The Genomic Impact of DNA CpG Methylation on Gene Expression; Relationships in Prostate Cancer.

PubMed

Long, Mark D; Smiraglia, Dominic J; Campbell, Moray J

2017-02-14

The process of DNA CpG methylation has been extensively investigated for over 50 years and revealed associations between changing methylation status of CpG islands and gene expression. As a result, DNA CpG methylation is implicated in the control of gene expression in developmental and homeostasis processes, as well as being a cancer-driver mechanism. The development of genome-wide technologies and sophisticated statistical analytical approaches has ushered in an era of widespread analyses, for example in the cancer arena, of the relationships between altered DNA CpG methylation, gene expression, and tumor status. The remarkable increase in the volume of such genomic data, for example, through investigators from the Cancer Genome Atlas (TCGA), has allowed dissection of the relationships between DNA CpG methylation density and distribution, gene expression, and tumor outcome. In this manner, it is now possible to test that the genome-wide correlations are measurable between changes in DNA CpG methylation and gene expression. Perhaps surprisingly is that these associations can only be detected for hundreds, but not thousands, of genes, and the direction of the correlations are both positive and negative. This, perhaps, suggests that CpG methylation events in cancer systems can act as disease drivers but the effects are possibly more restricted than suspected. Additionally, the positive and negative correlations suggest direct and indirect events and an incomplete understanding. Within the prostate cancer TCGA cohort, we examined the relationships between expression of genes that control DNA methylation, known targets of DNA methylation and tumor status. This revealed that genes that control the synthesis of S -adenosyl-l-methionine (SAM) associate with altered expression of DNA methylation targets in a subset of aggressive tumors.

Determinants of orofacial clefting I: Effects of 5-Aza-2'-deoxycytidine on cellular processes and gene expression during development of the first branchial arch.

PubMed

Mukhopadhyay, Partha; Seelan, Ratnam S; Rezzoug, Francine; Warner, Dennis R; Smolenkova, Irina A; Brock, Guy; Pisano, M Michele; Greene, Robert M

2017-01-01

In this study, we identify gene targets and cellular events mediating the teratogenic action(s) of 5-Aza-2'-deoxycytidine (AzaD), an inhibitor of DNA methylation, on secondary palate development. Exposure of pregnant mice (on gestation day (GD) 9.5) to AzaD for 12h resulted in the complete penetrance of cleft palate (CP) in fetuses. Analysis of cells of the embryonic first branchial arch (1-BA), in fetuses exposed to AzaD, revealed: 1) significant alteration in expression of genes encoding several morphogenetic factors, cell cycle inhibitors and regulators of apoptosis; 2) a decrease in cell proliferation; and, 3) an increase in apoptosis. Pyrosequencing of selected genes, displaying pronounced differential expression in AzaD-exposed 1-BAs, failed to reveal significant alterations in CpG methylation levels in their putative promoters or gene bodies. CpG methylation analysis suggested that the effects of AzaD on gene expression were likely indirect. Copyright © 2016 Elsevier Inc. All rights reserved.

Minimal doses of a sequence-optimized transgene mediate high-level and long-term EPO expression in vivo: challenging CpG-free gene design.

PubMed

Kosovac, D; Wild, J; Ludwig, C; Meissner, S; Bauer, A P; Wagner, R

2011-02-01

Advanced gene delivery techniques can be combined with rational gene design to further improve the efficiency of plasmid DNA (pDNA)-mediated transgene expression in vivo. Herein, we analyzed the influence of intragenic sequence modifications on transgene expression in vitro and in vivo using murine erythropoietin (mEPO) as a transgene model. A single electro-gene transfer of an RNA- and codon-optimized mEPOopt gene into skeletal muscle resulted in a 3- to 4-fold increase of mEPO production sustained for >1 year and triggered a significant increase in hematocrit and hemoglobin without causing adverse effects. mEPO expression and hematologic levels were significantly lower when using comparable amounts of the wild type (mEPOwt) gene and only marginal effects were induced by mEPOΔCpG lacking intragenic CpG dinucleotides, even at high pDNA amounts. Corresponding with these observations, in vitro analysis of transfected cells revealed a 2- to 3-fold increased (mEPOopt) and 50% decreased (mEPOΔCpG) erythropoietin expression compared with mEPOwt, respectively. RNA analyses demonstrated that the specific design of the transgene sequence influenced expression levels by modulating transcriptional activity and nuclear plus cytoplasmic RNA amounts rather than translation. In sum, whereas CpG depletion negatively interferes with efficient expression in postmitotic tissues, mEPOopt doses <0.5 μg were sufficient to trigger optimal long-term hematologic effects encouraging the use of sequence-optimized transgenes to further reduce effective pDNA amounts.

Newly identified CpG ODNs, M5-30 and M6-395, stimulate mouse immune cells to secrete TNF-alpha and enhance Th1-mediated immunity.

PubMed

Choi, Sun-Shim; Chung, Eunkyung; Jung, Yu-Jin

2010-08-01

Bacterial CpG motifs are known to induce both innate and adaptive immunity in infected hosts via toll-like receptor 9 (TLR9). Because small oligonucleotides (ODNs) mimicking bacterial CpG motifs are easily synthesized, they have found use as immunomodulatory agents in a number of disease models. We have developed a novel bioinformatics approach to identify effective CpG ODN sequences and evaluate their function as TLR9 ligands in a murine system. Among the CpG ODNs we identified, M5-30 and M6-395 showed significant ability to stimulate TNF-alpha and IFN-gamma production in a mouse macrophage cell line and mouse splenocytes, respectively. We also found that these CpG ODNs activated cells through the canonical NF-kappa B signaling pathway. Moreover, both CpG ODNs were able to induce Th1-mediated immunity in Mycobacterium tuberculosis (Mtb)-infected mice. Our results demonstrate that M5-30 and M6-395 function as TLR9-specific ligands, making them useful in the study of TLR9 functionality and signaling in mice.

TLR9-ERK-mTOR signaling is critical for autophagic cell death induced by CpG oligodeoxynucleotide 107 combined with irradiation in glioma cells

PubMed Central

Li, Xiaoli; Cen, Yanyan; Cai, Yongqing; Liu, Tao; Liu, Huan; Cao, Guanqun; Liu, Dan; Li, Bin; Peng, Wei; Zou, Jintao; Pang, Xueli; Zheng, Jiang; Zhou, Hong

2016-01-01

Synthetic oligodeoxynucleotides containing unmethylated CpG dinucleotides (CpG ODN) function as potential radiosensitizers for glioma treatment, although the underlying mechanism is unclear. It was observed that CpG ODN107, when combined with irradiation, did not induce apoptosis. Herein, the effect of CpG ODN107 + irradiation on autophagy and the related signaling pathways was investigated. In vitro, CpG ODN107 + irradiation induced autophagosome formation, increased the ratio of LC3 II/LC3 I, beclin 1 and decreased p62 expression in U87 cells. Meanwhile, CpG ODN107 also increased LC3 II/LC3 I expression in U251 and CHG-5 cells. In vivo, CpG ODN107 combined with local radiotherapy induced autophagosome formation in orthotopic transplantation tumor. Investigation of the molecular mechanisms demonstrated that CpG ODN107 + irradiation increased the levels of TLR9 and p-ERK, and decreased the level of p-mTOR in glioma cells. Further, TLR9-specific siRNA could affect the expressions of p-ERK and autophagy-related proteins in glioma cells. Taken together, CpG ODN107 combined with irradiation could induce autophagic cell death, and this effect was closely related to the TLR9-ERK-mTOR signaling pathway in glioma cells, providing new insights into the investigation mechanism of CpG ODN. PMID:27251306

Promoter methylation assay of SASH1 gene in breast cancer.

PubMed

Sheyu, Lin; Hui, Liu; Junyu, Zhang; Jiawei, Xu; Honglian, Wang; Qing, Sang; Hengwei, Zhang; Xuhui, Guo; Qinghe, Xing; Lin, He

2013-01-01

To analyze the relationship between the expression of SASH1 and its methylation level of SASH1 gene promoter in human breast cancer. Expression levels of SASH1 were examined in breast cancer tissues and adjacent normal tissues with immunohistochemistry and with real time PCR (RT-PCR) methylation analysis was performed with MassArray. Immunohistochemistry showed that SASH1 expression was strongly reduced in breast cancer compared with adjacent normal tissues. Quantitative methylation analysis by MassArray revealed that CpG sites in SASH1 promoter shared similar methylation pattern in tumor tissue and adjacent normal tissue. The CpG sites with significant difference in methylation level were CpG_26.27 and CpG_54.55. Moreover, 5-aza-2'-deoxycytidine (5-Aza-dc) treatment of tumor cell line MDA-MB-231 caused significant elevation of SASH1 mRNA. Based on these data, we propose that increase of DNA methylation level in the promoter region of gene SASH1, particularly CpG_26.27 or CpG_54.55 sites, possibly repressed SASH1 expression in breast cancer.

DNA methylome and transcriptome alterations and cancer prevention by curcumin in colitis-accelerated colon cancer in mice.

PubMed

Guo, Yue; Wu, Renyi; Gaspar, John M; Sargsyan, Davit; Su, Zheng-Yuan; Zhang, Chengyue; Gao, Linbo; Cheng, David; Li, Wenji; Wang, Chao; Yin, Ran; Fang, Mingzhu; Verzi, Michael P; Hart, Ronald P; Kong, Ah-Ng

2018-05-03

Inflammation is highly associated with colon carcinogenesis. Epigenetic mechanisms could play an important role in the initiation and progression of colon cancer. Curcumin, a dietary phytochemical, shows promising effects in suppressing colitis-associated colon cancer in azoxymethane-dextran sulfate sodium (AOM-DSS) mice. However, the potential epigenetic mechanisms of curcumin in colon cancer remain unknown. In this study, the anticancer effect of curcumin in suppressing colon cancer in an 18-week AOM-DSS colon cancer mouse model was confirmed. We identified lists of differentially expressed and differentially methylated genes in pairwise comparisons and several pathways involved in the potential anticancer effect of curcumin. These pathways include LPS/IL-1-mediated inhibition of RXR function, Nrf2-mediated oxidative stress response, production of NO and ROS in macrophages and IL-6 signaling. Among these genes, Tnf stood out with decreased DNA CpG methylation of Tnf in the AOM-DSS group and reversal of the AOM-DSS induced Tnf demethylation by curcumin. These observations in Tnf methylation correlated with increased and decreased Tnf expression in RNA-seq. The functional role of DNA methylation of Tnf was further confirmed by in vitro luciferase transcriptional activity assay. In addition, the DNA methylation level in a group of inflammatory genes was decreased in the AOM+DSS group but restored by curcumin and was validated by pyrosequencing. This study shows for the first time epigenomic changes in DNA CpG methylation in the inflammatory response from colitis-associated colon cancer and the reversal of their CpG methylation changes by curcumin. Future clinical epigenetic studies with curcumin in inflammation-associated colon cancer would be warranted.

Parvovirus B19 DNA CpG Dinucleotide Methylation and Epigenetic Regulation of Viral Expression

PubMed Central

Bonvicini, Francesca; Manaresi, Elisabetta; Di Furio, Francesca; De Falco, Luisa; Gallinella, Giorgio

2012-01-01

CpG DNA methylation is one of the main epigenetic modifications playing a role in the control of gene expression. For DNA viruses whose genome has the ability to integrate in the host genome or to maintain as a latent episome, a correlation has been found between the extent of DNA methylation and viral quiescence. No information is available for Parvovirus B19, a human pathogenic virus, which is capable of both lytic and persistent infections. Within Parvovirus B19 genome, the inverted terminal regions display all the characteristic signatures of a genomic CpG island; therefore we hypothesised a role of CpG dinucleotide methylation in the regulation of viral genome expression. The analysis of CpG dinucleotide methylation of Parvovirus B19 DNA was carried out by an aptly designed quantitative real-time PCR assay on bisulfite-modified DNA. The effects of CpG methylation on the regulation of viral genome expression were first investigated by transfection of either unmethylated or in vitro methylated viral DNA in a model cell line, showing that methylation of viral DNA was correlated to lower expression levels of the viral genome. Then, in the course of in vitro infections in different cellular environments, it was observed that absence of viral expression and genome replication were both correlated to increasing levels of CpG methylation of viral DNA. Finally, the presence of CpG methylation was documented in viral DNA present in bioptic samples, indicating the occurrence and a possible role of this epigenetic modification in the course of natural infections. The presence of an epigenetic level of regulation of viral genome expression, possibly correlated to the silencing of the viral genome and contributing to the maintenance of the virus in tissues, can be relevant to the balance and outcome of the different types of infection associated to Parvovirus B19. PMID:22413013

Oxytocin Receptor Genetic and Epigenetic Variations: Association With Child Abuse and Adult Psychiatric Symptoms.

PubMed

Smearman, Erica L; Almli, Lynn M; Conneely, Karen N; Brody, Gene H; Sales, Jessica M; Bradley, Bekh; Ressler, Kerry J; Smith, Alicia K

2016-01-01

Childhood abuse can alter biological systems and increase risk for adult psychopathology. Epigenetic mechanisms, alterations in DNA structure that regulate the gene expression, are a potential mechanism underlying this risk. While abuse associates with methylation of certain genes, particularly those in the stress response system, no study to date has evaluated abuse and methylation of the oxytocin receptor (OXTR). However, studies support a role for OXTR in the link between abuse and adverse adult outcomes, showing that abuse can confer greater risk for psychiatric symptoms in those with specific OXTR genotypes. This study therefore sought to (a) assess the role of epigenetics in the link between abuse and psychopathology and (b) begin to integrate the genetic and epigenetic literature by exploring associations between OXTR genotypes and DNA CpG methylation. Data on 18 OXTR CpG sites, 44 single nucleotide polymorphisms, childhood abuse, and adult depression and anxiety symptoms were assessed in 393 African American adults (age = 41 ± 12.8 years). Overall, 68% of genotypes were associated with methylation of nearby CpG sites, with a subset surviving multiple test correction. Child abuse associated with higher methylation of two CpG sites yet did not survive correction or serve as a mediator of psychopathology. However, abuse interacted with CpG methylation to predict psychopathology. These findings suggest a role for OXTR in understanding the influence of early environments on adult psychiatric symptoms. © 2016 The Authors. Child Development © 2016 Society for Research in Child Development, Inc.

Identification and expression analysis of cobia (Rachycentron canadum) Toll-like receptor 9 gene.

PubMed

Byadgi, Omkar; Puteri, Dinda; Lee, Yan-Horn; Lee, Jai-Wei; Cheng, Ta-Chih

2014-02-01

Cobia culture is hindered by bacterial infection (Photobacterium damselae subsp. piscicida) and in order to study the effect of P. damselae subsp. piscicida challenge and CpG ODN stimulation on cobia Toll like receptor 9 (RCTLR9), we used PCR to clone RCTLR9 gene and qRT-PCR to quantify gene expression. The results indicated that RCTLR9 cDNA contains 3141 bp. It encodes 1047 amino acids containing 16 typical structures of leucine-rich repeats (LRRs) including an LRRTYP, LRRCT and a motif involved in PAMP binding was identified at position 240-253 amino acid. Broad expression of RCTLR9 was found in larval, juvenile and adult stages irrespective of the tissues. In larval stage, RCTLR9 mRNA expression decreased at 5 d and then increased at 10 dph. At juvenile stage cobia, the expression was significantly high (p < 0.05) in spleen and intestine compared to gill, kidney, liver and skin. However, at adult stage, the significant high expression was found in gill and intestine. Cobia challenged with P. damselae subsp. piscicida showed significant increase in RCTLR9 expression at 24 h post challenge in intestine, spleen and liver, while in kidney the expression was peak at 12 h and later it decreased at 24 h. The highest expression was 40 fold increase in spleen and the lowest expression was ∼3.6 fold increase in liver. Cobia stimulated with CpG oligonucleotides showed that the induction of these genes was CpG ODN type and time dependent. In spleen and liver, CpG ODNs 1668 and 2006 injected group showed high expression of RCTLR9, IL-1β, chemokine CC compared to other groups. Meanwhile, CpG ODN 2006 has induced high expression of IgM. The CpG ODNs 2395 have induced significant high expression of Mx in spleen and liver. These results demonstrates the potential of using CpG ODN to enhance cobia resistance to P. damselae subsp. piscicida infection and use as an adjuvant in vaccine development. Copyright © 2013 Elsevier Ltd. All rights reserved.

Genome-Wide Associations between Genetic and Epigenetic Variation Influence mRNA Expression and Insulin Secretion in Human Pancreatic Islets

PubMed Central

Olsson, Anders H.; Volkov, Petr; Bacos, Karl; Dayeh, Tasnim; Hall, Elin; Nilsson, Emma A.; Ladenvall, Claes; Rönn, Tina; Ling, Charlotte

2014-01-01

Genetic and epigenetic mechanisms may interact and together affect biological processes and disease development. However, most previous studies have investigated genetic and epigenetic mechanisms independently, and studies examining their interactions throughout the human genome are lacking. To identify genetic loci that interact with the epigenome, we performed the first genome-wide DNA methylation quantitative trait locus (mQTL) analysis in human pancreatic islets. We related 574,553 single nucleotide polymorphisms (SNPs) with genome-wide DNA methylation data of 468,787 CpG sites targeting 99% of RefSeq genes in islets from 89 donors. We identified 67,438 SNP-CpG pairs in cis, corresponding to 36,783 SNPs (6.4% of tested SNPs) and 11,735 CpG sites (2.5% of tested CpGs), and 2,562 significant SNP-CpG pairs in trans, corresponding to 1,465 SNPs (0.3% of tested SNPs) and 383 CpG sites (0.08% of tested CpGs), showing significant associations after correction for multiple testing. These include reported diabetes loci, e.g. ADCY5, KCNJ11, HLA-DQA1, INS, PDX1 and GRB10. CpGs of significant cis-mQTLs were overrepresented in the gene body and outside of CpG islands. Follow-up analyses further identified mQTLs associated with gene expression and insulin secretion in human islets. Causal inference test (CIT) identified SNP-CpG pairs where DNA methylation in human islets is the potential mediator of the genetic association with gene expression or insulin secretion. Functional analyses further demonstrated that identified candidate genes (GPX7, GSTT1 and SNX19) directly affect key biological processes such as proliferation and apoptosis in pancreatic β-cells. Finally, we found direct correlations between DNA methylation of 22,773 (4.9%) CpGs with mRNA expression of 4,876 genes, where 90% of the correlations were negative when CpGs were located in the region surrounding transcription start site. Our study demonstrates for the first time how genome-wide genetic and epigenetic variation interacts to influence gene expression, islet function and potential diabetes risk in humans. PMID:25375650

The effect of TLR9 agonist CpG oligodeoxynucleotides on the intestinal immune response of cobia (Rachycentron canadum).

PubMed

Byadgi, Omkar; Puteri, Dinda; Lee, Jai-Wei; Chang, Tsung-Chou; Lee, Yan-Horn; Chu, Chun-Yen; Cheng, Ta-Chih

2014-01-01

Cytosine-guanine oligodeoxynucleotide (CpG ODN) motifs of bacterial DNA are recognized through toll-like receptor 9 (TLR9) and are potent activators of innate immunity. However, the interaction between TLR9 and CpG ODN in aquatic species has not been well characterized. Hence, cobia TLR9 isoform B (RCTLR9B) was cloned and its expression and induction in intestine were investigated. RCTLR9B cDNA consists of 3113bp encoding 1009 amino acids containing three regions, leucine rich repeats, transmembrane domain, and toll/interleukin-1 receptor (TIR) domain. Intraperitoneal injection of CpG ODN 2395 upregulated RCTLR9 A and B and MyD88 and also induced the expressions of Mx, chemokine CC, and interleukin IL-1 β . Cobia intraperitoneally injected with CpG ODN 1668 and 2395 had increased survival rates after challenge with Photobacterium damselae subsp. piscicida. In addition, formulation of CpG ODN with formalin-killed bacteria (FKB) and aluminum hydroxide gel significantly increased expressions of RCTLR9 A (50 folds) and B (30 folds) isoforms at 10 dpi (CpG ODN 1668) and MyD88 (21 folds) at 6 dpv (CpG ODN 2395). Subsequently, IL-1 β increased at 6 dpv in 1668 group. No histopathological damage and inflammatory responses were observed in the injected cobia. Altogether, these results facilitate CpG ODNs as an adjuvant to increase bacterial disease resistance and efficacy of vaccines in cobia.

The Effect of TLR9 Agonist CpG Oligodeoxynucleotides on the Intestinal Immune Response of Cobia (Rachycentron canadum)

PubMed Central

Byadgi, Omkar; Puteri, Dinda; Lee, Jai-Wei; Chang, Tsung-Chou; Lee, Yan-Horn; Chu, Chun-Yen; Cheng, Ta-Chih

2014-01-01

Cytosine-guanine oligodeoxynucleotide (CpG ODN) motifs of bacterial DNA are recognized through toll-like receptor 9 (TLR9) and are potent activators of innate immunity. However, the interaction between TLR9 and CpG ODN in aquatic species has not been well characterized. Hence, cobia TLR9 isoform B (RCTLR9B) was cloned and its expression and induction in intestine were investigated. RCTLR9B cDNA consists of 3113bp encoding 1009 amino acids containing three regions, leucine rich repeats, transmembrane domain, and toll/interleukin-1 receptor (TIR) domain. Intraperitoneal injection of CpG ODN 2395 upregulated RCTLR9 A and B and MyD88 and also induced the expressions of Mx, chemokine CC, and interleukin IL-1β. Cobia intraperitoneally injected with CpG ODN 1668 and 2395 had increased survival rates after challenge with Photobacterium damselae subsp. piscicida. In addition, formulation of CpG ODN with formalin-killed bacteria (FKB) and aluminum hydroxide gel significantly increased expressions of RCTLR9 A (50 folds) and B (30 folds) isoforms at 10 dpi (CpG ODN 1668) and MyD88 (21 folds) at 6 dpv (CpG ODN 2395). Subsequently, IL-1β increased at 6 dpv in 1668 group. No histopathological damage and inflammatory responses were observed in the injected cobia. Altogether, these results facilitate CpG ODNs as an adjuvant to increase bacterial disease resistance and efficacy of vaccines in cobia. PMID:24991578

Analysis of the association between CIMP and BRAF in colorectal cancer by DNA methylation profiling.

PubMed

Hinoue, Toshinori; Weisenberger, Daniel J; Pan, Fei; Campan, Mihaela; Kim, Myungjin; Young, Joanne; Whitehall, Vicki L; Leggett, Barbara A; Laird, Peter W

2009-12-21

A CpG island methylator phenotype (CIMP) is displayed by a distinct subset of colorectal cancers with a high frequency of DNA hypermethylation in a specific group of CpG islands. Recent studies have shown that an activating mutation of BRAF (BRAF(V600E)) is tightly associated with CIMP, raising the question of whether BRAF(V600E) plays a causal role in the development of CIMP or whether CIMP provides a favorable environment for the acquisition of BRAF(V600E). We employed Illumina GoldenGate DNA methylation technology, which interrogates 1,505 CpG sites in 807 different genes, to further study this association. We first examined whether expression of BRAF(V600E) causes DNA hypermethylation by stably expressing BRAF(V600E) in the CIMP-negative, BRAF wild-type COLO 320DM colorectal cancer cell line. We determined 100 CIMP-associated CpG sites and examined changes in DNA methylation in eight stably transfected clones over multiple passages. We found that BRAF(V600E) is not sufficient to induce CIMP in our system. Secondly, considering the alternative possibility, we identified genes whose DNA hypermethylation was closely linked to BRAF(V600E) and CIMP in 235 primary colorectal tumors. Interestingly, genes that showed the most significant link include those that mediate various signaling pathways implicated in colorectal tumorigenesis, such as BMP3 and BMP6 (BMP signaling), EPHA3, KIT, and FLT1 (receptor tyrosine kinases) and SMO (Hedgehog signaling). Furthermore, we identified CIMP-dependent DNA hypermethylation of IGFBP7, which has been shown to mediate BRAF(V600E)-induced cellular senescence and apoptosis. Promoter DNA hypermethylation of IGFBP7 was associated with silencing of the gene. CIMP-specific inactivation of BRAF(V600E)-induced senescence and apoptosis pathways by IGFBP7 DNA hypermethylation might create a favorable context for the acquisition of BRAF(V600E) in CIMP+ colorectal cancer. Our data will be useful for future investigations toward understanding CIMP in colorectal cancer and gaining insights into the role of aberrant DNA hypermethylation in colorectal tumorigenesis.

Expression of MUC17 Is Regulated by HIF1α-Mediated Hypoxic Responses and Requires a Methylation-Free Hypoxia Responsible Element in Pancreatic Cancer

PubMed Central

Kitamoto, Sho; Yokoyama, Seiya; Higashi, Michiyo; Yamada, Norishige; Matsubara, Shyuichiro; Takao, Sonshin; Batra, Surinder K.; Yonezawa, Suguru

2012-01-01

MUC17 is a type 1 membrane-bound glycoprotein that is mainly expressed in the digestive tract. Recent studies have demonstrated that the aberrant overexpression of MUC17 is correlated with the malignant potential of pancreatic ductal adenocarcinomas (PDACs); however, the exact regulatory mechanism of MUC17 expression has yet to be identified. Here, we provide the first report of the MUC17 regulatory mechanism under hypoxia, an essential feature of the tumor microenvironment and a driving force of cancer progression. Our data revealed that MUC17 was significantly induced by hypoxic stimulation through a hypoxia-inducible factor 1α (HIF1α)-dependent pathway in some pancreatic cancer cells (e.g., AsPC1), whereas other pancreatic cancer cells (e.g., BxPC3) exhibited little response to hypoxia. Interestingly, these low-responsive cells have highly methylated CpG motifs within the hypoxia responsive element (HRE, 5′-RCGTG-3′), a binding site for HIF1α. Thus, we investigated the demethylation effects of CpG at HRE on the hypoxic induction of MUC17. Treatment of low-responsive cells with 5-aza-2′-deoxycytidine followed by additional hypoxic incubation resulted in the restoration of hypoxic MUC17 induction. Furthermore, DNA methylation of HRE in pancreatic tissues from patients with PDACs showed higher hypomethylation status as compared to those from non-cancerous tissues, and hypomethylation was also correlated with MUC17 mRNA expression. Taken together, these findings suggested that the HIF1α-mediated hypoxic signal pathway contributes to MUC17 expression, and DNA methylation of HRE could be a determinant of the hypoxic inducibility of MUC17 in pancreatic cancer cells. PMID:22970168

Pathogenic mechanisms of intracellular bacteria.

PubMed

Niller, Hans Helmut; Masa, Roland; Venkei, Annamária; Mészáros, Sándor; Minarovits, Janos

2017-06-01

We wished to overview recent data on a subset of epigenetic changes elicited by intracellular bacteria in human cells. Reprogramming the gene expression pattern of various host cells may facilitate bacterial growth, survival, and spread. DNA-(cytosine C5)-methyltransferases of Mycoplasma hyorhinis targeting cytosine-phosphate-guanine (CpG) dinucleotides and a Mycobacterium tuberculosis methyltransferase targeting non-CpG sites methylated the host cell DNA and altered the pattern of gene expression. Gene silencing by CpG methylation and histone deacetylation, mediated by cellular enzymes, also occurred in M. tuberculosis-infected macrophages. M. tuberculosis elicited cell type-specific epigenetic changes: it caused increased DNA methylation in macrophages, but induced demethylation, deposition of euchromatic histone marks and activation of immune-related genes in dendritic cells. A secreted transposase of Acinetobacter baumannii silenced a cellular gene, whereas Mycobacterium leprae altered the epigenotype, phenotype, and fate of infected Schwann cells. The 'keystone pathogen' oral bacterium Porphyromonas gingivalis induced local DNA methylation and increased the level of histone acetylation in host cells. These epigenetic changes at the biofilm-gingiva interface may contribute to the development of periodontitis. Epigenetic regulators produced by intracellular bacteria alter the epigenotype and gene expression pattern of host cells and play an important role in pathogenesis.

Induction of anti-aging gene klotho with a small chemical compound that demethylates CpG islands

PubMed Central

Jung, Dongju; Xu, Yuechi; Sun, Zhongjie

2017-01-01

Klotho (KL) is described as an anti-aging gene because mutation of Kl gene leads to multiple pre-mature aging phenotypes and shortens lifespan in mice. Growing evidence suggests that an increase in KL expression may be beneficial for age-related diseases such as arteriosclerosis and diabetes. It remains largely unknown, however, how Kl expression could be induced. Here we discovered novel molecular mechanism for induction of Kl expression with a small molecule ‘Compound H’, N-(2-chlorophenyl)-1H-indole-3-caboxamide. Compound H was originally identified through a high-throughput screening of small molecules for identifying Kl inducers. However, how Compound H induces Kl expression has never been investigated. We found that Compound H increased Kl expression via demethylation in CpG islands of the Kl gene. The demethylation was accomplished by activating demethylases rather than inhibiting methylases. Due to demethylation, Compound H enhanced binding of transcription factors, Pax4 and Kid3, to the promoter of the Kl gene. Pax4 and Kid3 regulated Kl promoter activity positively and negatively, respectively. Thus, our results show that demethylation is an important molecular mechanism that mediates Compound H-induced Kl expression. Further investigation is warranted to determine whether Compound H demethylates the Kl gene in vivo and whether it can serve as a therapeutic agent for repressing or delaying the onset of age-related diseases. PMID:28657902

Effects of CPG ODN on biological behavior of PANC-1 and expression of TLR9 in pancreatic cancer.

PubMed

Wu, Han-Qing; Wang, Bo; Zhu, Shi-Kai; Tian, Yuan; Zhang, Jing-Hui; Wu, He-Shui

2011-02-28

To determine the expression of toll-like receptor 9 (TLR9) in pancreatic tumor and the effects of cytosine phosphate-guanosine oligodeoxynucleotides 2216 (CPG ODN2216) on biological behavior of pancreatic carcinoma cell line PANC-1 and explore their clinical significance. The immunohistochemistry and Western blot were used to determine the expression of TLR9 protein in pancreatic cancer tissues, and immunofluorescence staining was performed to detect the TLR9 protein expression in pancreatic carcinoma cell line PANC-1. To assess the effects of CPG ODN2216 on the invasive property of Panc-1 cells, in vitro cell adhesion, wound-healing scrape, and invasion and cell colony formation were evaluated. TLR9 was highly expressed in pancreatic cancer tissues and PANC-1 cells. The percentage of positive cells expressing TLR9 protein in human pancreatic tissues, paracancerous tissues and normal tissues were 73.3%, 33.3% and 20.0%, respectively, and the protein expression level of TLR9 was gradually descending (P < 0.05). In vitro tests in wound-healing scrape, cell adhesion, colony formation and matrigel invasion showed that the adhesion and motility of PANC-1 cells in CPG ODN 2216 treatment group were significantly lower than in the control group (P < 0.05). The cell growth assay showed that the proliferative ability of PANC-1 cells in treatment group was significantly decreased and CPG ODN2216 had an inhibitive effect in the growth of Panc-1 cells in a dose and time-dependent manner (P < 0.05). The gene of TLR9 is correlated with the invasive and metastatic potential of human pancreatic carcinoma, and CPG ODN2216 induces the inhibition of migration and invasion of Panc-1 cells.

CpG methylation patterns and decitabine treatment response in acute myeloid leukemia cells and normal hematopoietic precursors

PubMed Central

Negrotto, Soledad; Ng, Kwok Peng; Jankowska, Ania M.; Bodo, Juraj; Gopalan, Banu; Guinta, Kathryn; Mulloy, James C.; Hsi, Eric; Maciejewski, Jaroslaw; Saunthararajah, Yogen

2011-01-01

The DNA hypomethylating drug decitabine maintains normal hematopoietic stem cell (HSC) self-renewal but induces terminal differentiation in acute myeloid leukemia (AML) cells. The basis for these contrasting cell-fates, and for selective CpG hypomethylation by decitabine, is poorly understood. Promoter CpGs, with methylation measured by microarray, were classified by the direction of methylation change with normal myeloid maturation. In AML cells, the methylation pattern at maturation-responsive CpG suggested at least partial maturation. Consistent with partial maturation, in gene expression analyses, AML cells expressed high levels of the key lineage-specifying factor CEBPA, but relatively low levels of the key late-differentiation driver CEBPE. In methylation analysis by mass-spectrometry, CEBPE promoter CpG that are usually hypomethylated during granulocyte maturation were significantly hypermethylated in AML cells. Decitabine treatment induced cellular differentiation of AML cells, and the largest methylation decreases were at CpG that are hypomethylated with myeloid maturation, including CEBPE promoter CpG. In contrast, decitabine-treated normal HSC retained immature morphology, and methylation significantly decreased at CpG that are less methylated in immature cells. High expression of lineage-specifying factor and aberrant epigenetic repression of some key late-differentiation genes distinguishes AML cells from normal HSC and could explain the contrasting differentiation and methylation responses to decitabine. PMID:21836612

Dietary vitamin E deficiency does not affect global and specific DNA methylation patterns in rat liver.

PubMed

Fischer, Alexandra; Gaedicke, Sonja; Frank, Jan; Döring, Frank; Rimbach, Gerald

2010-10-01

The aim of the present study was to determine the effects of a 6-month dietary vitamin E (VE) deficiency on DNA methylation and gene expression in rat liver. Two enzymes, 5-α-steroid reductase type 1 (SRD5A1) and the regulatory subunit of γ-glutamylcysteinyl synthetase (GCLM), which are differentially expressed on the mRNA level, were analysed for promoter methylation in putative cytosine-phospho-guanine (CpG) island regions located at the 5' end using base-specific cleavage and matrix-assisted laser desorption ionisation time-of-flight MS. A twofold increase in the mRNA level of SRD5A1 gene and a twofold decrease in the mRNA level of GCLM gene in VE-deficient animals were not associated with different CpG methylation of the analysed promoter region. Furthermore, global DNA methylation was not significantly different in these two groups. Thus, the present results indicate that the VE-induced regulation of SRD5A1 and GCLM in rat liver is not directly mediated by changes in promoter DNA methylation.

CpG ODN 1668 induce innate and adaptive immune responses in rock bream (Oplegnathus fasciatus) against rock bream iridovirus (RBIV) infection.

PubMed

Jung, Myung-Hwa; Jung, Sung-Ju

2017-10-01

Rock bream iridovirus (RBIV) causes severe mass mortalities in rock bream in Korea. CpG ODN 1668 showed promise as immunoprotective agents against RBIV infection in rock bream. In this study, we assessed innate/adaptive-related gene expression patterns in RBIV-infected rock bream with and without CpG ODN 1668 administration to determine important immune defense related factors that may affect fish survival. In the CpG ODN 1668+virus-injected group, virus copies were more than 7.4- to 790591-fold lower than in the virus-injected group at 4 d (8.79 × 10 4 and 6.58 × 10 5 /μl, respectively), 7 d (5.30 × 10 2 and 2.29 × 10 7 /μl, respectively) and 10 dpi (7.79 × 10 1 and 6.16 × 10 7 /μl, respectively). Furthermore, in the CpG ODN 1668+virus-injected group, significantly higher levels of MyD88 (6 h, 1 d, 4 d and 7 dpi), IL1β (1 d, 2 d and 7 dpi) and perforin/granzyme (1 dpi) expression were observed, whereas these genes were not significantly expressed in the virus-injected group at that time points. Mx, ISG15 and PKR were significantly highly expressed at 4 d and 7 dpi and reduced when low viral loads at 10 dpi in the CpG ODN 1668+virus-injected group. Conversely, in the virus-injected group, Mx, ISG15 and PKR expression were significantly higher than the control group until 10 dpi. However, MHC class I, CD8, Fas, Fas ligand and caspases (3, 8 and 9) expression levels showed no statistically significant differences between virus- and CpG ODN 1668+virus-injected group. In summary, CpG ODN 1668 administration in fish induces innate immune response or cell death pathway, which could be a major contributing factor to effective fish control over viral transcription on 4 d to 10 dpi. Expression of MyD88, IL1β, perforin and granzyme-related immune gene response is critical factor for inhibition of RBIV replication. Copyright © 2017 Elsevier Ltd. All rights reserved.

Clinical evaluation of CpG oligonucleotides as adjuvants for vaccines targeting infectious diseases and cancer

PubMed Central

Scheiermann, Julia; Klinman, Dennis M.

2014-01-01

Synthetic oligonucleotides (ODN) that express unmethylated “CpG motifs” trigger cells that express Toll-like receptor 9. In humans this includes plasmacytoid dendritic cells and B cells. CpG ODN induce an innate immune response characterized by the production of Th1 and pro-inflammatory cytokines. Their utility as vaccine adjuvants was evaluated in a number of clinical trials. Results indicate that CpG ODN improve antigen presentation and the generation of vaccine-specific cellular and humoral responses. This work provides an up-to-date overview of the utility of CpG ODN as adjuvants for vaccines targeting infectious agents and cancer. PMID:24975812

CpG oligodeoxynucleotide induces apoptosis and cell cycle arrest in A20 lymphoma cells via TLR9-mediated pathways.

PubMed

Qi, Xu-Feng; Zheng, Li; Kim, Cheol-Su; Lee, Kyu-Jae; Kim, Dong-Heui; Cai, Dong-Qing; Qin, Jun-Wen; Yu, Yan-Hong; Wu, Zheng; Kim, Soo-Ki

2013-07-01

Recent studies have suggested that the anti-cancer activity of CpG-oligodeoxynucleotides (CpG-ODNs) is owing to their immunomodulatory effects in tumor-bearing host. The purpose of this study is to investigate the directly cytotoxic activity of KSK-CpG, a novel CpG-ODN with an alternative CpG motif, against A20 and EL4 lymphoma cells in comparison with previously used murine CpG motif (1826-CpG). To evaluate the potential cytotoxic effects of KSK-CpG on lymphoma cells, cell viability assay, confocal microscopy, flow cytometry, DNA fragmentation, Western blotting, and reverse transcription-polymerase chain reaction (RT-PCR) analysis were used. We found that KSK-CpG induced direct cytotoxicity in A20 lymphoma cells, but not in EL4 lymphoma cells, at least in part via TLR9-mediated pathways. Apoptotic cell death was demonstrated to play an important role in CpG-ODNs-induced cytotoxicity. In addition, both mitochondrial membrane potential decrease and G1-phase arrest were involved in KSK-CpG-induced apoptosis in A20 cells. The activities of apoptotic molecules such as caspase-3, PARP, and Bax were increased, but the activation of p27 Kip1 and ERK were decreased in KSK-CpG-treated A20 cells. Furthermore, autocrine IFN-γ partially contributed to apoptotic cell death in KSK-CpG-treated A20 cells. Collectively, our findings suggest that KSK-CpG induces apoptotic cell death in A20 lymphoma cells at least in part by inducing G1-phase arrest and autocrine IFN-γ via increasing TLR9 expression, without the need for immune system of tumor-bearing host. This new understanding supports the development of TLR9-targeted therapy with CpG-ODN as a direct therapeutic agent for treating B lymphoma. Copyright © 2013 Elsevier Ltd. All rights reserved.

Methylomics of gene expression in human monocytes

PubMed Central

Liu, Yongmei; Ding, Jingzhong; Reynolds, Lindsay M.; Lohman, Kurt; Register, Thomas C.; De La Fuente, Alberto; Howard, Timothy D.; Hawkins, Greg A.; Cui, Wei; Morris, Jessica; Smith, Shelly G.; Barr, R. Graham; Kaufman, Joel D.; Burke, Gregory L.; Post, Wendy; Shea, Steven; Mccall, Charles E.; Siscovick, David; Jacobs, David R.; Tracy, Russell P.; Herrington, David M.; Hoeschele, Ina

2013-01-01

DNA methylation is one of several epigenetic mechanisms that contribute to the regulation of gene expression; however, the extent to which methylation of CpG dinucleotides correlates with gene expression at the genome-wide level is still largely unknown. Using purified primary monocytes from subjects in a large community-based cohort (n = 1264), we characterized methylation (>485 000 CpG sites) and mRNA expression (>48K transcripts) and carried out genome-wide association analyses of 8370 expression phenotypes. We identified 11 203 potential cis-acting CpG loci whose degree of methylation was associated with gene expression (eMS) at a false discovery rate threshold of 0.001. Most of the associations were consistent in effect size and direction of effect across sex and three ethnicities. Contrary to expectation, these eMS were not predominately enriched in promoter regions, or CpG islands, but rather in the 3′ UTR, gene bodies, CpG shores or ‘offshore’ sites, and both positive and negative correlations between methylation and expression were observed across all locations. eMS were enriched for regions predicted to be regulatory by ENCODE (Encyclopedia of DNA Elements) data in multiple cell types, particularly enhancers. One of the strongest association signals detected (P < 2.2 × 10−308) was a methylation probe (cg17005068) in the promoter/enhancer region of the glutathione S-transferase theta 1 gene (GSTT1, encoding the detoxification enzyme) with GSTT1 mRNA expression. Our study provides a detailed description of the epigenetic architecture in human monocytes and its relationship to gene expression. These data may help prioritize interrogation of biologically relevant methylation loci and provide new insights into the epigenetic basis of human health and diseases. PMID:23900078

CPG2 Recruits Endophilin B2 to the Cytoskeleton for Activity-Dependent Endocytosis of Synaptic Glutamate Receptors.

PubMed

Loebrich, Sven; Benoit, Marc Robert; Konopka, Jaclyn Aleksandra; Cottrell, Jeffrey Richard; Gibson, Joanne; Nedivi, Elly

2016-02-08

Internalization of glutamate receptors at the postsynaptic membrane via clathrin-mediated endocytosis (CME) is a key mechanism for regulating synaptic strength. A role for the F-actin cytoskeleton in CME is well established, and recently, PKA-dependent association of candidate plasticity gene 2 (CPG2) with the spine-cytoskeleton has been shown to mediate synaptic glutamate receptor internalization. Yet, how the endocytic machinery is physically coupled to the actin cytoskeleton to facilitate glutamate receptor internalization has not been demonstrated. Moreover, there has been no distinction of endocytic-machinery components that are specific to activity-dependent versus constitutive glutamate receptor internalization. Here, we show that CPG2, through a direct physical interaction, recruits endophilin B2 (EndoB2) to F-actin, thus anchoring the endocytic machinery to the spine cytoskeleton and facilitating glutamate receptor internalization. Regulation of CPG2 binding to the actin cytoskeleton by protein kinase A directly impacts recruitment of EndoB2 and clathrin. Specific disruption of EndoB2 or the CPG2-EndoB2 interaction impairs activity-dependent, but not constitutive, internalization of both NMDA- and AMPA-type glutamate receptors. These results demonstrate that, through direct interactions with F-actin and EndoB2, CPG2 physically bridges the spine cytoskeleton and the endocytic machinery, and this tripartite association is critical specifically for activity-dependent CME of synaptic glutamate receptors. Copyright © 2016 Elsevier Ltd. All rights reserved.

Epigenetic Loss of MLH1 Expression in Normal Human Hematopoietic Stem Cell Clones is Defined by the Promoter CpG Methylation Pattern Observed by High-Throughput Methylation Specific Sequencing

PubMed Central

Kenyon, Jonathan; Nickel-Meester, Gabrielle; Qing, Yulan; Santos-Guasch, Gabriela; Drake, Ellen; PingfuFu; Sun, Shuying; Bai, Xiaodong; Wald, David; Arts, Eric; Gerson, Stanton L.

2016-01-01

Normal human hematopoietic stem and progenitor cells (HPC) lose expression of MLH1, an important mismatch repair (MMR) pathway gene, with age. Loss of MMR leads to replication dependent mutational events and microsatellite instability observed in secondary acute myelogenous leukemia and other hematologic malignancies. Epigenetic CpG methylation upstream of the MLH1 promoter is a contributing factor to acquired loss of MLH1 expression in tumors of the epithelia and proximal mucosa. Using single molecule high-throughput bisulfite sequencing we have characterized the CpG methylation landscape from −938 to −337 bp upstream of the MLH1 transcriptional start site (position +0), from 30 hematopoietic colony forming cell clones (CFC) either expressing or not expressing MLH1. We identify a correlation between MLH1 promoter methylation and loss of MLH1 expression. Additionally, using the CpG site methylation frequencies obtained in this study we were able to generate a classification algorithm capable of sorting the expressing and non-expressing CFC. Thus, as has been previously described for many tumor cell types, we report for the first time a correlation between the loss of MLH1 expression and increased MLH1 promoter methylation in CFC derived from CD34+ selected hematopoietic stem and progenitor cells. PMID:27570841

Epigenetic Loss of MLH1 Expression in Normal Human Hematopoietic Stem Cell Clones is Defined by the Promoter CpG Methylation Pattern Observed by High-Throughput Methylation Specific Sequencing.

PubMed

Kenyon, Jonathan; Nickel-Meester, Gabrielle; Qing, Yulan; Santos-Guasch, Gabriela; Drake, Ellen; PingfuFu; Sun, Shuying; Bai, Xiaodong; Wald, David; Arts, Eric; Gerson, Stanton L

Normal human hematopoietic stem and progenitor cells (HPC) lose expression of MLH1 , an important mismatch repair (MMR) pathway gene, with age. Loss of MMR leads to replication dependent mutational events and microsatellite instability observed in secondary acute myelogenous leukemia and other hematologic malignancies. Epigenetic CpG methylation upstream of the MLH1 promoter is a contributing factor to acquired loss of MLH1 expression in tumors of the epithelia and proximal mucosa. Using single molecule high-throughput bisulfite sequencing we have characterized the CpG methylation landscape from -938 to -337 bp upstream of the MLH1 transcriptional start site (position +0), from 30 hematopoietic colony forming cell clones (CFC) either expressing or not expressing MLH1 . We identify a correlation between MLH1 promoter methylation and loss of MLH1 expression. Additionally, using the CpG site methylation frequencies obtained in this study we were able to generate a classification algorithm capable of sorting the expressing and non-expressing CFC. Thus, as has been previously described for many tumor cell types, we report for the first time a correlation between the loss of MLH1 expression and increased MLH1 promoter methylation in CFC derived from CD34 + selected hematopoietic stem and progenitor cells.

Gene expression profiling of chicken cecal tonsils and ileum following oral exposure to soluble and PLGA-encapsulated CpG ODN, and lysate of Campylobacter jejuni.

PubMed

Taha-Abdelaziz, Khaled; Alkie, Tamiru Negash; Hodgins, Douglas C; Yitbarek, Alexander; Shojadoost, Bahram; Sharif, Shayan

2017-12-01

Campylobacter jejuni (C. jejuni) is a leading bacterial cause of food-borne illness in humans. Contaminated chicken meat is an important source of infection for humans. Chickens are not clinically affected by colonization, and immune responses following natural infection have limited effects on bacterial load in the gut. Induction of intestinal immune responses may possibly lead to a breakdown of the commensal relationship of chickens with Campylobacter. We have recently shown that soluble and poly D, L-lactic-co-glycolic acid (PLGA)-encapsulated CpG oligodeoxynucleotide (ODN) as well as C. jejuni lysate, are effective in reducing the intestinal burden of C. jejuni in chickens; however, the mechanisms behind this protection have yet to be determined. The present study was undertaken to investigate the mechanisms of host responses conferred by these treatments. Chickens were treated orally with soluble CpG ODN, or PLGA-encapsulated CpG ODN, or C. jejuni lysate, and expression of cytokines and antimicrobial peptides was evaluated in cecal tonsils and ileum using quantitative RT-PCR. Oral administration of soluble CpG ODN upregulated the expression of interferon (IFN)-γ, interleukin (IL)-1β, CXCLi2, transforming growth factor (TGF)-β4/1, IL-10 and IL-13, while treatment with PLGA-encapsulated CpG ODN upregulated the expression of IL-1β, CXCLi2, TGF-β4/1, IL-13, avian β-defensin (AvBD) 1, AvBD2 and cathelicidin 3 (CATHL-3). C. jejuni lysate upregulated the expression of IFN-γ, IL-1β, TGF-β4/1, IL-13, AvBD1, and CATHL-3. In conclusion, induction of cytokine and antimicrobial peptides expression in intestinal microenvironments may provide a means of reducing C. jejuni colonization in broiler chickens, a key step in reducing the incidence of campylobacteriosis in humans. Copyright © 2017 Elsevier B.V. All rights reserved.

Induction of Cyclooxygenase-2 Expression by Hepatitis B Virus Depends on Demethylation-associated Recruitment of Transcription Factors to the Promoter

PubMed Central

2011-01-01

Background The hepatitis B virus (HBV) is a major etiological factor of inflammation and damage to the liver resulting in hepatocellular carcinoma. Transcription factors play important roles in the disordered gene expression and liver injury caused by HBV. However, the molecular mechanisms behind this observation have not been defined. Results In this study, we observed that circulating prostaglandin (PGE) 2 synthesis was increased in patients with chronic hepatitis B infection, and detected elevated cyclooxygenase (COX)-2 expression in HBV- and HBx-expressing liver cells. Likewise, the association of HBx with C/EBPβ contributed to the induction of COX-2. The COX-2 promoter was hypomethylated in HBV-positive cells, and specific demethylation of CpG dinucleotides within each of the two NF-AT sites in the COX-2 promoter resulted in the increased binding affinity of NF-AT to the cognate sites in the promoter, followed by increased COX-2 expression and PGE2 accumulation. The DNA methylatransferase DNMT3B played a key role in the methylation of the COX-2 promoter, and its decreased binding to the promoter was responsible for the regional demethylation of CpG sites, and for the increased binding of transcription factors in HBV-positive cells. Conclusion Our results indicate that upregulation of COX-2 by HBV and HBx is mediated by both demethylation events and recruitment of multiple transcription factors binding to the promoter. PMID:21401943

Diabetes Mellitus in Pregnancy Leads to Growth Restriction and Epigenetic Modification of the Srebf2 Gene in Rat Fetuses.

PubMed

Golic, Michaela; Stojanovska, Violeta; Bendix, Ivo; Wehner, Anika; Herse, Florian; Haase, Nadine; Kräker, Kristin; Fischer, Caroline; Alenina, Natalia; Bader, Michael; Schütte, Till; Schuchardt, Mirjam; van der Giet, Markus; Henrich, Wolfgang; Muller, Dominik N; Felderhoff-Müser, Ursula; Scherjon, Sicco; Plösch, Torsten; Dechend, Ralf

2018-05-01

Diabetic pregnancy is correlated with increased risk of metabolic and neurological disorders in the offspring putatively mediated epigenetically. Little is known about epigenetic changes already present in fetuses of diabetic pregnancies. We aimed at characterizing the perinatal environment after preexisting maternal diabetes mellitus and at identifying relevant epigenetic changes in the fetus. We focused on the transcription factor Srebf2 (sterol regulatory element binding transcription factor 2), a master gene in regulation of cholesterol metabolism. We tested whether diabetic pregnancy induces epigenetic changes in the Srebf2 promoter and if they become manifest in altered Srebf2 gene expression. We worked with a transgenic rat model of type 2 diabetes mellitus (Tet29) in which the insulin receptor is knocked down by doxycycline-induced RNA interference. Doxycycline was administered preconceptionally to Tet29 and wild-type control rats. Only Tet29 doxycycline dams were hyperglycemic, hyperinsulinemic, and hyperlipidemic. Gene expression was analyzed with quantitative real-time reverse transcriptase polymerase chain reaction and CpG promoter methylation with pyrosequencing. Immunohistochemistry was performed on fetal brains. Fetuses from diabetic Tet29 dams were hyperglycemic and growth restricted at the end of pregnancy. They further displayed decreased liver and brain weight with concomitant decreased microglial activation in the hippocampus in comparison to fetuses of normoglycemic mothers. Importantly, diabetic pregnancy induced CpG hypermethylation of the Srebf2 promoter in the fetal liver and brain, which was associated with decreased Srebf2 gene expression. In conclusion, diabetic and hyperlipidemic pregnancy induces neurological, metabolic, and epigenetic alterations in the rat fetus. Srebf2 is a potential candidate mediating intrauterine environment-driven epigenetic changes and later diabetic offspring health. © 2018 American Heart Association, Inc.

Early demethylation of non-CpG, CpC-rich, elements in the myogenin 5′-flanking region

PubMed Central

Fuso, Andrea; Ferraguti, Giampiero; Grandoni, Francesco; Ruggeri, Raffaella; Scarpa, Sigfrido; Strom, Roberto

2010-01-01

The dynamic changes and structural patterns of DNA methylation of genes without CpG islands are poorly characterized. The relevance of CpG to the non-CpG methylation equilibrium in transcriptional repression is unknown. In this work, we analyzed the DNA methylation pattern of the 5′-flanking of the myogenin gene, a positive regulator of muscle differentiation with no CpG island and low CpG density, in both C2C12 muscle satellite cells and embryonic muscle. Embryonic brain was studied as a non-expressing tissue. High levels of both CpG and non-CpG methylation were observed in non-expressing experimental conditions. Both CpG and non-CpG methylation rapidly dropped during muscle differentiation and myogenin transcriptional activation with active demethylation dynamics. Non-CpG demethylation occurred more rapidly than CpG demethylation. Demethylation spread from initially highly methylated short CpC-rich elements to a virtually unmethylated status. These short elements have a high CpC content and density, share some motifs and largely coincide with putative recognition sequences of some differentiation-related transcription factors. Our findings point to a dynamically controlled equilibrium between CpG and non-CpG active demethylation in the transcriptional control of tissue-specific genes. The short CpC-rich elements are new structural features of the methylation machinery, whose functions may include priming the complete demethylation of a transcriptionally crucial DNA region. PMID:20935518

Conserved Role of Intragenic DNA Methylation in Regulating Alternative Promoters

PubMed Central

Maunakea, Alika K.; Nagarajan, Raman P.; Bilenky, Mikhail; Ballinger, Tracy J.; D’Souza, Cletus; Fouse, Shaun D.; Johnson, Brett E.; Hong, Chibo; Nielsen, Cydney; Zhao, Yongjun; Turecki, Gustavo; Delaney, Allen; Varhol, Richard; Thiessen, Nina; Shchors, Ksenya; Heine, Vivi M.; Rowitch, David H.; Xing, Xiaoyun; Fiore, Chris; Schillebeeckx, Maximiliaan; Jones, Steven J.M.; Haussler, David; Marra, Marco A.; Hirst, Martin; Wang, Ting; Costello, Joseph F.

2014-01-01

While the methylation of DNA in 5′ promoters suppresses gene expression, the role of DNA methylation in gene bodies is unclear1–5. In mammals, tissue- and cell type-specific methylation is present in a small percentage of 5′ CpG island (CGI) promoters, while a far greater proportion occurs across gene bodies, coinciding with highly conserved sequences5–10. Tissue-specific intragenic methylation might reduce,3 or, paradoxically, enhance transcription elongation efficiency1,2,4,5. Capped analysis of gene expression (CAGE) experiments also indicate that transcription commonly initiates within and between genes11–15. To investigate the role of intragenic methylation, we generated a map of DNA methylation from human brain encompassing 24.7 million of the 28 million CpG sites. From the dense, high-resolution coverage of CpG islands, the majority of methylated CpG islands were revealed to be in intragenic and intergenic regions, while less than 3% of CpG islands in 5′ promoters were methylated. The CpG islands in all three locations overlapped with RNA markers of transcription initiation, and unmethylated CpG islands also overlapped significantly with trimethylation of H3K4, a histone modification enriched at promoters16. The general and CpG-island-specific patterns of methylation are conserved in mouse tissues. An in-depth investigation of the human SHANK3 locus17,18 and its mouse homologue demonstrated that this tissue-specific DNA methylation regulates intragenic promoter activity in vitro and in vivo. These methylation-regulated, alternative transcripts are expressed in a tissue and cell type-specific manner, and are expressed differentially within a single cell type from distinct brain regions. These results support a major role for intragenic methylation in regulating cell context-specific alternative promoters in gene bodies. PMID:20613842

Carbon nanotubes enhance CpG uptake and potentiate antiglioma immunity.

PubMed

Zhao, Dongchang; Alizadeh, Darya; Zhang, Leying; Liu, Wei; Farrukh, Omar; Manuel, Edwin; Diamond, Don J; Badie, Behnam

2011-02-15

Stimulation of toll-like receptor-9 (TLR9) by CpG oligodeoxynucleotides (CpG) has been shown to counteract the immunosuppressive microenvironment and to inhibit tumor growth in glioma models. Because TLR9 is located intracellularly, we hypothesized that methods that enhance its internalization may also potentiate its immunostimulatory response. The goal of this study was to evaluate carbon nanotubes (CNT) as a CpG delivery vehicle in brain tumor models. Functionalized single-walled CNTs were conjugated with CpG (CNT-CpG) and evaluated in vitro and in mice bearing intracranial GL261 gliomas. Flow cytometry was used to assess CNT-CpG uptake and antiglioma immune response. Tumor growth was measured by bioluminescent imaging, histology, and animal survival. CNT-CpG was nontoxic and enhanced CpG uptake both in vitro and intracranial gliomas. CNT-mediated CpG delivery also potentiated proinflammatory cytokine production by primary monocytes. Interestingly, a single intracranial injection of low-dose CNT-CpG (but not free CpG or blank CNT) eradicated intracranial GL261 gliomas in half of tumor-bearing mice. Moreover, surviving animals exhibited durable tumor-free remission (>3 months), and were protected from intracranial tumor rechallenge, demonstrating induction of long-term antitumor immunity. These findings suggest that CNTs can potentiate CpG immunopotency by enhancing its delivery into tumor-associated inflammatory cells. ©2010 AACR.

Carbon Nanotubes Enhance CpG Uptake and Potentiate Anti-Glioma Immunity

PubMed Central

Zhao, Dongchang; Alizadeh, Darya; Zhang, Leying; Liu, Wei; Farrukh, Omar; Manuel, Edwin; Diamond, Don J.; Badie, Behnam

2010-01-01

Purpose Stimulation of toll-like receptor-9 (TLR9) by CpG oligodeoxynucleotides (CpG) has been shown to counteract the immunosuppressive microenvironment and to inhibit tumor growth in glioma models. Since TLR9 is located intracellularly, we hypothesized that methods that enhance its internalization may also potentiate its immunostimulatory response. The goal of this study was to evaluate carbon nanotubes (CNTs) as a CpG delivery vehicle in brain tumor models. Experimental Design Functionalized single-walled CNTs were conjugated with CpG (CNT-CpG) and evaluated in vitro and in mice bearing intracranial GL261 gliomas. Flow cytometry was used to assess CNT-CpG uptake and anti-glioma immune response. Tumor growth was measured by bioluminescent imaging, histology, and animal survival. Results CNT-CpG was nontoxic and enhanced CpG uptake both in vitro and intracranial gliomas. CNT-mediated CpG delivery also potentiated pro-inflammatory cytokine production by primary monocytes. Interestingly, a single intracranial injection of low-dose CNT-CpG (but not free CpG or blank CNT) eradicated intracranial GL261 gliomas in half of tumor-bearing mice. Moreover, surviving animals exhibited durable tumor-free remission (> 3 months), and were protected from intracranial tumor rechallenge, demonstrating induction of long-term anti-tumor immunity. Conclusions These findings suggest that CNTs can potentiate CpG immunopotency by enhancing its delivery into tumor-associated inflammatory cells. PMID:21088258

Migration phenology and breeding success are predicted by methylation of a photoperiodic gene in the barn swallow

PubMed Central

Saino, Nicola; Ambrosini, Roberto; Albetti, Benedetta; Caprioli, Manuela; De Giorgio, Barbara; Gatti, Emanuele; Liechti, Felix; Parolini, Marco; Romano, Andrea; Romano, Maria; Scandolara, Chiara; Gianfranceschi, Luca; Bollati, Valentina; Rubolini, Diego

2017-01-01

Individuals often considerably differ in the timing of their life-cycle events, with major consequences for individual fitness, and, ultimately, for population dynamics. Phenological variation can arise from genetic effects but also from epigenetic modifications in DNA expression and translation. Here, we tested if CpG methylation at the poly-Q and 5′-UTR loci of the photoperiodic Clock gene predicted migration and breeding phenology of long-distance migratory barn swallows (Hirundo rustica) that were tracked year-round using light-level geolocators. Increasing methylation at Clock poly-Q was associated with earlier spring departure from the African wintering area, arrival date at the European breeding site, and breeding date. Higher methylation levels also predicted increased breeding success. Thus, we showed for the first time in any species that CpG methylation at a candidate gene may affect phenology and breeding performance. Methylation at Clock may be a candidate mechanism mediating phenological responses of migratory birds to ongoing climate change. PMID:28361883

Migration phenology and breeding success are predicted by methylation of a photoperiodic gene in the barn swallow.

PubMed

Saino, Nicola; Ambrosini, Roberto; Albetti, Benedetta; Caprioli, Manuela; De Giorgio, Barbara; Gatti, Emanuele; Liechti, Felix; Parolini, Marco; Romano, Andrea; Romano, Maria; Scandolara, Chiara; Gianfranceschi, Luca; Bollati, Valentina; Rubolini, Diego

2017-03-31

Individuals often considerably differ in the timing of their life-cycle events, with major consequences for individual fitness, and, ultimately, for population dynamics. Phenological variation can arise from genetic effects but also from epigenetic modifications in DNA expression and translation. Here, we tested if CpG methylation at the poly-Q and 5'-UTR loci of the photoperiodic Clock gene predicted migration and breeding phenology of long-distance migratory barn swallows (Hirundo rustica) that were tracked year-round using light-level geolocators. Increasing methylation at Clock poly-Q was associated with earlier spring departure from the African wintering area, arrival date at the European breeding site, and breeding date. Higher methylation levels also predicted increased breeding success. Thus, we showed for the first time in any species that CpG methylation at a candidate gene may affect phenology and breeding performance. Methylation at Clock may be a candidate mechanism mediating phenological responses of migratory birds to ongoing climate change.

Decreased IL-10 production mediated by Toll-like receptor 9 in B cells in multiple sclerosis.

PubMed

Hirotani, Makoto; Niino, Masaaki; Fukazawa, Toshiyuki; Kikuchi, Seiji; Yabe, Ichiro; Hamada, Shinsuke; Tajima, Yasutaka; Sasaki, Hidenao

2010-04-15

The complexity of the roles of Toll-like receptors (TLRs) is attributable to their ability to promote or suppress autoimmune diseases. Recent studies have demonstrated that B cells regulate autoimmune diseases, including multiple sclerosis (MS), by producing interleukin (IL)-10. By using CpG DNA as a TLR9 agonist, we investigated the immunoregulatory functions of B cell via TLR9 in MS. Our results indicate that TLR9-mediated IL-10 production by B cells was significantly decreased in MS, and this decrease is likely due to decreased TLR9 expression in memory B cells, suggesting a role of TLR9 in immunoregulation in MS. Copyright 2010 Elsevier B.V. All rights reserved.

Site-specific methylation of the rat prolactin and growth hormone promoters correlates with gene expression.

PubMed Central

Ngô, V; Gourdji, D; Laverrière, J N

1996-01-01

The methylation patterns of the rat prolactin (rPRL) (positions -440 to -20) and growth hormone (rGH) (positions -360 to -110) promoters were analyzed by bisulfite genomic sequencing. Two normal tissues, the anterior pituitary and the liver, and three rat pituitary GH3 cell lines that differ considerably in their abilities to express both genes were tested. High levels of rPRL gene expression were correlated with hypomethylation of the CpG dinucleotides located at positions -277 and -97, near or within positive cis-acting regulatory elements. For the nine CpG sites analyzed in the rGH promoter, an overall hypomethylation-expression coupling was also observed for the anterior pituitary, the liver, and two of the cell lines. The effect of DNA methylation was tested by measuring the transient expression of the chloramphenicol acetyltransferase reporter gene driven by a regionally methylated rPRL promoter. CpG methylation resulted in a decrease in the activity of the rPRL promoter which was proportional to the number of modified CpG sites. The extent of the inhibition was also found to be dependent on the position of methylated sites. Taken together, these data suggest that site-specific methylation may modulate the action of transcription factors that dictate the tissue-specific expression of the rPRL and rGH genes in vivo. PMID:8668139

The DNA methylation status alteration of two steroidogenic genes in gonads of rare minnow after bisphenol A exposure.

PubMed

Zhang, Ting; Liu, Yan; Chen, Hong; Gao, Jiancao; Zhang, Yingying; Yuan, Cong; Wang, Zaizhao

2017-08-01

Both cytochrome P450c17 (CYP17A1) and P-450 side chain cleavage (CYP11A1) play important roles in steroid biosynthesis. According to our previous studies, bisphenol A (BPA) could regulate the mRNA expression of cyp17a1 and cyp11a1 in rare minnow Gobiocypris rarus. However, the potential mechanism of the regulation is barely understood. In the present study, aiming to explore how BPA affects the mRNA expression of cyp17a1 and cyp11a1 in testes and ovaries of G. rarus, we firstly cloned 340-bp fragment of 5' flanking region of cyp11a1 and then detected the methylation level of CpG loci involved in 5' flanking of cyp11a1 and cyp17a1 and their mRNA expression levels. Results showed that exposure to BPA significantly increased serum estradiol (E2) and 11-ketotesterone (11-KT) concentrations. Ovarian mRNA expression of cyp17a1 and cyp11a1 were significantly decreased after BPA exposure 7- for and 14-days. However, transcriptions of testicular cyp17a1 and cyp11a1 were significantly increased and decreased respectively after BPA treatment for 14days. The DNA methylation levels of cyp17a1 were decreased in ovaries on day 7 and increased in ovaries and decreased in testes respectively on day 14. The methylation levels of cyp11a1 were increased in ovaries on day 7 and both ovaries and testes on day 14. There were a significant correlation between DNA methylation at specific CpG loci and cyp17a1 and cyp11a1 genes transcription levels. In conclusion, the CpG loci methylation in 5' flanking region appears to involve in the regulation of mRNA expression of cyp17a1 and cyp11a1 mediated by BPA. Copyright © 2017 Elsevier Inc. All rights reserved.

Potential interaction between the GARS-AIRS-GART Gene and CP2/LBP-1c/LSF transcription factor in Down syndrome-related Alzheimer disease.

PubMed

Banerjee, Disha; Nandagopal, Krishnadas

2007-12-01

(1) GARS-AIRS-GART is an important candidate gene in studies of Down syndrome (DS)-related Alzheimer's disease (AD), due to its chromosomal localization (21q22.1) in the Down syndrome critical region, involvement in de novo purine biosynthesis, and over-expression in DS brain. The aim of this study was to identify factor(s) likely to enhance transcription of GARS-AIRS-GART in DS-related AD. (2) Based on a bio-informatics approach, the PromoterInspector, Promoter Scan II, and EBI toolbox CpG plot software programs were used to identify GARS-AIRS-GART sequences important for gene transcription. Transcription factor binding motifs within these regions were mapped with the help of the MatInspector and TFSEARCH programs. Factors implicated in neurodevelopment or neurodegeneration were the focus of attention, and mining of human (T1Dbase) and murine (GNF) expression databases revealed information on the regional distribution of these factors and their relative abundance vis-a-vis GARS-AIRS-GART. (3) The Leader-binding protein 1-c (LBP-1c/CP2/LSF) emerged as a promising candidate from these studies, as MatInspector and TFSEARCH analyses revealed a total of four CP2 binding sites with potential for functional interaction(s) within the promoter and CpG islands of GARS-AIRS-GART. Furthermore, two of these sites harbor sequences for methylation-sensitive restriction enzymes, which suggest that methylation status may, in part, regulate CP2-mediated transcription of GARS-AIRS-GART. A search of T1Dbase and GNF expression databases reveals co-expression of CP2 and GARS-AIRS-GART in brain regions relevant to DS-related AD. (4) The virtual screen identified CP2/LBP-1c/LSF as a factor that likely mediates enhanced transcription of GARS-AIRS-GART in DS-related AD.

Repetition priming of motor activity mediated by a central pattern generator: the importance of extrinsic vs. intrinsic program initiators

PubMed Central

Siniscalchi, Michael J.; Jing, Jian; Weiss, Klaudiusz R.

2016-01-01

Repetition priming is characterized by increased performance as a behavior is repeated. Although this phenomenon is ubiquitous, mediating mechanisms are poorly understood. We address this issue in a model system, the feeding network of Aplysia. This network generates both ingestive and egestive motor programs. Previous data suggest a chemical coding model: ingestive and egestive inputs to the feeding central pattern generator (CPG) release different modulators, which act via different second messengers to prime motor activity in different ways. The ingestive input to the CPG (neuron CBI-2) releases the peptides feeding circuit activating peptide and cerebral peptide 2, which produce an ingestive pattern of activity. The egestive input to the CPG (the esophageal nerve) releases the peptide small cardioactive peptide. This model is based on research that focused on a single aspect of motor control (radula opening). Here we ask whether repetition priming is observed if activity is triggered with a neuron within the core CPG itself and demonstrate that it is not. Moreover, previous studies demonstrated that effects of modulatory neurotransmitters that induce repetition priming persist. This suggests that it should be possible to “prime” motor programs triggered from within the CPG by first stimulating extrinsic modulatory inputs. We demonstrate that programs triggered after ingestive input activation are ingestive and programs triggered after egestive input activation are egestive. We ask where this priming occurs and demonstrate modifications within the CPG itself. This arrangement is likely to have important consequences for “task” switching, i.e., the cessation of one type of motor activity and the initiation of another. PMID:27466134

CpG DNA in the prevention and treatment of infections.

PubMed

Dalpke, Alexander; Zimmermann, Stefan; Heeg, Klaus

2002-01-01

Microbial infection is sensed by Toll-like receptors (TLRs) on innate immune cells. Among the ten so far defined TLRs, TLR9 and its ligand are peculiar. TLR9 recognises bacterial DNA characterised by the abundance of unmethylated CpG dinucleotides, which distinguish bacterial DNA (CpG DNA) from mammalian DNA. Moreover, TLR9 shows a restricted cellular and subcellular pattern of expression. In contrast to other TLR agonists, CpG DNA is superior in activation of dendritic dells and induction of costimulatory cytokines such as interleukin (IL)-12 and IL-18. This qualifies CpG DNA as a Th1-promoting adjuvant. During infection, recognition of CpG DNA of intracellular pathogens skews and fine-tunes the ongoing immune response and induces long-lasting Th1 milieus. Thus, CpG DNA might play an important role in driving the immune system to a Th1 profile, preventing undesired Th2 milieus that might favour induction of allergic responses. Since CpG DNA can be synthesised with high purity and sequence fidelity, synthetic CpG DNA will become an important agent for Th1 instruction and be an effective adjuvant during vaccination.

Enhanced sensitivity of CpG island search and primer design based on predicted CpG island position.

PubMed

Park, Hyun-Chul; Ahn, Eu-Ree; Jung, Ju Yeon; Park, Ji-Hye; Lee, Jee Won; Lim, Si-Keun; Kim, Won

2018-05-01

DNA methylation has important biological roles, such as gene expression regulation, as well as practical applications in forensics, such as in body fluid identification and age estimation. DNA methylation often occurs in the CpG site, and methylation within the CpG islands affects various cellular functions and is related to tissue-specific identification. Several programs have been developed to identify CpG islands; however, the size, location, and number of predicted CpG islands are not identical due to different search algorithms. In addition, they only provide structural information for predicted CpG islands without experimental information, such as primer design. We developed an analysis pipeline package, CpGPNP, to integrate CpG island prediction and primer design. CpGPNP predicts CpG islands more accurately and sensitively than other programs, and designs primers easily based on the predicted CpG island locations. The primer design function included standard, bisulfite, and methylation-specific PCR to identify the methylation of particular CpG sites. In this study, we performed CpG island prediction on all chromosomes and compared CpG island search performance of CpGPNP with other CpG island prediction programs. In addition, we compared the position of primers designed for a specific region within the predicted CpG island using other bisulfite PCR primer programs. The primers designed by CpGPNP were used to experimentally verify the amplification of the target region of markers for body fluid identification and age estimation. CpGPNP is freely available at http://forensicdna.kr/cpgpnp/. Copyright © 2018 Elsevier B.V. All rights reserved.

The correlation between pulmonary fibrosis and methylation of peripheral Smad3 in cases of pigeon breeder's lung in a Chinese Uygur population.

PubMed

Wu, Chao; Ding, Wei; Li, Qifeng; Wang, Wenyi; Deng, Mingqin; Jin, Rong; Pang, Baosen; Yang, Xiaohong

2017-06-27

Smad3 is a key protein in the transforming growth factor-beta (TGF-β)/Smad signaling pathway, which is involved in fibrosis in many organs. We investigated the relationship between Smad3 gene methylation and pulmonary fibrosis in pigeon breeder's lung (PBL). Twenty Uygur PBL patients with pulmonary fibrosis in Kashi between October 2015 and March 2016 were enrolled. Twenty PBL-free pigeon breeders and 20 healthy non-pigeon breeders enrolled during the same period constituted the negative and normal control groups, respectively. Participants' data and peripheral blood samples were collected, and three Smad3 CpG loci were examined. Distributions of CpG_2 and CpG_4 methylation rates did not differ across groups, whereas distributions of CpG_3 methylation rates were significantly different among the three groups. The CpG_3 methylation rate was significantly lower in the patient group than in the negative control group. Smad3 mRNA expression was significantly higher in the patient group than in the negative control group but did not differ between the two control groups. TGF-βlevels were significantly higher in the patient group than in either control group (both P<0.01). Smad3 gene methylation and Smad3 mRNA expression were negatively correlated, with a correlation coefficient of -0.84. The number of pigeons bred during the preceding three months was positively correlated with Smad3 mRNA expression, with a correlation coefficient of 0.77. Smad3 gene hypomethylation might promote pulmonary fibrosis in Uygur PBL patients via increased Smad3 mRNA expression. Smad3 methylation, Smad3 mRNA expression and TGF-β level were correlated with the number of pigeons bred by patients.

CpG methylation in human papillomavirus (HPV) type 31 long control region (LCR) in cervical infections associated with cytological abnormalities.

PubMed

László, Brigitta; Ferenczi, Annamária; Madar, László; Gyöngyösi, Eszter; Szalmás, Anita; Szakács, Levente; Veress, György; Kónya, József

2016-08-01

The mechanisms that regulate papillomavirus gene expression include DNA methylation. The transcription of papillomavirus oncogenes E6 and E7 is controlled by certain regulatory elements in the LCR, which include binding sites for the E2 protein, a viral regulator of oncogene expression. In HPV-31-infected exfoliated cervical cells, the CpG methylation of the entire LCR was determined by next-generation sequencing after bisulfite modification. Six of the 22 cases had methylated CpG sites in the HPV-31 LCR, including position 7479 and/or 7485, at the promoter distal E2 binding site, thus suggesting a potential regulatory mechanism for papillomavirus transcription.

Characterization and expression of cyp19a gene in the Chinese giant salamander Andrias davidianus.

PubMed

Hu, Qiaomu; Xiao, Hanbing; Tian, HaiFeng; Meng, Yan

2016-02-01

We cloned the full length cyp19a of Chinese giant salamander Andrias davidianus, determined its distribution in tissues and developing gonads, and analyzed the CpG methylation pattern of the cyp19a promoter. The results revealed isoforms of 1706 bp (G arom) and 1698 bp (B arom) in length, differing in the 5' flanking region, both encoding 502 amino acids. The G arom gene was observed mainly in the ovary and kidney, with little in other investigated tissues, while B arom expression was high in the brain, ovary, testis, and pituitary, with low or undetected expression in other examined tissues. Total aromatase expression was high in the ovary; moderate in the kidney, brain, testis, and pituitary; and low in the remaining tissues. G arom expression was significantly higher in the ovary than in the testis and gradually decreased with maturation of the salamander. A single injection of methyltestosterone or letrozole resulted in ovarian G arom expression decreasing over a 12-96 h period. A 1366 bp sequence of the cyp19a promoter was cloned and shown to be conserved in selected species. CpG methylation level was negatively correlated with cyp19a expression in the examined tissues and developing ovaries. Five and three CpG methylation sites positively correlated with DNA methylation levels in tissues and developing ovary, suggesting that they play an important role in regulating cyp19a expression. The aromatase gene showed two isoforms with distinct expression patterns, and the promoter methylation level at specific CpG sites was associated with variation in expression profiles of tissues and developing ovaries. Copyright © 2015 Elsevier Inc. All rights reserved.

Inducible nitric oxide synthase gene methylation and parkinsonism in manganese-exposed welders

PubMed Central

Nielsen, Susan Searles; Checkoway, Harvey; Criswell, Susan R.; Farin, Federico M.; Stapleton, Patricia L.; Sheppard, Lianne; Racette, Brad A.

2015-01-01

Introduction Neurologist-assessed parkinsonism signs are prevalent among workers exposed to manganese (Mn)-containing welding fume. Neuroinflammation may possibly play a role. Inducible nitric oxide synthase, coded by NOS2, is involved in inflammation, and particulate exposure increases the gene’s expression through methylation of CpG sites in the 5′ region. Methods We assessed DNA methylation at three CpG sites in the NOS2 exon 1 from blood from 201 welders. All were non-Hispanic Caucasian men 25–65 years old who were examined by a neurologist specializing in movement disorders. We categorized the workers according to their Unified Parkinson Disease Rating Scale motor subsection 3 (UPDRS3) scores as parkinsonism cases (UPDRS3 ≥ 15; n = 49), controls (UPDRS3 < 6; n = 103), or intermediate (UPDRS3 ≥6 to <15; n = 49). Results While accounting for age, examiner and experimental plate, parkinsonism cases had lower mean NOS2 methylation than controls (p-value for trend = 0.04), specifically at CpG site 8329 located in an exonic splicing enhancer of NOS2 (p-value for trend = 0.07). These associations were not observed for the intermediate UPDRS3 group (both p-value for trend ≥ 0.59). Conclusions Inflammation mediated by inducible nitric oxide synthase may possibly contribute to the association between welding fume and parkinsonism, but requires verification in a longitudinal study. PMID:25634431

Promoter DNA methylation regulates progranulin expression and is altered in FTLD

PubMed Central

2013-01-01

Background Frontotemporal lobar degeneration (FTLD) is a heterogeneous group of neurodegenerative diseases associated with personality changes and progressive dementia. Loss-of-function mutations in the growth factor progranulin (GRN) cause autosomal dominant FTLD, but so far the pathomechanism of sporadic FTLD is unclear. Results We analyzed whether DNA methylation in the GRN core promoter restricts GRN expression and, thus, might promote FTLD in the absence of GRN mutations. GRN expression in human lymphoblast cell lines is negatively correlated with methylation at several CpG units within the GRN promoter. Chronic treatment with the DNA methyltransferase inhibitor 5-aza-2′-deoxycytidine (DAC) strongly induces GRN mRNA and protein levels. In a reporter assay, CpG methylation blocks transcriptional activity of the GRN core promoter. In brains of FTLD patients several CpG units in the GRN promoter are significantly hypermethylated compared to age-matched healthy controls, Alzheimer and Parkinson patients. These CpG motifs are critical for GRN promoter activity in reporter assays. Furthermore, DNA methyltransferase 3a (DNMT3a) is upregulated in FTLD patients and overexpression of DNMT3a reduces GRN promoter activity and expression. Conclusion These data suggest that altered DNA methylation is a novel pathomechanism for FTLD that is potentially amenable to targeted pharmacotherapy. PMID:24252647

Combined DNA methylation and gene expression profiling in gastrointestinal stromal tumors reveals hypomethylation of SPP1 as an independent prognostic factor.

PubMed

Haller, Florian; Zhang, Jitao David; Moskalev, Evgeny A; Braun, Alexander; Otto, Claudia; Geddert, Helene; Riazalhosseini, Yasser; Ward, Aoife; Balwierz, Aleksandra; Schaefer, Inga-Marie; Cameron, Silke; Ghadimi, B Michael; Agaimy, Abbas; Fletcher, Jonathan A; Hoheisel, Jörg; Hartmann, Arndt; Werner, Martin; Wiemann, Stefan; Sahin, Ozgür

2015-03-01

Gastrointestinal stromal tumors (GISTs) have distinct gene expression patterns according to localization, genotype and aggressiveness. DNA methylation at CpG dinucleotides is an important mechanism for regulation of gene expression. We performed targeted DNA methylation analysis of 1.505 CpG loci in 807 cancer-related genes in a cohort of 76 GISTs, combined with genome-wide mRNA expression analysis in 22 GISTs, to identify signatures associated with clinicopathological parameters and prognosis. Principal component analysis revealed distinct DNA methylation patterns associated with anatomical localization, genotype, mitotic counts and clinical follow-up. Methylation of a single CpG dinucleotide in the non-CpG island promoter of SPP1 was significantly correlated with shorter disease-free survival. Hypomethylation of this CpG was an independent prognostic parameter in a multivariate analysis compared to anatomical localization, genotype, tumor size and mitotic counts in a cohort of 141 GISTs with clinical follow-up. The epigenetic regulation of SPP1 was confirmed in vitro, and the functional impact of SPP1 protein on tumorigenesis-related signaling pathways was demonstrated. In summary, SPP1 promoter methylation is a novel and independent prognostic parameter in GISTs, and might be helpful in estimating the aggressiveness of GISTs from the intermediate-risk category. © 2014 UICC.

Methylation of avpr1a in the cortex of wild prairie voles: effects of CpG position and polymorphism

PubMed Central

Maguire, S. M.; Phelps, S. M.

2017-01-01

DNA methylation can cause stable changes in neuronal gene expression, but we know little about its role in individual differences in the wild. In this study, we focus on the vasopressin 1a receptor (avpr1a), a gene extensively implicated in vertebrate social behaviour, and explore natural variation in DNA methylation, genetic polymorphism and neuronal gene expression among 30 wild prairie voles (Microtus ochrogaster). Examination of CpG density across 8 kb of the locus revealed two distinct CpG islands overlapping promoter and first exon, characterized by few CpG polymorphisms. We used a targeted bisulfite sequencing approach to measure DNA methylation across approximately 3 kb of avpr1a in the retrosplenial cortex, a brain region implicated in male space use and sexual fidelity. We find dramatic variation in methylation across the avrp1a locus, with pronounced diversity near the exon–intron boundary and in a genetically variable putative enhancer within the intron. Among our wild voles, differences in cortical avpr1a expression correlate with DNA methylation in this putative enhancer, but not with the methylation status of the promoter. We also find an unusually high number of polymorphic CpG sites (polyCpGs) in this focal enhancer. One polyCpG within this enhancer (polyCpG 2170) may drive variation in expression either by disrupting transcription factor binding motifs or by changing local DNA methylation and chromatin silencing. Our results contradict some assumptions made within behavioural epigenetics, but are remarkably concordant with genome-wide studies of gene regulation. PMID:28280564

α-Synuclein Sequesters Dnmt1 from the Nucleus

PubMed Central

Desplats, Paula; Spencer, Brian; Coffee, Elizabeth; Patel, Pruthul; Michael, Sarah; Patrick, Christina; Adame, Anthony; Rockenstein, Edward; Masliah, Eliezer

2011-01-01

DNA methylation is a major epigenetic modification that regulates gene expression. Dnmt1, the maintenance DNA methylation enzyme, is abundantly expressed in the adult brain and is mainly located in the nuclear compartment, where it has access to chromatin. Hypomethylation of CpG islands at intron 1 of the SNCA gene has recently been reported to result in overexpression of α-synuclein in Parkinson disease (PD) and related disorders. We therefore investigated the mechanisms underlying altered DNA methylation in PD and dementia with Lewy bodies (DLB). We present evidence of reduction of nuclear Dnmt1 levels in human postmortem brain samples from PD and DLB patients as well as in the brains of α-synuclein transgenic mice models. Furthermore, sequestration of Dnmt1 in the cytoplasm results in global DNA hypomethylation in human and mouse brains, involving CpG islands upstream of SNCA, SEPW1, and PRKAR2A genes. We report that association of Dnmt1 and α-synuclein might mediate aberrant subcellular localization of Dnmt1. Nuclear Dnmt1 levels were partially rescued by overexpression of Dnmt1 in neuronal cell cultures and in α-synuclein transgenic mice brains. Our results underscore a novel mechanism for epigenetic dysregulation in Lewy body diseases, which might underlie the decrease in DNA methylation reported for PD and DLB. PMID:21296890

DNA Methylation Suppresses Expression of the Urea Cycle Enzyme Carbamoyl Phosphate Synthetase 1 (CPS1) in Human Hepatocellular Carcinoma

PubMed Central

Liu, Hongyan; Dong, Huijia; Robertson, Keith; Liu, Chen

2011-01-01

Carbamoyl phosphate synthetase 1 (CPS1) is a liver-specific, intramitochondrial, rate-limiting enzyme in the urea cycle. A previous study showed that CPS1 is the antigen for hepatocyte paraffin 1 antibody, a commonly used antibody in surgical pathology practice; and CPS1 expression appears to be down-regulated in liver cancer tissue and cell lines. The aim of this study is to understand how the CPS1 gene is regulated in liver carcinogenesis. In this report, we show that human hepatocellular carcinoma (HCC) cells do not express CPS1, whereas cultured human primary hepatocytes express abundant levels. In addition, CPS1 was silenced or down-regulated in liver tumor tissues compared with the matched noncancerous tissues. The expression of CPS1 in HCC cells was restored with a demethylation agent, 5-azacytidine. We show that two CpG dinucleotides, located near the transcription start site, and a CpG-rich region in the first intron were hypermethylated in HCC cells. The hypermethylation of the two CpG dinucleotides was also detected in HCC tumor tissues compared with noncancerous tissues. Further molecular analysis with mutagenesis indicated that the two CpG dinucleotides play a role in promoter activity of the CPS1 gene. In conclusion, our study demonstrates that DNA methylation is a key mechanism of silencing CPS1 expression in human HCC cells, and CPS1 gene hypermethylation of the two CpG dinucleotides is a potential biomarker for HCC. PMID:21281797

Vitamin D dose response is underestimated by Endocrine Society's Clinical Practice Guideline.

PubMed

McKenna, Malachi J; Murray, Barbara F

2013-06-01

The recommended daily intakes of vitamin D according to the recent Clinical Practice Guideline (CPG) of the Endocrine Society are three- to fivefold higher than the Institute of Medicine (IOM) report. We speculated that these differences could be explained by different mathematical approaches to the vitamin D dose response. Studies were selected if the daily dose was ≤2000 IU/day, the duration exceeded 3 months, and 25-hydroxyvitamin D (25OHD) concentrations were measured at baseline and post-therapy. The rate constant was estimated according to the CPG approach. The achieved 25OHD result was estimated according to the following: i) the regression equation approach of the IOM; ii) the regression approach of the Vitamin D Supplementation in Older Subjects (ViDOS) study; and iii) the CPG approach using a rate constant of 2.5 (CPG2.5) and a rate constant of 5.0 (CPG5.0). The difference between the expected and the observed 25OHD result was expressed as a percentage of observed and analyzed for significance against a value of 0% for the four groups. Forty-one studies were analyzed. The mean (95% CI) rate constant was 5.3 (4.4-6.2) nmol/l per 100 IU per day, on average twofold higher than the CPG rate constant. The mean (95% CI) for the difference between the expected and observed expressed as a percentage of observed was as follows: i) IOM, -7 (-16,+2)% (t=1.64, P=0.110); ii) ViDOS, +2 (-8,+12)% (t=0.40, P=0.69); iii) CPG2.5, -21 (-27,-15)% (t=7.2, P<0.0001); and iv) CPG5.0+3 (-4,+10)% (t=0.91, P=0.366). The CPG 'rule of thumb' should be doubled to 5.0 nmol/l (2.0 ng/ml) per 100 IU per day, adopting a more risk-averse position.

Effect of dietary betaine supplementation on lipogenesis gene expression and CpG methylation of lipoprotein lipase gene in broilers.

PubMed

Xing, Jinyi; Kang, Li; Jiang, Yunliang

2011-03-01

Experiments were conducted to investigate the effect of betaine supplementation on mRNA expression levels of lipogenesis genes and CpG methylation of lipoprotein lipase gene (LPL) in broilers. From 22 days of age, 78 broilers were feed basal diet without betaine and basal diet supplemented with 0.1% betaine, respectively, and at 56 and 66 days of age, the traits of 15 chickens (7 males and 8 females) of each group were recorded and abdominal fat pads were collected. The mRNA expression levels of several lipogenesis gene were analyzed by semi-quantitative RT-PCR and real-time quantitative RT-PCR (qPCR), respectively. The CpG methylation profile at the promoter region of LPL gene in 66-day-old broilers was determined by bisulfite sequencing. The average daily gain and percent abdominal fat traits were slightly improved in 56-day-old and 66-day-old broilers after dietary supplementation of betaine to diet. After adding 0.1% betaine to diet, the mRNA levels of fatty acid synthase (FAS) and adipocyte-type fatty acid-binding protein genes in abdominal adipose were significantly decreased in 56-day-old broilers, and those of LPL and FAS genes in abdominal adipose were significantly decreased in 66-day-old broilers comparing with the control group (P < 0.05 and P < 0.001). Moreover, in 66-day-old broilers fed 0.1% betaine diet, a different CpG methylation pattern was observed: the CpG dinucleotides of 1st, 6th, 7th, 8th and from 10th to 50th were less methylated; however, those of 2nd, 5th and 9th were more heavily methylated. The results suggest that transcription of some lipogenesis genes was decreased by betaine supplementation and betaine may decrease LPL mRNA expression by altering CpG methylation pattern on LPL promoter region.

E2-mediated cathepsin D (CTSD) activation involves looping of distal enhancer elements.

PubMed

Bretschneider, Nancy; Kangaspeska, Sara; Seifert, Martin; Reid, George; Gannon, Frank; Denger, Stefanie

2008-08-01

Estrogen receptor alpha (ERalpha) is a ligand dependent transcription factor that regulates the expression of target genes through interacting with cis-acting estrogen response elements (EREs). However, only a minority of ERalpha binding sites are located within the proximal promoter regions of responsive genes. Here we report the characterization of an ERE located 9kbp upstream of the TSS of the cathepsin D gene (CTSD) that up-regulates CTSD expression upon estrogen stimulation in MCF-7 cells. Using ChIP, we show recruitment of ERalpha and phosphorylated PolII at the CTSD distal enhancer region. Moreover, we determine the kinetics of transient CpG methylation on the promoter region of CTSD and for the first time, at a distal enhancer element. We show that ERalpha is crucial for long-distance regulation of CTSD expression involving a looping mechanism.

DNA Methylation of T1R1 Gene in the Vegetarian Adaptation of Grass Carp Ctenopharyngodon idella.

PubMed

Cai, Wenjing; He, Shan; Liang, Xu-Fang; Yuan, Xiaochen

2018-05-02

Although previous studies have indicated importance of taste receptors in food habits formation in mammals, little is known about those in fish. Grass carp is an excellent model for studying vegetarian adaptation, as it shows food habit transition from carnivore to herbivore. In the present study, pseudogenization or frameshift mutations of the umami receptors that hypothesized related to dietary switch in vertebrates, were not found in grass carp, suggesting other mechanisms for vegetarian adaptation in grass carp. T1R1 and T1R3 strongly responded to L-Arg and L-Lys, differing from those of zebrafish and medaka, contributing to high species specificity in amino acid preferences and diet selection of grass carp. After food habit transition of grass carp, DNA methylation levels were higher in CPG1 and CPG3 islands of upstream control region of T1R1 gene. Luciferase activity assay of upstream regulatory region of T1R1 (-2500-0 bp) without CPG1 or CPG3 indicated that CPG1 and CPG3 might be involved in transcriptional regulation of T1R1 gene. Subsequently, high DNA methylation decreased expression of T1R1 in intestinal tract. It could be a new mechanism to explain, at least partially, the vegetarian adaptation of grass carp by regulation of expression of umami receptor via epigenetic modification.

DNA Methylation Mediated Downregulation of miR-449c Controls Osteosarcoma Cell Cycle Progression by Directly Targeting Oncogene c-Myc

PubMed Central

Li, Qing; Li, Hua; Zhao, Xueling; Wang, Bing; Zhang, Lin; Zhang, Caiguo; Zhang, Fan

2017-01-01

MicroRNAs (miRNAs) are critical regulators of gene expression, and they have broad roles in the pathogenesis of different diseases including cancer. Limited studies and expression profiles of miRNAs are available in human osteosarcoma cells. By applying a miRNA microarray analysis, we observed a number of miRNAs with abnormal expression in cancerous tissues from osteosarcoma patients. Of particular interest in this study was miR-449c, which was significantly downregulated in osteosarcoma cells and patients, and its expression was negatively correlated with tumor size and tumor MSTS stages. Ectopic expression of miR-449c significantly inhibited osteosarcoma cell proliferation and colony formation ability, and caused cell cycle arrest at the G1 phase. Further analysis identified that miR-449c was able to directly target the oncogene c-Myc and negatively regulated its expression. Overexpression of c-Myc partially reversed miR-449c-mimic-inhibited cell proliferation and colony formation. Moreover, DNA hypermethylation was observed in two CpG islands adjacent to the genomic locus of miR-449c in osteosarcoma cells. Conversely, treatment with the DNA methylation inhibitor AZA caused induction of miR-449c. In conclusion, our results support a model that DNA methylation mediates downregulation of miR-449c, diminishing miR-449c mediated inhibition of c-Myc and thus leading to the activation of downstream targets, eventually contributing to osteosarcoma tumorigenesis. PMID:28924385

Characterization of Immune Responses to an Inactivated Avian Influenza Virus Vaccine Adjuvanted with Nanoparticles Containing CpG ODN.

PubMed

Singh, Shirene M; Alkie, Tamiru N; Abdelaziz, Khaled Taha; Hodgins, Douglas C; Novy, Anastasia; Nagy, Éva; Sharif, Shayan

2016-06-01

Avian influenza virus (AIV), a mucosal pathogen, gains entry into host chickens through respiratory and gastrointestinal routes. Most commercial AIV vaccines for poultry consist of inactivated, whole virus with adjuvant, delivered by parenteral administration. Recent advances in vaccine development have led to the application of nanoparticle emulsion delivery systems, such as poly (d,l-lactic-co-glycolic acid) (PLGA) nanoparticles to enhance antigen-specific immune responses. In chickens, the Toll-like receptor 21 ligand, CpG oligodeoxynucleotides (ODNs), have been demonstrated to be immunostimulatory. The objective of this study was to compare the adjuvant potential of CpG ODN 2007 encapsulated in PLGA nanoparticles with nonencapsulated CpG ODN 2007 when combined with a formalin-inactivated H9N2 virus, through intramuscular and aerosol delivery routes. Chickens were vaccinated at days 7 and 21 posthatch for the intramuscular route and at days 7, 21, and 35 for the aerosol route. Antibody-mediated responses were evaluated weekly in sera and lacrimal secretions in specific pathogen-free chickens. The results indicate that nonencapsulated CpG ODN 2007 in inactivated AIV vaccines administered by the intramuscular route generated higher antibody responses compared to the encapsulated CpG ODN 2007 formulation by the same route. Additionally, encapsulated CpG ODN 2007 in AIV vaccines administered by the aerosol route elicited higher mucosal responses compared to nonencapsulated CpG ODN 2007. Future studies may be aimed at evaluating protective immune responses induced with PLGA encapsulation of AIV and adjuvants.

A cross-study analysis of prenatal exposures to environmental contaminants and the epigenome: support for stress-responsive transcription factor occupancy as a mediator of gene-specific CpG methylation patterning

PubMed Central

Martin, Elizabeth M.; Fry, Rebecca C.

2016-01-01

Abstract A biological mechanism by which exposure to environmental contaminants results in gene-specific CpG methylation patterning is currently unknown. We hypothesize that gene-specific CpG methylation is related to environmentally perturbed transcription factor occupancy. To test this hypothesis, a database of 396 genes with altered CpG methylation either in cord blood leukocytes or placental tissue was compiled from 14 studies representing assessments of six environmental contaminants. Subsequently, an in silico approach was used to identify transcription factor binding sites enriched among the genes with altered CpG methylation in relationship to the suite of environmental contaminants. For each study, the sequences of the promoter regions (representing −1000 to +500 bp from the transcription start site) of all genes with altered CpG methylation were analyzed for enrichment of transcription factor binding sites. Binding sites for a total of 56 unique transcription factors were identified to be enriched within the promoter regions of the genes. Binding sites for the Kidney-Enriched Krupple-like Factor 15, a known responder to endogenous stress, were enriched ( P  < 0.001–0.041) among the genes with altered CpG methylation associated for five of the six environmental contaminants. These data support the transcription factor occupancy theory as a potential mechanism underlying environmentally-induced gene-specific CpG methylation. PMID:27066266

CpG oligodeoxynucleotide nanomedicines for the prophylaxis or treatment of cancers, infectious diseases, and allergies.

PubMed

Hanagata, Nobutaka

2017-01-01

Unmethylated cytosine-guanine dinucleotide-containing oligodeoxynucleotides (CpG ODNs), which are synthetic agonists of Toll-like receptor 9 (TLR9), activate humoral and cellular immunity and are being developed as vaccine adjuvants to prevent or treat cancers, infectious diseases, and allergies. Free CpG ODNs have been used in many clinical trials implemented to verify their effects. However, recent research has reported that self-assembled CpG ODNs, protein/peptide-CpG ODN conjugates, and nanomaterial-CpG ODN complexes demonstrate higher adjuvant effects than free CpG ODNs, owing to their improved uptake efficiency into cells expressing TLR9. Moreover, protein/peptide-CpG ODN conjugates and nanomaterial-CpG ODN complexes are able to deliver CpG ODNs and antigens (or allergens) to the same types of cells, which enables a higher degree of prophylaxis or therapeutic effect. In this review, the author describes recent trends in the research and development of CpG ODN nanomedicines containing self-assembled CpG ODNs, protein/peptide-CpG ODN conjugates, and nanomaterial-CpG ODN complexes, focusing mainly on the results of preclinical and clinical studies.

A Genome-Wide mQTL Analysis in Human Adipose Tissue Identifies Genetic Variants Associated with DNA Methylation, Gene Expression and Metabolic Traits

PubMed Central

Volkov, Petr; Olsson, Anders H.; Gillberg, Linn; Jørgensen, Sine W.; Brøns, Charlotte; Eriksson, Karl-Fredrik; Groop, Leif; Jansson, Per-Anders; Nilsson, Emma; Rönn, Tina; Vaag, Allan; Ling, Charlotte

2016-01-01

Little is known about the extent to which interactions between genetics and epigenetics may affect the risk of complex metabolic diseases and/or their intermediary phenotypes. We performed a genome-wide DNA methylation quantitative trait locus (mQTL) analysis in human adipose tissue of 119 men, where 592,794 single nucleotide polymorphisms (SNPs) were related to DNA methylation of 477,891 CpG sites, covering 99% of RefSeq genes. SNPs in significant mQTLs were further related to gene expression in adipose tissue and obesity related traits. We found 101,911 SNP-CpG pairs (mQTLs) in cis and 5,342 SNP-CpG pairs in trans showing significant associations between genotype and DNA methylation in adipose tissue after correction for multiple testing, where cis is defined as distance less than 500 kb between a SNP and CpG site. These mQTLs include reported obesity, lipid and type 2 diabetes loci, e.g. ADCY3/POMC, APOA5, CETP, FADS2, GCKR, SORT1 and LEPR. Significant mQTLs were overrepresented in intergenic regions meanwhile underrepresented in promoter regions and CpG islands. We further identified 635 SNPs in significant cis-mQTLs associated with expression of 86 genes in adipose tissue including CHRNA5, G6PC2, GPX7, RPL27A, THNSL2 and ZFP57. SNPs in significant mQTLs were also associated with body mass index (BMI), lipid traits and glucose and insulin levels in our study cohort and public available consortia data. Importantly, the Causal Inference Test (CIT) demonstrates how genetic variants mediate their effects on metabolic traits (e.g. BMI, cholesterol, high-density lipoprotein (HDL), hemoglobin A1c (HbA1c) and homeostatic model assessment of insulin resistance (HOMA-IR)) via altered DNA methylation in human adipose tissue. This study identifies genome-wide interactions between genetic and epigenetic variation in both cis and trans positions influencing gene expression in adipose tissue and in vivo (dys)metabolic traits associated with the development of obesity and diabetes. PMID:27322064

Nucleosome dynamics and maintenance of epigenetic states of CpG islands

NASA Astrophysics Data System (ADS)

Sneppen, Kim; Dodd, Ian B.

2016-06-01

Methylation of mammalian DNA occurs primarily at CG dinucleotides. These CpG sites are located nonrandomly in the genome, tending to occur within high density clusters of CpGs (islands) or within large regions of low CpG density. Cluster methylation tends to be bimodal, being dominantly unmethylated or mostly methylated. For CpG clusters near promoters, low methylation is associated with transcriptional activity, while high methylation is associated with gene silencing. Alternative CpG methylation states are thought to be stable and heritable, conferring localized epigenetic memory that allows transient signals to create long-lived gene expression states. Positive feedback where methylated CpG sites recruit enzymes that methylate nearby CpGs, can produce heritable bistability but does not easily explain that as clusters increase in size or density they change from being primarily methylated to primarily unmethylated. Here, we show that an interaction between the methylation state of a cluster and its occupancy by nucleosomes provides a mechanism to generate these features and explain genome wide systematics of CpG islands.

Long noncoding RNA AB074169 inhibits cell proliferation via modulation of KHSRP-mediated p21 expression in papillary thyroid carcinoma.

PubMed

Gou, Qiheng; Gao, Linbo; Nie, Xinwen; Pu, Wenchen; Zhu, Jingqiang; Wang, Yichao; Liu, Xuesha; Tan, Shuangyan; Zhou, Jian-Kang; Gong, Yanqiu; He, Juan; Wu, Ke; Xie, Yuxin; Zhao, Wanjun; Dai, Lunzhi; Liu, Lunxu; Xiang, Rong; Wei, Yu-Quan; Zhang, Lin; Peng, Yong

2018-05-07

Long noncoding RNAs (lncRNAs) are emerging as a novel class of regulators in gene expression associated with tumorigenesis. However, the role of lncRNAs in papillary thyroid carcinoma (PTC) is poorly understood. Here we conducted global lncRNA profiling and identified lncRNA AB074169 (lncAB) as significantly downregulated in PTC. Decreased expression of lncAB in PTC was caused by CpG hypermethylation within its gene promoter. Functional studies showed that lncAB overexpression led to cell cycle arrest and tumor growth inhibition in vitro and in vivo, whereas lncAB knockdown promoted cell proliferation. Mechanistic analyses revealed that lncAB bound KH-type splicing regulatory protein (KHSRP) and also decreased expression of KHSRP, thus increasing CDKN1a (p21) expression and decreasing CDK2 expression to repress cell proliferation. Taken together, these findings demonstrate that lncAB functions as a tumor suppressor during PTC tumorigenesis. Copyright ©2018, American Association for Cancer Research.

