIMP-0 tumors (with 0/5 methylated promoters, 37%, P = 0.007). The associations of CIMP-low tumors with male sex and KRAS mutations still existed after tumors were stratified by microsatellite instability status. In conclusion, CIMP-low colorectal cancer is associated with male sex and KRAS mutations. The hypothesis that CIMP-low tumors are different from CIMP-high and CIMP-0 tumors needs to be tested further. PMID:17065427

  6. The role of the CpG island methylator phenotype on survival outcome in colon cancer.

    PubMed

    Kang, Ki Joo; Min, Byung Hoon; Ryu, Kyung Ju; Kim, Kyoung Mee; Chang, Dong Kyung; Kim, Jae J; Rhee, Jong Chul; Kim, Young Ho

    2015-03-01

    CpG island methylator phenotype (CIMP)- high colorectal cancers (CRCs) have distinct clinicopathologi-cal features from their CIMP-low/negative CRC counterparts. However, controversy exists regarding the prognosis of CRC according to the CIMP status. Therefore, this study examined the prognosis of Korean patients with colon cancer according to the CIMP status. Among a previous cohort pop-ulation with CRC, a total of 154 patients with colon cancer who had available tissue for DNA extraction were included in the study. CIMP-high was defined as ≥3/5 methylated mark-ers using the five-marker panel (CACNA1G, IGF2, NEUROG1, RUNX3, and SOCS1). CIMP-high and CIMP-low/neg-ative cancers were observed in 27 patients (17.5%) and 127 patients (82.5%), respectively. Multivariate analysis adjust-ing for age, gender, tumor location, tumor stage and CIMP and microsatellite instability (MSI) statuses indicated that CIMP-high colon cancers were associated with a significant increase in colon cancer-specific mortality (hazard ratio [HR], 3.23; 95% confidence interval [CI], 1.20 to 8.69; p=0.02). In microsatellite stable cancers, CIMP-high cancer had a poor survival outcome compared to CIMP-low/negative cancer (HR, 2.91; 95% CI, 1.02 to 8.27; p=0.04). Re-gardless of the MSI status, CIMP-high cancers had poor sur-vival outcomes in Korean patients. (Gut Liver, 2015;9202-207).

  7. CpG island methylator phenotype and prognosis of colorectal cancer in Northeast China.

    PubMed

    Li, Xia; Hu, Fulan; Wang, Yibaina; Yao, Xiaoping; Zhang, Zuoming; Wang, Fan; Sun, Guizhi; Cui, Bin-Bin; Dong, Xinshu; Zhao, Yashuang

    2014-01-01

    To investigate the association between CpG island methylator phenotype (CIMP) and the overall survival of sporadic colorectal cancer (CRC) in Northeast China. 282 sporadic CRC patients were recruited in this study. We selected MLH1, MGMT, p16, APC, MINT1, MINT31, and RUNX3 as the CIMP panel markers. The promoter methylation was assessed by methylation sensitive high resolution melting (MS-HRM). Proportional hazards-regression models were fitted with computing hazard ratios (HR) and the corresponding 95% confidence intervals (95% CI). 12.77% (36/282) of patients were CIMP-0, 74.1% (209/282) of patients were CIMP-L, and 13.12% (37/282) of patients were CIMP-H. The five-year survival of the 282 CRC patients was 58%. There was significant association between APC gene promoter methylation and CRC overall survival (HR = 1.61; 95% CI: 1.05-2.46; P = 0.03). CIMP-H was significantly associated with worse prognosis compared to CIMP-0 (HR = 3.06; 95% CI: 1.19-7.89; P = 0.02) and CIMP-L (HR = 1.97; 95% CI: 1.11-3.48; P = 0.02), respectively. While comparing with the combine of CIMP-L and CIMP-0 (CIMP-L/0), CIMP-H also presented a worse prognosis (HR = 2.31; 95% CI: 1.02-5.24; P = 0.04). CIMP-H may be a predictor of a poor prognosis of CRC in Northeast China patients.

  8. Evaluation of markers for CpG island methylator phenotype (CIMP) in colorectal cancer by a large population-based sample.

    PubMed

    Ogino, Shuji; Kawasaki, Takako; Kirkner, Gregory J; Kraft, Peter; Loda, Massimo; Fuchs, Charles S

    2007-07-01

    The CpG island methylator phenotype (CIMP or CIMP-high) with extensive promoter methylation is a distinct phenotype in colorectal cancer. However, a choice of markers for CIMP has been controversial. A recent extensive investigation has selected five methylation markers (CACNA1G, IGF2, NEUROG1, RUNX3, and SOCS1) as surrogate markers for epigenomic aberrations in tumor. The use of these markers as a CIMP-specific panel needs to be validated by an independent, large dataset. Using MethyLight assays on 920 colorectal cancers from two large prospective cohort studies, we quantified DNA methylation in eight CIMP-specific markers [the above five plus CDKN2A (p16), CRABP1, and MLH1]. A CIMP-high cutoff was set at > or = 6/8 or > or = 5/8 methylated promoters, based on tumor distribution and BRAF/KRAS mutation frequencies. All but two very specific markers [MLH1 (98% specific) and SOCS1 (93% specific)] demonstrated > or = 85% sensitivity and > or = 80% specificity, indicating overall good concordance in methylation patterns and good performance of these markers. Based on sensitivity, specificity, and false positives and negatives, the eight markers were ranked in order as: RUNX3, CACNA1G, IGF2, MLH1, NEUROG1, CRABP1, SOCS1, and CDKN2A. In conclusion, a panel of markers including at least RUNX3, CACNA1G, IGF2, and MLH1 can serve as a sensitive and specific marker panel for CIMP-high.

  9. A CpG island methylator phenotype of colorectal cancer that is contiguous with conventional adenomas, but not serrated polyps

    PubMed Central

    HOKAZONO, KOJI; UEKI, TAKASHI; NAGAYOSHI, KINUKO; NISHIOKA, YASUNOBU; HATAE, TATSUNOBU; KOGA, YUTAKA; HIRAHASHI, MINAKO; ODA, YOSHINAO; TANAKA, MASAO

    2014-01-01

    A subset of colorectal cancers (CRCs) harbor the CpG island methylator phenotype (CIMP), with concurrent multiple promoter hypermethylation of tumor-related genes. A serrated pathway in which CIMP is developed from serrated polyps is proposed. The present study characterized CIMP and morphologically examined precursor lesions of CIMP. In total, 104 CRCs treated between January 1996 and December 2004 were examined. Aberrant promoter methylation of 15 cancer-related genes was analyzed. CIMP status was classified according to the number of methylated genes and was correlated with the clinicopathological features, including the concomitant polyps in and around the tumors. The frequency of aberrant methylation in each CRC showed a bimodal pattern, and the CRCs were classified as CIMP-high (CIMP-H), CIMP-low (CIMP-L) and CIMP-negative (CIMP-N). CIMP-H was associated with aberrant methylation of MLH1 (P=0.005) and with an improved recurrence-free survival (RFS) rate following curative resection compared with CIMP-L/N (five-year RFS rate, 93.8 vs. 67.1%; P=0.044), while CIMP-N tumors were associated with frequent distant metastases at diagnosis (P=0.023). No concomitant serrated lesions were present in the tumors, whereas conventional adenoma was contiguous with 11 (10.6%) of 104 CRCs, including four CIMP-H CRCs. CIMP-H was classified in CRCs by a novel CIMP marker panel and the presence of concomitant tumors revealed that certain CIMP-H CRCs may have arisen from conventional adenomas. PMID:25289081

  10. CpG island methylator phenotype identifies high risk patients among microsatellite stable BRAF mutated colorectal cancers

    PubMed Central

    Vedeld, Hege Marie; Merok, Marianne; Jeanmougin, Marine; Danielsen, Stine A.; Honne, Hilde; Presthus, Gro Kummeneje; Svindland, Aud; Sjo, Ole H.; Hektoen, Merete; Eknæs, Mette; Nesbakken, Arild; Lothe, Ragnhild A.

    2017-01-01

    The prognostic value of CpG island methylator phenotype (CIMP) in colorectal cancer remains unsettled. We aimed to assess the prognostic value of this phenotype analyzing a total of 1126 tumor samples obtained from two Norwegian consecutive colorectal cancer series. CIMP status was determined by analyzing the 5‐markers CAGNA1G, IGF2, NEUROG1, RUNX3 and SOCS1 by quantitative methylation specific PCR (qMSP). The effect of CIMP on time to recurrence (TTR) and overall survival (OS) were determined by uni‐ and multivariate analyses. Subgroup analyses were conducted according to MSI and BRAF mutation status, disease stage, and also age at time of diagnosis (<60, 60‐74, ≥75 years). Patients with CIMP positive tumors demonstrated significantly shorter TTR and worse OS compared to those with CIMP negative tumors (multivariate hazard ratio [95% CI] 1.86 [1.31‐2.63] and 1.89 [1.34‐2.65], respectively). In stratified analyses, CIMP tumors showed significantly worse outcome among patients with microsatellite stable (MSS, P < 0.001), and MSS BRAF mutated tumors (P < 0.001), a finding that persisted in patients with stage II, III or IV disease, and that remained significant in multivariate analysis (P < 0.01). Consistent results were found for all three age groups. To conclude, CIMP is significantly associated with inferior outcome for colorectal cancer patients, and can stratify the poor prognostic patients with MSS BRAF mutated tumors. PMID:28542846

  11. Isocitrate dehydrogenase 1 R132C mutation occurs exclusively in microsatellite stable colorectal cancers with the CpG island methylator phenotype.

    PubMed

    Whitehall, V L J; Dumenil, T D; McKeone, D M; Bond, C E; Bettington, M L; Buttenshaw, R L; Bowdler, L; Montgomery, G W; Wockner, L F; Leggett, B A

    2014-11-01

    The CpG Island Methylator Phenotype (CIMP) is fundamental to an important subset of colorectal cancer; however, its cause is unknown. CIMP is associated with microsatellite instability but is also found in BRAF mutant microsatellite stable cancers that are associated with poor prognosis. The isocitrate dehydrogenase 1 (IDH1) gene causes CIMP in glioma due to an activating mutation that produces the 2-hydroxyglutarate oncometabolite. We therefore examined IDH1 alteration as a potential cause of CIMP in colorectal cancer. The IDH1 mutational hotspot was screened in 86 CIMP-positive and 80 CIMP-negative cancers. The entire coding sequence was examined in 81 CIMP-positive colorectal cancers. Forty-seven cancers varying by CIMP-status and IDH1 mutation status were examined using Illumina 450K DNA methylation microarrays. The R132C IDH1 mutation was detected in 4/166 cancers. All IDH1 mutations were in CIMP cancers that were BRAF mutant and microsatellite stable (4/45, 8.9%). Unsupervised hierarchical cluster analysis identified an IDH1 mutation-like methylation signature in approximately half of the CIMP-positive cancers. IDH1 mutation appears to cause CIMP in a small proportion of BRAF mutant, microsatellite stable colorectal cancers. This study provides a precedent that a single gene mutation may cause CIMP in colorectal cancer, and that this will be associated with a specific epigenetic signature and clinicopathological features.

  12. A CpG island methylator phenotype of colorectal cancer that is contiguous with conventional adenomas, but not serrated polyps.

    PubMed

    Hokazono, Koji; Ueki, Takashi; Nagayoshi, Kinuko; Nishioka, Yasunobu; Hatae, Tatsunobu; Koga, Yutaka; Hirahashi, Minako; Oda, Yoshinao; Tanaka, Masao

    2014-11-01

    A subset of colorectal cancers (CRCs) harbor the CpG island methylator phenotype (CIMP), with concurrent multiple promoter hypermethylation of tumor-related genes. A serrated pathway in which CIMP is developed from serrated polyps is proposed. The present study characterized CIMP and morphologically examined precursor lesions of CIMP. In total, 104 CRCs treated between January 1996 and December 2004 were examined. Aberrant promoter methylation of 15 cancer-related genes was analyzed. CIMP status was classified according to the number of methylated genes and was correlated with the clinicopathological features, including the concomitant polyps in and around the tumors. The frequency of aberrant methylation in each CRC showed a bimodal pattern, and the CRCs were classified as CIMP-high (CIMP-H), CIMP-low (CIMP-L) and CIMP-negative (CIMP-N). CIMP-H was associated with aberrant methylation of MLH1 (P=0.005) and with an improved recurrence-free survival (RFS) rate following curative resection compared with CIMP-L/N (five-year RFS rate, 93.8 vs. 67.1%; P=0.044), while CIMP-N tumors were associated with frequent distant metastases at diagnosis (P=0.023). No concomitant serrated lesions were present in the tumors, whereas conventional adenoma was contiguous with 11 (10.6%) of 104 CRCs, including four CIMP-H CRCs. CIMP-H was classified in CRCs by a novel CIMP marker panel and the presence of concomitant tumors revealed that certain CIMP-H CRCs may have arisen from conventional adenomas.

  13. Different definitions of CpG island methylator phenotype and outcomes of colorectal cancer: a systematic review.

    PubMed

    Jia, Min; Gao, Xu; Zhang, Yan; Hoffmeister, Michael; Brenner, Hermann

    2016-01-01

    Contradictory results were reported for the prognostic role of CpG island methylator phenotype (CIMP) among colorectal cancer (CRC) patients. Differences in the definitions of CIMP were the most common explanation for these discrepancies. The aim of this systematic review was to give an overview of the published studies on CRC prognosis according to the different definitions of CIMP. A systematic literature search was performed in MEDLINE and ISI Web of Science for articles published until 3 April 2015. Data extraction included information about the study population, the definition of CIMP, and investigated outcomes. Thirty-six studies were included in this systematic review. Among them, 30 studies reported the association of CIMP and CRC prognosis and 11 studies reported the association of CIMP with survival after CRC therapy. Overall, 16 different definitions of CIMP were identified. The majority of studies reported a poorer prognosis for patients with CIMP-positive (CIMP+)/CIMP-high (CIMP-H) CRC than with CIMP-negative (CIMP-)/CIMP-low (CIMP-L) CRC. Inconsistent results or varying effect strengths could not be explained by different CIMP definitions used. No consistent variation in response to specific therapies according to CIMP status was found. Comparative analyses of different CIMP panels in the same large study populations are needed to further clarify the role of CIMP definitions and to find out how methylation information can best be used to predict CRC prognosis and response to specific CRC therapies.

  14. CpG island methylator phenotype-low (CIMP-low) in colorectal cancer: possible associations with male sex and KRAS mutations.

    PubMed

    Ogino, Shuji; Kawasaki, Takako; Kirkner, Gregory J; Loda, Massimo; Fuchs, Charles S

    2006-11-01

    The CpG island methylator phenotype (CIMP or CIMP-high) with extensive promoter methylation seems to be a distinct epigenotype of colorectal cancer. However, no study has comprehensively examined features of colorectal cancer with less extensive promoter methylation (designated as "CIMP-low"). Using real-time polymerase chain reaction (MethyLight), we quantified DNA methylation in five CIMP-specific gene promoters [CACNA1G, CDKN2A (p16), CRABP1, MLH1, and NEUROG1] in 840 relatively unbiased, population-based colorectal cancer samples, obtained from two large prospective cohort studies. CIMP-low (defined as 1/5 to 3/5 methylated promoters) colorectal cancers were significantly more common among men (38 versus 30% in women, P = 0.01) and among KRAS-mutated tumors (44 versus 30% in KRAS/BRAF wild-type tumors, P = 0.0003; 19% in BRAF-mutated tumors, P < 0.0001). In addition, KRAS mutations were significantly more common in CIMP-low tumors (47%) than in CIMP-high tumors (with > or =4/5 methylated promoters, 12%, P < 0.0001) and CIMP-0 tumors (with 0/5 methylated promoters, 37%, P = 0.007). The associations of CIMP-low tumors with male sex and KRAS mutations still existed after tumors were stratified by microsatellite instability status. In conclusion, CIMP-low colorectal cancer is associated with male sex and KRAS mutations. The hypothesis that CIMP-low tumors are different from CIMP-high and CIMP-0 tumors needs to be tested further.

  15. Selection for avian leukosis virus integration sites determines the clonal progression of B-cell lymphomas

    PubMed Central

    Malhotra, Sanandan; Justice, James; Morgan, Robin

    2017-01-01

    Avian leukosis virus (ALV) is a simple retrovirus that causes a wide range of tumors in chickens, the most common of which are B-cell lymphomas. The viral genome integrates into the host genome and uses its strong promoter and enhancer sequences to alter the expression of nearby genes, frequently inducing tumors. In this study, we compare the preferences for ALV integration sites in cultured cells and in tumors, by analysis of over 87,000 unique integration sites. In tissue culture we observed integration was relatively random with slight preferences for genes, transcription start sites and CpG islands. We also observed a preference for integrations in or near expressed and spliced genes. The integration pattern in cultured cells changed over the course of selection for oncogenic characteristics in tumors. In comparison to tissue culture, ALV integrations are more highly selected for proximity to transcription start sites in tumors. There is also a significant selection of ALV integrations away from CpG islands in the highly clonally expanded cells in tumors. Additionally, we utilized a high throughput method to quantify the magnitude of clonality in different stages of tumorigenesis. An ALV-induced tumor carries between 700 and 3000 unique integrations, with an average of 2.3 to 4 copies of proviral DNA per infected cell. We observed increasing tumor clonality during progression of B-cell lymphomas and identified gene players (especially TERT and MYB) and biological processes involved in tumor progression. PMID:29099869

  16. Cloning of the anhidrotic ectodermal dysplasia gene: Identification of cDNAs associated with CpG islands mapped near translocation breakpoint in two female patients

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Srivastava, A.K.; Schlessinger, D.; Kere, J.

    1994-09-01

    The gene for the X chromosomal developmental disorder anhidrotic ectodermal dysplasia (EDA) has been mapped to Xq12-q13 by linkage analysis and is expressed in a few females with chromosomal translocations involving band Xq12-q13. A yeast artificial chromosome (YAC) contig (2.0 Mb) spanning two translocation breakpoints has been assembled by sequence-tagged site (STS)-based chromosomal walking. The two translocation breakpoints (X:autosome translocations from the affected female patients) have been mapped less than 60 kb apart within a YAC contig. Unique probes and intragenic STSs (mapped between the two translocations) have been developed and a somatic cell hybrid carrying the translocated X chromosomemore » from the AK patient has been analyzed by isolating unique probes that span the breakpoint. Several STSs made from intragenic sequences have been found to be conserved in mouse, hamster and monkey, but we have detected no mRNAs in a number of tissues tested. However, a probe and STS developed from the DNA spanning the AK breakpoint is conserved in mouse, hamster and monkey, and we have detected expressed sequences in skin cells and cDNA libraries. In addition, unique sequences have been obtained from two CpG islands in the region that maps proximal to the breakpoints. cDNAs containing these sequences are being studied as candidates for the gene affected in the etiology of EDA.« less

  17. Epigenetic regulation of the circadian clock: role of 5-aza-2′-deoxycytidine

    PubMed Central

    Tomita, Tatsunosuke; Kurita, Ryoji

    2017-01-01

    We have been investigating transcriptional regulation of the BMAL1 gene, a critical component of the mammalian clock system including DNA methylation. Here, a more detailed analysis of the regulation of DNA methylation of BMAL1 proceeded in RPMI8402 lymphoma cells. We found that CpG islands in the BMAL1 and the PER2 promoters were hyper- and hypomethylated, respectively and that 5-aza-2′-deoxycytidine (aza-dC) not only enhanced PER2 gene expression but also PER2 oscillation within 24 h in RPMI8402 cells. That is, such hypermethylation of CpG islands in the BMAL1 promoter restricted PER2 expression which was recovered by aza-dC within 1 day in these cells. These results suggest that the circadian clock system can be recovered through BMAL1 expression induced by aza-dC within a day. The RPIB9 promoter of RPMI8402 cells, which is a methylation hotspot in lymphoblastic leukemia, was also hypermethylated and aza-dC gradually recovered RPIB9 expression in 3 days. In addition, methylation-specific PCR revealed a different degree of aza-dC-induced methylation release between BMAL1 and RPIB9. These results suggest that the aza-dC-induced recovery of gene expression from DNA methylation is dependent on a gene, for example the rapid response to demethylation by the circadian system, and thus, is of importance to clinical strategies for treating cancer. PMID:28487473

  18. A survey of FRAXE allele sizes in three populations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhong, N.; Ju, W.; Curley, D.

    1996-08-09

    FRAXE is a fragile site located at Xq27-8, which contains polymorphic triplet GCC repeats associated with a CpG island. Similar to FRAXA, expansion of the GCC repeats results in an abnormal methylation of the CpG island and is associated with a mild mental retardation syndrome (FRAXE-MR). We surveyed the GCC repeat alleles of FRAXE from 3 populations. A total of 665 X chromosomes including 416 from a New York Euro-American sample (259 normal and 157 with FRAXA mutations), 157 from a Chinese sample (144 normal and 13 FRAXA), and 92 from a Finnish sample (56 normal and 36 FRAXA) weremore » analyzed by polymerase chain reaction. Twenty-seven alleles, ranging from 4 to 39 GCC repeats, were observed. The modal repeat number was 16 in the New York and Finnish samples and accounted for 24% of all the chromosomes tested (162/665). The modal repeat number in the Chinese sample was 18. A founder effect for FRAXA was suggested among the Finnish FRAXA samples in that 75% had the FRAXE 16 repeat allele versus only 30% of controls. Sequencing of the FRAXE region showed no imperfections within the GCC repeat region, such as those commonly seen in FRAXA. The smaller size and limited range of repeats and the lack of imperfections suggests the molecular mechanisms underlying FRAXE triplet mutations may be different from those underlying FRAXA. 27 refs., 4 figs., 1 tab.« less

  19. CpG island methylation of TMS1/ASC and CASP8 genes in cervical cancer

    PubMed Central

    2009-01-01

    Background Gene silencing associated with aberrant methylation of promoter region CpG islands is an acquired epigenetic alteration that serves as an alternative to genetic defects in the inactivation of tumor suppressor and other genes in human cancers. Aims This study describes the methylation status of TMS1/ASC and CASP8 genes in cervical cancer. We also examined the prevalence of TMS1/ASC and CASP8 genes methylation in cervical cancer tissue and none - neo plastic samples in an effort to correlate with smoking habit and clinicopathological features. Method Target DNA was modified by sodium bisulfite, converting all unmethylated, but not methylated, cytosines to uracil, and subsequently amplified by Methylation Specific (MS) PCR with primers specific for methylated versus unmethylated DNA. The PCR product was detected by gel electrophoresis and combined with the clinical records of patients. Results The methylation pattern of the TMS1/ASC and CASP8 genes in specimens of cervical cancer and adjacent normal tissues were detected [5/80 (6.2%), 3/80 (3.75%)-2/80 (2.5%), 1/80 (1.2%) respectively]. No statistical differences were seen in the extent of differentiation, invasion, pathological type and smoking habit between the methylated and unmethylated tissues (P > 0.05). Conclusion The present study conclude that the frequency of TMS1/ASC and CASP8 genes methylation in cervical cancer are rare (< 6%), and have no any critical role in development of cervical cancer. PMID:19258216

  20. Functional characterization of the human phosphodiesterase 7A1 promoter.

    PubMed Central

    Torras-Llort, Mònica; Azorín, Fernando

    2003-01-01

    In this paper, the human phosphodiesterase 7A1 (h PDE7A1 ) promoter region was identified and functionally characterized. Transient transfection experiments indicated that a 2.9 kb fragment of the h PDE7A1 5'-flanking region, to position -2907, has strong promoter activity in Jurkat T-cells. Deletion analysis showed that the proximal region, up to position -988, contains major cis -regulatory elements of the h PDE7A1 promoter. This minimal promoter region contains a regulatory CpG island which is essential for promoter activity. The CpG island contains three potential cAMP-response-element-binding protein (CREB)-binding sites that, as judged by in vivo dimethyl sulphate (DMS) footprinting, are occupied in Jurkat T-cells. Moreover, over-expression of CREB results in increased promoter activity, but, on the other hand, promoter activity decreases when a dominant-negative form of CREB (KCREB) is over-expressed. In vivo DMS footprinting strongly indicates that other transcription factors, such Ets-2, nuclear factor of activated T-cells 1 (NFAT-1) and nuclear factor kappaB (NF-kappaB), might also contribute to the regulation of h PDE7A1 promoter. Finally, h PDE7A1 promoter was found to be induced by treatment with PMA, but not by treatment with dibutyryl cAMP or forskolin. These results provide insights into the factors and mechanisms that regulate expression of the h PDE7A gene. PMID:12737631

  1. [SINEs in mammalian genomes can serve as additional signals in formation of facultative heterochromatin].

    PubMed

    Usmanova, N M; Kazakov, V I; Tomilin, N V

    2008-01-01

    Using computer-based methods we determined the global distribution of short interspersed nuclear elements (SINEs) in the human and mouse X chromosomes. It has been shown that this distributions is similar to the distributions of CpG islands and genes but is different from the distribution of LINE1 elements. Since SINEs (human Alu and mouse B2) may have binding sites for Polycomb protein YY1, we suggest that these repeats can serve as additional signals ("boosters") in Polycomb-dependent silencing of gene rich segments during X inactivation.

  2. Dual Roles for CXCL4 Chemokines and CXCR3 in Angiogenesis and Invasion of Pancreatic Cancer.

    PubMed

    Quemener, Cathy; Baud, Jessica; Boyé, Kevin; Dubrac, Alexandre; Billottet, Clotilde; Soulet, Fabienne; Darlot, Florence; Dumartin, Laurent; Sire, Marie; Grepin, Renaud; Daubon, Thomas; Rayne, Fabienne; Wodrich, Harald; Couvelard, Anne; Pineau, Raphael; Schilling, Martin; Castronovo, Vincent; Sue, Shih-Che; Clarke, Kim; Lomri, Abderrahim; Khatib, Abdel-Majid; Hagedorn, Martin; Prats, Hervé; Bikfalvi, Andreas

    2016-11-15

    The CXCL4 paralog CXCL4L1 is a less studied chemokine that has been suggested to exert an antiangiogenic function. However, CXCL4L1 is also expressed in patient tumors, tumor cell lines, and murine xenografts, prompting a more detailed analysis of its role in cancer pathogenesis. We used genetic and antibody-based approaches to attenuate CXCL4L1 in models of pancreatic ductal adenocarcinoma (PDAC). Mechanisms of expression were assessed in cell coculture experiments, murine, and avian xenotransplants, including through an evaluation of CpG methylation and mutation of critical CpG residues. CXCL4L1 gene expression was increased greatly in primary and metastatic PDAC. We found that myofibroblasts triggered cues in the tumor microenvironment, which led to induction of CXCL4L1 in tumor cells. CXCL4L1 expression was also controlled by epigenetic modifications at critical CpG islands, which were mapped. CXCL4L1 inhibited angiogenesis but also affected tumor development more directly, depending on the tumor cell type. In vivo administration of an mAb against CXCL4L1 demonstrated a blockade in the growth of tumors positive for CXCR3, a critical receptor for CXCL4 ligands. Our findings define a protumorigenic role in PDAC development for endogenous CXCL4L1, which is independent of its antiangiogenic function. Cancer Res; 76(22); 6507-19. ©2016 AACR. ©2016 American Association for Cancer Research.

  3. Alterations of the spindle checkpoint pathway in clinicopathologically aggressive CpG island methylator phenotype clear cell renal cell carcinomas.

    PubMed

    Arai, Eri; Gotoh, Masahiro; Tian, Ying; Sakamoto, Hiromi; Ono, Masaya; Matsuda, Akio; Takahashi, Yoriko; Miyata, Sayaka; Totsuka, Hirohiko; Chiku, Suenori; Komiyama, Motokiyo; Fujimoto, Hiroyuki; Matsumoto, Kenji; Yamada, Tesshi; Yoshida, Teruhiko; Kanai, Yae

    2015-12-01

    CpG-island methylator phenotype (CIMP)-positive clear cell renal cell carcinomas (RCCs) are characterized by accumulation of DNA hypermethylation of CpG islands, clinicopathological aggressiveness and poor patient outcome. The aim of this study was to clarify the molecular pathways participating in CIMP-positive renal carcinogenesis. Genome (whole-exome and copy number), transcriptome and proteome (two-dimensional image converted analysis of liquid chromatography-mass spectrometry) analyses were performed using tissue specimens of 87 CIMP-negative and 14 CIMP-positive clear cell RCCs and corresponding specimens of non-cancerous renal cortex. Genes encoding microtubule-associated proteins, such as DNAH2, DNAH5, DNAH10, RP1 and HAUS8, showed a 10% or higher incidence of genetic aberrations (non-synonymous single-nucleotide mutations and insertions/deletions) in CIMP-positive RCCs, whereas CIMP-negative RCCs lacked distinct genetic characteristics. MetaCore pathway analysis of CIMP-positive RCCs revealed that alterations of mRNA or protein expression were significantly accumulated in six pathways, all participating in the spindle checkpoint, including the "The metaphase checkpoint (p = 1.427 × 10(-6))," "Role of Anaphase Promoting Complex in cell cycle regulation (p = 7.444 × 10(-6))" and "Spindle assembly and chromosome separation (p = 9.260 × 10(-6))" pathways. Quantitative RT-PCR analysis revealed that mRNA expression levels for genes included in such pathways, i.e., AURKA, AURKB, BIRC5, BUB1, CDC20, NEK2 and SPC25, were significantly higher in CIMP-positive than in CIMP-negative RCCs. All CIMP-positive RCCs showed overexpression of Aurora kinases, AURKA and AURKB, and this overexpression was mainly attributable to increased copy number. These data suggest that abnormalities of the spindle checkpoint pathway participate in CIMP-positive renal carcinogenesis, and that AURKA and AURKB may be potential therapeutic targets in more aggressive CIMP-positive RCCs. © 2015 The Authors. Published by Wiley Periodicals, Inc. on behalf of UICC.

  4. Alterations of the spindle checkpoint pathway in clinicopathologically aggressive CpG island methylator phenotype clear cell renal cell carcinomas

    PubMed Central

    Arai, Eri; Gotoh, Masahiro; Tian, Ying; Sakamoto, Hiromi; Ono, Masaya; Matsuda, Akio; Takahashi, Yoriko; Miyata, Sayaka; Totsuka, Hirohiko; Chiku, Suenori; Komiyama, Motokiyo; Fujimoto, Hiroyuki; Matsumoto, Kenji; Yamada, Tesshi; Yoshida, Teruhiko

    2015-01-01

    CpG‐island methylator phenotype (CIMP)‐positive clear cell renal cell carcinomas (RCCs) are characterized by accumulation of DNA hypermethylation of CpG islands, clinicopathological aggressiveness and poor patient outcome. The aim of this study was to clarify the molecular pathways participating in CIMP‐positive renal carcinogenesis. Genome (whole‐exome and copy number), transcriptome and proteome (two‐dimensional image converted analysis of liquid chromatography‐mass spectrometry) analyses were performed using tissue specimens of 87 CIMP‐negative and 14 CIMP‐positive clear cell RCCs and corresponding specimens of non‐cancerous renal cortex. Genes encoding microtubule‐associated proteins, such as DNAH2, DNAH5, DNAH10, RP1 and HAUS8, showed a 10% or higher incidence of genetic aberrations (non‐synonymous single‐nucleotide mutations and insertions/deletions) in CIMP‐positive RCCs, whereas CIMP‐negative RCCs lacked distinct genetic characteristics. MetaCore pathway analysis of CIMP‐positive RCCs revealed that alterations of mRNA or protein expression were significantly accumulated in six pathways, all participating in the spindle checkpoint, including the “The metaphase checkpoint (p = 1.427 × 10−6),” “Role of Anaphase Promoting Complex in cell cycle regulation (p = 7.444 × 10−6)” and “Spindle assembly and chromosome separation (p = 9.260 × 10−6)” pathways. Quantitative RT‐PCR analysis revealed that mRNA expression levels for genes included in such pathways, i.e., AURKA, AURKB, BIRC5, BUB1, CDC20, NEK2 and SPC25, were significantly higher in CIMP‐positive than in CIMP‐negative RCCs. All CIMP‐positive RCCs showed overexpression of Aurora kinases, AURKA and AURKB, and this overexpression was mainly attributable to increased copy number. These data suggest that abnormalities of the spindle checkpoint pathway participate in CIMP‐positive renal carcinogenesis, and that AURKA and AURKB may be potential therapeutic targets in more aggressive CIMP‐positive RCCs. PMID:26061684

  5. PISMA: A Visual Representation of Motif Distribution in DNA Sequences.

    PubMed

    Alcántara-Silva, Rogelio; Alvarado-Hermida, Moisés; Díaz-Contreras, Gibrán; Sánchez-Barrios, Martha; Carrera, Samantha; Galván, Silvia Carolina

    2017-01-01

    Because the graphical presentation and analysis of motif distribution can provide insights for experimental hypothesis, PISMA aims at identifying motifs on DNA sequences, counting and showing them graphically. The motif length ranges from 2 to 10 bases, and the DNA sequences range up to 10 kb. The motif distribution is shown as a bar-code-like, as a gene-map-like, and as a transcript scheme. We obtained graphical schemes of the CpG site distribution from 91 human papillomavirus genomes. Also, we present 2 analyses: one of DNA motifs associated with either methylation-resistant or methylation-sensitive CpG islands and another analysis of motifs associated with exosome RNA secretion. PISMA is developed in Java; it is executable in any type of hardware and in diverse operating systems. PISMA is freely available to noncommercial users. The English version and the User Manual are provided in Supplementary Files 1 and 2, and a Spanish version is available at www.biomedicas.unam.mx/wp-content/software/pisma.zip and www.biomedicas.unam.mx/wp-content/pdf/manual/pisma.pdf.

  6. DNA Methylation Errors in Cloned Mouse Sperm by Germ Line Barrier Evasion.

    PubMed

    Koike, Tasuku; Wakai, Takuya; Jincho, Yuko; Sakashita, Akihiko; Kobayashi, Hisato; Mizutani, Eiji; Wakayama, Sayaka; Miura, Fumihito; Ito, Takashi; Kono, Tomohiro

    2016-06-01

    The germ line reprogramming barrier resets parental epigenetic modifications according to sex, conferring totipotency to mammalian embryos upon fertilization. However, it is not known whether epigenetic errors are committed during germ line reprogramming that are then transmitted to germ cells, and consequently to offspring. We addressed this question in the present study by performing a genome-wide DNA methylation analysis using a target postbisulfite sequencing method in order to identify DNA methylation errors in cloned mouse sperm. The sperm genomes of two somatic cell-cloned mice (CL1 and CL7) contained significantly higher numbers of differentially methylated CpG sites (P = 0.0045 and P = 0.0116). As a result, they had higher numbers of differentially methylated CpG islands. However, there was no evidence that these sites were transmitted to the sperm genome of offspring. These results suggest that DNA methylation errors resulting from embryo cloning are transmitted to the sperm genome by evading the germ line reprogramming barrier. © 2016 by the Society for the Study of Reproduction, Inc.

  7. Neonatal Persistent Exposure to 6-Propyl-2-thiouracil, a Thyroid-Disrupting Chemical, Differentially Modulates Expression of Hepatic Catalase and C/EBP-β in Adult Rats.

    PubMed

    Bunker, Suresh Kumar; Dandapat, Jagneshwar; Sahoo, Sunil Kumar; Roy, Anita; Chainy, Gagan B N

    2016-02-01

    Persistent exposure of rats to 6-propyl-2-thiouracil (PTU) from birth resulted in decreases in plasma thyroid hormone (TH) levels and hepatic expression of catalase and CCAAT enhancer binding protein β (C/EBP-β). Catalase promoter region (-185 to +52) that contains binding sites for C/EBP-β showed an augmentation in the methylation level along with a change in methylation pattern of CpG islands in response to PTU treatment. PTU withdrawal on 30 days of birth restored TH levels and C/EBP-β to control rats in adulthood. Although catalase expression was restored to some extent in adult rats in response to PTU withdrawal, a permanent change in its promoter CpG methylation pattern was recorded. The results suggest that downregulation of adult hepatic catalase gene in response to persistent neonatal PTU exposure may not solely be attributed to thyroid-disrupting properties of PTU. It is possible that besides thyroid-disrupting behavior, PTU may impair expression of hepatic catalase by altering methylation pattern of its promoter. © 2015 Wiley Periodicals, Inc.

  8. Dietary vitamin E deficiency does not affect global and specific DNA methylation patterns in rat liver.

    PubMed

    Fischer, Alexandra; Gaedicke, Sonja; Frank, Jan; Döring, Frank; Rimbach, Gerald

    2010-10-01

    The aim of the present study was to determine the effects of a 6-month dietary vitamin E (VE) deficiency on DNA methylation and gene expression in rat liver. Two enzymes, 5-α-steroid reductase type 1 (SRD5A1) and the regulatory subunit of γ-glutamylcysteinyl synthetase (GCLM), which are differentially expressed on the mRNA level, were analysed for promoter methylation in putative cytosine-phospho-guanine (CpG) island regions located at the 5' end using base-specific cleavage and matrix-assisted laser desorption ionisation time-of-flight MS. A twofold increase in the mRNA level of SRD5A1 gene and a twofold decrease in the mRNA level of GCLM gene in VE-deficient animals were not associated with different CpG methylation of the analysed promoter region. Furthermore, global DNA methylation was not significantly different in these two groups. Thus, the present results indicate that the VE-induced regulation of SRD5A1 and GCLM in rat liver is not directly mediated by changes in promoter DNA methylation.

  9. PISMA: A Visual Representation of Motif Distribution in DNA Sequences

    PubMed Central

    Alcántara-Silva, Rogelio; Alvarado-Hermida, Moisés; Díaz-Contreras, Gibrán; Sánchez-Barrios, Martha; Carrera, Samantha; Galván, Silvia Carolina

    2017-01-01

    Background: Because the graphical presentation and analysis of motif distribution can provide insights for experimental hypothesis, PISMA aims at identifying motifs on DNA sequences, counting and showing them graphically. The motif length ranges from 2 to 10 bases, and the DNA sequences range up to 10 kb. The motif distribution is shown as a bar-code–like, as a gene-map–like, and as a transcript scheme. Results: We obtained graphical schemes of the CpG site distribution from 91 human papillomavirus genomes. Also, we present 2 analyses: one of DNA motifs associated with either methylation-resistant or methylation-sensitive CpG islands and another analysis of motifs associated with exosome RNA secretion. Availability and Implementation: PISMA is developed in Java; it is executable in any type of hardware and in diverse operating systems. PISMA is freely available to noncommercial users. The English version and the User Manual are provided in Supplementary Files 1 and 2, and a Spanish version is available at www.biomedicas.unam.mx/wp-content/software/pisma.zip and www.biomedicas.unam.mx/wp-content/pdf/manual/pisma.pdf. PMID:28469418

  10. Genetic and Epigenetic Inactivation of Kruppel-like Factor 4 in Medulloblastoma1

    PubMed Central

    Nakahara, Yukiko; Northcott, Paul A; Li, Meihua; Kongkham, Paul N; Smith, Christian; Yan, Hai; Croul, Sidney; Ra, Young-Shin; Eberhart, Charles; Huang, Annie; Bigner, Darell; Grajkowska, Wesia; Van Meter, Timothy; Rutka, James T; Taylor, Michael D

    2010-01-01

    Although medulloblastoma is the most common pediatric malignant brain tumor, its molecular underpinnings are largely unknown. We have identified rare, recurrent homozygous deletions of Kruppel-like Factor 4 (KLF4) in medulloblastoma using high-resolution single nucleotide polymorphism arrays, digital karyotyping, and genomic real-time polymerase chain reaction (PCR). Furthermore, we show that there is loss of physiological KLF4 expression in more than 40% of primary medulloblastomas both at the RNA and protein levels. Medulloblastoma cell lines drastically increase the expression of KLF4 in response to the demethylating agent 5-azacytidine and demonstrate dense methylation of the promoter CpG island by bisulfite sequencing. Methylation-specific PCR targeting the KLF4 promoter demonstrates CpG methylation in approximately 16% of primary medulloblastomas. Reexpression of KLF4 in the D283 medulloblastoma cell line results in significant growth suppression both in vitro and in vivo. We conclude that KLF4 is inactivated by either genetic or epigenetic mechanisms in a large subset of medulloblastomas and that it likely functions as a tumor suppressor gene in the pathogenesis of medulloblastoma. PMID:20072650

  11. Formulation of vaccines containing CpG oligonucleotides and alum

    PubMed Central

    Aebig, Joan A.; Mullen, Gregory E. D.; Dobrescu, Gelu; Rausch, Kelly; Lambert, Lynn; Ajose-Popoola, Olubunmi; Long, Carole A.; Saul, Allan; Miles, Aaron P.

    2007-01-01

    CpG oligodeoxynucleotides are potent immunostimulants. For parenterally delivered alum based vaccines, the immunostimulatory effect of CpG depends on the association of the CpG and antigen to the alum. We describe effects of buffer components on the binding of CPG 7909 to aluminum hydroxide (Alhydrogel), assays for measuring binding of CPG 7909 to alum and CPG 7909 induced dissociation of antigen from the alum. Free CPG 7909 is a potent inducer of IP-10 in mice. However the lack of IP-10 production from formulations containing bound CPG 7909 suggested that CPG 7909 does not rapidly dissociate from the alum after injection. It also suggests that IP-10 assays are not a good basis for potency assays for alum based vaccines containing CPG 7909. PMID:17512533

  12. Distinct features between MLH1-methylated and unmethylated colorectal carcinomas with the CpG island methylator phenotype: implications in the serrated neoplasia pathway

    PubMed Central

    Cho, Nam-Yun; Kang, Gyeong Hoon

    2016-01-01

    The presence or absence of MLH1 methylation may critically affect the heterogeneity of colorectal carcinoma (CRC) with the CpG island methylator phenotype (CIMP). Here, we investigated the differential characteristics of CIMP-high (CIMP-H) CRCs according to MLH1 methylation status. To further confirm the MLH1-dependent features in CIMP-H CRC, an independent analysis was performed using data from The Cancer Genome Atlas (TCGA). In our CIMP-H CRC samples, MLH1-methylated tumors were characterized by older patient age, proximal colonic location, mucinous histology, intense lymphoid reactions, RUNX3/SOCS1 promoter methylation, BRAF mutations, and microsatellite instability-high (MSI-H) status. By contrast, MLH1-unmethylated tumors were associated with earlier age of onset, increased distal colorectal localization, adverse pathologic features, and KRAS mutations. In the TCGA dataset, the MLH1-silenced CIMP-H CRC demonstrated proximal location, MSI-H status, hypermutated phenotype, and frequent BRAF mutations, but the MLH1-non-silenced CIMP-H CRC was significantly associated with high frequencies of KRAS and APC mutations. In conclusion, the differential nature of CIMP-H CRCs depends primarily on the MLH1 methylation status. Based on the current knowledge, the sessile serrated adenoma/polyp may be the major precursor of MLH1-methylated CIMP-H CRCs, whereas MLH1-unmethylated CIMP-H CRCs may develop predominantly from KRAS-mutated traditional serrated adenomas and less commonly from BRAF-mutated traditional serrated adenomas and/or sessile serrated adenomas/polyps. PMID:26883113

  13. Distinct features between MLH1-methylated and unmethylated colorectal carcinomas with the CpG island methylator phenotype: implications in the serrated neoplasia pathway.

    PubMed

    Kim, Jung Ho; Bae, Jeong Mo; Cho, Nam-Yun; Kang, Gyeong Hoon

    2016-03-22

    The presence or absence of MLH1 methylation may critically affect the heterogeneity of colorectal carcinoma (CRC) with the CpG island methylator phenotype (CIMP). Here, we investigated the differential characteristics of CIMP-high (CIMP-H) CRCs according to MLH1 methylation status. To further confirm the MLH1-dependent features in CIMP-H CRC, an independent analysis was performed using data from The Cancer Genome Atlas (TCGA). In our CIMP-H CRC samples, MLH1-methylated tumors were characterized by older patient age, proximal colonic location, mucinous histology, intense lymphoid reactions, RUNX3/SOCS1 promoter methylation, BRAF mutations, and microsatellite instability-high (MSI-H) status. By contrast, MLH1-unmethylated tumors were associated with earlier age of onset, increased distal colorectal localization, adverse pathologic features, and KRAS mutations. In the TCGA dataset, the MLH1-silenced CIMP-H CRC demonstrated proximal location, MSI-H status, hypermutated phenotype, and frequent BRAF mutations, but the MLH1-non-silenced CIMP-H CRC was significantly associated with high frequencies of KRAS and APC mutations. In conclusion, the differential nature of CIMP-H CRCs depends primarily on the MLH1 methylation status. Based on the current knowledge, the sessile serrated adenoma/polyp may be the major precursor of MLH1-methylated CIMP-H CRCs, whereas MLH1-unmethylated CIMP-H CRCs may develop predominantly from KRAS-mutated traditional serrated adenomas and less commonly from BRAF-mutated traditional serrated adenomas and/or sessile serrated adenomas/polyps.

  14. Increased Frequency of CpG Island Methylator Phenotype and CDH1 Methylation in a Gastric Cancer High-Risk Region of China1

    PubMed Central

    Zhang, Kai-Li; Sun, Yuan; Li, Yan; Liu, Ming; Qu, Bo; Cui, Shu-Hong; Kong, Qing-You; Chen, Xiao-Yan; Li, Hong; Liu, Jia

    2008-01-01

    This study aimed to profile the methylation statuses of CDH1/E-cadherin and five CpG island methylator phenotype (CIMP)-associated genes (p16, hMLH1, MINT1, MINT2, and MINT31) in gastric specimens of 47 Dalian long-term residents with and 31 without gastric cancers (GCs). CIMP patterns were classified as CIMP-H with over three methylated genes, CIMP-L with one to two methylated genes, and CIMP-N without methylation. Of 47 GC cases, 24 (51.1%) were CIMP-H, 18 (38.3%) were CIMP-L, and 5 (10.6%) were CIMP-N, whereas 5 of 21 (23.8%) premalignant lesions were CIMP-H and 15 (71.4%) were CIMP-L. CIMP-L was found in 75% (12/16) of GC-adjacent mucosa and in 38.7% (12/31) of mucosa from GC-free patients. CDH1 methylation occurred in 48.9% (23/47) of cancer, in 23.8% (5/21) of premalignant, and in 25% (4/16) of noncancerous tissues and was correlated with patients' age (P = .01), lymph node metastasis, and CIMP severity (P = .000–.028). Our results demonstrated that the frequencies of CIMP-H in Dalian GCs, CIMP-L, and p16 methylation in GC-adjacent tissues and in GC-free mucosa were much higher than those reported previously, indicating the elevated methylation pressure in this GC high-risk region. The close correlation between CDH1 methylation and CIMP severity suggests the necessity of their combination in GC prevention and earlier diagnosis. PMID:18607505

  15. Multigene methylation analysis of ocular adnexal MALT lymphoma and their relationship to Chlamydophila psittaci infection and clinical characteristics in South Korea.

    PubMed

    Choung, Ho-Kyung; Kim, Young A; Lee, Min Joung; Kim, Namju; Khwarg, Sang In

    2012-04-06

    We investigated the aberrant promoter methylation status of known or suspected tumor suppressor genes in ocular adnexal lymphoma (OAL) and the possible association with clinical characteristics and Chlamydophila psittaci infection. Thirty-five cases of ocular adnexal mucosa-associated lymphoid tissue (MALT) lymphoma cases were examined for the methylation status of nine genes using methylation-specific PCR and for the detection of C. psittaci DNA using PCR. The medical records were reviewed retrospectively. Patient demographics, clinical characteristics including the response of the lymphoma to the therapy, and C. psittaci infection status were evaluated for possible association with methylation frequencies. CpG island methylation in nine genes was variously found as follows; DAPK (94.3%), ECAD (77.1%), MT1G (48.6%), THBS1 (37.1%), RAR-β (31.4%), p16 (20%), MGMT (5.7%), p14 (0%), and RASSF1A (0%). Methylation was not observed in any of 13 control cases. C. psittaci DNA was observed in 25 (75.8%) of 33 patients with available tumor tissues, and ECAD hypermethylation was significantly higher in C. psittaci-positive cases (P = 0.041). Promoter hypermethylation status was not correlated with clinical characteristics. Aberrant CpG island methylation of tumor suppressor genes is a frequent event in ocular adnexal MALT lymphoma. In particular, high frequencies of DAPK and ECAD methylation may be strongly correlated with ocular adnexal MALT lymphomagenesis in South Korea. Furthermore, ECAD hypermethylation is closely associated with C. psittaci infection, which may shed light on the mechanisms of bacterium-induced oncogenesis.

  16. Human papillomavirus type 16 E6 suppresses microRNA-23b expression in human cervical cancer cells through DNA methylation of the host gene C9orf3.

    PubMed

    Yeung, Chi Lam Au; Tsang, Tsun Yee; Yau, Pak Lun; Kwok, Tim Tak

    2017-02-14

    Oncogenic protein E6 of human papillomavirus type 16 (HPV-16) is believed to involve in the aberrant methylation in cervical cancer as it upregulates DNA methyltransferase 1 (DNMT1) through tumor suppressor p53. In addition, DNA demethylating agent induces the expression of one of the HPV-16 E6 regulated microRNAs (miRs), miR-23b, in human cervical carcinoma SiHa cells. Thus, the importance of DNA methylation and miR-23b in HPV-16 E6 associated cervical cancer development is investigated. In the present study, however, it is found that miR-23b is not embedded in any typical CpG island. Nevertheless, a functional CpG island is predicted in the promoter region of C9orf3, the host gene of miR-23b, and is validated by methylation-specific PCR and bisulfite genomic sequencing analyses. Besides, c-MET is confirmed to be a target gene of miR-23b. Silencing of HPV-16 E6 is found to increase the expression of miR-23b, decrease the expression of c-MET and thus induce the apoptosis of SiHa cells through the c-MET downstream signaling pathway. Taken together, the tumor suppressive miR-23b is epigenetically inactivated through its host gene C9orf3 and this is probably a critical pathway during HPV-16 E6 associated cervical cancer development.

