Sample records for cpg sequence context

  1. DNA motifs associated with aberrant CpG island methylation.

    PubMed

    Feltus, F Alex; Lee, Eva K; Costello, Joseph F; Plass, Christoph; Vertino, Paula M

    2006-05-01

    Epigenetic silencing involving the aberrant methylation of promoter region CpG islands is widely recognized as a tumor suppressor silencing mechanism in cancer. However, the molecular pathways underlying aberrant DNA methylation remain elusive. Recently we showed that, on a genome-wide level, CpG island loci differ in their intrinsic susceptibility to aberrant methylation and that this susceptibility can be predicted based on underlying sequence context. These data suggest that there are sequence/structural features that contribute to the protection from or susceptibility to aberrant methylation. Here we use motif elicitation coupled with classification techniques to identify DNA sequence motifs that selectively define methylation-prone or methylation-resistant CpG islands. Motifs common to 28 methylation-prone or 47 methylation-resistant CpG island-containing genomic fragments were determined using the MEME and MAST algorithms (). The five most discriminatory motifs derived from methylation-prone sequences were found to be associated with CpG islands in general and were nonrandomly distributed throughout the genome. In contrast, the eight most discriminatory motifs derived from the methylation-resistant CpG islands were randomly distributed throughout the genome. Interestingly, this latter group tended to associate with Alu and other repetitive sequences. Used together, the frequency of occurrence of these motifs successfully discriminated methylation-prone and methylation-resistant CpG island groups with an accuracy of 87% after 10-fold cross-validation. The motifs identified here are candidate methylation-targeting or methylation-protection DNA sequences.

  2. Comparison of sequencing-based methods to profile DNA methylation and identification of monoallelic epigenetic modifications

    PubMed Central

    Harris, R. Alan; Wang, Ting; Coarfa, Cristian; Nagarajan, Raman P.; Hong, Chibo; Downey, Sara L.; Johnson, Brett E.; Fouse, Shaun D.; Delaney, Allen; Zhao, Yongjun; Olshen, Adam; Ballinger, Tracy; Zhou, Xin; Forsberg, Kevin J.; Gu, Junchen; Echipare, Lorigail; O’Geen, Henriette; Lister, Ryan; Pelizzola, Mattia; Xi, Yuanxin; Epstein, Charles B.; Bernstein, Bradley E.; Hawkins, R. David; Ren, Bing; Chung, Wen-Yu; Gu, Hongcang; Bock, Christoph; Gnirke, Andreas; Zhang, Michael Q.; Haussler, David; Ecker, Joseph; Li, Wei; Farnham, Peggy J.; Waterland, Robert A.; Meissner, Alexander; Marra, Marco A.; Hirst, Martin; Milosavljevic, Aleksandar; Costello, Joseph F.

    2010-01-01

    Sequencing-based DNA methylation profiling methods are comprehensive and, as accuracy and affordability improve, will increasingly supplant microarrays for genome-scale analyses. Here, four sequencing-based methodologies were applied to biological replicates of human embryonic stem cells to compare their CpG coverage genome-wide and in transposons, resolution, cost, concordance and its relationship with CpG density and genomic context. The two bisulfite methods reached concordance of 82% for CpG methylation levels and 99% for non-CpG cytosine methylation levels. Using binary methylation calls, two enrichment methods were 99% concordant, while regions assessed by all four methods were 97% concordant. To achieve comprehensive methylome coverage while reducing cost, an approach integrating two complementary methods was examined. The integrative methylome profile along with histone methylation, RNA, and SNP profiles derived from the sequence reads allowed genome-wide assessment of allele-specific epigenetic states, identifying most known imprinted regions and new loci with monoallelic epigenetic marks and monoallelic expression. PMID:20852635

  3. Predicting aberrant CpG island methylation

    PubMed Central

    Feltus, F. A.; Lee, E. K.; Costello, J. F.; Plass, C.; Vertino, P. M.

    2003-01-01

    Epigenetic silencing associated with aberrant methylation of promoter region CpG islands is one mechanism leading to loss of tumor suppressor function in human cancer. Profiling of CpG island methylation indicates that some genes are more frequently methylated than others, and that each tumor type is associated with a unique set of methylated genes. However, little is known about why certain genes succumb to this aberrant event. To address this question, we used Restriction Landmark Genome Scanning to analyze the susceptibility of 1,749 unselected CpG islands to de novo methylation driven by overexpression of DNA cytosine-5-methyltransferase 1 (DNMT1). We found that although the overall incidence of CpG island methylation was increased in cells overexpressing DNMT1, not all loci were equally affected. The majority of CpG islands (69.9%) were resistant to de novo methylation, regardless of DNMT1 overexpression. In contrast, we identified a subset of methylation-prone CpG islands (3.8%) that were consistently hypermethylated in multiple DNMT1 overexpressing clones. Methylation-prone and methylation-resistant CpG islands were not significantly different with respect to size, C+G content, CpG frequency, chromosomal location, or promoter association. We used DNA pattern recognition and supervised learning techniques to derive a classification function based on the frequency of seven novel sequence patterns that was capable of discriminating methylation-prone from methylation-resistant CpG islands with 82% accuracy. The data indicate that CpG islands differ in their intrinsic susceptibility to de novo methylation, and suggest that the propensity for a CpG island to become aberrantly methylated can be predicted based on its sequence context. PMID:14519846

  4. Predicting aberrant CpG island methylation.

    PubMed

    Feltus, F A; Lee, E K; Costello, J F; Plass, C; Vertino, P M

    2003-10-14

    Epigenetic silencing associated with aberrant methylation of promoter region CpG islands is one mechanism leading to loss of tumor suppressor function in human cancer. Profiling of CpG island methylation indicates that some genes are more frequently methylated than others, and that each tumor type is associated with a unique set of methylated genes. However, little is known about why certain genes succumb to this aberrant event. To address this question, we used Restriction Landmark Genome Scanning to analyze the susceptibility of 1,749 unselected CpG islands to de novo methylation driven by overexpression of DNA cytosine-5-methyltransferase 1 (DNMT1). We found that although the overall incidence of CpG island methylation was increased in cells overexpressing DNMT1, not all loci were equally affected. The majority of CpG islands (69.9%) were resistant to de novo methylation, regardless of DNMT1 overexpression. In contrast, we identified a subset of methylation-prone CpG islands (3.8%) that were consistently hypermethylated in multiple DNMT1 overexpressing clones. Methylation-prone and methylation-resistant CpG islands were not significantly different with respect to size, C+G content, CpG frequency, chromosomal location, or promoter association. We used DNA pattern recognition and supervised learning techniques to derive a classification function based on the frequency of seven novel sequence patterns that was capable of discriminating methylation-prone from methylation-resistant CpG islands with 82% accuracy. The data indicate that CpG islands differ in their intrinsic susceptibility to de novo methylation, and suggest that the propensity for a CpG island to become aberrantly methylated can be predicted based on its sequence context.

  5. Dendritic Cell-Based Immunotherapy of Breast Cancer: Modulation by CpG DNA

    DTIC Science & Technology

    2005-09-01

    tumor-associated antigens and bacterial DNA oligodeoxynucleotides containing unmethylated CpG sequences (CpG DNA) further augment the immune priming...associated antigens by cytotoxic T lymphocytes, and bacterial DNA oligodeoxy- nucleotides containing unmethylated CpG sequences (CpG DNA) can further...further amplify their immunostimulatory capacity and bacterial DNA oligodeoxynucleotides (ODN) containing unmethylated CpG sequences (CpG DNA) provide such

  6. In Vivo Control of CpG and Non-CpG DNA Methylation by DNA Methyltransferases

    PubMed Central

    Arand, Julia; Spieler, David; Karius, Tommy; Branco, Miguel R.; Meilinger, Daniela; Meissner, Alexander; Jenuwein, Thomas; Xu, Guoliang; Leonhardt, Heinrich; Wolf, Verena; Walter, Jörn

    2012-01-01

    The enzymatic control of the setting and maintenance of symmetric and non-symmetric DNA methylation patterns in a particular genome context is not well understood. Here, we describe a comprehensive analysis of DNA methylation patterns generated by high resolution sequencing of hairpin-bisulfite amplicons of selected single copy genes and repetitive elements (LINE1, B1, IAP-LTR-retrotransposons, and major satellites). The analysis unambiguously identifies a substantial amount of regional incomplete methylation maintenance, i.e. hemimethylated CpG positions, with variant degrees among cell types. Moreover, non-CpG cytosine methylation is confined to ESCs and exclusively catalysed by Dnmt3a and Dnmt3b. This sequence position–, cell type–, and region-dependent non-CpG methylation is strongly linked to neighboring CpG methylation and requires the presence of Dnmt3L. The generation of a comprehensive data set of 146,000 CpG dyads was used to apply and develop parameter estimated hidden Markov models (HMM) to calculate the relative contribution of DNA methyltransferases (Dnmts) for de novo and maintenance DNA methylation. The comparative modelling included wild-type ESCs and mutant ESCs deficient for Dnmt1, Dnmt3a, Dnmt3b, or Dnmt3a/3b, respectively. The HMM analysis identifies a considerable de novo methylation activity for Dnmt1 at certain repetitive elements and single copy sequences. Dnmt3a and Dnmt3b contribute de novo function. However, both enzymes are also essential to maintain symmetrical CpG methylation at distinct repetitive and single copy sequences in ESCs. PMID:22761581

  7. CpG PatternFinder: a Windows-based utility program for easy and rapid identification of the CpG methylation status of DNA.

    PubMed

    Xu, Yi-Hua; Manoharan, Herbert T; Pitot, Henry C

    2007-09-01

    The bisulfite genomic sequencing technique is one of the most widely used techniques to study sequence-specific DNA methylation because of its unambiguous ability to reveal DNA methylation status to the order of a single nucleotide. One characteristic feature of the bisulfite genomic sequencing technique is that a number of sample sequence files will be produced from a single DNA sample. The PCR products of bisulfite-treated DNA samples cannot be sequenced directly because they are heterogeneous in nature; therefore they should be cloned into suitable plasmids and then sequenced. This procedure generates an enormous number of sample DNA sequence files as well as adding extra bases belonging to the plasmids to the sequence, which will cause problems in the final sequence comparison. Finding the methylation status for each CpG in each sample sequence is not an easy job. As a result CpG PatternFinder was developed for this purpose. The main functions of the CpG PatternFinder are: (i) to analyze the reference sequence to obtain CpG and non-CpG-C residue position information. (ii) To tailor sample sequence files (delete insertions and mark deletions from the sample sequence files) based on a configuration of ClustalW multiple alignment. (iii) To align sample sequence files with a reference file to obtain bisulfite conversion efficiency and CpG methylation status. And, (iv) to produce graphics, highlighted aligned sequence text and a summary report which can be easily exported to Microsoft Office suite. CpG PatternFinder is designed to operate cooperatively with BioEdit, a freeware on the internet. It can handle up to 100 files of sample DNA sequences simultaneously, and the total CpG pattern analysis process can be finished in minutes. CpG PatternFinder is an ideal software tool for DNA methylation studies to determine the differential methylation pattern in a large number of individuals in a population. Previously we developed the CpG Analyzer program; CpG PatternFinder is our further effort to create software tools for DNA methylation studies.

  8. MethPrimer: designing primers for methylation PCRs.

    PubMed

    Li, Long-Cheng; Dahiya, Rajvir

    2002-11-01

    DNA methylation is an epigenetic mechanism of gene regulation. Bisulfite- conversion-based PCR methods, such as bisulfite sequencing PCR (BSP) and methylation specific PCR (MSP), remain the most commonly used techniques for methylation mapping. Existing primer design programs developed for standard PCR cannot handle primer design for bisulfite-conversion-based PCRs due to changes in DNA sequence context caused by bisulfite treatment and many special constraints both on the primers and the region to be amplified for such experiments. Therefore, the present study was designed to develop a program for such applications. MethPrimer, based on Primer 3, is a program for designing PCR primers for methylation mapping. It first takes a DNA sequence as its input and searches the sequence for potential CpG islands. Primers are then picked around the predicted CpG islands or around regions specified by users. MethPrimer can design primers for BSP and MSP. Results of primer selection are delivered through a web browser in text and in graphic view.

  9. Protection of CpG islands from DNA methylation is DNA-encoded and evolutionarily conserved

    PubMed Central

    Long, Hannah K.; King, Hamish W.; Patient, Roger K.; Odom, Duncan T.; Klose, Robert J.

    2016-01-01

    DNA methylation is a repressive epigenetic modification that covers vertebrate genomes. Regions known as CpG islands (CGIs), which are refractory to DNA methylation, are often associated with gene promoters and play central roles in gene regulation. Yet how CGIs in their normal genomic context evade the DNA methylation machinery and whether these mechanisms are evolutionarily conserved remains enigmatic. To address these fundamental questions we exploited a transchromosomic animal model and genomic approaches to understand how the hypomethylated state is formed in vivo and to discover whether mechanisms governing CGI formation are evolutionarily conserved. Strikingly, insertion of a human chromosome into mouse revealed that promoter-associated CGIs are refractory to DNA methylation regardless of host species, demonstrating that DNA sequence plays a central role in specifying the hypomethylated state through evolutionarily conserved mechanisms. In contrast, elements distal to gene promoters exhibited more variable methylation between host species, uncovering a widespread dependence on nucleotide frequency and occupancy of DNA-binding transcription factors in shaping the DNA methylation landscape away from gene promoters. This was exemplified by young CpG rich lineage-restricted repeat sequences that evaded DNA methylation in the absence of co-evolved mechanisms targeting methylation to these sequences, and species specific DNA binding events that protected against DNA methylation in CpG poor regions. Finally, transplantation of mouse chromosomal fragments into the evolutionarily distant zebrafish uncovered the existence of a mechanistically conserved and DNA-encoded logic which shapes CGI formation across vertebrate species. PMID:27084945

  10. The CpG island searcher: a new WWW resource.

    PubMed

    Takai, Daiya; Jones, Peter A

    2003-01-01

    Clusters of CpG dinucleotides in GC rich regions of the genome called "CpG islands" frequently occur in the 5' ends of genes. Methylation of CpG islands plays a role in transcriptional silencing in higher organisms in certain situations. We have established a CpG-island-extraction algorithm, which we previously developed [Takai and Jones, 2002], on a web site which has a simple user interface to identify CpG islands from submitted sequences of up to 50kb. The web site determines the locations of CpG islands using parameters (lower limit of %GC, ObsCpG/ExpCpG, length) set by the user, to display the value of parameters on each CpG island, and provides a graphical map of CpG dinucleotide distribution and borders of CpG islands. A command-line version of the CpG islands searcher has also been developed for larger sequences. The CpG Island Searcher was applied to the latest sequence and mapping information of human chromosomes 20, 21 and 22, and a total of 2345 CpG islands were extracted and 534 (23%) of them contained first coding exons and 650 (28%) contained other exons. The CpG Island Searcher is available on the World Wide Web at http://www.cpgislands.com or http://www.uscnorris.com/cpgislands/cpg.cgi.

  11. Comprehensive analysis of CpG islands in human chromosomes 21 and 22

    NASA Astrophysics Data System (ADS)

    Takai, Daiya; Jones, Peter A.

    2002-03-01

    CpG islands are useful markers for genes in organisms containing 5-methylcytosine in their genomes. In addition, CpG islands located in the promoter regions of genes can play important roles in gene silencing during processes such as X-chromosome inactivation, imprinting, and silencing of intragenomic parasites. The generally accepted definition of what constitutes a CpG island was proposed in 1987 by Gardiner-Garden and Frommer [Gardiner-Garden, M. & Frommer, M. (1987) J. Mol. Biol. 196, 261-282] as being a 200-bp stretch of DNA with a C+G content of 50% and an observed CpG/expected CpG in excess of 0.6. Any definition of a CpG island is somewhat arbitrary, and this one, which was derived before the sequencing of mammalian genomes, will include many sequences that are not necessarily associated with controlling regions of genes but rather are associated with intragenomic parasites. We have therefore used the complete genomic sequences of human chromosomes 21 and 22 to examine the properties of CpG islands in different sequence classes by using a search algorithm that we have developed. Regions of DNA of greater than 500 bp with a G+C equal to or greater than 55% and observed CpG/expected CpG of 0.65 were more likely to be associated with the 5' regions of genes and this definition excluded most Alu-repetitive elements. We also used genome sequences to show strong CpG suppression in the human genome and slight suppression in Drosophila melanogaster and Saccharomyces cerevisiae. This finding is compatible with the recent detection of 5-methylcytosine in Drosophila, and might suggest that S. cerevisiae has, or once had, CpG methylation.