Identification of the human homolog of the imprinted mouse Air non-coding RNA

PubMed Central

Yotova, Iveta Y.; Vlatkovic, Irena M.; Pauler, Florian M.; Warczok, Katarzyna E.; Ambros, Peter F.; Oshimura, Mitsuo; Theussl, Hans-Christian; Gessler, Manfred; Wagner, Erwin F.; Barlow, Denise P.

2010-01-01

Genomic imprinting is widely conserved amongst placental mammals. Imprinted expression of IGF2R, however, differs between mice and humans. In mice, Igf2r imprinted expression is seen in all fetal and adult tissues. In humans, adult tissues lack IGF2R imprinted expression, but it is found in fetal tissues and Wilms' tumors where it is polymorphic and only seen in a small proportion of tested samples. Mouse Igf2r imprinted expression is controlled by the Air (Airn) ncRNA whose promoter lies in an intronic maternally-methylated CpG island. The human IGF2R gene carries a homologous intronic maternally-methylated CpG island of unknown function. Here, we use transfection and transgenic studies to show that the human IGF2R intronic CpG island is a ncRNA promoter. We also identify the same ncRNA at the endogenous human locus in 16–40% of Wilms' tumors. Thus, the human IGF2R gene shows evolutionary conservation of key features that control imprinted expression in the mouse. PMID:18789384

Neonatal testosterone suppresses a neuroendocrine pulse generator required for reproduction

NASA Astrophysics Data System (ADS)

Israel, Jean-Marc; Cabelguen, Jean-Marie; Le Masson, Gwendal; Oliet, Stéphane H.; Ciofi, Philippe

2014-02-01

The pituitary gland releases hormones in a pulsatile fashion guaranteeing signalling efficiency. The determinants of pulsatility are poorly circumscribed. Here we show in magnocellular hypothalamo-neurohypophyseal oxytocin (OT) neurons that the bursting activity underlying the neurohormonal pulses necessary for parturition and the milk-ejection reflex is entirely driven by a female-specific central pattern generator (CPG). Surprisingly, this CPG is active in both male and female neonates, but is inactivated in males after the first week of life. CPG activity can be restored in males by orchidectomy or silenced in females by exogenous testosterone. This steroid effect is aromatase and caspase dependent, and is mediated via oestrogen receptor-α. This indicates the apoptosis of the CPG network during hypothalamic sexual differentiation, explaining why OT neurons do not burst in adult males. This supports the view that stereotypic neuroendocrine pulsatility is governed by CPGs, some of which are subjected to gender-specific perinatal programming.

Genomic sequencing and in vivo footprinting of an expression-specific DNase I-hypersensitive site of avian vitellogenin II promoter reveal a demethylation of a mCpG and a change in specific interactions of proteins with DNA.

PubMed Central

Saluz, H P; Feavers, I M; Jiricny, J; Jost, J P

1988-01-01

Genomic sequencing was used to study the in vivo methylation pattern of two CpG sites in the promoter region of the avian vitellogenin gene. The CpG at position +10 was fully methylated in DNA isolated from tissues that do not express the gene but was unmethylated in the liver of mature hens and estradiol-treated roosters. In the latter tissue, this site became demethylated and DNase I hypersensitive after estradiol treatment. A second CpG (position -52) was unmethylated in all tissues examined. In vivo genomic footprinting with dimethyl sulfate revealed different patterns of DNA protection in silent and expressed genes. In rooster liver cells, at least 10 base pairs of DNA, including the methylated CpG, were protected by protein(s). Gel-shift assays indicated that a protein factor, present in rooster liver nuclear extract, bound at this site only when it was methylated. In hen liver cells, the same unmethylated CpG lies within a protected region of approximately equal to 20 base pairs. In vitro DNase I protection and gel-shift assays indicate that this sequence is bound by a protein, which binds both double- and single-stranded DNA. For the latter substrate, this factor was shown to bind solely the noncoding (i.e., mRNA-like) strand. Images PMID:3413118

A crucial role for plasmacytoid dendritic cells in antiviral protection by CpG ODN–based vaginal microbicide

PubMed Central

Shen, Hong; Iwasaki, Akiko

2006-01-01

Topical microbicides represent a promising new approach to preventing HIV and other sexually transmitted infections. TLR agonists are ideal candidates for microbicides, as they trigger a multitude of antiviral genes effective against a broad range of viruses. Although vaginal application of CpG oligodeoxynucleotides (ODNs) and poly I:C has been shown to protect mice from genital herpes infection, the mechanism by which these agents provide protection remains unclear. Here, we show that plasmacytoid DCs (pDCs) are required for CpG ODN–mediated protection against lethal vaginal challenge with herpes simplex virus type 2 (HSV-2). Moreover, we demonstrate that cells of both the hematopoietic and stromal compartments must respond to CpG ODN via TLR9 and to type I IFNs through IFN-αβ receptor (IFN-αβR) for protection. Thus, crosstalk between pDCs and vaginal stromal cells provides for optimal microbicide efficacy. Our results imply that temporally and spatially controlled targeting of CpG ODN to pDCs and epithelial cells can potentially maximize their effectiveness as microbicides while minimizing the associated inflammatory responses. PMID:16878177

Intratumoral delivery of CpG-conjugated anti-MUC1 antibody enhances NK cell anti-tumor activity.

PubMed

Schettini, Jorge; Kidiyoor, Amritha; Besmer, Dahlia M; Tinder, Teresa L; Roy, Lopamudra Das; Lustgarten, Joseph; Gendler, Sandra J; Mukherjee, Pinku

2012-11-01

Monoclonal antibodies (mAbs) against tumor-associated antigens are useful anticancer agents. Antibody-dependent cellular cytotoxicity (ADCC) is one of the major mechanisms responsible for initiating natural killer cell (NK)-mediated killing of tumors. However, the regulation of ADCC via NK cells is poorly understood. We have investigated the cytolytic activity of NK cells against pancreatic cancer cells that were coated with an antibody directed against the human tumor antigen, Mucin-1 designated HMFG-2, either alone or conjugated to CpG oligodeoxynucleotide (CpG ODN). Conjugated antibodies were tested for their ability to elicit ADCC in vitro and in vivo against pancreatic cancer cells. NK cells cultured in the presence of immobilized CpG ODN, HMFG-2 Ab, or CpG ODN-conjugated HMFG-2 Ab were able to up-regulate perforin similarly. Interestingly, a significant higher ADCC was observed when CpG ODN-conjugated HMFG-2-coated tumor cells were co-cultured with NK cells compared to unconjugated HMFG-2 Ab or CpG ODN alone. Moreover, MyD88-deficient NK cells can perform ADCC in vitro. Furthermore, intratumoral injections of CpG ODN-conjugated HMFG-2 induced a significant reduction in tumor burden in vivo in an established model of pancreatic tumor in nude mice compared to CpG ODN or the HMFG-2 alone. Depletion of macrophages or NK cells before treatment confirmed that both cells were required for the anti-tumor response in vivo. Results also suggest that CpG ODN and HMFG-2 Ab could be sensed by NK cells on the mAb-coated tumor cells triggering enhanced ADCC in vitro and in vivo.

Intratumoral delivery of CpG-conjugated anti-MUC1 antibody enhances NK cell anti-tumor activity

PubMed Central

Schettini, Jorge; Kidiyoor, Amritha; Besmer, Dahlia M.; Tinder, Teresa L.; Roy, Lopamudra Das; Lustgarten, Joseph; Gendler, Sandra J.

2013-01-01

Monoclonal antibodies (mAbs) against tumor-associated antigens are useful anticancer agents. Antibody-dependent cellular cytotoxicity (ADCC) is one of the major mechanisms responsible for initiating natural killer cell (NK)-mediated killing of tumors. However, the regulation of ADCC via NK cells is poorly understood. We have investigated the cytolytic activity of NK cells against pancreatic cancer cells that were coated with an antibody directed against the human tumor antigen, Mucin-1 designated HMFG-2, either alone or conjugated to CpG oligodeoxynucleotide (CpG ODN). Conjugated antibodies were tested for their ability to elicit ADCC in vitro and in vivo against pancreatic cancer cells. NK cells cultured in the presence of immobilized CpG ODN, HMFG-2 Ab, or CpG ODN-conjugated HMFG-2 Ab were able to up-regulate perforin similarly. Interestingly, a significant higher ADCC was observed when CpG ODN-conjugated HMFG-2-coated tumor cells were co-cultured with NK cells compared to unconjugated HMFG-2 Ab or CpG ODN alone. Moreover, MyD88-deficient NK cells can perform ADCC in vitro. Furthermore, intratumoral injections of CpG ODN-conjugated HMFG-2 induced a significant reduction in tumor burden in vivo in an established model of pancreatic tumor in nude mice compared to CpG ODN or the HMFG-2 alone. Depletion of macrophages or NK cells before treatment confirmed that both cells were required for the anti-tumor response in vivo. Results also suggest that CpG ODN and HMFG-2 Ab could be sensed by NK cells on the mAb-coated tumor cells triggering enhanced ADCC in vitro and in vivo. PMID:22543528

Phlpp1 facilitates post-traumatic osteoarthritis and is induced by inflammation and promoter demethylation in human osteoarthritis

PubMed Central

Bradley, Elizabeth W.; Carpio, Lomeli R.; McGee-Lawrence, Meghan E.; Becerra, Clara Castillejo; Amanatullah, Derek F.; Ta, Lauren E.; Otero, Miguel; Goldring, Mary B.; Kakar, Sanjeev; Westendorf, Jennifer J.

2016-01-01

OBJECTIVE Osteoarthritis (OA) is the most common form of arthritis and a leading cause of disability. OA is characterized by articular chondrocyte deterioration, subchondral bone changes and debilitating pain. One strategy to promote cartilage regeneration and repair is to accelerate proliferation and matrix production of articular chondrocytes. We previously reported that the protein phosphatase Phlpp1 controls chondrocyte differentiation by regulating the activities of anabolic kinases. Here we examined the role of Phlpp1 in osteoarthritis progression in a murine model. We also assessed PHLPP1 expression and promoter methylation. DESIGN Knee joints of WT and Phlpp1−/− mice were surgically destabilized by transection of the medial meniscal ligament (DMM). Mice were assessed for signs of OA progression via radiographic and histological analyses, and pain assessment for mechanical hypersensitivity using the von Frey assay. Methylation of the PHLPP1 promoter and PHLPP1 expression was evaluated in human articular cartilage and chondrocyte cell lines. RESULTS Following DMM surgeries, Phlpp1 deficient mice showed fewer signs of OA and cartilage degeneration. Mechanical allodynia associated with DMM surgeries was also attenuated in Phlpp1−/− mice. PHLPP1 was highly expressed in human articular cartilage from OA patients, but was undetectable in cartilage specimens from femoral neck fractures. Higher PHLPP1 levels correlated with less PHLPP1 promoter CpG methylation in cartilage from OA patients. Blocking cytosine methylation or treatment with inflammatory mediators enhanced PHLPP1 expression in human chondrocyte cell lines. CONCLUSION Phlpp1 deficiency protects against OA progression while CpG demethylation and inflammatory responses promote PHLPP1 expression. PMID:26746148

Immunostimulatory Properties of Lipid Modified CpG Oligonucleotides.

PubMed

Yu, Chunsong; An, Myunggi; Li, Meng; Liu, Haipeng

2017-08-07

Innate immune responses recognizing pathogen associated molecular patterns play important roles in adaptive immunity. As such, ligands which mimic the conserved products of microbial and activate innate immunity are widely used as adjuvants for vaccines. Synthetic single strand oligodeoxynucleotides (ODNs) containing unmethylated cytosine-guanine (CpG) motifs which bind Toll-like receptor 9 (TLR9) are powerful molecular adjuvants, potentiating both humoral and cellular responses. However, CpG ODN's in vitro potency has not been translated to in vivo settings primarily due to issues associated with delivery and toxicity. A major challenge in clinical application of CpG ODN is the efficient delivery to lymph nodes, the anatomic sites where all the immune responses are initiated. Targeting CpG to the key antigen presenting cells (APC) is essential for its application as a vaccine adjuvant, as it not only enhances CpG's efficacy, but also greatly reduces the systemic toxicity. We recently discovered an "albumin-hitchhiking" approach by which CpG ODNs were conjugated to a lipophilic lipid tail and follow subcutaneous injection, accumulated in lymph nodes by binding and transporting with endogenous albumin. This molecular approach targets CpG to antigen presenting cells in the draining lymph nodes via an endogenous albumin-mediated mechanism and simultaneously improves both the efficacy and safety of CpG as a vaccine adjuvant. Since CpG ODNs can be divided into structurally distinct classes, and each class of CpG ODN activates different types of immune cells and triggers different types of immunostimulatory activities, it is important to thoroughly evaluate the efficacy of this "albumin-hitchhiking" strategy in each class of CpG. Here we compare the immunostimulatory activities of three classes of lipid conjugated CpG ODNs in vitro and in vivo. Three representative sequences of lipid modified CpG ODNs were synthesized and their stimulatory effects as a vaccine adjuvant were evaluated. Our results showed that in vitro, lipid modified class A CpG exhibited enhanced stimulatory activities toward TLR transfected reporter cells or bone-marrow derived dendritic cells, whereas lipid-modification of class B or C CpG reduces the activation of TLR9 by 2-3 fold, as compared with unmodified class B and class C CpG, respectively. However, in vivo coadministration of ovalbumin (OVA) protein antigen mixed with lipid-conjugated class B or C CpG ODNs, but not class A CpGs induced dramatically increased OVA-specific humoral and cytotoxic CD8 + T cells responses compared with OVA mixed with unmodified CpGs. Further, lipid-modification greatly reduces the toxicity associated with CpG by minimizing the systemic dissemination. Taken together, these results demonstrated that amphiphilic modification of three classes of CpG motifs differentially affected and modulated the immunostimulatory activities in vitro and in vivo. Our study highlights the importance of in vivo lymph node targeting of CpG ODNs in fulfilling their use as vaccine adjuvants, providing implications for the rational design of molecular adjuvant for subunit vaccines.

Expression and methylation of BDNF in the human brain in schizophrenia.

PubMed

Cheah, Sern-Yih; McLeay, Robert; Wockner, Leesa F; Lawford, Bruce R; Young, Ross McD; Morris, Charles P; Voisey, Joanne

2017-08-01

To examine the combined effect of the BDNF Val66Met (rs6265) polymorphism and BDNF DNA methylation on transcriptional regulation of the BDNF gene. DNA methylation profiles were generated for CpG sites proximal to Val66Met, within BDNF promoter I and exon V for prefrontal cortex samples from 25 schizophrenia and 25 control subjects. Val66Met genotypes and BDNF mRNA expression data were generated by transcriptome sequencing. Expression, methylation and genotype data were correlated and examined for association with schizophrenia. There was 43% more of the BDNF V-VIII-IX transcript in schizophrenia samples. BDNF mRNA expression and DNA methylation of seven CpG sites were not associated with schizophrenia after accounting for age and PMI effects. BDNF mRNA expression and DNA methylation were not altered by Val66Met after accounting for age and PMI effects. DNA methylation of one CpG site had a marginally significant positive correlation with mRNA expression in schizophrenia subjects. Schizophrenia risk was not associated with differential BDNF mRNA expression and DNA methylation. A larger age-matched cohort with comprehensive clinical history is required to accurately identify the effects of genotype, mRNA expression and DNA methylation on schizophrenia risk.

Local Delivery of the Toll-Like Receptor 9 Ligand CpG Downregulates Host Immune and Inflammatory Responses, Ameliorating Established Leishmania (Viannia) panamensis Chronic Infection

PubMed Central

Fernández, Olga L.; Rodriguez-Pinto, Daniel; Castilho, Tiago M.; Corral Caridad, Maria J.; Goldsmith-Pestana, Karen; Saravia, Nancy Gore; McMahon-Pratt, Diane

2017-01-01

ABSTRACT Infection by Leishmania (Viannia) panamensis, the predominant etiologic agent for cutaneous leishmaniasis in Colombia, is characterized by a chronic mixed inflammatory response. Current treatment options are plagued by toxicity, lengthy treatment regimens, and growing evidence of drug resistance. Immunotherapy, modulating the immune system to mount a protective response, may provide an alternate therapeutic approach. We investigated the ability of the Toll-like receptor 9 (TLR9) ligand CpG to modulate established disease in the L. (V.) panamensis mouse model. Treatment of established infection with a high dose (50 μg) of CpG ameliorated disease and lowered parasite burden. Interestingly, immediately after treatment there was a significant increase in transforming growth factor β (TGF-β) and concomitantly an increase in T regulatory cell (Treg) function. Although a general reduction in cell-mediated immune cytokine and chemokine (gamma interferon [IFN-γ], interleukin 10 [IL-10], IL-13, IL-6, granulocyte-macrophage colony-stimulating factor [GM-CSF], IL-4, and MIP-1α) responses of the treated mice was observed, certain chemokines (RANTES, monocyte chemoattractant protein 1[MCP-1], and IP-10) were increased. Further, in peripheral blood mononuclear cells (PBMCs) from patients with cutaneous leishmaniasis, CpG treatment similarly exhibited a dose-response effect on the production of IFN-γ, IL-17, IL-10, and IL-13, with reductions observed at higher doses. To further understand the underlying mechanisms and cell populations driving the CpG mediated response, we examined the ex vivo dose effects mediated by the TLR9+ cell populations (dendritic cells, macrophages, and B cells) found to accumulate labeled CpG in vivo. Notably, B cells altered the production of IL-17, IL-13, and IFN-γ, supporting a role for B cells functioning as antigen-presenting cells (APCs) and/or regulatory cells during infection. Interestingly, B cells have been previously demonstrated as a primary type of APC in patients infected with L. (V.) panamensis and thus may be useful targets of immunotherapy. Collectively, our results show that CpG-induced immune regulation leads to a dampening of the host immune response and healing in the mouse model, and it may provide an alternate approach to treatment of cutaneous leishmaniasis caused by L. (V.) panamensis. PMID:28052994

Placental surface area mediates the association between FGFR2 methylation in placenta and full-term low birth weight in girls.

PubMed

Tian, Fu-Ying; Wang, Xi-Meng; Xie, Chuanbo; Zhao, Bo; Niu, Zhongzheng; Fan, Lijun; Hivert, Marie-France; Chen, Wei-Qing

2018-01-01

Fibroblast growth factor receptor 2 ( FGFR2 ) gene encodes a protein of the fibroblast growth factor receptor family. FGFR2 gene expression is associated with the regulation of implantation process of placenta which plays a vital role in fetal growth. DNA methylation is widely known as a mechanism of fetal growth. However, it is unclear whether and how DNA methylation of FGFR2 gene in the placenta is associated with full-term low birth weight. This case-control study aims to explore the links between FGFR2 methylation in placenta and full-term low birth weight and to further examine the mediation effect of placental surface area on this association. We conducted analyses for each of the five valid CpG sites at FGFR2 in 165 mother-baby pairs (86 FT-LBW vs. 79 FT-NBW) and found that per one standard deviation increase in the DNA methylation of CpG 11 at FGFR2 was associated with 1.64-fold higher risk of full-term low birth weight (OR = 1.64, 95% CI = [1.07, 2.52]) and 0.18 standard deviation decrease in placental surface area ( β  = - 0.18; standard error = 0.08, p  = 0.02). The mediation effect of placental surface area on the association between DNA methylation and full-term low birth weight was significant in girls (OR = 1.38, 95% CI = [1.05, 1.80]) but not in boys. The estimated mediation proportion was 48.38%. Our findings suggested that placental surface area mediated the association between DNA methylation of FGFR2 in placenta and full-term low birth weight in a sex-specific manner. Our study supported the importance of placental epigenetic changes in placental development and fetal growth.

Mechanism of Mitochondrial Transcription Factor A Attenuation of CpG-Induced Antibody Production

PubMed Central

Saifee, Jessica F.; Torres, Raul M.; Janoff, Edward N.

2016-01-01

Mitochondrial transcription factor A (TFAM) had previously been shown to act as a damage associated molecular pattern with the ability to enhance CpG-A phosphorothioate oligodeoxynucleotide (ODN)-mediated stimulation of IFNα production from human plasmacytoid dendritic cells. Examination of the mechanism by which TFAM might influence CpG ODN mediated innate immune responses revealed that TFAM binds directly, tightly and selectively to the structurally related CpG-A, -B, and -C ODN. TFAM also modulated the ability of the CpG-B or -C to stimulate the production of antibodies from human B cells. TFAM showed a dose-dependent modulation of CpG-B, and -C -induced antibody production from human B cells in vitro, with enhancement of high dose and inhibition of low doses of CpG stimulation. This effect was linked to the ability of TFAM to directly inhibit the binding of CpG ODNs to B cells, in a manner consistent with the relative binding affinities of TFAM for the ODNs. These data suggest that TFAM alters the free concentration of the CpG available to stimulate B cells by sequestering this ODN in a TFAM-CpG complex. Thus, TFAM has the potential to decrease the pathogenic consequences of exposure to natural CpG-like hypomethylated DNA in vivo, as well as such as that found in traumatic injury, infection, autoimmune disease and during pregnancy. PMID:27280778

Nightshift work and genome-wide DNA methylation.

PubMed

Bhatti, Parveen; Zhang, Yuzheng; Song, Xiaoling; Makar, Karen W; Sather, Cassandra L; Kelsey, Karl T; Houseman, E Andres; Wang, Pei

2015-02-01

The negative health effects of shift work, including carcinogenesis, may be mediated by changes in DNA methylation, particularly in the circadian genes. Using the Infinium HumanMethylation450 Bead Array (Illumina, San Diego, CA), we compared genome-wide methylation between 65 actively working dayshift workers and 59 actively working nightshift workers in the healthcare industry. A total of 473 800 loci, including 391 loci across the 12 core circadian genes, were analyzed to identify methylation markers associated with shift work status using linear regression models adjusted for gender, age, body mass index, race, smoking status and leukocyte cell profile as measured by flow cytometry. Analyses at the level of gene, CpG island and gene region were also conducted. To account for multiple comparisons, we controlled the false discovery rate (FDR ≤0.05). Significant differences between nightshift and dayshift workers were found at 16 135 of 473 800 loci, across 3769 of 20 164 genes, across 7173 of 22 721 CpG islands and across 5508 of 51 843 gene regions. For each significant loci, gene, CpG island or gene region, average methylation was consistently found to be decreased among nightshift workers compared to dayshift workers. Twenty-one loci located in the circadian genes were also found to be significantly hypomethylated among nightshift workers. The largest differences were observed for three loci located in the gene body of PER3. A total of nine significant loci were found in the CSNK1E gene, most of which were located in a CpG island and near the transcription start site of the gene. Methylation changes in these circadian genes may lead to altered expression of these genes which has been associated with cancer in previous studies. Gene ontology enrichment analysis revealed that among the significantly hypomethylated genes, processes related to host defense and immunity were represented. Our results indicate that the health effects of shift work may be mediated by hypomethylation of a wide variety of genes, including those related to circadian rhythms. While these findings need to be followed-up among a considerably expanded group of shift workers, the data generated by this study supports the need for future targeted research into the potential impacts of shift work on specific carcinogenic mechanisms.

Preliminary evaluation of cytosine-phosphate-guanine oligodeoxynucleotides bound to gelatine nanoparticles as immunotherapy for canine atopic dermatitis.

PubMed

Wagner, I; Geh, K J; Hubert, M; Winter, G; Weber, K; Classen, J; Klinger, C; Mueller, R S

2017-07-29

Cytosine-phosphate-guanine oligodeoxynucleotides (CpG ODN) are a promising new immunotherapeutic treatment option for canine atopic dermatitis (AD). The aim of this uncontrolled pilot study was to evaluate clinical and immunological effects of gelatine nanoparticle (GNP)-bound CpG ODN (CpG GNP) on atopic dogs. Eighteen dogs with AD were treated for 8 weeks (group 1, n=8) or 18 weeks (group 2, n=10). Before inclusion and after 2 weeks, 4 weeks, 6 weeks (group 1+2), 8 weeks, 12 weeks and 16 weeks (group 2) 75 µg CpG ODN/dog (bound to 1.5 mg GNP) were injected subcutaneously. Pruritus was evaluated daily by the owner. Lesions were evaluated and serum concentrations and mRNA expressions of interferon-γ, tumour necrosis factor-α, transforming growth factor-β, interleukin (IL) 10 and IL-4 (only mRNA expression) were determined at inclusion and after 8 weeks (group 1+2) and 18 weeks (group 2). Lesions and pruritus improved significantly from baseline to week 8. Mean improvements from baseline to week 18 were 23 per cent and 44 per cent for lesions and pruritus, respectively, an improvement of ≥50 per cent was seen in six out of nine and three out of six dogs, respectively. IL-4 mRNA expression decreased significantly. The results of this study show a clinical improvement of canine AD with CpG GNP comparable to allergen immunotherapy. Controlled studies are needed to confirm these findings. British Veterinary Association.

Modulation of aerial respiratory behaviour in a pond snail.

PubMed

Lukowiak, Ken; Martens, Kara; Orr, Mike; Parvez, Kashif; Rosenegger, David; Sangha, Susan

2006-11-01

Aerial respiratory in Lymnaea is driven by a three-neuron CPG whose sufficiency and necessity has been directly demonstrated. While this CPG is 'hard-wired' it displays a tremendous amount of plasticity. That is, it is possible by employing specific training procedures to alter how it functions in a specific hypoxic environment. Thus, it is possible to study directly the causal mechanisms of long-term memory formation, forgetting, and modulation of the memory at a single cell level. Thus, it is possible to use a relatively simple three-neuron CPG to study not only important questions concerning regulation of important homeostatic mechanisms but to also use it to study how learning and non-declarative memory are mediated at a cellular level.

CpG oligodeoxynucleotides containing GACGTT motifs enhance the immune responses elicited by a goose parvovirus vaccine in ducks.

PubMed

Lee, Jai-Wei; Lin, Yu-Ming; Yen, Ting-Ying; Yang, Wen-Jen; Chu, Chun-Yen

2010-11-23

Recombinant parvovirus VP2 (rVP2) was formulated with different types of adjuvant, including aluminum adjuvant and CpG oligodeoxynucleotides (ODNs), and the immunological responses after vaccination in ducks were examined. In comparison with the control group, production of rVP2-specific antibodies, expression of cytokines in peripheral blood mononuclear cells (PBMC) stimulated by rVP2, and percentage of CD4(+)/CD8(+) cells in PBMC were significantly increased in ducks immunized with rVP2 formulated with CpG ODNs containing 3 copies of GACGTT motif. CpG ODNs with GACGTT motifs might be used to improve the efficacy of vaccines for ducks. Copyright © 2010 Elsevier Ltd. All rights reserved.

Western environment/lifestyle is associated with increased genome methylation and decreased gene expression in Chinese immigrants living in Australia.

PubMed

Zhang, Guicheng; Wang, Kui; Schultz, Ennee; Khoo, Siew-Kim; Zhang, Xiaopeng; Annamalay, Alicia; Laing, Ingrid A; Hales, Belinda J; Goldblatt, Jack; Le Souëf, Peter N

2016-01-01

Several human diseases and conditions are disproportionally distributed in the world with a significant "Western-developed" vs. "Eastern-developing" gradient. We compared genome-wide DNA methylation of peripheral blood mononuclear cells in 25 newly arrived Chinese immigrants living in a Western environment for less than 6 months ("Newly arrived") with 23 Chinese immigrants living in the Western environment for more than two years ("Long-term") with a mean of 8.7 years, using the Infinium HumanMethylation450 BeadChip. In a sub-group of both subject groups (n = 12 each) we also investigated genome-wide gene expression using a Human HT-12 v4 expression beadChip. There were 62.5% probes among the total number of 382,250 valid CpG sites with greater mean Beta (β) in "Long-term" than in "Newly arrived". In the regions of CpG islands and gene promoters, compared with the CpG sites in all other regions, lower percentages of CpG sites with mean methylation levels in "Long-term" greater than "Newly arrived" were observed, but still >50%. The increase of methylation was associated with a general decrease of gene expression in Chinese immigrants living in the Western environment for a longer period of time. After adjusting for age, gender and other confounding factors the findings remained. Chinese immigrants living in Australia for a longer period of time have increased overall genome methylation and decreased overall gene expression compared with newly arrived immigrants. © 2015 Wiley Periodicals, Inc.

Association of the CpG Methylation Pattern of the Proximal Insulin Gene Promoter with Type 1 Diabetes

PubMed Central

Fradin, Delphine; Le Fur, Sophie; Mille, Clémence; Naoui, Nadia; Groves, Chris; Zelenika, Diana; McCarthy, Mark I.; Lathrop, Mark; Bougnères, Pierre

2012-01-01

The insulin (INS) region is the second most important locus associated with Type 1 Diabetes (T1D). The study of the DNA methylation pattern of the 7 CpGs proximal to the TSS in the INS gene promoter revealed that T1D patients have a lower level of methylation of CpG -19, -135 and -234 (p = 2.10−16) and a higher methylation of CpG -180 than controls, while methylation was comparable for CpG -69, -102, -206. The magnitude of the hypomethylation relative to a control population was 8–15% of the corresponding levels in controls and was correlated in CpGs -19 and -135 (r = 0.77) and CpG -135 and -234 (r = 0.65). 70/485 (14%) of T1D patients had a simultaneous decrease in methylation of CpG -19, -135, -234 versus none in 317 controls. CpG methylation did not correlate with glycated hemoglobin or with T1D duration. The methylation of CpG -69, -102, -180, -206, but not CpG -19, -135, -234 was strongly influenced by the cis-genotype at rs689, a SNP known to show a strong association with T1D. We hypothesize that part of this genetic association could in fact be mediated at the statistical and functional level by the underlying changes in neighboring CpG methylation. Our observation of a CpG-specific, locus-specific methylation pattern, although it can provide an epigenetic biomarker of a multifactorial disease, does not indicate whether the reported epigenetic pattern preexists or follows the establishment of T1D. To explore the effect of chronic hyperglycemia on CpG methylation, we studied non obese patients with type 2 diabetes (T2D) who were found to have decreased CpG-19 methylation versus age-matched controls, similar to T1D (p = 2.10−6) but increased CpG-234 methylation (p = 5.10−8), the opposite of T1D. The causality and natural history of the different epigenetic changes associated with T1D or T2D remain to be determined. PMID:22567146

EG-05COMBINATION OF GENE COPY GAIN AND EPIGENETIC DEREGULATION ARE ASSOCIATED WITH THE ABERRANT EXPRESSION OF A STEM CELL RELATED HOX-SIGNATURE IN GLIOBLASTOMA

PubMed Central

Kurscheid, Sebastian; Bady, Pierre; Sciuscio, Davide; Samarzija, Ivana; Shay, Tal; Vassallo, Irene; Van Criekinge, Wim; Domany, Eytan; Stupp, Roger; Delorenzi, Mauro; Hegi, Monika

2014-01-01

We previously reported a stem cell related HOX gene signature associated with resistance to chemo-radiotherapy (TMZ/RT- > TMZ) in glioblastoma. However, underlying mechanisms triggering overexpression remain mostly elusive. Interestingly, HOX genes are neither involved in the developing brain, nor expressed in normal brain, suggestive of an acquired gene expression signature during gliomagenesis. HOXA genes are located on CHR 7 that displays trisomy in most glioblastoma which strongly impacts gene expression on this chromosome, modulated by local regulatory elements. Furthermore we observed more pronounced DNA methylation across the HOXA locus as compared to non-tumoral brain (Human methylation 450K BeadChip Illumina; 59 glioblastoma, 5 non-tumoral brain sampes). CpG probes annotated for HOX-signature genes, contributing most to the variability, served as input into the analysis of DNA methylation and expression to identify key regulatory regions. The structural similarity of the observed correlation matrices between DNA methylation and gene expression in our cohort and an independent data-set from TCGA (106 glioblastoma) was remarkable (RV-coefficient, 0.84; p-value < 0.0001). We identified a CpG located in the promoter region of the HOXA10 locus exerting the strongest mean negative correlation between methylation and expression of the whole HOX-signature. Applying this analysis the same CpG emerged in the external set. We then determined the contribution of both, gene copy aberration (CNA) and methylation at the selected probe to explain expression of the HOX-signature using a linear model. Statistically significant results suggested an additive effect between gene dosage and methylation at the key CpG identified. Similarly, such an additive effect was also observed in the external data-set. Taken together, we hypothesize that overexpression of the stem-cell related HOX signature is triggered by gain of trisomy 7 and escape from compensatory DNA methylation at positions controlling the effect of enhanced gene dose on expression.

Activation of plasmacytoid dendritic cells with TLR9 agonists initiates invariant NKT cell-mediated cross-talk with myeloid dendritic cells.

PubMed

Montoya, Carlos J; Jie, Hyun-Bae; Al-Harthi, Lena; Mulder, Candice; Patiño, Pablo J; Rugeles, María T; Krieg, Arthur M; Landay, Alan L; Wilson, S Brian

2006-07-15

CD1d-restricted invariant NK T (iNKT) cells and dendritic cells (DCs) have been shown to play crucial roles in various types of immune responses, including TLR9-dependent antiviral responses initiated by plasmacytoid DCs (pDCs). However, the mechanism by which this occurs is enigmatic because TLRs are absent in iNKT cells and human pDCs do not express CD1d. To explore this process, pDCs were activated with CpG oligodeoxyribonucleotides, which stimulated the secretion of several cytokines such as type I and TNF-alpha. These cytokines and other soluble factors potently induced the expression of activation markers on iNKT cells, selectively enhanced double-negative iNKT cell survival, but did not induce their expansion or production of cytokines. Notably, pDC-derived factors licensed iNKT cells to respond to myeloid DCs: an important downstream cellular target of iNKT cell effector function and a critical contributor to the initiation of adaptive immune responses. This interaction supports the notion that iNKT cells can mediate cross-talk between DC subsets known to express mutually exclusive TLR and cytokine profiles.

Methylation detection oligonucleotide microarray analysis: a high-resolution method for detection of CpG island methylation

PubMed Central

Kamalakaran, Sitharthan; Kendall, Jude; Zhao, Xiaoyue; Tang, Chunlao; Khan, Sohail; Ravi, Kandasamy; Auletta, Theresa; Riggs, Michael; Wang, Yun; Helland, Åslaug; Naume, Bjørn; Dimitrova, Nevenka; Børresen-Dale, Anne-Lise; Hicks, Jim; Lucito, Robert

2009-01-01

Methylation of CpG islands associated with genes can affect the expression of the proximal gene, and methylation of non-associated CpG islands correlates to genomic instability. This epigenetic modification has been shown to be important in many pathologies, from development and disease to cancer. We report the development of a novel high-resolution microarray that detects the methylation status of over 25 000 CpG islands in the human genome. Experiments were performed to demonstrate low system noise in the methodology and that the array probes have a high signal to noise ratio. Methylation measurements between different cell lines were validated demonstrating the accuracy of measurement. We then identified alterations in CpG islands, both those associated with gene promoters, as well as non-promoter-associated islands in a set of breast and ovarian tumors. We demonstrate that this methodology accurately identifies methylation profiles in cancer and in principle it can differentiate any CpG methylation alterations and can be adapted to analyze other species. PMID:19474344

DNA-inorganic hybrid nanovaccine for cancer immunotherapy

NASA Astrophysics Data System (ADS)

Zhu, Guizhi; Liu, Yijing; Yang, Xiangyu; Kim, Young-Hwa; Zhang, Huimin; Jia, Rui; Liao, Hsien-Shun; Jin, Albert; Lin, Jing; Aronova, Maria; Leapman, Richard; Nie, Zhihong; Niu, Gang; Chen, Xiaoyuan

2016-03-01

Cancer evolves to evade or compromise the surveillance of the immune system, and cancer immunotherapy aims to harness the immune system in order to inhibit cancer development. Unmethylated CpG dinucleotide-containing oligonucleotides (CpG), a class of potent adjuvants that activate the toll-like receptor 9 (TLR9) located in the endolysosome of many antigen-presenting cells (APCs), are promising for cancer immunotherapy. However, clinical application of synthetic CpG confronts many challenges such as suboptimal delivery into APCs, unfavorable pharmacokinetics caused by limited biostability and short in vivo half-life, and side effects associated with leaking of CpG into the systemic circulation. Here we present DNA-inorganic hybrid nanovaccines (hNVs) for efficient uptake into APCs, prolonged tumor retention, and potent immunostimulation and cancer immunotherapy. hNVs were self-assembled from concatemer CpG analogs and magnesium pyrophosphate (Mg2PPi). Mg2PPi renders hNVs resistant to nuclease degradation and thermal denaturation, both of which are demanding characteristics for effective vaccination and the storage and transportation of vaccines. Fluorophore-labeled hNVs were tracked to be efficiently internalized into the endolysosomes of APCs, where Mg2PPi was dissolved in an acidic environment and thus CpG analogs were exposed to hNVs. Internalized hNVs in APCs led to (1) elevated secretion of proinflammatory factors, and (2) elevated expression of co-stimulatory factors. Compared with molecular CpG, hNVs dramatically prolonged the tissue retention of CpG analogs and reduced splenomegaly, a common side effect of CpG. In a melanoma mouse model, two injections of hNVs significantly inhibited the tumor growth and outperformed the molecular CpG. These results suggest hNVs are promising for cancer immunotherapy.Cancer evolves to evade or compromise the surveillance of the immune system, and cancer immunotherapy aims to harness the immune system in order to inhibit cancer development. Unmethylated CpG dinucleotide-containing oligonucleotides (CpG), a class of potent adjuvants that activate the toll-like receptor 9 (TLR9) located in the endolysosome of many antigen-presenting cells (APCs), are promising for cancer immunotherapy. However, clinical application of synthetic CpG confronts many challenges such as suboptimal delivery into APCs, unfavorable pharmacokinetics caused by limited biostability and short in vivo half-life, and side effects associated with leaking of CpG into the systemic circulation. Here we present DNA-inorganic hybrid nanovaccines (hNVs) for efficient uptake into APCs, prolonged tumor retention, and potent immunostimulation and cancer immunotherapy. hNVs were self-assembled from concatemer CpG analogs and magnesium pyrophosphate (Mg2PPi). Mg2PPi renders hNVs resistant to nuclease degradation and thermal denaturation, both of which are demanding characteristics for effective vaccination and the storage and transportation of vaccines. Fluorophore-labeled hNVs were tracked to be efficiently internalized into the endolysosomes of APCs, where Mg2PPi was dissolved in an acidic environment and thus CpG analogs were exposed to hNVs. Internalized hNVs in APCs led to (1) elevated secretion of proinflammatory factors, and (2) elevated expression of co-stimulatory factors. Compared with molecular CpG, hNVs dramatically prolonged the tissue retention of CpG analogs and reduced splenomegaly, a common side effect of CpG. In a melanoma mouse model, two injections of hNVs significantly inhibited the tumor growth and outperformed the molecular CpG. These results suggest hNVs are promising for cancer immunotherapy. Electronic supplementary information (ESI) available: ESI materials and methods, characterization of hNVs. See DOI: 10.1039/c5nr08821f

Mechanisms of stress in the brain.

PubMed

McEwen, Bruce S; Bowles, Nicole P; Gray, Jason D; Hill, Matthew N; Hunter, Richard G; Karatsoreos, Ilia N; Nasca, Carla

2015-10-01

The brain is the central organ involved in perceiving and adapting to social and physical stressors via multiple interacting mediators, from the cell surface to the cytoskeleton to epigenetic regulation and nongenomic mechanisms. A key result of stress is structural remodeling of neural architecture, which may be a sign of successful adaptation, whereas persistence of these changes when stress ends indicates failed resilience. Excitatory amino acids and glucocorticoids have key roles in these processes, along with a growing list of extra- and intracellular mediators that includes endocannabinoids and brain-derived neurotrophic factor (BDNF). The result is a continually changing pattern of gene expression mediated by epigenetic mechanisms involving histone modifications and CpG methylation and hydroxymethylation as well as by the activity of retrotransposons that may alter genomic stability. Elucidation of the underlying mechanisms of plasticity and vulnerability of the brain provides a basis for understanding the efficacy of interventions for anxiety and depressive disorders as well as age-related cognitive decline.

Immunostimulatory CpG on Carbon Nanotubes Selectively Inhibits Migration of Brain Tumor Cells.

PubMed

Alizadeh, Darya; White, Ethan E; Sanchez, Teresa C; Liu, Shunan; Zhang, Leying; Badie, Behnam; Berlin, Jacob M

2018-05-16

Even when treated with aggressive current therapies, patients with glioblastoma usually survive less than two years and exhibit a high rate of recurrence. CpG is an oligonucleotide that activates the innate immune system via Toll-like receptor 9 (TLR9) activation. Injection of CpG into glioblastoma tumors showed promise as an immunotherapy in mouse models but proved disappointing in human trials. One aspect of glioma that is not addressed by CpG therapy alone is the highly invasive nature of glioma cells, which is associated with resistance to radiation and chemotherapy. Here, we demonstrate that single-walled carbon nanotubes noncovalently functionalized with CpG (SWNT/CpG), which retain the immunostimulatory property of the CpG, selectively inhibit the migration of glioma cells and not macrophages without affecting cell viability or proliferation. SWNT/CpG also selectively decreased NF-κB activation in glioma cells, while activating macrophages by induction of the TLR9/NF-κB pathway, as we have previously reported. The migration inhibition of glioma cells was correlated with selective reduction of intracellular levels of reactive oxygen species (ROS), suggesting that an antioxidant-based mechanism mediates the observed effects. To the best of our knowledge, SWNT/CpG is the first nanomaterial that inhibits the migration of cancer cells while stimulating the immune system.

DNA-inorganic hybrid nanovaccine for cancer immunotherapy.

PubMed

Zhu, Guizhi; Liu, Yijing; Yang, Xiangyu; Kim, Young-Hwa; Zhang, Huimin; Jia, Rui; Liao, Hsien-Shun; Jin, Albert; Lin, Jing; Aronova, Maria; Leapman, Richard; Nie, Zhihong; Niu, Gang; Chen, Xiaoyuan

2016-03-28

Cancer evolves to evade or compromise the surveillance of the immune system, and cancer immunotherapy aims to harness the immune system in order to inhibit cancer development. Unmethylated CpG dinucleotide-containing oligonucleotides (CpG), a class of potent adjuvants that activate the toll-like receptor 9 (TLR9) located in the endolysosome of many antigen-presenting cells (APCs), are promising for cancer immunotherapy. However, clinical application of synthetic CpG confronts many challenges such as suboptimal delivery into APCs, unfavorable pharmacokinetics caused by limited biostability and short in vivo half-life, and side effects associated with leaking of CpG into the systemic circulation. Here we present DNA-inorganic hybrid nanovaccines (hNVs) for efficient uptake into APCs, prolonged tumor retention, and potent immunostimulation and cancer immunotherapy. hNVs were self-assembled from concatemer CpG analogs and magnesium pyrophosphate (Mg2PPi). Mg2PPi renders hNVs resistant to nuclease degradation and thermal denaturation, both of which are demanding characteristics for effective vaccination and the storage and transportation of vaccines. Fluorophore-labeled hNVs were tracked to be efficiently internalized into the endolysosomes of APCs, where Mg2PPi was dissolved in an acidic environment and thus CpG analogs were exposed to hNVs. Internalized hNVs in APCs led to (1) elevated secretion of proinflammatory factors, and (2) elevated expression of co-stimulatory factors. Compared with molecular CpG, hNVs dramatically prolonged the tissue retention of CpG analogs and reduced splenomegaly, a common side effect of CpG. In a melanoma mouse model, two injections of hNVs significantly inhibited the tumor growth and outperformed the molecular CpG. These results suggest hNVs are promising for cancer immunotherapy.

The Adjuvant LT-K63 Can Restore Delayed Maturation of Follicular Dendritic Cells and Poor Persistence of Both Protein- and Polysaccharide-Specific Antibody-Secreting Cells in Neonatal Mice

PubMed Central

Bjarnarson, Stefania P.; Adarna, Brenda C.; Benonisson, Hreinn; Del Giudice, Giuseppe

2012-01-01

Ab responses in early life are low and short-lived; therefore, induction of protective immunity requires repeated vaccinations. One of the major limitations in early-life immunity is delayed maturation of follicular dendritic cells (FDCs), which play a central role in mediating the germinal center (GC) reaction leading to production of Ab-secreting cells (AbSCs). We assessed whether a nontoxic mutant of Escherichia coli heat-labile enterotoxin (LT-K63) and CpG1826 as model adjuvants could accelerate FDC maturation and immune response in neonatal mice, using a pneumococcal polysaccharide of serotype 1 conjugated to tetanus toxoid (Pnc1-TT) as a model vaccine. In neonatal NMRI mice, a single dose of Pnc1-TT coadministered with LT-K63 enhanced Pnc1-TT–induced GC reaction. In contrast, CpG1826 had no effect. Accordingly, LT-K63, but not CpG1826, accelerated the maturation of FDC networks, detected by FDC-M2+ staining, characteristic for adult-like FDCs. This coincided with migration of MOMA-1+ macrophages into the GCs that can enhance GC reaction and B cell activation. The FDC-M2+ FDC networks colocalized with enhanced expression of TNF-α, which is critical for the maintenance of mature FDCs and is poorly expressed in neonates. The accelerated maturation of FDC networks correlated with increased frequency and prolonged persistence of polysaccharide- and protein-specific IgG+ AbSCs in spleen and bone marrow. Our data show for the first time, to our knowledge, that an adjuvant (LT-K63) can overcome delayed maturation of FDCs in neonates, enhance the GC reaction, and prolong the persistence of vaccine-specific AbSCs in the BM. These properties are attractive for parenteral vaccination in early life. PMID:22753937

Immortalization of T-cells is accompanied by gradual changes in CpG methylation resulting in a profile resembling a subset of T-cell leukemias.

PubMed

Degerman, Sofie; Landfors, Mattias; Siwicki, Jan Konrad; Revie, John; Borssén, Magnus; Evelönn, Emma; Forestier, Erik; Chrzanowska, Krystyna H; Rydén, Patrik; Keith, W Nicol; Roos, Göran

2014-07-01

We have previously described gene expression changes during spontaneous immortalization of T-cells, thereby identifying cellular processes important for cell growth crisis escape and unlimited proliferation. Here, we analyze the same model to investigate the role of genome-wide methylation in the immortalization process at different time points pre-crisis and post-crisis using high-resolution arrays. We show that over time in culture there is an overall accumulation of methylation alterations, with preferential increased methylation close to transcription start sites (TSSs), islands, and shore regions. Methylation and gene expression alterations did not correlate for the majority of genes, but for the fraction that correlated, gain of methylation close to TSS was associated with decreased gene expression. Interestingly, the pattern of CpG site methylation observed in immortal T-cell cultures was similar to clinical T-cell acute lymphoblastic leukemia (T-ALL) samples classified as CpG island methylator phenotype positive. These sites were highly overrepresented by polycomb target genes and involved in developmental, cell adhesion, and cell signaling processes. The presence of non-random methylation events in in vitro immortalized T-cell cultures and diagnostic T-ALL samples indicates altered methylation of CpG sites with a possible role in malignant hematopoiesis. Copyright © 2014 Neoplasia Press, Inc. Published by Elsevier Inc. All rights reserved.

Radiolabelling of glycosylated MFE-23::CPG2 fusion protein (MFECP1) with 99mTc for quantitation of tumour antibody-enzyme localisation in antibody-directed enzyme pro-drug therapy (ADEPT).

PubMed

Francis, R J; Mather, S J; Chester, K; Sharma, S K; Bhatia, J; Pedley, R B; Waibel, R; Green, A J; Begent, R H J

2004-08-01

MFECP1 is a glycosylated recombinant fusion protein composed of MFE-23, a high-affinity anti-carcinoembryonic antigen (CEA) single chain Fv (scFv), fused to the enzyme carboxypeptidase G2 (CPG2), and has been constructed for use in antibody-directed enzyme pro-drug therapy (ADEPT). Radiolabelling of glycosylated MFECP1 with technetium-99m was developed for the purpose of determining tumour localisation of MFECP1 in a phase I ADEPT clinical study. The method used was 99mTc-carbonyl [99mTc(H2O)3(CO)3]+ (abbreviated to TcCO) mediated labelling of 99mTc to the hexahistidine (His) tag of MFECP1. MFECP1 fusion protein was labelled with TcCO under a variety of conditions, and this was shown to be a relatively simple and robust method. Tissue biodistribution was assessed in a CEA-expressing LS174T (human colon carcinoma) nude mouse xenograft model. Tissues were taken at 1, 4 and 6 h for assessment of distribution of radioactivity and for measurement of CPG2 enzyme levels. The amount of radioactivity retained by the tumour proved to be an accurate estimation of actual measured enzyme activity, indicating that this radiolabelling method does not appear to damage the antibody-antigen binding or the enzyme activity of MFECP1. However, correlation between CPG2 enzyme activity and measured radioactivity in liver, spleen and kidney was poor, indicating retention of radioactivity in non-tumour sites but loss of enzyme activity. The high retention of technetium radioisotope in normal tissues may limit the clinical applicability of this radiolabelling method for MFECP1; however, these results suggest that this technique does have applicability for measuring the biodistribution of His-tagged recombinant proteins.

KDM2B links the Polycomb Repressive Complex 1 (PRC1) to recognition of CpG islands

PubMed Central

Farcas, Anca M; Blackledge, Neil P; Sudbery, Ian; Long, Hannah K; McGouran, Joanna F; Rose, Nathan R; Lee, Sheena; Sims, David; Cerase, Andrea; Sheahan, Thomas W; Koseki, Haruhiko; Brockdorff, Neil; Ponting, Chris P; Kessler, Benedikt M; Klose, Robert J

2012-01-01

CpG islands (CGIs) are associated with most mammalian gene promoters. A subset of CGIs act as polycomb response elements (PREs) and are recognized by the polycomb silencing systems to regulate expression of genes involved in early development. How CGIs function mechanistically as nucleation sites for polycomb repressive complexes remains unknown. Here we discover that KDM2B (FBXL10) specifically recognizes non-methylated DNA in CGIs and recruits the polycomb repressive complex 1 (PRC1). This contributes to histone H2A lysine 119 ubiquitylation (H2AK119ub1) and gene repression. Unexpectedly, we also find that CGIs are occupied by low levels of PRC1 throughout the genome, suggesting that the KDM2B-PRC1 complex may sample CGI-associated genes for susceptibility to polycomb-mediated silencing. These observations demonstrate an unexpected and direct link between recognition of CGIs by KDM2B and targeting of the polycomb repressive system. This provides the basis for a new model describing the functionality of CGIs as mammalian PREs. DOI: http://dx.doi.org/10.7554/eLife.00205.001 PMID:23256043

A nebulized gelatin nanoparticle-based CpG formulation is effective in immunotherapy of allergic horses.

PubMed

Klier, John; Fuchs, Sebastian; May, Anna; Schillinger, Ulrike; Plank, Christian; Winter, Gerhard; Coester, Conrad; Gehlen, Heidrun

2012-06-01

In the recent years, nanotechnology has boosted the development of potential drug delivery systems and material engineering on nanoscale basis in order to increase drug specificity and reduce side effects. A potential delivery system for immunostimulating agents such as cytosine-phosphate-guanine-oligodeoxynucleotides (CpG-ODN) needs to be developed to maximize the efficacy of immunotherapy against hypersensitivity. In this study, an aerosol formulation of biodegradable, biocompatible and nontoxic gelatin nanoparticle-bound CpG-ODN 2216 was used to treat equine recurrent airway obstruction in a clinical study. Bronchoalveolar lavage fluid was obtained from healthy and allergic horses to quantify Th1/Th2 cytokine levels before and after inhalation regimen. Full clinical examinations were performed to evaluate the therapeutic potential of this nebulized gelatin nanoparticle-based CpG formulation. Most remarkable was that regulatory anti-inflammatory and anti-allergic cytokine IL-10 expression was significantly triggered by five consecutive inhalations. Thorough assessment of clinical parameters following nanoparticle treatment indicated a partial remission of the allergic condition. Thus this study, for the first time, showed effectiveness of colloidal nanocarrier-mediated immunotherapy in food-producing animals with potential future applicability to other species including humans.

PiiL: visualization of DNA methylation and gene expression data in gene pathways.

PubMed

Moghadam, Behrooz Torabi; Zamani, Neda; Komorowski, Jan; Grabherr, Manfred

2017-08-02

DNA methylation is a major mechanism involved in the epigenetic state of a cell. It has been observed that the methylation status of certain CpG sites close to or within a gene can directly affect its expression, either by silencing or, in some cases, up-regulating transcription. However, a vertebrate genome contains millions of CpG sites, all of which are potential targets for methylation, and the specific effects of most sites have not been characterized to date. To study the complex interplay between methylation status, cellular programs, and the resulting phenotypes, we present PiiL, an interactive gene expression pathway browser, facilitating analyses through an integrated view of methylation and expression on multiple levels. PiiL allows for specific hypothesis testing by quickly assessing pathways or gene networks, where the data is projected onto pathways that can be downloaded directly from the online KEGG database. PiiL provides a comprehensive set of analysis features that allow for quick and specific pattern searches. Individual CpG sites and their impact on host gene expression, as well as the impact on other genes present in the regulatory network, can be examined. To exemplify the power of this approach, we analyzed two types of brain tumors, Glioblastoma multiform and lower grade gliomas. At a glance, we could confirm earlier findings that the predominant methylation and expression patterns separate perfectly by mutations in the IDH genes, rather than by histology. We could also infer the IDH mutation status for samples for which the genotype was not known. By applying different filtering methods, we show that a subset of CpG sites exhibits consistent methylation patterns, and that the status of sites affect the expression of key regulator genes, as well as other genes located downstream in the same pathways. PiiL is implemented in Java with focus on a user-friendly graphical interface. The source code is available under the GPL license from https://github.com/behroozt/PiiL.git .

Phenotype-specific CpG island methylation events in a murine model of prostate cancer.

PubMed

Camoriano, Marta; Kinney, Shannon R Morey; Moser, Michael T; Foster, Barbara A; Mohler, James L; Trump, Donald L; Karpf, Adam R; Smiraglia, Dominic J

2008-06-01

Aberrant DNA methylation plays a significant role in nearly all human cancers and may contribute to disease progression to advanced phenotypes. Study of advanced prostate cancer phenotypes in the human disease is hampered by limited availability of tissues. We therefore took advantage of the Transgenic Adenocarcinoma of Mouse Prostate (TRAMP) model to study whether three different phenotypes of TRAMP tumors (PRIM, late-stage primary tumors; AIP, androgen-independent primary tumors; and MET, metastases) displayed specific patterns of CpG island hypermethylation using Restriction Landmark Genomic Scanning. Each tumor phenotype displayed numerous hypermethylation events, with the most homogeneous methylation pattern in AIP and the most heterogeneous pattern in MET. Several loci displayed a phenotype-specific methylation pattern; the most striking pattern being loci methylated at high frequency in PRIM and AIP but rarely in MET. Examination of the mRNA expression of three genes, BC058385, Goosecoid, and Neurexin 2, which exhibited nonpromoter methylation, revealed increased expression associated with downstream methylation. Only methylated samples showed mRNA expression, in which tumor phenotype was a key factor determining the level of expression. The CpG island in the human orthologue of BC058385 was methylated in human AIP but not in primary androgen-stimulated prostate cancer or benign prostate. The clinical data show a proof-of-principle that the TRAMP model can be used to identify targets of aberrant CpG island methylation relevant to human disease. In conclusion, phenotype-specific hypermethylation events were associated with the overexpression of different genes and may provide new markers of prostate tumorigenesis.

Extensive sequence-influenced DNA methylation polymorphism in the human genome

PubMed Central

2010-01-01

Background Epigenetic polymorphisms are a potential source of human diversity, but their frequency and relationship to genetic polymorphisms are unclear. DNA methylation, an epigenetic mark that is a covalent modification of the DNA itself, plays an important role in the regulation of gene expression. Most studies of DNA methylation in mammalian cells have focused on CpG methylation present in CpG islands (areas of concentrated CpGs often found near promoters), but there are also interesting patterns of CpG methylation found outside of CpG islands. Results We compared DNA methylation patterns on both alleles between many pairs (and larger groups) of related and unrelated individuals. Direct observation and simulation experiments revealed that around 10% of common single nucleotide polymorphisms (SNPs) reside in regions with differences in the propensity for local DNA methylation between the two alleles. We further showed that for the most common form of SNP, a polymorphism at a CpG dinucleotide, the presence of the CpG at the SNP positively affected local DNA methylation in cis. Conclusions Taken together with the known effect of DNA methylation on mutation rate, our results suggest an interesting interdependence between genetics and epigenetics underlying diversity in the human genome. PMID:20497546

DNA activates human immune cells through a CpG sequence-dependent manner

PubMed Central

Bauer, M; Heeg, K; Wagner, H; Lipford, G B

1999-01-01

While bacterial DNA and cytosine–guanosine-dinucleotide-containing oligonucleotides (CpG ODN) are well described activators of murine immune cells, their effect on human cells is inconclusive. We investigated their properties on human peripheral blood mononuclear cells (PBMC) and subsets thereof, such as purified monocytes, T and B cells. Here we demonstrate that bacterial DNA and CpG ODN induce proliferation of B cells, while other subpopulations, such as monocytes and T cells, did not proliferate. PBMC mixed cell cultures, as well as purified monocytes, produced interleukin-6 (IL-6), IL-12 and tumour necrosis factor-α upon stimulation with bacterial DNA; however, only IL-6 and IL-12 secretion became induced upon CpG ODN stimulation. We conclude that monocytes, but not B or T cells, represent the prime source of cytokines. Monocytes up-regulated expression of antigen-presenting, major histocompatibility complex class I and class II molecules in response to CpG DNA. In addition, both monocytes and B cells up-regulate costimulatory CD86 and CD40 molecules. The activation by CpG ODN depended on sequence motifs containing the core dinucleotide CG since destruction of the motif strongly reduced immunostimulatory potential. PMID:10457226

CpG methylation increases the DNA binding of 9-aminoacridine carboxamide Pt analogues.

PubMed

Kava, Hieronimus W; Murray, Vincent

2016-10-01

This study investigated the effect of CpG methylation on the DNA binding of cisplatin analogues with an attached aminoacridine intercalator. DNA-targeted 9-aminoacridine carboxamide Pt complexes are known to bind at 5'-CpG sequences. Their binding to methylated and non-methylated 5'-CpG sequences was determined and compared with cisplatin. The damage profiles of each platinum compound were quantified via a polymerase stop assay with fluorescently labelled primers and capillary electrophoresis. Methylation at 5'-CpG was shown to significantly increase the binding intensity for the 9-aminoacridine carboxamide compounds, whereas no significant increase was found for cisplatin. 5'-CpG methylation had the largest effect on the 9-ethanolamine-acridine carboxamide Pt complex, followed by the 9-aminoacridine carboxamide Pt complex and the 7-fluoro complex. The methylation state of a cell's genome is important in maintaining normal gene expression, and is often aberrantly altered in cancer cells. An analogue of cisplatin which differentially targets methylated DNA may be able to improve its therapeutic activity, or alter its range of targets and evade the chemoresistance which hampers cisplatin efficacy in clinical use. Copyright © 2016 Elsevier Ltd. All rights reserved.

In vitro induction of T regulatory cells by a methylated CpG DNA sequence in humans: Potential therapeutic applications in allergic and autoimmune diseases.

PubMed

Lawless, Oliver J; Bellanti, Joseph A; Brown, Milton L; Sandberg, Kathryn; Umans, Jason G; Zhou, Li; Chen, Weiqian; Wang, Julie; Wang, Kan; Zheng, Song Guo

2018-03-01

Allergic and autoimmune diseases comprise a group of inflammatory disorders caused by aberrant immune responses in which CD25+ Forkhead box P3-positive (FOXP3+) T regulatory (Treg) cells that normally suppress inflammatory events are often poorly functioning. This has stimulated an intensive investigative effort to find ways of increasing Tregs as a method of therapy for these conditions. One such line of investigation includes the study of how ligation of Toll-like receptors (TLRs) by CpG oligonucleotides (ODN) results in an immunostimulatory cascade that leads to induction of T-helper (Th) type 1 and Treg-type immune responses. The present study investigated the mechanisms by which calf thymus mammalian double-stranded DNA (CT-DNA) and a synthetic methylated DNA CpG ODN sequence suppress in vitro lymphoproliferative responses to antigens, mitogens, and alloantigens when measured by [3H]-thymidine incorporation and promote FoxP3 expression in human CD4+ T cells in the presence of transforming growth factor (TGF) beta and interleukin-2 (IL-2). Lymphoproliferative responses of peripheral blood mononuclear cells from four healthy subjects or nine subjects with systemic lupus erythematosus to CT-DNA or phytohemagglutinin (PHA) was measured by tritiated thymidine ([3H]-TdR) incorporation expressed as a stimulation index. Mechanisms of immunosuppressive effects of CT-DNA were evaluated by measurement of the degree of inhibition to lymphoproliferative responses to streptokinase-streptodornase, phytohemagglutinin (PHA), concanavalin A (Con A), pokeweed mitogen (PWM), or alloantigens by a Con A suppressor assay. The effects of CpG methylation on induction of FoxP3 expression in human T cells were measured by comparing inhibitory responses of synthetic methylated and nonmethylated 8-mer CpG ODN sequences by using cell sorting, in vitro stimulation, and suppressor assay. Here, we showed that CT-DNA and a synthetic methylated DNA 8-mer sequence could suppress antigen-, mitogen-, and alloantigen-induced lymphoproliferation in vitro when measured by [3H]-thymidine. The synthetic methylated DNA CpG ODN but not an unmethylated CpG ODN sequence was shown to promote FoxP3 expression in human CD4+ T cells in the presence of TGF beta and IL-2. The induction of FoxP3+ suppressor cells is dose dependent and offers a potential clinical therapeutic application in allergic and autoimmune and inflammatory diseases. The use of this methylated CpG ODN offers a broad clinical application as a novel therapeutic method for Treg induction and, because of its low cost and small size, should facilitate delivery via nasal, respiratory, gastrointestinal routes, and/or by injection, routes of administration important for vaccine delivery to target sites responsible for respiratory, gastrointestinal, and systemic forms of allergic and autoimmune disease.

Adjuvant-Loaded Spiky Gold Nanoparticles for Activation of Innate Immune Cells.

PubMed

Nam, Jutaek; Son, Sejin; Moon, James J

2017-10-01

Gold nanoparticles are versatile carriers for delivery of biomacromolecules. Here, we have developed spiky gold nanoparticles (SGNPs) that can efficiently deliver immunostimulatory agents. Our goal was to develop a platform technology for co-delivery of multiple adjuvant molecules for synergistic stimulation and maturation of innate immune cells. SGNPs were synthesized by a seed-mediated, surfactant-free synthesis method and incorporated with polyinosinic-polycytidylic acid (pIC) and DNA oligonucleotide containing unmethylated CpG motif (CpG) by an electrostatic layer-by-layer approach. Adjuvant-loaded SGNP nano-complexes were examined for their biophysical and biochemical properties and studied for immune activation using bone marrow-derived dendritic cells (BMDCs). We have synthesized SGNPs with branched nano-spikes layered with pIC and/or CpG. Adjuvant-loaded SGNP nano-complexes promoted cellular uptake of the adjuvants. Importantly, we achieved spatio-temporal control over co-delivery of pIC and CpG via SGNPs, which produced synergistic enhancement in cytokine release (IL-6, TNF-α) and upregulation of co-stimulatory markers (CD40, CD80, CD86) in BMDCs, compared with pIC, CpG, or their admixtures. SGNPs serve as a versatile delivery platform that allows flexible and on-demand cargo fabrication for strong activation of innate immune cells.

Genome-wide DNA methylation profiling identifies ALDH1A3 promoter methylation as a prognostic predictor in G-CIMP- primary glioblastoma.

PubMed

Zhang, Wei; Yan, Wei; You, Gan; Bao, Zhaoshi; Wang, Yongzhi; Liu, Yanwei; You, Yongping; Jiang, Tao

2013-01-01

To date, the aberrations in the DNA methylation patterns that are associated with different prognoses of G-CIMP- primary GBMs remain to be elucidated. Here, DNA methylation profiling of primary GBM tissues from 13 long-term survivors (LTS; overall survival ⩾18months) and 20 short-term survivors (STS; overall survival ⩽9months) was performed. Then G-CIMP+ samples were excluded. The differentially expressed CpG loci were identified between residual 18 STS and 9 LTS G-CIMP- samples. Methylation levels of 11 CpG loci (10genes) were statistically significantly lower, and 43 CpG loci (40genes) were statistically significantly higher in the tumor tissues of LTS than those of STS G-CIMP- samples (P<0.01). Of the 43 CpG loci that were hypermethylated in LTS G-CIMP- samples, 3 CpG loci localized in the promoter of ALDH1A3. Furthermore, using an independent validation cohort containing 37 primary GBM samples without IDH1 mutation and MGMT promoter methylation, the hypermethylation status of ALDH1A3 promoter predicted a better prognosis with an accompanied low expression of ALDH1A3 protein. Taken together, our results defined prognosis-related methylation signatures systematically for the first time in G-CIMP- primary GBMs. ALDH1A3 promoter methylation conferred a favorable prognosis in G-CIMP- primary GBMs. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

Identification of Gene Networks Associated with Acute Myeloid Leukemia by Comparative Molecular Methylation and Expression Profiling

PubMed Central

Dellett, Margaret; O’Hagan, Kathleen Ann; Colyer, Hilary Ann Alexandra; Mills, Ken I.

2010-01-01

Around 80% of acute myeloid leukemia (AML) patients achieve a complete remission, however many will relapse and ultimately die of their disease. The association between karyotype and prognosis has been studied extensively and identified patient cohorts as having favourable [e.g. t(8; 21), inv (16)/t(16; 16), t(15; 17)], intermediate [e.g. cytogenetically normal (NK-AML)] or adverse risk [e.g. complex karyotypes]. Previous studies have shown that gene expression profiling signatures can classify the sub-types of AML, although few reports have shown a similar feature by using methylation markers. The global methylation patterns in 19 diagnostic AML samples were investigated using the Methylated CpG Island Amplification Microarray (MCAM) method and CpG island microarrays containing 12,000 CpG sites. The first analysis, comparing favourable and intermediate cytogenetic risk groups, revealed significantly differentially methylated CpG sites (594 CpG islands) between the two subgroups. Mutations in the NPM1 gene occur at a high frequency (40%) within the NK-AML subgroup and are associated with a more favourable prognosis in these patients. A second analysis comparing the NPM1 mutant and wild-type research study subjects again identified distinct methylation profiles between these two subgroups. Network and pathway analysis revealed possible molecular mechanisms associated with the different risk and/or mutation sub-groups. This may result in a better classification of the risk groups, improved monitoring targets, or the identification of novel molecular therapies. PMID:24179384

Dopamine receptor D4 promoter hypermethylation increases the risk of drug addiction.

PubMed

Ji, Huihui; Xu, Xuting; Liu, Guili; Liu, Huifen; Wang, Qinwen; Shen, Wenwen; Li, Longhui; Xie, Xiaohu; Hu, Haochang; Xu, Lei; Zhou, Wenhua; Duan, Shiwei

2018-02-01

Heroin and methylamphetamine (METH) are two addictive drugs that cause serious problems for society. Dopamine receptor D4 (DRD4), a key receptor in the dopaminergic system, may facilitate the development of drug addiction. The aim of the present study was to investigate the association between the promoter methylation level of DRD4 gene and drug addiction. Bisulfite pyrosequencing technology was used to measure the methylation levels of DRD4 promoter in 60 drug addicts and 52 matched controls. Significantly higher levels of DRD4 CpG1 and CpG4 methylation were detected in METH and heroin drug addicts compared with controls (P<0.05). Male METH addicts exhibited significantly higher DRD4 CpG1, CpG2 and CpG4 methylation levels compared with sex-matched controls (P<0.05). In heroin addicts, a positive correlation was observed between depression-dejection and DRD4 CpG5 methylation (r=0.537, P=0.039) whereas there was a negative correlation between drug usage frequency and CpG1 methylation (r=-0.632, P=0.011). In METH addicts, methylation levels were not significantly associated with depression-dejection and drug usage frequency. In addition, luciferase assays demonstrated that the target sequence of the DRD4 promoter upregulates gene expression. The results of the present study suggest that DNA methylation of DRD4 may be responsible for the pathophysiology of drug addiction.

Levels of DNA Methylation Vary at CpG Sites across the BRCA1 Promoter, and Differ According to Triple Negative and "BRCA-Like" Status, in Both Blood and Tumour DNA.

PubMed

Daniels, Sarah L; Burghel, George J; Chambers, Philip; Al-Baba, Shadi; Connley, Daniel D; Brock, Ian W; Cramp, Helen E; Dotsenko, Olena; Wilks, Octavia; Wyld, Lynda; Cross, Simon S; Cox, Angela

2016-01-01

Triple negative breast cancer is typically an aggressive and difficult to treat subtype. It is often associated with loss of function of the BRCA1 gene, either through mutation, loss of heterozygosity or methylation. This study aimed to measure methylation of the BRCA1 gene promoter at individual CpG sites in blood, tumour and normal breast tissue, to assess whether levels were correlated between different tissues, and with triple negative receptor status, histopathological scoring for BRCA-like features and BRCA1 protein expression. Blood DNA methylation levels were significantly correlated with tumour methylation at 9 of 11 CpG sites examined (p<0.0007). The levels of tumour DNA methylation were significantly higher in triple negative tumours, and in tumours with high BRCA-like histopathological scores (10 of 11 CpG sites; p<0.01 and p<0.007 respectively). Similar results were observed in blood DNA (6 of 11 CpG sites; p<0.03 and 7 of 11 CpG sites; p<0.02 respectively). This study provides insight into the pattern of CpG methylation across the BRCA1 promoter, and supports previous studies suggesting that tumours with BRCA1 promoter methylation have similar features to those with BRCA1 mutations, and therefore may be suitable for the same targeted therapies.

Cytosine-phosphate-guanine oligodeoxynucleotides containing GACGTT motifs enhance the immune responses elicited by keyhole limpet hemocyanin antigen in dairy cattle.

PubMed

Chu, Chun-Yen; Lee, Shang-Chun; Liu, Shyh-Shyan; Lin, Yu-Ming; Shen, Perng-Chi; Yu, Chi; Lee, Kuo-Hua; Zhao, Xin; Lee, Jai-Wei

2011-10-01

Adjuvants are important components of vaccine formulations. Effective adjuvants line innate and adaptive immunity by signaling through pathogen recognition receptors. Synthetic cytosine-phosphate-guanine (CpG) oligodeoxynucleotides (ODNs) have been shown to have potentials as adjuvants for vaccines. However, the immunostimulatory effect of CpG is species-specific and depends on the sequence of CpG motifs. A CpG ODN (2135), containing 3 identical copies of GTCGTT motif, was previously reported to have the strongest effects on bovine peripheral blood mononuclear cells (PBMC). Based on the sequence of 2135, we replaced the GTCGTT motif with 11 other sequences containing CG and investigated their effects on bovine lymphocyte proliferation. Results showed that the CpG ODNs containing 3 copies of GACGTT motif had the highest lymphocyte stimulation index (7.91±1.18), which was significantly (P<0.05) higher than that of 2135 (4.25±0.56). The CpG ODNs containing 3 copies of GACGTT motif also significantly increased the mRNA expression of interferon (IFN)-α, interleukin (IL)-12, and IL-21 in bovine PBMC. When dairy cows were immunized with the keyhole limpet hemocyanin (KLH) antigen formulated with CpG ODNs containing 3 copies of GACGTT, production of KLH-specific antibodies in serum and in milk whey was significantly (P<0.05) enhanced. IFN-γ in whole blood stimulated by KLH was also significantly (P<0.05) increased in cows immunized with KLH plus CpG ODNs. Our results indicate that CpG ODNs containing 3 copies of the GACGTT motifs is a potential adjuvant for bovine vaccines.

DNA methylation of the BRD2 promoter is associated with juvenile myoclonic epilepsy in Caucasians.

PubMed

Pathak, Shilpa; Miller, James; Morris, Emily C; Stewart, William C L; Greenberg, David A

2018-05-01

Juvenile myoclonic epilepsy (JME) is a common adolescent-onset genetic generalized epilepsy (GGE) syndrome. Multiple linkage and association studies have found that BRD2 influences the expression of JME. The BRD2-JME connection is further corroborated by our murine model; Brd2 haploinsufficiency produces characteristics that typify the clinical hallmarks of JME. Neither we, nor several large-scale studies of JME, found JME-related BRD2 coding mutations. Therefore, we investigated noncoding BRD2 regions, seeking the origin of BRD2's JME influence. BRD2's promoter harbors a JME-associated single nucleotide polymorphism (rs3918149) and a CpG (C-phosphate-G dinucleotides) island (CpG76), making it a potential "hotspot" for JME-associated epigenetic variants. Methylating promoter CpG sites causes gene silencing, often resulting in reduced gene expression. We tested for differences in DNA methylation at CpG76 in 3 different subgroups: (1) JME patients versus their unaffected family members, (2) JME versus patients with other forms of GGE, and (3) Caucasian versus non-Caucasian JME patients. We used DNA pyrosequencing to analyze the methylation status of 10 BRD2 promoter CpG sites in lymphoblastoid cells from JME patients of Caucasian and non-Caucasian origin, unaffected family members, and also non-JME GGE patients. We also measured global methylation levels and DNA methyl transferase 1 (DNMT1) transcript expression in JME families by standard methods. CpG76 is highly methylated in JME patients compared to unaffected family members. In families with non-JME GGE, we found no relationship between promoter methylation and epilepsy. In non-Caucasian JME families, promoter methylation was mostly not associated with epilepsy. This makes the BRD2 promoter a JME-specific, ethnicity-specific, differentially methylated region. Global methylation was constant across groups. BRD2 promoter methylation in JME, and the lack of methylation in unaffected relatives, in non-JME GGE patients, and in non-Caucasian JME, demonstrate that methylation specificity is a possible seizure susceptibility motif in JME risk and suggests JME therapeutics targeting BRD2. Wiley Periodicals, Inc. © 2018 International League Against Epilepsy.

In utero and lactational exposure of DEHP increases the susceptibility of prostate carcinogenesis in male offspring through PSCA hypomethylation.

PubMed

Xia, Bin; Wang, Yong; Wang, Xiu; Wu, Jianhui; Song, Qi; Sun, Zuyue; Zhang, Yunhui

2018-04-22

As an ubiquitous environmental endocrine disruptor, di(2-ethylhexyl) phthalate (DEHP) has been shown to interfere with the development of reproductive organs and induce pathological changes in prostate. Our previous finding showed that in utero and lactational (IUL) DEHP exposure could disrupt the balance of testosterone and estrogen and increase the susceptibility of prostate carcinogenesis. The purpose of this study is to investigate whether the early-life specific epigenetic modifications could mediate the effect of DEHP exposure on prostate carcinogenesis in rodents, for epigenetic modifications play important roles in regulating prostate carcinogenesis. The pregnant rats were treated with corn oil (negative control) or DEHP at 0.01, 0.1 and 1 mg/kg BW/day from GD7 to PND21. On PND21, the expression and DNA methylation change of six prostate carcinogenesis-related genes (ESR2/GSTP1/NKX3.1/PSCA/PTGS2/Rassf1a) were assessed through SYBR-Green real-time PCR combined with pyrosequencing assay in F1 male offspring. On PND196, the relationship b(STP1, PSCA and PTGS2 in a dose-dependent manner, which were positively correlated with PIN scores, Gleason scores, serum PSA concentrations and negatively correlated with prostate/body weight ratio on PND196. Meanwhile, 1 mg/kg BW/day DEHP markedly reduced DNA methylation level of PSCA in all studied CpG sites. Significant inverse correlations between methylation levels of the promoter CpG site and PSCA mRNA expression were observed. These results indicated that transcriptional changes of GSTP1, PSCA and PTGS2 induced by DEHP exposure might be contribute to the increasing susceptibility of prostate carcinogenesis in late life. Moreover, hypomethylation of PSCA could mediate the effect of DEHP on prostate carcinogenesis in rats. Copyright © 2018 Elsevier B.V. All rights reserved.

Genetic and epigenetic regulation of YKL-40 in childhood.

PubMed

Guerra, Stefano; Melén, Erik; Sunyer, Jordi; Xu, Cheng-Jian; Lavi, Iris; Benet, Marta; Bustamante, Mariona; Carsin, Anne-Elie; Dobaño, Carlota; Guxens, Mònica; Tischer, Christina; Vrijheid, Martine; Kull, Inger; Bergström, Anna; Kumar, Ashish; Söderhäll, Cilla; Gehring, Ulrike; Dijkstra, Dorieke J; van der Vlies, Pieter; Wickman, Magnus; Bousquet, Jean; Postma, Dirkje S; Anto, Josep M; Koppelman, Gerard H

2018-03-01

Circulating levels of the chitinase-like protein YKL-40 are influenced by genetic variation in its encoding gene (chitinase 3-like 1 [CHI3L1]) and are increased in patients with several diseases, including asthma. Epigenetic regulation of circulating YKL-40 early in life is unknown. We sought to determine (1) whether methylation levels at CHI3L1 CpG sites mediate the association of CHI3L1 single nucleotide polymorphisms (SNPs) with YKL-40 levels in the blood and (2) whether these biomarkers (CHI3L1 SNPs, methylation profiles, and YKL-40 levels) are associated with asthma in early childhood. We used data from up to 2405 participants from the Spanish Infancia y Medio Ambiente; the Swedish Barn/Children, Allergy, Milieu, Stockholm, Epidemiological survey; and the Dutch Prevention and Incidence of Asthma and Mite Allergy birth cohorts. Associations between 68 CHI3L1 SNPs, methylation levels at 14 CHI3L1 CpG sites in whole-blood DNA, and circulating YKL-40 levels at 4 years of age were tested by using correlation analysis, multivariable regression, and mediation analysis. Each of these biomarkers was also tested for association with asthma at 4 years of age by using multivariable logistic regression. YKL-40 levels were significantly associated with 7 SNPs and with methylation at 5 CpG sites. Consistent associations between these 7 SNPs (particularly rs10399931 and rs4950928) and 5 CpG sites were observed. Alleles linked to lower YKL-40 levels were associated with higher methylation levels. Participants with high YKL-40 levels (defined as the highest YKL-40 tertile) had increased odds for asthma compared with subjects with low YKL-40 levels (meta-analyzed adjusted odds ratio, 1.90 [95% CI, 1.08-3.36]). In contrast, neither SNPs nor methylation levels at CpG sites in CHI3L1 were associated with asthma. The effects of CHI3L1 genetic variation on circulating YKL-40 levels are partly mediated by methylation profiles. In our study YKL-40 levels, but not CHI3L1 SNPs or methylation levels, were associated with childhood asthma. Copyright © 2017 American Academy of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

VEZF1 Elements Mediate Protection from DNA Methylation

PubMed Central

Strogantsev, Ruslan; Gaszner, Miklos; Hair, Alan; Felsenfeld, Gary; West, Adam G.

2010-01-01

There is growing consensus that genome organization and long-range gene regulation involves partitioning of the genome into domains of distinct epigenetic chromatin states. Chromatin insulator or barrier elements are key components of these processes as they can establish boundaries between chromatin states. The ability of elements such as the paradigm β-globin HS4 insulator to block the range of enhancers or the spread of repressive histone modifications is well established. Here we have addressed the hypothesis that a barrier element in vertebrates should be capable of defending a gene from silencing by DNA methylation. Using an established stable reporter gene system, we find that HS4 acts specifically to protect a gene promoter from de novo DNA methylation. Notably, protection from methylation can occur in the absence of histone acetylation or transcription. There is a division of labor at HS4; the sequences that mediate protection from methylation are separable from those that mediate CTCF-dependent enhancer blocking and USF-dependent histone modification recruitment. The zinc finger protein VEZF1 was purified as the factor that specifically interacts with the methylation protection elements. VEZF1 is a candidate CpG island protection factor as the G-rich sequences bound by VEZF1 are frequently found at CpG island promoters. Indeed, we show that VEZF1 elements are sufficient to mediate demethylation and protection of the APRT CpG island promoter from DNA methylation. We propose that many barrier elements in vertebrates will prevent DNA methylation in addition to blocking the propagation of repressive histone modifications, as either process is sufficient to direct the establishment of an epigenetically stable silent chromatin state. PMID:20062523

Exposure to welding fumes is associated with hypomethylation of the F2RL3 gene: a cardiovascular disease marker

PubMed Central

Hossain, Mohammad B; Li, Huiqi; Hedmer, Maria; Tinnerberg, Håkan; Albin, Maria; Broberg, Karin

2015-01-01

Background Welders are at risk for cardiovascular disease. Recent studies linked tobacco smoke exposure to hypomethylation of the F2RL3 (coagulation factor II (thrombin) receptor-like 3) gene, a marker for cardiovascular disease prognosis and mortality. However, whether welding fumes cause hypomethylation of F2RL3 remains unknown. Methods We investigated 101 welders (median span of working as a welder: 7 years) and 127 unexposed controls (non-welders with no obvious exposure to respirable dust at work), age range 23–60 years, all currently non-smoking, in Sweden. The participants were interviewed about their work history, lifestyle factors and diseases. Personal sampling of respirable dust was performed for the welders. DNA methylation of F2RL3 in blood was assessed by pyrosequencing of four CpG sites, CpG_2 (corresponds to cg03636183) to CpG_5, in F2RL3. Multivariable linear regression analysis was used to assess the association between exposure to welding fumes and F2RL3 methylation. Results Welders had 2.6% lower methylation of CpG_5 than controls (p<0.001). Higher concentrations of measured respirable dust among the welders were associated with hypomethylation of CpG_2, CpG_4 and CpG_5 (β=−0.49 to −1.4, p<0.012); p<0.029 adjusted for age, previous smoking, passive smoking, education, current residence and respirator use. Increasing the number of years working as a welder was associated with hypomethylation of CpG_4 (linear regression analysis, β=−0.11, p=0.039, adjusted for previous smoking). Previous tobacco smokers had 1.5–4.7% (p<0.014) lower methylation of 3 of the 4 CpG sites in F2RL3 (CpG_2, CpG_4 and CpG_5) compared to never-smokers. A non-significant lower risk of cardiovascular disease with more methylation was observed for all CpG sites. Conclusions Welding fumes exposure and previous smoking were associated with F2RL3 hypomethylation. This finding links low-to-moderate exposure to welding fumes to adverse effects on the cardiovascular system, and suggests a potential mechanistic pathway for this link, via epigenetic effects on F2RL3 expression. PMID:26395445

Mediation analysis of alcohol consumption, DNA methylation, and epithelial ovarian cancer.

PubMed

Wu, Dongyan; Yang, Haitao; Winham, Stacey J; Natanzon, Yanina; Koestler, Devin C; Luo, Tiane; Fridley, Brooke L; Goode, Ellen L; Zhang, Yanbo; Cui, Yuehua

2018-03-01

Epigenetic factors and consumption of alcohol, which suppresses DNA methylation, may influence the development and progression of epithelial ovarian cancer (EOC). However, there is a lack of understanding whether these factors interact to affect the EOC risk. In this study, we aimed to gain insight into this relationship by identifying leukocyte-derived DNA methylation markers acting as potential mediators of alcohol-associated EOC. We implemented a causal inference test (CIT) and the VanderWeele and Vansteelandt multiple mediator model to examine CpG sites that mediate the association between alcohol consumption and EOC risk. We modified one step of the CIT by adopting a high-dimensional inference procedure. The data were based on 196 cases and 202 age-matched controls from the Mayo Clinic Ovarian Cancer Case-Control Study. Implementation of the CIT test revealed two CpG sites (cg09358725, cg11016563), which represent potential mediators of the relationship between alcohol consumption and EOC case-control status. Implementation of the VanderWeele and Vansteelandt multiple mediator model further revealed that these two CpGs were the key mediators. Decreased methylation at both CpGs was more common in cases who drank alcohol at the time of enrollment vs. those who did not. cg11016563 resides in TRPC6 which has been previously shown to be overexpressed in EOC. These findings suggest two CpGs may serve as novel biomarkers for EOC susceptibility.

Enhanced early innate and T cell-mediated responses in subjects immunized with Anthrax Vaccine Adsorbed Plus CPG 7909 (AV7909).

PubMed

Minang, Jacob T; Inglefield, Jon R; Harris, Andrea M; Lathey, Janet L; Alleva, David G; Sweeney, Diane L; Hopkins, Robert J; Lacy, Michael J; Bernton, Edward W

2014-11-28

NuThrax™ (Anthrax Vaccine Adsorbed with CPG 7909 Adjuvant) (AV7909) is in development. Samples obtained in a phase Ib clinical trial were tested to confirm biomarkers of innate immunity and evaluate effects of CPG 7909 (PF-03512676) on adaptive immunity. Subjects received two intramuscular doses of commercial BioThrax(®) (Anthrax Vaccine Adsorbed, AVA), or two intramuscular doses of one of four formulations of AV7909. IP-10, IL-6, and C-reactive protein (CRP) levels were elevated 24-48 h after administration of AV7909 formulations, returning to baseline by Day 7. AVA (no CPG 7909) resulted in elevated IL-6 and CRP, but not IP-10. Another marker of CpG, transiently decreased absolute lymphocyte counts (ALCs), correlated with transiently increased IP-10. Cellular recall responses to anthrax protective antigen (PA) or PA peptides were assessed by IFN-γ ELISpot assay performed on cryopreserved PBMCs obtained from subjects prior to immunization and 7 days following the second immunization (study day 21). One-half of subjects that received AV7909 with low-dose (0.25mg/dose) CPG 7909 possessed positive Day 21 T cell responses to PA. In contrast, positive T cell responses occurred at an 11% average rate (1/9) for AVA-treated subjects. Differences in cellular responses due to dose level of CPG 7909 were not associated with differences in humoral anti-PA IgG responses, which were elevated for recipients of AV7909 compared to recipients of AVA. Serum markers at 24 or 48 h (i.e. % ALC decrease, or increase in IL-6, IP-10, or CRP) correlated with the humoral (antibody) responses 1 month later, but did not correlate with cellular ELISpot responses. In summary, biomarkers of early responses to CPG 7909 were confirmed, and adding a CpG adjuvant to a vaccine administered twice resulted in increased T cell effects relative to vaccine alone. Changes in early biomarkers correlated with subsequent adaptive humoral immunity but not cellular immunity. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.

TET1 Depletion Induces Aberrant CpG Methylation in Colorectal Cancer Cells

PubMed Central

Yamamoto, Eiichiro; Harada, Taku; Aoki, Hironori; Maruyama, Reo; Toyota, Mutsumi; Sasaki, Yasushi; Sugai, Tamotsu; Tokino, Takashi; Nakase, Hiroshi

2016-01-01

Aberrant DNA methylation is commonly observed in colorectal cancer (CRC), but the underlying mechanism is not fully understood. 5-hydroxymethylcytosine levels and TET1 expression are both reduced in CRC, while epigenetic silencing of TET1 is reportedly associated with the CpG island methylator phenotype. In the present study, we aimed to clarify the relationship between loss of TET1 and aberrant DNA methylation in CRC. Stable TET1 knockdown clones were established using Colo320DM cells, which express high levels of TET1, and HCT116 cells, which express TET1 at a level similar to that in normal colonic tissue. Infinium HumanMethylation450 BeadChip assays revealed increased levels of 5-methylcytosine at more than 10,000 CpG sites in TET1-depleted Colo320DM cells. Changes in DNA methylation were observed at various positions within the genome, including promoters, gene bodies and intergenic regions, and the altered methylation affected expression of a subset of genes. By contrast, TET1 knockdown did not significantly affect DNA methylation in HCT116 cells. However, TET1 depletion was associated with attenuated effects of 5-aza-2’-deoxycytidine on gene expression profiles in both cell lines. These results suggest that loss of TET1 may induce aberrant DNA methylation and may attenuate the effect of 5-aza-2’-deoxycytidine in CRC cells. PMID:27977763

Restoration of CpG Methylation in The Egf Promoter Region during Rat Liver Regeneration.

PubMed

Deming, Li; Ziwei, Li; Xueqiang, Guo; Cunshuan, Xu

2015-01-01

Epidermal growth factor (EGF) is an important factor for healing after tissue damage in diverse experimental models. It plays an important role in liver regeneration (LR). The objective of this experiment is to investigate the methylation variation of 10 CpG sites in the Egf promoter region and their relevance to Egf expression during rat liver regenera- tion. As a follow up of our previous study, rat liver tissue was collected after rat 2/3 partial hepatectomy (PH) during the re-organization phase (from days 14 to days 28). Liver DNA was extracted and modified by sodium bisulfate. The methylation status of 10 CpG sites in Egf promoter region was determined using bisulfite sequencing polymerase chain reaction (PCR), as BSP method. The results showed that 3 (sites 3, 4 and 9) out of 10 CpG sites have strikingly methylation changes during the re-organization phase compared to the regeneration phase (from 2 hours to 168 hours, P=0.002, 0.048 and 0.018, respectively). Our results showed that methylation modification of CpGs in the Egf promoter region could be restored to the status before PH operation and changes of methylation didn't affect Egf mRNA expression during the re-organization phase.

Next-generation sequencing identifies major DNA methylation changes during progression of Ph+ chronic myeloid leukemia

PubMed Central

Heller, G; Topakian, T; Altenberger, C; Cerny-Reiterer, S; Herndlhofer, S; Ziegler, B; Datlinger, P; Byrgazov, K; Bock, C; Mannhalter, C; Hörmann, G; Sperr, W R; Lion, T; Zielinski, C C; Valent, P; Zöchbauer-Müller, S

2016-01-01

Little is known about the impact of DNA methylation on the evolution/progression of Ph+ chronic myeloid leukemia (CML). We investigated the methylome of CML patients in chronic phase (CP-CML), accelerated phase (AP-CML) and blast crisis (BC-CML) as well as in controls by reduced representation bisulfite sequencing. Although only ~600 differentially methylated CpG sites were identified in samples obtained from CP-CML patients compared with controls, ~6500 differentially methylated CpG sites were found in samples from BC-CML patients. In the majority of affected CpG sites, methylation was increased. In CP-CML patients who progressed to AP-CML/BC-CML, we identified up to 897 genes that were methylated at the time of progression but not at the time of diagnosis. Using RNA-sequencing, we observed downregulated expression of many of these genes in BC-CML compared with CP-CML samples. Several of them are well-known tumor-suppressor genes or regulators of cell proliferation, and gene re-expression was observed by the use of epigenetic active drugs. Together, our results demonstrate that CpG site methylation clearly increases during CML progression and that it may provide a useful basis for revealing new targets of therapy in advanced CML. PMID:27211271

Identification of the physiological promoter for spinocerebellar ataxia 2 gene reveals a CpG island for promoter activity situated into the exon 1 of this gene and provides data about the origin of the nonmethylated state of these types of islands.

PubMed

Aguiar, J; Santurlidis, S; Nowok, J; Alexander, C; Rudnicki, D; Gispert, S; Schulz, W; Auburger, G

1999-01-19

In order to further use the spinocerebellar ataxia 2 (SCA2) promoter for transgenic mice models of "CAG repeat" neurodegeneration, different fragments of this 5' end were ligated into pGL3-Luc plasmid to obtain the better promoter-activity of the physiological promoter for SCA2. Base-par composition of the SCA2-5' region, and promoter prediction algorithms such as TSSW and TSSG, together with the high firefly luciferase expression after 48 hours of transient transfection in mammalian cells lines, showed a typical CpG island for promoter-activity. The promoter activity was specifically localized into the exon 1 of the SCA2 gene. The higher expression of firefly luciferase in the embryonal F9 cells by the use of SCA2 promoter, rather than by the use of CMV promoter may be related with the origin of the nonmethylated CpG island during the early embryogenesis. Analysis of the 5' region from HD gene revealed to a CpG island, which could be containing the physiological promoter for this gene. Copyright 1999 Academic Press.

Restoration of CpG Methylation in The Egf Promoter Region during Rat Liver Regeneration

PubMed Central

Deming, Li; Ziwei, Li; Xueqiang, Guo; Cunshuan, Xu

2015-01-01

Epidermal growth factor (EGF) is an important factor for healing after tissue damage in diverse experimental models. It plays an important role in liver regeneration (LR). The objective of this experiment is to investigate the methylation variation of 10 CpG sites in the Egf promoter region and their relevance to Egf expression during rat liver regenera- tion. As a follow up of our previous study, rat liver tissue was collected after rat 2/3 partial hepatectomy (PH) during the re-organization phase (from days 14 to days 28). Liver DNA was extracted and modified by sodium bisulfate. The methylation status of 10 CpG sites in Egf promoter region was determined using bisulfite sequencing polymerase chain reaction (PCR), as BSP method. The results showed that 3 (sites 3, 4 and 9) out of 10 CpG sites have strikingly methylation changes during the re-organization phase compared to the regeneration phase (from 2 hours to 168 hours, P=0.002, 0.048 and 0.018, respectively). Our results showed that methylation modification of CpGs in the Egf promoter region could be restored to the status before PH operation and changes of methylation didn’t affect Egf mRNA expression during the re-organization phase. PMID:26464832

Global identification of genes regulated by estrogen signaling and demethylation in MCF-7 breast cancer cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Putnik, Milica, E-mail: milica.putnik@ki.se; Zhao, Chunyan, E-mail: chunyan.zhao@ki.se; Gustafsson, Jan-Ake, E-mail: jan-ake.gustafsson@ki.se

Highlights: Black-Right-Pointing-Pointer Estrogen signaling and demethylation can both control gene expression in breast cancers. Black-Right-Pointing-Pointer Cross-talk between these mechanisms is investigated in human MCF-7 breast cancer cells. Black-Right-Pointing-Pointer 137 genes are influenced by both 17{beta}-estradiol and demethylating agent 5-aza-2 Prime -deoxycytidine. Black-Right-Pointing-Pointer A set of genes is identified as targets of both estrogen signaling and demethylation. Black-Right-Pointing-Pointer There is no direct molecular interplay of mediators of estrogen and epigenetic signaling. -- Abstract: Estrogen signaling and epigenetic modifications, in particular DNA methylation, are involved in regulation of gene expression in breast cancers. Here we investigated a potential regulatory cross-talk between thesemore » two pathways by identifying their common target genes and exploring underlying molecular mechanisms in human MCF-7 breast cancer cells. Gene expression profiling revealed that the expression of approximately 140 genes was influenced by both 17{beta}-estradiol (E2) and a demethylating agent 5-aza-2 Prime -deoxycytidine (DAC). Gene ontology (GO) analysis suggests that these genes are involved in intracellular signaling cascades, regulation of cell proliferation and apoptosis. Based on previously reported association with breast cancer, estrogen signaling and/or DNA methylation, CpG island prediction and GO analysis, we selected six genes (BTG3, FHL2, PMAIP1, BTG2, CDKN1A and TGFB2) for further analysis. Tamoxifen reverses the effect of E2 on the expression of all selected genes, suggesting that they are direct targets of estrogen receptor. Furthermore, DAC treatment reactivates the expression of all selected genes in a dose-dependent manner. Promoter CpG island methylation status analysis revealed that only the promoters of BTG3 and FHL2 genes are methylated, with DAC inducing demethylation, suggesting DNA methylation directs repression of these genes in MCF-7 cells. In a further analysis of the potential interplay between estrogen signaling and DNA methylation, E2 treatment showed no effect on the methylation status of these promoters. Additionally, we show that the ER{alpha} recruitment occurs at the FHL2 promoter in an E2- and DAC-independent fashion. In conclusion, we identified a set of genes regulated by both estrogen signaling and DNA methylation. However, our data does not support a direct molecular interplay of mediators of estrogen and epigenetic signaling at promoters of regulated genes.« less

Validation of DAB2IP methylation and its relative significance in predicting outcome in renal cell carcinoma

PubMed Central

Zhao, Liang-Yun; Kapur, Payal; Wu, Kai-Jie; Wang, Bin; Yu, Yan-Hong; Liao, Bing; He, Da-Lin; Chen, Wei; Margulis, Vitaly; Hsieh, Jer-Tsong; Luo, Jun-Hang

2016-01-01

We have recently reported tumor suppressive role of DAB2IP in RCC development. In this study, We identified one CpG methylation biomarker (DAB2IP CpG1) located UTSS of DAB2IP that was associated with poor overall survival in a cohort of 318 ccRCC patients from the Cancer Genome Atlas (TCGA). We further validated the prognostic accuracy of DAB2IP CpG methylation by pyrosequencing quantitative methylation assay in 224 ccRCC patients from multiple Chinese centers (MCHC set), and 239 patients from University of Texas Southwestern Medical Center at Dallas (UTSW set) by using FFPE samples. DAB2IP CpG1 can predict the overall survival of patients in TCGA, MCHC, and UTSW sets independent of patient age, Fuhrman grade and TNM stage (all p<0.05). DAB2IP CpG1 successfully categorized patients into high-risk and low-risk groups with significant differences of clinical outcome in respective clinical subsets, regardless of age, sex, grade, stage, or race (HR: 1.63-7.83; all p<0.05). The detection of DAB2IP CpG1 methylation was minimally affected by ITH in ccRCC. DAB2IP mRNA expression was regulated by DNA methylation in vitro. DAB2IP CpG1 methylation is a practical and repeatable biomarker for ccRCC, which can provide prognostic value that complements the current staging system. PMID:27129174

CpG Distribution and Methylation Pattern in Porcine Parvovirus

PubMed Central

Tóth, Renáta; Mészáros, István; Stefancsik, Rajmund; Bartha, Dániel; Bálint, Ádám; Zádori, Zoltán

2013-01-01

Based on GC content and the observed/expected CpG ratio (oCpGr), we found three major groups among the members of subfamily Parvovirinae: Group I parvoviruses with low GC content and low oCpGr values, Group II with low GC content and high oCpGr values and Group III with high GC content and high oCpGr values. Porcine parvovirus belongs to Group I and it features an ascendant CpG distribution by position in its coding regions similarly to the majority of the parvoviruses. The entire PPV genome remains hypomethylated during the viral lifecycle independently from the tissue of origin. In vitro CpG methylation of the genome has a modest inhibitory effect on PPV replication. The in vitro hypermethylation disappears from the replicating PPV genome suggesting that beside the maintenance DNMT1 the de novo DNMT3a and DNMT3b DNA methyltransferases can’t methylate replicating PPV DNA effectively either, despite that the PPV infection does not seem to influence the expression, translation or localization of the DNA methylases. SNP analysis revealed high mutability of the CpG sites in the PPV genome, while introduction of 29 extra CpG sites into the genome has no significant biological effects on PPV replication in vitro. These experiments raise the possibility that beyond natural selection mutational pressure may also significantly contribute to the low level of the CpG sites in the PPV genome. PMID:24392033

Levels of DNA Methylation Vary at CpG Sites across the BRCA1 Promoter, and Differ According to Triple Negative and “BRCA-Like” Status, in Both Blood and Tumour DNA

PubMed Central

Burghel, George J.; Chambers, Philip; Al-Baba, Shadi; Connley, Daniel D.; Brock, Ian W.; Cramp, Helen E.; Dotsenko, Olena; Wilks, Octavia; Wyld, Lynda; Cross, Simon S.; Cox, Angela

2016-01-01

Triple negative breast cancer is typically an aggressive and difficult to treat subtype. It is often associated with loss of function of the BRCA1 gene, either through mutation, loss of heterozygosity or methylation. This study aimed to measure methylation of the BRCA1 gene promoter at individual CpG sites in blood, tumour and normal breast tissue, to assess whether levels were correlated between different tissues, and with triple negative receptor status, histopathological scoring for BRCA-like features and BRCA1 protein expression. Blood DNA methylation levels were significantly correlated with tumour methylation at 9 of 11 CpG sites examined (p<0.0007). The levels of tumour DNA methylation were significantly higher in triple negative tumours, and in tumours with high BRCA-like histopathological scores (10 of 11 CpG sites; p<0.01 and p<0.007 respectively). Similar results were observed in blood DNA (6 of 11 CpG sites; p<0.03 and 7 of 11 CpG sites; p<0.02 respectively). This study provides insight into the pattern of CpG methylation across the BRCA1 promoter, and supports previous studies suggesting that tumours with BRCA1 promoter methylation have similar features to those with BRCA1 mutations, and therefore may be suitable for the same targeted therapies. PMID:27463681

Paradoxical Role of DNA Methylation in Activation of FoxA2 Gene Expression during Endoderm Development*

PubMed Central

Bahar Halpern, Keren; Vana, Tal; Walker, Michael D.

2014-01-01

The transcription factor FoxA2 is a master regulator of endoderm development and pancreatic beta cell gene expression. To elucidate the mechanisms underlying the activation of the FoxA2 gene during differentiation, we have compared the epigenetic status of undifferentiated human embryonic stem cells (hESCs), hESC-derived early endoderm stage cells (CXCR4+ cells), and pancreatic islet cells. Unexpectedly, a CpG island in the promoter region of the FoxA2 gene displayed paradoxically high levels of DNA methylation in expressing tissues (CXCR4+, islets) and low levels in nonexpressing tissues. This CpG island region was found to repress reporter gene expression and bind the Polycomb group protein SUZ12 and the DNA methyltransferase (DNMT)3b preferentially in undifferentiated hESCs as compared with CXCR4+ or islets cells. Consistent with this, activation of FoxA2 gene expression, but not CXCR4 or SOX17, was strongly inhibited by 5-aza-2′-deoxycytidine and by knockdown of DNMT3b. We hypothesize that in nonexpressing tissues, the lack of DNA methylation allows the binding of DNA methyltransferases and repressing proteins, such as Polycomb group proteins; upon differentiation, DNMT activation leads to CpG island methylation, causing loss of repressor protein binding. These results suggest a novel and unexpected role for DNA methylation in the activation of FoxA2 gene expression during differentiation. PMID:25016019

Hypermethylation of MST1 in IgG4-related autoimmune pancreatitis and rheumatoid arthritis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fukuhara, Takataro; Tomiyama, Takashi; Yasuda, Kaneki

The serine/threonine kinase Mst1 plays important roles in the control of immune cell trafficking, proliferation, and differentiation. Previously, we reported that Mst1 was required for thymocyte selection and regulatory T-cell functions, thereby the prevention of autoimmunity in mice. In humans, MST1 null mutations cause T-cell immunodeficiency and hypergammaglobulinemia with autoantibody production. RASSF5C(RAPL) is an activator of MST1 and it is frequently methylated in some tumors. Herein, we investigated methylation of the promoter regions of MST1 and RASSF5C(RAPL) in leukocytes from patients with IgG4-related autoimmune pancreatitis (AIP) and rheumatoid arthritis (RA). Increased number of CpG methylation in the 5′ region ofmore » MST1 was detected in AIP patients with extrapancreatic lesions, whereas AIP patients without extrapancreatic lesions were similar to controls. In RA patients, we detected a slight increased CpG methylation in MST1, although the overall number of methylation sites was lower than that of AIP patients with extrapancreatic lesions. There were no significant changes of the methylation levels of the CpG islands in the 5′ region of RASSF5C(RAPL) in leukocytes from AIP and RA patients. Consistently, we found a significantly down-regulated expression of MST1 in regulatory T cells of AIP patients. Our results suggest that the decreased expression of MST1 in regulatory T cells due to hypermethylation of the promoter contributes to the pathogenesis of IgG4-related AIP. - Highlights: • Mst1 controls immune cells trafficking, cell proliferation and differentiation. • Autoimmune pancreatitis (AIP) is an idiopathic pancreatitis affecting multiple organs. • Decreased MST1 expression and increased CpG methylation of promoter of MST1 in AIP. • Slight increased CpG methylation of MST1 in rheumatoid arthritis patients. • MST1 contributes pathogenesis of IgG4-related AIP.« less

DNA methylation Landscape of body size variation in sheep.