  17. Aldosterone alters the chromatin structure of the murine endothelin-1 gene.

    PubMed

    Welch, Amanda K; Jeanette Lynch, I; Gumz, Michelle L; Cain, Brian D; Wingo, Charles S

    2016-08-15

    Aldosterone increases sodium reabsorption in the renal collecting duct and systemic blood pressure. Paradoxically, aldosterone also induces transcription of the endothelin-1 (Edn1) gene to increase protein (ET-1) levels, which inhibits sodium reabsorption. Here we investigated changes in the chromatin structure of the Edn1 gene of collecting duct cell lines in response to aldosterone treatment. The Edn1 gene has a CpG island that encompasses the transcription start site and four sites in the 5' regulatory region previously linked to transcriptional regulation. The chromatin structure of the Edn1 gene was investigated using a quantitative PCR-based DNaseI hypersensitivity assay in murine hepatocyte (AML12), renal cortical collecting duct (mpkCCDC14), outer medullary collecting duct1 (OMCD1), and inner medullary collecting duct-3 (IMCD-3) cell lines. The CpG island was uniformly accessible. One calcium-responsive NFAT element remained at low chromatin accessibility in all cell lines under all conditions tested. However, the second calcium responsive NFAT element located at -1563bp upstream became markedly more accessible in IMCD-3 cells exposed to aldosterone. Importantly, one established aldosterone hormone response element HRE at -671bp relative to the transcription start site was highly accessible, and another HRE (-551bp) became more accessible in aldosterone-treated IMCD-3 and OMCD1 cells. The evidence supports a model in which aldosterone activation of the mineralocorticoid receptor (MR) results in the MR-hormone complex binding at HRE at -671bp to open chromatin structure around other regulatory elements in the Edn1 gene. Published by Elsevier Inc.

  18. Correlation of beta-catenin localization with cyclooxygenase-2 expression and CpG island methylator phenotype (CIMP) in colorectal cancer.

    PubMed

    Kawasaki, Takako; Nosho, Katsuhiko; Ohnishi, Mutsuko; Suemoto, Yuko; Kirkner, Gregory J; Dehari, Reiko; Meyerhardt, Jeffrey A; Fuchs, Charles S; Ogino, Shuji

    2007-07-01

    The WNT/beta-catenin (CTNNB1) pathway is commonly activated in the carcinogenic process. Cross-talks between the WNT and cyclooxygenase-2 (COX-2 or PTGS2)/prostaglandin pathways have been suggested. The relationship between beta-catenin activation and microsatellite instability (MSI) in colorectal cancer has been controversial. The CpG island methylator phenotype (CIMP or CIMP-high) with widespread promoter methylation is a distinct epigenetic phenotype in colorectal cancer, which is associated with MSI-high. However, no study has examined the relationship between beta-catenin activation and CIMP status. Using 832 population-based colorectal cancer specimens, we assessed beta-catenin localization by immunohistochemistry. We quantified DNA methylation in eight CIMP-specific promoters [CACNA1G, CDKN2A(p16), CRABP1, IGF2, MLH1, NEUROG1, RUNX3, and SOCS1] by real-time polymerase chain reaction (MethyLight). MSI-high, CIMP-high, and BRAF mutation were associated inversely with cytoplasmic and nuclear beta-catenin expressions (i.e., beta-catenin activation) and associated positively with membrane expression. The inverse relation between beta-catenin activation and CIMP was independent of MSI. COX-2 overexpression correlated with cytoplasmic beta-catenin expression (even after tumors were stratified by CIMP status), but did not correlate significantly with nuclear or membrane expression. In conclusion, beta-catenin activation is inversely associated with CIMP-high independent of MSI status. Cytoplasmic beta-catenin is associated with COX-2 overexpression, supporting the role of cytoplasmic beta-catenin in stabilizing PTGS2 (COX-2) mRNA.

  19. The CpG island methylator phenotype is concordant between primary colorectal carcinoma and matched distant metastases.

    PubMed

    Cohen, Stacey A; Yu, Ming; Baker, Kelsey; Redman, Mary; Wu, Chen; Heinzerling, Tai J; Wirtz, Ralph M; Charalambous, Elpida; Pentheroudakis, George; Kotoula, Vassiliki; Kalogeras, Konstantine T; Fountzilas, George; Grady, William M

    2017-01-01

    The CpG island methylator phenotype (CIMP) in stage III colon cancer (CRC) has been associated with improved survival after treatment with adjuvant irinotecan-based chemotherapy. In this analysis, we determine whether CIMP status in the primary CRC is concordant with the CIMP status of matched metastases in order to determine if assessment of CIMP status in the primary tumor can be used to predict CIMP status of metastatic disease, which is relevant for patient management as well as for understanding the biology of CIMP CRCs. We assessed the CIMP status of 70 pairs of primary CRC and matched metastases using a CRC-specific panel of five markers ( CACNA1G , IGF2 , NEUROG1 , RUNX3 , and SOCS1 ) where CIMP positive was defined as 3/5 positive markers at a percent methylated reference threshold of ≥10%. Concordance was compared using the Fisher's exact test and P  < 0.05 was considered significant. Sixty-nine of the pairs (98.6%) showed concordant CIMP status in the primary tumor and matched metastasis; five (7.0%) of the pairs were concordantly CIMP positive. Only one pair (1.4%) had divergent CIMP status, demonstrating CIMP positivity (4/5 markers positive) in the primary tumor, while the matched metastasis was CIMP negative (0 markers positive). CIMP status is generally concordant between primary CRCs and matched metastases. Thus, CIMP status in the primary tumor is maintained in matched metastases and can be used to inform CIMP-based therapy options for the metastases.

  20. CpG island methylator phenotype identifies high risk patients among microsatellite stable BRAF mutated colorectal cancers.

    PubMed

    Vedeld, Hege Marie; Merok, Marianne; Jeanmougin, Marine; Danielsen, Stine A; Honne, Hilde; Presthus, Gro Kummeneje; Svindland, Aud; Sjo, Ole H; Hektoen, Merete; Eknaes, Mette; Nesbakken, Arild; Lothe, Ragnhild A; Lind, Guro E

    2017-09-01

    The prognostic value of CpG island methylator phenotype (CIMP) in colorectal cancer remains unsettled. We aimed to assess the prognostic value of this phenotype analyzing a total of 1126 tumor samples obtained from two Norwegian consecutive colorectal cancer series. CIMP status was determined by analyzing the 5-markers CAGNA1G, IGF2, NEUROG1, RUNX3 and SOCS1 by quantitative methylation specific PCR (qMSP). The effect of CIMP on time to recurrence (TTR) and overall survival (OS) were determined by uni- and multivariate analyses. Subgroup analyses were conducted according to MSI and BRAF mutation status, disease stage, and also age at time of diagnosis (<60, 60-74, ≥75 years). Patients with CIMP positive tumors demonstrated significantly shorter TTR and worse OS compared to those with CIMP negative tumors (multivariate hazard ratio [95% CI] 1.86 [1.31-2.63] and 1.89 [1.34-2.65], respectively). In stratified analyses, CIMP tumors showed significantly worse outcome among patients with microsatellite stable (MSS, P < 0.001), and MSS BRAF mutated tumors (P < 0.001), a finding that persisted in patients with stage II, III or IV disease, and that remained significant in multivariate analysis (P < 0.01). Consistent results were found for all three age groups. To conclude, CIMP is significantly associated with inferior outcome for colorectal cancer patients, and can stratify the poor prognostic patients with MSS BRAF mutated tumors. © 2017 The Authors International Journal of Cancer published by John Wiley & Sons Ltd on behalf of UICC.

  1. Integrated genetic and epigenetic analysis identifies three different subclasses of colon cancer

    PubMed Central

    Shen, Lanlan; Toyota, Minoru; Kondo, Yutaka; Lin, E; Zhang, Li; Guo, Yi; Hernandez, Natalie Supunpong; Chen, Xinli; Ahmed, Saira; Konishi, Kazuo; Hamilton, Stanley R.; Issa, Jean-Pierre J.

    2007-01-01

    Colon cancer has been viewed as the result of progressive accumulation of genetic and epigenetic abnormalities. However, this view does not fully reflect the molecular heterogeneity of the disease. We have analyzed both genetic (mutations of BRAF, KRAS, and p53 and microsatellite instability) and epigenetic alterations (DNA methylation of 27 CpG island promoter regions) in 97 primary colorectal cancer patients. Two clustering analyses on the basis of either epigenetic profiling or a combination of genetic and epigenetic profiling were performed to identify subclasses with distinct molecular signatures. Unsupervised hierarchical clustering of the DNA methylation data identified three distinct groups of colon cancers named CpG island methylator phenotype (CIMP) 1, CIMP2, and CIMP negative. Genetically, these three groups correspond to very distinct profiles. CIMP1 are characterized by MSI (80%) and BRAF mutations (53%) and rare KRAS and p53 mutations (16% and 11%, respectively). CIMP2 is associated with 92% KRAS mutations and rare MSI, BRAF, or p53 mutations (0, 4, and 31% respectively). CIMP-negative cases have a high rate of p53 mutations (71%) and lower rates of MSI (12%) or mutations of BRAF (2%) or KRAS (33%). Clustering based on both genetic and epigenetic parameters also identifies three distinct (and homogeneous) groups that largely overlap with the previous classification. The three groups are independent of age, gender, or stage, but CIMP1 and 2 are more common in proximal tumors. Together, our integrated genetic and epigenetic analysis reveals that colon cancers correspond to three molecularly distinct subclasses of disease. PMID:18003927

  2. Significant impact of amount of PCR input templates on various PCR-based DNA methylation analysis and countermeasure.

    PubMed

    Liu, Zhaojun; Zhou, Jing; Gu, Liankun; Deng, Dajun

    2016-08-30

    Methylation changes of CpG islands can be determined using PCR-based assays. However, the exact impact of the amount of input templates (TAIT) on DNA methylation analysis has not been previously recognized. Using COL2A1 gene as an input reference, TAIT difference between human tissues with methylation-positive and -negative detection was calculated for two representative genes GFRA1 and P16. Results revealed that TAIT in GFRA1 methylation-positive frozen samples (n = 332) was significantly higher than the methylation-negative ones (n = 44) (P < 0.001). Similar difference was found in P16 methylation analysis. The TAIT-related effect was also observed in methylation-specific PCR (MSP) and denatured high performance liquid chromatography (DHPLC) analysis. Further study showed that the minimum TAIT for a successful MethyLight PCR reaction should be ≥ 9.4 ng (CtCOL2A1 ≤ 29.3), when the cutoff value of the methylated-GFRA1 proportion for methylation-positive detection was set at 1.6%. After TAIT of the methylation non-informative frozen samples (n = 94; CtCOL2A1 > 29.3) was increased above the minimum TAIT, the methylation-positive rate increased from 72.3% to 95.7% for GFRA1 and 26.6% to 54.3% for P16, respectively (Ps < 0.001). Similar results were observed in the FFPE samples. In conclusion, TAIT critically affects results of various PCR-based DNA methylation analyses. Characterization of the minimum TAIT for target CpG islands is essential to avoid false-negative results.

  3. REST–Mediated Recruitment of Polycomb Repressor Complexes in Mammalian Cells

    PubMed Central

    Landt, Eskild; Agrawal-Singh, Shuchi; Bak, Mads; Tommerup, Niels; Rappsilber, Juri; Södersten, Erik; Hansen, Klaus

    2012-01-01

    Polycomb Repressive Complex (PRC) 1 and PRC2 regulate genes involved in differentiation and development. However, the mechanism for how PRC1 and PRC2 are recruited to genes in mammalian cells is unclear. Here we present evidence for an interaction between the transcription factor REST, PRC1, and PRC2 and show that RNF2 and REST co-regulate a number of neuronal genes in human teratocarcinoma cells (NT2-D1). Using NT2-D1 cells as a model of neuronal differentiation, we furthermore showed that retinoic-acid stimulation led to displacement of PRC1 at REST binding sites, reduced H3K27Me3, and increased gene expression. Genome-wide analysis of Polycomb binding in Rest−/− and Eed−/− mouse embryonic stem (mES) cells showed that Rest was required for PRC1 recruitment to a subset of Polycomb regulated neuronal genes. Furthermore, we found that PRC1 can be recruited to Rest binding sites independently of CpG islands and the H3K27Me3 mark. Surprisingly, PRC2 was frequently increased around Rest binding sites located in CpG-rich regions in the Rest−/− mES cells, indicating a more complex interplay where Rest also can limit PRC2 recruitment. Therefore, we propose that Rest has context-dependent functions for PRC1- and PRC2- recruitment, which allows this transcription factor to act both as a recruiter of Polycomb as well as a limiting factor for PRC2 recruitment at CpG islands. PMID:22396653

  4. Regulation of Hepatic Triacylglycerol Metabolism by CGI-58 Does Not Require ATGL Co-activation.

    PubMed

    Lord, Caleb C; Ferguson, Daniel; Thomas, Gwynneth; Brown, Amanda L; Schugar, Rebecca C; Burrows, Amy; Gromovsky, Anthony D; Betters, Jenna; Neumann, Chase; Sacks, Jessica; Marshall, Stephanie; Watts, Russell; Schweiger, Martina; Lee, Richard G; Crooke, Rosanne M; Graham, Mark J; Lathia, Justin D; Sakaguchi, Takuya F; Lehner, Richard; Haemmerle, Guenter; Zechner, Rudolf; Brown, J Mark

    2016-07-26

    Adipose triglyceride lipase (ATGL) and comparative gene identification 58 (CGI-58) are critical regulators of triacylglycerol (TAG) turnover. CGI-58 is thought to regulate TAG mobilization by stimulating the enzymatic activity of ATGL. However, it is not known whether this coactivation function of CGI-58 occurs in vivo. Moreover, the phenotype of human CGI-58 mutations suggests ATGL-independent functions. Through direct comparison of mice with single or double deficiency of CGI-58 and ATGL, we show here that CGI-58 knockdown causes hepatic steatosis in both the presence and absence of ATGL. CGI-58 also regulates hepatic diacylglycerol (DAG) and inflammation in an ATGL-independent manner. Interestingly, ATGL deficiency, but not CGI-58 deficiency, results in suppression of the hepatic and adipose de novo lipogenic program. Collectively, these findings show that CGI-58 regulates hepatic neutral lipid storage and inflammation in the genetic absence of ATGL, demonstrating that mechanisms driving TAG lipolysis in hepatocytes differ significantly from those in adipocytes. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.

  5. Reassessing the Potential Activities of Plant CGI-58 Protein

    PubMed Central

    Khatib, Abdallah; Arhab, Yani; Bentebibel, Assia; Abousalham, Abdelkarim; Noiriel, Alexandre

    2016-01-01

    Comparative Gene Identification-58 (CGI-58) is a widespread protein found in animals and plants. This protein has been shown to participate in lipolysis in mice and humans by activating Adipose triglyceride lipase (ATGL), the initial enzyme responsible for the triacylglycerol (TAG) catabolism cascade. Human mutation of CGI-58 is the cause of Chanarin-Dorfman syndrome, an orphan disease characterized by a systemic accumulation of TAG which engenders tissue disorders. The CGI-58 protein has also been shown to participate in neutral lipid metabolism in plants and, in this case, a mutation again provokes TAG accumulation. Although its roles as an ATGL coactivator and in lipid metabolism are quite clear, the catalytic activity of CGI-58 is still in question. The acyltransferase activities of CGI-58 have been speculated about, reported or even dismissed and experimental evidence that CGI-58 expressed in E. coli possesses an unambiguous catalytic activity is still lacking. To address this problem, we developed a new set of plasmids and site-directed mutants to elucidate the in vivo effects of CGI-58 expression on lipid metabolism in E. coli. By analyzing the lipid composition in selected E. coli strains expressing CGI-58 proteins, and by reinvestigating enzymatic tests with adequate controls, we show here that recombinant plant CGI-58 has none of the proposed activities previously described. Recombinant plant and mouse CGI-58 both lack acyltransferase activity towards either lysophosphatidylglycerol or lysophosphatidic acid to form phosphatidylglycerol or phosphatidic acid and recombinant plant CGI-58 does not catalyze TAG or phospholipid hydrolysis. However, expression of recombinant plant CGI-58, but not mouse CGI-58, led to a decrease in phosphatidylglycerol in all strains of E. coli tested, and a mutation of the putative catalytic residues restored a wild-type phenotype. The potential activities of plant CGI-58 are subsequently discussed. PMID:26745266

  6. Dendritic Cell-Based Immunotherapy of Breast Cancer: Modulation by CpG DNA

    DTIC Science & Technology

    2005-09-01

    tumor-associated antigens and bacterial DNA oligodeoxynucleotides containing unmethylated CpG sequences (CpG DNA) further augment the immune priming...associated antigens by cytotoxic T lymphocytes, and bacterial DNA oligodeoxy- nucleotides containing unmethylated CpG sequences (CpG DNA) can further...further amplify their immunostimulatory capacity and bacterial DNA oligodeoxynucleotides (ODN) containing unmethylated CpG sequences (CpG DNA) provide such

  7. Liposomal SLA co-incorporated with PO CpG ODNs or PS CpG ODNs induce the same protection against the murine model of leishmaniasis.

    PubMed

    Shargh, Vahid Heravi; Jaafari, Mahmoud Reza; Khamesipour, Ali; Jaafari, Iman; Jalali, Seyed Amir; Abbasi, Azam; Badiee, Ali

    2012-06-06

    First generation Leishmania vaccines consisting of whole killed parasites with or without adjuvants have reached phase 3 trial and failed to show enough efficacy mainly due to the lack of an appropriate adjuvant. In this study, the nuclease-resistant phosphorothioate CpG oligodeoxynucleotides (PS CpG) or nuclease-sensitive phosphodiester CpG ODNs (PO CpG) were used as adjuvants to enhance immunogenicity and rate of protection against leishmaniasis. Due to the susceptibility of PO CpG to nuclease degradation, an efficient liposomal delivery system was developed to protect them from degradation. 1, 2-dioleoyl-3-trimethylammonium-propane (DOTAP) as a cationic lipid was used because of its unique adjuvanticity and electrostatic interaction with negatively charged CpG ODNs. To evaluate the role of liposomal formulation in protection rate and enhanced immune response, BALB/c mice were immunized subcutaneously with liposomal soluble Leishmania antigens (SLA) co-incorporated with PO CpG (Lip-SLA-PO CpG), Lip-SLA-PS CpG, SLA+PO CpG, SLA+PS CpG, SLA or buffer. As criteria for protection, footpad swelling at the site of challenge, parasite loads, the levels of IFN-γ and IL-4, and the IgG subtypes were evaluated. The groups of mice receiving Lip-SLA-PO CpG or Lip-SLA-PS CpG showed a high protection rate compared with the control groups. In addition, there was no significant difference in immune response generation between mice immunized with PS CpG and the group receiving PO CpG when incorporated into the liposomes. The results suggested that liposomal form of PO CpG might be used instead of PS CpG in future vaccine formulations as an efficient adjuvant. Copyright © 2012 Elsevier Ltd. All rights reserved.

  8. Methyl-CpG island-associated genome signature tags

    DOEpatents

    Dunn, John J

    2014-05-20

    Disclosed is a method for analyzing the organismic complexity of a sample through analysis of the nucleic acid in the sample. In the disclosed method, through a series of steps, including digestion with a type II restriction enzyme, ligation of capture adapters and linkers and digestion with a type IIS restriction enzyme, genome signature tags are produced. The sequences of a statistically significant number of the signature tags are determined and the sequences are used to identify and quantify the organisms in the sample. Various embodiments of the invention described herein include methods for using single point genome signature tags to analyze the related families present in a sample, methods for analyzing sequences associated with hyper- and hypo-methylated CpG islands, methods for visualizing organismic complexity change in a sampling location over time and methods for generating the genome signature tag profile of a sample of fragmented DNA.

  9. Effect of amino groups of mesoporous silica nanoparticles on CpG oligodexynucleotide delivery

    NASA Astrophysics Data System (ADS)

    Xu, Yi; Claiden, Peter; Zhu, Yufang; Morita, Hiromi; Hanagata, Nobutaka

    2015-08-01

    In this study, we proposed to modify mesoporous silica nanoparticles (MSNs) with 3-aminopropyltriethoxysilane (NH2-TES), aminoethylaminopropyltriethoxysilane (2NH2-TES) and 3-[2-(2-aminoethylamino)ethylamino] propyl-trimethoxysilane (3NH2-TES) for binding of cytosine-phosphate-guanosine oligodexynucleotides (CpG ODN), and investigated the effect of different amino groups of MSNs on the CpG ODN delivery. Serum stability, in vitro cytotoxicity, and cytokine interleukin-6 (IL-6) induction by MSN-NH2/CpG, MSN-2NH2/CpG and MSN-3NH2/CpG complexes were investigated in detail. The results showed that three kinds of aminated-MSN-based CpG ODN delivery systems had no cytotoxicity to RAW264.7 cells, and binding of CpG ODN to MSN-NH2, MSN-2NH2 and MSN-3NH2 nanoparticles enhanced the serum stability of CpG ODN due to protection by the nanoparticles. However, three aminated MSN-based CpG ODN delivery systems exhibited different CpG ODN delivery efficiency, and MSN-NH2/CpG complexes had the highest ability to induce IL-6 secretion.

  10. Skin Barrier Development Depends on CGI-58 Protein Expression during Late-Stage Keratinocyte Differentiation

    PubMed Central

    Grond, Susanne; Radner, Franz P.W.; Eichmann, Thomas O.; Kolb, Dagmar; Grabner, Gernot F.; Wolinski, Heimo; Gruber, Robert; Hofer, Peter; Heier, Christoph; Schauer, Silvia; Rülicke, Thomas; Hoefler, Gerald; Schmuth, Matthias; Elias, Peter M.; Lass, Achim; Zechner, Rudolf; Haemmerle, Guenter

    2017-01-01

    Adipose triglyceride lipase (ATGL) and its coactivator comparative gene identification-58 (CGI-58) are limiting in cellular triglyceride catabolism. Although ATGL deficiency is compatible with normal skin development, mice globally lacking CGI-58 die postnatally and exhibit a severe epidermal permeability barrier defect, which may originate from epidermal and/or peripheral changes in lipid and energy metabolism. Here, we show that epidermis-specific disruption of CGI-58 is sufficient to provoke a defect in the formation of a functional corneocyte lipid envelope linked to impaired ω-O-acylceramide synthesis. As a result, epidermis-specific CGI-58-deficient mice show severe skin dysfunction, arguing for a tissue autonomous cause of disease development. Defective skin permeability barrier formation in global CGI-58-deficient mice could be reversed via transgenic restoration of CGI-58 expression in differentiated but not basal keratinocytes suggesting that CGI-58 is essential for lipid metabolism in suprabasal epidermal layers. The compatibility of ATGL deficiency with normal epidermal function indicated that CGI-58 may stimulate an epidermal triglyceride lipase beyond ATGL required for the adequate provision of fatty acids as a substrate for ω-O-acylceramide synthesis. Pharmacological inhibition of ATGL enzyme activity similarly reduced triglyceride-hydrolytic activities in wild-type and CGI-58 overexpressing epidermis implicating that CGI-58 participates in ω-O-acylceramide biogenesis independent of its role as a coactivator of epidermal triglyceride catabolism. PMID:27725204

  11. Transcription and chromatin determinants of de novo DNA methylation timing in oocytes.

    PubMed

    Gahurova, Lenka; Tomizawa, Shin-Ichi; Smallwood, Sébastien A; Stewart-Morgan, Kathleen R; Saadeh, Heba; Kim, Jeesun; Andrews, Simon R; Chen, Taiping; Kelsey, Gavin

    2017-01-01

    Gametogenesis in mammals entails profound re-patterning of the epigenome. In the female germline, DNA methylation is acquired late in oogenesis from an essentially unmethylated baseline and is established largely as a consequence of transcription events. Molecular and functional studies have shown that imprinted genes become methylated at different times during oocyte growth; however, little is known about the kinetics of methylation gain genome wide and the reasons for asynchrony in methylation at imprinted loci. Given the predominant role of transcription, we sought to investigate whether transcription timing is rate limiting for de novo methylation and determines the asynchrony of methylation events. Therefore, we generated genome-wide methylation and transcriptome maps of size-selected, growing oocytes to capture the onset and progression of methylation. We find that most sequence elements, including most classes of transposable elements, acquire methylation at similar rates overall. However, methylation of CpG islands (CGIs) is delayed compared with the genome average and there are reproducible differences amongst CGIs in onset of methylation. Although more highly transcribed genes acquire methylation earlier, the major transitions in the oocyte transcriptome occur well before the de novo methylation phase, indicating that transcription is generally not rate limiting in conferring permissiveness to DNA methylation. Instead, CGI methylation timing negatively correlates with enrichment for histone 3 lysine 4 (H3K4) methylation and dependence on the H3K4 demethylases KDM1A and KDM1B, implicating chromatin remodelling as a major determinant of methylation timing. We also identified differential enrichment of transcription factor binding motifs in CGIs acquiring methylation early or late in oocyte growth. By combining these parameters into multiple regression models, we were able to account for about a fifth of the variation in methylation timing of CGIs. Finally, we show that establishment of non-CpG methylation, which is prevalent in fully grown oocytes, and methylation over non-transcribed regions, are later events in oogenesis. These results do not support a major role for transcriptional transitions in the time of onset of DNA methylation in the oocyte, but suggest a model in which sequences least dependent on chromatin remodelling are the earliest to become permissive for methylation.

  12. The Composite of Bone Marrow Concentrate and PRP as an Alternative to Autologous Bone Grafting

    PubMed Central

    Hakimi, Mohssen; Grassmann, Jan-Peter; Betsch, Marcel; Schneppendahl, Johannes; Gehrmann, Sebastian; Hakimi, Ahmad-Reza; Kröpil, Patric; Sager, Martin; Herten, Monika; Wild, Michael; Windolf, Joachim; Jungbluth, Pascal

    2014-01-01

    One possible alternative to the application of autologous bone grafts represents the use of autologous bone marrow concentrate (BMC). The purpose of our study was to evaluate the potency of autologous platelet-rich plasma (PRP) in combination with BMC. In 32 mini-pigs a metaphyseal critical-size defect was surgically created at the proximal tibia. The animals were allocated to four treatment groups of eight animals each (1. BMC+CPG group, 2. BMC+CPG+PRP group, 3. autograft group, 4. CPG group). In the BMC+CPG group the defect was filled with autologous BMC in combination with calcium phosphate granules (CPG), whereas in the BMC+CPG+PRP group the defect was filled with the composite of autologous BMC, CPG and autologous PRP. In the autograft group the defect was filled with autologous cancellous graft, whereas in the CPG group the defect was filled with CPG solely. After 6 weeks radiological and histomorphometrical analysis showed significantly more new bone formation in the BMC+CPG+PRP group compared to the BMC+CPG group and the CPG group. There were no significant differences between the BMC+CPG+PRP group and the autograft group. In the PRP platelets were enriched significantly about 4.7-fold compared to native blood. In BMC the count of mononuclear cells increased significantly (3.5-fold) compared to the bone marrow aspirate. This study demonstrates that the composite of BMC+CPG+PRP leads to a significantly higher bone regeneration of critical-size defects at the proximal tibia in mini-pigs than the use of BMC+CPG without PRP. Furthermore, within the limits of the present study the composite BMC+CPG+PRP represents a comparable alternative to autologous bone grafting. PMID:24950251

  13. SU-F-P-50: Performance Evaluation of Optically Stimulated Luminescence (OSL) NanoDots in Therapy and Imaging In-Vivo Dose Measurement During Patient Treatment

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kumar, S; Sarkar, B; Kaur, H

    Purpose: This study was designed to evaluate the performance of optically stimulated Luminescence (OSL) nanoDots as in-vivo dosimeter. For the measurements of surface doses as well as scattered plus leakage doses, nanoDots were used during the setup verification as well as during the treatment delivery. Methods: For a total seven patients undergoing radiotherapy by volumetric modulated arc therapy, surface doses from image guidance and scattered plus leakage doses from treatment delivery were measured. Two sets of calibration curves were generated – one for therapy and another for imaging. Two different nanoDots were used for imaging and therapy doses. Imaging nanoDotsmore » were placed at the isocenter only at the time of CBCT and therapy nanoDots were placed at 25 cm away from the isocenter (either in cranial or in caudal direction) only at the time of treatment delivery. During the entire course, nanoDots were placed at the same measurement points. NanoDots were read after 15 minutes of their exposure. For the next fraction, nanoDots were corrected for the residual doses from the previous fractions. Results: Measured surface doses during imaging were 0.14±0.32 cGy, 0.11±0.04 cGy, 0.12±0.53 cGy, 0.04±0.02 cGy, 0.13±0.23 cGy, 0.11±0.43 cGy, 0.10±0.04 cGy with overall mean dose of 0.08±0.1 cGy. Measured doses during treatment delivery, indicative of scattered and leakage dose, were 0.84±0.43 cGy, 1.3±0.4 cGy, 1.4±0.4 cGy, 0.18±0.48 cGy, 0.78±0.29 cGy, 0.27±0.08 cGy, 0.78±0.07 cGy with overall mean dose of 0.61±1.3 cGy. Conclusion: This dosimeter can be used as supplementary unit to verify the doses. No change in the prescription is recommended based on nanoDots measurement. This study is on-going therefore we are presenting only mere number of patients. A large volume data will be presented after completion of the study with proper statistical analysis.« less

  14. The influence of aging on the methylation status of brain-derived neurotrophic factor gene in blood.

    PubMed

    Ihara, Kazushige; Fuchikami, Manabu; Hashizume, Masahiro; Okada, Satoshi; Kawai, Hisashi; Obuchi, Shuichi; Hirano, Hirohiko; Fujiwara, Yoshinori; Hachisu, Mitsugu; Hongyong, Kim; Morinobu, Shigeru

    2018-06-28

    Brain-derived neurotrophic factor (BDNF) is involved in the pathophysiology of psychiatric disorders in adults and elderly individuals, and as a result, the DNA methylation (DNAm) of the BDNF gene in peripheral tissues including blood has been extensively examined to develop a useful biomarker for psychiatric disorders. However, studies to date have not previously investigated the effect of age on DNAm of the BDNF gene in blood. In this context, we measured DNAm of 39 CpG units in the CpG island at the promoter of exon I of the BDNF gene. We analyzed genomic DNA from peripheral blood of 105 health Japanese women 20 to 80 years of age to identify aging-associated change in DNAm of the BDNF gene. In addition, we examined the relationship between total MMSE scores, numbers of stressful life events, and serum BDNF levels on DNAm of the BDNF gene. The DNAm rate at each CpG unit was measured using a MassArray ® system (Agena Bioscience), and serum BDNF levels were measured by ELISA. There was a significant correlation between DNAm and age in 13 CpGs. However, there was no significant correlation between DNAm and total MMSE scores, numbers of life events, or serum BDNF levels. Despite the small number of subjects and the inclusion of only female subjects, our results suggest that DNAm of 13 CpGs of the BDNF gene may be an appropriate biomarker for aging and useful for predicting increased susceptibility to age-related psychiatric disorders. © 2018 John Wiley & Sons, Ltd.

  15. Aging effects on DNA methylation modules in human brain and blood tissue

    PubMed Central

    2012-01-01

    Background Several recent studies reported aging effects on DNA methylation levels of individual CpG dinucleotides. But it is not yet known whether aging-related consensus modules, in the form of clusters of correlated CpG markers, can be found that are present in multiple human tissues. Such a module could facilitate the understanding of aging effects on multiple tissues. Results We therefore employed weighted correlation network analysis of 2,442 Illumina DNA methylation arrays from brain and blood tissues, which enabled the identification of an age-related co-methylation module. Module preservation analysis confirmed that this module can also be found in diverse independent data sets. Biological evaluation showed that module membership is associated with Polycomb group target occupancy counts, CpG island status and autosomal chromosome location. Functional enrichment analysis revealed that the aging-related consensus module comprises genes that are involved in nervous system development, neuron differentiation and neurogenesis, and that it contains promoter CpGs of genes known to be down-regulated in early Alzheimer's disease. A comparison with a standard, non-module based meta-analysis revealed that selecting CpGs based on module membership leads to significantly increased gene ontology enrichment, thus demonstrating that studying aging effects via consensus network analysis enhances the biological insights gained. Conclusions Overall, our analysis revealed a robustly defined age-related co-methylation module that is present in multiple human tissues, including blood and brain. We conclude that blood is a promising surrogate for brain tissue when studying the effects of age on DNA methylation profiles. PMID:23034122

  16. Exploiting Semantic Web Technologies to Develop OWL-Based Clinical Practice Guideline Execution Engines.

    PubMed

    Jafarpour, Borna; Abidi, Samina Raza; Abidi, Syed Sibte Raza

    2016-01-01

    Computerizing paper-based CPG and then executing them can provide evidence-informed decision support to physicians at the point of care. Semantic web technologies especially web ontology language (OWL) ontologies have been profusely used to represent computerized CPG. Using semantic web reasoning capabilities to execute OWL-based computerized CPG unties them from a specific custom-built CPG execution engine and increases their shareability as any OWL reasoner and triple store can be utilized for CPG execution. However, existing semantic web reasoning-based CPG execution engines suffer from lack of ability to execute CPG with high levels of expressivity, high cognitive load of computerization of paper-based CPG and updating their computerized versions. In order to address these limitations, we have developed three CPG execution engines based on OWL 1 DL, OWL 2 DL and OWL 2 DL + semantic web rule language (SWRL). OWL 1 DL serves as the base execution engine capable of executing a wide range of CPG constructs, however for executing highly complex CPG the OWL 2 DL and OWL 2 DL + SWRL offer additional executional capabilities. We evaluated the technical performance and medical correctness of our execution engines using a range of CPG. Technical evaluations show the efficiency of our CPG execution engines in terms of CPU time and validity of the generated recommendation in comparison to existing CPG execution engines. Medical evaluations by domain experts show the validity of the CPG-mediated therapy plans in terms of relevance, safety, and ordering for a wide range of patient scenarios.

  17. The Potential of CGI: Using Pre-Built CGI Scripts to Make Interactive Web Pages.

    ERIC Educational Resources Information Center

    Nackerud, Shane A.

    1998-01-01

    Describes CGI (Common Gateway Interface) scripts that are available on the Web and explains how librarians can use them to make Web pages more interactive. Topics include CGI security; Perl scripts; UNIX; and HTML. (LRW)

  18. Promoter methylation assay of SASH1 gene in hepatocellular carcinoma.

    PubMed

    Peng, Liu; Wei, He; Liren, Li

    2014-01-01

    To analyse the relationship between the expression of SASH1 and its methylation level in human hepatocellular carcinoma. Expression levels of SASH1 were examined with real-time PCR (RT-PCR) in tissues and cells, and methylation analysis was performed with MassArray. The expression levels of SASH1 were strongly reduced in liver cancer tissues compared with adjacent normal tissues. Quantitative methylation analysis by MassArray revealed different CpG sites in SASH1 promoter shared similar methylation pattern between liver cancer tissues and adjacent normal tissues and the CpG sites of significant difference in methylation level were found as follows: CpG_3, CpG_17, CpG_21.22, CpG_25, CpG_26.27, CpG_28, CpG_34.35.36 and CpG_51.52. Moreover, 5-aza-2'-deoxycytidine treatment of Hep-G2 cell line caused significant elevation of SASH1 mRNA. Based on these data, we propose that increase of DNA methylation degree in the promoter region of SASH1 gene, particularly CpG_26.27 sites, possibly repressed SASH1 expression in liver cancer.

  19. The corpus-predominant gastritis index can be an early and reversible marker to identify the gastric cancer risk of Helicobacter pylori-infected nonulcer dyspepsia.

    PubMed

    Cheng, Hsiu-Chi; Tsai, Yu-Ching; Yang, Hsiao-Bai; Yeh, Yi-Chun; Chang, Wei-Lun; Kuo, Hsin-Yu; Lu, Cheng-Chan; Sheu, Bor-Shyang

    2017-08-01

    Corpus-predominant gastritis index (CGI) is an early histological marker to identify Helicobacter pylori-infected gastric cancer relatives at risk of cancer. This study validated whether CGI is more prevalent in H. pylori-infected nonulcer dyspepsia (NUD) subjects than in duodenal ulcer (DU) controls and whether it is reversible after H. pylori eradication or is correlated with noninvasive biomarkers. In this longitudinal cohort study, 573 H. pylori-infected subjects were enrolled, including 349 NUD and 224 DU. Gastric specimens were provided to assess CGI, spasmolyic polypeptide-expressing metaplasia (SPEM), and Operative Link on Gastric Intestinal Metaplasia assessment (OLGIM). Serum pepsinogen I and II levels were assessed using enzyme-linked immunosorbent assay. CGI subjected were followed up at least 1 year after H. pylori eradication. NUD subjects had higher prevalence rates of CGI (47.0% vs 29.9%, P<.001) and OLGIM stages III-IV (24.1% vs 15.2%, P=.01) than controls. CGI was highly prevalent in NUD subjects after the age of 40, which was 10 years earlier than atrophic gastritis and intestinal metaplasia. NUD subjects with CGI had higher risk of SPEM (OR 2.86, P<.001) and lower serum pepsinogen I/II ratios (P<.001) than those without CGI. Serum pepsinogen I/II ratios <9 could predict CGI modestly (AUROC 0.69, 95% CI: 0.63-0.74). CGI was regressed after eradication (P<.001). CGI was more prevalent in H. pylori-infected NUD subjects than in controls, was correlated with SPEM, and may serve as a marker earlier than OLGIM to indicate risk of gastric cancer. Moreover, CGI could be regressed after eradication. © 2017 John Wiley & Sons Ltd.

  20. Identification of a boron nitride nanosphere-binding peptide for the intracellular delivery of CpG oligodeoxynucleotides

    NASA Astrophysics Data System (ADS)

    Zhang, Huijie; Yamazaki, Tomohiko; Zhi, Chunyi; Hanagata, Nobutaka

    2012-09-01

    CpG oligonucleotides (CpG ODNs) interact with Toll-like receptor 9 (TLR9), which results in the induction of immunostimulatory cytokines. We delivered CpG ODNs intracellularly using boron nitride nanospheres (BNNS). To enhance the loading capacity of CpG ODNs on BNNS, we used a phage display technique to identify a 12-amino acid peptide designated as BP7, with specific affinity for BNNS, and used it as a linker to load CpG ODNs on BNNS. The tyrosine residue (Y) at the eighth position from the N-terminus played a crucial role in the affinity of BP7 to BNNS. BNNS that bound BP7 (BNNS-BP7) were taken up by cells and showed no cytotoxicity, and CpG ODNs were successfully crosslinked with BP7 to create BP7-CpG ODN conjugates. Using BP7 as a linker, the loading efficiency of CpG ODNs on BNNS increased 5-fold compared to the direct binding of CpG ODNs to BNNS. Furthermore, the BP7-CpG ODN conjugate-loaded BNNS had a greater capacity to induce interleukin-6 (IL-6) and tumor necrosis factor-alpha (TNF-α) production from peripheral blood mononuclear cells (PBMCs) than that of CpG ODNs directly loaded on BNNS. The higher amount of cytokine induction by BP7-CpG ODN conjugate-loaded BNNS may be attributed to a higher loading capacity and stronger binding to BNNS of the linker BP7. The greater functionality of BP7-conjugated CpG ODNs on BNNS expands the potential of BNNS for drug delivery applications.CpG oligonucleotides (CpG ODNs) interact with Toll-like receptor 9 (TLR9), which results in the induction of immunostimulatory cytokines. We delivered CpG ODNs intracellularly using boron nitride nanospheres (BNNS). To enhance the loading capacity of CpG ODNs on BNNS, we used a phage display technique to identify a 12-amino acid peptide designated as BP7, with specific affinity for BNNS, and used it as a linker to load CpG ODNs on BNNS. The tyrosine residue (Y) at the eighth position from the N-terminus played a crucial role in the affinity of BP7 to BNNS. BNNS that bound BP7 (BNNS-BP7) were taken up by cells and showed no cytotoxicity, and CpG ODNs were successfully crosslinked with BP7 to create BP7-CpG ODN conjugates. Using BP7 as a linker, the loading efficiency of CpG ODNs on BNNS increased 5-fold compared to the direct binding of CpG ODNs to BNNS. Furthermore, the BP7-CpG ODN conjugate-loaded BNNS had a greater capacity to induce interleukin-6 (IL-6) and tumor necrosis factor-alpha (TNF-α) production from peripheral blood mononuclear cells (PBMCs) than that of CpG ODNs directly loaded on BNNS. The higher amount of cytokine induction by BP7-CpG ODN conjugate-loaded BNNS may be attributed to a higher loading capacity and stronger binding to BNNS of the linker BP7. The greater functionality of BP7-conjugated CpG ODNs on BNNS expands the potential of BNNS for drug delivery applications. Electronic supplementary information (ESI) available. See DOI: 10.1039/c2nr31189e

  1. Aberrant signature methylome by DNMT1 hot spot mutation in hereditary sensory and autonomic neuropathy 1E.

    PubMed

    Sun, Zhifu; Wu, Yanhong; Ordog, Tamas; Baheti, Saurabh; Nie, Jinfu; Duan, Xiaohui; Hojo, Kaori; Kocher, Jean-Pierre; Dyck, Peter J; Klein, Christopher J

    2014-08-01

    DNA methyltransferase 1 (DNMT1) is essential for DNA methylation, gene regulation and chromatin stability. We previously discovered DNMT1 mutations cause hereditary sensory and autonomic neuropathy type 1 with dementia and hearing loss (HSAN1E; OMIM 614116). HSAN1E is the first adult-onset neurodegenerative disorder caused by a defect in a methyltransferase gene. HSAN1E patients appear clinically normal until young adulthood, then begin developing the characteristic symptoms involving central and peripheral nervous systems. Some HSAN1E patients also develop narcolepsy and it has recently been suggested that HSAN1E is allelic to autosomal dominant cerebellar ataxia, deafness, with narcolepsy (ADCA-DN; OMIM 604121), which is also caused by mutations in DNMT1. A hotspot mutation Y495C within the targeting sequence domain of DNMT1 has been identified among HSAN1E patients. The mutant DNMT1 protein shows premature degradation and reduced DNA methyltransferase activity. Herein, we investigate genome-wide DNA methylation at single-base resolution through whole-genome bisulfite sequencing of germline DNA in 3 pairs of HSAN1E patients and their gender- and age-matched siblings. Over 1 billion 75-bp single-end reads were generated for each sample. In the 3 affected siblings, overall methylation loss was consistently found in all chromosomes with X and 18 being most affected. Paired sample analysis identified 564,218 differentially methylated CpG sites (DMCs; P<0.05), of which 300 134 were intergenic and 264 084 genic CpGs. Hypomethylation was predominant in both genic and intergenic regions, including promoters, exons, most CpG islands, L1, L2, Alu, and satellite repeats and simple repeat sequences. In some CpG islands, hypermethylated CpGs outnumbered hypomethylated CpGs. In 201 imprinted genes, there were more DMCs than in non-imprinted genes and most were hypomethylated. Differentially methylated region (DMR) analysis identified 5649 hypomethylated and 1872 hypermethylated regions. Importantly, pathway analysis revealed 1693 genes associated with the identified DMRs were highly associated in diverse neurological disorders and NAD+/NADH metabolism pathways is implicated in the pathogenesis. Our results provide novel insights into the epigenetic mechanism of neurodegeneration arising from a hotspot DNMT1 mutation and reveal pathways potentially important in a broad category of neurological and psychological disorders.

  2. Aberrant signature methylome by DNMT1 hot spot mutation in hereditary sensory and autonomic neuropathy 1E

    PubMed Central

    Sun, Zhifu; Wu, Yanhong; Ordog, Tamas; Baheti, Saurabh; Nie, Jinfu; Duan, Xiaohui; Hojo, Kaori; Kocher, Jean-Pierre; Dyck, Peter J; Klein, Christopher J

    2014-01-01

    DNA methyltransferase 1 (DNMT1) is essential for DNA methylation, gene regulation and chromatin stability. We previously discovered DNMT1 mutations cause hereditary sensory and autonomic neuropathy type 1 with dementia and hearing loss (HSAN1E; OMIM 614116). HSAN1E is the first adult-onset neurodegenerative disorder caused by a defect in a methyltransferase gene. HSAN1E patients appear clinically normal until young adulthood, then begin developing the characteristic symptoms involving central and peripheral nervous systems. Some HSAN1E patients also develop narcolepsy and it has recently been suggested that HSAN1E is allelic to autosomal dominant cerebellar ataxia, deafness, with narcolepsy (ADCA-DN; OMIM 604121), which is also caused by mutations in DNMT1. A hotspot mutation Y495C within the targeting sequence domain of DNMT1 has been identified among HSAN1E patients. The mutant DNMT1 protein shows premature degradation and reduced DNA methyltransferase activity. Herein, we investigate genome-wide DNA methylation at single-base resolution through whole-genome bisulfite sequencing of germline DNA in 3 pairs of HSAN1E patients and their gender- and age-matched siblings. Over 1 billion 75-bp single-end reads were generated for each sample. In the 3 affected siblings, overall methylation loss was consistently found in all chromosomes with X and 18 being most affected. Paired sample analysis identified 564,218 differentially methylated CpG sites (DMCs; P < 0.05), of which 300 134 were intergenic and 264 084 genic CpGs. Hypomethylation was predominant in both genic and intergenic regions, including promoters, exons, most CpG islands, L1, L2, Alu, and satellite repeats and simple repeat sequences. In some CpG islands, hypermethylated CpGs outnumbered hypomethylated CpGs. In 201 imprinted genes, there were more DMCs than in non-imprinted genes and most were hypomethylated. Differentially methylated region (DMR) analysis identified 5649 hypomethylated and 1872 hypermethylated regions. Importantly, pathway analysis revealed 1693 genes associated with the identified DMRs were highly associated in diverse neurological disorders and NAD+/NADH metabolism pathways is implicated in the pathogenesis. Our results provide novel insights into the epigenetic mechanism of neurodegeneration arising from a hotspot DNMT1 mutation and reveal pathways potentially important in a broad category of neurological and psychological disorders. PMID:25033457

  3. An alternative approach to account for patient organ doses from imaging guidance procedures.

    PubMed

    Nelson, Alan P; Ding, George X

    2014-07-01

    To investigate the feasibility of an alternative method of accounting for additional organ doses resulting from image guidance procedures during patient treatment planning through tabulated values based on scan protocol and scan site. Patient-specific imaging dose to 30 patients resulting from Varian OBI kV-CBCT scans using the Standard Head (17 patients), Low-dose Thorax (8 patients), and Pelvic (5 patients) scan protocols were retrospectively calculated using Monte Carlo methods. Dose dependence on scan location and patient geometry was explored. Patient organ doses were analyzed by using dose-volume histograms and expressed by the mean, minimum dose delivered to 50% of the organ volume, D50. The reported doses are dose-to-medium instead of dose-to-water. The organ doses from all patient-specific calculations show predictable and limited ranges across patients. For brain isocenters using Standard Head Scans: Bone: 0.7-1.1 cGy, Brain: 0.2-0.3 cGy, Brainstem: 0.2-0.3 cGy, Skin: 0.3-0.4 cGy, Eye: 0.03-0.3 cGy. For head and neck patients using the Standard Head Scan: Bone: 0.3-0.6 cGy, Parotids: 0.3-0.4 cGy, Spinal Cord: 0.15-0.25 cGy, Thyroid: 0.1-0.25 cGy, Skin: 0.2-0.3 cGy, Trachea-Esophagus: 0.1-0.2 cGy. For chest using Thorax Scans: Bone: 1.1-1.8 cGy, Soft tissue organs (Bowel, Lung, Heart, Kidney, Esophagus, and Spinal Cord): 0.3-0.6 cGy. For abdominal site using Pelvic Scans: Bone: 3.2-4.2 cGy. Soft tissue organs (Bladder, Bowel, Rectum, Prostate, and Skin) D50s fell between 1.2 and 2.2 cGy. Femoral Heads: 2.5-3.4 cGy. It is adequate to estimate and account for organ dose by using tabulated values based on scan procedure and site because organ doses from imaging procedures are only modestly dependent upon scan location and body size. Considering the dose variation and magnitude of dose from each scan protocol in comparison to therapeutic doses, this approach provides a simple alternative to account for additional imaging guidance doses during patient treatment planning. Clinicians can use these tabulated values to make informed decisions in selecting the appropriate imaging procedures and imaging frequency during radiotherapy treatment. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  4. The 14-3-3σ gene promoter is methylated in both human melanocytes and melanoma

    PubMed Central

    2009-01-01

    Background Recent evidence demonstrates that 14-3-3σ acts as a tumor suppressor gene inactivated by methylation of its 5' CpG islands in epithelial tumor cells, while remaining un-methylated in normal human epithelia. The methylation analysis of 14-3-3σ has been largely overlooked in melanoma. Methods The methylation status of 14-3-3σ CpG island in melanocytes and melanoma cells was analyzed by methylation-specific sequencing (MSS) and quantitative methylation-specific PCR (Q-MSP). 14-3-3σ mRNA and protein expression in cell lines was detected by real-time RT-PCR and western blot. Melanoma cells were also treated by 5-aza-2'-deoxycytidine (DAC), a demethylating agent, and/or histone deacetylase inhibitor, Trichostatin A (TSA), to evaluate their effects on 14-3-3σ gene expression. Results 14-3-3σ is hypermethylated in both human melanocytes and most melanoma cells in a lineage-specific manner, resulting in the silencing of 14-3-3σ gene expression and the active induction of 14-3-3σ mRNA and protein expression following treatment with DAC. We also observed a synergistic effect upon gene expression when DAC was combined with TSA. The promoter methylation status of 14-3-3σ was analyzed utilizing Q-MSP in 20 melanoma tissue samples and 10 cell lines derived from these samples, showing that the majority of melanoma samples maintain their hypermethylation status of the 14-3-3σ gene. Conclusion 14-3-3σ is hypermethylated in human melanoma in a cell-linage specific manner. Spontaneous demethylation and re-expression of 14-3-3σ is a rare event in melanoma, indicating 14-3-3σ might have a tentative role in the pathogenesis of melanoma. PMID:19473536

  5. Icariin may benefit the mesenchymal stem cells of patients with steroid-associated osteonecrosis by ABCB1-promoter demethylation: a preliminary study.