  12. Protection of CpG islands from DNA methylation is DNA-encoded and evolutionarily conserved.

    PubMed

    Long, Hannah K; King, Hamish W; Patient, Roger K; Odom, Duncan T; Klose, Robert J

    2016-08-19

    DNA methylation is a repressive epigenetic modification that covers vertebrate genomes. Regions known as CpG islands (CGIs), which are refractory to DNA methylation, are often associated with gene promoters and play central roles in gene regulation. Yet how CGIs in their normal genomic context evade the DNA methylation machinery and whether these mechanisms are evolutionarily conserved remains enigmatic. To address these fundamental questions we exploited a transchromosomic animal model and genomic approaches to understand how the hypomethylated state is formed in vivo and to discover whether mechanisms governing CGI formation are evolutionarily conserved. Strikingly, insertion of a human chromosome into mouse revealed that promoter-associated CGIs are refractory to DNA methylation regardless of host species, demonstrating that DNA sequence plays a central role in specifying the hypomethylated state through evolutionarily conserved mechanisms. In contrast, elements distal to gene promoters exhibited more variable methylation between host species, uncovering a widespread dependence on nucleotide frequency and occupancy of DNA-binding transcription factors in shaping the DNA methylation landscape away from gene promoters. This was exemplified by young CpG rich lineage-restricted repeat sequences that evaded DNA methylation in the absence of co-evolved mechanisms targeting methylation to these sequences, and species specific DNA binding events that protected against DNA methylation in CpG poor regions. Finally, transplantation of mouse chromosomal fragments into the evolutionarily distant zebrafish uncovered the existence of a mechanistically conserved and DNA-encoded logic which shapes CGI formation across vertebrate species. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  13. CpG island mapping by epigenome prediction.

    PubMed

    Bock, Christoph; Walter, Jörn; Paulsen, Martina; Lengauer, Thomas

    2007-06-01

    CpG islands were originally identified by epigenetic and functional properties, namely, absence of DNA methylation and frequent promoter association. However, this concept was quickly replaced by simple DNA sequence criteria, which allowed for genome-wide annotation of CpG islands in the absence of large-scale epigenetic datasets. Although widely used, the current CpG island criteria incur significant disadvantages: (1) reliance on arbitrary threshold parameters that bear little biological justification, (2) failure to account for widespread heterogeneity among CpG islands, and (3) apparent lack of specificity when applied to the human genome. This study is driven by the idea that a quantitative score of "CpG island strength" that incorporates epigenetic and functional aspects can help resolve these issues. We construct an epigenome prediction pipeline that links the DNA sequence of CpG islands to their epigenetic states, including DNA methylation, histone modifications, and chromatin accessibility. By training support vector machines on epigenetic data for CpG islands on human Chromosomes 21 and 22, we identify informative DNA attributes that correlate with open versus compact chromatin structures. These DNA attributes are used to predict the epigenetic states of all CpG islands genome-wide. Combining predictions for multiple epigenetic features, we estimate the inherent CpG island strength for each CpG island in the human genome, i.e., its inherent tendency to exhibit an open and transcriptionally competent chromatin structure. We extensively validate our results on independent datasets, showing that the CpG island strength predictions are applicable and informative across different tissues and cell types, and we derive improved maps of predicted "bona fide" CpG islands. The mapping of CpG islands by epigenome prediction is conceptually superior to identifying CpG islands by widely used sequence criteria since it links CpG island detection to their characteristic epigenetic and functional states. And it is superior to purely experimental epigenome mapping for CpG island detection since it abstracts from specific properties that are limited to a single cell type or tissue. In addition, using computational epigenetics methods we could identify high correlation between the epigenome and characteristics of the DNA sequence, a finding which emphasizes the need for a better understanding of the mechanistic links between genome and epigenome.

  14. A Bayesian hierarchical model to detect differentially methylated loci from single nucleotide resolution sequencing data

    PubMed Central

    Feng, Hao; Conneely, Karen N.; Wu, Hao

    2014-01-01

    DNA methylation is an important epigenetic modification that has essential roles in cellular processes including gene regulation, development and disease and is widely dysregulated in most types of cancer. Recent advances in sequencing technology have enabled the measurement of DNA methylation at single nucleotide resolution through methods such as whole-genome bisulfite sequencing and reduced representation bisulfite sequencing. In DNA methylation studies, a key task is to identify differences under distinct biological contexts, for example, between tumor and normal tissue. A challenge in sequencing studies is that the number of biological replicates is often limited by the costs of sequencing. The small number of replicates leads to unstable variance estimation, which can reduce accuracy to detect differentially methylated loci (DML). Here we propose a novel statistical method to detect DML when comparing two treatment groups. The sequencing counts are described by a lognormal-beta-binomial hierarchical model, which provides a basis for information sharing across different CpG sites. A Wald test is developed for hypothesis testing at each CpG site. Simulation results show that the proposed method yields improved DML detection compared to existing methods, particularly when the number of replicates is low. The proposed method is implemented in the Bioconductor package DSS. PMID:24561809

  15. Nullomers and High Order Nullomers in Genomic Sequences

    PubMed Central

    Vergni, Davide; Santoni, Daniele

    2016-01-01

    A nullomer is an oligomer that does not occur as a subsequence in a given DNA sequence, i.e. it is an absent word of that sequence. The importance of nullomers in several applications, from drug discovery to forensic practice, is now debated in the literature. Here, we investigated the nature of nullomers, whether their absence in genomes has just a statistical explanation or it is a peculiar feature of genomic sequences. We introduced an extension of the notion of nullomer, namely high order nullomers, which are nullomers whose mutated sequences are still nullomers. We studied different aspects of them: comparison with nullomers of random sequences, CpG distribution and mean helical rise. In agreement with previous results we found that the number of nullomers in the human genome is much larger than expected by chance. Nevertheless antithetical results were found when considering a random DNA sequence preserving dinucleotide frequencies. The analysis of CpG frequencies in nullomers and high order nullomers revealed, as expected, a high CpG content but it also highlighted a strong dependence of CpG frequencies on the dinucleotide position, suggesting that nullomers have their own peculiar structure and are not simply sequences whose CpG frequency is biased. Furthermore, phylogenetic trees were built on eleven species based on both the similarities between the dinucleotide frequencies and the number of nullomers two species share, showing that nullomers are fairly conserved among close species. Finally the study of mean helical rise of nullomers sequences revealed significantly high mean rise values, reinforcing the hypothesis that those sequences have some peculiar structural features. The obtained results show that nullomers are the consequence of the peculiar structure of DNA (also including biased CpG frequency and CpGs islands), so that the hypermutability model, also taking into account CpG islands, seems to be not sufficient to explain nullomer phenomenon. Finally, high order nullomers could emphasize those features that already make simple nullomers useful in several applications. PMID:27906971

  16. Methylation levels of the "long interspersed nucleotide element-1" repetitive sequences predict survival of melanoma patients.

    PubMed

    Sigalotti, Luca; Fratta, Elisabetta; Bidoli, Ettore; Covre, Alessia; Parisi, Giulia; Colizzi, Francesca; Coral, Sandra; Massarut, Samuele; Kirkwood, John M; Maio, Michele

    2011-05-26

    The prognosis of cutaneous melanoma (CM) differs for patients with identical clinico-pathological stage, and no molecular markers discriminating the prognosis of stage III individuals have been established. Genome-wide alterations in DNA methylation are a common event in cancer. This study aimed to define the prognostic value of genomic DNA methylation levels in stage III CM patients. Overall level of genomic DNA methylation was measured using bisulfite pyrosequencing at three CpG sites (CpG1, CpG2, CpG3) of the Long Interspersed Nucleotide Element-1 (LINE-1) sequences in short-term CM cultures from 42 stage IIIC patients. The impact of LINE-1 methylation on overall survival (OS) was assessed using Cox regression and Kaplan-Meier analysis. Hypomethylation (i.e., methylation below median) at CpG2 and CpG3 sites significantly associated with improved prognosis of CM, CpG3 showing the strongest association. Patients with hypomethylated CpG3 had increased OS (P = 0.01, log-rank = 6.39) by Kaplan-Meyer analysis. Median OS of patients with hypomethylated or hypermethylated CpG3 were 31.9 and 11.5 months, respectively. The 5 year OS for patients with hypomethylated CpG3 was 48% compared to 7% for patients with hypermethylated sequences. Among the variables examined by Cox regression analysis, LINE-1 methylation at CpG2 and CpG3 was the only predictor of OS (Hazard Ratio = 2.63, for hypermethylated CpG3; 95% Confidence Interval: 1.21-5.69; P = 0.01). LINE-1 methylation is identified as a molecular marker of prognosis for CM patients in stage IIIC. Evaluation of LINE-1 promises to represent a key tool for driving the most appropriate clinical management of stage III CM patients.

  17. Methylation levels of the "long interspersed nucleotide element-1" repetitive sequences predict survival of melanoma patients

    PubMed Central

    2011-01-01

    Background The prognosis of cutaneous melanoma (CM) differs for patients with identical clinico-pathological stage, and no molecular markers discriminating the prognosis of stage III individuals have been established. Genome-wide alterations in DNA methylation are a common event in cancer. This study aimed to define the prognostic value of genomic DNA methylation levels in stage III CM patients. Methods Overall level of genomic DNA methylation was measured using bisulfite pyrosequencing at three CpG sites (CpG1, CpG2, CpG3) of the Long Interspersed Nucleotide Element-1 (LINE-1) sequences in short-term CM cultures from 42 stage IIIC patients. The impact of LINE-1 methylation on overall survival (OS) was assessed using Cox regression and Kaplan-Meier analysis. Results Hypomethylation (i.e., methylation below median) at CpG2 and CpG3 sites significantly associated with improved prognosis of CM, CpG3 showing the strongest association. Patients with hypomethylated CpG3 had increased OS (P = 0.01, log-rank = 6.39) by Kaplan-Meyer analysis. Median OS of patients with hypomethylated or hypermethylated CpG3 were 31.9 and 11.5 months, respectively. The 5 year OS for patients with hypomethylated CpG3 was 48% compared to 7% for patients with hypermethylated sequences. Among the variables examined by Cox regression analysis, LINE-1 methylation at CpG2 and CpG3 was the only predictor of OS (Hazard Ratio = 2.63, for hypermethylated CpG3; 95% Confidence Interval: 1.21-5.69; P = 0.01). Conclusion LINE-1 methylation is identified as a molecular marker of prognosis for CM patients in stage IIIC. Evaluation of LINE-1 promises to represent a key tool for driving the most appropriate clinical management of stage III CM patients. PMID:21615918

  18. Complete Chloroplast Genome of Pinus massoniana (Pinaceae): Gene Rearrangements, Loss of ndh Genes, and Short Inverted Repeats Contraction, Expansion.

    PubMed

    Ni, ZhouXian; Ye, YouJu; Bai, Tiandao; Xu, Meng; Xu, Li-An

    2017-09-11

    The chloroplast genome (CPG) of Pinus massoniana belonging to the genus Pinus (Pinaceae), which is a primary source of turpentine, was sequenced and analyzed in terms of gene rearrangements, ndh genes loss, and the contraction and expansion of short inverted repeats (IRs). P. massoniana CPG has a typical quadripartite structure that includes large single copy (LSC) (65,563 bp), small single copy (SSC) (53,230 bp) and two IRs (IRa and IRb, 485 bp). The 108 unique genes were identified, including 73 protein-coding genes, 31 tRNAs, and 4 rRNAs. Most of the 81 simple sequence repeats (SSRs) identified in CPG were mononucleotides motifs of A/T types and located in non-coding regions. Comparisons with related species revealed an inversion (21,556 bp) in the LSC region; P. massoniana CPG lacks all 11 intact ndh genes (four ndh genes lost completely; the five remained truncated as pseudogenes; and the other two ndh genes remain as pseudogenes because of short insertions or deletions). A pair of short IRs was found instead of large IRs, and size variations among pine species were observed, which resulted from short insertions or deletions and non-synchronized variations between "IRa" and "IRb". The results of phylogenetic analyses based on whole CPG sequences of 16 conifers indicated that the whole CPG sequences could be used as a powerful tool in phylogenetic analyses.

  19. Unique DNA methylome profiles in CpG island methylator phenotype colon cancers

    PubMed Central

    Xu, Yaomin; Hu, Bo; Choi, Ae-Jin; Gopalan, Banu; Lee, Byron H.; Kalady, Matthew F.; Church, James M.; Ting, Angela H.

    2012-01-01

    A subset of colorectal cancers was postulated to have the CpG island methylator phenotype (CIMP), a higher propensity for CpG island DNA methylation. The validity of CIMP, its molecular basis, and its prognostic value remain highly controversial. Using MBD-isolated genome sequencing, we mapped and compared genome-wide DNA methylation profiles of normal, non-CIMP, and CIMP colon specimens. Multidimensional scaling analysis revealed that each specimen could be clearly classified as normal, non-CIMP, and CIMP, thus signifying that these three groups have distinctly different global methylation patterns. We discovered 3780 sites in various genomic contexts that were hypermethylated in both non-CIMP and CIMP colon cancers when compared with normal colon. An additional 2026 sites were found to be hypermethylated in CIMP tumors only; and importantly, 80% of these sites were located in CpG islands. These data demonstrate on a genome-wide level that the additional hypermethylation seen in CIMP tumors occurs almost exclusively at CpG islands and support definitively that these tumors were appropriately named. When these sites were examined more closely, we found that 25% were adjacent to sites that were also hypermethylated in non-CIMP tumors. Thus, CIMP is also characterized by more extensive methylation of sites that are already prone to be hypermethylated in colon cancer. These observations indicate that CIMP tumors have specific defects in controlling both DNA methylation seeding and spreading and serve as an important first step in delineating molecular mechanisms that control these processes. PMID:21990380

  20. Cytosine-phosphate-guanine oligodeoxynucleotides containing GACGTT motifs enhance the immune responses elicited by keyhole limpet hemocyanin antigen in dairy cattle.

    PubMed

    Chu, Chun-Yen; Lee, Shang-Chun; Liu, Shyh-Shyan; Lin, Yu-Ming; Shen, Perng-Chi; Yu, Chi; Lee, Kuo-Hua; Zhao, Xin; Lee, Jai-Wei

    2011-10-01

    Adjuvants are important components of vaccine formulations. Effective adjuvants line innate and adaptive immunity by signaling through pathogen recognition receptors. Synthetic cytosine-phosphate-guanine (CpG) oligodeoxynucleotides (ODNs) have been shown to have potentials as adjuvants for vaccines. However, the immunostimulatory effect of CpG is species-specific and depends on the sequence of CpG motifs. A CpG ODN (2135), containing 3 identical copies of GTCGTT motif, was previously reported to have the strongest effects on bovine peripheral blood mononuclear cells (PBMC). Based on the sequence of 2135, we replaced the GTCGTT motif with 11 other sequences containing CG and investigated their effects on bovine lymphocyte proliferation. Results showed that the CpG ODNs containing 3 copies of GACGTT motif had the highest lymphocyte stimulation index (7.91±1.18), which was significantly (P<0.05) higher than that of 2135 (4.25±0.56). The CpG ODNs containing 3 copies of GACGTT motif also significantly increased the mRNA expression of interferon (IFN)-α, interleukin (IL)-12, and IL-21 in bovine PBMC. When dairy cows were immunized with the keyhole limpet hemocyanin (KLH) antigen formulated with CpG ODNs containing 3 copies of GACGTT, production of KLH-specific antibodies in serum and in milk whey was significantly (P<0.05) enhanced. IFN-γ in whole blood stimulated by KLH was also significantly (P<0.05) increased in cows immunized with KLH plus CpG ODNs. Our results indicate that CpG ODNs containing 3 copies of the GACGTT motifs is a potential adjuvant for bovine vaccines.

  1. A dinucleotide motif in oligonucleotides shows potent immunomodulatory activity and overrides species-specific recognition observed with CpG motif.

    PubMed

    Kandimalla, Ekambar R; Bhagat, Lakshmi; Zhu, Fu-Gang; Yu, Dong; Cong, Yan-Ping; Wang, Daqing; Tang, Jimmy X; Tang, Jin-Yan; Knetter, Cathrine F; Lien, Egil; Agrawal, Sudhir

    2003-11-25

    Bacterial and synthetic DNAs containing CpG dinucleotides in specific sequence contexts activate the vertebrate immune system through Toll-like receptor 9 (TLR9). In the present study, we used a synthetic nucleoside with a bicyclic heterobase [1-(2'-deoxy-beta-d-ribofuranosyl)-2-oxo-7-deaza-8-methyl-purine; R] to replace the C in CpG, resulting in an RpG dinucleotide. The RpG dinucleotide was incorporated in mouse- and human-specific motifs in oligodeoxynucleotides (oligos) and 3'-3-linked oligos, referred to as immunomers. Oligos containing the RpG motif induced cytokine secretion in mouse spleen-cell cultures. Immunomers containing RpG dinucleotides showed activity in transfected-HEK293 cells stably expressing mouse TLR9, suggesting direct involvement of TLR9 in the recognition of RpG motif. In J774 macrophages, RpG motifs activated NF-kappa B and mitogen-activated protein kinase pathways. Immunomers containing the RpG dinucleotide induced high levels of IL-12 and IFN-gamma, but lower IL-6 in time- and concentration-dependent fashion in mouse spleen-cell cultures costimulated with IL-2. Importantly, immunomers containing GTRGTT and GARGTT motifs were recognized to a similar extent by both mouse and human immune systems. Additionally, both mouse- and human-specific RpG immunomers potently stimulated proliferation of peripheral blood mononuclear cells obtained from diverse vertebrate species, including monkey, pig, horse, sheep, goat, rat, and chicken. An immunomer containing GTRGTT motif prevented conalbumin-induced and ragweed allergen-induced allergic inflammation in mice. We show that a synthetic bicyclic nucleotide is recognized in the C position of a CpG dinucleotide by immune cells from diverse vertebrate species without bias for flanking sequences, suggesting a divergent nucleotide motif recognition pattern of TLR9.