PubMed

Cao, Jiaxue; Wei, Caihong; Liu, Dongming; Wang, Huihua; Wu, Mingming; Xie, Zhiyuan; Capellini, Terence D; Zhang, Li; Zhao, Fuping; Li, Li; Zhong, Tao; Wang, Linjie; Lu, Jian; Liu, Ruizao; Zhang, Shifang; Du, Yongfei; Zhang, Hongping; Du, Lixin

2015-10-16

Sub-populations of Chinese Mongolian sheep exhibit significant variance in body mass. In the present study, we sequenced the whole genome DNA methylation in these breeds to detect whether DNA methylation plays a role in determining the body mass of sheep by Methylated DNA immunoprecipitation - sequencing method. A high quality methylation map of Chinese Mongolian sheep was obtained in this study. We identified 399 different methylated regions located in 93 human orthologs, which were previously reported as body size related genes in human genome-wide association studies. We tested three regions in LTBP1, and DNA methylation of two CpG sites showed significant correlation with its RNA expression. Additionally, a particular set of differentially methylated windows enriched in the "development process" (GO: 0032502) was identified as potential candidates for association with body mass variation. Next, we validated small part of these windows in 5 genes; DNA methylation of SMAD1, TSC1 and AKT1 showed significant difference across breeds, and six CpG were significantly correlated with RNA expression. Interestingly, two CpG sites showed significant correlation with TSC1 protein expression. This study provides a thorough understanding of body size variation in sheep from an epigenetic perspective.

Activation-induced cytidine deaminase (AID) is necessary for the epithelial–mesenchymal transition in mammary epithelial cells

PubMed Central

Muñoz, Denise P.; Lee, Elbert L.; Takayama, Sachiko; Coppé, Jean-Philippe; Heo, Seok-Jin; Boffelli, Dario; Di Noia, Javier M.; Martin, David I. K.

2013-01-01

Activation-induced cytidine deaminase (AID), which functions in antibody diversification, is also expressed in a variety of germ and somatic cells. Evidence that AID promotes DNA demethylation in epigenetic reprogramming phenomena, and that it is induced by inflammatory signals, led us to investigate its role in the epithelial–mesenchymal transition (EMT), a critical process in normal morphogenesis and tumor metastasis. We find that expression of AID is induced by inflammatory signals that induce the EMT in nontransformed mammary epithelial cells and in ZR75.1 breast cancer cells. shRNA–mediated knockdown of AID blocks induction of the EMT and prevents cells from acquiring invasive properties. Knockdown of AID suppresses expression of several key EMT transcriptional regulators and is associated with increased methylation of CpG islands proximal to the promoters of these genes; furthermore, the DNA demethylating agent 5 aza-2'deoxycytidine (5-Aza-dC) antagonizes the effects of AID knockdown on the expression of EMT factors. We conclude that AID is necessary for the EMT in this breast cancer cell model and in nontransformed mammary epithelial cells. Our results suggest that AID may act near the apex of a hierarchy of regulatory steps that drive the EMT, and are consistent with this effect being mediated by cytosine demethylation. This evidence links our findings to other reports of a role for AID in epigenetic reprogramming and control of gene expression. PMID:23882083

Beta-Glucan Activated Human B-Lymphocytes Participate in Innate Immune Responses by Releasing Pro-inflammatory Cytokines and Stimulating Neutrophil Chemotaxis

PubMed Central

Ali, Mohamed F.; Driscoll, Christopher B.; Walters, Paula R.; Limper, Andrew H.; Carmona, Eva M.

2015-01-01

B-lymphocytes play an essential regulatory role in the adaptive immune response through antibody production during infection. A less known function of B-lymphocytes is their ability to respond directly to infectious antigens through stimulation of pattern recognition receptors expressed on their surfaces. β-glucans are carbohydrates present in the cell wall of many pathogenic fungi that can be detected in the peripheral blood of patients during infection. They have been shown to participate in the innate inflammatory response as they can directly activate peripheral macrophages and dendritic cells. However, their effect as direct stimulators of B-lymphocytes has not been yet fully elucidated. The aim of this study was to examine the molecular mechanisms and cytokine profiles generated following β-glucan stimulation of B-lymphocytes, compared with the well-established TLR-9 agonist CpG-oligodeoxynucleotide (CpG) and study the participation of β-glucan stimulated B-cells in the innate immune response. Herein, we demonstrate that β-glucan activated B-lymphocytes upregulate pro-inflammatory cytokines (TNFα, IL-6 and IL-8). Interestingly, β-glucan, unlike CpG, had no effect on B-lymphocyte proliferation or IgM production. When compared with CpG (TLR9 agonist), β-glucan-activated cells secreted significantly higher levels of IL-8. Furthermore, IL-8 secretion was partially mediated by Dectin-1 and required SYK, MAPKs and the transcription factors NF-κB and AP-1. Moreover, we observed that conditioned media from β-glucan stimulated B-lymphocytes elicited neutrophil chemotaxis. These studies suggest that β-glucan activated B-lymphocytes have an important and novel role in fungal innate immune responses. PMID:26519534

Dual activation of Toll-like receptors 7 and 9 impairs the efficacy of antitumor vaccines in murine models of metastatic breast cancer.

PubMed

Moreno Ayala, Mariela A; Gottardo, María Florencia; Gori, María Soledad; Nicola Candia, Alejandro Javier; Caruso, Carla; De Laurentiis, Andrea; Imsen, Mercedes; Klein, Slobodanka; Bal de Kier Joffé, Elisa; Salamone, Gabriela; Castro, Maria G; Seilicovich, Adriana; Candolfi, Marianela

2017-09-01

Since combination of Toll-like receptor (TLR) ligands could boost antitumor immunity, we evaluated the efficacy of dendritic cell (DC) vaccines upon dual activation of TLR9 and TLR7 in breast cancer models. DCs were generated from mouse bone marrow or peripheral blood from healthy human donors and stimulated with CpG1826 (mouse TLR9 agonist), CpG2006 or IMT504 (human TLR9 agonists) and R848 (TLR7 agonist). Efficacy of antitumor vaccines was evaluated in BALB/c mice bearing metastatic mammary adenocarcinomas. CpG-DCs improved the survival of tumor-bearing mice, reduced the development of lung metastases and generated immunological memory. However, dual activation of TLRs impaired the efficacy of DC vaccines. In vitro, we found that R848 inhibited CpG-mediated maturation of murine DCs. A positive feedback loop in TLR9 mRNA expression was observed upon CpG stimulation that was inhibited in the presence of R848. Impaired activation of NF-κB was detected when TLR9 and TLR7 were simultaneously activated. Blockade of nitric oxide synthase (NOS) and indoleamine-pyrrole-2,3-dioxygenase (IDO) improved the activation of CpG-DCs. When we evaluated the effect of combined activation of TLR9 and TLR7 in human DCs, we found that R848 induced robust DC activation that was inhibited by TLR9 agonists. These observations provide insight in the biology of TLR9 and TLR7 crosstalk and suggest caution in the selection of agonists for multiple TLR stimulation. Blockade of NOS and IDO could improve the maturation of antitumor DC vaccines. R848 could prove a useful adjuvant for DC vaccines in human patients.

Distribution of CpG Motifs in Upstream Gene Domains in a Reef Coral and Sea Anemone: Implications for Epigenetics in Cnidarians.

PubMed

Marsh, Adam G; Hoadley, Kenneth D; Warner, Mark E

2016-01-01

Coral reefs are under assault from stressors including global warming, ocean acidification, and urbanization. Knowing how these factors impact the future fate of reefs requires delineating stress responses across ecological, organismal and cellular scales. Recent advances in coral reef biology have integrated molecular processes with ecological fitness and have identified putative suites of temperature acclimation genes in a Scleractinian coral Acropora hyacinthus. We wondered what unique characteristics of these genes determined their coordinate expression in response to temperature acclimation, and whether or not other corals and cnidarians would likewise possess these features. Here, we focus on cytosine methylation as an epigenetic DNA modification that is responsive to environmental stressors. We identify common conserved patterns of cytosine-guanosine dinucleotide (CpG) motif frequencies in upstream promoter domains of different functional gene groups in two cnidarian genomes: a coral (Acropora digitifera) and an anemone (Nematostella vectensis). Our analyses show that CpG motif frequencies are prominent in the promoter domains of functional genes associated with environmental adaptation, particularly those identified in A. hyacinthus. Densities of CpG sites in upstream promoter domains near the transcriptional start site (TSS) are 1.38x higher than genomic background levels upstream of -2000 bp from the TSS. The increase in CpG usage suggests selection to allow for DNA methylation events to occur more frequently within 1 kb of the TSS. In addition, observed shifts in CpG densities among functional groups of genes suggests a potential role for epigenetic DNA methylation within promoter domains to impact functional gene expression responses in A. digitifera and N. vectensis. Identifying promoter epigenetic sequence motifs among genes within specific functional groups establishes an approach to describe integrated cellular responses to environmental stress in reef corals and potential roles of epigenetics on survival and fitness in the face of global climate change.

Computational Modeling Approach in Probing the Effects of Cytosine Methylation on the Transcription Factor Binding to DNA.

PubMed

Tenayuca, John; Cousins, Kimberley; Yang, Shumei; Zhang, Lubo

2017-01-01

Cytosine methylation at CpG dinucleotides is a chief mechanism in epigenetic modification of gene expression patterns. Previous studies demonstrated that increased CpG methylation of Sp1 sites at -268 and -346 of protein kinase C ε promoter repressed the gene expression. The present study investigated the impact of CpG methylation on the Sp1 binding via molecular modeling and electrophoretic mobility shift assay. Each of the Sp1 sites contain two CpGs. Methylation of either CpG lowered the binding affinity of Sp1, whereas methylation of both CpGs produced a greater decrease in the binding affinity. Computation of van der Waals (VDW) energy of Sp1 in complex with the Sp1 sites demonstrated increased VDW values from one to two sites of CpG methylation. Molecular modeling indicated that single CpG methylation caused underwinding of the DNA fragment, with the phosphate groups at C1, C4 and C5 reoriented from their original positions. Methylation of both CpGs pinched the minor groove and increased the helical twist concomitant with a shallow, hydrophobic major groove. Additionally, double methylation eliminated hydrogen bonds on recognition helix residues located at positions -1 and 1, which were essential for interaction with O6/N7 of G-bases. Bonding from linker residues Arg565, Lys595 and Lys596 were also reduced. Methylation of single or both CpGs significantly affected hydrogen bonding from all three Sp1 DNA binding domains, demonstrating that the consequences of cytosine modification extend beyond the neighboring nucleotides. The results indicate that cytosine methylation causes subtle structural alterations in Sp1 binding sites consequently resulting in inhibition of side chain interactions critical for specific base recognition and reduction of the binding affinity of Sp1. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Prediction of epigenetically regulated genes in breast cancer cell lines.

PubMed

Loss, Leandro A; Sadanandam, Anguraj; Durinck, Steffen; Nautiyal, Shivani; Flaucher, Diane; Carlton, Victoria E H; Moorhead, Martin; Lu, Yontao; Gray, Joe W; Faham, Malek; Spellman, Paul; Parvin, Bahram

2010-06-04

Methylation of CpG islands within the DNA promoter regions is one mechanism that leads to aberrant gene expression in cancer. In particular, the abnormal methylation of CpG islands may silence associated genes. Therefore, using high-throughput microarrays to measure CpG island methylation will lead to better understanding of tumor pathobiology and progression, while revealing potentially new biomarkers. We have examined a recently developed high-throughput technology for measuring genome-wide methylation patterns called mTACL. Here, we propose a computational pipeline for integrating gene expression and CpG island methylation profiles to identify epigenetically regulated genes for a panel of 45 breast cancer cell lines, which is widely used in the Integrative Cancer Biology Program (ICBP). The pipeline (i) reduces the dimensionality of the methylation data, (ii) associates the reduced methylation data with gene expression data, and (iii) ranks methylation-expression associations according to their epigenetic regulation. Dimensionality reduction is performed in two steps: (i) methylation sites are grouped across the genome to identify regions of interest, and (ii) methylation profiles are clustered within each region. Associations between the clustered methylation and the gene expression data sets generate candidate matches within a fixed neighborhood around each gene. Finally, the methylation-expression associations are ranked through a logistic regression, and their significance is quantified through permutation analysis. Our two-step dimensionality reduction compressed 90% of the original data, reducing 137,688 methylation sites to 14,505 clusters. Methylation-expression associations produced 18,312 correspondences, which were used to further analyze epigenetic regulation. Logistic regression was used to identify 58 genes from these correspondences that showed a statistically significant negative correlation between methylation profiles and gene expression in the panel of breast cancer cell lines. Subnetwork enrichment of these genes has identified 35 common regulators with 6 or more predicted markers. In addition to identifying epigenetically regulated genes, we show evidence of differentially expressed methylation patterns between the basal and luminal subtypes. Our results indicate that the proposed computational protocol is a viable platform for identifying epigenetically regulated genes. Our protocol has generated a list of predictors including COL1A2, TOP2A, TFF1, and VAV3, genes whose key roles in epigenetic regulation is documented in the literature. Subnetwork enrichment of these predicted markers further suggests that epigenetic regulation of individual genes occurs in a coordinated fashion and through common regulators.

Exposure to welding fumes is associated with hypomethylation of the F2RL3 gene: a cardiovascular disease marker.

PubMed

Hossain, Mohammad B; Li, Huiqi; Hedmer, Maria; Tinnerberg, Håkan; Albin, Maria; Broberg, Karin

2015-12-01

Welders are at risk for cardiovascular disease. Recent studies linked tobacco smoke exposure to hypomethylation of the F2RL3 (coagulation factor II (thrombin) receptor-like 3) gene, a marker for cardiovascular disease prognosis and mortality. However, whether welding fumes cause hypomethylation of F2RL3 remains unknown. We investigated 101 welders (median span of working as a welder: 7 years) and 127 unexposed controls (non-welders with no obvious exposure to respirable dust at work), age range 23-60 years, all currently non-smoking, in Sweden. The participants were interviewed about their work history, lifestyle factors and diseases. Personal sampling of respirable dust was performed for the welders. DNA methylation of F2RL3 in blood was assessed by pyrosequencing of four CpG sites, CpG_2 (corresponds to cg03636183) to CpG_5, in F2RL3. Multivariable linear regression analysis was used to assess the association between exposure to welding fumes and F2RL3 methylation. Welders had 2.6% lower methylation of CpG_5 than controls (p<0.001). Higher concentrations of measured respirable dust among the welders were associated with hypomethylation of CpG_2, CpG_4 and CpG_5 (β=-0.49 to -1.4, p<0.012); p<0.029 adjusted for age, previous smoking, passive smoking, education, current residence and respirator use. Increasing the number of years working as a welder was associated with hypomethylation of CpG_4 (linear regression analysis, β=-0.11, p=0.039, adjusted for previous smoking). Previous tobacco smokers had 1.5-4.7% (p<0.014) lower methylation of 3 of the 4 CpG sites in F2RL3 (CpG_2, CpG_4 and CpG_5) compared to never-smokers. A non-significant lower risk of cardiovascular disease with more methylation was observed for all CpG sites. Welding fumes exposure and previous smoking were associated with F2RL3 hypomethylation. This finding links low-to-moderate exposure to welding fumes to adverse effects on the cardiovascular system, and suggests a potential mechanistic pathway for this link, via epigenetic effects on F2RL3 expression. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

Epigenetic effects of methoxychlor and vinclozolin on male gametes.

PubMed

Paoloni-Giacobino, Ariane

2014-01-01

Imprinting is an epigenetic form of gene regulation that mediates a parent-of-origin-dependent expression of the alleles of a number of genes. Imprinting, which occurs at specific sites within or surrounding the gene, called differentially methylated domains, consists in a methylation of CpGs. The appropriate transmission of genomics imprints is essential for the control of embryonic development and fetal growth. A number of endocrine disruptors (EDs) affect male reproductive tract development and spermatogenesis. It was postulated that the genetic effects of EDs might be induced by alterations in gene imprinting. We tested two EDs: methoxychlor and vinclozolin. Their administration during gestation induced in the offspring a decrease in sperm counts and significant modifications in the methylation pattern of a selection of paternally and maternally expressed canonical imprinted genes. The observation that imprinting was largely untouched in somatic cells suggests that EDs exert their damaging effects via the process of reprogramming that is unique to gamete development. Interestingly, the effects were transgenerational, although disappearing gradually from F1 to F3. A systematic analysis showed a heterogeneity in the CpG sensitivity to EDs. We propose that the deleterious effects of EDs on the male reproductive system are mediated by imprinting defects in the sperm. The reported effects of EDs on human male spermatogenesis might be mediated by analogous imprinting alterations. © 2014 Elsevier Inc. All rights reserved.

Compositional searching of CpG islands in the human genome

NASA Astrophysics Data System (ADS)

Luque-Escamilla, Pedro Luis; Martínez-Aroza, José; Oliver, José L.; Gómez-Lopera, Juan Francisco; Román-Roldán, Ramón

2005-06-01

We report on an entropic edge detector based on the local calculation of the Jensen-Shannon divergence with application to the search for CpG islands. CpG islands are pieces of the genome related to gene expression and cell differentiation, and thus to cancer formation. Searching for these CpG islands is a major task in genetics and bioinformatics. Some algorithms have been proposed in the literature, based on moving statistics in a sliding window, but its size may greatly influence the results. The local use of Jensen-Shannon divergence is a completely different strategy: the nucleotide composition inside the islands is different from that in their environment, so a statistical distance—the Jensen-Shannon divergence—between the composition of two adjacent windows may be used as a measure of their dissimilarity. Sliding this double window over the entire sequence allows us to segment it compositionally. The fusion of those segments into greater ones that satisfy certain identification criteria must be achieved in order to obtain the definitive results. We find that the local use of Jensen-Shannon divergence is very suitable in processing DNA sequences for searching for compositionally different structures such as CpG islands, as compared to other algorithms in literature.

Collaborations between CpG sites in DNA methylation

NASA Astrophysics Data System (ADS)

Song, You; Ren, Honglei; Lei, Jinzhi

2017-08-01

DNA methylation patterns have profound impacts on genome stability, gene expression and development. The molecular base of DNA methylation patterns has long been focused at single CpG sites level. Here, we construct a kinetic model of DNA methylation with collaborations between CpG sites, from which a correlation function was established based on experimental data. The function consists of three parts that suggest three possible sources of the correlation: movement of enzymes along DNA, collaboration between DNA methylation and nucleosome modification, and global enzyme concentrations within a cell. Moreover, the collaboration strength between DNA methylation and nucleosome modification is universal for mouse early embryo cells. The obtained correlation function provides insightful understanding for the mechanisms of inheritance of DNA methylation patterns.

Transcript Isoform Variation Associated with Cytosine Modification in Human Lymphoblastoid Cell Lines.

PubMed

Zhang, Xu; Zhang, Wei

2016-06-01

Cytosine modification on DNA is variable among individuals, which could correlate with gene expression variation. The effect of cytosine modification on interindividual transcript isoform variation (TIV), however, remains unclear. In this study, we assessed the extent of cytosine modification-specific TIV in lymphoblastoid cell lines (LCLs) derived from unrelated individuals of European and African descent. Our study detected cytosine modification-specific TIVs for 17% of the analyzed genes at a 5% false discovery rate. Forty-five percent of the TIV-associated cytosine modifications correlated with the overall gene expression levels as well, with the corresponding CpG sites overrepresented in transcript initiation sites, transcription factor binding sites, and distinct histone modification peaks, suggesting that alternative isoform transcription underlies the TIVs. Our analysis also revealed 33% of the TIV-associated cytosine modifications that affected specific exons, with the corresponding CpG sites overrepresented in exon/intron junctions, splicing branching points, and transcript termination sites, implying that the TIVs are attributable to alternative splicing or transcription termination. Genetic and epigenetic regulation of TIV shared target preference but exerted independent effects on 61% of the common exon targets. Cytosine modification-specific TIVs detected from LCLs were differentially enriched in those detected from various tissues in The Cancer Genome Atlas, indicating their developmental dependency. Genes containing cytosine modification-specific TIVs were enriched in pathways of cancers and metabolic disorders. Our study demonstrated a prominent effect of cytosine modification variation on the transcript isoform spectrum over gross transcript abundance and revealed epigenetic contributions to diseases that were mediated through cytosine modification-specific TIV. Copyright © 2016 by the Genetics Society of America.

Exosome-based tumor antigens-adjuvant co-delivery utilizing genetically engineered tumor cell-derived exosomes with immunostimulatory CpG DNA.

PubMed

Morishita, Masaki; Takahashi, Yuki; Matsumoto, Akihiro; Nishikawa, Makiya; Takakura, Yoshinobu

2016-12-01

For cancer immunotherapy via tumor antigen vaccination in combination with an adjuvant, major challenges include the identification of a particular tumor antigen and efficient delivery of the antigen as well as adjuvant to antigen-presenting cells. In this study, we proposed an efficient exosome-based tumor antigens-adjuvant co-delivery system using genetically engineered tumor cell-derived exosomes containing endogenous tumor antigens and immunostimulatory CpG DNA. Murine melanoma B16BL6 cells were transfected with a plasmid vector encoding a fusion streptavidin (SAV; a protein that binds to biotin with high affinity)-lactadherin (LA; an exosome-tropic protein) protein, yielding genetically engineered SAV-LA-expressing exosomes (SAV-exo). SAV-exo were combined with biotinylated CpG DNA to prepare CpG DNA-modified exosomes (CpG-SAV-exo). Fluorescent microscopic observation revealed the successful modification of exosomes with CpG DNA by SAV-biotin interaction. CpG-SAV-exo showed efficient and simultaneous delivery of exosomes with CpG DNA to murine dendritic DC2.4 cells in culture. Treatment with CpG-SAV-exo effectively activated DC2.4 cells and enhanced tumor antigen presentation capacity. Immunization with CpG-SAV-exo exhibited stronger in vivo antitumor effects in B16BL6 tumor-bearing mice than simple co-administration of exosomes and CpG DNA. Thus, genetically engineered CpG-SAV-exo is an effective exosome-based tumor antigens-adjuvant co-delivery system that will be useful for cancer immunotherapy. Copyright © 2016 Elsevier Ltd. All rights reserved.

Topical CpG Adjuvantation of a Protein-Based Vaccine Induces Protective Immunity to Listeria monocytogenes

PubMed Central

Cheng, Wing Ki; Wee, Kathleen; Kollmann, Tobias R.

2014-01-01

Robust CD8+ T cell responses are essential for immune protection against intracellular pathogens. Using parenteral administration of ovalbumin (OVA) protein as a model antigen, the effect of the Toll-like receptor 9 (TLR9) agonist, CpG oligodeoxynucleotide (ODN) 1826, as an adjuvant delivered either topically, subcutaneously, or intramuscularly on antigen-specific CD8+ T cell responses in a mouse model was evaluated. Topical CpG adjuvant increased the frequency of OVA-specific CD8+ T cells in the peripheral blood and in the spleen. The more effective strategy to administer topical CpG adjuvant to enhance CD8+ T cell responses was single-dose administration at the time of antigen injection with a prime-boost regimen. Topical CpG adjuvant conferred both rapid and long-lasting protection against systemic challenge with recombinant Listeria monocytogenes expressing the cytotoxic T lymphocyte (CTL) epitope of OVA257–264 (strain Lm-OVA) in a TLR9-dependent manner. Topical CpG adjuvant induced a higher proportion of CD8+ effector memory T cells than parenteral administration of the adjuvant. Although traditional vaccination strategies involve coformulation of antigen and adjuvant, split administration using topical adjuvant is effective and has advantages of safety and flexibility. Split administration of topical CpG ODN 1826 with parenteral protein antigen is superior to other administration strategies in enhancing both acute and memory protective CD8+ T cell immune responses to subcutaneous protein vaccines. This vaccination strategy induces rapid and persistent protective immune responses against the intracellular organism L. monocytogenes. PMID:24391136

CpG islands: algorithms and applications in methylation studies.

PubMed

Zhao, Zhongming; Han, Leng

2009-05-15

Methylation occurs frequently at 5'-cytosine of the CpG dinucleotides in vertebrate genomes; however, this epigenetic feature is rarely observed in CpG islands (CGIs) or CpG clusters in the promoter regions of genes. Aberrant methylation of the promoter-associated CGIs might influence gene expression and cause carcinogenesis. Because of the functional importance, multiple algorithms have been available for identifying CGIs in a genome or a sequence. They can be categorized into the traditional algorithms (e.g., Gardiner-Garden and Frommer (1987), Takai and Jones (2002), and CpGPRoD (2002)) or statistical property based algorithms (CpGcluster (2006) and CG cluster (2007)). We reviewed the features of these algorithms and evaluated their performance on identifying functional CGIs using genome-wide methylation data. Moreover, identification of CGIs is an initial step in many recent studies for predicting methylation status as well as in the design of methylation detection platforms. We reviewed the benchmarks and features used in these studies.

Gene silencing of Nox4 by CpG island methylation during hepatocarcinogenesis in rats

PubMed Central

López-Álvarez, Guadalupe S.; Wojdacz, Tomasz K.; García-Cuellar, Claudia M.; Monroy-Ramírez, Hugo C.; Rodríguez-Segura, Miguel A.; Pacheco-Rivera, Ruth A.; Valencia-Antúnez, Carlos A.; Cervantes-Anaya, Nancy; Soto-Reyes, Ernesto; Vásquez-Garzón, Verónica R.; Sánchez-Pérez, Yesennia; Villa-Treviño, Saúl

2017-01-01

ABSTRACT The association between the downregulation of genes and DNA methylation in their CpG islands has been extensively studied as a mechanism that favors carcinogenesis. The objective of this study was to analyze the methylation of a set of genes selected based on their microarray expression profiles during the process of hepatocarcinogenesis. Rats were euthanized at: 24 h, 7, 11, 16 and 30 days and 5, 9, 12 and 18 months post-treatment. We evaluated the methylation status in the CpG islands of four deregulated genes (Casp3, Cldn1, Pex11a and Nox4) using methylation-sensitive high-resolution melting technology for the samples obtained from different stages of hepatocarcinogenesis. We did not observe methylation in Casp3, Cldn1 or Pex11a. However, Nox4 exhibited altered methylation patterns, reaching a maximum of 10%, even during the early stages of hepatocarcinogenesis. We observed downregulation of mRNA and protein of Nox4 (97.5% and 40%, respectively) after the first carcinogenic stimulus relative to the untreated samples. Our results suggest that Nox4 downregulation is associated with DNA methylation of the CpG island in its promoter. We propose that methylation is a mechanism that can silence the expression of Nox4, which could contribute to the acquisition of neoplastic characteristics during hepatocarcinogenesis in rats. PMID:27895046

Human gingival fibroblasts express functional chemokine receptor CXCR6.

PubMed

Hosokawa, Y; Hosokawa, I; Ozaki, K; Nakae, H; Matsuo, T

2009-06-01

We have reported that CXCL16, a recently discovered transmembrane chemokine, is expressed in human gingival fibroblasts (HGF). However, it is not known whether HGF express CXCR6, the receptor for CXCL16, or CXCL16 affects HGF biology. We have shown that HGF expressed CXCR6 by reverse transcription-polymerase chain reaction and flow cytometric analysis. Moreover, we elucidated that tumour necrosis factor (TNF)-alpha and cytosine-guanine dinucleotide (CpG) DNA (Toll-like receptor-9 ligand) treatment enhanced CXCR6 expression by HGF. Interleukin (IL)-4, IL-13 and CpG DNA up-regulated CXCR6 expression by TNF-alpha-stimulated HGF. On the other hand, IL-1beta and interferon-gamma inhibited CXCR6 expression on TNF-alpha-treated HGF. CXCL16 treatment induced HGF proliferation and phosphorylation of extracellular regulated kinase (ERK) and protein kinase B (AKT) in HGF. In conclusion, HGF expressed CXCR6 functionally, because CXCL16 induced HGF proliferation and ERK and AKT phosphorylation in HGF. These results indicate that CXCL16 may play an important role in the pathogenesis and remodelling in periodontally diseased tissues.

Polycomb-like proteins link the PRC2 complex to CpG islands

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Haojie; Liefke, Robert; Jiang, Junyi

The Polycomb repressive complex 2 (PRC2) mainly mediates transcriptional repression1,2 and has essential roles in various biological processes including the maintenance of cell identity and proper differentiation. Polycomb-like (PCL) proteins, such as PHF1, MTF2 and PHF19, are PRC2-associated factors that form sub-complexes with PRC2 core components3, and have been proposed to modulate the enzymatic activity of PRC2 or the recruitment of PRC2 to specific genomic loci4,5,6,7,8,9,10,11,12,13. Mammalian PRC2-binding sites are enriched in CG content, which correlates with CpG islands that display a low level of DNA methylation14. However, the mechanism of PRC2 recruitment to CpG islands is not fully understood.more » Here we solve the crystal structures of the N-terminal domains of PHF1 and MTF2 with bound CpG-containing DNAs in the presence of H3K36me3-containing histone peptides. We show that the extended homologous regions of both proteins fold into a winged-helix structure, which specifically binds to the unmethylated CpG motif but in a completely different manner from the canonical winged-helix DNA recognition motif. We also show that the PCL extended homologous domains are required for efficient recruitment of PRC2 to CpG island-containing promoters in mouse embryonic stem cells. Our research provides the first, to our knowledge, direct evidence to demonstrate that PCL proteins are crucial for PRC2 recruitment to CpG islands, and further clarifies the roles of these proteins in transcriptional regulation in vivo.« less

DNA methylation signatures of chronic low-grade inflammation are associated with complex diseases.

PubMed

Ligthart, Symen; Marzi, Carola; Aslibekyan, Stella; Mendelson, Michael M; Conneely, Karen N; Tanaka, Toshiko; Colicino, Elena; Waite, Lindsay L; Joehanes, Roby; Guan, Weihua; Brody, Jennifer A; Elks, Cathy; Marioni, Riccardo; Jhun, Min A; Agha, Golareh; Bressler, Jan; Ward-Caviness, Cavin K; Chen, Brian H; Huan, Tianxiao; Bakulski, Kelly; Salfati, Elias L; Fiorito, Giovanni; Wahl, Simone; Schramm, Katharina; Sha, Jin; Hernandez, Dena G; Just, Allan C; Smith, Jennifer A; Sotoodehnia, Nona; Pilling, Luke C; Pankow, James S; Tsao, Phil S; Liu, Chunyu; Zhao, Wei; Guarrera, Simonetta; Michopoulos, Vasiliki J; Smith, Alicia K; Peters, Marjolein J; Melzer, David; Vokonas, Pantel; Fornage, Myriam; Prokisch, Holger; Bis, Joshua C; Chu, Audrey Y; Herder, Christian; Grallert, Harald; Yao, Chen; Shah, Sonia; McRae, Allan F; Lin, Honghuang; Horvath, Steve; Fallin, Daniele; Hofman, Albert; Wareham, Nicholas J; Wiggins, Kerri L; Feinberg, Andrew P; Starr, John M; Visscher, Peter M; Murabito, Joanne M; Kardia, Sharon L R; Absher, Devin M; Binder, Elisabeth B; Singleton, Andrew B; Bandinelli, Stefania; Peters, Annette; Waldenberger, Melanie; Matullo, Giuseppe; Schwartz, Joel D; Demerath, Ellen W; Uitterlinden, André G; van Meurs, Joyce B J; Franco, Oscar H; Chen, Yii-Der Ida; Levy, Daniel; Turner, Stephen T; Deary, Ian J; Ressler, Kerry J; Dupuis, Josée; Ferrucci, Luigi; Ong, Ken K; Assimes, Themistocles L; Boerwinkle, Eric; Koenig, Wolfgang; Arnett, Donna K; Baccarelli, Andrea A; Benjamin, Emelia J; Dehghan, Abbas

2016-12-12

Chronic low-grade inflammation reflects a subclinical immune response implicated in the pathogenesis of complex diseases. Identifying genetic loci where DNA methylation is associated with chronic low-grade inflammation may reveal novel pathways or therapeutic targets for inflammation. We performed a meta-analysis of epigenome-wide association studies (EWAS) of serum C-reactive protein (CRP), which is a sensitive marker of low-grade inflammation, in a large European population (n = 8863) and trans-ethnic replication in African Americans (n = 4111). We found differential methylation at 218 CpG sites to be associated with CRP (P < 1.15 × 10 -7 ) in the discovery panel of European ancestry and replicated (P < 2.29 × 10 -4 ) 58 CpG sites (45 unique loci) among African Americans. To further characterize the molecular and clinical relevance of the findings, we examined the association with gene expression, genetic sequence variants, and clinical outcomes. DNA methylation at nine (16%) CpG sites was associated with whole blood gene expression in cis (P < 8.47 × 10 -5 ), ten (17%) CpG sites were associated with a nearby genetic variant (P < 2.50 × 10 -3 ), and 51 (88%) were also associated with at least one related cardiometabolic entity (P < 9.58 × 10 -5 ). An additive weighted score of replicated CpG sites accounted for up to 6% inter-individual variation (R2) of age-adjusted and sex-adjusted CRP, independent of known CRP-related genetic variants. We have completed an EWAS of chronic low-grade inflammation and identified many novel genetic loci underlying inflammation that may serve as targets for the development of novel therapeutic interventions for inflammation.

Altered DNA Methylation and Expression Profiles of 8-Oxoguanine DNA Glycosylase 1 in Lens Tissue from Age-related Cataract Patients.

PubMed

Wang, Yong; Li, Fei; Zhang, Guowei; Kang, Lihua; Qin, Bai; Guan, Huaijin

2015-01-01

Oxidative stress and DNA damage contribute to the pathogenesis of age-related cataract (ARC). Most oxidative DNA lesions are repaired via the base excision repair (BER) proteins including 8-oxoguanine DNA glycosylase 1 (OGG1). This study examined DNA methylation of CpG islands upstream of OGG1 and their relation to the gene expression in lens cortex from ARC patients. The clinical case-control study consisted of 15 cortical type of ARC patients and 15 age-matched non-ARC controls who received transparent lens extraction due to vitreoretinal diseases. OGG1 expression in lens cortex was analyzed by qRT-PCR and Western blot. The localization and the proportion of cells positive for OGG1 were determined by immunofluorescence. Bisulfite-sequencing PCR (BSP) was performed to evaluate the methylation status of CpG islands near OGG1 in DNA extracted from lens cortex. To test relationship between the methylation and the expression of the gene of interest, 5-Aza-2'-deoxycytidine (5-Aza-dC) was used to induce demethylation of cultured human lens epithelium B-3 (HLE B-3). To test the role of OGG1 in the repair of cellular damage, HLE B-3 was transfected with OGG1 vector, followed by ultraviolet radiation b (UVB) exposure to induce apoptosis. The mRNA and protein levels of OGG1 were significantly reduced in the lens cortex of ARC. Immunofluorescence showed that the proportion of OGG1-positive cells decreased significantly in ARC cortex in comparison with the control. The CpG island in first exon of OGG1 displayed hypermethylation in the DNA extracted from the lens cortex of ARC. Treatment of HLEB-3 cells with 5-Aza-dC upregulated OGG1 expression. UVB-induced apoptosis was attenuated after transfection with OGG1. A reduced OGG1 expression was correlated with hypermethylation of a CpG island of OGG1 in lens cortex of ARC. The role of epigenetic change in OGG1 gene in the susceptibility to oxidative stress induced cortical ARC is warranted to further study.

pcDNA-IL-12 vaccination blocks eosinophilic inflammation but not airway hyperresponsiveness following murine Toxocara canis infection.

PubMed

Malheiro, Adriana; Aníbal, Fernanda F; Martins-Filho, Olindo Assis; Teixeira-Carvalho, Andréa; Perini, Adenir; Martins, Milton A; Medeiros, Alexandra I; Turato, Walter M; Acencio, Milene P M; Brandão, Izaíra T; Nomizo, Auro; Silva, Célio L; Faccioli, Lúcia H

2008-01-17

We have investigated the effect of pcDNA3-CpG and pcDNA-IL-12, delivered by intradermal gene gun administration, on the blood/lung eosinophilia, airway hyperresponsiveness as well as the immune response in a murine model of toxocariasis. Our results demonstrated that pcDNA-IL-12 but not pcDNA3-CpG vaccination led to a persistent lower blood/bronchoalveolar eosinophilia following Toxocara canis infection, as pcDNA3-CpG led only to an early transient blockage of eosinophil transmigration into bronchoalveolar fluid following T. canis infection. Prominent Type-1 immune response was pointed out as the hallmark of T. canis infection following pcDNA-IL-12 vaccination. Outstanding IFN-gamma/IL-4 ratio besides low levels of IgG1 with subsequent high IgG2a/IgG1 ratio further characterized a Type-1 polarized immunological profile in pcDNA-IL-12-vaccinated animals. Nevertheless, only pcDNA3-CpG was able to prevent airway hyperresponsiveness induced by T. canis infection. The persistent airway hyperresponsiveness observed in pcDNA-IL-12-vaccinated animals demonstrated that the airway constriction involved other immunological mediator than those blocked by pcDNA-IL-12. Together, these data indicated that pcDNA-IL-12 and pcDNA3-CpG vaccines have distinct therapeutic benefits regarding the eosinophilic inflammation/airway hyperresponsiveness triggered by T. canis infection, suggesting their possible use in further combined therapeutic interventions.

Cell Cycle-Dependent Recruitment of Polycomb Proteins to the ASNS Promoter Counteracts C/ebp-Mediated Transcriptional Activation in Bombyx mori

PubMed Central

Li, Zhiqing; Cheng, Daojun; Mon, Hiroaki; Zhu, Li; Xu, Jian; Tatsuke, Tsuneyuki; Lee, Jae Man; Xia, Qingyou; Kusakabe, Takahiro

2013-01-01

Epigenetic modifiers and transcription factors contribute to developmentally programmed gene expression. Here, we establish a functional link between epigenetic regulation by Polycomb group (PcG) proteins and transcriptional regulation by C/ebp that orchestrates the correct expression of Bombyx mori asparagine synthetase (BmASNS), a gene involved in the biosynthesis of asparagine. We show that the cis-regulatory elements of YY1-binding motifs and the CpG island present on the BmASNS promoter are required for the recruitment of PcG proteins and the subsequent deposition of the epigenetic repression mark H3K27me3. RNAi-mediated knockdown of PcG genes leads to derepression of the BmASNS gene via the recruitment of activators, including BmC/ebp, to the promoter. Intriguingly, we find that PcG proteins and BmC/ebp can dynamically modulate the transcriptional output of the BmASNS target in a cell cycle-dependent manner. It will be essential to suppress BmASNS expression by PcG proteins at the G2/M phase of the cell cycle in the presence of BmC/ebp activator. Thus, our results provide a novel insight into the molecular mechanism underlying the recruitment and regulation of the PcG system at a discrete gene locus in Bombyx mori. PMID:23382816

PCFT/SLC46A1 promoter methylation and restoration of gene expression in human leukemia cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gonen, Nitzan; Bram, Eran E.; Assaraf, Yehuda G.

2008-11-28

The proton-coupled folate transporter (PCFT/SLC46A1) displays optimal and prominent folate and antifolate transport activity at acidic pH in human carcinoma cells but poor activity in leukemia cells. Consistently herein, human leukemia cell lines expressed poor PCFT transcript levels, whereas various carcinoma cell lines showed substantial PCFT gene expression. We identified a CpG island with high density at nucleotides -200 through +100 and explored its role in PCFT promoter silencing. Leukemia cells with barely detectable PCFT transcripts consistently harbored 85-100% methylation of this CpG island, whereas no methylation was found in carcinoma cells. Treatment with 5-Aza-2'-deoxycytidine which induced demethylation but notmore » with the histone deacetylase inhibitor trichostatin A, restored 50-fold PCFT expression only in leukemia cells. These findings constitute the first demonstration of the dominant epigenetic silencing of the PCFT gene in leukemia cells. The potential translational implications of the restoration of PCFT expression in chemotherapy of leukemia are discussed.« less

DNA methylation and exposure to ambient air pollution in two prospective cohorts.

PubMed

Plusquin, Michelle; Guida, Florence; Polidoro, Silvia; Vermeulen, Roel; Raaschou-Nielsen, Ole; Campanella, Gianluca; Hoek, Gerard; Kyrtopoulos, Soterios A; Georgiadis, Panagiotis; Naccarati, Alessio; Sacerdote, Carlotta; Krogh, Vittorio; Bas Bueno-de-Mesquita, H; Monique Verschuren, W M; Sayols-Baixeras, Sergi; Panni, Tommaso; Peters, Annette; Hebels, Dennie G A J; Kleinjans, Jos; Vineis, Paolo; Chadeau-Hyam, Marc

2017-11-01

Long-term exposure to air pollution has been associated with several adverse health effects including cardiovascular, respiratory diseases and cancers. However, underlying molecular alterations remain to be further investigated. The aim of this study is to investigate the effects of long-term exposure to air pollutants on (a) average DNA methylation at functional regions and, (b) individual differentially methylated CpG sites. An assumption is that omic measurements, including the methylome, are more sensitive to low doses than hard health outcomes. This study included blood-derived DNA methylation (Illumina-HM450 methylation) for 454 Italian and 159 Dutch participants from the European Prospective Investigation into Cancer and Nutrition (EPIC). Long-term air pollution exposure levels, including NO 2 , NO x , PM 2.5 , PM coarse , PM 10 , PM 2.5 absorbance (soot) were estimated using models developed within the ESCAPE project, and back-extrapolated to the time of sampling when possible. We meta-analysed the associations between the air pollutants and global DNA methylation, methylation in functional regions and epigenome-wide methylation. CpG sites found differentially methylated with air pollution were further investigated for functional interpretation in an independent population (EnviroGenoMarkers project), where (N=613) participants had both methylation and gene expression data available. Exposure to NO 2 was associated with a significant global somatic hypomethylation (p-value=0.014). Hypomethylation of CpG island's shores and shelves and gene bodies was significantly associated with higher exposures to NO 2 and NO x . Meta-analysing the epigenome-wide findings of the 2 cohorts did not show genome-wide significant associations at single CpG site level. However, several significant CpG were found if the analyses were separated by countries. By regressing gene expression levels against methylation levels of the exposure-related CpG sites, we identified several significant CpG-transcript pairs and highlighted 5 enriched pathways for NO 2 and 9 for NO x mainly related to the immune system and its regulation. Our findings support results on global hypomethylation associated with air pollution, and suggest that the shores and shelves of CpG islands and gene bodies are mostly affected by higher exposure to NO 2 and NO x . Functional differences in the immune system were suggested by transcriptome analyses. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

Motoneurons regulate the central pattern generator during drug-induced locomotor-like activity in the neonatal mouse

PubMed Central

Falgairolle, Melanie; Puhl, Joshua G; Pujala, Avinash; Liu, Wenfang; O’Donovan, Michael J

2017-01-01

Motoneurons are traditionally viewed as the output of the spinal cord that do not influence locomotor rhythmogenesis. We assessed the role of motoneuron firing during ongoing locomotor-like activity in neonatal mice expressing archaerhopsin-3 (Arch), halorhodopsin (eNpHR), or channelrhodopsin-2 (ChR2) in Choline acetyltransferase neurons (ChAT+) or Arch in LIM-homeodomain transcription factor Isl1+ neurons. Illumination of the lumbar cord in mice expressing eNpHR or Arch in ChAT+ or Isl1+ neurons, depressed motoneuron discharge, transiently decreased the frequency, and perturbed the phasing of the locomotor-like rhythm. When the light was turned off motoneuron firing and locomotor frequency both transiently increased. These effects were not due to cholinergic neurotransmission, persisted during partial blockade of gap junctions and were mediated, in part, by AMPAergic transmission. In spinal cords expressing ChR2, illumination increased motoneuron discharge and transiently accelerated the rhythm. We conclude that motoneurons provide feedback to the central pattern generator (CPG) during drug-induced locomotor-like activity. DOI: http://dx.doi.org/10.7554/eLife.26622.001 PMID:28671548

Role for DNA methylation in the regulation of miR-200c and miR-141 expression in normal and cancer cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vrba, Lukas; Jensen, Taylor J.; Garbe, James C.

2009-12-23

BACKGROUND: The microRNA-200 family participates in the maintenance of an epithelial phenotype and loss of its expression can result in epithelial to mesenchymal transition (EMT). Furthermore, the loss of expression of miR-200 family members is linked to an aggressive cancer phenotype. Regulation of the miR-200 family expression in normal and cancer cells is not fully understood. METHODOLOGY/ PRINCIPAL FINDINGS: Epigenetic mechanisms participate in the control of miR-200c and miR-141 expression in both normal and cancer cells. A CpG island near the predicted mir-200c/mir-141 transcription start site shows a striking correlation between miR-200c and miR-141 expression and DNA methylation in bothmore » normal and cancer cells, as determined by MassARRAY technology. The CpG island is unmethylated in human miR-200/miR-141 expressing epithelial cells and in miR-200c/miR-141 positive tumor cells. The CpG island is heavily methylated in human miR-200c/miR-141 negative fibroblasts and miR-200c/miR-141 negative tumor cells. Mouse cells show a similar inverse correlation between DNA methylation and miR-200c expression. Enrichment of permissive histone modifications, H3 acetylation and H3K4 trimethylation, is seen in normal miR-200c/miR-141-positive epithelial cells, as determined by chromatin immunoprecipitation coupled to real-time PCR. In contrast, repressive H3K9 dimethylation marks are present in normal miR-200c/miR-141-negative fibroblasts and miR-200c/miR-141 negative cancer cells and the permissive histone modifications are absent. The epigenetic modifier drug, 5-aza-2'-deoxycytidine, reactivates miR-200c/miR-141 expression showing that epigenetic mechanisms play a functional role in their transcriptional control. CONCLUSIONS/ SIGNIFICANCE: We report that DNA methylation plays a role in the normal cell type-specific expression of miR-200c and miR-141 and this role appears evolutionarily conserved, since similar results were obtained in mouse. Aberrant DNA methylation of the miR-200c/141 CpG island is closely linked to their inappropriate silencing in cancer cells. Since the miR-200c cluster plays a significant role in EMT, our results suggest an important role for DNA methylation in the control of phenotypic conversions in normal cells.« less

Methylation and microRNA-mediated epigenetic regulation of SOCS3

PubMed Central

Boosani, Chandra S.; Agrawal, Devendra K.

2017-01-01

Epigenetic gene silencing of several genes causes different pathological conditions in humans, and DNA methylation has been identified as one of the key mechanisms that underlie this evolutionarily conserved phenomenon associated with developmental and pathological gene regulation. Recent advances in the miRNA technology with high throughput analysis of gene regulation further increased our understanding on the role of miRNAs regulating multiple gene expression. There is increasing evidence supporting that the miRNAs not only regulate gene expression but they also are involved in the hypermethylation of promoter sequences, which cumulatively contributes to the epigenetic gene silencing. Here, we critically evaluated the recent progress on the transcriptional regulation of an important suppressor protein that inhibits cytokine-mediated signaling, SOCS3, whose expression is directly regulated both by promoter methylation and also by microRNAs, affecting its vital cell regulating functions. SOCS3 was identified as a potent inhibitor of Jak/STAT signaling pathway which is frequently upregulated in several pathologies, including cardiovascular disease, cancer, diabetes, viral infections, and the expression of SOCS3 was inhibited or greatly reduced due to hypermethylation of the CpG islands in its promoter region or suppression of its expression by different microRNAs. Additionally, we discuss key intracellular signaling pathways regulated by SOCS3 involving cellular events, including cell proliferation, cell growth, cell migration and apoptosis. Identification of the pathway intermediates as specific targets would not only aid in the development of novel therapeutic drugs, but, would also assist in developing new treatment strategies that could successfully be employed in combination therapy to target multiple signaling pathways. PMID:25682267

Epigenome-wide association study reveals longitudinally stable DNA methylation differences in CD4+ T cells from children with IgE-mediated food allergy.

PubMed

Martino, David; Joo, Jihoon E; Sexton-Oates, Alexandra; Dang, Thanh; Allen, Katrina; Saffery, Richard; Prescott, Susan

2014-07-01

Food allergy is mediated by a combination of genetic and environmental risk factors, potentially mediated by epigenetic mechanisms. CD4+ T-cells are key drivers of the allergic response, and may therefore harbor epigenetic variation in association with the disease phenotype. Here we retrospectively examined genome-wide DNA methylation profiles (~450,000 CpGs) from CD4+ T-cells on a birth cohort of 12 children with IgE-mediated food allergy diagnosed at 12-months, and 12 non-allergic controls. DNA samples were available at two time points, birth and 12-months. control comparisons of CD4+ methylation profiles identified 179 differentially methylated probes (DMP) at 12-months and 136 DMP at birth (FDR-adjusted P value<0.05, delta β>0.1). Approximately 30% of DMPs were coincident with previously annotated SNPs. A total of 92 [corrected] allergy-associated non-SNP DMPs were present at birth when individuals were initially disease-free, potentially implicating these loci in the causal pathway. Pathway analysis of differentially methylated genes identified several MAP kinase signaling molecules. Mass spectrometry was used to validate 15 CpG sites at 3 candidate genes. Combined analysis of differential methylation with gene expression profiles revealed gene expression differences at some but not all allergy associated differentially methylated genes. Thus, dysregulation of DNA methylation at MAPK signaling-associated genes during early CD4+ T-cell development may contribute to suboptimal T-lymphocyte responses in early childhood associated with the development of food allergy.

Differential production of immunoglobulin classes and subclasses by mucosal-type human B-lymphocytes exposed in vitro to CpG oligodeoxynucleotides.

PubMed

Cognasse, Fabrice; Acquart, Sophie; Beniguel, Lydie; Sabido, Odile; Chavarin, Patricia; Genin, Christian; Garraud, Olivier

2005-01-01

As B-lymphocytes play an important role in innate and adaptive immunity, we aimed to examine the effects of CpG oligodeoxynucleotides (ODNs) on purified tonsil-originating CD19+ B-cells, representing mucosal B-cells. We screened various K-type ODNs, reactive with human B-cells, and tested for the production of immunoglobulins in vitro. Using one CpG-ODN, DSP30, we observed that it could upregulate not only Toll-like receptor 9 (TLR9) mRNA expression in activated B-cells, but also the early expression of CD69 followed by the sequential expression of CD80, CD86 and the nuclear factor (NF)-kappaB pathway. Furthermore, mRNA expression of certain B-cell-derived cytokines was influenced by exposure to DSP30, with a strong upregulation of interleukin 6 (IL-6) and downregulation of IL1-beta. Stimulation of B-cells, co-stimulated with IL-2, IL-10 and soluble CD40 ligand (sCD40L) with different CpG-ODNs, had differing effects on the terminal differentiation in vitro of B-cells into immunoglobulin-secreting cells. TLR9 is involved in innate immunity and the recognition of bound CpG DNA from invading bacterial pathogens. As tonsillar B-cells are mucosal-type B-lymphocytes, this study suggests that CpG-ODNs show promise as mucosal adjuvants in modulating the local production of immunoglobulins of certain classes and subclasses, a crucial issue in vaccine perspectives.

Nuclear translocation of Acinetobacter baumannii transposase induces DNA methylation of CpG regions in the promoters of E-cadherin gene.

PubMed

Moon, Dong Chan; Choi, Chul Hee; Lee, Su Man; Lee, Jung Hwa; Kim, Seung Il; Kim, Dong Sun; Lee, Je Chul

2012-01-01

Nuclear targeting of bacterial proteins has emerged as a pathogenic mechanism whereby bacterial proteins induce host cell pathology. In this study, we examined nuclear targeting of Acinetobacter baumannii transposase (Tnp) and subsequent epigenetic changes in host cells. Tnp of A. baumannii ATCC 17978 possesses nuclear localization signals (NLSs), (225)RKRKRK(230). Transient expression of A. baumannii Tnp fused with green fluorescent protein (GFP) resulted in the nuclear localization of these proteins in COS-7 cells, whereas the truncated Tnp without NLSs fused with GFP were exclusively localized in the cytoplasm. A. baumannii Tnp was found in outer membrane vesicles, which delivered this protein to the nucleus of host cells. Nuclear expression of A. baumannii Tnp fused with GFP in A549 cells induced DNA methylation of CpG regions in the promoters of E-cadherin (CDH1) gene, whereas the cytoplasmic localization of the truncated Tnp without NLSs fused with GFP did not induce DNA methylation. DNA methylation in the promoters of E-cadherin gene induced by nuclear targeting of A. baumannii Tnp resulted in down-regulation of gene expression. In conclusion, our data show that nuclear traffic of A. baumannii Tnp induces DNA methylation of CpG regions in the promoters of E-cadherin gene, which subsequently down-regulates gene expression. This study provides a new insight into the epigenetic control of host genes by bacterial proteins.

Dual Roles for CXCL4 Chemokines and CXCR3 in Angiogenesis and Invasion of Pancreatic Cancer.

PubMed

Quemener, Cathy; Baud, Jessica; Boyé, Kevin; Dubrac, Alexandre; Billottet, Clotilde; Soulet, Fabienne; Darlot, Florence; Dumartin, Laurent; Sire, Marie; Grepin, Renaud; Daubon, Thomas; Rayne, Fabienne; Wodrich, Harald; Couvelard, Anne; Pineau, Raphael; Schilling, Martin; Castronovo, Vincent; Sue, Shih-Che; Clarke, Kim; Lomri, Abderrahim; Khatib, Abdel-Majid; Hagedorn, Martin; Prats, Hervé; Bikfalvi, Andreas

2016-11-15

The CXCL4 paralog CXCL4L1 is a less studied chemokine that has been suggested to exert an antiangiogenic function. However, CXCL4L1 is also expressed in patient tumors, tumor cell lines, and murine xenografts, prompting a more detailed analysis of its role in cancer pathogenesis. We used genetic and antibody-based approaches to attenuate CXCL4L1 in models of pancreatic ductal adenocarcinoma (PDAC). Mechanisms of expression were assessed in cell coculture experiments, murine, and avian xenotransplants, including through an evaluation of CpG methylation and mutation of critical CpG residues. CXCL4L1 gene expression was increased greatly in primary and metastatic PDAC. We found that myofibroblasts triggered cues in the tumor microenvironment, which led to induction of CXCL4L1 in tumor cells. CXCL4L1 expression was also controlled by epigenetic modifications at critical CpG islands, which were mapped. CXCL4L1 inhibited angiogenesis but also affected tumor development more directly, depending on the tumor cell type. In vivo administration of an mAb against CXCL4L1 demonstrated a blockade in the growth of tumors positive for CXCR3, a critical receptor for CXCL4 ligands. Our findings define a protumorigenic role in PDAC development for endogenous CXCL4L1, which is independent of its antiangiogenic function. Cancer Res; 76(22); 6507-19. ©2016 AACR. ©2016 American Association for Cancer Research.

Epigenetic inactivation of CHFR in human tumors

PubMed Central

Toyota, Minoru; Sasaki, Yasushi; Satoh, Ayumi; Ogi, Kazuhiro; Kikuchi, Takefumi; Suzuki, Hiromu; Mita, Hiroaki; Tanaka, Nobuyuki; Itoh, Fumio; Issa, Jean-Pierre J.; Jair, Kam-Wing; Schuebel, Kornel E.; Imai, Kohzoh; Tokino, Takashi

2003-01-01

Cell-cycle checkpoints controlling the orderly progression through mitosis are frequently disrupted in human cancers. One such checkpoint, entry into metaphase, is regulated by the CHFR gene encoding a protein possessing forkhead-associated and RING finger domains as well as ubiquitin–ligase activity. Although defects in this checkpoint have been described, the molecular basis and prevalence of CHFR inactivation in human tumors are still not fully understood. To address this question, we analyzed the pattern of CHFR expression in a number of human cancer cell lines and primary tumors. We found CpG methylation-dependent silencing of CHFR expression in 45% of cancer cell lines, 40% of primary colorectal cancers, 53% of colorectal adenomas, and 30% of primary head and neck cancers. Expression of CHFR was precisely correlated with both CpG methylation and deacetylation of histones H3 and H4 in the CpG-rich regulatory region. Moreover, CpG methylation and thus silencing of CHFR depended on the activities of two DNA methyltransferases, DNMT1 and DNMT3b, as their genetic inactivation restored CHFR expression. Finally, cells with CHFR methylation had an intrinsically high mitotic index when treated with microtubule inhibitor. This means that cells in which CHFR was epigenetically inactivated constitute loss-of-function alleles for mitotic checkpoint control. Taken together, these findings shed light on a pathway by which mitotic checkpoint is bypassed in cancer cells and suggest that inactivation of checkpoint genes is much more widespread than previously suspected. PMID:12810945

Glucocorticoid receptor gene expression and promoter CpG modifications throughout the human brain.

PubMed

Cao-Lei, Lei; Suwansirikul, Songkiet; Jutavijittum, Prapan; Mériaux, Sophie B; Turner, Jonathan D; Muller, Claude P

2013-11-01

Glucocorticoids and the glucocorticoid (GR) and mineralocorticoid (MR) receptors have been implicated in many processes, particularly in negative feedback regulation of the hypothalamic-pituitary-adrenal axis. Epigenetically programmed GR alternative promoter usage underlies transcriptional control of GR levels, generation of GR 3' splice variants, and the overall GC response in the brain. No detailed analysis of GR first exons or GR transcript variants throughout the human brain has been reported. Therefore we investigated post mortem tissues from 28 brain regions of 5 individuals. GR first exons were expressed throughout the healthy human brain with no region-specific usage patterns. First exon levels were highly inter-correlated suggesting that they are co-regulated. GR 3' splice variants (GRα and GR-P) were equally distributed in all regions, and GRβ expression was always low. GR/MR ratios showed significant differences between the 28 tissues with the highest ratio in the pituitary gland. Modification levels of individual CpG dinucleotides, including 5-mC and 5-hmC, in promoters 1D, 1E, 1F, and 1H were low, and diffusely clustered; despite significant heterogeneity between the donors. In agreement with this clustering, sum modification levels rather than individual CpG modifications correlated with GR expression. Two-way ANOVA showed that this sum modification was both promoter and brain region specific, but that there was however no promoter*tissue interaction. The heterogeneity between donors may however hide such an interaction. In both promoters 1F and 1H modification levels correlated with GRα expression suggesting that 5-mC and 5-hmC play an important role in fine tuning GR expression levels throughout the brain. Copyright © 2013 Elsevier Ltd. All rights reserved.

Expression of metastasis suppressor gene AES driven by a Yin Yang (YY) element in a CpG island promoter and transcription factor YY2.

PubMed

Kakizaki, Fumihiko; Sonoshita, Masahiro; Miyoshi, Hiroyuki; Itatani, Yoshiro; Ito, Shinji; Kawada, Kenji; Sakai, Yoshiharu; Taketo, M Mark

2016-11-01

We recently found that the product of the AES gene functions as a metastasis suppressor of colorectal cancer (CRC) in both humans and mice. Expression of amino-terminal enhancer of split (AES) protein is significantly decreased in liver metastatic lesions compared with primary colon tumors. To investigate its downregulation mechanism in metastases, we searched for transcriptional regulators of AES in human CRC and found that its expression is reduced mainly by transcriptional dysregulation and, in some cases, by additional haploidization of its coding gene. The AES promoter-enhancer is in a typical CpG island, and contains a Yin-Yang transcription factor recognition sequence (YY element). In human epithelial cells of normal colon and primary tumors, transcription factor YY2, a member of the YY family, binds directly to the YY element, and stimulates expression of AES. In a transplantation mouse model of liver metastases, however, expression of Yy2 (and therefore of Aes) is downregulated. In human CRC metastases to the liver, the levels of AES protein are correlated with those of YY2. In addition, we noticed copy-number reduction for the AES coding gene in chromosome 19p13.3 in 12% (5/42) of human CRC cell lines. We excluded other mechanisms such as point or indel mutations in the coding or regulatory regions of the AES gene, CpG methylation in the AES promoter enhancer, expression of microRNAs, and chromatin histone modifications. These results indicate that Aes may belong to a novel family of metastasis suppressors with a CpG-island promoter enhancer, and it is regulated transcriptionally. © 2016 The Authors. Cancer Science published by John Wiley & Sons Australia, Ltd on behalf of Japanese Cancer Association.

CpG Oligodeoxynucleotide and Montanide ISA 51 Adjuvant Combination Enhanced the Protective Efficacy of a Subunit Malaria Vaccine

PubMed Central

Kumar, Sanjai; Jones, Trevor R.; Oakley, Miranda S.; Zheng, Hong; Kuppusamy, Shanmuga P.; Taye, Alem; Krieg, Arthur M.; Stowers, Anthony W.; Kaslow, David C.; Hoffman, Stephen L.

2004-01-01

Unmethylated CpG dinucleotide motifs present in bacterial genomes or synthetic oligodeoxynucleotides (ODNs) serve as strong immunostimulatory agents in mice, monkeys and humans. We determined the adjuvant effect of murine CpG ODN 1826 on the immunogenicity and protective efficacy of the Saccharomyces cerevisiae-expressed 19-kDa C-terminal region of merozoite surface protein 1 (yMSP119) of the murine malaria parasite Plasmodium yoelii. We found that in C57BL/6 mice, following sporozoite challenge, the degree of protective immunity against malaria induced by yMSP119 in a formulation of Montanide ISA 51 (ISA) plus CpG ODN 1826 was similar or superior to that conferred by yMSP119 emulsified in complete Freund's adjuvant (CFA/incomplete Freund's adjuvant). In total, among mice immunized with yMSP119, 22 of 32 (68.7%) with ISA plus CpG 1826, 0 of 4 (0%) with CFA/incomplete Freund’s adjuvant, 0 of 4 (0%) with CpG 1826 mixed with ISA (no yMSP119), and 0 of 11 (0%) with CpG 1826 alone were completely protected against development of erythrocytic stage infection after sporozoite challenge. The adjuvant effect of CpG ODN 1826 was manifested as both significantly improved complete protection from malaria (defined as the absence of detectable erythrocytic form parasites) (P = 0.007, chi square) and reduced parasite burden in infected mice. In vivo depletions of interleukin-12 and gamma interferon cytokines and CD4+ and CD8+ T cells in vaccinated mice had no significant effect on immunity. On the other hand, immunoglobulin G (IgG) isotype levels appeared to correlate with protection. Inclusion of CpG ODN 1826 in the yMSP119 plus ISA vaccine contributed towards the induction of higher levels of IgG2a and IgG2b (Th1 type) antibodies, suggesting that CpG ODN 1826 caused a shift towards a Th1 type of immune response that could be responsible for the higher degree of protective immunity. Our results indicate that this potent adjuvant formulation should be further evaluated for use in clinical trials of recombinant malarial vaccine candidates. PMID:14742540

TET1-mediated hypomethylation activates oncogenic signaling in triple-negative breast cancer.

PubMed

Good, Charly Ryan; Panjarian, Shoghag; Kelly, Andrew D; Madzo, Jozef; Patel, Bela; Jelinek, Jaroslav; Issa, Jean-Pierre J

2018-06-11

Both gains and losses of DNA methylation are common in cancer, but the factors controlling this balance of methylation remain unclear. Triple-negative breast cancer (TNBC), a subtype that does not overexpress hormone receptors or HER2/NEU, is one of the most hypomethylated cancers observed. Here we discovered that the TET1 DNA demethylase is specifically overexpressed in about 40% of patients with TNBC, where it is associated with hypomethylation of up to 10% of queried CpG sites and a worse overall survival. Through bioinformatic analyses in both breast and ovarian cancer cell line panels, we uncovered an intricate network connecting TET1 to hypomethylation and activation of cancer-specific oncogenic pathways including PI3K, EGFR, and PDGF. TET1 expression correlated with sensitivity to drugs targeting the PI3K-mTOR pathway, and CRISPR-mediated deletion of TET1 in two independent TNBC cell lines resulted in reduced expression of PI3K pathway genes, upregulation of immune response genes, and substantially reduced cellular proliferation, suggesting dependence of oncogenic pathways on TET1 overexpression. Our work establishes TET1 as a potential oncogene that contributes to aberrant hypomethylation in cancer and suggests that TET1 could serve as a druggable target for therapeutic intervention. Copyright ©2018, American Association for Cancer Research.

Prediction of epigenetically regulated genes in breast cancer cell lines

DOE Office of Scientific and Technical Information (OSTI.GOV)

Loss, Leandro A; Sadanandam, Anguraj; Durinck, Steffen

Methylation of CpG islands within the DNA promoter regions is one mechanism that leads to aberrant gene expression in cancer. In particular, the abnormal methylation of CpG islands may silence associated genes. Therefore, using high-throughput microarrays to measure CpG island methylation will lead to better understanding of tumor pathobiology and progression, while revealing potentially new biomarkers. We have examined a recently developed high-throughput technology for measuring genome-wide methylation patterns called mTACL. Here, we propose a computational pipeline for integrating gene expression and CpG island methylation profles to identify epigenetically regulated genes for a panel of 45 breast cancer cell lines,more » which is widely used in the Integrative Cancer Biology Program (ICBP). The pipeline (i) reduces the dimensionality of the methylation data, (ii) associates the reduced methylation data with gene expression data, and (iii) ranks methylation-expression associations according to their epigenetic regulation. Dimensionality reduction is performed in two steps: (i) methylation sites are grouped across the genome to identify regions of interest, and (ii) methylation profles are clustered within each region. Associations between the clustered methylation and the gene expression data sets generate candidate matches within a fxed neighborhood around each gene. Finally, the methylation-expression associations are ranked through a logistic regression, and their significance is quantified through permutation analysis. Our two-step dimensionality reduction compressed 90% of the original data, reducing 137,688 methylation sites to 14,505 clusters. Methylation-expression associations produced 18,312 correspondences, which were used to further analyze epigenetic regulation. Logistic regression was used to identify 58 genes from these correspondences that showed a statistically signifcant negative correlation between methylation profles and gene expression in the panel of breast cancer cell lines. Subnetwork enrichment of these genes has identifed 35 common regulators with 6 or more predicted markers. In addition to identifying epigenetically regulated genes, we show evidence of differentially expressed methylation patterns between the basal and luminal subtypes. Our results indicate that the proposed computational protocol is a viable platform for identifying epigenetically regulated genes. Our protocol has generated a list of predictors including COL1A2, TOP2A, TFF1, and VAV3, genes whose key roles in epigenetic regulation is documented in the literature. Subnetwork enrichment of these predicted markers further suggests that epigenetic regulation of individual genes occurs in a coordinated fashion and through common regulators.« less

Toll-like receptor 9 mediates oral bacteria-induced IL-8 expression in gingival epithelial cells.

PubMed

Kim, Youngsook; Jo, Ah-ram; Jang, Da Hyun; Cho, Yong-Joon; Chun, Jongsik; Min, Byung-Moo; Choi, Youngnim

2012-07-01

Previously, we reported that various oral bacteria regulate interleukin (IL)-8 production differently in gingival epithelial cells. The aim of this study was to characterize the pattern recognition receptor(s) that mediate bacteria-induced IL-8 expression. Among ligands that mimic bacterial components, only a Toll-like receptor (TLR) 9 ligand enhanced IL-8 expression as determined by ELISA. Both normal and immortalized human gingival epithelial (HOK-16B) cells expressed TLR9 intracellularly and showed enhanced IL-8 expression in response to CpG-oligonucleotide. The ability of eight strains of four oral bacterial species to induce IL-8 expression in HOK-16B cells, and their invasion capacity were examined in the absence or presence of 2% human serum. The ability of purified bacterial DNA (bDNA) to induce IL-8 was also examined. Six out of eight strains increased IL-8 production in the absence of serum. Usage of an endosomal acidification blocker or a TLR9 antagonist inhibited the IL-8 induction by two potent strains. In the presence of serum, many strains lost the ability to induce IL-8 and presented substantially reduced invasion capacity. The IL-8-inducing ability of bacteria in the absence or presence of serum showed a strong positive correlation with their invasion index. The IL-8-inducing ability of bacteria in the absence of human serum was also correlated with the immunostimulatory activity of its bDNA. The observed immunostimulatory activity of the bDNA could not be linked to its CpG motif content. In conclusion, oral bacteria induce IL-8 in gingival epithelial cells through TLR9 and the IL-8-inducing ability depends on the invasive capacity and immunostimulating DNA.

Short-term memory of motor network performance via activity-dependent potentiation of Na+/K+ pump function.

PubMed

Zhang, Hong-Yan; Sillar, Keith T

2012-03-20

Brain networks memorize previous performance to adjust their output in light of past experience. These activity-dependent modifications generally result from changes in synaptic strengths or ionic conductances, and ion pumps have only rarely been demonstrated to play a dynamic role. Locomotor behavior is produced by central pattern generator (CPG) networks and modified by sensory and descending signals to allow for changes in movement frequency, intensity, and duration, but whether or how the CPG networks recall recent activity is largely unknown. In Xenopus frog tadpoles, swim bout duration correlates linearly with interswim interval, suggesting that the locomotor network retains a short-term memory of previous output. We discovered an ultraslow, minute-long afterhyperpolarization (usAHP) in network neurons following locomotor episodes. The usAHP is mediated by an activity- and sodium spike-dependent enhancement of electrogenic Na(+)/K(+) pump function. By integrating spike frequency over time and linking the membrane potential of spinal neurons to network performance, the usAHP plays a dynamic role in short-term motor memory. Because Na(+)/K(+) pumps are ubiquitously expressed in neurons of all animals and because sodium spikes inevitably accompany network activity, the usAHP may represent a phylogenetically conserved but largely overlooked mechanism for short-term memory of neural network function. Copyright © 2012 Elsevier Ltd. All rights reserved.

Eicosapentaenoic acid induces DNA demethylation in carcinoma cells through a TET1-dependent mechanism.

PubMed

Ceccarelli, Veronica; Valentini, Virginia; Ronchetti, Simona; Cannarile, Lorenza; Billi, Monia; Riccardi, Carlo; Ottini, Laura; Talesa, Vincenzo Nicola; Grignani, Francesco; Vecchini, Alba

2018-05-14

In cancer cells, global genomic hypomethylation is found together with localized hypermethylation of CpG islands within the promoters and regulatory regions of silenced tumor suppressor genes. Demethylating agents may reverse hypermethylation, thus promoting gene re-expression. Unfortunately, demethylating strategies are not efficient in solid tumor cells. DNA demethylation is mediated by ten-eleven translocation enzymes (TETs). They sequentially convert 5-methylcytosine (5mC) to 5-hydroxymethylcytosine (5hmC), which is associated with active transcription; 5-formylcytosine; and finally, 5-carboxylcytosine. Although α-linolenic acid, eicosapentaenoic acid (EPA), and docosahexaenoic acid, the major n-3 polyunsaturated fatty acids, have anti-cancer effects, their action, as DNA-demethylating agents, has never been investigated in solid tumor cells. Here, we report that EPA demethylates DNA in hepatocarcinoma cells. EPA rapidly increases 5hmC on DNA, inducing p21 Waf1/Cip1 gene expression, which slows cancer cell-cycle progression. We show that the underlying molecular mechanism involves TET1. EPA simultaneously binds peroxisome proliferator-activated receptor γ (PPARγ) and retinoid X receptor α (RXRα), thus promoting their heterodimer and inducing a PPARγ-TET1 interaction. They generate a TET1-PPARγ-RXRα protein complex, which binds to a hypermethylated CpG island on the p21 gene, where TET1 converts 5mC to 5hmC. In an apparent shuttling motion, PPARγ and RXRα leave the DNA, whereas TET1 associates stably. Overall, EPA directly regulates DNA methylation levels, permitting TET1 to exert its anti-tumoral function.-Ceccarelli, V., Valentini, V., Ronchetti, S., Cannarile, L., Billi, M., Riccardi, C., Ottini, L., Talesa, V. N., Grignani, F., Vecchini, A., Eicosapentaenoic acid induces DNA demethylation in carcinoma cells through a TET1-dependent mechanism.

Improved Prefusion Stability, Optimized Codon Usage, and Augmented Virion Packaging Enhance the Immunogenicity of Respiratory Syncytial Virus Fusion Protein in a Vectored-Vaccine Candidate

PubMed Central

Liang, Bo; Ngwuta, Joan O.; Surman, Sonja; Kabatova, Barbora; Liu, Xiang; Lingemann, Matthias; Liu, Xueqiao; Yang, Lijuan; Herbert, Richard; Swerczek, Joanna; Chen, Man; Moin, Syed M.; Kumar, Azad; McLellan, Jason S.; Kwong, Peter D.; Graham, Barney S.; Collins, Peter L.

2017-01-01

ABSTRACT Respiratory syncytial virus (RSV) is the most important viral agent of severe pediatric respiratory tract disease worldwide, but it lacks a licensed vaccine or suitable antiviral drug. A live attenuated chimeric bovine/human parainfluenza virus type 3 (rB/HPIV3) was developed previously as a vector expressing RSV fusion (F) protein to confer bivalent protection against RSV and HPIV3. In a previous clinical trial in virus-naive children, rB/HPIV3 was well tolerated but the immunogenicity of wild-type RSV F was unsatisfactory. We previously modified RSV F with a designed disulfide bond (DS) to increase stability in the prefusion (pre-F) conformation and to be efficiently packaged in the vector virion. Here, we further stabilized pre-F by adding both disulfide and cavity-filling mutations (DS-Cav1), and we also modified RSV F codon usage to have a lower CpG content and a higher level of expression. This RSV F open reading frame was evaluated in rB/HPIV3 in three forms: (i) pre-F without vector-packaging signal, (ii) pre-F with vector-packaging signal, and (iii) secreted pre-F ectodomain trimer. Despite being efficiently expressed, the secreted pre-F was poorly immunogenic. DS-Cav1 stabilized pre-F, with or without packaging, induced higher titers of pre-F specific antibodies in hamsters, and improved the quality of RSV-neutralizing serum antibodies. Codon-optimized RSV F containing fewer CpG dinucleotides had higher F expression, replicated more efficiently in vivo, and was more immunogenic. The combination of DS-Cav1 pre-F stabilization, optimized codon usage, reduced CpG content, and vector packaging significantly improved vector immunogenicity and protective efficacy against RSV. This provides an improved vectored RSV vaccine candidate suitable for pediatric clinical evaluation. IMPORTANCE RSV and HPIV3 are the first and second leading viral causes of severe pediatric respiratory disease worldwide. Licensed vaccines or suitable antiviral drugs are not available. We are developing a chimeric rB/HPIV3 vector expressing RSV F as a bivalent RSV/HPIV3 vaccine and have been evaluating means to increase RSV F immunogenicity. In this study, we evaluated the effects of improved stabilization of F in the pre-F conformation and of codon optimization resulting in reduced CpG content and greater pre-F expression. Reduced CpG content dampened the interferon response to infection, promoting higher replication and increased F expression. We demonstrate that improved pre-F stabilization and strategic manipulation of codon usage, together with efficient pre-F packaging into vector virions, significantly increased F immunogenicity in the bivalent RSV/HPIV3 vaccine. The improved immunogenicity included induction of increased titers of high-quality complement-independent antibodies with greater pre-F site Ø binding and greater protection against RSV challenge. PMID:28539444

Methylation Analysis of the BMPR2 Gene Promoter Region in Patients With Pulmonary Arterial Hypertension.

PubMed

Pousada, Guillermo; Baloira, Adolfo; Valverde, Diana

2016-06-01

Pulmonary arterial hypertension is characterizated by obstruction of the pulmonary arteries. The gene mainly related to pathology is the bone morphogenetic protein receptor type II (BMPR2). The aim of this study was to analyze the methylation pattern of the BMPR2 promoter region in patients and controls. We used Methyl Primer Express(®) v.1.0 and MatInspector softwares to analyze this region. Genomic DNA obtained from the peripheral blood of patients and controls was modified with sodium bisulphite. Methylation was analyzed using methylation-specific PCR. DNA treated with CpG methyltransferase was used as a positive control for methylation and H1299 cell culture DNA was used as positive control for gene expression. We identified a CpG island, which may have been methylated, in the BMPR2 promoter region, in addition to NIT-2 (global-acting regulatory protein), sex-determining region Y) and heat shock factor transcription factor binding sites. We found no evidence of methylation in patients and controls. No methylated CpG sites were identified in H1299 cells expressing the BMPR2 gene. The BMPR2 promoter region is the most suitable for study because of the high number of transcription factor binding sites that could alter gene function. No evidence of methylation was detected in this region in patients and controls. Copyright © 2015 SEPAR. Published by Elsevier Espana. All rights reserved.

B cell TLR1/2, TLR4, TLR7 and TLR9 interact in induction of class switch DNA recombination: modulation by BCR and CD40, and relevance to T-independent antibody responses.

PubMed

Pone, Egest J; Lou, Zheng; Lam, Tonika; Greenberg, Milton L; Wang, Rui; Xu, Zhenming; Casali, Paolo

2015-02-01

Ig class switch DNA recombination (CSR) in B cells is crucial to the maturation of antibody responses. It requires IgH germline IH-CH transcription and expression of AID, both of which are induced by engagement of CD40 or dual engagement of a Toll-like receptor (TLR) and B cell receptor (BCR). Here, we have addressed cross-regulation between two different TLRs or between a TLR and CD40 in CSR induction by using a B cell stimulation system involving lipopolysaccharides (LPS). LPS-mediated long-term primary class-switched antibody responses and memory-like antibody responses in vivo and induced generation of class-switched B cells and plasma cells in vitro. Consistent with the requirement for dual TLR and BCR engagement in CSR induction, LPS, which engages TLR4 through its lipid A moiety, triggered cytosolic Ca2+ flux in B cells through its BCR-engaging polysaccharidic moiety. In the presence of BCR crosslinking, LPS synergized with a TLR1/2 ligand (Pam3CSK4) in CSR induction, but much less efficiently with a TLR7 (R-848) or TLR9 (CpG) ligand. In the absence of BCR crosslinking, R-848 and CpG, which per se induced marginal CSR, virtually abrogated CSR to IgG1, IgG2a, IgG2b, IgG3 and/or IgA, as induced by LPS or CD154 (CD40 ligand) plus IL-4, IFN-γ or TGF-β, and reduced secretion of class-switched Igs, without affecting B cell proliferation or IgM expression. The CSR inhibition by TLR9 was associated with the reduction in AID expression and/or IgH germline IH-S-CH transcription, and required co-stimulation of B cells by CpG with LPS or CD154. Unexpectedly, B cells also failed to undergo CSR or plasma cell differentiation when co-stimulated by LPS and CD154. Overall, by addressing the interaction of TLR1/2, TLR4, TLR7 and TLR9 in the induction of CSR and modulation of TLR-dependent CSR by BCR and CD40, our study suggests the complexity of how different stimuli cross-regulate an important B cell differentiation process and an important role of TLRs in inducing effective T-independent antibody responses to microbial pathogens, allergens and vaccines.

B cell TLR1/2, TLR4, TLR7 and TLR9 interact in induction of class switch DNA recombination: modulation by BCR and CD40, and relevance to T-independent antibody responses

PubMed Central

Pone, Egest J.; Lou, Zheng; Lam, Tonika; Greenberg, Milton L.; Wang, Rui; Xu, Zhenming; Casali, Paolo

2015-01-01

Ig class switch DNA recombination (CSR) in B cells is crucial to the maturation of antibody responses. It requires IgH germline IH-CH transcription and expression of AID, both of which are induced by engagement of CD40 or dual engagement of a Toll-like receptor (TLR) and B cell receptor (BCR). Here, we have addressed cross-regulation between two different TLRs or between a TLR and CD40 in CSR induction by using a B cell stimulation system involving lipopolysaccharides (LPS). LPS mediated long-term primary class-switched antibody responses and memory-like antibody responses in vivo and induced generation of class-switched B cells and plasma cells in vitro. Consistent with the requirement for dual TLR and BCR engagement in CSR induction, LPS, which engages TLR4 through its lipid A moiety, triggered cytosolic Ca2+ flux in B cells through its BCR-engaging polysaccharidic moiety. In the presence of BCR crosslinking, LPS synergized with a TLR1/2 ligand (Pam3CSK4) in CSR induction, but much less efficiently with a TLR7 (R-848) or TLR9 (CpG) ligand. In the absence of BCR crosslinking, R-848 and CpG, which per se induced marginal CSR, virtually abrogated CSR to IgG1, IgG2a, IgG2b, IgG3 and/or IgA, as induced by LPS or CD154 (CD40 ligand) plus IL-4, IFN-γ or TGF-β, and reduced secretion of class-switched Igs, without affecting B cell proliferation or IgM expression. The CSR inhibition by TLR9 was associated with the reduction in AID expression and/or IgH germline IH-S-CH transcription, and required co-stimulation of B cells by CpG with LPS or CD154. Unexpectedly, B cells also failed to undergo CSR or plasma cell differentiation when co-stimulated by LPS and CD154. Overall, by addressing the interaction of TLR1/2, TLR4, TLR7 and TLR9 in the induction of CSR and modulation of TLR-dependent CSR by BCR and CD40, our study suggests the complexity of how different stimuli cross-regulate an important B cell differentiation process and an important role of TLRs in inducing effective T-independent antibody responses to microbial pathogens, allergens and vaccines. PMID:25536171

Regulation of IL-10 expression by upstream stimulating factor (USF-1) in glioma-associated microglia.

PubMed

Zhang, Leying; Handel, Michelle Van; Schartner, Jill M; Hagar, Aaron; Allen, Grant; Curet, Marjorie; Badie, Behnam

2007-03-01

Understanding the local CNS immune response to neoplasms is essential in the development of immune-based treatments for malignant brain tumors. Using rodent glioma models, we have recently found tumor-associated microglia/macrophages (MG/MP) to be less responsive to known MG/MP activators such as CpG, LPS and IFN-gamma. To understand the mechanism of MG/MP suppression, nuclear extracts from rodent intracranial C6 gliomas, C6 glioma-associated MG/MP, normal brain, and normal MG/MP were obtained and studied using Electrophoretic Mobility Shift Assay (EMSA). Among the nuclear factors studied (AP-1, IRF, USF-1 and Stat-1) only USF-1, which is constitutively expressed in most cells, was down-regulated in tumor-associated MG/MP, but not normal MG/MP. Because tumor-associated MG/MP had higher expression of IL-10 (but not TNF-alpha or TGF-beta), we evaluated the role of USF-1 on IL-10 expression. siRNA mediated inhibition of USF-1 expression in primary MG/MP cultures resulted in up-regulation of IL-10 mRNA but not TNF-alpha or TGF-beta. These findings suggest that USF-1 may play a role in IL-10 regulation in MG/MP in brain tumors.

Epigenetics mediate environment : gene effects on occupational sensitization.

PubMed

Pacheco, Karin A

2012-04-01

Epigenetics is the study of stable modifications of fixed genomes that direct which genes are expressed and which are silenced. Epigenetic changes are modulated by environmental exposures, making epigenetics the interface between genes and environment. This has particular relevance in understanding the effect of occupational exposures on the expression of allergic disease. The goal of this review is to describe how epigenetic changes affect transcription potential, and to examine more closely the effect of specific environmental and occupational exposures on epigenetic variations that alter allergy gene transcripts and the inflammatory milieu. Gene transcription is activated when specific CpG sites are demethylated and histones are acetylated, and, conversely, silenced when sites are methylated and histones deacetylated. The development of Th1 and Th2 phenotypes, and expression of Treg cells, are now known to be modulated by epigenetic mechanisms. Workplace exposures such as tobacco smoke, particulates, diesel exhaust, polyaromatic hydrocarbons, ozone, and endotoxin, among others, suppress Treg development, and enhance expression of inflammatory cytokines and allergic phenotypes by epigenetic means. Epigenetic manipulation to open and close transcription sites provides flexibility of gene expression in response to changing environmental cues. It may also be the window whereby allergic disease in the workplace can be reduced by targeted environmental interventions.

Possible Mediation by Methylation in Acute Inflammation Following Personal Exposure to Fine Particulate Air Pollution

PubMed Central

Wang, Cuicui; Chen, Renjie; Shi, Min; Cai, Jing; Shi, Jingjin; Yang, Changyuan; Li, Huichu; Lin, Zhijing; Meng, Xia; Liu, Cong; Niu, Yue; Xia, Yongjie; Zhao, Zhuohui; Kan, Haidong; Weinberg, Clarice R

2018-01-01

Abstract Air pollution may increase cardiovascular and respiratory risk through inflammatory pathways, but evidence for acute effects has been weak and indirect. Between December 2014 and July 2015, we enrolled 36 healthy, nonsmoking college students for a panel study in Shanghai, China, a city with highly variable levels of air pollution. We measured personal exposure to particulate matter with an aerodynamic diameter less than or equal to 2.5 μm (PM2.5) continuously for 72 hours preceding each of 4 clinical visits that included phlebotomy. We measured 4 inflammation proteins and DNA methylation at nearby regulatory cytosine-phosphate-guanine (CpG) loci. We applied linear mixed-effect models to examine associations over various lag times. When results suggested mediation, we evaluated methylation as mediator. Increased PM2.5 concentration was positively associated with all 4 inflammation proteins and negatively associated with DNA methylation at regulatory loci for tumor necrosis factor alpha (TNF-α) and soluble intercellular adhesion molecule-1. A 10-μg/m3 increase in average PM2.5 during the 24 hours preceding blood draw corresponded to a 4.4% increase in TNF-α and a statistically significant decrease in methylation at one of the two studied candidate CpG loci for TNF-α. Epigenetics may play an important role in mediating effects of PM2.5 on inflammatory pathways. PMID:29020142

miR-140-5p regulates hypoxia-mediated human pulmonary artery smooth muscle cell proliferation, apoptosis and differentiation by targeting Dnmt1 and promoting SOD2 expression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Yanwei; Xu, Jing, E-mail: xujingdoc@163.com

miR-140-5p is down-regulated in patients with pulmonary arterial hypertension (PAH) and experimental models of PAH, and inhibits hypoxia-mediated pulmonary artery smooth muscle cell (PASMC) proliferation in vitro. Delivery of synthetic miR-140-5p prevents and treats established, experimental PAH. DNA methyltransferase 1 (Dnmt1) is up-regulated in PAH associated human PASMCs (HPASMCs), which promotes the development of PAH by hypermethylation of CpG islands within the promoter for superoxide dismutase 2 (SOD2) and down-regulating SOD2 expression. We searched for miR-140-5p targets using TargetScan, PicTar and MiRanda tools, and found that Dnmt1 is a potential target of miR-140-5p. Based on these findings, we speculated that miR-140-5pmore » might target Dnmt1 and regulate SOD2 expression to regulate hypoxia-mediated HPASMC proliferation, apoptosis and differentiation. We detected the expression of miR-140-5p, Dnmt1 and SOD2 by quantitative real-time polymerase chain reaction (qRT-PCR) and western blot assays, respectively, and found down-regulation of miR-140-5p and SOD2 and up-regulation of Dnmt1 exist in PAH tissues and hypoxia-mediated HPASMCs. Cell proliferation, apoptosis and differentiation detection showed that miR-140-5p inhibits proliferation and promotes apoptosis and differentiation of HPASMCs in hypoxia, while the effect of Dnmt1 on hypoxia-mediated HPASMCs is reversed. Luciferase assay confirmed that miR-140-5p targets Dnmt1 directly. An inverse correlation is also found between miR-140-5p and Dnmt1 in HPASMCs. In addition, we further investigated whether miR-140-5p and Dnmt1 regulate HPASMC proliferation, apoptosis and differentiation by regulating SOD2 expression, and the results confirmed our speculation. Taken together, these results indicated that miR-140-5p at least partly targets Dnmt1 and regulates SOD2 expression to inhibit proliferation and promote apoptosis and differentiation of HPASMCs in hypoxia. - Highlights: • miR-140-5p and SOD2 are down-regulated in PAH tissues and hypoxia-mediated HPASMCs. • Dnmt1 is up-regulated in PAH tissues and hypoxia-mediated HPASMCs. • miR-140-5p regulates HPASMC proliferation, apoptosis and differentiation. • Dnmt1 and SOD2 regulates HPASMC proliferation, apoptosis and differentiation. • miR-140-5p targets Dnmt1 and regulates SOD2 expression.« less

Curcumin sensitizes prostate cancer cells to radiation partly via epigenetic activation of miR-143 and miR-143 mediated autophagy inhibition.

PubMed

Liu, Jianbo; Li, Min; Wang, Yuewei; Luo, Jianchao

2017-08-01

Curcumin has been reported as a radiosensitizer in prostate cancer. But the underlying mechanism is not well understood. In this study, we firstly assessed how curcumin affects the expression of miR-143/miR-145 cluster. Then, we investigated whether miR-143 is involved in regulation of radiosensitivity and its association with autophagy in prostate cancer cells. Our data showed that PC3, DU145 and LNCaP cells treated with curcumin had significantly restored miR-143 and miR-145 expression. Curcumin showed similar effect as 5-AZA-dC on reducing methylation of CpG dinucleotides in miR-143 promoter. In addition, curcumin treatment reduced the expression of DNMT1 and DNMT3B, which contribute to promoter hypermethylation of the miR-143/miR-145 cluster. Therefore, we infer that curcumin can restore miR-143 and miR-145 expression via hypomethylation. MiR-143 overexpression and curcumin pretreatment enhanced radiation induced cancer cell growth inhibition and apoptosis. MiR-143 and curcumin remarkably reduced radiation-induced autophagy in PC3 and DU145 cells. MiR-143 overexpression alone also reduced the basal level of autophagy in DU145 cells. Mechanistically, miR-143 can suppress autophagy in prostate cancer cells at least via downregulating ATG2B. Based on these findings, we infer that curcumin sensitizes prostate cancer cells to radiation partly via epigenetic activation of miR-143 and miR-143 mediated autophagy inhibition.

A role for neuronal piRNAs in the epigenetic control of memory-related synaptic plasticity.

PubMed

Rajasethupathy, Priyamvada; Antonov, Igor; Sheridan, Robert; Frey, Sebastian; Sander, Chris; Tuschl, Thomas; Kandel, Eric R

2012-04-27

Small RNA-mediated gene regulation during development causes long-lasting changes in cellular phenotypes. To determine whether small RNAs of the adult brain can regulate memory storage, a process that requires stable and long-lasting changes in the functional state of neurons, we generated small RNA libraries from the Aplysia CNS. In these libraries, we discovered an unexpectedly abundant expression of a 28 nucleotide sized class of piRNAs in brain, which had been thought to be germline specific. These piRNAs have unique biogenesis patterns, predominant nuclear localization, and robust sensitivity to serotonin, a modulatory transmitter that is important for memory. We find that the Piwi/piRNA complex facilitates serotonin-dependent methylation of a conserved CpG island in the promoter of CREB2, the major inhibitory constraint of memory in Aplysia, leading to enhanced long-term synaptic facilitation. These findings provide a small RNA-mediated gene regulatory mechanism for establishing stable long-term changes in neurons for the persistence of memory. Copyright © 2012 Elsevier Inc. All rights reserved.

Deregulation of RB1 expression by loss of imprinting in human hepatocellular carcinoma.

PubMed

Anwar, Sumadi Lukman; Krech, Till; Hasemeier, Britta; Schipper, Elisa; Schweitzer, Nora; Vogel, Arndt; Kreipe, Hans; Lehmann, Ulrich

2014-08-01

The tumour suppressor gene RB1 is frequently silenced in many different types of human cancer, including hepatocellular carcinoma (HCC). However, mutations of the RB1 gene are relatively rare in HCC. A systematic screen for the identification of imprinted genes deregulated in human HCC revealed that RB1 shows imprint abnormalities in a high proportion of primary patient samples. Altogether, 40% of the HCC specimens (16/40) showed hyper- or hypomethylation at the CpG island in intron 2 of the RB1 gene. Re-analysis of publicly available genome-wide DNA methylation data confirmed these findings in two independent HCC cohorts. Loss of correct DNA methylation patterns at the RB1 locus leads to the aberrant expression of an alternative RB1-E2B transcript, as measured by quantitative real-time PCR. Demethylation at the intron 2 CpG island by DNMT1 knock-down or aza-deoxycytidine (DAC) treatment stimulated expression of the RB1-E2B transcript, accompanied by diminished RB1 main transcript expression. No aberrant DNA methylation was found at the RB1 locus in hepatocellular adenoma (HCA, n = 10), focal nodular hyperplasia (FNH, n = 5) and their corresponding adjacent liver tissue specimens. Deregulated RB1 expression due to hyper- or hypomethylation in intron 2 of the RB1 gene is found in tumours without loss of heterozygosity and is associated with a decrease in overall survival (p = 0.032) if caused by hypermethylation of CpG85. This unequivocally demonstrates that loss of imprinting represents an important additional mechanism for RB1 pathway inactivation in human HCC, complementing well-described molecular defects. Copyright © 2014 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

A recombinant plasmid containing CpG motifs as a novel vaccine adjuvant for immune protection against herpes simplex virus 2.

PubMed

He, Zhuojing; Xu, Juan; Tao, Wei; Fu, Ting; He, Fang; Hu, Ruxi; Jia, Lan; Hong, Yan

2016-08-01

The aim of the present study was to evaluate the efficacy of a herpes simplex virus type 2 (HSV-2) DNA vaccine co‑immunized with a plasmid adjuvant containing CpG motifs. A novel eukaryotic expression plasmid vector containing kanamycin resistance gene (pcDNA3Kan) was acquired from pET‑28a(+) and pcDNA3 plasmids. A gene encoding full length HSV‑2 glycoprotein D (gD) was amplified from the pcDNA3‑gD plasmid, which was cloned into pcDNA3Kan resulting in the construction of the recombinant plasmid pcDNA3Kan‑gD (pgD). A DNA segment containing 8 CpG motifs was synthesized, and cloned into pcDNA3Kan, resulting in the recombinant plasmid pcDNA3Kan‑CpG (pCpG). Mice were co‑inoculated with pgD (used as a DNA vaccine) and pCpG (used as an adjuvant) by bilateral intramuscular injection. Mice inoculated with pgD+pCpG showed higher titers of antibodies than those inoculated with the DNA vaccine alone (P<0.05). In addition, mice inoculated with pgD+pCpG showed the highest percentage of CD4+ T cells in the blood of all the groups (P﹤0.05). Thus, the present study demonstrated that pCpG could stimulate the HSV‑2 DNA vaccine to induce a stronger cell‑mediated immune response than the DNA vaccine alone. The aim of the present study was to evaluate the efficacy of a HSV‑2 DNA vaccine (pgD) co‑immunized with a plasmid adjuvant containing CpG motifs (pCpG). Whether the pCpG would be able to stimulate the pgD to induce a stronger immune response compared with pgD alone.

Demethylation-mediated miR-129-5p up-regulation inhibits malignant phenotype of osteogenic osteosarcoma by targeting Homo sapiens valosin-containing protein (VCP).

PubMed

Long, Xin Hua; Zhou, Yun Fei; Peng, Ai Fen; Zhang, Zhi Hong; Chen, Xuan Yin; Chen, Wen Zhao; Liu, Jia Ming; Huang, Shan Hu; Liu, Zhi Li

2015-05-01

Previous studies demonstrated that increased Homo sapiens valosin-containing protein (VCP) may be involved in osteosarcoma (OS) metastasis. However, the underlying mechanism of VCP over-expression in OS remains unknown. In the present study, we found a significantly negative correlation between miR-129-5p and VCP protein expression in OS tissues with pulmonary metastasis (Spearman's rho, rs = -0.948). Bioinformatical prediction, Luciferase reporter assay, Western blot, and RT-PCR assays performed on OS cells indicated that VCP is a target of miR-129-5p. In addition, three CPG islands in the region of miR-129-5p promoter were detected by bioinformatical prediction, and significantly higher expression of miR-129-5p and lower methylation level of miR-129-2 gene in OS cells treated with 5-Aza-2'-deoxycytidine (a potent DNA demethylating agent) than in those untreated cells were observed. Furthermore, lower migratory and invasive ability was found in cells with elevated miR-129-5p than in those with decreased miR-129-5p. These findings indicated that increased miR-129-5p may be mediated by demethylation and inhibit OS cell migration and invasion by targeting VCP in OS, and targeting miR-129-5p/VCP signaling pathway may serve as a therapeutic strategy for OS management, although further studies will be necessary.

Anxiety Associated Increased CpG Methylation in the Promoter of Asb1: A Translational Approach Evidenced by Epidemiological and Clinical Studies and a Murine Model.

PubMed

Emeny, Rebecca T; Baumert, Jens; Zannas, Anthony S; Kunze, Sonja; Wahl, Simone; Iurato, Stella; Arloth, Janine; Erhardt, Angelika; Balsevich, Georgia; Schmidt, Mathias V; Weber, Peter; Kretschmer, Anja; Pfeiffer, Liliane; Kruse, Johannes; Strauch, Konstantin; Roden, Michael; Herder, Christian; Koenig, Wolfgang; Gieger, Christian; Waldenberger, Melanie; Peters, Annette; Binder, Elisabeth B; Ladwig, Karl-Heinz

2018-01-01

Epigenetic regulation in anxiety is suggested, but evidence from large studies is needed. We conducted an epigenome-wide association study (EWAS) on anxiety in a population-based cohort and validated our finding in a clinical cohort as well as a murine model. In the KORA cohort, participants (n=1522, age 32-72 years) were administered the Generalized Anxiety Disorder (GAD-7) instrument, whole blood DNA methylation was measured (Illumina 450K BeadChip), and circulating levels of hs-CRP and IL-18 were assessed in the association between anxiety and methylation. DNA methylation was measured using the same instrument in a study of patients with anxiety disorders recruited at the Max Planck Institute of Psychiatry (MPIP, 131 non-medicated cases and 169 controls). To expand our mechanistic understanding, these findings were reverse translated in a mouse model of acute social defeat stress. In the KORA study, participants were classified according to mild, moderate, or severe levels of anxiety (29.4%/6.0%/1.5%, respectively). Severe anxiety was associated with 48.5% increased methylation at a single CpG site (cg12701571) located in the promoter of the gene encoding Asb1 (β-coefficient=0.56 standard error (SE)=0.10, p (Bonferroni)=0.005), a protein hypothetically involved in regulation of cytokine signaling. An interaction between IL-18 and severe anxiety with methylation of this CpG cite showed a tendency towards significance in the total population (p=0.083) and a significant interaction among women (p=0.014). Methylation of the same CpG was positively associated with Panic and Agoraphobia scale (PAS) scores (β=0.005, SE=0.002, p=0.021, n=131) among cases in the MPIP study. In a murine model of acute social defeat stress, Asb1 gene expression was significantly upregulated in a tissue-specific manner (p=0.006), which correlated with upregulation of the neuroimmunomodulating cytokine interleukin 1 beta. Our findings suggest epigenetic regulation of the stress-responsive Asb1 gene in anxiety-related phenotypes. Further studies are necessary to elucidate the causal direction of this association and the potential role of Asb1-mediated immune dysregulation in anxiety disorders.

Anxiety Associated Increased CpG Methylation in the Promoter of Asb1: A Translational Approach Evidenced by Epidemiological and Clinical Studies and a Murine Model

PubMed Central

Emeny, Rebecca T; Baumert, Jens; Zannas, Anthony S; Kunze, Sonja; Wahl, Simone; Iurato, Stella; Arloth, Janine; Erhardt, Angelika; Balsevich, Georgia; Schmidt, Mathias V; Weber, Peter; Kretschmer, Anja; Pfeiffer, Liliane; Kruse, Johannes; Strauch, Konstantin; Roden, Michael; Herder, Christian; Koenig, Wolfgang; Gieger, Christian; Waldenberger, Melanie; Peters, Annette; Binder, Elisabeth B; Ladwig, Karl-Heinz

2018-01-01

Epigenetic regulation in anxiety is suggested, but evidence from large studies is needed. We conducted an epigenome-wide association study (EWAS) on anxiety in a population-based cohort and validated our finding in a clinical cohort as well as a murine model. In the KORA cohort, participants (n=1522, age 32–72 years) were administered the Generalized Anxiety Disorder (GAD-7) instrument, whole blood DNA methylation was measured (Illumina 450K BeadChip), and circulating levels of hs-CRP and IL-18 were assessed in the association between anxiety and methylation. DNA methylation was measured using the same instrument in a study of patients with anxiety disorders recruited at the Max Planck Institute of Psychiatry (MPIP, 131 non-medicated cases and 169 controls). To expand our mechanistic understanding, these findings were reverse translated in a mouse model of acute social defeat stress. In the KORA study, participants were classified according to mild, moderate, or severe levels of anxiety (29.4%/6.0%/1.5%, respectively). Severe anxiety was associated with 48.5% increased methylation at a single CpG site (cg12701571) located in the promoter of the gene encoding Asb1 (β-coefficient=0.56 standard error (SE)=0.10, p (Bonferroni)=0.005), a protein hypothetically involved in regulation of cytokine signaling. An interaction between IL-18 and severe anxiety with methylation of this CpG cite showed a tendency towards significance in the total population (p=0.083) and a significant interaction among women (p=0.014). Methylation of the same CpG was positively associated with Panic and Agoraphobia scale (PAS) scores (β=0.005, SE=0.002, p=0.021, n=131) among cases in the MPIP study. In a murine model of acute social defeat stress, Asb1 gene expression was significantly upregulated in a tissue-specific manner (p=0.006), which correlated with upregulation of the neuroimmunomodulating cytokine interleukin 1 beta. Our findings suggest epigenetic regulation of the stress-responsive Asb1 gene in anxiety-related phenotypes. Further studies are necessary to elucidate the causal direction of this association and the potential role of Asb1-mediated immune dysregulation in anxiety disorders. PMID:28540928

Probable Chemical Hypoxia Effects on Progress of CNV Through Induction of Promoter CpG Demethylation and Overexpression of IL17RC in Human RPE Cells.