    PubMed

    Sun, Z-B; Wang, J-W; Xiao, H; Zhang, Q-S; Kan, W-S; Mo, F-B; Hu, S; Ye, S-N

    2015-01-01

    In this study, we found out a previously undefined function of icariin which restored the dynamic balance between osteogenic and adipogenic differentiation of mesenchymal stem cells (MSCs) in patients with osteonecrosis of femoral head (ONFH) via ABCB1-promoter demethylation. These findings provided important information regarding potential implication of icariin targeting epigenetic changes for the treatment of steroid -associated ONFH. Here, we investigated whether icariin can also exert a beneficial role in the reactivation of MSCs in the patients with steroid-associated ONFH via ABCB1-promoter demethylation. Bone marrow was collected from the proximal femur in patients with steroid-associated ONFH (n = 20) and patients with new femoral neck fractures (n = 22), and then MSCs were isolated. We investigated cell viability, intracellular reactive oxygen species (ROS) level, mitochondrial membrane potential (MMP), P-glycoprotein (P-gp) activity, the transcript levels of ABCB1 and oxidative stress-related genes, methylation extent at CpG islands of ABCB1 promoter, and osteogenic and adipogenic differentiation ability of MSCs from the femoral neck fractures group and from the steroid-associated ONFH group treated with or without icariin. We observed that MSCs from the steroid-associated ONFH group showed reduced proliferation ability, elevated ROS level, depressed MMP, weakened osteogenesis, and enhanced adipogenesis while low P-gp activity, transcription level of ABCB1, and oxidative stress-related genes as well as aberrant CpG islands hypermethylation of ABCB1 were also noted in steroid-associated ONFH group. Treatment with icariin obviously induced de novo P-gp expression, decreased oxidative stress, and promoted osteogenesis. Icariin may be a potential drug targeting epigenetic changes for the treatment of steroid-associated ONFH.

  6. Methylation of CpG island of p14(ARK), p15(INK4b) and p16(INK4a) genes in coke oven workers.

    PubMed

    Zhang, H; Li, X; Ge, L; Yang, J; Sun, J; Niu, Q

    2015-02-01

    To detect the blood genomic DNA methylation in coke oven workers and find a possible early screening index for occupational lung cancer, 74 coke oven workers as the exposed group and 47 water pump workers as the controls were surveyed, and urine samples and peripheral blood mononuclear cells (PBMCs) were collected. Airborne benzo[a]pyrene (B[a]P) levels in workplace and urinary 1-hydroxypyrene (1-OH-Py) levels were determined by high-performance liquid chromatography. DNA damage of PBMCs and the p14(ARK), p15(INK4b) and p16(INK4a) gene CpG island methylation in the promoter region were detected by comet assay and methylation-specific polymerase chain reaction techniques, respectively. Results show that compared with the controls, concentration of airborne B[a]Ps was elevated in the coke plant, and urinary 1-OH-Py's level and DNA olive tail moment in comet assay were significantly increased in the coke oven workers, and p14(ARK), p15(INK4b) and p16(INK4a) gene methylation rates were also significantly increased. With the working years and urinary 1-OH-Py's level, the rates of p14(ARK) and p16(INK4a) gene methylation were significantly increased while that of p15(INK4b) gene methylation displayed no statistical change. We conclude that PBMCs' p14(ARK) and p16(INK4a) gene methylation may be used for screening and warning lung cancer in coke oven workers. © The Author(s) 2015.

  7. Eicosapentaenoic acid induces DNA demethylation in carcinoma cells through a TET1-dependent mechanism.

    PubMed

    Ceccarelli, Veronica; Valentini, Virginia; Ronchetti, Simona; Cannarile, Lorenza; Billi, Monia; Riccardi, Carlo; Ottini, Laura; Talesa, Vincenzo Nicola; Grignani, Francesco; Vecchini, Alba

    2018-05-14

    In cancer cells, global genomic hypomethylation is found together with localized hypermethylation of CpG islands within the promoters and regulatory regions of silenced tumor suppressor genes. Demethylating agents may reverse hypermethylation, thus promoting gene re-expression. Unfortunately, demethylating strategies are not efficient in solid tumor cells. DNA demethylation is mediated by ten-eleven translocation enzymes (TETs). They sequentially convert 5-methylcytosine (5mC) to 5-hydroxymethylcytosine (5hmC), which is associated with active transcription; 5-formylcytosine; and finally, 5-carboxylcytosine. Although α-linolenic acid, eicosapentaenoic acid (EPA), and docosahexaenoic acid, the major n-3 polyunsaturated fatty acids, have anti-cancer effects, their action, as DNA-demethylating agents, has never been investigated in solid tumor cells. Here, we report that EPA demethylates DNA in hepatocarcinoma cells. EPA rapidly increases 5hmC on DNA, inducing p21 Waf1/Cip1 gene expression, which slows cancer cell-cycle progression. We show that the underlying molecular mechanism involves TET1. EPA simultaneously binds peroxisome proliferator-activated receptor γ (PPARγ) and retinoid X receptor α (RXRα), thus promoting their heterodimer and inducing a PPARγ-TET1 interaction. They generate a TET1-PPARγ-RXRα protein complex, which binds to a hypermethylated CpG island on the p21 gene, where TET1 converts 5mC to 5hmC. In an apparent shuttling motion, PPARγ and RXRα leave the DNA, whereas TET1 associates stably. Overall, EPA directly regulates DNA methylation levels, permitting TET1 to exert its anti-tumoral function.-Ceccarelli, V., Valentini, V., Ronchetti, S., Cannarile, L., Billi, M., Riccardi, C., Ottini, L., Talesa, V. N., Grignani, F., Vecchini, A., Eicosapentaenoic acid induces DNA demethylation in carcinoma cells through a TET1-dependent mechanism.

  8. Combined Analysis of COX-2 and p53 Expressions Reveals Synergistic Inverse Correlations with Microsatellite Instability and CpG Island Methylator Phenotype in Colorectal Cancer1

    PubMed Central

    Ogino, Shuji; Brahmandam, Mohan; Kawasaki, Takako; Kirkner, Gregory J; Loda, Massimo; Fuchs, Charles S

    2006-01-01

    Abstract Cyclooxygenase-2 (COX-2) overexpression and mutations of p53 (a known COX-2 regulator) are inversely associated with microsatellite instability—high (MSI-H) and CpG island methylator phenotype (CIMP), characterized by extensive promoter methylation, is associated with MSI-H. However, no studies have comprehensively examined interrelations between COX-2, p53, MSI, and CIMP. Using MethyLight, we measured DNA methylation in five CIMP-specific gene promoters [CACNA1G, CDKN2A (p16/INK4A), CRABP1, MLH1, and NEUROG1] in relatively unbiased samples of 751 colorectal cancer cases obtained from two large prospective cohorts; 115 (15%) tumors were CIMP-high (≥ 4 of 5 methylated promoters), 251 (33%) were CIMP-low (1 to 3 methylated promoters), and the remaining 385 (51%) were CIMP-0 (no methylated promoters). CIMP-high tumors were much less frequent in COX-2+/p53+ tumors (4.6%) than in COX-2+/p53- tumors (19%; P < .0001), COX-2-/p53+ tumors (17%; P= .04), and COX-2-/p53- tumors (28%; P < .0001). In addition, COX-2+/p53+ tumors were significantly less common in MSI-H CIMP-high tumors (9.7%) than in non-MSI-H CIMP-low/CIMP-0 tumors (44–47%; P< .0001). In conclusion, COX-2 and p53 alterations were synergistically inversely correlated with both MSI-H and CIMP-high. Our data suggest that a combined analysis of COX-2 and p53 may be more useful for the molecular classification of colorectal cancer than either COX-2 or p53 analysis alone. PMID:16820091

  9. Efficient molecular screening of Lynch syndrome by specific 3' promoter methylation of the MLH1 or BRAF mutation in colorectal cancer with high-frequency microsatellite instability.

    PubMed

    Nakagawa, Hitoshi; Nagasaka, Takeshi; Cullings, Harry M; Notohara, Kenji; Hoshijima, Naoko; Young, Joanne; Lynch, Henry T; Tanaka, Noriaki; Matsubara, Nagahide

    2009-06-01

    It is sometimes difficult to diagnose Lynch syndrome by the simple but strict clinical criteria, or even by the definitive genetic testing for causative germline mutation of mismatch repair genes. Thus, some practical and efficient screening strategy to select highly possible Lynch syndrome patients is exceedingly desirable. We performed a comprehensive study to evaluate the methylation status of whole MLH1 promoter region by direct bisulfite sequencing of the entire MLH1 promoter regions on Lynch and non-Lynch colorectal cancers (CRCs). Then, we established a convenient assay to detect methylation in key CpG islands responsible for the silencing of MLH1 expression. We studied the methylation status of MLH1 as well as the CpG island methylator phenotype (CIMP) and immunohistochemical analysis of mismatch repair proteins on 16 cases of Lynch CRC and 19 cases of sporadic CRCs with high-frequency microsatellite instability (MSI-H). Sensitivity to detect Lynch syndrome by MLH1 (CCAAT) methylation was 88% and the specificity was 84%. Positive likelihood ratio (PLR) was 5.5 and negative likelihood ratio (NLR) was 0.15. Sensitivity by mutational analysis of BRAF was 100%, specificity was 84%, PLR was 6.3 and NLR was zero. By CIMP analysis; sensitivity was 88%, specificity was 79%, PLR was 4.2, and NLR was 0.16. BRAF mutation or MLH1 methylation analysis combined with MSI testing could be a good alternative to screen Lynch syndrome patients in a cost effective manner. Although the assay for CIMP status also showed acceptable sensitivity and specificity, it may not be practical because of its rather complicated assay.

  10. CpG island methylator phenotype is an independent predictor of survival after curative resection for colorectal cancer: A prospective cohort study.

    PubMed

    Kim, Chang Hyun; Huh, Jung Wook; Kim, Hyeong Rok; Kim, Young Jin

    2017-08-01

    The CpG island methylator phenotype (CIMP) is found in approximately 30% of colorectal cancer (CRC) cases. However, the role of CIMP status in predicting oncologic outcomes in curatively resected CRC is still unclear. Between January 2006 and December 2006, we retrospectively reviewed 157 consecutive patients who underwent curative surgery for CRC. Prognostic significance of CIMP status was evaluated using reverse transcriptase-polymerase chain reaction. CIMP-high (H) and CIMP-none/low (N/L) tumors were found in 50 cases (31.8%) and 107 cases (68.2%), respectively. CIMP-H tumors were significantly associated with female sex, colonic location, poorly/mucinous histologic type, higher T category, perineural invasion, and MSI-high status (P = 0.001). During a median of 64.5 months, tumor recurrence developed in 47 (29.9%) patients. The 5-year disease-free survival for CIMP-H and CIMP-N/L was 61.4% and 76.3% (P = 0.018). In addition, multivariate analysis showed that CIMP-H was also a significant prognostic factor (P = 0.042). When analysis was performed according to anatomical location, more marked survival differences were observed in patients with colon cancer (P = 0.026) than in patients with rectal cancer (P = 0.210). Similarly, the role of CIMP status as a prognostic indicator was more prominent in patients with stage I/II (P = 0.006) than in patients with stage III/IV CRC (P = 0.65). DNA methylation status can be considered as a useful predictor of survival after CRC surgery, particularly for patients with stage I/II disease or colon cancer. © 2017 Journal of Gastroenterology and Hepatology Foundation and John Wiley & Sons Australia, Ltd.

  11. CpG island methylator phenotype (CIMP) of colorectal cancer is best characterised by quantitative DNA methylation analysis and prospective cohort studies.

    PubMed

    Ogino, S; Cantor, M; Kawasaki, T; Brahmandam, M; Kirkner, G J; Weisenberger, D J; Campan, M; Laird, P W; Loda, M; Fuchs, C S

    2006-07-01

    The concept of CpG island methylator phenotype (CIMP) is not universally accepted. Even if specific clinicopathological features have been associated with CIMP, investigators often failed to demonstrate a bimodal distribution of the number of methylated markers, which would suggest CIMP as a distinct subtype of colorectal cancer. Previous studies primarily used methylation specific polymerase chain reaction which might detect biologically insignificant low levels of methylation. To demonstrate a distinct genetic profile of CIMP colorectal cancer using quantitative DNA methylation analysis that can distinguish high from low levels of DNA methylation. We developed quantitative real time polymerase chain reaction (MethyLight) assays and measured DNA methylation (percentage of methylated reference) of five carefully selected loci (promoters of CACNA1G, CDKN2A (p16), CRABP1, MLH1, and NEUROG1) in 460 colorectal cancers from large prospective cohorts. There was a clear bimodal distribution of 80 microsatellite instability-high (MSI-H) tumours according to the number of methylated promoters, with no tumours showing 3/5 methylated loci. Thus we defined CIMP as having >or=4/5 methylated loci, and 17% (78) of the 460 tumours were classified as CIMP. CIMP was significantly associated with female sex, MSI, BRAF mutations, and wild-type KRAS. Both CIMP MSI-H tumours and CIMP microsatellite stable (MSS) tumours showed much higher frequencies of BRAF mutations (63% and 54%) than non-CIMP counterparts (non-CIMP MSI-H (0%, p<10(-5)) and non-CIMP MSS tumours (6.6%, p<10(-4)), respectively). CIMP is best characterised by quantitative DNA methylation analysis. CIMP is a distinct epigenotype of colorectal cancer and may be less frequent than previously reported.

  12. Differential clinicopathological features in microsatellite instability-positive colorectal cancers depending on CIMP status.

    PubMed

    Bae, Jeong Mo; Kim, Mi Jung; Kim, Jung Ho; Koh, Jae Moon; Cho, Nam-Yun; Kim, Tae-You; Kang, Gyeong Hoon

    2011-07-01

    Microsatellite instability-positive (MSI+) colorectal cancers (CRCs) are divided into CpG island methylator phenotype-positive (CIMP+) and CpG island methylator phenotype-negative (CIMP-) tumors. The repertoire of inactivated genes in CIMP+/MSI+ CRCs overlaps with but is likely to differ from that of CIMP-/MSI+ CRCs. Because epigenotypic differences are likely to be manifested as phenotypic differences, CIMP+/MSI+ CRCs are expected to differ from CIMP-/MSI+ CRCs in some clinicopathological features. This study aimed to characterize both common and different features between the two subtypes. A total of 72 MSI+ CRCs were analyzed for their methylation status in eight CIMP panel markers using MethyLight assay. CIMP+/MSI+ and CIMP-/MSI+ CRCs were compared regarding clinicopathologic features and mutation in KRAS/BRAF. An independent set of MSI+ CRCs (n = 97) was analyzed for their relationship of CIMP+ status with clinical outcome. Eighteen cases (25%) were CIMP+, and this CIMP+ subtype was highly correlated with older age (P < 0.001). Polypoid gross appearance without ulceration was observed only in CIMP-/MSI+ CRCs (18.5%, P = 0.057). CIMP+/MSI+ CRCs were closely associated with poor differentiation, medullary appearance, signet ring cell appearance, and acinar-form appearance, whereas the CIMP-/MSI+ subtype was closely associated with intraglandular eosinophilic mucin and stratified nuclei (all P values <0.05). Patients with CIMP+/MSI+ CRCs showed worse overall survival than patients with CIMP-/MSI+ CRCs. Our results demonstrate heterogeneity in the clinicopathological features of MSI+ CRCs depending on CIMP status. The observation that CIMP+ and CIMP- subtypes showed different clinical behaviors may provide a clue for establishing subtype-specific therapeutic strategies for these two subtypes.

  13. Meta-analysis of the prognostic value of CpG island methylator phenotype in gastric cancer.

    PubMed

    Powell, A G M T; Soul, S; Christian, A; Lewis, W G

    2018-01-01

    CpG island methylator phenotype (CIMP) has been identified as a distinct molecular subtype of gastric cancer, yet associations with survival are conflicting. A meta-analysis was performed to estimate the prognostic significance of CIMP. Embase, MEDLINE, PubMed, PubMed Central and Cochrane databases were searched systematically for studies related to the association between CIMP and survival in patients undergoing potentially curative resection for gastric cancer. A total of 918 patients from ten studies were included, and the median proportion of tumours with CIMP-high (CIMP-H) status was 40·9 (range 4·8-63) per cent. Gene panels for assessing CIMP status varied between the studies. Pooled analysis suggested that specimens exhibiting CIMP-H were associated with poorer 5-year survival (odds ratio (OR) for death 1·48, 95 per cent c.i. 1·10 to 1·99; P = 0·009). Significant heterogeneity was observed between studies (I 2 = 88 per cent, P < 0·001). Subgroup analysis according to whether studies showed a tendency towards poor (5 studies) or improved (5) outcomes for patients with CIMP-H tumours, revealed that CIMP-H was associated with both poor (OR for death 8·15, 4·65 to 14·28, P < 0·001; heterogeneity I 2 = 52 per cent, P = 0·08) and improved (OR 0·42, 0·27 to 0·65; P < 0·001, heterogeneity I 2 = 0 per cent, P = 0·960) survival. There was heterogeneity in the gene panels used to identify CIMP, which may explain the survival differences. © 2018 BJS Society Ltd Published by John Wiley & Sons Ltd.

  14. Evaluation of CpG Island Methylator Phenotype as a Biomarker in Colorectal Cancer Treated With Adjuvant Oxaliplatin.

    PubMed

    Cohen, Stacey A; Wu, Chen; Yu, Ming; Gourgioti, Georgia; Wirtz, Ralph; Raptou, Georgia; Gkakou, Chryssa; Kotoula, Vassiliki; Pentheroudakis, George; Papaxoinis, George; Karavasilis, Vasilios; Pectasides, Dimitrios; Kalogeras, Konstantine T; Fountzilas, George; Grady, William M

    2016-06-01

    The CpG island methylator phenotype (CIMP) is a promising biomarker for irinotecan/5-fluorouracil/leucovorin chemotherapy for stage III colon cancer. In the present study, we evaluated whether CIMP is a prognostic biomarker for standard-of-care oxaliplatin-based adjuvant therapy. The HE6C/05 trial randomized 441 patients with stage II-III colorectal adenocarcinoma to adjuvant XELOX (capecitabine, oxaliplatin) or modified FOLFOX6 (5-fluorouracil, leucovorin, oxaliplatin). The primary and secondary objectives were disease-free and overall survival, respectively. CIMP status was determined using the DNA methylation status of CACNA1G, IGF2, NEUROG1, RUNX3, and SOCS1. Cox models were used to assess the association of CIMP with survival. Of the 293 available tumors, 28 (9.6%) were CIMP(+). On univariate Cox regression analysis, no significant differences in survival were observed between individuals with CIMP(+) versus CIMP(-) tumors. CIMP(+) tumors were more likely to be right-sided and BRAF mutant (χ(2), P < .001). In the multivariate model, TNM stage II (vs. stage III) was associated with a reduced risk of relapse (hazard ratio [HR], 0.25; 95% confidence interval [CI], 0.11-0.55; Wald's P < .001), and a colon primary located on the left side and earlier TNM stage were associated with a reduced risk of death (HR, 0.48; 95% CI, 0.28-0.81; P = .006; and HR, 0.22; 95% CI, 0.10-0.49; P < .001, respectively). In the present exploratory analysis, CIMP did not appear to be a prognostic biomarker in oxaliplatin-treated patients with resected colorectal cancer. Copyright © 2015 Elsevier Inc. All rights reserved.

  15. The CpG island methylator phenotype may confer a survival benefit in patients with stage II or III colorectal carcinomas receiving fluoropyrimidine-based adjuvant chemotherapy

    PubMed Central

    2011-01-01

    Background Colorectal carcinoma (CRC) with CpG island methylator phenotype (CIMP) is recognized as a distinct subgroup of CRC, and CIMP status affects prognosis and response to chemotherapy. Identification of CIMP status in CRC is important for proper patient management. In Eastern countries, however, the clinicopathologic and molecular characteristics and prognosis of CRCs with CIMP are still unclear. Methods A total of 245 patients who underwent their first surgical resection for sporadic CRC were enrolled and CIMP status of the CRCs was determined using the quantitative MethyLight assay. The clinicopathologic and molecular characteristics were reviewed and compared according to CIMP status. In addition, the three-year recurrence-free survival (RFS) of 124 patients with stage II or stage III CRC was analyzed in order to assess the effectiveness of fluoropyrimidine-based adjuvant chemotherapy with respect to CIMP status. Results CIMP-high CRCs were identified in 34 cases (13.9%), and were significantly associated with proximal tumor location, poorly differentiated carcinoma, mucinous histology, and high frequencies of BRAF mutation, MGMT methylation, and MSI-high compared to CIMP-low/negative carcinomas. For patients with stage II or III CIMP-low/negative CRCs, no significant difference was found in RFS between those undergoing surgery alone and those receiving surgery with fluoropyrimidine-based adjuvant chemotherapy. However, for patients with CIMP-high CRCs, patients undergoing surgery with fluoropyrimidine-based adjuvant chemotherapy (n = 17; three-year RFS: 100%) showed significantly better RFS than patients treated with surgery alone (n = 7; three-year RFS: 71.4%) (P = 0.022). Conclusions Our results suggest that selected patients with CIMP-high CRC may benefit from fluoropyrimidine-based adjuvant chemotherapy with longer RFS. Further large scale-studies are required to confirm our results. PMID:21827707

  16. Correlation of pathologic features with CpG island methylator phenotype (CIMP) by quantitative DNA methylation analysis in colorectal carcinoma.

    PubMed

    Ogino, Shuji; Odze, Robert D; Kawasaki, Takako; Brahmandam, Mohan; Kirkner, Gregory J; Laird, Peter W; Loda, Massimo; Fuchs, Charles S

    2006-09-01

    Extensive gene promoter methylation in colorectal carcinoma has been termed the CpG island methylator phenotype (CIMP). Previous studies on CIMP used primarily methylation-specific polymerase chain reaction (PCR), which, unfortunately, may detect low levels of methylation that has little or no biological significance. Utilizing quantitative real-time PCR (MethyLight), we measured DNA methylation in a panel of 5 CIMP-specific gene promoters (CACNA1G, CDKN2A (p16), CRABP1, MLH1, and NEUROG1) in 459 colorectal carcinomas obtained from 2 large prospective cohort studies. CIMP was defined as tumors that showed methylation in >or=4/5 promoters. CIMP was significantly associated with the presence of mucinous or signet ring cell morphology, marked Crohn's-like lymphoid reaction, tumor infiltrating lymphocytes, marked peritumoral lymphocytic reaction, tumor necrosis, tumor cell sheeting, and poor differentiation. All these features have previously been associated with microsatellite instability (MSI). Therefore, we divided the 459 colorectal carcinomas into 6 subtypes, namely, MSI-high (MSI-H)/CIMP, MSI-H/non-CIMP, MSI-low (MSI-L)/CIMP, MSI-L/non-CIMP, microsatellite stable/CIMP, and micro satellite sstable/non-CIMP. Compared with MSI-H/non-CIMP, MSI-H/CIMP was associated with marked tumor infiltrating lymphocytes, tumor necrosis, sheeting, and poor differentiation (all P

  17. CpG Island Methylator Phenotype Positive Tumors in the Absence of MLH1 Methylation Constitute a Distinct Subset of Duodenal Adenocarcinomas and Are Associated with Poor Prognosis

    PubMed Central

    Fu, Tao; Pappou, Emmanouil P.; Guzzetta, Angela A.; Jeschke, Jana; Kwak, Ruby; Dave, Pujan; Hooker, Craig M.; Morgan, Richard; Baylin, Stephen B.; Iacobuzio-Donahue, Christine A.; Wolfgang, Christopher L.; Ahuja, Nita

    2012-01-01

    Purpose Little information is available on genetic and epigenetic changes in duodenal adenocarcinomas. The purpose was to identify possible subsets of duodenal adenocarcinomas based on microsatellite instability (MSI), DNA methylation, mutations in the KRAS and BRAF genes, clinicopathologic features, and prognosis. Experimental Design Demographics, tumor characteristics and survival were available for 99 duodenal adenocarcinoma patients. Testing for KRAS and BRAF mutations, MSI, MLH1 methylation and CpG island methylator phenotype (CIMP) status was performed. A Cox proportional hazard model was built to predict survival. Results CIMP+ was detected in 27 of 99 (27.3%) duodenal adenocarcinomas, and was associated with MSI (P = 0.011) and MLH1 methylation (P < 0.001), but not with KRAS mutations (P = 0.114), as compared to CIMP− tumors. No BRAF V600E mutation was detected. Among the CIMP+ tumors, 15 (55.6%) were CIMP+/MLH1-unmethylated (MLH1-U). Kaplan-Meier analysis showed tumors classified by CIMP, CIMP/MLH1 methylation status or CIMP/MSI status could predict overall survival (OS; P = 0.047, 0.002, and 0.002, respectively), while CIMP/MLH1 methylation status could also predict time-to-recurrence (TTR; P = 0.016). In multivariate analysis, CIMP/MLH1 methylation status showed a significant prognostic value regarding both OS (P < 0.001) and TTR (P = 0.023). Patients with CIMP+/MLH1-U tumors had the worst OS and TTR. Conclusions Our results demonstrate existence of CIMP in duodenal adenocarcinomas. The combination of CIMP+/MLH1-U appears to be independently associated with poor prognosis in patients with duodenal adenocarcinomas. This study also suggests that BRAF mutations are not involved in duodenal tumorigenesis, MSI or CIMP development. PMID:22825585

  18. MicroRNA-31 expression in relation to BRAF mutation, CpG island methylation and colorectal continuum in serrated lesions.

    PubMed

    Ito, Miki; Mitsuhashi, Kei; Igarashi, Hisayoshi; Nosho, Katsuhiko; Naito, Takafumi; Yoshii, Shinji; Takahashi, Hiroaki; Fujita, Masahiro; Sukawa, Yasutaka; Yamamoto, Eiichiro; Takahashi, Taiga; Adachi, Yasushi; Nojima, Masanori; Sasaki, Yasushi; Tokino, Takashi; Baba, Yoshifumi; Maruyama, Reo; Suzuki, Hiromu; Imai, Kohzoh; Yamamoto, Hiroyuki; Shinomura, Yasuhisa

    2014-12-01

    The CpG island methylator phenotype (CIMP) is a distinct form of epigenomic instability. Many CIMP-high colorectal cancers (CRCs) with BRAF mutation are considered to arise from serrated pathway. We recently reported that microRNA-31 (miR-31) is associated with BRAF mutation in colorectal tumors. Emerging new approaches have revealed gradual changes in BRAF mutation and CIMP-high throughout the colorectum in CRCs. Here, we attempted to identify a possible association between miR-31 and epigenetic features in serrated pathway, and hypothesized that miR-31 supports the "colorectal continuum" concept. We evaluated miR-31 expression, BRAF mutation and epigenetic features including CIMP status in 381 serrated lesions and 222 non-serrated adenomas and examined associations between them and tumor location (rectum; sigmoid, descending, transverse and ascending colon and cecum). A significant association was observed between high miR-31 expression and CIMP-high status in serrated lesions with BRAF mutation (p = 0.0001). In contrast, miR-31 was slightly but insignificantly associated with CIMP status in the cases with wild-type BRAF. miR-31 expression in sessile serrated adenomas (SSAs) with cytological dysplasia was higher than that in SSAs, whereas, no significant difference was observed between traditional serrated adenomas (TSAs) and TSAs with high-grade dysplasia. The frequency of miR-31, BRAF mutation CIMP-high and MLH1 methylation increased gradually from the rectum to cecum in serrated lesions. In conclusion, miR-31 expression was associated with CIMP-high status in serrated lesions with BRAF mutation. Our data also suggested that miR-31 plays an important role in SSA evolution and may be a molecule supporting the colorectal continuum. © 2014 UICC.

  19. The CpG Island in the Murine Foxl2 Proximal Promoter Is Differentially Methylated in Primary and Immortalized Cells

    PubMed Central

    Tran, Stella; Wang, Ying; Lamba, Pankaj; Zhou, Xiang; Boehm, Ulrich; Bernard, Daniel J.

    2013-01-01

    Forkhead box L2 (Foxl2), a member of the forkhead transcription factor family, plays important roles in pituitary follicle-stimulating hormone synthesis and in ovarian maintenance and function. Mutations in the human FOXL2 gene cause eyelid malformations and premature ovarian failure. FOXL2/Foxl2 is expressed in pituitary gonadotrope and thyrotrope cells, the perioptic mesenchyme of the developing eyelid, and ovarian granulosa cells. The mechanisms governing this cell-restricted expression have not been described. We mapped the Foxl2 transcriptional start site in immortalized murine gonadotrope-like cells, LβT2, by 5’ rapid amplification of cDNA ends and then PCR amplified approximately 1 kb of 5’ flanking sequence from murine genomic DNA. When ligated into a reporter plasmid, the proximal promoter conferred luciferase activity in both homologous (LβT2) and, unexpectedly, heterologous (NIH3T3) cells. In silico analyses identified a CpG island in the proximal promoter and 5’ untranslated region, suggesting that Foxl2 transcription might be regulated epigenetically. Indeed, pyrosequencing and quantitative analysis of DNA methylation using real-time PCR revealed Foxl2 proximal promoter hypomethylation in homologous compared to some, though not all, heterologous cell lines. The promoter was also hypomethylated in purified murine gonadotropes. In vitro promoter methylation completely silenced reporter activity in heterologous and homologous cells. Collectively, the data suggest that differential proximal promoter DNA methylation may contribute to cell-specific Foxl2 expression in some cellular contexts. However, gonadotrope-specific expression of the gene cannot be explained by promoter hypomethylation alone. PMID:24098544

  20. Research on DNA methylation of human osteosarcoma cell MGMT and its relationship with cell resistance to alkylating agents.

    PubMed

    Guo, Jun; Cui, Qiu; Jiang, WeiHao; Liu, Cheng; Li, DingFeng; Zeng, Yanjun

    2013-08-01

    The objective of this study was to explore the O(6)-methylguanine-DNA methyltransferase (MGMT) gene methylation status and its protein expression, as well as the effects of demethylating agent 5-Aza-2'-deoxycytidine (5-Aza-CdR) on MGMT gene expression and its resistance to alkylating agents, and to elucidate MGMT expression mechanism and significance in osteosarcoma. The human osteosarcoma cell lines Saos-2 and MG-63 were collected and treated with 5-Aza-CdR for 6 days. The cells not treated with 5-Aza-CdR were set as a negative control. The genomic DNA was extracted from the Saos-2 and MG-63 cells using methylation-specific PCR to detect the promoter CpG island methylation status of the MGMT gene. Cell sensitivity to alkylating agents before and after drug administration was detected by the MTT method. The variation in MGMT gene mRNA and protein was detected by reverse transcription PCR (RT-PCR) and Western blotting. The MGMT promoter gene of normal Saos-2 cells was methylated, with reduced MGMT mRNA and protein expression; the MGMT mRNA and protein expression of Saos-2 cells treated with 5-Aza-CdR was obviously enhanced, and its sensitivity to alkylating agents was reversed. Meanwhile, with promoter CpG island unmethylation of the MGMT gene, MGMT protein was expressed in the normal MG-63 cells and the MG-63 cells treated with 5-Aza-CdR, and both showed resistance to alkylating agents. The methylation status of the MGMT gene promoter in human osteosarcoma cells reflected the cells' ability to induce MGMT protein expression and can be used as a molecular marker to project the sensitivity of cancer tissues to alkylating agent drugs.

  1. Recurrent patterns of DNA methylation in the ZNF154, CASP8, and VHL promoters across a wide spectrum of human solid epithelial tumors and cancer cell lines

    PubMed Central

    Sánchez-Vega, Francisco; Gotea, Valer; Petrykowska, Hanna M; Margolin, Gennady; Krivak, Thomas C; DeLoia, Julie A; Bell, Daphne W; Elnitski, Laura

    2013-01-01

    The study of aberrant DNA methylation in cancer holds the key to the discovery of novel biological markers for diagnostics and can help to delineate important mechanisms of disease. We have identified 12 loci that are differentially methylated in serous ovarian cancers and endometrioid ovarian and endometrial cancers with respect to normal control samples. The strongest signal showed hypermethylation in tumors at a CpG island within the ZNF154 promoter. We show that hypermethylation of this locus is recurrent across solid human epithelial tumor samples for 15 of 16 distinct cancer types from TCGA. Furthermore, ZNF154 hypermethylation is strikingly present across a diverse panel of ENCODE cell lines, but only in those derived from tumor cells. By extending our analysis from the Illumina 27K Infinium platform to the 450K platform, to sequencing of PCR amplicons from bisulfite treated DNA, we demonstrate that hypermethylation extends across the breadth of the ZNF154 CpG island. We have also identified recurrent hypomethylation in two genomic regions associated with CASP8 and VHL. These three genes exhibit significant negative correlation between methylation and gene expression across many cancer types, as well as patterns of DNaseI hypersensitivity and histone marks that reflect different chromatin accessibility in cancer vs. normal cell lines. Our findings emphasize hypermethylation of ZNF154 as a biological marker of relevance for tumor identification. Epigenetic modifications affecting the promoters of ZNF154, CASP8, and VHL are shared across a vast array of tumor types and may therefore be important for understanding the genomic landscape of cancer. PMID:24149212

  2. Recurrent patterns of DNA methylation in the ZNF154, CASP8, and VHL promoters across a wide spectrum of human solid epithelial tumors and cancer cell lines.

    PubMed

    Sánchez-Vega, Francisco; Gotea, Valer; Petrykowska, Hanna M; Margolin, Gennady; Krivak, Thomas C; DeLoia, Julie A; Bell, Daphne W; Elnitski, Laura

    2013-12-01

    The study of aberrant DNA methylation in cancer holds the key to the discovery of novel biological markers for diagnostics and can help to delineate important mechanisms of disease. We have identified 12 loci that are differentially methylated in serous ovarian cancers and endometrioid ovarian and endometrial cancers with respect to normal control samples. The strongest signal showed hypermethylation in tumors at a CpG island within the ZNF154 promoter. We show that hypermethylation of this locus is recurrent across solid human epithelial tumor samples for 15 of 16 distinct cancer types from TCGA. Furthermore, ZNF154 hypermethylation is strikingly present across a diverse panel of ENCODE cell lines, but only in those derived from tumor cells. By extending our analysis from the Illumina 27K Infinium platform to the 450K platform, to sequencing of PCR amplicons from bisulfite treated DNA, we demonstrate that hypermethylation extends across the breadth of the ZNF154 CpG island. We have also identified recurrent hypomethylation in two genomic regions associated with CASP8 and VHL. These three genes exhibit significant negative correlation between methylation and gene expression across many cancer types, as well as patterns of DNaseI hypersensitivity and histone marks that reflect different chromatin accessibility in cancer vs. normal cell lines. Our findings emphasize hypermethylation of ZNF154 as a biological marker of relevance for tumor identification. Epigenetic modifications affecting the promoters of ZNF154, CASP8, and VHL are shared across a vast array of tumor types and may therefore be important for understanding the genomic landscape of cancer.

  3. Potential roles of DNA methylation in the initiation and establishment of replicative senescence revealed by array-based methylome and transcriptome analyses

    PubMed Central

    Sakaki, Mizuho; Ebihara, Yukiko; Okamura, Kohji; Nakabayashi, Kazuhiko; Igarashi, Arisa; Matsumoto, Kenji; Hata, Kenichiro; Kobayashi, Yoshiro

    2017-01-01

    Cellular senescence is classified into two groups: replicative and premature senescence. Gene expression and epigenetic changes are reported to differ between these two groups and cell types. Normal human diploid fibroblast TIG-3 cells have often been used in cellular senescence research; however, their epigenetic profiles are still not fully understood. To elucidate how cellular senescence is epigenetically regulated in TIG-3 cells, we analyzed the gene expression and DNA methylation profiles of three types of senescent cells, namely, replicatively senescent, ras-induced senescent (RIS), and non-permissive temperature-induced senescent SVts8 cells, using gene expression and DNA methylation microarrays. The expression of genes involved in the cell cycle and immune response was commonly either down- or up-regulated in the three types of senescent cells, respectively. The altered DNA methylation patterns were observed in replicatively senescent cells, but not in prematurely senescent cells. Interestingly, hypomethylated CpG sites detected on non-CpG island regions (“open sea”) were enriched in immune response-related genes that had non-CpG island promoters. The integrated analysis of gene expression and methylation in replicatively senescent cells demonstrated that differentially expressed 867 genes, including cell cycle- and immune response-related genes, were associated with DNA methylation changes in CpG sites close to the transcription start sites (TSSs). Furthermore, several miRNAs regulated in part through DNA methylation were found to affect the expression of their targeted genes. Taken together, these results indicate that the epigenetic changes of DNA methylation regulate the expression of a certain portion of genes and partly contribute to the introduction and establishment of replicative senescence. PMID:28158250

  4. SU-E-T-583: Operated Left Breast and Chest Wall Radiotherapy: A Dosimetric Comparison Between 3DCRT, IMRT and VMAT

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sarkar, B; Roy, S; Munshi, A

    2015-06-15

    Purpose: To evaluate the comparative dosimetric efficacy between field and field 3DCRT(FnF), multiple field Intensity modulated radiotherapy (SnS IMRT) and, partial arc volumetric modulated arc therapy (VMAT) in case of post operative left side breast and chest wall irradiation. Methods: CT study set of fifteen post-operative left breast and chest wall patient was tested for a treatment plan of 50Gy in 25 fraction using partial arc VMAT, SnSIMRT and tangential beam 3DCRT . 3DCRT FnF gantry angle was ranging for left medial tangential 290±17{sup 0} and Lt lateral tangential l14°±12{sup 0}. For IMRT four fixed beam at gantry angle G130{supmore » 0} G110{sup 0} G300{sup 0} and G330{sup 0} was used, in case of insufficient dose another beam G150{sup 0} was added. In case of partial arc VMAT, lateral tangential arc G130{sup 0}-G100{sup 0} and medial tangential arc G280{sup 0}-G310{sup 0}. Inverse optimization was opted to cover at least 95%PTV by 95% prescription dose (RxD) and a strong weightage on reduction of heart and lung dose. PTV coverage was evaluated for it’s clinically acceptability depending on the tumor spatial location and its quadrant. Out of the three plans, any one was used for the actual patient treatment. Results: Dosimetric analysis done for breast PTV, left lung, heart and the opposite breast. PTV mean dose and maximum dose was 5129.8±214.8cGy, 4749.0±329.7cGy, 5024.6±73.4cGy and 5855.2±510.7cGy, 5340.7±146.1cGy, 5347.2±196.8cGy for FnF, VMAT and IMRT respectively. Ipsilateral lung volume receiving 20Gy and 5Gy was 23.6±9.5cGy and 32.7±10.3cGy for FnF, 18.6±8.7cGy and 38.8±15.2cGy for VMAT and 25.7±9.6cGy and 50.7±8.4cGy for IMRT respectively. Heart mean and 2cc dose was 867.9±456.7cGy and 5038.5±184.3cGy for FnF, 532.6±263cGy and 3632.1±990.6 for VMAT, 711±229.9cGy and 4421±463.7cGy for IMRT respectively. VMAT shows minimum contralateral breast dose 168±113.8cGy. Conclusion: VMAT shows a better tumor conformity, minimum heart, ipsilateral lung and opposite breast dose. Cardiac Toxicity and risk of contralateral breast cancer can be reduce using VMAT.« less

  5. Integrating prior knowledge in multiple testing under dependence with applications to detecting differential DNA methylation.

    PubMed

    Kuan, Pei Fen; Chiang, Derek Y

    2012-09-01

    DNA methylation has emerged as an important hallmark of epigenetics. Numerous platforms including tiling arrays and next generation sequencing, and experimental protocols are available for profiling DNA methylation. Similar to other tiling array data, DNA methylation data shares the characteristics of inherent correlation structure among nearby probes. However, unlike gene expression or protein DNA binding data, the varying CpG density which gives rise to CpG island, shore and shelf definition provides exogenous information in detecting differential methylation. This article aims to introduce a robust testing and probe ranking procedure based on a nonhomogeneous hidden Markov model that incorporates the above-mentioned features for detecting differential methylation. We revisit the seminal work of Sun and Cai (2009, Journal of the Royal Statistical Society: Series B (Statistical Methodology)71, 393-424) and propose modeling the nonnull using a nonparametric symmetric distribution in two-sided hypothesis testing. We show that this model improves probe ranking and is robust to model misspecification based on extensive simulation studies. We further illustrate that our proposed framework achieves good operating characteristics as compared to commonly used methods in real DNA methylation data that aims to detect differential methylation sites. © 2012, The International Biometric Society.

  6. Epigenetic regulation of the DRD4 gene and dimensions of attention-deficit/hyperactivity disorder in children.

    PubMed

    Dadds, Mark R; Schollar-Root, Olivia; Lenroot, Rhoshel; Moul, Caroline; Hawes, David J

    2016-10-01

    Recent evidence suggests that epigenetic regulation of the DRD4 gene may characterise specific aspects of ADHD symptomology. We tested associations between ADHD symptoms and epigenetic changes to the DRD4 gene in DNA extracted from blood and saliva in N = 330 children referred for a variety of behavioural and emotional problems. ADHD was indexed using DSM diagnoses as well as mother, father, and teacher reports. Methylation levels were assayed for the island of 18 CpG sites in the DRD4 receptor gene. A nearby SNP, rs3758653, was also genotyped as it has previously been shown to influence methylation levels. There was high consistency of methylation levels across CpG sites and tissue sources, and higher methylation levels were associated with the major allele of SNP rs3758653. Higher methylation levels were associated with more severe ADHD independent of SNP status, tissue source, ethnicity, environmental adversity, and comorbid conduct problems. The association applied specifically to the cognitive/attentional, rather than hyperactivity problems that characterise ADHD. The results indicate that epigenetic regulation of the DRD4 gene in the form of increased methylation is associated with the cognitive/attentional deficits in ADHD.

  7. Modification of the Clinical Global Impressions (CGI) Scale for use in bipolar illness (BP): the CGI-BP.

    PubMed

    Spearing, M K; Post, R M; Leverich, G S; Brandt, D; Nolen, W

    1997-12-05

    The Clinical Global Impressions Scale (CGI) was modified specifically for use in assessing global illness severity and change in patients with bipolar disorder. Criticisms of the original CGI were addressed by correcting inconsistencies in scaling, identifying time frames for comparison, clarifying definitions of illness severity and change, and separating out assessment of treatment side effects from illness improvement during treatment. A Detailed User's Guide was developed to train clinicians in the use of the new CGI-Bipolar Version (CGI-BP) for rating severity of manic and depressive episodes and the degree of change from the immediately preceding phase and from the worst phase of illness. The revised scale and manual provide a focused set of instructions to facilitate the reliability of these ratings of mania, depression, and overall bipolar illness during treatment of an acute episode or in longer-term illness prophylaxis. Interrater reliability of the scale was demonstrated in preliminary analyses. Thus, the modified CGI-BP is anticipated to be more useful than the original CGI in studies of bipolar disorder.

  8. Healthcare professionals' and policy makers' views on implementing a clinical practice guideline of hypertension management: a qualitative study.

    PubMed

    Lee, Ping Yein; Liew, Su May; Abdullah, Adina; Abdullah, Nurdiana; Ng, Chirk Jenn; Hanafi, Nik Sherina; Chia, Yook Chin; Lai, Pauline S M; Wong, Stalia S L; Khoo, Ee Ming

    2015-01-01

    Most studies have reported barriers to guideline usage mainly from doctors' perspective; few have reported the perspective of other stakeholders. This study aimed to determine the views and barriers to adherence of a national clinical practice guideline (CPG) on management of hypertension from the perspectives of policymakers, doctors and allied healthcare professionals. This study used a qualitative approach with purposive sampling. Seven in depth interviews and six focus group discussions were conducted with 35 healthcare professionals (policy makers, doctors, pharmacists and nurses) at a teaching hospital in Kuala Lumpur, Malaysia, between February and June 2013. All interviews were audio-recorded, transcribed verbatim and checked. Thematic approach was used to analyse the data. Two main themes and three sub-themes emerged from this study. The main themes were (1) variation in the use of CPG and (2) barriers to adherence to CPG. The three sub-themes for barriers were issues inherent to the CPG, systems and policy that is not supportive of CPG use, and attitudes and behaviour of stakeholders. The main users of the CPG were the primary care doctors. Pharmacists only partially use the guidelines, while nurses and policy makers were not using the CPG at all. Participants had suggested few strategies to improve usage and adherence to CPG. First, update the CPG regularly and keep its content simple with specific sections for allied health workers. Second, use technology to facilitate CPG accessibility and provide protected time for implementation of CPG recommendations. Third, incorporate local CPG in professional training, link CPG adherence to key performance indicators and provide incentives for its use. Barriers to the use of CPG hypertension management span across all stakeholders. The development and implementation of CPG focused mainly on doctors with lack of involvement of other healthcare stakeholders. Guidelines should be made simple, current, reliable, accessible, inclusive of all stakeholders and with good policy support.

  9. A Knowledge-Modeling Approach to Integrate Multiple Clinical Practice Guidelines to Provide Evidence-Based Clinical Decision Support for Managing Comorbid Conditions.

    PubMed

    Abidi, Samina

    2017-10-26

    Clinical management of comorbidities is a challenge, especially in a clinical decision support setting, as it requires the safe and efficient reconciliation of multiple disease-specific clinical procedures to formulate a comorbid therapeutic plan that is both effective and safe for the patient. In this paper we pursue the integration of multiple disease-specific Clinical Practice Guidelines (CPG) in order to manage co-morbidities within a computerized Clinical Decision Support System (CDSS). We present a CPG integration framework-termed as COMET (Comorbidity Ontological Modeling & ExecuTion) that manifests a knowledge management approach to model, computerize and integrate multiple CPG to yield a comorbid CPG knowledge model that upon execution can provide evidence-based recommendations for handling comorbid patients. COMET exploits semantic web technologies to achieve (a) CPG knowledge synthesis to translate a paper-based CPG to disease-specific clinical pathways (CP) that include specialized co-morbidity management procedures based on input from domain experts; (b) CPG knowledge modeling to computerize the disease-specific CP using a Comorbidity CPG ontology; (c) CPG knowledge integration by aligning multiple ontologically-modeled CP to develop a unified comorbid CPG knowledge model; and (e) CPG knowledge execution using reasoning engines to derive CPG-mediated recommendations for managing patients with comorbidities. We present a web-accessible COMET CDSS that provides family physicians with CPG-mediated comorbidity decision support to manage Atrial Fibrillation and Chronic Heart Failure. We present our qualitative and quantitative analysis of the knowledge content and usability of COMET CDSS.