  2. DNA Methylation of Gene Expression in Acanthamoeba castellanii Encystation.

    PubMed

    Moon, Eun-Kyung; Hong, Yeonchul; Lee, Hae-Ahm; Quan, Fu-Shi; Kong, Hyun-Hee

    2017-04-01

    Encystation mediating cyst specific cysteine proteinase (CSCP) of Acanthamoeba castellanii is expressed remarkably during encystation. However, the molecular mechanism involved in the regulation of CSCP gene expression remains unclear. In this study, we focused on epigenetic regulation of gene expression during encystation of Acanthamoeba . To evaluate methylation as a potential mechanism involved in the regulation of CSCP expression, we first investigated the correlation between promoter methylation status of CSCP gene and its expression. A 2,878 bp of promoter sequence of CSCP gene was amplified by PCR. Three CpG islands (island 1-3) were detected in this sequence using bioinformatics tools. Methylation of CpG island in trophozoites and cysts was measured by bisulfite sequence PCR. CSCP promoter methylation of CpG island 1 (1,633 bp) was found in 8.2% of trophozoites and 7.3% of cysts. Methylation of CpG island 2 (625 bp) was observed in 4.2% of trophozoites and 5.8% of cysts. Methylation of CpG island 3 (367 bp) in trophozoites and cysts was both 3.6%. These results suggest that DNA methylation system is present in CSCP gene expression of Acanthamoeba . In addition, the expression of encystation mediating CSCP is correlated with promoter CpG island 1 hypomethylation.

  3. Transformation of Context-dependent Sensory Dynamics into Motor Behavior

    PubMed Central

    Latorre, Roberto; Levi, Rafael; Varona, Pablo

    2013-01-01

    The intrinsic dynamics of sensory networks play an important role in the sensory-motor transformation. In this paper we use conductance based models and electrophysiological recordings to address the study of the dual role of a sensory network to organize two behavioral context-dependent motor programs in the mollusk Clione limacina. We show that: (i) a winner take-all dynamics in the gravimetric sensory network model drives the typical repetitive rhythm in the wing central pattern generator (CPG) during routine swimming; (ii) the winnerless competition dynamics of the same sensory network organizes the irregular pattern observed in the wing CPG during hunting behavior. Our model also shows that although the timing of the activity is irregular, the sequence of the switching among the sensory cells is preserved whenever the same set of neurons are activated in a given time window. These activation phase locks in the sensory signals are transformed into specific events in the motor activity. The activation phase locks can play an important role in motor coordination driven by the intrinsic dynamics of a multifunctional sensory organ. PMID:23459114

  4. Structural impact of complete CpG methylation within target DNA on specific complex formation of the inducible transcription factor Egr-1.

    PubMed

    Zandarashvili, Levani; White, Mark A; Esadze, Alexandre; Iwahara, Junji

    2015-07-08

    The inducible transcription factor Egr-1 binds specifically to 9-bp target sequences containing two CpG sites that can potentially be methylated at four cytosine bases. Although it appears that complete CpG methylation would make an unfavorable steric clash in the previous crystal structures of the complexes with unmethylated or partially methylated DNA, our affinity data suggest that DNA recognition by Egr-1 is insensitive to CpG methylation. We have determined, at a 1.4-Å resolution, the crystal structure of the Egr-1 zinc-finger complex with completely methylated target DNA. Structural comparison of the three different methylation states reveals why Egr-1 can recognize the target sequences regardless of CpG methylation. Copyright © 2015 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  5. Molecular characterization and transcriptional analysis of the female-enriched chondroitin proteoglycan 2 of Toxocara canis.

    PubMed

    Ma, G X; Zhou, R Q; Hu, L; Luo, Y L; Luo, Y F; Zhu, H H

    2018-03-01

    Toxocara canis is an important but neglected zoonotic parasite, and is the causative agent of human toxocariasis. Chondroitin proteoglycans are biological macromolecules, widely distributed in extracellular matrices, with a great diversity of functions in mammals. However, there is limited information regarding chondroitin proteoglycans in nematode parasites. In the present study, a female-enriched chondroitin proteoglycan 2 gene of T. canis (Tc-cpg-2) was cloned and characterized. Quantitative real-time polymerase chain reaction (qRT-PCR) was employed to measure the transcription levels of Tc-cpg-2 among tissues of male and female adult worms. A 485-amino-acid (aa) polypeptide was predicted from a continuous 1458-nuleotide open reading frame and designated as TcCPG2, which contains a 21-aa signal peptide. Conserved domain searching indicated three chitin-binding peritrophin-A (CBM_14) domains in the amino acid sequence of TcCPG2. Multiple alignment with the inferred amino acid sequences of Caenorhabditis elegans and Ascaris suum showed that CBM_14 domains were well conserved among these species. Phylogenetic analysis suggested that TcCPG2 was closely related to the sequence of chondroitin proteoglycan 2 of A. suum. Interestingly, a high level of Tc-cpg-2 was detected in female germline tissues, particularly in the oviduct, suggesting potential roles of this gene in reproduction (e.g. oogenesis and embryogenesis) of adult T. canis. The functional roles of Tc-cpg-2 in reproduction and development in this parasite and related parasitic nematodes warrant further functional studies.

  6. Conserved Role of Intragenic DNA Methylation in Regulating Alternative Promoters

    PubMed Central

    Maunakea, Alika K.; Nagarajan, Raman P.; Bilenky, Mikhail; Ballinger, Tracy J.; D’Souza, Cletus; Fouse, Shaun D.; Johnson, Brett E.; Hong, Chibo; Nielsen, Cydney; Zhao, Yongjun; Turecki, Gustavo; Delaney, Allen; Varhol, Richard; Thiessen, Nina; Shchors, Ksenya; Heine, Vivi M.; Rowitch, David H.; Xing, Xiaoyun; Fiore, Chris; Schillebeeckx, Maximiliaan; Jones, Steven J.M.; Haussler, David; Marra, Marco A.; Hirst, Martin; Wang, Ting; Costello, Joseph F.

    2014-01-01

    While the methylation of DNA in 5′ promoters suppresses gene expression, the role of DNA methylation in gene bodies is unclear1–5. In mammals, tissue- and cell type-specific methylation is present in a small percentage of 5′ CpG island (CGI) promoters, while a far greater proportion occurs across gene bodies, coinciding with highly conserved sequences5–10. Tissue-specific intragenic methylation might reduce,3 or, paradoxically, enhance transcription elongation efficiency1,2,4,5. Capped analysis of gene expression (CAGE) experiments also indicate that transcription commonly initiates within and between genes11–15. To investigate the role of intragenic methylation, we generated a map of DNA methylation from human brain encompassing 24.7 million of the 28 million CpG sites. From the dense, high-resolution coverage of CpG islands, the majority of methylated CpG islands were revealed to be in intragenic and intergenic regions, while less than 3% of CpG islands in 5′ promoters were methylated. The CpG islands in all three locations overlapped with RNA markers of transcription initiation, and unmethylated CpG islands also overlapped significantly with trimethylation of H3K4, a histone modification enriched at promoters16. The general and CpG-island-specific patterns of methylation are conserved in mouse tissues. An in-depth investigation of the human SHANK3 locus17,18 and its mouse homologue demonstrated that this tissue-specific DNA methylation regulates intragenic promoter activity in vitro and in vivo. These methylation-regulated, alternative transcripts are expressed in a tissue and cell type-specific manner, and are expressed differentially within a single cell type from distinct brain regions. These results support a major role for intragenic methylation in regulating cell context-specific alternative promoters in gene bodies. PMID:20613842

  7. Detecting cooperative sequences in the binding of RNA Polymerase-II

    NASA Astrophysics Data System (ADS)

    Glass, Kimberly; Rozenberg, Julian; Girvan, Michelle; Losert, Wolfgang; Ott, Ed; Vinson, Charles

    2008-03-01

    Regulation of the expression level of genes is a key biological process controlled largely by the 1000 base pair (bp) sequence preceding each gene (the promoter region). Within that region transcription factor binding sites (TFBS), 5-10 bp long sequences, act individually or cooperate together in the recruitment of, and therefore subsequent gene transcription by, RNA Polymerase-II (RNAP). We have measured the binding of RNAP to promoters on a genome-wide basis using Chromatin Immunoprecipitation (ChIP-on-Chip) microarray assays. Using all 8-base pair long sequences as a test set, we have identified the DNA sequences that are enriched in promoters with high RNAP binding values. We are able to demonstrate that virtually all sequences enriched in such promoters contain a CpG dinucleotide, indicating that TFBS that contain the CpG dinucleotide are involved in RNAP binding to promoters. Further analysis shows that the presence of pairs of CpG containing sequences cooperate to enhance the binding of RNAP to the promoter.

  8. Depletion of CpG Dinucleotides in Papillomaviruses and Polyomaviruses: A Role for Divergent Evolutionary Pressures.

    PubMed

    Upadhyay, Mohita; Vivekanandan, Perumal

    2015-01-01

    Papillomaviruses and polyomaviruses are small ds-DNA viruses infecting a wide-range of vertebrate hosts. Evidence supporting co-evolution of the virus with the host does not fully explain the evolutionary path of papillomaviruses and polyomaviruses. Studies analyzing CpG dinucleotide frequencies in virus genomes have provided interesting insights on virus evolution. CpG dinucleotide depletion has not been extensively studied among papillomaviruses and polyomaviruses. We sought to analyze the relative abundance of dinucleotides and the relative roles of evolutionary pressures in papillomaviruses and polyomaviruses. We studied 127 full-length sequences from papillomaviruses and 56 full-length sequences from polyomaviruses. We analyzed the relative abundance of dinucleotides, effective codon number (ENC), differences in synonymous codon usage. We examined the association, if any, between the extent of CpG dinucleotide depletion and the evolutionary lineage of the infected host. We also investigated the contribution of mutational pressure and translational selection to the evolution of papillomaviruses and polyomaviruses. All papillomaviruses and polyomaviruses are CpG depleted. Interestingly, the evolutionary lineage of the infected host determines the extent of CpG depletion among papillomaviruses and polyomaviruses. CpG dinucleotide depletion was more pronounced among papillomaviruses and polyomaviruses infecting human and other mammals as compared to those infecting birds. Our findings demonstrate that CpG depletion among papillomaviruses is linked to mutational pressure; while CpG depletion among polyomaviruses is linked to translational selection. We also present evidence that suggests methylation of CpG dinucleotides may explain, at least in part, the depletion of CpG dinucleotides among papillomaviruses but not polyomaviruses. The extent of CpG depletion among papillomaviruses and polyomaviruses is linked to the evolutionary lineage of the infected host. Our results highlight the existence of divergent evolutionary pressures leading to CpG dinucleotide depletion among small ds-DNA viruses infecting vertebrate hosts.

  9. Targeted-bisulfite sequence analysis of the methylation of CpG islands in genes encoding PNPLA3, SAMM50, and PARVB of patients with non-alcoholic fatty liver disease.

    PubMed

    Kitamoto, Takuya; Kitamoto, Aya; Ogawa, Yuji; Honda, Yasushi; Imajo, Kento; Saito, Satoru; Yoneda, Masato; Nakamura, Takahiro; Nakajima, Atsushi; Hotta, Kikuko

    2015-08-01

    The pathogenesis of non-alcoholic fatty liver disease (NAFLD) is affected by epigenetic factors as well as by genetic variation. We performed targeted-bisulfite sequencing to determine the levels of DNA methylation of 4 CpG islands (CpG99, CpG71, CpG26, and CpG101) in the regulatory regions of PNPLA3, SAMM50, PARVB variant 1, and PARVB variant 2, respectively. We compared the levels of methylation of DNA in the livers of the first and second sets of patients with mild (fibrosis stages 0 and 1) or advanced (fibrosis stages 2 to 4) NAFLD and in those of patients with mild (F0 to F2) or advanced (F3 and F4) chronic hepatitis C infection. The hepatic mRNA levels of PNPLA3, SAMM50, and PARVB were measured using qPCR. CpG26, which resides in the regulatory region of PARVB variant 1, was markedly hypomethylated in the livers of patients with advanced NAFLD. Conversely, CpG99 in the regulatory region of PNPLA3 was substantially hypermethylated in these patients. These differences in DNA methylation were replicated in a second set of patients with NAFLD or chronic hepatitis C. PNPLA3 mRNA levels in the liver of the same section of a biopsy specimen used for genomic DNA preparation were lower in patients with advanced NAFLD compared with those with mild NAFLD and correlated inversely with CpG99 methylation in liver DNA. Moreover, the levels of CpG99 methylation and PNPLA3 mRNA were affected by the rs738409 genotype. Hypomethylation of CpG26 and hypermethylation of CpG99 may contribute to the severity of fibrosis in patients with NAFLD or chronic hepatitis C infection. Copyright © 2015 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved.

  10. DNA activates human immune cells through a CpG sequence-dependent manner

    PubMed Central

    Bauer, M; Heeg, K; Wagner, H; Lipford, G B

    1999-01-01

    While bacterial DNA and cytosine–guanosine-dinucleotide-containing oligonucleotides (CpG ODN) are well described activators of murine immune cells, their effect on human cells is inconclusive. We investigated their properties on human peripheral blood mononuclear cells (PBMC) and subsets thereof, such as purified monocytes, T and B cells. Here we demonstrate that bacterial DNA and CpG ODN induce proliferation of B cells, while other subpopulations, such as monocytes and T cells, did not proliferate. PBMC mixed cell cultures, as well as purified monocytes, produced interleukin-6 (IL-6), IL-12 and tumour necrosis factor-α upon stimulation with bacterial DNA; however, only IL-6 and IL-12 secretion became induced upon CpG ODN stimulation. We conclude that monocytes, but not B or T cells, represent the prime source of cytokines. Monocytes up-regulated expression of antigen-presenting, major histocompatibility complex class I and class II molecules in response to CpG DNA. In addition, both monocytes and B cells up-regulate costimulatory CD86 and CD40 molecules. The activation by CpG ODN depended on sequence motifs containing the core dinucleotide CG since destruction of the motif strongly reduced immunostimulatory potential. PMID:10457226

  11. CpG methylation increases the DNA binding of 9-aminoacridine carboxamide Pt analogues.

    PubMed

    Kava, Hieronimus W; Murray, Vincent

    2016-10-01

    This study investigated the effect of CpG methylation on the DNA binding of cisplatin analogues with an attached aminoacridine intercalator. DNA-targeted 9-aminoacridine carboxamide Pt complexes are known to bind at 5'-CpG sequences. Their binding to methylated and non-methylated 5'-CpG sequences was determined and compared with cisplatin. The damage profiles of each platinum compound were quantified via a polymerase stop assay with fluorescently labelled primers and capillary electrophoresis. Methylation at 5'-CpG was shown to significantly increase the binding intensity for the 9-aminoacridine carboxamide compounds, whereas no significant increase was found for cisplatin. 5'-CpG methylation had the largest effect on the 9-ethanolamine-acridine carboxamide Pt complex, followed by the 9-aminoacridine carboxamide Pt complex and the 7-fluoro complex. The methylation state of a cell's genome is important in maintaining normal gene expression, and is often aberrantly altered in cancer cells. An analogue of cisplatin which differentially targets methylated DNA may be able to improve its therapeutic activity, or alter its range of targets and evade the chemoresistance which hampers cisplatin efficacy in clinical use. Copyright © 2016 Elsevier Ltd. All rights reserved.

  12. Profiling DNA methylome landscapes of mammalian cells with single-cell reduced-representation bisulfite sequencing.

    PubMed

    Guo, Hongshan; Zhu, Ping; Guo, Fan; Li, Xianlong; Wu, Xinglong; Fan, Xiaoying; Wen, Lu; Tang, Fuchou

    2015-05-01

    The heterogeneity of DNA methylation within a population of cells necessitates DNA methylome profiling at single-cell resolution. Recently, we developed a single-cell reduced-representation bisulfite sequencing (scRRBS) technique in which we modified the original RRBS method by integrating all the experimental steps before PCR amplification into a single-tube reaction. These modifications enable scRRBS to provide digitized methylation information on ∼1 million CpG sites within an individual diploid mouse or human cell at single-base resolution. Compared with the single-cell bisulfite sequencing (scBS) technique, scRRBS covers fewer CpG sites, but it provides better coverage for CpG islands (CGIs), which are likely to be the most informative elements for DNA methylation. The entire procedure takes ∼3 weeks, and it requires strong molecular biology skills.