PubMed

Alivand, Mohammad Reza; Sabouni, Farzaneh; Soheili, Zahra-Soheila

2016-09-01

To survey the changes of promoter CpG methylation status and mRNA expression of IL17RC (interleukin 17 receptor C) gene in retinal pigment epithelium (RPE) cells under chemical hypoxia condition for choroidal neovascularization (CNV) modeling in vitro. RPE cells were cultured in both untreated as a control group and treated by cobalt chloride media as a hypoxia group for various concentrations (100-150μM) and times (24-36 hrs.) To confirm chemical hypoxia condition, mRNA expression of HIF (Hypoxia Inducible Factor) -1α, -2α, and Vascular Endothelial Growth Factor (VEGF) was compared between two groups by Real-time PCR. Also, in normoxia and hypoxia conditions, IL17RC expression changes and promoter CpG methylation status were evaluated by Real-time PCR and methylation-specific PCR (MSP) techniques, respectively. Overexpression of HIF-1α, HIF-2α, and VEGF was significant in hypoxia versus normoxia conditions. Our data showed overexpression of IL17RC (2.1- to 6.3-fold) and decreasing of its promoter methylation in comparison with hypoxia and normoxia conditions. It was found that there are significant association between promoter methylation status and expression of IL17RC in chemical hypoxia condition. Therefore, methylation of IL17RC could play as a marker in CNV and degeneration of RPE cells in vitro. Additionally, HIF-α and methylation phenomena may be considered as critical targets for blocking in angiogenesis of age-related degeneration in future studies.

Experimental murine myopia induces collagen type Iα1 (COL1A1) DNA methylation and altered COL1A1 messenger RNA expression in sclera

PubMed Central

Zhou, Xiangtian; Ji, Fengtao; An, Jianhong; Zhao, Fuxin; Shi, Fanjun; Huang, Furong; Li, Yuan; Jiao, Shiming; Yan, Dongsheng; Chen, Xiaoyan; Chen, JiangFan

2012-01-01

Purpose To investigate whether myopia development is associated with changes of scleral DNA methylation in cytosine-phosphate-guanine (CpG) sites in the collagen 1A1 (COL1A1) promoter and messenger RNA (mRNA) levels following murine form deprivation myopia. Methods Fifty-seven C57BL/6 mice (postnatal day 23) were randomly assigned to four groups: (1) monocular form deprivation (MD) in which a diffuser lens was placed over one eye for 28 days; (2) normal controls without MD; (3) MD recovery in which the diffuser lens was removed for seven days; and (4) MD recovery normal controls. The DNA methylation pattern in COL1A1 promoter and exon 1 was determined by bisulfite DNA sequencing, and the COL1A1 mRNA level in sclera was determined by quantitative PCR. Results MD was found to induce myopia in the treated eyes. Six CpG sites in the promoter and exon 1 region of COL1A1 were methylated with significantly higher frequency in the treated eyes than normal control eyes (p<0.05), with CpG island methylation in MD-contralateral eyes being intermediate. Consistent with the CpG methylation, scleral COL1A1 mRNA was reduced by 57% in the MD-treated eyes compared to normal controls (p<0.05). After seven days of MD recovery, CpG methylation was significantly reduced (p=0.01). The methylation patterns returned to near normal level in five CpG sites, but the sixth was hypomethylated compared to normal controls. Conclusions In parallel with the development of myopia and the reduced COL1A1 mRNA, the frequency of methylation in CpG sites of the COL1A1 promoter/exon 1 increased during MD and returned to near normal during recovery. Thus, hypermethylation of CpG sites in the promoter/exon 1 of COL1A1 may underlie reduced collagen synthesis at the transcriptional level in myopic scleras. PMID:22690110

Regulation of the ITGA2 gene by epigenetic mechanisms in prostate cancer.

PubMed

Chin, Suyin Paulynn; Marthick, James R; West, Alison C; Short, Annabel K; Chuckowree, Jyoti; Polanowski, Andrea M; Thomson, Russell J; Holloway, Adele F; Dickinson, Joanne L

2015-05-01

Integrin alpha2 beta1 (α2 β1 ) plays an integral role in tumour cell invasion, metastasis and angiogenesis, and altered expression of the receptor has been linked to tumour prognosis in several solid tumours. However, the relationship is complex, with both increased and decreased expression associated with different stages of tumour metastases in several tumour types. The ITGA2 gene, which codes for the α2 subunit, was examined to investigate whether a large CpG island associated with its promoter region is involved in the differential expression of ITGA2 observed in prostate cancer. Bisulphite sequencing of the ITGA2 promoter was used to assess methylation in formalin-fixed paraffin-embedded (FFPE) prostate tumour specimens and prostate cancer cell lines, PC3, 22Rv1 and LNCaP. Changes in ITGA2 mRNA expression were measured using quantitative PCR. ITGA2 functionality was interrogated using cell migration scratch assays and siRNA knockdown experiments. Bisulphite sequencing revealed strikingly decreased methylation at key CpG sites within the promoter of tumour samples, when compared with normal prostate tissue. Altered methylation of this CpG island is also associated with differences in expression in the non-invasive LNCaP, and the highly metastatic PC3 and 22Rv1 prostate cancer cell lines. Further bisulphite sequencing confirmed that selected CpGs were highly methylated in LNCaP cells, whilst only low levels of methylation were observed in PC3 and 22Rv1 cells, correlating with ITGA2 transcript levels. Examination of the increased expression of ITGA2 was shown to influence migratory potential via scratch assay in PC3, 22Rv1 and LNCaP cells, and was confirmed by siRNA knockdown experiments. Taken together, our data supports the assertion that epigenetic modification of the ITGA2 promoter is a mechanism by which ITGA2 expression is regulated. © 2015 Wiley Periodicals, Inc.

A phenolic glycoside from Flacourtia indica induces heme mediated oxidative stress in Plasmodium falciparum and attenuates malaria pathogenesis in mice.

PubMed

Singh, Shiv Vardan; Manhas, Ashan; Singh, Suriya P; Mishra, Sonali; Tiwari, Nimisha; Kumar, Parmanand; Shanker, Karuna; Srivastava, Kumkum; Sashidhara, Koneni V; Pal, Anirban

2017-07-01

Flacourtia indica is especially popular among the various communities of many African countries where it is being used traditionally for the treatment of malaria. In our previous report, we have identified some phenolic glycosides from the aerial parts of F. indica as promising antiplasmodial agents under in vitro conditions. Antimalarial bioprospection of F. indica derived phenolic glycoside in Swiss mice (in vivo) with special emphasis on its mode of action. Chloroquine sensitive strain of Plasmodium falciparum was routinely cultured and used for the in vitro studies. The in vivo antimalarial potential of phenolic glycoside was evaluated against P. berghei in Swiss mice through an array of parameters viz., hematological, biochemical, chemo-suppression and mean survival time. 2-(6-benzoyl-β-d-glucopyranosyloxy)-7-(1α, 2α, 6α-trihydroxy-3-oxocyclohex-4-enoyl)-5-hydroxybenzyl alcohol (CPG), a phenolic glycoside isolated from the aerial parts of F. indica was found to exhibit promising antiplasmodial activity by arresting the P. falciparum growth at the trophozoite stage. Spectroscopic investigations reveal that CPG possesses a strong binding affinity with free heme moieties. In addition, these interactions lead to the inhibition of heme polymerization in malaria parasite, augmenting oxidative stress, and delaying the rapid growth of parasite. Under in-vivo condition, CPG exhibited significant antimalarial activity against P. berghei at 50 and 75mg/kg body weight through chemo-suppression of parasitemia and ameliorating the parasite induced inflammatory and oxidative (hepatic) imbalance in the experimental mice. CPG was found to be a potential antimalarial constituent of F. indica with an explored mechanism of action, which also offers the editing choices for developing CPG based antimalarial chemotypes. Copyright © 2017 Elsevier GmbH. All rights reserved.

Interactions between Dorsal and Ventral Root Stimulation on the Generation of Locomotor-Like Activity in the Neonatal Mouse Spinal Cord

PubMed Central

2016-01-01

Abstract We investigated whether dorsal (DR) and ventral root (VR) stimulus trains engage common postsynaptic components to activate the central pattern generator (CPG) for locomotion in the neonatal mouse spinal cord. VR stimulation did not activate the first order interneurons mediating the activation of the locomotor CPG by sacrocaudal afferent stimulation. Simultaneous stimulation of adjacent dorsal or ventral root pairs, subthreshold for evoking locomotor-like activity, did not summate to activate the CPG. This suggests that locomotor-like activity is triggered when a critical class of efferent or afferent axons is stimulated and does not depend on the number of stimulated axons or activated postsynaptic neurons. DR- and VR-evoked episodes exhibited differences in the coupling between VR pairs. In DR-evoked episodes, the coupling between the ipsilateral and contralateral flexor/extensor roots was similar and stronger than the bilateral extensor roots. In VR-evoked episodes, ipsilateral flexor/extensor coupling was stronger than both the contralateral flexor/extensor and the bilateral extensor coupling. For both types of stimulation, the coupling was greatest between the bilateral L1/L2 flexor-dominated roots. This indicates that the recruitment and/or the firing pattern of motoneurons differed in DR and VR-evoked episodes. However, the DR and VR trains do not appear to activate distinct CPGs because trains of DR and VR stimuli at frequencies too low to evoke locomotor-like activity did so when they were interleaved. These results indicate that the excitatory actions of VR stimulation converge onto the CPG through an unknown pathway that is not captured by current models of the locomotor CPG. PMID:27419215

Genome-wide methylation analysis identifies differentially methylated CpG loci associated with severe obesity in childhood.

PubMed

Huang, R C; Garratt, E S; Pan, H; Wu, Y; Davis, E A; Barton, S J; Burdge, G C; Godfrey, K M; Holbrook, J D; Lillycrop, K A

2015-01-01

Childhood obesity is a major public health issue. Here we investigated whether differential DNA methylation was associated with childhood obesity. We studied DNA methylation profiles in whole blood from 78 obese children (mean BMI Z-score: 2.6) and 71 age- and sex-matched controls (mean BMI Z-score: 0.1). DNA samples from obese and control groups were pooled and analyzed using the Infinium HumanMethylation450 BeadChip array. Comparison of the methylation profiles between obese and control subjects revealed 129 differentially methylated CpG (DMCpG) loci associated with 80 unique genes that had a greater than 10% difference in methylation (P-value < 0.05). The top pathways enriched among the DMCpGs included developmental processes, immune system regulation, regulation of cell signaling, and small GTPase-mediated signal transduction. The associations between the methylation of selected DMCpGs with childhood obesity were validated using sodium bisulfite pyrosequencing across loci within the FYN, PIWIL4, and TAOK3 genes in individual subjects. Three CpG loci within FYN were hypermethylated in obese individuals (all P < 0.01), while obesity was associated with lower methylation of CpG loci within PIWIL4 (P = 0.003) and TAOK3 (P = 0.001). After building logistic regression models, we determined that a 1% increase in methylation in TAOK3, multiplicatively decreased the odds of being obese by 0.91 (95% CI: 0.86 - 0.97), and an increase of 1% methylation in FYN CpG3, multiplicatively increased the odds of being obese by 1.03 (95% CI: 0.99 - 1.07). In conclusion, these findings provide evidence that childhood obesity is associated with specific DNA methylation changes in whole blood, which may have utility as biomarkers of obesity risk.

CpA/CpG methylation of CiMDA5 possesses tight association with the resistance against GCRV and negatively regulates mRNA expression in grass carp, Ctenopharyngodon idella.

PubMed

Shang, Xueying; Su, Jianguo; Wan, Quanyuan; Su, Juanjuan

2015-01-01

Melanoma differentiation-associated gene 5 (MDA5) plays a crucial role in recognizing intracellular viral infection, activating the interferon regulatory factor pathways as well as inducing antiviral response. While the antiviral regulatory mechanism of MDA5 remains unclear. In the present study, CiMDA5 (Ctenopharyngodon idella MDA5) against grass carp reovirus (GCRV) would be initially revealed from the perspective of DNA methylation, a pivotal epigenetic modification. Two CpG islands (CGIs) were predicted located in the first exon of CiMDA5, of which the first CpG island was 427 bp in length possessed 29 candidate CpG loci and 34 CpA loci, and the second one was 130 bp in length involving 7 CpG loci as well as 10 CpA loci. By bisulfite sequencing PCR (BSP), the methylation statuses were detected in spleen of 70 individuals divided into resistant/susceptible groups post challenge experiment, and the resistance-association analysis was performed with Chi-square test. Quantitative real-time RT-PCR (qRT-PCR) was carried out to explore the relationship between DNA methylation and gene expression in CiMDA5. Results indicated that the methylation levels of CpA/CpG sites at +200, +202, +204, +207 nt, which consisted of a putative densely methylated element (DME), were significantly higher in the susceptible group than those in the resistant group. Meanwhile, the average transcription of CiMDA5 was down-regulated in the susceptible individuals compared with the resistant individuals. Evidently, the DNA methylation may be the negative modulator of CiMDA5 antiviral expression. Collectively, the methylation levels of CiMDA5 demonstrated the tight association with the resistance against GCRV and the negative-regulated roles in mRNA expression. This study first discovered the resistance-associated gene modulated by DNA methylation in teleost, preliminary revealed the underlying regulatory mechanism of CiMDA5 transcription against GCRV as well as laid a theoretical foundation on molecular nosogenesis of hemorrhagic diseases in C. idella. Copyright © 2014 Elsevier Ltd. All rights reserved.

Stress-induced gene expression and behavior are controlled by DNA methylation and methyl donor availability in the dentate gyrus

PubMed Central

Saunderson, Emily A.; Spiers, Helen; Gutierrez-Mecinas, Maria; Trollope, Alexandra F.; Shaikh, Abeera; Mill, Jonathan; Reul, Johannes M. H. M.

2016-01-01

Stressful events evoke long-term changes in behavioral responses; however, the underlying mechanisms in the brain are not well understood. Previous work has shown that epigenetic changes and immediate-early gene (IEG) induction in stress-activated dentate gyrus (DG) granule neurons play a crucial role in these behavioral responses. Here, we show that an acute stressful challenge [i.e., forced swimming (FS)] results in DNA demethylation at specific CpG (5′-cytosine–phosphate–guanine-3′) sites close to the c-Fos (FBJ murine osteosarcoma viral oncogene homolog) transcriptional start site and within the gene promoter region of Egr-1 (early growth response protein 1) specifically in the DG. Administration of the (endogenous) methyl donor S-adenosyl methionine (SAM) did not affect CpG methylation and IEG gene expression at baseline. However, administration of SAM before the FS challenge resulted in an enhanced CpG methylation at the IEG loci and suppression of IEG induction specifically in the DG and an impaired behavioral immobility response 24 h later. The stressor also specifically increased the expression of the de novo DNA methyltransferase Dnmt3a [DNA (cytosine-5-)-methyltransferase 3 alpha] in this hippocampus region. Moreover, stress resulted in an increased association of Dnmt3a enzyme with the affected CpG loci within the IEG genes. No effects of SAM were observed on stress-evoked histone modifications, including H3S10p-K14ac (histone H3, phosphorylated serine 10 and acetylated lysine-14), H3K4me3 (histone H3, trimethylated lysine-4), H3K9me3 (histone H3, trimethylated lysine-9), and H3K27me3 (histone H3, trimethylated lysine-27). We conclude that the DNA methylation status of IEGs plays a crucial role in FS-induced IEG induction in DG granule neurons and associated behavioral responses. In addition, the concentration of available methyl donor, possibly in conjunction with Dnmt3a, is critical for the responsiveness of dentate neurons to environmental stimuli in terms of gene expression and behavior. PMID:27078100

Comprehensive analysis of MGMT promoter methylation: correlation with MGMT expression and clinical response in GBM.

PubMed

Shah, Nameeta; Lin, Biaoyang; Sibenaller, Zita; Ryken, Timothy; Lee, Hwahyung; Yoon, Jae-Geun; Rostad, Steven; Foltz, Greg

2011-01-07

O⁶-methylguanine DNA-methyltransferase (MGMT) promoter methylation has been identified as a potential prognostic marker for glioblastoma patients. The relationship between the exact site of promoter methylation and its effect on gene silencing, and the patient's subsequent response to therapy, is still being defined. The aim of this study was to comprehensively characterize cytosine-guanine (CpG) dinucleotide methylation across the entire MGMT promoter and to correlate individual CpG site methylation patterns to mRNA expression, protein expression, and progression-free survival. To best identify the specific MGMT promoter region most predictive of gene silencing and response to therapy, we determined the methylation status of all 97 CpG sites in the MGMT promoter in tumor samples from 70 GBM patients using quantitative bisulfite sequencing. We next identified the CpG site specific and regional methylation patterns most predictive of gene silencing and improved progression-free survival. Using this data, we propose a new classification scheme utilizing methylation data from across the entire promoter and show that an analysis based on this approach, which we call 3R classification, is predictive of progression-free survival (HR  = 5.23, 95% CI [2.089-13.097], p<0.0001). To adapt this approach to the clinical setting, we used a methylation-specific multiplex ligation-dependent probe amplification (MS-MLPA) test based on the 3R classification and show that this test is both feasible in the clinical setting and predictive of progression free survival (HR  = 3.076, 95% CI [1.301-7.27], p = 0.007). We discuss the potential advantages of a test based on this promoter-wide analysis and compare it to the commonly used methylation-specific PCR test. Further prospective validation of these two methods in a large independent patient cohort will be needed to confirm the added value of promoter wide analysis of MGMT methylation in the clinical setting.

Comprehensive Analysis of MGMT Promoter Methylation: Correlation with MGMT Expression and Clinical Response in GBM

PubMed Central

Shah, Nameeta; Lin, Biaoyang; Sibenaller, Zita; Ryken, Timothy; Lee, Hwahyung; Yoon, Jae-Geun; Rostad, Steven; Foltz, Greg

2011-01-01

O6-methylguanine DNA-methyltransferase (MGMT) promoter methylation has been identified as a potential prognostic marker for glioblastoma patients. The relationship between the exact site of promoter methylation and its effect on gene silencing, and the patient's subsequent response to therapy, is still being defined. The aim of this study was to comprehensively characterize cytosine-guanine (CpG) dinucleotide methylation across the entire MGMT promoter and to correlate individual CpG site methylation patterns to mRNA expression, protein expression, and progression-free survival. To best identify the specific MGMT promoter region most predictive of gene silencing and response to therapy, we determined the methylation status of all 97 CpG sites in the MGMT promoter in tumor samples from 70 GBM patients using quantitative bisulfite sequencing. We next identified the CpG site specific and regional methylation patterns most predictive of gene silencing and improved progression-free survival. Using this data, we propose a new classification scheme utilizing methylation data from across the entire promoter and show that an analysis based on this approach, which we call 3R classification, is predictive of progression-free survival (HR  = 5.23, 95% CI [2.089–13.097], p<0.0001). To adapt this approach to the clinical setting, we used a methylation-specific multiplex ligation-dependent probe amplification (MS-MLPA) test based on the 3R classification and show that this test is both feasible in the clinical setting and predictive of progression free survival (HR  = 3.076, 95% CI [1.301–7.27], p = 0.007). We discuss the potential advantages of a test based on this promoter-wide analysis and compare it to the commonly used methylation-specific PCR test. Further prospective validation of these two methods in a large independent patient cohort will be needed to confirm the added value of promoter wide analysis of MGMT methylation in the clinical setting. PMID:21249131

Effects of low-dose aspirin on maternal blood pressure and vascular function in an experimental model of gestational hypertension.

PubMed

Osikoya, Oluwatobiloba; Jaini, Paresh A; Nguyen, An; Valdes, Melissa; Goulopoulou, Styliani

2017-06-01

Daily intake of low-dose aspirin after 12weeks of gestation is currently recommended as a preventative intervention in pregnancies in high risk of developing preeclampsia. This recommendation is based on epidemiological evidence, whereas experimental studies investigating the exact mechanisms of aspirin action during pregnancy are lacking. We previously showed that treating pregnant rats with a synthetic mimetic of unmethylated CpG DNA (bacterial DNA) caused preeclampsia-like characteristics such as maternal hypertension and increased cyclooxygenase (COX) expression and activity. In this study, we tested the hypothesis that daily maternal treatment with low-dose aspirin would prevent the development of maternal hypertension, reduce COX activity and thromboxane A 2 (TxA 2 ) production, and improve maternal vascular function in pregnant rats exposed to CpG ODN during gestation. Pregnant rats were treated with ODN2395 (synthetic CpG DNA) or saline (vehicle) on gestational days (GD) 14, 16, 18. Daily low-dose aspirin treatment (1.5mg/kgBW) started on GD10 and continued throughout gestation. Pregnant rats treated with ODN2395 had greater systolic blood pressure compared to controls (120±4mmHg vs. 100±5mmHg, p=0.03) and aspirin did not prevent this increase (p=0.86). Aspirin prevented ODN2395-induced increases of TxB 2 (TxA 2 metabolite) in serum and mesenteric arteries. ODN2395 increased expression of COX-1 and COX-2 in mesenteric and uterine arteries and aspirin abolished these effects. Aspirin reduced contractile responses to phenylephrine and U46619 (TxA 2 mimetic) in mesenteric arteries from control rats but not from ODN2395-treated rats. In conclusion, treatment with low-dose aspirin reduced systemic and vascular COX expression and activity but did not prevent the development of maternal hypertension induced by exposure to unmethylated CpG DNA (bacterial DNA). Copyright © 2017 Elsevier Ltd. All rights reserved.

A Six Months Exercise Intervention Influences the Genome-wide DNA Methylation Pattern in Human Adipose Tissue

PubMed Central

Rönn, Tina; Volkov, Petr; Davegårdh, Cajsa; Dayeh, Tasnim; Hall, Elin; Olsson, Anders H.; Nilsson, Emma; Tornberg, Åsa; Dekker Nitert, Marloes; Eriksson, Karl-Fredrik; Jones, Helena A.; Groop, Leif; Ling, Charlotte

2013-01-01

Epigenetic mechanisms are implicated in gene regulation and the development of different diseases. The epigenome differs between cell types and has until now only been characterized for a few human tissues. Environmental factors potentially alter the epigenome. Here we describe the genome-wide pattern of DNA methylation in human adipose tissue from 23 healthy men, with a previous low level of physical activity, before and after a six months exercise intervention. We also investigate the differences in adipose tissue DNA methylation between 31 individuals with or without a family history of type 2 diabetes. DNA methylation was analyzed using Infinium HumanMethylation450 BeadChip, an array containing 485,577 probes covering 99% RefSeq genes. Global DNA methylation changed and 17,975 individual CpG sites in 7,663 unique genes showed altered levels of DNA methylation after the exercise intervention (q<0.05). Differential mRNA expression was present in 1/3 of gene regions with altered DNA methylation, including RALBP1, HDAC4 and NCOR2 (q<0.05). Using a luciferase assay, we could show that increased DNA methylation in vitro of the RALBP1 promoter suppressed the transcriptional activity (p = 0.03). Moreover, 18 obesity and 21 type 2 diabetes candidate genes had CpG sites with differences in adipose tissue DNA methylation in response to exercise (q<0.05), including TCF7L2 (6 CpG sites) and KCNQ1 (10 CpG sites). A simultaneous change in mRNA expression was seen for 6 of those genes. To understand if genes that exhibit differential DNA methylation and mRNA expression in human adipose tissue in vivo affect adipocyte metabolism, we silenced Hdac4 and Ncor2 respectively in 3T3-L1 adipocytes, which resulted in increased lipogenesis both in the basal and insulin stimulated state. In conclusion, exercise induces genome-wide changes in DNA methylation in human adipose tissue, potentially affecting adipocyte metabolism. PMID:23825961

Chlamydia abortus Pmp18.1 Induces IL-1β Secretion by TLR4 Activation through the MyD88, NF-κB, and Caspase-1 Signaling Pathways

PubMed Central

Pan, Qing; Zhang, Qiang; Chu, Jun; Pais, Roshan; Liu, Shanshan; He, Cheng; Eko, Francis O.

2017-01-01

The polymorphic membrane protein D (Pmp18D) is a 160-kDa outer membrane protein that is conserved and plays an important role in Chlamydia abortus pathogenesis. We have identified an N-terminal fragment of Pmp18D (designated Pmp18.1) as a possible subunit vaccine antigen. In this study, we evaluated the vaccine potential of Pmp18.1 by investigating its ability to induce innate immune responses in dendritic cells and the signaling pathway(s) involved in rPmp18.1-induced IL-1β secretion. We next investigated the immunomodulatory impact of VCG, in comparison with the more established Th1-promoting adjuvants, CpG and FL, on rPmp18.1-mediated innate immune activation. Finally, the effect of siRNA targeting TLR4, MyD88, NF-κB p50, and Caspase-1 mRNA in DCs on IL-1β cytokine secretion was also investigated. Bone marrow-derived dendritic cells (BMDCs) were stimulated with rPmp18.1 in the presence or absence of VCG or CpG or FL and the magnitude of cytokines produced was assessed using a multiplex cytokine ELISA assay. Expression of costimulatory molecules and Toll-like receptors (TLRs) was analyzed by flow cytometry. Quantitation of intracellular levels of myeloid differentiation factor 88 (MyD88), nuclear factor kappa beta (NF-κB p50/p65), and Caspase-1 was evaluated by Western immunoblotting analysis while NF-κB p65 nuclear translocation was assessed by confocal microscopy. The results showed DC stimulation with rPmp18.1 provoked the secretion of proinflammatory cytokines and upregulated expression of TLRs and co-stimulatory molecules associated with DC maturation. These responses were significantly (p ≤ 0.001) enhanced by VCG but not CpG or FL. In addition, rPmp18.1 activated the expression of MyD88, NF-κB p50, and Caspase-1 as well as the nuclear expression of NF-κB p65 in treated DCs. Furthermore, targeting TLR4, MyD88, NF-κB p50, and Caspase-1 mRNA in BMDCs with siRNA significantly reduced their expression levels, resulting in decreased IL-1β cytokine secretion, strongly suggesting their involvement in the rPmp18.1-induced IL-1β cytokine secretion. Taken together, these results indicate that C. abortus Pmp18.1 induces IL-1β secretion by TLR4 activation through the MyD88, NF-κB as well as the Caspase-1 signaling pathways and may be a potential C. abortus vaccine candidate. The vaccine potential of Pmp18.1 will subsequently be evaluated in an appropriate animal model, using VCG as an immunomodulator, following immunization and challenge. PMID:29326885

Combined Chromatin and Expression Analysis Reveals Specific Regulatory Mechanisms within Cytokine Genes in the Macrophage Early Immune Response

PubMed Central

Emanuelsson, Olof; Sennblad, Bengt; Pirmoradian Najafabadi, Mohammad; Folkersen, Lasse; Mälarstig, Anders; Lagergren, Jens; Eriksson, Per; Hamsten, Anders; Odeberg, Jacob

2012-01-01

Macrophages play a critical role in innate immunity, and the expression of early response genes orchestrate much of the initial response of the immune system. Macrophages undergo extensive transcriptional reprogramming in response to inflammatory stimuli such as Lipopolysaccharide (LPS). To identify gene transcription regulation patterns involved in early innate immune responses, we used two genome-wide approaches - gene expression profiling and chromatin immunoprecipitation-sequencing (ChIP-seq) analysis. We examined the effect of 2 hrs LPS stimulation on early gene expression and its relation to chromatin remodeling (H3 acetylation; H3Ac) and promoter binding of Sp1 and RNA polymerase II phosphorylated at serine 5 (S5P RNAPII), which is a marker for transcriptional initiation. Our results indicate novel and alternative gene regulatory mechanisms for certain proinflammatory genes. We identified two groups of up-regulated inflammatory genes with respect to chromatin modification and promoter features. One group, including highly up-regulated genes such as tumor necrosis factor (TNF), was characterized by H3Ac, high CpG content and lack of TATA boxes. The second group, containing inflammatory mediators (interleukins and CCL chemokines), was up-regulated upon LPS stimulation despite lacking H3Ac in their annotated promoters, which were low in CpG content but did contain TATA boxes. Genome-wide analysis showed that few H3Ac peaks were unique to either +/−LPS condition. However, within these, an unpacking/expansion of already existing H3Ac peaks was observed upon LPS stimulation. In contrast, a significant proportion of S5P RNAPII peaks (approx 40%) was unique to either condition. Furthermore, data indicated a large portion of previously unannotated TSSs, particularly in LPS-stimulated macrophages, where only 28% of unique S5P RNAPII peaks overlap annotated promoters. The regulation of the inflammatory response appears to occur in a very specific manner at the chromatin level for specific genes and this study highlights the level of fine-tuning that occurs in the immune response. PMID:22384210

Discovering high-resolution patterns of differential DNA methylation that correlate with gene expression changes

PubMed Central

VanderKraats, Nathan D.; Hiken, Jeffrey F.; Decker, Keith F.; Edwards, John R.

2013-01-01

Methylation of the CpG-rich region (CpG island) overlapping a gene’s promoter is a generally accepted mechanism for silencing expression. While recent technological advances have enabled measurement of DNA methylation and expression changes genome-wide, only modest correlations between differential methylation at gene promoters and expression have been found. We hypothesize that stronger associations are not observed because existing analysis methods oversimplify their representation of the data and do not capture the diversity of existing methylation patterns. Recently, other patterns such as CpG island shore methylation and long partially hypomethylated domains have also been linked with gene silencing. Here, we detail a new approach for discovering differential methylation patterns associated with expression change using genome-wide high-resolution methylation data: we represent differential methylation as an interpolated curve, or signature, and then identify groups of genes with similarly shaped signatures and corresponding expression changes. Our technique uncovers a diverse set of patterns that are conserved across embryonic stem cell and cancer data sets. Overall, we find strong associations between these methylation patterns and expression. We further show that an extension of our method also outperforms other approaches by generating a longer list of genes with higher quality associations between differential methylation and expression. PMID:23748561

Genome-wide DNA Methylation Profiling of CpG Islands in Hypospadias

PubMed Central

Choudhry, Shweta; Deshpande, Archana; Qiao, Liang; Beckman, Kenneth; Sen, Saunak; Baskin, Laurence S.

2013-01-01

Purpose Hypospadias is one of the most frequent genital malformations in the male newborn, and results from abnormal penile and urethral development. The etiology of hypospadias remains largely unknown despite intensive investigations. Fetal androgens have a crucial role in genital differentiation. Recent studies have suggested that molecular mechanisms that underlie the effects of androgens on the fetus may involve disruption of epigenetic programming of gene expression during development. We assessed whether epigenetic modification of DNA methylation is associated with hypospadias in a case-control study of 12 hypospadias and 8 control subjects. Materials and Methods Genome-wide DNA methylation profiling was performed on the study subjects using the Illumina Infinium® HumanMethylation450 Bead-Chip, which enables the direct investigation of methylation status of more than 485,000 individual CpG sites throughout the genome. The methylation level at each CpG site was compared between cases and controls using the t test and logistic regression. Results We identified 14 CpG sites that were associated with hypospadias with p <0.00001. These CpG sites were in or near the SCARB1, MYBPH, SORBS1, LAMA4, HOXD11, MYO1D, EGFL7, C10orf41, LMAN1L and SULF1 genes. Two CpG sites in SCARB1 and MYBPH genes remained statistically significant after correction for multiple testing (p = 2.61×10−09, pcorrected = 0.008; p = 3.06×10−08, pcorrected = 0.02, respectively). Conclusions To our knowledge this is the first study to investigate hypospadias using a unique and novel epigenetic approach. Our findings suggest DNA methylation patterns are useful in identifying new genes such as SCARB1 and MYBPH that may be involved in the etiology of hypospadias. PMID:22906644

Transcript profiling of pattern recognition receptors in a semi domesticated breed of buffalo, Toda, of India.

PubMed

Vignesh, A R; Dhanasekaran, S; Raj, G Dhinakar; Balachandran, C; Pazhanivel, N; Sreekumar, C; Tirumurugaan, K G; Raja, A; Kumanan, K

2012-06-15

The primary objective of this study was to assess the expression profile and levels of toll-like receptor (TLR) mRNAs in the spleen, lung, mediastinal lymph node (MLN), jejunum, rectum, skin and peripheral blood mononuclear cells (PBMC) of Toda and Murrah buffalos. Spleen and PBMC had increased expression of TLR mRNAs 2, 4, 5, 6, 8, 9 and 10; lung had increased expression of TLR mRNAs 2, 4, 5, 6 and 8, MLN TLR mRNA 6, 9, 10 and decrease in TLR 3 and 7 mRNAs in skin. No significant differences were observed in the expression levels of any of the TLR mRNA in jejunum and rectum. Toda buffaloes showed significantly higher expression levels of TLR 9 mRNA in MLN, TLR mRNAs 1, 5, 6, 9 and 10 in skin and TLR mRNAs 2, 4, 7 and 9 in PBMC than Murrah buffaloes living in the vicinity. Toda and Murrah buffaloes were inoculated with TLR5 (flagellin) and TLR9 (CpG ODN) ligands in vivo and expression levels of the respective TLRs analyzed 12h later. Following CpG inoculation, Toda buffaloes had significantly higher levels of TLR 9 mRNA expression but not in Murrah. However, flagellin induction did not increase TLR 5 mRNA expression in both these breeds. Histological sections of the skin were made and infiltrating cell clusters were graded and quantified. Following CpG inoculation, Toda buffaloes showed higher numbers of infiltrating grade 1 and grade 3 cell clusters while Murrah showed lower numbers of infiltrating grade 1 cells as compared to mock-inoculated skin sections. Flagellin treatment revealed no significant differences in infiltrating cell clusters in both the breeds. The results have shown differential expression of TLR mRNAs in various tissues between two divergent buffalo breeds with the highest difference in TLR expression profile seen in the skin, the largest portal of entry of pathogens, of Toda. Copyright © 2012 Elsevier B.V. All rights reserved.

A molluscan model system in the search for the engram.

PubMed

Lukowiak, Ken; Sangha, Susan; Scheibenstock, Andi; Parvez, Kashif; McComb, Chloe; Rosenegger, David; Varshney, Nishi; Sadamoto, Hisayo

2003-01-01

A 3-neuron central pattern generator, whose sufficiency and necessity has been directly demonstrated, mediates aerial respiratory behaviour in the pond snail, Lymnaea stagnalis. This behaviour can be operantly conditioned, and this associative learning is consolidated into long-lasting memory. Depending on the operant conditioning training procedure used the learning can be consolidated into intermediate term (ITM) or long-term memory (LTM). ITM persists for only 2-3 h, whilst LTM persists for days to weeks. LTM is dependent on both altered gene activity and new protein synthesis while ITM is only dependent on new protein synthesis. We have now directly established that one of the 3-CPG neurons, RPeD1, is a site of LTM formation and storage. We did this by ablating the soma of RPeD1 and leaving behind a functional primary neurite capable of mediating the necessary synaptic interactions to drive aerial respiratory behaviour by the 3-neuron CPG. However, following soma ablation the neuronal circuit is only capable of mediating learning and ITM. LTM can no longer be demonstrated. However, if RPeD1's soma is ablated after LTM consolidation memory is still present. Thus the soma is not needed for the retention of LTM. Using a similar strategy it may be possible to block forgetting.

The dynamic DNA methylation landscape of the mutL homolog 1 shore is altered by MLH1-93G>A polymorphism in normal tissues and colorectal cancer.

PubMed

Savio, Andrea J; Mrkonjic, Miralem; Lemire, Mathieu; Gallinger, Steven; Knight, Julia A; Bapat, Bharat

2017-01-01

Colorectal cancers (CRCs) undergo distinct genetic and epigenetic alterations. Expression of mutL homolog 1 ( MLH1 ), a mismatch repair gene that corrects DNA replication errors, is lost in up to 15% of sporadic tumours due to mutation or, more commonly, due to DNA methylation of its promoter CpG island. A single nucleotide polymorphism (SNP) in the CpG island of MLH1 ( MLH1 -93G>A or rs1800734) is associated with CpG island hypermethylation and decreased MLH1 expression in CRC tumours. Further, in peripheral blood mononuclear cell (PBMC) DNA of both CRC cases and non-cancer controls, the variant allele of rs1800734 is associated with hypomethylation at the MLH1 shore, a region upstream of its CpG island that is less dense in CpG sites . To determine whether this genotype-epigenotype association is present in other tissue types, including colorectal tumours, we assessed DNA methylation in matched normal colorectal tissue, tumour, and PBMC DNA from 349 population-based CRC cases recruited from the Ontario Familial Colorectal Cancer Registry. Using the semi-quantitative real-time PCR-based MethyLight assay, MLH1 shore methylation was significantly higher in tumour tissue than normal colon or PBMCs ( P  < 0.01). When shore methylation levels were stratified by SNP genotype, normal colorectal DNA and PBMC DNA were significantly hypomethylated in association with variant SNP genotype ( P  < 0.05). However, this association was lost in tumour DNA. Among distinct stages of CRC, metastatic stage IV CRC tumours incurred significant hypomethylation compared to stage I-III cases, irrespective of genotype status. Shore methylation of MLH1 was not associated with MSI status or promoter CpG island hypermethylation, regardless of genotype. To confirm these results, bisulfite sequencing was performed in matched tumour and normal colorectal specimens from six CRC cases, including two cases per genotype (wildtype, heterozygous, and homozygous variant). Bisulfite sequencing results corroborated the methylation patterns found by MethyLight, with significant hypomethylation in normal colorectal tissue of variant SNP allele carriers. These results indicate that the normal tissue types tested (colorectum and PBMC) experience dynamic genotype-associated epigenetic alterations at the MLH1 shore, whereas tumour DNA incurs aberrant hypermethylation compared to normal DNA.

Variation in DNA methylation is not consistently reflected by CpG depletion or sociality in Hymenoptera

USDA-ARS?s Scientific Manuscript database

Changes in gene regulation that underlie phenotypic evolution can be encoded directly in the DNA sequence or mediated by chromatin modifications such as DNA methylation. It has been hypothesized that the evolution of social behavior is associated with enhanced gene regulatory potential, which may in...

Transforming Growth Factor β1 Induces the Expression of Collagen Type I by DNA Methylation in Cardiac Fibroblasts

PubMed Central

Pan, Xiaodong; Chen, Zhongpu; Huang, Rong; Yao, Yuyu; Ma, Genshan

2013-01-01

Transforming growth factor-beta (TGF-β), a key mediator of cardiac fibroblast activation, has a major influence on collagen type I production. However, the epigenetic mechanisms by which TGF-β induces collagen type I alpha 1 (COL1A1) expression are not fully understood. This study was designed to examine whether or not DNA methylation is involved in TGF-β-induced COL1A1 expression in cardiac fibroblasts. Cells isolated from neonatal Sprague-Dawley rats were cultured and stimulated with TGF-β1. The mRNA levels of COL1A1 and DNA methyltransferases (DNMTs) were determined via quantitative polymerase chain reaction and the protein levels of collagen type I were determined via Western blot as well as enzyme-linked immunosorbent assay. The quantitative methylation of the COL1A1 promoter region was analyzed using the MassARRAY platform of Sequenom. Results showed that TGF-β1 upregulated the mRNA expression of COL1A1 and induced the synthesis of cell-associated and secreted collagen type I in cardiac fibroblasts. DNMT1 and DNMT3a expressions were significantly downregulated and the global DNMT activity was inhibited when treated with 10 ng/mL of TGF-β1 for 48 h. TGF-β1 treatment resulted in a significant reduction of the DNA methylation percentage across multiple CpG sites in the rat COL1A1 promoter. Thus, TGF-β1 can induce collagen type I expression through the inhibition of DNMT1 and DNMT3a expressions as well as global DNMT activity, thereby resulting in DNA demethylation of the COL1A1 promoter. These findings suggested that the DNMT-mediated DNA methylation is an important mechanism in regulating the TGF-β1-induced COL1A1 gene expression. PMID:23560091

Expression profiling of clonal lymphocyte cell cultures from Rett syndrome patients

USDA-ARS?s Scientific Manuscript database

More than 85% of Rett syndrome (RTT) patients have heterozygous mutations in the X-linked MECP2 gene which encodes methyl-CpG-binding protein 2, a transcriptional repressor that binds methylated CpG sites. Because MECP2 is subject to X chromosome inactivation (XCI), girls with RTT express either the...

Neonatal Persistent Exposure to 6-Propyl-2-thiouracil, a Thyroid-Disrupting Chemical, Differentially Modulates Expression of Hepatic Catalase and C/EBP-β in Adult Rats.

PubMed

Bunker, Suresh Kumar; Dandapat, Jagneshwar; Sahoo, Sunil Kumar; Roy, Anita; Chainy, Gagan B N

2016-02-01

Persistent exposure of rats to 6-propyl-2-thiouracil (PTU) from birth resulted in decreases in plasma thyroid hormone (TH) levels and hepatic expression of catalase and CCAAT enhancer binding protein β (C/EBP-β). Catalase promoter region (-185 to +52) that contains binding sites for C/EBP-β showed an augmentation in the methylation level along with a change in methylation pattern of CpG islands in response to PTU treatment. PTU withdrawal on 30 days of birth restored TH levels and C/EBP-β to control rats in adulthood. Although catalase expression was restored to some extent in adult rats in response to PTU withdrawal, a permanent change in its promoter CpG methylation pattern was recorded. The results suggest that downregulation of adult hepatic catalase gene in response to persistent neonatal PTU exposure may not solely be attributed to thyroid-disrupting properties of PTU. It is possible that besides thyroid-disrupting behavior, PTU may impair expression of hepatic catalase by altering methylation pattern of its promoter. © 2015 Wiley Periodicals, Inc.

Variable promoter methylation contributes to differential expression of key genes in human placenta-derived venous and arterial endothelial cells.

PubMed

Joo, Jihoon E; Hiden, Ursula; Lassance, Luciana; Gordon, Lavinia; Martino, David J; Desoye, Gernot; Saffery, Richard

2013-07-15

The endothelial compartment, comprising arterial, venous and lymphatic cell types, is established prenatally in association with rapid phenotypic and functional changes. The molecular mechanisms underpinning this process in utero have yet to be fully elucidated. The aim of this study was to investigate the potential for DNA methylation to act as a driver of the specific gene expression profiles of arterial and venous endothelial cells. Placenta-derived venous and arterial endothelial cells were collected at birth prior to culturing. DNA methylation was measured at >450,000 CpG sites in parallel with expression measurements taken from 25,000 annotated genes. A consistent set of genomic loci was found to show coordinate differential methylation between the arterial and venous cell types. This included many loci previously not investigated in relation to endothelial function. An inverse relationship was observed between gene expression and promoter methylation levels for a limited subset of genes implicated in endothelial function, including NOS3, encoding endothelial Nitric Oxide Synthase. Endothelial cells derived from the placental vasculature at birth contain widespread methylation of key regulatory genes. These are candidates involved in the specification of different endothelial cell types and represent potential target genes for environmentally mediated epigenetic disruption in utero in association with cardiovascular disease risk later in life.

The Role of Placental 11-Beta Hydroxysteroid Dehydrogenase Type 1 and Type 2 Methylation on Gene Expression and Infant Birth Weight.

PubMed

Green, Benjamin B; Armstrong, David A; Lesseur, Corina; Paquette, Alison G; Guerin, Dylan J; Kwan, Lauren E; Marsit, Carmen J

2015-06-01

Maternal stress has been linked to infant birth weight outcomes, which itself may be associated with health later in life. The placenta acts as a master regulator for the fetal environment, mediating intrauterine exposures to stress through the activity of genes regulating glucocorticoids, including the 11beta-hydroxysteroid dehydrogenase (HSD11B) type 1 and 2 genes, and so we hypothesized that variation in these genes will be associated with infant birth weight. We investigated DNA methylation levels at six sites across the two genes, as well as mRNA expression for each, and the relationship to infant birth weight. Logistic regressions correcting for potential confounding factors revealed a significant association between methylation at a single CpG site within HSD11B1 and being born large for gestational age. In addition, our analysis identified correlations between methylation and gene expression, including sex-specific transcriptional regulation of HSD11B2. Our work is one of the first comprehensive views of DNA methylation and expression in the placenta for both HSD11B types 1 and 2, linking epigenetic alterations with the regulation of fetal stress and birth weight outcomes. © 2015 by the Society for the Study of Reproduction, Inc.

Asymmetric DNA methylation of CpG dyads is a feature of secondary DMRs associated with the Dlk1/Gtl2 imprinting cluster in mouse.

PubMed

Guntrum, Megan; Vlasova, Ekaterina; Davis, Tamara L

2017-01-01

Differential DNA methylation plays a critical role in the regulation of imprinted genes. The differentially methylated state of the imprinting control region is inherited via the gametes at fertilization, and is stably maintained in somatic cells throughout development, influencing the expression of genes across the imprinting cluster. In contrast, DNA methylation patterns are more labile at secondary differentially methylated regions which are established at imprinted loci during post-implantation development. To investigate the nature of these more variably methylated secondary differentially methylated regions, we adopted a hairpin linker bisulfite mutagenesis approach to examine CpG dyad methylation at differentially methylated regions associated with the murine Dlk1/Gtl2 imprinting cluster on both complementary strands. We observed homomethylation at greater than 90% of the methylated CpG dyads at the IG-DMR, which serves as the imprinting control element. In contrast, homomethylation was only observed at 67-78% of the methylated CpG dyads at the secondary differentially methylated regions; the remaining 22-33% of methylated CpG dyads exhibited hemimethylation. We propose that this high degree of hemimethylation could explain the variability in DNA methylation patterns at secondary differentially methylated regions associated with imprinted loci. We further suggest that the presence of 5-hydroxymethylation at secondary differentially methylated regions may result in hemimethylation and methylation variability as a result of passive and/or active demethylation mechanisms.

Prenatal arsenic exposure and the epigenome: identifying sites of 5-methylcytosine alterations that predict functional changes in gene expression in newborn cord blood and subsequent birth outcomes.

PubMed

Rojas, Daniel; Rager, Julia E; Smeester, Lisa; Bailey, Kathryn A; Drobná, Zuzana; Rubio-Andrade, Marisela; Stýblo, Miroslav; García-Vargas, Gonzalo; Fry, Rebecca C

2015-01-01

Prenatal exposure to inorganic arsenic (iAs) is detrimental to the health of newborns and increases the risk of disease development later in life. Here we examined a subset of newborn cord blood leukocyte samples collected from subjects enrolled in the Biomarkers of Exposure to ARsenic (BEAR) pregnancy cohort in Gómez Palacio, Mexico, who were exposed to a range of drinking water arsenic concentrations (0.456-236 µg/l). Changes in iAs-associated DNA 5-methylcytosine methylation were assessed across 424,935 CpG sites representing 18,761 genes and compared with corresponding mRNA expression levels and birth outcomes. In the context of arsenic exposure, a total of 2919 genes were identified with iAs-associated differences in DNA methylation. Site-specific analyses identified DNA methylation changes that were most predictive of gene expression levels where CpG methylation within CpG islands positioned within the first exon, the 5' untranslated region and 200 bp upstream of the transcription start site yielded the most significant association with gene expression levels. A set of 16 genes was identified with correlated iAs-associated changes in DNA methylation and mRNA expression and all were highly enriched for binding sites of the early growth response (EGR) and CCCTC-binding factor (CTCF) transcription factors. Furthermore, DNA methylation levels of 7 of these genes were associated with differences in birth outcomes including gestational age and head circumference.These data highlight the complex interplay between DNA methylation, functional changes in gene expression and health outcomes and underscore the need for functional analyses coupled to epigenetic assessments. © The Author 2014. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

TLR-Stimulated Eosinophils Mediate Recruitment and Activation of NK Cells In Vivo.

PubMed

O'Flaherty, S M; Sutummaporn, K; Häggtoft, W L; Worrall, A P; Rizzo, M; Braniste, V; Höglund, P; Kadri, N; Chambers, B J

2017-06-01

Eosinophils like many myeloid innate immune cells can provide cytokines and chemokines for the activation of other immune cells upon TLR stimulation. When TLR-stimulated eosinophils were inoculated i.p. into wild-type mice, and NK cells were rapidly recruited and exhibited antitumour cytotoxicity. However, when mice depleted of CD11c + cells were used, a marked decrease in the number of recruited NK cells was observed. We postulated that CpG or LPS from the injected eosinophils could be transferred to host cells, which in turn could recruit NK cells. However, by inoculating mice deficient in TLR4 or TLR9 with LPS or CpG-stimulated eosinophils respectively, NK cell recruitment was still observed alongside cytotoxicity and IFNγ production. CpG stimulation of eosinophils produced the pro-inflammatory cytokine IL-12 and the chemokine CXCL10, which are important for NK cell activation and recruitment in vivo. To demonstrate the importance of CXCL10 in NK cell recruitment, we found that CpG-stimulated eosinophils pretreated with the gut microbial metabolite butyrate had reduced expression and production of CXCL10 and IL-12 and concomitantly were poor at recruitment of NK cells and inducing IFNγ in NK cells. Therefore, eosinophils like other innate immune cells of myeloid origin can conceivably stimulate NK cell activity. In addition, products of the gut microbiota can be potential inhibitors of NK cell. © 2017 The Foundation for the Scandinavian Journal of Immunology.

Cooperative STAT/NF-κB signaling regulates lymphoma metabolic reprogramming and aberrant GOT2 expression.

PubMed

Feist, Maren; Schwarzfischer, Philipp; Heinrich, Paul; Sun, Xueni; Kemper, Judith; von Bonin, Frederike; Perez-Rubio, Paula; Taruttis, Franziska; Rehberg, Thorsten; Dettmer, Katja; Gronwald, Wolfram; Reinders, Jörg; Engelmann, Julia C; Dudek, Jan; Klapper, Wolfram; Trümper, Lorenz; Spang, Rainer; Oefner, Peter J; Kube, Dieter

2018-04-17

Knowledge of stromal factors that have a role in the transcriptional regulation of metabolic pathways aside from c-Myc is fundamental to improvements in lymphoma therapy. Using a MYC-inducible human B-cell line, we observed the cooperative activation of STAT3 and NF-κB by IL10 and CpG stimulation. We show that IL10 + CpG-mediated cell proliferation of MYC low cells depends on glutaminolysis. By 13 C- and 15 N-tracing of glutamine metabolism and metabolite rescue experiments, we demonstrate that GOT2 provides aspartate and nucleotides to cells with activated or aberrant Jak/STAT and NF-κB signaling. A model of GOT2 transcriptional regulation is proposed, in which the cooperative phosphorylation of STAT3 and direct joint binding of STAT3 and p65/NF-κB to the proximal GOT2 promoter are important. Furthermore, high aberrant GOT2 expression is prognostic in diffuse large B-cell lymphoma underscoring the current findings and importance of stromal factors in lymphoma biology.

Epigenomic profiling of DNA methylation in paired prostate cancer versus adjacent benign tissue

PubMed Central

Geybels, Milan S.; Zhao, Shanshan; Wong, Chao-Jen; Bibikova, Marina; Klotzle, Brandy; Wu, Michael; Ostrander, Elaine A.; Fan, Jian-Bing; Feng, Ziding; Stanford, Janet L.

2016-01-01

Background Aberrant DNA methylation may promote prostate carcinogenesis. We investigated epigenome-wide DNA methylation profiles in prostate cancer (PCa) compared to adjacent benign tissue to identify differentially methylated CpG sites. Methods The study included paired PCa and adjacent benign tissue samples from 20 radical prostatectomy patients. Epigenetic profiling was done using the Infinium HumanMethylation450 BeadChip. Linear models that accounted for the paired study design and False Discovery Rate Q-values were used to evaluate differential CpG methylation. mRNA expression levels of the genes with the most differentially methylated CpG sites were analyzed. Results In total, 2,040 differentially methylated CpG sites were identified in PCa versus adjacent benign tissue (Q-value <0.001), the majority of which were hypermethylated (n = 1,946; 95%). DNA methylation profiles accurately distinguished between PCa and benign tissue samples. Twenty-seven top-ranked hypermethylated CpGs had a mean methylation difference of at least 40% between tissue types, which included 25 CpGs in 17 genes. Furthermore, for ten genes over 50% of promoter region CpGs were hypermethylated in PCa versus benign tissue. The top-ranked differentially methylated genes included three genes that were associated with both promoter hypermethylation and reduced gene expression: SCGB3A1, HIF3A, and AOX1. Analysis of The Cancer Genome Atlas (TCGA) data provided confirmatory evidence for our findings. Conclusions This study of PCa versus adjacent benign tissue showed many differentially methylated CpGs and regions in and outside gene promoter regions, which may potentially be used for the development of future epigenetic-based diagnostic tests or as therapeutic targets. PMID:26383847

Epigenomic profiling of DNA methylation in paired prostate cancer versus adjacent benign tissue.

PubMed

Geybels, Milan S; Zhao, Shanshan; Wong, Chao-Jen; Bibikova, Marina; Klotzle, Brandy; Wu, Michael; Ostrander, Elaine A; Fan, Jian-Bing; Feng, Ziding; Stanford, Janet L

2015-12-01

Aberrant DNA methylation may promote prostate carcinogenesis. We investigated epigenome-wide DNA methylation profiles in prostate cancer (PCa) compared to adjacent benign tissue to identify differentially methylated CpG sites. The study included paired PCa and adjacent benign tissue samples from 20 radical prostatectomy patients. Epigenetic profiling was done using the Infinium HumanMethylation450 BeadChip. Linear models that accounted for the paired study design and False Discovery Rate Q-values were used to evaluate differential CpG methylation. mRNA expression levels of the genes with the most differentially methylated CpG sites were analyzed. In total, 2,040 differentially methylated CpG sites were identified in PCa versus adjacent benign tissue (Q-value < 0.001), the majority of which were hypermethylated (n = 1,946; 95%). DNA methylation profiles accurately distinguished between PCa and benign tissue samples. Twenty-seven top-ranked hypermethylated CpGs had a mean methylation difference of at least 40% between tissue types, which included 25 CpGs in 17 genes. Furthermore, for 10 genes over 50% of promoter region CpGs were hypermethylated in PCa versus benign tissue. The top-ranked differentially methylated genes included three genes that were associated with both promoter hypermethylation and reduced gene expression: SCGB3A1, HIF3A, and AOX1. Analysis of The Cancer Genome Atlas (TCGA) data provided confirmatory evidence for our findings. This study of PCa versus adjacent benign tissue showed many differentially methylated CpGs and regions in and outside gene promoter regions, which may potentially be used for the development of future epigenetic-based diagnostic tests or as therapeutic targets. © 2015 Wiley Periodicals, Inc.

PU.1 is a major transcriptional activator of the tumour suppressor gene LIMD1

PubMed Central

Foxler, Daniel E.; James, Victoria; Shelton, Samuel J.; Vallim, Thomas Q. de A.; Shaw, Peter E.; Sharp, Tyson V.

2011-01-01

LIMD1 is a tumour suppressor gene (TSG) down regulated in ∼80% of lung cancers with loss also demonstrated in breast and head and neck squamous cell carcinomas. LIMD1 is also a candidate TSG in childhood acute lymphoblastic leukaemia. Mechanistically, LIMD1 interacts with pRB, repressing E2F-driven transcription as well as being a critical component of microRNA-mediated gene silencing. In this study we show a CpG island within the LIMD1 promoter contains a conserved binding motif for the transcription factor PU.1. Mutation of the PU.1 consensus reduced promoter driven transcription by 90%. ChIP and EMSA analysis demonstrated that PU.1 specifically binds to the LIMD1 promoter. siRNA depletion of PU.1 significantly reduced endogenous LIMD1 expression, demonstrating that PU.1 is a major transcriptional activator of LIMD1. PMID:21402070

Quantitative DNA Methylation Analysis Identifies a Single CpG Dinucleotide Important for ZAP-70 Expression and Predictive of Prognosis in Chronic Lymphocytic Leukemia

PubMed Central

Claus, Rainer; Lucas, David M.; Stilgenbauer, Stephan; Ruppert, Amy S.; Yu, Lianbo; Zucknick, Manuela; Mertens, Daniel; Bühler, Andreas; Oakes, Christopher C.; Larson, Richard A.; Kay, Neil E.; Jelinek, Diane F.; Kipps, Thomas J.; Rassenti, Laura Z.; Gribben, John G.; Döhner, Hartmut; Heerema, Nyla A.; Marcucci, Guido; Plass, Christoph; Byrd, John C.

2012-01-01

Purpose Increased ZAP-70 expression predicts poor prognosis in chronic lymphocytic leukemia (CLL). Current methods for accurately measuring ZAP-70 expression are problematic, preventing widespread application of these tests in clinical decision making. We therefore used comprehensive DNA methylation profiling of the ZAP-70 regulatory region to identify sites important for transcriptional control. Patients and Methods High-resolution quantitative DNA methylation analysis of the entire ZAP-70 gene regulatory regions was conducted on 247 samples from patients with CLL from four independent clinical studies. Results Through this comprehensive analysis, we identified a small area in the 5′ regulatory region of ZAP-70 that showed large variability in methylation in CLL samples but was universally methylated in normal B cells. High correlation with mRNA and protein expression, as well as activity in promoter reporter assays, revealed that within this differentially methylated region, a single CpG dinucleotide and neighboring nucleotides are particularly important in ZAP-70 transcriptional regulation. Furthermore, by using clustering approaches, we identified a prognostic role for this site in four independent data sets of patients with CLL using time to treatment, progression-free survival, and overall survival as clinical end points. Conclusion Comprehensive quantitative DNA methylation analysis of the ZAP-70 gene in CLL identified important regions responsible for transcriptional regulation. In addition, loss of methylation at a specific single CpG dinucleotide in the ZAP-70 5′ regulatory sequence is a highly predictive and reproducible biomarker of poor prognosis in this disease. This work demonstrates the feasibility of using quantitative specific ZAP-70 methylation analysis as a relevant clinically applicable prognostic test in CLL. PMID:22564988

Association of mitofusin 2 methylation and essential hypertension: a case-control study in a Chinese population.

PubMed

Jin, Fei; Li, Xiao; Wang, Zuoguang; Liu, Ya; Liu, Jielin; Sun, Dongdong; Jin, Yongxin; Wang, Shiqi; Wen, Shaojun; Wei, Yongxiang

2018-06-07

Mitofusin 2 (Mfn2), a gene that negatively regulates the proliferation of vascular smooth muscle cells (VSMCs), is expressed at low levels in the VSMCs of hypertensive patients. DNA methylation can inhibit gene expression. The purpose of this study was to investigate the relationship between Mfn2 methylation and essential hypertension (EH). After bioinformatics analysis, five EH patients and five normal control (NC) subjects were selected for methylation chip screening. Then, bisulfite DNA sequencing was used to analyze the methylation status of differentially methylated fragments of Mfn2 in 40 EH patients and 36 NC subjects. Mfn2 mRNA expression in the blood was detected by RT-qPCR. There were three CpG islands in the full length Mfn2 DNA sequence and some transcription factor binding sites in these regions, including Sp1, Ap2, GATA box, NF-κB, etc. The chip screening showed that only the third CpG island had a significantly high degree of methylation. Subsequent verification experiments found that the EH group had a significantly lower C base rate of methylation than the NC group (2.5% vs. 44.44%, P < 0.0001), but a similar CpG methylation rate (P > 0.05). RT-qPCR detection showed that the level of Mfn2 mRNA expression was significantly lower in the EH group than in the NC group (P = 0.013). Further association analysis showed that the level of Mfn2 methylation was associated with systolic blood pressure and diastolic blood pressure (r = -0.902, r = -0.713, respectively) but not the other indexes. The DNA methylation level of Mfn2 was significantly lower in hypertensive patients than in control subjects, which may be an independent risk factor for EH.

MicroRNA-99a and 100 mediated upregulation of FOXA1 in bladder cancer

PubMed Central

Drayton, Ross M.; Peter, Stefan; Myers, Katie; Miah, Saiful; Dudziec, Ewa; Bryant, Helen E.; Catto, James W. F.

2014-01-01

Urothelial cell carcinoma of the bladder (UCC) is a common disease often characterized by FGFR3 dysregulation. Whilst upregulation of this oncogene occurs most frequently in low-grade non-invasive tumors, recent data reveal increased FGFR3 expression characterizes a common sub-type of invasive UCC sharing molecular similarities with breast cancer. These similarities include upregulation of the FOXA1 transcription factor and reduced expression of microRNAs-99a/100. We have previously identified direct regulation of FGFR3 by these two microRNAs and now search for further targets. Using a microarray meta-database we find potential FOXA1 regulation by microRNAs-99a/100. We confirm direct targeting of the FOXA1 3′UTR by microRNAs-99a/100 and also potential indirect regulation through microRNA-485-5p/SOX5/JUN-D/FOXL1 and microRNA-486/FOXO1a. In 292 benign and malignant urothelial samples, we find an inverse correlation between the expression of FOXA1 and microRNAs-99a/100 (r=−0.33 to −0.43, p<0.05). As for FGFR3 in UCC, tumors with high FOXA1 expression have lower rates of progression than those with low expression (Log rank p=0.009). Using global gene expression and CpG methylation profiling we find genotypic consequences of FOXA1 upregulation in UCC. Genetic changes are associated with regional hypomethylation, occur near FOXA1 binding sites, and mirror gene expression changes previously reported in FGFR3 mutant-UCC. These include gene silencing through aberrant hypermethylation (e.g. IGFBP3) and affect genes characterizing breast cancer sub-types (e.g. ERBB2). In conclusion, we have identified microRNAs-99a/100 mediate a direct relationship between FGFR3 and FOXA1 and potentially facilitate cross talk between these pathways in UCC. PMID:25071007

MicroRNA-99a and 100 mediated upregulation of FOXA1 in bladder cancer.

PubMed

Drayton, Ross M; Peter, Stefan; Myers, Katie; Miah, Saiful; Dudziec, Ewa; Bryant, Helen E; Catto, James W F

2014-08-15

Urothelial cell carcinoma of the bladder (UCC) is a common disease often characterized by FGFR3 dysregulation. Whilst upregulation of this oncogene occurs most frequently in low-grade non-invasive tumors, recent data reveal increased FGFR3 expression characterizes a common sub-type of invasive UCC sharing molecular similarities with breast cancer. These similarities include upregulation of the FOXA1 transcription factor and reduced expression of microRNAs-99a/100. We have previously identified direct regulation of FGFR3 by these two microRNAs and now search for further targets. Using a microarray meta-database we find potential FOXA1 regulation by microRNAs-99a/100. We confirm direct targeting of the FOXA1 3'UTR by microRNAs-99a/100 and also potential indirect regulation through microRNA-485-5p/SOX5/JUN-D/FOXL1 and microRNA-486/FOXO1a. In 292 benign and malignant urothelial samples, we find an inverse correlation between the expression of FOXA1 and microRNAs-99a/100 (r=-0.33 to -0.43, p<0.05). As for FGFR3 in UCC, tumors with high FOXA1 expression have lower rates of progression than those with low expression (Log rank p=0.009). Using global gene expression and CpG methylation profiling we find genotypic consequences of FOXA1 upregulation in UCC. Genetic changes are associated with regional hypomethylation, occur near FOXA1 binding sites, and mirror gene expression changes previously reported in FGFR3 mutant-UCC. These include gene silencing through aberrant hypermethylation (e.g. IGFBP3) and affect genes characterizing breast cancer sub-types (e.g. ERBB2). In conclusion, we have identified microRNAs-99a/100 mediate a direct relationship between FGFR3 and FOXA1 and potentially facilitate cross talk between these pathways in UCC.

Prenatal stress-induced programming of genome-wide promoter DNA methylation in 5-HTT-deficient mice.

PubMed

Schraut, K G; Jakob, S B; Weidner, M T; Schmitt, A G; Scholz, C J; Strekalova, T; El Hajj, N; Eijssen, L M T; Domschke, K; Reif, A; Haaf, T; Ortega, G; Steinbusch, H W M; Lesch, K P; Van den Hove, D L

2014-10-21

The serotonin transporter gene (5-HTT/SLC6A4)-linked polymorphic region has been suggested to have a modulatory role in mediating effects of early-life stress exposure on psychopathology rendering carriers of the low-expression short (s)-variant more vulnerable to environmental adversity in later life. The underlying molecular mechanisms of this gene-by-environment interaction are not well understood, but epigenetic regulation including differential DNA methylation has been postulated to have a critical role. Recently, we used a maternal restraint stress paradigm of prenatal stress (PS) in 5-HTT-deficient mice and showed that the effects on behavior and gene expression were particularly marked in the hippocampus of female 5-Htt+/- offspring. Here, we examined to which extent these effects are mediated by differential methylation of DNA. For this purpose, we performed a genome-wide hippocampal DNA methylation screening using methylated-DNA immunoprecipitation (MeDIP) on Affymetrix GeneChip Mouse Promoter 1.0 R arrays. Using hippocampal DNA from the same mice as assessed before enabled us to correlate gene-specific DNA methylation, mRNA expression and behavior. We found that 5-Htt genotype, PS and their interaction differentially affected the DNA methylation signature of numerous genes, a subset of which showed overlap with the expression profiles of the corresponding transcripts. For example, a differentially methylated region in the gene encoding myelin basic protein (Mbp) was associated with its expression in a 5-Htt-, PS- and 5-Htt × PS-dependent manner. Subsequent fine-mapping of this Mbp locus linked the methylation status of two specific CpG sites to Mbp expression and anxiety-related behavior. In conclusion, hippocampal DNA methylation patterns and expression profiles of female prenatally stressed 5-Htt+/- mice suggest that distinct molecular mechanisms, some of which are promoter methylation-dependent, contribute to the behavioral effects of the 5-Htt genotype, PS exposure and their interaction.

The bovine viral diarrhea virus E2 protein formulated with a novel adjuvant induces strong, balanced immune responses and provides protection from viral challenge in cattle.

PubMed

Snider, Marlene; Garg, Ravendra; Brownlie, Robert; van den Hurk, Jan V; van Drunen Littel-van den Hurk, Sylvia

2014-11-28

Bovine viral diarrhea virus (BVDV) is still one of the most serious pathogens in cattle, meriting the development of improved vaccines. Recently, we developed a new adjuvant consisting of poly[di(sodium carboxylatoethylphenoxy)]-phosphazene (PCEP), either CpG ODN or poly(I:C), and an immune defense regulator (IDR) peptide. As this adjuvant has been shown to mediate the induction of robust, balanced immune responses, it was evaluated in an E2 subunit vaccine against BVDV in lambs and calves. The BVDV type 2 E2 protein was produced at high levels in a mammalian expression system and purified. When formulated with either CpG ODN or poly(I:C), together with IDR and PCEP, the E2 protein elicited high antibody titers and production of IFN-γ secreting cells in lambs. As the immune responses were stronger when poly(I:C) was used, the E2 protein with poly(I:C), IDR and PCEP was subsequently tested in cattle. Robust virus neutralizing antibodies as well as cell-mediated immune responses, including CD8(+) cytotoxic T cell (CTL) responses, were induced. The fact that CTL responses were demonstrated in calves vaccinated with an E2 protein subunit vaccine indicates that this adjuvant formulation promotes cross-presentation. Furthermore, upon challenge with a high dose of virulent BVDV-2, the vaccinated calves showed almost no temperature response, weight loss, leukopenia or virus replication, in contrast to the control animals, which had severe clinical disease. These data suggest that this E2 subunit formulation induces significant protection from BVDV-2 challenge, and thus is a promising BVDV vaccine candidate; in addition, the adjuvant platform has applications in bovine vaccines in general. Copyright © 2014 Elsevier Ltd. All rights reserved.

Triplex-mediated analysis of cytosine methylation at CpA sites in DNA.

PubMed

Johannsen, Marie W; Gerrard, Simon R; Melvin, Tracy; Brown, Tom

2014-01-18

Modified triplex-forming oligonucleotides distinguish 5-methyl cytosine from unmethylated cytosine in DNA duplexes by differences in triplex melting temperatures. The discrimination is sequence-specific; dramatic differences in stabilisation are seen for CpA methylation, whereas CpG methylation is not detected. This direct detection of DNA methylation constitutes a new approach for epigenetic analysis.

Virus-like nanostructures for tuning immune response

NASA Astrophysics Data System (ADS)

Mammadov, Rashad; Cinar, Goksu; Gunduz, Nuray; Goktas, Melis; Kayhan, Handan; Tohumeken, Sehmus; Topal, Ahmet E.; Orujalipoor, Ilghar; Delibasi, Tuncay; Dana, Aykutlu; Ide, Semra; Tekinay, Ayse B.; Guler, Mustafa O.

2015-11-01

Synthetic vaccines utilize viral signatures to trigger immune responses. Although the immune responses raised against the biochemical signatures of viruses are well characterized, the mechanism of how they affect immune response in the context of physical signatures is not well studied. In this work, we investigated the ability of zero- and one-dimensional self-assembled peptide nanostructures carrying unmethylated CpG motifs (signature of viral DNA) for tuning immune response. These nanostructures represent the two most common viral shapes, spheres and rods. The nanofibrous structures were found to direct immune response towards Th1 phenotype, which is responsible for acting against intracellular pathogens such as viruses, to a greater extent than nanospheres and CpG ODN alone. In addition, nanofibers exhibited enhanced uptake into dendritic cells compared to nanospheres or the ODN itself. The chemical stability of the ODN against nuclease-mediated degradation was also observed to be enhanced when complexed with the peptide nanostructures. In vivo studies showed that nanofibers promoted antigen-specific IgG production over 10-fold better than CpG ODN alone. To the best of our knowledge, this is the first report showing the modulation of the nature of an immune response through the shape of the carrier system.

Formulation of vaccines containing CpG oligonucleotides and alum

PubMed Central

Aebig, Joan A.; Mullen, Gregory E. D.; Dobrescu, Gelu; Rausch, Kelly; Lambert, Lynn; Ajose-Popoola, Olubunmi; Long, Carole A.; Saul, Allan; Miles, Aaron P.

2007-01-01

CpG oligodeoxynucleotides are potent immunostimulants. For parenterally delivered alum based vaccines, the immunostimulatory effect of CpG depends on the association of the CpG and antigen to the alum. We describe effects of buffer components on the binding of CPG 7909 to aluminum hydroxide (Alhydrogel), assays for measuring binding of CPG 7909 to alum and CPG 7909 induced dissociation of antigen from the alum. Free CPG 7909 is a potent inducer of IP-10 in mice. However the lack of IP-10 production from formulations containing bound CPG 7909 suggested that CPG 7909 does not rapidly dissociate from the alum after injection. It also suggests that IP-10 assays are not a good basis for potency assays for alum based vaccines containing CPG 7909. PMID:17512533

Aberrant DNA methylation associated with silencing BNIP3 gene expression in haematopoietic tumours

PubMed Central

Murai, M; Toyota, M; Satoh, A; Suzuki, H; Akino, K; Mita, H; Sasaki, Y; Ishida, T; Shen, L; Garcia-Manero, G; Issa, J-P J; Hinoda, Y; Tokino, T; Imai, K

2005-01-01

Hypoxia is a key factor contributing to the progression of human neoplasias and to the development of resistance to chemotherapy. BNIP3 is a proapoptotic member of the Bcl-2 protein family involved in hypoxia-induced cell death. We evaluated the expression and methylation status of BNIP3 gene to better understand the role of epigenetic alteration of its expression in haematopoietic tumours. Methylation of the region around the BNIP3 transcription start site was detected in four acute lymphocytic leukaemia, one multiple myeloma and one Burkitt lymphoma cell lines, and was closely associated with silencing the gene. That expression of BNIP3 was restored by treatment with 5-aza2′-deoxycytidine (5-aza-dC), a methyltransferase inhibitor, which confirmed the gene to be epigenetically inactivated by methylation. Notably, re-expression of BNIP3 using 5-aza2-dC also restored hypoxia-mediated cell death in methylated cell lines. Acetylation of histone H3 in the 5′ region of the gene, which was assessed using chromatin immunoprecipitation assays, correlated directly with gene expression and inversely with DNA methylation. Among primary tumours, methylation of BNIP3 was detected in five of 34 (15%) acute lymphocytic leukaemias, six of 35 (17%) acute myelogenous leukaemias and three of 14 (21%) multiple myelomas. These results suggest that aberrant DNA methylation of the 5′ CpG island and histone deacetylation play key roles in silencing BNIP3 expression in haematopoietic tumours. PMID:15756280

Towards understanding the breast cancer epigenome: a comparison of genome-wide DNA methylation and gene expression data

PubMed Central

Michiels, Stefan; Metzger-Filho, Otto; Saini, Kamal S.

2016-01-01

Until recently, an elevated disease risk has been ascribed to a genetic predisposition, however, exciting progress over the past years has discovered alternate elements of inheritance that involve epigenetic regulation. Epigenetic changes are heritably stable alterations that include DNA methylation, histone modifications and RNA-mediated silencing. Aberrant DNA methylation is a common molecular basis for a number of important human diseases, including breast cancer. Changes in DNA methylation profoundly affect global gene expression patterns. What is emerging is a more dynamic and complex association between DNA methylation and gene expression than previously believed. Although many tools have already been developed for analyzing genome-wide gene expression data, tools for analyzing genome-wide DNA methylation have not yet reached the same level of refinement. Here we provide an in-depth analysis of DNA methylation in parallel with gene expression data characteristics and describe the particularities of low-level and high-level analyses of DNA methylation data. Low-level analysis refers to pre-processing of methylation data (i.e. normalization, transformation and filtering), whereas high-level analysis is focused on illustrating the application of the widely used class comparison, class prediction and class discovery methods to DNA methylation data. Furthermore, we investigate the influence of DNA methylation on gene expression by measuring the correlation between the degree of CpG methylation and the level of expression and to explore the pattern of methylation as a function of the promoter region. PMID:26657508

Towards understanding the breast cancer epigenome: a comparison of genome-wide DNA methylation and gene expression data.

PubMed

Singhal, Sandeep K; Usmani, Nawaid; Michiels, Stefan; Metzger-Filho, Otto; Saini, Kamal S; Kovalchuk, Olga; Parliament, Matthew

2016-01-19

Until recently, an elevated disease risk has been ascribed to a genetic predisposition, however, exciting progress over the past years has discovered alternate elements of inheritance that involve epigenetic regulation. Epigenetic changes are heritably stable alterations that include DNA methylation, histone modifications and RNA-mediated silencing. Aberrant DNA methylation is a common molecular basis for a number of important human diseases, including breast cancer. Changes in DNA methylation profoundly affect global gene expression patterns. What is emerging is a more dynamic and complex association between DNA methylation and gene expression than previously believed. Although many tools have already been developed for analyzing genome-wide gene expression data, tools for analyzing genome-wide DNA methylation have not yet reached the same level of refinement. Here we provide an in-depth analysis of DNA methylation in parallel with gene expression data characteristics and describe the particularities of low-level and high-level analyses of DNA methylation data. Low-level analysis refers to pre-processing of methylation data (i.e. normalization, transformation and filtering), whereas high-level analysis is focused on illustrating the application of the widely used class comparison, class prediction and class discovery methods to DNA methylation data. Furthermore, we investigate the influence of DNA methylation on gene expression by measuring the correlation between the degree of CpG methylation and the level of expression and to explore the pattern of methylation as a function of the promoter region.

Genetic and epigenetic influences on expression of spermine synthase and spermine oxidase in suicide completers.

PubMed

Fiori, Laura M; Turecki, Gustavo

2010-07-01

Alterations in the levels of spermine synthase (SMS) and spermine oxidase (SMOX), two enzymes involved in polyamine metabolism, have previously been observed in brains of suicide completers. To characterize the roles played by genetic and epigenetic factors in determining expression levels of these genes, as well as to identify potential mechanisms by which to explain our findings in suicide completers, we (1) assessed the role of promoter polymorphisms in determining expression in the brain and in vitro, and (2) examined CpG methylation and levels of methylated histone H3 lysine-27 in the promoter regions of these genes in the prefrontal cortex of suicide completers and healthy controls. We identified several promoter haplotypes in SMS and SMOX, but found no consistent effects of haplotype on expression levels in either the brain or in reporter gene assays performed in three different cell lines. We also found no overall effects of epigenetic factors in determining expression, with the exception of a relationship between CpG methylation at one site in the promoter of SMOX and its expression in Brodmann area 8/9. In conclusion, the genetic and epigenetic factors examined in this study show little influence on the expression levels of SMS and SMOX, and do not appear to be responsible for the dysregulated expression of these genes in suicide completers.

Modulation of transcription factor binding and epigenetic regulation of the MLH1 CpG island and shore by polymorphism rs1800734 in colorectal cancer

PubMed Central

Savio, Andrea J.; Bapat, Bharati

2017-01-01

ABSTRACT The MLH1 promoter polymorphism rs1800734 is associated with MLH1 CpG island hypermethylation and expression loss in colorectal cancer (CRC). Conversely, variant rs1800734 is associated with MLH1 shore, but not island, hypomethylation in peripheral blood mononuclear cell DNA. To explore these distinct patterns, MLH1 CpG island and shore methylation was assessed in CRC cell lines stratified by rs1800734 genotype. Cell lines containing the variant A allele demonstrated MLH1 shore hypomethylation compared to wild type (GG). There was significant enrichment of transcription factor AP4 at the MLH1 promoter in GG and GA cell lines, but not the AA cell line, by chromatin immunoprecipitation studies. Preferential binding to the G allele was confirmed by sequencing in the GA cell line. The enhancer-associated histone modification H3K4me1 was enriched at the MLH1 shore; however, H3K27ac was not, indicating the shore is an inactive enhancer. These results demonstrate the role of variant rs1800734 in altering transcription factor binding as well as epigenetics at regions beyond the MLH1 CpG island in which it is located. PMID:28304185

Modulation of transcription factor binding and epigenetic regulation of the MLH1 CpG island and shore by polymorphism rs1800734 in colorectal cancer.

PubMed

Savio, Andrea J; Bapat, Bharati

2017-06-03

The MLH1 promoter polymorphism rs1800734 is associated with MLH1 CpG island hypermethylation and expression loss in colorectal cancer (CRC). Conversely, variant rs1800734 is associated with MLH1 shore, but not island, hypomethylation in peripheral blood mononuclear cell DNA. To explore these distinct patterns, MLH1 CpG island and shore methylation was assessed in CRC cell lines stratified by rs1800734 genotype. Cell lines containing the variant A allele demonstrated MLH1 shore hypomethylation compared to wild type (GG). There was significant enrichment of transcription factor AP4 at the MLH1 promoter in GG and GA cell lines, but not the AA cell line, by chromatin immunoprecipitation studies. Preferential binding to the G allele was confirmed by sequencing in the GA cell line. The enhancer-associated histone modification H3K4me1 was enriched at the MLH1 shore; however, H3K27ac was not, indicating the shore is an inactive enhancer. These results demonstrate the role of variant rs1800734 in altering transcription factor binding as well as epigenetics at regions beyond the MLH1 CpG island in which it is located.

CpG island methylator phenotype (CIMP) in cancer: causes and implications.

PubMed

Teodoridis, Jens M; Hardie, Catriona; Brown, Robert

2008-09-18

Strong evidence exists for a subgroup of tumours, from a variety of tissue types, exhibiting concordant tumour specific DNA methylation: the "CpG island methylator phenotype" (CIMP). Occurrence of CIMP is associated with a range of genetic and environmental factors, although the molecular causes are not well-understood. Both increased expression and aberrant targeting of DNA methyltransferases (DNMTs) could contribute to the occurrence of CIMP. One under-explored area is the possibility that DNA damage may induce or select for CIMP during carcinogenesis or treatment of tumours with chemotherapy. DNA damaging agents can induce DNA damage at guanine rich regions throughout the genome, including CpG islands. This DNA damage can result in stalled DNA synthesis, which will lead to localised increased DNMT1 concentration and therefore potentially increased DNA methylation at these sites. Chemotherapy can select for cells which have increased tolerance to DNA damage due to increased lesion bypass, in some cases by mechanisms which involve inactivation of genes by CpG island methylation. CIMP has been associated with worse patient prognosis, probably due to increased epigenetic plasticity. Therefore, further clinical testing of the diagnostic and prognostic value of the current CIMP markers, as well as increasing our understanding of the molecular causes underlying CIMP are required.

CpG methylation of a silent controlling element in the murine Avy allele is incomplete and unresponsive to methyl donor supplementation.

PubMed

Cropley, Jennifer E; Suter, Catherine M; Beckman, Kenneth B; Martin, David I K

2010-02-04

The viable yellow allele of agouti (A(vy)) is remarkable for its unstable and partially heritable epigenetic state, which produces wide variation in phenotypes of isogenic mice. In the A(vy) allele an inserted intracisternal A particle (IAP) acts as a controlling element which deregulates expression of agouti by transcription from the LTR of the IAP; the phenotypic state has been linked to CpG methylation of the LTR. Phenotypic variation between A(vy) mice indicates that the epigenetic state of the IAP is unstable in the germline. We have made a detailed examination of somatic methylation of the IAP using bisulphite allelic sequencing, and find that the promoter is incompletely methylated even when it is transcriptionally silent. In utero exposure to supplementary methyl donors, which alters the spectrum of A(vy) phenotypes, does not increase the density of CpG methylation in the silent LTR. Our findings suggest that, contrary to previous supposition, methyl donor supplementation acts through an indirect mechanism to silence A(vy). The incomplete cytosine methylation we observe at the somatically silent A(vy) allele may reflect its unstable germline state, and the influence of epigenetic modifications underlying CpG methylation.

CpG Methylation of a Silent Controlling Element in the Murine Avy Allele Is Incomplete and Unresponsive to Methyl Donor Supplementation

PubMed Central

Cropley, Jennifer E.; Suter, Catherine M.; Beckman, Kenneth B.; Martin, David I. K.

2010-01-01

Background The viable yellow allele of agouti (Avy) is remarkable for its unstable and partially heritable epigenetic state, which produces wide variation in phenotypes of isogenic mice. In the Avy allele an inserted intracisternal A particle (IAP) acts as a controlling element which deregulates expression of agouti by transcription from the LTR of the IAP; the phenotypic state has been linked to CpG methylation of the LTR. Phenotypic variation between Avy mice indicates that the epigenetic state of the IAP is unstable in the germline. Principal Findings We have made a detailed examination of somatic methylation of the IAP using bisulphite allelic sequencing, and find that the promoter is incompletely methylated even when it is transcriptionally silent. In utero exposure to supplementary methyl donors, which alters the spectrum of Avy phenotypes, does not increase the density of CpG methylation in the silent LTR. Conclusions Our findings suggest that, contrary to previous supposition, methyl donor supplementation acts through an indirect mechanism to silence Avy. The incomplete cytosine methylation we observe at the somatically silent Avy allele may reflect its unstable germline state, and the influence of epigenetic modifications underlying CpG methylation. PMID:20140227

Structure of the MLL CXXC domain – DNA complex and its functional role in MLL-AF9 leukemia

PubMed Central

Cierpicki, Tomasz; Risner, Laurie E.; Grembecka, Jolanta; Lukasik, Stephen M.; Popovic, Relja; Omonkowska, Monika; Shultis, David S.; Zeleznik-Le, Nancy J.; Bushweller, John H.

2010-01-01

MLL (Mixed Lineage Leukemia) is the target of chromosomal translocations which cause leukemias with poor prognosis. All leukemogenic MLL fusion proteins retain the CXXC domain which binds to nonmethylated CpG DNA. We present the solution structure of the MLL CXXC domain in complex with DNA, showing for the first time how the CXXC domain distinguishes nonmethylated from methylated CpG DNA. Based on the structure, we designed point mutations which disrupt DNA binding. Introduction of these mutations into MLL-AF9 results in increased DNA methylation of specific CpG nucleotides in Hoxa9, increased H3K9 methylation, decreased expression of Hoxa9 locus transcripts, loss of immortalization potential, and inability to induce leukemia in mice. These results establish that DNA binding by the CXXC domain and protection against DNA methylation is essential for MLL fusion leukemia. They also provide support for this interaction as a potential target for therapeutic intervention. PMID:20010842

Epigenomic alterations define lethal CIMP-positive ependymomas of infancy

PubMed Central

Mack, S. C.; Witt, H.; Piro, R. M.; Gu, L.; Zuyderduyn, S.; Stütz, A. M.; Wang, X.; Gallo, M.; Garzia, L.; Zayne, K.; Zhang, X.; Ramaswamy, V.; Jäger, N.; Jones, D. T. W.; Sill, M.; Pugh, T. J.; Ryzhova, M.; Wani, K. M.; Shih, D. J. H.; Head, R.; Remke, M.; Bailey, S. D.; Zichner, T.; Faria, C. C.; Barszczyk, M.; Stark, S.; Seker-Cin, H.; Hutter, S.; Johann, P.; Bender, S.; Hovestadt, V.; Tzaridis, T.; Dubuc, A. M.; Northcott, P. A.; Peacock, J.; Bertrand, K. C.; Agnihotri, S.; Cavalli, F. M. G.; Clarke, I.; Nethery-Brokx, K.; Creasy, C. L.; Verma, S. K.; Koster, J.; Wu, X.; Yao, Y.; Milde, T.; Sin-Chan, P.; Zuccaro, J.; Lau, L.; Pereira, S.; Castelo-Branco, P.; Hirst, M.; Marra, M. A.; Roberts, S. S.; Fults, D.; Massimi, L.; Cho, Y. J.; Van Meter, T.; Grajkowska, W.; Lach, B.; Kulozik, A. E.; von Deimling, A.; Witt, O.; Scherer, S. W.; Fan, X.; Muraszko, K. M.; Kool, M.; Pomeroy, S. L.; Gupta, N.; Phillips, J.; Huang, A.; Tabori, U.; Hawkins, C.; Malkin, D.; Kongkham, P. N.; Weiss, W. A.; Jabado, N.; Rutka, J. T.; Bouffet, E.; Korbel, J. O.; Lupien, M.; Aldape, K. D.; Bader, G. D.; Eils, R.; Lichter, P.; Dirks, P. B.; Pfister, S. M.; Korshunov, A.; Taylor, M. D.

2014-01-01

Ependymomas are common childhood brain tumours that occur throughout the nervous system, but are most common in the paediatric hindbrain. Current standard therapy comprises surgery and radiation, but not cytotoxic chemotherapy as it does not further increase survival. Whole-genome and whole-exome sequencing of 47 hindbrain ependymomas reveals an extremely low mutation rate, and zero significant recurrent somatic single nucleotide variants. Although devoid of recurrent single nucleotide variants and focal copy number aberrations, poor-prognosis hindbrain ependymomas exhibit a CpG island methylator phenotype. Transcriptional silencing driven by CpG methylation converges exclusively on targets of the Polycomb repressive complex 2 which represses expression of differentiation genes through trimethylation of H3K27. CpG island methylator phenotype-positive hindbrain ependymomas are responsive to clinical drugs that target either DNA or H3K27 methylation both in vitro and in vivo. We conclude that epigenetic modifiers are the first rational therapeutic candidates for this deadly malignancy, which is epigenetically deregulated but genetically bland. PMID:24553142

Comparison of sequencing-based methods to profile DNA methylation and identification of monoallelic epigenetic modifications

PubMed Central

Harris, R. Alan; Wang, Ting; Coarfa, Cristian; Nagarajan, Raman P.; Hong, Chibo; Downey, Sara L.; Johnson, Brett E.; Fouse, Shaun D.; Delaney, Allen; Zhao, Yongjun; Olshen, Adam; Ballinger, Tracy; Zhou, Xin; Forsberg, Kevin J.; Gu, Junchen; Echipare, Lorigail; O’Geen, Henriette; Lister, Ryan; Pelizzola, Mattia; Xi, Yuanxin; Epstein, Charles B.; Bernstein, Bradley E.; Hawkins, R. David; Ren, Bing; Chung, Wen-Yu; Gu, Hongcang; Bock, Christoph; Gnirke, Andreas; Zhang, Michael Q.; Haussler, David; Ecker, Joseph; Li, Wei; Farnham, Peggy J.; Waterland, Robert A.; Meissner, Alexander; Marra, Marco A.; Hirst, Martin; Milosavljevic, Aleksandar; Costello, Joseph F.

2010-01-01

Sequencing-based DNA methylation profiling methods are comprehensive and, as accuracy and affordability improve, will increasingly supplant microarrays for genome-scale analyses. Here, four sequencing-based methodologies were applied to biological replicates of human embryonic stem cells to compare their CpG coverage genome-wide and in transposons, resolution, cost, concordance and its relationship with CpG density and genomic context. The two bisulfite methods reached concordance of 82% for CpG methylation levels and 99% for non-CpG cytosine methylation levels. Using binary methylation calls, two enrichment methods were 99% concordant, while regions assessed by all four methods were 97% concordant. To achieve comprehensive methylome coverage while reducing cost, an approach integrating two complementary methods was examined. The integrative methylome profile along with histone methylation, RNA, and SNP profiles derived from the sequence reads allowed genome-wide assessment of allele-specific epigenetic states, identifying most known imprinted regions and new loci with monoallelic epigenetic marks and monoallelic expression. PMID:20852635

Epigenomic alterations define lethal CIMP-positive ependymomas of infancy.

PubMed

Mack, S C; Witt, H; Piro, R M; Gu, L; Zuyderduyn, S; Stütz, A M; Wang, X; Gallo, M; Garzia, L; Zayne, K; Zhang, X; Ramaswamy, V; Jäger, N; Jones, D T W; Sill, M; Pugh, T J; Ryzhova, M; Wani, K M; Shih, D J H; Head, R; Remke, M; Bailey, S D; Zichner, T; Faria, C C; Barszczyk, M; Stark, S; Seker-Cin, H; Hutter, S; Johann, P; Bender, S; Hovestadt, V; Tzaridis, T; Dubuc, A M; Northcott, P A; Peacock, J; Bertrand, K C; Agnihotri, S; Cavalli, F M G; Clarke, I; Nethery-Brokx, K; Creasy, C L; Verma, S K; Koster, J; Wu, X; Yao, Y; Milde, T; Sin-Chan, P; Zuccaro, J; Lau, L; Pereira, S; Castelo-Branco, P; Hirst, M; Marra, M A; Roberts, S S; Fults, D; Massimi, L; Cho, Y J; Van Meter, T; Grajkowska, W; Lach, B; Kulozik, A E; von Deimling, A; Witt, O; Scherer, S W; Fan, X; Muraszko, K M; Kool, M; Pomeroy, S L; Gupta, N; Phillips, J; Huang, A; Tabori, U; Hawkins, C; Malkin, D; Kongkham, P N; Weiss, W A; Jabado, N; Rutka, J T; Bouffet, E; Korbel, J O; Lupien, M; Aldape, K D; Bader, G D; Eils, R; Lichter, P; Dirks, P B; Pfister, S M; Korshunov, A; Taylor, M D

2014-02-27

Ependymomas are common childhood brain tumours that occur throughout the nervous system, but are most common in the paediatric hindbrain. Current standard therapy comprises surgery and radiation, but not cytotoxic chemotherapy as it does not further increase survival. Whole-genome and whole-exome sequencing of 47 hindbrain ependymomas reveals an extremely low mutation rate, and zero significant recurrent somatic single nucleotide variants. Although devoid of recurrent single nucleotide variants and focal copy number aberrations, poor-prognosis hindbrain ependymomas exhibit a CpG island methylator phenotype. Transcriptional silencing driven by CpG methylation converges exclusively on targets of the Polycomb repressive complex 2 which represses expression of differentiation genes through trimethylation of H3K27. CpG island methylator phenotype-positive hindbrain ependymomas are responsive to clinical drugs that target either DNA or H3K27 methylation both in vitro and in vivo. We conclude that epigenetic modifiers are the first rational therapeutic candidates for this deadly malignancy, which is epigenetically deregulated but genetically bland.

Detecting cooperative sequences in the binding of RNA Polymerase-II

NASA Astrophysics Data System (ADS)

Glass, Kimberly; Rozenberg, Julian; Girvan, Michelle; Losert, Wolfgang; Ott, Ed; Vinson, Charles

2008-03-01

Regulation of the expression level of genes is a key biological process controlled largely by the 1000 base pair (bp) sequence preceding each gene (the promoter region). Within that region transcription factor binding sites (TFBS), 5-10 bp long sequences, act individually or cooperate together in the recruitment of, and therefore subsequent gene transcription by, RNA Polymerase-II (RNAP). We have measured the binding of RNAP to promoters on a genome-wide basis using Chromatin Immunoprecipitation (ChIP-on-Chip) microarray assays. Using all 8-base pair long sequences as a test set, we have identified the DNA sequences that are enriched in promoters with high RNAP binding values. We are able to demonstrate that virtually all sequences enriched in such promoters contain a CpG dinucleotide, indicating that TFBS that contain the CpG dinucleotide are involved in RNAP binding to promoters. Further analysis shows that the presence of pairs of CpG containing sequences cooperate to enhance the binding of RNAP to the promoter.

Genome-wide determination of on-target and off-target characteristics for RNA-guided DNA methylation by dCas9 methyltransferases

PubMed Central

Lin, Lin; Liu, Yong; Xu, Fengping; Huang, Jinrong; Daugaard, Tina Fuglsang; Petersen, Trine Skov; Hansen, Bettina; Ye, Lingfei; Zhou, Qing; Fang, Fang; Yang, Ling; Li, Shengting; Fløe, Lasse; Jensen, Kristopher Torp; Shrock, Ellen; Chen, Fang; Yang, Huanming; Wang, Jian; Liu, Xin; Xu, Xun; Bolund, Lars; Nielsen, Anders Lade; Luo, Yonglun

2018-01-01

Abstract Background Fusion of DNA methyltransferase domains to the nuclease-deficient clustered regularly interspaced short palindromic repeat (CRISPR) associated protein 9 (dCas9) has been used for epigenome editing, but the specificities of these dCas9 methyltransferases have not been fully investigated. Findings We generated CRISPR-guided DNA methyltransferases by fusing the catalytic domain of DNMT3A or DNMT3B to the C terminus of the dCas9 protein from Streptococcus pyogenes and validated its on-target and global off-target characteristics. Using targeted quantitative bisulfite pyrosequencing, we prove that dCas9-BFP-DNMT3A and dCas9-BFP-DNMT3B can efficiently methylate the CpG dinucleotides flanking its target sites at different genomic loci (uPA and TGFBR3) in human embryonic kidney cells (HEK293T). Furthermore, we conducted whole genome bisulfite sequencing (WGBS) to address the specificity of our dCas9 methyltransferases. WGBS revealed that although dCas9-BFP-DNMT3A and dCas9-BFP-DNMT3B did not cause global methylation changes, a substantial number (more than 1000) of the off-target differentially methylated regions (DMRs) were identified. The off-target DMRs, which were hypermethylated in cells expressing dCas9 methyltransferase and guide RNAs, were predominantly found in promoter regions, 5΄ untranslated regions, CpG islands, and DNase I hypersensitivity sites, whereas unexpected hypomethylated off-target DMRs were significantly enriched in repeated sequences. Through chromatin immunoprecipitation with massive parallel DNA sequencing analysis, we further revealed that these off-target DMRs were weakly correlated with dCas9 off-target binding sites. Using quantitative polymerase chain reaction, RNA sequencing, and fluorescence reporter cells, we also found that dCas9-BFP-DNMT3A and dCas9-BFP-DNMT3B can mediate transient inhibition of gene expression, which might be caused by dCas9-mediated de novo DNA methylation as well as interference with transcription. Conclusion Our results prove that dCas9 methyltransferases cause efficient RNA-guided methylation of specific endogenous CpGs. However, there is significant off-target methylation indicating that further improvements of the specificity of CRISPR-dCas9 based DNA methylation modifiers are required. PMID:29635374

Genome-wide determination of on-target and off-target characteristics for RNA-guided DNA methylation by dCas9 methyltransferases.

PubMed

Lin, Lin; Liu, Yong; Xu, Fengping; Huang, Jinrong; Daugaard, Tina Fuglsang; Petersen, Trine Skov; Hansen, Bettina; Ye, Lingfei; Zhou, Qing; Fang, Fang; Yang, Ling; Li, Shengting; Fløe, Lasse; Jensen, Kristopher Torp; Shrock, Ellen; Chen, Fang; Yang, Huanming; Wang, Jian; Liu, Xin; Xu, Xun; Bolund, Lars; Nielsen, Anders Lade; Luo, Yonglun

2018-03-01

Fusion of DNA methyltransferase domains to the nuclease-deficient clustered regularly interspaced short palindromic repeat (CRISPR) associated protein 9 (dCas9) has been used for epigenome editing, but the specificities of these dCas9 methyltransferases have not been fully investigated. We generated CRISPR-guided DNA methyltransferases by fusing the catalytic domain of DNMT3A or DNMT3B to the C terminus of the dCas9 protein from Streptococcus pyogenes and validated its on-target and global off-target characteristics. Using targeted quantitative bisulfite pyrosequencing, we prove that dCas9-BFP-DNMT3A and dCas9-BFP-DNMT3B can efficiently methylate the CpG dinucleotides flanking its target sites at different genomic loci (uPA and TGFBR3) in human embryonic kidney cells (HEK293T). Furthermore, we conducted whole genome bisulfite sequencing (WGBS) to address the specificity of our dCas9 methyltransferases. WGBS revealed that although dCas9-BFP-DNMT3A and dCas9-BFP-DNMT3B did not cause global methylation changes, a substantial number (more than 1000) of the off-target differentially methylated regions (DMRs) were identified. The off-target DMRs, which were hypermethylated in cells expressing dCas9 methyltransferase and guide RNAs, were predominantly found in promoter regions, 5΄ untranslated regions, CpG islands, and DNase I hypersensitivity sites, whereas unexpected hypomethylated off-target DMRs were significantly enriched in repeated sequences. Through chromatin immunoprecipitation with massive parallel DNA sequencing analysis, we further revealed that these off-target DMRs were weakly correlated with dCas9 off-target binding sites. Using quantitative polymerase chain reaction, RNA sequencing, and fluorescence reporter cells, we also found that dCas9-BFP-DNMT3A and dCas9-BFP-DNMT3B can mediate transient inhibition of gene expression, which might be caused by dCas9-mediated de novo DNA methylation as well as interference with transcription. Our results prove that dCas9 methyltransferases cause efficient RNA-guided methylation of specific endogenous CpGs. However, there is significant off-target methylation indicating that further improvements of the specificity of CRISPR-dCas9 based DNA methylation modifiers are required.

Murine J774 Macrophages Recognize LPS/IFN-g, Non-CpG DNA or Two-CpG DNA-containing Sequences as Immunologically Distinct

PubMed Central

Crosby, Lynn; Casey, Warren; Morgan, Kevin; Ni, Hong; Yoon, Lawrence; Easton, Marilyn; Misukonis, Mary; Burleson, Gary; Ghosh, Dipak K.

2010-01-01

Specific bacterial lipopolysaccharides (LPS), IFN-γ, and unmethylated cytosine or guanosine-phosphorothioate containing DNAs (CpG) activate host immunity, influencing infectious responses. Macrophages detect, inactivate and destroy infectious particles, and synthetic CpG sequences invoke similar responses of the innate immune system. Previously, murine macrophage J774 cells treated with CpG induced the expression of nitric oxide synthase 2 (NOS2) and cyclo-oxygenase 2 (COX2) mRNA and protein. In this study murine J774 macrophages were exposed to vehicle, interferon γ + lipopolysaccharide (IFN-g/LPS), non-CpG (SAK1), or two-CpG sequence-containing DNA (SAK2) for 0–18 hr and gene expression changes measured. A large number of immunostimulatory and inflammatory changes were observed. SAK2 was a stronger activator of TNFα- and chemokine expression-related changes than LPS/IFN-g. Up regulation included tumor necrosis factor receptor superfamily genes (TNFRSF’s), IL-1 receptor signaling via stress-activated protein kinase (SAPK), NF-κB activation, hemopoietic maturation factors and sonic hedgehog/wingless integration site (SHH/Wnt) pathway genes. Genes of the TGF-β pathway were down regulated. In contrast, LPS/IFN-g -treated cells showed increased levels for TGF-β signaling genes, which may be linked to the observed up regulation of numerous collagens and down regulation of Wnt pathway genes. SAK1 produced distinct changes from LPS/IFN-g or SAK2. Therefore, J774 macrophages recognize LPS/IFN-g, non-CpG DNA or two-CpG DNA-containing sequences as immunologically distinct. PMID:20097302

Differential DNA Methylation in Relation to Age and Health Risks of Obesity.

PubMed

Mansego, María Luisa; Milagro, Fermín I; Zulet, María Ángeles; Moreno-Aliaga, María J; Martínez, José Alfredo

2015-07-24

The aim of this study was to evaluate whether genome-wide levels of DNA methylation are associated with age and the health risks of obesity (HRO); defined according to BMI categories as "Low HRO" (overweight and class 1 obesity) versus "High HRO" (class 2 and class 3 obesity). Anthropometric measurements were assessed in a subsample of 48 volunteers from the Metabolic Syndrome Reduction in Navarra (RESMENA) study and 24 women from another independent study, Effects of Lipoic Acid and Eicosapentaenoic Acid in Human Obesity (OBEPALIP study). In the pooled population; the methylation levels of 55 CpG sites were significantly associated with age after Benjamini-Hochberg correction. In addition, DNA methylation of three CpG sites located in ELOVL2; HOXC4 and PI4KB were further negatively associated with their mRNA levels. Although no differentially methylated CpG sites were identified in relation to HRO after multiple testing correction; several nominally significant CpG sites were identified in genes related to insulin signaling; energy and lipid metabolism. Moreover, statistically significant associations between BMI or mRNA levels and two HRO-related CpG sites located in GPR133 and ITGB5 are reported. As a conclusion, these findings from two Spanish cohorts add knowledge about the important role of DNA methylation in the age-related regulation of gene expression. In addition; a relevant influence of age on DNA methylation in white blood cells was found, as well as, on a trend level, novel associations between DNA methylation and obesity.

Base Excision Repair of Tandem Modifications in a Methylated CpG Dinucleotide*

PubMed Central

Sassa, Akira; Çağlayan, Melike; Dyrkheeva, Nadezhda S.; Beard, William A.; Wilson, Samuel H.

2014-01-01

Cytosine methylation and demethylation in tracks of CpG dinucleotides is an epigenetic mechanism for control of gene expression. The initial step in the demethylation process can be deamination of 5-methylcytosine producing the TpG alteration and T:G mispair, and this step is followed by thymine DNA glycosylase (TDG) initiated base excision repair (BER). A further consideration is that guanine in the CpG dinucleotide may become oxidized to 7,8-dihydro-8-oxoguanine (8-oxoG), and this could affect the demethylation process involving TDG-initiated BER. However, little is known about the enzymology of BER of altered in-tandem CpG dinucleotides; e.g. Tp8-oxoG. Here, we investigated interactions between this altered dinucleotide and purified BER enzymes, the DNA glycosylases TDG and 8-oxoG DNA glycosylase 1 (OGG1), apurinic/apyrimidinic (AP) endonuclease 1, DNA polymerase β, and DNA ligases. The overall TDG-initiated BER of the Tp8-oxoG dinucleotide is significantly reduced. Specifically, TDG and DNA ligase activities are reduced by a 3′-flanking 8-oxoG. In contrast, the OGG1-initiated BER pathway is blocked due to the 5′-flanking T:G mispair; this reduces OGG1, AP endonuclease 1, and DNA polymerase β activities. Furthermore, in TDG-initiated BER, TDG remains bound to its product AP site blocking OGG1 access to the adjacent 8-oxoG. These results reveal BER enzyme specificities enabling suppression of OGG1-initiated BER and coordination of TDG-initiated BER at this tandem alteration in the CpG dinucleotide. PMID:24695738

Intensive hypermethylation of the CpG island of Ras association domain family 1A in hepatitis B virus-associated hepatocellular carcinomas.