  10. SU-E-T-619: Comparison of CyberKnife Versus HDR (SAVI) for Partial Breast Irradiation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mooij, R; Ding, X; Nagda, S

    2014-06-15

    Purpose: Compare SAVI plans and CyberKnife (CK) plans for the same accelerated course. Methods and Materials: Three SAVI patients were selected. Pre-SAVI CTs were used for CK planning. All prescriptions are 3400cGy in 10 fractions BID. Max dose to skin and chestwall is 425cGy. For SAVI, PTV is a 1cm expansion of the cavity minus the cavity. For CK, CTV is a 1cm expansion of the seroma, with 2mm margin. CK plans are normalized to SAVI, so that in both cases the 323cGy isodose line covers the same percentage of PTV. For CK Fiducial/Synchrony tracking is used. Results: In themore » following, all doses are per fraction and results are averaged. The PTVs for the CK plans are 2.4 times larger than the corresponding SAVI PTVs. Nonetheless the CK plans meet all constraints and are superior to SAVI plans in several respects. Max skin dose for SAVI vs CK is 332cGy vs 337cGy. Max dose to chestwall is 252cGy vs 286cGy. The volume of lung over 125cGy is 6.4cc for SAVI and 2.5cc for CK. Max heart dose is 60cGy for SAVI and 83cGy for CK. The volume of PTV receiving over 425cGy is 49cc for SAVI and 1.3cc for CK. Max dose to contra-lateral breast is 16cGy for SAVI and 4.5cGy for CK. Conclusion: CK PTVs are directly derived from the seroma. Corresponding SAVI PTVs tend to be much smaller. Dosimetrically, CK plans are equivalent or superior to SAVI plans despite the larger PTVs. Interestingly, the dose delivered to the lung is higher in SAVI vs CK. Fiducial/Synchrony tracking employed by CK might reduce errors in delivery compared to errors associated with shifts of the SAVI implant. In conclusion, when CK is an option for partial breast irradiation it may preferable to SAVI.« less

  11. Immunostimulatory Properties of Lipid Modified CpG Oligonucleotides.

    PubMed

    Yu, Chunsong; An, Myunggi; Li, Meng; Liu, Haipeng

    2017-08-07

    Innate immune responses recognizing pathogen associated molecular patterns play important roles in adaptive immunity. As such, ligands which mimic the conserved products of microbial and activate innate immunity are widely used as adjuvants for vaccines. Synthetic single strand oligodeoxynucleotides (ODNs) containing unmethylated cytosine-guanine (CpG) motifs which bind Toll-like receptor 9 (TLR9) are powerful molecular adjuvants, potentiating both humoral and cellular responses. However, CpG ODN's in vitro potency has not been translated to in vivo settings primarily due to issues associated with delivery and toxicity. A major challenge in clinical application of CpG ODN is the efficient delivery to lymph nodes, the anatomic sites where all the immune responses are initiated. Targeting CpG to the key antigen presenting cells (APC) is essential for its application as a vaccine adjuvant, as it not only enhances CpG's efficacy, but also greatly reduces the systemic toxicity. We recently discovered an "albumin-hitchhiking" approach by which CpG ODNs were conjugated to a lipophilic lipid tail and follow subcutaneous injection, accumulated in lymph nodes by binding and transporting with endogenous albumin. This molecular approach targets CpG to antigen presenting cells in the draining lymph nodes via an endogenous albumin-mediated mechanism and simultaneously improves both the efficacy and safety of CpG as a vaccine adjuvant. Since CpG ODNs can be divided into structurally distinct classes, and each class of CpG ODN activates different types of immune cells and triggers different types of immunostimulatory activities, it is important to thoroughly evaluate the efficacy of this "albumin-hitchhiking" strategy in each class of CpG. Here we compare the immunostimulatory activities of three classes of lipid conjugated CpG ODNs in vitro and in vivo. Three representative sequences of lipid modified CpG ODNs were synthesized and their stimulatory effects as a vaccine adjuvant were evaluated. Our results showed that in vitro, lipid modified class A CpG exhibited enhanced stimulatory activities toward TLR transfected reporter cells or bone-marrow derived dendritic cells, whereas lipid-modification of class B or C CpG reduces the activation of TLR9 by 2-3 fold, as compared with unmodified class B and class C CpG, respectively. However, in vivo coadministration of ovalbumin (OVA) protein antigen mixed with lipid-conjugated class B or C CpG ODNs, but not class A CpGs induced dramatically increased OVA-specific humoral and cytotoxic CD8 + T cells responses compared with OVA mixed with unmodified CpGs. Further, lipid-modification greatly reduces the toxicity associated with CpG by minimizing the systemic dissemination. Taken together, these results demonstrated that amphiphilic modification of three classes of CpG motifs differentially affected and modulated the immunostimulatory activities in vitro and in vivo. Our study highlights the importance of in vivo lymph node targeting of CpG ODNs in fulfilling their use as vaccine adjuvants, providing implications for the rational design of molecular adjuvant for subunit vaccines.

  12. The alpha/beta hydrolase CGI-58 and peroxisomal transport protein PXA1 coregulate lipid homeostasis and signaling in Arabidopsis

    USDA-ARS?s Scientific Manuscript database

    COMPARATIVE GENE IDENTIFICATION-58 (CGI-58) is a key regulator of lipid metabolism and signaling in mammals, but its underlying mechanisms are unclear. Disruption of CGI-58 in either mammals or plants results in a significant increase in triacylglycerol (TAG), suggesting that CGI-58 activity is evol...

  13. Genome-Wide Associations between Genetic and Epigenetic Variation Influence mRNA Expression and Insulin Secretion in Human Pancreatic Islets

    PubMed Central

    Olsson, Anders H.; Volkov, Petr; Bacos, Karl; Dayeh, Tasnim; Hall, Elin; Nilsson, Emma A.; Ladenvall, Claes; Rönn, Tina; Ling, Charlotte

    2014-01-01

    Genetic and epigenetic mechanisms may interact and together affect biological processes and disease development. However, most previous studies have investigated genetic and epigenetic mechanisms independently, and studies examining their interactions throughout the human genome are lacking. To identify genetic loci that interact with the epigenome, we performed the first genome-wide DNA methylation quantitative trait locus (mQTL) analysis in human pancreatic islets. We related 574,553 single nucleotide polymorphisms (SNPs) with genome-wide DNA methylation data of 468,787 CpG sites targeting 99% of RefSeq genes in islets from 89 donors. We identified 67,438 SNP-CpG pairs in cis, corresponding to 36,783 SNPs (6.4% of tested SNPs) and 11,735 CpG sites (2.5% of tested CpGs), and 2,562 significant SNP-CpG pairs in trans, corresponding to 1,465 SNPs (0.3% of tested SNPs) and 383 CpG sites (0.08% of tested CpGs), showing significant associations after correction for multiple testing. These include reported diabetes loci, e.g. ADCY5, KCNJ11, HLA-DQA1, INS, PDX1 and GRB10. CpGs of significant cis-mQTLs were overrepresented in the gene body and outside of CpG islands. Follow-up analyses further identified mQTLs associated with gene expression and insulin secretion in human islets. Causal inference test (CIT) identified SNP-CpG pairs where DNA methylation in human islets is the potential mediator of the genetic association with gene expression or insulin secretion. Functional analyses further demonstrated that identified candidate genes (GPX7, GSTT1 and SNX19) directly affect key biological processes such as proliferation and apoptosis in pancreatic β-cells. Finally, we found direct correlations between DNA methylation of 22,773 (4.9%) CpGs with mRNA expression of 4,876 genes, where 90% of the correlations were negative when CpGs were located in the region surrounding transcription start site. Our study demonstrates for the first time how genome-wide genetic and epigenetic variation interacts to influence gene expression, islet function and potential diabetes risk in humans. PMID:25375650

  14. Isolation of a yeast artificial chromosome contig spanning the Greig cephalopolysyndactyly syndrome (GCPS) gene region

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vortkamp, A.; Gessler, M.; Le Paslier, D.

    1994-08-01

    Disruption of the zinc finger gene GLI3 has been shown to be the cause of Greig cephalopolysyndactyly syndrome (GCPS), at least in some GCPS translocation patients. To characterize this genomic region on human chromosome 7p13, we have isolated a YAC contig of more than 1000 kb including the GLI3 gene. In this contig the gene itself spans at least 200-250 kb. A CpG island is located in the vicinity of the 5{prime} region of the known GLI3 cDNA, implying a potential promoter region. 28 refs., 3 figs., 1 tab.

  15. Retention of the Native Epigenome in Purified Mammalian Chromatin

    PubMed Central

    Ehrensberger, Andreas H.; Franchini, Don-Marc; East, Philip; George, Roger; Matthews, Nik; Maslen, Sarah L.; Svejstrup, Jesper Q.

    2015-01-01

    A protocol is presented for the isolation of native mammalian chromatin as fibers of 25–250 nucleosomes under conditions that preserve the natural epigenetic signature. The material is composed almost exclusively of histones and DNA and conforms to the structure expected by electron microscopy. All sequences probed for were retained, indicating that the material is representative of the majority of the genome. DNA methylation marks and histone marks resembled the patterns observed in vivo. Importantly, nucleosome positions also remained largely unchanged, except on CpG islands, where nucleosomes were found to be unstable. The technical challenges of reconstituting biochemical reactions with native mammalian chromatin are discussed. PMID:26248330

  16. Serrated colorectal cancer: Molecular classification, prognosis, and response to chemotherapy

    PubMed Central

    Murcia, Oscar; Juárez, Miriam; Hernández-Illán, Eva; Egoavil, Cecilia; Giner-Calabuig, Mar; Rodríguez-Soler, María; Jover, Rodrigo

    2016-01-01

    Molecular advances support the existence of an alternative pathway of colorectal carcinogenesis that is based on the hypermethylation of specific DNA regions that silences tumor suppressor genes. This alternative pathway has been called the serrated pathway due to the serrated appearance of tumors in histological analysis. New classifications for colorectal cancer (CRC) were proposed recently based on genetic profiles that show four types of molecular alterations: BRAF gene mutations, KRAS gene mutations, microsatellite instability, and hypermethylation of CpG islands. This review summarizes what is known about the serrated pathway of CRC, including CRC molecular and clinical features, prognosis, and response to chemotherapy. PMID:27053844

  17. Epigenetic alterations as cancer diagnostic, prognostic, and predictive biomarkers.

    PubMed

    Deng, Dajun; Liu, Zhaojun; Du, Yantao

    2010-01-01

    Alterations of DNA methylation and transcription of microRNAs (miRNAs) are very stable phenomena in tissues and body fluids and suitable for sensitive detection. These advantages enable us to translate some important discoveries on epigenetic oncology into biomarkers for control of cancer. A few promising epigenetic biomarkers are emerging. Clinical trials using methylated CpG islands of p16, Septin9, and MGMT as biomarkers are carried out for predication of cancer development, diagnosis, and chemosensitivity. Circulating miRNAs are promising biomarkers, too. Breakthroughs in the past decade imply that epigenetic biomarkers may be useful in reducing the burden of cancer. Copyright © 2010 Elsevier Inc. All rights reserved.

  18. Differential methylation at the RELN gene promoter in temporal cortex from autistic and typically developing post-puberal subjects.

    PubMed

    Lintas, Carla; Sacco, Roberto; Persico, Antonio M

    2016-01-01

    Reelin plays a pivotal role in neurodevelopment and in post-natal synaptic plasticity and has been implicated in the pathogenesis of autism spectrum disorder (ASD). The reelin (RELN) gene expression is significantly decreased in ASD, both in the brain and peripherally. Methylation at the RELN gene promoter is largely triggered at puberty, and hypermethylation has been found in post-mortem brains of schizophrenic and bipolar patients. In this study, we assessed RELN gene methylation status in post-mortem temporocortical tissue samples (BA41/42 or 22) of six pairs of post-puberal individuals with ASD and typically developing subjects, matched for sex (male:female, M:F = 5:1), age, and post-mortem interval. ASD patients display a significantly higher number of methylated CpG islands and heavier methylation in the 5' region of the RELN gene promoter, spanning from -458 to -223 bp, whereas controls have more methylated CpG positions and greater extent of methylation at the 3' promoter region, spanning from -222 to +1 bp. The most upstream promoter region (-458 to -364 bp) is methylated only in ASD brains, while the most downstream region (-131 to +1 bp) is methylated exclusively in control brains. Within this general framework, three different methylation patterns are discernible, each correlated with different extents of reduction in reelin gene expression among ASD individuals compared to controls. The methylation pattern is different in ASD and control post-mortem brains. ASD-specific CpG positions, located in the most upstream gene promoter region, may exert a functional role potentially conferring ASD risk by blunting RELN gene expression.

  19. Characterization of tumor cells and stem cells by differential nuclear methylation imaging

    NASA Astrophysics Data System (ADS)

    Tajbakhsh, Jian; Wawrowsky, Kolja A.; Gertych, Arkadiusz; Bar-Nur, Ori; Vishnevsky, Eugene; Lindsley, Erik H.; Farkas, Daniel L.

    2008-02-01

    DNA methylation plays a key role in cellular differentiation. Aberrant global methylation patterns are associated with several cancer types, as a result of changes in long-term activation status of up to 50% of genes, including oncogenes and tumor-suppressor genes, which are regulated by methylation and demethylation of promoter region CpG dinucleotides (CpG islands). Furthermore, DNA methylation also occurs in nonisland CpG sites (> 95% of the genome), present once per 80 dinucleotides on average. Nuclear DNA methylation increases during the course of cellular differentiation while cancer cells usually show a net loss in methylation. Given the large dynamic range in DNA methylation load, the methylation pattern of a cell can provide a valuable distinction as to its status during differentiation versus the disease state. By applying immunofluorescence, confocal microscopy and 3D image analysis we assessed the potential of differential nuclear distribution of methylated DNA to be utilized as a biomarker to characterize cells during development and when diseased. There are two major fields that may immediately benefit from this development: (1) the search for factors that contribute to pluripotency and cell fate in human embryonic stem cell expansion and differentiation, and (2) the characterization of tumor cells with regard to their heterogeneity in molecular composition and behavior. We performed topological analysis of the distribution of methylated CpG-sites (MeC) versus heterochromatin. This innovative approach revealed significant differences in colocalization patterns of MeC and heterochromatin-derived signals between undifferentiated and differentiated human embryonic stem cells, as well as untreated AtT20 mouse pituitary tumor cells compared to a subpopulation of these cells treated with 5-azacytidine for 48 hours.

  20. Methylation levels of the "long interspersed nucleotide element-1" repetitive sequences predict survival of melanoma patients.

    PubMed

    Sigalotti, Luca; Fratta, Elisabetta; Bidoli, Ettore; Covre, Alessia; Parisi, Giulia; Colizzi, Francesca; Coral, Sandra; Massarut, Samuele; Kirkwood, John M; Maio, Michele

    2011-05-26

    The prognosis of cutaneous melanoma (CM) differs for patients with identical clinico-pathological stage, and no molecular markers discriminating the prognosis of stage III individuals have been established. Genome-wide alterations in DNA methylation are a common event in cancer. This study aimed to define the prognostic value of genomic DNA methylation levels in stage III CM patients. Overall level of genomic DNA methylation was measured using bisulfite pyrosequencing at three CpG sites (CpG1, CpG2, CpG3) of the Long Interspersed Nucleotide Element-1 (LINE-1) sequences in short-term CM cultures from 42 stage IIIC patients. The impact of LINE-1 methylation on overall survival (OS) was assessed using Cox regression and Kaplan-Meier analysis. Hypomethylation (i.e., methylation below median) at CpG2 and CpG3 sites significantly associated with improved prognosis of CM, CpG3 showing the strongest association. Patients with hypomethylated CpG3 had increased OS (P = 0.01, log-rank = 6.39) by Kaplan-Meyer analysis. Median OS of patients with hypomethylated or hypermethylated CpG3 were 31.9 and 11.5 months, respectively. The 5 year OS for patients with hypomethylated CpG3 was 48% compared to 7% for patients with hypermethylated sequences. Among the variables examined by Cox regression analysis, LINE-1 methylation at CpG2 and CpG3 was the only predictor of OS (Hazard Ratio = 2.63, for hypermethylated CpG3; 95% Confidence Interval: 1.21-5.69; P = 0.01). LINE-1 methylation is identified as a molecular marker of prognosis for CM patients in stage IIIC. Evaluation of LINE-1 promises to represent a key tool for driving the most appropriate clinical management of stage III CM patients.

  1. Fatty acid binding protein 3 (fabp3) is associated with insulin, lipids and cardiovascular phenotypes of the metabolic syndrome through epigenetic modifications in a Northern European family population.

    PubMed

    Zhang, Yi; Kent, Jack W; Lee, Adam; Cerjak, Diana; Ali, Omar; Diasio, Robert; Olivier, Michael; Blangero, John; Carless, Melanie A; Kissebah, Ahmed H

    2013-03-19

    Fatty acid-binding proteins (FABPs) play regulatory roles at the nexus of lipid metabolism and signaling. Dyslipidemia in clinical manifestation frequently co-occurs with obesity, insulin resistance and hypertension in the Metabolic Syndrome (MetS). Animal studies have suggested FABPs play regulatory roles in expressing MetS phenotypes. In our family cohort of Northern European descent, transcript levels in peripheral white blood cells (PWBCs) of a key FABPs, FABP3, is correlated with the MetS leading components. However, evidence supporting the functions of FABPs in humans using genetic approaches has been scarce, suggesting FABPs may be under epigenetic regulation. The objective of this study was to test the hypothesis that CpG methylation status of a key regulator of lipid homeostasis, FABP3, is a quantitative trait associated with status of MetS phenotypes in humans. We used a mass-spec based quantitative method, EpiTYPER®, to profile a CpG island that extends from the promoter to the first exon of the FABP3 gene in our family-based cohort of Northern European descent (n=517). We then conducted statistical analysis of the quantitative relationship of CpG methylation and MetS measures following the variance-component association model. Heritability of each methylation and the effect of age and sex on CpG methylation were also assessed in our families. We find that methylation levels of individual CpG units and the regional average are heritable and significantly influenced by age and sex. Regional methylation was strongly associated with plasma total cholesterol (p=0.00028) and suggestively associated with LDL-cholesterol (p=0.00495). Methylation at individual units was significantly associated with insulin sensitivity, lipid particle sizing and diastolic blood pressure (p<0.0028, corrected for multiple testing for each trait). Peripheral white blood cell (PWBC) expression of FABP3 in a separate group of subjects (n=128) negatively correlated with adverse profiles of metabolism (βWHR=-0.72; βLDL-c=-0.53) while positively correlated with plasma adiponectin (β=0.24). Further, we show that differential methylation of FABP3 affects binding activity with nuclear proteins from heart tissue. This region that we found under methylation regulation overlaps with a region actively modified by histone codes in the newly available ENCODE data. Our findings suggest that DNA methylation of FABP3 strongly influences MetS, and this may have important implications for cardiovascular disease.

  2. Writing World-Wide Web CGI scripts in the REXX language

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cottrell, R.L.A.

    This talk is aimed at people who have experience with REXX and are interested in using it to write WWW CGI scripts. As part of this, the author describes several functions that are available in a library of REXX functions that simplify writing WWW CGI scripts. This library is freely available at //www.slac.standard.edu/slac/www/tool/cgi-rexx/.

  3. SU-F-P-55: Testicular Scatter Dose Determination During Prostate SBRT with and Without Pelvic Lymph Nodes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Venencia, C; Garrigo, E; Castro Pena, P

    Purpose: The elective irradiation of pelvis lymph node for prostate cancer is still controversial. Including pelvic lymph node as part of the planning target volume could increase the testicular scatter dose, which could have a clinical impact. The objective of this work was to measure testicular scatter dose for prostate SBRT treatment with and without pelvic lymph nodes using TLD dosimetry. Methods: A 6MV beam (1000UM/min) produce by a Novalis TX (BrainLAB-VARIAN) equipped HDMLC was used. Treatment plan were done using iPlan v4.5.3 (BrainLAB) treatment planning system with sliding windows IMRT technique. Prostate SBRT plan (PLAN-1) uses 9 beams withmore » a dose prescription (D95%) of 4000cGy in 5 fractions. Prostate with lymph nodes SBRT plan (PLAN-2) uses 11 beams with a dose prescription (D95%) of 4000cGy to the prostate and 2500cGy to the lymph node in 5 fractions. An anthropomorphic pelvic phantom with a testicular volume was used. Phantom was positioned using ExacTrac IGRT system. Phosphor TLDs LiF:Mg, Ti (TLD700 Harshaw) were positioned in the anterior, posterior and inferior portion of the testicle. Two set of TLD measurements was done for each treatment plan. TLD in vivo dosimetry was done in one patient for each treatment plan. Results: The average phantom scatter doses per fraction for the PLAN-1 were 10.9±1cGy (anterior), 7.8±1cGy (inferior) and 10.7±1cGy (posterior) which represent an average total dose of 48±1cGy (1.2% of prostate dose prescription). The doses for PLAN-2 plan were 17.7±1cGy (anterior), 11±1cGy (inferior) and 13.3±1cGy (posterior) which represent an average total dose of 70.1±1cGy (1.8% of prostate dose prescription). The average dose for in vivo patient dosimetry was 60±1cGy for PLAN-1 and 85±1cGy for PLAN-2. Conclusion: Phantom and in vivo dosimetry shows that the pelvic lymph node irradiation with SBRT slightly increases the testicular scatter dose, which could have a clinical impact.« less

  4. ZikaVR: An Integrated Zika Virus Resource for Genomics, Proteomics, Phylogenetic and Therapeutic Analysis

    PubMed Central

    Gupta, Amit Kumar; Kaur, Karambir; Rajput, Akanksha; Dhanda, Sandeep Kumar; Sehgal, Manika; Khan, Md. Shoaib; Monga, Isha; Dar, Showkat Ahmad; Singh, Sandeep; Nagpal, Gandharva; Usmani, Salman Sadullah; Thakur, Anamika; Kaur, Gazaldeep; Sharma, Shivangi; Bhardwaj, Aman; Qureshi, Abid; Raghava, Gajendra Pal Singh; Kumar, Manoj

    2016-01-01

    Current Zika virus (ZIKV) outbreaks that spread in several areas of Africa, Southeast Asia, and in pacific islands is declared as a global health emergency by World Health Organization (WHO). It causes Zika fever and illness ranging from severe autoimmune to neurological complications in humans. To facilitate research on this virus, we have developed an integrative multi-omics platform; ZikaVR (http://bioinfo.imtech.res.in/manojk/zikavr/), dedicated to the ZIKV genomic, proteomic and therapeutic knowledge. It comprises of whole genome sequences, their respective functional information regarding proteins, genes, and structural content. Additionally, it also delivers sophisticated analysis such as whole-genome alignments, conservation and variation, CpG islands, codon context, usage bias and phylogenetic inferences at whole genome and proteome level with user-friendly visual environment. Further, glycosylation sites and molecular diagnostic primers were also analyzed. Most importantly, we also proposed potential therapeutically imperative constituents namely vaccine epitopes, siRNAs, miRNAs, sgRNAs and repurposing drug candidates. PMID:27633273

  5. Radiotherapy for gastric lymphoma: a planning study of 3D conformal radiotherapy, the half-beam method, and intensity-modulated radiotherapy.

    PubMed

    Inaba, Koji; Okamoto, Hiroyuki; Wakita, Akihisa; Nakamura, Satoshi; Kobayashi, Kazuma; Harada, Ken; Kitaguchi, Mayuka; Sekii, Shuhei; Takahashi, Kana; Yoshio, Kotaro; Murakami, Naoya; Morota, Madoka; Ito, Yoshinori; Sumi, Minako; Uno, Takashi; Itami, Jun

    2014-11-01

    During radiotherapy for gastric lymphoma, it is difficult to protect the liver and kidneys in cases where there is considerable overlap between these organs and the target volume. This study was conducted to compare the three radiotherapy planning techniques of four-fields 3D conformal radiotherapy (3DCRT), half-field radiotherapy (the half-beam method) and intensity-modulated radiotherapy (IMRT) used to treat primary gastric lymphoma in which the planning target volume (PTV) had a large overlap with the left kidney. A total of 17 patients with gastric diffuse large B-cell lymphoma (DLBCL) were included. In DLBCL, immunochemotherapy (Rituximab + CHOP) was followed by radiotherapy of 40 Gy to the whole stomach and peri-gastric lymph nodes. 3DCRT, the half-field method, and IMRT were compared with respect to the dose-volume histogram (DVH) parameters and generalized equivalent uniform dose (gEUD) to the kidneys, liver and PTV. The mean dose and gEUD for 3DCRT was higher than for IMRT and the half-beam method in the left kidney and both kidneys. The mean dose and gEUD of the left kidney was 2117 cGy and 2224 cGy for 3DCRT, 1520 cGy and 1637 cGy for IMRT, and 1100 cGy and 1357 cGy for the half-beam method, respectively. The mean dose and gEUD of both kidneys was 1335 cGy and 1559 cGy for 3DCRT, 1184 cGy and 1311 cGy for IMRT, and 700 cGy and 937 cGy for the half-beam method, respectively. Dose-volume histograms (DVHs) of the liver revealed a larger volume was irradiated in the dose range <25 Gy with 3DCRT, while the half-beam method irradiated a larger volume of liver with the higher dose range (>25 Gy). IMRT and the half-beam method had the advantages of dose reduction for the kidneys and liver. © The Author 2014. Published by Oxford University Press on behalf of The Japan Radiation Research Society and Japanese Society for Radiation Oncology.

  6. Dosimetric analysis of testicular doses in prostate intensity-modulated and volumetric-modulated arc radiation therapy at different energy levels

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Onal, Cem, E-mail: hcemonal@hotmail.com; Arslan, Gungor; Dolek, Yemliha

    2016-01-01

    The aim of this study is to evaluate the incidental testicular doses during prostate radiation therapy with intensity-modulated radiotherapy (IMRT) and volumetric-modulated arc radiotherapy (VMAT) at different energies. Dosimetric data of 15 patients with intermediate-risk prostate cancer who were treated with radiotherapy were analyzed. The prescribed dose was 78 Gy in 39 fractions. Dosimetric analysis compared testicular doses generated by 7-field intensity-modulated radiotherapy and volumetric-modulated arc radiotherapy with a single arc at 6, 10, and 15 MV energy levels. Testicular doses calculated from the treatment planning system and doses measured from the detectors were analyzed. Mean testicular doses from themore » intensity-modulated radiotherapy and volumetric-modulated arc radiotherapy per fraction calculated in the treatment planning system were 16.3 ± 10.3 cGy vs 21.5 ± 11.2 cGy (p = 0.03) at 6 MV, 13.4 ± 10.4 cGy vs 17.8 ± 10.7 cGy (p = 0.04) at 10 MV, and 10.6 ± 8.5 cGy vs 14.5 ± 8.6 cGy (p = 0.03) at 15 MV, respectively. Mean scattered testicular doses in the phantom measurements were 99.5 ± 17.2 cGy, 118.7 ± 16.4 cGy, and 193.9 ± 14.5 cGy at 6, 10, and 15 MV, respectively, in the intensity-modulated radiotherapy plans. In the volumetric-modulated arc radiotherapy plans, corresponding testicular doses per course were 90.4 ± 16.3 cGy, 103.6 ± 16.4 cGy, and 139.3 ± 14.6 cGy at 6, 10, and 15 MV, respectively. In conclusions, this study was the first to measure the incidental testicular doses by intensity-modulated radiotherapy and volumetric-modulated arc radiotherapy plans at different energy levels during prostate-only irradiation. Higher photon energy and volumetric-modulated arc radiotherapy plans resulted in higher incidental testicular doses compared with lower photon energy and intensity-modulated radiotherapy plans.« less

  7. TLR9-ERK-mTOR signaling is critical for autophagic cell death induced by CpG oligodeoxynucleotide 107 combined with irradiation in glioma cells

    PubMed Central

    Li, Xiaoli; Cen, Yanyan; Cai, Yongqing; Liu, Tao; Liu, Huan; Cao, Guanqun; Liu, Dan; Li, Bin; Peng, Wei; Zou, Jintao; Pang, Xueli; Zheng, Jiang; Zhou, Hong

    2016-01-01

    Synthetic oligodeoxynucleotides containing unmethylated CpG dinucleotides (CpG ODN) function as potential radiosensitizers for glioma treatment, although the underlying mechanism is unclear. It was observed that CpG ODN107, when combined with irradiation, did not induce apoptosis. Herein, the effect of CpG ODN107 + irradiation on autophagy and the related signaling pathways was investigated. In vitro, CpG ODN107 + irradiation induced autophagosome formation, increased the ratio of LC3 II/LC3 I, beclin 1 and decreased p62 expression in U87 cells. Meanwhile, CpG ODN107 also increased LC3 II/LC3 I expression in U251 and CHG-5 cells. In vivo, CpG ODN107 combined with local radiotherapy induced autophagosome formation in orthotopic transplantation tumor. Investigation of the molecular mechanisms demonstrated that CpG ODN107 + irradiation increased the levels of TLR9 and p-ERK, and decreased the level of p-mTOR in glioma cells. Further, TLR9-specific siRNA could affect the expressions of p-ERK and autophagy-related proteins in glioma cells. Taken together, CpG ODN107 combined with irradiation could induce autophagic cell death, and this effect was closely related to the TLR9-ERK-mTOR signaling pathway in glioma cells, providing new insights into the investigation mechanism of CpG ODN. PMID:27251306

  8. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pantelis, Evaggelos, E-mail: vpantelis@phys.uoa.g; Medical Physics Laboratory, Medical School, University of Athens, Athens; Papadakis, Nikolaos

    Purpose: To study the efficacy of the integration of functional magnetic resonance imaging (fMRI) and diffusion tensor imaging tractography data into stereotactic radiosurgery clinical practice. Methods and Materials: fMRI and tractography data sets were acquired and fused with corresponding anatomical MR and computed tomography images of patients with arteriovenous malformation (AVM), astrocytoma, brain metastasis, or hemangioma and referred for stereotactic radiosurgery. The acquired data sets were imported into a CyberKnife stereotactic radiosurgery system and used to delineate the target, organs at risk, and nearby functional structures and fiber tracts. Treatment plans with and without the incorporation of the functional structuresmore » and the fiber tracts into the optimization process were developed and compared. Results: The nearby functional structures and fiber tracts could receive doses of >50% of the maximum dose if they were excluded from the planning process. In the AVM case, the doses received by the Broadmann-17 structure and the optic tract were reduced to 700 cGy from 1,400 cGy and to 1,200 cGy from 2,000 cGy, respectively, upon inclusion into the optimization process. In the metastasis case, the motor cortex received 850 cGy instead of 1,400 cGy; and in the hemangioma case, the pyramidal tracts received 780 cGy instead of 990 cGy. In the astrocytoma case, the dose to the motor cortex bordering the lesion was reduced to 1,900 cGy from 2,100 cGy, and therefore, the biologically equivalent dose in three fractions was delivered instead. Conclusions: Functional structures and fiber tracts could receive high doses if they were not considered during treatment planning. With the aid of fMRI and tractography images, they can be delineated and spared.« less

  9. Contralateral Breast Dose After Whole-Breast Irradiation: An Analysis by Treatment Technique

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Williams, Terence M.; Moran, Jean M., E-mail: jmmoran@med.umich.edu; Hsu, Shu-Hui

    2012-04-01

    Purpose: To investigate the contralateral breast dose (CBD) across a continuum of breast-conservation therapy techniques. Methods and Materials: An anthropomorphic phantom was CT-simulated, and six treatment plans were generated: open tangents, tangents with an external wedge on the lateral beam, tangents with lateral and medial external wedges, a simple segment plan (three segments per tangent), a complex segmental intensity-modulated radiotherapy (IMRT) plan (five segments per tangent), and a beamlet IMRT plan (>100 segments). For all techniques, the breast on the phantom was irradiated to 5000 cGy. Contralateral breast dose was measured at a uniform depth at the center and eachmore » quadrant using thermoluminescent detectors. Results: Contralateral breast dose varied with position and was 50 {+-} 7.3 cGy in the inner half, 24 {+-} 4.1 cGy at the center, and 16 {+-} 2.2 cGy in the outer half for the open tangential plan. Compared with an average dose of 31 cGy across all points for the open field, the average doses were simple segment 32 cGy (range, 99-105% compared with open technique), complex segment 34 cGy (range, 103-117% compared with open technique), beamlet IMRT 34 cGy (range, 103-124% compared with open technique), lateral wedge only 46 cGy (range, 133-175% compared with open technique), and medial and lateral wedge 96 cGy (range, 282-370% compared with open technique). Conclusions: Single or dual wedge techniques resulted in the highest CBD increases compared with open tangents. To obtain the desired homogeneity to the treated breast while minimizing CBD, segmental and IMRT techniques should be encouraged over external physical compensators.« less

  10. Implementation of antibiotic use guidelines for fresh traumatic wound at Siriraj Hospital.

    PubMed

    Sirijatuphat, Rujipas; Choochan, Tanatchon; Siritongtaworn, Preecha; Sripojtham, Vipaporn; Thamlikitkul, Visanu

    2015-03-01

    To determine the effectiveness of implementing a clinical practice guideline (CPG) on antibiotic use for adults with fresh traumatic wounds who attended the trauma center at Siriraj Hospital, Bangkok. A prospective study of 600 adult patients who had fresh traumatic wounds (≤ 6 hours) was conducted at Siriraj Trauma Center from March 2013 to March 2014. The CPG was introduced to physicians, nurses and medical students by posting the CPG at the patient care areas of the trauma center. The outcomes were an appropriate classification of wounds according to the CPG recommendations, prevalence of antibiotic prescribing, incidence of wound infection and compliance with the CPG. Clean-contaminated wounds that did not need antibiotic treatment and clean-contaminated and contaminated wounds that required antibiotics were observed in 63.2, 6.7, and 30.1% ofthe patients, respectively. Antibiotics were given to 512 patients (85.3%). Infections occurred in six patients (1.0%). Antibiotic prescription according to CPG recommendations was observed for 243 patients (40.5%). The prevalence of antibiotic use in the CPG-compliant group (65.8%) was significantly less than that in the CPG-noncompliant group (98.6%) (p < 0.001). The patients in the CPG-compliant group had more contaminated wounds than those in the CPG-noncompliant group (51.4 vs. 15.7%, p < 0.001). The incidences of wound infection were very low in both groups and not significantly different (1.2 vs. 0.8%, p = 0.690). Antibiotic prophylaxis was necessary in less than 36.8% of adults with fresh traumatic wounds who attended Siriraj Trauma Center Compliance to CPG implementation using simple intervention seemed to be low. Adhering to CPG recommendations for antibiotic prophylaxis in adults with fresh traumatic wounds can reduce the unnecessary prescribing of antibiotics without increasing the rate of wound infection.

  11. Depletion of CpG Dinucleotides in Papillomaviruses and Polyomaviruses: A Role for Divergent Evolutionary Pressures.

    PubMed

    Upadhyay, Mohita; Vivekanandan, Perumal

    2015-01-01

    Papillomaviruses and polyomaviruses are small ds-DNA viruses infecting a wide-range of vertebrate hosts. Evidence supporting co-evolution of the virus with the host does not fully explain the evolutionary path of papillomaviruses and polyomaviruses. Studies analyzing CpG dinucleotide frequencies in virus genomes have provided interesting insights on virus evolution. CpG dinucleotide depletion has not been extensively studied among papillomaviruses and polyomaviruses. We sought to analyze the relative abundance of dinucleotides and the relative roles of evolutionary pressures in papillomaviruses and polyomaviruses. We studied 127 full-length sequences from papillomaviruses and 56 full-length sequences from polyomaviruses. We analyzed the relative abundance of dinucleotides, effective codon number (ENC), differences in synonymous codon usage. We examined the association, if any, between the extent of CpG dinucleotide depletion and the evolutionary lineage of the infected host. We also investigated the contribution of mutational pressure and translational selection to the evolution of papillomaviruses and polyomaviruses. All papillomaviruses and polyomaviruses are CpG depleted. Interestingly, the evolutionary lineage of the infected host determines the extent of CpG depletion among papillomaviruses and polyomaviruses. CpG dinucleotide depletion was more pronounced among papillomaviruses and polyomaviruses infecting human and other mammals as compared to those infecting birds. Our findings demonstrate that CpG depletion among papillomaviruses is linked to mutational pressure; while CpG depletion among polyomaviruses is linked to translational selection. We also present evidence that suggests methylation of CpG dinucleotides may explain, at least in part, the depletion of CpG dinucleotides among papillomaviruses but not polyomaviruses. The extent of CpG depletion among papillomaviruses and polyomaviruses is linked to the evolutionary lineage of the infected host. Our results highlight the existence of divergent evolutionary pressures leading to CpG dinucleotide depletion among small ds-DNA viruses infecting vertebrate hosts.

  12. Methylation levels of the "long interspersed nucleotide element-1" repetitive sequences predict survival of melanoma patients

    PubMed Central

    2011-01-01

    Background The prognosis of cutaneous melanoma (CM) differs for patients with identical clinico-pathological stage, and no molecular markers discriminating the prognosis of stage III individuals have been established. Genome-wide alterations in DNA methylation are a common event in cancer. This study aimed to define the prognostic value of genomic DNA methylation levels in stage III CM patients. Methods Overall level of genomic DNA methylation was measured using bisulfite pyrosequencing at three CpG sites (CpG1, CpG2, CpG3) of the Long Interspersed Nucleotide Element-1 (LINE-1) sequences in short-term CM cultures from 42 stage IIIC patients. The impact of LINE-1 methylation on overall survival (OS) was assessed using Cox regression and Kaplan-Meier analysis. Results Hypomethylation (i.e., methylation below median) at CpG2 and CpG3 sites significantly associated with improved prognosis of CM, CpG3 showing the strongest association. Patients with hypomethylated CpG3 had increased OS (P = 0.01, log-rank = 6.39) by Kaplan-Meyer analysis. Median OS of patients with hypomethylated or hypermethylated CpG3 were 31.9 and 11.5 months, respectively. The 5 year OS for patients with hypomethylated CpG3 was 48% compared to 7% for patients with hypermethylated sequences. Among the variables examined by Cox regression analysis, LINE-1 methylation at CpG2 and CpG3 was the only predictor of OS (Hazard Ratio = 2.63, for hypermethylated CpG3; 95% Confidence Interval: 1.21-5.69; P = 0.01). Conclusion LINE-1 methylation is identified as a molecular marker of prognosis for CM patients in stage IIIC. Evaluation of LINE-1 promises to represent a key tool for driving the most appropriate clinical management of stage III CM patients. PMID:21615918

  13. Chitosan-coated boron nitride nanospheres enhance delivery of CpG oligodeoxynucleotides and induction of cytokines

    PubMed Central

    Zhang, Huijie; Chen, Song; Zhi, Chunyi; Yamazaki, Tomohiko; Hanagata, Nobutaka

    2013-01-01

    Background Cytosine-phosphate-guanine (CpG) oligodeoxynucleotides activate Toll-like receptor 9, leading to induction of proinflammatory cytokines, which play an important role in induction and maintenance of innate and adaptive immune responses. Previously, we have used boron nitride nanospheres (BNNS) as a carrier for delivery of unmodified CpG oligodeoxynucleotides to activate Toll-like receptor 9. However, because CpG oligodeoxynucleotides and BNNS are both negatively charged, electrostatic repulsion between them is likely to reduce the loading of CpG oligodeoxynucleotides onto BNNS. Therefore, the efficiency of uptake of CpG oligodeoxynucleotides is also limited and does not result in induction of a robust cytokine response. To ameliorate these problems, we developed a CpG oligodeoxynucleotide delivery system using chitosan-coated BNNS as a carrier. Methods To facilitate attachment of CpG oligodeoxynucleotides onto the BNNS and improve their loading capacity, we prepared positively charged BNNS by coating them with chitosan preparations of three different molecular weights and used them as carriers for delivery of CpG oligodeoxynucleotides. Results The zeta potentials of the BNNS-CS complexes were positive, and chitosan coating improved their dispersity and stability in aqueous solution compared with BNNS. The positive charge of the BNNS-CS complexes greatly improved the loading capacity and cellular uptake efficiency of CpG oligodeoxynucleotides. The loading capacity of the CpG oligodeoxynucleotides depended on the molecular weight of chitosan, which affected the positive charge density on the surface of the BNNS. CpG oligodeoxynucleotides loaded onto BNNS-CS complexes significantly enhanced production of interleukin-6 and tumor necrosis factor-α by peripheral blood mononuclear cells compared with CpG oligodeoxynucleotides directly loaded onto BNNS, or when Lipofectamine™ 2000 was used as the carrier. The molecular weight of the chitosan used to coat the BNNS affected the magnitude of cytokine induction by varying the strength of condensation of the CpG oligodeoxynucleotides. Conclusion Although the loading capacity of BNNS coated with low molecular weight chitosan preparations was the lowest of all the preparations, they induced the highest levels of cytokines. PMID:23674892

  14. Computational ghost imaging using deep learning

    NASA Astrophysics Data System (ADS)

    Shimobaba, Tomoyoshi; Endo, Yutaka; Nishitsuji, Takashi; Takahashi, Takayuki; Nagahama, Yuki; Hasegawa, Satoki; Sano, Marie; Hirayama, Ryuji; Kakue, Takashi; Shiraki, Atsushi; Ito, Tomoyoshi

    2018-04-01

    Computational ghost imaging (CGI) is a single-pixel imaging technique that exploits the correlation between known random patterns and the measured intensity of light transmitted (or reflected) by an object. Although CGI can obtain two- or three-dimensional images with a single or a few bucket detectors, the quality of the reconstructed images is reduced by noise due to the reconstruction of images from random patterns. In this study, we improve the quality of CGI images using deep learning. A deep neural network is used to automatically learn the features of noise-contaminated CGI images. After training, the network is able to predict low-noise images from new noise-contaminated CGI images.

  15. CpG DNA in the prevention and treatment of infections.

    PubMed

    Dalpke, Alexander; Zimmermann, Stefan; Heeg, Klaus

    2002-01-01

    Microbial infection is sensed by Toll-like receptors (TLRs) on innate immune cells. Among the ten so far defined TLRs, TLR9 and its ligand are peculiar. TLR9 recognises bacterial DNA characterised by the abundance of unmethylated CpG dinucleotides, which distinguish bacterial DNA (CpG DNA) from mammalian DNA. Moreover, TLR9 shows a restricted cellular and subcellular pattern of expression. In contrast to other TLR agonists, CpG DNA is superior in activation of dendritic dells and induction of costimulatory cytokines such as interleukin (IL)-12 and IL-18. This qualifies CpG DNA as a Th1-promoting adjuvant. During infection, recognition of CpG DNA of intracellular pathogens skews and fine-tunes the ongoing immune response and induces long-lasting Th1 milieus. Thus, CpG DNA might play an important role in driving the immune system to a Th1 profile, preventing undesired Th2 milieus that might favour induction of allergic responses. Since CpG DNA can be synthesised with high purity and sequence fidelity, synthetic CpG DNA will become an important agent for Th1 instruction and be an effective adjuvant during vaccination.

  16. Emergent central pattern generator behavior in chemical coupled two-compartment models with time delay

    NASA Astrophysics Data System (ADS)

    Li, Shanshan; Zhang, Guoshan; Wang, Jiang; Chen, Yingyuan; Deng, Bin

    2018-02-01

    This paper proposes that modified two-compartment Pinsky-Rinzel (PR) neural model can be used to develop the simple form of central pattern generator (CPG). The CPG is called as 'half-central oscillator', which constructed by two inhibitory chemical coupled PR neurons with time delay. Some key properties of PR neural model related to CPG are studied and proved to meet the requirements of CPG. Using the simple CPG network, we first study the relationship between rhythmical output and key factors, including ambient noise, sensory feedback signals, morphological character of single neuron as well as the coupling delay time. We demonstrate that, appropriate intensity noise can enhance synchronization between two coupled neurons. Different output rhythm of CPG network can be entrained by sensory feedback signals. We also show that the morphology of single neuron has strong effect on the output rhythm. The phase synchronization indexes decrease with the increase of morphology parameter's difference. Through adjusting coupled delay time, we can get absolutely phase synchronization and antiphase state of CPG. Those results of simulation show the feasibility of PR neural model as a valid CPG as well as the emergent behaviors of the particularly CPG.

  17. CGI-99 promotes breast cancer metastasis via autocrine interleukin-6 signaling.

    PubMed

    Lin, C; Liao, W; Jian, Y; Peng, Y; Zhang, X; Ye, L; Cui, Y; Wang, B; Wu, X; Xiong, Z; Wu, S; Li, J; Wang, X; Song, L

    2017-06-29

    Metastatic relapse remains largely incurable and a major challenge of clinical management in breast cancer, but the underlying mechanisms are poorly understood. Herein, we report that CGI-99 is overexpressed in breast cancer tissues from patients with metastatic recurrence within 5 years. High CGI-99 significantly predicts poorer 5-year metastasis-free patient survival. We find that CGI-99 increases breast cancer stem cell properties, and potentiates efficient tumor lung colonization and outgrowth in vivo. Furthermore, we demonstrate that CGI-99 activates the autocrine interleukin-6 (IL-6)/STAT3 signaling by increasing the accumulation and activity of RNA polymerase II and p300 cofactor at the proximal promoter of IL-6. Importantly, delivery of the IL-6-receptor humanized monoclonal antibody tocilizumab robustly abrogates CGI-99-induced metastasis in vivo. Finally, we find that high levels of CGI-99 are significantly correlated with STAT3 hyperactivation in breast cancer patients. These findings reveal a potential mechanism for constitutive activation of autocrine IL-6/STAT3 signaling and may suggest a novel target for clinical intervention in breast cancer.

  18. Combinations of various CpG motifs cloned into plasmid backbone modulate and enhance protective immunity of viral replicon DNA anthrax vaccines.

    PubMed

    Yu, Yun-Zhou; Ma, Yao; Xu, Wen-Hui; Wang, Shuang; Sun, Zhi-Wei

    2015-08-01

    DNA vaccines are generally weak stimulators of the immune system. Fortunately, their efficacy can be improved using a viral replicon vector or by the addition of immunostimulatory CpG motifs, although the design of these engineered DNA vectors requires optimization. Our results clearly suggest that multiple copies of three types of CpG motifs or combinations of various types of CpG motifs cloned into a viral replicon vector backbone with strong immunostimulatory activities on human PBMC are efficient adjuvants for these DNA vaccines to modulate and enhance protective immunity against anthrax, although modifications with these different CpG forms in vivo elicited inconsistent immune response profiles. Modification with more copies of CpG motifs elicited more potent adjuvant effects leading to the generation of enhanced immunity, which indicated a CpG motif dose-dependent enhancement of antigen-specific immune responses. Notably, the enhanced and/or synchronous adjuvant effects were observed in modification with combinations of two different types of CpG motifs, which provides not only a contribution to the knowledge base on the adjuvant activities of CpG motifs combinations but also implications for the rational design of optimal DNA vaccines with combinations of CpG motifs as "built-in" adjuvants. We describe an efficient strategy to design and optimize DNA vaccines by the addition of combined immunostimulatory CpG motifs in a viral replicon DNA plasmid to produce strong immune responses, which indicates that the CpG-modified viral replicon DNA plasmid may be desirable for use as vector of DNA vaccines.

  19. Polyethyleneimine-functionalized boron nitride nanospheres as efficient carriers for enhancing the immunostimulatory effect of CpG oligodeoxynucleotides

    PubMed Central

    Zhang, Huijie; Feng, Shini; Yan, Ting; Zhi, Chunyi; Gao, Xiao-Dong; Hanagata, Nobutaka

    2015-01-01

    CpG oligodeoxynucleotides (ODNs) stimulate innate and adaptive immune responses. Thus, these molecules are promising therapeutic agents and vaccine adjuvants against various diseases. In this study, we developed a novel CpG ODNs delivery system based on polyethyleneimine (PEI)-functionalized boron nitride nanospheres (BNNS). PEI was coated on the surface of BNNS via electrostatic interactions. The prepared BNNS–PEI complexes had positive zeta potential and exhibited enhanced dispersity and stability in aqueous solution. In vitro cytotoxicity assays revealed that the BNNS–PEI complexes with concentrations up to 100 μg/mL exhibited no obvious cytotoxicity. Furthermore, the positively charged surface of the BNNS–PEI complexes greatly improved the loading capacity and cellular uptake efficiency of CpG ODNs. Class B CpG ODNs loaded on the BNNS–PEI complexes enhanced the production of interleukin-6 and tumor necrosis factor-α from peripheral blood mononuclear cells compared with CpG ODNs directly loaded on BNNS. Contrary to the free CpG ODNs or CpG ODNs directly loaded on BNNS, class B CpG ODNs loaded on the BNNS–PEI complexes induced interferon-α simultaneously. PEI coating may have changed the physical form of class B CpG ODNs on BNNS, which further affected their interaction with Toll-like receptor 9 and induced interferon-α. Therefore, BNNS–PEI complexes can be used to enhance the immunostimulatory effect and therapeutic activity of CpG ODNs and the treatment of diseases requiring interleukin-6, tumor necrosis factor-α, and interferon-α. PMID:26346655

  20. Polyethyleneimine-functionalized boron nitride nanospheres as efficient carriers for enhancing the immunostimulatory effect of CpG oligodeoxynucleotides.

    PubMed

    Zhang, Huijie; Feng, Shini; Yan, Ting; Zhi, Chunyi; Gao, Xiao-Dong; Hanagata, Nobutaka

    2015-01-01

    CpG oligodeoxynucleotides (ODNs) stimulate innate and adaptive immune responses. Thus, these molecules are promising therapeutic agents and vaccine adjuvants against various diseases. In this study, we developed a novel CpG ODNs delivery system based on polyethyleneimine (PEI)-functionalized boron nitride nanospheres (BNNS). PEI was coated on the surface of BNNS via electrostatic interactions. The prepared BNNS-PEI complexes had positive zeta potential and exhibited enhanced dispersity and stability in aqueous solution. In vitro cytotoxicity assays revealed that the BNNS-PEI complexes with concentrations up to 100 μg/mL exhibited no obvious cytotoxicity. Furthermore, the positively charged surface of the BNNS-PEI complexes greatly improved the loading capacity and cellular uptake efficiency of CpG ODNs. Class B CpG ODNs loaded on the BNNS-PEI complexes enhanced the production of interleukin-6 and tumor necrosis factor-α from peripheral blood mononuclear cells compared with CpG ODNs directly loaded on BNNS. Contrary to the free CpG ODNs or CpG ODNs directly loaded on BNNS, class B CpG ODNs loaded on the BNNS-PEI complexes induced interferon-α simultaneously. PEI coating may have changed the physical form of class B CpG ODNs on BNNS, which further affected their interaction with Toll-like receptor 9 and induced interferon-α. Therefore, BNNS-PEI complexes can be used to enhance the immunostimulatory effect and therapeutic activity of CpG ODNs and the treatment of diseases requiring interleukin-6, tumor necrosis factor-α, and interferon-α.

  1. Characterization of radiation-induced emesis in the ferret

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    King, G.L.

    1988-06-01

    Forty-eight ferrets (Mustela putorius furo) were individually head-shielded and radiated with bilateral /sup 60/Co gamma radiation at 100 cGy min-1 at doses ranging between 49 and 601 cGy. The emetic threshold was observed at 69 cGy, the ED50 was calculated at 77 cGy, and 100% incidence of emesis occurred at 201 cGy. With increasing doses of radiation, the latency to first emesis after radiation decreased dramatically, whereas the duration of the prodromal period increased. Two other sets of experiments suggest that dopaminergic mechanisms play a minor role in radiation-induced emesis in the ferret. Twenty-two animals were injected either intravenously ormore » subcutaneously with 30 to 300 micrograms/kg of apomorphine. Fewer than 50% of the animals vomited to 300 micrograms/kg apomorphine; central dopaminergic receptor activation was apparent at all doses. Another eight animals received 1 mg/kg domperidone prior to either 201 (n = 4) or 401 (n = 4) cGy radiation and their emetic responses were compared with NaCl-injected-irradiated controls (n = 8). At 201 cGy, domperidone significantly reduced only the total time in emetic behavior. At 401 cGy, domperidone had no salutary effect on radiation-induced emesis. The emetic responses of the ferret to radiation and apomorphine are compared with these responses in other vomiting species.« less

  2. Characterization of radiation-induced emesis in the ferret

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    King, G.L.