  13. Sequence-Dependent Diastereospecific and Diastereodivergent Crosslinking of DNA by Decarbamoylmitomycin C.

    PubMed

    Aguilar, William; Paz, Manuel M; Vargas, Anayatzinc; Clement, Cristina C; Cheng, Shu-Yuan; Champeil, Elise

    2018-04-20

    Mitomycin C (MC), a potent antitumor drug, and decarbamoylmitomycin C (DMC), a derivative lacking the carbamoyl group, form highly cytotoxic DNA interstrand crosslinks. The major interstrand crosslink formed by DMC is the C1'' epimer of the major crosslink formed by MC. The molecular basis for the stereochemical configuration exhibited by DMC was investigated using biomimetic synthesis. The formation of DNA-DNA crosslinks by DMC is diastereospecific and diastereodivergent: Only the 1''S-diastereomer of the initially formed monoadduct can form crosslinks at GpC sequences, and only the 1''R-diastereomer of the monoadduct can form crosslinks at CpG sequences. We also show that CpG and GpC sequences react with divergent diastereoselectivity in the first alkylation step: 1"S stereochemistry is favored at GpC sequences and 1''R stereochemistry is favored at CpG sequences. Therefore, the first alkylation step results, at each sequence, in the selective formation of the diastereomer able to generate an interstrand DNA-DNA crosslink after the "second arm" alkylation. Examination of the known DNA adduct pattern obtained after treatment of cancer cell cultures with DMC indicates that the GpC sequence is the major target for the formation of DNA-DNA crosslinks in vivo by this drug. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Developing prehospital clinical practice guidelines for resource limited settings: why re-invent the wheel?

    PubMed

    McCaul, Michael; de Waal, Ben; Hodkinson, Peter; Pigoga, Jennifer L; Young, Taryn; Wallis, Lee A

    2018-02-05

    Methods on developing new (de novo) clinical practice guidelines (CPGs) have received substantial attention. However, the volume of literature is not matched by research into alternative methods of CPG development using existing CPG documents-a specific issue for guideline development groups in low- and middle-income countries. We report on how we developed a context specific prehospital CPG using an alternative guideline development method. Difficulties experienced and lessons learnt in applying existing global guidelines' recommendations to a national context are highlighted. The project produced the first emergency care CPG for prehospital providers in Africa. It included > 270 CPGs and produced over 1000 recommendations for prehospital emergency care. We encountered various difficulties, including (1) applicability issues: few pre-hospital CPGs applicable to Africa, (2) evidence synthesis: heterogeneous levels of evidence classifications and (3) guideline quality. Learning points included (1) focusing on key CPGs and evidence mapping, (2) searching other resources for CPGs, (3) broad representation on CPG advisory boards and (4) transparency and knowledge translation. Re-inventing the wheel to produce CPGs is not always feasible. We hope this paper will encourage further projects to use existing CPGs in developing guidance to improve patient care in resource-limited settings.

  15. Compositional searching of CpG islands in the human genome

    NASA Astrophysics Data System (ADS)

    Luque-Escamilla, Pedro Luis; Martínez-Aroza, José; Oliver, José L.; Gómez-Lopera, Juan Francisco; Román-Roldán, Ramón

    2005-06-01

    We report on an entropic edge detector based on the local calculation of the Jensen-Shannon divergence with application to the search for CpG islands. CpG islands are pieces of the genome related to gene expression and cell differentiation, and thus to cancer formation. Searching for these CpG islands is a major task in genetics and bioinformatics. Some algorithms have been proposed in the literature, based on moving statistics in a sliding window, but its size may greatly influence the results. The local use of Jensen-Shannon divergence is a completely different strategy: the nucleotide composition inside the islands is different from that in their environment, so a statistical distance—the Jensen-Shannon divergence—between the composition of two adjacent windows may be used as a measure of their dissimilarity. Sliding this double window over the entire sequence allows us to segment it compositionally. The fusion of those segments into greater ones that satisfy certain identification criteria must be achieved in order to obtain the definitive results. We find that the local use of Jensen-Shannon divergence is very suitable in processing DNA sequences for searching for compositionally different structures such as CpG islands, as compared to other algorithms in literature.

  16. CpG DNA in the prevention and treatment of infections.

    PubMed

    Dalpke, Alexander; Zimmermann, Stefan; Heeg, Klaus

    2002-01-01

    Microbial infection is sensed by Toll-like receptors (TLRs) on innate immune cells. Among the ten so far defined TLRs, TLR9 and its ligand are peculiar. TLR9 recognises bacterial DNA characterised by the abundance of unmethylated CpG dinucleotides, which distinguish bacterial DNA (CpG DNA) from mammalian DNA. Moreover, TLR9 shows a restricted cellular and subcellular pattern of expression. In contrast to other TLR agonists, CpG DNA is superior in activation of dendritic dells and induction of costimulatory cytokines such as interleukin (IL)-12 and IL-18. This qualifies CpG DNA as a Th1-promoting adjuvant. During infection, recognition of CpG DNA of intracellular pathogens skews and fine-tunes the ongoing immune response and induces long-lasting Th1 milieus. Thus, CpG DNA might play an important role in driving the immune system to a Th1 profile, preventing undesired Th2 milieus that might favour induction of allergic responses. Since CpG DNA can be synthesised with high purity and sequence fidelity, synthetic CpG DNA will become an important agent for Th1 instruction and be an effective adjuvant during vaccination.

  17. Genomic sequencing and in vivo footprinting of an expression-specific DNase I-hypersensitive site of avian vitellogenin II promoter reveal a demethylation of a mCpG and a change in specific interactions of proteins with DNA.

    PubMed Central

    Saluz, H P; Feavers, I M; Jiricny, J; Jost, J P

    1988-01-01

    Genomic sequencing was used to study the in vivo methylation pattern of two CpG sites in the promoter region of the avian vitellogenin gene. The CpG at position +10 was fully methylated in DNA isolated from tissues that do not express the gene but was unmethylated in the liver of mature hens and estradiol-treated roosters. In the latter tissue, this site became demethylated and DNase I hypersensitive after estradiol treatment. A second CpG (position -52) was unmethylated in all tissues examined. In vivo genomic footprinting with dimethyl sulfate revealed different patterns of DNA protection in silent and expressed genes. In rooster liver cells, at least 10 base pairs of DNA, including the methylated CpG, were protected by protein(s). Gel-shift assays indicated that a protein factor, present in rooster liver nuclear extract, bound at this site only when it was methylated. In hen liver cells, the same unmethylated CpG lies within a protected region of approximately equal to 20 base pairs. In vitro DNase I protection and gel-shift assays indicate that this sequence is bound by a protein, which binds both double- and single-stranded DNA. For the latter substrate, this factor was shown to bind solely the noncoding (i.e., mRNA-like) strand. Images PMID:3413118

  18. A simple algorithm for quantifying DNA methylation levels on multiple independent CpG sites in bisulfite genomic sequencing electropherograms.

    PubMed

    Leakey, Tatiana I; Zielinski, Jerzy; Siegfried, Rachel N; Siegel, Eric R; Fan, Chun-Yang; Cooney, Craig A

    2008-06-01

    DNA methylation at cytosines is a widely studied epigenetic modification. Methylation is commonly detected using bisulfite modification of DNA followed by PCR and additional techniques such as restriction digestion or sequencing. These additional techniques are either laborious, require specialized equipment, or are not quantitative. Here we describe a simple algorithm that yields quantitative results from analysis of conventional four-dye-trace sequencing. We call this method Mquant and we compare it with the established laboratory method of combined bisulfite restriction assay (COBRA). This analysis of sequencing electropherograms provides a simple, easily applied method to quantify DNA methylation at specific CpG sites.

  19. Leveraging workflow control patterns in the domain of clinical practice guidelines.

    PubMed

    Kaiser, Katharina; Marcos, Mar

    2016-02-10

    Clinical practice guidelines (CPGs) include recommendations describing appropriate care for the management of patients with a specific clinical condition. A number of representation languages have been developed to support executable CPGs, with associated authoring/editing tools. Even with tool assistance, authoring of CPG models is a labor-intensive task. We aim at facilitating the early stages of CPG modeling task. In this context, we propose to support the authoring of CPG models based on a set of suitable procedural patterns described in an implementation-independent notation that can be then semi-automatically transformed into one of the alternative executable CPG languages. We have started with the workflow control patterns which have been identified in the fields of workflow systems and business process management. We have analyzed the suitability of these patterns by means of a qualitative analysis of CPG texts. Following our analysis we have implemented a selection of workflow patterns in the Asbru and PROforma CPG languages. As implementation-independent notation for the description of patterns we have chosen BPMN 2.0. Finally, we have developed XSLT transformations to convert the BPMN 2.0 version of the patterns into the Asbru and PROforma languages. We showed that although a significant number of workflow control patterns are suitable to describe CPG procedural knowledge, not all of them are applicable in the context of CPGs due to their focus on single-patient care. Moreover, CPGs may require additional patterns not included in the set of workflow control patterns. We also showed that nearly all the CPG-suitable patterns can be conveniently implemented in the Asbru and PROforma languages. Finally, we demonstrated that individual patterns can be semi-automatically transformed from a process specification in BPMN 2.0 to executable implementations in these languages. We propose a pattern and transformation-based approach for the development of CPG models. Such an approach can form the basis of a valid framework for the authoring of CPG models. The identification of adequate patterns and the implementation of transformations to convert patterns from a process specification into different executable implementations are the first necessary steps for our approach.

  20. Influence of Electron–Holes on DNA Sequence-Specific Mutation Rates

    PubMed Central

    Suárez-Villagrán, Martha Y; Azevedo, Ricardo B R; Miller, John H

    2018-01-01

    Abstract Biases in mutation rate can influence molecular evolution, yielding rates of evolution that vary widely in different parts of the genome and even among neighboring nucleotides. Here, we explore one possible mechanism of influence on sequence-specific mutation rates, the electron–hole, which can localize and potentially trigger a replication mismatch. A hole is a mobile site of positive charge created during one-electron oxidation by, for example, radiation, contact with a mutagenic agent, or oxidative stress. Its quantum wavelike properties cause it to localize at various sites with probabilities that vary widely, by orders of magnitude, and depend strongly on the local sequence. We find significant correlations between hole probabilities and mutation rates within base triplets, observed in published mutation accumulation experiments on four species of bacteria. We have also computed hole probability spectra for hypervariable segment I of the human mtDNA control region, which contains several mutational hotspots, and for heptanucleotides in noncoding regions of the human genome, whose polymorphism levels have recently been reported. We observe significant correlations between hole probabilities, and context-specific mutation and substitution rates. The correlation with hole probability cannot be explained entirely by CpG methylation in the heptanucleotide data. Peaks in hole probability tend to coincide with mutational hotspots, even in mtDNA where CpG methylation is rare. Our results suggest that hole-enhanced mutational mechanisms, such as oxidation-stabilized tautomerization and base deamination, contribute to molecular evolution. PMID:29617801

  1. Next-generation sequencing identifies major DNA methylation changes during progression of Ph+ chronic myeloid leukemia

    PubMed Central

    Heller, G; Topakian, T; Altenberger, C; Cerny-Reiterer, S; Herndlhofer, S; Ziegler, B; Datlinger, P; Byrgazov, K; Bock, C; Mannhalter, C; Hörmann, G; Sperr, W R; Lion, T; Zielinski, C C; Valent, P; Zöchbauer-Müller, S

    2016-01-01

    Little is known about the impact of DNA methylation on the evolution/progression of Ph+ chronic myeloid leukemia (CML). We investigated the methylome of CML patients in chronic phase (CP-CML), accelerated phase (AP-CML) and blast crisis (BC-CML) as well as in controls by reduced representation bisulfite sequencing. Although only ~600 differentially methylated CpG sites were identified in samples obtained from CP-CML patients compared with controls, ~6500 differentially methylated CpG sites were found in samples from BC-CML patients. In the majority of affected CpG sites, methylation was increased. In CP-CML patients who progressed to AP-CML/BC-CML, we identified up to 897 genes that were methylated at the time of progression but not at the time of diagnosis. Using RNA-sequencing, we observed downregulated expression of many of these genes in BC-CML compared with CP-CML samples. Several of them are well-known tumor-suppressor genes or regulators of cell proliferation, and gene re-expression was observed by the use of epigenetic active drugs. Together, our results demonstrate that CpG site methylation clearly increases during CML progression and that it may provide a useful basis for revealing new targets of therapy in advanced CML. PMID:27211271

  2. In vitro induction of T regulatory cells by a methylated CpG DNA sequence in humans: Potential therapeutic applications in allergic and autoimmune diseases.

    PubMed

    Lawless, Oliver J; Bellanti, Joseph A; Brown, Milton L; Sandberg, Kathryn; Umans, Jason G; Zhou, Li; Chen, Weiqian; Wang, Julie; Wang, Kan; Zheng, Song Guo

    2018-03-01

    Allergic and autoimmune diseases comprise a group of inflammatory disorders caused by aberrant immune responses in which CD25+ Forkhead box P3-positive (FOXP3+) T regulatory (Treg) cells that normally suppress inflammatory events are often poorly functioning. This has stimulated an intensive investigative effort to find ways of increasing Tregs as a method of therapy for these conditions. One such line of investigation includes the study of how ligation of Toll-like receptors (TLRs) by CpG oligonucleotides (ODN) results in an immunostimulatory cascade that leads to induction of T-helper (Th) type 1 and Treg-type immune responses. The present study investigated the mechanisms by which calf thymus mammalian double-stranded DNA (CT-DNA) and a synthetic methylated DNA CpG ODN sequence suppress in vitro lymphoproliferative responses to antigens, mitogens, and alloantigens when measured by [3H]-thymidine incorporation and promote FoxP3 expression in human CD4+ T cells in the presence of transforming growth factor (TGF) beta and interleukin-2 (IL-2). Lymphoproliferative responses of peripheral blood mononuclear cells from four healthy subjects or nine subjects with systemic lupus erythematosus to CT-DNA or phytohemagglutinin (PHA) was measured by tritiated thymidine ([3H]-TdR) incorporation expressed as a stimulation index. Mechanisms of immunosuppressive effects of CT-DNA were evaluated by measurement of the degree of inhibition to lymphoproliferative responses to streptokinase-streptodornase, phytohemagglutinin (PHA), concanavalin A (Con A), pokeweed mitogen (PWM), or alloantigens by a Con A suppressor assay. The effects of CpG methylation on induction of FoxP3 expression in human T cells were measured by comparing inhibitory responses of synthetic methylated and nonmethylated 8-mer CpG ODN sequences by using cell sorting, in vitro stimulation, and suppressor assay. Here, we showed that CT-DNA and a synthetic methylated DNA 8-mer sequence could suppress antigen-, mitogen-, and alloantigen-induced lymphoproliferation in vitro when measured by [3H]-thymidine. The synthetic methylated DNA CpG ODN but not an unmethylated CpG ODN sequence was shown to promote FoxP3 expression in human CD4+ T cells in the presence of TGF beta and IL-2. The induction of FoxP3+ suppressor cells is dose dependent and offers a potential clinical therapeutic application in allergic and autoimmune and inflammatory diseases. The use of this methylated CpG ODN offers a broad clinical application as a novel therapeutic method for Treg induction and, because of its low cost and small size, should facilitate delivery via nasal, respiratory, gastrointestinal routes, and/or by injection, routes of administration important for vaccine delivery to target sites responsible for respiratory, gastrointestinal, and systemic forms of allergic and autoimmune disease.