PubMed

Zhong, Sheng; Yeo, Winnie; Tang, Mandy W; Wong, Nathalie; Lai, Paul B S; Johnson, Phillip J

2003-08-15

The human Ras association domain family 1A gene (RASSF1A) is a newly isolated tumor suppressor gene. In this study, we analyzed the methylation status of the promoter region of RASSF1A using bisulfite sequencing and PCR-RFLP in four liver cancer cell lines (Hep3B, HepG(2), SK-HEP-1, and Huh-7) and a cohort of 43 hepatitis B virus-associated hepatocellular carcinoma (HCC) tissues and their corresponding nontumor tissue specimens. The methylation of the CpG islands in the RASSF1A promoter was not detected in 4 samples of normal liver tissue or 10 samples of peripheral blood mononuclear cells from normal subjects. However, the CpG islands were completely methylated, and transcription of the RASSF1A was silenced in the four cell lines. Treatment with the DNA methylation inhibitor 5-aza-2'-deoxycytidine reactivated the expression of RASSF1A in the Hep3B and HepG2 cells. In 41 of 43 (95%) HCC specimens studied, the promoter region of RASSF1A was intensively methylated at its CpG sites. Although heterogeneous methylation was also detected in 16 of the 23 (70%) corresponding nontumorous tissues analyzed, the level of methylation was significantly lower than in the corresponding tumor tissues. HCC has the highest incidence of promoter methylation of RASSF1A among all malignancies yet reported suggesting that hypermethylation of the CpG island promoter of RASSF1A may play an important pathological role in this tumor.

Dendritic Cell-Based Immunotherapy of Breast Cancer: Modulation by CpG DNA

DTIC Science & Technology

2005-09-01

tumor-associated antigens and bacterial DNA oligodeoxynucleotides containing unmethylated CpG sequences (CpG DNA) further augment the immune priming...associated antigens by cytotoxic T lymphocytes, and bacterial DNA oligodeoxy- nucleotides containing unmethylated CpG sequences (CpG DNA) can further...further amplify their immunostimulatory capacity and bacterial DNA oligodeoxynucleotides (ODN) containing unmethylated CpG sequences (CpG DNA) provide such

Human papillomavirus dysregulates the cellular apparatus controlling the methylation status of H3K27 in different human cancers to consistently alter gene expression regardless of tissue of origin

PubMed Central

Zhang, Ali; Barrett, John W.; Nichols, Anthony C.; Torchia, Joe; Mymryk, Joe S.

2017-01-01

High-risk human papillomaviruses (HPV) cause cancer at multiple distinct anatomical locations. Regardless of the tissue of origin, most HPV positive (HPV+) cancers show highly upregulated expression of the p16 product of the cyclin-dependent kinase inhibitor 2A (CDKN2A) gene. Paradoxically, HPV+ tumor cells require continuous expression of this tumor suppressor for survival. Thus, restoration of normal p16 regulation has potential therapeutic value against HPV induced cancers. Normally, p16 transcription is tightly controlled at the epigenetic level via polycomb repressive complex-mediated tri-methylation of histone 3 lysine 27 (H3K27me3). Although a mechanism by which HPV induces p16 has been proposed based on tissue culture models, it has not been extensively validated in human tumors. In this study, we used data from over 800 human cervical and head and neck tumors from The Cancer Genome Atlas (TCGA) to test this model. We determined the impact of HPV status on expression from the CDKN2A locus, the adjacent CDKN2B locus, and transcript levels of key epigenetic regulators of these loci. As expected, HPV+ tumors from both anatomical sites exhibited high levels of p16. Furthermore, HPV+ tumors expressed higher levels of KDM6A, which demethylates H3K27me3. CpG methylation of the CDKN2A locus was also consistently altered in HPV+ tumors. This data validates previous tissue culture studies and identifies remarkable similarities between the effects of HPV on gene expression and DNA methylation in both cervical and oral tumors in large human cohorts. Furthermore, these results support a model whereby HPV-mediated dysregulation of CDKN2A transcription requires KDM6A, a potentially druggable target. PMID:29069809

Autoimmune Th17 Cells Induced Synovial Stromal and Innate Lymphoid Cell Secretion of the Cytokine GM-CSF to Initiate and Augment Autoimmune Arthritis.

PubMed

Hirota, Keiji; Hashimoto, Motomu; Ito, Yoshinaga; Matsuura, Mayumi; Ito, Hiromu; Tanaka, Masao; Watanabe, Hitomi; Kondoh, Gen; Tanaka, Atsushi; Yasuda, Keiko; Kopf, Manfred; Potocnik, Alexandre J; Stockinger, Brigitta; Sakaguchi, Noriko; Sakaguchi, Shimon

2018-06-19

Despite the importance of Th17 cells in autoimmune diseases, it remains unclear how they control other inflammatory cells in autoimmune tissue damage. Using a model of spontaneous autoimmune arthritis, we showed that arthritogenic Th17 cells stimulated fibroblast-like synoviocytes via interleukin-17 (IL-17) to secrete the cytokine GM-CSF and also expanded synovial-resident innate lymphoid cells (ILCs) in inflamed joints. Activated synovial ILCs, which expressed CD25, IL-33Ra, and TLR9, produced abundant GM-CSF upon stimulation by IL-2, IL-33, or CpG DNA. Loss of GM-CSF production by either ILCs or radio-resistant stromal cells prevented Th17 cell-mediated arthritis. GM-CSF production by Th17 cells augmented chronic inflammation but was dispensable for the initiation of arthritis. We showed that GM-CSF-producing ILCs were present in inflamed joints of rheumatoid arthritis patients. Thus, a cellular cascade of autoimmune Th17 cells, ILCs, and stromal cells, via IL-17 and GM-CSF, mediates chronic joint inflammation and can be a target for therapeutic intervention. Copyright © 2018 Elsevier Inc. All rights reserved.

Liposomal SLA co-incorporated with PO CpG ODNs or PS CpG ODNs induce the same protection against the murine model of leishmaniasis.

PubMed

Shargh, Vahid Heravi; Jaafari, Mahmoud Reza; Khamesipour, Ali; Jaafari, Iman; Jalali, Seyed Amir; Abbasi, Azam; Badiee, Ali

2012-06-06

First generation Leishmania vaccines consisting of whole killed parasites with or without adjuvants have reached phase 3 trial and failed to show enough efficacy mainly due to the lack of an appropriate adjuvant. In this study, the nuclease-resistant phosphorothioate CpG oligodeoxynucleotides (PS CpG) or nuclease-sensitive phosphodiester CpG ODNs (PO CpG) were used as adjuvants to enhance immunogenicity and rate of protection against leishmaniasis. Due to the susceptibility of PO CpG to nuclease degradation, an efficient liposomal delivery system was developed to protect them from degradation. 1, 2-dioleoyl-3-trimethylammonium-propane (DOTAP) as a cationic lipid was used because of its unique adjuvanticity and electrostatic interaction with negatively charged CpG ODNs. To evaluate the role of liposomal formulation in protection rate and enhanced immune response, BALB/c mice were immunized subcutaneously with liposomal soluble Leishmania antigens (SLA) co-incorporated with PO CpG (Lip-SLA-PO CpG), Lip-SLA-PS CpG, SLA+PO CpG, SLA+PS CpG, SLA or buffer. As criteria for protection, footpad swelling at the site of challenge, parasite loads, the levels of IFN-γ and IL-4, and the IgG subtypes were evaluated. The groups of mice receiving Lip-SLA-PO CpG or Lip-SLA-PS CpG showed a high protection rate compared with the control groups. In addition, there was no significant difference in immune response generation between mice immunized with PS CpG and the group receiving PO CpG when incorporated into the liposomes. The results suggested that liposomal form of PO CpG might be used instead of PS CpG in future vaccine formulations as an efficient adjuvant. Copyright © 2012 Elsevier Ltd. All rights reserved.

Receptor for advanced glycation end products is targeted by FBXO10 for ubiquitination and degradation.

PubMed

Evankovich, John; Lear, Travis; Mckelvey, Alison; Dunn, Sarah; Londino, James; Liu, Yuan; Chen, Bill B; Mallampalli, Rama K

2017-09-01

The receptor for advanced glycation end products (RAGE) is a highly expressed cell membrane receptor serving to anchor lung epithelia to matrix components, and it also amplifies inflammatory signaling during acute lung injury. However, mechanisms that regulate its protein concentrations in cells remain largely unknown. Here we show that RAGE exhibits an extended life span in lung epithelia ( t ½ 6 h), is monoubiquitinated at K374, and is degraded in lysosomes. The RAGE ligand ODN2006, a synthetic oligodeoxynucleotide resembling pathogenic hypomethylated CpG DNA, promotes rapid lysosomal RAGE degradation through activation of protein kinase Cζ (PKCζ), which phosphorylates RAGE. PKCζ overexpression enhances RAGE degradation, while PKCζ knockdown stabilizes RAGE protein levels and prevents ODN2006-mediated degradation. We identify that RAGE is targeted by the ubiquitin E3 ligase subunit F-box protein O10 (FBXO10), which associates with RAGE to mediate its ubiquitination and degradation. FBXO10 depletion in cells stabilizes RAGE and is required for ODN2006-mediated degradation. These data suggest that modulation of regulators involved in ubiquitin-mediated disposal of RAGE might serve as unique molecular inputs directing RAGE cellular concentrations and downstream responses, which are critical in an array of inflammatory disorders, including acute lung injury.-Evankovich, J., Lear, T., Mckelvey, A., Dunn, S., Londino, J., Liu, Y., Chen, B. B., Mallampalli, R. K. Receptor for advanced glycation end products is targeted by FBXO10 for ubiquitination and degradation. © FASEB.

Influence of the Prader-Willi syndrome imprinting center on the DNA methylation landscape in the mouse brain

PubMed Central

Brant, Jason O; Riva, Alberto; Resnick, James L; Yang, Thomas P

2014-01-01

Reduced representation bisulfite sequencing (RRBS) was used to analyze DNA methylation patterns across the mouse brain genome in mice carrying a deletion of the Prader-Willi syndrome imprinting center (PWS-IC) on either the maternally- or paternally-inherited chromosome. Within the ∼3.7 Mb imprinted Angelman/Prader-Willi syndrome (AS/PWS) domain, 254 CpG sites were interrogated for changes in methylation due to PWS-IC deletion. Paternally-inherited deletion of the PWS-IC increased methylation levels ∼2-fold at each CpG site (compared to wild-type controls) at differentially methylated regions (DMRs) associated with 5′ CpG island promoters of paternally-expressed genes; these methylation changes extended, to a variable degree, into the adjacent CpG island shores. Maternal PWS-IC deletion yielded little or no changes in methylation at these DMRs, and methylation of CpG sites outside of promoter DMRs also was unchanged upon maternal or paternal PWS-IC deletion. Using stringent ascertainment criteria, ∼750,000 additional CpG sites were also interrogated across the entire mouse genome. This analysis identified 26 loci outside of the imprinted AS/PWS domain showing altered DNA methylation levels of ≥25% upon PWS-IC deletion. Curiously, altered methylation at 9 of these loci was a consequence of maternal PWS-IC deletion (maternal PWS-IC deletion by itself is not known to be associated with a phenotype in either humans or mice), and 10 of these loci exhibited the same changes in methylation irrespective of the parental origin of the PWS-IC deletion. These results suggest that the PWS-IC may affect DNA methylation at these loci by directly interacting with them, or may affect methylation at these loci through indirect downstream effects due to PWS-IC deletion. They further suggest the PWS-IC may have a previously uncharacterized function outside of the imprinted AS/PWS domain. PMID:25482058

Influence of the Prader-Willi syndrome imprinting center on the DNA methylation landscape in the mouse brain.

PubMed

Brant, Jason O; Riva, Alberto; Resnick, James L; Yang, Thomas P

2014-11-01

Reduced representation bisulfite sequencing (RRBS) was used to analyze DNA methylation patterns across the mouse brain genome in mice carrying a deletion of the Prader-Willi syndrome imprinting center (PWS-IC) on either the maternally- or paternally-inherited chromosome. Within the ~3.7 Mb imprinted Angelman/Prader-Willi syndrome (AS/PWS) domain, 254 CpG sites were interrogated for changes in methylation due to PWS-IC deletion. Paternally-inherited deletion of the PWS-IC increased methylation levels ~2-fold at each CpG site (compared to wild-type controls) at differentially methylated regions (DMRs) associated with 5' CpG island promoters of paternally-expressed genes; these methylation changes extended, to a variable degree, into the adjacent CpG island shores. Maternal PWS-IC deletion yielded little or no changes in methylation at these DMRs, and methylation of CpG sites outside of promoter DMRs also was unchanged upon maternal or paternal PWS-IC deletion. Using stringent ascertainment criteria, ~750,000 additional CpG sites were also interrogated across the entire mouse genome. This analysis identified 26 loci outside of the imprinted AS/PWS domain showing altered DNA methylation levels of ≥25% upon PWS-IC deletion. Curiously, altered methylation at 9 of these loci was a consequence of maternal PWS-IC deletion (maternal PWS-IC deletion by itself is not known to be associated with a phenotype in either humans or mice), and 10 of these loci exhibited the same changes in methylation irrespective of the parental origin of the PWS-IC deletion. These results suggest that the PWS-IC may affect DNA methylation at these loci by directly interacting with them, or may affect methylation at these loci through indirect downstream effects due to PWS-IC deletion. They further suggest the PWS-IC may have a previously uncharacterized function outside of the imprinted AS/PWS domain.

DNA methylation of intragenic CpG islands depends on their transcriptional activity during differentiation and disease

PubMed Central

Jeziorska, Danuta M.; Murray, Robert J. S.; De Gobbi, Marco; Gaentzsch, Ricarda; Garrick, David; Ayyub, Helena; Chen, Taiping; Li, En; Telenius, Jelena; Lynch, Magnus; Graham, Bryony; Smith, Andrew J. H.; Lund, Jonathan N.; Hughes, Jim R.; Higgs, Douglas R.

2017-01-01

The human genome contains ∼30,000 CpG islands (CGIs). While CGIs associated with promoters nearly always remain unmethylated, many of the ∼9,000 CGIs lying within gene bodies become methylated during development and differentiation. Both promoter and intragenic CGIs may also become abnormally methylated as a result of genome rearrangements and in malignancy. The epigenetic mechanisms by which some CGIs become methylated but others, in the same cell, remain unmethylated in these situations are poorly understood. Analyzing specific loci and using a genome-wide analysis, we show that transcription running across CGIs, associated with specific chromatin modifications, is required for DNA methyltransferase 3B (DNMT3B)-mediated DNA methylation of many naturally occurring intragenic CGIs. Importantly, we also show that a subgroup of intragenic CGIs is not sensitive to this process of transcription-mediated methylation and that this correlates with their individual intrinsic capacity to initiate transcription in vivo. We propose a general model of how transcription could act as a primary determinant of the patterns of CGI methylation in normal development and differentiation, and in human disease. PMID:28827334

CpG- and LPS-activated MAPK signaling in in vitro cultured salmon (Salmo salar) mononuclear phagocytes.

PubMed

Iliev, Dimitar B; Hansen, Tom; Jørgensen, Sven Martin; Krasnov, Aleksei; Jørgensen, Jorunn B

2013-10-01

The Mitogen-activated protein kinases (MAPK) are involved in transmitting intracellular signals downstream of diverse cell surface receptors and mediate the response to ligands such as growth factors, hormones and cytokines. In addition, MAPK are critically involved in the innate immune response to pathogen-derived substances, commonly referred to as pathogen-associated molecular patterns (PAMPs), such as bacterial lipopolysaccharide (LPS) and bacterial DNA rich in CpG dinucleotides. Currently, a great deal of knowledge is available about the involvement of MAPK in the innate immune response to PAMPs in mammals; however, little is known about the role of the different MAPK classes in the immune response to PAMPs in lower vertebrates. In the current study, p38 phosphorylation was induced by CpG oligonucleotides (ODNs) and LPS in primary salmon mononuclear phagocytes. Pre-treatment of the cells with a p38 inhibitor (SB203580) blocked the PAMP-induced p38 activity and suppressed the upregulation of most of the CpG- and LPS-induced transcripts highlighting the role of this kinase in the salmon innate immune response to PAMPs. In contrast to p38, the phosphorylation of extracellular signal-regulated kinase (ERK), a MAPK involved primarily in response to mitogens, was high in resting cells and, surprisingly, incubation with both CpG and control ODNs downregulated the phospho-ERK levels independently of p38 activation. The basal phospho-ERK level and the CpG-inducible p38 phosphorylation were greatly influenced by the length of in vitro incubation. The basal phospho-ERK level increased gradually throughout a 5-day culture period and was PI3K-dependent as demonstrated by its sensitivity to Wortmannin suggesting it is influenced by growth factors. Overall these data indicate that both basal and PAMP-induced activity of MAPKs might be greatly influenced by the differentiation status of salmon mononuclear phagocytes. Copyright © 2013. Published by Elsevier Ltd.

Long-term outdoor air pollution and DNA methylation in circulating monocytes: results from the Multi-Ethnic Study of Atherosclerosis (MESA).

PubMed

Chi, Gloria C; Liu, Yongmei; MacDonald, James W; Barr, R Graham; Donohue, Kathleen M; Hensley, Mark D; Hou, Lifang; McCall, Charles E; Reynolds, Lindsay M; Siscovick, David S; Kaufman, Joel D

2016-12-01

DNA methylation may mediate effects of air pollution on cardiovascular disease. The association between long-term air pollution exposure and DNA methylation in monocytes, which are central to atherosclerosis, has not been studied. We investigated the association between long-term ambient air pollution exposure and DNA methylation (candidate sites and global) in monocytes of adults (aged ≥55). One-year average ambient fine particulate matter (PM 2.5 ) and oxides of nitrogen (NO X ) concentrations were predicted at participants' (n = 1,207) addresses using spatiotemporal models. We assessed DNA methylation in circulating monocytes at 1) 2,713 CpG sites associated with mRNA expression of nearby genes and 2) probes mapping to Alu and LINE-1 repetitive elements (surrogates for global DNA methylation) using Illumina's Infinium HumanMethylation450 BeadChip. We used linear regression models adjusted for demographics, smoking, physical activity, socioeconomic status, methyl-nutrients, and technical variables. For significant air pollution-associated methylation sites, we also assessed the association between expression of gene transcripts previously associated with these CpG sites and air pollution. At a false discovery rate of 0.05, five candidate CpGs (cg20455854, cg07855639, cg07598385, cg17360854, and cg23599683) had methylation significantly associated with PM 2.5 and none were associated with NO X . Cg20455854 had the smallest p-value for the association with PM 2.5 (p = 2.77 × 10 -5 ). mRNA expression profiles of genes near three of the PM 2.5 -associated CpGs (ANKHD1, LGALS2, and ANKRD11) were also significantly associated with PM 2.5 exposure. Alu and LINE-1 methylation were not associated with long-term air pollution exposure. We observed novel associations between long-term ambient air pollution exposure and site-specific DNA methylation, but not global DNA methylation, in purified monocytes of a multi-ethnic adult population. Epigenetic markers may provide insights into mechanisms underlying environmental factors in complex diseases like atherosclerosis.

HMGB1 Is Involved in IFN-α Production and TRAIL Expression by HIV-1-Exposed Plasmacytoid Dendritic Cells: Impact of the Crosstalk with NK Cells.

PubMed

Saïdi, Héla; Bras, Marlène; Formaglio, Pauline; Melki, Marie-Thérèse; Charbit, Bruno; Herbeuval, Jean-Philippe; Gougeon, Marie-Lise

2016-02-01

Plasmacytoid dendritic cells (pDCs) are innate sensors of viral infections and important mediators of antiviral innate immunity through their ability to produce large amounts of IFN-α. Moreover, Toll-like receptor 7 (TLR7) and 9 (TLR9) ligands, such as HIV and CpG respectively, turn pDCs into TRAIL-expressing killer pDCs able to lyse HIV-infected CD4+ T cells. NK cells can regulate antiviral immunity by modulating pDC functions, and pDC production of IFN-α as well as cell-cell contact is required to promote NK cell functions. Impaired pDC-NK cell crosstalk was reported in the setting of HIV-1 infection, but the impact of HIV-1 on TRAIL expression and innate antiviral immunity during this crosstalk is unknown. Here, we report that low concentrations of CCR5-tropic HIV-1Ba-L promote the release of pro-inflammatory cytokines such as IFN-α, TNF-α, IFN-γ and IL-12, and CCR5-interacting chemokines (MIP-1α and MIP-1β) in NK-pDCs co-cultures. At high HIV-1BaL concentrations, the addition of NK cells did not promote the release of these mediators, suggesting that once efficiently triggered by the virus, pDCs could not integrate new activating signals delivered by NK cells. However, high HIV-1BaL concentrations were required to trigger IFN-α-mediated TRAIL expression at the surface of both pDCs and NK cells during their crosstalk. Interestingly, we identified the alarmin HMGB1, released at pDC-NK cell synapse, as an essential trigger for the secretion of IFN-α and IFN-related soluble mediators during the interplay of HIV-1 exposed pDCs with NK cells. Moreover, HMGB1 was found crucial for mTRAIL translocation to the plasma membrane of both pDCs and NK cells during their crosstalk following pDC exposure to HIV-1. Data from serum analyses of circulating HMGB1, HMGB1-specific antibodies, sTRAIL and IP-10 in a cohort of 67 HIV-1+ patients argue for the in vivo relevance of these observations. Altogether, these findings identify HMGB1 as a trigger for IFN-α-mediated TRAIL expression at the surface of pDCs and NK cells, and they suggest a novel mechanism of innate control of HIV-1 infection.

HMGB1 Is Involved in IFN-α Production and TRAIL Expression by HIV-1-Exposed Plasmacytoid Dendritic Cells: Impact of the Crosstalk with NK Cells

PubMed Central

Formaglio, Pauline; Melki, Marie-Thérèse; Charbit, Bruno; Herbeuval, Jean-Philippe; Gougeon, Marie-Lise

2016-01-01

Plasmacytoid dendritic cells (pDCs) are innate sensors of viral infections and important mediators of antiviral innate immunity through their ability to produce large amounts of IFN-α. Moreover, Toll-like receptor 7 (TLR7) and 9 (TLR9) ligands, such as HIV and CpG respectively, turn pDCs into TRAIL-expressing killer pDCs able to lyse HIV-infected CD4+ T cells. NK cells can regulate antiviral immunity by modulating pDC functions, and pDC production of IFN-α as well as cell–cell contact is required to promote NK cell functions. Impaired pDC-NK cell crosstalk was reported in the setting of HIV-1 infection, but the impact of HIV-1 on TRAIL expression and innate antiviral immunity during this crosstalk is unknown. Here, we report that low concentrations of CCR5-tropic HIV-1Ba-L promote the release of pro-inflammatory cytokines such as IFN-α, TNF-α, IFN-γ and IL-12, and CCR5-interacting chemokines (MIP-1α and MIP-1β) in NK-pDCs co-cultures. At high HIV-1BaL concentrations, the addition of NK cells did not promote the release of these mediators, suggesting that once efficiently triggered by the virus, pDCs could not integrate new activating signals delivered by NK cells. However, high HIV-1BaL concentrations were required to trigger IFN-α-mediated TRAIL expression at the surface of both pDCs and NK cells during their crosstalk. Interestingly, we identified the alarmin HMGB1, released at pDC-NK cell synapse, as an essential trigger for the secretion of IFN-α and IFN-related soluble mediators during the interplay of HIV-1 exposed pDCs with NK cells. Moreover, HMGB1 was found crucial for mTRAIL translocation to the plasma membrane of both pDCs and NK cells during their crosstalk following pDC exposure to HIV-1. Data from serum analyses of circulating HMGB1, HMGB1-specific antibodies, sTRAIL and IP-10 in a cohort of 67 HIV-1+ patients argue for the in vivo relevance of these observations. Altogether, these findings identify HMGB1 as a trigger for IFN-α-mediated TRAIL expression at the surface of pDCs and NK cells, and they suggest a novel mechanism of innate control of HIV-1 infection. PMID:26871575

Effect of amino groups of mesoporous silica nanoparticles on CpG oligodexynucleotide delivery

NASA Astrophysics Data System (ADS)

Xu, Yi; Claiden, Peter; Zhu, Yufang; Morita, Hiromi; Hanagata, Nobutaka

2015-08-01

In this study, we proposed to modify mesoporous silica nanoparticles (MSNs) with 3-aminopropyltriethoxysilane (NH2-TES), aminoethylaminopropyltriethoxysilane (2NH2-TES) and 3-[2-(2-aminoethylamino)ethylamino] propyl-trimethoxysilane (3NH2-TES) for binding of cytosine-phosphate-guanosine oligodexynucleotides (CpG ODN), and investigated the effect of different amino groups of MSNs on the CpG ODN delivery. Serum stability, in vitro cytotoxicity, and cytokine interleukin-6 (IL-6) induction by MSN-NH2/CpG, MSN-2NH2/CpG and MSN-3NH2/CpG complexes were investigated in detail. The results showed that three kinds of aminated-MSN-based CpG ODN delivery systems had no cytotoxicity to RAW264.7 cells, and binding of CpG ODN to MSN-NH2, MSN-2NH2 and MSN-3NH2 nanoparticles enhanced the serum stability of CpG ODN due to protection by the nanoparticles. However, three aminated MSN-based CpG ODN delivery systems exhibited different CpG ODN delivery efficiency, and MSN-NH2/CpG complexes had the highest ability to induce IL-6 secretion.

Epigenetic Regulation of Werner Syndrome Gene in Age-Related Cataract

PubMed Central

Guan, Huaijin

2015-01-01

Purpose. To examine the promoter methylation and histone modification of WRN (Werner syndrome gene), a DNA repair gene, and their relationship with the gene expression in age-related cataract (ARC) lens. Methods. We collected the lenses after cataract surgery from 117ARC patients and 39 age-matched non-ARC. WRN expression, DNA methylation and histone modification around the CpG island were assessed. The methylation status of Human-lens-epithelium cell (HLEB-3) was chemically altered to observe the relationship between methylation and expression of WRN. Results. The WRN expression was significantly decreased in the ARC anterior lens capsules comparing with the control. The CpG island of WRN promoter in the ARC anterior lens capsules displayed hypermethylation comparing with the controls. The WRN promoter was almost fully methylated in the cortex of ARC and control lens. Acetylated H3 was lower while methylated H3-K9 was higher in ARC anterior lens capsules than that of the controls. The expression of WRN in HLEB-3 increased after demethylation of the cells. Conclusions. A hypermethylation in WRN promoter and altered histone modification in anterior lens capsules might contribute to the ARC mechanism. The data suggest an association of altered DNA repair capability in lens with ARC pathogenesis. PMID:26509079

An Animal Model of Abacavir-Induced HLA-Mediated Liver Injury.

PubMed

Song, Binbin; Aoki, Shigeki; Liu, Cong; Susukida, Takeshi; Ito, Kousei

2018-04-01

Genome-wide association studies indicate that several idiosyncratic adverse drug reactions are highly associated with specific human leukocyte antigen (HLA) alleles. For instance, abacavir, a human immunodeficiency virus reverse transcriptase inhibitor, induces multiorgan toxicity exclusively in patients carrying the HLA-B*57:01 allele. However, the underlying mechanism is unclear due to a lack of appropriate animal models. Previously, we developed HLA-B*57:01 transgenic mice and found that topical application of abacavir to the ears induced proliferation of CD8+ lymphocytes in local lymph nodes. Here, we attempted to reproduce abacavir-induced liver injury in these mice. However, oral administration of abacavir alone to HLA-B*57:01 transgenic mice did not increase levels of the liver injury marker alanine aminotransferase. Considering the importance of innate immune activation in mouse liver, we treated mice with CpG oligodeoxynucleotide, a toll-like receptor 9 agonist, plus abacavir. This resulted in a marked increase in alanine aminotransferase, pathological changes in liver, increased numbers of activated CD8+ T cells, and tissue infiltration by immune cells exclusively in HLA-B*57:01 transgenic mice. These results indicate that CpG oligodeoxynucleotide-induced inflammatory reactions and/or innate immune activation are necessary for abacavir-induced HLA-mediated liver injury characterized by infiltration of CD8+ T cells. Thus, we developed the first mouse model of HLA-mediated abacavir-induced idiosyncratic liver injury. Further investigation will show that the proposed HLA-mediated liver injury model can be applied to other combinations of drugs and HLA types, thereby improving drug development and contributing to the development of personalized medicine.

Aberrant TET1 Methylation Closely Associated with CpG Island Methylator Phenotype in Colorectal Cancer.

PubMed

Ichimura, Norihisa; Shinjo, Keiko; An, Byonggu; Shimizu, Yasuhiro; Yamao, Kenji; Ohka, Fumiharu; Katsushima, Keisuke; Hatanaka, Akira; Tojo, Masayuki; Yamamoto, Eiichiro; Suzuki, Hiromu; Ueda, Minoru; Kondo, Yutaka

2015-08-01

Inactivation of methylcytosine dioxygenase, ten-eleven translocation (TET) is known to be associated with aberrant DNA methylation in cancers. Tumors with a CpG island methylator phenotype (CIMP), a distinct subgroup with extensive DNA methylation, show characteristic features in the case of colorectal cancer. The relationship between TET inactivation and CIMP in colorectal cancers is not well understood. The expression level of TET family genes was compared between CIMP-positive (CIMP-P) and CIMP-negative (CIMP-N) colorectal cancers. Furthermore, DNA methylation profiling, including assessment of the TET1 gene, was assessed in colorectal cancers, as well as colon polyps. The TET1 was silenced by DNA methylation in a subset of colorectal cancers as well as cell lines, expression of which was reactivated by demethylating agent. TET1 methylation was more frequent in CIMP-P (23/55, 42%) than CIMP-N (2/113, 2%, P < 0.0001) colorectal cancers. This trend was also observed in colon polyps (CIMP-P, 16/40, 40%; CIMP-N, 2/24, 8%; P = 0.002), suggesting that TET1 methylation is an early event in CIMP tumorigenesis. TET1 methylation was significantly associated with BRAF mutation but not with hMLH1 methylation in the CIMP-P colorectal cancers. Colorectal cancers with TET1 methylation have a significantly greater number of DNA methylated genes and less pathological metastasis compared to those without TET1 methylation (P = 0.007 and 0.045, respectively). Our data suggest that TET1 methylation may contribute to the establishment of a unique pathway in respect to CIMP-mediated tumorigenesis, which may be incidental to hMLH1 methylation. In addition, our findings provide evidence that TET1 methylation may be a good biomarker for the prediction of metastasis in colorectal cancer. ©2015 American Association for Cancer Research.

To enforce or not to enforce? The use of collaborative interfaces to promote social skills in children with high functioning autism spectrum disorder.

PubMed

Ben-Sasson, Ayelet; Lamash, Liron; Gal, Eynat

2013-09-01

The goal of this stud was to examine whether a technological touch activated Collaborative Puzzle Game (CPG) increased positive social behaviors in children with high functioning autism spectrum disorder (HFASD). The CPG involved construction of a virtual puzzle by selecting and dragging pieces into the solution area on a touch screen table. The target picture was presented on the top of the screen. Six dyads of children with HFASD (aged 8-11 years) engaged in the CPG in a Free Play (FP) mode in which partners could independently move puzzle pieces versus in an Enforced Collaboration (EC) mode in which partners could only move puzzle pieces together. Videos of the dames were coded for the frequencies of positive and negative social interaction, affect, play, and autistic behaviors. Parents completed the Social Responsiveness Scale (SRS). Wilcoxon Signed-ranks tests indicated that children with HFASD showed significantly higher frequencies of positive social interaction and collaborative play in the EC versus FP modes but there were no differences in negative social behaviors. Differences in social behaviors between partners during the puzzle games were not significant; however there were differences within pair in the severity of social deficits as assessed by the SRS questionnaire. The CPG in an EC mode was effective in promoting positive social interaction by requiring children to work together towards a mutual goal. However, the increased challenge in this mode, particularly for children with lower social-communication skills, suggests the need for establishing selection criteria and mediation steps for such interventions.

The CpG island searcher: a new WWW resource.

PubMed

Takai, Daiya; Jones, Peter A

2003-01-01

Clusters of CpG dinucleotides in GC rich regions of the genome called "CpG islands" frequently occur in the 5' ends of genes. Methylation of CpG islands plays a role in transcriptional silencing in higher organisms in certain situations. We have established a CpG-island-extraction algorithm, which we previously developed [Takai and Jones, 2002], on a web site which has a simple user interface to identify CpG islands from submitted sequences of up to 50kb. The web site determines the locations of CpG islands using parameters (lower limit of %GC, ObsCpG/ExpCpG, length) set by the user, to display the value of parameters on each CpG island, and provides a graphical map of CpG dinucleotide distribution and borders of CpG islands. A command-line version of the CpG islands searcher has also been developed for larger sequences. The CpG Island Searcher was applied to the latest sequence and mapping information of human chromosomes 20, 21 and 22, and a total of 2345 CpG islands were extracted and 534 (23%) of them contained first coding exons and 650 (28%) contained other exons. The CpG Island Searcher is available on the World Wide Web at http://www.cpgislands.com or http://www.uscnorris.com/cpgislands/cpg.cgi.

The Role of TLR2, TLR4, and TLR9 in the Pathogenesis of Atherosclerosis

PubMed Central

2016-01-01

Toll-like receptors (TLRs) are key players in the pathogenesis of inflammatory conditions including coronary arterial disease (CAD). They are expressed by a variety of immune cells where they recognize pathogen-associated molecular patterns (PAMPs). TLRs recruit adaptor molecules, including myeloid differentiation primary response protein (MYD88) and TIRF-related adaptor protein (TRAM), to mediate activation of MAPKs and NF-kappa B pathways. They are associated with the development of CAD through various mechanisms. TLR4 is expressed in lipid-rich and atherosclerotic plaques. In TLR2−/− and TLR4−/− mice, atherosclerosis-associated inflammation was diminished. Moreover, TLR2 and TLR4 may induce expression of Wnt5a in advanced staged atheromatous plaque leading to activation of the inflammatory processes. TLR9 is activated by CpG motifs in nucleic acids and have been implicated in macrophage activation and the uptake of oxLDL from the circulation. Furthermore, TLR9 also stimulates interferon-α (INF-α) secretion and increases cytotoxic activity of CD4+ T-cells towards coronary artery tunica media smooth muscle cells. This review outlines the pathophysiological role of TLR2, TLR4, and TLR9 in atherosclerosis, focusing on evidence from animal models of the disease. PMID:27795867

The Composite of Bone Marrow Concentrate and PRP as an Alternative to Autologous Bone Grafting

PubMed Central

Hakimi, Mohssen; Grassmann, Jan-Peter; Betsch, Marcel; Schneppendahl, Johannes; Gehrmann, Sebastian; Hakimi, Ahmad-Reza; Kröpil, Patric; Sager, Martin; Herten, Monika; Wild, Michael; Windolf, Joachim; Jungbluth, Pascal

2014-01-01

One possible alternative to the application of autologous bone grafts represents the use of autologous bone marrow concentrate (BMC). The purpose of our study was to evaluate the potency of autologous platelet-rich plasma (PRP) in combination with BMC. In 32 mini-pigs a metaphyseal critical-size defect was surgically created at the proximal tibia. The animals were allocated to four treatment groups of eight animals each (1. BMC+CPG group, 2. BMC+CPG+PRP group, 3. autograft group, 4. CPG group). In the BMC+CPG group the defect was filled with autologous BMC in combination with calcium phosphate granules (CPG), whereas in the BMC+CPG+PRP group the defect was filled with the composite of autologous BMC, CPG and autologous PRP. In the autograft group the defect was filled with autologous cancellous graft, whereas in the CPG group the defect was filled with CPG solely. After 6 weeks radiological and histomorphometrical analysis showed significantly more new bone formation in the BMC+CPG+PRP group compared to the BMC+CPG group and the CPG group. There were no significant differences between the BMC+CPG+PRP group and the autograft group. In the PRP platelets were enriched significantly about 4.7-fold compared to native blood. In BMC the count of mononuclear cells increased significantly (3.5-fold) compared to the bone marrow aspirate. This study demonstrates that the composite of BMC+CPG+PRP leads to a significantly higher bone regeneration of critical-size defects at the proximal tibia in mini-pigs than the use of BMC+CPG without PRP. Furthermore, within the limits of the present study the composite BMC+CPG+PRP represents a comparable alternative to autologous bone grafting. PMID:24950251

Ionotropic and metabotropic glutamate receptor mediation of glucocorticoid-induced apoptosis in hippocampal cells and the neuroprotective role of synaptic N-methyl-D-aspartate receptors.

PubMed

Lu, J; Goula, D; Sousa, N; Almeida, O F X

2003-01-01

Glutamate receptors have been proposed to mediate the apoptotic actions of glucocorticoids in hippocampal cells. To further analyze the role of glutamate receptors in this process, we pretreated primary hippocampal cells from neonatal (postnatal day 4) rats with antagonists of ionotropic glutamate receptor (iGluR) and metabotropic glutamate receptor (mGluR) antagonists before exposure to the specific glucocorticoid receptor agonist dexamethasone (DEX) at a dose of 1 microM. Dizocilpine (MK801; a general N-methyl-D-aspartic acid [NMDA] receptor antagonist, NMDAR antagonist) and ifenprodil (a specific ligand of the NMDAR 2B subunit, NR2B), were used to block iGluR; (RS)-alpha-ethyl-4-carboxyphenylglycine (E4CPG) and (RS)-alpha-cyclopropyl-4-phosphonophenyl-glycine (CPPG) were employed as I/II (E4CPG) and II/III (CPPG) mGluR antagonists. Blockade of iGluR resulted in a significant attenuation of DEX-induced cell death; the finding that ifenprodil exerted a similar potency to MK801 demonstrates the involvement of NR2B receptors in glucocorticoid-induced cell death. Apoptosis accounted for a significant amount of the cell loss observed, as detected by terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling histochemistry for the in situ labeling of DNA breaks; apoptotic cells were distinguished from necrosis on the basis of morphological criteria, including chromatin condensation, membrane blebbing and presence of apoptotic bodies. Treatment with E4CPG and CPPG completely abolished the apoptotic response to DEX, thus showing the additional contribution of mGluR to the phenomenon. Further, dose-response studies with NMDA revealed that whereas high (10 microM) doses of NMDA themselves elicit cytotoxic responses, low (1-5 microM) concentrations of NMDA can effectively oppose DEX-induced cell death. Interestingly, the neuroprotective actions of low dose NMDA stimulation were abolished when either synaptic or extrasynaptic NMDA receptors were blocked with MK801 in combination with the GABA receptor antagonist bicuculline (synaptic) or ifenprodil (extrasynaptic). In summary, the present data show that both iGluR and mGluR mediate the neurotoxic effects of glucocorticoids on hippocampal cells and that pre-treatment with low doses of NMDA, by acting on synaptic and extrasynaptic receptors, render hippocampal cells less vulnerable to glucocorticoid insults.

REST–Mediated Recruitment of Polycomb Repressor Complexes in Mammalian Cells

PubMed Central

Landt, Eskild; Agrawal-Singh, Shuchi; Bak, Mads; Tommerup, Niels; Rappsilber, Juri; Södersten, Erik; Hansen, Klaus

2012-01-01

Polycomb Repressive Complex (PRC) 1 and PRC2 regulate genes involved in differentiation and development. However, the mechanism for how PRC1 and PRC2 are recruited to genes in mammalian cells is unclear. Here we present evidence for an interaction between the transcription factor REST, PRC1, and PRC2 and show that RNF2 and REST co-regulate a number of neuronal genes in human teratocarcinoma cells (NT2-D1). Using NT2-D1 cells as a model of neuronal differentiation, we furthermore showed that retinoic-acid stimulation led to displacement of PRC1 at REST binding sites, reduced H3K27Me3, and increased gene expression. Genome-wide analysis of Polycomb binding in Rest−/− and Eed−/− mouse embryonic stem (mES) cells showed that Rest was required for PRC1 recruitment to a subset of Polycomb regulated neuronal genes. Furthermore, we found that PRC1 can be recruited to Rest binding sites independently of CpG islands and the H3K27Me3 mark. Surprisingly, PRC2 was frequently increased around Rest binding sites located in CpG-rich regions in the Rest−/− mES cells, indicating a more complex interplay where Rest also can limit PRC2 recruitment. Therefore, we propose that Rest has context-dependent functions for PRC1- and PRC2- recruitment, which allows this transcription factor to act both as a recruiter of Polycomb as well as a limiting factor for PRC2 recruitment at CpG islands. PMID:22396653

Gestational Diabetes Mellitus Impairs Nrf2-Mediated Adaptive Antioxidant Defenses and Redox Signaling in Fetal Endothelial Cells In Utero

PubMed Central

Cheng, Xinghua; Chapple, Sarah J.; Patel, Bijal; Puszyk, William; Sugden, David; Yin, Xiaoke; Mayr, Manuel; Siow, Richard C.M.; Mann, Giovanni E.

2013-01-01

In utero exposure to gestational diabetes mellitus (GDM) is associated with an increased risk of type 2 diabetes and cardiovascular disease in later life, yet the underlying mechanisms remain to be elucidated. We examined the effects of GDM on the proteome, redox status, and nuclear factor erythroid 2–related factor 2 (Nrf2)-mediated antioxidant gene expression in human fetal endothelial cells. Proteomic analysis revealed that proteins involved in redox homeostasis were significantly altered in GDM and associated with increased mitochondrial superoxide generation, protein oxidation, DNA damage, and diminished glutathione (GSH) synthesis. In GDM cells, the lipid peroxidation product 4-hydroxynonenal (HNE) failed to induce nuclear Nrf2 accumulation and mRNA and/or protein expression of Nrf2 and its target genes NAD(P)H:quinone oxidoreductase 1 (NQO1), Bach1, cystine/glutamate transporter, and glutamate cysteine ligase. Although methylation of CpG islands in Nrf2 or NQO1 promoters was unaltered by GDM, decreased DJ-1 and increased phosphorylated glycogen synthase kinase 3β levels may account for impaired Nrf2 signaling. HNE-induced increases in GSH and NQO1 levels were abrogated by Nrf2 small interfering RNA in normal cells, and overexpression of Nrf2 in GDM cells partially restored NQO1 induction. Dysregulation of Nrf2 in fetal endothelium may contribute to the increased risk of type 2 diabetes and cardiovascular disease in offspring. PMID:23974919

Gestational diabetes mellitus impairs Nrf2-mediated adaptive antioxidant defenses and redox signaling in fetal endothelial cells in utero.

PubMed

Cheng, Xinghua; Chapple, Sarah J; Patel, Bijal; Puszyk, William; Sugden, David; Yin, Xiaoke; Mayr, Manuel; Siow, Richard C M; Mann, Giovanni E

2013-12-01

In utero exposure to gestational diabetes mellitus (GDM) is associated with an increased risk of type 2 diabetes and cardiovascular disease in later life, yet the underlying mechanisms remain to be elucidated. We examined the effects of GDM on the proteome, redox status, and nuclear factor erythroid 2-related factor 2 (Nrf2)-mediated antioxidant gene expression in human fetal endothelial cells. Proteomic analysis revealed that proteins involved in redox homeostasis were significantly altered in GDM and associated with increased mitochondrial superoxide generation, protein oxidation, DNA damage, and diminished glutathione (GSH) synthesis. In GDM cells, the lipid peroxidation product 4-hydroxynonenal (HNE) failed to induce nuclear Nrf2 accumulation and mRNA and/or protein expression of Nrf2 and its target genes NAD(P)H:quinone oxidoreductase 1 (NQO1), Bach1, cystine/glutamate transporter, and glutamate cysteine ligase. Although methylation of CpG islands in Nrf2 or NQO1 promoters was unaltered by GDM, decreased DJ-1 and increased phosphorylated glycogen synthase kinase 3β levels may account for impaired Nrf2 signaling. HNE-induced increases in GSH and NQO1 levels were abrogated by Nrf2 small interfering RNA in normal cells, and overexpression of Nrf2 in GDM cells partially restored NQO1 induction. Dysregulation of Nrf2 in fetal endothelium may contribute to the increased risk of type 2 diabetes and cardiovascular disease in offspring.

Activation of the Early B-Cell-Specific mb-1 (Ig-α) Gene by Pax-5 Is Dependent on an Unmethylated Ets Binding Site

PubMed Central

Maier, Holly; Colbert, Jeff; Fitzsimmons, Daniel; Clark, Dawn R.; Hagman, James

2003-01-01

Methylation of cytosine in CpG dinucleotides promotes transcriptional repression in mammals by blocking transcription factor binding and recruiting methyl-binding proteins that initiate chromatin remodeling. Here, we use a novel cell-based system to show that retrovirally expressed Pax-5 protein activates endogenous early B-cell-specific mb-1 genes in plasmacytoma cells, but only when the promoter is hypomethylated. CpG methylation does not directly affect binding of the promoter by Pax-5. Instead, methylation of an adjacent CpG interferes with assembly of ternary complexes comprising Pax-5 and Ets proteins. In electrophoretic mobility shift assays, recruitment of Ets-1 is blocked by methylation of the Ets site (5′CCGGAG) on the antisense strand. In transfection assays, selective methylation of a single CpG within the Pax-5-dependent Ets site greatly reduces mb-1 promoter activity. Prior demethylation of the endogenous mb-1 promoter is required for its activation by Pax-5 in transduced cells. Although B-lineage cells have only unmethylated mb-1 genes and do not modulate methylation of the mb-1 promoter during development, other tissues feature high percentages of methylated alleles. Together, these studies demonstrate a novel DNA methylation-dependent mechanism for regulating transcriptional activity through the inhibition of DNA-dependent protein-protein interactions. PMID:12612069

Bisphenol A-associated epigenomic changes in prepubescent girls: a cross-sectional study in Gharbiah, Egypt

PubMed Central

2013-01-01

Background There is now compelling evidence that epigenetic modifications link adult disease susceptibility to environmental exposures during specific life stages, including pre-pubertal development. Animal studies indicate that bisphenol A (BPA), the monomer used in epoxy resins and polycarbonate plastics, may impact health through epigenetic mechanisms, and epidemiological data associate BPA levels with metabolic disorders, behavior changes, and reproductive effects. Thus, we conducted an environmental epidemiology study of BPA exposure and CpG methylation in pre-adolescent girls from Gharbiah, Egypt hypothesizing that methylation profiles exhibit exposure-dependent trends. Methods Urinary concentrations of total (free plus conjugated) species of BPA in spot samples were quantified for 60 girls aged 10 to 13. Genome-wide CpG methylation was concurrently measured in bisulfite-converted saliva DNA using the Infinium HumanMethylation27 BeadChip (N = 46). CpG sites from four candidate genes were validated via quantitative bisulfite pyrosequencing. Results CpG methylation varied widely among girls, and higher urinary BPA concentrations were generally associated with less genomic methylation. Based on pathway analyses, genes exhibiting reduced methylation with increasing urinary BPA were involved in immune function, transport activity, metabolism, and caspase activity. In particular, hypomethylation of CpG targets on chromosome X was associated with higher urinary BPA. Using the Comparative Toxicogenomics Database, we identified a number of candidate genes in our sample that previously have been associated with BPA-related expression change. Conclusions These data indicate that BPA may affect human health through specific epigenomic modification of genes in relevant pathways. Thus, epigenetic epidemiology holds promise for the identification of biomarkers from previous exposures and the development of epigenetic-based diagnostic strategies. PMID:23590724

Combined epigenetic and intraspecific variation of the DRD4 and SERT genes influence novelty seeking behavior in great tit Parus major

PubMed Central

Riyahi, Sepand; Sánchez-Delgado, Marta; Calafell, Francesc; Monk, David; Senar, Juan Carlos

2015-01-01

DNA methylation is one of the main epigenetic mechanisms that can regulate gene expression and is an important means for creating phenotypic variation. In the present study, we performed methylation profiling of 2 candidate genes for personality traits, namely DRD4 and SERT, in the great tit Parus major to ascertain whether personality traits and behavior within different habitats have evolved with the aid of epigenetic variation. We applied bisulphite PCR and strand-specific sequencing to determine the methylation profile of the CpG dinucleotides in the DRD4 and SERT promoters and also in the CpG island overlapping DRD4 exon 3. Furthermore, we performed pyrosequencing to quantify the total methylation levels at each CpG location. Our results indicated that methylation was ∼1–4% higher in urban than in forest birds, for all loci and tissues analyzed, suggesting that this epigenetic modification is influenced by environmental conditions. Screening of genomic DNA sequence revealed that the SERT promoter is CpG poor region. The methylation at a single CpG dinucleotide located 288 bp from the transcription start site was related to exploration score in urban birds. In addition, the genotypes of the SERT polymorphism SNP234 located within the minimal promoter were significantly correlated with novelty seeking behavior in captivity, with the allele increasing this behavior being more frequent in urban birds. As a conclusion, it seems that both genetic and methylation variability of the SERT gene have an important role in shaping personality traits in great tits, whereas genetic and methylation variation at the DRD4 gene is not strongly involved in behavior and personality traits. PMID:25933062

Prophylactic Administration of Bacterially Derived Immunomodulators Improves the Outcome of Influenza Virus Infection in a Murine Model▿

PubMed Central

Norton, Elizabeth B.; Clements, John D.; Voss, Thomas G.; Cárdenas-Freytag, Lucia

2010-01-01

Prophylactic or therapeutic immunomodulation is an antigen-independent strategy that induces nonspecific immune system activation, thereby enhancing host defense to disease. In this study, we investigated the effect of prophylactic immunomodulation on the outcome of influenza virus infection using three bacterially derived immune-enhancing agents known for promoting distinct immunological profiles. BALB/c mice were treated nasally with either cholera toxin (CT), a mutant form of the CT-related Escherichia coli heat-labile enterotoxin designated LT(R192G), or CpG oligodeoxynucleotide. Mice were subsequently challenged with a lethal dose of influenza A/PR/8/34 virus 24 h after the last immunomodulation treatment and either monitored for survival or sacrificed postchallenge for viral and immunological analysis. Treatment with the three immunomodulators prevented or delayed mortality and weight loss, but only CT and LT(R192G) significantly reduced initial lung viral loads as measured by plaque assay. Analysis performed 4 days postinfection indicated that prophylactic treatments with CT, LT(R192G), or CpG resulted in significantly increased numbers of CD4 T cells, B cells, and dendritic cells and altered costimulatory marker expression in the airways of infected mice, coinciding with reduced expression of pulmonary chemokines and the appearance of inducible bronchus-associated lymphoid tissue-like structures in the lungs. Collectively, these results suggest that, despite different immunomodulatory mechanisms, CT, LT(R192G), and CpG induce an initial inflammatory process and enhance the immune response to primary influenza virus challenge while preventing potentially damaging chemokine expression. These studies provide insight into the immunological parameters and immune modulation strategies that have the potential to enhance the nonspecific host response to influenza virus infection. PMID:20053748

Differential methylation at the RELN gene promoter in temporal cortex from autistic and typically developing post-puberal subjects.

PubMed

Lintas, Carla; Sacco, Roberto; Persico, Antonio M

2016-01-01

Reelin plays a pivotal role in neurodevelopment and in post-natal synaptic plasticity and has been implicated in the pathogenesis of autism spectrum disorder (ASD). The reelin (RELN) gene expression is significantly decreased in ASD, both in the brain and peripherally. Methylation at the RELN gene promoter is largely triggered at puberty, and hypermethylation has been found in post-mortem brains of schizophrenic and bipolar patients. In this study, we assessed RELN gene methylation status in post-mortem temporocortical tissue samples (BA41/42 or 22) of six pairs of post-puberal individuals with ASD and typically developing subjects, matched for sex (male:female, M:F = 5:1), age, and post-mortem interval. ASD patients display a significantly higher number of methylated CpG islands and heavier methylation in the 5' region of the RELN gene promoter, spanning from -458 to -223 bp, whereas controls have more methylated CpG positions and greater extent of methylation at the 3' promoter region, spanning from -222 to +1 bp. The most upstream promoter region (-458 to -364 bp) is methylated only in ASD brains, while the most downstream region (-131 to +1 bp) is methylated exclusively in control brains. Within this general framework, three different methylation patterns are discernible, each correlated with different extents of reduction in reelin gene expression among ASD individuals compared to controls. The methylation pattern is different in ASD and control post-mortem brains. ASD-specific CpG positions, located in the most upstream gene promoter region, may exert a functional role potentially conferring ASD risk by blunting RELN gene expression.

The cancer-promoting gene fatty acid-binding protein 5 (FABP5) is epigenetically regulated during human prostate carcinogenesis.

PubMed

Kawaguchi, Koichiro; Kinameri, Ayumi; Suzuki, Shunsuke; Senga, Shogo; Ke, Youqiang; Fujii, Hiroshi

2016-02-15

FABPs (fatty-acid-binding proteins) are a family of low-molecular-mass intracellular lipid-binding proteins consisting of ten isoforms. FABPs are involved in binding and storing hydrophobic ligands such as long-chain fatty acids, as well as transporting these ligands to the appropriate compartments in the cell. FABP5 is overexpressed in multiple types of tumours. Furthermore, up-regulation of FABP5 is strongly associated with poor survival in triple-negative breast cancer. However, the mechanisms underlying the specific up-regulation of the FABP5 gene in these cancers remain poorly characterized. In the present study, we determined that FABP5 has a typical CpG island around its promoter region. The DNA methylation status of the CpG island in the FABP5 promoter of benign prostate cells (PNT2), prostate cancer cells (PC-3, DU-145, 22Rv1 and LNCaP) and human normal or tumour tissue was assessed by bisulfite sequencing analysis, and then confirmed by COBRA (combined bisulfite restriction analysis) and qAMP (quantitative analysis of DNA methylation using real-time PCR). These results demonstrated that overexpression of FABP5 in prostate cancer cells can be attributed to hypomethylation of the CpG island in its promoter region, along with up-regulation of the direct trans-acting factors Sp1 (specificity protein 1) and c-Myc. Together, these mechanisms result in the transcriptional activation of FABP5 expression during human prostate carcinogenesis. Importantly, silencing of Sp1, c-Myc or FABP5 expression led to a significant decrease in cell proliferation, indicating that up-regulation of FABP5 expression by Sp1 and c-Myc is critical for the proliferation of prostate cancer cells. © 2016 Authors; published by Portland Press Limited.

Identification of a boron nitride nanosphere-binding peptide for the intracellular delivery of CpG oligodeoxynucleotides

NASA Astrophysics Data System (ADS)

Zhang, Huijie; Yamazaki, Tomohiko; Zhi, Chunyi; Hanagata, Nobutaka

2012-09-01

CpG oligonucleotides (CpG ODNs) interact with Toll-like receptor 9 (TLR9), which results in the induction of immunostimulatory cytokines. We delivered CpG ODNs intracellularly using boron nitride nanospheres (BNNS). To enhance the loading capacity of CpG ODNs on BNNS, we used a phage display technique to identify a 12-amino acid peptide designated as BP7, with specific affinity for BNNS, and used it as a linker to load CpG ODNs on BNNS. The tyrosine residue (Y) at the eighth position from the N-terminus played a crucial role in the affinity of BP7 to BNNS. BNNS that bound BP7 (BNNS-BP7) were taken up by cells and showed no cytotoxicity, and CpG ODNs were successfully crosslinked with BP7 to create BP7-CpG ODN conjugates. Using BP7 as a linker, the loading efficiency of CpG ODNs on BNNS increased 5-fold compared to the direct binding of CpG ODNs to BNNS. Furthermore, the BP7-CpG ODN conjugate-loaded BNNS had a greater capacity to induce interleukin-6 (IL-6) and tumor necrosis factor-alpha (TNF-α) production from peripheral blood mononuclear cells (PBMCs) than that of CpG ODNs directly loaded on BNNS. The higher amount of cytokine induction by BP7-CpG ODN conjugate-loaded BNNS may be attributed to a higher loading capacity and stronger binding to BNNS of the linker BP7. The greater functionality of BP7-conjugated CpG ODNs on BNNS expands the potential of BNNS for drug delivery applications.CpG oligonucleotides (CpG ODNs) interact with Toll-like receptor 9 (TLR9), which results in the induction of immunostimulatory cytokines. We delivered CpG ODNs intracellularly using boron nitride nanospheres (BNNS). To enhance the loading capacity of CpG ODNs on BNNS, we used a phage display technique to identify a 12-amino acid peptide designated as BP7, with specific affinity for BNNS, and used it as a linker to load CpG ODNs on BNNS. The tyrosine residue (Y) at the eighth position from the N-terminus played a crucial role in the affinity of BP7 to BNNS. BNNS that bound BP7 (BNNS-BP7) were taken up by cells and showed no cytotoxicity, and CpG ODNs were successfully crosslinked with BP7 to create BP7-CpG ODN conjugates. Using BP7 as a linker, the loading efficiency of CpG ODNs on BNNS increased 5-fold compared to the direct binding of CpG ODNs to BNNS. Furthermore, the BP7-CpG ODN conjugate-loaded BNNS had a greater capacity to induce interleukin-6 (IL-6) and tumor necrosis factor-alpha (TNF-α) production from peripheral blood mononuclear cells (PBMCs) than that of CpG ODNs directly loaded on BNNS. The higher amount of cytokine induction by BP7-CpG ODN conjugate-loaded BNNS may be attributed to a higher loading capacity and stronger binding to BNNS of the linker BP7. The greater functionality of BP7-conjugated CpG ODNs on BNNS expands the potential of BNNS for drug delivery applications. Electronic supplementary information (ESI) available. See DOI: 10.1039/c2nr31189e

Potent Anti-Inflammatory Activity of Pyrenocine A Isolated from the Marine-Derived Fungus Penicillium paxilli Ma(G)K

PubMed Central

Toledo, Thaís Regina; Dejani, Naiara N.; Monnazzi, Luis Gustavo Silva; Kossuga, Miriam H.; Berlinck, Roberto G. S.; Sette, Lara D.; Medeiros, Alexandra I.

2014-01-01

Very little is known about the immunomodulatory potential of secondary metabolites isolated from marine microorganisms. In the present study, we characterized pyrenocine A, which is produced by the marine-derived fungus Penicillium paxilli Ma(G)K and possesses anti-inflammatory activity. Pyrenocine A was able to suppress, both pretreatment and posttreatment, the LPS-induced activation of macrophages via the inhibition of nitrite production and the synthesis of inflammatory cytokines and PGE2. Pyrenocine A also exhibited anti-inflammatory effects on the expression of receptors directly related to cell migration (Mac-1) as well as costimulatory molecules involved in lymphocyte activation (B7.1). Nitrite production was inhibited by pyrenocine A in macrophages stimulated with CpG but not Poly I:C, suggesting that pyrenocine A acts through the MyD88-dependent intracellular signaling pathway. Moreover, pyrenocine A is also able to inhibit the expression of genes related to NFκB-mediated signal transduction on macrophages stimulated by LPS. Our results indicate that pyrenocine A has promissory anti-inflammatory properties and additional experiments are necessary to confirm this finding in vivo model. PMID:24574582

DyNAVacS: an integrative tool for optimized DNA vaccine design.

PubMed

Harish, Nagarajan; Gupta, Rekha; Agarwal, Parul; Scaria, Vinod; Pillai, Beena

2006-07-01

DNA vaccines have slowly emerged as keystones in preventive immunology due to their versatility in inducing both cell-mediated as well as humoral immune responses. The design of an efficient DNA vaccine, involves choice of a suitable expression vector, ensuring optimal expression by codon optimization, engineering CpG motifs for enhancing immune responses and providing additional sequence signals for efficient translation. DyNAVacS is a web-based tool created for rapid and easy design of DNA vaccines. It follows a step-wise design flow, which guides the user through the various sequential steps in the design of the vaccine. Further, it allows restriction enzyme mapping, design of primers spanning user specified sequences and provides information regarding the vectors currently used for generation of DNA vaccines. The web version uses Apache HTTP server. The interface was written in HTML and utilizes the Common Gateway Interface scripts written in PERL for functionality. DyNAVacS is an integrated tool consisting of user-friendly programs, which require minimal information from the user. The software is available free of cost, as a web based application at URL: http://miracle.igib.res.in/dynavac/.

SOCS3 Modulates the Response to Enzalutamide and Is Regulated by Androgen Receptor Signaling and CpG Methylation in Prostate Cancer Cells.

PubMed

Handle, Florian; Erb, Holger H H; Luef, Birgit; Hoefer, Julia; Dietrich, Dimo; Parson, Walther; Kristiansen, Glen; Santer, Frédéric R; Culig, Zoran

2016-06-01

The proinflammatory cytokine IL6 is associated with bad prognosis in prostate cancer and implicated in progression to castration resistance. Suppressor of cytokine signaling 3 (SOCS3) is an IL6-induced negative feedback regulator of the IL6/Janus kinase (JAK)/STAT3 pathway. This study reveals that the SOCS3 promoter is hypermethylated in cancerous regions compared with adjacent benign tissue in prostate cancer using methylation-specific qPCR. A series of in vitro experiments was performed to assess the functional impact of low SOCS3 expression during anti-androgen treatment. Using lentivirus-mediated knockdown, it was demonstrated for the first time that SOCS3 regulates IL6/JAK/STAT3 signaling in androgen receptor-positive LNCaP cells. In addition, SOCS3 mRNA is upregulated by the anti-androgens bicalutamide and enzalutamide. This effect is caused by androgen receptor-mediated suppression of IL6ST and JAK1 expression, which leads to altered STAT3 signaling. Functionally, knockdown of SOCS3 led to enhanced androgen receptor activity after 3 weeks of enzalutamide treatment in an inflammatory setting. Furthermore, the stemness/self-renewal associated genes SOX2 and NANOG were strongly upregulated by the long-term treatment, and modulation of SOCS3 expression was sufficient to counteract this effect. These findings prove that SOCS3 plays an important role during anti-androgen treatment in an inflammatory environment. SOCS3 is frequently inactivated by promoter hypermethylation in prostate cancer, which disrupts the feedback regulation of IL6 signaling and leads to reduced efficacy of enzalutamide in the presence of inflammatory cytokines. Mol Cancer Res; 14(6); 574-85. ©2016 AACR. ©2016 American Association for Cancer Research.

Type I Interferons Function as Autocrine and Paracrine Factors to Induce Autotaxin in Response to TLR Activation

PubMed Central

Song, Jianwen; Guan, Ming; Zhao, Zhenwen; Zhang, Junjie

2015-01-01

Lysophosphatidic acid (LPA) is an important phospholipid mediator in inflammation and immunity. However, the mechanism of LPA regulation during inflammatory response is largely unknown. Autotaxin (ATX) is the key enzyme to produce extracellular LPA from lysophosphatidylcholine (LPC). In this study, we found that ATX was induced in monocytic THP-1 cells by TLR4 ligand lipopolysaccharide (LPS), TLR9 ligand CpG oligonucleotide, and TLR3 ligand poly(I:C), respectively. The ATX induction by TLR ligand was abolished by the neutralizing antibody against IFN-β or the knockdown of IFNAR1, indicating that type I IFN autocrine loop is responsible for the ATX induction upon TLR activation. Both IFN-β and IFN-α were able to induce ATX expression via the JAK-STAT and PI3K-AKT pathways but with different time-dependent manners. The ATX induction by IFN-β was dramatically enhanced by IFN-γ, which had no significant effect on ATX expression alone, suggesting a synergy effect between type I and type II IFNs in ATX induction. Extracellular LPA levels were significantly increased when THP-1 cells were treated with IFN-α/β or TLR ligands. In addition, the type I IFN-mediated ATX induction was identified in human monocyte-derived dendritic cells (moDCs) stimulated with LPS or poly(I:C), and IFN-α/β could induce ATX expression in human peripheral blood mononuclear cells (PBMCs) and monocytes isolated form blood samples. These results suggest that, in response to TLR activation, ATX is induced through a type I INF autocrine-paracrine loop to enhance LPA generation. PMID:26313906

Integrative DNA methylation and gene expression analysis to assess the universality of the CpG island methylator phenotype.

PubMed

Moarii, Matahi; Reyal, Fabien; Vert, Jean-Philippe

2015-10-13

The CpG island methylator phenotype (CIMP) was first characterized in colorectal cancer but since has been extensively studied in several other tumor types such as breast, bladder, lung, and gastric. CIMP is of clinical importance as it has been reported to be associated with prognosis or response to treatment. However, the identification of a universal molecular basis to define CIMP across tumors has remained elusive. We perform a genome-wide methylation analysis of over 2000 tumor samples from 5 cancer sites to assess the existence of a CIMP with common molecular basis across cancers. We then show that the CIMP phenotype is associated with specific gene expression variations. However, we do not find a common genetic signature in all tissues associated with CIMP. Our results suggest the existence of a universal epigenetic and transcriptomic signature that defines the CIMP across several tumor types but does not indicate the existence of a common genetic signature of CIMP.

Sex differences in DNA methylation and expression in zebrafish brain: a test of an extended 'male sex drive' hypothesis.

PubMed

Chatterjee, Aniruddha; Lagisz, Malgorzata; Rodger, Euan J; Zhen, Li; Stockwell, Peter A; Duncan, Elizabeth J; Horsfield, Julia A; Jeyakani, Justin; Mathavan, Sinnakaruppan; Ozaki, Yuichi; Nakagawa, Shinichi

2016-09-30

The sex drive hypothesis predicts that stronger selection on male traits has resulted in masculinization of the genome. Here we test whether such masculinizing effects can be detected at the level of the transcriptome and methylome in the adult zebrafish brain. Although methylation is globally similar, we identified 914 specific differentially methylated CpGs (DMCs) between males and females (435 were hypermethylated and 479 were hypomethylated in males compared to females). These DMCs were prevalent in gene body, intergenic regions and CpG island shores. We also discovered 15 distinct CpG clusters with striking sex-specific DNA methylation differences. In contrast, at transcriptome level, more female-biased genes than male-biased genes were expressed, giving little support for the male sex drive hypothesis. Our study provides genome-wide methylome and transcriptome assessment and sheds light on sex-specific epigenetic patterns and in zebrafish for the first time. Copyright © 2016 Elsevier B.V. All rights reserved.

Allele-specific DNA methylation and its interplay with repressive histone marks at promoter-mutant TERT genes

PubMed Central

Stern, Josh Lewis; Paucek, Richard D.; Huang, Franklin W.; Ghandi, Mahmoud; Nwumeh, Ronald; Costello, James C.; Cech, Thomas R.

2017-01-01

SUMMARY A mutation in the promoter of the Telomerase Reverse Transcriptase (TERT) gene is the most frequent noncoding mutation in cancer. The mutation drives unusual monoallelic expression of TERT, allowing immortalization. Here we find that DNA methylation of the TERT CpG Island (CGI) is also allele-specific in multiple cancers. The expressed allele is hypomethylated, which is opposite to cancers without TERT promoter mutations. The continued presence of Polycomb repressive complex 2 (PRC2) on the inactive allele suggests that histone marks of repressed chromatin may be causally linked to high DNA methylation. Consistent with this hypothesis, TERT promoter DNA containing 5-methyl-CpG has much increased affinity for PRC2 in vitro. Thus, CpG methylation and histone marks appear to collaborate to maintain the two TERT alleles in different epigenetic states in TERT promoter-mutant cancers. Finally, in several cancers DNA methylation levels at the TERT CGI correlate with altered patient survival. PMID:29281820

Polycomb Responds to Low Levels of Transcription.

PubMed

Berrozpe, Georgina; Bryant, Gene O; Warpinski, Katherine; Spagna, Dan; Narayan, Santosh; Shah, Shivangi; Ptashne, Mark

2017-07-25

How is Polycomb (Pc), a eukaryotic negative regulator of transcription, targeted to specific mammalian genes? Our genome-wide analysis of the Pc mark H3K27me3 in murine cells revealed that Pc is preferentially associated with CpG island promoters of genes that are transcribed at a low level and less so with promoters of genes that are either silent or more highly expressed. Studies of the CpG island promoter of the Kit gene demonstrate that Pc is largely absent when the gene is silent in myeloid cells, as well as when the gene is highly expressed in mast cells. Manipulations that increase transcription in the former case, and reduce it in the latter, increase Pc occupancy. The average negative effect of Pc, we infer, is about 2-fold. We suggest possible biological roles for such negative effects and propose a mechanism by which Pc might be recruited to weakly transcribed genes. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

Encapsulating Immunostimulatory CpG Oligonucleotides in Listeriolysin O-Liposomes Promotes a Th1-Type Response and CTL Activity

PubMed Central

Andrews, Chasity D.; Huh, Myung-Sook; Patton, Kathryn; Higgins, Debbie; Van Nest, Gary; Ott, Gary; Lee, Kyung-Dall

2013-01-01

Immunostimulatory sequences (ISS) are short DNA sequences containing unmethylated CpG dimers that have multiple effects on the host immune system, including the ability to stimulate antigen-specific cytotoxic T lymphocytes (CTLs) and drive Th1-type immune responses. Listeriolysin O (LLO)-containing pH-sensitive liposomes have been shown to efficiently deliver macromolecules to the cytosol of APCs and efficiently stimulate CTLs. We hypothesized that encapsulating ISS-oligodeoxyribonucleotides (ODNs) in this delivery system would enhance the cell-mediated immune response and skew Th1-type responses in protein antigen-based vaccination utilizing LLO-liposomes. In vitro studies indicated that co-encapsulation of ISS in LLO-liposomes engendered activation of the NF-κB pathway while maintaining the efficient cytosolic delivery of antigen mediated by the co-encapsulated LLO. Antigen-specific CTL responses monitored by using the model antigen ovalbumin (OVA) in mice were enhanced when mice were immunized with OVA and ISS-ODN-containing LLO-liposomes compared with those immunized with either OVA-containing LLO-liposomes or OVA-ISS conjugates. The enhanced immune responses were of the Th1-type as monitored by the robust OVA-specific IgG2a induction and the OVA CD8 peptide-stimulated IFN-γ secretion. Our study suggests that including ISS-ODN in LLO-containing pH-sensitive liposomes yields a vaccine delivery system that enhances the cell-mediated immune response and skews this response toward the Th1-type. PMID:22376145

Genome-Wide DNA Methylation Analysis of Human Pancreatic Islets from Type 2 Diabetic and Non-Diabetic Donors Identifies Candidate Genes That Influence Insulin Secretion

PubMed Central

Dayeh, Tasnim; Volkov, Petr; Salö, Sofia; Hall, Elin; Nilsson, Emma; Olsson, Anders H.; Kirkpatrick, Clare L.; Wollheim, Claes B.; Eliasson, Lena; Rönn, Tina; Bacos, Karl; Ling, Charlotte

2014-01-01

Impaired insulin secretion is a hallmark of type 2 diabetes (T2D). Epigenetics may affect disease susceptibility. To describe the human methylome in pancreatic islets and determine the epigenetic basis of T2D, we analyzed DNA methylation of 479,927 CpG sites and the transcriptome in pancreatic islets from T2D and non-diabetic donors. We provide a detailed map of the global DNA methylation pattern in human islets, β- and α-cells. Genomic regions close to the transcription start site showed low degrees of methylation and regions further away from the transcription start site such as the gene body, 3′UTR and intergenic regions showed a higher degree of methylation. While CpG islands were hypomethylated, the surrounding 2 kb shores showed an intermediate degree of methylation, whereas regions further away (shelves and open sea) were hypermethylated in human islets, β- and α-cells. We identified 1,649 CpG sites and 853 genes, including TCF7L2, FTO and KCNQ1, with differential DNA methylation in T2D islets after correction for multiple testing. The majority of the differentially methylated CpG sites had an intermediate degree of methylation and were underrepresented in CpG islands (∼7%) and overrepresented in the open sea (∼60%). 102 of the differentially methylated genes, including CDKN1A, PDE7B, SEPT9 and EXOC3L2, were differentially expressed in T2D islets. Methylation of CDKN1A and PDE7B promoters in vitro suppressed their transcriptional activity. Functional analyses demonstrated that identified candidate genes affect pancreatic β- and α-cells as Exoc3l silencing reduced exocytosis and overexpression of Cdkn1a, Pde7b and Sept9 perturbed insulin and glucagon secretion in clonal β- and α-cells, respectively. Together, our data can serve as a reference methylome in human islets. We provide new target genes with altered DNA methylation and expression in human T2D islets that contribute to perturbed insulin and glucagon secretion. These results highlight the importance of epigenetics in the pathogenesis of T2D. PMID:24603685

Comprehensive analysis of genome-wide DNA methylation across human polycystic ovary syndrome ovary granulosa cell.

PubMed

Xu, Jiawei; Bao, Xiao; Peng, Zhaofeng; Wang, Linlin; Du, Linqing; Niu, Wenbin; Sun, Yingpu

2016-05-10

Polycystic ovary syndrome (PCOS) affects approximately 7% of the reproductive-age women. A growing body of evidence indicated that epigenetic mechanisms contributed to the development of PCOS. The role of DNA modification in human PCOS ovary granulosa cell is still unknown in PCOS progression. Global DNA methylation and hydroxymethylation were detected between PCOS' and controls' granulosa cell. Genome-wide DNA methylation was profiled to investigate the putative function of DNA methylaiton. Selected genes expressions were analyzed between PCOS' and controls' granulosa cell. Our results showed that the granulosa cell global DNA methylation of PCOS patients was significant higher than the controls'. The global DNA hydroxymethylation showed low level and no statistical difference between PCOS and control. 6936 differentially methylated CpG sites were identified between control and PCOS-obesity. 12245 differential methylated CpG sites were detected between control and PCOS-nonobesity group. 5202 methylated CpG sites were significantly differential between PCOS-obesity and PCOS-nonobesity group. Our results showed that DNA methylation not hydroxymethylation altered genome-wide in PCOS granulosa cell. The different methylation genes were enriched in development protein, transcription factor activity, alternative splicing, sequence-specific DNA binding and embryonic morphogenesis. YWHAQ, NCF2, DHRS9 and SCNA were up-regulation in PCOS-obesity patients with no significance different between control and PCOS-nonobesity patients, which may be activated by lower DNA methylaiton. Global and genome-wide DNA methylation alteration may contribute to different genes expression and PCOS clinical pathology.

Murine Polyomavirus Virus-Like Particles Carrying Full-Length Human PSA Protect BALB/c Mice from Outgrowth of a PSA Expressing Tumor

PubMed Central

Eriksson, Mathilda; Andreasson, Kalle; Weidmann, Joachim; Lundberg, Kajsa; Tegerstedt, Karin

2011-01-01

Virus-like particles (VLPs) consist of capsid proteins from viruses and have been shown to be usable as carriers of protein and peptide antigens for immune therapy. In this study, we have produced and assayed murine polyomavirus (MPyV) VLPs carrying the entire human Prostate Specific Antigen (PSA) (PSA-MPyVLPs) for their potential use for immune therapy in a mouse model system. BALB/c mice immunized with PSA-MPyVLPs were only marginally protected against outgrowth of a PSA-expressing tumor. To improve protection, PSA-MPyVLPs were co-injected with adjuvant CpG, either alone or loaded onto murine dendritic cells (DCs). Immunization with PSA-MPyVLPs loaded onto DCs in the presence of CpG was shown to efficiently protect mice from tumor outgrowth. In addition, cellular and humoral immune responses after immunization were examined. PSA-specific CD4+ and CD8+ cells were demonstrated, but no PSA-specific IgG antibodies. Vaccination with DCs loaded with PSA-MPyVLPs induced an eight-fold lower titre of anti-VLP antibodies than vaccination with PSA-MPyVLPs alone. In conclusion, immunization of BALB/c mice with PSA-MPyVLPs, loaded onto DCs and co-injected with CpG, induces an efficient PSA-specific tumor protective immune response, including both CD4+ and CD8+ cells with a low induction of anti-VLP antibodies. PMID:21858228

Methylation Status of the Follistatin Gene at Different Development Stages of Japanese Flounder (Paralichthys olivaceus)

NASA Astrophysics Data System (ADS)

Huang, Yajuan; Hu, Nan; Si, Yufeng; Li, Siping; Wu, Shuxian; Zhang, Meizhao; Wen, Haishen; Li, Jifang; Li, Yun; He, Feng

2018-06-01

Follistatin (Fst) is a hyperplasia factor that plays a crucial role in muscle development. DNA methylation, a significant process, regulates gene expression. The aim of our study is to examine the DNA methylation and expression patterns of Fst gene at five different development stages of Japanese flounder (stage A, 7 dph; stage B, 90 dph; stage C, about 180 dph; stage D, about 24 months; stage E, about 36 months). The muscle tissue of Japanese flounder was obtained at different development stages in this experiment. DNA methylation levels in the promoter and exon 2 of Fst were determined by bisulfite sequencing, and the relative expression of the Fst gene at the five stages was measured by quantitative PCR. The results showed that the lowest methylation level was at stage A and the highest methylation level was at stage B. Moreover, the highest expression level of the Fst gene was observed at stage A. The mRNA abundance was negatively correlated with DNA methylation level. Three CpG islands in the promoter region and three CpG islands in exon 2 of Fst were found in the binding sequence of the putative transcription factor. These results offered a theoretical basis for the mechanism of Fst gene regulation to muscle development at different development stages.

Effects of soluble and particulate Cr(VI) on genome-wide DNA methylation in human B lymphoblastoid cells.

PubMed

Lou, Jianlin; Wang, Yu; Chen, Junqiang; Ju, Li; Yu, Min; Jiang, Zhaoqiang; Feng, Lingfang; Jin, Lingzhi; Zhang, Xing

2015-10-01

Several previous studies highlighted the potential epigenetic effects of Cr(VI), especially DNA methylation. However, few studies have compared the effects of Cr(VI) on DNA methylation profiles between soluble and particulate chromate in vitro. Accordingly, Illumina Infinium Human Methylation 450K BeadChip array was used to analyze DNA methylation profiles of human B lymphoblastoid cells exposed to potassium dichromate or lead chromate, and the cell viability was also studied. Array based DNA methylation analysis showed that the impacts of Cr(VI) on DNA methylation were limited, only about 40 differentially methylated CpG sites, with an overlap of 15CpG sites, were induced by both potassium dichromate and lead chromate. The results of mRNA expression showed that after Cr(VI) treatment, mRNA expression changes of four genes (TBL1Y, FZD5, IKZF2, and KIAA1949) were consistent with their DNA methylation alteration, but DNA methylation changes of other six genes did not correlate with mRNA expression. In conclusion, both of soluble and particulate Cr(VI) could induce a small amount of differentially methylated sites in human B lymphoblastoid cells, and the correlations between DNA methylation changes and mRNA expression varied between different genes. Copyright © 2015 Elsevier B.V. All rights reserved.

Novel epigenetic determinants of type 2 diabetes in Mexican-American families.

PubMed

Kulkarni, Hemant; Kos, Mark Z; Neary, Jennifer; Dyer, Thomas D; Kent, Jack W; Göring, Harald H H; Cole, Shelley A; Comuzzie, Anthony G; Almasy, Laura; Mahaney, Michael C; Curran, Joanne E; Blangero, John; Carless, Melanie A

2015-09-15

Although DNA methylation is now recognized as an important mediator of complex diseases, the extent to which the genetic basis of such diseases is accounted for by DNA methylation is unknown. In the setting of large, extended families representing a minority, high-risk population of the USA, we aimed to characterize the role of epigenome-wide DNA methylation in type 2 diabetes (T2D). Using Illumina HumanMethylation450 BeadChip arrays, we tested for association of DNA methylation at 446 356 sites with age, sex and phenotypic traits related to T2D in 850 pedigreed Mexican-American individuals. Robust statistical analyses showed that (i) 15% of the methylome is significantly heritable, with a median heritability of 0.14; (ii) DNA methylation at 14% of CpG sites is associated with nearby sequence variants; (iii) 22% and 3% of the autosomal CpG sites are associated with age and sex, respectively; (iv) 53 CpG sites were significantly associated with liability to T2D, fasting blood glucose and insulin resistance; (v) DNA methylation levels at five CpG sites, mapping to three well-characterized genes (TXNIP, ABCG1 and SAMD12) independently explained 7.8% of the heritability of T2D (vi) methylation at these five sites was unlikely to be influenced by neighboring DNA sequence variation. Our study has identified novel epigenetic indicators of T2D risk in Mexican Americans who have increased risk for this disease. These results provide new insights into potential treatment targets of T2D. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Healthcare professionals' and policy makers' views on implementing a clinical practice guideline of hypertension management: a qualitative study.

PubMed

Lee, Ping Yein; Liew, Su May; Abdullah, Adina; Abdullah, Nurdiana; Ng, Chirk Jenn; Hanafi, Nik Sherina; Chia, Yook Chin; Lai, Pauline S M; Wong, Stalia S L; Khoo, Ee Ming

2015-01-01

Most studies have reported barriers to guideline usage mainly from doctors' perspective; few have reported the perspective of other stakeholders. This study aimed to determine the views and barriers to adherence of a national clinical practice guideline (CPG) on management of hypertension from the perspectives of policymakers, doctors and allied healthcare professionals. This study used a qualitative approach with purposive sampling. Seven in depth interviews and six focus group discussions were conducted with 35 healthcare professionals (policy makers, doctors, pharmacists and nurses) at a teaching hospital in Kuala Lumpur, Malaysia, between February and June 2013. All interviews were audio-recorded, transcribed verbatim and checked. Thematic approach was used to analyse the data. Two main themes and three sub-themes emerged from this study. The main themes were (1) variation in the use of CPG and (2) barriers to adherence to CPG. The three sub-themes for barriers were issues inherent to the CPG, systems and policy that is not supportive of CPG use, and attitudes and behaviour of stakeholders. The main users of the CPG were the primary care doctors. Pharmacists only partially use the guidelines, while nurses and policy makers were not using the CPG at all. Participants had suggested few strategies to improve usage and adherence to CPG. First, update the CPG regularly and keep its content simple with specific sections for allied health workers. Second, use technology to facilitate CPG accessibility and provide protected time for implementation of CPG recommendations. Third, incorporate local CPG in professional training, link CPG adherence to key performance indicators and provide incentives for its use. Barriers to the use of CPG hypertension management span across all stakeholders. The development and implementation of CPG focused mainly on doctors with lack of involvement of other healthcare stakeholders. Guidelines should be made simple, current, reliable, accessible, inclusive of all stakeholders and with good policy support.

Shared genetic origin of asthma, hay fever and eczema elucidates allergic disease biology.

PubMed

Ferreira, Manuel A; Vonk, Judith M; Baurecht, Hansjörg; Marenholz, Ingo; Tian, Chao; Hoffman, Joshua D; Helmer, Quinta; Tillander, Annika; Ullemar, Vilhelmina; van Dongen, Jenny; Lu, Yi; Rüschendorf, Franz; Esparza-Gordillo, Jorge; Medway, Chris W; Mountjoy, Edward; Burrows, Kimberley; Hummel, Oliver; Grosche, Sarah; Brumpton, Ben M; Witte, John S; Hottenga, Jouke-Jan; Willemsen, Gonneke; Zheng, Jie; Rodríguez, Elke; Hotze, Melanie; Franke, Andre; Revez, Joana A; Beesley, Jonathan; Matheson, Melanie C; Dharmage, Shyamali C; Bain, Lisa M; Fritsche, Lars G; Gabrielsen, Maiken E; Balliu, Brunilda; Nielsen, Jonas B; Zhou, Wei; Hveem, Kristian; Langhammer, Arnulf; Holmen, Oddgeir L; Løset, Mari; Abecasis, Gonçalo R; Willer, Cristen J; Arnold, Andreas; Homuth, Georg; Schmidt, Carsten O; Thompson, Philip J; Martin, Nicholas G; Duffy, David L; Novak, Natalija; Schulz, Holger; Karrasch, Stefan; Gieger, Christian; Strauch, Konstantin; Melles, Ronald B; Hinds, David A; Hübner, Norbert; Weidinger, Stephan; Magnusson, Patrik K E; Jansen, Rick; Jorgenson, Eric; Lee, Young-Ae; Boomsma, Dorret I; Almqvist, Catarina; Karlsson, Robert; Koppelman, Gerard H; Paternoster, Lavinia

2017-12-01

Asthma, hay fever (or allergic rhinitis) and eczema (or atopic dermatitis) often coexist in the same individuals, partly because of a shared genetic origin. To identify shared risk variants, we performed a genome-wide association study (GWAS; n = 360,838) of a broad allergic disease phenotype that considers the presence of any one of these three diseases. We identified 136 independent risk variants (P < 3 × 10 -8 ), including 73 not previously reported, which implicate 132 nearby genes in allergic disease pathophysiology. Disease-specific effects were detected for only six variants, confirming that most represent shared risk factors. Tissue-specific heritability and biological process enrichment analyses suggest that shared risk variants influence lymphocyte-mediated immunity. Six target genes provide an opportunity for drug repositioning, while for 36 genes CpG methylation was found to influence transcription independently of genetic effects. Asthma, hay fever and eczema partly coexist because they share many genetic risk variants that dysregulate the expression of immune-related genes.

Shared genetic origin of asthma, hay fever and eczema elucidates allergic disease biology

PubMed Central

Esparza-Gordillo, Jorge; Medway, Chris W; Mountjoy, Edward; Burrows, Kimberley; Hummel, Oliver; Grosche, Sarah; Brumpton, Ben M; Witte, John S; Hottenga, Jouke-Jan; Willemsen, Gonneke; Zheng, Jie; Rodríguez, Elke; Hotze, Melanie; Franke, Andre; Revez, Joana A; Beesley, Jonathan; Matheson, Melanie C; Dharmage, Shyamali C; Bain, Lisa M; Fritsche, Lars G; Gabrielsen, Maiken E; Balliu, Brunilda; Nielsen, Jonas B; Zhou, Wei; Hveem, Kristian; Langhammer, Arnulf; Holmen, Oddgeir L; Løset, Mari; Abecasis, Gonçalo R; Willer, Cristen J; Arnold, Andreas; Homuth, Georg; Schmidt, Carsten O; Thompson, Philip J; Martin, Nicholas G; Duffy, David L; Novak, Natalija; Schulz, Holger; Karrasch, Stefan; Gieger, Christian; Strauch, Konstantin; Melles, Ronald B; Hinds, David A; Hübner, Norbert; Weidinger, Stephan; Magnusson, Patrik KE; Jansen, Rick; Jorgenson, Eric; Lee, Young-Ae; Boomsma, Dorret I; Almqvist, Catarina; Karlsson, Robert; Koppelman, Gerard H; Paternoster, Lavinia

2017-01-01

Asthma, hay fever (or allergic rhinitis) and eczema (or atopic dermatitis) often coexist in the same individuals1, partly because of a shared genetic origin2–4. To identify shared risk variants, we performed a genome-wide association study (GWAS, n=360,838) of a broad allergic disease phenotype that considers the presence of any one of these three diseases. We identified 136 independent risk variants (P<3x10-8), including 73 not previously reported, which implicate 132 nearby genes in allergic disease pathophysiology. Disease-specific effects were detected for only six variants, confirming that most represent shared risk factors. Tissue-specific heritability and biological process enrichment analyses suggest that shared risk variants influence lymphocyte-mediated immunity. Six target genes provide an opportunity for drug repositioning, while for 36 genes CpG methylation was found to influence transcription independently of genetic effects. Asthma, hay fever and eczema partly coexist because they share many genetic risk variants that dysregulate the expression of immune-related genes. PMID:29083406

Dietary Glucosinolates Sulforaphane, Phenethyl Isothiocyanate, Indole-3-Carbinol/3,3'-Diindolylmethane: Anti-Oxidative Stress/Inflammation, Nrf2, Epigenetics/Epigenomics and In Vivo Cancer Chemopreventive Efficacy.

PubMed

Fuentes, Francisco; Paredes-Gonzalez, Ximena; Kong, Ah-Ng Tony

2015-05-01

Glucosinolates are a group of sulfur-containing glycosides found in many plant species, including cruciferous vegetables such as broccoli, cabbage, brussels sprouts, and cauliflower. Accumulating evidence increasingly supports the beneficial effects of dietary glucosinolates on overall health, including as potential anti-cancer agents, because of their role in the prevention of the initiation of carcinogenesis via the induction of cellular defense detoxifying/antioxidant enzymes and their epigenetic mechanisms, including modification of the CpG methylation of cancer-related genes, histone modification regulation and changes in the expression of miRNAs. In this context, the defense mechanism mediated by Nrf2-antioxidative stress and anti-inflammatory signaling pathways can contribute to cellular protection against oxidative stress and reactive metabolites of carcinogens. In this review, we summarize the cancer chemopreventive role of naturally occurring glucosinolate derivatives as inhibitors of carcinogenesis, with particular emphasis on specific molecular targets and epigenetic alterations in in vitro and in vivo human cancer animal models.

Epigenetic regulation of REG1A and chemosensitivity of cutaneous melanoma

PubMed Central

Sato, Yusuke; Marzese, Diego M; Ohta, Katsuya; Huang, Sharon K; Sim, Myung Shin; Chong, Kelly; Hoon, Dave SB

2013-01-01

Regenerating gene 1A (REG1A) plays an important role in tissue regeneration and in cell proliferation in epithelium origin tumors; however, its role in melanoma has not been explored in details. The objective of this study was to identify whether REG1A is expressed in cutaneous melanoma and if REG1A expression status can predict prognosis in cutaneous melanoma patients with metastasis. We also determined whether epigenetic regulation of the promoter region regulates REG1A expression. AJCC stage III cutaneous melanoma specimens with clinically well annotated stage III lymph node melanoma metastasis tissue microarray were assessed by IHC. MALDI-TOF-mass spectrometry and HM450K array were used to identify REG1A promoter region CpG site methylation. Chemotherapeutic agent response by melanoma cells as related to REG1A protein expression was assessed. Post-surgery melanoma patients followed by adjuvant chemotherapy with high REG1A expression had a significantly better prognosis (disease-specific survival) compared with patients with low REG1A expression (log rank test; p = 0.0013). The demethylating reagent 5-Aza-2′-deoxycytidine activated REG1A promoter region resulting in enhanced REG1A mRNA and protein expression in melanoma cell lines. Promoter region CpG methylation was shown to regulate REG1A expression in melanoma cells. Moreover, melanoma lines with high REG1A mRNA expression were more susceptible to Dacarbazine and Cisplatin, as compared with those with low REG1A mRNA expression. In conclusion, REG1A expression status may be useful as a biomarker in melanoma patients for sensitivity to these chemotherapeutic agents. The epigenetic regulation of the REG1A promoter region may offer a potential therapeutic approach to improve chemotherapy for metastatic melanoma patients. PMID:23903855

CpG island mapping by epigenome prediction.

PubMed

Bock, Christoph; Walter, Jörn; Paulsen, Martina; Lengauer, Thomas

2007-06-01

CpG islands were originally identified by epigenetic and functional properties, namely, absence of DNA methylation and frequent promoter association. However, this concept was quickly replaced by simple DNA sequence criteria, which allowed for genome-wide annotation of CpG islands in the absence of large-scale epigenetic datasets. Although widely used, the current CpG island criteria incur significant disadvantages: (1) reliance on arbitrary threshold parameters that bear little biological justification, (2) failure to account for widespread heterogeneity among CpG islands, and (3) apparent lack of specificity when applied to the human genome. This study is driven by the idea that a quantitative score of "CpG island strength" that incorporates epigenetic and functional aspects can help resolve these issues. We construct an epigenome prediction pipeline that links the DNA sequence of CpG islands to their epigenetic states, including DNA methylation, histone modifications, and chromatin accessibility. By training support vector machines on epigenetic data for CpG islands on human Chromosomes 21 and 22, we identify informative DNA attributes that correlate with open versus compact chromatin structures. These DNA attributes are used to predict the epigenetic states of all CpG islands genome-wide. Combining predictions for multiple epigenetic features, we estimate the inherent CpG island strength for each CpG island in the human genome, i.e., its inherent tendency to exhibit an open and transcriptionally competent chromatin structure. We extensively validate our results on independent datasets, showing that the CpG island strength predictions are applicable and informative across different tissues and cell types, and we derive improved maps of predicted "bona fide" CpG islands. The mapping of CpG islands by epigenome prediction is conceptually superior to identifying CpG islands by widely used sequence criteria since it links CpG island detection to their characteristic epigenetic and functional states. And it is superior to purely experimental epigenome mapping for CpG island detection since it abstracts from specific properties that are limited to a single cell type or tissue. In addition, using computational epigenetics methods we could identify high correlation between the epigenome and characteristics of the DNA sequence, a finding which emphasizes the need for a better understanding of the mechanistic links between genome and epigenome.

Human Endometrial DNA Methylome Is Cycle-Dependent and Is Associated With Gene Expression Regulation

PubMed Central

Houshdaran, Sahar; Zelenko, Zara; Irwin, Juan C.

2014-01-01

Human endometrium undergoes major gene expression changes, resulting in altered cellular functions in response to cyclic variations in circulating estradiol and progesterone, largely mediated by transcription factors and nuclear receptors. In addition to classic modulators, epigenetic mechanisms regulate gene expression during development in response to environmental factors and in some diseases and have roles in steroid hormone action. Herein, we tested the hypothesis that DNA methylation plays a role in gene expression regulation in human endometrium in different hormonal milieux. High throughput, genome-wide DNA methylation profiling of endometrial samples in proliferative, early secretory, and midsecretory phases revealed dynamic DNA methylation patterns with segregation of proliferative from secretory phase samples by unsupervised cluster analysis of differentially methylated genes. Changes involved different frequencies of gain and loss of methylation within or outside CpG islands. Comparison of changes in transcriptomes and corresponding DNA methylomes from the same samples revealed association of DNA methylation and gene expression in a number of loci, some important in endometrial biology. Human endometrial stromal fibroblasts treated in vitro with estradiol and progesterone exhibited DNA methylation changes in several genes observed in proliferative and secretory phase tissues, respectively. Taken together, the data support the observation that epigenetic mechanisms are involved in gene expression regulation in human endometrium in different hormonal milieux, adding endometrium to a small number of normal adult tissues exhibiting dynamic DNA methylation. The data also raise the possibility that the interplay between steroid hormone and methylome dynamics regulates normal endometrial functions and, if abnormal, may result in endometrial dysfunction and associated disorders. PMID:24877562

Analysis of estrogen receptor β gene methylation in autistic males in a Chinese Han population.

PubMed

Wang, Xuelai; Liang, Shuang; Sun, Yi; Li, Haixin; Endo, Fumio; Nakao, Mitsuyoshi; Saitoh, Noriko; Wu, Lijie

2017-08-01

Autism spectrum disorder (ASD) is a neurodevelopment disorder with abnormalities of social interaction, communication and repetitive behaviors. The higher prevalence of ASD in men implies a potential relationship between sex hormones and ASD etiology. The ESR2 gene encodes estrogen receptor beta (ESR2) and plays an important role during brain development. A relationship between ESR2 and ASD has been suggested by studies on single nucleotide polymorphisms and mRNA and protein expression levels in ASD patients. Here, we explored the possible epigenetic regulation of the ESR2 gene in autism. We collected genomic DNA from the peripheral blood of Chinese Han males with autism and age-matched normal males and measured DNA methylation of CpG islands in the ESR2 gene, which consisted of 41 CpG sites among the proximal promoter region and an untranslated exon, by bisulfite sequencing. We also investigated a relationship between DNA methylation and phenotypic features of autism, as assessed by the Children Autism Rating Scale. We found little overall difference in the DNA methylation of the ESR2 5'-flanking region in individuals with autism compared with normal individuals. However, detailed analyses revealed that eight specific CpG sites were hypermethylated in autistic individuals and that four specific CpG sites were positively associated with the severity of autistic symptoms. Our study indicates that the epigenetic dysregulation of ESR2 may govern the development of autism.

SU94. Allele-Specific and Trauma-Related Epigenetic Changes in the FKBP5 Gene: Differences Between Psychotic Patients and Healthy Controls

PubMed Central

Mihaljevic, Marina; Franic, Dusica; Soldatovic, Ivan; Andric, Sanja; Mirjanic, Tijana; Novakovic, Ivana; Adzic, Miroslav; Maric, Nadja

2017-01-01

Abstract Background: Hypothalamic-pituitary-adrenal (HPA) axis dysregulation is a proposed etiological mechanism of psychosis. Recent studies highlighted impact of the FKBP5 gene and its functional variant rs1360780, which risk (T) allele affects the activity of HPA axis following stress exposure, on psychotic patients exposed to early trauma (1). Additionally, risk allele and trauma dependent FKBP5 demethylation in intron 7 was observed in traumatized individuals (2). Thus, the purpose of this pilot study was to investigate influence of the risk allele and trauma on FKBP5 DNA methylation levels at intron 7 in psychotic patients and to compare it with healthy individuals. Methods: The sample consisted of 24 psychosis spectrum patients and 24 controls matched by age and gender. All participants were genotyped for rs1360780 and divided into 2 groups depending on the presence of the risk allele (risk and nonrisk group). DNA methylation levels at 3 CpG sites (CpG1, CpG2, and CpG3) in intron 7 were analyzed by Sanger sequencing. Early-life adversities were measured by Childhood Trauma Questionnaire. Pearson correlation and t test were performed as appropriate. Results: Analyses revealed decreased FKBP5 methylation at targeted CpG sites and averaged methylation level (AML) at intron 7 in patients compared to controls (P = .026, P = .017, P = .027, and P = .003, respectively). Decreased AML and methylation at CpG3 were observed comparing risk and nonrisk patients’ groups (P = .018 and P = .016, respectively). Additionally, decreased methylation was found in risk patients’ group compared to risk controls’ group. No differences were found comparing nonrisk groups. Furthermore, strong negative associations between trauma and methylation at CpG3 and AML were observed only in risk controls’ group (r = −0.707, P = .007; r = −0.741, P = .004, respectively). Conclusion: Our preliminary results revealed allele-specific epigenetic changes of the FKBP5 gene in psychotic patients, which is in line with previous reports in traumatized individuals. Trauma-related demethylation in risk controls’ group supports the hypothesis that psychotic and stress-related conditions could share common neurobiological underlying mechanism, such as HPA axis dysregulation, particularly in individuals with genetic predisposition for altered stress response. References 1.Daskalakis NP, Binder EB. Schizophrenia in the spectrum of gene-stress interactions: the FKBP5 example. Schizophr Bull. 2015;41:323–329. 2.Klengel T, Mehta D, Anacker C et al. Allele-specific FKBP5 DNA demethylation mediates gene-childhood trauma interactions. Nat Neurosci. 2013;16:33–41.

Preferential epigenetic programming of estrogen response after in utero xenoestrogen (bisphenol-A) exposure

PubMed Central

Jorgensen, Elisa M.; Alderman, Myles H.; Taylor, Hugh S.

2016-01-01

Bisphenol-A (BPA) is an environmentally ubiquitous estrogen-like endocrine-disrupting compound. Exposure to BPA in utero has been linked to female reproductive disorders, including endometrial hyperplasia and breast cancer. Estrogens are an etiological factor in many of these conditions. We sought to determine whether in utero exposure to BPA altered the global CpG methylation pattern of the uterine genome, subsequent gene expression, and estrogen response. Pregnant mice were exposed to an environmentally relevant dose of BPA or DMSO control. Uterine DNA and RNA were examined by using methylated DNA immunoprecipitation methylation microarray, expression microarray, and quantitative PCR. In utero BPA exposure altered the global CpG methylation profile of the uterine genome and subsequent gene expression. The effect on gene expression was not apparent until sexual maturation, which suggested that estrogen response was the primary alteration. Indeed, prenatal BPA exposure preferentially altered adult estrogen-responsive gene expression. Changes in estrogen response were accompanied by altered methylation that preferentially affected estrogen receptor-α (ERα)–binding genes. The majority of genes that demonstrated both altered expression and ERα binding had decreased methylation. BPA selectively altered the normal developmental programming of estrogen-responsive genes via modification of the genes that bind ERα. Gene–environment interactions driven by early life xenoestrogen exposure likely contributes to increased risk of estrogen-related disease in adults.—Jorgensen, E. M., Alderman, M. H., III, Taylor, H. S. Preferential epigenetic programming of estrogen response after in utero xenoestrogen (bisphenol-A) exposure. PMID:27312807

Methylation levels of the "long interspersed nucleotide element-1" repetitive sequences predict survival of melanoma patients.

PubMed

Sigalotti, Luca; Fratta, Elisabetta; Bidoli, Ettore; Covre, Alessia; Parisi, Giulia; Colizzi, Francesca; Coral, Sandra; Massarut, Samuele; Kirkwood, John M; Maio, Michele

2011-05-26

The prognosis of cutaneous melanoma (CM) differs for patients with identical clinico-pathological stage, and no molecular markers discriminating the prognosis of stage III individuals have been established. Genome-wide alterations in DNA methylation are a common event in cancer. This study aimed to define the prognostic value of genomic DNA methylation levels in stage III CM patients. Overall level of genomic DNA methylation was measured using bisulfite pyrosequencing at three CpG sites (CpG1, CpG2, CpG3) of the Long Interspersed Nucleotide Element-1 (LINE-1) sequences in short-term CM cultures from 42 stage IIIC patients. The impact of LINE-1 methylation on overall survival (OS) was assessed using Cox regression and Kaplan-Meier analysis. Hypomethylation (i.e., methylation below median) at CpG2 and CpG3 sites significantly associated with improved prognosis of CM, CpG3 showing the strongest association. Patients with hypomethylated CpG3 had increased OS (P = 0.01, log-rank = 6.39) by Kaplan-Meyer analysis. Median OS of patients with hypomethylated or hypermethylated CpG3 were 31.9 and 11.5 months, respectively. The 5 year OS for patients with hypomethylated CpG3 was 48% compared to 7% for patients with hypermethylated sequences. Among the variables examined by Cox regression analysis, LINE-1 methylation at CpG2 and CpG3 was the only predictor of OS (Hazard Ratio = 2.63, for hypermethylated CpG3; 95% Confidence Interval: 1.21-5.69; P = 0.01). LINE-1 methylation is identified as a molecular marker of prognosis for CM patients in stage IIIC. Evaluation of LINE-1 promises to represent a key tool for driving the most appropriate clinical management of stage III CM patients.