    1988-01-01

    Forty-eight ferrets (Mustela putorius furo) were individually head-shielded and radiated with bilateral cobalt 60 gamma radiation at 100 cGy min at doses ranging between 49 and 601 cGy. The emetic threshold was observed at 69 cGy, the ED 50 was calculated as 77 cGy, and 100% incidence of emesis occurred at 201 cGy. With increasing doses of radiation, the latency to first emesis after radiation decreased dramatically, whereas the duration of the prodromal period increased. Two other sets of experiments suggest that dopaminergic mechanisms play a minor role in radiation-induced emesis in the ferret. Twenty-two animals were injected either intravenouslymore » or subcutaneously with 30 to 300 micrograms /kg of apomorphine. Fewer than 50% of the animals vomited to 300 micrograms/kg apomorphine; central dopaminergic receptor activation was apparent at all doses. Another eight animals received 1 mg/kg domperidone prior to either 201 (n=4) or 401 (n=4) cGy radiation and their emetic responses were compared with NaCi-injected-irradiated controls (n=8). At 201 cGy, domperidone significantly reduced only the total time in emetic behavior. At 401 cGy, domperidone had no salutary effect on radiation-induced emesis. The emetic responses of the ferret to radiation and apomorphine are compared with these responses in other vomiting species.« less

  3. Neuromodulation intrinsic to the central pattern generator for escape swimming in Tritonia.

    PubMed

    Katz, P S

    1998-11-16

    Extrinsic neuromodulatory inputs to central pattern generators (CPGs) can alter the properties and synaptic interactions of neurons in those circuits and thereby modify the output of the CPG. Recent work in a number of systems has now demonstrated that neurons intrinsic to CPG can also evoke neuromodulatory actions on other members of the CPG. Such "intrinsic neuromodulation" plays a role in controlling the CPG underlying the escape swim response of the nudibrach mollusc, Tritonia diomedea. The dorsal swim interneurons (DSIs) are a bilaterally represented set of three serotonergic neurons that participate in the generation of the rhythmic swim motor program. Serotonin released from these CPG neurons functions both as a fast neurotransmitter and as a slower neuromodulator. In its modulatory role, serotonin enhances the release of neurotransmitter from another CPG neuron, C2, and also increases C2 excitability by decreasing spike frequency adaptation. These neuromodulatory actions intrinsic to the CPG may be important for the initial self-configuration of the system into a function CPG and for experience-dependent changes in the output such as behavioral sensitization and habituation.

  4. Therapeutic modulation of epigenetic drivers of drug resistance in ovarian cancer

    PubMed Central

    Zeller, Constanze; Brown, Robert

    2010-01-01

    Epigenetic changes in tumours are associated not only with cancer development and progression, but also with resistance to chemotherapy. Aberrant DNA methylation at CpG islands and associated epigenetic silencing are observed during the acquisition of drug resistance. However, it remains unclear whether all of the observed changes are drivers of drug resistance, causally associated with response of tumours to chemotherapy, or are passenger events representing chance DNA methylation changes. Systematic approaches that link DNA methylation and expression with chemosensitivity will be required to identify key drivers. Such drivers will be important prognostic or predicitive biomarkers, both to existing chemotherapies, but also to epigenetic therapies used to modulate drug resistance. PMID:21789144

  5. General Aspects of Colorectal Cancer

    PubMed Central

    Centelles, Josep J.

    2012-01-01

    Colorectal cancer (CRC) is one of the main causes of death. Cancer is initiated by several DNA damages, affecting proto-oncogenes, tumour suppressor genes, and DNA repairing genes. The molecular origins of CRC are chromosome instability (CIN), microsatellite instability (MSI), and CpG island methylator phenotype (CIMP). A brief description of types of CRC cancer is presented, including sporadic CRC, hereditary nonpolyposis colorectal cancer (HNPCC) or Lynch syndromes, familiar adenomatous polyposis (FAP), MYH-associated polyposis (MAP), Peutz-Jeghers syndrome (PJS), and juvenile polyposis syndrome (JPS). Some signalling systems for CRC are also described, including Wnt-β-catenin pathway, tyrosine kinase receptors pathway, TGF-β pathway, and Hedgehog pathway. Finally, this paper describes also some CRC treatments. PMID:23209942

  6. Effect of CpG dinucleotides within IgH switch region repeats on immunoglobulin class switch recombination.

    PubMed

    Zhang, Zheng Z; Hsieh, Chih-Lin; Okitsu, Cindy Yen; Han, Li; Yu, Kefei; Lieber, Michael R

    2015-08-01

    Immunoglobulin (Ig) heavy chains undergo class switch recombination (CSR) to change the heavy chain isotype from IgM to IgG, A or E. The switch regions are several kilobases long, repetitive, and G-rich on the nontemplate strand. They are also relatively depleted of CpG (also called CG) sites for unknown reasons. Here we use synthetic switch regions at the IgH switch alpha (Sα) locus to test the effect of CpG sites and to try to understand why the IgH switch sequences evolved to be relatively depleted of CpG. We find that even just two CpG sites within an 80 bp synthetic switch repeat iterated 15 times (total switch region length of 1200 bp containing 30 CpG sites) are sufficient to dramatically reduce both Ig CSR and transcription through the switch region from the upstream Iα sterile transcript promoter, which is the promoter that directs transcripts through the Sα region. De novo DNA methylation occurs at the four CpG sites in and around the Iα promoter when each 80 bp Iα switch repeat contains the two CpG sites. Thus, a relatively low density of CpG sites within the switch repeats can induce upstream CpG methylation at the IgH alpha locus, and cause a substantial decrease in transcription from the sterile transcript promoter. This effect is likely the reason that switch regions evolved to contain very few CpG sites. We discuss these findings as they relate to DNA methylation and to Ig CSR. Copyright © 2015 Elsevier Ltd. All rights reserved.

  7. Interleukin-12- and Gamma Interferon-Dependent Protection against Malaria Conferred by CpG Oligodeoxynucleotide in Mice

    PubMed Central

    Gramzinski, Robert A.; Doolan, Denise L.; Sedegah, Martha; Davis, Heather L.; Krieg, Arthur M.; Hoffman, Stephen L.

    2001-01-01

    Unmethylated CpG dinucleotides in bacterial DNA or synthetic oligodeoxynucleotides (ODNs) cause B-cell proliferation and immunoglobulin secretion, monocyte cytokine secretion, and activation of natural killer (NK) cell lytic activity and gamma interferon (IFN-γ) secretion in vivo and in vitro. The potent Th1-like immune activation by CpG ODNs suggests a possible utility for enhancing innate immunity against infectious pathogens. We therefore investigated whether the innate immune response could protect against malaria. Treatment of mice with CpG ODN 1826 (TCCATGACGTTCCTGACGTT, with the CpG dinucleotides underlined) or 1585 (ggGGTCAACGTTGAgggggG, with g representing diester linkages and phosphorothioate linkages being to the right of lowercase letters) in the absence of antigen 1 to 2 days prior to challenge with Plasmodium yoelii sporozoites conferred sterile protection against infection. A higher level of protection was consistently induced by CpG ODN 1826 compared with CpG ODN 1585. The protective effects of both CpG ODNs were dependent on interleukin-12, as well as IFN-γ. Moreover, CD8+ T cells (but not CD4+ T cells), NK cells, and nitric oxide were implicated in the CpG ODN 1585-induced protection. These data establish that the protective mechanism induced by administration of CpG ODN 1585 in the absence of parasite antigen is similar in nature to the mechanism induced by immunization with radiation-attenuated P. yoelii sporozoites or with plasmid DNA encoding preerythrocytic-stage P. yoelii antigens. We were unable to confirm whether CD8+ T cells, NK cells, or nitric oxide were required for the CpG ODN 1826-induced protection, but this may reflect differences in the potency of the ODNs rather than a real difference in the mechanism of action of the two ODNs. This is the first report that stimulation of the innate immune system by CpG immunostimulatory motifs can confer sterile protection against malaria. PMID:11179339

  8. Skeletal muscle PLIN proteins, ATGL and CGI-58, interactions at rest and following stimulated contraction

    PubMed Central

    Ramos, Sofhia V.; Vandenboom, Rene; Roy, Brian D.; Peters, Sandra J.

    2013-01-01

    Evidence indicates that skeletal muscle lipid droplet-associated proteins (PLINs) regulate lipolysis through protein-protein interactions on the lipid droplet surface. In adipocytes, PLIN1 is thought to regulate lipolysis by directly interacting with comparative gene identification-58 (CGI-58), an activator of adipose triglyceride lipase (ATGL). Upon lipolytic stimulation, PLIN1 is phosphorylated, releasing CGI-58 to fully activate ATGL and initiate triglyceride breakdown. The absence of PLIN1 in skeletal muscle leads us to believe that other PLIN family members undertake this role. Our purpose was to examine interactions between PLIN2, PLIN3, and PLIN5, with ATGL and its coactivator CGI-58 at rest and following contraction. Isolated rat solei were incubated for 30 min at rest or during 30 min of intermittent tetanic stimulation [150-ms volleys at 60 Hz with a train rate of 20 tetani/min (25°C)] to maximally stimulate intramuscular lipid breakdown. Results show that the interaction between ATGL and CGI-58 increased 128% following contraction (P = 0.041). Further, ATGL interacts with PLIN2, PLIN3, and PLIN5 at rest and following contraction. The PLIN2-ATGL interaction decreased significantly by 21% following stimulation (P = 0.013). Both PLIN3 and PLIN5 coprecipitated with CGI-58 at rest and following contraction, while there was no detectable interaction between PLIN2 and CGI-58 in either condition. Therefore, our findings indicate that in skeletal muscle, during contraction-induced muscle lipolysis, ATGL and CGI-58 strongly associate and that the PLIN proteins work together to regulate lipolysis, in part, by preventing ATGL and CGI-58 interactions at rest. PMID:23408028

  9. Validation of a Clinical Global Impression Scale for Aggression (CGI-A) in a sample of 558 psychiatric patients.

    PubMed

    Huber, Christian G; Lambert, Martin; Naber, Dieter; Schacht, Alexander; Hundemer, Hans-Peter; Wagner, Thomas T; Schimmelmann, Benno G

    2008-03-01

    Clinical management of aggression depends on the availability of easily administrable measurements allowing reliable evaluation. The present study's aim is to validate a Clinical Global Impression-Severity of Aggression scale (CGI-A). 558 inpatients with psychiatric disorders and an agitated-aggressive syndrome at baseline were continuously assessed over 5 days using CGI-A and the Positive and Negative Syndrome Scale-Excited Component (PANSS-EC). Equipercentile linking, correlation analyses and linear regression were applied. Relationship between CGI-A and PANSS-EC total score was found to be linear. On a 5-level CGI-A scale, values of 1 to 5 points were found to correspond to PANSS-EC scores of 12.2, 16.7, 21.3, 25.8, and 30.4, respectively (average increase: 4.6). All findings remained stable when only data from patients with schizophrenia spectrum disorders were analyzed. The CGI-A is proposed as a quickly administrable scale for the assessment of patients' aggressiveness.

  10. Carbon nanotubes enhance CpG uptake and potentiate antiglioma immunity.

    PubMed

    Zhao, Dongchang; Alizadeh, Darya; Zhang, Leying; Liu, Wei; Farrukh, Omar; Manuel, Edwin; Diamond, Don J; Badie, Behnam

    2011-02-15

    Stimulation of toll-like receptor-9 (TLR9) by CpG oligodeoxynucleotides (CpG) has been shown to counteract the immunosuppressive microenvironment and to inhibit tumor growth in glioma models. Because TLR9 is located intracellularly, we hypothesized that methods that enhance its internalization may also potentiate its immunostimulatory response. The goal of this study was to evaluate carbon nanotubes (CNT) as a CpG delivery vehicle in brain tumor models. Functionalized single-walled CNTs were conjugated with CpG (CNT-CpG) and evaluated in vitro and in mice bearing intracranial GL261 gliomas. Flow cytometry was used to assess CNT-CpG uptake and antiglioma immune response. Tumor growth was measured by bioluminescent imaging, histology, and animal survival. CNT-CpG was nontoxic and enhanced CpG uptake both in vitro and intracranial gliomas. CNT-mediated CpG delivery also potentiated proinflammatory cytokine production by primary monocytes. Interestingly, a single intracranial injection of low-dose CNT-CpG (but not free CpG or blank CNT) eradicated intracranial GL261 gliomas in half of tumor-bearing mice. Moreover, surviving animals exhibited durable tumor-free remission (>3 months), and were protected from intracranial tumor rechallenge, demonstrating induction of long-term antitumor immunity. These findings suggest that CNTs can potentiate CpG immunopotency by enhancing its delivery into tumor-associated inflammatory cells. ©2010 AACR.

  11. CpG Dinucleotide Frequencies Reveal the Role of Host Methylation Capabilities in Parvovirus Evolution

    PubMed Central

    Upadhyay, Mohita; Samal, Jasmine; Kandpal, Manish; Vasaikar, Suhas; Biswas, Banhi; Gomes, James

    2013-01-01

    Parvoviruses are rapidly evolving viruses that infect a wide range of hosts, including vertebrates and invertebrates. Extensive methylation of the parvovirus genome has been recently demonstrated. A global pattern of methylation of CpG dinucleotides is seen in vertebrate genomes, compared to “fractional” methylation patterns in invertebrate genomes. It remains unknown if the loss of CpG dinucleotides occurs in all viruses of a given DNA virus family that infect host species spanning across vertebrates and invertebrates. We investigated the link between the extent of CpG dinucleotide depletion among autonomous parvoviruses and the evolutionary lineage of the infected host. We demonstrate major differences in the relative abundance of CpG dinucleotides among autonomous parvoviruses which share similar genome organization and common ancestry, depending on the infected host species. Parvoviruses infecting vertebrate hosts had significantly lower relative abundance of CpG dinucleotides than parvoviruses infecting invertebrate hosts. The strong correlation of CpG dinucleotide depletion with the gain in TpG/CpA dinucleotides and the loss of TpA dinucleotides among parvoviruses suggests a major role for CpG methylation in the evolution of parvoviruses. Our data present evidence that links the relative abundance of CpG dinucleotides in parvoviruses to the methylation capabilities of the infected host. In sum, our findings support a novel perspective of host-driven evolution among autonomous parvoviruses. PMID:24109231

  12. Nanoparticle conjugation enhances the immunomodulatory effects of intranasally delivered CpG in house dust mite-allergic mice

    DOE PAGES

    Ballester, Marie; Jeanbart, Laura; de Titta, Alexandre; ...

    2015-09-21

    An emerging strategy in preventing and treating airway allergy consists of modulating the immune response induced against allergens in the lungs. CpG oligodeoxynucleotides have been investigated in airway allergy studies, but even if promising, efficacy requires further substantiation. We investigated the effect of pulmonary delivery of nanoparticle (NP)-conjugated CpG on lung immunity and found that NP-CpG led to enhanced recruitment of activated dendritic cells and to Th1 immunity compared to free CpG. We then evaluated if pulmonary delivery of NP-CpG could prevent and treat house dust mite-induced allergy by modulating immunity directly in lungs. When CpG was administered as immunomodulatorymore » therapy prior to allergen sensitization, we found that NP-CpG significantly reduced eosinophilia, IgE levels, mucus production and Th2 cytokines, while free CpG had only a moderate effect on these parameters. In a therapeutic setting where CpG was administered after allergen sensitization, we found that although both free CpG and NP-CpG reduced eosinophilia and IgE levels to the same extent, NP conjugation of CpG significantly enhanced reduction of Th2 cytokines in lungs of allergic mice. Taken together, these data highlight benefits of NP conjugation and the relevance of NP-CpG as allergen-free therapy to modulate lung immunity and treat airway allergy.« less

  13. Carbon Nanotubes Enhance CpG Uptake and Potentiate Anti-Glioma Immunity

    PubMed Central

    Zhao, Dongchang; Alizadeh, Darya; Zhang, Leying; Liu, Wei; Farrukh, Omar; Manuel, Edwin; Diamond, Don J.; Badie, Behnam

    2010-01-01

    Purpose Stimulation of toll-like receptor-9 (TLR9) by CpG oligodeoxynucleotides (CpG) has been shown to counteract the immunosuppressive microenvironment and to inhibit tumor growth in glioma models. Since TLR9 is located intracellularly, we hypothesized that methods that enhance its internalization may also potentiate its immunostimulatory response. The goal of this study was to evaluate carbon nanotubes (CNTs) as a CpG delivery vehicle in brain tumor models. Experimental Design Functionalized single-walled CNTs were conjugated with CpG (CNT-CpG) and evaluated in vitro and in mice bearing intracranial GL261 gliomas. Flow cytometry was used to assess CNT-CpG uptake and anti-glioma immune response. Tumor growth was measured by bioluminescent imaging, histology, and animal survival. Results CNT-CpG was nontoxic and enhanced CpG uptake both in vitro and intracranial gliomas. CNT-mediated CpG delivery also potentiated pro-inflammatory cytokine production by primary monocytes. Interestingly, a single intracranial injection of low-dose CNT-CpG (but not free CpG or blank CNT) eradicated intracranial GL261 gliomas in half of tumor-bearing mice. Moreover, surviving animals exhibited durable tumor-free remission (> 3 months), and were protected from intracranial tumor rechallenge, demonstrating induction of long-term anti-tumor immunity. Conclusions These findings suggest that CNTs can potentiate CpG immunopotency by enhancing its delivery into tumor-associated inflammatory cells. PMID:21088258

  14. CpG dinucleotide frequencies reveal the role of host methylation capabilities in parvovirus evolution.

    PubMed

    Upadhyay, Mohita; Samal, Jasmine; Kandpal, Manish; Vasaikar, Suhas; Biswas, Banhi; Gomes, James; Vivekanandan, Perumal

    2013-12-01

    Parvoviruses are rapidly evolving viruses that infect a wide range of hosts, including vertebrates and invertebrates. Extensive methylation of the parvovirus genome has been recently demonstrated. A global pattern of methylation of CpG dinucleotides is seen in vertebrate genomes, compared to "fractional" methylation patterns in invertebrate genomes. It remains unknown if the loss of CpG dinucleotides occurs in all viruses of a given DNA virus family that infect host species spanning across vertebrates and invertebrates. We investigated the link between the extent of CpG dinucleotide depletion among autonomous parvoviruses and the evolutionary lineage of the infected host. We demonstrate major differences in the relative abundance of CpG dinucleotides among autonomous parvoviruses which share similar genome organization and common ancestry, depending on the infected host species. Parvoviruses infecting vertebrate hosts had significantly lower relative abundance of CpG dinucleotides than parvoviruses infecting invertebrate hosts. The strong correlation of CpG dinucleotide depletion with the gain in TpG/CpA dinucleotides and the loss of TpA dinucleotides among parvoviruses suggests a major role for CpG methylation in the evolution of parvoviruses. Our data present evidence that links the relative abundance of CpG dinucleotides in parvoviruses to the methylation capabilities of the infected host. In sum, our findings support a novel perspective of host-driven evolution among autonomous parvoviruses.

  15. CpG oligodeoxynucleotide nanomedicines for the prophylaxis or treatment of cancers, infectious diseases, and allergies.

    PubMed

    Hanagata, Nobutaka

    2017-01-01

    Unmethylated cytosine-guanine dinucleotide-containing oligodeoxynucleotides (CpG ODNs), which are synthetic agonists of Toll-like receptor 9 (TLR9), activate humoral and cellular immunity and are being developed as vaccine adjuvants to prevent or treat cancers, infectious diseases, and allergies. Free CpG ODNs have been used in many clinical trials implemented to verify their effects. However, recent research has reported that self-assembled CpG ODNs, protein/peptide-CpG ODN conjugates, and nanomaterial-CpG ODN complexes demonstrate higher adjuvant effects than free CpG ODNs, owing to their improved uptake efficiency into cells expressing TLR9. Moreover, protein/peptide-CpG ODN conjugates and nanomaterial-CpG ODN complexes are able to deliver CpG ODNs and antigens (or allergens) to the same types of cells, which enables a higher degree of prophylaxis or therapeutic effect. In this review, the author describes recent trends in the research and development of CpG ODN nanomedicines containing self-assembled CpG ODNs, protein/peptide-CpG ODN conjugates, and nanomaterial-CpG ODN complexes, focusing mainly on the results of preclinical and clinical studies.

  16. Immunostimulatory Oligodeoxynucleotides Containing the CpG Motif are Effective as Immune Adjuvants in Tumor Antigen Immunization

    NASA Astrophysics Data System (ADS)

    Weiner, George J.; Liu, Hsin-Ming; Wooldridge, James E.; Dahle, Christopher E.; Krieg, Arthur M.

    1997-09-01

    Recent advances in our understanding of the immune response are allowing for the logical design of new approaches to cancer immunization. One area of interest is the development of new immune adjuvants. Immunostimulatory oligodeoxynucleotides containing the CpG motif (CpG ODN) can induce production of a wide variety of cytokines and activate B cells, monocytes, dendritic cells, and NK cells. Using the 38C13 B cell lymphoma model, we assessed whether CpG ODN can function as immune adjuvants in tumor antigen immunization. The idiotype served as the tumor antigen. Select CpG ODN were as effective as complete Freund's adjuvant at inducing an antigen-specific antibody response but were associated with less toxicity. These CpG ODN induced a higher titer of antigen-specific IgG2a than did complete Freund's adjuvant, suggesting an enhanced TH1 response. Mice immunized with CpG ODN as an adjuvant were protected from tumor challenge to a degree similar to that seen in mice immunized with complete Freund's adjuvant. We conclude that CpG ODN are effective as immune adjuvants and are attractive as part of a tumor immunization strategy.

  17. DNA containing CpG motifs induces angiogenesis

    NASA Astrophysics Data System (ADS)

    Zheng, Mei; Klinman, Dennis M.; Gierynska, Malgorzata; Rouse, Barry T.

    2002-06-01

    New blood vessel formation in the cornea is an essential step in the pathogenesis of a blinding immunoinflammatory reaction caused by ocular infection with herpes simplex virus (HSV). By using a murine corneal micropocket assay, we found that HSV DNA (which contains a significant excess of potentially bioactive "CpG" motifs when compared with mammalian DNA) induces angiogenesis. Moreover, synthetic oligodeoxynucleotides containing CpG motifs attract inflammatory cells and stimulate the release of vascular endothelial growth factor (VEGF), which in turn triggers new blood vessel formation. In vitro, CpG DNA induces the J774A.1 murine macrophage cell line to produce VEGF. In vivo CpG-induced angiogenesis was blocked by the administration of anti-mVEGF Ab or the inclusion of "neutralizing" oligodeoxynucleotides that specifically oppose the stimulatory activity of CpG DNA. These findings establish that DNA containing bioactive CpG motifs induces angiogenesis, and suggest that CpG motifs in HSV DNA may contribute to the blinding lesions of stromal keratitis.

  18. [Quality and compliance with Clinical Practice Guidelines of Chronic Noncommunicable Diseases in primary care].

    PubMed

    Poblano-Verástegui, Ofelia; Vieyra-Romero, Waldo I; Galván-García, Ángel F; Fernández-Elorriaga, María; Rodríguez-Martínez, Antonia I; Saturno-Hernández, Pedro J

    2017-01-01

    To assess the quality and compliance of clinical practice guidelines (CPG) applicable to chronic non-communicable diseases (CNCD) in primary healthcare (CS), and views of staff on the barriers, facilitators and their use. 18 valued CPG with AGREEII, 3 are selected to develop indicators and assess compliance using lot quality acceptance sample (LQAS, standard 75 / 95% threshold 40 / 75% respectively, α:0. 05, β:0. 10) on 5 CS. 70 professionals surveyed about knowledge and use of CPG. Average quality of the CPG was 57.2%; low rating in domains: "Applicability" (<25%), "Stakeholder involvement" (43.5%) and "Rigour of development" (55.0%). Compliance in CS ranges from 39 to 53.4%. Professionals show uneven knowledge of CPG; 44 to 45% (according to CPG), they declare that they are not used, they identify as main barriers the lack of training, and their difficult accessibility and management. The quality and implementation of evaluated CPG is deficient constituting an opportunity of improvement in health services.

  19. DNA-inorganic hybrid nanovaccine for cancer immunotherapy

    NASA Astrophysics Data System (ADS)

    Zhu, Guizhi; Liu, Yijing; Yang, Xiangyu; Kim, Young-Hwa; Zhang, Huimin; Jia, Rui; Liao, Hsien-Shun; Jin, Albert; Lin, Jing; Aronova, Maria; Leapman, Richard; Nie, Zhihong; Niu, Gang; Chen, Xiaoyuan

    2016-03-01

    Cancer evolves to evade or compromise the surveillance of the immune system, and cancer immunotherapy aims to harness the immune system in order to inhibit cancer development. Unmethylated CpG dinucleotide-containing oligonucleotides (CpG), a class of potent adjuvants that activate the toll-like receptor 9 (TLR9) located in the endolysosome of many antigen-presenting cells (APCs), are promising for cancer immunotherapy. However, clinical application of synthetic CpG confronts many challenges such as suboptimal delivery into APCs, unfavorable pharmacokinetics caused by limited biostability and short in vivo half-life, and side effects associated with leaking of CpG into the systemic circulation. Here we present DNA-inorganic hybrid nanovaccines (hNVs) for efficient uptake into APCs, prolonged tumor retention, and potent immunostimulation and cancer immunotherapy. hNVs were self-assembled from concatemer CpG analogs and magnesium pyrophosphate (Mg2PPi). Mg2PPi renders hNVs resistant to nuclease degradation and thermal denaturation, both of which are demanding characteristics for effective vaccination and the storage and transportation of vaccines. Fluorophore-labeled hNVs were tracked to be efficiently internalized into the endolysosomes of APCs, where Mg2PPi was dissolved in an acidic environment and thus CpG analogs were exposed to hNVs. Internalized hNVs in APCs led to (1) elevated secretion of proinflammatory factors, and (2) elevated expression of co-stimulatory factors. Compared with molecular CpG, hNVs dramatically prolonged the tissue retention of CpG analogs and reduced splenomegaly, a common side effect of CpG. In a melanoma mouse model, two injections of hNVs significantly inhibited the tumor growth and outperformed the molecular CpG. These results suggest hNVs are promising for cancer immunotherapy.Cancer evolves to evade or compromise the surveillance of the immune system, and cancer immunotherapy aims to harness the immune system in order to inhibit cancer development. Unmethylated CpG dinucleotide-containing oligonucleotides (CpG), a class of potent adjuvants that activate the toll-like receptor 9 (TLR9) located in the endolysosome of many antigen-presenting cells (APCs), are promising for cancer immunotherapy. However, clinical application of synthetic CpG confronts many challenges such as suboptimal delivery into APCs, unfavorable pharmacokinetics caused by limited biostability and short in vivo half-life, and side effects associated with leaking of CpG into the systemic circulation. Here we present DNA-inorganic hybrid nanovaccines (hNVs) for efficient uptake into APCs, prolonged tumor retention, and potent immunostimulation and cancer immunotherapy. hNVs were self-assembled from concatemer CpG analogs and magnesium pyrophosphate (Mg2PPi). Mg2PPi renders hNVs resistant to nuclease degradation and thermal denaturation, both of which are demanding characteristics for effective vaccination and the storage and transportation of vaccines. Fluorophore-labeled hNVs were tracked to be efficiently internalized into the endolysosomes of APCs, where Mg2PPi was dissolved in an acidic environment and thus CpG analogs were exposed to hNVs. Internalized hNVs in APCs led to (1) elevated secretion of proinflammatory factors, and (2) elevated expression of co-stimulatory factors. Compared with molecular CpG, hNVs dramatically prolonged the tissue retention of CpG analogs and reduced splenomegaly, a common side effect of CpG. In a melanoma mouse model, two injections of hNVs significantly inhibited the tumor growth and outperformed the molecular CpG. These results suggest hNVs are promising for cancer immunotherapy. Electronic supplementary information (ESI) available: ESI materials and methods, characterization of hNVs. See DOI: 10.1039/c5nr08821f

  20. Molecular genetics of X-linked retinitis pigmentosa: Progress towards cloning the RP3 gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fujita, R.; Yan, D.; McHenry, C.

    1994-09-01

    Our goal is to identify the X-linked retinitis pigmentosa (XLRP) gene RP3. The location of RP3 is genetically delimited to a region of 1 Mb, distal to DXS140, CYBB and tctex-1-like gene and proximal to the gene OTC. It is currently thought that RP3 is within 40 kb of the proximal deletion breakpoint of a patient BB. However, a more proximal location of the gene, closer to OTC, is not ruled out. We initiated the isolation of the genomic region between DXS140 to OTC in YACs. One of the clones from DXS140 region (55B) is 460 kb and spans aboutmore » 200 kb at each side of BB patient`s proximal breakpoint. It contains CYBB, tctex-1-like genes and two additional CpG islands. The 55B clone has been covered by cosmid and phage subclones. Another YAC clone from the OTC region (OTCC) spans about 1 Mb and contains at least 5 CpG islands. In situ hybridization performed with OTCC showed its location in Xp21; however, several derivative cosmids map to chromosome 7, indicating that it is a chimeric YAC. No overlap is evident between 55B and OTCC. We have isolated the YAC end-sequences and isolation of clones to close the gap is in progress. Cosmids are being used for screening eye tissue cDNA libraries, mainly from retina. Screening is done by hybridization to replica filters or by cDNA enrichment methods. Several cDNA clones have been isolated and are being characterized. Exon-amplification is also being used with the cosmids and phages. Genetic analysis is being performed to determine RP3 patients from clinically indistinguishable RP2, located in Xp11.23-p11.4, and to reduce the genetic distance of current flanking markers. For this we are analyzing a number of XLRP families with established markers in the region and with new microsatellites.« less

  1. Long range epigenetic silencing is a trans-species mechanism that results in cancer specific deregulation by overriding the chromatin domains of normal cells.

    PubMed

    Forn, Marta; Muñoz, Mar; Tauriello, Daniele V F; Merlos-Suárez, Anna; Rodilla, Verónica; Bigas, Anna; Batlle, Eduard; Jordà, Mireia; Peinado, Miguel A

    2013-12-01

    DNA methylation and chromatin remodeling are frequently implicated in the silencing of genes involved in carcinogenesis. Long Range Epigenetic Silencing (LRES) is a mechanism of gene inactivation that affects multiple contiguous CpG islands and has been described in different human cancer types. However, it is unknown whether there is a coordinated regulation of the genes embedded in these regions in normal cells and in early stages of tumor progression. To better characterize the molecular events associated with the regulation and remodeling of these regions we analyzed two regions undergoing LRES in human colon cancer in the mouse model. We demonstrate that LRES also occurs in murine cancer in vivo and mimics the molecular features of the human phenomenon, namely, downregulation of gene expression, acquisition of inactive histone marks, and DNA hypermethylation of specific CpG islands. The genes embedded in these regions showed a dynamic and autonomous regulation during mouse intestinal cell differentiation, indicating that, in the framework considered here, the coordinated regulation in LRES is restricted to cancer. Unexpectedly, benign adenomas in Apc(Min/+) mice showed overexpression of most of the genes affected by LRES in cancer, which suggests that the repressive remodeling of the region is a late event. Chromatin immunoprecipitation analysis of the transcriptional insulator CTCF in mouse colon cancer cells revealed disrupted chromatin domain boundaries as compared with normal cells. Malignant regression of cancer cells by in vitro differentiation resulted in partial reversion of LRES and gain of CTCF binding. We conclude that genes in LRES regions are plastically regulated in cell differentiation and hyperproliferation, but are constrained to a coordinated repression by abolishing boundaries and the autonomous regulation of chromatin domains in cancer cells. Copyright © 2013 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  2. Colorectal Carcinomas With CpG Island Methylator Phenotype 1 Frequently Contain Mutations in Chromatin Regulators

    PubMed Central

    Tahara, Tomomitsu; Yamamoto, Eiichiro; Madireddi, Priyanka; Suzuki, Hiromu; Maruyama, Reo; Chung, Woonbok; Garriga, Judith; Jelinek, Jaroslav; Yamano, Hiro-o; Sugai, Tamotsu; Kondo, Yutaka; Toyota, Minoru; Issa, Jean-Pierre J.; Estécio, Marcos R. H.

    2014-01-01

    BACKGROUND & AIMS Subgroups of colorectal carcinomas (CRCs) characterized by DNA methylation anomalies are termed CpG island methylator phenotype (CIMP)1, CIMP2, or CIMP-negative. The pathogenesis of CIMP1 colorectal carcinomas, and their effects on patients’ prognoses and responses to treatment, differ from those of other CRCs. We sought to identify genetic somatic alterations associated with CIMP1 CRCs. METHODS We examined genomic DNA samples from 100 primary CRCs, 10 adenomas, and adjacent normal-appearing mucosae from patients undergoing surgery or colonoscopy at 3 tertiary medical centers. We performed exome sequencing of 16 colorectal tumors and their adjacent normal tissues. Extensive comparison with known somatic alterations in CRCs allowed segregation of CIMP1-exclusive alterations. The prevalence of mutations in selected genes was determined from an independent cohort. RESULTS We found that genes that regulate chromatin were mutated in CIMP1 CRCs; the highest rates of mutation were observed in CHD7 and CHD8, which encode members of the chromodomain helicase/adenosine triphosphate—dependent chromatin remodeling family. Somaticmutations in these 2 genes were detected in 5 of 9 CIMP1 CRCs. A prevalence screen showed that nonsilencing mutations in CHD7 and CHD8 occurred significantly more frequently in CIMP1 tumors (18 of 42 [43%]) than in CIMP2 (3 of 34 [9%]; P < .01) or CIMP-negative tumors (2 of 34 [6%]; P < .001). CIMP1 markers had increased binding by CHD7, compared with all genes. Genes altered in patients with CHARGE syndrome (congenital malformations involving the central nervous system, eye, ear, nose, and mediastinal organs) who had CHD7 mutations were also altered in CRCs with mutations in CHD7. CONCLUSIONS Aberrations in chromatin remodeling could contribute to the development of CIMP1 CRCs. A better understanding of the biological determinants of CRCs can be achieved when these tumors are categorized according to their epigenetic status. PMID:24211491

  3. Body Size, Physical Activity and Risk of Colorectal Cancer with or without the CpG Island Methylator Phenotype (CIMP)

    PubMed Central

    Hughes, Laura A. E.; Simons, Colinda C. J. M.; van den Brandt, Piet A.; Goldbohm, R. Alexandra; de Goeij, Anton F.; de Bruïne, Adriaan P.; van Engeland, Manon; Weijenberg, Matty P.

    2011-01-01

    Background We investigated how body size and physical activity influence the risk of the CpG island methylator phenotype (CIMP) in colorectal cancer (CRC). Methods In the Netherlands Cohort Study (n = 120,852), risk factors were self-reported at baseline in 1986. After 7.3 years of follow-up, 603 cases and 4,631 sub-cohort members were available. CIMP status according to the Weisenberger markers was determined using methylation specific PCR on DNA from paraffin embedded tumor tissue. Hazard rate ratios (HR) and 95% confidence intervals for CIMP (27.7%) and non-CIMP (72.3%) tumors were calculated according to BMI, BMI at age 20, BMI change, trouser/skirt size, height, and physical activity. Results BMI modeled per 5 kg/m2 increase was associated with both CIMP and non-CIMP tumors, however, HRs were attenuated when additionally adjusted for trouser/skirt size. Trouser/skirt size, per 2 size increase, was associated with both tumor subtypes, even after adjustment for BMI (CIMP HR: 1.20, 95%CI: 1.01–1.43; non-CIMP HR: 1.14, 95%CI: 1.04–1.28). Height per 5 cm was associated with both tumor sub-types, but HRs were attenuated when adjusted for body weight. BMI at age 20 was positively associated with increased risk of CIMP tumors and the association was significantly less pronounced for non-CIMP tumors (P-heterogeneity = 0.01). Physical activity was inversely associated with both subtypes, but a dose-response association was observed only for non-CIMP tumors (P-trend = 0.02). Conclusions Body size, especially central adiposity, may increase the risk of both CIMP and non-CIMP tumors. Body fat at young age may differentially influence risk. Physical activity appears to decrease the risk of CRC regardless of these molecular subtypes. PMID:21483668

  4. Assessing CpG island methylator phenotype, 1p/19q codeletion, and MGMT promoter methylation from epigenome-wide data in the biomarker cohort of the NOA-04 trial

    PubMed Central

    Wiestler, Benedikt; Capper, David; Hovestadt, Volker; Sill, Martin; Jones, David T.W.; Hartmann, Christian; Felsberg, Joerg; Platten, Michael; Feiden, Wolfgang; Keyvani, Kathy; Pfister, Stefan M.; Wiestler, Otmar D.; Meyermann, Richard; Reifenberger, Guido; Pietsch, Thorsten; von Deimling, Andreas; Weller, Michael; Wick, Wolfgang

    2014-01-01

    Background Molecular biomarkers including isocitrate dehydrogenase 1 or 2 (IDH1/2) mutation, 1p/19q codeletion, and O6-methylguanine-DNA-methyltransferase (MGMT) promoter methylation may improve prognostication and guide treatment decisions for patients with World Health Organization (WHO) anaplastic gliomas. At present, each marker is individually tested by distinct assays. Illumina Infinium HumanMethylation450 BeadChip arrays (HM450) enable the determination of large-scale methylation profiles and genome-wide DNA copy number changes. Algorithms have been developed to detect the glioma CpG island methylator phenotype (G-CIMP) associated with IDH1/2 mutation, 1p/19q codeletion, and MGMT promoter methylation using a single assay. Methods Here, we retrospectively investigated the diagnostic and prognostic performance of these algorithms in comparison to individual marker testing and patient outcome in the biomarker cohort (n = 115 patients) of the NOA-04 trial. Results Concordance for IDH and 1p/19q status was very high: In 92% of samples, the HM450 and reference data agreed. In discordant samples, survival analysis by Kaplan-Meier and Cox regression analyses suggested a more accurate assessment of biological phenotype by the HM450 analysis. The HM450-derived MGMT-STP27 model to calculate MGMT promoter methylation probability revealed this aberration in a significantly higher fraction of samples than conventional methylation-specific PCR, with 87 of 91 G-CIMP tumors predicted as MGMT promoter-methylated. Pyrosequencing of discordant samples confirmed the HM450 assessment in 14 of 17 cases. Conclusions G-CIMP and 1p/19q codeletion are reliably detectable by HM450 analysis and are associated with prognosis in the NOA-04 trial. For MGMT, HM450 suggests promoter methylation in the vast majority of G-CIMP tumors, which is supported by pyrosequencing. PMID:25028501

  5. Comprehensive analysis of CpG island methylator phenotype (CIMP)-high, -low, and -negative colorectal cancers based on protein marker expression and molecular features.

    PubMed

    Zlobec, Inti; Bihl, Michel; Foerster, Anja; Rufle, Alex; Lugli, Alessandro

    2011-11-01

    CpG island methylator phenotype (CIMP) is being investigated for its role in the molecular and prognostic classification of colorectal cancer patients but is also emerging as a factor with the potential to influence clinical decision-making. We report a comprehensive analysis of clinico-pathological and molecular features (KRAS, BRAF and microsatellite instability, MSI) as well as of selected tumour- and host-related protein markers characterizing CIMP-high (CIMP-H), -low, and -negative colorectal cancers. Immunohistochemical analysis for 48 protein markers and molecular analysis of CIMP (CIMP-H: ≥ 4/5 methylated genes), MSI (MSI-H: ≥ 2 instable genes), KRAS, and BRAF were performed on 337 colorectal cancers. Simple and multiple regression analysis and receiver operating characteristic (ROC) curve analysis were performed. CIMP-H was found in 24 cases (7.1%) and linked (p < 0.0001) to more proximal tumour location, BRAF mutation, MSI-H, MGMT methylation (p = 0.022), advanced pT classification (p = 0.03), mucinous histology (p = 0.069), and less frequent KRAS mutation (p = 0.067) compared to CIMP-low or -negative cases. Of the 48 protein markers, decreased levels of RKIP (p = 0.0056), EphB2 (p = 0.0045), CK20 (p = 0.002), and Cdx2 (p < 0.0001) and increased numbers of CD8+ intra-epithelial lymphocytes (p < 0.0001) were related to CIMP-H, independently of MSI status. In addition to the expected clinico-pathological and molecular associations, CIMP-H colorectal cancers are characterized by a loss of protein markers associated with differentiation, and metastasis suppression, and have increased CD8+ T-lymphocytes regardless of MSI status. In particular, Cdx2 loss seems to strongly predict CIMP-H in both microsatellite-stable (MSS) and MSI-H colorectal cancers. Cdx2 is proposed as a surrogate marker for CIMP-H. Copyright © 2011 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

  6. Adverse prognostic impact of the CpG island methylator phenotype in metastatic colorectal cancer

    PubMed Central

    Cha, Yongjun; Kim, Kyung-Ju; Han, Sae-Won; Rhee, Ye Young; Bae, Jeong Mo; Wen, Xianyu; Cho, Nam-Yun; Lee, Dae-Won; Lee, Kyung-Hun; Kim, Tae-Yong; Oh, Do-Youn; Im, Seock-Ah; Bang, Yung-Jue; Jeong, Seung-Yong; Park, Kyu Joo; Kang, Gyeong Hoon; Kim, Tae-You

    2016-01-01

    Background: The association between the CpG island methylator phenotype (CIMP) and clinical outcomes in metastatic colorectal cancer remains unclear. We investigated the prognostic impact of CIMP in patients with metastatic colorectal cancer treated with systemic chemotherapy. Methods: Eight CIMP-specific promoters (CACNA1G, IGF2, NEUROG1, RUNX3, SOCS1, CDKN2A, CRABP1, and MLH1) were examined. The CIMP status was determined by the number of methylated promoters as high (⩾5), low (1–4), and negative (0). Results: A total of 153 patients were included (men/women, 103/50; median age, 61 years; range, 22–80 years). The CIMP status was negative/low/high in 77/ 69/7 patients, respectively. Overall survival (OS) was significantly different among the three CIMP groups, with median values of 35.7, 22.2, and 9.77 months for the negative, low, and high groups, respectively (P<0.001). For patients treated with fluoropyrimidine and oxaliplatin first-line chemotherapy (N=128), OS and progression-free survival (PFS) were significantly different among the three CIMP groups; the median OS was 37.9, 23.8, and 6.77 months for the negative, low, and high groups, respectively (P<0.001), while the median PFS was 9.97, 7.87, and 1.83 months, respectively (P=0.002). Response rates were marginally different among the three CIMP groups (53.4% vs 45.1% vs 16.7%, respectively; P=0.107). For patients treated with fluoropyrimidine and irinotecan second-line chemotherapy (N=86), only OS showed a difference according to the CIMP status, with median values of 20.4, 13.4, and 2.90 months for the negative, low, and high groups, respectively (P<0.001). Conclusions: The CIMP status is a negative prognostic factor for patients with metastatic colorectal cancer treated with chemotherapy. PMID:27310704

  7. Adverse prognostic impact of the CpG island methylator phenotype in metastatic colorectal cancer.

    PubMed

    Cha, Yongjun; Kim, Kyung-Ju; Han, Sae-Won; Rhee, Ye Young; Bae, Jeong Mo; Wen, Xianyu; Cho, Nam-Yun; Lee, Dae-Won; Lee, Kyung-Hun; Kim, Tae-Yong; Oh, Do-Youn; Im, Seock-Ah; Bang, Yung-Jue; Jeong, Seung-Yong; Park, Kyu Joo; Kang, Gyeong Hoon; Kim, Tae-You

    2016-07-12

    The association between the CpG island methylator phenotype (CIMP) and clinical outcomes in metastatic colorectal cancer remains unclear. We investigated the prognostic impact of CIMP in patients with metastatic colorectal cancer treated with systemic chemotherapy. Eight CIMP-specific promoters (CACNA1G, IGF2, NEUROG1, RUNX3, SOCS1, CDKN2A, CRABP1, and MLH1) were examined. The CIMP status was determined by the number of methylated promoters as high (⩾5), low (1-4), and negative (0). A total of 153 patients were included (men/women, 103/50; median age, 61 years; range, 22-80 years). The CIMP status was negative/low/high in 77/ 69/7 patients, respectively. Overall survival (OS) was significantly different among the three CIMP groups, with median values of 35.7, 22.2, and 9.77 months for the negative, low, and high groups, respectively (P<0.001). For patients treated with fluoropyrimidine and oxaliplatin first-line chemotherapy (N=128), OS and progression-free survival (PFS) were significantly different among the three CIMP groups; the median OS was 37.9, 23.8, and 6.77 months for the negative, low, and high groups, respectively (P<0.001), while the median PFS was 9.97, 7.87, and 1.83 months, respectively (P=0.002). Response rates were marginally different among the three CIMP groups (53.4% vs 45.1% vs 16.7%, respectively; P=0.107). For patients treated with fluoropyrimidine and irinotecan second-line chemotherapy (N=86), only OS showed a difference according to the CIMP status, with median values of 20.4, 13.4, and 2.90 months for the negative, low, and high groups, respectively (P<0.001). The CIMP status is a negative prognostic factor for patients with metastatic colorectal cancer treated with chemotherapy.

  8. Molecular correlates with MGMT promoter methylation and silencing support CpG island methylator phenotype-low (CIMP-low) in colorectal cancer.

    PubMed

    Ogino, Shuji; Kawasaki, Takako; Kirkner, Gregory J; Suemoto, Yuko; Meyerhardt, Jeffrey A; Fuchs, Charles S

    2007-11-01

    The CpG island methylator phenotype (CIMP or CIMP-high) with widespread promoter methylation is a distinct epigenetic phenotype in colorectal cancer. In contrast, a phenotype with less widespread promoter methylation (CIMP-low) has not been well characterised. O-6-methylguanine-DNA methyltransferase (MGMT) promoter methylation and silencing have been associated with G>A mutations and microsatellite instability-low (MSI-low). To examine molecular correlates with MGMT methylation/silencing in colorectal cancer. Utilising MethyLight technology, we quantified DNA methylation in MGMT and eight other markers (a CIMP-diagnostic panel; CACNA1G, CDKN2A (p16), CRABP1, IGF2, MLH1, NEUROG1, RUNX3 and SOCS1) in 920 population-based colorectal cancers. Tumours with both MGMT methylation and loss were correlated positively with MSI-low (p = 0.02), CIMP-high (>or=6/8 methylated CIMP markers, p = 0.005), CIMP-low (1/8-5/8 methylated CIMP markers, p = 0.002, compared to CIMP-0 with 0/8 methylated markers), KRAS G>A mutation (p = 0.02), and inversely with 18q loss of heterozygosity (p = 0.0002). Tumours were classified into nine MSI/CIMP subtypes. Among the CIMP-low group, tumours with both MGMT methylation and loss were far more frequent in MSI-low tumours (67%, 12/18) than MSI-high tumours (5.6%, 1/18; p = 0.0003) and microsatellite stable (MSS) tumours (33%, 52/160; p = 0.008). However, no such relationship was observed among the CIMP-high or CIMP-0 groups. The relationship between MGMT methylation/silencing and MSI-low is limited to only CIMP-low tumours, supporting the suggestion that CIMP-low in colorectal cancer may be a different molecular phenotype from CIMP-high and CIMP-0. Our data support a molecular difference between MSI-low and MSS in colorectal cancer, and a possible link between CIMP-low, MSI-low, MGMT methylation/loss and KRAS mutation.

  9. CpG island methylator phenotype is associated with the efficacy of sequential oxaliplatin- and irinotecan-based chemotherapy and EGFR-related gene mutation in Japanese patients with metastatic colorectal cancer.

    PubMed

    Zhang, Xiaofei; Shimodaira, Hideki; Soeda, Hiroshi; Komine, Keigo; Takahashi, Hidekazu; Ouchi, Kota; Inoue, Masahiro; Takahashi, Masanobu; Takahashi, Shin; Ishioka, Chikashi

    2016-12-01

    The CpG island methylator phenotype (CIMP) with multiple promoter methylated loci has been observed in a subset of human colorectal cancer (CRC) cases. CIMP status, which is closely associated with specific clinicopathological and molecular characteristics, is considered a potential predictive biomarker for efficacy of cancer treatment. However, the relationship between the effect of standard chemotherapy, including cytotoxic drugs and anti-epidermal growth factor receptor (EGFR) antibodies, and CIMP status has not been elucidated. In 125 metastatic colorectal cancer (mCRC) patients, we investigated how clinical outcome of chemotherapy was related to CIMP status as detected by methylation-specific PCR (MSP) and to genetic status in five EGFR-related genes (KRAS, BRAF, PIK3CA, NRAS, and AKT1) as detected by direct sequencing. CIMP-positive status was significantly associated with proximal tumor location and peritoneum metastasis (all P values <0.05). The progression-free survival of patients with CIMP-positive tumors receiving sequential therapy with FOLFOX as the first-line treatment followed by irinotecan-based therapy as the second-line treatment (median = 6.6 months) was inferior to that of such patients receiving the reverse sequence (median = 15.2 months; P = 0.043). Furthermore, CIMP-positive tumors showed higher mutation frequencies for the five EGFR-related genes (74.1 %) than the CIMP-negative tumors did (50.0 %). Among the KRAS wild-type tumors, CIMP-positive tumors were associated with a worse clinical outcome than CIMP-negative tumors following anti-EGFR antibody therapy. Sequential FOLFOX followed by an irinotecan-based regimen is unfavorable in patients with CIMP-positive tumors. High frequencies of mutation in EGFR-related genes in CIMP-positive tumors may cause the lower response to anti-EGFR antibody therapy seen in patients with wild-type KRAS and CIMP-positive tumors.