  3. Improved Prediction of Non-methylated Islands in Vertebrates Highlights Different Characteristic Sequence Patterns

    PubMed Central

    Vingron, Martin

    2016-01-01

    Non-methylated islands (NMIs) of DNA are genomic regions that are important for gene regulation and development. A recent study of genome-wide non-methylation data in vertebrates by Long et al. (eLife 2013;2:e00348) has shown that many experimentally identified non-methylated regions do not overlap with classically defined CpG islands which are computationally predicted using simple DNA sequence features. This is especially true in cold-blooded vertebrates such as Danio rerio (zebrafish). In order to investigate how predictive DNA sequence is of a region’s methylation status, we applied a supervised learning approach using a spectrum kernel support vector machine, to see if a more complex model and supervised learning can be used to improve non-methylated island prediction and to understand the sequence properties of these regions. We demonstrate that DNA sequence is highly predictive of methylation status, and that in contrast to existing CpG island prediction methods our method is able to provide more useful predictions of NMIs genome-wide in all vertebrate organisms that were studied. Our results also show that in cold-blooded vertebrates (Anolis carolinensis, Xenopus tropicalis and Danio rerio) where genome-wide classical CpG island predictions consist primarily of false positives, longer primarily AT-rich DNA sequence features are able to identify these regions much more accurately. PMID:27984582

  4. H3K4me1 marks DNA regions hypomethylated during aging in human stem and differentiated cells

    PubMed Central

    Fernández, Agustín F.; Bayón, Gustavo F.; Urdinguio, Rocío G.; Toraño, Estela G.; García, María G.; Carella, Antonella; Petrus-Reurer, Sandra; Ferrero, Cecilia; Martinez-Camblor, Pablo; Cubillo, Isabel; García-Castro, Javier; Delgado-Calle, Jesús; Pérez-Campo, Flor M.; Riancho, José A.; Bueno, Clara; Menéndez, Pablo; Mentink, Anouk; Mareschi, Katia; Claire, Fabian; Fagnani, Corrado; Medda, Emanuela; Toccaceli, Virgilia; Brescianini, Sonia; Moran, Sebastián; Esteller, Manel; Stolzing, Alexandra; de Boer, Jan; Nisticò, Lorenza; Stazi, Maria A.

    2015-01-01

    In differentiated cells, aging is associated with hypermethylation of DNA regions enriched in repressive histone post-translational modifications. However, the chromatin marks associated with changes in DNA methylation in adult stem cells during lifetime are still largely unknown. Here, DNA methylation profiling of mesenchymal stem cells (MSCs) obtained from individuals aged 2 to 92 yr identified 18,735 hypermethylated and 45,407 hypomethylated CpG sites associated with aging. As in differentiated cells, hypermethylated sequences were enriched in chromatin repressive marks. Most importantly, hypomethylated CpG sites were strongly enriched in the active chromatin mark H3K4me1 in stem and differentiated cells, suggesting this is a cell type–independent chromatin signature of DNA hypomethylation during aging. Analysis of scedasticity showed that interindividual variability of DNA methylation increased during aging in MSCs and differentiated cells, providing a new avenue for the identification of DNA methylation changes over time. DNA methylation profiling of genetically identical individuals showed that both the tendency of DNA methylation changes and scedasticity depended on nongenetic as well as genetic factors. Our results indicate that the dynamics of DNA methylation during aging depend on a complex mixture of factors that include the DNA sequence, cell type, and chromatin context involved and that, depending on the locus, the changes can be modulated by genetic and/or external factors. PMID:25271306

  5. Newly identified CpG ODNs, M5-30 and M6-395, stimulate mouse immune cells to secrete TNF-alpha and enhance Th1-mediated immunity.

    PubMed

    Choi, Sun-Shim; Chung, Eunkyung; Jung, Yu-Jin

    2010-08-01

    Bacterial CpG motifs are known to induce both innate and adaptive immunity in infected hosts via toll-like receptor 9 (TLR9). Because small oligonucleotides (ODNs) mimicking bacterial CpG motifs are easily synthesized, they have found use as immunomodulatory agents in a number of disease models. We have developed a novel bioinformatics approach to identify effective CpG ODN sequences and evaluate their function as TLR9 ligands in a murine system. Among the CpG ODNs we identified, M5-30 and M6-395 showed significant ability to stimulate TNF-alpha and IFN-gamma production in a mouse macrophage cell line and mouse splenocytes, respectively. We also found that these CpG ODNs activated cells through the canonical NF-kappa B signaling pathway. Moreover, both CpG ODNs were able to induce Th1-mediated immunity in Mycobacterium tuberculosis (Mtb)-infected mice. Our results demonstrate that M5-30 and M6-395 function as TLR9-specific ligands, making them useful in the study of TLR9 functionality and signaling in mice.

  6. Base damage, local sequence context and TP53 mutation hotspots: a molecular dynamics study of benzo[a]pyrene induced DNA distortion and mutability

    PubMed Central

    Menzies, Georgina E.; Reed, Simon H.; Brancale, Andrea; Lewis, Paul D.

    2015-01-01

    The mutational pattern for the TP53 tumour suppressor gene in lung tumours differs to other cancer types by having a higher frequency of G:C>T:A transversions. The aetiology of this differing mutation pattern is still unknown. Benzo[a]pyrene,diol epoxide (BPDE) is a potent cigarette smoke carcinogen that forms guanine adducts at TP53 CpG mutation hotspot sites including codons 157, 158, 245, 248 and 273. We performed molecular modelling of BPDE-adducted TP53 duplex sequences to determine the degree of local distortion caused by adducts which could influence the ability of nucleotide excision repair. We show that BPDE adducted codon 157 has greater structural distortion than other TP53 G:C>T:A hotspot sites and that sequence context more distal to adjacent bases must influence local distortion. Using TP53 trinucleotide mutation signatures for lung cancer in smokers and non-smokers we further show that codons 157 and 273 have the highest mutation probability in smokers. Combining this information with adduct structural data we predict that G:C>T:A mutations at codon 157 in lung tumours of smokers are predominantly caused by BPDE. Our results provide insight into how different DNA sequence contexts show variability in DNA distortion at mutagen adduct sites that could compromise DNA repair at well characterized cancer related mutation hotspots. PMID:26400171

  7. Effect of CpG dinucleotides within IgH switch region repeats on immunoglobulin class switch recombination.

    PubMed

    Zhang, Zheng Z; Hsieh, Chih-Lin; Okitsu, Cindy Yen; Han, Li; Yu, Kefei; Lieber, Michael R

    2015-08-01

    Immunoglobulin (Ig) heavy chains undergo class switch recombination (CSR) to change the heavy chain isotype from IgM to IgG, A or E. The switch regions are several kilobases long, repetitive, and G-rich on the nontemplate strand. They are also relatively depleted of CpG (also called CG) sites for unknown reasons. Here we use synthetic switch regions at the IgH switch alpha (Sα) locus to test the effect of CpG sites and to try to understand why the IgH switch sequences evolved to be relatively depleted of CpG. We find that even just two CpG sites within an 80 bp synthetic switch repeat iterated 15 times (total switch region length of 1200 bp containing 30 CpG sites) are sufficient to dramatically reduce both Ig CSR and transcription through the switch region from the upstream Iα sterile transcript promoter, which is the promoter that directs transcripts through the Sα region. De novo DNA methylation occurs at the four CpG sites in and around the Iα promoter when each 80 bp Iα switch repeat contains the two CpG sites. Thus, a relatively low density of CpG sites within the switch repeats can induce upstream CpG methylation at the IgH alpha locus, and cause a substantial decrease in transcription from the sterile transcript promoter. This effect is likely the reason that switch regions evolved to contain very few CpG sites. We discuss these findings as they relate to DNA methylation and to Ig CSR. Copyright © 2015 Elsevier Ltd. All rights reserved.

  8. A Hybrid Approach for CpG Island Detection in the Human Genome.

    PubMed

    Yang, Cheng-Hong; Lin, Yu-Da; Chiang, Yi-Cheng; Chuang, Li-Yeh

    2016-01-01

    CpG islands have been demonstrated to influence local chromatin structures and simplify the regulation of gene activity. However, the accurate and rapid determination of CpG islands for whole DNA sequences remains experimentally and computationally challenging. A novel procedure is proposed to detect CpG islands by combining clustering technology with the sliding-window method (PSO-based). Clustering technology is used to detect the locations of all possible CpG islands and process the data, thus effectively obviating the need for the extensive and unnecessary processing of DNA fragments, and thus improving the efficiency of sliding-window based particle swarm optimization (PSO) search. This proposed approach, named ClusterPSO, provides versatile and highly-sensitive detection of CpG islands in the human genome. In addition, the detection efficiency of ClusterPSO is compared with eight CpG island detection methods in the human genome. Comparison of the detection efficiency for the CpG islands in human genome, including sensitivity, specificity, accuracy, performance coefficient (PC), and correlation coefficient (CC), ClusterPSO revealed superior detection ability among all of the test methods. Moreover, the combination of clustering technology and PSO method can successfully overcome their respective drawbacks while maintaining their advantages. Thus, clustering technology could be hybridized with the optimization algorithm method to optimize CpG island detection. The prediction accuracy of ClusterPSO was quite high, indicating the combination of CpGcluster and PSO has several advantages over CpGcluster and PSO alone. In addition, ClusterPSO significantly reduced implementation time.

  9. Characterization of DNA-protein interactions using high-throughput sequencing data from pulldown experiments

    NASA Astrophysics Data System (ADS)

    Moreland, Blythe; Oman, Kenji; Curfman, John; Yan, Pearlly; Bundschuh, Ralf

    Methyl-binding domain (MBD) protein pulldown experiments have been a valuable tool in measuring the levels of methylated CpG dinucleotides. Due to the frequent use of this technique, high-throughput sequencing data sets are available that allow a detailed quantitative characterization of the underlying interaction between methylated DNA and MBD proteins. Analyzing such data sets, we first found that two such proteins cannot bind closer to each other than 2 bp, consistent with structural models of the DNA-protein interaction. Second, the large amount of sequencing data allowed us to find rather weak but nevertheless clearly statistically significant sequence preferences for several bases around the required CpG. These results demonstrate that pulldown sequencing is a high-precision tool in characterizing DNA-protein interactions. This material is based upon work supported by the National Science Foundation under Grant No. DMR-1410172.

  10. Allele-Specific, Age-Dependent and BMI-Associated DNA Methylation of Human MCHR1

    PubMed Central

    Stepanow, Stefanie; Reichwald, Kathrin; Huse, Klaus; Gausmann, Ulrike; Nebel, Almut; Rosenstiel, Philip; Wabitsch, Martin; Fischer-Posovszky, Pamela; Platzer, Matthias

    2011-01-01

    Background Melanin-concentrating hormone receptor 1 (MCHR1) plays a significant role in regulation of energy balance, food intake, physical activity and body weight in humans and rodents. Several association studies for human obesity showed contrary results concerning the SNPs rs133072 (G/A) and rs133073 (T/C), which localize to the first exon of MCHR1. The variations constitute two main haplotypes (GT, AC). Both SNPs affect CpG dinucleotides, whereby each haplotype contains a potential methylation site at one of the two SNP positions. In addition, 15 CpGs in close vicinity of these SNPs constitute a weak CpG island. Here, we studied whether DNA methylation in this sequence context may contribute to population- and age-specific effects of MCHR1 alleles in obesity. Principal Findings We analyzed DNA methylation of a 315 bp region of MCHR1 encompassing rs133072 and rs133073 and the CpG island in blood samples of 49 individuals by bisulfite sequencing. The AC haplotype shows a significantly higher methylation level than the GT haplotype. This allele-specific methylation is age-dependent. In young individuals (20–30 years) the difference in DNA methylation between haplotypes is significant; whereas in individuals older than 60 years it is not detectable. Interestingly, the GT allele shows a decrease in methylation status with increasing BMI, whereas the methylation of the AC allele is not associated with this phenotype. Heterozygous lymphoblastoid cell lines show the same pattern of allele-specific DNA methylation. The cell line, which exhibits the highest difference in methylation levels between both haplotypes, also shows allele-specific transcription of MCHR1, which can be abolished by treatment with the DNA methylase inhibitor 5-aza-2′-deoxycytidine. Conclusions We show that DNA methylation at MCHR1 is allele-specific, age-dependent, BMI-associated and affects transcription. Conceivably, this epigenetic regulation contributes to the age- and/or population specific effects reported for MCHR1 in several human obesity studies. PMID:21637341

  11. [The effect of entrapment of CpG sequence with cationic PLG nanoparticles on the immune responses of mice to pig paratyphoid vaccine].

    PubMed

    Wu, Mei; Shi, Ling; Liu, Shigui; Li, Jiangling; Wu, Kaiyuan; Wang, Lihuan; Shen, Yi; Liu, Kun; Zheng, Yong; Zhang, Xinshen; Gao, Rong

    2005-10-01

    Cationic PLG nanoparticles and liposome were prepared and used as package molecules to pack up pUC18-CpG. The effects of the packed pUC18-CpG on the cellular and humoral immune responses were detected in the mice that were inoculated with pig paratyphoid vaccine. The results showed that compared with the control, the amount of IgG and the titre of specific antibody were significantly increased in the sera of mice immunized with the CpG plasmid entrapped by cationic PLG nanoparticles; the proliferation and induced IL-2 bioactivity of lymphocytes were significantly enhanced in the spleen of the immunized mice; the stimulatory effect of cationic PLG nanoparticles was similar to or stronger than that of cationic liposome. These indicated that cationic PLG nanoparticle could be employed as an effective package molecule to promote the immunostimulatory effect of pUC18-CpG.

  12. The evolution of CpG density and lifespan in conserved primate and mammalian promoters

    PubMed Central

    McLain, Adam T.

    2018-01-01

    Gene promoters are evolutionarily conserved across holozoans and enriched in CpG sites, the target for DNA methylation. As animals age, the epigenetic pattern of DNA methylation degrades, with highly methylated CpG sites gradually becoming demethylated while CpG islands increase in methylation. Across vertebrates, aging is a trait that varies among species. We used this variation to determine whether promoter CpG density correlates with species’ maximum lifespan. Human promoter sequences were used to identify conserved regions in 131 mammals and a subset of 28 primate genomes. We identified approximately 1000 gene promoters (5% of the total), that significantly correlated CpG density with lifespan. The correlations were performed via the phylogenetic least squares method to account for trait similarity by common descent using phylogenetic branch lengths. Gene set enrichment analysis revealed no significantly enriched pathways or processes, consistent with the hypothesis that aging is not under positive selection. However, within both mammals and primates, 95% of the promoters showed a positive correlation between increasing CpG density and species lifespan, and two thirds were shared between the primate subset and mammalian datasets. Thus, these genes may require greater buffering capacity against age-related dysregulation of DNA methylation in longer-lived species. PMID:29661983

  13. Performances of Different Fragment Sizes for Reduced Representation Bisulfite Sequencing in Pigs.

    PubMed

    Yuan, Xiao-Long; Zhang, Zhe; Pan, Rong-Yang; Gao, Ning; Deng, Xi; Li, Bin; Zhang, Hao; Sangild, Per Torp; Li, Jia-Qi

    2017-01-01

    Reduced representation bisulfite sequencing (RRBS) has been widely used to profile genome-scale DNA methylation in mammalian genomes. However, the applications and technical performances of RRBS with different fragment sizes have not been systematically reported in pigs, which serve as one of the important biomedical models for humans. The aims of this study were to evaluate capacities of RRBS libraries with different fragment sizes to characterize the porcine genome. We found that the Msp I-digested segments between 40 and 220 bp harbored a high distribution peak at 74 bp, which were highly overlapped with the repetitive elements and might reduce the unique mapping alignment. The RRBS library of 110-220 bp fragment size had the highest unique mapping alignment and the lowest multiple alignment. The cost-effectiveness of the 40-110 bp, 110-220 bp and 40-220 bp fragment sizes might decrease when the dataset size was more than 70, 50 and 110 million reads for these three fragment sizes, respectively. Given a 50-million dataset size, the average sequencing depth of the detected CpG sites in the 110-220 bp fragment size appeared to be deeper than in the 40-110 bp and 40-220 bp fragment sizes, and these detected CpG sties differently located in gene- and CpG island-related regions. In this study, our results demonstrated that selections of fragment sizes could affect the numbers and sequencing depth of detected CpG sites as well as the cost-efficiency. No single solution of RRBS is optimal in all circumstances for investigating genome-scale DNA methylation. This work provides the useful knowledge on designing and executing RRBS for investigating the genome-wide DNA methylation in tissues from pigs.

  14. Critical Points and Traveling Wave in Locomotion: Experimental Evidence and Some Theoretical Considerations.

    PubMed

    Saltiel, Philippe; d'Avella, Andrea; Tresch, Matthew C; Wyler, Kuno; Bizzi, Emilio

    2017-01-01

    The central pattern generator (CPG) architecture for rhythm generation remains partly elusive. We compare cat and frog locomotion results, where the component unrelated to pattern formation appears as a temporal grid, and traveling wave respectively. Frog spinal cord microstimulation with N-methyl-D-Aspartate (NMDA), a CPG activator, produced a limited set of force directions, sometimes tonic, but more often alternating between directions similar to the tonic forces. The tonic forces were topographically organized, and sites evoking rhythms with different force subsets were located close to the constituent tonic force regions. Thus CPGs consist of topographically organized modules. Modularity was also identified as a limited set of muscle synergies whose combinations reconstructed the EMGs. The cat CPG was investigated using proprioceptive inputs during fictive locomotion. Critical points identified both as abrupt transitions in the effect of phasic perturbations, and burst shape transitions, had biomechanical correlates in intact locomotion. During tonic proprioceptive perturbations, discrete shifts between these critical points explained the burst durations changes, and amplitude changes occurred at one of these points. Besides confirming CPG modularity, these results suggest a fixed temporal grid of anchoring points, to shift modules onsets and offsets. Frog locomotion, reconstructed with the NMDA synergies, showed a partially overlapping synergy activation sequence. Using the early synergy output evoked by NMDA at different spinal sites, revealed a rostrocaudal topographic organization, where each synergy is preferentially evoked from a few, albeit overlapping, cord regions. Comparing the locomotor synergy sequence with this topography suggests that a rostrocaudal traveling wave would activate the synergies in the proper sequence for locomotion. This output was reproduced in a two-layer model using this topography and a traveling wave. Together our results suggest two CPG components: modules, i.e., synergies; and temporal patterning, seen as a temporal grid in the cat, and a traveling wave in the frog. Animal and limb navigation have similarities. Research relating grid cells to the theta rhythm and on segmentation during navigation may relate to our temporal grid and traveling wave results. Winfree's mathematical work, combining critical phases and a traveling wave, also appears important. We conclude suggesting tracing, and imaging experiments to investigate our CPG model.