Epigenetic inactivation of the novel candidate tumor suppressor gene ITIH5 in colon cancer predicts unfavorable overall survival in the CpG island methylator phenotype

PubMed Central

Kloten, Vera; Rose, Michael; Kaspar, Sophie; von Stillfried, Saskia; Knüchel, Ruth; Dahl, Edgar

2014-01-01

Inter-α-trypsin inhibitor heavy chain 5 (ITIH5) is supposed to be involved in extracellular matrix stability and thus may play a key role in the inhibition of tumor progression. The current study is the first to analyze in depth ITIH5 expression as well as its potential clinical and functional impact in colon cancer. Based on 30 tumor and 30 adjacent normal tissues we examined ITIH5 mRNA expression and promoter methylation, whose significance was further validated by independent data sets from The Cancer Genome Atlas (TCGA) platform. In addition, ITIH5 protein expression was evaluated using immunohistochemistry. ITIH5 mRNA expression loss was significantly associated (P < 0.001) with hypermethylation of the ITIH5 promoter in primary colon tumors. In addition, treatment of tumor cell lines with demethylating (DAC) and histone acetylating (TSA) agents induced ITIH5 expression. In line, independent TCGA data revealed a significant expression loss of ITIH5, particularly in the MSI-high and CIMP-positive phenotype concordant with an increased ITIH5 hypermethylation in CIMP-positive colon tumors (P < 0.001). In proximal, i.e., right-sided tumors, abundant ITIH5 expression was associated with longer overall survival (OS, P = 0.049) and the CIMP-positive (P = 0.032) subgroup. Functionally, ITIH5 re-expression mediated a reduced proliferation in HCT116 and CaCo2 cells. In conclusion, our results indicate that ITIH5 is a novel putative tumor suppressor gene in colon cancer with a potential impact in the CIMP-related pathway. ITIH5 may serve as a novel epigenetic-based diagnostic biomarker with further clinical impact for risk stratification of CIMP-positive colon cancer patients. PMID:25093535

Genomic Methylation Inhibits Expression of Hepatitis B Virus Envelope Protein in Transgenic Mice: A Non-Infectious Mouse Model to Study Silencing of HBV Surface Antigen Genes.

PubMed

Graumann, Franziska; Churin, Yuri; Tschuschner, Annette; Reifenberg, Kurt; Glebe, Dieter; Roderfeld, Martin; Roeb, Elke

2015-01-01

The Hepatitis B virus genome persists in the nucleus of virus infected hepatocytes where it serves as template for viral mRNA synthesis. Epigenetic modifications, including methylation of the CpG islands contribute to the regulation of viral gene expression. The present study investigates the effects of spontaneous age dependent loss of hepatitis B surface protein- (HBs) expression due to HBV-genome specific methylation as well as its proximate positive effects in HBs transgenic mice. Liver and serum of HBs transgenic mice aged 5-33 weeks were analyzed by Western blot, immunohistochemistry, serum analysis, PCR, and qRT-PCR. From the third month of age hepatic loss of HBs was observed in 20% of transgenic mice. The size of HBs-free area and the relative number of animals with these effects increased with age and struck about 55% of animals aged 33 weeks. Loss of HBs-expression was strongly correlated with amelioration of serum parameters ALT and AST. In addition lower HBs-expression went on with decreased ER-stress. The loss of surface protein expression started on transcriptional level and appeared to be regulated epigenetically by DNA methylation. The amount of the HBs-expression correlated negatively with methylation of HBV DNA in the mouse genome. Our data suggest that methylation of specific CpG sites controls gene expression even in HBs-transgenic mice with truncated HBV genome. More important, the loss of HBs expression and intracellular aggregation ameliorated cell stress and liver integrity. Thus, targeted modulation of HBs expression may offer new therapeutic approaches. Furthermore, HBs-transgenic mice depict a non-infectious mouse model to study one possible mechanism of HBs gene silencing by hypermethylation.

Transcription factor activating protein 2 beta (TFAP2B) mediates noradrenergic neuronal differentiation in neuroblastoma.

PubMed

Ikram, Fakhera; Ackermann, Sandra; Kahlert, Yvonne; Volland, Ruth; Roels, Frederik; Engesser, Anne; Hertwig, Falk; Kocak, Hayriye; Hero, Barbara; Dreidax, Daniel; Henrich, Kai-Oliver; Berthold, Frank; Nürnberg, Peter; Westermann, Frank; Fischer, Matthias

2016-02-01

Neuroblastoma is an embryonal pediatric tumor that originates from the developing sympathetic nervous system and shows a broad range of clinical behavior, ranging from fatal progression to differentiation into benign ganglioneuroma. In experimental neuroblastoma systems, retinoic acid (RA) effectively induces neuronal differentiation, and RA treatment has been therefore integrated in current therapies. However, the molecular mechanisms underlying differentiation are still poorly understood. We here investigated the role of transcription factor activating protein 2 beta (TFAP2B), a key factor in sympathetic nervous system development, in neuroblastoma pathogenesis and differentiation. Microarray analyses of primary neuroblastomas (n = 649) demonstrated that low TFAP2B expression was significantly associated with unfavorable prognostic markers as well as adverse patient outcome. We also found that low TFAP2B expression was strongly associated with CpG methylation of the TFAP2B locus in primary neuroblastomas (n = 105) and demethylation with 5-aza-2'-deoxycytidine resulted in induction of TFAP2B expression in vitro, suggesting that TFAP2B is silenced by genomic methylation. Tetracycline inducible re-expression of TFAP2B in IMR-32 and SH-EP neuroblastoma cells significantly impaired proliferation and cell cycle progression. In IMR-32 cells, TFAP2B induced neuronal differentiation, which was accompanied by up-regulation of the catecholamine biosynthesizing enzyme genes DBH and TH, and down-regulation of MYCN and REST, a master repressor of neuronal genes. By contrast, knockdown of TFAP2B by lentiviral transduction of shRNAs abrogated RA-induced neuronal differentiation of SH-SY5Y and SK-N-BE(2)c neuroblastoma cells almost completely. Taken together, our results suggest that TFAP2B is playing a vital role in retaining RA responsiveness and mediating noradrenergic neuronal differentiation in neuroblastoma. Copyright © 2015 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

hNaa10p contributes to tumorigenesis by facilitating DNMT1-mediated tumor suppressor gene silencing

PubMed Central

Lee, Chung-Fan; Ou, Derick S.-C.; Lee, Sung-Bau; Chang, Liang-Hao; Lin, Ruo-Kai; Li, Ying-Shiuan; Upadhyay, Anup K.; Cheng, Xiaodong; Wang, Yi-Ching; Hsu, Han-Shui; Hsiao, Michael; Wu, Cheng-Wen; Juan, Li-Jung

2010-01-01

Hypermethylation-mediated tumor suppressor gene silencing plays a crucial role in tumorigenesis. Understanding its underlying mechanism is essential for cancer treatment. Previous studies on human N-α-acetyltransferase 10, NatA catalytic subunit (hNaa10p; also known as human arrest-defective 1 [hARD1]), have generated conflicting results with regard to its role in tumorigenesis. Here we provide multiple lines of evidence indicating that it is oncogenic. We have shown that hNaa10p overexpression correlated with poor survival of human lung cancer patients. In vitro, enforced expression of hNaa10p was sufficient to cause cellular transformation, and siRNA-mediated depletion of hNaa10p impaired cancer cell proliferation in colony assays and xenograft studies. The oncogenic potential of hNaa10p depended on its interaction with DNA methyltransferase 1 (DNMT1). Mechanistically, hNaa10p positively regulated DNMT1 enzymatic activity by facilitating its binding to DNA in vitro and its recruitment to promoters of tumor suppressor genes, such as E-cadherin, in vivo. Consistent with this, interaction between hNaa10p and DNMT1 was required for E-cadherin silencing through promoter CpG methylation, and E-cadherin repression contributed to the oncogenic effects of hNaa10p. Together, our data not only establish hNaa10p as an oncoprotein, but also reveal that it contributes to oncogenesis through modulation of DNMT1 function. PMID:20592467

Liver Restores Immune Homeostasis after Local Inflammation despite the Presence of Autoreactive T Cells

PubMed Central

Béland, Kathie; Lapierre, Pascal; Djilali-Saiah, Idriss; Alvarez, Fernando

2012-01-01

The liver must keep equilibrium between immune tolerance and immunity in order to protect itself from pathogens while maintaining tolerance to food antigens. An imbalance between these two states could result in an inflammatory liver disease. The aims of this study were to identify factors responsible for a break of tolerance and characterize the subsequent restoration of liver immune homeostasis. A pro-inflammatory environment was created in the liver by the co-administration of TLR ligands CpG and Poly(I:C) in presence or absence of activated liver-specific autoreactive CD8+ T cells. Regardless of autoreactive CD8+ T cells, mice injected with CpG and Poly(I:C) showed elevated serum ALT levels and a transient liver inflammation. Both CpG/Poly(I:C) and autoreactive CD8+T cells induced expression of TLR9 and INF-γ by the liver, and an up-regulation of homing and adhesion molecules CXCL9, CXCL10, CXCL16, ICAM-1 and VCAM-1. Transferred CFSE-labeled autoreactive CD8+ T cells, in presence of TLR3 and 9 ligands, were recruited by the liver and spleen and proliferated. This population then contracted by apoptosis through intrinsic and extrinsic pathways. Up-regulation of FasL and PD-L1 in the liver was observed. In conclusion, TLR-mediated activation of the innate immune system results in a pro-inflammatory environment that promotes the recruitment of lymphocytes resulting in bystander hepatitis. Despite this pro-inflammatory environment, the presence of autoreactive CD8+ T cells is not sufficient to sustain an autoimmune response against the liver and immune homeostasis is rapidly restored through the apoptosis of T cells. PMID:23110209

Methylation of PLCD1 and adenovirus-mediated PLCD1 overexpression elicits a gene therapy effect on human breast cancer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mu, Haixi; Department of Endocrine and breast Surgery, The First Affiliated Hospital of Chongqing Medical University, Chongqing 400016; Wang, Na

Our previous study showed that PLCD1 significantly decreases cell proliferation and affects cell cycle progression in breast cancer cells. In the present study, we aimed to investigate its functional and molecular mechanisms, and whether or not can become a new target for gene therapies. We found reduced PLCD1 protein expression in breast tumor tissues compared with paired surgical margin tissues. PLCD1 promoter CpG methylation was detected in 55 of 96 (57%) primary breast tumors, but not in surgical-margin tissues and normal breast tissues. Ectopic expression of PLCD1 inhibited breast tumor cell proliferation in vivo by inducing apoptosis and suppressed tumormore » cell migration by regulating cytoskeletal reorganization proteins including RhoA and phospho-cofilin. Furthermore, we found that PLCD1 induced p53 accumulation, increased p27 and p21 protein levels, and cleaved PARP. Finally, we constructed an adenoviral vector expressing PLCD1 (AdH5-PLCD1), which exhibited strong cytotoxicity in breast cancer cells. Our findings provide insights into the development of PLCD1 gene therapies for breast cancer and perhaps, other human cancers. - Highlights: • PLCD1 is downregulated via hypermethylation in breast cancer. • PLCD1 suppressed cell migration by regulating cytoskeletal reorganization proteins. • Adenovirus AdHu5-PLCD1 may be a novel therapeutic option for breast cancer.« less

‘Protected DNA Probes’ capable of strong hybridization without removal of base protecting groups

PubMed Central

Ohkubo, Akihiro; Kasuya, Rintaro; Sakamoto, Kazushi; Miyata, Kenichi; Taguchi, Haruhiko; Nagasawa, Hiroshi; Tsukahara, Toshifumi; Watanobe, Takuma; Maki, Yoshiyuki; Seio, Kohji; Sekine, Mitsuo

2008-01-01

We propose a new strategy called the ‘Protected DNA Probes (PDP) method’ in which appropriately protected bases selectively bind to the complementary bases without the removal of their base protecting groups. Previously, we reported that 4-N-acetylcytosine oligonucleotides (ac4C) exhibited a higher hybridization affinity for ssDNA than the unmodified oligonucleotides. For the PDP strategy, we created a modified adenine base and synthesized an N-acylated deoxyadenosine mimic having 6-N-acetyl-8-aza-7-deazaadenine (ac6az8c7A). It was found that PDP containing ac4C and ac6az8c7A exhibited higher affinity for the complementary ssDNA than the corresponding unmodified DNA probes and showed similar base recognition ability. Moreover, it should be noted that this PDP strategy could guarantee highly efficient synthesis of DNA probes on controlled pore glass (CPG) with high purity and thereby could eliminate the time-consuming procedures for isolating DNA probes. This strategy could also avoid undesired base-mediated elimination of DNA probes from CPG under basic conditions such as concentrated ammonia solution prescribed for removal of base protecting groups in the previous standard approach. Here, several successful applications of this strategy to single nucleotide polymorphism detection are also described in detail using PDPs immobilized on glass plates and those prepared on CPG plates, suggesting its potential usefulness. PMID:18272535

Expression of the TPα and TPβ isoforms of the thromboxane prostanoid receptor (TP) in prostate cancer: clinical significance and diagnostic potential.

PubMed

Mulvaney, Eamon P; Shilling, Christine; Eivers, Sarah B; Perry, Antoinette S; Bjartell, Anders; Kay, Elaine W; Watson, R William; Kinsella, B Therese

2016-11-08

The prostanoid thromboxane (TX)A2 plays a central role in haemostasis and is increasingly implicated in cancer progression. TXA2 signals through two T Prostanoid receptor (TP) isoforms termed TPα and TPβ, with both encoded by the TBXA2R gene. Despite exhibiting several functional and regulatory differences, the role of the individual TP isoforms in neoplastic diseases is largely unknown.This study evaluated expression of the TPα and TPβ isoforms in tumour microarrays of the benign prostate and different pathological (Gleason) grades of prostate cancer (PCa). Expression of TPβ was significantly increased in PCa relative to benign tissue and strongly correlated with increasing Gleason grade. Furthermore, higher TPβ expression was associated with increased risk of biochemical recurrence (BCR) and significantly shorter disease-free survival time in patients post-surgery. While TPα was more variably expressed than TPβ in PCa, increased/high TPα expression within the tumour also trended toward increased BCR and shorter disease-free survival time. Comparative genomic CpG DNA methylation analysis revealed substantial differences in the extent of methylation of the promoter regions of the TBXA2R that specifically regulate expression of TPα and TPβ, respectively, both in benign prostate and in clinically-derived tissue representative of precursor lesions and progressive stages of PCa. Collectively, TPα and TPβ expression is differentially regulated both in the benign and tumourigenic prostate, and coincides with clinical pathology and altered CpG methylation of the TBXA2R gene. Analysis of TPβ, or a combination of TPα/TPβ, expression levels may have significant clinical potential as a diagnostic biomarker and predictor of PCa disease recurrence.

Predicting aberrant CpG island methylation

PubMed Central

Feltus, F. A.; Lee, E. K.; Costello, J. F.; Plass, C.; Vertino, P. M.

2003-01-01

Epigenetic silencing associated with aberrant methylation of promoter region CpG islands is one mechanism leading to loss of tumor suppressor function in human cancer. Profiling of CpG island methylation indicates that some genes are more frequently methylated than others, and that each tumor type is associated with a unique set of methylated genes. However, little is known about why certain genes succumb to this aberrant event. To address this question, we used Restriction Landmark Genome Scanning to analyze the susceptibility of 1,749 unselected CpG islands to de novo methylation driven by overexpression of DNA cytosine-5-methyltransferase 1 (DNMT1). We found that although the overall incidence of CpG island methylation was increased in cells overexpressing DNMT1, not all loci were equally affected. The majority of CpG islands (69.9%) were resistant to de novo methylation, regardless of DNMT1 overexpression. In contrast, we identified a subset of methylation-prone CpG islands (3.8%) that were consistently hypermethylated in multiple DNMT1 overexpressing clones. Methylation-prone and methylation-resistant CpG islands were not significantly different with respect to size, C+G content, CpG frequency, chromosomal location, or promoter association. We used DNA pattern recognition and supervised learning techniques to derive a classification function based on the frequency of seven novel sequence patterns that was capable of discriminating methylation-prone from methylation-resistant CpG islands with 82% accuracy. The data indicate that CpG islands differ in their intrinsic susceptibility to de novo methylation, and suggest that the propensity for a CpG island to become aberrantly methylated can be predicted based on its sequence context. PMID:14519846

Predicting aberrant CpG island methylation.

PubMed

Feltus, F A; Lee, E K; Costello, J F; Plass, C; Vertino, P M

2003-10-14

Epigenetic silencing associated with aberrant methylation of promoter region CpG islands is one mechanism leading to loss of tumor suppressor function in human cancer. Profiling of CpG island methylation indicates that some genes are more frequently methylated than others, and that each tumor type is associated with a unique set of methylated genes. However, little is known about why certain genes succumb to this aberrant event. To address this question, we used Restriction Landmark Genome Scanning to analyze the susceptibility of 1,749 unselected CpG islands to de novo methylation driven by overexpression of DNA cytosine-5-methyltransferase 1 (DNMT1). We found that although the overall incidence of CpG island methylation was increased in cells overexpressing DNMT1, not all loci were equally affected. The majority of CpG islands (69.9%) were resistant to de novo methylation, regardless of DNMT1 overexpression. In contrast, we identified a subset of methylation-prone CpG islands (3.8%) that were consistently hypermethylated in multiple DNMT1 overexpressing clones. Methylation-prone and methylation-resistant CpG islands were not significantly different with respect to size, C+G content, CpG frequency, chromosomal location, or promoter association. We used DNA pattern recognition and supervised learning techniques to derive a classification function based on the frequency of seven novel sequence patterns that was capable of discriminating methylation-prone from methylation-resistant CpG islands with 82% accuracy. The data indicate that CpG islands differ in their intrinsic susceptibility to de novo methylation, and suggest that the propensity for a CpG island to become aberrantly methylated can be predicted based on its sequence context.

Implementation of antibiotic use guidelines for fresh traumatic wound at Siriraj Hospital.

PubMed

Sirijatuphat, Rujipas; Choochan, Tanatchon; Siritongtaworn, Preecha; Sripojtham, Vipaporn; Thamlikitkul, Visanu

2015-03-01

To determine the effectiveness of implementing a clinical practice guideline (CPG) on antibiotic use for adults with fresh traumatic wounds who attended the trauma center at Siriraj Hospital, Bangkok. A prospective study of 600 adult patients who had fresh traumatic wounds (≤ 6 hours) was conducted at Siriraj Trauma Center from March 2013 to March 2014. The CPG was introduced to physicians, nurses and medical students by posting the CPG at the patient care areas of the trauma center. The outcomes were an appropriate classification of wounds according to the CPG recommendations, prevalence of antibiotic prescribing, incidence of wound infection and compliance with the CPG. Clean-contaminated wounds that did not need antibiotic treatment and clean-contaminated and contaminated wounds that required antibiotics were observed in 63.2, 6.7, and 30.1% ofthe patients, respectively. Antibiotics were given to 512 patients (85.3%). Infections occurred in six patients (1.0%). Antibiotic prescription according to CPG recommendations was observed for 243 patients (40.5%). The prevalence of antibiotic use in the CPG-compliant group (65.8%) was significantly less than that in the CPG-noncompliant group (98.6%) (p < 0.001). The patients in the CPG-compliant group had more contaminated wounds than those in the CPG-noncompliant group (51.4 vs. 15.7%, p < 0.001). The incidences of wound infection were very low in both groups and not significantly different (1.2 vs. 0.8%, p = 0.690). Antibiotic prophylaxis was necessary in less than 36.8% of adults with fresh traumatic wounds who attended Siriraj Trauma Center Compliance to CPG implementation using simple intervention seemed to be low. Adhering to CPG recommendations for antibiotic prophylaxis in adults with fresh traumatic wounds can reduce the unnecessary prescribing of antibiotics without increasing the rate of wound infection.

Sequential DNA methylation changes are associated with DNMT3B overexpression in colorectal neoplastic progression.

PubMed

Ibrahim, Ashraf E K; Arends, Mark J; Silva, Ana-Luisa; Wyllie, Andrew H; Greger, Liliana; Ito, Yoko; Vowler, Sarah L; Huang, Tim H-M; Tavaré, Simon; Murrell, Adele; Brenton, James D

2011-04-01

Although aberrant methylation of key genes in the progression of colorectal neoplasia has been reported, no model-based analysis of the incremental changes through the intermediate adenoma stage has been described. In addition, the biological drivers for these methylation changes have yet to be defined. Linear mixed-effects modelling was used in this study to understand the onset and patterns of the methylation changes of SFRP2, IGF2 DMR0, H19, LINE-1 and a CpG island methylator phenotype (CIMP) marker panel, and they were correlated with DNA methyltransferase 3B (DNMT3B) levels of expression in a sample set representative of colorectal neoplastic progression. Methylation of the above CpG islands was measured using quantitative pyrosequencing assays in 261 tissue samples. This included a prospective collection of 44 colectomy specimens with concurrent normal mucosa, adenoma and invasive cancer tissues. Tissue microarrays from a subset of 64 cases were used for immunohistochemical analysis of DNMT3B expression. It is shown that the onset and pattern of methylation changes during colorectal neoplastic progression are locus dependent. The CIMP marker RUNX3 was the earliest CpG island showing significant change, followed by the CIMP markers NEUROG1 and CACNA1G at the hyperplastic polyp stage. SFRP2 and IGF2 DMR0 showed significant methylation changes at the adenomatous polyp stage, followed by the CIMP markers CDKN2A and hMLH1 at the adenocarcinoma stage. DNMT3B levels of immunohistochemical expression increased significantly (p < 0.001) from normal to hyperplastic and from adenomatous polyps to carcinoma samples. DNMT3B expression correlated positively with SFRP2 methylation (r = 0.42, p < 0.001, 95% CI 0.25 to 0.56), but correlated negatively with IGF2 DMR0 methylation (r = 0.26, p = 0.01, 95% CI -0.45 to -0.05). A subset of the CIMP panel (NEUROG1, CACNA1G and CDKN2A) positively correlated with DNMT3B levels of expression (p < 0.05). Hierarchical epigenetic alterations occur at transition points during colorectal neoplastic progression. These cumulative changes are closely correlated with a gain of DNMT3B expression, suggesting a causal relationship.

A significant association between BDNF promoter methylation and the risk of drug addiction.

PubMed

Xu, Xuting; Ji, Huihui; Liu, Guili; Wang, Qinwen; Liu, Huifen; Shen, Wenwen; Li, Longhui; Xie, Xiaohu; Zhou, Wenhua; Duan, Shiwei

2016-06-10

As a member of the neurotrophic factor family, brain derived neurotrophic factor (BDNF) plays an important role in the survival and differentiation of neurons. The aim of our work was to evaluate the role of BDNF promoter methylation in drug addiction. A total of 60 drug abusers (30 heroin and 30 methylamphetamine addicts) and 52 healthy age- and gender-matched controls were recruited for the current case control study. Bisulfite pyrosequencing technology was used to determine the methylation levels of five CpGs (CpG1-5) on the BDNF promoter. Among the five CpGs, CpG5 methylation was significantly lower in drug abusers than controls. Moreover, significant associations were found between CpG5 methylation and addictive phenotypes including tension-anxiety, anger-hostility, fatigue-inertia, and depression-dejection. In addition, luciferase assay showed that the DNA fragment of BDNF promoter played a key role in the regulation of gene expression. Our results suggest that BDNF promoter methylation is associated with drug addiction, although further studies are needed to understand the mechanisms by which BDNF promoter methylation contributes to the pathophysiology of drug addiction. Copyright © 2016. Published by Elsevier B.V.

CpG Island Methylation in Colorectal Cancer: Past, Present and Future

PubMed Central

Curtin, Karen; Slattery, Martha L.; Samowitz, Wade S.

2011-01-01

The concept of a CpG island methylator phenotype, or CIMP, quickly became the focus of several colorectal cancer studies describing its clinical and pathological features after its introduction in 1999 by Toyota and colleagues. Further characterization of CIMP in tumors lead to widespread acceptance of the concept, as expressed by Shen and Issa in their 2005 editorial, “CIMP, at last.” Since that time, extensive research efforts have brought great insights into the epidemiology and prognosis of CIMP+ tumors and other epigenetic mechanisms underlying tumorigenesis. With the advances in technology and subsequent cataloging of the human methylome in cancer and normal tissue, new directions in research to understand CIMP and its role in complex biological systems yield hope for future epigenetically based diagnostics and treatments. PMID:21559209

Depletion of CpG Dinucleotides in Papillomaviruses and Polyomaviruses: A Role for Divergent Evolutionary Pressures.

PubMed

Upadhyay, Mohita; Vivekanandan, Perumal

2015-01-01

Papillomaviruses and polyomaviruses are small ds-DNA viruses infecting a wide-range of vertebrate hosts. Evidence supporting co-evolution of the virus with the host does not fully explain the evolutionary path of papillomaviruses and polyomaviruses. Studies analyzing CpG dinucleotide frequencies in virus genomes have provided interesting insights on virus evolution. CpG dinucleotide depletion has not been extensively studied among papillomaviruses and polyomaviruses. We sought to analyze the relative abundance of dinucleotides and the relative roles of evolutionary pressures in papillomaviruses and polyomaviruses. We studied 127 full-length sequences from papillomaviruses and 56 full-length sequences from polyomaviruses. We analyzed the relative abundance of dinucleotides, effective codon number (ENC), differences in synonymous codon usage. We examined the association, if any, between the extent of CpG dinucleotide depletion and the evolutionary lineage of the infected host. We also investigated the contribution of mutational pressure and translational selection to the evolution of papillomaviruses and polyomaviruses. All papillomaviruses and polyomaviruses are CpG depleted. Interestingly, the evolutionary lineage of the infected host determines the extent of CpG depletion among papillomaviruses and polyomaviruses. CpG dinucleotide depletion was more pronounced among papillomaviruses and polyomaviruses infecting human and other mammals as compared to those infecting birds. Our findings demonstrate that CpG depletion among papillomaviruses is linked to mutational pressure; while CpG depletion among polyomaviruses is linked to translational selection. We also present evidence that suggests methylation of CpG dinucleotides may explain, at least in part, the depletion of CpG dinucleotides among papillomaviruses but not polyomaviruses. The extent of CpG depletion among papillomaviruses and polyomaviruses is linked to the evolutionary lineage of the infected host. Our results highlight the existence of divergent evolutionary pressures leading to CpG dinucleotide depletion among small ds-DNA viruses infecting vertebrate hosts.

Methylation levels of the "long interspersed nucleotide element-1" repetitive sequences predict survival of melanoma patients

PubMed Central

2011-01-01

Background The prognosis of cutaneous melanoma (CM) differs for patients with identical clinico-pathological stage, and no molecular markers discriminating the prognosis of stage III individuals have been established. Genome-wide alterations in DNA methylation are a common event in cancer. This study aimed to define the prognostic value of genomic DNA methylation levels in stage III CM patients. Methods Overall level of genomic DNA methylation was measured using bisulfite pyrosequencing at three CpG sites (CpG1, CpG2, CpG3) of the Long Interspersed Nucleotide Element-1 (LINE-1) sequences in short-term CM cultures from 42 stage IIIC patients. The impact of LINE-1 methylation on overall survival (OS) was assessed using Cox regression and Kaplan-Meier analysis. Results Hypomethylation (i.e., methylation below median) at CpG2 and CpG3 sites significantly associated with improved prognosis of CM, CpG3 showing the strongest association. Patients with hypomethylated CpG3 had increased OS (P = 0.01, log-rank = 6.39) by Kaplan-Meyer analysis. Median OS of patients with hypomethylated or hypermethylated CpG3 were 31.9 and 11.5 months, respectively. The 5 year OS for patients with hypomethylated CpG3 was 48% compared to 7% for patients with hypermethylated sequences. Among the variables examined by Cox regression analysis, LINE-1 methylation at CpG2 and CpG3 was the only predictor of OS (Hazard Ratio = 2.63, for hypermethylated CpG3; 95% Confidence Interval: 1.21-5.69; P = 0.01). Conclusion LINE-1 methylation is identified as a molecular marker of prognosis for CM patients in stage IIIC. Evaluation of LINE-1 promises to represent a key tool for driving the most appropriate clinical management of stage III CM patients. PMID:21615918

Computational Models and Emergent Properties of Respiratory Neural Networks

PubMed Central

Lindsey, Bruce G.; Rybak, Ilya A.; Smith, Jeffrey C.

2012-01-01

Computational models of the neural control system for breathing in mammals provide a theoretical and computational framework bringing together experimental data obtained from different animal preparations under various experimental conditions. Many of these models were developed in parallel and iteratively with experimental studies and provided predictions guiding new experiments. This data-driven modeling approach has advanced our understanding of respiratory network architecture and neural mechanisms underlying generation of the respiratory rhythm and pattern, including their functional reorganization under different physiological conditions. Models reviewed here vary in neurobiological details and computational complexity and span multiple spatiotemporal scales of respiratory control mechanisms. Recent models describe interacting populations of respiratory neurons spatially distributed within the Bötzinger and pre-Bötzinger complexes and rostral ventrolateral medulla that contain core circuits of the respiratory central pattern generator (CPG). Network interactions within these circuits along with intrinsic rhythmogenic properties of neurons form a hierarchy of multiple rhythm generation mechanisms. The functional expression of these mechanisms is controlled by input drives from other brainstem components, including the retrotrapezoid nucleus and pons, which regulate the dynamic behavior of the core circuitry. The emerging view is that the brainstem respiratory network has rhythmogenic capabilities at multiple levels of circuit organization. This allows flexible, state-dependent expression of different neural pattern-generation mechanisms under various physiological conditions, enabling a wide repertoire of respiratory behaviors. Some models consider control of the respiratory CPG by pulmonary feedback and network reconfiguration during defensive behaviors such as cough. Future directions in modeling of the respiratory CPG are considered. PMID:23687564

Chitosan-coated boron nitride nanospheres enhance delivery of CpG oligodeoxynucleotides and induction of cytokines

PubMed Central

Zhang, Huijie; Chen, Song; Zhi, Chunyi; Yamazaki, Tomohiko; Hanagata, Nobutaka

2013-01-01

Background Cytosine-phosphate-guanine (CpG) oligodeoxynucleotides activate Toll-like receptor 9, leading to induction of proinflammatory cytokines, which play an important role in induction and maintenance of innate and adaptive immune responses. Previously, we have used boron nitride nanospheres (BNNS) as a carrier for delivery of unmodified CpG oligodeoxynucleotides to activate Toll-like receptor 9. However, because CpG oligodeoxynucleotides and BNNS are both negatively charged, electrostatic repulsion between them is likely to reduce the loading of CpG oligodeoxynucleotides onto BNNS. Therefore, the efficiency of uptake of CpG oligodeoxynucleotides is also limited and does not result in induction of a robust cytokine response. To ameliorate these problems, we developed a CpG oligodeoxynucleotide delivery system using chitosan-coated BNNS as a carrier. Methods To facilitate attachment of CpG oligodeoxynucleotides onto the BNNS and improve their loading capacity, we prepared positively charged BNNS by coating them with chitosan preparations of three different molecular weights and used them as carriers for delivery of CpG oligodeoxynucleotides. Results The zeta potentials of the BNNS-CS complexes were positive, and chitosan coating improved their dispersity and stability in aqueous solution compared with BNNS. The positive charge of the BNNS-CS complexes greatly improved the loading capacity and cellular uptake efficiency of CpG oligodeoxynucleotides. The loading capacity of the CpG oligodeoxynucleotides depended on the molecular weight of chitosan, which affected the positive charge density on the surface of the BNNS. CpG oligodeoxynucleotides loaded onto BNNS-CS complexes significantly enhanced production of interleukin-6 and tumor necrosis factor-α by peripheral blood mononuclear cells compared with CpG oligodeoxynucleotides directly loaded onto BNNS, or when Lipofectamine™ 2000 was used as the carrier. The molecular weight of the chitosan used to coat the BNNS affected the magnitude of cytokine induction by varying the strength of condensation of the CpG oligodeoxynucleotides. Conclusion Although the loading capacity of BNNS coated with low molecular weight chitosan preparations was the lowest of all the preparations, they induced the highest levels of cytokines. PMID:23674892

MLH1 Region Polymorphisms Show a Significant Association with CpG Island Shore Methylation in a Large Cohort of Healthy Individuals

PubMed Central

Savio, Andrea J.; Lemire, Mathieu; Mrkonjic, Miralem; Gallinger, Steven; Zanke, Brent W.; Hudson, Thomas J.; Bapat, Bharati

2012-01-01

Single nucleotide polymorphisms (SNPs) are the most common form of genetic variation. We previously demonstrated that SNPs (rs1800734, rs749072, and rs13098279) in the MLH1 gene region are associated with MLH1 promoter island methylation, loss of MLH1 protein expression, and microsatellite instability (MSI) in colorectal cancer (CRC) patients. Recent studies have identified less CpG-dense “shore” regions flanking many CpG islands. These shores often exhibit distinct methylation profiles between different tissues and matched normal versus tumor cells of patients. To date, most epigenetic studies have focused on somatic methylation events occurring within solid tumors; less is known of the contributions of peripheral blood cell (PBC) methylation to processes such as aging and tumorigenesis. To address whether MLH1 methylation in PBCs is correlated with tumorigenesis we utilized the Illumina 450 K microarrays to measure methylation in PBC DNA of 846 healthy controls and 252 CRC patients from Ontario, Canada. Analysis of a region of chromosome 3p21 spanning the MLH1 locus in healthy controls revealed that a CpG island shore 1 kb upstream of the MLH1 gene exhibits different methylation profiles when stratified by SNP genotypes (rs1800734, rs749072, and rs13098279). Individuals with wild-type genotypes incur significantly higher PBC shore methylation than heterozygous or homozygous variant carriers (p<1.1×10−6; ANOVA). This trend is also seen in CRC cases (p<0.096; ANOVA). Shore methylation also decreases significantly with increasing age in cases and controls. This is the first study of its kind to integrate PBC methylation at a CpG island shore with SNP genotype status in CRC cases and controls. These results indicate that CpG island shore methylation in PBCs may be influenced by genotype as well as the normal aging process. PMID:23240038

Emergent central pattern generator behavior in chemical coupled two-compartment models with time delay

NASA Astrophysics Data System (ADS)

Li, Shanshan; Zhang, Guoshan; Wang, Jiang; Chen, Yingyuan; Deng, Bin

2018-02-01

This paper proposes that modified two-compartment Pinsky-Rinzel (PR) neural model can be used to develop the simple form of central pattern generator (CPG). The CPG is called as 'half-central oscillator', which constructed by two inhibitory chemical coupled PR neurons with time delay. Some key properties of PR neural model related to CPG are studied and proved to meet the requirements of CPG. Using the simple CPG network, we first study the relationship between rhythmical output and key factors, including ambient noise, sensory feedback signals, morphological character of single neuron as well as the coupling delay time. We demonstrate that, appropriate intensity noise can enhance synchronization between two coupled neurons. Different output rhythm of CPG network can be entrained by sensory feedback signals. We also show that the morphology of single neuron has strong effect on the output rhythm. The phase synchronization indexes decrease with the increase of morphology parameter's difference. Through adjusting coupled delay time, we can get absolutely phase synchronization and antiphase state of CPG. Those results of simulation show the feasibility of PR neural model as a valid CPG as well as the emergent behaviors of the particularly CPG.

Dietary vitamin A impacts DNA methylation patterns of adipogenesis-related genes in suckling rats.

PubMed

Arreguín, A; Ribot, J; Mušinović, H; von Lintig, J; Palou, A; Bonet, M L

2018-05-11

We previously showed that vitamin A supplementation in early life impacts white adipose tissue (WAT) biology. We here studied the vitamin's effects on DNA methylation of genes crucial for WAT cell development, determination and metabolism. CpG promoter methylation and mRNA expression of Pparg, Zfp423, Pcna, and Rbp4 was compared in inguinal WAT of 21-day-old rats supplemented during the suckling period with vehicle (controls) or an emulsion of vitamin A as retinyl ester (RE) or β-carotene (BC). The methylation profile of promoters was affected by vitamin A supplementation with pronounced differences between the RE and BC groups. In the RE group, hypermethylation of the Rbp4 (at multiple CpGs) and the Pparg2 (at a specific CpG) promoters and hypomethylation of the Pcna promoter (at multiple CpGs) was observed, together with inverse changes in gene expression levels. In the BC group, hypomethylation of the Rbp4 and hypermethylation of the Pcna promoter at distinct CpGs was observed, with no effects on gene expression. In both supplemention groups, hypomethylation and increased expression was found for Zfp423. Thus, modest vitamin A supplementation in early postnatal life impacts methylation marks in developing WAT. Differential epigenetic effects of RE and BC in early life may affect adipose tissue programming activity. Copyright © 2018 Elsevier Inc. All rights reserved.

Aberrant DNA methylation of miR-219 promoter in long-term night shiftworkers.

PubMed

Shi, Fengqin; Chen, Xinyi; Fu, Alan; Hansen, Johnni; Stevens, Richard; Tjonneland, Anne; Vogel, Ulla B; Zheng, Tongzhang; Zhu, Yong

2013-07-01

The idea that shiftwork may be carcinogenic in humans has gained widespread attention since the pioneering work linking shiftwork to breast cancer over two decades ago. However, the biomolecular consequences of long-term shiftwork exposure have not been fully explored. In this study, we performed a genome-wide CpG island methylation assay of microRNA (miRNA) promoters in long-term night shiftworkers and day workers. This analysis indicated that 50 CpG loci corresponding to 31 miRNAs were differentially methylated in night shiftworkers compared to day workers, including the circadian-relevant miR-219, the expression of which has been implicated in several cancers. A genome-wide expression microarray assay was carried out in a miR-219-overexpressed MCF-7 breast cancer cell line, which identified 319 differentially expressed transcripts. The identified transcriptional targets were analyzed for network and functional interrelatedness using the Ingenuity Pathway Analysis (IPA) software. Overexpression of miR-219 in MCF-7 breast cancer cells resulted in accentuated expression of apoptosis- and proliferation-related anti-viral immunodulators of the Jak-STAT and NF-κβ pathways. These findings suggest that long-term night shiftwork exposure may lead to the methylation-dependent downregulation of miR-219, which may in turn lead to the downregulation of immunomediated antitumor activity and increased breast cancer risk. © 2013 Wiley Periodicals, Inc.

Plasticity of DNA methylation and gene expression under zinc deficiency in Arabidopsis roots.

PubMed

Chen, Xiaochao; Schönberger, Brigitte; Menz, Jochen; Ludewig, Uwe

2018-05-25

DNA methylation is a heritable chromatin modification that maintains chromosome stability, regulates transposon silencing and appears to be involved in gene expression in response to environmental conditions. Environmental stress alters DNA methylation patterns that are correlated with gene expression differences. Here, genome-wide differential DNA-methylation was identified upon prolonged Zn deficiency, leading to hypo- and hyper-methylated chromosomal regions. Preferential CpG methylation changes occurred in gene promoters and gene bodies, but did not overlap with transcriptional start sites. Methylation changes were also prominent in transposable elements. By contrast, non-CG methylation differences were exclusively found in promoters of protein coding genes and in transposable elements. Strongly Zn deficiency-induced genes and their promoters were mostly non-methylated, irrespective of Zn supply. Differential DNA methylation in the CpG and CHG, but not in the CHH context, was found close to a few up-regulated Zn-deficiency genes. However, the transcriptional Zn-deficiency response in roots appeared little correlated with associated DNA methylation changes in promoters or gene bodies. Furthermore, under Zn deficiency, developmental defects were identified in an Arabidopsis mutant lacking non-CpG methylation. The root methylome thus responds specifically to a micro-nutrient deficiency and is important for efficient Zn utilization at low availability, but the relationship of differential methylation and differentially expressed genes is surprisingly poor.

Epigenetic regulation of the circadian clock: role of 5-aza-2′-deoxycytidine

PubMed Central

Tomita, Tatsunosuke; Kurita, Ryoji

2017-01-01

We have been investigating transcriptional regulation of the BMAL1 gene, a critical component of the mammalian clock system including DNA methylation. Here, a more detailed analysis of the regulation of DNA methylation of BMAL1 proceeded in RPMI8402 lymphoma cells. We found that CpG islands in the BMAL1 and the PER2 promoters were hyper- and hypomethylated, respectively and that 5-aza-2′-deoxycytidine (aza-dC) not only enhanced PER2 gene expression but also PER2 oscillation within 24 h in RPMI8402 cells. That is, such hypermethylation of CpG islands in the BMAL1 promoter restricted PER2 expression which was recovered by aza-dC within 1 day in these cells. These results suggest that the circadian clock system can be recovered through BMAL1 expression induced by aza-dC within a day. The RPIB9 promoter of RPMI8402 cells, which is a methylation hotspot in lymphoblastic leukemia, was also hypermethylated and aza-dC gradually recovered RPIB9 expression in 3 days. In addition, methylation-specific PCR revealed a different degree of aza-dC-induced methylation release between BMAL1 and RPIB9. These results suggest that the aza-dC-induced recovery of gene expression from DNA methylation is dependent on a gene, for example the rapid response to demethylation by the circadian system, and thus, is of importance to clinical strategies for treating cancer. PMID:28487473

A recombinant fusion protein and DNA vaccines against foot-and-mouth disease virus type Asia 1 infection in guinea pigs.

PubMed

Zhang, Q; Zhu, M W; Yang, Y Q; Shao, M; Zhang, Z Y; Lan, H Y; Yan, W Y; Wu, J J; Zheng, Z X

2003-01-01

On the basis of amino acid (aa) sequence of the tandem repeat 133-158-20-34-133-158 which consisted of aa 133-158 of VP1 and aa 20-34 of VP4 of Foot-and-mouth disease virus (FMDV) type Asia 1 a recombinant prokaryotic expression vector pAS1-P encoding a fusion protein and eukaryotic expression vectors pAS1-E and pAS1-EdeltaCpG-ODN representing DNA vaccines were constructed. Guinea pigs immunized with these vaccines showed both neutralizing antibody and T cell proliferation responses. FMDV challenge tests for the first time showed that the recombinant fusion protein and pAS1-E and pAS1-EdeltaCpG-ODN vaccines protected 86%, 60% and 43% of guinea pigs from FMDV type Asia1 challenge, respectively. The results also indicated that the immune response of animals treated with the vector pAS1-E containing an oligodeoxynucleotide (ODN), which consisted of immunostimulatory cytosine-phosphate-guanosine (CpG) motifs, was augmented by CpG ODN.

Allele-Specific DNA Methylation and Its Interplay with Repressive Histone Marks at Promoter-Mutant TERT Genes.

PubMed

Stern, Josh Lewis; Paucek, Richard D; Huang, Franklin W; Ghandi, Mahmoud; Nwumeh, Ronald; Costello, James C; Cech, Thomas R

2017-12-26

A mutation in the promoter of the Telomerase Reverse Transcriptase (TERT) gene is the most frequent noncoding mutation in cancer. The mutation drives unusual monoallelic expression of TERT, allowing immortalization. Here, we find that DNA methylation of the TERT CpG island (CGI) is also allele-specific in multiple cancers. The expressed allele is hypomethylated, which is opposite to cancers without TERT promoter mutations. The continued presence of Polycomb repressive complex 2 (PRC2) on the inactive allele suggests that histone marks of repressed chromatin may be causally linked to high DNA methylation. Consistent with this hypothesis, TERT promoter DNA containing 5-methyl-CpG has much increased affinity for PRC2 in vitro. Thus, CpG methylation and histone marks appear to collaborate to maintain the two TERT alleles in different epigenetic states in TERT promoter mutant cancers. Finally, in several cancers, DNA methylation levels at the TERT CGI correlate with altered patient survival. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

Genetic and Epigenetic Inactivation of Kruppel-like Factor 4 in Medulloblastoma1

PubMed Central

Nakahara, Yukiko; Northcott, Paul A; Li, Meihua; Kongkham, Paul N; Smith, Christian; Yan, Hai; Croul, Sidney; Ra, Young-Shin; Eberhart, Charles; Huang, Annie; Bigner, Darell; Grajkowska, Wesia; Van Meter, Timothy; Rutka, James T; Taylor, Michael D

2010-01-01

Although medulloblastoma is the most common pediatric malignant brain tumor, its molecular underpinnings are largely unknown. We have identified rare, recurrent homozygous deletions of Kruppel-like Factor 4 (KLF4) in medulloblastoma using high-resolution single nucleotide polymorphism arrays, digital karyotyping, and genomic real-time polymerase chain reaction (PCR). Furthermore, we show that there is loss of physiological KLF4 expression in more than 40% of primary medulloblastomas both at the RNA and protein levels. Medulloblastoma cell lines drastically increase the expression of KLF4 in response to the demethylating agent 5-azacytidine and demonstrate dense methylation of the promoter CpG island by bisulfite sequencing. Methylation-specific PCR targeting the KLF4 promoter demonstrates CpG methylation in approximately 16% of primary medulloblastomas. Reexpression of KLF4 in the D283 medulloblastoma cell line results in significant growth suppression both in vitro and in vivo. We conclude that KLF4 is inactivated by either genetic or epigenetic mechanisms in a large subset of medulloblastomas and that it likely functions as a tumor suppressor gene in the pathogenesis of medulloblastoma. PMID:20072650

Identification of secretaglobin Scgb2a1 as a target for developmental reprogramming by BPA in the rat prostate.

PubMed

Wong, Rebecca Lee Yean; Wang, Quan; Treviño, Lindsey S; Bosland, Maarten C; Chen, Jing; Medvedovic, Mario; Prins, Gail S; Kannan, Kurunthachalam; Ho, Shuk-Mei; Walker, Cheryl Lyn

2015-01-01

Secretoglobins are a superfamily of secreted proteins thought to participate in inflammation, tissue repair, and tumorigenesis. Secretoglobin family 2A member 1 (Scgb2a1) is a component of prostatein, a major androgen-binding protein secreted by the rat prostate. Using a rat model for developmental reprogramming of susceptibility to prostate carcinogenesis, we identified, by RNA-seq, that Scgb2a1 is significantly upregulated (>100-fold) in the prostate of adult rats neonatally exposed to bisphenol A (BPA), with increased gene expression confirmed by quantitative RT-PCR and chromatin immunoprecipitation for histone H3 lysine 9 acetylation. Bisulfite analysis of both CpG islands located within 10 kb of the Scgb2a1 promoter identified significant hypomethylation of the CpG island upstream of the transcription start site of this gene in the reprogrammed prostate. These data suggest that expression of Scgb2a1 in the adult prostate could be epigenetically reprogrammed by BPA exposure during prostate development, with potential implications for cancer risk and response to chemotherapeutics associated with prostatein binding.

Combinations of various CpG motifs cloned into plasmid backbone modulate and enhance protective immunity of viral replicon DNA anthrax vaccines.

PubMed

Yu, Yun-Zhou; Ma, Yao; Xu, Wen-Hui; Wang, Shuang; Sun, Zhi-Wei

2015-08-01

DNA vaccines are generally weak stimulators of the immune system. Fortunately, their efficacy can be improved using a viral replicon vector or by the addition of immunostimulatory CpG motifs, although the design of these engineered DNA vectors requires optimization. Our results clearly suggest that multiple copies of three types of CpG motifs or combinations of various types of CpG motifs cloned into a viral replicon vector backbone with strong immunostimulatory activities on human PBMC are efficient adjuvants for these DNA vaccines to modulate and enhance protective immunity against anthrax, although modifications with these different CpG forms in vivo elicited inconsistent immune response profiles. Modification with more copies of CpG motifs elicited more potent adjuvant effects leading to the generation of enhanced immunity, which indicated a CpG motif dose-dependent enhancement of antigen-specific immune responses. Notably, the enhanced and/or synchronous adjuvant effects were observed in modification with combinations of two different types of CpG motifs, which provides not only a contribution to the knowledge base on the adjuvant activities of CpG motifs combinations but also implications for the rational design of optimal DNA vaccines with combinations of CpG motifs as "built-in" adjuvants. We describe an efficient strategy to design and optimize DNA vaccines by the addition of combined immunostimulatory CpG motifs in a viral replicon DNA plasmid to produce strong immune responses, which indicates that the CpG-modified viral replicon DNA plasmid may be desirable for use as vector of DNA vaccines.

Polyethyleneimine-functionalized boron nitride nanospheres as efficient carriers for enhancing the immunostimulatory effect of CpG oligodeoxynucleotides

PubMed Central

Zhang, Huijie; Feng, Shini; Yan, Ting; Zhi, Chunyi; Gao, Xiao-Dong; Hanagata, Nobutaka

2015-01-01

CpG oligodeoxynucleotides (ODNs) stimulate innate and adaptive immune responses. Thus, these molecules are promising therapeutic agents and vaccine adjuvants against various diseases. In this study, we developed a novel CpG ODNs delivery system based on polyethyleneimine (PEI)-functionalized boron nitride nanospheres (BNNS). PEI was coated on the surface of BNNS via electrostatic interactions. The prepared BNNS–PEI complexes had positive zeta potential and exhibited enhanced dispersity and stability in aqueous solution. In vitro cytotoxicity assays revealed that the BNNS–PEI complexes with concentrations up to 100 μg/mL exhibited no obvious cytotoxicity. Furthermore, the positively charged surface of the BNNS–PEI complexes greatly improved the loading capacity and cellular uptake efficiency of CpG ODNs. Class B CpG ODNs loaded on the BNNS–PEI complexes enhanced the production of interleukin-6 and tumor necrosis factor-α from peripheral blood mononuclear cells compared with CpG ODNs directly loaded on BNNS. Contrary to the free CpG ODNs or CpG ODNs directly loaded on BNNS, class B CpG ODNs loaded on the BNNS–PEI complexes induced interferon-α simultaneously. PEI coating may have changed the physical form of class B CpG ODNs on BNNS, which further affected their interaction with Toll-like receptor 9 and induced interferon-α. Therefore, BNNS–PEI complexes can be used to enhance the immunostimulatory effect and therapeutic activity of CpG ODNs and the treatment of diseases requiring interleukin-6, tumor necrosis factor-α, and interferon-α. PMID:26346655

Polyethyleneimine-functionalized boron nitride nanospheres as efficient carriers for enhancing the immunostimulatory effect of CpG oligodeoxynucleotides.

PubMed

Zhang, Huijie; Feng, Shini; Yan, Ting; Zhi, Chunyi; Gao, Xiao-Dong; Hanagata, Nobutaka

2015-01-01

CpG oligodeoxynucleotides (ODNs) stimulate innate and adaptive immune responses. Thus, these molecules are promising therapeutic agents and vaccine adjuvants against various diseases. In this study, we developed a novel CpG ODNs delivery system based on polyethyleneimine (PEI)-functionalized boron nitride nanospheres (BNNS). PEI was coated on the surface of BNNS via electrostatic interactions. The prepared BNNS-PEI complexes had positive zeta potential and exhibited enhanced dispersity and stability in aqueous solution. In vitro cytotoxicity assays revealed that the BNNS-PEI complexes with concentrations up to 100 μg/mL exhibited no obvious cytotoxicity. Furthermore, the positively charged surface of the BNNS-PEI complexes greatly improved the loading capacity and cellular uptake efficiency of CpG ODNs. Class B CpG ODNs loaded on the BNNS-PEI complexes enhanced the production of interleukin-6 and tumor necrosis factor-α from peripheral blood mononuclear cells compared with CpG ODNs directly loaded on BNNS. Contrary to the free CpG ODNs or CpG ODNs directly loaded on BNNS, class B CpG ODNs loaded on the BNNS-PEI complexes induced interferon-α simultaneously. PEI coating may have changed the physical form of class B CpG ODNs on BNNS, which further affected their interaction with Toll-like receptor 9 and induced interferon-α. Therefore, BNNS-PEI complexes can be used to enhance the immunostimulatory effect and therapeutic activity of CpG ODNs and the treatment of diseases requiring interleukin-6, tumor necrosis factor-α, and interferon-α.

Fatty acid binding protein 3 (fabp3) is associated with insulin, lipids and cardiovascular phenotypes of the metabolic syndrome through epigenetic modifications in a Northern European family population.

PubMed

Zhang, Yi; Kent, Jack W; Lee, Adam; Cerjak, Diana; Ali, Omar; Diasio, Robert; Olivier, Michael; Blangero, John; Carless, Melanie A; Kissebah, Ahmed H

2013-03-19

Fatty acid-binding proteins (FABPs) play regulatory roles at the nexus of lipid metabolism and signaling. Dyslipidemia in clinical manifestation frequently co-occurs with obesity, insulin resistance and hypertension in the Metabolic Syndrome (MetS). Animal studies have suggested FABPs play regulatory roles in expressing MetS phenotypes. In our family cohort of Northern European descent, transcript levels in peripheral white blood cells (PWBCs) of a key FABPs, FABP3, is correlated with the MetS leading components. However, evidence supporting the functions of FABPs in humans using genetic approaches has been scarce, suggesting FABPs may be under epigenetic regulation. The objective of this study was to test the hypothesis that CpG methylation status of a key regulator of lipid homeostasis, FABP3, is a quantitative trait associated with status of MetS phenotypes in humans. We used a mass-spec based quantitative method, EpiTYPER®, to profile a CpG island that extends from the promoter to the first exon of the FABP3 gene in our family-based cohort of Northern European descent (n=517). We then conducted statistical analysis of the quantitative relationship of CpG methylation and MetS measures following the variance-component association model. Heritability of each methylation and the effect of age and sex on CpG methylation were also assessed in our families. We find that methylation levels of individual CpG units and the regional average are heritable and significantly influenced by age and sex. Regional methylation was strongly associated with plasma total cholesterol (p=0.00028) and suggestively associated with LDL-cholesterol (p=0.00495). Methylation at individual units was significantly associated with insulin sensitivity, lipid particle sizing and diastolic blood pressure (p<0.0028, corrected for multiple testing for each trait). Peripheral white blood cell (PWBC) expression of FABP3 in a separate group of subjects (n=128) negatively correlated with adverse profiles of metabolism (βWHR=-0.72; βLDL-c=-0.53) while positively correlated with plasma adiponectin (β=0.24). Further, we show that differential methylation of FABP3 affects binding activity with nuclear proteins from heart tissue. This region that we found under methylation regulation overlaps with a region actively modified by histone codes in the newly available ENCODE data. Our findings suggest that DNA methylation of FABP3 strongly influences MetS, and this may have important implications for cardiovascular disease.

High-throughput engineering of a mammalian genome reveals building principles of methylation states at CG rich regions.

PubMed

Krebs, Arnaud R; Dessus-Babus, Sophie; Burger, Lukas; Schübeler, Dirk

2014-09-26

The majority of mammalian promoters are CpG islands; regions of high CG density that require protection from DNA methylation to be functional. Importantly, how sequence architecture mediates this unmethylated state remains unclear. To address this question in a comprehensive manner, we developed a method to interrogate methylation states of hundreds of sequence variants inserted at the same genomic site in mouse embryonic stem cells. Using this assay, we were able to quantify the contribution of various sequence motifs towards the resulting DNA methylation state. Modeling of this comprehensive dataset revealed that CG density alone is a minor determinant of their unmethylated state. Instead, these data argue for a principal role for transcription factor binding sites, a prediction confirmed by testing synthetic mutant libraries. Taken together, these findings establish the hierarchy between the two cis-encoded mechanisms that define the DNA methylation state and thus the transcriptional competence of CpG islands.

Epigenetic Inactivation of GALR1 in Head and Neck Cancer

PubMed Central

Misawa, Kiyoshi; Ueda, Yo; Kanazawa, Takeharu; Misawa, Yuki; Jang, Ilwhan; Brenner, John Chadwick; Ogawa, Tetsuya; Takebayashi, Satoru; Grenman, Reidar A.; Herman, James G.; Mineta, Hiroyuki; Carey, Thomas E.

2011-01-01

Purpose One copy of the GALR1 locus on 18q is often deleted and expression is absent in some head and neck squamous cell carcinoma (HNSCC) cell lines. To determine if LOH and hypermethylation might silence the GALR1 gene, promoter methylation status and gene expression were assessed in a large panel of HNSCC cell lines and tumors. Experimental Design Promoter methylation of GALR1 in 72 cell lines and 100 primary tumor samples was analyzed using methylation-specific PCR (MSP). GALR1 expression and methylation status were analyzed further by real-time PCR and bisulfite sequencing analysis. Results The GALR1 promoter was fully or partially methylated in 38 of 72 HNSCC cell lines (52.7%) but not in the majority 18/20 (90.0%) of non-malignant lines. GALR1 methylation was also found in 38/100 (38%) primary tumor specimens. Methylation correlated with decreased GALR1 expression. In tumors methylation was significantly correlated with increased tumor size (P=0.0036), lymph-node status (P=0.0414), tumor stage (P=0.0037), cyclin D1 expression (P=0.0420), and p16 methylation (P=0.0494) and survival (P=0.045). Bisulfite sequencing of 36 CpG sites upstream of the transcription start site revealed that CpG methylation within transcription factor binding sites correlated with complete suppression of GALR1 mRNA. Treatment with TSA and 5-azacytidine restored GALR1 expression. In UM-SCC-23 cells that have total silencing of GALR1, exogenous GALR1 expression and stimulation with galanin suppressed cell proliferation. Conclusions Frequent promoter hypermethylation, gene silencing, association with prognosis, and growth suppression after re-expression support the hypothesis that GALR1 is a tumor suppressor gene in HNSCC. PMID:19047085

Potential roles of DNA methylation in the initiation and establishment of replicative senescence revealed by array-based methylome and transcriptome analyses

PubMed Central

Sakaki, Mizuho; Ebihara, Yukiko; Okamura, Kohji; Nakabayashi, Kazuhiko; Igarashi, Arisa; Matsumoto, Kenji; Hata, Kenichiro; Kobayashi, Yoshiro

2017-01-01

Cellular senescence is classified into two groups: replicative and premature senescence. Gene expression and epigenetic changes are reported to differ between these two groups and cell types. Normal human diploid fibroblast TIG-3 cells have often been used in cellular senescence research; however, their epigenetic profiles are still not fully understood. To elucidate how cellular senescence is epigenetically regulated in TIG-3 cells, we analyzed the gene expression and DNA methylation profiles of three types of senescent cells, namely, replicatively senescent, ras-induced senescent (RIS), and non-permissive temperature-induced senescent SVts8 cells, using gene expression and DNA methylation microarrays. The expression of genes involved in the cell cycle and immune response was commonly either down- or up-regulated in the three types of senescent cells, respectively. The altered DNA methylation patterns were observed in replicatively senescent cells, but not in prematurely senescent cells. Interestingly, hypomethylated CpG sites detected on non-CpG island regions (“open sea”) were enriched in immune response-related genes that had non-CpG island promoters. The integrated analysis of gene expression and methylation in replicatively senescent cells demonstrated that differentially expressed 867 genes, including cell cycle- and immune response-related genes, were associated with DNA methylation changes in CpG sites close to the transcription start sites (TSSs). Furthermore, several miRNAs regulated in part through DNA methylation were found to affect the expression of their targeted genes. Taken together, these results indicate that the epigenetic changes of DNA methylation regulate the expression of a certain portion of genes and partly contribute to the introduction and establishment of replicative senescence. PMID:28158250

Increased Neutrophil Secretion Induced by NLRP3 Mutation Links the Inflammasome to Azurophilic Granule Exocytosis

PubMed Central

Johnson, Jennifer L.; Ramadass, Mahalakshmi; Haimovich, Ariela; McGeough, Matthew D.; Zhang, Jinzhong; Hoffman, Hal M.; Catz, Sergio D.

2017-01-01

Heterozygous mutations in the NLRP3 gene in patients with cryopyrin associated periodic syndrome (CAPS) lead to hyper-responsive inflammasome function. CAPS is a systemic auto-inflammatory syndrome characterized by the activation of the innate immune system induced by elevated pro-inflammatory cytokines, but the involvement of selective innate immune cells in this process is not fully understood. Neutrophil secretion and the toxic components of their granules are mediators of inflammation associated with several human diseases and inflammatory conditions. Here, using the Nlrp3A350V inducible mouse model (MWS CreT) that recapitulates human patients with the A352V mutation in NLRP3 observed in the Muckle-Wells sub-phenotype of CAPS, we studied the relationship between hyper-activation of the inflammasome and neutrophil exocytosis. Using a flow cytometry approach, we show that Nlrp3A350V (MWS) neutrophils express normal basal levels of CD11b at the plasma membrane and that the upregulation of CD11b from secretory vesicles in response to several plasma membrane or endocytic agonist including the bacterial-derived mimetic peptide formyl-Leu-Met-Phe (fMLF) and the unmethylated oligonucleotide CpG is normal in MWS neutrophils. Significant but modest CD11b upregulation in MWS neutrophils compared to wild type was only observed in response to GM-CSF and CpG. The same pattern was observed for the secretion of matrix metalloproteinase-9 (MMP-9) from gelatinase granules in that MMP-9 secretion in MWS neutrophils was not different from that observed in wild-type neutrophils except when stimulated with GM-CSF and CpG. In contrast, azurophilic granule secretion, whose cargoes constitute the most toxic secretory and pro-inflammatory factors of the neutrophil, was markedly dysregulated in MWS neutrophils under both basal and stimulated conditions. This could not be attributed to paracrine effects of secretory cytokines because IL-1β secretion by neutrophils was undetectable under these experimental conditions. The increased azurophilic granule exocytosis in MWS neutrophils was attenuated by treatment with the neutrophil exocytosis inhibitor Nexinhib20. In agreement with a possible neutrophil contribution to systemic inflammation in CAPS, the levels of neutrophil secretory proteins were significantly elevated in the plasma from Nlrp3A350V mice. Altogether, our data indicates an azurophilic granule-selective dysregulation of neutrophil exocytosis in CAPS. PMID:29322034

Transcriptome Analysis of an Insecticide Resistant Housefly Strain: Insights about SNPs and Regulatory Elements in Cytochrome P450 Genes.

PubMed

Mahmood, Khalid; Højland, Dorte H; Asp, Torben; Kristensen, Michael

2016-01-01

Insecticide resistance in the housefly, Musca domestica, has been investigated for more than 60 years. It will enter a new era after the recent publication of the housefly genome and the development of multiple next generation sequencing technologies. The genetic background of the xenobiotic response can now be investigated in greater detail. Here, we investigate the 454-pyrosequencing transcriptome of the spinosad-resistant 791spin strain in relation to the housefly genome with focus on P450 genes. The de novo assembly of clean reads gave 35,834 contigs consisting of 21,780 sequences of the spinosad resistant strain. The 3,648 sequences were annotated with an enzyme code EC number and were mapped to 124 KEGG pathways with metabolic processes as most highly represented pathway. One hundred and twenty contigs were annotated as P450s covering 44 different P450 genes of housefly. Eight differentially expressed P450s genes were identified and investigated for SNPs, CpG islands and common regulatory motifs in promoter and coding regions. Functional annotation clustering of metabolic related genes and motif analysis of P450s revealed their association with epigenetic, transcription and gene expression related functions. The sequence variation analysis resulted in 12 SNPs and eight of them found in cyp6d1. There is variation in location, size and frequency of CpG islands and specific motifs were also identified in these P450s. Moreover, identified motifs were associated to GO terms and transcription factors using bioinformatic tools. Transcriptome data of a spinosad resistant strain provide together with genome data fundamental support for future research to understand evolution of resistance in houseflies. Here, we report for the first time the SNPs, CpG islands and common regulatory motifs in differentially expressed P450s. Taken together our findings will serve as a stepping stone to advance understanding of the mechanism and role of P450s in xenobiotic detoxification.

Tumor suppressor function of PGP9.5 is associated with epigenetic regulation in prostate cancer--novel predictor of biochemical recurrence after radical surgery.

PubMed

Mitsui, Yozo; Shiina, Hiroaki; Hiraki, Miho; Arichi, Naoko; Hiraoka, Takeo; Sumura, Masahiro; Honda, Satoshi; Yasumoto, Hiroaki; Igawa, Mikio

2012-03-01

The expression level of protein G product 9.5 (PGP9.5) is downregulated because of promoter CpG hypermethylation in several tumors. We speculated that impaired regulation of PGP9.5 through epigenetic pathways is associated with the pathogenesis of prostate cancer. CpG methylation of the PGP9.5 gene was analyzed in cultured prostate cancer cell lines, 226 localized prostate cancer samples from radical prostatectomy cases, and 80 benign prostate hyperplasia (BPH) tissues. Following 5-aza-2'-deoxycytidune treatment, increased PGP9.5 mRNA transcript expression was found in the LNCaP and PC3 cell lines. With bisulfite DNA sequencing, partial methylation of the PGP9.5 promoter was shown in LNCaP whereas complete methylation was found in PC3 cells. After transfection of PGP9.5 siRNA, cell viability was significantly accelerated in LNCaP but not in PC3 cells as compared with control siRNA transfection. Promoter methylation of PGP9.5 was extremely low in only one of 80 BPH tissues, whereas it was found in 37 of 226 prostate cancer tissues. Expression of the mRNA transcript of PGP9.5 was significantly lower in methylation (+) than methylation (-) prostate cancer tissues. Multivariate analysis of biochemical recurrence (BCR) after an radical prostatectomy revealed pT category and PGP9.5 methylation as prognostically relevant. Further stratification with the pT category in addition to methylation status identified a stepwise reduction of BCR-free probability. This is the first clinical and comprehensive study of inactivation of the PGP9.5 gene via epigenetic pathways in primary prostate cancer. CpG methylation of PGP9.5 in primary prostate cancer might become useful as a molecular marker for early clinical prediction of BCR after radical prostatectomy. ©2012 AACR.

T cells are influenced by a long non-coding RNA in the autoimmune associated PTPN2 locus.

PubMed

Houtman, Miranda; Shchetynsky, Klementy; Chemin, Karine; Hensvold, Aase Haj; Ramsköld, Daniel; Tandre, Karolina; Eloranta, Maija-Leena; Rönnblom, Lars; Uebe, Steffen; Catrina, Anca Irinel; Malmström, Vivianne; Padyukov, Leonid

2018-06-01

Non-coding SNPs in the protein tyrosine phosphatase non-receptor type 2 (PTPN2) locus have been linked with several autoimmune diseases, including rheumatoid arthritis, type I diabetes, and inflammatory bowel disease. However, the functional consequences of these SNPs are poorly characterized. Herein, we show in blood cells that SNPs in the PTPN2 locus are highly correlated with DNA methylation levels at four CpG sites downstream of PTPN2 and expression levels of the long non-coding RNA (lncRNA) LINC01882 downstream of these CpG sites. We observed that LINC01882 is mainly expressed in T cells and that anti-CD3/CD28 activated naïve CD4 + T cells downregulate the expression of LINC01882. RNA sequencing analysis of LINC01882 knockdown in Jurkat T cells, using a combination of antisense oligonucleotides and RNA interference, revealed the upregulation of the transcription factor ZEB1 and kinase MAP2K4, both involved in IL-2 regulation. Overall, our data suggests the involvement of LINC01882 in T cell activation and hints towards an auxiliary role of these non-coding SNPs in autoimmunity associated with the PTPN2 locus. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

Overexpression of hTERT increases stem-like properties and decreases spontaneous differentiation in human mesenchymal stem cell lines

PubMed Central

2010-01-01

To overcome loss of stem-like properties and spontaneous differentiation those hinder the expansion and application of human mesenchymal stem cells (hMSCs), we have clonally isolated permanent and stable human MSC lines by ectopic overexpression of primary cell cultures of hMSCs with HPV 16 E6E7 and human telomerase reverse transcriptase (hTERT) genes. These cells were found to have a differentiation potential far beyond the ordinary hMSCs. They expressed trophoectoderm and germline specific markers upon differentiation with BMP4 and retinoic acid, respectively. Furthermore, they displayed higher osteogenic and neural differentiation efficiency than primary hMSCs or hMSCs expressed HPV16 E6E7 alone with a decrease in methylation level as proven by a global CpG island methylation profile analysis. Notably, the demethylated CpG islands were highly associated with development and differentiation associated genes. Principal component analysis further pointed out the expression profile of the cells converged toward embryonic stem cells. These data demonstrate these cells not only are a useful tool for the studies of cell differentiation both for the mesenchymal and neurogenic lineages, but also provide a valuable source of cells for cell therapy studies in animal models of skeletal and neurological disorders. PMID:20670406

A varying T cell subtype explains apparent tobacco smoking induced single CpG hypomethylation in whole blood.

PubMed

Bauer, Mario; Linsel, Gunter; Fink, Beate; Offenberg, Kirsten; Hahn, Anne Maria; Sack, Ulrich; Knaack, Heike; Eszlinger, Markus; Herberth, Gunda

2015-01-01

Many recent epigenetic studies report that cigarette smoking reduces DNA methylation in whole blood at the single CpG site cg19859270 within the GPR15 gene. Within two independent cohorts, we confirmed the differentially expression of the GPR15 gene when smokers and non-smokers subjects are compared. By validating the GPR15 protein expression at the cellular level, we found that the observed decreased methylation at this site in white blood cells (WBC) of smokers is mainly caused by the high proportion of CD3+GPR15+ expressing T cells in peripheral blood. In current smokers, the percentage of GPR15+ cells among CD3+ T cells in peripheral blood is significantly higher (15.5 ± 7.2 %, mean ± standard deviation) compared to non-smokers (3.7 ± 1.6 %). Treatment of peripheral blood mononuclear cell (PBMC) cultures with aqueous cigarette smoke extract did not induce a higher proportion of this T cell subtype. Our results underline that DNA hypomethylation at cg19859270 site, observed in WBCs of smokers, did not arise by direct effect of tobacco smoking compounds on methylation of DNA but rather by the enrichment of a tobacco-smoking-induced lymphocyte population in the peripheral blood.

DNA methylation analysis of paediatric low-grade astrocytomas identifies a tumour-specific hypomethylation signature in pilocytic astrocytomas.

PubMed

Jeyapalan, Jennie N; Doctor, Gabriel T; Jones, Tania A; Alberman, Samuel N; Tep, Alexander; Haria, Chirag M; Schwalbe, Edward C; Morley, Isabel C F; Hill, Alfred A; LeCain, Magdalena; Ottaviani, Diego; Clifford, Steven C; Qaddoumi, Ibrahim; Tatevossian, Ruth G; Ellison, David W; Sheer, Denise

2016-05-27

Low-grade gliomas (LGGs) account for about a third of all brain tumours in children. We conducted a detailed study of DNA methylation and gene expression to improve our understanding of the biology of pilocytic and diffuse astrocytomas. Pilocytic astrocytomas were found to have a distinctive signature at 315 CpG sites, of which 312 were hypomethylated and 3 were hypermethylated. Genomic analysis revealed that 182 of these sites are within annotated enhancers. The signature was not present in diffuse astrocytomas, or in published profiles of other brain tumours and normal brain tissue. The AP-1 transcription factor was predicted to bind within 200 bp of a subset of the 315 differentially methylated CpG sites; the AP-1 factors, FOS and FOSL1 were found to be up-regulated in pilocytic astrocytomas. We also analysed splice variants of the AP-1 target gene, CCND1, which encodes cell cycle regulator cyclin D1. CCND1a was found to be highly expressed in both pilocytic and diffuse astrocytomas, but diffuse astrocytomas have far higher expression of the oncogenic variant, CCND1b. These findings highlight novel genetic and epigenetic differences between pilocytic and diffuse astrocytoma, in addition to well-described alterations involving BRAF, MYB and FGFR1.

Neuromodulation intrinsic to the central pattern generator for escape swimming in Tritonia.

PubMed

Katz, P S

1998-11-16

Extrinsic neuromodulatory inputs to central pattern generators (CPGs) can alter the properties and synaptic interactions of neurons in those circuits and thereby modify the output of the CPG. Recent work in a number of systems has now demonstrated that neurons intrinsic to CPG can also evoke neuromodulatory actions on other members of the CPG. Such "intrinsic neuromodulation" plays a role in controlling the CPG underlying the escape swim response of the nudibrach mollusc, Tritonia diomedea. The dorsal swim interneurons (DSIs) are a bilaterally represented set of three serotonergic neurons that participate in the generation of the rhythmic swim motor program. Serotonin released from these CPG neurons functions both as a fast neurotransmitter and as a slower neuromodulator. In its modulatory role, serotonin enhances the release of neurotransmitter from another CPG neuron, C2, and also increases C2 excitability by decreasing spike frequency adaptation. These neuromodulatory actions intrinsic to the CPG may be important for the initial self-configuration of the system into a function CPG and for experience-dependent changes in the output such as behavioral sensitization and habituation.

Effect of CpG dinucleotides within IgH switch region repeats on immunoglobulin class switch recombination.

PubMed

Zhang, Zheng Z; Hsieh, Chih-Lin; Okitsu, Cindy Yen; Han, Li; Yu, Kefei; Lieber, Michael R

2015-08-01

Immunoglobulin (Ig) heavy chains undergo class switch recombination (CSR) to change the heavy chain isotype from IgM to IgG, A or E. The switch regions are several kilobases long, repetitive, and G-rich on the nontemplate strand. They are also relatively depleted of CpG (also called CG) sites for unknown reasons. Here we use synthetic switch regions at the IgH switch alpha (Sα) locus to test the effect of CpG sites and to try to understand why the IgH switch sequences evolved to be relatively depleted of CpG. We find that even just two CpG sites within an 80 bp synthetic switch repeat iterated 15 times (total switch region length of 1200 bp containing 30 CpG sites) are sufficient to dramatically reduce both Ig CSR and transcription through the switch region from the upstream Iα sterile transcript promoter, which is the promoter that directs transcripts through the Sα region. De novo DNA methylation occurs at the four CpG sites in and around the Iα promoter when each 80 bp Iα switch repeat contains the two CpG sites. Thus, a relatively low density of CpG sites within the switch repeats can induce upstream CpG methylation at the IgH alpha locus, and cause a substantial decrease in transcription from the sterile transcript promoter. This effect is likely the reason that switch regions evolved to contain very few CpG sites. We discuss these findings as they relate to DNA methylation and to Ig CSR. Copyright © 2015 Elsevier Ltd. All rights reserved.

Targeted-bisulfite sequence analysis of the methylation of CpG islands in genes encoding PNPLA3, SAMM50, and PARVB of patients with non-alcoholic fatty liver disease.

PubMed

Kitamoto, Takuya; Kitamoto, Aya; Ogawa, Yuji; Honda, Yasushi; Imajo, Kento; Saito, Satoru; Yoneda, Masato; Nakamura, Takahiro; Nakajima, Atsushi; Hotta, Kikuko

2015-08-01

The pathogenesis of non-alcoholic fatty liver disease (NAFLD) is affected by epigenetic factors as well as by genetic variation. We performed targeted-bisulfite sequencing to determine the levels of DNA methylation of 4 CpG islands (CpG99, CpG71, CpG26, and CpG101) in the regulatory regions of PNPLA3, SAMM50, PARVB variant 1, and PARVB variant 2, respectively. We compared the levels of methylation of DNA in the livers of the first and second sets of patients with mild (fibrosis stages 0 and 1) or advanced (fibrosis stages 2 to 4) NAFLD and in those of patients with mild (F0 to F2) or advanced (F3 and F4) chronic hepatitis C infection. The hepatic mRNA levels of PNPLA3, SAMM50, and PARVB were measured using qPCR. CpG26, which resides in the regulatory region of PARVB variant 1, was markedly hypomethylated in the livers of patients with advanced NAFLD. Conversely, CpG99 in the regulatory region of PNPLA3 was substantially hypermethylated in these patients. These differences in DNA methylation were replicated in a second set of patients with NAFLD or chronic hepatitis C. PNPLA3 mRNA levels in the liver of the same section of a biopsy specimen used for genomic DNA preparation were lower in patients with advanced NAFLD compared with those with mild NAFLD and correlated inversely with CpG99 methylation in liver DNA. Moreover, the levels of CpG99 methylation and PNPLA3 mRNA were affected by the rs738409 genotype. Hypomethylation of CpG26 and hypermethylation of CpG99 may contribute to the severity of fibrosis in patients with NAFLD or chronic hepatitis C infection. Copyright © 2015 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved.

Interleukin-12- and Gamma Interferon-Dependent Protection against Malaria Conferred by CpG Oligodeoxynucleotide in Mice

PubMed Central

Gramzinski, Robert A.; Doolan, Denise L.; Sedegah, Martha; Davis, Heather L.; Krieg, Arthur M.; Hoffman, Stephen L.

2001-01-01

Unmethylated CpG dinucleotides in bacterial DNA or synthetic oligodeoxynucleotides (ODNs) cause B-cell proliferation and immunoglobulin secretion, monocyte cytokine secretion, and activation of natural killer (NK) cell lytic activity and gamma interferon (IFN-γ) secretion in vivo and in vitro. The potent Th1-like immune activation by CpG ODNs suggests a possible utility for enhancing innate immunity against infectious pathogens. We therefore investigated whether the innate immune response could protect against malaria. Treatment of mice with CpG ODN 1826 (TCCATGACGTTCCTGACGTT, with the CpG dinucleotides underlined) or 1585 (ggGGTCAACGTTGAgggggG, with g representing diester linkages and phosphorothioate linkages being to the right of lowercase letters) in the absence of antigen 1 to 2 days prior to challenge with Plasmodium yoelii sporozoites conferred sterile protection against infection. A higher level of protection was consistently induced by CpG ODN 1826 compared with CpG ODN 1585. The protective effects of both CpG ODNs were dependent on interleukin-12, as well as IFN-γ. Moreover, CD8+ T cells (but not CD4+ T cells), NK cells, and nitric oxide were implicated in the CpG ODN 1585-induced protection. These data establish that the protective mechanism induced by administration of CpG ODN 1585 in the absence of parasite antigen is similar in nature to the mechanism induced by immunization with radiation-attenuated P. yoelii sporozoites or with plasmid DNA encoding preerythrocytic-stage P. yoelii antigens. We were unable to confirm whether CD8+ T cells, NK cells, or nitric oxide were required for the CpG ODN 1826-induced protection, but this may reflect differences in the potency of the ODNs rather than a real difference in the mechanism of action of the two ODNs. This is the first report that stimulation of the innate immune system by CpG immunostimulatory motifs can confer sterile protection against malaria. PMID:11179339

GaussianCpG: a Gaussian model for detection of CpG island in human genome sequences.

PubMed

Yu, Ning; Guo, Xuan; Zelikovsky, Alexander; Pan, Yi

2017-05-24

As crucial markers in identifying biological elements and processes in mammalian genomes, CpG islands (CGI) play important roles in DNA methylation, gene regulation, epigenetic inheritance, gene mutation, chromosome inactivation and nuclesome retention. The generally accepted criteria of CGI rely on: (a) %G+C content is ≥ 50%, (b) the ratio of the observed CpG content and the expected CpG content is ≥ 0.6, and (c) the general length of CGI is greater than 200 nucleotides. Most existing computational methods for the prediction of CpG island are programmed on these rules. However, many experimentally verified CpG islands deviate from these artificial criteria. Experiments indicate that in many cases %G+C is < 50%, CpG obs /CpG exp varies, and the length of CGI ranges from eight nucleotides to a few thousand of nucleotides. It implies that CGI detection is not just a straightly statistical task and some unrevealed rules probably are hidden. A novel Gaussian model, GaussianCpG, is developed for detection of CpG islands on human genome. We analyze the energy distribution over genomic primary structure for each CpG site and adopt the parameters from statistics of Human genome. The evaluation results show that the new model can predict CpG islands efficiently by balancing both sensitivity and specificity over known human CGI data sets. Compared with other models, GaussianCpG can achieve better performance in CGI detection. Our Gaussian model aims to simplify the complex interaction between nucleotides. The model is computed not by the linear statistical method but by the Gaussian energy distribution and accumulation. The parameters of Gaussian function are not arbitrarily designated but deliberately chosen by optimizing the biological statistics. By using the pseudopotential analysis on CpG islands, the novel model is validated on both the real and artificial data sets.

High glucose induces podocyte epithelial-to-mesenchymal transition by demethylation-mediated enhancement of MMP9 expression

PubMed Central

Ling, Li; Chen, Libo; Zhang, Changning; Gui, Shuyan; Zhao, Haiyan; Li, Zhengzhang

2018-01-01

Abnormal expression of matrix metalloproteinase 9 (MMP9) is correlated with podocyte epithelial-to-mesenchymal transition (EMT) in diabetic nephropathy (DN). However, the mechanisms underlying this process are not well defined. Site-specific demethylation may sustain high expression levels of target genes. In the present study, in order to investigate the association between DNA demethylation of MMP9 promoter and podocyte EMT in DN, human podocytes were cultured in high-glucose (HG) medium and a rat model of DN was established by intraperitoneal injection of streptozotocin (STZ) to determine whether site-specific demethylation of the MMP9 promoter was involved in regulating podocyte EMT in DN. The MTT assay was used to assess the effects of HG culture on the growth of podocytes, and the demethylation status of the MMP9 promoter was assessed by bisulfite sequencing polymerase chain reaction. mRNA and protein expression levels of MMP9, α-smooth muscle actin (α-SMA), podocalyxin and fibronectin-1 in podocytes were assessed by reverse transcription-quantitative PCR (RT-qPCR) and western blot analyses. The results demonstrated that HG treatment up regulated the expression of MMP9, α-SMA and fibronectin-1, but down regulated the expression of podocalyxin in podocytes. The MMP9 promoter region was revealed to contain a variety of demethylated CpG sites, and HG treatment reduced the rate of MMP9 promotermethylation, which, in turn, enhanced its promoter activity. In summary, these data suggested that demethylation of the MMP9 promoter may serve an important role in podocyte EMT in DN. The demethylation status of the MMP9 promoter maybe used as an important prognostic marker of DN in clinic. PMID:29436620

Whole-genome transcription and DNA methylation analysis of peripheral blood mononuclear cells identified aberrant gene regulation pathways in systemic lupus erythematosus.

PubMed

Zhu, Honglin; Mi, Wentao; Luo, Hui; Chen, Tao; Liu, Shengxi; Raman, Indu; Zuo, Xiaoxia; Li, Quan-Zhen

2016-07-13

Recent achievement in genetics and epigenetics has led to the exploration of the pathogenesis of systemic lupus erythematosus (SLE). Identification of differentially expressed genes and their regulatory mechanism(s) at whole-genome level will provide a comprehensive understanding of the development of SLE and its devastating complications, lupus nephritis (LN). We performed whole-genome transcription and DNA methylation analysis in PBMC of 30 SLE patients, including 15 with LN (SLE LN(+)) and 15 without LN (SLE LN(-)), and 25 normal controls (NC) using HumanHT-12 Beadchips and Illumina Human Methy450 chips. The serum proinflammatory cytokines were quantified using Bio-plex Human Cytokine 27-plex assay. Differentially expressed genes and differentially methylated CpG were analyzed with GenomeStudio, R, and SAM software. The association between DNA methylation and gene expression were tested. Gene interaction pathways of the differentially expressed genes were analyzed by IPA software. We identified 552 upregulated genes and 550 downregulated genes in PBMC of SLE. Integration of DNA methylation and gene expression profiling showed that 334 upregulated genes were hypomethylated, and 479 downregulated genes were hypermethylated. Pathway analysis on the differential genes in SLE revealed significant enrichment in interferon (IFN) signaling and toll-like receptor (TLR) signaling pathways. Nine IFN- and seven TLR-related genes were identified and displayed step-wise increase in SLE LN(-) and SLE LN(+). Hypomethylated CpG sites were detected on these genes. The gene expressions for MX1, GPR84, and E2F2 were increased in SLE LN(+) as compared to SLE LN(-) patients. The serum levels of inflammatory cytokines, including IL17A, IP-10, bFGF, TNF-α, IL-6, IL-15, GM-CSF, IL-1RA, IL-5, and IL-12p70, were significantly elevated in SLE compared with NC. The levels of IL-15 and IL1RA correlated with their mRNA expression. The upregulation of IL-15 may be regulated by hypomethylated CpG sites in the promotor region of the gene. Our study has demonstrated that significant number of differential genes in SLE were involved in IFN, TLR signaling pathways, and inflammatory cytokines. The enrichment of differential genes has been associated with aberrant DNA methylation, which may be relevant to the pathogenesis of SLE. Our observations have laid the groundwork for further diagnostic and mechanistic studies of SLE and LN.

Induction of AID-targeting adaptor 14-3-3γ is mediated by NF-κB-dependent recruitment of CFP1 to the 5′-CpG-3′-rich 14-3-3γ promoter and is sustained by E2A

PubMed Central

Mai, Thach; Pone, Egest J.; Li, Guideng; Lam, Tonika S.; Moehlman, J’aime; Xu, Zhenming; Casali, Paolo

2013-01-01

Class switch DNA recombination (CSR) crucially diversifies antibody biological effectors functions. 14-3-3γ specifically binds to the 5′-AGCT-3′ repeats in the IgH locus switch (S) regions. By directly interacting with the C-terminal region of activation-induced cytidine deaminase (AID), 14-3-3γ targets this enzyme to S regions to mediate CSR. Here, we showed that 14-3-3γ was expressed in germinal center B cells in vivo and induced in B cells by T-dependent and T-independent primary CSR-inducing stimuli in vitro in humans and mice. Induction of 14-3-3γ was rapid, peaking within 3 h of stimulation by lipopolysaccharides (LPS), and sustained over the course of AID and CSR induction. It was dependent on recruitment of NF-κB to the 14-3-3γ gene promoter. The NF-κB recruitment enhanced the occupancy of the CpG island within the 14-3-3γ promoter by CFP1, a component of the COMPASS histone methyltransferase complex, and promoter-specific enrichment of histone 3 lysine 4 trimethylation (H3K4me3), which is indicative of open chromatin state and marks transcription-competent promoters. NF-κB also potentiated the binding of B cell lineage-specific factor E2A to an E-box motif located immediately downstream of the two closely-spaced transcription start sites (TSSs) for sustained 14-3-3γ expression and CSR induction. Thus, 14-3-3γ induction in CSR is enabled by the CFP1-mediated H3K4me3 enrichment in the promoter, dependent on NF-κB and sustained by E2A. PMID:23851690

Research on DNA methylation of human osteosarcoma cell MGMT and its relationship with cell resistance to alkylating agents.

PubMed

Guo, Jun; Cui, Qiu; Jiang, WeiHao; Liu, Cheng; Li, DingFeng; Zeng, Yanjun

2013-08-01

The objective of this study was to explore the O(6)-methylguanine-DNA methyltransferase (MGMT) gene methylation status and its protein expression, as well as the effects of demethylating agent 5-Aza-2'-deoxycytidine (5-Aza-CdR) on MGMT gene expression and its resistance to alkylating agents, and to elucidate MGMT expression mechanism and significance in osteosarcoma. The human osteosarcoma cell lines Saos-2 and MG-63 were collected and treated with 5-Aza-CdR for 6 days. The cells not treated with 5-Aza-CdR were set as a negative control. The genomic DNA was extracted from the Saos-2 and MG-63 cells using methylation-specific PCR to detect the promoter CpG island methylation status of the MGMT gene. Cell sensitivity to alkylating agents before and after drug administration was detected by the MTT method. The variation in MGMT gene mRNA and protein was detected by reverse transcription PCR (RT-PCR) and Western blotting. The MGMT promoter gene of normal Saos-2 cells was methylated, with reduced MGMT mRNA and protein expression; the MGMT mRNA and protein expression of Saos-2 cells treated with 5-Aza-CdR was obviously enhanced, and its sensitivity to alkylating agents was reversed. Meanwhile, with promoter CpG island unmethylation of the MGMT gene, MGMT protein was expressed in the normal MG-63 cells and the MG-63 cells treated with 5-Aza-CdR, and both showed resistance to alkylating agents. The methylation status of the MGMT gene promoter in human osteosarcoma cells reflected the cells' ability to induce MGMT protein expression and can be used as a molecular marker to project the sensitivity of cancer tissues to alkylating agent drugs.

IRAK-M alters the polarity of macrophages to facilitate the survival of Mycobacterium tuberculosis.

PubMed

Shen, Pei; Li, Quan; Ma, Jilei; Tian, Maopeng; Hong, Fei; Zhai, Xinjie; Li, Jianrong; Huang, Hanju; Shi, Chunwei

2017-08-23

Intracellular bacterium, Mycobacterium tuberculosis (M. tb), infects specifically macrophages as host cells. IRAK-M, a member of IRAK family, is a negative regulator in TLR signaling and specifically expresses in monocytes and macrophages. The role of IRAK-M in intracellular growth of M. tb and macrophage polarization was explored, for deeply understanding the pathogenesis of M. tb, the significance of IRAK-M to innate immunity and pathogen-host interaction. IRAK-M expression was detected in M. tb infected macrophages and in human lung tissue of pulmonary tuberculosis with immunofluorescence staining, Western blot and immunohistochemistry. IRAK-M knock-down and over-expressing cell strains were constructed and intracellular survival of M. tb was investigated by acid-fast staining and colony forming units. Molecular markers of M1-type (pSTAT1 and iNOS) and M2-type (pSTAT6 and Arg-1) macrophages were detected using Western blot in IRAK-M knockdown U937 cells infected with M. tb H37Rv. U937 cells were stimulated with immunostimulant CpG7909 into M1 status and then infected with M. tb H37Rv. Expression of IRAK-M, IRAK-4 and iNOS was detected with immunofluorescence staining and Western blot, to evaluate the effect of IRAK-M to CpG directed M1-type polarization of macrophages during M. tb infection. Molecules related with macrophage's bactericidal ability such as Hif-1 and phosphorylated ERK1/2 were detected with immunohistochemistry and Western blot. IRAK-M increased in M. tb infected macrophage cells and also in human lung tissue of pulmonary tuberculosis. IRAK-M over-expression resulted in higher bacterial load, while IRAK-M interference resulted in lower bacterial load in M. tb infected cells. During M. tb infection, IRAK-M knockdown induced M1-type, while inhibited M2-type polarization of macrophage. M1-type polarization of U937 cells induced by CpG7909 was inhibited by M. tb infection, which was reversed by IRAK-M knockdown in U937 cells. IRAK-M affected Hif-1 and MAPK signaling cascade during M. tb infection. Conclusively, IRAK-M might alter the polarity of macrophages, to facilitate intracellular survival of M. tb and affect Th1-type immunity of the host, which is helpful to understanding the pathogenesis of M. tb.

Epicutaneous immunization with ovalbumin and CpG induces TH1/TH17 cytokines, which regulate IgE and IgG2a production

PubMed Central

Majewska-Szczepanik, Monika; Askenase, Philip W.; Lobo, Francis M.; Marcińska, Katarzyna; Wen, Li; Szczepanik, Marian

2017-01-01

Background Subcutaneous allergen-specific immunotherapy is a standard route for the immunotherapy of allergic diseases. It modulates the course of allergy and can generate long-term remission. However, subcutaneous allergen-specific immunotherapy can also induce anaphylaxis in some patients, and therefore additional routes of administration should be investigated to improve the safety and tolerability of immunotherapy. Objective We sought to determine whether epicutaneous treatment with antigen in the presence of a Toll-like receptor 9 agonist can suppress TH2-mediated responses in an antigen-specific manner. Methods Epicutaneous immunization was performed by applying a skin patch soaked with ovalbumin (OVA) plus CpG, and its suppressor activity was determined by using the mouse model of atopic dermatitis. Finally, adoptive cell transfers were implemented to characterize the regulatory cells that are induced by epicutaneous immunization. Results Epicutaneous immunization with OVA and CpG reduces the production of OVA-specific IgE and increases the synthesis of OVA-specific IgG2a antibodies in an antigen-specific manner. Moreover, eosinophil peroxidase activity in the skin and production of IL-4, IL-5, IL-10, and IL-13 are suppressed. The observed reduction of IgE synthesis is transferable with T-cell receptor (TCR) αβ+CD4+CD25− cells, whereas IgG2a production is dependent on both TCRαβ+ and TCRγδ+ T cells. Further experiments show that the described phenomenon is myeloid differentiation primary response 88, IFN-γ, and IL-17A dependent. Finally, the results suggest that epicutaneous immunization with OVA and CpG decreases the synthesis of OVA-specific IgE and skin eosinophil peroxidase activity in mice with ongoing skin allergy. Conclusion Epicutaneous application of protein antigen in the presence of adjuvant could be an attractive needle-free and self-administered immunotherapy for allergic diseases. PMID:26810716

CpG Dinucleotide Frequencies Reveal the Role of Host Methylation Capabilities in Parvovirus Evolution

PubMed Central

Upadhyay, Mohita; Samal, Jasmine; Kandpal, Manish; Vasaikar, Suhas; Biswas, Banhi; Gomes, James

2013-01-01

Parvoviruses are rapidly evolving viruses that infect a wide range of hosts, including vertebrates and invertebrates. Extensive methylation of the parvovirus genome has been recently demonstrated. A global pattern of methylation of CpG dinucleotides is seen in vertebrate genomes, compared to “fractional” methylation patterns in invertebrate genomes. It remains unknown if the loss of CpG dinucleotides occurs in all viruses of a given DNA virus family that infect host species spanning across vertebrates and invertebrates. We investigated the link between the extent of CpG dinucleotide depletion among autonomous parvoviruses and the evolutionary lineage of the infected host. We demonstrate major differences in the relative abundance of CpG dinucleotides among autonomous parvoviruses which share similar genome organization and common ancestry, depending on the infected host species. Parvoviruses infecting vertebrate hosts had significantly lower relative abundance of CpG dinucleotides than parvoviruses infecting invertebrate hosts. The strong correlation of CpG dinucleotide depletion with the gain in TpG/CpA dinucleotides and the loss of TpA dinucleotides among parvoviruses suggests a major role for CpG methylation in the evolution of parvoviruses. Our data present evidence that links the relative abundance of CpG dinucleotides in parvoviruses to the methylation capabilities of the infected host. In sum, our findings support a novel perspective of host-driven evolution among autonomous parvoviruses. PMID:24109231

Nanoparticle conjugation enhances the immunomodulatory effects of intranasally delivered CpG in house dust mite-allergic mice

DOE PAGES

Ballester, Marie; Jeanbart, Laura; de Titta, Alexandre; ...

2015-09-21

An emerging strategy in preventing and treating airway allergy consists of modulating the immune response induced against allergens in the lungs. CpG oligodeoxynucleotides have been investigated in airway allergy studies, but even if promising, efficacy requires further substantiation. We investigated the effect of pulmonary delivery of nanoparticle (NP)-conjugated CpG on lung immunity and found that NP-CpG led to enhanced recruitment of activated dendritic cells and to Th1 immunity compared to free CpG. We then evaluated if pulmonary delivery of NP-CpG could prevent and treat house dust mite-induced allergy by modulating immunity directly in lungs. When CpG was administered as immunomodulatorymore » therapy prior to allergen sensitization, we found that NP-CpG significantly reduced eosinophilia, IgE levels, mucus production and Th2 cytokines, while free CpG had only a moderate effect on these parameters. In a therapeutic setting where CpG was administered after allergen sensitization, we found that although both free CpG and NP-CpG reduced eosinophilia and IgE levels to the same extent, NP conjugation of CpG significantly enhanced reduction of Th2 cytokines in lungs of allergic mice. Taken together, these data highlight benefits of NP conjugation and the relevance of NP-CpG as allergen-free therapy to modulate lung immunity and treat airway allergy.« less

CpG dinucleotide frequencies reveal the role of host methylation capabilities in parvovirus evolution.

PubMed

Upadhyay, Mohita; Samal, Jasmine; Kandpal, Manish; Vasaikar, Suhas; Biswas, Banhi; Gomes, James; Vivekanandan, Perumal

2013-12-01

Parvoviruses are rapidly evolving viruses that infect a wide range of hosts, including vertebrates and invertebrates. Extensive methylation of the parvovirus genome has been recently demonstrated. A global pattern of methylation of CpG dinucleotides is seen in vertebrate genomes, compared to "fractional" methylation patterns in invertebrate genomes. It remains unknown if the loss of CpG dinucleotides occurs in all viruses of a given DNA virus family that infect host species spanning across vertebrates and invertebrates. We investigated the link between the extent of CpG dinucleotide depletion among autonomous parvoviruses and the evolutionary lineage of the infected host. We demonstrate major differences in the relative abundance of CpG dinucleotides among autonomous parvoviruses which share similar genome organization and common ancestry, depending on the infected host species. Parvoviruses infecting vertebrate hosts had significantly lower relative abundance of CpG dinucleotides than parvoviruses infecting invertebrate hosts. The strong correlation of CpG dinucleotide depletion with the gain in TpG/CpA dinucleotides and the loss of TpA dinucleotides among parvoviruses suggests a major role for CpG methylation in the evolution of parvoviruses. Our data present evidence that links the relative abundance of CpG dinucleotides in parvoviruses to the methylation capabilities of the infected host. In sum, our findings support a novel perspective of host-driven evolution among autonomous parvoviruses.

Immunostimulatory Oligodeoxynucleotides Containing the CpG Motif are Effective as Immune Adjuvants in Tumor Antigen Immunization

NASA Astrophysics Data System (ADS)

Weiner, George J.; Liu, Hsin-Ming; Wooldridge, James E.; Dahle, Christopher E.; Krieg, Arthur M.

1997-09-01

Recent advances in our understanding of the immune response are allowing for the logical design of new approaches to cancer immunization. One area of interest is the development of new immune adjuvants. Immunostimulatory oligodeoxynucleotides containing the CpG motif (CpG ODN) can induce production of a wide variety of cytokines and activate B cells, monocytes, dendritic cells, and NK cells. Using the 38C13 B cell lymphoma model, we assessed whether CpG ODN can function as immune adjuvants in tumor antigen immunization. The idiotype served as the tumor antigen. Select CpG ODN were as effective as complete Freund's adjuvant at inducing an antigen-specific antibody response but were associated with less toxicity. These CpG ODN induced a higher titer of antigen-specific IgG2a than did complete Freund's adjuvant, suggesting an enhanced TH1 response. Mice immunized with CpG ODN as an adjuvant were protected from tumor challenge to a degree similar to that seen in mice immunized with complete Freund's adjuvant. We conclude that CpG ODN are effective as immune adjuvants and are attractive as part of a tumor immunization strategy.

DNA containing CpG motifs induces angiogenesis

NASA Astrophysics Data System (ADS)

Zheng, Mei; Klinman, Dennis M.; Gierynska, Malgorzata; Rouse, Barry T.

2002-06-01

New blood vessel formation in the cornea is an essential step in the pathogenesis of a blinding immunoinflammatory reaction caused by ocular infection with herpes simplex virus (HSV). By using a murine corneal micropocket assay, we found that HSV DNA (which contains a significant excess of potentially bioactive "CpG" motifs when compared with mammalian DNA) induces angiogenesis. Moreover, synthetic oligodeoxynucleotides containing CpG motifs attract inflammatory cells and stimulate the release of vascular endothelial growth factor (VEGF), which in turn triggers new blood vessel formation. In vitro, CpG DNA induces the J774A.1 murine macrophage cell line to produce VEGF. In vivo CpG-induced angiogenesis was blocked by the administration of anti-mVEGF Ab or the inclusion of "neutralizing" oligodeoxynucleotides that specifically oppose the stimulatory activity of CpG DNA. These findings establish that DNA containing bioactive CpG motifs induces angiogenesis, and suggest that CpG motifs in HSV DNA may contribute to the blinding lesions of stromal keratitis.

[Quality and compliance with Clinical Practice Guidelines of Chronic Noncommunicable Diseases in primary care].

PubMed

Poblano-Verástegui, Ofelia; Vieyra-Romero, Waldo I; Galván-García, Ángel F; Fernández-Elorriaga, María; Rodríguez-Martínez, Antonia I; Saturno-Hernández, Pedro J

2017-01-01

To assess the quality and compliance of clinical practice guidelines (CPG) applicable to chronic non-communicable diseases (CNCD) in primary healthcare (CS), and views of staff on the barriers, facilitators and their use. 18 valued CPG with AGREEII, 3 are selected to develop indicators and assess compliance using lot quality acceptance sample (LQAS, standard 75 / 95% threshold 40 / 75% respectively, α:0. 05, β:0. 10) on 5 CS. 70 professionals surveyed about knowledge and use of CPG. Average quality of the CPG was 57.2%; low rating in domains: "Applicability" (<25%), "Stakeholder involvement" (43.5%) and "Rigour of development" (55.0%). Compliance in CS ranges from 39 to 53.4%. Professionals show uneven knowledge of CPG; 44 to 45% (according to CPG), they declare that they are not used, they identify as main barriers the lack of training, and their difficult accessibility and management. The quality and implementation of evaluated CPG is deficient constituting an opportunity of improvement in health services.

Methylation profiling in individuals with Russell-Silver syndrome.

PubMed

Peñaherrera, Maria S; Weindler, Susanne; Van Allen, Margot I; Yong, Siu-Li; Metzger, Daniel L; McGillivray, Barbara; Boerkoel, Cornelius; Langlois, Sylvie; Robinson, Wendy P

2010-02-01

Russell-Silver syndrome (RSS) is a heterogeneous disorder associated with pre- and post-natal growth restriction and relative macrocephaly. Involvement of imprinted genes on both chromosome 7 and 11p15.5 has been reported. To further characterize the role of epimutations in RSS we evaluated the methylation status at both 11p15.5 imprinting control regions (ICRs): ICR1 associated with H19/IGF2 expression and ICR2 (KvDMR1) associated with CDKN1C expression in a series of 35 patients with RSS. We also evaluated methylation at the promoter regions of other imprinted genes involved in growth such as PLAGL1 (6q24), GCE (7q21), and PEG10 (7q21) in this series of 35 patients with RSS. Thirteen of the 35 patient samples, but none of 22 controls, showed methylation levels at ICR1 that were more than 2 SD below the mean for controls. Three RSS patients were highly methylated at the SCGE promoter, all of which were diagnosed with upd(7)mat. To identify further potential global methylation changes in RSS patients, a subset of 22 patients were evaluated at 1505 CpG sites by the Illumina GoldenGate methylation array. Among the few CpG sites displaying a significant difference between RSS patients and controls, was a CpG associated with the H19 promoter. No other sites associated with known imprinted genes were identified as abnormally methylated in RSS patients by this approach. While the association of hypomethylation of the H19/IGF2 ICR1 is clear, the continuous distribution of methylation values among the patients and controls complicates the establishment of clear cut-offs for clinical diagnosis. Copyright 2010 Wiley-Liss, Inc.

The CpG island encompassing the promoter and first exon of human DNMT3L gene is a PcG/TrX response element (PRE).

PubMed

Basu, Amitava; Dasari, Vasanthi; Mishra, Rakesh K; Khosla, Sanjeev

2014-01-01

DNMT3L, a member of DNA methyltransferases family, is present only in mammals. As it provides specificity to the action of de novo methyltransferases, DNMT3A and DNMT3B and interacts with histone H3, DNMT3L has been invoked as the molecule that can read the histone code and translate it into DNA methylation. It plays an important role in the initiation of genomic imprints during gametogenesis and in nuclear reprogramming. With important functions attributed to it, it is imperative that the DNMT3L expression is tightly controlled. Previously, we had identified a CpG island within the human DNMT3L promoter and first exon that showed loss of DNA methylation in cancer samples. Here we show that this Differentially Methylated CpG island within DNMT3L (DNMT3L DMC) acts to repress transcription, is a Polycomb/Trithorax Response Element (PRE) and interacts with both PRC1 and PRC2 Polycomb repressive complexes. In addition, it adopts inactive chromatin conformation and is associated with other inactive chromatin-specific proteins like SUV39H1 and HP1. The presence of DNMT3L DMC also influences the adjacent promoter to adopt repressive histone post-translational modifications. Due to its association with multiple layers of repressive epigenetic modifications, we believe that PRE within the DNMT3L DMC is responsible for the tight regulation of DNMT3L expression and the aberrant epigenetic modifications of this region leading to DNMT3L overexpression could be the reason of nuclear programming during carcinogenesis.