  10. Aberrant TET1 Methylation Closely Associated with CpG Island Methylator Phenotype in Colorectal Cancer.

    PubMed

    Ichimura, Norihisa; Shinjo, Keiko; An, Byonggu; Shimizu, Yasuhiro; Yamao, Kenji; Ohka, Fumiharu; Katsushima, Keisuke; Hatanaka, Akira; Tojo, Masayuki; Yamamoto, Eiichiro; Suzuki, Hiromu; Ueda, Minoru; Kondo, Yutaka

    2015-08-01

    Inactivation of methylcytosine dioxygenase, ten-eleven translocation (TET) is known to be associated with aberrant DNA methylation in cancers. Tumors with a CpG island methylator phenotype (CIMP), a distinct subgroup with extensive DNA methylation, show characteristic features in the case of colorectal cancer. The relationship between TET inactivation and CIMP in colorectal cancers is not well understood. The expression level of TET family genes was compared between CIMP-positive (CIMP-P) and CIMP-negative (CIMP-N) colorectal cancers. Furthermore, DNA methylation profiling, including assessment of the TET1 gene, was assessed in colorectal cancers, as well as colon polyps. The TET1 was silenced by DNA methylation in a subset of colorectal cancers as well as cell lines, expression of which was reactivated by demethylating agent. TET1 methylation was more frequent in CIMP-P (23/55, 42%) than CIMP-N (2/113, 2%, P < 0.0001) colorectal cancers. This trend was also observed in colon polyps (CIMP-P, 16/40, 40%; CIMP-N, 2/24, 8%; P = 0.002), suggesting that TET1 methylation is an early event in CIMP tumorigenesis. TET1 methylation was significantly associated with BRAF mutation but not with hMLH1 methylation in the CIMP-P colorectal cancers. Colorectal cancers with TET1 methylation have a significantly greater number of DNA methylated genes and less pathological metastasis compared to those without TET1 methylation (P = 0.007 and 0.045, respectively). Our data suggest that TET1 methylation may contribute to the establishment of a unique pathway in respect to CIMP-mediated tumorigenesis, which may be incidental to hMLH1 methylation. In addition, our findings provide evidence that TET1 methylation may be a good biomarker for the prediction of metastasis in colorectal cancer. ©2015 American Association for Cancer Research.

  11. Body size, physical activity and risk of colorectal cancer with or without the CpG island methylator phenotype (CIMP).

    PubMed

    Hughes, Laura A E; Simons, Colinda C J M; van den Brandt, Piet A; Goldbohm, R Alexandra; de Goeij, Anton F; de Bruïne, Adriaan P; van Engeland, Manon; Weijenberg, Matty P

    2011-04-05

    We investigated how body size and physical activity influence the risk of the CpG island methylator phenotype (CIMP) in colorectal cancer (CRC). In the Netherlands Cohort Study (n = 120,852), risk factors were self-reported at baseline in 1986. After 7.3 years of follow-up, 603 cases and 4,631 sub-cohort members were available. CIMP status according to the Weisenberger markers was determined using methylation specific PCR on DNA from paraffin embedded tumor tissue. Hazard rate ratios (HR) and 95% confidence intervals for CIMP (27.7%) and non-CIMP (72.3%) tumors were calculated according to BMI, BMI at age 20, BMI change, trouser/skirt size, height, and physical activity. BMI modeled per 5 kg/m(2) increase was associated with both CIMP and non-CIMP tumors, however, HRs were attenuated when additionally adjusted for trouser/skirt size. Trouser/skirt size, per 2 size increase, was associated with both tumor subtypes, even after adjustment for BMI (CIMP HR: 1.20, 95%CI: 1.01-1.43; non-CIMP HR: 1.14, 95%CI: 1.04-1.28). Height per 5 cm was associated with both tumor sub-types, but HRs were attenuated when adjusted for body weight. BMI at age 20 was positively associated with increased risk of CIMP tumors and the association was significantly less pronounced for non-CIMP tumors (P-heterogeneity = 0.01). Physical activity was inversely associated with both subtypes, but a dose-response association was observed only for non-CIMP tumors (P-trend = 0.02). Body size, especially central adiposity, may increase the risk of both CIMP and non-CIMP tumors. Body fat at young age may differentially influence risk. Physical activity appears to decrease the risk of CRC regardless of these molecular subtypes.

  12. Prognostic value of CpG island methylator phenotype among hepatocellular carcinoma patients: A systematic review and meta-analysis.

    PubMed

    Wang, Qian; Wang, Gang; Liu, Chaoxu; He, Xianli

    2018-04-24

    CpG island methylator phenotype (CIMP), characterized by multiple genes are concurrently methylated, has been reported to be associated with the prognosis of colorectal cancer. However, current studies have not explored the relationship between CIMP status with hepatocellular carcinoma (HCC) clinicopathological features. To assess these associations, we performed a comprehensive search of PubMed, EMBASE, and the Web of Science to identify all eligible studies. Publication bias was tested using Begg's and Egger's test. Seven studies that involved 568 HCC patients (379 CIMP+ and 189 CIMP-) were eligible for inclusion in our study. CIMP+ in HCC was significantly associated with distant metastasis (OR = 4.28, 95% CI = 2.57-7.10, P < 0.00001, heterogeneity = 0.888), TNM tumor stage IIII + IV (OR = 5.73, 95% CI = 3.70-8.88, P < 0.0001, heterogeneity = 0.449), cirrhosis (OR = 2.54, 95% CI = 1.33,4.83, P = 0.005, heterogeneity = 0.121) and a higher level of AFP (>300 ng/ml) than those with CIMP- (OR = 2.63, 95% CI = 1.79,3.89, P < 0.00001, heterogeneity = 0.432). Moreover, CIMP+ was associated with an unfavorable overall survival (OS) (HR = 3.02, 95% CI = 1.60-5.70, P < 0.001, heterogeneity = 0.251) and a disease-free survival (DFS) (HR = 2.80, 95% CI = 1.79-4.37, P < 0.001, heterogeneity = 0.603). CIMP is independently associated with significantly worse prognosis in HCC patients. Examination of CIMP status may be useful for identifying patients who are at higher risk for disease progression. Copyright © 2018 IJS Publishing Group Ltd. Published by Elsevier Ltd. All rights reserved.

  13. The Human ARF Cell Cycle Regulatory Gene Promoter Is a CpG Island Which Can Be Silenced by DNA Methylation and Down-Regulated by Wild-Type p53

    PubMed Central

    Robertson, Keith D.; Jones, Peter A.

    1998-01-01

    The INK4a/ARF locus encodes two proteins involved in tumor suppression in a manner virtually unique in mammalian cells. Distinct first exons, driven from separate promoters, splice onto a common exon 2 and 3 but utilize different reading frames to produce two completely distinct proteins, both of which play roles in cell cycle control. INK4a, a critical element of the retinoblastoma gene pathway, binds to and inhibits the activities of CDK4 and CDK6, while ARF, a critical element of the p53 pathway, increases the level of functional p53 via interaction with MDM2. Here we clone and characterize the promoter of the human ARF gene and show that it is a CpG island characteristic of a housekeeping gene which contains numerous Sp1 sites. Both ARF and INK4a are coordinately expressed in cells except when their promoter regions become de novo methylated. In one of these situations, ARF transcription could be reactivated by treatment with the DNA methylation inhibitor 5-aza-2′-deoxycytidine, and the reactivation kinetics of ARF and INK4a were found to differ slightly in a cell line in which both genes were silenced by methylation. The ARF promoter was also found to be highly responsive to E2F1 expression, in keeping with previous results at the RNA level. Lastly, transcription from the ARF promoter was down-regulated by wild-type p53 expression, and the magnitude of the effect correlated with the status of the endogenous p53 gene. This finding points to the existence of an autoregulatory feedback loop between p53, MDM2, and ARF, aimed at keeping p53 levels in check. PMID:9774662

  14. 5-Fluorouracil Adjuvant Chemotherapy Does Not Increase Survival in Patients with CpG Island Methylator Phenotype Colorectal Cancer

    PubMed Central

    Jover, Rodrigo; Nguyen, Thuy-Phuong; Pérez-Carbonell, Lucía; Zapater, Pedro; Payá, Artemio; Alenda, Cristina; Rojas, Estefanía; Cubiella, Joaquín; Balaguer, Francesc; Morillas, Juan D.; Clofent, Juan; Bujanda, Luis; Reñé, Josep M; Bessa, Xavier; Xicola, Rosa M.; Nicolás-Pérez, David; Castells, Antoni; Andreu, Montserrat; Llor, Xavier; Boland, C. Richard; Goel, Ajay

    2011-01-01

    Background & Aims 5-FU-based adjuvant chemotherapy does not increase survival times of patients with colorectal tumors with microsatellite instability. We determined the response of patients with colorectal tumors with the CpG island methylator phenotype (CIMP) to 5-FU-based therapy. Methods We analyzed a population-based cohort of 302 patients with colorectal cancer (CRC) for a median follow-up time of 50.7 months. CIMP status was determined by analysis of the CACNAG1, SOCS1, RUNX3, NEUROG1, and MLH1 promoters; tumors were considered to be CIMP-positive (CIMP+) if at least 3 promoters were methylated. Results Tumors from 29.5% (89/302) of patients were CIMP+; this did not influence disease-free survival (log rank=.26). Of tumors of TNM stages II–III (n=196), 32.7% were CIMP+. Among patients with CRC stages II–III who did not receive adjuvant 5-FU chemotherapy, those with CIMP+ tumors had longest times of disease-free survival (log rank=.04); patients with CIMP+ tumors who received chemotherapy had shorter times of disease-free survival (log rank=0.02). In patients with CIMP-negative tumors, adjuvant 5-FU chemotherapy significantly increased time of disease-free survival (log-rank=.00001). However, in patients with CIMP+ tumors, adjuvant 5-FU chemotherapy did not affect time of disease-free survival (log rank=.7). Multivariate analysis showed a significant, independent interaction between 5-FU treatment and CIMP status (hazard ratio [HR]=0.6; 95% confidence interval [CI], .5–.8). Among patients with CIMP+ tumors, adjuvant chemotherapy was not an independent predictor of outcome (HR=0.8; 95% CI, 0.3–2.0). In patients who did not receive adjuvant 5-FU chemotherapy, CIMP status was the only independent predictor of survival (HR=2.0; 95% CI, 1.1–3.8) Conclusion Patients with CIMP+ colorectal tumors do not benefit from 5-FU–based adjuvant chemotherapy. PMID:21185836

  15. Hypermethylation of testis derived transcript gene promoter significantly correlates with worse outcomes in glioblastoma patients.

    PubMed

    Wang, Li-jia; Bai, Yu; Bao, Zhao-shi; Chen, Yan; Yan, Zhuo-hong; Zhang, Wei; Zhang, Quan-geng

    2013-01-01

    Glioblastoma is the most common and lethal cancer of the central nervous system. Global genomic hypomethylation and some CpG island hypermethylation are common hallmarks of these malignancies, but the effects of these methylation abnormalities on glioblastomas are still largely unclear. Methylation of the O6-methylguanine-DNA methyltransferase promoter is currently an only confirmed molecular predictor of better outcome in temozolomide treatment. To better understand the relationship between CpG island methylation status and patient outcome, this study launched DNA methylation profiles for thirty-three primary glioblastomas (pGBMs) and nine secondary glioblastomas (sGBMs) with the expectation to identify valuable prognostic and therapeutic targets. We evaluated the methylation status of testis derived transcript (TES) gene promoter by microarray analysis of glioblastomas and the prognostic value for TES methylation in the clinical outcome of pGBM patients. Significance analysis of microarrays was used for genes significantly differently methylated between 33 pGBM and nine sGBM. Survival curves were calculated according to the Kaplan-Meier method, and differences between curves were assessed using the log-rank test. Then, we treated glioblastoma cell lines (U87 and U251) with 5-aza-2-deoxycytidines (5-aza-dC) and detected cell biological behaviors. Microarray data analysis identified TES promoter was hypermethylated in pGBMs compared with sGBMs (P < 0.05). Survival curves from the Kaplan-Meier method analysis revealed that the patients with TES hypermethylation had a short overall survival (P < 0.05). This abnormality is also confirmed in glioblastoma cell lines (U87 and U251). Treating these cells with 5-aza-dC released TES protein expression resulted in significant inhibition of cell growth (P = 0.013). Hypermethylation of TES gene promoter highly correlated with worse outcome in pGBM patients. TES might represent a valuable prognostic marker for glioblastoma.

  16. Identification of endometrial cancer methylation features using combined methylation analysis methods

    PubMed Central

    Trimarchi, Michael P.; Yan, Pearlly; Groden, Joanna; Bundschuh, Ralf; Goodfellow, Paul J.

    2017-01-01

    Background DNA methylation is a stable epigenetic mark that is frequently altered in tumors. DNA methylation features are attractive biomarkers for disease states given the stability of DNA methylation in living cells and in biologic specimens typically available for analysis. Widespread accumulation of methylation in regulatory elements in some cancers (specifically the CpG island methylator phenotype, CIMP) can play an important role in tumorigenesis. High resolution assessment of CIMP for the entire genome, however, remains cost prohibitive and requires quantities of DNA not available for many tissue samples of interest. Genome-wide scans of methylation have been undertaken for large numbers of tumors, and higher resolution analyses for a limited number of cancer specimens. Methods for analyzing such large datasets and integrating findings from different studies continue to evolve. An approach for comparison of findings from a genome-wide assessment of the methylated component of tumor DNA and more widely applied methylation scans was developed. Methods Methylomes for 76 primary endometrial cancer and 12 normal endometrial samples were generated using methylated fragment capture and second generation sequencing, MethylCap-seq. Publically available Infinium HumanMethylation 450 data from The Cancer Genome Atlas (TCGA) were compared to MethylCap-seq data. Results Analysis of methylation in promoter CpG islands (CGIs) identified a subset of tumors with a methylator phenotype. We used a two-stage approach to develop a 13-region methylation signature associated with a “hypermethylator state.” High level methylation for the 13-region methylation signatures was associated with mismatch repair deficiency, high mutation rate, and low somatic copy number alteration in the TCGA test set. In addition, the signature devised showed good agreement with previously described methylation clusters devised by TCGA. Conclusion We identified a methylation signature for a “hypermethylator phenotype” in endometrial cancer and developed methods that may prove useful for identifying extreme methylation phenotypes in other cancers. PMID:28278225

  17. Regulation of DNA methylation on EEF1D and RPL8 expression in cattle.

    PubMed

    Liu, Xuan; Yang, Jie; Zhang, Qin; Jiang, Li

    2017-10-01

    Dynamic changes to the epigenome play a critical role in a variety of biology processes and complex traits. Many important candidate genes have been identified through our previous genome wide association study (GWAS) on milk production traits in dairy cattle. However, the underlying mechanism of candidate genes have not yet been clearly understood. In this study, we analyzed the methylation variation of the candidate genes, EEF1D and RPL8, which were identified to be strongly associated with milk production traits in dairy cattle in our previous studies, and its effect on protein and mRNA expression. We compared DNA methylation profiles and gene expression levels of EEF1D and RPL8 in five different tissues (heart, liver, mammary gland, ovary and muscle) of three cows. Both genes showed the highest expression level in mammary gland. For RPL8, there was no difference in the DNA methylation pattern in the five tissues, suggesting no effect of DNA methylation on gene expression. For EEF1D, the DNA methylation levels of its first CpG island differed in the five tissues and were negatively correlated with the gene expression levels. To further investigate the function of DNA methylation on the expression of EEF1D, we collected blood samples of three cows at early stage of lactation and in dry period and analyzed its expression and the methylation status of the first CpG island in blood. As a result, the mRNA expression of EEF1D in the dry period was higher than that at the early stage of lactation, while the DNA methylation level in the dry period was lower than that at the early stage of lactation. Our result suggests that the DNA methylation of EEF1D plays an important role in the spatial and temporal regulation of its expression and possibly have an effect on the milk production traits.

  18. Exposure to welding fumes is associated with hypomethylation of the F2RL3 gene: a cardiovascular disease marker

    PubMed Central

    Hossain, Mohammad B; Li, Huiqi; Hedmer, Maria; Tinnerberg, Håkan; Albin, Maria; Broberg, Karin

    2015-01-01

    Background Welders are at risk for cardiovascular disease. Recent studies linked tobacco smoke exposure to hypomethylation of the F2RL3 (coagulation factor II (thrombin) receptor-like 3) gene, a marker for cardiovascular disease prognosis and mortality. However, whether welding fumes cause hypomethylation of F2RL3 remains unknown. Methods We investigated 101 welders (median span of working as a welder: 7 years) and 127 unexposed controls (non-welders with no obvious exposure to respirable dust at work), age range 23–60 years, all currently non-smoking, in Sweden. The participants were interviewed about their work history, lifestyle factors and diseases. Personal sampling of respirable dust was performed for the welders. DNA methylation of F2RL3 in blood was assessed by pyrosequencing of four CpG sites, CpG_2 (corresponds to cg03636183) to CpG_5, in F2RL3. Multivariable linear regression analysis was used to assess the association between exposure to welding fumes and F2RL3 methylation. Results Welders had 2.6% lower methylation of CpG_5 than controls (p<0.001). Higher concentrations of measured respirable dust among the welders were associated with hypomethylation of CpG_2, CpG_4 and CpG_5 (β=−0.49 to −1.4, p<0.012); p<0.029 adjusted for age, previous smoking, passive smoking, education, current residence and respirator use. Increasing the number of years working as a welder was associated with hypomethylation of CpG_4 (linear regression analysis, β=−0.11, p=0.039, adjusted for previous smoking). Previous tobacco smokers had 1.5–4.7% (p<0.014) lower methylation of 3 of the 4 CpG sites in F2RL3 (CpG_2, CpG_4 and CpG_5) compared to never-smokers. A non-significant lower risk of cardiovascular disease with more methylation was observed for all CpG sites. Conclusions Welding fumes exposure and previous smoking were associated with F2RL3 hypomethylation. This finding links low-to-moderate exposure to welding fumes to adverse effects on the cardiovascular system, and suggests a potential mechanistic pathway for this link, via epigenetic effects on F2RL3 expression. PMID:26395445

  19. Association of the CpG Methylation Pattern of the Proximal Insulin Gene Promoter with Type 1 Diabetes

    PubMed Central

    Fradin, Delphine; Le Fur, Sophie; Mille, Clémence; Naoui, Nadia; Groves, Chris; Zelenika, Diana; McCarthy, Mark I.; Lathrop, Mark; Bougnères, Pierre

    2012-01-01

    The insulin (INS) region is the second most important locus associated with Type 1 Diabetes (T1D). The study of the DNA methylation pattern of the 7 CpGs proximal to the TSS in the INS gene promoter revealed that T1D patients have a lower level of methylation of CpG -19, -135 and -234 (p = 2.10−16) and a higher methylation of CpG -180 than controls, while methylation was comparable for CpG -69, -102, -206. The magnitude of the hypomethylation relative to a control population was 8–15% of the corresponding levels in controls and was correlated in CpGs -19 and -135 (r = 0.77) and CpG -135 and -234 (r = 0.65). 70/485 (14%) of T1D patients had a simultaneous decrease in methylation of CpG -19, -135, -234 versus none in 317 controls. CpG methylation did not correlate with glycated hemoglobin or with T1D duration. The methylation of CpG -69, -102, -180, -206, but not CpG -19, -135, -234 was strongly influenced by the cis-genotype at rs689, a SNP known to show a strong association with T1D. We hypothesize that part of this genetic association could in fact be mediated at the statistical and functional level by the underlying changes in neighboring CpG methylation. Our observation of a CpG-specific, locus-specific methylation pattern, although it can provide an epigenetic biomarker of a multifactorial disease, does not indicate whether the reported epigenetic pattern preexists or follows the establishment of T1D. To explore the effect of chronic hyperglycemia on CpG methylation, we studied non obese patients with type 2 diabetes (T2D) who were found to have decreased CpG-19 methylation versus age-matched controls, similar to T1D (p = 2.10−6) but increased CpG-234 methylation (p = 5.10−8), the opposite of T1D. The causality and natural history of the different epigenetic changes associated with T1D or T2D remain to be determined. PMID:22567146

  20. CpG PatternFinder: a Windows-based utility program for easy and rapid identification of the CpG methylation status of DNA.

    PubMed

    Xu, Yi-Hua; Manoharan, Herbert T; Pitot, Henry C

    2007-09-01

    The bisulfite genomic sequencing technique is one of the most widely used techniques to study sequence-specific DNA methylation because of its unambiguous ability to reveal DNA methylation status to the order of a single nucleotide. One characteristic feature of the bisulfite genomic sequencing technique is that a number of sample sequence files will be produced from a single DNA sample. The PCR products of bisulfite-treated DNA samples cannot be sequenced directly because they are heterogeneous in nature; therefore they should be cloned into suitable plasmids and then sequenced. This procedure generates an enormous number of sample DNA sequence files as well as adding extra bases belonging to the plasmids to the sequence, which will cause problems in the final sequence comparison. Finding the methylation status for each CpG in each sample sequence is not an easy job. As a result CpG PatternFinder was developed for this purpose. The main functions of the CpG PatternFinder are: (i) to analyze the reference sequence to obtain CpG and non-CpG-C residue position information. (ii) To tailor sample sequence files (delete insertions and mark deletions from the sample sequence files) based on a configuration of ClustalW multiple alignment. (iii) To align sample sequence files with a reference file to obtain bisulfite conversion efficiency and CpG methylation status. And, (iv) to produce graphics, highlighted aligned sequence text and a summary report which can be easily exported to Microsoft Office suite. CpG PatternFinder is designed to operate cooperatively with BioEdit, a freeware on the internet. It can handle up to 100 files of sample DNA sequences simultaneously, and the total CpG pattern analysis process can be finished in minutes. CpG PatternFinder is an ideal software tool for DNA methylation studies to determine the differential methylation pattern in a large number of individuals in a population. Previously we developed the CpG Analyzer program; CpG PatternFinder is our further effort to create software tools for DNA methylation studies.

  1. [Comparative evaluation of clinical practice guidelines for the treatment of schizophrenia].

    PubMed

    Delessert, D; Pomini, V; Grasset, F; Baumann, P

    2008-01-01

    Many clinical practice guidelines (CPG) have been published in reply to the development of the concept of "evidence-based medicine" (EBM) and as a solution to the difficulty of synthesizing and selecting relevant medical literature. Taking into account the expansion of new CPG, the question of choice arises: which CPG to consider in a given clinical situation? It is of primary importance to evaluate the quality of the CPG, but until recently, there has been no standardized tool of evaluation or comparison of the quality of the CPG. An instrument of evaluation of the quality of the CPG, called "AGREE" for appraisal of guidelines for research and evaluation was validated in 2002. The six principal CPG concerning the treatment of schizophrenia are compared with the help of the "AGREE" instrument: (1) "the Agence nationale pour le développement de l'évaluation médicale (ANDEM) recommendations"; (2) "The American Psychiatric Association (APA) practice guideline for the treatment of patients with schizophrenia"; (3) "The quick reference guide of APA practice guideline for the treatment of patients with schizophrenia"; (4) "The schizophrenia patient outcomes research team (PORT) treatment recommendations"; (5) "The Texas medication algorithm project (T-MAP)" and (6) "The expert consensus guideline for the treatment of schizophrenia". The results of our study were then compared with those of a similar investigation published in 2005, structured on 24 CPG tackling the treatment of schizophrenia. The "AGREE" tool was also used by two investigators in their study. In general, the scores of the two studies differed little and the two global evaluations of the CPG converged; however, each of the six CPG is perfectible. The rigour of elaboration of the six CPG was in general average. The consideration of the opinion of potential users was incomplete, and an effort made in the presentation of the recommendations would facilitate their clinical use. Moreover, there was little consideration by the authors regarding the applicability of the recommendations. Globally, two CPG are considered as strongly recommended: "the quick reference guide of the APA practice guideline for the treatment of patients with schizophrenia" and "the T-MAP".

  2. Clinical practice guidelines (CPGs) reduce costs in the management of isolated splenic injuries at pediatric trauma centers.

    PubMed

    Gutierrez, Ivan M; Zurakowski, David; Chen, Qiaoli; Mooney, David P

    2013-02-01

    The American Pediatric Surgical Association Trauma Committee proposed the use of a clinical practice guideline (CPG) for the non-operative management of isolated splenic injuries in 1998. An analysis was conducted to determine the financial impact of CPGs on the management of these injuries. The Pediatric Health Information System database, which contains data from 44 children's hospitals, was used to identify children who sustained a graded isolated splenic injury between June 2005 and June 2010. Demographics, length of stay (LOS), readmission rates, and laboratory, imaging, procedural, and total cost data were determined for all hospitals verified as a pediatric trauma center by the American College of Surgeons and/or designated by their local authority. Comparisons were made between facilities self-identifying as having a splenic injury management CPG and those without a CPG. Children (1,154) with isolated splenic injuries (grades 1-4) were cared for in 26 pediatric trauma centers: 20 with a CPG and 6 without (non-CPG). Median costs were significantly lower at CPG than non-CPG centers for imaging (US $163 vs. US $641, P < .001), laboratory (US $629 vs. US $1,044, P < .001), and total hospital stay (US $9,868 vs. US $10,830, P < .001). The median LOS for CPG and non-CPG centers were similar (3 vs. 2 days, P = .38), as were readmission rates within 90 days (3.1 vs. 5.1 %, P = .21). Multiple linear regression indicated that LOS (P < .001) and utilization of a CPG (P = .007) are significant independent predictors of total cost. Utilization of a CPG to manage children with isolated splenic injuries at a pediatric trauma center results in significantly reduced imaging, laboratory, and total hospital costs independent of patient age, gender, grade, and LOS.

  3. Performance of Different Analytical Software Packages in Quantification of DNA Methylation by Pyrosequencing.

    PubMed

    Grasso, Chiara; Trevisan, Morena; Fiano, Valentina; Tarallo, Valentina; De Marco, Laura; Sacerdote, Carlotta; Richiardi, Lorenzo; Merletti, Franco; Gillio-Tos, Anna

    2016-01-01

    Pyrosequencing has emerged as an alternative method of nucleic acid sequencing, well suited for many applications which aim to characterize single nucleotide polymorphisms, mutations, microbial types and CpG methylation in the target DNA. The commercially available pyrosequencing systems can harbor two different types of software which allow analysis in AQ or CpG mode, respectively, both widely employed for DNA methylation analysis. Aim of the study was to assess the performance for DNA methylation analysis at CpG sites of the two pyrosequencing software which allow analysis in AQ or CpG mode, respectively. Despite CpG mode having been specifically generated for CpG methylation quantification, many investigations on this topic have been carried out with AQ mode. As proof of equivalent performance of the two software for this type of analysis is not available, the focus of this paper was to evaluate if the two modes currently used for CpG methylation assessment by pyrosequencing may give overlapping results. We compared the performance of the two software in quantifying DNA methylation in the promoter of selected genes (GSTP1, MGMT, LINE-1) by testing two case series which include DNA from paraffin embedded prostate cancer tissues (PC study, N = 36) and DNA from blood fractions of healthy people (DD study, N = 28), respectively. We found discrepancy in the two pyrosequencing software-based quality assignment of DNA methylation assays. Compared to the software for analysis in the AQ mode, less permissive criteria are supported by the Pyro Q-CpG software, which enables analysis in CpG mode. CpG mode warns the operators about potential unsatisfactory performance of the assay and ensures a more accurate quantitative evaluation of DNA methylation at CpG sites. The implementation of CpG mode is strongly advisable in order to improve the reliability of the methylation analysis results achievable by pyrosequencing.

  4. Treatment of Tobacco Dependence, a Critical Gap in Czech Clinical Practice Guidelines.

    PubMed

    Zvolská, Kamila; Fraser, Keely; Zvolský, Miroslav; Králíková, Eva

    2017-06-01

    Tobacco related comorbidities and treatment of dependence are relevant to clinicians of all disciplines. Clinicians should provide a brief intervention about tobacco use with smokers at each clinical contact (success rate of 5-10 %). Intensive treatment (success rate >30%) should be available to those who need it. Brief intervention is not yet standard clinical practice. Our aim was to assess clinical practice guidelines (CPG) of selected medical professional societies to determine whether or not tobacco dependence treatment recommendations were included. Between October and December 2013, we conducted a keyword search of CPG for 20 medical professional societies in the Czech Republic. We searched for the keywords "smoking", "tobacco" and "nicotine addiction" in 91 CPG documents, which were freely available on the websites of selected professional societies. We focused specifically on CPG relating to cardiovascular and respiratory diseases as well as cancer. We excluded any CPG focused on acute conditions, diagnostics only, laboratory methods, or administration. There was no mention of smoking in 27.7% (26/94) of CPG documents. Only 16% (15/94) of CPG documents listed smoking as a risk factor. 42.5% (40/94) mentioned smoking related phrases (e.g. "smoking ban"). Only 13.8% (13/94) of CPG included a section on tobacco dependence, referenced tobacco dependence treatment guidelines or mentioned specialized treatment centres where smokers can be referred. Nearly one third of CPG related to cardiovascular and respiratory diseases as well as cancer made no mention of smoking. Despite the clinical significance of smoking, the majority of CPG did not adequately address tobacco dependence and its treatment. Copyright© by the National Institute of Public Health, Prague 2017

  5. DNA-inorganic hybrid nanovaccine for cancer immunotherapy.

    PubMed

    Zhu, Guizhi; Liu, Yijing; Yang, Xiangyu; Kim, Young-Hwa; Zhang, Huimin; Jia, Rui; Liao, Hsien-Shun; Jin, Albert; Lin, Jing; Aronova, Maria; Leapman, Richard; Nie, Zhihong; Niu, Gang; Chen, Xiaoyuan

    2016-03-28

    Cancer evolves to evade or compromise the surveillance of the immune system, and cancer immunotherapy aims to harness the immune system in order to inhibit cancer development. Unmethylated CpG dinucleotide-containing oligonucleotides (CpG), a class of potent adjuvants that activate the toll-like receptor 9 (TLR9) located in the endolysosome of many antigen-presenting cells (APCs), are promising for cancer immunotherapy. However, clinical application of synthetic CpG confronts many challenges such as suboptimal delivery into APCs, unfavorable pharmacokinetics caused by limited biostability and short in vivo half-life, and side effects associated with leaking of CpG into the systemic circulation. Here we present DNA-inorganic hybrid nanovaccines (hNVs) for efficient uptake into APCs, prolonged tumor retention, and potent immunostimulation and cancer immunotherapy. hNVs were self-assembled from concatemer CpG analogs and magnesium pyrophosphate (Mg2PPi). Mg2PPi renders hNVs resistant to nuclease degradation and thermal denaturation, both of which are demanding characteristics for effective vaccination and the storage and transportation of vaccines. Fluorophore-labeled hNVs were tracked to be efficiently internalized into the endolysosomes of APCs, where Mg2PPi was dissolved in an acidic environment and thus CpG analogs were exposed to hNVs. Internalized hNVs in APCs led to (1) elevated secretion of proinflammatory factors, and (2) elevated expression of co-stimulatory factors. Compared with molecular CpG, hNVs dramatically prolonged the tissue retention of CpG analogs and reduced splenomegaly, a common side effect of CpG. In a melanoma mouse model, two injections of hNVs significantly inhibited the tumor growth and outperformed the molecular CpG. These results suggest hNVs are promising for cancer immunotherapy.

  6. Dosimetric Evaluation Between Megavoltage Cone-Beam Computed Tomography and Body Mass Index for Intracranial, Thoracic, and Pelvic Localization

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    VanAntwerp, April E.; Raymond, Sarah M., E-mail: raymons9@ccf.org; Addington, Mark C.

    2011-10-01

    The aim of this study was to evaluate radiation dose for organs at risk (OAR) within the cranium, thorax, and pelvis from megavoltage cone-beam computed tomography (MV-CBCT). Using a clinical treatment planning system, CBCT doses were calculated from 60 patient datasets using 27.4 x 27.4 cm{sup 2} field size and 200{sup o} arc length. The body mass indices (BMIs) for these patients range from 17.2-48.4 kg/m{sup 2}. A total of 60 CBCT plans were created and calculated with heterogeneity corrections, with monitor units (MU) that varied from 8, 4, and 2 MU per plan. The isocenters of these plans weremore » placed at defined anatomical structures. The maximum dose, dose to the isocenter, and mean dose to the selected critical organs were analyzed. The study found that maximum and isocenter doses were weakly associated with BMI, but linearly associated with the total MU. Average maximum/isocenter doses in the cranium were 10.0 ({+-} 0.18)/7.0 ({+-} 0.08) cGy, 5.0 ({+-} 0.09)/3.5 ({+-} 0.05) cGy, and 2.5 ({+-} .04)/1.8 ({+-} 0.05) cGy for 8, 4, and 2 MU, respectively. Similar trends but slightly larger maximum/isocenter doses were found in the thoracic and pelvic regions. For the cranial region, the average mean doses with a total of 8 MU to the eye, lens, and brain were 9.7 ({+-} 0.12) cGy, 9.1 ({+-} 0.16) cGy, and 7.2 ({+-} 0.10) cGy, respectively. For the thoracic region, the average mean doses to the lung, heart, and spinal cord were 6.6 ({+-} 0.05) cGy, 6.9 ({+-} 1.2) cGy, and 4.7 ({+-} 0.8) cGy, respectively. For the pelvic region, the average mean dose to the femoral heads was 6.4 ({+-} 1.1) cGy. The MV-CBCT doses were linearly associated with the total MU but weakly dependent on patients' BMIs. Daily MV-CBCT has a cumulative effect on the total body dose and critical organs, which should be carefully considered for clinical impacts.« less

  7. The effect of TLR9 agonist CpG oligodeoxynucleotides on the intestinal immune response of cobia (Rachycentron canadum).

    PubMed

    Byadgi, Omkar; Puteri, Dinda; Lee, Jai-Wei; Chang, Tsung-Chou; Lee, Yan-Horn; Chu, Chun-Yen; Cheng, Ta-Chih

    2014-01-01

    Cytosine-guanine oligodeoxynucleotide (CpG ODN) motifs of bacterial DNA are recognized through toll-like receptor 9 (TLR9) and are potent activators of innate immunity. However, the interaction between TLR9 and CpG ODN in aquatic species has not been well characterized. Hence, cobia TLR9 isoform B (RCTLR9B) was cloned and its expression and induction in intestine were investigated. RCTLR9B cDNA consists of 3113bp encoding 1009 amino acids containing three regions, leucine rich repeats, transmembrane domain, and toll/interleukin-1 receptor (TIR) domain. Intraperitoneal injection of CpG ODN 2395 upregulated RCTLR9 A and B and MyD88 and also induced the expressions of Mx, chemokine CC, and interleukin IL-1 β . Cobia intraperitoneally injected with CpG ODN 1668 and 2395 had increased survival rates after challenge with Photobacterium damselae subsp. piscicida. In addition, formulation of CpG ODN with formalin-killed bacteria (FKB) and aluminum hydroxide gel significantly increased expressions of RCTLR9 A (50 folds) and B (30 folds) isoforms at 10 dpi (CpG ODN 1668) and MyD88 (21 folds) at 6 dpv (CpG ODN 2395). Subsequently, IL-1 β increased at 6 dpv in 1668 group. No histopathological damage and inflammatory responses were observed in the injected cobia. Altogether, these results facilitate CpG ODNs as an adjuvant to increase bacterial disease resistance and efficacy of vaccines in cobia.

  8. The Effect of TLR9 Agonist CpG Oligodeoxynucleotides on the Intestinal Immune Response of Cobia (Rachycentron canadum)

    PubMed Central

    Byadgi, Omkar; Puteri, Dinda; Lee, Jai-Wei; Chang, Tsung-Chou; Lee, Yan-Horn; Chu, Chun-Yen; Cheng, Ta-Chih

    2014-01-01

    Cytosine-guanine oligodeoxynucleotide (CpG ODN) motifs of bacterial DNA are recognized through toll-like receptor 9 (TLR9) and are potent activators of innate immunity. However, the interaction between TLR9 and CpG ODN in aquatic species has not been well characterized. Hence, cobia TLR9 isoform B (RCTLR9B) was cloned and its expression and induction in intestine were investigated. RCTLR9B cDNA consists of 3113bp encoding 1009 amino acids containing three regions, leucine rich repeats, transmembrane domain, and toll/interleukin-1 receptor (TIR) domain. Intraperitoneal injection of CpG ODN 2395 upregulated RCTLR9 A and B and MyD88 and also induced the expressions of Mx, chemokine CC, and interleukin IL-1β. Cobia intraperitoneally injected with CpG ODN 1668 and 2395 had increased survival rates after challenge with Photobacterium damselae subsp. piscicida. In addition, formulation of CpG ODN with formalin-killed bacteria (FKB) and aluminum hydroxide gel significantly increased expressions of RCTLR9 A (50 folds) and B (30 folds) isoforms at 10 dpi (CpG ODN 1668) and MyD88 (21 folds) at 6 dpv (CpG ODN 2395). Subsequently, IL-1β increased at 6 dpv in 1668 group. No histopathological damage and inflammatory responses were observed in the injected cobia. Altogether, these results facilitate CpG ODNs as an adjuvant to increase bacterial disease resistance and efficacy of vaccines in cobia. PMID:24991578

  9. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ballester, Marie; Jeanbart, Laura; de Titta, Alexandre

    An emerging strategy in preventing and treating airway allergy consists of modulating the immune response induced against allergens in the lungs. CpG oligodeoxynucleotides have been investigated in airway allergy studies, but even if promising, efficacy requires further substantiation. We investigated the effect of pulmonary delivery of nanoparticle (NP)-conjugated CpG on lung immunity and found that NP-CpG led to enhanced recruitment of activated dendritic cells and to Th1 immunity compared to free CpG. We then evaluated if pulmonary delivery of NP-CpG could prevent and treat house dust mite-induced allergy by modulating immunity directly in lungs. When CpG was administered as immunomodulatorymore » therapy prior to allergen sensitization, we found that NP-CpG significantly reduced eosinophilia, IgE levels, mucus production and Th2 cytokines, while free CpG had only a moderate effect on these parameters. In a therapeutic setting where CpG was administered after allergen sensitization, we found that although both free CpG and NP-CpG reduced eosinophilia and IgE levels to the same extent, NP conjugation of CpG significantly enhanced reduction of Th2 cytokines in lungs of allergic mice. Taken together, these data highlight benefits of NP conjugation and the relevance of NP-CpG as allergen-free therapy to modulate lung immunity and treat airway allergy.« less

  10. A Living Metaphor of Differentiation: A Meta-Ethnography of Cognitively Guided Instruction in the Elementary Classroom

    ERIC Educational Resources Information Center

    Baker, Katherine; Harter, Meghan Evelynne

    2015-01-01

    This meta-ethnography explores qualitative studies around the Cognitively Guided Instruction (CGI) framework of mathematics and illustrates how CGI epitomizes differentiation. The meta-ethnographic process is used to synthesize CGI as differentiation, specifically within the elementary mathematics classroom. Thomas P. Carpenter is credited as one…

  11. Technical Evaluation for the Determination of CGI Designation for Safety Class Items Incorporated in Hose-in-Hose Transfer Line Assemblies

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    BUCHANAN, J.R.

    2000-05-16

    The purpose of this technical evaluation is to determine whether the secondary hoses are to be categorized as Commercial Grade Items (CGI) or Engineered Equipment. This determination will identify whether or not use of the CGI Dedication process is appropriate.

  12. Disruption of the Arabidopsis CGI-58 homologue produces Chanarin-Dorfman-like lipodystrophy in plants

    USDA-ARS?s Scientific Manuscript database

    CGI-58 is the defective gene in the human neutral lipid storage disease called Chanarin-Dorfman syndrome. This disorder causes intracellular lipid droplets to accumulate in nonadipose tissues, such as skin and blood cells. Here, disruption of the homologous CGI-58 gene in Arabidopsis thaliana result...

  13. Successful pregnancy following very high-dose total body irradiation (1575 cGy) and bone marrow transplantation in a woman with acute myeloid leukemia.

    PubMed

    Wang, W S; Tzeng, C H; Hsieh, R K; Chiou, T J; Liu, J H; Yen, C C; Chen, P M

    1998-02-01

    A 22-year-old woman had a normal full-term delivery 6 years after a successful allogeneic bone marrow transplantation (BMT) for acute myeloid leukemia (AML). Conditioning therapy consisted of cyclophosphamide (120 mg/kg) and total body irradiation (TBI) to a total of 1575 cGy in seven fractions (225 cGy x 7, at a dose rate of 3.5 cGy/min). Graft-versus-host disease prophylaxis was with methotrexate and cyclosporin A. Grade I acute GVHD developed after BMT but there was no chronic GVHD. She became amenorrhoeic after BMT and serial gonadal testing indicated hypergonadotrophic hypogonadism. She became pregnant and delivered a full-term, healthy baby 6 years after BMT. Successful pregnancy after TBI of more than 1200 cGy is extremely rare. This case, to the best of our knowledge, is the second patient who received a higher dose of TBI (1575 cGy) to have a successful pregnancy. This and previous reports indicate that normal pregnancy is possible after BMT with TBI in excess of 1200 cGy.

  14. Pattern generating and reflex-like processes controlling aiming movements in the presence of inertia, damping and gravity. A theoretical note.

    PubMed

    Kalveram, K T

    1991-01-01

    A model is proposed, in which goal-directed movements of the forearm are controlled by a central pattern generator (CPG) initiated for exactly one period, and by reflex-analogous processes. Movement width is proportional to the amplitude factor of the CPG's output, and to the square of the CPG's period length. The period duration can be freely selected, thus enabling the CPG to accommodate its time scale to the period of others CPG's. Parameters which influence movement accuracy can be adjusted by means of closed control loop, which are discrete with respect to time: The time unit corresponds to the period of the CPG. For instance, momentum adjustment balances the CPG in such a manner that the velocity of the arm becomes zero on termination of the period, while gain adjustment serves to attain a correct movement length in the presence of an inertial load. Friction, stiffness and gravitational force are neutralized by additional reflex-type processes, interpretable as positive feedback loops with adjustable gain factors, using position and velocity signals.

  15. Marrow toxicity of fractionated vs. single dose total body irradiation is identical in a canine model

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Storb, R.; Raff, R.F.; Graham, T.

    1993-03-20

    The authors explored in dogs the marrow toxicity of single dose total body irradiation delivered from two opposing [sup 60]Co sources at a rate of 10 cGy/min and compared results to those seen with total body irradiation administered in 100 cGy fractions with minimum interfraction intervals of 6 hr. Dogs were not given marrow transplants. They found that 200 cGy single dose total body irradiation was sublethal, with 12 of 13 dogs showing hematopoietic recovery and survival. Seven of 21 dogs given 300 cGy single dose total body irradiation survived compared to 6 of 10 dogs given 300 cGy fractionatedmore » total body irradiation. One of 28 dogs given 400 cGy single dose total body irradiation survived compared to none of six given fractionated radiation. With granulocyte colony stimulating factor (GCSF) administered from day 0-21 after 400 cGy total body irradiation, most dogs survived with hematological recovery. Because of the almost uniform success with GCSF after 400 cGy single dose total body irradiation, a study of GCSF after 400 cGy fractionated total body irradiation was deemed not to be informative and, thus, not carried out. Additional comparisons between single dose and fractionated total body irradiation were carried out with GCSF administered after 500 and 600 cGy of total body irradiation. As with lower doses of total body irradiation, no significant survival differences were seen between the two modes of total body irradiation, and only 3 of 26 dogs studied survived with complete hematological recovery. Overall, therefore, survival among dogs given single dose total body irradiation was not different from that of dogs given fractionated total body irradiation (p = .67). Similarly, the slopes of the postirradiation declines of granulocyte and platelet counts and the rates of their recovery in surviving dogs given equal total doses of single versus fractionated total body irradiation were indistinguishable. 24 refs., 3 figs., 2 tabs.« less

  16. Prenatal arsenic exposure and the epigenome: identifying sites of 5-methylcytosine alterations that predict functional changes in gene expression in newborn cord blood and subsequent birth outcomes.

    PubMed

    Rojas, Daniel; Rager, Julia E; Smeester, Lisa; Bailey, Kathryn A; Drobná, Zuzana; Rubio-Andrade, Marisela; Stýblo, Miroslav; García-Vargas, Gonzalo; Fry, Rebecca C

    2015-01-01

    Prenatal exposure to inorganic arsenic (iAs) is detrimental to the health of newborns and increases the risk of disease development later in life. Here we examined a subset of newborn cord blood leukocyte samples collected from subjects enrolled in the Biomarkers of Exposure to ARsenic (BEAR) pregnancy cohort in Gómez Palacio, Mexico, who were exposed to a range of drinking water arsenic concentrations (0.456-236 µg/l). Changes in iAs-associated DNA 5-methylcytosine methylation were assessed across 424,935 CpG sites representing 18,761 genes and compared with corresponding mRNA expression levels and birth outcomes. In the context of arsenic exposure, a total of 2919 genes were identified with iAs-associated differences in DNA methylation. Site-specific analyses identified DNA methylation changes that were most predictive of gene expression levels where CpG methylation within CpG islands positioned within the first exon, the 5' untranslated region and 200 bp upstream of the transcription start site yielded the most significant association with gene expression levels. A set of 16 genes was identified with correlated iAs-associated changes in DNA methylation and mRNA expression and all were highly enriched for binding sites of the early growth response (EGR) and CCCTC-binding factor (CTCF) transcription factors. Furthermore, DNA methylation levels of 7 of these genes were associated with differences in birth outcomes including gestational age and head circumference.These data highlight the complex interplay between DNA methylation, functional changes in gene expression and health outcomes and underscore the need for functional analyses coupled to epigenetic assessments. © The Author 2014. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  17. Cloning of polymorphisms (COP): enrichment of polymorphic sequences from complex genomes

    PubMed Central

    Li, Jingfeng; Wang, Fuli; Zabarovska, Veronika; Wahlestedt, Claes; Zabarovsky, Eugene R.

    2000-01-01

    Here we describe a new procedure (cloning of polymorphisms, COP) for enrichment of single nucleotide polymorphisms (SNPs) that represent restriction fragment length polymorphisms (RFLPs). COP would be applicable to the isolation of SNPs from particular regions of the genome, e.g. CpG islands, chromosomal bands, YACs or PAC contigs. A combination of digestion with restriction enzymes, treatment with uracil-DNA glycosylase and mung bean nuclease, PCR amplification and purification with streptavidin magnetic beads was used to isolate polymorphic sequences from the genomes of two human samples. After only two cycles of enrichment, 80% of the isolated clones were found to contain RFLPs. A simple method for the PCR detection of these polymorphisms was also developed. PMID:10606669

  18. The Huntington disease locus is most likely within 325 kilobases of the chromosome 4p telomere

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Doggett, N.A.; Cheng, J.F.; Smith, C.L.

    1989-12-01

    The genetic defect responsible for Huntington disease was originally localized near the tip of the short arm of chromosome 4 by genetic linkage to the locus D4S10. Several markers closer to Huntington disease have since been isolated, but these all appear to be proximal to the defect. A physical map that extends from the most distal of these loci, D4S90, to the telomere of chromosome 4 was constructed. This map identifies at least two CpG islands as markers for Huntington disease candidate genes and places the most likely location of the Huntington disease defect remarkably close (within 325 kilobases) tomore » the telomere.« less

  19. Effects of aripiprazole once-monthly on symptoms of schizophrenia in patients switched from oral antipsychotics.

    PubMed

    Peters-Strickland, Timothy; Zhao, Cathy; Perry, Pamela P; Eramo, Anna; Salzman, Phyllis M; McQuade, Robert D; Johnson, Brian R; Sanchez, Raymond

    2016-12-01

    To assess the effects of aripiprazole once-monthly 400 mg (AOM 400) on clinical symptoms and global improvement in schizophrenia after switching from an oral antipsychotic. In a multicenter, open-label, mirror-image, naturalistic study in patients with schizophrenia (>1 year, Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition, Text Revision [DSM-IV-TR] criteria), changes in efficacy measures were assessed during prospective treatment (6 months) with AOM 400 after switching from standard-of-care oral antipsychotics. During prospective treatment, patients were cross-titrated to oral aripiprazole monotherapy (1-4) weeks followed by open-label AOM 400 (24 weeks). Mean change from baseline of the open-label AOM 400 phase in Positive and Negative Syndrome Scale (PANSS) scores (total, positive and negative subscales) and Clinical Global Impression-Severity (CGI-S) scores; mean CGI-Improvement (CGI-I) score; and proportion of responders (≥30% decrease from baseline in PANSS total score or CGI-I score of 1 [very much improved] or 2 [much improved]) were assessed. PANSS and CGI-S scores improved from baseline (P<0.0001) and CGI-I demonstrated improvement at all time points. By the end of the study, 49.0% of patients were PANSS or CGI-I responders. In a community setting, patients with schizophrenia who were stabilized at baseline and switched to AOM 400 from oral antipsychotics showed clear improvements in clinical symptoms.

  20. Cloning and characterization of a new cold-adapted and thermo-tolerant ι-carrageenase from marine bacterium Flavobacterium sp. YS-80-122.