  15. GaussianCpG: a Gaussian model for detection of CpG island in human genome sequences.

    PubMed

    Yu, Ning; Guo, Xuan; Zelikovsky, Alexander; Pan, Yi

    2017-05-24

    As crucial markers in identifying biological elements and processes in mammalian genomes, CpG islands (CGI) play important roles in DNA methylation, gene regulation, epigenetic inheritance, gene mutation, chromosome inactivation and nuclesome retention. The generally accepted criteria of CGI rely on: (a) %G+C content is ≥ 50%, (b) the ratio of the observed CpG content and the expected CpG content is ≥ 0.6, and (c) the general length of CGI is greater than 200 nucleotides. Most existing computational methods for the prediction of CpG island are programmed on these rules. However, many experimentally verified CpG islands deviate from these artificial criteria. Experiments indicate that in many cases %G+C is < 50%, CpG obs /CpG exp varies, and the length of CGI ranges from eight nucleotides to a few thousand of nucleotides. It implies that CGI detection is not just a straightly statistical task and some unrevealed rules probably are hidden. A novel Gaussian model, GaussianCpG, is developed for detection of CpG islands on human genome. We analyze the energy distribution over genomic primary structure for each CpG site and adopt the parameters from statistics of Human genome. The evaluation results show that the new model can predict CpG islands efficiently by balancing both sensitivity and specificity over known human CGI data sets. Compared with other models, GaussianCpG can achieve better performance in CGI detection. Our Gaussian model aims to simplify the complex interaction between nucleotides. The model is computed not by the linear statistical method but by the Gaussian energy distribution and accumulation. The parameters of Gaussian function are not arbitrarily designated but deliberately chosen by optimizing the biological statistics. By using the pseudopotential analysis on CpG islands, the novel model is validated on both the real and artificial data sets.

  16. Extensive sequence-influenced DNA methylation polymorphism in the human genome

    PubMed Central

    2010-01-01

    Background Epigenetic polymorphisms are a potential source of human diversity, but their frequency and relationship to genetic polymorphisms are unclear. DNA methylation, an epigenetic mark that is a covalent modification of the DNA itself, plays an important role in the regulation of gene expression. Most studies of DNA methylation in mammalian cells have focused on CpG methylation present in CpG islands (areas of concentrated CpGs often found near promoters), but there are also interesting patterns of CpG methylation found outside of CpG islands. Results We compared DNA methylation patterns on both alleles between many pairs (and larger groups) of related and unrelated individuals. Direct observation and simulation experiments revealed that around 10% of common single nucleotide polymorphisms (SNPs) reside in regions with differences in the propensity for local DNA methylation between the two alleles. We further showed that for the most common form of SNP, a polymorphism at a CpG dinucleotide, the presence of the CpG at the SNP positively affected local DNA methylation in cis. Conclusions Taken together with the known effect of DNA methylation on mutation rate, our results suggest an interesting interdependence between genetics and epigenetics underlying diversity in the human genome. PMID:20497546

  17. CpG island methylator phenotype in colorectal cancer

    PubMed Central

    Toyota, Minoru; Ahuja, Nita; Ohe-Toyota, Mutsumi; Herman, James G.; Baylin, Stephen B.; Issa, Jean-Pierre J.

    1999-01-01

    Aberrant methylation of promoter region CpG islands is associated with transcriptional inactivation of tumor-suppressor genes in neoplasia. To understand global patterns of CpG island methylation in colorectal cancer, we have used a recently developed technique called methylated CpG island amplification to examine 30 newly cloned differentially methylated DNA sequences. Of these 30 clones, 19 (63%) were progressively methylated in an age-dependent manner in normal colon, 7 (23%) were methylated in a cancer-specific manner, and 4 (13%) were methylated only in cell lines. Thus, a majority of CpG islands methylated in colon cancer are also methylated in a subset of normal colonic cells during the process of aging. In contrast, methylation of the cancer-specific clones was found exclusively in a subset of colorectal cancers, which appear to display a CpG island methylator phenotype (CIMP). CIMP+ tumors also have a high incidence of p16 and THBS1 methylation, and they include the majority of sporadic colorectal cancers with microsatellite instability related to hMLH1 methylation. We thus define a pathway in colorectal cancer that appears to be responsible for the majority of sporadic tumors with mismatch repair deficiency. PMID:10411935

  18. Early demethylation of non-CpG, CpC-rich, elements in the myogenin 5′-flanking region

    PubMed Central

    Fuso, Andrea; Ferraguti, Giampiero; Grandoni, Francesco; Ruggeri, Raffaella; Scarpa, Sigfrido; Strom, Roberto

    2010-01-01

    The dynamic changes and structural patterns of DNA methylation of genes without CpG islands are poorly characterized. The relevance of CpG to the non-CpG methylation equilibrium in transcriptional repression is unknown. In this work, we analyzed the DNA methylation pattern of the 5′-flanking of the myogenin gene, a positive regulator of muscle differentiation with no CpG island and low CpG density, in both C2C12 muscle satellite cells and embryonic muscle. Embryonic brain was studied as a non-expressing tissue. High levels of both CpG and non-CpG methylation were observed in non-expressing experimental conditions. Both CpG and non-CpG methylation rapidly dropped during muscle differentiation and myogenin transcriptional activation with active demethylation dynamics. Non-CpG demethylation occurred more rapidly than CpG demethylation. Demethylation spread from initially highly methylated short CpC-rich elements to a virtually unmethylated status. These short elements have a high CpC content and density, share some motifs and largely coincide with putative recognition sequences of some differentiation-related transcription factors. Our findings point to a dynamically controlled equilibrium between CpG and non-CpG active demethylation in the transcriptional control of tissue-specific genes. The short CpC-rich elements are new structural features of the methylation machinery, whose functions may include priming the complete demethylation of a transcriptionally crucial DNA region. PMID:20935518

  19. A cross-study analysis of prenatal exposures to environmental contaminants and the epigenome: support for stress-responsive transcription factor occupancy as a mediator of gene-specific CpG methylation patterning

    PubMed Central

    Martin, Elizabeth M.; Fry, Rebecca C.

    2016-01-01

    Abstract A biological mechanism by which exposure to environmental contaminants results in gene-specific CpG methylation patterning is currently unknown. We hypothesize that gene-specific CpG methylation is related to environmentally perturbed transcription factor occupancy. To test this hypothesis, a database of 396 genes with altered CpG methylation either in cord blood leukocytes or placental tissue was compiled from 14 studies representing assessments of six environmental contaminants. Subsequently, an in silico approach was used to identify transcription factor binding sites enriched among the genes with altered CpG methylation in relationship to the suite of environmental contaminants. For each study, the sequences of the promoter regions (representing −1000 to +500 bp from the transcription start site) of all genes with altered CpG methylation were analyzed for enrichment of transcription factor binding sites. Binding sites for a total of 56 unique transcription factors were identified to be enriched within the promoter regions of the genes. Binding sites for the Kidney-Enriched Krupple-like Factor 15, a known responder to endogenous stress, were enriched ( P  < 0.001–0.041) among the genes with altered CpG methylation associated for five of the six environmental contaminants. These data support the transcription factor occupancy theory as a potential mechanism underlying environmentally-induced gene-specific CpG methylation. PMID:27066266

  20. Profiling the genome-wide DNA methylation pattern of porcine ovaries using reduced representation bisulfite sequencing.

    PubMed

    Yuan, Xiao-Long; Gao, Ning; Xing, Yan; Zhang, Hai-Bin; Zhang, Ai-Ling; Liu, Jing; He, Jin-Long; Xu, Yuan; Lin, Wen-Mian; Chen, Zan-Mou; Zhang, Hao; Zhang, Zhe; Li, Jia-Qi

    2016-02-25

    Substantial evidence has shown that DNA methylation regulates the initiation of ovarian and sexual maturation. Here, we investigated the genome-wide profile of DNA methylation in porcine ovaries at single-base resolution using reduced representation bisulfite sequencing. The biological variation was minimal among the three ovarian replicates. We found hypermethylation frequently occurred in regions with low gene abundance, while hypomethylation in regions with high gene abundance. The DNA methylation around transcriptional start sites was negatively correlated with their own CpG content. Additionally, the methylation level in the bodies of genes was higher than that in their 5' and 3' flanking regions. The DNA methylation pattern of the low CpG content promoter genes differed obviously from that of the high CpG content promoter genes. The DNA methylation level of the porcine ovary was higher than that of the porcine intestine. Analyses of the genome-wide DNA methylation in porcine ovaries would advance the knowledge and understanding of the porcine ovarian methylome.

  1. H3K4me1 marks DNA regions hypomethylated during aging in human stem and differentiated cells.

    PubMed

    Fernández, Agustín F; Bayón, Gustavo F; Urdinguio, Rocío G; Toraño, Estela G; García, María G; Carella, Antonella; Petrus-Reurer, Sandra; Ferrero, Cecilia; Martinez-Camblor, Pablo; Cubillo, Isabel; García-Castro, Javier; Delgado-Calle, Jesús; Pérez-Campo, Flor M; Riancho, José A; Bueno, Clara; Menéndez, Pablo; Mentink, Anouk; Mareschi, Katia; Claire, Fabian; Fagnani, Corrado; Medda, Emanuela; Toccaceli, Virgilia; Brescianini, Sonia; Moran, Sebastián; Esteller, Manel; Stolzing, Alexandra; de Boer, Jan; Nisticò, Lorenza; Stazi, Maria A; Fraga, Mario F

    2015-01-01

    In differentiated cells, aging is associated with hypermethylation of DNA regions enriched in repressive histone post-translational modifications. However, the chromatin marks associated with changes in DNA methylation in adult stem cells during lifetime are still largely unknown. Here, DNA methylation profiling of mesenchymal stem cells (MSCs) obtained from individuals aged 2 to 92 yr identified 18,735 hypermethylated and 45,407 hypomethylated CpG sites associated with aging. As in differentiated cells, hypermethylated sequences were enriched in chromatin repressive marks. Most importantly, hypomethylated CpG sites were strongly enriched in the active chromatin mark H3K4me1 in stem and differentiated cells, suggesting this is a cell type-independent chromatin signature of DNA hypomethylation during aging. Analysis of scedasticity showed that interindividual variability of DNA methylation increased during aging in MSCs and differentiated cells, providing a new avenue for the identification of DNA methylation changes over time. DNA methylation profiling of genetically identical individuals showed that both the tendency of DNA methylation changes and scedasticity depended on nongenetic as well as genetic factors. Our results indicate that the dynamics of DNA methylation during aging depend on a complex mixture of factors that include the DNA sequence, cell type, and chromatin context involved and that, depending on the locus, the changes can be modulated by genetic and/or external factors. © 2015 Fernández et al.; Published by Cold Spring Harbor Laboratory Press.

  2. Performance of Different Analytical Software Packages in Quantification of DNA Methylation by Pyrosequencing.

    PubMed

    Grasso, Chiara; Trevisan, Morena; Fiano, Valentina; Tarallo, Valentina; De Marco, Laura; Sacerdote, Carlotta; Richiardi, Lorenzo; Merletti, Franco; Gillio-Tos, Anna

    2016-01-01

    Pyrosequencing has emerged as an alternative method of nucleic acid sequencing, well suited for many applications which aim to characterize single nucleotide polymorphisms, mutations, microbial types and CpG methylation in the target DNA. The commercially available pyrosequencing systems can harbor two different types of software which allow analysis in AQ or CpG mode, respectively, both widely employed for DNA methylation analysis. Aim of the study was to assess the performance for DNA methylation analysis at CpG sites of the two pyrosequencing software which allow analysis in AQ or CpG mode, respectively. Despite CpG mode having been specifically generated for CpG methylation quantification, many investigations on this topic have been carried out with AQ mode. As proof of equivalent performance of the two software for this type of analysis is not available, the focus of this paper was to evaluate if the two modes currently used for CpG methylation assessment by pyrosequencing may give overlapping results. We compared the performance of the two software in quantifying DNA methylation in the promoter of selected genes (GSTP1, MGMT, LINE-1) by testing two case series which include DNA from paraffin embedded prostate cancer tissues (PC study, N = 36) and DNA from blood fractions of healthy people (DD study, N = 28), respectively. We found discrepancy in the two pyrosequencing software-based quality assignment of DNA methylation assays. Compared to the software for analysis in the AQ mode, less permissive criteria are supported by the Pyro Q-CpG software, which enables analysis in CpG mode. CpG mode warns the operators about potential unsatisfactory performance of the assay and ensures a more accurate quantitative evaluation of DNA methylation at CpG sites. The implementation of CpG mode is strongly advisable in order to improve the reliability of the methylation analysis results achievable by pyrosequencing.

  3. A High-Throughput Process for the Solid-Phase Purification of Synthetic DNA Sequences

    PubMed Central

    Grajkowski, Andrzej; Cieślak, Jacek; Beaucage, Serge L.

    2017-01-01

    An efficient process for the purification of synthetic phosphorothioate and native DNA sequences is presented. The process is based on the use of an aminopropylated silica gel support functionalized with aminooxyalkyl functions to enable capture of DNA sequences through an oximation reaction with the keto function of a linker conjugated to the 5′-terminus of DNA sequences. Deoxyribonucleoside phosphoramidites carrying this linker, as a 5′-hydroxyl protecting group, have been synthesized for incorporation into DNA sequences during the last coupling step of a standard solid-phase synthesis protocol executed on a controlled pore glass (CPG) support. Solid-phase capture of the nucleobase- and phosphate-deprotected DNA sequences released from the CPG support is demonstrated to proceed near quantitatively. Shorter than full-length DNA sequences are first washed away from the capture support; the solid-phase purified DNA sequences are then released from this support upon reaction with tetra-n-butylammonium fluoride in dry dimethylsulfoxide (DMSO) and precipitated in tetrahydrofuran (THF). The purity of solid-phase-purified DNA sequences exceeds 98%. The simulated high-throughput and scalability features of the solid-phase purification process are demonstrated without sacrificing purity of the DNA sequences. PMID:28628204

  4. Dopamine receptor D4 promoter hypermethylation increases the risk of drug addiction.

    PubMed

    Ji, Huihui; Xu, Xuting; Liu, Guili; Liu, Huifen; Wang, Qinwen; Shen, Wenwen; Li, Longhui; Xie, Xiaohu; Hu, Haochang; Xu, Lei; Zhou, Wenhua; Duan, Shiwei

    2018-02-01

    Heroin and methylamphetamine (METH) are two addictive drugs that cause serious problems for society. Dopamine receptor D4 (DRD4), a key receptor in the dopaminergic system, may facilitate the development of drug addiction. The aim of the present study was to investigate the association between the promoter methylation level of DRD4 gene and drug addiction. Bisulfite pyrosequencing technology was used to measure the methylation levels of DRD4 promoter in 60 drug addicts and 52 matched controls. Significantly higher levels of DRD4 CpG1 and CpG4 methylation were detected in METH and heroin drug addicts compared with controls (P<0.05). Male METH addicts exhibited significantly higher DRD4 CpG1, CpG2 and CpG4 methylation levels compared with sex-matched controls (P<0.05). In heroin addicts, a positive correlation was observed between depression-dejection and DRD4 CpG5 methylation (r=0.537, P=0.039) whereas there was a negative correlation between drug usage frequency and CpG1 methylation (r=-0.632, P=0.011). In METH addicts, methylation levels were not significantly associated with depression-dejection and drug usage frequency. In addition, luciferase assays demonstrated that the target sequence of the DRD4 promoter upregulates gene expression. The results of the present study suggest that DNA methylation of DRD4 may be responsible for the pathophysiology of drug addiction.

  5. Technical adequacy of bisulfite sequencing and pyrosequencing for detection of mitochondrial DNA methylation: Sources and avoidance of false-positive detection.