In vitro CpG methylation increases the transformation efficiency of Borrelia burgdorferi strains harboring the endogenous linear plasmid lp56.

PubMed

Chen, Qiang; Fischer, Joshua R; Benoit, Vivian M; Dufour, Nicholas P; Youderian, Philip; Leong, John M

2008-12-01

Borrelia burgdorferi is the causative agent of Lyme disease, the most common vector-borne illness in the Northern hemisphere. Low-passage-number infectious strains of B. burgdorferi exhibit extremely low transformation efficiencies-so low, in fact, as to hinder the genetic study of putative virulence factors. Two putative restriction-modification (R-M) systems, BBE02 contained on linear plasmid 25 (lp25) and BBQ67 contained on lp56, have been postulated to contribute to this poor transformability. Restriction barriers posed by other bacteria have been overcome by the in vitro methylation of DNA prior to transformation. To test whether a methylation-sensitive restriction system contributes to poor B. burgdorferi transformability, shuttle plasmids were treated with the CpG methylase M.SssI prior to the electroporation of a variety of strains harboring different putative R-M systems. We found that for B. burgdorferi strains that harbor lp56, in vitro methylation increased transformation by at least 1 order of magnitude. These results suggest that in vitro CpG methylation protects exogenous DNA from degradation by an lp56-contained R-M system, presumably BBQ67. The utility of in vitro methylation for the genetic manipulation of B. burgdorferi was exemplified by the ease of plasmid complementation of a B. burgdorferi B31 A3 BBK32 kanamycin-resistant (B31 A3 BBK32::Kan(r)) mutant, deficient in the expression of the fibronectin- and glycosaminoglycan (GAG)-binding adhesin BBK32. Consistent with the observation that several surface proteins may promote GAG binding, the B. burgdorferi B31 A3 BBK32::Kan(r) mutant demonstrated no defect in the ability to bind purified GAGs or GAGs expressed on the surfaces of cultured cells.

Genomic Distribution and Inter-Sample Variation of Non-CpG Methylation across Human Cell Types

PubMed Central

Liao, Jing; Zhang, Yingying; Gu, Hongcang; Bock, Christoph; Boyle, Patrick; Epstein, Charles B.; Bernstein, Bradley E.; Lengauer, Thomas; Gnirke, Andreas; Meissner, Alexander

2011-01-01

DNA methylation plays an important role in development and disease. The primary sites of DNA methylation in vertebrates are cytosines in the CpG dinucleotide context, which account for roughly three quarters of the total DNA methylation content in human and mouse cells. While the genomic distribution, inter-individual stability, and functional role of CpG methylation are reasonably well understood, little is known about DNA methylation targeting CpA, CpT, and CpC (non-CpG) dinucleotides. Here we report a comprehensive analysis of non-CpG methylation in 76 genome-scale DNA methylation maps across pluripotent and differentiated human cell types. We confirm non-CpG methylation to be predominantly present in pluripotent cell types and observe a decrease upon differentiation and near complete absence in various somatic cell types. Although no function has been assigned to it in pluripotency, our data highlight that non-CpG methylation patterns reappear upon iPS cell reprogramming. Intriguingly, the patterns are highly variable and show little conservation between different pluripotent cell lines. We find a strong correlation of non-CpG methylation and DNMT3 expression levels while showing statistical independence of non-CpG methylation from pluripotency associated gene expression. In line with these findings, we show that knockdown of DNMTA and DNMT3B in hESCs results in a global reduction of non-CpG methylation. Finally, non-CpG methylation appears to be spatially correlated with CpG methylation. In summary these results contribute further to our understanding of cytosine methylation patterns in human cells using a large representative sample set. PMID:22174693

Insulin-like growth factor-1-mediated regulation of miR-193a expression promotes the migration and proliferation of c-kit-positive mouse cardiac stem cells.

PubMed

Sun, Yuning; Xu, Rongfeng; Huang, Jia; Yao, Yuyu; Pan, Xiaodong; Chen, Zhongpu; Ma, Genshan

2018-02-21

C-kit-positive cardiac stem cells (CSCs) have been shown to be a promising candidate treatment for myocardial infarction and heart failure. Insulin-like growth factor (IGF)-1 is an anabolic growth hormone that regulates cellular proliferation, differentiation, senescence, and death in various tissues. Although IGF-1 promotes the migration and proliferation of c-kit-positive mouse CSCs, the underlying mechanism remains unclear. Cells were isolated from adult mouse hearts, and c-kit-positive CSCs were separated using magnetic beads. The cells were cultured with or without IGF-1, and c-kit expression was measured by Western blotting. IGF-1 induced CSC proliferation and migration, as measured through Cell Counting Kit-8 (CCK-8) and Transwell assays, respectively. The miR-193a expression was measured by quantitative real-time PCR (qPCR) assays. IGF-1 enhanced c-kit expression in c-kit-positive CSCs. The activities of the phosphoinositol 3-kinase (PI3K)/AKT signaling pathway and DNA methyltransferases (DNMTs) were enhanced, and their respective inhibitors LY294002 and 5-azacytidine (5-AZA) blunted c-kit expression. Based on the results of quantitative real-time PCR (qPCR) assays, the expression of miR-193a, which is embedded in a CpG island, was down-regulated in the IGF-1-stimulated group and negatively correlated with c-kit expression, whereas c-kit-positive CSCs infected with lentivirus carrying micro-RNA193a displayed reduced c-kit expression, migration and proliferation. IGF-1 upregulated c-kit expression in c-kit-positive CSCs resulting in enhanced CSC proliferation and migration by activating the PI3K/AKT/DNMT signaling pathway to epigenetically silence miR-193a, which negatively modifies the c-kit expression level.

Frequency Modulation and Spatiotemporal Stability of the sCPG in Preterm Infants with RDS

PubMed Central

Barlow, Steven M.; Burch, Mimi; Venkatesan, Lalit; Harold, Meredith; Zimmerman, Emily

2012-01-01

The nonnutritive suck (NNS) is an observable and accessible motor behavior which is often used to make inference about brain development and pre-feeding skill in preterm and term infants. The purpose of this study was to model NNS burst compression pressure dynamics in the frequency and time domain among two groups of preterm infants, including those with respiratory distress syndrome (RDS, N = 15) and 17 healthy controls. Digitized samples of NNS compression pressure waveforms recorded at a 1-week interval were collected 15 minutes prior to a scheduled feed. Regression analysis and ANOVA revealed that healthy preterm infants produced longer NNS bursts and the mean burst initiation cycle frequencies were higher when compared to the RDS group. Moreover, the initial 5 cycles of the NNS burst manifest a frequency modulated (FM) segment which is a significant feature of the suck central pattern generator (sCPG), and differentially expressed in healthy and RDS infants. The NNS burst structure revealed significantly lower spatiotemporal index values for control versus RDS preterm infants during FM, and provides additional information on the microstructure of the sCPG which may be used to gauge the developmental status and progression of oromotor control systems among these fragile infants. PMID:22888359

Retardation of Antigen Release from DNA Hydrogel Using Cholesterol-Modified DNA for Increased Antigen-Specific Immune Response.

PubMed

Umeki, Yuka; Saito, Masaaki; Takahashi, Yuki; Takakura, Yoshinobu; Nishikawa, Makiya

2017-10-01

Our previous study indicates that cationization of an antigen is effective for sustained release of both immunostimulatory DNA containing unmethylated cytosine-phosphate-guanine (CpG) dinucleotides, or CpG DNA, and antigen from a DNA hydrogel. Another approach to sustained antigen release would increase the applicability and versatility of the system. In this study, a hydrophobic interaction-based sustained release system of ovalbumin (OVA), a model antigen, from immunostimulatory CpG DNA hydrogel is developed by the use of cholesterol-modified DNA and urea-denatured OVA (udOVA). Cholesterol-modified DNA forms a hydrogel, Dgel(chol), and induces IL-6 mRNA expression in mouse skin after intradermal injection, as DNA without cholesterol does. Cholesterol-modified DNA associated with OVA and denaturation of OVA using urea increases the interaction. The release of udOVA from Dgel(chol) is significantly slower than that from DNA hydrogel with no cholesterol, Dgel. Moreover, intratumoral injections of udOVA/Dgel(chol) significantly inhibit the growth of EG7-OVA tumors in mice. These results indicate that sustained release of antigen from Dgel can be achieved by the combination of urea denaturation and cholesterol modification, and retardation of antigen release is effective to induce antigen-specific cancer immunity. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Reintroducing domesticated wild mice to sociality induces adaptive transgenerational effects on MUP expression

PubMed Central

Nelson, Adam C.; Cauceglia, Joseph W.; Merkley, Seth D.; Youngson, Neil A.; Oler, Andrew J.; Nelson, Randy J.; Cairns, Bradley R.; Whitelaw, Emma; Potts, Wayne K.

2013-01-01

When brought into captivity, wild animals can adapt to domestication within 10 generations. Such adaptations may decrease fitness in natural conditions. Many selective pressures are disrupted in captivity, including social behavioral networks. Although lack of sociality in captivity appears to mediate domestication, the underlying mechanisms are not well understood. Additionally, determining the contribution of genetic inheritance vs. transgenerational effects during relaxed selection may provide insight into the flexibility of adaptation. When wild-derived mice kept under laboratory conditions for eight generations were reintroduced to sociality and promiscuity (free mate choice), they adapted within two generations. Fitness assessments between this promiscuous lineage and a monogamous laboratory lineage revealed male-specific effects. Promiscuous-line males had deficits in viability, but a striking advantage in attracting mates, and their scent marks were also more attractive to females. Here, we investigate mechanistic details underlying this olfactory signal and identify a role of major urinary protein (MUP) pheromones. Promiscuous-line males inherit higher MUP expression than monogamous-line males through transgenerational inheritance. Sociality-driven maternal and paternal effects reveal intriguing conflicts among parents and offspring over pheromone expression. MUP up-regulation is not driven by hormone-driven transduction pathways, but rather is associated with reduction in DNA methylation of a CpG dinucleotide in the promoter. This reduction in methylation could enhance transcription by promoting the binding of transcription factor USF1 (upstream stimulatory factor 1). Finally, we experimentally demonstrate that increased MUP expression is a female attractant. These results identify molecular mechanisms guiding domestication and adaptive responses to fluctuating sociality. PMID:24248373

CpG PatternFinder: a Windows-based utility program for easy and rapid identification of the CpG methylation status of DNA.

PubMed

Xu, Yi-Hua; Manoharan, Herbert T; Pitot, Henry C

2007-09-01

The bisulfite genomic sequencing technique is one of the most widely used techniques to study sequence-specific DNA methylation because of its unambiguous ability to reveal DNA methylation status to the order of a single nucleotide. One characteristic feature of the bisulfite genomic sequencing technique is that a number of sample sequence files will be produced from a single DNA sample. The PCR products of bisulfite-treated DNA samples cannot be sequenced directly because they are heterogeneous in nature; therefore they should be cloned into suitable plasmids and then sequenced. This procedure generates an enormous number of sample DNA sequence files as well as adding extra bases belonging to the plasmids to the sequence, which will cause problems in the final sequence comparison. Finding the methylation status for each CpG in each sample sequence is not an easy job. As a result CpG PatternFinder was developed for this purpose. The main functions of the CpG PatternFinder are: (i) to analyze the reference sequence to obtain CpG and non-CpG-C residue position information. (ii) To tailor sample sequence files (delete insertions and mark deletions from the sample sequence files) based on a configuration of ClustalW multiple alignment. (iii) To align sample sequence files with a reference file to obtain bisulfite conversion efficiency and CpG methylation status. And, (iv) to produce graphics, highlighted aligned sequence text and a summary report which can be easily exported to Microsoft Office suite. CpG PatternFinder is designed to operate cooperatively with BioEdit, a freeware on the internet. It can handle up to 100 files of sample DNA sequences simultaneously, and the total CpG pattern analysis process can be finished in minutes. CpG PatternFinder is an ideal software tool for DNA methylation studies to determine the differential methylation pattern in a large number of individuals in a population. Previously we developed the CpG Analyzer program; CpG PatternFinder is our further effort to create software tools for DNA methylation studies.

[Comparative evaluation of clinical practice guidelines for the treatment of schizophrenia].

PubMed

Delessert, D; Pomini, V; Grasset, F; Baumann, P

2008-01-01

Many clinical practice guidelines (CPG) have been published in reply to the development of the concept of "evidence-based medicine" (EBM) and as a solution to the difficulty of synthesizing and selecting relevant medical literature. Taking into account the expansion of new CPG, the question of choice arises: which CPG to consider in a given clinical situation? It is of primary importance to evaluate the quality of the CPG, but until recently, there has been no standardized tool of evaluation or comparison of the quality of the CPG. An instrument of evaluation of the quality of the CPG, called "AGREE" for appraisal of guidelines for research and evaluation was validated in 2002. The six principal CPG concerning the treatment of schizophrenia are compared with the help of the "AGREE" instrument: (1) "the Agence nationale pour le développement de l'évaluation médicale (ANDEM) recommendations"; (2) "The American Psychiatric Association (APA) practice guideline for the treatment of patients with schizophrenia"; (3) "The quick reference guide of APA practice guideline for the treatment of patients with schizophrenia"; (4) "The schizophrenia patient outcomes research team (PORT) treatment recommendations"; (5) "The Texas medication algorithm project (T-MAP)" and (6) "The expert consensus guideline for the treatment of schizophrenia". The results of our study were then compared with those of a similar investigation published in 2005, structured on 24 CPG tackling the treatment of schizophrenia. The "AGREE" tool was also used by two investigators in their study. In general, the scores of the two studies differed little and the two global evaluations of the CPG converged; however, each of the six CPG is perfectible. The rigour of elaboration of the six CPG was in general average. The consideration of the opinion of potential users was incomplete, and an effort made in the presentation of the recommendations would facilitate their clinical use. Moreover, there was little consideration by the authors regarding the applicability of the recommendations. Globally, two CPG are considered as strongly recommended: "the quick reference guide of the APA practice guideline for the treatment of patients with schizophrenia" and "the T-MAP".

Genistein promotes DNA demethylation of the steroidogenic factor 1 (SF-1) promoter in endometrial stromal cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Matsukura, Hiroshi, E-mail: hmatsukura.epi@mri.tmd.ac.jp; Aisaki, Ken-ichi; Igarashi, Katsuhide

2011-08-26

Highlights: {yields} Genistein (GEN) is a phytoestrogen found in soy products. {yields} GEN demethylated/unsilenced the steroidogenic factor 1 gene in endometrial tissue. {yields} GEN thus altered mRNA expression in uteri of ovariectomized (OVX) mice. {yields} A high-resolution melting assay was used to screen for epigenetic change. {yields} We isolated an endometrial cell clone that was epigenetically modulated by GEN. -- Abstract: It has recently been demonstrated that genistein (GEN), a phytoestrogen in soy products, is an epigenetic modulator in various types of cells; but its effect on endometrium has not yet been determined. We investigated the effects of GEN onmore » mouse uterine cells, in vivo and in vitro. Oral administration of GEN for 1 week induced mild proliferation of the endometrium in ovariectomized (OVX) mice, which was accompanied by the induction of steroidogenic factor 1 (SF-1) gene expression. GEN administration induced demethylation of multiple CpG sites in the SF-1 promoter; these sites are extensively methylated and thus silenced in normal endometrium. The GEN-mediated promoter demethylation occurred predominantly on the luminal side, as opposed to myometrium side, indicating that the epigenetic change was mainly shown in regenerated cells. Primary cultures of endometrial stromal cell colonies were screened for GEN-mediated alterations of DNA methylation by a high-resolution melting (HRM) method. One out of 20 colony-forming cell clones showed GEN-induced demethylation of SF-1. This clone exhibited a high proliferation capacity with continuous colony formation activity through multiple serial clonings. We propose that only a portion of endometrial cells are capable of receiving epigenetic modulation by GEN.« less

Correlation of beta-catenin localization with cyclooxygenase-2 expression and CpG island methylator phenotype (CIMP) in colorectal cancer.

PubMed

Kawasaki, Takako; Nosho, Katsuhiko; Ohnishi, Mutsuko; Suemoto, Yuko; Kirkner, Gregory J; Dehari, Reiko; Meyerhardt, Jeffrey A; Fuchs, Charles S; Ogino, Shuji

2007-07-01

The WNT/beta-catenin (CTNNB1) pathway is commonly activated in the carcinogenic process. Cross-talks between the WNT and cyclooxygenase-2 (COX-2 or PTGS2)/prostaglandin pathways have been suggested. The relationship between beta-catenin activation and microsatellite instability (MSI) in colorectal cancer has been controversial. The CpG island methylator phenotype (CIMP or CIMP-high) with widespread promoter methylation is a distinct epigenetic phenotype in colorectal cancer, which is associated with MSI-high. However, no study has examined the relationship between beta-catenin activation and CIMP status. Using 832 population-based colorectal cancer specimens, we assessed beta-catenin localization by immunohistochemistry. We quantified DNA methylation in eight CIMP-specific promoters [CACNA1G, CDKN2A(p16), CRABP1, IGF2, MLH1, NEUROG1, RUNX3, and SOCS1] by real-time polymerase chain reaction (MethyLight). MSI-high, CIMP-high, and BRAF mutation were associated inversely with cytoplasmic and nuclear beta-catenin expressions (i.e., beta-catenin activation) and associated positively with membrane expression. The inverse relation between beta-catenin activation and CIMP was independent of MSI. COX-2 overexpression correlated with cytoplasmic beta-catenin expression (even after tumors were stratified by CIMP status), but did not correlate significantly with nuclear or membrane expression. In conclusion, beta-catenin activation is inversely associated with CIMP-high independent of MSI status. Cytoplasmic beta-catenin is associated with COX-2 overexpression, supporting the role of cytoplasmic beta-catenin in stabilizing PTGS2 (COX-2) mRNA.

Serum microRNA expression patterns that predict early treatment failure in prostate cancer patients.

PubMed

Singh, Prashant K; Preus, Leah; Hu, Qiang; Yan, Li; Long, Mark D; Morrison, Carl D; Nesline, Mary; Johnson, Candace S; Koochekpour, Shahriar; Kohli, Manish; Liu, Song; Trump, Donald L; Sucheston-Campbell, Lara E; Campbell, Moray J

2014-02-15

We aimed to identify microRNA (miRNA) expression patterns in the serum of prostate cancer (CaP) patients that predict the risk of early treatment failure following radical prostatectomy (RP). Microarray and Q-RT-PCR analyses identified 43 miRNAs as differentiating disease stages within 14 prostate cell lines and reflectedpublically available patient data. 34 of these miRNA were detectable in the serum of CaP patients. Association with time to biochemical progression was examined in a cohort of CaP patients following RP. A greater than two-fold increase in hazard of biochemical progression associated with altered expression of miR-103, miR-125b and miR-222 (p<.0008) in the serum of CaP patients. Prediction models based on penalized regression analyses showed that the levels of the miRNAs and PSA together were better at detecting false positives than models without miRNAs, for similar level of sensitivity. Analyses of publically available data revealed significant and reciprocal relationships between changes in CpG methylation and miRNA expression patterns suggesting a role for CpG methylation to regulate miRNA. Exploratory validation supported roles for miR-222 and miR-125b to predict progression risk in CaP. The current study established that expression patterns of serum-detectable miRNAs taken at the time of RP are prognostic for men who are at risk of experiencing subsequent early biochemical progression. These non-invasive approaches could be used to augment treatment decisions.

DNA Methylation Status of the Estrogen Receptor α Gene in Canine Mammary Tumors.

PubMed

Brandão, Yara de Oliveira; Toledo, Mariana Busato; Chequin, Andressa; Cristo, Thierry Grima; Sousa, Renato Silva; Ramos, Edneia Amancio Souza; Klassen, Giseli

2018-01-01

Estrogen receptor α (ERα) has an important role in mammary carcinogenesis, prognosis, and treatment. In human and canine mammary cancer, the most aggressive tumors show loss of ERα expression, which in human breast cancer has been attributed to methylation of the cytosine followed by guanine (CpG) island within the estrogen receptor α gene ( ESR1) promoter. This study aimed to investigate the role of ESR1 CpG island (CGI) methylation in ERα expression in canine mammary tumors. Twenty-one canine mammary samples were sorted into three groups: malignant tumor (n = 9), benign tumor (n = 8), and normal gland (n = 4). Immunohistochemical analysis and reverse-transcription quantitative real-time PCR were performed to assess ERα expression and ESR1 mRNA levels. The methylation status was determined using sodium-bisulfite-treated DNA sequencing. All normal mammary glands and benign tumors showed high ERα expression (score range, 5-8). Six of the nine malignant tumors did not show ERα expression (score 0), two had score 2, and one had score 4. Lower ERα ( P < .005) and ESR1 mRNA levels ( P < .005) were found in malignant mammary tumors than in the other two groups. Canine ESR1 has an intragenic and non-promoter-associated CGI, different from humans. No significant variation in methylation percentage was observed among the groups, suggesting that ESR1 is not regulated by DNA methylation, unlike that in humans. This difference should be considered in further research using ERα as a biomarker for mammary tumors in canine studies on ERα-targeting therapy.

Galectin-9 Produced by Intestinal Epithelial Cells Enhances Aldehyde Dehydrogenase Activity in Dendritic Cells in a PI3K- and p38-Dependent Manner.

PubMed

de Kivit, Sander; Kostadinova, Atanaska I; Kerperien, JoAnn; Ayechu Muruzabal, Veronica; Morgan, Mary E; Knippels, Leon M J; Kraneveld, Aletta D; Garssen, Johan; Willemsen, Linette E M

2017-01-01

Intestinal epithelial cells (IEC) drive regulatory T cell (Treg) responses by promoting the differentiation of aldehyde dehydrogenase (ALDH)-expressing CD103+ dendritic cells (DC). Apical stimulation of TLR9 by CpG DNA on IEC supports galectin-9 expression by IEC, which is promoted by short-chain galacto-oligosaccharides and long-chain fructo-oligosaccharides (GF). While galectin-9 can induce the maturation of monocyte-derived DC (moDC), the contribution of galectin-9 on the induction of ALDH activity in DC is not known. To this end, DC were stimulated with galectin-9, and ALDH activity and the expression of CD103 were assessed. ALDH activity was increased by moDC exposed to galectin-9, while the expression of CD103 remained unaltered. Galectin-9 secreted by IEC apically exposed to CpG DNA and GF enhanced ALDH activity, but not CD103 expression by moDC, which was abrogated upon galectin-9 neutralization. Similar observations were found in murine GM-CSF-cultured bone marrow-derived DC (BMDC). Using Flt3L-cultured BMDC and ex vivo murine splenic DC, it was observed that galectin-9 only enhanced ALDH activity in the presence of GM-CSF in CD103- cells. The induction of ALDH activity in BMDC was dependent on p38 and PI3K signaling. These data indicate a novel role for galectin-9 in modulating innate immunity by inducing ALDH activity in DC. © 2017 S. Karger AG, Basel.

Clinical practice guidelines (CPGs) reduce costs in the management of isolated splenic injuries at pediatric trauma centers.

PubMed

Gutierrez, Ivan M; Zurakowski, David; Chen, Qiaoli; Mooney, David P

2013-02-01

The American Pediatric Surgical Association Trauma Committee proposed the use of a clinical practice guideline (CPG) for the non-operative management of isolated splenic injuries in 1998. An analysis was conducted to determine the financial impact of CPGs on the management of these injuries. The Pediatric Health Information System database, which contains data from 44 children's hospitals, was used to identify children who sustained a graded isolated splenic injury between June 2005 and June 2010. Demographics, length of stay (LOS), readmission rates, and laboratory, imaging, procedural, and total cost data were determined for all hospitals verified as a pediatric trauma center by the American College of Surgeons and/or designated by their local authority. Comparisons were made between facilities self-identifying as having a splenic injury management CPG and those without a CPG. Children (1,154) with isolated splenic injuries (grades 1-4) were cared for in 26 pediatric trauma centers: 20 with a CPG and 6 without (non-CPG). Median costs were significantly lower at CPG than non-CPG centers for imaging (US $163 vs. US $641, P < .001), laboratory (US $629 vs. US $1,044, P < .001), and total hospital stay (US $9,868 vs. US $10,830, P < .001). The median LOS for CPG and non-CPG centers were similar (3 vs. 2 days, P = .38), as were readmission rates within 90 days (3.1 vs. 5.1 %, P = .21). Multiple linear regression indicated that LOS (P < .001) and utilization of a CPG (P = .007) are significant independent predictors of total cost. Utilization of a CPG to manage children with isolated splenic injuries at a pediatric trauma center results in significantly reduced imaging, laboratory, and total hospital costs independent of patient age, gender, grade, and LOS.

Performance of Different Analytical Software Packages in Quantification of DNA Methylation by Pyrosequencing.

PubMed

Grasso, Chiara; Trevisan, Morena; Fiano, Valentina; Tarallo, Valentina; De Marco, Laura; Sacerdote, Carlotta; Richiardi, Lorenzo; Merletti, Franco; Gillio-Tos, Anna

2016-01-01

Pyrosequencing has emerged as an alternative method of nucleic acid sequencing, well suited for many applications which aim to characterize single nucleotide polymorphisms, mutations, microbial types and CpG methylation in the target DNA. The commercially available pyrosequencing systems can harbor two different types of software which allow analysis in AQ or CpG mode, respectively, both widely employed for DNA methylation analysis. Aim of the study was to assess the performance for DNA methylation analysis at CpG sites of the two pyrosequencing software which allow analysis in AQ or CpG mode, respectively. Despite CpG mode having been specifically generated for CpG methylation quantification, many investigations on this topic have been carried out with AQ mode. As proof of equivalent performance of the two software for this type of analysis is not available, the focus of this paper was to evaluate if the two modes currently used for CpG methylation assessment by pyrosequencing may give overlapping results. We compared the performance of the two software in quantifying DNA methylation in the promoter of selected genes (GSTP1, MGMT, LINE-1) by testing two case series which include DNA from paraffin embedded prostate cancer tissues (PC study, N = 36) and DNA from blood fractions of healthy people (DD study, N = 28), respectively. We found discrepancy in the two pyrosequencing software-based quality assignment of DNA methylation assays. Compared to the software for analysis in the AQ mode, less permissive criteria are supported by the Pyro Q-CpG software, which enables analysis in CpG mode. CpG mode warns the operators about potential unsatisfactory performance of the assay and ensures a more accurate quantitative evaluation of DNA methylation at CpG sites. The implementation of CpG mode is strongly advisable in order to improve the reliability of the methylation analysis results achievable by pyrosequencing.

Regulation of DNA methylation on EEF1D and RPL8 expression in cattle.

PubMed

Liu, Xuan; Yang, Jie; Zhang, Qin; Jiang, Li

2017-10-01

Dynamic changes to the epigenome play a critical role in a variety of biology processes and complex traits. Many important candidate genes have been identified through our previous genome wide association study (GWAS) on milk production traits in dairy cattle. However, the underlying mechanism of candidate genes have not yet been clearly understood. In this study, we analyzed the methylation variation of the candidate genes, EEF1D and RPL8, which were identified to be strongly associated with milk production traits in dairy cattle in our previous studies, and its effect on protein and mRNA expression. We compared DNA methylation profiles and gene expression levels of EEF1D and RPL8 in five different tissues (heart, liver, mammary gland, ovary and muscle) of three cows. Both genes showed the highest expression level in mammary gland. For RPL8, there was no difference in the DNA methylation pattern in the five tissues, suggesting no effect of DNA methylation on gene expression. For EEF1D, the DNA methylation levels of its first CpG island differed in the five tissues and were negatively correlated with the gene expression levels. To further investigate the function of DNA methylation on the expression of EEF1D, we collected blood samples of three cows at early stage of lactation and in dry period and analyzed its expression and the methylation status of the first CpG island in blood. As a result, the mRNA expression of EEF1D in the dry period was higher than that at the early stage of lactation, while the DNA methylation level in the dry period was lower than that at the early stage of lactation. Our result suggests that the DNA methylation of EEF1D plays an important role in the spatial and temporal regulation of its expression and possibly have an effect on the milk production traits.

A novel isoform of TET1 that lacks a CXXC domain is overexpressed in cancer

PubMed Central

Good, Charly R.; Madzo, Jozef; Patel, Bela; Maegawa, Shinji; Engel, Nora; Jelinek, Jaroslav

2017-01-01

Abstract TET1 oxidizes methylated cytosine into 5-hydroxymethylcytosine (5hmC), resulting in regulation of DNA methylation and gene expression. Full length TET1 (TET1FL) has a CXXC domain that binds to unmethylated CpG islands (CGIs). This CXXC domain allows TET1 to protect CGIs from aberrant methylation, but it also limits its ability to regulate genes outside of CGIs. Here, we report a novel isoform of TET1 (TET1ALT) that has a unique transcription start site from an alternate promoter in intron 2, yielding a protein with a unique translation start site. Importantly, TET1ALT lacks the CXXC domain but retains the catalytic domain. TET1ALT is repressed in embryonic stem cells (ESCs) but becomes activated in embryonic and adult tissues while TET1FL is expressed in ESCs, but repressed in adult tissues. Overexpression of TET1ALT shows production of 5hmC with distinct (and weaker) effects on DNA methylation or gene expression when compared to TET1FL. TET1ALT is aberrantly activated in multiple cancer types including breast, uterine and glioblastoma, and TET1 activation is associated with a worse overall survival in breast, uterine and ovarian cancers. Our data suggest that the predominantly activated isoform of TET1 in cancer cells does not protect from CGI methylation and likely mediates dynamic site-specific demethylation outside of CGIs. PMID:28531272

Comprehensive analysis of CpG islands in human chromosomes 21 and 22

NASA Astrophysics Data System (ADS)

Takai, Daiya; Jones, Peter A.

2002-03-01

CpG islands are useful markers for genes in organisms containing 5-methylcytosine in their genomes. In addition, CpG islands located in the promoter regions of genes can play important roles in gene silencing during processes such as X-chromosome inactivation, imprinting, and silencing of intragenomic parasites. The generally accepted definition of what constitutes a CpG island was proposed in 1987 by Gardiner-Garden and Frommer [Gardiner-Garden, M. & Frommer, M. (1987) J. Mol. Biol. 196, 261-282] as being a 200-bp stretch of DNA with a C+G content of 50% and an observed CpG/expected CpG in excess of 0.6. Any definition of a CpG island is somewhat arbitrary, and this one, which was derived before the sequencing of mammalian genomes, will include many sequences that are not necessarily associated with controlling regions of genes but rather are associated with intragenomic parasites. We have therefore used the complete genomic sequences of human chromosomes 21 and 22 to examine the properties of CpG islands in different sequence classes by using a search algorithm that we have developed. Regions of DNA of greater than 500 bp with a G+C equal to or greater than 55% and observed CpG/expected CpG of 0.65 were more likely to be associated with the 5' regions of genes and this definition excluded most Alu-repetitive elements. We also used genome sequences to show strong CpG suppression in the human genome and slight suppression in Drosophila melanogaster and Saccharomyces cerevisiae. This finding is compatible with the recent detection of 5-methylcytosine in Drosophila, and might suggest that S. cerevisiae has, or once had, CpG methylation.

Treatment of Tobacco Dependence, a Critical Gap in Czech Clinical Practice Guidelines.

PubMed

Zvolská, Kamila; Fraser, Keely; Zvolský, Miroslav; Králíková, Eva

2017-06-01

Tobacco related comorbidities and treatment of dependence are relevant to clinicians of all disciplines. Clinicians should provide a brief intervention about tobacco use with smokers at each clinical contact (success rate of 5-10 %). Intensive treatment (success rate >30%) should be available to those who need it. Brief intervention is not yet standard clinical practice. Our aim was to assess clinical practice guidelines (CPG) of selected medical professional societies to determine whether or not tobacco dependence treatment recommendations were included. Between October and December 2013, we conducted a keyword search of CPG for 20 medical professional societies in the Czech Republic. We searched for the keywords "smoking", "tobacco" and "nicotine addiction" in 91 CPG documents, which were freely available on the websites of selected professional societies. We focused specifically on CPG relating to cardiovascular and respiratory diseases as well as cancer. We excluded any CPG focused on acute conditions, diagnostics only, laboratory methods, or administration. There was no mention of smoking in 27.7% (26/94) of CPG documents. Only 16% (15/94) of CPG documents listed smoking as a risk factor. 42.5% (40/94) mentioned smoking related phrases (e.g. "smoking ban"). Only 13.8% (13/94) of CPG included a section on tobacco dependence, referenced tobacco dependence treatment guidelines or mentioned specialized treatment centres where smokers can be referred. Nearly one third of CPG related to cardiovascular and respiratory diseases as well as cancer made no mention of smoking. Despite the clinical significance of smoking, the majority of CPG did not adequately address tobacco dependence and its treatment. Copyright© by the National Institute of Public Health, Prague 2017

A dinucleotide motif in oligonucleotides shows potent immunomodulatory activity and overrides species-specific recognition observed with CpG motif.

PubMed

Kandimalla, Ekambar R; Bhagat, Lakshmi; Zhu, Fu-Gang; Yu, Dong; Cong, Yan-Ping; Wang, Daqing; Tang, Jimmy X; Tang, Jin-Yan; Knetter, Cathrine F; Lien, Egil; Agrawal, Sudhir

2003-11-25

Bacterial and synthetic DNAs containing CpG dinucleotides in specific sequence contexts activate the vertebrate immune system through Toll-like receptor 9 (TLR9). In the present study, we used a synthetic nucleoside with a bicyclic heterobase [1-(2'-deoxy-beta-d-ribofuranosyl)-2-oxo-7-deaza-8-methyl-purine; R] to replace the C in CpG, resulting in an RpG dinucleotide. The RpG dinucleotide was incorporated in mouse- and human-specific motifs in oligodeoxynucleotides (oligos) and 3'-3-linked oligos, referred to as immunomers. Oligos containing the RpG motif induced cytokine secretion in mouse spleen-cell cultures. Immunomers containing RpG dinucleotides showed activity in transfected-HEK293 cells stably expressing mouse TLR9, suggesting direct involvement of TLR9 in the recognition of RpG motif. In J774 macrophages, RpG motifs activated NF-kappa B and mitogen-activated protein kinase pathways. Immunomers containing the RpG dinucleotide induced high levels of IL-12 and IFN-gamma, but lower IL-6 in time- and concentration-dependent fashion in mouse spleen-cell cultures costimulated with IL-2. Importantly, immunomers containing GTRGTT and GARGTT motifs were recognized to a similar extent by both mouse and human immune systems. Additionally, both mouse- and human-specific RpG immunomers potently stimulated proliferation of peripheral blood mononuclear cells obtained from diverse vertebrate species, including monkey, pig, horse, sheep, goat, rat, and chicken. An immunomer containing GTRGTT motif prevented conalbumin-induced and ragweed allergen-induced allergic inflammation in mice. We show that a synthetic bicyclic nucleotide is recognized in the C position of a CpG dinucleotide by immune cells from diverse vertebrate species without bias for flanking sequences, suggesting a divergent nucleotide motif recognition pattern of TLR9.

Characterization of the differentially methylated region of the Impact gene that exhibits Glires-specific imprinting.

PubMed

Okamura, Kohji; Wintle, Richard F; Scherer, Stephen W

2008-01-01

Imprinted genes are exclusively expressed from one of the two parental alleles in a parent-of-origin-specific manner. In mammals, nearly 100 genes are documented to be imprinted. To understand the mechanism behind this gene regulation and to identify novel imprinted genes, common features of DNA sequences have been analyzed; however, the general features required for genomic imprinting have not yet been identified, possibly due to variability in underlying molecular mechanisms from locus to locus. We performed a thorough comparative genomic analysis of a single locus, Impact, which is imprinted only in Glires (rodents and lagomorphs). The fact that Glires and primates diverged from each other as recent as 70 million years ago makes comparisons between imprinted and non-imprinted orthologues relatively reliable. In species from the Glires clade, Impact bears a differentially methylated region, whereby the maternal allele is hypermethylated. Analysis of this region demonstrated that imprinting was not associated with the presence of direct tandem repeats nor with CpG dinucleotide density. In contrast, a CpG periodicity of 8 bp was observed in this region in species of the Glires clade compared to those of carnivores, artiodactyls, and primates. We show that tandem repeats are dispensable, establishment of the differentially methylated region does not rely on G+C content and CpG density, and the CpG periodicity of 8 bp is meaningful to the imprinting. This interval has recently been reported to be optimal for de novo methylation by the Dnmt3a-Dnmt3L complex, suggesting its importance in the establishment of imprinting in Impact and other genes.

Blocking Indolamine-2,3-Dioxygenase Rebound Immune Suppression Boosts Antitumor Effects of Radio-Immunotherapy in Murine Models and Spontaneous Canine Malignancies.

PubMed

Monjazeb, Arta M; Kent, Michael S; Grossenbacher, Steven K; Mall, Christine; Zamora, Anthony E; Mirsoian, Annie; Chen, Mingyi; Kol, Amir; Shiao, Stephen L; Reddy, Abhinav; Perks, Julian R; T N Culp, William; Sparger, Ellen E; Canter, Robert J; Sckisel, Gail D; Murphy, William J

2016-09-01

Previous studies demonstrate that intratumoral CpG immunotherapy in combination with radiotherapy acts as an in-situ vaccine inducing antitumor immune responses capable of eradicating systemic disease. Unfortunately, most patients fail to respond. We hypothesized that immunotherapy can paradoxically upregulate immunosuppressive pathways, a phenomenon we term "rebound immune suppression," limiting clinical responses. We further hypothesized that the immunosuppressive enzyme indolamine-2,3-dioxygenase (IDO) is a mechanism of rebound immune suppression and that IDO blockade would improve immunotherapy efficacy. We examined the efficacy and immunologic effects of a novel triple therapy consisting of local radiotherapy, intratumoral CpG, and systemic IDO blockade in murine models and a pilot canine clinical trial. In murine models, we observed marked increase in intratumoral IDO expression after treatment with radiotherapy, CpG, or other immunotherapies. The addition of IDO blockade to radiotherapy + CpG decreased IDO activity, reduced tumor growth, and reduced immunosuppressive factors, such as regulatory T cells in the tumor microenvironment. This triple combination induced systemic antitumor effects, decreasing metastases, and improving survival in a CD8(+) T-cell-dependent manner. We evaluated this novel triple therapy in a canine clinical trial, because spontaneous canine malignancies closely reflect human cancer. Mirroring our mouse studies, the therapy was well tolerated, reduced intratumoral immunosuppression, and induced robust systemic antitumor effects. These results suggest that IDO maintains immune suppression in the tumor after therapy, and IDO blockade promotes a local antitumor immune response with systemic consequences. The efficacy and limited toxicity of this strategy are attractive for clinical translation. Clin Cancer Res; 22(17); 4328-40. ©2016 AACR. ©2016 American Association for Cancer Research.

A Hybrid Approach for CpG Island Detection in the Human Genome.

PubMed

Yang, Cheng-Hong; Lin, Yu-Da; Chiang, Yi-Cheng; Chuang, Li-Yeh

2016-01-01

CpG islands have been demonstrated to influence local chromatin structures and simplify the regulation of gene activity. However, the accurate and rapid determination of CpG islands for whole DNA sequences remains experimentally and computationally challenging. A novel procedure is proposed to detect CpG islands by combining clustering technology with the sliding-window method (PSO-based). Clustering technology is used to detect the locations of all possible CpG islands and process the data, thus effectively obviating the need for the extensive and unnecessary processing of DNA fragments, and thus improving the efficiency of sliding-window based particle swarm optimization (PSO) search. This proposed approach, named ClusterPSO, provides versatile and highly-sensitive detection of CpG islands in the human genome. In addition, the detection efficiency of ClusterPSO is compared with eight CpG island detection methods in the human genome. Comparison of the detection efficiency for the CpG islands in human genome, including sensitivity, specificity, accuracy, performance coefficient (PC), and correlation coefficient (CC), ClusterPSO revealed superior detection ability among all of the test methods. Moreover, the combination of clustering technology and PSO method can successfully overcome their respective drawbacks while maintaining their advantages. Thus, clustering technology could be hybridized with the optimization algorithm method to optimize CpG island detection. The prediction accuracy of ClusterPSO was quite high, indicating the combination of CpGcluster and PSO has several advantages over CpGcluster and PSO alone. In addition, ClusterPSO significantly reduced implementation time.

TLR9 expression is required for the development of cigarette smoke-induced emphysema in mice

PubMed Central

Foronjy, Robert F.; Salathe, Matthias A.; Dabo, Abdoulaye J.; Baumlin, Nathalie; Cummins, Neville; Eden, Edward

2016-01-01

The expression of Toll-like receptor (TLR)-9, a pathogen recognition receptor that recognizes unmethylated CpG sequences in microbial DNA molecules, is linked to the pathogenesis of several lung diseases. TLR9 expression and signaling was investigated in animal and cell models of chronic obstructive pulmonary disease (COPD). We observed enhanced TLR9 expression in mouse lungs following exposure to cigarette smoke. Tlr9−/− mice were resistant to cigarette smoke-induced loss of lung function as determined by mean linear intercept, total lung capacity, lung compliance, and tissue elastance analysis. Tlr9 expression also regulated smoke-mediated immune cell recruitment to the lung; apoptosis; expression of granulocyte-colony stimulating factor (G-CSF), the CXCL5 protein, and matrix metalloproteinase-2 (MMP-2); and protein tyrosine phosphatase 1B (PTP1B) activity in the lung. PTP1B, a phosphatase with anti-inflammatory abilities, was identified as binding to TLR9. In vivo delivery of a TLR9 agonist enhanced TLR9 binding to PTP1B, which inactivated PTP1B. Ptp1b−/− mice had elevated lung concentrations of G-CSF, CXCL5, and MMP-2, and tissue expression of type-1 interferon following TLR9 agonist administration, compared with wild-type mice. TLR9 responses were further determined in fully differentiated normal human bronchial epithelial (NHBE) cells isolated from nonsmoker, smoker, and COPD donors, and then cultured at air liquid interface. NHBE cells from smokers and patients with COPD expressed more TLR9 and secreted greater levels of G-CSF, IL-6, CXCL5, IL-1β, and MMP-2 upon TLR9 ligand stimulation compared with cells from nonsmoker donors. Although TLR9 combats infection, our results indicate that TLR9 induction can affect lung function by inactivating PTP1B and upregulating expression of proinflammatory cytokines. PMID:27288485

The 14-3-3σ gene promoter is methylated in both human melanocytes and melanoma

PubMed Central

2009-01-01

Background Recent evidence demonstrates that 14-3-3σ acts as a tumor suppressor gene inactivated by methylation of its 5' CpG islands in epithelial tumor cells, while remaining un-methylated in normal human epithelia. The methylation analysis of 14-3-3σ has been largely overlooked in melanoma. Methods The methylation status of 14-3-3σ CpG island in melanocytes and melanoma cells was analyzed by methylation-specific sequencing (MSS) and quantitative methylation-specific PCR (Q-MSP). 14-3-3σ mRNA and protein expression in cell lines was detected by real-time RT-PCR and western blot. Melanoma cells were also treated by 5-aza-2'-deoxycytidine (DAC), a demethylating agent, and/or histone deacetylase inhibitor, Trichostatin A (TSA), to evaluate their effects on 14-3-3σ gene expression. Results 14-3-3σ is hypermethylated in both human melanocytes and most melanoma cells in a lineage-specific manner, resulting in the silencing of 14-3-3σ gene expression and the active induction of 14-3-3σ mRNA and protein expression following treatment with DAC. We also observed a synergistic effect upon gene expression when DAC was combined with TSA. The promoter methylation status of 14-3-3σ was analyzed utilizing Q-MSP in 20 melanoma tissue samples and 10 cell lines derived from these samples, showing that the majority of melanoma samples maintain their hypermethylation status of the 14-3-3σ gene. Conclusion 14-3-3σ is hypermethylated in human melanoma in a cell-linage specific manner. Spontaneous demethylation and re-expression of 14-3-3σ is a rare event in melanoma, indicating 14-3-3σ might have a tentative role in the pathogenesis of melanoma. PMID:19473536

Chicken Pleiotrophin: Regulation of Tissue Specific Expression by Estrogen in the Oviduct and Distinct Expression Pattern in the Ovarian Carcinomas

PubMed Central

Lim, Whasun; Kim, Jinyoung; Bazer, Fuller W.; Han, Jae Yong; Song, Gwonhwa

2012-01-01

Pleiotrophin (PTN) is a developmentally-regulated growth factor which is widely distributed in various tissues and also detected in many kinds of carcinomas. However, little is known about the PTN gene in chickens. In the present study, we found chicken PTN to be highly conserved with respect to mammalian PTN genes (91–92.6%) and its mRNA was most abundant in brain, heart and oviduct. This study focused on the PTN gene in the oviduct where it was detected in the glandular (GE) and luminal (LE) epithelial cells. Treatment of young chicks with diethylstilbesterol induced PTN mRNA and protein in GE and LE, but not in other cell types of the oviduct. Further, several microRNAs, specifically miR-499 and miR-1709 were discovered to influence PTN expression via its 3′-UTR which suggests that post-transcriptional regulation influences PTN expression in chickens. We also compared expression patterns and CpG methylation status of the PTN gene in normal and cancerous ovaries from chickens. Our results indicated that PTN is most abundant in the GE of adenocarcinoma of cancerous, but not normal ovaries of hens. Bisulfite sequencing revealed that 30- and 40% of −1311 and −1339 CpG sites are demethylated in ovarian cancer cells, respectively. Collectively, these results indicate that chicken PTN is a novel estrogen-induced gene expressed mainly in the oviductal epithelia implicating PTN regulation of oviduct development and egg formation, and also suggest that PTN is a biomarker for epithelial ovarian carcinoma that could be used for diagnosis and monitoring effects of therapies for the disease. PMID:22496782

Maternally expressed gene 3, an imprinted noncoding RNA gene, is associated with meningioma pathogenesis and progression.

PubMed

Zhang, Xun; Gejman, Roger; Mahta, Ali; Zhong, Ying; Rice, Kimberley A; Zhou, Yunli; Cheunsuchon, Pornsuk; Louis, David N; Klibanski, Anne

2010-03-15

Meningiomas are common tumors, representing 15% to 25% of all central nervous system tumors. NF2 gene inactivation on chromosome 22 has been shown as an early event in tumorigenesis; however, few factors underlying tumor growth and progression have been identified. The chromosomal abnormalities of 14q32 are often associated with meningioma pathogenesis and progression; therefore, it has been proposed that an as yet unidentified tumor suppressor is present at this locus. Maternally expressed gene 3 (MEG3) is an imprinted gene located at 14q32 which encodes a noncoding RNA with an antiproliferative function. We found that MEG3 mRNA is highly expressed in normal arachnoidal cells. However, MEG3 is not expressed in the majority of human meningiomas or the human meningioma cell lines IOMM-Lee and CH157-MN. There is a strong association between loss of MEG3 expression and tumor grade. Allelic loss at the MEG3 locus is also observed in meningiomas, with increasing prevalence in higher grade tumors. In addition, there is an increase in CpG methylation within the promoter and the imprinting control region of MEG3 gene in meningiomas. Functionally, MEG3 suppresses DNA synthesis in both IOMM-Lee and CH157-MN cells by approximately 60% in bromodeoxyuridine incorporation assays. Colony-forming efficiency assays show that MEG3 inhibits colony formation in CH157-MN cells by approximately 80%. Furthermore, MEG3 stimulates p53-mediated transactivation in these cell lines. Therefore, these data are consistent with the hypothesis that MEG3, which encodes a noncoding RNA, may be a tumor suppressor gene at chromosome 14q32 involved in meningioma progression via a novel mechanism.

Bisphenol A-Associated Alterations in the Expression and Epigenetic Regulation of Genes Encoding Xenobiotic Metabolizing Enzymes in Human Fetal Liver

PubMed Central

Nahar, Muna S.; Kim, Jung H.; Sartor, Maureen A.; Dolinoy, Dana C.

2014-01-01

Alterations in xenobiotic metabolizing enzyme (XME) expression across the life course, along with genetic, nutritional, and environmental regulation, can influence how organisms respond to toxic insults. In this study, we investigated the hypothesis that in utero exposure to the endocrine active compound, bisphenol A (BPA), influences expression and epigenetic regulation of phase I and II XME genes during development. Using healthy 1st to 2nd trimester human fetal liver specimens quantified for internal BPA levels, we examined XME gene expression using PCR Array (n =8) and RNA-sequencing (n =12) platforms. Of the greater than 160 XME genes assayed, 2 phase I and 12 phase II genes exhibited significantly reduced expression with higher BPA levels, including isoforms from the carboxylesterase, catechol O-methyltransferase, glutathione S-transferase, sulfotransferase, and UDP-glucuronosyltransferase families. When the promoters of these candidate genes were evaluated in silico, putative binding sites for the E-twenty-six (ETS) and activator protein1 (AP1) related transcription factor families were identified and unique to 97% of all candidate transcripts. Interestingly, many ETS binding sites contain cytosine-guanine dinucleotides (CpGs) within their consensus sequences. Thus, quantitative analysis of CpG methylation of three candidate genes was conducted across n =50 samples. Higher BPA levels were associated with increased site-specific methylation at COMT (P <0.005) and increased average methylation at SULT2A1 (P <0.020) promoters. While toxicological studies have traditionally focused on high-dose effects and hormonal receptor mediated regulation, our findings suggest the importance of low-dose effects and nonclassical mechanisms of endocrine disruption during development. PMID:24214726

Effect of oestradiol and pathogen-associated molecular patterns on class II-mediated antigen presentation and immunomodulatory molecule expression in the mouse female reproductive tract

PubMed Central

Ochiel, Daniel O; Rossoll, Richard M; Schaefer, Todd M; Wira, Charles R

2012-01-01

Cells of the female reproductive tract (FRT) can present antigen to naive and memory T cells. However, the effects of oestrogen, known to modulate immune responses, on antigen presentation in the FRT remain undefined. In the present study, DO11.10 T-cell antigen receptor transgenic mice specific for the class II MHC-restricted ovalbumin (OVA) 323–339 peptide were used to study the effects of oestradiol and pathogen-associated molecular patterns on antigen presentation in the FRT. We report here that oestradiol inhibited antigen presentation of OVA by uterine epithelial cells, uterine stromal cells and vaginal cells to OVA-specific memory T cells. When ovariectomized animals were treated with oestradiol for 1 or 3 days, antigen presentation was decreased by 20–80%. In contrast, incubation with PAMP increased antigen presentation by epithelial cells (Pam3Cys), stromal cells (peptidoglycan, Pam3Cys) and vaginal cells (Pam3Cys). In contrast, CpG inhibited both stromal and vaginal cell antigen presentation. Analysis of mRNA expression by reverse transcription PCR indicated that oestradiol inhibited CD40, CD80 and class II in the uterus and CD40, CD86 and class II in the vagina. Expression in isolated uterine and vaginal cells paralleled that seen in whole tissues. In contrast, oestradiol increased polymeric immunoglobulin receptor mRNA expression in the uterus and decreased it in the vagina. These results indicate that antigen-presenting cells in the uterus and vagina are responsive to oestradiol, which inhibits antigen presentation and co-stimulatory molecule expression. Further, these findings suggest that antigen-presenting cells in the uterus and vagina respond to selected Toll-like receptor agonists with altered antigen presentation. PMID:22043860

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ballester, Marie; Jeanbart, Laura; de Titta, Alexandre

An emerging strategy in preventing and treating airway allergy consists of modulating the immune response induced against allergens in the lungs. CpG oligodeoxynucleotides have been investigated in airway allergy studies, but even if promising, efficacy requires further substantiation. We investigated the effect of pulmonary delivery of nanoparticle (NP)-conjugated CpG on lung immunity and found that NP-CpG led to enhanced recruitment of activated dendritic cells and to Th1 immunity compared to free CpG. We then evaluated if pulmonary delivery of NP-CpG could prevent and treat house dust mite-induced allergy by modulating immunity directly in lungs. When CpG was administered as immunomodulatorymore » therapy prior to allergen sensitization, we found that NP-CpG significantly reduced eosinophilia, IgE levels, mucus production and Th2 cytokines, while free CpG had only a moderate effect on these parameters. In a therapeutic setting where CpG was administered after allergen sensitization, we found that although both free CpG and NP-CpG reduced eosinophilia and IgE levels to the same extent, NP conjugation of CpG significantly enhanced reduction of Th2 cytokines in lungs of allergic mice. Taken together, these data highlight benefits of NP conjugation and the relevance of NP-CpG as allergen-free therapy to modulate lung immunity and treat airway allergy.« less

Pattern generating and reflex-like processes controlling aiming movements in the presence of inertia, damping and gravity. A theoretical note.

PubMed

Kalveram, K T

1991-01-01

A model is proposed, in which goal-directed movements of the forearm are controlled by a central pattern generator (CPG) initiated for exactly one period, and by reflex-analogous processes. Movement width is proportional to the amplitude factor of the CPG's output, and to the square of the CPG's period length. The period duration can be freely selected, thus enabling the CPG to accommodate its time scale to the period of others CPG's. Parameters which influence movement accuracy can be adjusted by means of closed control loop, which are discrete with respect to time: The time unit corresponds to the period of the CPG. For instance, momentum adjustment balances the CPG in such a manner that the velocity of the arm becomes zero on termination of the period, while gain adjustment serves to attain a correct movement length in the presence of an inertial load. Friction, stiffness and gravitational force are neutralized by additional reflex-type processes, interpretable as positive feedback loops with adjustable gain factors, using position and velocity signals.

Association between DNA Methylation in Whole Blood and Measures of Glucose Metabolism: KORA F4 Study

PubMed Central

Wahl, Simone; Kunze, Sonja; Molnos, Sophie; Volkova, Nadezda; Schramm, Katharina; Carstensen-Kirberg, Maren; Waldenberger, Melanie; Gieger, Christian; Peters, Annette; Illig, Thomas; Prokisch, Holger; Roden, Michael; Grallert, Harald

2016-01-01

Epigenetic regulation has been postulated to affect glucose metabolism, insulin sensitivity and the risk of type 2 diabetes. Therefore, we performed an epigenome-wide association study for measures of glucose metabolism in whole blood samples of the population-based Cooperative Health Research in the Region of Augsburg F4 study using the Illumina HumanMethylation 450 BeadChip. We identified a total of 31 CpG sites where methylation level was associated with measures of glucose metabolism after adjustment for age, sex, smoking, and estimated white blood cell proportions and correction for multiple testing using the Benjamini-Hochberg (B-H) method (four for fasting glucose, seven for fasting insulin, 25 for homeostasis model assessment-insulin resistance [HOMA-IR]; B-H-adjusted p-values between 9.2x10-5 and 0.047). In addition, DNA methylation at cg06500161 (annotated to ABCG1) was associated with all the aforementioned phenotypes and 2-hour glucose (B-H-adjusted p-values between 9.2x10-5 and 3.0x10-3). Methylation status of additional three CpG sites showed an association with fasting insulin only after additional adjustment for body mass index (BMI) (B-H-adjusted p-values = 0.047). Overall, effect strengths were reduced by around 30% after additional adjustment for BMI, suggesting that this variable has an influence on the investigated phenotypes. Furthermore, we found significant associations between methylation status of 21 of the aforementioned CpG sites and 2-hour insulin in a subset of samples with seven significant associations persisting after additional adjustment for BMI. In a subset of 533 participants, methylation of the CpG site cg06500161 (ABCG1) was inversely associated with ABCG1 gene expression (B-H-adjusted p-value = 1.5x10-9). Additionally, we observed an enrichment of the top 1,000 CpG sites for diabetes-related canonical pathways using Ingenuity Pathway Analysis. In conclusion, our study indicates that DNA methylation and diabetes-related traits are associated and that these associations are partially BMI-dependent. Furthermore, the interaction of ABCG1 with glucose metabolism is modulated by epigenetic processes. PMID:27019061

Gaining insight into the Clinical Practice Guideline development processes: qualitative study in a workshop to implement the GRADE proposal in Spain

PubMed Central

Calderón, Carlos; Rotaeche, Rafael; Etxebarria, Arritxu; Marzo, Mercé; Rico, Rosa; Barandiaran, Marta

2006-01-01

Background The GRADE method represents a new approach to grading the quality of evidence and strength of recommendations in the preparation of Clinical Practice Guidelines (CPG). In the context of a pilot study to assess the implementability of the system in Spain, we considered it relevant to gain an insight into the significance of the perceptions and attitudes expressed by the actual experts participating in the system try-out. Methods Qualitative research with an ethnographic approach, through non-participant observation and focus groups within the context of a consensus workshop in which 19 CPG experts participated to evaluate the GRADE proposal using 12 evidence tables taken from hypertension, asthma and arthritis CPGs. The interventions were recorded, under a guarantee of confidentiality. The transcriptions and field notes were analyzed, based on a sociological discourse analysis model, and the provisional findings were re-sent to participants in order to improve their validity. Results 1) Certain problems over procedure and terminology hindered the acceptance of this new method as a common reference system for the preparation of CPGs. 2). A greater closeness to clinical practice was accompanied by concerns over value judgments and subjectivity, with a demand for greater explicitness in the consensus process. 3). The type of "evidence" on which the guidelines are based, how and by whom the evidence is prepared, and what the role of the different actors should be, all constitute unresolved concerns in the CPG preparation and implementation processes. 4). The grading process is not neutral: professional background, prior experience and the degree of leadership all condition the participants' input and interactions. Conclusion The findings obtained allow the quantitative evaluation to be better interpreted and, in turn, go beyond the particularities of the GRADE method. Adaptation to the complexities of clinical practice, the need for carefully designed multi-disciplinary work and the reflexivity present in the CPG preparation process, all represent lines of debate that are necessary to improve the CPG quality in the Spanish health care sector. PMID:17059600

PBOV1 Is a Human De Novo Gene with Tumor-Specific Expression That Is Associated with a Positive Clinical Outcome of Cancer

PubMed Central

Samusik, Nikolay; Krukovskaya, Larisa; Meln, Irina; Shilov, Evgeny; Kozlov, Andrey P.

2013-01-01

PBOV1 is a known human protein-coding gene with an uncharacterized function. We have previously found that PBOV1 lacks orthologs in non-primate genomes and is expressed in a wide range of tumor types. Here we report that PBOV1 protein-coding sequence is human-specific and has originated de novo in the primate evolution through a series of frame-shift and stop codon mutations. We profiled PBOV1 expression in multiple cancer and normal tissue samples and found that it was expressed in 19 out of 34 tumors of various origins but completely lacked expression in any of the normal adult or fetal human tissues. We found that, unlike the cancer/testis antigens that are typically controlled by CpG island-containing promoters, PBOV1 was expressed from a GC-poor TATA-containing promoter which was not influenced by CpG demethylation and was inactive in testis. Our analysis of public microarray data suggests that PBOV1 activation in tumors could be dependent on the Hedgehog signaling pathway. Despite the recent de novo origin and the lack of identifiable functional signatures, a missense SNP in the PBOV1 coding sequence has been previously associated with an increased risk of breast cancer. Using publicly available microarray datasets, we found that high levels of PBOV1 expression in breast cancer and glioma samples were significantly associated with a positive outcome of the cancer disease. We also found that PBOV1 was highly expressed in primary but not in recurrent high-grade gliomas, suggesting the presence of a negative selection against PBOV1-expressing cancer cells. Our findings could contribute to the understanding of the mechanisms behind de novo gene origin and the possible role of tumors in this process. PMID:23418531

Impaired capacity for upregulation of MHC class II in tumor-associated microglia.

PubMed

Schartner, Jill M; Hagar, Aaron R; Van Handel, Michelle; Zhang, Leying; Nadkarni, Nivedita; Badie, Behnam

2005-09-01

Immunotherapy for malignant gliomas is being studied as a possible adjunctive therapy for this highly fatal disease. Thus far, inadequate understanding of brain tumor immunology has hindered the design of such therapies. For instance, the role of microglia and macrophages, which comprise a significant proportion of tumor-infiltrating inflammatory cells, in the regulation of the local anti-tumor immune response is poorly understood. To study the response of microglia and macrophages to known activators in brain tumors, we injected CpG oligodeoxynucleotide (ODN), interferon-gamma (IFN-gamma), and IFN-gamma/LPS into normal and intracranial RG2 glioma-bearing rodents. Microglia/macrophage infiltration and their surface expression of MHC class II B7.1 and B7.2 was examined by flow cytometry. Each agent evaluated yielded a distinct microglia/macrophage response: CpG ODN was the most potent inducer of microglia/macrophage infiltration and B7.1 expression, while IFN-gamma resulted in the highest MHC-II expression in both normal and tumors. Regardless of the agent injected, however, MHC-II induction was significantly muted in tumor microglia/macrophage as compared with normal brain. These data suggest that microglia/macrophage responsiveness to activators can vary in brain tumors when compared with normal brain. Understanding the mechanism of these differences may be critical in the development of novel immunotherapies for malignant glioma. (c) 2005 Wiley-Liss, Inc.

Effects of supplementation with nondigestible carbohydrates on fecal calprotectin and on epigenetic regulation of SFRP1 expression in the large-bowel mucosa of healthy individuals12

PubMed Central

Willis, Naomi D; McCallum, Iain; Xie, Long; Ibero-Baraibar, Idoia; Leung, Wing C; Kelly, Seamus; Bradburn, D Michael; Belshaw, Nigel J; Johnson, Ian T

2017-01-01

Background: Hyperactive Wnt signaling is frequently observed in colorectal cancer. Higher intakes of dietary fiber [nondigestible carbohydrates (NDCs)] and the fermentation product butyrate are protective against colorectal cancer and may exert their preventative effects via modulation of the Wnt pathway. Objectives: We investigated the effects of supplementing healthy individuals with 2 NDCs [resistant starch (RS) and polydextrose] on fecal calprotectin concentrations and Wnt pathway–related gene expression. In addition, we determined whether effects on secreted frizzled-related protein 1 (SFRP1) expression are mediated via the epigenetic mechanisms DNA methylation and microRNA expression. Design: In a randomized, double-blind, placebo-controlled trial (the Dietary Intervention, Stem cells and Colorectal Cancer (DISC) Study), 75 healthy participants were supplemented with RS and/or polydextrose or placebo for 50 d in a 2 × 2 factorial design. Pre- and postintervention stool samples and rectal mucosal biopsies were collected and used to quantify calprotectin and expression of 12 Wnt-related genes, respectively. The expression of 10 microRNAs predicted to target SFRP1 was also quantified by quantitative reverse transcriptase-polymerase chain reaction, and DNA methylation was quantified at 7 CpG sites within the SFRP1 promoter region by pyrosequencing. Results: NDC supplementation did not affect fecal calprotectin concentration. SFRP1 mRNA expression was reduced by both RS (P = 0.005) and polydextrose (P = 0.053). RS and polydextrose did not affect SFRP1 methylation or alter the expression of 10 microRNAs predicted to target SFRP1. There were no significant interactions between RS and polydextrose. Conclusions: RS and polydextrose supplementation did not affect fecal calprotectin concentrations. Downregulation of SFRP1 with RS and polydextrose could result in increased Wnt pathway activity. However, effects on Wnt pathway activity and downstream functional effects in the healthy large-bowel mucosa remain to be investigated. The DISC Study was registered at clinicaltrials.gov as NCT01214681. PMID:28077379

Effects of supplementation with nondigestible carbohydrates on fecal calprotectin and on epigenetic regulation of SFRP1 expression in the large-bowel mucosa of healthy individuals.

PubMed

Malcomson, Fiona C; Willis, Naomi D; McCallum, Iain; Xie, Long; Ibero-Baraibar, Idoia; Leung, Wing C; Kelly, Seamus; Bradburn, D Michael; Belshaw, Nigel J; Johnson, Ian T; Mathers, John C

2017-02-01

Hyperactive Wnt signaling is frequently observed in colorectal cancer. Higher intakes of dietary fiber [nondigestible carbohydrates (NDCs)] and the fermentation product butyrate are protective against colorectal cancer and may exert their preventative effects via modulation of the Wnt pathway. We investigated the effects of supplementing healthy individuals with 2 NDCs [resistant starch (RS) and polydextrose] on fecal calprotectin concentrations and Wnt pathway-related gene expression. In addition, we determined whether effects on secreted frizzled-related protein 1 (SFRP1) expression are mediated via the epigenetic mechanisms DNA methylation and microRNA expression. In a randomized, double-blind, placebo-controlled trial (the Dietary Intervention, Stem cells and Colorectal Cancer (DISC) Study), 75 healthy participants were supplemented with RS and/or polydextrose or placebo for 50 d in a 2 × 2 factorial design. Pre- and postintervention stool samples and rectal mucosal biopsies were collected and used to quantify calprotectin and expression of 12 Wnt-related genes, respectively. The expression of 10 microRNAs predicted to target SFRP1 was also quantified by quantitative reverse transcriptase-polymerase chain reaction, and DNA methylation was quantified at 7 CpG sites within the SFRP1 promoter region by pyrosequencing. NDC supplementation did not affect fecal calprotectin concentration. SFRP1 mRNA expression was reduced by both RS (P = 0.005) and polydextrose (P = 0.053). RS and polydextrose did not affect SFRP1 methylation or alter the expression of 10 microRNAs predicted to target SFRP1. There were no significant interactions between RS and polydextrose. RS and polydextrose supplementation did not affect fecal calprotectin concentrations. Downregulation of SFRP1 with RS and polydextrose could result in increased Wnt pathway activity. However, effects on Wnt pathway activity and downstream functional effects in the healthy large-bowel mucosa remain to be investigated. The DISC Study was registered at clinicaltrials.gov as NCT01214681.

A CpG Oligonucleotide Can Protect Mice from a Low Aerosol Challenge Dose of Burkholderia mallei

PubMed Central

Waag, David M.; McCluskie, Michael J.; Zhang, Ningli; Krieg, Arthur M.

2006-01-01

Treatment with an oligodeoxynucleotide (ODN) containing CPG motifs (CpG ODN 7909) was found to protect BALB/c mice from lung infection or death after aerosol challenge with Burkholderia mallei. Protection was associated with enhanced levels of gamma interferon (IFN-γ)-inducible protein 10, interleukin-12 (IL-12), IFN-γ, and IL-6. Preexposure therapy with CpG ODNs may protect victims of a biological attack from glanders. PMID:16495571

A CpG oligonucleotide can protect mice from a low aerosol challenge dose of Burkholderia mallei.

PubMed

Waag, David M; McCluskie, Michael J; Zhang, Ningli; Krieg, Arthur M

2006-03-01

Treatment with an oligodeoxynucleotide (ODN) containing CPG motifs (CpG ODN 7909) was found to protect BALB/c mice from lung infection or death after aerosol challenge with Burkholderia mallei. Protection was associated with enhanced levels of gamma interferon (IFN-gamma)-inducible protein 10, interleukin-12 (IL-12), IFN-gamma, and IL-6. Preexposure therapy with CpG ODNs may protect victims of a biological attack from glanders.

Lack of chart reminder effectiveness on family medicine resident JNC-VI and NCEP III guideline knowledge and attitudes.

PubMed

Echlin, Paul S; Upshur, Ross E G; Markova, Tsveti P

2004-07-05

The literature demonstrates that medical residents and practicing physicians have an attitudinal-behavioral discordance concerning their positive attitudes towards clinical practice guidelines (CPG), and the implementation of these guidelines into clinical practice patterns. A pilot study was performed to determine if change in a previously identified CPG compliance factor (accessibility) would produce a significant increase in family medicine resident knowledge and attitude toward the guidelines. The primary study intervention involved placing a summary of the Sixth Report of the Joint National Committee on Prevention, Detection, Evaluation, and Treatment of High Blood Pressure (JNC VI) and the National Cholesterol Education Program Expert Panel on Detection, Evaluation, and Treatment of High Blood Cholesterol in Adults (NCEP III) CPGs in all patient (>18 yr.) charts for a period of three months. The JNC VI and NCEP III CPGs were also distributed to each Wayne State family medicine resident, and a copy of each CPG was placed in the preceptor's area of the involved clinics. Identical pre- and post- intervention questionnaires were administered to all residents concerning CPG knowledge and attitude. Post-intervention analysis failed to demonstrate a significant difference in CPG knowledge. A statistically significant post-intervention difference was found in only on attitude question. The barriers to CPG compliance were identified as 1) lack of CPG instruction; 2) lack of critical appraisal ability; 3) insufficient time; 4) lack of CPG accessibility; and 5) lack of faculty modeling. This study demonstrated no significant post intervention changes in CPG knowledge, and only one question that reflected attitude change. Wider resident access to dedicated clinic time, increased faculty modeling, and the implementation of an electronic record/reminder system that uses a team-based approach are compliance factors that should be considered for further investigation. The interpretation of CPG non-compliance will benefit from a causal matrix focused on physician knowledge, attitudes, and behavior. Recent findings in resident knowledge-behavior discordance may direct the future investigation of physician CPG non-compliance away from generalized barrier research, and toward the development of information that maximizes the sense of individual practitioner urgency and certainty.

Methylation analysis of p16, SLIT2, SCARA5, and Runx3 genes in hepatocellular carcinoma

PubMed Central

Sun, Gaofeng; Zhang, Chen; Feng, Min; Liu, Wensheng; Xie, Huifang; Qin, Qin; Zhao, E.; Wan, Li

2017-01-01

Abstract This study is to investigate the methylation status of multiple tumor suppressor 1 (p16), secreted glycoprotein 2 (SLIT2), scavenger receptor class A, member 5 putative (SCARA5), and human runt-related transcription factor 3 (Runx3) genes in the peripheral blood of hepatocellular carcinoma (HCC). This is a case–control study. The peripheral blood samples were collected from 25 HCC patients, 25 patients with high risk of HCC (defined as “internal control group”), and 25 healthy individuals (defined as “external control group”), respectively. Then the methylation status of p16, SLIT2, SCARA5, and Runx3 genes in the blood samples were analyzed by pyrosequencing. The relationship between the methylation and the clinical features of HCC patients were evaluated. The methylation levels in the 7 CpG loci of p16 gene in HCC patients were low and without statistically significant difference (P > .05) compared to the control groups. Although the methylation levels of CpG3 and CpG4 in SLIT2 gene loci were higher than those of the control groups, there was no statistically significant difference (P > .05). However, the methylation rate of CpG2 locus in SCARA5 gene in HCC patients was significantly higher (P < .05). And the methylation rates of CpG1, CpG2, CpG3, CpG4, CpG5, and CpG8 in Runx3 gene in HCC patients were significantly different to that of control groups (P < .05). We also have analyzed the correlations between the CpG islands methylation of Runx3 or SCARA5 genes and the age, gender, hepatitis B, liver cirrhosis, alpha fetal protein, or hepatitis B surface antigen (HBsAg) of the HCC patients, which all showed no significant correlations (P > .05). The methylation status of SCARA5 and Runx3 genes are abnormal in HCC patients, which may further be used as molecular markers for early auxiliary diagnosis of liver cancer. PMID:29019900

DHA-rich n-3 fatty acid supplementation decreases DNA methylation in blood leukocytes: the OmegAD study.

PubMed

Karimi, Mohsen; Vedin, Inger; Freund Levi, Yvonne; Basun, Hans; Faxén Irving, Gerd; Eriksdotter, Maria; Wahlund, Lars-Olof; Schultzberg, Marianne; Hjorth, Erik; Cederholm, Tommy; Palmblad, Jan

2017-10-01

Background: Dietary fish oils, rich in long-chain n-3 (ω-3) fatty acids (FAs) [e.g., docosahexaenoic acid (DHA, 22:6n-3) and eicosapentaenoic acid (EPA, 20:5n-3)], modulate inflammatory reactions through various mechanisms, including gene expression, which is measured as messenger RNA concentration. However, the effects of long-term treatment of humans with DHA and EPA on various epigenetic factors-such as DNA methylation, which controls messenger RNA generation-are poorly described. Objective: We wanted to determine the effects of 6 mo of dietary supplementation with an n-3 FA preparation rich in DHA on global DNA methylation of peripheral blood leukocytes (PBLs) and the relation to plasma EPA and DHA concentrations in Alzheimer disease (AD) patients. Design: In the present study, DNA methylation in four 5'-cytosine-phosphate-guanine-3' (CpG) sites of long interspersed nuclear element-1 repetitive sequences was assessed in a group of 63 patients (30 given the n-3 FA preparation and 33 given placebo) as an estimation of the global DNA methylation in blood cells. Patients originated from the randomized, double-blind, placebo-controlled OmegAD study, in which 174 AD patients received either 1.7 g DHA and 0.6 g EPA (the n-3 FA group) or placebo daily for 6 mo. Results: At 6 mo, the n-3 FA group displayed marked increases in DHA and EPA plasma concentrations (2.6- and 3.5-fold), as well as decreased methylation in 2 out of 4 CpG sites ( P < 0.05 for all), respectively. This hypomethylation in CpG2 and CpG4 sites showed a reverse correlation to changes in plasma EPA concentration ( r = -0.25, P = 0.045; and r = -0.26, P = 0.041, respectively), but not to changes in plasma DHA concentration, and were not related to apolipoprotein E-4 allele frequency. Conclusion: Supplementation with n-3 FA for 6 mo was associated with global DNA hypomethylation in PBLs. Our data may be of importance in measuring various effects of marine oils, including gene expression, in patients with AD and in other patients taking n-3 FA supplements. This trial was registered at clinicaltrials.gov as NCT00211159. © 2017 American Society for Nutrition.

Coulometric determination of NAD+ and NADH in normal and cancer cells using LDH, RVC and a polymer mediator.

PubMed

Torabi, F; Ramanathan, K; Larsson, P O; Gorton, L; Svanberg, K; Okamoto, Y; Danielsson, B; Khayyami, M

1999-11-15

An electrochemical method for the measurement of NAD(+) and NADH in normal and cancer tissues using flow injection analysis (FIA) is reported. Reticulated vitreous carbon (RVC) electrodes with entrapped l-lactate dehydrogenase (LDH) and a new redox polymer containing covalently bound toluidine blue O (TBO) were employed for this purpose. Both NAD(+) and NADH were estimated coulometrically based on their reaction with LDH. The latter was immobilized on controlled pore glass (CPG) by cross-linking with glutaraldehyde and packed within the RVC. The concentrations of NAD(+) and NADH in the tissues, estimated using different electron mediators such as ferricyanide (FCN), meldola blue (MB) and TBO have also been compared. The effects of flow rate, pH, applied potential (versus Ag/AgCl reference) and adsorption of the mediators have also been investigated. Based on the measurements of NAD(+) and NADH in normal and cancer tissues it has been concluded that the NADH concentration is lower, while the NAD(+) concentration is higher in cancer tissues. Amongst the electron mediators TBO was found to be a more stable mediator for such measurements.

Links between DNA methylation and nucleosome occupancy in the human genome.

PubMed

Collings, Clayton K; Anderson, John N

2017-01-01

DNA methylation is an epigenetic modification that is enriched in heterochromatin but depleted at active promoters and enhancers. However, the debate on whether or not DNA methylation is a reliable indicator of high nucleosome occupancy has not been settled. For example, the methylation levels of DNA flanking CTCF sites are higher in linker DNA than in nucleosomal DNA, while other studies have shown that the nucleosome core is the preferred site of methylation. In this study, we make progress toward understanding these conflicting phenomena by implementing a bioinformatics approach that combines MNase-seq and NOMe-seq data and by comprehensively profiling DNA methylation and nucleosome occupancy throughout the human genome. The results demonstrated that increasing methylated CpG density is correlated with nucleosome occupancy in the total genome and within nearly all subgenomic regions. Features with elevated methylated CpG density such as exons, SINE-Alu sequences, H3K36-trimethylated peaks, and methylated CpG islands are among the highest nucleosome occupied elements in the genome, while some of the lowest occupancies are displayed by unmethylated CpG islands and unmethylated transcription factor binding sites. Additionally, outside of CpG islands, the density of CpGs within nucleosomes was shown to be important for the nucleosomal location of DNA methylation with low CpG frequencies favoring linker methylation and high CpG frequencies favoring core particle methylation. Prominent exceptions to the correlations between methylated CpG density and nucleosome occupancy include CpG islands marked by H3K27me3 and CpG-poor heterochromatin marked by H3K9me3, and these modifications, along with DNA methylation, distinguish the major silencing mechanisms of the human epigenome. Thus, the relationship between DNA methylation and nucleosome occupancy is influenced by the density of methylated CpG dinucleotides and by other epigenomic components in chromatin.

Clinical practice guideline for Sjögren's syndrome 2017.

PubMed

Sumida, Takayuki; Azuma, Naoto; Moriyama, Masafumi; Takahashi, Hiroyuki; Asashima, Hiromitsu; Honda, Fumika; Abe, Saori; Ono, Yuko; Hirota, Tomoya; Hirata, Shintaro; Tanaka, Yoshiya; Shimizu, Toshimasa; Nakamura, Hideki; Kawakami, Atsushi; Sano, Hajime; Ogawa, Yoko; Tsubota, Kazuo; Ryo, Koufuchi; Saito, Ichiro; Tanaka, Akihiko; Nakamura, Seiji; Takamura, Etsuko; Tanaka, Masao; Suzuki, Katsuya; Takeuchi, Tsutomu; Yamakawa, Noriyuki; Mimori, Tsuneyo; Ohta, Akiko; Nishiyama, Susumu; Yoshihara, Toshio; Suzuki, Yasunori; Kawano, Mitsuhiro; Tomiita, Minako; Tsuboi, Hiroto

2018-05-01

The objective of this study is to develop clinical practice guideline (CPG) for Sjögren's syndrome (SS) based on recently available clinical and therapeutic evidences. The CPG committee for SS was organized by the Research Team for Autoimmune Diseases, Research Program for Intractable Disease of the Ministry of Health, Labor and Welfare (MHLW), Japan. The committee completed a systematic review of evidences for several clinical questions and developed CPG for SS 2017 according to the procedure proposed by the Medical Information Network Distribution Service (Minds). The recommendations and their strength were checked by the modified Delphi method. The CPG for SS 2017 has been officially approved by both Japan College of Rheumatology and the Japanese Society for SS. The CPG committee set 38 clinical questions for clinical symptoms, signs, treatment, and management of SS in pediatric, adult and pregnant patients, using the PICO (P: patients, problem, population, I: interventions, C: comparisons, controls, comparators, O: outcomes) format. A summary of evidence, development of recommendation, recommendation, and strength for these 38 clinical questions are presented in the CPG. The CPG for SS 2017 should contribute to improvement and standardization of diagnosis and treatment of SS.

Substantial reduction in hospital stay of children and adolescents with diabetic ketoacidosis after implementation of Clinical Practice Guidelines in a university hospital in Saudi Arabia.

PubMed

Al Nemri, Abdulrahman; Amer, Yasser Sami; Gasim, Hala; Osman, Mohamed Elfaki; Aleyadhy, Ayman; Al Otaibi, Hessah; Iqbal, Shaikh Mohammed; Aljurayyan, Nasir Abdullah; Assiri, Asaad M; Babiker, Amir; Mohamed, Sarar

2017-02-01

We aimed to determine the effect of Clinical Practice Guideline (CPG) implementation on length of hospital stay of children and adolescents with diabetic ketoacidosis (DKA). This was a 6-year (2008-2014) case-control retrospective study conducted at King Khalid University Hospital, Riyadh, that compared patients with DKA managed using CPG with those treated before CPG implementation. There were 63 episodes of DKA in 41 patients managed using CPG compared with 40 episodes in 33 patients treated before implementation of CPG. Baseline characteristics of the 2 groups were similar (age, sex, newly diagnosed patients, recurrent DKA, DKA severity, and mean glycosylated hemoglobin). The mean length of hospital stay (±SD) was 68.6 ± 53.1 hours after implementation of CPG compared with 107.4 ± 65.6 hours before implementation (P < .001). The reduction in length of hospital stay equals to 1700 bed days saved per year per 1000 patients. Implementation of CPG for DKA decreased the length of hospital stay. © 2016 John Wiley & Sons, Ltd.

Methylation of the PMEPA1 gene, a negative regulator of the androgen receptor in prostate cancer.

PubMed

Sharad, Shashwat; Ravindranath, Lakshmi; Haffner, Michael C; Li, Hua; Yan, Wusheng; Sesterhenn, Isabell A; Chen, Yongmei; Ali, Amina; Srinivasan, Alagarsamy; McLeod, David G; Yegnasubramanian, Srinivasan; Srivastava, Shiv; Dobi, Albert; Petrovics, Gyorgy

2014-06-01

The prostate transmembrane protein androgen induced 1 (PMEPA1) gene is highly expressed in prostate epithelial cells and is a direct transcriptional target for the androgen receptor (AR). AR protein levels are controlled by the AR-PMEPA1 negative feedback loop through NEDD4-E3 ligase. Reduced expression of PMEPA1 observed in prostate tumors, suggests that loss of PMEPA1 may play critical roles in prostate tumorigenesis. This study focuses on epigenetic mechanisms of reduced PMEPA1 expression in the cancer of the prostate (CaP). Benign (n = 77) and matched malignant (n = 77) prostate epithelial cells were laser capture micro-dissected from optimum cutting temperature embedded frozen prostate sections from 42 Caucasian American (CA) and 35 African American (AA) cases. Purified DNA specimens were analyzed for CpG methylation of the PMEPA1 gene. PMEPA1 mRNA expression levels were evaluated by qRT-PCR. Analysis of PMEPA1 methylation and mRNA expression in the same tumor cell populations indicated a significant inverse correlation between mRNA expression and methylation in CaP (P = 0.0115). We noted higher frequency of CpG methylation within the evaluated first intronic region of the PMEPA1 gene in prostate tumors of CA men as compared with AA. In CaP cell lines, PMEPA1 expression was induced and AR protein levels were diminished in response to treatment with the DNA methyltransferase inhibitor, 5-aza-2'-deoxycytidine (decitabine). Cell culture-based studies demonstrated that decitabine restores PMEPA1 expression in AR-positive CaP cell lines. This report reveals the potential role of PMEPA1 gene methylation in the regulation of AR stability. Thus, downregulation of PMEPA1 may result in increased AR protein levels and function in CaP cells, contributing to prostate tumorigenesis.

Methylation of the PMEPA1 gene, a negative regulator of the androgen receptor in prostate cancer

PubMed Central

Sharad, Shashwat; Ravindranath, Lakshmi; Haffner, Michael C; Li, Hua; Yan, Wusheng; Sesterhenn, Isabell A; Chen, Yongmei; Ali, Amina; Srinivasan, Alagarsamy; McLeod, David G; Yegnasubramanian, Srinivasan; Srivastava, Shiv; Dobi, Albert; Petrovics, Gyorgy

2014-01-01

The prostate transmembrane protein androgen induced 1 (PMEPA1) gene is highly expressed in prostate epithelial cells and is a direct transcriptional target for the androgen receptor (AR). AR protein levels are controlled by the AR-PMEPA1 negative feedback loop through NEDD4-E3 ligase. Reduced expression of PMEPA1 observed in prostate tumors, suggests that loss of PMEPA1 may play critical roles in prostate tumorigenesis. This study focuses on epigenetic mechanisms of reduced PMEPA1 expression in the cancer of the prostate (CaP). Benign (n = 77) and matched malignant (n = 77) prostate epithelial cells were laser capture micro-dissected from optimum cutting temperature embedded frozen prostate sections from 42 Caucasian American (CA) and 35 African American (AA) cases. Purified DNA specimens were analyzed for CpG methylation of the PMEPA1 gene. PMEPA1 mRNA expression levels were evaluated by qRT-PCR. Analysis of PMEPA1 methylation and mRNA expression in the same tumor cell populations indicated a significant inverse correlation between mRNA expression and methylation in CaP (P = 0.0115). We noted higher frequency of CpG methylation within the evaluated first intronic region of the PMEPA1 gene in prostate tumors of CA men as compared with AA. In CaP cell lines, PMEPA1 expression was induced and AR protein levels were diminished in response to treatment with the DNA methyltransferase inhibitor, 5-aza-2'-deoxycytidine (decitabine). Cell culture-based studies demonstrated that decitabine restores PMEPA1 expression in AR-positive CaP cell lines. This report reveals the potential role of PMEPA1 gene methylation in the regulation of AR stability. Thus, downregulation of PMEPA1 may result in increased AR protein levels and function in CaP cells, contributing to prostate tumorigenesis. PMID:24694733

Genome-wide site-specific differential methylation in the blood of individuals with Klinefelter Syndrome

PubMed Central

Wan, Emily S.; Qiu, Weiliang; Morrow, Jarrett; Beaty, Terri H.; Hetmanski, Jacqueline; Make, Barry J.; Lomas, David A.; Silverman, Edwin K.; DeMeo, Dawn L.

2015-01-01

Klinefelter syndrome (KS) (47 XXY) is a common sex-chromosome aneuploidy with an estimated prevalence of 1 in every 660 male births. Investigations into the associations between DNA methylation and the highly variable clinical manifestations of KS have largely focused on the supernumerary X chromosome; systematic investigations of the epigenome have been limited. We obtained genome-wide DNA methylation data from peripheral blood using the Illumina HumanMethylation450K platform in 5 KS (47 XXY), 102 male (46 XY), and 113 female (46 XX) control subjects participating in the chronic obstructive pulmonary disease (COPD) Gene Study. Empirical Bayes-mediated models were used to test for differential methylation by KS status. CpG sites with a false-discovery rate <0.05 from the first-generation HumanMethylation27K platform were further examined in an independent replication cohort of 2 KS subjects, 590 male, and 495 female controls drawn from the International COPD Genetics Network (ICGN). Differential methylation at sites throughout the genome were identified, including 86 CpG sites that were differentially methylated in KS subjects relative to both male and female controls. CpG sites annotated to the HEN1 methyltransferase homolog 1 (HENMT1), calcyclin-binding protein (CACYBP), and GTPase-activating protein (SH3 domain)-binding protein 1 (G3BP1) genes were among the “KS-specific” loci that were replicated in ICGN. We therefore conclude that site-specific differential methylation exists throughout the genome in KS. The functional impact and clinical relevance of these differentially methylated loci should be explored in future studies. PMID:25988574

Unusual Characteristics of the DNA Binding Domain of Epigenetic Regulatory Protein MeCP2 Determine Its Binding Specificity

PubMed Central

2015-01-01

The protein MeCP2 mediates epigenetic regulation by binding methyl-CpG (mCpG) sites on chromatin. MeCP2 consists of six domains of which one, the methyl binding domain (MBD), binds mCpG sites in duplex DNA. We show that solution conditions with physiological or greater salt concentrations or the presence of nonspecific competitor DNA is necessary for the MBD to discriminate mCpG from CpG with high specificity. The specificity for mCpG over CpG is >100-fold under these solution conditions. In contrast, the MBD does not discriminate hydroxymethyl-CpG from CpG. The MBD is unusual among site-specific DNA binding proteins in that (i) specificity is not conferred by the enhanced affinity for the specific site but rather by suppression of its affinity for generic DNA, (ii) its specific binding to mCpG is highly electrostatic, and (iii) it takes up as well as displaces monovalent cations upon DNA binding. The MBD displays an unusually high affinity for single-stranded DNA independent of modification or sequence. In addition, the MBD forms a discrete dimer on DNA via a noncooperative binding pathway. Because the affinity of the second monomer is 1 order of magnitude greater than that of nonspecific binding, the MBD dimer is a unique molecular complex. The significance of these results in the context of neuronal function and development and MeCP2-related developmental disorders such as Rett syndrome is discussed. PMID:24828757

Prediction of CpG-island function: CpG clustering vs. sliding-window methods

PubMed Central

2010-01-01

Background Unmethylated stretches of CpG dinucleotides (CpG islands) are an outstanding property of mammal genomes. Conventionally, these regions are detected by sliding window approaches using %G + C, CpG observed/expected ratio and length thresholds as main parameters. Recently, clustering methods directly detect clusters of CpG dinucleotides as a statistical property of the genome sequence. Results We compare sliding-window to clustering (i.e. CpGcluster) predictions by applying new ways to detect putative functionality of CpG islands. Analyzing the co-localization with several genomic regions as a function of window size vs. statistical significance (p-value), CpGcluster shows a higher overlap with promoter regions and highly conserved elements, at the same time showing less overlap with Alu retrotransposons. The major difference in the prediction was found for short islands (CpG islets), often exclusively predicted by CpGcluster. Many of these islets seem to be functional, as they are unmethylated, highly conserved and/or located within the promoter region. Finally, we show that window-based islands can spuriously overlap several, differentially regulated promoters as well as different methylation domains, which might indicate a wrong merge of several CpG islands into a single, very long island. The shorter CpGcluster islands seem to be much more specific when concerning the overlap with alternative transcription start sites or the detection of homogenous methylation domains. Conclusions The main difference between sliding-window approaches and clustering methods is the length of the predicted islands. Short islands, often differentially methylated, are almost exclusively predicted by CpGcluster. This suggests that CpGcluster may be the algorithm of choice to explore the function of these short, but putatively functional CpG islands. PMID:20500903

[Web Visit Patterns for the Clinical Practice Guidelines for Management of Depressive Disorder and Alcohol Abuse-Dependence].

PubMed

Suárez-Obando, Fernando; Restrepo, Carlos Gómez

Clinical practice guidelines (CPG) are a set of recommendations for professionals, patients, and families, in order to make decisions about health care. The CPG respond to the need for concise, accurate, practical, and up to date information. In the field of mental health, Colombia has developed three GPC; alcohol (GPC-OH), depression (GPC-TDA), and schizophrenia. To describe the Web Portal traffic related to psychiatry guidelines, with emphasis on the number of visits, distribution throughout Colombian cities, and estimating user behaviour patterns. An evaluation was made of the traffic at the Clinical Practice Guidelines Web Portal of the Ministry of Health and Social Protection between 2013 and 2015 (two years of observation since the inauguration of the Portal). Out of the 45 GPC published on the website, the CPG-OH represented 1.21% of all page views of the Portal. CPG-TDA reached 1.52% (accumulated percentage of 2.73%), being the eighth most consulted guideline, with CPG-OH being number 16. The highest mean monthly number of visits for this group of guideliness was for the CPG-OH for health professionals (353 visits/month), and the lowest was for the CPG-AD for patients and relatives (24 single visits/month). Bogotá D.C. was the city where health carers accessed the guidelines more often. The guidelines for patients and relatives were consulted more in Villavicencio, Cúcuta, Manizales, Pereira, and Pasto. The web portal partially fulfills the purpose of circulating the CPG in Colombia. The visits to the CPG of mental health is quite low, and requires better dissemination strategies that allow the use of information and communication technology. Copyright © 2016 Asociación Colombiana de Psiquiatría. Publicado por Elsevier España. All rights reserved.

Assessing the efficacy of Duddingtonia flagrans chlamydospores per gram of faeces to control Haemonchus contortus larvae.

PubMed

Ojeda-Robertos, Nadia Florencia; Torres-Acosta, Juan Felipe de Jesus; Aguilar-Caballero, Armando Jacinto; Ayala-Burgos, Armín; Cob-Galera, Ligia Amira; Sandoval-Castro, Carlos Alfredo; Barrientos-Medina, Roberto Carlos; de Gives, Pedro Mendoza

2008-12-20

The aims were (a) to quantify the number of Duddingtonia flagrans chlamydospores per gram of faeces (CPG) recovered from sheep administered with different oral doses and, (b) to describe the relationship between CPG and eggs per gram of faeces (EPG) on the efficacy to reduce Haemonchus contortus infective larvae. Three doses of chlamydospores per kg BW were orally administered during seven days: (T1) non treated control group, (T2) 1 x 10(6), (T3) 2.5 x 10(6) and (T4) 5 x 10(6). Three lambs, infected with H. contortus, were used per group. Faeces were obtained from the rectum of each lamb during the fungal administration period (days 0-6) and for six days after that period. Four coproculture replicates were made from each animal in days 2, 4, 6, 8 and 10. A higher chlamydospore dose produced higher CPG in faeces (p < 0.05), but a clear dose dependent effect was not found either in the larvae reduction or in the CPG:EPG ratio. When ratios were re-analyzed, independently of the treatment groups of origin, a better efficacy was obtained with a ratio from 5 to 10 CPG:EPG and a higher ratio (> 10 per egg) showed a lower reduction efficacy (p < 0.05). The binomial analysis showed that for each unit of increment in CPG:EPG ratio there was a reduction of larvae number until a point (between 5 and 10 CPG:EPG) where no further reduction was detected. The surface response test indicated that the number of larvae was reduced by CPG until possible saturation. The highest CPG:EPG ratios did not necessarily improve efficacy of D. flagrans.

Transcriptome Analysis of an Insecticide Resistant Housefly Strain: Insights about SNPs and Regulatory Elements in Cytochrome P450 Genes

PubMed Central

Asp, Torben; Kristensen, Michael

2016-01-01

Background Insecticide resistance in the housefly, Musca domestica, has been investigated for more than 60 years. It will enter a new era after the recent publication of the housefly genome and the development of multiple next generation sequencing technologies. The genetic background of the xenobiotic response can now be investigated in greater detail. Here, we investigate the 454-pyrosequencing transcriptome of the spinosad-resistant 791spin strain in relation to the housefly genome with focus on P450 genes. Results The de novo assembly of clean reads gave 35,834 contigs consisting of 21,780 sequences of the spinosad resistant strain. The 3,648 sequences were annotated with an enzyme code EC number and were mapped to 124 KEGG pathways with metabolic processes as most highly represented pathway. One hundred and twenty contigs were annotated as P450s covering 44 different P450 genes of housefly. Eight differentially expressed P450s genes were identified and investigated for SNPs, CpG islands and common regulatory motifs in promoter and coding regions. Functional annotation clustering of metabolic related genes and motif analysis of P450s revealed their association with epigenetic, transcription and gene expression related functions. The sequence variation analysis resulted in 12 SNPs and eight of them found in cyp6d1. There is variation in location, size and frequency of CpG islands and specific motifs were also identified in these P450s. Moreover, identified motifs were associated to GO terms and transcription factors using bioinformatic tools. Conclusion Transcriptome data of a spinosad resistant strain provide together with genome data fundamental support for future research to understand evolution of resistance in houseflies. Here, we report for the first time the SNPs, CpG islands and common regulatory motifs in differentially expressed P450s. Taken together our findings will serve as a stepping stone to advance understanding of the mechanism and role of P450s in xenobiotic detoxification. PMID:27019205

Mechanistic insights into induction of vitellogenin gene expression by estrogens in Sydney rock oysters, Saccostrea glomerata.

PubMed

Tran, Thi Kim Anh; MacFarlane, Geoff R; Kong, Richard Yuen Chong; O'Connor, Wayne A; Yu, Richard Man Kit

2016-05-01

Marine molluscs, such as oysters, respond to estrogenic compounds with the induction of the egg yolk protein precursor, vitellogenin (Vtg), availing a biomarker for estrogenic pollution. Despite this application, the precise molecular mechanism through which estrogens exert their action to induce molluscan vitellogenesis is unknown. As a first step to address this question, we cloned a gene encoding Vtg from the Sydney rock oyster Saccostrea glomerata (sgVtg). Using primers designed from a partial sgVtg cDNA sequence available in Genbank, a full-length sgVtg cDNA of 8498bp was obtained by 5'- and 3'-RACE. The open reading frame (ORF) of sgVtg was determined to be 7980bp, which is substantially longer than the orthologs of other oyster species. Its deduced protein sequence shares the highest homology at the N- and C-terminal regions with other molluscan Vtgs. The full-length genomic DNA sequence of sgVtg was obtained by genomic PCR and genome walking targeting the gene body and flanking regions, respectively. The genomic sequence spans 20kb and consists of 30 exons and 29 introns. Computer analysis identified three closely spaced half-estrogen responsive elements (EREs) in the promoter region and a 210-bp CpG island 62bp downstream of the transcription start site. Upregulation of sgVtg mRNA expression was observed in the ovaries following in vitro (explants) and in vivo (tank) exposure to 17β-estradiol (E2). Notably, treatment with an estrogen receptor (ER) antagonist in vitro abolished the upregulation, suggesting a requirement for an estrogen-dependent receptor for transcriptional activation. DNA methylation of the 5' CpG island was analysed using bisulfite genomic sequencing of the in vivo exposed ovaries. The CpG island was found to be hypomethylated (with 0-3% methylcytosines) in both control and E2-exposed oysters. However, no significant differential methylation or any correlation between methylation and sgVtg expression levels was observed. Overall, the results support the possible involvement of an ERE-containing promoter and an estrogen-activated receptor in estrogen signalling in marine molluscs. Copyright © 2016 Elsevier B.V. All rights reserved.

Epigenetics Reactivation of Nrf2 in Prostate TRAMP C1 Cells by Curcumin Analogue FN1.

PubMed

Li, Wenji; Pung, Doug; Su, Zheng-Yuan; Guo, Yue; Zhang, Chengyue; Yang, Anne Yuqing; Zheng, Xi; Du, Zhi-Yun; Zhang, Kun; Kong, Ah-Ng

2016-04-18

It has previously been shown that curcumin can effectively inhibit prostate cancer proliferation and progression in TRAMP mice, potentially acting through the hypomethylation of the Nrf2 gene promoter and hence activation of the Nrf2 pathway to enhance cell antioxidative defense. FN1 is a synthetic curcumin analogue that shows stronger anticancer activity than curcumin in other reports. We aimed to explore the epigenetic modification of FN1 that restores Nrf2 expression in TRAMP-C1 cells. Stably transfected HepG2-C8 cells were used to investigate the effect of FN1 on the Nrf2- antioxidant response element (ARE) pathway. Real-time quantitative PCR and Western blotting were applied to study the influence of FN1 on endogenous Nrf2 and its downstream genes. Bisulfite genomic sequencing (BGS) and methylated DNA immunoprecipitation (MeDIP) were then performed to examine the methylation profile of the Nrf2 promoter. An anchorage-independent colony-formation analysis was conducted to examine the tumor inhibition activity of FN1. Epigenetic modification enzymes, including DNMTs and HDACs, were investigated by Western blotting. The luciferase reporter assay indicated that FN1 was more potent than curcumin in activating the Nrf2-ARE pathway. FN1 increased the expression of Nrf2 and its downstream detoxifying enzymes. FN1 significantly inhibited the colony formation of TRAMP-C1 cells. BGS and MeDIP assays revealed that FN1 treatment (250 nM for 3 days) reduced the percentage of CpG methylation of the Nrf2 promoter. FN1 also downregulated epigenetic modification enzymes. In conclusion, our results suggest that FN1 is a novel anticancer agent for prostate cancer. In the TRAMP-C1 cell line, FN1 can increase the level of Nrf2 and downstream genes via activating the Nrf2-ARE pathway and inhibit the colony formation potentially through the decreased expression of keap1 coupled with CpG demethylation of the Nrf2 promoter. This CpG demethylation effect may come from decreased epigenetic modification enzymes, such as DNMT1, DNMT3a, DNMT3b, and HDAC4.

MicroRNA-31 expression in relation to BRAF mutation, CpG island methylation and colorectal continuum in serrated lesions.

PubMed

Ito, Miki; Mitsuhashi, Kei; Igarashi, Hisayoshi; Nosho, Katsuhiko; Naito, Takafumi; Yoshii, Shinji; Takahashi, Hiroaki; Fujita, Masahiro; Sukawa, Yasutaka; Yamamoto, Eiichiro; Takahashi, Taiga; Adachi, Yasushi; Nojima, Masanori; Sasaki, Yasushi; Tokino, Takashi; Baba, Yoshifumi; Maruyama, Reo; Suzuki, Hiromu; Imai, Kohzoh; Yamamoto, Hiroyuki; Shinomura, Yasuhisa

2014-12-01

The CpG island methylator phenotype (CIMP) is a distinct form of epigenomic instability. Many CIMP-high colorectal cancers (CRCs) with BRAF mutation are considered to arise from serrated pathway. We recently reported that microRNA-31 (miR-31) is associated with BRAF mutation in colorectal tumors. Emerging new approaches have revealed gradual changes in BRAF mutation and CIMP-high throughout the colorectum in CRCs. Here, we attempted to identify a possible association between miR-31 and epigenetic features in serrated pathway, and hypothesized that miR-31 supports the "colorectal continuum" concept. We evaluated miR-31 expression, BRAF mutation and epigenetic features including CIMP status in 381 serrated lesions and 222 non-serrated adenomas and examined associations between them and tumor location (rectum; sigmoid, descending, transverse and ascending colon and cecum). A significant association was observed between high miR-31 expression and CIMP-high status in serrated lesions with BRAF mutation (p = 0.0001). In contrast, miR-31 was slightly but insignificantly associated with CIMP status in the cases with wild-type BRAF. miR-31 expression in sessile serrated adenomas (SSAs) with cytological dysplasia was higher than that in SSAs, whereas, no significant difference was observed between traditional serrated adenomas (TSAs) and TSAs with high-grade dysplasia. The frequency of miR-31, BRAF mutation CIMP-high and MLH1 methylation increased gradually from the rectum to cecum in serrated lesions. In conclusion, miR-31 expression was associated with CIMP-high status in serrated lesions with BRAF mutation. Our data also suggested that miR-31 plays an important role in SSA evolution and may be a molecule supporting the colorectal continuum. © 2014 UICC.

Interaction of DRD4 Methylation and Phthalate Metabolites Affects Continuous Performance Test Performance in ADHD.

PubMed

Kim, Johanna Inhyang; Kim, Jae-Won; Shin, Inkyung; Kim, Bung-Nyun

2018-05-01

We investigated the interaction effect between the methylation of dopamine receptor D4 (DRD4) and phthalate exposure in ADHD on continuous performance test (CPT) variables. Urine concentrations of mono-(2-ethyl-5-hydroxyhexyl) phthalate (MEHHP), mono-(2-ethyl-5-oxohexyl) phthalate (MEOHP), and mono-n-butyl phthalate (MBP) were tested. The methylation status was analyzed for CpG sites of DRD4. Multivariable linear regression models were applied to investigate the interaction effects of methylation and phthalate levels. There was a significant interaction effect of the methylation of CpG26 and CpG28 with the MEHHP level on omission errors in ADHD patients, but not in controls. The post hoc analysis revealed a significant correlation between the MEHHP concentration and omission errors in the methylated group, but not in the unmethylated group. The interaction between the methylation status of CpG sites of DRD4, particularly CpG26 and CpG28, and phthalate metabolite levels affects the attention level in ADHD patients.