    PubMed

    Li, Shangyong; Hao, Jianhua; Sun, Mi

    2017-09-01

    ι-Carrageenases play a role in marine ι-carrageenan degradation, and their enzymatic hydrolysates are thought to be excellent antioxidants. In this study, we identified a new ι-carrageenase, encoded by cgiF, in psychrophilic bacterium Flavobacterium sp. YS-80-122. The deduced ι-carrageenase, CgiF, belongs to glycoside hydrolase family 82 and shows less than 40% amino acid identity with characterized ι-carrageenases. The activity of recombinant CgiF peaked at 30°C (1,207.8U/mg). Notably, CgiF is a cold-adapted ι-carrageenase, which showed 36.5% and 57% of the maximum activity at 10°C and 15°C, respectively. In addition, it is a thermo-tolerant enzyme that recovered 58.2% of its initial activity after heat shock. Furthermore, although the activity of CgiF was enhanced by NaCl, the enzyme is active in absence of NaCl. This study also shows that CgiF is an endo-type ι-carrageenase that hydrolyzes β-1,4-linkages of ι-carrageenan, yielding neo-ι-carratetraose as the main product. Its cold-adaptation, thermo-tolerance, NaCl independence and high neo-ι-carratetraose yield make CgiF an excellent candidate for industrial applications in production of ι-carrageen oligosaccharides from seaweed polysaccharides. Copyright © 2017. Published by Elsevier B.V.

  1. Exposure to welding fumes is associated with hypomethylation of the F2RL3 gene: a cardiovascular disease marker.

    PubMed

    Hossain, Mohammad B; Li, Huiqi; Hedmer, Maria; Tinnerberg, Håkan; Albin, Maria; Broberg, Karin

    2015-12-01

    Welders are at risk for cardiovascular disease. Recent studies linked tobacco smoke exposure to hypomethylation of the F2RL3 (coagulation factor II (thrombin) receptor-like 3) gene, a marker for cardiovascular disease prognosis and mortality. However, whether welding fumes cause hypomethylation of F2RL3 remains unknown. We investigated 101 welders (median span of working as a welder: 7 years) and 127 unexposed controls (non-welders with no obvious exposure to respirable dust at work), age range 23-60 years, all currently non-smoking, in Sweden. The participants were interviewed about their work history, lifestyle factors and diseases. Personal sampling of respirable dust was performed for the welders. DNA methylation of F2RL3 in blood was assessed by pyrosequencing of four CpG sites, CpG_2 (corresponds to cg03636183) to CpG_5, in F2RL3. Multivariable linear regression analysis was used to assess the association between exposure to welding fumes and F2RL3 methylation. Welders had 2.6% lower methylation of CpG_5 than controls (p<0.001). Higher concentrations of measured respirable dust among the welders were associated with hypomethylation of CpG_2, CpG_4 and CpG_5 (β=-0.49 to -1.4, p<0.012); p<0.029 adjusted for age, previous smoking, passive smoking, education, current residence and respirator use. Increasing the number of years working as a welder was associated with hypomethylation of CpG_4 (linear regression analysis, β=-0.11, p=0.039, adjusted for previous smoking). Previous tobacco smokers had 1.5-4.7% (p<0.014) lower methylation of 3 of the 4 CpG sites in F2RL3 (CpG_2, CpG_4 and CpG_5) compared to never-smokers. A non-significant lower risk of cardiovascular disease with more methylation was observed for all CpG sites. Welding fumes exposure and previous smoking were associated with F2RL3 hypomethylation. This finding links low-to-moderate exposure to welding fumes to adverse effects on the cardiovascular system, and suggests a potential mechanistic pathway for this link, via epigenetic effects on F2RL3 expression. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

  2. Disruption of the human CGI-58 homologue in Arabidopsis results in lipid droplet accumulation in the cytosol of plant cells

    USDA-ARS?s Scientific Manuscript database

    CGI-58 has been identified as the causative gene in the human neutral lipid storage disease called Chanarin-Dorfman Syndrome. This disorder results in accumulation of intracellular lipid droplets in non-adipose tissues. Here we show that disruption of the homologous CGI-58 gene in Arabidopsis thal...

  3. The impact of histology and delivered dose on local control of spinal metastases treated with stereotactic radiosurgery.

    PubMed

    Yamada, Yoshiya; Katsoulakis, Evangelia; Laufer, Ilya; Lovelock, Michael; Barzilai, Ori; McLaughlin, Lily A; Zhang, Zhigang; Schmitt, Adam M; Higginson, Daniel S; Lis, Eric; Zelefsky, Michael J; Mechalakos, James; Bilsky, Mark H

    2017-01-01

    OBJECTIVE An analysis of factors contributing to durable radiographic control of spinal metastases was undertaken, drawing from a large single-institution database in an attempt to elucidate indications and dose requirements for successful treatment. METHODS All patients treated at a single institution with stereotactic radiosurgery (SRS) of the spine as first-line therapy were assessed for local progression of the treated site, defined as radiographic enlargement of the treated tumor and/or biopsy-proven evidence of active tumor cells. All patients were followed with CT, PET, or MR imaging every 3-6 months until death. Treatment decisions were made by a multidisciplinary team of radiation oncologists, neurosurgeons, and neuroradiologists. Target volumes were defined according to the international consensus guidelines and were reviewed in a multidisciplinary conference. Image-guided techniques and intensity modulation were used for every case. The tumor's histological type, gross tumor volume (GTV), dose that covers 95% of the GTV (GTV D95), percentage of GTV covered by 95% of the prescribed dose (GTV V95), planning target volume (PTV), dose that covers 95% of the PTV (PTV D95), and percentage of PTV covered by 95% of the prescribed dose (PTV V95) were analyzed for significance in relation to local control, based on time to local progression. RESULTS A total of 811 lesions were treated in 657 patients between 2003 and 2015 at a single institution. The mean follow-up and overall survival for the entire cohort was 26.9 months (range 2-141 months). A total of 28 lesions progressed and the mean time to failure was 26 months (range 9.7-57 months). The median prescribed dose was 2400 cGy (range 1600-2600 cGy). Both GTV D95 and PTV D95 were highly significantly associated with local failure in univariate analysis, but GTV and PTV and histological type did not reach statistical significance. The median GTV D95 for the cohort equal to or above the GTV D95 1830 cGy cut point (high dose) was 2356 cGy, and it was 1709 cGy for the cohort of patients who received less than 1830 cGy (low dose). In terms of PTV D95, the median dose for those equal to or above the cut point of 1740 cGy (high dose) was 2233 cGy, versus 1644 cGy for those lesions below the PTV D95 cut point of 1740 cGy (low dose). CONCLUSIONS High-dose single-session SRS provides durable long-term control, regardless of the histological findings or tumor size. In this analysis, the only significant factors predictive of local control were related to the actual dose of radiation given. Although the target volumes were well treated with the intended dose, those lesions irradiated to higher doses (median GTV D95 2356 cGy, minimum 1830 cGy) had a significantly higher probability of durable local control than those treated with lower doses (median PTV D95 2232 cGy, minimum of 1740 cGy) (p < 0.001). Patients in the high-dose cohort had a 2% cumulative rate of local failure. Histological findings were not associated with local failure, suggesting that radioresistant histological types benefit in particular from radiosurgery. For patients with a favorable prognosis, a higher dose of SRS is important for long-term outcomes.

  4. The impact of histology and delivered dose on local control of spinal metastases treated with stereotactic radiosurgery

    PubMed Central

    Yamada, Yoshiya; Katsoulakis, Evangelia; Laufer, Ilya; Lovelock, Michael; Barzilai, Ori; McLaughlin, Lily A.; Zhang, Zhigang; Schmitt, Adam M.; Higginson, Daniel S.; Lis, Eric; Zelefsky, Michael J.; Mechalakos, James; Bilsky, Mark H.

    2017-01-01

    Objective An analysis of factors contributing to durable radiographic control of spinal metastases was undertaken, drawing from a large single-institution database in an attempt to elucidate indications and dose requirements for successful treatment. Methods All patients treated at a single institution with stereotactic radiosurgery (SRS) of the spine as first-line therapy were assessed for local progression of the treated site, defined as radiographic enlargement of the treated tumor and/or biopsy-proven evidence of active tumor cells. All patients were followed with CT, PET, or MR imaging every 3–6 months until death. Treatment decisions were made by a multidisciplinary team of radiation oncologists, neurosurgeons, and neuroradiologists. Target volumes were defined according to the international consensus guidelines and were reviewed in a multidisciplinary conference. Image-guided techniques and intensity modulation were used for every case. The tumor’s histological type, gross tumor volume (GTV), dose that covers 95% of the GTV (GTV D95), percentage of GTV covered by 95% of the prescribed dose (GTV V95), planning target volume (PTV), dose that covers 95% of the PTV (PTV D95), and percentage of PTV covered by 95% of the prescribed dose (PTV V95) were analyzed for significance in relation to local control, based on time to local progression. Results A total of 811 lesions were treated in 657 patients between 2003 and 2015 at a single institution. The mean follow-up and overall survival for the entire cohort was 26.9 months (range 2–141 months). A total of 28 lesions progressed and the mean time to failure was 26 months (range 9.7–57 months). The median prescribed dose was 2400 cGy (range 1600–2600 cGy). Both GTV D95 and PTV D95 were highly significantly associated with local failure in univariate analysis, but GTV and PTV and histological type did not reach statistical significance. The median GTV D95 for the cohort equal to or above the GTV D95 1830 cGy cut point (high dose) was 2356 cGy, and it was 1709 cGy for the cohort of patients who received less than 1830 cGy (low dose). In terms of PTV D95, the median dose for those equal to or above the cut point of 1740 cGy (high dose) was 2233 cGy, versus 1644 cGy for those lesions below the PTV D95 cut point of 1740 cGy (low dose). Conclusions High-dose single-session SRS provides durable long-term control, regardless of the histological findings or tumor size. In this analysis, the only significant factors predictive of local control were related to the actual dose of radiation given. Although the target volumes were well treated with the intended dose, those lesions irradiated to higher doses (median GTV D95 2356 cGy, minimum 1830 cGy) had a significantly higher probability of durable local control than those treated with lower doses (median PTV D95 2232 cGy, minimum of 1740 cGy) (p < 0.001). Patients in the high-dose cohort had a 2% cumulative rate of local failure. Histological findings were not associated with local failure, suggesting that radioresistant histological types benefit in particular from radiosurgery. For patients with a favorable prognosis, a higher dose of SRS is important for long-term outcomes. PMID:28041329

  5. Incidental Testicular Irradiation From Prostate IMRT: It All Adds Up

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    King, Christopher R., E-mail: crking@stanford.ed; Maxim, Peter G.; Hsu, Annie

    Purpose: To identify the technical aspects of image-guided intensity-modulated radiation therapy (IMRT) for localized prostate cancer that could result in a clinically meaningful incidental dose to the testes. Methods and Materials: We examined three sources that contribute incidental dose to the testes, namely, from internal photon scattering from IMRT small field and large pelvic nodal fields with 6 or 15 MV, from neutrons when >10-MV photons are used, and from daily image-guided fiducial-based portal imaging. Using clinical data from 10 patients who received IMRT for prostate cancer, and thermo-luminescent dosimeter measurements in phantom, we estimated the dose to the testesmore » from each of these sources. Results: A mean testicular dose of 172 and 220 cGy results from internal photon scatter for pelvic nodal fields and 68 and 93 cGy for prostate-only fields, for 6- and 15-MV energies, respectively. For 15-MV photon energies, the mean testicular dose from neutrons is 60 cGy for pelvic fields and 31 cGy for prostate-only fields. From daily portal MV image guidance, the testes-in-field mean dose is 350 cGy, whereas the testes-out-of-field scatter dose is 16 cGy. Dosimetric comparisons between IMRT using 6-MV and 15-MV photon energies are not significantly different. Worst-case scenarios can potentially deliver cumulative incidental mean testicular doses of 630 cGy, whereas best-case scenarios can deliver only 84 cGy. Conclusions: Incidental dose to the testes from prostate IMRT can be minimized by opting to restrict the use of elective pelvic nodal fields, by choosing photon energies <10 MV, and by using the smallest port sizes necessary for daily image guidance.« less

  6. Effect of OROS methylphenidate on encopresis in children with attention-deficit/hyperactivity disorder.

    PubMed

    Yılmaz, Savaş; Bilgiç, Ayhan; Hergüner, Sabri

    2014-04-01

    Although encopresis shows a high rate of comorbidity in patients with attention-deficit/hyperactivity disorder (ADHD), the etiologic origin of this relationship and the effect of ADHD drugs on encopresis are unclear. In this chart review, we explored the effect of OROS long-acting methylphenidate (MPH) treatment on encopresis in children with ADHD. We also evaluated the relationship between the clinical variables of ADHD and encopresis. The sample consisted of 21 children and adolescents (20 boys and 1 girl) with encopresis and coexisting ADHD 7-15 years of age. Their clinical characteristics and baseline (visit 1) and end of the second months' (visit 2) Conners' Parent Rating Scale (CPRS) subscores were recorded. Retrospective clinician determinations were made using the Clinical Global Impressions-Severity subscale (CGI-S) for encopresis severity and the Clinical Global Impressions-Improvement subscale (CGI-I) for encopresis response. According to the CGI-I, 14 subjects (71.4 %) showed much or very much improvement in their encopresis at the second visit. All of the CPRS scores showed a significant reduction during the second visit. No association was found between the CGI-I score and the changes in any of the CPRS scores. Baseline oppositional defiant disorder (ODD) and conduct disorder (CD) scores were correlated with the CGI-S score; however, no association was found between core ADHD symptom severity and the CGI-S score. With regard to the encopresis outcome, the baseline CD score was negatively correlated with the CGI-I score, and the baseline ODD score was prone to show a negative correlation with the CGI-I score. These results suggest that coexisting behavioral problems may be a vulnerability factor based on the severity of encopresis, and that MPH treatment may have a positive effect on encopresis in children and adolescents with ADHD.

  7. What does the MADRS mean? Equipercentile linking with the CGI using a company database of mirtazapine studies.

    PubMed

    Leucht, Stefan; Fennema, Hein; Engel, Rolf R; Kaspers-Janssen, Marion; Lepping, Peter; Szegedi, Armin

    2017-03-01

    Little is known about the clinical relevance of the Montgomery Asberg Depression Rating Scale (MADRS) total scores. It is unclear how total scores translate into clinical severity, or how commonly used measures for response (reduction from baseline of ≥50% in the total score) translate into clinical relevance. Moreover, MADRS based definitions of remission vary. We therefore compared: a/ the MADRS total score with the Clinical Global Impression - Severity Score (CGI-S) b/ the percentage and absolute change in the MADRS total scores with Clinical Global Impression - Improvement (CGI-I); c/ the absolute and percentage change in the MADRS total scores with CGI-S absolute change. The method used was equipercentile linking of MADRS and CGI ratings from 22 drug trials in patients with Major Depressive Disorder (MDD) (n=3288). Our results confirm the validity of the commonly used measures for response in MDD trials: a CGI-I score of 2 ('much improved') corresponded to a percentage MADRS reduction from baseline of 48-57%, and a CGI-I score of 1 ('very much improved') to a reduction of 80-84%. If a state of almost complete absence of symptoms were required for a definition of remission, a MADRS total score would be <8, because such scores corresponded to a CGI-S score of 2 ('borderline mentally ill'). Although our analysis is based on a large number of patients, the original trials were not specifically designed to examine our research question. The results might contribute to a better understanding and improved interpretation of clinical trial results in MDD. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. Relationship between the clinical global impression of severity for schizoaffective disorder scale and established mood scales for mania and depression.

    PubMed

    Turkoz, Ibrahim; Fu, Dong-Jing; Bossie, Cynthia A; Sheehan, John J; Alphs, Larry

    2013-08-15

    This analysis explored the relationship between ratings on HAM-D-17 or YMRS and those on the depressive or manic subscale of CGI-S for schizoaffective disorder (CGI-S-SCA). This post hoc analysis used the database (N=614) from two 6-week, randomized, placebo-controlled studies of paliperidone ER versus placebo in symptomatic subjects with schizoaffective disorder assessed using HAM-D-17, YMRS, and CGI-S-SCA scales. Parametric and nonparametric regression models explored the relationships between ratings on YMRS and HAM-D-17 and on depressive and manic domains of the CGI-S-SCA from baseline to the 6-week end point. A clinically meaningful improvement was defined as a change of 1 point in the CGI-S-SCA score. No adjustment was made for multiplicity. Multiple linear regression models suggested that a 1-point change in the depressive domain of CGI-S-SCA corresponded to an average 3.6-point (SE=0.2) change in HAM-D-17 score. Similarly, a 1-point change in the manic domain of CGI-S-SCA corresponded to an average 5.8-point (SE=0.2) change in YMRS score. Results were confirmed using local and cumulative logistic regression models in addition to equipercentile linking. Lack of subjects scoring over the complete range of possible scores may limit broad application of the analyses. Clinically meaningful score changes in depressive and manic domains of CGI-S-SCA corresponded to approximately 4- and 6-point score changes on HAM-D-17 and YMRS, respectively, in symptomatic subjects with schizoaffective disorder. Copyright © 2013 Elsevier B.V. All rights reserved.

  9. SU-F-T-17: A Feasibility Study for the Transit Dosimetry with a Glass Dosimeter in Brachytherapy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Moon, S; Yoon, M; Chung, W

    Purpose: Confirming the dose delivered to a patient is important to make sure the treatment quality and safety of the radiotherapy. Measuring a transit dose of the patient during the radiotherapy could be an interesting way to confirm the patient dose. In this study, we evaluated the feasibility of the transit dosimetry with a glass dosimeter in brachytherapy. Methods: We made a phantom that inserted the glass dosimeters and placed under patient lying on a couch for cervix cancer brachytherapy. The 18 glass dosimeters were placed in the phantom arranged 6 per row. A point putting 1cm vertically from themore » source was prescribed as 500.00 cGy. Solid phantoms of 0, 2, 4, 6, 8, 10 cm were placed between the source and the glass dosimeter. The transit dose was measured each thickness using the glass dosimeters and compared with a treatment planning system (TPS). Results: When the transit dose was smaller than 10 cGy, the average of the differences between measured values and calculated values by TPS was 0.50 cGy and the standard deviation was 0.69 cGy. If the transit dose was smaller than 100 cGy, the average of the error was 1.67 ± 4.01 cGy. The error to a point near the prescription point was −14.02 cGy per 500.00 cGy of the prescription dose. Conclusion: The distances from the sources to skin of the patient generally are within 10 cm for cervix cancer cases in brachytherapy. The results of this preliminary study showed the probability of the glass dosimeter as the transit dosimeter in brachytherapy.« less

  10. COBRA-Seq: Sensitive and Quantitative Methylome Profiling

    PubMed Central

    Varinli, Hilal; Statham, Aaron L.; Clark, Susan J.; Molloy, Peter L.; Ross, Jason P.

    2015-01-01

    Combined Bisulfite Restriction Analysis (COBRA) quantifies DNA methylation at a specific locus. It does so via digestion of PCR amplicons produced from bisulfite-treated DNA, using a restriction enzyme that contains a cytosine within its recognition sequence, such as TaqI. Here, we introduce COBRA-seq, a genome wide reduced methylome method that requires minimal DNA input (0.1–1.0 μg) and can either use PCR or linear amplification to amplify the sequencing library. Variants of COBRA-seq can be used to explore CpG-depleted as well as CpG-rich regions in vertebrate DNA. The choice of enzyme influences enrichment for specific genomic features, such as CpG-rich promoters and CpG islands, or enrichment for less CpG dense regions such as enhancers. COBRA-seq coupled with linear amplification has the additional advantage of reduced PCR bias by producing full length fragments at high abundance. Unlike other reduced representative methylome methods, COBRA-seq has great flexibility in the choice of enzyme and can be multiplexed and tuned, to reduce sequencing costs and to interrogate different numbers of sites. Moreover, COBRA-seq is applicable to non-model organisms without the reference genome and compatible with the investigation of non-CpG methylation by using restriction enzymes containing CpA, CpT, and CpC in their recognition site. PMID:26512698

  11. The epigenetic landscape of oral squamous cell carcinoma

    PubMed Central

    Jithesh, P V; Risk, J M; Schache, A G; Dhanda, J; Lane, B; Liloglou, T; Shaw, R J

    2013-01-01

    Background: There is relatively little methylation array data available specifically for oral squamous cell carcinoma (OSCC). This study aims to compare the DNA methylome across a large cohort of tumour/normal pairs. Methods: DNA was extracted from 44 OSCCs and paired normal mucosa. DNA methylation analysis employed the Illumina GoldenGate high-throughput array comprising 1505 CpG loci selected from 807 epigenetically regulated genes. This data was correlated with extracapsular spread (ECS), human papilloma virus (HPV) status, recurrence and 5-year survival. Results: Differential methylation levels of a number of genes distinguished the tumour tissue sample from the matched normal. Putative methylation signatures for ECS and recurrence were identified. The concept of concordant methylation or CpG island methylator phenotype (CIMP) in OSCC is supported by our data, with an association between ‘CIMP-high' and worse prognosis. Epigenetic deregulation of NOTCH4 signalling in OSCC was also observed, as part of a possible methylation signature for recurrence, with parallels to recently discovered NOTCH mutations in HNSCC. Differences in methylation in HPV-driven cases were seen, but are less significant than that has been recently proposed in other series. Conclusion: Although OSCC seems as much an ‘epigenetic' as a genetic disease, the translational potential of cancer epigenetics has yet to be fully exploited. This data points to the application of epigenetic biomarkers and targets available to further the development of therapy in OSCC. PMID:23287992

  12. Aberrant DNA methylation of miR-219 promoter in long-term night shiftworkers.

    PubMed

    Shi, Fengqin; Chen, Xinyi; Fu, Alan; Hansen, Johnni; Stevens, Richard; Tjonneland, Anne; Vogel, Ulla B; Zheng, Tongzhang; Zhu, Yong

    2013-07-01

    The idea that shiftwork may be carcinogenic in humans has gained widespread attention since the pioneering work linking shiftwork to breast cancer over two decades ago. However, the biomolecular consequences of long-term shiftwork exposure have not been fully explored. In this study, we performed a genome-wide CpG island methylation assay of microRNA (miRNA) promoters in long-term night shiftworkers and day workers. This analysis indicated that 50 CpG loci corresponding to 31 miRNAs were differentially methylated in night shiftworkers compared to day workers, including the circadian-relevant miR-219, the expression of which has been implicated in several cancers. A genome-wide expression microarray assay was carried out in a miR-219-overexpressed MCF-7 breast cancer cell line, which identified 319 differentially expressed transcripts. The identified transcriptional targets were analyzed for network and functional interrelatedness using the Ingenuity Pathway Analysis (IPA) software. Overexpression of miR-219 in MCF-7 breast cancer cells resulted in accentuated expression of apoptosis- and proliferation-related anti-viral immunodulators of the Jak-STAT and NF-κβ pathways. These findings suggest that long-term night shiftwork exposure may lead to the methylation-dependent downregulation of miR-219, which may in turn lead to the downregulation of immunomediated antitumor activity and increased breast cancer risk. © 2013 Wiley Periodicals, Inc.

  13. Galactic Cosmic Radiation Induces Persistent Epigenome Alterations Relevant to Human Lung Cancer.

    PubMed

    Kennedy, E M; Powell, D R; Li, Z; Bell, J S K; Barwick, B G; Feng, H; McCrary, M R; Dwivedi, B; Kowalski, J; Dynan, W S; Conneely, K N; Vertino, P M

    2018-04-30

    Human deep space and planetary travel is limited by uncertainties regarding the health risks associated with exposure to galactic cosmic radiation (GCR), and in particular the high linear energy transfer (LET), heavy ion component. Here we assessed the impact of two high-LET ions 56 Fe and 28 Si, and low-LET X rays on genome-wide methylation patterns in human bronchial epithelial cells. We found that all three radiation types induced rapid and stable changes in DNA methylation but at distinct subsets of CpG sites affecting different chromatin compartments. The 56 Fe ions induced mostly hypermethylation, and primarily affected sites in open chromatin regions including enhancers, promoters and the edges ("shores") of CpG islands. The 28 Si ion-exposure had mixed effects, inducing both hyper and hypomethylation and affecting sites in more repressed heterochromatic environments, whereas X rays induced mostly hypomethylation, primarily at sites in gene bodies and intergenic regions. Significantly, the methylation status of 56 Fe ion sensitive sites, but not those affected by X ray or 28 Si ions, discriminated tumor from normal tissue for human lung adenocarcinomas and squamous cell carcinomas. Thus, high-LET radiation exposure leaves a lasting imprint on the epigenome, and affects sites relevant to human lung cancer. These methylation signatures may prove useful in monitoring the cumulative biological impact and associated cancer risks encountered by astronauts in deep space.

  14. A CpG Oligonucleotide Can Protect Mice from a Low Aerosol Challenge Dose of Burkholderia mallei

    PubMed Central

    Waag, David M.; McCluskie, Michael J.; Zhang, Ningli; Krieg, Arthur M.

    2006-01-01

    Treatment with an oligodeoxynucleotide (ODN) containing CPG motifs (CpG ODN 7909) was found to protect BALB/c mice from lung infection or death after aerosol challenge with Burkholderia mallei. Protection was associated with enhanced levels of gamma interferon (IFN-γ)-inducible protein 10, interleukin-12 (IL-12), IFN-γ, and IL-6. Preexposure therapy with CpG ODNs may protect victims of a biological attack from glanders. PMID:16495571

  15. A CpG oligonucleotide can protect mice from a low aerosol challenge dose of Burkholderia mallei.

    PubMed

    Waag, David M; McCluskie, Michael J; Zhang, Ningli; Krieg, Arthur M

    2006-03-01

    Treatment with an oligodeoxynucleotide (ODN) containing CPG motifs (CpG ODN 7909) was found to protect BALB/c mice from lung infection or death after aerosol challenge with Burkholderia mallei. Protection was associated with enhanced levels of gamma interferon (IFN-gamma)-inducible protein 10, interleukin-12 (IL-12), IFN-gamma, and IL-6. Preexposure therapy with CpG ODNs may protect victims of a biological attack from glanders.

  16. Lack of chart reminder effectiveness on family medicine resident JNC-VI and NCEP III guideline knowledge and attitudes.

    PubMed

    Echlin, Paul S; Upshur, Ross E G; Markova, Tsveti P

    2004-07-05

    The literature demonstrates that medical residents and practicing physicians have an attitudinal-behavioral discordance concerning their positive attitudes towards clinical practice guidelines (CPG), and the implementation of these guidelines into clinical practice patterns. A pilot study was performed to determine if change in a previously identified CPG compliance factor (accessibility) would produce a significant increase in family medicine resident knowledge and attitude toward the guidelines. The primary study intervention involved placing a summary of the Sixth Report of the Joint National Committee on Prevention, Detection, Evaluation, and Treatment of High Blood Pressure (JNC VI) and the National Cholesterol Education Program Expert Panel on Detection, Evaluation, and Treatment of High Blood Cholesterol in Adults (NCEP III) CPGs in all patient (>18 yr.) charts for a period of three months. The JNC VI and NCEP III CPGs were also distributed to each Wayne State family medicine resident, and a copy of each CPG was placed in the preceptor's area of the involved clinics. Identical pre- and post- intervention questionnaires were administered to all residents concerning CPG knowledge and attitude. Post-intervention analysis failed to demonstrate a significant difference in CPG knowledge. A statistically significant post-intervention difference was found in only on attitude question. The barriers to CPG compliance were identified as 1) lack of CPG instruction; 2) lack of critical appraisal ability; 3) insufficient time; 4) lack of CPG accessibility; and 5) lack of faculty modeling. This study demonstrated no significant post intervention changes in CPG knowledge, and only one question that reflected attitude change. Wider resident access to dedicated clinic time, increased faculty modeling, and the implementation of an electronic record/reminder system that uses a team-based approach are compliance factors that should be considered for further investigation. The interpretation of CPG non-compliance will benefit from a causal matrix focused on physician knowledge, attitudes, and behavior. Recent findings in resident knowledge-behavior discordance may direct the future investigation of physician CPG non-compliance away from generalized barrier research, and toward the development of information that maximizes the sense of individual practitioner urgency and certainty.

  17. SU-F-T-448: Use of Mixed Photon Energy Beam in Volumetric Modulated Arc Therapy (VMAT) Treatment Plan for Prostate Cancer

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Manigandan, D; Kumar, M; Mohandas, P

    Purpose: To study the impact of different photon beam combination during VMAT planning and treatment delivery. Methods: Five prostate patients with no nodal involvement were chosen for the study and only prostate was considered as target (7920cGy/44fractions). In each case, three different VMAT plans were generated with two arcs (200°–160°&160°–200°). First plan used only 6MV in both arcs (6X-6X) and second utilized 6MV&15MV (6X-15X), whereas third one used 15MV&15MV (15X-15X). For consistency, all the plans were generated by the same planner using Monaco− treatment planning system (V5.1) for Elekta Synergy− linear accelerator with 1cm leaf-width. For plan comparison, target meanmore » dose, conformity index (CI)=Planning target volume (PTV) covered by 95% of prescription dose/PTV were analyzed. Mean doses of bladder, rectum, left femur and right femur were analyzed. Integral dose (liter-Gray) to normal tissue (patient volume minus PTV), total monitor unit (MU) required to deliver a plan and gamma pass rate for each plan was analyzed. Results: The CI for PTV was 0.9937±0.0037, 0.9917±0.0033, and 0.9897±0.0048 for 6X-6X, 6X-15X and 15X-15X, respectively. Mean dose to target slightly increases with the decrease of energy. Mean doses to bladder were 3546.23±692.13cGy, 3487.43±715.53cGy and 3504.40±683.1cGy for 6X-6X, 6X-15X and 15X-15X, respectively. Mean doses to rectum were 4294.60±309.5cGy, 4277.07±279.93cGy and 4290.77±379.07cGy. Mean doses to left femur were 2737.13±545.93cGy, 2668.67±407.12cGy and 2416.77±300.73cGy and mean doses to the right femur were 2682.70±460.81cGy, 2722.58±541.92cGy and 2598.57±481.83cGy. Higher Integral doses to normal tissue observed for 6X-6X (163.06±24.6 Litre-Gray) followed by 6X-15X (154.35±24.74 Litre-Gray) and 15X-15X (145.84±26.03 Litre-Gray). Average MU required to deliver one fraction was 680.75±72.09, 634.81±95.07 and 605.06±114.65. Gamma pass rates were 99.83±0.21, 99.53±0.27 and 99.2±0.20. Conclusion: 6X-15X VMAT plan offer dosimetric advantage compared to 6X-6X in terms of lesser MU and integral dose without significant compromise in plan quality, where as in 15X-15X, neutron contamination risk is relatively higher.« less

  18. Clinical practice guideline for Sjögren's syndrome 2017.

    PubMed

    Sumida, Takayuki; Azuma, Naoto; Moriyama, Masafumi; Takahashi, Hiroyuki; Asashima, Hiromitsu; Honda, Fumika; Abe, Saori; Ono, Yuko; Hirota, Tomoya; Hirata, Shintaro; Tanaka, Yoshiya; Shimizu, Toshimasa; Nakamura, Hideki; Kawakami, Atsushi; Sano, Hajime; Ogawa, Yoko; Tsubota, Kazuo; Ryo, Koufuchi; Saito, Ichiro; Tanaka, Akihiko; Nakamura, Seiji; Takamura, Etsuko; Tanaka, Masao; Suzuki, Katsuya; Takeuchi, Tsutomu; Yamakawa, Noriyuki; Mimori, Tsuneyo; Ohta, Akiko; Nishiyama, Susumu; Yoshihara, Toshio; Suzuki, Yasunori; Kawano, Mitsuhiro; Tomiita, Minako; Tsuboi, Hiroto

    2018-05-01

    The objective of this study is to develop clinical practice guideline (CPG) for Sjögren's syndrome (SS) based on recently available clinical and therapeutic evidences. The CPG committee for SS was organized by the Research Team for Autoimmune Diseases, Research Program for Intractable Disease of the Ministry of Health, Labor and Welfare (MHLW), Japan. The committee completed a systematic review of evidences for several clinical questions and developed CPG for SS 2017 according to the procedure proposed by the Medical Information Network Distribution Service (Minds). The recommendations and their strength were checked by the modified Delphi method. The CPG for SS 2017 has been officially approved by both Japan College of Rheumatology and the Japanese Society for SS. The CPG committee set 38 clinical questions for clinical symptoms, signs, treatment, and management of SS in pediatric, adult and pregnant patients, using the PICO (P: patients, problem, population, I: interventions, C: comparisons, controls, comparators, O: outcomes) format. A summary of evidence, development of recommendation, recommendation, and strength for these 38 clinical questions are presented in the CPG. The CPG for SS 2017 should contribute to improvement and standardization of diagnosis and treatment of SS.

  19. Substantial reduction in hospital stay of children and adolescents with diabetic ketoacidosis after implementation of Clinical Practice Guidelines in a university hospital in Saudi Arabia.

    PubMed

    Al Nemri, Abdulrahman; Amer, Yasser Sami; Gasim, Hala; Osman, Mohamed Elfaki; Aleyadhy, Ayman; Al Otaibi, Hessah; Iqbal, Shaikh Mohammed; Aljurayyan, Nasir Abdullah; Assiri, Asaad M; Babiker, Amir; Mohamed, Sarar

    2017-02-01

    We aimed to determine the effect of Clinical Practice Guideline (CPG) implementation on length of hospital stay of children and adolescents with diabetic ketoacidosis (DKA). This was a 6-year (2008-2014) case-control retrospective study conducted at King Khalid University Hospital, Riyadh, that compared patients with DKA managed using CPG with those treated before CPG implementation. There were 63 episodes of DKA in 41 patients managed using CPG compared with 40 episodes in 33 patients treated before implementation of CPG. Baseline characteristics of the 2 groups were similar (age, sex, newly diagnosed patients, recurrent DKA, DKA severity, and mean glycosylated hemoglobin). The mean length of hospital stay (±SD) was 68.6 ± 53.1 hours after implementation of CPG compared with 107.4 ± 65.6 hours before implementation (P < .001). The reduction in length of hospital stay equals to 1700 bed days saved per year per 1000 patients. Implementation of CPG for DKA decreased the length of hospital stay. © 2016 John Wiley & Sons, Ltd.

  20. Newly identified CpG ODNs, M5-30 and M6-395, stimulate mouse immune cells to secrete TNF-alpha and enhance Th1-mediated immunity.

    PubMed

    Choi, Sun-Shim; Chung, Eunkyung; Jung, Yu-Jin

    2010-08-01

    Bacterial CpG motifs are known to induce both innate and adaptive immunity in infected hosts via toll-like receptor 9 (TLR9). Because small oligonucleotides (ODNs) mimicking bacterial CpG motifs are easily synthesized, they have found use as immunomodulatory agents in a number of disease models. We have developed a novel bioinformatics approach to identify effective CpG ODN sequences and evaluate their function as TLR9 ligands in a murine system. Among the CpG ODNs we identified, M5-30 and M6-395 showed significant ability to stimulate TNF-alpha and IFN-gamma production in a mouse macrophage cell line and mouse splenocytes, respectively. We also found that these CpG ODNs activated cells through the canonical NF-kappa B signaling pathway. Moreover, both CpG ODNs were able to induce Th1-mediated immunity in Mycobacterium tuberculosis (Mtb)-infected mice. Our results demonstrate that M5-30 and M6-395 function as TLR9-specific ligands, making them useful in the study of TLR9 functionality and signaling in mice.

  1. Calculating Clinically Significant Change: Applications of the Clinical Global Impressions (CGI) Scale to Evaluate Client Outcomes in Private Practice

    ERIC Educational Resources Information Center

    Kelly, Peter James

    2010-01-01

    The Clinical Global Impressions (CGI) scale is a therapist-rated measure of client outcome that has been widely used within the research literature. The current study aimed to develop reliable and clinically significant change indices for the CGI, and to demonstrate its application in private psychological practice. Following the guidelines…

  2. The simple neuroendocrine-immune regulatory network in oyster Crassostrea gigas mediates complex functions.

    PubMed

    Liu, Zhaoqun; Wang, Lingling; Zhou, Zhi; Sun, Ying; Wang, Mengqiang; Wang, Hao; Hou, Zhanhui; Gao, Dahai; Gao, Qiang; Song, Linsheng

    2016-05-19

    The neuroendocrine-immune (NEI) regulatory network is a complex system, which plays an indispensable role in the immunity of the host. In the present study, the bioinformatical analysis of the transcriptomic data from oyster Crassostrea gigas and further biological validation revealed that oyster TNF (CgTNF-1 CGI_10018786) could activate the transcription factors NF-κB and HSF (heat shock transcription factor) through MAPK signaling pathway, and then regulate apoptosis, redox reaction, neuro-regulation and protein folding in oyster haemocytes. The activated immune cells then released neurotransmitters including acetylcholine, norepinephrine and [Met(5)]-enkephalin to regulate the immune response by arising the expression of three TNF (CGI_10005109, CGI_10005110 and CGI_10006440) and translocating two NF-κB (Cgp65, CGI_10018142 and CgRel, CGI_10021567) between the cytoplasm and nuclei of haemocytes. Neurotransmitters exhibited the immunomodulation effects by influencing apoptosis and phagocytosis of oyster haemocytes. Acetylcholine and norepinephrine could down-regulate the immune response, while [Met(5)]-enkephalin up-regulate the immune response. These results suggested that the simple neuroendocrine-immune regulatory network in oyster might be activated by oyster TNF and then regulate the immune response by virtue of neurotransmitters, cytokines and transcription factors.

  3. The simple neuroendocrine-immune regulatory network in oyster Crassostrea gigas mediates complex functions

    NASA Astrophysics Data System (ADS)

    Liu, Zhaoqun; Wang, Lingling; Zhou, Zhi; Sun, Ying; Wang, Mengqiang; Wang, Hao; Hou, Zhanhui; Gao, Dahai; Gao, Qiang; Song, Linsheng

    2016-05-01

    The neuroendocrine-immune (NEI) regulatory network is a complex system, which plays an indispensable role in the immunity of the host. In the present study, the bioinformatical analysis of the transcriptomic data from oyster Crassostrea gigas and further biological validation revealed that oyster TNF (CgTNF-1 CGI_10018786) could activate the transcription factors NF-κB and HSF (heat shock transcription factor) through MAPK signaling pathway, and then regulate apoptosis, redox reaction, neuro-regulation and protein folding in oyster haemocytes. The activated immune cells then released neurotransmitters including acetylcholine, norepinephrine and [Met5]-enkephalin to regulate the immune response by arising the expression of three TNF (CGI_10005109, CGI_10005110 and CGI_10006440) and translocating two NF-κB (Cgp65, CGI_10018142 and CgRel, CGI_10021567) between the cytoplasm and nuclei of haemocytes. Neurotransmitters exhibited the immunomodulation effects by influencing apoptosis and phagocytosis of oyster haemocytes. Acetylcholine and norepinephrine could down-regulate the immune response, while [Met5]-enkephalin up-regulate the immune response. These results suggested that the simple neuroendocrine-immune regulatory network in oyster might be activated by oyster TNF and then regulate the immune response by virtue of neurotransmitters, cytokines and transcription factors.

  4. [Web Visit Patterns for the Clinical Practice Guidelines for Management of Depressive Disorder and Alcohol Abuse-Dependence].

    PubMed

    Suárez-Obando, Fernando; Restrepo, Carlos Gómez

    Clinical practice guidelines (CPG) are a set of recommendations for professionals, patients, and families, in order to make decisions about health care. The CPG respond to the need for concise, accurate, practical, and up to date information. In the field of mental health, Colombia has developed three GPC; alcohol (GPC-OH), depression (GPC-TDA), and schizophrenia. To describe the Web Portal traffic related to psychiatry guidelines, with emphasis on the number of visits, distribution throughout Colombian cities, and estimating user behaviour patterns. An evaluation was made of the traffic at the Clinical Practice Guidelines Web Portal of the Ministry of Health and Social Protection between 2013 and 2015 (two years of observation since the inauguration of the Portal). Out of the 45 GPC published on the website, the CPG-OH represented 1.21% of all page views of the Portal. CPG-TDA reached 1.52% (accumulated percentage of 2.73%), being the eighth most consulted guideline, with CPG-OH being number 16. The highest mean monthly number of visits for this group of guideliness was for the CPG-OH for health professionals (353 visits/month), and the lowest was for the CPG-AD for patients and relatives (24 single visits/month). Bogotá D.C. was the city where health carers accessed the guidelines more often. The guidelines for patients and relatives were consulted more in Villavicencio, Cúcuta, Manizales, Pereira, and Pasto. The web portal partially fulfills the purpose of circulating the CPG in Colombia. The visits to the CPG of mental health is quite low, and requires better dissemination strategies that allow the use of information and communication technology. Copyright © 2016 Asociación Colombiana de Psiquiatría. Publicado por Elsevier España. All rights reserved.

  5. Intratumoral delivery of CpG-conjugated anti-MUC1 antibody enhances NK cell anti-tumor activity.

    PubMed

    Schettini, Jorge; Kidiyoor, Amritha; Besmer, Dahlia M; Tinder, Teresa L; Roy, Lopamudra Das; Lustgarten, Joseph; Gendler, Sandra J; Mukherjee, Pinku

    2012-11-01

    Monoclonal antibodies (mAbs) against tumor-associated antigens are useful anticancer agents. Antibody-dependent cellular cytotoxicity (ADCC) is one of the major mechanisms responsible for initiating natural killer cell (NK)-mediated killing of tumors. However, the regulation of ADCC via NK cells is poorly understood. We have investigated the cytolytic activity of NK cells against pancreatic cancer cells that were coated with an antibody directed against the human tumor antigen, Mucin-1 designated HMFG-2, either alone or conjugated to CpG oligodeoxynucleotide (CpG ODN). Conjugated antibodies were tested for their ability to elicit ADCC in vitro and in vivo against pancreatic cancer cells. NK cells cultured in the presence of immobilized CpG ODN, HMFG-2 Ab, or CpG ODN-conjugated HMFG-2 Ab were able to up-regulate perforin similarly. Interestingly, a significant higher ADCC was observed when CpG ODN-conjugated HMFG-2-coated tumor cells were co-cultured with NK cells compared to unconjugated HMFG-2 Ab or CpG ODN alone. Moreover, MyD88-deficient NK cells can perform ADCC in vitro. Furthermore, intratumoral injections of CpG ODN-conjugated HMFG-2 induced a significant reduction in tumor burden in vivo in an established model of pancreatic tumor in nude mice compared to CpG ODN or the HMFG-2 alone. Depletion of macrophages or NK cells before treatment confirmed that both cells were required for the anti-tumor response in vivo. Results also suggest that CpG ODN and HMFG-2 Ab could be sensed by NK cells on the mAb-coated tumor cells triggering enhanced ADCC in vitro and in vivo.

  6. Intratumoral delivery of CpG-conjugated anti-MUC1 antibody enhances NK cell anti-tumor activity

    PubMed Central

    Schettini, Jorge; Kidiyoor, Amritha; Besmer, Dahlia M.; Tinder, Teresa L.; Roy, Lopamudra Das; Lustgarten, Joseph; Gendler, Sandra J.

    2013-01-01

    Monoclonal antibodies (mAbs) against tumor-associated antigens are useful anticancer agents. Antibody-dependent cellular cytotoxicity (ADCC) is one of the major mechanisms responsible for initiating natural killer cell (NK)-mediated killing of tumors. However, the regulation of ADCC via NK cells is poorly understood. We have investigated the cytolytic activity of NK cells against pancreatic cancer cells that were coated with an antibody directed against the human tumor antigen, Mucin-1 designated HMFG-2, either alone or conjugated to CpG oligodeoxynucleotide (CpG ODN). Conjugated antibodies were tested for their ability to elicit ADCC in vitro and in vivo against pancreatic cancer cells. NK cells cultured in the presence of immobilized CpG ODN, HMFG-2 Ab, or CpG ODN-conjugated HMFG-2 Ab were able to up-regulate perforin similarly. Interestingly, a significant higher ADCC was observed when CpG ODN-conjugated HMFG-2-coated tumor cells were co-cultured with NK cells compared to unconjugated HMFG-2 Ab or CpG ODN alone. Moreover, MyD88-deficient NK cells can perform ADCC in vitro. Furthermore, intratumoral injections of CpG ODN-conjugated HMFG-2 induced a significant reduction in tumor burden in vivo in an established model of pancreatic tumor in nude mice compared to CpG ODN or the HMFG-2 alone. Depletion of macrophages or NK cells before treatment confirmed that both cells were required for the anti-tumor response in vivo. Results also suggest that CpG ODN and HMFG-2 Ab could be sensed by NK cells on the mAb-coated tumor cells triggering enhanced ADCC in vitro and in vivo. PMID:22543528

  7. Cytosine-phosphate-guanine oligodeoxynucleotides containing GACGTT motifs enhance the immune responses elicited by keyhole limpet hemocyanin antigen in dairy cattle.

    PubMed

    Chu, Chun-Yen; Lee, Shang-Chun; Liu, Shyh-Shyan; Lin, Yu-Ming; Shen, Perng-Chi; Yu, Chi; Lee, Kuo-Hua; Zhao, Xin; Lee, Jai-Wei

    2011-10-01

    Adjuvants are important components of vaccine formulations. Effective adjuvants line innate and adaptive immunity by signaling through pathogen recognition receptors. Synthetic cytosine-phosphate-guanine (CpG) oligodeoxynucleotides (ODNs) have been shown to have potentials as adjuvants for vaccines. However, the immunostimulatory effect of CpG is species-specific and depends on the sequence of CpG motifs. A CpG ODN (2135), containing 3 identical copies of GTCGTT motif, was previously reported to have the strongest effects on bovine peripheral blood mononuclear cells (PBMC). Based on the sequence of 2135, we replaced the GTCGTT motif with 11 other sequences containing CG and investigated their effects on bovine lymphocyte proliferation. Results showed that the CpG ODNs containing 3 copies of GACGTT motif had the highest lymphocyte stimulation index (7.91±1.18), which was significantly (P<0.05) higher than that of 2135 (4.25±0.56). The CpG ODNs containing 3 copies of GACGTT motif also significantly increased the mRNA expression of interferon (IFN)-α, interleukin (IL)-12, and IL-21 in bovine PBMC. When dairy cows were immunized with the keyhole limpet hemocyanin (KLH) antigen formulated with CpG ODNs containing 3 copies of GACGTT, production of KLH-specific antibodies in serum and in milk whey was significantly (P<0.05) enhanced. IFN-γ in whole blood stimulated by KLH was also significantly (P<0.05) increased in cows immunized with KLH plus CpG ODNs. Our results indicate that CpG ODNs containing 3 copies of the GACGTT motifs is a potential adjuvant for bovine vaccines.

  8. Assessing the efficacy of Duddingtonia flagrans chlamydospores per gram of faeces to control Haemonchus contortus larvae.

    PubMed

    Ojeda-Robertos, Nadia Florencia; Torres-Acosta, Juan Felipe de Jesus; Aguilar-Caballero, Armando Jacinto; Ayala-Burgos, Armín; Cob-Galera, Ligia Amira; Sandoval-Castro, Carlos Alfredo; Barrientos-Medina, Roberto Carlos; de Gives, Pedro Mendoza

    2008-12-20

    The aims were (a) to quantify the number of Duddingtonia flagrans chlamydospores per gram of faeces (CPG) recovered from sheep administered with different oral doses and, (b) to describe the relationship between CPG and eggs per gram of faeces (EPG) on the efficacy to reduce Haemonchus contortus infective larvae. Three doses of chlamydospores per kg BW were orally administered during seven days: (T1) non treated control group, (T2) 1 x 10(6), (T3) 2.5 x 10(6) and (T4) 5 x 10(6). Three lambs, infected with H. contortus, were used per group. Faeces were obtained from the rectum of each lamb during the fungal administration period (days 0-6) and for six days after that period. Four coproculture replicates were made from each animal in days 2, 4, 6, 8 and 10. A higher chlamydospore dose produced higher CPG in faeces (p < 0.05), but a clear dose dependent effect was not found either in the larvae reduction or in the CPG:EPG ratio. When ratios were re-analyzed, independently of the treatment groups of origin, a better efficacy was obtained with a ratio from 5 to 10 CPG:EPG and a higher ratio (> 10 per egg) showed a lower reduction efficacy (p < 0.05). The binomial analysis showed that for each unit of increment in CPG:EPG ratio there was a reduction of larvae number until a point (between 5 and 10 CPG:EPG) where no further reduction was detected. The surface response test indicated that the number of larvae was reduced by CPG until possible saturation. The highest CPG:EPG ratios did not necessarily improve efficacy of D. flagrans.

  9. Prevention of hypothyroidism related to mantle irradiation for Hodgkin's disease: Preparative phantom study

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Marcial-Vega, V.A.; Order, S.E.; Lastner, G.

    1990-03-01

    To decrease the incidence of hypothyroidism related to mantle irradiation for Hodgkin's disease, we initiated a study designed to protect the thyroid gland using a phantom. A thyroid phantom was filled with technetium-99m. The thyroid phantom was placed inside of its corresponding anterior neck position in a whole body phantom. An anterior scintiscan of the head and neck region demonstrated the radioactivity in the simulated thyroid. A mantle port included a focused block that would shield the thyroid from the anterior port. The phantom was exposed (4 MeV) to 180 cGy (AP-PA) at midplane with lithium fluoride dosimeters in themore » position of the thyroid. The thyroid received an average of 12 cGy from the anterior field and 48 cGy from the posterior field for a total of 60 cGy per treatment or 30% of the prescribed dose. A complete mantle field course of radiation of 4000 cGy would lead to a thyroid dose of 1200 cGy at a daily fractional dose of 60 cGy. We elected not to block the thyroid from the posterior field to prevent shielding and potential underdosage of involved nodal sites. The present study suggests a method of safe and effective thyroid shielding which needs to be tested clinically to determine whether it would reduce the incidence of chemical and clinical hypothyroidism or simply extend the period until occurrence.« less

  10. Interaction of DRD4 Methylation and Phthalate Metabolites Affects Continuous Performance Test Performance in ADHD.

    PubMed

    Kim, Johanna Inhyang; Kim, Jae-Won; Shin, Inkyung; Kim, Bung-Nyun

    2018-05-01

    We investigated the interaction effect between the methylation of dopamine receptor D4 (DRD4) and phthalate exposure in ADHD on continuous performance test (CPT) variables. Urine concentrations of mono-(2-ethyl-5-hydroxyhexyl) phthalate (MEHHP), mono-(2-ethyl-5-oxohexyl) phthalate (MEOHP), and mono-n-butyl phthalate (MBP) were tested. The methylation status was analyzed for CpG sites of DRD4. Multivariable linear regression models were applied to investigate the interaction effects of methylation and phthalate levels. There was a significant interaction effect of the methylation of CpG26 and CpG28 with the MEHHP level on omission errors in ADHD patients, but not in controls. The post hoc analysis revealed a significant correlation between the MEHHP concentration and omission errors in the methylated group, but not in the unmethylated group. The interaction between the methylation status of CpG sites of DRD4, particularly CpG26 and CpG28, and phthalate metabolite levels affects the attention level in ADHD patients.