    PubMed

    Owa, Chie; Poulin, Matthew; Yan, Liying; Shioda, Toshi

    2018-01-01

    The existence of cytosine methylation in mammalian mitochondrial DNA (mtDNA) is a controversial subject. Because detection of DNA methylation depends on resistance of 5'-modified cytosines to bisulfite-catalyzed conversion to uracil, examined parameters that affect technical adequacy of mtDNA methylation analysis. Negative control amplicons (NCAs) devoid of cytosine methylation were amplified to cover the entire human or mouse mtDNA by long-range PCR. When the pyrosequencing template amplicons were gel-purified after bisulfite conversion, bisulfite pyrosequencing of NCAs did not detect significant levels of bisulfite-resistant cytosines (brCs) at ND1 (7 CpG sites) or CYTB (8 CpG sites) genes (CI95 = 0%-0.94%); without gel-purification, significant false-positive brCs were detected from NCAs (CI95 = 4.2%-6.8%). Bisulfite pyrosequencing of highly purified, linearized mtDNA isolated from human iPS cells or mouse liver detected significant brCs (~30%) in human ND1 gene when the sequencing primer was not selective in bisulfite-converted and unconverted templates. However, repeated experiments using a sequencing primer selective in bisulfite-converted templates almost completely (< 0.8%) suppressed brC detection, supporting the false-positive nature of brCs detected using the non-selective primer. Bisulfite-seq deep sequencing of linearized, gel-purified human mtDNA detected 9.4%-14.8% brCs for 9 CpG sites in ND1 gene. However, because all these brCs were associated with adjacent non-CpG brCs showing the same degrees of bisulfite resistance, DNA methylation in this mtDNA-encoded gene was not confirmed. Without linearization, data generated by bisulfite pyrosequencing or deep sequencing of purified mtDNA templates did not pass the quality control criteria. Shotgun bisulfite sequencing of human mtDNA detected extremely low levels of CpG methylation (<0.65%) over non-CpG methylation (<0.55%). Taken together, our study demonstrates that adequacy of mtDNA methylation analysis using methods dependent on bisulfite conversion needs to be established for each experiment, taking effects of incomplete bisulfite conversion and template impurity or topology into consideration.

  6. ampliMethProfiler: a pipeline for the analysis of CpG methylation profiles of targeted deep bisulfite sequenced amplicons.

    PubMed

    Scala, Giovanni; Affinito, Ornella; Palumbo, Domenico; Florio, Ermanno; Monticelli, Antonella; Miele, Gennaro; Chiariotti, Lorenzo; Cocozza, Sergio

    2016-11-25

    CpG sites in an individual molecule may exist in a binary state (methylated or unmethylated) and each individual DNA molecule, containing a certain number of CpGs, is a combination of these states defining an epihaplotype. Classic quantification based approaches to study DNA methylation are intrinsically unable to fully represent the complexity of the underlying methylation substrate. Epihaplotype based approaches, on the other hand, allow methylation profiles of cell populations to be studied at the single molecule level. For such investigations, next-generation sequencing techniques can be used, both for quantitative and for epihaplotype analysis. Currently available tools for methylation analysis lack output formats that explicitly report CpG methylation profiles at the single molecule level and that have suited statistical tools for their interpretation. Here we present ampliMethProfiler, a python-based pipeline for the extraction and statistical epihaplotype analysis of amplicons from targeted deep bisulfite sequencing of multiple DNA regions. ampliMethProfiler tool provides an easy and user friendly way to extract and analyze the epihaplotype composition of reads from targeted bisulfite sequencing experiments. ampliMethProfiler is written in python language and requires a local installation of BLAST and (optionally) QIIME tools. It can be run on Linux and OS X platforms. The software is open source and freely available at http://amplimethprofiler.sourceforge.net .

  7. DNA methylation analysis of phenotype specific stratified Indian population.

    PubMed

    Rotti, Harish; Mallya, Sandeep; Kabekkodu, Shama Prasada; Chakrabarty, Sanjiban; Bhale, Sameer; Bharadwaj, Ramachandra; Bhat, Balakrishna K; Dedge, Amrish P; Dhumal, Vikram Ram; Gangadharan, G G; Gopinath, Puthiya M; Govindaraj, Periyasamy; Joshi, Kalpana S; Kondaiah, Paturu; Nair, Sreekumaran; Nair, S N Venugopalan; Nayak, Jayakrishna; Prasanna, B V; Shintre, Pooja; Sule, Mayura; Thangaraj, Kumarasamy; Patwardhan, Bhushan; Valiathan, Marthanda Varma Sankaran; Satyamoorthy, Kapaettu

    2015-05-08

    DNA methylation and its perturbations are an established attribute to a wide spectrum of phenotypic variations and disease conditions. Indian traditional system practices personalized medicine through indigenous concept of distinctly descriptive physiological, psychological and anatomical features known as prakriti. Here we attempted to establish DNA methylation differences in these three prakriti phenotypes. Following structured and objective measurement of 3416 subjects, whole blood DNA of 147 healthy male individuals belonging to defined prakriti (Vata, Pitta and Kapha) between the age group of 20-30years were subjected to methylated DNA immunoprecipitation (MeDIP) and microarray analysis. After data analysis, prakriti specific signatures were validated through bisulfite DNA sequencing. Differentially methylated regions in CpG islands and shores were significantly enriched in promoters/UTRs and gene body regions. Phenotypes characterized by higher metabolism (Pitta prakriti) in individuals showed distinct promoter (34) and gene body methylation (204), followed by Vata prakriti which correlates to motion showed DNA methylation in 52 promoters and 139 CpG islands and finally individuals with structural attributes (Kapha prakriti) with 23 and 19 promoters and CpG islands respectively. Bisulfite DNA sequencing of prakriti specific multiple CpG sites in promoters and 5'-UTR such as; LHX1 (Vata prakriti), SOX11 (Pitta prakriti) and CDH22 (Kapha prakriti) were validated. Kapha prakriti specific CDH22 5'-UTR CpG methylation was also found to be associated with higher body mass index (BMI). Differential DNA methylation signatures in three distinct prakriti phenotypes demonstrate the epigenetic basis of Indian traditional human classification which may have relevance to personalized medicine.

  8. Unusual Characteristics of the DNA Binding Domain of Epigenetic Regulatory Protein MeCP2 Determine Its Binding Specificity

    PubMed Central

    2015-01-01

    The protein MeCP2 mediates epigenetic regulation by binding methyl-CpG (mCpG) sites on chromatin. MeCP2 consists of six domains of which one, the methyl binding domain (MBD), binds mCpG sites in duplex DNA. We show that solution conditions with physiological or greater salt concentrations or the presence of nonspecific competitor DNA is necessary for the MBD to discriminate mCpG from CpG with high specificity. The specificity for mCpG over CpG is >100-fold under these solution conditions. In contrast, the MBD does not discriminate hydroxymethyl-CpG from CpG. The MBD is unusual among site-specific DNA binding proteins in that (i) specificity is not conferred by the enhanced affinity for the specific site but rather by suppression of its affinity for generic DNA, (ii) its specific binding to mCpG is highly electrostatic, and (iii) it takes up as well as displaces monovalent cations upon DNA binding. The MBD displays an unusually high affinity for single-stranded DNA independent of modification or sequence. In addition, the MBD forms a discrete dimer on DNA via a noncooperative binding pathway. Because the affinity of the second monomer is 1 order of magnitude greater than that of nonspecific binding, the MBD dimer is a unique molecular complex. The significance of these results in the context of neuronal function and development and MeCP2-related developmental disorders such as Rett syndrome is discussed. PMID:24828757

  9. Prediction of CpG-island function: CpG clustering vs. sliding-window methods

    PubMed Central

    2010-01-01

    Background Unmethylated stretches of CpG dinucleotides (CpG islands) are an outstanding property of mammal genomes. Conventionally, these regions are detected by sliding window approaches using %G + C, CpG observed/expected ratio and length thresholds as main parameters. Recently, clustering methods directly detect clusters of CpG dinucleotides as a statistical property of the genome sequence. Results We compare sliding-window to clustering (i.e. CpGcluster) predictions by applying new ways to detect putative functionality of CpG islands. Analyzing the co-localization with several genomic regions as a function of window size vs. statistical significance (p-value), CpGcluster shows a higher overlap with promoter regions and highly conserved elements, at the same time showing less overlap with Alu retrotransposons. The major difference in the prediction was found for short islands (CpG islets), often exclusively predicted by CpGcluster. Many of these islets seem to be functional, as they are unmethylated, highly conserved and/or located within the promoter region. Finally, we show that window-based islands can spuriously overlap several, differentially regulated promoters as well as different methylation domains, which might indicate a wrong merge of several CpG islands into a single, very long island. The shorter CpGcluster islands seem to be much more specific when concerning the overlap with alternative transcription start sites or the detection of homogenous methylation domains. Conclusions The main difference between sliding-window approaches and clustering methods is the length of the predicted islands. Short islands, often differentially methylated, are almost exclusively predicted by CpGcluster. This suggests that CpGcluster may be the algorithm of choice to explore the function of these short, but putatively functional CpG islands. PMID:20500903

  10. Immunostimulatory Properties of Lipid Modified CpG Oligonucleotides.

    PubMed

    Yu, Chunsong; An, Myunggi; Li, Meng; Liu, Haipeng

    2017-08-07

    Innate immune responses recognizing pathogen associated molecular patterns play important roles in adaptive immunity. As such, ligands which mimic the conserved products of microbial and activate innate immunity are widely used as adjuvants for vaccines. Synthetic single strand oligodeoxynucleotides (ODNs) containing unmethylated cytosine-guanine (CpG) motifs which bind Toll-like receptor 9 (TLR9) are powerful molecular adjuvants, potentiating both humoral and cellular responses. However, CpG ODN's in vitro potency has not been translated to in vivo settings primarily due to issues associated with delivery and toxicity. A major challenge in clinical application of CpG ODN is the efficient delivery to lymph nodes, the anatomic sites where all the immune responses are initiated. Targeting CpG to the key antigen presenting cells (APC) is essential for its application as a vaccine adjuvant, as it not only enhances CpG's efficacy, but also greatly reduces the systemic toxicity. We recently discovered an "albumin-hitchhiking" approach by which CpG ODNs were conjugated to a lipophilic lipid tail and follow subcutaneous injection, accumulated in lymph nodes by binding and transporting with endogenous albumin. This molecular approach targets CpG to antigen presenting cells in the draining lymph nodes via an endogenous albumin-mediated mechanism and simultaneously improves both the efficacy and safety of CpG as a vaccine adjuvant. Since CpG ODNs can be divided into structurally distinct classes, and each class of CpG ODN activates different types of immune cells and triggers different types of immunostimulatory activities, it is important to thoroughly evaluate the efficacy of this "albumin-hitchhiking" strategy in each class of CpG. Here we compare the immunostimulatory activities of three classes of lipid conjugated CpG ODNs in vitro and in vivo. Three representative sequences of lipid modified CpG ODNs were synthesized and their stimulatory effects as a vaccine adjuvant were evaluated. Our results showed that in vitro, lipid modified class A CpG exhibited enhanced stimulatory activities toward TLR transfected reporter cells or bone-marrow derived dendritic cells, whereas lipid-modification of class B or C CpG reduces the activation of TLR9 by 2-3 fold, as compared with unmodified class B and class C CpG, respectively. However, in vivo coadministration of ovalbumin (OVA) protein antigen mixed with lipid-conjugated class B or C CpG ODNs, but not class A CpGs induced dramatically increased OVA-specific humoral and cytotoxic CD8 + T cells responses compared with OVA mixed with unmodified CpGs. Further, lipid-modification greatly reduces the toxicity associated with CpG by minimizing the systemic dissemination. Taken together, these results demonstrated that amphiphilic modification of three classes of CpG motifs differentially affected and modulated the immunostimulatory activities in vitro and in vivo. Our study highlights the importance of in vivo lymph node targeting of CpG ODNs in fulfilling their use as vaccine adjuvants, providing implications for the rational design of molecular adjuvant for subunit vaccines.

  11. Immunoregulation of GVHD by triggering the innate immune system with CpG.

    PubMed

    Morecki, Shoshana; Slavin, Shimon

    2009-08-01

    Stimulation of Toll-like receptors by oligodeoxynucleotide sequences containing a CpG motif provides signals capable of triggering the innate and adaptive immune systems, thereby leading either to stimulation or suppression of immunoreactivities. Similar immunoregulatory capabilities are necessary for achieving the fine balance between engraftment and graft-versus-host disease required in the setup of allogeneic cell therapy. Ligation of CpG to its Toll-like receptors can be accomplished by treatment of the host or pretransplant treatment of the donor in vivo. These different strategies are presented in this review, which summarizes the attempts to maximize beneficial alloreactivity against malignant or other undesirable host cells, while controlling graft-versus-host disease.

  12. CpG methylation in human papillomavirus (HPV) type 31 long control region (LCR) in cervical infections associated with cytological abnormalities.

    PubMed

    László, Brigitta; Ferenczi, Annamária; Madar, László; Gyöngyösi, Eszter; Szalmás, Anita; Szakács, Levente; Veress, György; Kónya, József

    2016-08-01

    The mechanisms that regulate papillomavirus gene expression include DNA methylation. The transcription of papillomavirus oncogenes E6 and E7 is controlled by certain regulatory elements in the LCR, which include binding sites for the E2 protein, a viral regulator of oncogene expression. In HPV-31-infected exfoliated cervical cells, the CpG methylation of the entire LCR was determined by next-generation sequencing after bisulfite modification. Six of the 22 cases had methylated CpG sites in the HPV-31 LCR, including position 7479 and/or 7485, at the promoter distal E2 binding site, thus suggesting a potential regulatory mechanism for papillomavirus transcription.

  13. Links between DNA methylation and nucleosome occupancy in the human genome.

    PubMed

    Collings, Clayton K; Anderson, John N

    2017-01-01

    DNA methylation is an epigenetic modification that is enriched in heterochromatin but depleted at active promoters and enhancers. However, the debate on whether or not DNA methylation is a reliable indicator of high nucleosome occupancy has not been settled. For example, the methylation levels of DNA flanking CTCF sites are higher in linker DNA than in nucleosomal DNA, while other studies have shown that the nucleosome core is the preferred site of methylation. In this study, we make progress toward understanding these conflicting phenomena by implementing a bioinformatics approach that combines MNase-seq and NOMe-seq data and by comprehensively profiling DNA methylation and nucleosome occupancy throughout the human genome. The results demonstrated that increasing methylated CpG density is correlated with nucleosome occupancy in the total genome and within nearly all subgenomic regions. Features with elevated methylated CpG density such as exons, SINE-Alu sequences, H3K36-trimethylated peaks, and methylated CpG islands are among the highest nucleosome occupied elements in the genome, while some of the lowest occupancies are displayed by unmethylated CpG islands and unmethylated transcription factor binding sites. Additionally, outside of CpG islands, the density of CpGs within nucleosomes was shown to be important for the nucleosomal location of DNA methylation with low CpG frequencies favoring linker methylation and high CpG frequencies favoring core particle methylation. Prominent exceptions to the correlations between methylated CpG density and nucleosome occupancy include CpG islands marked by H3K27me3 and CpG-poor heterochromatin marked by H3K9me3, and these modifications, along with DNA methylation, distinguish the major silencing mechanisms of the human epigenome. Thus, the relationship between DNA methylation and nucleosome occupancy is influenced by the density of methylated CpG dinucleotides and by other epigenomic components in chromatin.

  14. Comparative Analyses of DNA Methylation and Sequence Evolution Using Nasonia Genomes

    PubMed Central

    Park, Jungsun; Peng, Zuogang; Zeng, Jia; Elango, Navin; Park, Taesung; Wheeler, Dave; Werren, John H.; Yi, Soojin V.