Analysis of a Cholera Toxin B Subunit (CTB) and Human Mucin 1 (MUC1) Conjugate Protein in a MUC1 Tolerant Mouse Model

PubMed Central

Pinkhasov, Julia; Alvarez, M. Lucrecia; Pathangey, Latha B.; Tinder, Teresa L.; Mason, Hugh S.; Walmsley, Amanda M.; Gendler, Sandra J.; Mukherjee, Pinku

2011-01-01

Since epithelial mucin 1 (MUC1) is associated with several adenocarcinomas at mucosal sites, it is pertinent to test the efficacy of a mucosally targeted vaccine formulation. The B subunit of the Vibrio cholerae cholera toxin (CTB) has great potential to act as a mucosal carrier for subunit vaccines. In the present study we evaluated whether a MUC1 tandem repeat (TR) peptide chemically linked to CTB would break self-antigen tolerance in the transgenic MUC1 tolerant mouse model (MUC1.Tg) through oral or parenteral immunizations. We report that oral immunization with the CTB-MUC1 conjugate along with mucosal adjuvant, unmethylated CpG oligodeoxynucleotide (ODN) and interleukin-12 (IL-12), did not break self-antigen tolerance in MUC1.Tg mice, but induced a strong humoral response in wild-type C57BL/6 mice. However, self-antigen tolerance in the MUC1.Tg mouse model was broken after parenteral immunizations with different doses of the CTB-MUC1 conjugate protein and with the adjuvant CpG ODN co-delivered with CTB-MUC1. Importantly, mice immunized systemically with CpG ODN alone and with CTB-MUC1 exhibited decreased tumor burden when challenged with a mammary gland tumor cell line that expresses human MUC1. PMID:20824430

Analysis of a cholera toxin B subunit (CTB) and human mucin 1 (MUC1) conjugate protein in a MUC1-tolerant mouse model.

PubMed

Pinkhasov, Julia; Alvarez, M Lucrecia; Pathangey, Latha B; Tinder, Teresa L; Mason, Hugh S; Walmsley, Amanda M; Gendler, Sandra J; Mukherjee, Pinku

2010-12-01

Since epithelial mucin 1 (MUC1) is associated with several adenocarcinomas at the mucosal sites, it is pertinent to test the efficacy of a mucosally targeted vaccine formulation. The B subunit of the Vibrio cholerae cholera toxin (CTB) has great potential to act as a mucosal carrier for subunit vaccines. In the present study we evaluated whether a MUC1 tandem repeat (TR) peptide chemically linked to CTB would break self-antigen tolerance in the transgenic MUC1-tolerant mouse model (MUC1.Tg) through oral or parenteral immunizations. We report that oral immunization with the CTB-MUC1 conjugate along with mucosal adjuvant, unmethylated CpG oligodeoxynucleotide (ODN) and interleukin-12 (IL-12) did not break self-antigen tolerance in MUC1.Tg mice, but induced a strong humoral response in wild-type C57BL/6 mice. However, self-antigen tolerance in the MUC1.Tg mouse model was broken after parenteral immunizations with different doses of the CTB-MUC1 conjugate protein and with the adjuvant CpG ODN co-delivered with CTB-MUC1. Importantly, mice immunized systemically with CpG ODN alone and with CTB-MUC1 exhibited decreased tumor burden when challenged with a mammary gland tumor cell line that expresses human MUC1.

Human papillomavirus type 16 E6 suppresses microRNA-23b expression in human cervical cancer cells through DNA methylation of the host gene C9orf3.

PubMed

Yeung, Chi Lam Au; Tsang, Tsun Yee; Yau, Pak Lun; Kwok, Tim Tak

2017-02-14

Oncogenic protein E6 of human papillomavirus type 16 (HPV-16) is believed to involve in the aberrant methylation in cervical cancer as it upregulates DNA methyltransferase 1 (DNMT1) through tumor suppressor p53. In addition, DNA demethylating agent induces the expression of one of the HPV-16 E6 regulated microRNAs (miRs), miR-23b, in human cervical carcinoma SiHa cells. Thus, the importance of DNA methylation and miR-23b in HPV-16 E6 associated cervical cancer development is investigated. In the present study, however, it is found that miR-23b is not embedded in any typical CpG island. Nevertheless, a functional CpG island is predicted in the promoter region of C9orf3, the host gene of miR-23b, and is validated by methylation-specific PCR and bisulfite genomic sequencing analyses. Besides, c-MET is confirmed to be a target gene of miR-23b. Silencing of HPV-16 E6 is found to increase the expression of miR-23b, decrease the expression of c-MET and thus induce the apoptosis of SiHa cells through the c-MET downstream signaling pathway. Taken together, the tumor suppressive miR-23b is epigenetically inactivated through its host gene C9orf3 and this is probably a critical pathway during HPV-16 E6 associated cervical cancer development.

DNA motifs associated with aberrant CpG island methylation.

PubMed

Feltus, F Alex; Lee, Eva K; Costello, Joseph F; Plass, Christoph; Vertino, Paula M

2006-05-01

Epigenetic silencing involving the aberrant methylation of promoter region CpG islands is widely recognized as a tumor suppressor silencing mechanism in cancer. However, the molecular pathways underlying aberrant DNA methylation remain elusive. Recently we showed that, on a genome-wide level, CpG island loci differ in their intrinsic susceptibility to aberrant methylation and that this susceptibility can be predicted based on underlying sequence context. These data suggest that there are sequence/structural features that contribute to the protection from or susceptibility to aberrant methylation. Here we use motif elicitation coupled with classification techniques to identify DNA sequence motifs that selectively define methylation-prone or methylation-resistant CpG islands. Motifs common to 28 methylation-prone or 47 methylation-resistant CpG island-containing genomic fragments were determined using the MEME and MAST algorithms (). The five most discriminatory motifs derived from methylation-prone sequences were found to be associated with CpG islands in general and were nonrandomly distributed throughout the genome. In contrast, the eight most discriminatory motifs derived from the methylation-resistant CpG islands were randomly distributed throughout the genome. Interestingly, this latter group tended to associate with Alu and other repetitive sequences. Used together, the frequency of occurrence of these motifs successfully discriminated methylation-prone and methylation-resistant CpG island groups with an accuracy of 87% after 10-fold cross-validation. The motifs identified here are candidate methylation-targeting or methylation-protection DNA sequences.

A heterozygous IDH1R132H/WT mutation induces genome-wide alterations in DNA methylation.

PubMed

Duncan, Christopher G; Barwick, Benjamin G; Jin, Genglin; Rago, Carlo; Kapoor-Vazirani, Priya; Powell, Doris R; Chi, Jen-Tsan; Bigner, Darell D; Vertino, Paula M; Yan, Hai

2012-12-01

Monoallelic point mutations of the NADP(+)-dependent isocitrate dehydrogenases IDH1 and IDH2 occur frequently in gliomas, acute myeloid leukemias, and chondromas, and display robust association with specific DNA hypermethylation signatures. Here we show that heterozygous expression of the IDH1(R132H) allele is sufficient to induce the genome-wide alterations in DNA methylation characteristic of these tumors. Using a gene-targeting approach, we knocked-in a single copy of the most frequently observed IDH1 mutation, R132H, into a human cancer cell line and profiled changes in DNA methylation at over 27,000 CpG dinucleotides relative to wild-type parental cells. We find that IDH1(R132H/WT) mutation induces widespread alterations in DNA methylation, including hypermethylation of 2010 and hypomethylation of 842 CpG loci. We demonstrate that many of these alterations are consistent with those observed in IDH1-mutant and G-CIMP+ primary gliomas and can segregate IDH wild-type and mutated tumors as well as those exhibiting the G-CIMP phenotype in unsupervised analysis of two primary glioma cohorts. Further, we show that the direction of IDH1(R132H/WT)-mediated DNA methylation change is largely dependent upon preexisting DNA methylation levels, resulting in depletion of moderately methylated loci. Additionally, whereas the levels of multiple histone H3 and H4 methylation modifications were globally increased, consistent with broad inhibition of histone demethylation, hypermethylation at H3K9 in particular accompanied locus-specific DNA hypermethylation at several genes down-regulated in IDH1(R132H/WT) knock-in cells. These data provide insight on epigenetic alterations induced by IDH1 mutations and support a causal role for IDH1(R132H/WT) mutants in driving epigenetic instability in human cancer cells.

Maternally Expressed Gene 3, an imprinted non-coding RNA gene, is associated with meningioma pathogenesis and progression

PubMed Central

Zhang, Xun; Gejman, Roger; Mahta, Ali; Zhong, Ying; Rice, Kimberley A.; Zhou, Yunli; Cheunsuchon, Pornsuk; Louis, David N.; Klibanski, Anne

2010-01-01

Meningiomas are common tumors, representing 15-25% of all central nervous system tumors. NF2 gene inactivation on chromosome 22 has been shown as an early event in tumorigenesis; however, few factors underlying tumor growth and progression have been identified. Chromosomal abnormalities of 14q32 are often associated with meningioma pathogenesis and progression; therefore it has been proposed that an as yet unidentified tumor suppressor is present at this locus. MEG3 is an imprinted gene located at 14q32 that encodes a non-coding RNA with an anti-proliferative function. We found that MEG3 mRNA is highly expressed in normal arachnoidal cells. However, MEG3 is not expressed in the majority of human meningiomas or the human meningioma cell lines IOMM-Lee and CH157-MN. There is a strong association between loss of MEG3 expression and tumor grade. Allelic loss at the MEG3 locus is also observed in meningiomas, with increasing prevalence in higher grade tumors. In addition, there is an increase in CpG methylation within the promoter and the imprinting control region of MEG3 gene in meningiomas. Functionally, MEG3 suppresses DNA synthesis in both IOMM-Lee and CH157-MN cells by approximately 60% in BrdU incorporation assays. Colony-forming efficiency assays show that MEG3 inhibits colony formation in CH157-MN cells by approximately 80%. Furthermore, MEG3 stimulates p53-mediated transactivation in these cell lines. Therefore, these data are consistent with the hypothesis that MEG3, which encodes a non-coding RNA, may be a tumor suppressor gene at chromosome 14q32 involved in meningioma progression via a novel mechanism. PMID:20179190

Sustained exogenous expression of therapeutic levels of IFN-gamma ameliorates atopic dermatitis in NC/Nga mice via Th1 polarization.

PubMed

Hattori, Kayoko; Nishikawa, Makiya; Watcharanurak, Kanitta; Ikoma, Akihiko; Kabashima, Kenji; Toyota, Hiroyasu; Takahashi, Yuki; Takahashi, Rei; Watanabe, Yoshihiko; Takakura, Yoshinobu

2010-03-01

The short in vivo half-life of IFN-gamma can prevent the cytokine from inducing immunological changes that are favorable for the treatment of Th2-dominant diseases, such as atopic dermatitis. To examine whether a sustained supply of IFN-gamma is effective in regulating the balance of Th lymphocyte subpopulations, plasmid vector encoding mouse IFN-gamma, pCpG-Mugamma, or pCMV-Mugamma was injected into the tail vein of NC/Nga mice, a model for human atopic dermatitis. A single hydrodynamic injection of a CpG motif reduced pCpG-Mugamma at a dose of 0.14 microg/mouse resulted in a sustained concentration of IFN-gamma in the serum, and the concentration was maintained at >300 pg/ml over 80 d. The pCpG-Mugamma-mediated IFN-gamma gene transfer was associated with an increase in the serum concentration of IL-12, reduced production of IgE, and inhibition of mRNA expression of IL-4, -5, -10, -13, and -17 and thymus and activation-regulated chemokine in the spleen. These immunological changes were not clearly observed in mice receiving two injections of 20 microg pCMV-Mugamma, a CpG-replete plasmid DNA, because of the transient nature of the expression from the vector. The mice receiving pCpG-Mugamma showed a significant reduction in the severity of skin lesions and in the intensity of their scratching behavior. Furthermore, high transepidermal water loss, epidermal thickening, and infiltration of lymphocytes and eosinophils, all of which were obvious in the untreated mice, were significantly inhibited. These results indicate that an extraordinary sustained IFN-gamma expression induces favorable immunological changes, leading to a Th1-dominant state in the atopic dermatitis model.

Successful Therapy of Murine Visceral Leishmaniasis with Astrakurkurone, a Triterpene Isolated from the Mushroom Astraeus hygrometricus, Involves the Induction of Protective Cell-Mediated Immunity and TLR9

PubMed Central

Mallick, Suvadip; Dutta, Aritri; Chaudhuri, Ankur; Mukherjee, Debasri; Dey, Somaditya; Halder, Subhadra; Ghosh, Joydip; Mukherjee, Debarati; Sultana, Sirin Salma; Biswas, Gunjan; Lai, Tapan Kumar; Patra, Pradyumna; Sarkar, Indranil; Chakraborty, Sibani; Saha, Bhaskar; Acharya, Krishnendu

2016-01-01

In our previous report, we showed that astrakurkurone, a triterpene isolated from the Indian mushroom Astraeus hygrometricus (Pers.) Morgan, induced reactive oxygen species, leading to apoptosis in Leishmania donovani promastigotes, and also was effective in inhibiting intracellular amastigotes at the 50% inhibitory concentration of 2.5 μg/ml. The aim of the present study is to characterize the associated immunomodulatory potentials and cellular activation provided by astrakurkurone, leading to effective antileishmanial activity in vitro and in vivo. Astrakurkurone-mediated antileishmanial activity was evaluated by real-time PCR and flow cytometry. The involvement of Toll-like receptor 9 (TLR9) was studied by in vitro assay in the presence of a TLR9 agonist and antagonist and by in silico modeling of a three-dimensional structure of the ectodomain of TLR9 and its interaction with astrakurkurone. Astrakurkurone caused a significant increase in TLR9 expression of L. donovani-infected macrophages along with the activation of proinflammatory responses. The involvement of TLR9 in astrakurkurone-mediated amastigote killing has been evidenced from the fact that a TLR9 agonist (CpG, ODN 1826) in combination with astrakurkurone enhanced the amastigote killing, while a TLR9 antagonist (bafilomycin A1) alone or in combination with astrakurkurone curbed the amastigote killing, which could be further justified by in silico evidence of docking between mouse TLR9 and astrakurkurone. Astrakurkurone was found to reduce the parasite burden in vivo by inducing protective cytokines, gamma interferon and interleukin 17. Moreover, astrakurkurone was nontoxic toward peripheral blood mononuclear cells of immunocompromised patients with visceral leishmaniasis. Astrakurkurone, a nontoxic antileishmanial, enhances the immune efficiency of host cells, leading to parasite clearance in vitro and in vivo. PMID:26883702

Phenobarbital Mediates an Epigenetic Switch at the Constitutive Androstane Receptor (CAR) Target Gene Cyp2b10 in the Liver of B6C3F1 Mice

PubMed Central

Brasa, Sarah; Teo, Soon-Siong; Roloff, Tim-Christoph; Morawiec, Laurent; Zamurovic, Natasa; Vicart, Axel; Funhoff, Enrico; Couttet, Philippe; Schübeler, Dirk; Grenet, Olivier; Marlowe, Jennifer; Moggs, Jonathan; Terranova, Rémi

2011-01-01

Evidence suggests that epigenetic perturbations are involved in the adverse effects associated with some drugs and toxicants, including certain classes of non-genotoxic carcinogens. Such epigenetic changes (altered DNA methylation and covalent histone modifications) may take place at the earliest stages of carcinogenesis and their identification holds great promise for biomedical research. Here, we evaluate the sensitivity and specificity of genome-wide epigenomic and transcriptomic profiling in phenobarbital (PB)-treated B6C3F1 mice, a well-characterized rodent model of non-genotoxic liver carcinogenesis. Methylated DNA Immunoprecipitation (MeDIP)-coupled microarray profiling of 17,967 promoter regions and 4,566 intergenic CpG islands was combined with genome-wide mRNA expression profiling to identify liver tissue-specific PB-mediated DNA methylation and transcriptional alterations. Only a limited number of significant anti-correlations were observed between PB-induced transcriptional and promoter-based DNA methylation perturbations. However, the constitutive androstane receptor (CAR) target gene Cyp2b10 was found to be concomitantly hypomethylated and transcriptionally activated in a liver tissue-specific manner following PB treatment. Furthermore, analysis of active and repressive histone modifications using chromatin immunoprecipitation revealed a strong PB-mediated epigenetic switch at the Cyp2b10 promoter. Our data reveal that PB-induced transcriptional perturbations are not generally associated with broad changes in the DNA methylation status at proximal promoters and suggest that the drug-inducible CAR pathway regulates an epigenetic switch from repressive to active chromatin at the target gene Cyp2b10. This study demonstrates the utility of integrated epigenomic and transcriptomic profiling for elucidating early mechanisms and biomarkers of non-genotoxic carcinogenesis. PMID:21455306

Phenobarbital mediates an epigenetic switch at the constitutive androstane receptor (CAR) target gene Cyp2b10 in the liver of B6C3F1 mice.

PubMed

Lempiäinen, Harri; Müller, Arne; Brasa, Sarah; Teo, Soon-Siong; Roloff, Tim-Christoph; Morawiec, Laurent; Zamurovic, Natasa; Vicart, Axel; Funhoff, Enrico; Couttet, Philippe; Schübeler, Dirk; Grenet, Olivier; Marlowe, Jennifer; Moggs, Jonathan; Terranova, Rémi

2011-03-24

Evidence suggests that epigenetic perturbations are involved in the adverse effects associated with some drugs and toxicants, including certain classes of non-genotoxic carcinogens. Such epigenetic changes (altered DNA methylation and covalent histone modifications) may take place at the earliest stages of carcinogenesis and their identification holds great promise for biomedical research. Here, we evaluate the sensitivity and specificity of genome-wide epigenomic and transcriptomic profiling in phenobarbital (PB)-treated B6C3F1 mice, a well-characterized rodent model of non-genotoxic liver carcinogenesis. Methylated DNA Immunoprecipitation (MeDIP)-coupled microarray profiling of 17,967 promoter regions and 4,566 intergenic CpG islands was combined with genome-wide mRNA expression profiling to identify liver tissue-specific PB-mediated DNA methylation and transcriptional alterations. Only a limited number of significant anti-correlations were observed between PB-induced transcriptional and promoter-based DNA methylation perturbations. However, the constitutive androstane receptor (CAR) target gene Cyp2b10 was found to be concomitantly hypomethylated and transcriptionally activated in a liver tissue-specific manner following PB treatment. Furthermore, analysis of active and repressive histone modifications using chromatin immunoprecipitation revealed a strong PB-mediated epigenetic switch at the Cyp2b10 promoter. Our data reveal that PB-induced transcriptional perturbations are not generally associated with broad changes in the DNA methylation status at proximal promoters and suggest that the drug-inducible CAR pathway regulates an epigenetic switch from repressive to active chromatin at the target gene Cyp2b10. This study demonstrates the utility of integrated epigenomic and transcriptomic profiling for elucidating early mechanisms and biomarkers of non-genotoxic carcinogenesis.

75 FR 13555 - Compliance Policy Guide Sec. 540.375 Canned Salmon - Adulteration Involving Decomposition (CPG...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-03-22

...] (Formerly Docket No. 1998N-0046) Compliance Policy Guide Sec. 540.375 Canned Salmon -- Adulteration... of Compliance Policy Guide Sec. 540.375 Canned Salmon -- Adulteration Involving Decomposition (CPG... relating to decomposition in fish and fishery products, including canned salmon, is provided in CPG Sec...

Distinct Effects of Monophosphoryl Lipid A, Oligodeoxynucleotide CpG, and Combination Adjuvants on Modulating Innate and Adaptive Immune Responses to Influenza Vaccination.

PubMed

Ko, Eun-Ju; Lee, Young-Tae; Lee, Youri; Kim, Ki-Hye; Kang, Sang-Moo

2017-10-01

Monophosphoryl lipid A (MPL) and oligodeoxynucleotide CpG are toll-like receptor (TLR) 4 and 9 agonist, respectively. Here, we investigated the effects of MPL, CpG, and combination adjuvants on stimulating in vitro dendritic cells (DCs), in vivo innate and adaptive immune responses, and protective efficacy of influenza vaccination. Combination of MPL and CpG was found to exhibit distinct effects on stimulating DCs in vitro to secrete IL-12p70 and tumor necrosis factor (TNF)-α and proliferate allogeneic CD8 T cells. Prime immunization of mice with inactivated split influenza vaccine in the presence of low dose MPL+CpG adjuvants increased the induction of virus-specific IgG and IgG2a isotype antibodies. MPL and CpG adjuvants contribute to improving the efficacy of prime influenza vaccination against lethal influenza challenge as determined by body weight monitoring, lung function, viral titers, and histology. A combination of MPL and CpG adjuvants was effective in improving vaccine efficacy as well as in reducing inflammatory immune responses locally and in inducing cellular immune responses upon lethal influenza virus challenge. This study demonstrates unique adjuvant effects of MPL, CpG, and combination adjuvants on modulating innate and adaptive immune responses to influenza prime vaccination.

Quantitative, high-resolution epigenetic profiling of CpG loci identifies associations with cord blood plasma homocysteine and birth weight in humans

PubMed Central

Ismail, Khaled MK; Haworth, Kim E; Mein, Charles; Carroll, William D

2011-01-01

Supplementation with folic acid during pregnancy is known to reduce the risk of neural tube defects and low birth weight. It is thought that folate and other one-carbon intermediates might secure these clinical effects via DNA methylation. We examined the effects of folate on the human methylome using quantitative interrogation of 27,578 CpG loci associated with 14,496 genes at single-nucleotide resolution across 12 fetal cord blood samples. Consistent with previous studies, the majority of CpG dinucleotides located within CpG islands exhibited hypomethylation while those outside CpG islands showed mid-high methylation. However, for the first time in human samples, unbiased analysis of methylation across samples revealed a significant correlation of methylation patterns with plasma homocysteine, LINE-1 methylation and birth weight centile. Additionally, CpG methylation significantly correlated with either birth weight or LINE-1 methylation were predominantly located in CpG islands. These data indicate that levels of folate-associated intermediates in cord blood reflect their influence and consequences for the fetal epigenome and potentially on pregnancy outcome. In these cases, their influence might be exerted during late gestation or reflect those present during the peri-conceptual period. PMID:20864804

Role of Replication and CpG Methylation in Fragile X Syndrome CGG Deletions in Primate Cells

PubMed Central

Nichol Edamura, Kerrie; Leonard, Michelle R.; Pearson, Christopher E.

2005-01-01

Instability of the fragile X CGG repeat involves both maternally derived expansions and deletions in the gametes of full-mutation males. It has also been suggested that the absence of aberrant CpG methylation may enhance repeat deletions through an unknown process. The effect of CGG tract length, DNA replication direction, location of replication initiation, and CpG methylation upon CGG stability were investigated using an SV40 primate replication system. Replication-dependant deletions with 53 CGG repeats were observed when replication was initiated proximal to the repeat, with CGG as the lagging-strand template. When we initiated replication further from the repeat, while maintaining CGG as the lagging-strand template or using CCG as the lagging-strand template, significant instability was not observed. CpG methylation of the unstable template stabilized the repeat, decreasing both the frequency and the magnitude of deletion events. Furthermore, CpG methylation slowed the efficiency of replication for all templates. Interestingly, replication forks displayed no evidence of a block at the CGG repeat tract, regardless of replication direction or CpG methylation status. Templates with 20 CGG repeats were stable under all circumstances. These results reveal that CGG deletions occur during replication and are sensitive to replication-fork dynamics, tract length, and CpG methylation. PMID:15625623

Topical CpG enhances the response of murine malignant melanoma to dacarbazine.

PubMed

Najar, Hossain M; Dutz, Jan P

2008-09-01

Malignant melanoma is a potentially fatal skin cancer that is increasing in incidence. Standard chemoimmunotherapy consisting of dacarbazine (DTIC) given with IFN-alpha has had disappointing results. We describe a chemoimmunotherapy protocol for cutaneous melanoma that combines the administration of DTIC with the topical application of CpG oligodinucleotide (ODN). Subcutaneous B16 melanoma tumors in C57BL/6 mice were treated with intraperitoneal injections of DTIC followed by the topical application of CpG-ODN over the tumors. This therapeutic approach abrogated the growth of established tumors and significantly enhanced survival. Topical CpG application was more effective than intratumoral CpG. Cell depletion studies indicated that the antitumor effect was dependent on both CD4(+) and CD8(+) cells but not on natural killer (NK) cells. Tumor-specific cytotoxic T-lymphocyte activity was generated in treated animals and was highest in topically treated animals. Immunohistochemical analysis revealed that DTIC, but not CpG, enhanced tumor cell apoptosis. Further, topical CpG induced an expansion of a B220(+)CD8(+) subset of dendritic cells and a subset of NK1.1(+) CD11c(+) cells within the tumors. By enhancing both tumor cell death and local immune activation, DTIC/topical CpG chemoimmunotherapy induced an effective T-cell-dependent host-immune response against melanoma.

CpG oligodeoxynucleotides augment the murine immune response to the Yersinia pestis F1-V vaccine in bubonic and pneumonic models of plague.

PubMed

Amemiya, Kei; Meyers, Jennifer L; Rogers, Taralyn E; Fast, Randy L; Bassett, Anthony D; Worsham, Patricia L; Powell, Bradford S; Norris, Sarah L; Krieg, Arthur M; Adamovicz, Jeffrey J

2009-04-06

The current U.S. Department of Defense candidate plague vaccine is a fusion between two Yersinia pestis proteins: the F1 capsular protein, and the low calcium response (Lcr) V-protein. We hypothesized that an immunomodulator, such as CpG oligodeoxynucleotide (ODN)s, could augment the immune response to the plague F1-V vaccine in a mouse model for plague. CpG ODNs significantly augmented the antibody response and efficacy of a single dose of the plague vaccine in murine bubonic and pneumonic models of plague. In the latter study, we also found an overall significant augmentation the immune response to the individual subunits of the plague vaccine by CpG ODN 2006. In a long-term, prime-boost study, CpG ODN induced a significant early augmentation of the IgG response to the vaccine. The presence of CpG ODN induced a significant increase in the IgG2a subclass response to the vaccine up to 5 months after the boost. Our studies showed that CpG ODNs significantly augmented the IgG antibody response to the plague vaccine, which increased the probability of survival in murine models of plague (P<0.0001).

The evolution of CpG density and lifespan in conserved primate and mammalian promoters

PubMed Central

McLain, Adam T.

2018-01-01

Gene promoters are evolutionarily conserved across holozoans and enriched in CpG sites, the target for DNA methylation. As animals age, the epigenetic pattern of DNA methylation degrades, with highly methylated CpG sites gradually becoming demethylated while CpG islands increase in methylation. Across vertebrates, aging is a trait that varies among species. We used this variation to determine whether promoter CpG density correlates with species’ maximum lifespan. Human promoter sequences were used to identify conserved regions in 131 mammals and a subset of 28 primate genomes. We identified approximately 1000 gene promoters (5% of the total), that significantly correlated CpG density with lifespan. The correlations were performed via the phylogenetic least squares method to account for trait similarity by common descent using phylogenetic branch lengths. Gene set enrichment analysis revealed no significantly enriched pathways or processes, consistent with the hypothesis that aging is not under positive selection. However, within both mammals and primates, 95% of the promoters showed a positive correlation between increasing CpG density and species lifespan, and two thirds were shared between the primate subset and mammalian datasets. Thus, these genes may require greater buffering capacity against age-related dysregulation of DNA methylation in longer-lived species. PMID:29661983

Leveraging workflow control patterns in the domain of clinical practice guidelines.

PubMed

Kaiser, Katharina; Marcos, Mar

2016-02-10

Clinical practice guidelines (CPGs) include recommendations describing appropriate care for the management of patients with a specific clinical condition. A number of representation languages have been developed to support executable CPGs, with associated authoring/editing tools. Even with tool assistance, authoring of CPG models is a labor-intensive task. We aim at facilitating the early stages of CPG modeling task. In this context, we propose to support the authoring of CPG models based on a set of suitable procedural patterns described in an implementation-independent notation that can be then semi-automatically transformed into one of the alternative executable CPG languages. We have started with the workflow control patterns which have been identified in the fields of workflow systems and business process management. We have analyzed the suitability of these patterns by means of a qualitative analysis of CPG texts. Following our analysis we have implemented a selection of workflow patterns in the Asbru and PROforma CPG languages. As implementation-independent notation for the description of patterns we have chosen BPMN 2.0. Finally, we have developed XSLT transformations to convert the BPMN 2.0 version of the patterns into the Asbru and PROforma languages. We showed that although a significant number of workflow control patterns are suitable to describe CPG procedural knowledge, not all of them are applicable in the context of CPGs due to their focus on single-patient care. Moreover, CPGs may require additional patterns not included in the set of workflow control patterns. We also showed that nearly all the CPG-suitable patterns can be conveniently implemented in the Asbru and PROforma languages. Finally, we demonstrated that individual patterns can be semi-automatically transformed from a process specification in BPMN 2.0 to executable implementations in these languages. We propose a pattern and transformation-based approach for the development of CPG models. Such an approach can form the basis of a valid framework for the authoring of CPG models. The identification of adequate patterns and the implementation of transformations to convert patterns from a process specification into different executable implementations are the first necessary steps for our approach.

Aberrant Methylation-Mediated Suppression of APAF1 in Myelodysplastic Syndrome.

PubMed

Zaker, Farhad; Nasiri, Nahid; Amirizadeh, Naser; Razavi, Seyed Mohsen; Yaghmaie, Marjan; Teimoori-Toolabi, Ladan; Maleki, Ali; Bakhshayesh, Masoumeh

2017-04-01

Background: Myelodysplastic syndromes (MDSs) include a diverse group of clonal bone marrow disorders characterized by ineffective hematopoiesis and pancytopenia. It was found that down regulation of APAF1, a putative tumor suppressor gene (TSG), leads to resistance to chemotherapy and disease development in some cancers. In this study, we investigated the relation of APAF1 methylation status with its expression and clinicopathological factors in myelodysplastic syndrome (MDS) patients. Materials and Methods: Methylation Sensitive-High Resolution Melting Curve Analysis (MS-HRM) was employed in studying the methylation of CpG islands in the APAF1promoter region in MDS. Gene expression was analyzed by using real time RT-PCR. Results: 42.6% of patient samples were methylated in promoter region of APAF1analyzed, while methylation of the gene was not seen in controls (P<0.05). Methylation of APAF1was significantly associated with the suppression of its mRNA expression (P=0.00). The methylation status of APAF1in advanced-stage MDS patients (80%) was significantly higher than that of the early-stage MDS patients (28.2%) (P=0.001). The difference in frequency of hypermethylatedAPAF1 gene was significant between good (37.5%) and poor (85.71%) cytogenetic risk groups (P=0.043). In addition, a higher frequency of APAF1hypermethylation was observed in higher-risk MDS group (69.2%) compared to lower-risk MDS group (34.14%) (P=0.026). Conclusion: Our study indicated that APAF1hypermethylation in MDS was associated to high-risk disease classified according to the IPSS, WHO and cytogenetic risk.

In ovo CpG DNA delivery increases innate and adaptive immune cells in respiratory, gastrointestinal and immune systems post-hatch correlating with lower infectious laryngotracheitis virus infection.

PubMed

Abdul-Cader, Mohamed Sarjoon; Amarasinghe, Aruna; Palomino-Tapia, Victor; Ahmed-Hassan, Hanaa; Bakhtawar, Khawaja; Nagy, Eva; Sharif, Shayan; Gomis, Susantha; Abdul-Careem, Mohamed Faizal

2018-01-01

Cytosine-guanosine deoxynucleotides (CpG) DNA can be delivered in ovo at embryo day (ED)18 for the stimulation of toll-like receptor (TLR)21 signaling pathway that ultimately protects chickens against a number of bacterial and viral infections. There is a dearth of information understanding the mechanisms of protection induced by in ovo delivered CpG DNA. The objective of this study was to determine the immune cell changes post-hatch following in ovo delivery of the TLR21 ligand, CpG DNA. In order to quantify changes of percentage of KUL01+, IgM+ B, cluster of differentiation (CD)4+ and CD8α+ cells, trachea, lung, duodenum, large intestine, spleen and bursa of Fabricius were collected on day 1 post-hatch. We found increased recruitments of KUL01+ cells, in organs of these body systems post-hatch following in ovo delivery of CpG DNA. Although IgM+ B cells, CD4+ and CD8α+ cells were increased in lungs and immune system organs, these cells were not quantifiable from the trachea, duodenum and large intestine immediately following the hatch. Furthermore, when CpG DNA is delivered in ovo and subsequently infected with infectious laryngotracheitis virus (ILTV) post-hatch on day 1, CpG DNA reduces morbidity and mortality resulting from ILTV infection. This study provides insights into the mechanisms of host responses elicited following in ovo delivery of CpG DNA in avian species.

Rolling Thunder -- Integration of the Solo 161 Stirling engine with the CPG-460 solar concentrator at Ft. Huachuca

DOE Office of Scientific and Technical Information (OSTI.GOV)

Diver, R.B.; Moss, T.A.; Goldberg, V.

Project Rolling Thunder is a dish/Stirling demonstration project at Ft. Huachuca, a US Army fort in southeastern Arizona (Huachuca means rolling thunder in Apache). It has been supported by the Strategic Environmental Research and Development Program (SERDP), a cooperative program between the Department of Defense (DoD) and the Department of Energy (DOE). As part of a 1992 SERDP project, Cummins Power Generation, Inc. (CPG) installed a CPG 7 kW(c) dish/Stirling system at the Joint Interoperability Test Command (JITC) in Ft. Huachuca, Arizona. The primary objective of the SERDP Dish/Stirling for DoD Applications project was to demonstrate a CPG 7-kW(c) dish/Stirlingmore » system at a military facility. Unfortunately, Cummins Engine Company decided to divest its solar operations. As a direct result of Ft. Huachuca`s interest in the Cummins dish/Stirling technology, Sandia explored the possibility of installing a SOLO 161 Stirling power conversion unit (PCU) on the Ft. Huachuca CPG-460. In January 1997, a decision was made to retrofit a SOLO 161 Stirling engine on the CPG-460 at Ft. Huachuca. Project Rolling Thunder. The SOLO 161 Demonstration at Ft. Huachuca has been a challenge. Although, the SOLO 161 PCU has operated nearly flawlessly and the CPG-460 has been, for the most part, a solid and reliable component, integration of the SOLO PCU with the CPG-460 has required significant attention. In this paper, the integration issues and technical approaches of project Rolling Thunder are presented. Lessons of the project are also discussed.« less

Guideline-Driven Care Improves Outcomes in Patients with Traumatic Rib Fractures.

PubMed

Flarity, Kathleen; Rhodes, Whitney C; Berson, Andrew J; Leininger, Brian E; Reckard, Paul E; Riley, Keyan D; Shahan, Charles P; Schroeppel, Thomas J

2017-09-01

There is no established national standard for rib fracture management. A clinical practice guideline (CPG) for rib fractures, including monitoring of pulmonary function, early initiation of aggressive loco-regional analgesia, and early identification of deteriorating respiratory function, was implemented in 2013. The objective of the study was to evaluate the effect of the CPG on hospital length of stay. Hospital length of stay (LOS) was compared for adult patients admitted to the hospital with rib fracture(s) two years before and two years after CPG implementation. A separate analysis was done for the patients admitted to the intensive care unit (ICU). Over the 48-month study period, 571 patients met inclusion criteria for the study. Pre-CPG and CPG study groups were well matched with few differences. Multivariable regression did not demonstrate a difference in LOS (B = -0.838; P = 0.095) in the total study cohort. In the ICU cohort (n = 274), patients in the CPG group were older (57 vs 52 years; P = 0.023) and had more rib fractures (4 vs 3; P = 0.003). Multivariable regression identified a significant decrease in LOS for those patients admitted in the CPG period (B = -2.29; P = 0.019). Despite being significantly older with more rib fractures in the ICU cohort, patients admitted after implementation of the CPG had a significantly reduced LOS on multivariable analysis, reducing LOS by over two days. This structured intervention can limit narcotic usage, improve pulmonary function, and decrease LOS in the most injured patients with chest trauma.

Energetic study of cardioplegic hearts under ischaemia/reperfusion and [Ca(2+)] changes in cardiomyocytes of guinea-pig: mitochondrial role.

PubMed

Ragone, M I; Torres, N S; Consolini, A E

2013-02-01

To study the role of mitochondria in the recovery of guinea-pig hearts exposed to high-K(+)-cardioplegia (CPG) and ischaemia/reperfusion (I/R) METHODS: We measured contractility and heat release in perfused guinea-pig hearts and cytosolic and mitochondrial Ca(2+) by epifluorescence and confocal microscopy in isolated cardiomyocytes loaded with Fluo-4 or Rhod-2. In hearts, CPG increased the postischaemic contractile recovery, and this was potentiated by the mNCX blocker clonazepam and the mKATP opener diazoxide, which also prevented the fall in muscle economy. Moreover, CPG prevented the stunning induced by ouabain, which was reduced by clonazepam. In cardiomyocytes, CPG increased fluorescent signals of cytosolic and mitochondrial Ca(2+), while the addition of a mNCX blocker (CGP37157) increased cytosolic but reduced mitochondrial [Ca(2+)]. Ouabain in CPG increased cytosolic Ca(2+) and resting heat, but the addition of CGP37157 reduced them, as well as mitochondrial Ca(2+). CPG, diazoxide and clonazepam improve postischaemic recovery, respectively, by increasing the Ca(2+) cycling and by reducing the mitochondrial Ca(2+) uptake either by uniporter or by mNCX. The mitochondria compete with the leaky sarcoplasmic reticulum (SR) as sink of Ca(2+) in guinea-pig hearts, affecting the postischaemic contractility. CPG also prevented the ouabain-induced dysfunction by avoiding the Ca(2+) overload. Ouabain reduced the synergism between CPG and clonazepam suggesting that [Na(+)]i and SR load influence the mNCX role. © 2012 The Authors Acta Physiologica © 2012 Scandinavian Physiological Society.

Epigenetic silencing of BTB and CNC homology 2 and concerted promoter CpG methylation in gastric cancer.

PubMed

Haam, Keeok; Kim, Hee-Jin; Lee, Kyung-Tae; Kim, Jeong-Hwan; Kim, Mirang; Kim, Seon-Young; Noh, Seung-Moo; Song, Kyu-Sang; Kim, Yong Sung

2014-09-01

BTB and CNC homology 2 (BACH2) is a lymphoid-specific transcription factor with a prominent role in B-cell development. Genetic polymorphisms within a single locus encoding BACH2 are associated with various autoimmune diseases and allergies. In this study, restriction landmark genomic scanning revealed methylation at a NotI site in a CpG island covering the BACH2 promoter in gastric cancer cell lines and primary gastric tumors. Increased methylation of the BACH2 promoter was observed in 52% (43/83) of primary gastric tumors, and BACH2 hypermethylation was significantly associated with decreased gene expression. Treatment with 5-aza-2'-deoxycytidine and/or trichostatin. A restored BACH2 expression in BACH2-silenced gastric cancer cell lines, and knockdown of BACH2 using short hairpin RNA (i.e. RNA interference) increased cell proliferation in gastric cancer cells. Clinicopathologic data showed that decreased BACH2 expression occurred significantly more frequently in intestinal-type (27/44, 61%) compared with diffuse-type (13/50, 26%) gastric cancers (P<0.001). Furthermore, BACH2 promoter methylation paralleled that of previously identified targets, such as LRRC3B, LIMS2, PRKD1 and POPDC3, in a given set of gastric tumors. We propose that concerted methylation in many promoters plays a role in accelerating gastric tumor formation and that methylated promoter loci may be targets for therapeutic treatment, such as the recently introduced technique of epigenetic editing. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Genome-wide mapping and analysis of active promoters in mouse embryonic stem cells and adult organs

PubMed Central

Barrera, Leah O.; Li, Zirong; Smith, Andrew D.; Arden, Karen C.; Cavenee, Webster K.; Zhang, Michael Q.; Green, Roland D.; Ren, Bing

2008-01-01

By integrating genome-wide maps of RNA polymerase II (Polr2a) binding with gene expression data and H3ac and H3K4me3 profiles, we characterized promoters with enriched activity in mouse embryonic stem cells (mES) as well as adult brain, heart, kidney, and liver. We identified ∼24,000 promoters across these samples, including 16,976 annotated mRNA 5′ ends and 5153 additional sites validating cap-analysis of gene expression (CAGE) 5′ end data. We showed that promoters with CpG islands are typically non-tissue specific, with the majority associated with Polr2a and the active chromatin modifications in nearly all the tissues examined. By contrast, the promoters without CpG islands are generally associated with Polr2a and the active chromatin marks in a tissue-dependent way. We defined 4396 tissue-specific promoters by adapting a quantitative index of tissue-specificity based on Polr2a occupancy. While there is a general correspondence between Polr2a occupancy and active chromatin modifications at the tissue-specific promoters, a subset of them appear to be persistently marked by active chromatin modifications in the absence of detectable Polr2a binding, highlighting the complexity of the functional relationship between chromatin modification and gene expression. Our results provide a resource for exploring promoter Polr2a binding and epigenetic states across pluripotent and differentiated cell types in mammals. PMID:18042645

Epigenetic Upregulation of HGF and c-Met Drives Metastasis in Hepatocellular Carcinoma

PubMed Central

Ogunwobi, Olorunseun O.; Puszyk, William; Dong, Hui-Jia; Liu, Chen

2013-01-01

Hepatocyte growth factor (HGF) and its receptor, c-Met, are important regulators of growth and differentiation of healthy hepatocytes. However, upregulation of HGF and c-Met have been associated with tumor progression and metastasis in hepatocellular carcinoma (HCC). Hematogenous dissemination is the most common route for cancer metastasis, but the role of HGF and c-Met in circulating tumor cells (CTCs) is unknown. We have isolated and established a circulating tumor cell line from the peripheral blood of a mouse HCC model. Our studies show that these CTCs have increased expression of HGF and c-Met in comparison to the primary tumor cells. The CTCs display phenotypic evidence of epithelial-mesenchymal transition (EMT) and the EMT appears to be inducible by HGF. Epigenetic analysis of the c-Met promoter identified significant loss of DNA methylation in CTCs which correlated with overexpression of c-Met and increased expression of HGF. Six specific CpG sites of c-Met promoter demethylation were identified. CTCs show significantly increased tumorigenicity and metastatic potential in a novel orthotopic syngeneic model of metastatic HCC. We conclude that during hematogenous dissemination in HCC, CTCs undergo EMT under the influence of increased HGF. This process also involves up regulation of c-Met via promoter demethylation at 6 CpG sites. Consequently, targeting HGF and c-Met expression by CTCs may be a novel non-invasive approach with potential clinical applications in HCC management. PMID:23723997

Functional characterization of the human phosphodiesterase 7A1 promoter.

PubMed Central

Torras-Llort, Mònica; Azorín, Fernando

2003-01-01

In this paper, the human phosphodiesterase 7A1 (h PDE7A1 ) promoter region was identified and functionally characterized. Transient transfection experiments indicated that a 2.9 kb fragment of the h PDE7A1 5'-flanking region, to position -2907, has strong promoter activity in Jurkat T-cells. Deletion analysis showed that the proximal region, up to position -988, contains major cis -regulatory elements of the h PDE7A1 promoter. This minimal promoter region contains a regulatory CpG island which is essential for promoter activity. The CpG island contains three potential cAMP-response-element-binding protein (CREB)-binding sites that, as judged by in vivo dimethyl sulphate (DMS) footprinting, are occupied in Jurkat T-cells. Moreover, over-expression of CREB results in increased promoter activity, but, on the other hand, promoter activity decreases when a dominant-negative form of CREB (KCREB) is over-expressed. In vivo DMS footprinting strongly indicates that other transcription factors, such Ets-2, nuclear factor of activated T-cells 1 (NFAT-1) and nuclear factor kappaB (NF-kappaB), might also contribute to the regulation of h PDE7A1 promoter. Finally, h PDE7A1 promoter was found to be induced by treatment with PMA, but not by treatment with dibutyryl cAMP or forskolin. These results provide insights into the factors and mechanisms that regulate expression of the h PDE7A gene. PMID:12737631

Stress-related methylation of the catechol-O-methyltransferase Val 158 allele predicts human prefrontal cognition and activity.

PubMed

Ursini, Gianluca; Bollati, Valentina; Fazio, Leonardo; Porcelli, Annamaria; Iacovelli, Luisa; Catalani, Assia; Sinibaldi, Lorenzo; Gelao, Barbara; Romano, Raffaella; Rampino, Antonio; Taurisano, Paolo; Mancini, Marina; Di Giorgio, Annabella; Popolizio, Teresa; Baccarelli, Andrea; De Blasi, Antonio; Blasi, Giuseppe; Bertolino, Alessandro

2011-05-04

DNA methylation at CpG dinucleotides is associated with gene silencing, stress, and memory. The catechol-O-methyltransferase (COMT) Val(158) allele in rs4680 is associated with differential enzyme activity, stress responsivity, and prefrontal activity during working memory (WM), and it creates a CpG dinucleotide. We report that methylation of the Val(158) allele measured from peripheral blood mononuclear cells (PBMCs) of Val/Val humans is associated negatively with lifetime stress and positively with WM performance; it interacts with stress to modulate prefrontal activity during WM, such that greater stress and lower methylation are related to reduced cortical efficiency; and it is inversely related to mRNA expression and protein levels, potentially explaining the in vivo effects. Finally, methylation of COMT in prefrontal cortex and that in PBMCs of rats are correlated. The relationship of methylation of the COMT Val(158) allele with stress, gene expression, WM performance, and related brain activity suggests that stress-related methylation is associated with silencing of the gene, which partially compensates the physiological role of the high-activity Val allele in prefrontal cognition and activity. Moreover, these results demonstrate how stress-related DNA methylation of specific functional alleles impacts directly on human brain physiology beyond sequence variation.

Genome-wide DNA methylomes from discrete developmental stages reveal the predominance of non-CpG methylation in Tribolium castaneum

PubMed Central

Song, Xiaowen; Huang, Fei; Liu, Juanjuan; Li, Chengjun; Gao, Shanshan; Wu, Wei; Zhai, Mengfan; Yu, Xiaojuan; Xiong, Wenfeng; Xie, Jia

2017-01-01

Abstract Cytosine DNA methylation is a vital epigenetic regulator of eukaryotic development. Whether this epigenetic modification occurs in Tribolium castaneum has been controversial, its distribution pattern and functions have not been established. Here, using bisulphite sequencing (BS-Seq), we confirmed the existence of DNA methylation and described the methylation profiles of the four life stages of T. castaneum. In the T. castaneum genome, both symmetrical CpG and non-CpG methylcytosines were observed. Symmetrical CpG methylation, which was catalysed by DNMT1 and occupied a small part in T. castaneum methylome, was primarily enriched in gene bodies and was positively correlated with gene expression levels. Asymmetrical non-CpG methylation, which was predominant in the methylome, was strongly concentrated in intergenic regions and introns but absent from exons. Gene body methylation was negatively correlated with gene expression levels. The distribution pattern and functions of this type of methylation were similar only to the methylome of Drosophila melanogaster, which further supports the existence of a novel methyltransferase in the two species responsible for this type of methylation. This first life-cycle methylome of T. castaneum reveals a novel and unique methylation pattern, which will contribute to the further understanding of the variety and functions of DNA methylation in eukaryotes. PMID:28449092

75 FR 60761 - Government-Owned Inventions; Availability for Licensing

Federal Register 2010, 2011, 2012, 2013, 2014

2010-10-01

... cells conjugated to a K-type CpG oligodeoxynucleotide (ODN) to a subject. Methods for treating a tumor... therapeutically effective amount of apoptotic tumor cells conjugated to a K-type CpG oligodeoxynucleotide (ODN) to... the prevention of cancer and other indications Use of CpG oligonucleotides for prophylaxis and/or...

78 FR 46594 - Prospective Grant of Start-up Exclusive License: Topical Antibiotic With Immune Stimulating...

Federal Register 2010, 2011, 2012, 2013, 2014

2013-08-01

... Speed Wound Healing; and Use of CpG Oligodeoxynucleotides To Induce Epithelial Cell Growth AGENCY... CpG Oligodeoxynucleotides to Induce Epithelial Cell Growth'' to Tollgene having a place of business... 37 CFR part 404. These technologies relate to relate to use of CpG oligodeoxynucleotides (ODNs) to...

The Use of Chlorhexidine/n-Propyl Gallate (CPG) as an Ambient-Temperature Urine Preservative

NASA Technical Reports Server (NTRS)

Nillen, Jeannie L.; Smith, Scott M.

2003-01-01

A safe, effective ambient temperature urine preservative, chlorhexidine/n-propyl gallate (CPG), has been formulated for use during spacefli ght that reduces the effects of oxidation and bacterial contamination on sample integrity while maintaining urine pH. The ability of this preservative to maintain stability of nine key analytes was evaluated for a period of one year. CPG effectively maintained stability of a mmonia, total nitrogen, 3-methylhistidine, chloride, sodium, potassiu m, and urea; however, creatinine and osmolality were not preserved by CPG. These data indicate that CPG offers prolonged room-temperature storage for multiple urine analytes, reducing the requirements for f rozen urine storage on future spaceflights. Iii medical applications on Earth, this technology can allow urine samples to be collected in remote settings and eliminate the need to ship frozen samples.

Reinforcement learning for a biped robot based on a CPG-actor-critic method.

PubMed

Nakamura, Yutaka; Mori, Takeshi; Sato, Masa-aki; Ishii, Shin

2007-08-01

Animals' rhythmic movements, such as locomotion, are considered to be controlled by neural circuits called central pattern generators (CPGs), which generate oscillatory signals. Motivated by this biological mechanism, studies have been conducted on the rhythmic movements controlled by CPG. As an autonomous learning framework for a CPG controller, we propose in this article a reinforcement learning method we call the "CPG-actor-critic" method. This method introduces a new architecture to the actor, and its training is roughly based on a stochastic policy gradient algorithm presented recently. We apply this method to an automatic acquisition problem of control for a biped robot. Computer simulations show that training of the CPG can be successfully performed by our method, thus allowing the biped robot to not only walk stably but also adapt to environmental changes.

Methylation oligonucleotide microarray: a novel tool to analyze methylation patterns

NASA Astrophysics Data System (ADS)

Hou, Peng; Ji, Meiju; He, Nongyao; Lu, Zuhong

2003-04-01

A new technique to analyze methylation patterns in several adjacent CpG sites was developed and reported here. We selected a 336bp segment of the 5"-untranslated region and the first exon of the p16Ink4a gene, which include the most densely packed CpG fragment of the islands containing 32 CpG dinucleotides, as the investigated target. The probes that include all types of methylation patterns were designed to fabricate a DNA microarray to determine the methylation patterns of seven adjacent CpG dinucleotides sites. High accuracy and reproducibility were observed in several parallel experiments. The results led us to the conclusion that the methylation oligonucleotide microarray can be applied as a novel and powerful tool to map methylation patterns and changes in multiple CpG island loci in a variety of tumors.

DNA methylation profiles of long- and short-term glioblastoma survivors

PubMed Central

Shinawi, Thoraia; Hill, Victoria K.; Krex, Dietmar; Schackert, Gabriele; Gentle, Dean; Morris, Mark R.; Wei, Wenbin; Cruickshank, Garth; Maher, Eamonn R.; Latif, Farida

2013-01-01

Glioblastoma (GBM) is the most common and malignant type of primary brain tumor in adults and prognosis of most GBM patients is poor. However, a small percentage of patients show a long term survival of 36 mo or longer after diagnosis. Epigenetic profiles can provide molecular markers for patient prognosis: recently, a G-CIMP positive phenotype associated with IDH1 mutations has been described for GBMs with good prognosis. In the present analysis we performed genome-wide DNA methylation profiling of short-term survivors (STS; overall survival < 1 y) and long-term survivors (LTS; overall survival > 3 y) by utilizing the HumanMethylation450K BeadChips to assess quantitative methylation at > 480,000 CpG sites. Cluster analysis has shown that a subset of LTS showed a G-CIMP positive phenotype that was tightly associated with IDH1 mutation status and was confirmed by analysis of the G-CIMP signature genes. Using high stringency criteria for differential hypermethylation between non-cancer brain and tumor samples, we identified 2,638 hypermethylated CpG loci (890 genes) in STS GBMs, 3,101 hypermethylated CpG loci (1,062 genes) in LTS (wild type IDH1) and 11,293 hypermethylated CpG loci in LTS (mutated for IDH1), reflecting the CIMP positive phenotype. The location of differentially hypermethylated CpG loci with respect to CpG content, neighborhood context and functional genomic distribution was similar in our sample set, with the majority of CpG loci residing in CpG islands and in gene promoters. Our preliminary study also identified a set of CpG loci differentially hypermethylated between STS and LTS cases, including members of the homeobox gene family (HOXD8, HOXD13 and HOXC4), the transcription factors NR2F2 and TFAP2A, and Dickkopf 2, a negative regulator of the wnt/β-catenin signaling pathway. PMID:23291739

Association between Promoter Methylation of Gene ERCC3 and Benzene Hematotoxicity.

PubMed

Zheng, Min; Lin, Feiliang; Hou, Fenxia; Li, Guilan; Zhu, Caiying; Xu, Peiyu; Xing, Caihong; Wang, Qianfei

2017-08-16

Benzene is a primary industrial chemical and a ubiquitous environmental pollutant. ERCC3 is a key player in nucleotide excision repair. Recent studies suggested that site-specific methylation is a possible mechanism of the transcriptional dysregulation by blocking transcription factors binding. We previously found that the average promoter methylation level of ERCC3 was increased in benzene-exposed workers. In order to test whether specific CpG sites of ERCC3 play an important role in benzene-induced epigenetic changes and whether the specific methylation patterns are associated with benzene hematotoxicity, we analyzed the promoter methylation levels of individual CpG sites, transcription factor binding motif and the correlation between aberrant CpG methylation and hematotoxicity in 76 benzene-exposed workers and 24 unexposed controls in China. Out of all the CpGs analyzed, two CpG units located 43 bp upstream and 99 bp downstream of the transcription start site of ERCC3 (CpG 2-4 and CpG 17-18, respectively), showed the most pronounced increase in methylation levels in benzene-exposed workers, compared with unexposed controls (Mean ± SD: 5.86 ± 2.77% vs. 4.92 ± 1.53%, p = 0.032; 8.45 ± 4.09% vs. 6.79 ± 2.50%, p = 0.024, respectively). Using the JASPAR CORE Database, we found that CpG 2-4 and CpG 17-18 were bound by three putative transcription factors (TFAP2A, E2F4 and MZF1). Furthermore, the methylation levels for CpG 2-4 were correlated negatively with the percentage of neutrophils ( β = -0.676, p = 0.005) in benzene-exposed workers. This study demonstrates that CpG-specific DNA methylation in the ERCC3 promoter region may be involved in benzene-induced epigenetic modification and it may contribute to benzene-induced hematotoxicity.

Association between Promoter Methylation of Gene ERCC3 and Benzene Hematotoxicity

PubMed Central

Lin, Feiliang; Hou, Fenxia; Li, Guilan; Zhu, Caiying; Xu, Peiyu; Xing, Caihong; Wang, Qianfei

2017-01-01

Benzene is a primary industrial chemical and a ubiquitous environmental pollutant. ERCC3 is a key player in nucleotide excision repair. Recent studies suggested that site-specific methylation is a possible mechanism of the transcriptional dysregulation by blocking transcription factors binding. We previously found that the average promoter methylation level of ERCC3 was increased in benzene-exposed workers. In order to test whether specific CpG sites of ERCC3 play an important role in benzene-induced epigenetic changes and whether the specific methylation patterns are associated with benzene hematotoxicity, we analyzed the promoter methylation levels of individual CpG sites, transcription factor binding motif and the correlation between aberrant CpG methylation and hematotoxicity in 76 benzene-exposed workers and 24 unexposed controls in China. Out of all the CpGs analyzed, two CpG units located 43 bp upstream and 99 bp downstream of the transcription start site of ERCC3 (CpG 2–4 and CpG 17–18, respectively), showed the most pronounced increase in methylation levels in benzene-exposed workers, compared with unexposed controls (Mean ± SD: 5.86 ± 2.77% vs. 4.92 ± 1.53%, p = 0.032; 8.45 ± 4.09% vs. 6.79 ± 2.50%, p = 0.024, respectively). Using the JASPAR CORE Database, we found that CpG 2–4 and CpG 17–18 were bound by three putative transcription factors (TFAP2A, E2F4 and MZF1). Furthermore, the methylation levels for CpG 2–4 were correlated negatively with the percentage of neutrophils (β = −0.676, p = 0.005) in benzene-exposed workers. This study demonstrates that CpG-specific DNA methylation in the ERCC3 promoter region may be involved in benzene-induced epigenetic modification and it may contribute to benzene-induced hematotoxicity. PMID:28813025

Post-weaning selenium and folate supplementation affects gene and protein expression and global DNA methylation in mice fed high-fat diets.

PubMed

Bermingham, Emma N; Bassett, Shalome A; Young, Wayne; Roy, Nicole C; McNabb, Warren C; Cooney, Janine M; Brewster, Di T; Laing, William A; Barnett, Matthew P G

2013-03-05

Consumption of high-fat diets has negative impacts on health and well-being, some of which may be epigenetically regulated. Selenium and folate are two compounds which influence epigenetic mechanisms. We investigated the hypothesis that post-weaning supplementation with adequate levels of selenium and folate in offspring of female mice fed a high-fat, low selenium and folate diet during gestation and lactation will lead to epigenetic changes of potential importance for long-term health. Female offspring of mothers fed the experimental diet were either maintained on this diet (HF-low-low), or weaned onto a high-fat diet with sufficient levels of selenium and folate (HF-low-suf), for 8 weeks. Gene and protein expression, DNA methylation, and histone modifications were measured in colon and liver of female offspring. Adequate levels of selenium and folate post-weaning affected gene expression in colon and liver of offspring, including decreasing Slc2a4 gene expression. Protein expression was only altered in the liver. There was no effect of adequate levels of selenium and folate on global histone modifications in the liver. Global liver DNA methylation was decreased in mice switched to adequate levels of selenium and folate, but there was no effect on methylation of specific CpG sites within the Slc2a4 gene in liver. Post-weaning supplementation with adequate levels of selenium and folate in female offspring of mice fed high-fat diets inadequate in selenium and folate during gestation and lactation can alter global DNA methylation in liver. This may be one factor through which the negative effects of a poor diet during early life can be ameliorated. Further research is required to establish what role epigenetic changes play in mediating observed changes in gene and protein expression, and the relevance of these changes to health.

Post-weaning selenium and folate supplementation affects gene and protein expression and global DNA methylation in mice fed high-fat diets

PubMed Central

2013-01-01

Background Consumption of high-fat diets has negative impacts on health and well-being, some of which may be epigenetically regulated. Selenium and folate are two compounds which influence epigenetic mechanisms. We investigated the hypothesis that post-weaning supplementation with adequate levels of selenium and folate in offspring of female mice fed a high-fat, low selenium and folate diet during gestation and lactation will lead to epigenetic changes of potential importance for long-term health. Methods Female offspring of mothers fed the experimental diet were either maintained on this diet (HF-low-low), or weaned onto a high-fat diet with sufficient levels of selenium and folate (HF-low-suf), for 8 weeks. Gene and protein expression, DNA methylation, and histone modifications were measured in colon and liver of female offspring. Results Adequate levels of selenium and folate post-weaning affected gene expression in colon and liver of offspring, including decreasing Slc2a4 gene expression. Protein expression was only altered in the liver. There was no effect of adequate levels of selenium and folate on global histone modifications in the liver. Global liver DNA methylation was decreased in mice switched to adequate levels of selenium and folate, but there was no effect on methylation of specific CpG sites within the Slc2a4 gene in liver. Conclusions Post-weaning supplementation with adequate levels of selenium and folate in female offspring of mice fed high-fat diets inadequate in selenium and folate during gestation and lactation can alter global DNA methylation in liver. This may be one factor through which the negative effects of a poor diet during early life can be ameliorated. Further research is required to establish what role epigenetic changes play in mediating observed changes in gene and protein expression, and the relevance of these changes to health. PMID:23497688

Ethanol deregulates Mecp2/MeCP2 in differentiating neural stem cells via interplay between 5-methylcytosine and 5-hydroxymethylcytosine at the Mecp2 regulatory elements

PubMed Central

Liyanage, Vichithra Rasangi Batuwita; Zachariah, Robby Mathew; Davie, James Ronald; Rastegar, Mojgan

2017-01-01

Methyl CpG Binding Protein 2 (MeCP2) is an important epigenetic factor in the brain. MeCP2 expression is affected by different environmental insults including alcohol exposure. Accumulating evidence supports the role of aberrant MeCP2 expression in ethanol exposure-induced neurological symptoms. However, the underlying molecular mechanisms of ethanol-induced MeCP2 deregulation remain elusive. To study the effect of ethanol on Mecp2/MeCP2 expression during neurodifferentiation, we established an in vitro model of ethanol exposure, using differentiating embryonic brain-derived neural stem cells (NSC). Previously, we demonstrated the impact of DNA methylation at the Mecp2 regulatory elements (REs) on Mecp2/MeCP2 expression in vitro and in vivo. Here, we studied whether altered DNA methylation at these REs is associated with the Mecp2/MeCP2 misexpression induced by ethanol. Binge-like and continuous ethanol exposure upregulated Mecp2/MeCP2, while ethanol withdrawal downregulated its expression. DNA methylation analysis by methylated DNA immunoprecipitation indicated that increased 5-hydroxymethylcytosine (5hmC) and decreased 5-methylcytosine (5mC) enrichment at specific REs were associated with upregulated Mecp2/MeCP2 following continuous ethanol exposure. The reduced Mecp2/MeCP2 expression upon ethanol withdrawal was associated with reduced 5hmC and increased 5mC enrichment at these REs. Moreover, ethanol altered global DNA methylation (5mC and 5hmC). Under the tested conditions, ethanol had minimal effects on NSC cell fate commitment, but caused changes in neuronal morphology and glial cell size. Taken together, our data represent an epigenetic mechanism for ethanol-mediated misexpression of Mecp2/MeCP2 in differentiating embryonic brain cells. We also show the potential role of DNA methylation and MeCP2 in alcohol-related neurological disorders, specifically Fetal Alcohol Spectrum Disorders. PMID:25620416

Distinct Effects of Monophosphoryl Lipid A, Oligodeoxynucleotide CpG, and Combination Adjuvants on Modulating Innate and Adaptive Immune Responses to Influenza Vaccination

PubMed Central

Ko, Eun-Ju; Lee, Young-Tae; Lee, Youri; Kim, Ki-Hye

2017-01-01

Monophosphoryl lipid A (MPL) and oligodeoxynucleotide CpG are toll-like receptor (TLR) 4 and 9 agonist, respectively. Here, we investigated the effects of MPL, CpG, and combination adjuvants on stimulating in vitro dendritic cells (DCs), in vivo innate and adaptive immune responses, and protective efficacy of influenza vaccination. Combination of MPL and CpG was found to exhibit distinct effects on stimulating DCs in vitro to secrete IL-12p70 and tumor necrosis factor (TNF)-α and proliferate allogeneic CD8 T cells. Prime immunization of mice with inactivated split influenza vaccine in the presence of low dose MPL+CpG adjuvants increased the induction of virus-specific IgG and IgG2a isotype antibodies. MPL and CpG adjuvants contribute to improving the efficacy of prime influenza vaccination against lethal influenza challenge as determined by body weight monitoring, lung function, viral titers, and histology. A combination of MPL and CpG adjuvants was effective in improving vaccine efficacy as well as in reducing inflammatory immune responses locally and in inducing cellular immune responses upon lethal influenza virus challenge. This study demonstrates unique adjuvant effects of MPL, CpG, and combination adjuvants on modulating innate and adaptive immune responses to influenza prime vaccination. PMID:29093654

Construction and characterization of normalized cDNA libraries by 454 pyrosequencing and estimation of DNA methylation levels in three distantly related termite species.

PubMed

Hayashi, Yoshinobu; Shigenobu, Shuji; Watanabe, Dai; Toga, Kouhei; Saiki, Ryota; Shimada, Keisuke; Bourguignon, Thomas; Lo, Nathan; Hojo, Masaru; Maekawa, Kiyoto; Miura, Toru

2013-01-01

In termites, division of labor among castes, categories of individuals that perform specialized tasks, increases colony-level productivity and is the key to their ecological success. Although molecular studies on caste polymorphism have been performed in termites, we are far from a comprehensive understanding of the molecular basis of this phenomenon. To facilitate future molecular studies, we aimed to construct expressed sequence tag (EST) libraries covering wide ranges of gene repertoires in three representative termite species, Hodotermopsis sjostedti, Reticulitermes speratus and Nasutitermes takasagoensis. We generated normalized cDNA libraries from whole bodies, except for guts containing microbes, of almost all castes, sexes and developmental stages and sequenced them with the 454 GS FLX titanium system. We obtained >1.2 million quality-filtered reads yielding >400 million bases for each of the three species. Isotigs, which are analogous to individual transcripts, and singletons were produced by assembling the reads and annotated using public databases. Genes related to juvenile hormone, which plays crucial roles in caste differentiation of termites, were identified from the EST libraries by BLAST search. To explore the potential for DNA methylation, which plays an important role in caste differentiation of honeybees, tBLASTn searches for DNA methyltransferases (dnmt1, dnmt2 and dnmt3) and methyl-CpG binding domain (mbd) were performed against the EST libraries. All four of these genes were found in the H. sjostedti library, while all except dnmt3 were found in R. speratus and N. takasagoensis. The ratio of the observed to the expected CpG content (CpG O/E), which is a proxy for DNA methylation level, was calculated for the coding sequences predicted from the isotigs and singletons. In all of the three species, the majority of coding sequences showed depletion of CpG O/E (less than 1), and the distributions of CpG O/E were bimodal, suggesting the presence of DNA methylation.

Construction and Characterization of Normalized cDNA Libraries by 454 Pyrosequencing and Estimation of DNA Methylation Levels in Three Distantly Related Termite Species

PubMed Central

Hayashi, Yoshinobu; Shigenobu, Shuji; Watanabe, Dai; Toga, Kouhei; Saiki, Ryota; Shimada, Keisuke; Bourguignon, Thomas; Lo, Nathan; Hojo, Masaru; Maekawa, Kiyoto; Miura, Toru

2013-01-01

In termites, division of labor among castes, categories of individuals that perform specialized tasks, increases colony-level productivity and is the key to their ecological success. Although molecular studies on caste polymorphism have been performed in termites, we are far from a comprehensive understanding of the molecular basis of this phenomenon. To facilitate future molecular studies, we aimed to construct expressed sequence tag (EST) libraries covering wide ranges of gene repertoires in three representative termite species, Hodotermopsis sjostedti , Reticulitermessperatus and Nasutitermestakasagoensis . We generated normalized cDNA libraries from whole bodies, except for guts containing microbes, of almost all castes, sexes and developmental stages and sequenced them with the 454 GS FLX titanium system. We obtained >1.2 million quality-filtered reads yielding >400 million bases for each of the three species. Isotigs, which are analogous to individual transcripts, and singletons were produced by assembling the reads and annotated using public databases. Genes related to juvenile hormone, which plays crucial roles in caste differentiation of termites, were identified from the EST libraries by BLAST search. To explore the potential for DNA methylation, which plays an important role in caste differentiation of honeybees, tBLASTn searches for DNA methyltransferases (dnmt1, dnmt2 and dnmt3) and methyl-CpG binding domain (mbd) were performed against the EST libraries. All four of these genes were found in the H . sjostedti library, while all except dnmt3 were found in R . speratus and N . takasagoensis . The ratio of the observed to the expected CpG content (CpG O/E), which is a proxy for DNA methylation level, was calculated for the coding sequences predicted from the isotigs and singletons. In all of the three species, the majority of coding sequences showed depletion of CpG O/E (less than 1), and the distributions of CpG O/E were bimodal, suggesting the presence of DNA methylation. PMID:24098800

Trichloroethylene-induced alterations in DNA methylation were enriched in polycomb protein binding sites in effector/memory CD4+ T cells

PubMed Central

Gilbert, Kathleen M.; Blossom, Sarah J.; Reisfeld, Brad; Erickson, Stephen W.; Vyas, Kanan; Maher, Mary; Broadfoot, Brannon; West, Kirk; Bai, Shasha; Cooney, Craig A.; Bhattacharyya, Sudeepa

2017-01-01

Abstract Exposure to industrial solvent and water pollutant trichloroethylene (TCE) can promote autoimmunity, and expand effector/memory (CD62L) CD4+ T cells. In order to better understand etiology reduced representation bisulfite sequencing was used to study how a 40-week exposure to TCE in drinking water altered methylation of ∼337 770 CpG sites across the entire genome of effector/memory CD4+ T cells from MRL+/+ mice. Regardless of TCE exposure, 62% of CpG sites in autosomal chromosomes were hypomethylated (0–15% methylation), and 25% were hypermethylated (85–100% methylation). In contrast, only 6% of the CpGs on the X chromosome were hypomethylated, and 51% had mid-range methylation levels. In terms of TCE impact, TCE altered (≥ 10%) the methylation of 233 CpG sites in effector/memory CD4+ T cells. Approximately 31.7% of these differentially methylated sites occurred in regions known to bind one or more Polycomb group (PcG) proteins, namely Ezh2, Suz12, Mtf2 or Jarid2. In comparison, only 23.3% of CpG sites not differentially methylated by TCE were found in PcG protein binding regions. Transcriptomics revealed that TCE altered the expression of ∼560 genes in the same effector/memory CD4+ T cells. At least 80% of the immune genes altered by TCE had binding sites for PcG proteins flanking their transcription start site, or were regulated by other transcription factors that were in turn ordered by PcG proteins at their own transcription start site. Thus, PcG proteins, and the differential methylation of their binding sites, may represent a new mechanism by which TCE could alter the function of effector/memory CD4+ T cells. PMID:29129997

A Genetic Variant Ameliorates β-Thalassemia Severity by Epigenetic-Mediated Elevation of Human Fetal Hemoglobin Expression.

PubMed

Chen, Diyu; Zuo, Yangjin; Zhang, Xinhua; Ye, Yuhua; Bao, Xiuqin; Huang, Haiyan; Tepakhan, Wanicha; Wang, Lijuan; Ju, Junyi; Chen, Guangfu; Zheng, Mincui; Liu, Dun; Huang, Shuodan; Zong, Lu; Li, Changgang; Chen, Yajun; Zheng, Chenguang; Shi, Lihong; Zhao, Quan; Wu, Qiang; Fucharoen, Supan; Zhao, Cunyou; Xu, Xiangmin

2017-07-06

A delayed fetal-to-adult hemoglobin (Hb) switch ameliorates the severity of β-thalassemia and sickle cell disease. The molecular mechanism underlying the epigenetic dysregulation of the switch is unclear. To explore the potential cis-variants responsible for the Hb switching, we systematically analyzed an 80-kb region spanning the β-globin cluster using capture-based next-generation sequencing of 1142 Chinese β-thalassemia persons and identified 31 fetal hemoglobin (HbF)-associated haplotypes of the selected 28 tag regulatory single-nucleotide polymorphisms (rSNPs) in seven linkage disequilibrium (LD) blocks. A Ly1 antibody reactive (LYAR)-binding motif disruptive rSNP rs368698783 (G/A) from LD block 5 in the proximal promoter of hemoglobin subunit gamma 1 (HBG1) was found to be a significant predictor for β-thalassemia clinical severity by epigenetic-mediated variant-dependent HbF elevation. We found this rSNP accounted for 41.6% of β-hemoglobinopathy individuals as an ameliorating factor in a total of 2,738 individuals from southern China and Thailand. We uncovered that the minor allele of the rSNP triggers the attenuation of LYAR and two repressive epigenetic regulators DNA methyltransferase 3 alpha (DNMT3A) and protein arginine methyltransferase 5 (PRMT5) from the HBG promoters, mediating allele-biased γ-globin elevation by facilitating demethylation of HBG core promoter CpG sites in erythroid progenitor cells from β-thalassemia persons. The present study demonstrates that this common rSNP in the proximal A γ-promoter is a major genetic modifier capable of ameliorating the severity of thalassemia major through the epigenetic-mediated regulation of the delayed fetal-to-adult Hb switch and provides potential targets for the treatment of β-hemoglobinopathy. Copyright © 2017 American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

DNA methylation in adult diffuse gliomas.

PubMed

LeBlanc, Veronique G; Marra, Marco A

2016-11-01

Adult diffuse gliomas account for the majority of primary malignant brain tumours, and are in most cases lethal. Current therapies are often only marginally effective, and improved options will almost certainly benefit from further insight into the various processes contributing to gliomagenesis and pathology. While molecular characterization of these tumours classifies them on the basis of genetic alterations and chromosomal abnormalities, DNA methylation patterns are increasingly understood to play a role in glioma pathogenesis. Indeed, a subset of gliomas associated with improved survival is characterized by the glioma CpG island methylator phenotype (G-CIMP), which can be induced by the expression of mutant isocitrate dehydrogenase (IDH1/2). Aberrant methylation of particular genes or regulatory elements, within the context of G-CIMP-positive and/or negative tumours, has also been shown to be associated with differential survival. In this review, we provide an overview of the current knowledge regarding the role of DNA methylation in adult diffuse gliomas. In particular, we discuss IDH mutations and G-CIMP, MGMT promoter methylation, DNA methylation-mediated microRNA regulation and aberrant methylation of specific genes or groups of genes. © The Author 2016. Published by Oxford University Press. All rights reserved. For permissions, please email: journals.permissions@oup.com.

Regulation of a mammalian gene bearing a CpG island promoter and a distal enhancer.

PubMed

Berrozpe, Georgina; Bryant, Gene O; Warpinski, Katherine; Ptashne, Mark

2013-08-15

A quantitative nucleosome occupancy assay revealed rules for nucleosome disposition in yeast and showed how disposition affects regulation of the GAL genes. Here, we show how those findings apply to the control of Kit, a mammalian gene. The Kit promoter lies in a CpG island, and its enhancer (active in mast cells) lies some 150 kb upstream. Nucleosomes form with especially high avidities at the Kit promoter, a reaction that, we surmise, ensures extremely low basal expression. In mast cells, transcriptional activators displace nucleosomes that are less tightly formed at the Kit enhancer. In turn, the active enhancer replaces a single Kit promoter nucleosome with the transcriptional machinery, thereby inducing transcription over 1,000-fold. As at the yeast GAL genes, the inhibitory effects of nucleosomes facilitate high factors of induction by mammalian activators working in the absence of specific repressors. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

Grafting of fetal brainstem 5-HT neurons into the sublesional spinal cord of paraplegic rats restores coordinated hindlimb locomotion.

PubMed

Sławińska, Urszula; Miazga, Krzysztof; Cabaj, Anna M; Leszczyńska, Anna N; Majczyński, Henryk; Nagy, James I; Jordan, Larry M

2013-09-01

In rodent models of spinal cord injury, there is increasing evidence that activation of the locomotor central pattern generator (CPG) below the site of injury with 5-hydroxytryptamine (5-HT) agonists improves locomotor recovery and restores coordination. A promising means of replacing 5-HT control of locomotion is to graft brainstem 5-HT neurons into the spinal cord below the level of the spinal cord injury. However, it is not known whether this approach improves limb coordination because recovery of coordinated stepping has not been documented in detail in previous studies employing this transplantation strategy. Here, adult rats with complete spinal cord transections at the T9/10 level were grafted with E14 fetal neurons from the medulla at the T10/11 vertebra level one month after injury. The B1, B2 and B3 fetal anlagen of brainstem 5-HT neurons, a grouping that included the presumed precursors of recently described 5-HT locomotor command neurons, were used in these grafts. EMG and video recordings of treadmill locomotion evoked by tail stimulation showed full recovery of inter- and intralimb coordination in the grafted rats. We showed, using systemically applied antagonists, that 5-HT₂ and 5-HT₇ receptors mediate the improved locomotion after grafting, but through actions on different populations of spinal locomotor neurons. Specifically, 5-HT₂ receptors control CPG activation as well as motoneuron output, while 5-HT₇ receptors contribute primarily to activity of the locomotor CPG. These results are consistent with the roles for these receptors during locomotion in intact rodents and in rodent brainstem-spinal cord in vitro preparations. Copyright © 2013 Elsevier Inc. All rights reserved.

Induction of anti-glioma NK cell response following multiple low-dose intracerebral CpG therapy

PubMed Central

Alizadeh, Darya; Zhang, Leying; Brown, Christine E.; Farrukh, Omar; Jensen, Michael C.; Badie, Behnam

2010-01-01

Purpose Stimulation of toll-like receptor-9 (TLR9) by CpG oligodeoxynucleotides (CpG-ODN) has been shown to counteract the immunosuppressive microenvironment and to inhibit tumor growth in glioma models. These studies, however, have used high doses of CpG-ODN which can induce toxicity in a clinical setting. The goal of this study was to evaluate the anti-tumor efficacy of multiple low-dose intratumoral CpG- ODN in a glioma model. Experimental Design Mice bearing four-day old intracranial GL261 gliomas received a single or multiple (two or four) intratumoral injections of CpG-ODN (3 μg) every 4 days. Tumor growth was measured by bioluminescent imaging, brain histology, and animal survival. Flow cytometry and cytotoxicity assays were used to assess anti-glioma immune response. Results Two and four intracranial injections of low-dose CpG-ODN, but not a single injection, eradicated gliomas in 70% of mice. Moreover, surviving animals exhibited durable tumor free remission (> 3 months), and were protected from intracranial rechallenge with GL21 gliomas, demonstrating the capacity for long-term anti-tumor immunity. Although most inflammatory cells appeared to increase, activated NK cells (i.e. NK+CD107a+) were more frequent than CD8+CD107a+ in the brains of rechallenged CpG-ODN-treated animals and demonstrated a stronger in vitro cytotoxicity against GL261 target cells. Leukocyte depletion studies confirmed that NK cells played an important role in the initial CpG-ODN anti-tumor response, but both CD8 and NK cells were equally important in long-term immunity against gliomas. Conclusions These findings suggest that multiple low-dose intratumoral injections of CpG-ODN can eradicate intracranial gliomas possibly through mechanisms involving NK mediated effector function. PMID:20570924

Promoter methylation of glucocorticoid receptor gene is associated with subclinical atherosclerosis: A monozygotic twin study.

PubMed

Zhao, Jinying; An, Qiang; Goldberg, Jack; Quyyumi, Arshed A; Vaccarino, Viola

2015-09-01

Endothelial dysfunction assessed by brachial artery flow-mediated dilation (FMD) is a marker of early atherosclerosis. Glucocorticoid receptor gene (NR3C1) regulates many biological processes, including stress response, behavioral, cardiometabolic and immunologic functions. Genetic variants in NR3C1 have been associated with atherosclerosis and related risk factors. This study investigated the association of NR3C1 promoter methylation with FMD, independent of genetic and family-level environmental factors. We studied 84 middle-aged, male-male monozygotic twin pairs recruited from the Vietnam Era Twin Registry. Brachial artery FMD was measured by ultrasound. DNA methylation levels at 22 CpG residues in the NR3C1 exon 1F promoter region were quantified by bisulfite pyrosequencing in genomic DNA isolated from peripheral blood leukocytes. Co-twin control analyses were conducted to examine the association of methylation variation with FMD, adjusting for smoking, physical activity, body mass index, lipids, blood pressure, fasting glucose, and depressive symptoms. Multiple testing was corrected using the false discovery rate. Mean methylation level across the 22 studied CpG sites was 2.02%. Methylation alterations at 12 out of the 22 CpG residues were significantly associated with FMD. On average, a 1% increase in the intra-pair difference in mean DNA methylation was associated with 2.83% increase in the intra-pair difference in FMD (95% CI: 1.46-4.20; P < 0.0001) after adjusting for risk factors and multiple testing. Methylation variation in NR3C1 exon 1F promoter significantly influences subclinical atherosclerosis, independent of genetic, early family environmental and other risk factors. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

The causal effect of red blood cell folate on genome-wide methylation in cord blood: a Mendelian randomization approach.

PubMed

Binder, Alexandra M; Michels, Karin B

2013-12-04

Investigation of the biological mechanism by which folate acts to affect fetal development can inform appraisal of expected benefits and risk management. This research is ethically imperative given the ubiquity of folic acid fortified products in the US. Considering that folate is an essential component in the one-carbon metabolism pathway that provides methyl groups for DNA methylation, epigenetic modifications provide a putative molecular mechanism mediating the effect of folic acid supplementation on neonatal and pediatric outcomes. In this study we use a Mendelian Randomization Unnecessary approach to assess the effect of red blood cell (RBC) folate on genome-wide DNA methylation in cord blood. Site-specific CpG methylation within the proximal promoter regions of approximately 14,500 genes was analyzed using the Illumina Infinium Human Methylation27 Bead Chip for 50 infants from the Epigenetic Birth Cohort at Brigham and Women's Hospital in Boston. Using methylenetetrahydrofolate reductase genotype as the instrument, the Mendelian Randomization approach identified 7 CpG loci with a significant (mostly positive) association between RBC folate and methylation level. Among the genes in closest proximity to this significant subset of CpG loci, several enriched biologic processes were involved in nucleic acid transport and metabolic processing. Compared to the standard ordinary least squares regression method, our estimates were demonstrated to be more robust to unmeasured confounding. To the authors' knowledge, this is the largest genome-wide analysis of the effects of folate on methylation pattern, and the first to employ Mendelian Randomization to assess the effects of an exposure on epigenetic modifications. These results can help guide future analyses of the causal effects of periconceptional folate levels on candidate pathways.

Evidence-based clinical practice guideline for adult Still's disease.

PubMed

Mimura, Toshihide; Kondo, Yuya; Ohta, Akihide; Iwamoto, Masahiro; Ota, Akiko; Okamoto, Nami; Kawaguchi, Yasushi; Kono, Hajime; Takasaki, Yoshinari; Takei, Shuji; Nishimoto, Norihiro; Fujimoto, Manabu; Asanuma, Yu Funakubo; Mimori, Akio; Okiyama, Naoko; Kaneko, Shunta; Takahashi, Hiroyuki; Yokosawa, Masahiro; Sumida, Takayuki

2018-05-09

Using an expert- and data-driven methodology, we have constructed the first clinical practice guidelines (CPGs) for adult Still's disease (ASD) after complete systematic review (SR) of the literature based upon the Medical Information Network Distribution Service (Minds) procedure. The CPG committee for ASD organized by the Research Team for Autoimmune Diseases, the Research Program for Intractable Disease of the Japanese Ministry of Health, Labour, and Welfare has developed CPG for ASD 2017, according to the procedure proposed by Minds. The CPG development process includes (1) clarification of the purpose of CPG, (2) organization of the steering committee, (3) organization of the CPG committee and secretariat, (4) defining the scope (setting of clinical questions (CQs)), (5) SR, (6) development of recommendations, (7) drafting the CPG, (8) external evaluation and public comments, and (9) release. Because we wanted to construct CPG for ASD to encompass both adult-onset Still's disease (AOSD) and adult patients with systemic juvenile idiopathic arthritis (sJIA), we also included SR data from sJIA in this study. Twenty-six CQs were selected and roughly divided into the following items: (1) clinical findings (CQs 1-4), (2) laboratory findings (CQs 5-8), (3) complications (CQs 9-13), (4) treatment with oral medicine (CQs 14-19), (5) treatment with biological reagents (CQs 20-23), and (6) treatments for sJIA (CQs 25-26). Recommendations and the strength of the recommendations for these CQs were decided by a modified Delphi method. We have developed the first published CPG for ASD including AOSD and sJIA, which includes 26 CQs and recommendations. This guideline will help rheumatologists, non-specialized physicians, other healthcare providers, medical and health-related students, and patients and their family members to understand and treat ASD.

Provider Adherence to Implementation of Clinical Practice Guidelines for Neurogenic Bowel in Adults With Spinal Cord Injury

PubMed Central

Goetz, Lance L; Nelson, Audrey L; Guihan, Marylou; Bosshart, Helen T; Harrow, Jeffrey J; Gerhart, Kevin D; Krasnicka, Barbara; Burns, Stephen P

2005-01-01

Background/Objectives: Clinical Practice Guidelines (CPGs) have been published on a number of topics in spinal cord injury (SCI) medicine. Research in the general medical literature shows that the distribution of CPGs has a minimal effect on physician practice without targeted implementation strategies. The purpose of this study was to determine (a) whether dissemination of an SCI CPG improved the likelihood that patients would receive CPG recommended care and (b) whether adherence to CPG recommendations could be improved through a targeted implementation strategy. Specifically, this study addressed the “Neurogenic Bowel Management in Adults with Spinal Cord Injury” Clinical Practice Guideline published in March 1998 by the Consortium for Spinal Cord Medicine Methods: CPG adherence was determined from medical record review at 6 Veterans Affairs SCI centers for 3 time periods: before guideline publication (T1), after guideline publication but before CPG implementation (T2), and after targeted CPG implementation (T3). Specific implementation strategies to enhance guideline adherence were chosen to address the barriers identified by SCI providers in focus groups before the intervention. Results: Overall adherence to recommendations related to neurogenic bowel did not change between T1 and T2 (P = not significant) but increased significantly between T2 and T3 (P < 0.001) for 3 of 6 guideline recommendations. For the other 3 guideline recommendations, adherence rates were noted to be high at T1. Conclusions: While publication of the CPG alone did not alter rates of provider adherence, the use of a targeted implementation plan resulted in increases in adherence rates with some (3 of 6) CPG recommendations for neurogenic bowel management. PMID:16869086

Bayesian inference supports a location and neighbour-dependent model of DNA methylation propagation at the MGMT gene promoter in lung tumours.

PubMed

Bonello, Nicolas; Sampson, James; Burn, John; Wilson, Ian J; McGrown, Gail; Margison, Geoff P; Thorncroft, Mary; Crossbie, Philip; Povey, Andrew C; Santibanez-Koref, Mauro; Walters, Kevin

2013-11-07

We exploit model-based Bayesian inference methodologies to analyse lung tumour-derived methylation data from a CpG island in the O6-methylguanine-DNA methyltransferase (MGMT) promoter. Interest is in modelling the changes in methylation patterns in a CpG island in the first exon of the promoter during lung tumour development. We propose four competils of methylation state propagation based on two mechanisms. The first is the location-dependence mechanism in which the probability of a gain or loss of methylation at a CpG within the promoter depends upon its location in the CpG sequence. The second mechanism is that of neighbour-dependence in which gain or loss of methylation at a CpG depends upon the methylation status of the immediately preceding CpG. Our data comprises the methylation status at 12 CpGs near the 5' end of the CpG island in two lung tumour samples for both alleles of a nearby polymorphism. We use approximate Bayesian computation, a computationally intensive rejection-sampling algorithm to infer model parameters and compare models without the need to evaluate the likelihood function. We compare the four proposed models using two criteria: the approximate Bayes factors and the distribution of the Euclidean distance between the summary statistics of the observed and simulated datasets. Our model-based analysis demonstrates compelling evidence for both location and neighbour dependence in the process of aberrant DNA methylation of this MGMT promoter CpG island in lung tumours. We find equivocal evidence to support the hypothesis that the methylation patterns of the two alleles evolve independently. © 2013 Published by Elsevier Ltd. All rights reserved.

Structural impact of complete CpG methylation within target DNA on specific complex formation of the inducible transcription factor Egr-1.

PubMed

Zandarashvili, Levani; White, Mark A; Esadze, Alexandre; Iwahara, Junji

2015-07-08

The inducible transcription factor Egr-1 binds specifically to 9-bp target sequences containing two CpG sites that can potentially be methylated at four cytosine bases. Although it appears that complete CpG methylation would make an unfavorable steric clash in the previous crystal structures of the complexes with unmethylated or partially methylated DNA, our affinity data suggest that DNA recognition by Egr-1 is insensitive to CpG methylation. We have determined, at a 1.4-Å resolution, the crystal structure of the Egr-1 zinc-finger complex with completely methylated target DNA. Structural comparison of the three different methylation states reveals why Egr-1 can recognize the target sequences regardless of CpG methylation. Copyright © 2015 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

A terahertz EO detector with large dynamical range, high modulation depth and signal-noise ratio

NASA Astrophysics Data System (ADS)

Pan, Xinjian; Cai, Yi; Zeng, Xuanke; Zheng, Shuiqin; Li, Jingzhen; Xu, Shixiang

2017-05-01

The paper presents a novel design for terahertz (THz) free-space time domain electro-optic (EO) detection where the static birefringent phases of the two balanced arms are set close to zero but opposite to each other. Our theoretical and numerical analyses show this design has much stronger ability to cancel the optical background noise than both THz ellipsometer and traditional crossed polarizer geometry (CPG). Its optical modulation depth is about twice as high as that of traditional CPG, but about ten times as high as that of THz ellipsometer. As for the dynamical range, our improved design is comparable to the THz ellipsometer but obviously larger than the traditional CPG. Some experiments for comparing our improved CPG with traditional CPG agree well with the corresponding theoretical predictions. Our experiments also show that the splitting ratio of the used non-polarization beam splitter is critical for the performance of our design.

CpG oligodeoxyribonucleotides protect mice from Burkholderia pseudomallei but not Francisella tularensis Schu S4 aerosols

PubMed Central

2010-01-01

Studies have shown that CpG oligodeoxyribonucleotides (ODN) protect mice from various bacterial pathogens, including Burkholderia pseudomallei and Francisella tularensis live vaccine strain (LVS), when administered before parenteral challenge. Given the potential to develop CpG ODN as a pre-treatment for multiple bacterial biological warfare agents, we examined survival, histopathology, and cytokine data from CpG ODN-treated C57BL/6 mice to determine whether previously-reported protection extended to aerosolized B. pseudomallei 1026b and highly virulent F. tularensis Schu S4 infections. We found that, although CpG ODN protected mice from aerosolized B. pseudomallei challenges, the immunostimulant failed to benefit the animals exposed to F. tularensis Schu S4 aerosols. Our results, which contrast with earlier F. tularensis LVS studies, highlight potential differences in Francisella species pathogenesis and underscore the need to evaluate immunotherapies against human pathogenic species. PMID:20181102

CpG oligodeoxyribonucleotides protect mice from Burkholderia pseudomallei but not Francisella tularensis Schu S4 aerosols.

PubMed

Rozak, David A; Gelhaus, Herbert C; Smith, Mark; Zadeh, Mojgan; Huzella, Louis; Waag, David; Adamovicz, Jeffrey J

2010-02-05

Studies have shown that CpG oligodeoxyribonucleotides (ODN) protect mice from various bacterial pathogens, including Burkholderia pseudomallei and Francisella tularensis live vaccine strain (LVS), when administered before parenteral challenge. Given the potential to develop CpG ODN as a pre-treatment for multiple bacterial biological warfare agents, we examined survival, histopathology, and cytokine data from CpG ODN-treated C57BL/6 mice to determine whether previously-reported protection extended to aerosolized B. pseudomallei 1026b and highly virulent F. tularensis Schu S4 infections. We found that, although CpG ODN protected mice from aerosolized B. pseudomallei challenges, the immunostimulant failed to benefit the animals exposed to F. tularensis Schu S4 aerosols. Our results, which contrast with earlier F. tularensis LVS studies, highlight potential differences in Francisella species pathogenesis and underscore the need to evaluate immunotherapies against human pathogenic species.

Analysis of serotonin receptor 2A gene (HTR2A): association study with autism spectrum disorder in the Indian population and investigation of the gene expression in peripheral blood leukocytes.

PubMed

Guhathakurta, Subhrangshu; Singh, Asem Surindro; Sinha, Swagata; Chatterjee, Anindita; Ahmed, Shabina; Ghosh, Saurabh; Usha, Rajamma

2009-12-01

Several studies suggest involvement of serotoninergic system in the pathophysiology of Autism Spectrum Disorder (ASD). The 5-HT receptor binding studies using (3)H-lysergic acid diethylamide ((3)H-LSD) and linkage analysis provided evidences to consider HTR2A as a potential candidate gene for ASD. The three SNPs, -1438A/G (rs6311), 102T/C (rs6313) and 1354C/T (rs6314) of HTR2A have been well studied in the etiology of various neuropsychiatric disorders. But studies on association of this gene with ASD are limited to two reports from American and Korean populations. Additionally there are reports, which demonstrated paternal imprinting of HTR2A with expression from only one allele. So far no reports are available on HTR2A and its association with any neuropsychiatric disorders from Indian population. Therefore, the present study investigates association of the above mentioned three markers of HTR2A with ASD in Indian population using population and family-based approaches. The study also deals with allelic expression pattern of HTR2A in Peripheral Blood Leukocytes (PBLs) to understand the parental imprinting status. The genotyping analyses were carried out for probands, parents and controls. The subsequent association analyses did not show association of these markers with ASD. So, HTR2A is unlikely to be a genetic marker for ASD in Indian population. The expression analyses showed absence of monoallelic expression, suggesting lack of parental imprinting of HTR2A gene. However, we noticed methylation of the CpG sites at -1438A/G and 102T/C loci of HTR2A gene. Further bioinformatics analysis revealed absence of CpG islands in the promoter of the gene supporting biallelic expression pattern of HTR2A in PBLs.

Methylation of p15INK4b and Expression of ANRIL on Chromosome 9p21 Are Associated with Coronary Artery Disease

PubMed Central

Zhuang, Jianhui; Peng, Wenhui; Li, Hailing; Wang, Wei; Wei, Yidong; Li, Weiming; Xu, Yawei

2012-01-01

Background Genome-wide association studies have identified that multiple single nucleiotide polymorphisms on chromosome 9p21 are tightly associated with coronary artery disease (CAD). However, the mechanism linking this risk locus to CAD remains unclear. Methodology/Principal Findings The methylation status of six candidate genes (BAX, BCL-2, TIMP3, p14ARF, p15INK4b and p16INK4a) in 205 patients and controls who underwent coronary angiography were analyzed by quantitative MethyLight assay. Rs10757274 was genotyped and expression of INK4/ARF and antisense non-coding RNA in the INK4 locus (ANRIL) was determined by real-time RT-PCR. Compared with controls, DNA methylation levels at p15INK4b significantly increased in CAD patients (p = 0.006). To validate and dissect the methylation percentage of each target CpG site at p15INK4b, pyrosequencing was performed, finding CpG +314 and +332 remarkably hypermethylated in CAD patients. Further investigation determined that p15INK4b hypermethylation prevalently emerged in lymphocytes of CAD patients (p = 0.013). The rs10757274 genotype was significantly associated with CAD (p = 0.003) and GG genotype carriers had a higher level of ANRIL exon 1–5 expression compared among three genotypes (p = 0.009). There was a stepwise increase in p15INK4b and p16INK4a methylation as ANRIL exon 1–5 expression elevated (r = 0.23, p = 0.001 and r = 0.24, p = 0.001, respectively), although neither of two loci methylation was directly linked to rs10757274 genotype. Conclusions/Significance p15INK4b methylation is associated with CAD and ANRIL expression. The epigenetic changes in p15INK4b methylation and ANRIL expression may involve in the mechanisms of chromosome 9p21 on CAD development. PMID:23091611

The Zinc Concentration in the Diet and the Length of the Feeding Period Affect the Methylation Status of the ZIP4 Zinc Transporter Gene in Piglets

PubMed Central

Karweina, Diana; Kreuzer-Redmer, Susanne; Müller, Uwe; Franken, Tobias; Pieper, Robert; Baron, Udo; Olek, Sven; Zentek, Jürgen; Brockmann, Gudrun A.

2015-01-01

High doses of zinc oxide are commonly used in weaned pig diets to improve performance and health. Recent reports show that this may also lead to an imbalanced zinc homeostasis in the animal. For a better understanding of the regulatory mechanisms of different zinc intakes, we performed a feeding experiment to assess potential epigenetic regulation of the ZIP4 gene expression via DNA methylation in the small intestine of piglets. Fifty-four piglets were fed diets with 57 (LZn), 164 (NZn) or 2,425 (HZn) mg Zn/kg feed for one or four weeks. The ZIP4 expression data provided significant evidence for counter-regulation of zinc absorption with higher dietary zinc concentrations. The CpG +735 in the second exon had a 56% higher methylation in the HZn group compared to the others after one week of feeding (8.0·10-4 < p < 0.035); the methylation of this CpG was strongly negatively associated with the expression of the long ZIP4 transcripts (p < 0.007). In the LZn and NZn diets, the expression of the long ZIP4 transcripts were lower after four vs. one week of feeding (2.9·10-4 < p < 0.017). The strongest switch leading to high DNA methylation in nearly all analysed regions was dependent on feeding duration or age in all diet groups (3.7·10-10 < p < 0.099). The data suggest that DNA methylation serves as a fine-tuning mechanism of ZIP4 gene regulation to maintain zinc homeostasis. Methylation of the ZIP4 gene may play a minor role in the response to very high dietary zinc concentration, but may affect binding of alternate zinc-responsive transcription factors. PMID:26599865

The CpG Island in the Murine Foxl2 Proximal Promoter Is Differentially Methylated in Primary and Immortalized Cells

PubMed Central

Tran, Stella; Wang, Ying; Lamba, Pankaj; Zhou, Xiang; Boehm, Ulrich; Bernard, Daniel J.

2013-01-01

Forkhead box L2 (Foxl2), a member of the forkhead transcription factor family, plays important roles in pituitary follicle-stimulating hormone synthesis and in ovarian maintenance and function. Mutations in the human FOXL2 gene cause eyelid malformations and premature ovarian failure. FOXL2/Foxl2 is expressed in pituitary gonadotrope and thyrotrope cells, the perioptic mesenchyme of the developing eyelid, and ovarian granulosa cells. The mechanisms governing this cell-restricted expression have not been described. We mapped the Foxl2 transcriptional start site in immortalized murine gonadotrope-like cells, LβT2, by 5’ rapid amplification of cDNA ends and then PCR amplified approximately 1 kb of 5’ flanking sequence from murine genomic DNA. When ligated into a reporter plasmid, the proximal promoter conferred luciferase activity in both homologous (LβT2) and, unexpectedly, heterologous (NIH3T3) cells. In silico analyses identified a CpG island in the proximal promoter and 5’ untranslated region, suggesting that Foxl2 transcription might be regulated epigenetically. Indeed, pyrosequencing and quantitative analysis of DNA methylation using real-time PCR revealed Foxl2 proximal promoter hypomethylation in homologous compared to some, though not all, heterologous cell lines. The promoter was also hypomethylated in purified murine gonadotropes. In vitro promoter methylation completely silenced reporter activity in heterologous and homologous cells. Collectively, the data suggest that differential proximal promoter DNA methylation may contribute to cell-specific Foxl2 expression in some cellular contexts. However, gonadotrope-specific expression of the gene cannot be explained by promoter hypomethylation alone. PMID:24098544

Non-linear patterns in age-related DNA methylation may reflect CD4+ T cell differentiation

PubMed Central

Johnson, Nicholas D.; Wiener, Howard W.; Smith, Alicia K.; Nishitani, Shota; Absher, Devin M.; Arnett, Donna K.; Aslibekyan, Stella; Conneely, Karen N.

2017-01-01

ABSTRACT DNA methylation (DNAm) is an important epigenetic process involved in the regulation of gene expression. While many studies have identified thousands of loci associated with age, few have differentiated between linear and non-linear DNAm trends with age. Non-linear trends could indicate early- or late-life gene regulatory processes. Using data from the Illumina 450K array on 336 human peripheral blood samples, we identified 21 CpG sites that associated with age (P<1.03E-7) and exhibited changing rates of DNAm change with age (P<1.94E-6). For 2 of these CpG sites (cg07955995 and cg22285878), DNAm increased with age at an increasing rate, indicating that differential DNAm was greatest among elderly individuals. We observed significant replication for both CpG sites (P<5.0E-8) in a second set of peripheral blood samples. In 8 of 9 additional data sets comprising samples of monocytes, T cell subtypes, and brain tissue, we observed a pattern directionally consistent with DNAm increasing with age at an increasing rate, which was nominally significant in the 3 largest data sets (4.3E-15

Development of a novel, multilayered presentation format for clinical practice guidelines.

PubMed

Kristiansen, Annette; Brandt, Linn; Alonso-Coello, Pablo; Agoritsas, Thomas; Akl, Elie A; Conboy, Tara; Elbarbary, Mahmoud; Ferwana, Mazen; Medani, Wedad; Murad, Mohammad Hassan; Rigau, David; Rosenbaum, Sarah; Spencer, Frederick A; Treweek, Shaun; Guyatt, Gordon; Vandvik, Per Olav

2015-03-01

Bridging the gap between clinical research and everyday health-care practice requires effective communication strategies. To address current shortcomings in conveying practice recommendations and supporting evidence, we are creating and testing presentation formats for clinical practice guidelines (CPGs). We carried out multiple cycles of brainstorming and sketching, developing a prototype. Physicians participating in the user testing viewed CPG formats linked to clinical scenarios and engaged in semistructured interviews applying a think-aloud method for exploring important aspects of user experience. We developed a multilayered presentation format that allows clinicians to successively view more in-depth information. Starting with the recommendations, clinicians can, on demand, access a rationale and a key information section containing statements on quality of the evidence, balance between desirable and undesirable consequences, values and preferences, and resource considerations. We collected feedback from 27 stakeholders and performed user testing with 47 practicing physicians from six countries. Advisory group feedback and user testing of the first version revealed problems with conceptual understanding of underlying CPG methodology, as well as difficulties with the complexity of the layout and content. Extensive revisions made before the second round of user testing resulted in most participants expressing overall satisfaction with the final presentation format. We have developed an electronic, multilayered, CPG format that enhances the usability of CPGs for frontline clinicians. We have implemented the format in electronic guideline tools that guideline organizations can now use when authoring and publishing their guidelines.

[Evaluation of the quality of clinical practice guidelines published in the Annales de Biologie Clinique with the help of the EFLM checklist].

PubMed

Wils, Julien; Fonfrède, Michèle; Augereau, Christine; Watine, Joseph

2014-01-01

Several tools are available to help evaluate the quality of clinical practice guidelines (CPG). The AGREE instrument (Appraisal of guidelines for research & evaluation) is the most consensual tool but it has been designed to assess CPG methodology only. The European federation of laboratory medicine (EFLM) recently designed a check-list dedicated to laboratory medicine which is supposed to be comprehensive and which therefore makes it possible to evaluate more thoroughly the quality of CPG in laboratory medicine. In the present work we test the comprehensiveness of this check-list on a sample of CPG written in French and published in Annales de biologie clinique (ABC). Thus we show that some work remains to be achieved before a truly comprehensive check-list is designed. We also show that there is some room for improvement for the CPG published in ABC, for example regarding the fact that some of these CPG do not provide any information about allowed durations of transport and of storage of biological samples before analysis, or about standards of minimal analytical performance, or about the sensitivities or the specificities of the recommended tests.