  11. Characterization of Immune Responses to an Inactivated Avian Influenza Virus Vaccine Adjuvanted with Nanoparticles Containing CpG ODN.

    PubMed

    Singh, Shirene M; Alkie, Tamiru N; Abdelaziz, Khaled Taha; Hodgins, Douglas C; Novy, Anastasia; Nagy, Éva; Sharif, Shayan

    2016-06-01

    Avian influenza virus (AIV), a mucosal pathogen, gains entry into host chickens through respiratory and gastrointestinal routes. Most commercial AIV vaccines for poultry consist of inactivated, whole virus with adjuvant, delivered by parenteral administration. Recent advances in vaccine development have led to the application of nanoparticle emulsion delivery systems, such as poly (d,l-lactic-co-glycolic acid) (PLGA) nanoparticles to enhance antigen-specific immune responses. In chickens, the Toll-like receptor 21 ligand, CpG oligodeoxynucleotides (ODNs), have been demonstrated to be immunostimulatory. The objective of this study was to compare the adjuvant potential of CpG ODN 2007 encapsulated in PLGA nanoparticles with nonencapsulated CpG ODN 2007 when combined with a formalin-inactivated H9N2 virus, through intramuscular and aerosol delivery routes. Chickens were vaccinated at days 7 and 21 posthatch for the intramuscular route and at days 7, 21, and 35 for the aerosol route. Antibody-mediated responses were evaluated weekly in sera and lacrimal secretions in specific pathogen-free chickens. The results indicate that nonencapsulated CpG ODN 2007 in inactivated AIV vaccines administered by the intramuscular route generated higher antibody responses compared to the encapsulated CpG ODN 2007 formulation by the same route. Additionally, encapsulated CpG ODN 2007 in AIV vaccines administered by the aerosol route elicited higher mucosal responses compared to nonencapsulated CpG ODN 2007. Future studies may be aimed at evaluating protective immune responses induced with PLGA encapsulation of AIV and adjuvants.

  12. A cross-study analysis of prenatal exposures to environmental contaminants and the epigenome: support for stress-responsive transcription factor occupancy as a mediator of gene-specific CpG methylation patterning

    PubMed Central

    Martin, Elizabeth M.; Fry, Rebecca C.

    2016-01-01

    Abstract A biological mechanism by which exposure to environmental contaminants results in gene-specific CpG methylation patterning is currently unknown. We hypothesize that gene-specific CpG methylation is related to environmentally perturbed transcription factor occupancy. To test this hypothesis, a database of 396 genes with altered CpG methylation either in cord blood leukocytes or placental tissue was compiled from 14 studies representing assessments of six environmental contaminants. Subsequently, an in silico approach was used to identify transcription factor binding sites enriched among the genes with altered CpG methylation in relationship to the suite of environmental contaminants. For each study, the sequences of the promoter regions (representing −1000 to +500 bp from the transcription start site) of all genes with altered CpG methylation were analyzed for enrichment of transcription factor binding sites. Binding sites for a total of 56 unique transcription factors were identified to be enriched within the promoter regions of the genes. Binding sites for the Kidney-Enriched Krupple-like Factor 15, a known responder to endogenous stress, were enriched ( P  < 0.001–0.041) among the genes with altered CpG methylation associated for five of the six environmental contaminants. These data support the transcription factor occupancy theory as a potential mechanism underlying environmentally-induced gene-specific CpG methylation. PMID:27066266

  13. High speed turning of compacted graphite iron using controlled modulation

    NASA Astrophysics Data System (ADS)

    Stalbaum, Tyler Paul

    Compacted graphite iron (CGI) is a material which emerged as a candidate material to replace cast iron (CI) in the automotive industry for engine block castings. Its thermal and mechanical properties allow the CGI-based engines to operate at higher cylinder pressures and temperatures than CI-based engines, allowing for lower fuel emissions and increased fuel economy. However, these same properties together with the thermomechanical wear mode in the CGI-CBN system result in poor machinability and inhibit CGI from seeing wide spread use in the automotive industry. In industry, machining of CGI is done only at low speeds, less than V = 200 m/min, to avoid encountering rapid wear of the cutting tools during cutting. Studies have suggested intermittent cutting operations such as milling suffer less severe tool wear than continuous cutting. Furthermore, evidence that a hard sulfide layer which forms over the cutting edge in machining CI at high speeds is absent during machining CGI is a major factor in the difference in machinability of these material systems. The present study addresses both of these issues by modification to the conventional machining process to allow intermittent continuous cutting. The application of controlled modulation superimposed onto the cutting process -- modulation-assisted machining (MAM) -- is shown to be quite effective in reducing the wear of cubic boron nitride (CBN) tools when machining CGI at high machining speeds (> 500 m/min). The tool life is at least 20 times greater than found in conventional machining of CGI. This significant reduction in wear is a consequence of reduction in the severity of the tool-work contact conditions with MAM. The propensity for thermochemical wear of CBN is thus reduced. It is found that higher cutting speed (> 700 m/min) leads to lower tool wear with MAM. The MAM configuration employing feed-direction modulation appears feasible for implementation at high speeds and offers a solution to this challenging class of industrial machining applications. This study's approach is by series of high speed turning tests of CGI with CBN tools, comparing conventional machining to MAM for similar parameters otherwise, by tool wear measurements and machinability observations.

  14. Categorical improvements in disease severity in patients with major depressive disorder treated with vilazodone: post hoc analysis of four randomized, placebo-controlled trials.

    PubMed

    Durgam, Suresh; Chen, Changzheng; Gommoll, Carl P; Edwards, John; Citrome, Leslie

    2016-01-01

    In three 8-week studies of vilazodone 40 mg/d (NCT00285376, NCT00683592, and NCT01473394) and a 10-week study of vilazodone 20 or 40 mg/d (NCT01473381), adults with major depressive disorder (MDD) showed significantly greater improvement with vilazodone versus placebo in global disease severity as measured by mean change from baseline in Clinical Global Impression of Severity (CGI-S) score. To assess the proportion of patients achieving clinically meaningful improvement, a post hoc pooled analysis was conducted using categorical shifts in disease severity based on CGI-S scores at baseline and end of treatment (EOT). Analyses were conducted in the pooled intent-to-treat population (N=2,218). Definitions of categorical shifts included CGI-S ≥4 (moderately ill or worse) at baseline to CGI-S ≤2 (normal or borderline ill) at EOT; CGI-S ≥5 (markedly ill or worse) at baseline to CGI-S ≤2 at EOT; and CGI-S ≥6 (severely ill or worse) at baseline to CGI-S ≤3 (mildly ill or better) at EOT. At baseline, 2,217 patients were moderately ill or worse. The percentage who improved to normal or borderline ill was significantly higher with vilazodone than with placebo (40.0% versus 27.8%; odds ratio [OR] =1.7, P <0.001; number needed to treat [NNT] =9). In the 979 patients who were markedly ill or worse at baseline, the percentage who improved to normal or borderline ill was significantly higher with vilazodone than with placebo (36.8% versus 25.5%; OR =1.7, P <0.001; NNT =9). The small number of severely ill patients at baseline (n =43) provided inadequate power to detect statistically significant between-group differences, but an NNT =5 was found for improvement to mildly ill or better. Categorical shift analyses, defined using baseline and EOT CGI-S scores, showed that significantly higher proportions of patients had clinically meaningful improvements in global disease severity with vilazodone 20-40 mg/d versus placebo. This type of analysis may be useful for evaluating the effects of antidepressant treatment in adults with MDD.

  15. See Also:physica status solidi (a)physica status solidi (c)Copyright © 2004 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

  16. Get Sample Copy
  17. Recommend to Your Librarian
  18. E-MailPrint
  1. CpG oligodeoxynucleotides augment the murine immune response to the Yersinia pestis F1-V vaccine in bubonic and pneumonic models of plague.

    PubMed

    Amemiya, Kei; Meyers, Jennifer L; Rogers, Taralyn E; Fast, Randy L; Bassett, Anthony D; Worsham, Patricia L; Powell, Bradford S; Norris, Sarah L; Krieg, Arthur M; Adamovicz, Jeffrey J

    2009-04-06

    The current U.S. Department of Defense candidate plague vaccine is a fusion between two Yersinia pestis proteins: the F1 capsular protein, and the low calcium response (Lcr) V-protein. We hypothesized that an immunomodulator, such as CpG oligodeoxynucleotide (ODN)s, could augment the immune response to the plague F1-V vaccine in a mouse model for plague. CpG ODNs significantly augmented the antibody response and efficacy of a single dose of the plague vaccine in murine bubonic and pneumonic models of plague. In the latter study, we also found an overall significant augmentation the immune response to the individual subunits of the plague vaccine by CpG ODN 2006. In a long-term, prime-boost study, CpG ODN induced a significant early augmentation of the IgG response to the vaccine. The presence of CpG ODN induced a significant increase in the IgG2a subclass response to the vaccine up to 5 months after the boost. Our studies showed that CpG ODNs significantly augmented the IgG antibody response to the plague vaccine, which increased the probability of survival in murine models of plague (P<0.0001).

  2. High-resolution computational ghost imaging and ghost diffraction through turbulence via a beam-shaping method

    NASA Astrophysics Data System (ADS)

    Luo, Chun-Ling; Zhuo, Ling-Qing

    2017-01-01

    Imaging through atmospheric turbulence is a topic with a long history and grand challenges still exist in the remote sensing and astro observation fields. In this letter, we try to propose a simple scheme to improve the resolution of imaging through turbulence based on the computational ghost imaging (CGI) and computational ghost diffraction (CGD) setup via the laser beam shaping techniques. A unified theory of CGI and CGD through turbulence with the multi-Gaussian shaped incoherent source is developed, and numerical examples are given to see clearly the effects of the system parameters to CGI and CGD. Our results show that the atmospheric effect to the CGI and CGD system is closely related to the propagation distance between the source and the object. In addition, by properly increasing the beam order of the multi-Gaussian source, we can improve the resolution of CGI and CGD through turbulence relative to the commonly used Gaussian source. Therefore our results may find applications in remote sensing and astro observation.

  3. Role of Ovarian Transposition Based on the Dosimetric Effects of Craniospinal Irradiation on the Ovaries: A Case Report

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mitchell, James D.; Hitchen, Christine; Vlachaki, Maria T.

    2007-10-01

    In this study, we present a case of laparoscopic ovarian transposition to preserve ovarian function in an adult female patient treated with craniospinal irradiation for standard risk medulloblastoma. The prescribed dose to the craniospinal axis was 2340 cGy at 180 cGy per fraction and was delivered with 6-MV photons. Before ovarian transposition, magnetic resonance imaging (MRI) of the pelvis was obtained for localization of the ovaries and was registered with the planning computed tomography (CT) scan. Surgical clips allowed for CT localization of the ovaries after transposition. As a result of ovarian transposition, mean and maximum radiation doses decreased frommore » 983 to 68 cGy and 1624 to 84 cGy for the left ovary and from 166 to 87 cGy and 723 to 103 cGy for the right ovary, respectively. Review of the literature indicates that such radiation doses are below the threshold that causes ovarian dysfunction and infertility. We conclude that ovarian localization with an MRI of the pelvis can be offered to females undergoing craniospinal irradiation. Transposition of the ovaries provides an option to preserve ovarian function in cases where the ovaries would otherwise be included within the radiation field.« less

  4. A SoxC gene related to larval shell development and co-expression analysis of different shell formation genes in early larvae of oyster.

    PubMed

    Liu, Gang; Huan, Pin; Liu, Baozhong

    2017-06-01

    Among the potential larval shell formation genes in mollusks, most are expressed in cells surrounding the shell field during the early phase of shell formation. The only exception (cgi-tyr1) is expressed in the whole larval mantle and thus represents a novel type of expression pattern. This study reports another gene with such an expression pattern. The gene encoded a SoxC homolog of the Pacific oyster Crassostrea gigas and was named cgi-soxc. Whole-mount in situ hybridization revealed that the gene was highly expressed in the whole larval mantle of early larvae. Based on its spatiotemporal expression, cgi-soxc is hypothesized to be involved in periostracum biogenesis, biomineralization, and regulation of cell proliferation. Furthermore, we investigated the interrelationship between cgi-soxc expression and two additional potential shell formation genes, cgi-tyr1 and cgi-gata2/3. The results confirmed co-expression of the three genes in the larval mantle of early D-veliger. Nevertheless, cgi-gata2/3 was only expressed in the mantle edge, and the other two genes were expressed in all mantle cells. Based on the spatial expression patterns of the three genes, two cell groups were identified from the larval mantle (tyr1 + /soxc + /gata2/3 + cells and tyr1 + /soxc + /gata2/3 - cells) and are important to study the differentiation and function of this tissue. The results of this study enrich our knowledge on the structure and function of larval mantle and provide important information to understand the molecular mechanisms of larval shell formation.

  5. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Santoro, J; Witten, M; Haas, J

    Purpose: Brachytherapy has been the standard of care for cervical cancer for 100 years. The treatment can be administered using an HDR (high dose rate) remote afterloader with a {sup 192}Ir source in an outpatient setting, a PDR afterloader with a {sup 192}Ir source, or with LDR manually loaded or a remote afterloader utilizing {sup 192}Ir or {sup 137}Cs sources in an inpatient setting. The procedure involves the placement of a tandem and ovoid, tandem and ring, or tandem and cylinder applicator in an operating room setting with the patient under general anesthesia. Inaccuracies introduced into the process occurring betweenmore » placement of the applicator and actual delivery can introduce uncertainty into the actual dose delivered to the tumor and critical organs. In this study we seek to investigate the dosimetric difference between an SBRT-based radiotherapy boost and conventional Brachytherapy in treating cervical cancer. Methods: Five HDR tandem and ovoid patients were planned using the Brachyvision treatment planning system and treated in four fractions using the Varian Varisource afterloader (Varian Medical Systems). For the same cohort, the patient planning CTs were imported into Multiplan (Accuray Inc) and a dose/fractionation-equivalent CyberKnife SBRT plan was retrospectively generated. Dosimetric quantities such as target/CTV D90, V90, D2cc for rectum, bladder, and bowel were measured and compared between the two modalities. Results: The CTV D90 for the tandem and ovoid was 2540cGy (90.7%) and 3009cGy (107.5%) for the CyberKnife plan. The D2cc for the rectum, bladder, and bowel were 1576cGy, 1641cGy, and 996cGy for the tandem and ovoid and 1374cGy, 1564cGy, and 1547cGy for CyberKnife. Conclusion: The D2cc doses to critical structures are comparable in both modalities. The CTV coverage is far superior for the CyberKnife plan. The dose distribution for CyberKnife has the advantage of increased conformality and lower maximum CTV dose.« less

  6. Leveraging workflow control patterns in the domain of clinical practice guidelines.

    PubMed

    Kaiser, Katharina; Marcos, Mar

    2016-02-10

    Clinical practice guidelines (CPGs) include recommendations describing appropriate care for the management of patients with a specific clinical condition. A number of representation languages have been developed to support executable CPGs, with associated authoring/editing tools. Even with tool assistance, authoring of CPG models is a labor-intensive task. We aim at facilitating the early stages of CPG modeling task. In this context, we propose to support the authoring of CPG models based on a set of suitable procedural patterns described in an implementation-independent notation that can be then semi-automatically transformed into one of the alternative executable CPG languages. We have started with the workflow control patterns which have been identified in the fields of workflow systems and business process management. We have analyzed the suitability of these patterns by means of a qualitative analysis of CPG texts. Following our analysis we have implemented a selection of workflow patterns in the Asbru and PROforma CPG languages. As implementation-independent notation for the description of patterns we have chosen BPMN 2.0. Finally, we have developed XSLT transformations to convert the BPMN 2.0 version of the patterns into the Asbru and PROforma languages. We showed that although a significant number of workflow control patterns are suitable to describe CPG procedural knowledge, not all of them are applicable in the context of CPGs due to their focus on single-patient care. Moreover, CPGs may require additional patterns not included in the set of workflow control patterns. We also showed that nearly all the CPG-suitable patterns can be conveniently implemented in the Asbru and PROforma languages. Finally, we demonstrated that individual patterns can be semi-automatically transformed from a process specification in BPMN 2.0 to executable implementations in these languages. We propose a pattern and transformation-based approach for the development of CPG models. Such an approach can form the basis of a valid framework for the authoring of CPG models. The identification of adequate patterns and the implementation of transformations to convert patterns from a process specification into different executable implementations are the first necessary steps for our approach.

  7. SU-E-T-365: Dosimetric Impact of Dental Amalgam CT Image Artifacts On IMRT and VMAT Head and Neck Plans

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cao, N; Young, L; Parvathaneni, U

    Purpose: The presence of high density dental amalgam in patient CT image data sets causes dose calculation errors for head and neck (HN) treatment planning. This study assesses and compares dosimetric variations in IMRT and VMAT treatment plans due to dental artifacts. Methods: Sixteen HN patients with similar treatment sites (oropharynx), tumor volume and extensive dental artifacts were divided into two groups: IMRT (n=8, 6 to 9 beams) and VMAT (n=8, 2 arcs with 352° rotation). All cases were planned with the Pinnacle 9.2 treatment planning software using the collapsed cone convolution superposition algorithm and a range of prescription dosemore » from 60 to 72Gy. Two different treatment plans were produced, each based on one of two image sets: (a)uncorrected; (b)dental artifacts density overridden (set to 1.0g/cm{sup 3}). Differences between the two treatment plans for each of the IMRT and VMAT techniques were quantified by the following dosimetric parameters: maximum point dose, maximum spinal cord and brainstem dose, mean left and right parotid dose, and PTV coverage (V95%Rx). Average differences generated for these dosimetric parameters were compared between IMRT and VMAT plans. Results: The average absolute dose differences (plan a minus plan b) for the VMAT and IMRT techniques, respectively, caused by dental artifacts were: 2.2±3.3cGy vs. 37.6±57.5cGy (maximum point dose, P=0.15); 1.2±0.9cGy vs. 7.9±6.7cGy (maximum spinal cord dose, P=0.026); 2.2±2.4cGy vs. 12.1±13.0cGy (maximum brainstem dose, P=0.077); 0.9±1.1cGy vs. 4.1±3.5cGy (mean left parotid dose, P=0.038); 0.9±0.8cGy vs. 7.8±11.9cGy (mean right parotid dose, P=0.136); 0.021%±0.014% vs. 0.803%±1.44% (PTV coverage, P=0.17). Conclusion: For the HN plans studied, dental artifacts demonstrated a greater dose calculation error for IMRT plans compared to VMAT plans. Rotational arcs appear on the average to compensate dose calculation errors induced by dental artifacts. Thus, compared to VMAT, density overrides for dental artifacts are more important when planning IMRT of HN.« less

  8. Molecular Classification and Correlates in Colorectal Cancer

    PubMed Central

    Ogino, Shuji; Goel, Ajay

    2008-01-01

    Molecular classification of colorectal cancer is evolving. As our understanding of colorectal carcinogenesis improves, we are incorporating new knowledge into the classification system. In particular, global genomic status [microsatellite instability (MSI) status and chromosomal instability (CIN) status] and epigenomic status [CpG island methylator phenotype (CIMP) status] play a significant role in determining clinical, pathological and biological characteristics of colorectal cancer. In this review, we discuss molecular classification and molecular correlates based on MSI status and CIMP status in colorectal cancer. Studying molecular correlates is important in cancer research because it can 1) provide clues to pathogenesis, 2) propose or support the existence of a new molecular subtype, 3) alert investigators to be aware of potential confounding factors in association studies, and 4) suggest surrogate markers in clinical or research settings. PMID:18165277

  9. Spreadsheet-based program for alignment of overlapping DNA sequences.

    PubMed

    Anbazhagan, R; Gabrielson, E

    1999-06-01

    Molecular biology laboratories frequently face the challenge of aligning small overlapping DNA sequences derived from a long DNA segment. Here, we present a short program that can be used to adapt Excel spreadsheets as a tool for aligning DNA sequences, regardless of their orientation. The program runs on any Windows or Macintosh operating system computer with Excel 97 or Excel 98. The program is available for use as an Excel file, which can be downloaded from the BioTechniques Web site. Upon execution, the program opens a specially designed customized workbook and is capable of identifying overlapping regions between two sequence fragments and displaying the sequence alignment. It also performs a number of specialized functions such as recognition of restriction enzyme cutting sites and CpG island mapping without costly specialized software.

  10. Understanding the relationship between DNA methylation and histone lysine methylation☆

    PubMed Central

    Rose, Nathan R.; Klose, Robert J.

    2014-01-01

    DNA methylation acts as an epigenetic modification in vertebrate DNA. Recently it has become clear that the DNA and histone lysine methylation systems are highly interrelated and rely mechanistically on each other for normal chromatin function in vivo. Here we examine some of the functional links between these systems, with a particular focus on several recent discoveries suggesting how lysine methylation may help to target DNA methylation during development, and vice versa. In addition, the emerging role of non-methylated DNA found in CpG islands in defining histone lysine methylation profiles at gene regulatory elements will be discussed in the context of gene regulation. This article is part of a Special Issue entitled: Methylation: A Multifaceted Modification — looking at transcription and beyond. PMID:24560929

  11. In ovo CpG DNA delivery increases innate and adaptive immune cells in respiratory, gastrointestinal and immune systems post-hatch correlating with lower infectious laryngotracheitis virus infection.

    PubMed

    Abdul-Cader, Mohamed Sarjoon; Amarasinghe, Aruna; Palomino-Tapia, Victor; Ahmed-Hassan, Hanaa; Bakhtawar, Khawaja; Nagy, Eva; Sharif, Shayan; Gomis, Susantha; Abdul-Careem, Mohamed Faizal

    2018-01-01

    Cytosine-guanosine deoxynucleotides (CpG) DNA can be delivered in ovo at embryo day (ED)18 for the stimulation of toll-like receptor (TLR)21 signaling pathway that ultimately protects chickens against a number of bacterial and viral infections. There is a dearth of information understanding the mechanisms of protection induced by in ovo delivered CpG DNA. The objective of this study was to determine the immune cell changes post-hatch following in ovo delivery of the TLR21 ligand, CpG DNA. In order to quantify changes of percentage of KUL01+, IgM+ B, cluster of differentiation (CD)4+ and CD8α+ cells, trachea, lung, duodenum, large intestine, spleen and bursa of Fabricius were collected on day 1 post-hatch. We found increased recruitments of KUL01+ cells, in organs of these body systems post-hatch following in ovo delivery of CpG DNA. Although IgM+ B cells, CD4+ and CD8α+ cells were increased in lungs and immune system organs, these cells were not quantifiable from the trachea, duodenum and large intestine immediately following the hatch. Furthermore, when CpG DNA is delivered in ovo and subsequently infected with infectious laryngotracheitis virus (ILTV) post-hatch on day 1, CpG DNA reduces morbidity and mortality resulting from ILTV infection. This study provides insights into the mechanisms of host responses elicited following in ovo delivery of CpG DNA in avian species.

  12. Rolling Thunder -- Integration of the Solo 161 Stirling engine with the CPG-460 solar concentrator at Ft. Huachuca

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Diver, R.B.; Moss, T.A.; Goldberg, V.

    Project Rolling Thunder is a dish/Stirling demonstration project at Ft. Huachuca, a US Army fort in southeastern Arizona (Huachuca means rolling thunder in Apache). It has been supported by the Strategic Environmental Research and Development Program (SERDP), a cooperative program between the Department of Defense (DoD) and the Department of Energy (DOE). As part of a 1992 SERDP project, Cummins Power Generation, Inc. (CPG) installed a CPG 7 kW(c) dish/Stirling system at the Joint Interoperability Test Command (JITC) in Ft. Huachuca, Arizona. The primary objective of the SERDP Dish/Stirling for DoD Applications project was to demonstrate a CPG 7-kW(c) dish/Stirlingmore » system at a military facility. Unfortunately, Cummins Engine Company decided to divest its solar operations. As a direct result of Ft. Huachuca`s interest in the Cummins dish/Stirling technology, Sandia explored the possibility of installing a SOLO 161 Stirling power conversion unit (PCU) on the Ft. Huachuca CPG-460. In January 1997, a decision was made to retrofit a SOLO 161 Stirling engine on the CPG-460 at Ft. Huachuca. Project Rolling Thunder. The SOLO 161 Demonstration at Ft. Huachuca has been a challenge. Although, the SOLO 161 PCU has operated nearly flawlessly and the CPG-460 has been, for the most part, a solid and reliable component, integration of the SOLO PCU with the CPG-460 has required significant attention. In this paper, the integration issues and technical approaches of project Rolling Thunder are presented. Lessons of the project are also discussed.« less

  13. Guideline-Driven Care Improves Outcomes in Patients with Traumatic Rib Fractures.

    PubMed

    Flarity, Kathleen; Rhodes, Whitney C; Berson, Andrew J; Leininger, Brian E; Reckard, Paul E; Riley, Keyan D; Shahan, Charles P; Schroeppel, Thomas J

    2017-09-01

    There is no established national standard for rib fracture management. A clinical practice guideline (CPG) for rib fractures, including monitoring of pulmonary function, early initiation of aggressive loco-regional analgesia, and early identification of deteriorating respiratory function, was implemented in 2013. The objective of the study was to evaluate the effect of the CPG on hospital length of stay. Hospital length of stay (LOS) was compared for adult patients admitted to the hospital with rib fracture(s) two years before and two years after CPG implementation. A separate analysis was done for the patients admitted to the intensive care unit (ICU). Over the 48-month study period, 571 patients met inclusion criteria for the study. Pre-CPG and CPG study groups were well matched with few differences. Multivariable regression did not demonstrate a difference in LOS (B = -0.838; P = 0.095) in the total study cohort. In the ICU cohort (n = 274), patients in the CPG group were older (57 vs 52 years; P = 0.023) and had more rib fractures (4 vs 3; P = 0.003). Multivariable regression identified a significant decrease in LOS for those patients admitted in the CPG period (B = -2.29; P = 0.019). Despite being significantly older with more rib fractures in the ICU cohort, patients admitted after implementation of the CPG had a significantly reduced LOS on multivariable analysis, reducing LOS by over two days. This structured intervention can limit narcotic usage, improve pulmonary function, and decrease LOS in the most injured patients with chest trauma.

  14. Energetic study of cardioplegic hearts under ischaemia/reperfusion and [Ca(2+)] changes in cardiomyocytes of guinea-pig: mitochondrial role.

    PubMed

    Ragone, M I; Torres, N S; Consolini, A E

    2013-02-01

    To study the role of mitochondria in the recovery of guinea-pig hearts exposed to high-K(+)-cardioplegia (CPG) and ischaemia/reperfusion (I/R) METHODS: We measured contractility and heat release in perfused guinea-pig hearts and cytosolic and mitochondrial Ca(2+) by epifluorescence and confocal microscopy in isolated cardiomyocytes loaded with Fluo-4 or Rhod-2. In hearts, CPG increased the postischaemic contractile recovery, and this was potentiated by the mNCX blocker clonazepam and the mKATP opener diazoxide, which also prevented the fall in muscle economy. Moreover, CPG prevented the stunning induced by ouabain, which was reduced by clonazepam. In cardiomyocytes, CPG increased fluorescent signals of cytosolic and mitochondrial Ca(2+), while the addition of a mNCX blocker (CGP37157) increased cytosolic but reduced mitochondrial [Ca(2+)]. Ouabain in CPG increased cytosolic Ca(2+) and resting heat, but the addition of CGP37157 reduced them, as well as mitochondrial Ca(2+). CPG, diazoxide and clonazepam improve postischaemic recovery, respectively, by increasing the Ca(2+) cycling and by reducing the mitochondrial Ca(2+) uptake either by uniporter or by mNCX. The mitochondria compete with the leaky sarcoplasmic reticulum (SR) as sink of Ca(2+) in guinea-pig hearts, affecting the postischaemic contractility. CPG also prevented the ouabain-induced dysfunction by avoiding the Ca(2+) overload. Ouabain reduced the synergism between CPG and clonazepam suggesting that [Na(+)]i and SR load influence the mNCX role. © 2012 The Authors Acta Physiologica © 2012 Scandinavian Physiological Society.

  15. Oxidative Stress and Skeletal Health with Low-Dose, Low-LET (Linear Energy Transfer) Ionizing Radiation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Globus, Ruth K.

    We performed in vivo and in vitro experiments to accomplish the following specific aims of this project: 1) determine if low dose, low LET radiation affects skeletal remodeling at structural, cellular and molecular levels and 2) determine if low dose, low LET radiation modulates skeletal health during aging via oxidative mechanisms. A third aim is supported by NASA supplement to this DOE grant focusing on the influence of high LET radiation on bone. A series of experiments were conducted at the NASA Space Radiation Laboratory at Brookhaven, NSRL-BNL, using iron (56Fe) or a sequential exposure to protons / iron /more » protons, and separate experiments at NASA Ames Research Center (ARC) using 137Cs. The following provides a summary of key findings. (1) Exposure of nine-week old female mice to priming doses of gamma radiation (10cGy x 5) did not significantly affect bone volume/total volume (BV/TV) or microarchitecture as analyzed by 3D microcomputed tomography. As expected, exposure to the challenge dose of 2 Gy gamma irradiation resulted in significant decreases in BV/TV. The priming dose combined with the 2Gy challenge dose had no further effect on BV/TV compared to challenge dose alone, with the sole exception of the Structural Model Index (SMI). SMI reflects the ratio of rods-to-plates in cancellous bone tissue, such that higher SMI values indicate a tendency toward a weaker structure compared to lower SMI values. Mice treated with both priming and challenge dose had 25% higher SMI values compared to sham-irradiated controls and 7% higher values compared to mice treated with the challenge dose alone. Thus, although this priming regimen had relatively modest effects on cancellous tissue, the difference in SMI suggests this fractionated priming doses have adverse, rather than beneficial, effects on bone structure. (2) In 10-week old male mice, a single exposure to 100cGy of 137Cs reduces trabecular bone number and connectivity density by 20% and 36% respectively one month after irradiation (IR). At four months post-IR, these animals were comparable to sham-treated controls with regards to the abovementioned structural parameters. Irradation at 1 or 10 cGy did not result in any significant changes in bone structural parameters. (3) Irradiation of 16-wk old male mice with high doses of 56Fe or proton (50 or 200cGy), but not at low doses (5 or 10cGy), showed a similar loss of cancellous BV/TV and trabecular number at five weeks post-IR. (4) Age-related bone loss overtook acute radiation-induced decrements in bone structure within four months post-IR with 100 cGy gamma and 12 months post-IR with 200 cGy iron. Transgenic mice globally overexpressing human catalase gene in mitochondria did not exhibit cancellous bone loss as assessed at four month post-IR with 10 cGy proton, 50 cGy iron, or in combination. (5) The cellular and molecular mechanisms responsible for loss of bone with radiation are mediated primarily through increased osteoclastogenesis. Our data provide evidence that there are increases in gene expression of TNF alpha and MCP1 in the bone marrow cells 24 hours post-IR and of osteoclastogenic differentiation factor RANKL by day 3. These cytokines in the marrow may stimulate mature osteoclasts or drive osteoclastogenesis from precursors. (6) Osteoblastogenesis from marrow progenitors evaluated ex vivo decreased following whole body 56Fe irradiation at a dose threshold between 20 and 50 cGy whereas osteoclastogenesis ex vivo increased with doses as low as 10cGy two days post-IR of mice. However, the latter finding was not observed in more than a single experiment. (7) Gamma irradiation of cells in vitro requires relatively high doses (200cGy) to disturb normal osteoblastogenesis and osteoclastogenesis as evidenced by decrements in mineralized nodule formation, osteoclast counts, and expression of osteoblast related genes such as runx2, col1a1. (8) We also investigated the effect of antioxidants on osteoblastogenesis following low dose in vitro gamma irradiation (15cGy) on day four bone marrow stromal cell cultures. Superoxide dismutase (SOD) was added to the cell culture medium for 2 or 3 days post-irradiation and cell colonies were counted on days 7 and 10. SOD treatment increased cell growth as measured by DNA content and colony forming units (CFU) in both irradiated cells and 0 cGy control groups. However, low dose radiation of 15cGy abolished SOD stimulatory effects on cell growth and CFU number. These results suggest that exogenous SOD increases osteoblast cell growth and colony formation and that low-dose radiation (15cGy) can interfere with the antioxidant effects. In summary, our findings indicate that acute, whole body irradiation at high doses (50-200 cGy) results in prompt tissue degradation and bone loss. Lower doses (<50 cGy) do not cause bone structural deterioration but may deplete stem/progenitor cell pools in the bone marrow.« less

  16. 75 FR 60761 - Government-Owned Inventions; Availability for Licensing

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-10-01

    ... cells conjugated to a K-type CpG oligodeoxynucleotide (ODN) to a subject. Methods for treating a tumor... therapeutically effective amount of apoptotic tumor cells conjugated to a K-type CpG oligodeoxynucleotide (ODN) to... the prevention of cancer and other indications Use of CpG oligonucleotides for prophylaxis and/or...

  17. 78 FR 46594 - Prospective Grant of Start-up Exclusive License: Topical Antibiotic With Immune Stimulating...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-08-01

    ... Speed Wound Healing; and Use of CpG Oligodeoxynucleotides To Induce Epithelial Cell Growth AGENCY... CpG Oligodeoxynucleotides to Induce Epithelial Cell Growth'' to Tollgene having a place of business... 37 CFR part 404. These technologies relate to relate to use of CpG oligodeoxynucleotides (ODNs) to...

  18. Promoter methylation assay of SASH1 gene in breast cancer.

    PubMed

    Sheyu, Lin; Hui, Liu; Junyu, Zhang; Jiawei, Xu; Honglian, Wang; Qing, Sang; Hengwei, Zhang; Xuhui, Guo; Qinghe, Xing; Lin, He

    2013-01-01

    To analyze the relationship between the expression of SASH1 and its methylation level of SASH1 gene promoter in human breast cancer. Expression levels of SASH1 were examined in breast cancer tissues and adjacent normal tissues with immunohistochemistry and with real time PCR (RT-PCR) methylation analysis was performed with MassArray. Immunohistochemistry showed that SASH1 expression was strongly reduced in breast cancer compared with adjacent normal tissues. Quantitative methylation analysis by MassArray revealed that CpG sites in SASH1 promoter shared similar methylation pattern in tumor tissue and adjacent normal tissue. The CpG sites with significant difference in methylation level were CpG_26.27 and CpG_54.55. Moreover, 5-aza-2'-deoxycytidine (5-Aza-dc) treatment of tumor cell line MDA-MB-231 caused significant elevation of SASH1 mRNA. Based on these data, we propose that increase of DNA methylation level in the promoter region of gene SASH1, particularly CpG_26.27 or CpG_54.55 sites, possibly repressed SASH1 expression in breast cancer.

  19. The Use of Chlorhexidine/n-Propyl Gallate (CPG) as an Ambient-Temperature Urine Preservative

    NASA Technical Reports Server (NTRS)

    Nillen, Jeannie L.; Smith, Scott M.

    2003-01-01

    A safe, effective ambient temperature urine preservative, chlorhexidine/n-propyl gallate (CPG), has been formulated for use during spacefli ght that reduces the effects of oxidation and bacterial contamination on sample integrity while maintaining urine pH. The ability of this preservative to maintain stability of nine key analytes was evaluated for a period of one year. CPG effectively maintained stability of a mmonia, total nitrogen, 3-methylhistidine, chloride, sodium, potassiu m, and urea; however, creatinine and osmolality were not preserved by CPG. These data indicate that CPG offers prolonged room-temperature storage for multiple urine analytes, reducing the requirements for f rozen urine storage on future spaceflights. Iii medical applications on Earth, this technology can allow urine samples to be collected in remote settings and eliminate the need to ship frozen samples.

  20. Reinforcement learning for a biped robot based on a CPG-actor-critic method.

    PubMed

    Nakamura, Yutaka; Mori, Takeshi; Sato, Masa-aki; Ishii, Shin

    2007-08-01

    Animals' rhythmic movements, such as locomotion, are considered to be controlled by neural circuits called central pattern generators (CPGs), which generate oscillatory signals. Motivated by this biological mechanism, studies have been conducted on the rhythmic movements controlled by CPG. As an autonomous learning framework for a CPG controller, we propose in this article a reinforcement learning method we call the "CPG-actor-critic" method. This method introduces a new architecture to the actor, and its training is roughly based on a stochastic policy gradient algorithm presented recently. We apply this method to an automatic acquisition problem of control for a biped robot. Computer simulations show that training of the CPG can be successfully performed by our method, thus allowing the biped robot to not only walk stably but also adapt to environmental changes.

  1. Association between Promoter Methylation of Gene ERCC3 and Benzene Hematotoxicity.

    PubMed

    Zheng, Min; Lin, Feiliang; Hou, Fenxia; Li, Guilan; Zhu, Caiying; Xu, Peiyu; Xing, Caihong; Wang, Qianfei

    2017-08-16

    Benzene is a primary industrial chemical and a ubiquitous environmental pollutant. ERCC3 is a key player in nucleotide excision repair. Recent studies suggested that site-specific methylation is a possible mechanism of the transcriptional dysregulation by blocking transcription factors binding. We previously found that the average promoter methylation level of ERCC3 was increased in benzene-exposed workers. In order to test whether specific CpG sites of ERCC3 play an important role in benzene-induced epigenetic changes and whether the specific methylation patterns are associated with benzene hematotoxicity, we analyzed the promoter methylation levels of individual CpG sites, transcription factor binding motif and the correlation between aberrant CpG methylation and hematotoxicity in 76 benzene-exposed workers and 24 unexposed controls in China. Out of all the CpGs analyzed, two CpG units located 43 bp upstream and 99 bp downstream of the transcription start site of ERCC3 (CpG 2-4 and CpG 17-18, respectively), showed the most pronounced increase in methylation levels in benzene-exposed workers, compared with unexposed controls (Mean ± SD: 5.86 ± 2.77% vs. 4.92 ± 1.53%, p = 0.032; 8.45 ± 4.09% vs. 6.79 ± 2.50%, p = 0.024, respectively). Using the JASPAR CORE Database, we found that CpG 2-4 and CpG 17-18 were bound by three putative transcription factors (TFAP2A, E2F4 and MZF1). Furthermore, the methylation levels for CpG 2-4 were correlated negatively with the percentage of neutrophils ( β = -0.676, p = 0.005) in benzene-exposed workers. This study demonstrates that CpG-specific DNA methylation in the ERCC3 promoter region may be involved in benzene-induced epigenetic modification and it may contribute to benzene-induced hematotoxicity.

  2. Association between Promoter Methylation of Gene ERCC3 and Benzene Hematotoxicity

    PubMed Central

    Lin, Feiliang; Hou, Fenxia; Li, Guilan; Zhu, Caiying; Xu, Peiyu; Xing, Caihong; Wang, Qianfei

    2017-01-01

    Benzene is a primary industrial chemical and a ubiquitous environmental pollutant. ERCC3 is a key player in nucleotide excision repair. Recent studies suggested that site-specific methylation is a possible mechanism of the transcriptional dysregulation by blocking transcription factors binding. We previously found that the average promoter methylation level of ERCC3 was increased in benzene-exposed workers. In order to test whether specific CpG sites of ERCC3 play an important role in benzene-induced epigenetic changes and whether the specific methylation patterns are associated with benzene hematotoxicity, we analyzed the promoter methylation levels of individual CpG sites, transcription factor binding motif and the correlation between aberrant CpG methylation and hematotoxicity in 76 benzene-exposed workers and 24 unexposed controls in China. Out of all the CpGs analyzed, two CpG units located 43 bp upstream and 99 bp downstream of the transcription start site of ERCC3 (CpG 2–4 and CpG 17–18, respectively), showed the most pronounced increase in methylation levels in benzene-exposed workers, compared with unexposed controls (Mean ± SD: 5.86 ± 2.77% vs. 4.92 ± 1.53%, p = 0.032; 8.45 ± 4.09% vs. 6.79 ± 2.50%, p = 0.024, respectively). Using the JASPAR CORE Database, we found that CpG 2–4 and CpG 17–18 were bound by three putative transcription factors (TFAP2A, E2F4 and MZF1). Furthermore, the methylation levels for CpG 2–4 were correlated negatively with the percentage of neutrophils (β = −0.676, p = 0.005) in benzene-exposed workers. This study demonstrates that CpG-specific DNA methylation in the ERCC3 promoter region may be involved in benzene-induced epigenetic modification and it may contribute to benzene-induced hematotoxicity. PMID:28813025

  3. Vitamin D dose response is underestimated by Endocrine Society's Clinical Practice Guideline.

    PubMed

    McKenna, Malachi J; Murray, Barbara F

    2013-06-01

    The recommended daily intakes of vitamin D according to the recent Clinical Practice Guideline (CPG) of the Endocrine Society are three- to fivefold higher than the Institute of Medicine (IOM) report. We speculated that these differences could be explained by different mathematical approaches to the vitamin D dose response. Studies were selected if the daily dose was ≤2000 IU/day, the duration exceeded 3 months, and 25-hydroxyvitamin D (25OHD) concentrations were measured at baseline and post-therapy. The rate constant was estimated according to the CPG approach. The achieved 25OHD result was estimated according to the following: i) the regression equation approach of the IOM; ii) the regression approach of the Vitamin D Supplementation in Older Subjects (ViDOS) study; and iii) the CPG approach using a rate constant of 2.5 (CPG2.5) and a rate constant of 5.0 (CPG5.0). The difference between the expected and the observed 25OHD result was expressed as a percentage of observed and analyzed for significance against a value of 0% for the four groups. Forty-one studies were analyzed. The mean (95% CI) rate constant was 5.3 (4.4-6.2) nmol/l per 100 IU per day, on average twofold higher than the CPG rate constant. The mean (95% CI) for the difference between the expected and observed expressed as a percentage of observed was as follows: i) IOM, -7 (-16,+2)% (t=1.64, P=0.110); ii) ViDOS, +2 (-8,+12)% (t=0.40, P=0.69); iii) CPG2.5, -21 (-27,-15)% (t=7.2, P<0.0001); and iv) CPG5.0+3 (-4,+10)% (t=0.91, P=0.366). The CPG 'rule of thumb' should be doubled to 5.0 nmol/l (2.0 ng/ml) per 100 IU per day, adopting a more risk-averse position.

  4. CpG methylation patterns and decitabine treatment response in acute myeloid leukemia cells and normal hematopoietic precursors

    PubMed Central

    Negrotto, Soledad; Ng, Kwok Peng; Jankowska, Ania M.; Bodo, Juraj; Gopalan, Banu; Guinta, Kathryn; Mulloy, James C.; Hsi, Eric; Maciejewski, Jaroslaw; Saunthararajah, Yogen

    2011-01-01

    The DNA hypomethylating drug decitabine maintains normal hematopoietic stem cell (HSC) self-renewal but induces terminal differentiation in acute myeloid leukemia (AML) cells. The basis for these contrasting cell-fates, and for selective CpG hypomethylation by decitabine, is poorly understood. Promoter CpGs, with methylation measured by microarray, were classified by the direction of methylation change with normal myeloid maturation. In AML cells, the methylation pattern at maturation-responsive CpG suggested at least partial maturation. Consistent with partial maturation, in gene expression analyses, AML cells expressed high levels of the key lineage-specifying factor CEBPA, but relatively low levels of the key late-differentiation driver CEBPE. In methylation analysis by mass-spectrometry, CEBPE promoter CpG that are usually hypomethylated during granulocyte maturation were significantly hypermethylated in AML cells. Decitabine treatment induced cellular differentiation of AML cells, and the largest methylation decreases were at CpG that are hypomethylated with myeloid maturation, including CEBPE promoter CpG. In contrast, decitabine-treated normal HSC retained immature morphology, and methylation significantly decreased at CpG that are less methylated in immature cells. High expression of lineage-specifying factor and aberrant epigenetic repression of some key late-differentiation genes distinguishes AML cells from normal HSC and could explain the contrasting differentiation and methylation responses to decitabine. PMID:21836612

  5. Distinct Effects of Monophosphoryl Lipid A, Oligodeoxynucleotide CpG, and Combination Adjuvants on Modulating Innate and Adaptive Immune Responses to Influenza Vaccination

    PubMed Central

    Ko, Eun-Ju; Lee, Young-Tae; Lee, Youri; Kim, Ki-Hye

    2017-01-01

    Monophosphoryl lipid A (MPL) and oligodeoxynucleotide CpG are toll-like receptor (TLR) 4 and 9 agonist, respectively. Here, we investigated the effects of MPL, CpG, and combination adjuvants on stimulating in vitro dendritic cells (DCs), in vivo innate and adaptive immune responses, and protective efficacy of influenza vaccination. Combination of MPL and CpG was found to exhibit distinct effects on stimulating DCs in vitro to secrete IL-12p70 and tumor necrosis factor (TNF)-α and proliferate allogeneic CD8 T cells. Prime immunization of mice with inactivated split influenza vaccine in the presence of low dose MPL+CpG adjuvants increased the induction of virus-specific IgG and IgG2a isotype antibodies. MPL and CpG adjuvants contribute to improving the efficacy of prime influenza vaccination against lethal influenza challenge as determined by body weight monitoring, lung function, viral titers, and histology. A combination of MPL and CpG adjuvants was effective in improving vaccine efficacy as well as in reducing inflammatory immune responses locally and in inducing cellular immune responses upon lethal influenza virus challenge. This study demonstrates unique adjuvant effects of MPL, CpG, and combination adjuvants on modulating innate and adaptive immune responses to influenza prime vaccination. PMID:29093654

  6. Dopamine receptor D4 promoter hypermethylation increases the risk of drug addiction.

    PubMed

    Ji, Huihui; Xu, Xuting; Liu, Guili; Liu, Huifen; Wang, Qinwen; Shen, Wenwen; Li, Longhui; Xie, Xiaohu; Hu, Haochang; Xu, Lei; Zhou, Wenhua; Duan, Shiwei

    2018-02-01

    Heroin and methylamphetamine (METH) are two addictive drugs that cause serious problems for society. Dopamine receptor D4 (DRD4), a key receptor in the dopaminergic system, may facilitate the development of drug addiction. The aim of the present study was to investigate the association between the promoter methylation level of DRD4 gene and drug addiction. Bisulfite pyrosequencing technology was used to measure the methylation levels of DRD4 promoter in 60 drug addicts and 52 matched controls. Significantly higher levels of DRD4 CpG1 and CpG4 methylation were detected in METH and heroin drug addicts compared with controls (P<0.05). Male METH addicts exhibited significantly higher DRD4 CpG1, CpG2 and CpG4 methylation levels compared with sex-matched controls (P<0.05). In heroin addicts, a positive correlation was observed between depression-dejection and DRD4 CpG5 methylation (r=0.537, P=0.039) whereas there was a negative correlation between drug usage frequency and CpG1 methylation (r=-0.632, P=0.011). In METH addicts, methylation levels were not significantly associated with depression-dejection and drug usage frequency. In addition, luciferase assays demonstrated that the target sequence of the DRD4 promoter upregulates gene expression. The results of the present study suggest that DNA methylation of DRD4 may be responsible for the pathophysiology of drug addiction.

  7. Levels of DNA Methylation Vary at CpG Sites across the BRCA1 Promoter, and Differ According to Triple Negative and "BRCA-Like" Status, in Both Blood and Tumour DNA.

    PubMed

    Daniels, Sarah L; Burghel, George J; Chambers, Philip; Al-Baba, Shadi; Connley, Daniel D; Brock, Ian W; Cramp, Helen E; Dotsenko, Olena; Wilks, Octavia; Wyld, Lynda; Cross, Simon S; Cox, Angela

    2016-01-01

    Triple negative breast cancer is typically an aggressive and difficult to treat subtype. It is often associated with loss of function of the BRCA1 gene, either through mutation, loss of heterozygosity or methylation. This study aimed to measure methylation of the BRCA1 gene promoter at individual CpG sites in blood, tumour and normal breast tissue, to assess whether levels were correlated between different tissues, and with triple negative receptor status, histopathological scoring for BRCA-like features and BRCA1 protein expression. Blood DNA methylation levels were significantly correlated with tumour methylation at 9 of 11 CpG sites examined (p<0.0007). The levels of tumour DNA methylation were significantly higher in triple negative tumours, and in tumours with high BRCA-like histopathological scores (10 of 11 CpG sites; p<0.01 and p<0.007 respectively). Similar results were observed in blood DNA (6 of 11 CpG sites; p<0.03 and 7 of 11 CpG sites; p<0.02 respectively). This study provides insight into the pattern of CpG methylation across the BRCA1 promoter, and supports previous studies suggesting that tumours with BRCA1 promoter methylation have similar features to those with BRCA1 mutations, and therefore may be suitable for the same targeted therapies.

  8. See Also:physica status solidi (a)physica status solidi (c)Copyright © 2004 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

  9. Get Sample Copy
  10. Recommend to Your Librarian
  11. E-MailPrint
Top