    2011-01-01

    The functional and evolutionary significance of DNA methylation in insect genomes remains to be resolved. Nasonia is well situated for comparative analyses of DNA methylation and genome evolution, since the genomes of a moderately distant outgroup species as well as closely related sibling species are available. Using direct sequencing of bisulfite-converted DNA, we uncovered a substantial level of DNA methylation in 17 of 18 Nasonia vitripennis genes and a strong correlation between methylation level and CpG depletion. Notably, in the sex-determining locus transformer, the exon that is alternatively spliced between the sexes is heavily methylated in both males and females, whereas other exons are only sparsely methylated. Orthologous genes of the honeybee and Nasonia show highly similar relative levels of CpG depletion, despite ∼190 My divergence. Densely and sparsely methylated genes in these species also exhibit similar functional enrichments. We found that the degree of CpG depletion is negatively correlated with substitution rates between closely related Nasonia species for synonymous, nonsynonymous, and intron sites. This suggests that mutation rates increase with decreasing levels of germ line methylation. Thus, DNA methylation is prevalent in the Nasonia genome, may participate in regulatory processes such as sex determination and alternative splicing, and is correlated with several aspects of genome and sequence evolution. PMID:21693438

  15. Mapping the zebrafish brain methylome using reduced representation bisulfite sequencing

    PubMed Central

    Chatterjee, Aniruddha; Ozaki, Yuichi; Stockwell, Peter A; Horsfield, Julia A; Morison, Ian M; Nakagawa, Shinichi

    2013-01-01

    Reduced representation bisulfite sequencing (RRBS) has been used to profile DNA methylation patterns in mammalian genomes such as human, mouse and rat. The methylome of the zebrafish, an important animal model, has not yet been characterized at base-pair resolution using RRBS. Therefore, we evaluated the technique of RRBS in this model organism by generating four single-nucleotide resolution DNA methylomes of adult zebrafish brain. We performed several simulations to show the distribution of fragments and enrichment of CpGs in different in silico reduced representation genomes of zebrafish. Four RRBS brain libraries generated 98 million sequenced reads and had higher frequencies of multiple mapping than equivalent human RRBS libraries. The zebrafish methylome indicates there is higher global DNA methylation in the zebrafish genome compared with its equivalent human methylome. This observation was confirmed by RRBS of zebrafish liver. High coverage CpG dinucleotides are enriched in CpG island shores more than in the CpG island core. We found that 45% of the mapped CpGs reside in gene bodies, and 7% in gene promoters. This analysis provides a roadmap for generating reproducible base-pair level methylomes for zebrafish using RRBS and our results provide the first evidence that RRBS is a suitable technique for global methylation analysis in zebrafish. PMID:23975027

  16. Epigenetic Loss of MLH1 Expression in Normal Human Hematopoietic Stem Cell Clones is Defined by the Promoter CpG Methylation Pattern Observed by High-Throughput Methylation Specific Sequencing

    PubMed Central

    Kenyon, Jonathan; Nickel-Meester, Gabrielle; Qing, Yulan; Santos-Guasch, Gabriela; Drake, Ellen; PingfuFu; Sun, Shuying; Bai, Xiaodong; Wald, David; Arts, Eric; Gerson, Stanton L.

    2016-01-01

    Normal human hematopoietic stem and progenitor cells (HPC) lose expression of MLH1, an important mismatch repair (MMR) pathway gene, with age. Loss of MMR leads to replication dependent mutational events and microsatellite instability observed in secondary acute myelogenous leukemia and other hematologic malignancies. Epigenetic CpG methylation upstream of the MLH1 promoter is a contributing factor to acquired loss of MLH1 expression in tumors of the epithelia and proximal mucosa. Using single molecule high-throughput bisulfite sequencing we have characterized the CpG methylation landscape from −938 to −337 bp upstream of the MLH1 transcriptional start site (position +0), from 30 hematopoietic colony forming cell clones (CFC) either expressing or not expressing MLH1. We identify a correlation between MLH1 promoter methylation and loss of MLH1 expression. Additionally, using the CpG site methylation frequencies obtained in this study we were able to generate a classification algorithm capable of sorting the expressing and non-expressing CFC. Thus, as has been previously described for many tumor cell types, we report for the first time a correlation between the loss of MLH1 expression and increased MLH1 promoter methylation in CFC derived from CD34+ selected hematopoietic stem and progenitor cells. PMID:27570841

  17. Epigenetic Loss of MLH1 Expression in Normal Human Hematopoietic Stem Cell Clones is Defined by the Promoter CpG Methylation Pattern Observed by High-Throughput Methylation Specific Sequencing.

    PubMed

    Kenyon, Jonathan; Nickel-Meester, Gabrielle; Qing, Yulan; Santos-Guasch, Gabriela; Drake, Ellen; PingfuFu; Sun, Shuying; Bai, Xiaodong; Wald, David; Arts, Eric; Gerson, Stanton L

    Normal human hematopoietic stem and progenitor cells (HPC) lose expression of MLH1 , an important mismatch repair (MMR) pathway gene, with age. Loss of MMR leads to replication dependent mutational events and microsatellite instability observed in secondary acute myelogenous leukemia and other hematologic malignancies. Epigenetic CpG methylation upstream of the MLH1 promoter is a contributing factor to acquired loss of MLH1 expression in tumors of the epithelia and proximal mucosa. Using single molecule high-throughput bisulfite sequencing we have characterized the CpG methylation landscape from -938 to -337 bp upstream of the MLH1 transcriptional start site (position +0), from 30 hematopoietic colony forming cell clones (CFC) either expressing or not expressing MLH1 . We identify a correlation between MLH1 promoter methylation and loss of MLH1 expression. Additionally, using the CpG site methylation frequencies obtained in this study we were able to generate a classification algorithm capable of sorting the expressing and non-expressing CFC. Thus, as has been previously described for many tumor cell types, we report for the first time a correlation between the loss of MLH1 expression and increased MLH1 promoter methylation in CFC derived from CD34 + selected hematopoietic stem and progenitor cells.

  18. Construction and characterization of normalized cDNA libraries by 454 pyrosequencing and estimation of DNA methylation levels in three distantly related termite species.

    PubMed

    Hayashi, Yoshinobu; Shigenobu, Shuji; Watanabe, Dai; Toga, Kouhei; Saiki, Ryota; Shimada, Keisuke; Bourguignon, Thomas; Lo, Nathan; Hojo, Masaru; Maekawa, Kiyoto; Miura, Toru

    2013-01-01

    In termites, division of labor among castes, categories of individuals that perform specialized tasks, increases colony-level productivity and is the key to their ecological success. Although molecular studies on caste polymorphism have been performed in termites, we are far from a comprehensive understanding of the molecular basis of this phenomenon. To facilitate future molecular studies, we aimed to construct expressed sequence tag (EST) libraries covering wide ranges of gene repertoires in three representative termite species, Hodotermopsis sjostedti, Reticulitermes speratus and Nasutitermes takasagoensis. We generated normalized cDNA libraries from whole bodies, except for guts containing microbes, of almost all castes, sexes and developmental stages and sequenced them with the 454 GS FLX titanium system. We obtained >1.2 million quality-filtered reads yielding >400 million bases for each of the three species. Isotigs, which are analogous to individual transcripts, and singletons were produced by assembling the reads and annotated using public databases. Genes related to juvenile hormone, which plays crucial roles in caste differentiation of termites, were identified from the EST libraries by BLAST search. To explore the potential for DNA methylation, which plays an important role in caste differentiation of honeybees, tBLASTn searches for DNA methyltransferases (dnmt1, dnmt2 and dnmt3) and methyl-CpG binding domain (mbd) were performed against the EST libraries. All four of these genes were found in the H. sjostedti library, while all except dnmt3 were found in R. speratus and N. takasagoensis. The ratio of the observed to the expected CpG content (CpG O/E), which is a proxy for DNA methylation level, was calculated for the coding sequences predicted from the isotigs and singletons. In all of the three species, the majority of coding sequences showed depletion of CpG O/E (less than 1), and the distributions of CpG O/E were bimodal, suggesting the presence of DNA methylation.

  19. Construction and Characterization of Normalized cDNA Libraries by 454 Pyrosequencing and Estimation of DNA Methylation Levels in Three Distantly Related Termite Species

    PubMed Central

    Hayashi, Yoshinobu; Shigenobu, Shuji; Watanabe, Dai; Toga, Kouhei; Saiki, Ryota; Shimada, Keisuke; Bourguignon, Thomas; Lo, Nathan; Hojo, Masaru; Maekawa, Kiyoto; Miura, Toru

    2013-01-01

    In termites, division of labor among castes, categories of individuals that perform specialized tasks, increases colony-level productivity and is the key to their ecological success. Although molecular studies on caste polymorphism have been performed in termites, we are far from a comprehensive understanding of the molecular basis of this phenomenon. To facilitate future molecular studies, we aimed to construct expressed sequence tag (EST) libraries covering wide ranges of gene repertoires in three representative termite species, Hodotermopsis sjostedti , Reticulitermessperatus and Nasutitermestakasagoensis . We generated normalized cDNA libraries from whole bodies, except for guts containing microbes, of almost all castes, sexes and developmental stages and sequenced them with the 454 GS FLX titanium system. We obtained >1.2 million quality-filtered reads yielding >400 million bases for each of the three species. Isotigs, which are analogous to individual transcripts, and singletons were produced by assembling the reads and annotated using public databases. Genes related to juvenile hormone, which plays crucial roles in caste differentiation of termites, were identified from the EST libraries by BLAST search. To explore the potential for DNA methylation, which plays an important role in caste differentiation of honeybees, tBLASTn searches for DNA methyltransferases (dnmt1, dnmt2 and dnmt3) and methyl-CpG binding domain (mbd) were performed against the EST libraries. All four of these genes were found in the H . sjostedti library, while all except dnmt3 were found in R . speratus and N . takasagoensis . The ratio of the observed to the expected CpG content (CpG O/E), which is a proxy for DNA methylation level, was calculated for the coding sequences predicted from the isotigs and singletons. In all of the three species, the majority of coding sequences showed depletion of CpG O/E (less than 1), and the distributions of CpG O/E were bimodal, suggesting the presence of DNA methylation. PMID:24098800

  20. Combined epigenetic and intraspecific variation of the DRD4 and SERT genes influence novelty seeking behavior in great tit Parus major

    PubMed Central

    Riyahi, Sepand; Sánchez-Delgado, Marta; Calafell, Francesc; Monk, David; Senar, Juan Carlos

    2015-01-01

    DNA methylation is one of the main epigenetic mechanisms that can regulate gene expression and is an important means for creating phenotypic variation. In the present study, we performed methylation profiling of 2 candidate genes for personality traits, namely DRD4 and SERT, in the great tit Parus major to ascertain whether personality traits and behavior within different habitats have evolved with the aid of epigenetic variation. We applied bisulphite PCR and strand-specific sequencing to determine the methylation profile of the CpG dinucleotides in the DRD4 and SERT promoters and also in the CpG island overlapping DRD4 exon 3. Furthermore, we performed pyrosequencing to quantify the total methylation levels at each CpG location. Our results indicated that methylation was ∼1–4% higher in urban than in forest birds, for all loci and tissues analyzed, suggesting that this epigenetic modification is influenced by environmental conditions. Screening of genomic DNA sequence revealed that the SERT promoter is CpG poor region. The methylation at a single CpG dinucleotide located 288 bp from the transcription start site was related to exploration score in urban birds. In addition, the genotypes of the SERT polymorphism SNP234 located within the minimal promoter were significantly correlated with novelty seeking behavior in captivity, with the allele increasing this behavior being more frequent in urban birds. As a conclusion, it seems that both genetic and methylation variability of the SERT gene have an important role in shaping personality traits in great tits, whereas genetic and methylation variation at the DRD4 gene is not strongly involved in behavior and personality traits. PMID:25933062

  1. Bayesian inference supports a location and neighbour-dependent model of DNA methylation propagation at the MGMT gene promoter in lung tumours.

    PubMed

    Bonello, Nicolas; Sampson, James; Burn, John; Wilson, Ian J; McGrown, Gail; Margison, Geoff P; Thorncroft, Mary; Crossbie, Philip; Povey, Andrew C; Santibanez-Koref, Mauro; Walters, Kevin

    2013-11-07

    We exploit model-based Bayesian inference methodologies to analyse lung tumour-derived methylation data from a CpG island in the O6-methylguanine-DNA methyltransferase (MGMT) promoter. Interest is in modelling the changes in methylation patterns in a CpG island in the first exon of the promoter during lung tumour development. We propose four competils of methylation state propagation based on two mechanisms. The first is the location-dependence mechanism in which the probability of a gain or loss of methylation at a CpG within the promoter depends upon its location in the CpG sequence. The second mechanism is that of neighbour-dependence in which gain or loss of methylation at a CpG depends upon the methylation status of the immediately preceding CpG. Our data comprises the methylation status at 12 CpGs near the 5' end of the CpG island in two lung tumour samples for both alleles of a nearby polymorphism. We use approximate Bayesian computation, a computationally intensive rejection-sampling algorithm to infer model parameters and compare models without the need to evaluate the likelihood function. We compare the four proposed models using two criteria: the approximate Bayes factors and the distribution of the Euclidean distance between the summary statistics of the observed and simulated datasets. Our model-based analysis demonstrates compelling evidence for both location and neighbour dependence in the process of aberrant DNA methylation of this MGMT promoter CpG island in lung tumours. We find equivocal evidence to support the hypothesis that the methylation patterns of the two alleles evolve independently. © 2013 Published by Elsevier Ltd. All rights reserved.

  2. Genome-Wide Mutational Signature of the Chemotherapeutic Agent Mitomycin C in Caenorhabditis elegans.

    PubMed

    Tam, Annie S; Chu, Jeffrey S C; Rose, Ann M

    2015-11-12

    Cancer therapy largely depends on chemotherapeutic agents that generate DNA lesions. However, our understanding of the nature of the resulting lesions as well as the mutational profiles of these chemotherapeutic agents is limited. Among these lesions, DNA interstrand crosslinks are among the more toxic types of DNA damage. Here, we have characterized the mutational spectrum of the commonly used DNA interstrand crosslinking agent mitomycin C (MMC). Using a combination of genetic mapping, whole genome sequencing, and genomic analysis, we have identified and confirmed several genomic lesions linked to MMC-induced DNA damage in Caenorhabditis elegans. Our data indicate that MMC predominantly causes deletions, with a 5'-CpG-3' sequence context prevalent in the deleted regions of DNA. Furthermore, we identified microhomology flanking the deletion junctions, indicative of DNA repair via nonhomologous end joining. Based on these results, we propose a general repair mechanism that is likely to be involved in the biological response to this highly toxic agent. In conclusion, the systematic study we have described provides insight into potential sequence specificity of MMC with DNA. Copyright © 2016 Tam et al.

  3. CpG islands: algorithms and applications in methylation studies.

    PubMed

    Zhao, Zhongming; Han, Leng

    2009-05-15

    Methylation occurs frequently at 5'-cytosine of the CpG dinucleotides in vertebrate genomes; however, this epigenetic feature is rarely observed in CpG islands (CGIs) or CpG clusters in the promoter regions of genes. Aberrant methylation of the promoter-associated CGIs might influence gene expression and cause carcinogenesis. Because of the functional importance, multiple algorithms have been available for identifying CGIs in a genome or a sequence. They can be categorized into the traditional algorithms (e.g., Gardiner-Garden and Frommer (1987), Takai and Jones (2002), and CpGPRoD (2002)) or statistical property based algorithms (CpGcluster (2006) and CG cluster (2007)). We reviewed the features of these algorithms and evaluated their performance on identifying functional CGIs using genome-wide methylation data. Moreover, identification of CGIs is an initial step in many recent studies for predicting methylation status as well as in the design of methylation detection platforms. We reviewed the benchmarks and features used in these studies.

  4. DNA methylome profiling identifies novel methylated genes in African American patients with colorectal neoplasia.

    PubMed

    Ashktorab, Hassan; Daremipouran, M; Goel, Ajay; Varma, Sudhir; Leavitt, R; Sun, Xueguang; Brim, Hassan

    2014-04-01

    The identification of genes that are differentially methylated in colorectal cancer (CRC) has potential value for both diagnostic and therapeutic interventions specifically in high-risk populations such as African Americans (AAs). However, DNA methylation patterns in CRC, especially in AAs, have not been systematically explored and remain poorly understood. Here, we performed DNA methylome profiling to identify the methylation status of CpG islands within candidate genes involved in critical pathways important in the initiation and development of CRC. We used reduced representation bisulfite sequencing (RRBS) in colorectal cancer and adenoma tissues that were compared with DNA methylome from a healthy AA subject's colon tissue and peripheral blood DNA. The identified methylation markers were validated in fresh frozen CRC tissues and corresponding normal tissues from AA patients diagnosed with CRC at Howard University Hospital. We identified and validated the methylation status of 355 CpG sites located within 16 gene promoter regions associated with CpG islands. Fifty CpG sites located within CpG islands-in genes ATXN7L1 (2), BMP3 (7), EID3 (15), GAS7 (1), GPR75 (24), and TNFAIP2 (1)-were significantly hypermethylated in tumor vs. normal tissues (P<0.05). The methylation status of BMP3, EID3, GAS7, and GPR75 was confirmed in an independent, validation cohort. Ingenuity pathway analysis mapped three of these markers (GAS7, BMP3 and GPR) in the insulin and TGF-β1 network-the two key pathways in CRC. In addition to hypermethylated genes, our analysis also revealed that LINE-1 repeat elements were progressively hypomethylated in the normal-adenoma-cancer sequence. We conclude that DNA methylome profiling based on RRBS is an effective method for screening aberrantly methylated genes in CRC. While previous studies focused on the limited identification of hypermethylated genes, ours is the first study to systematically and comprehensively identify novel hypermethylated genes, as well as hypomethylated LINE-1 sequences, which may serve as potential biomarkers for CRC in African Americans. Our discovered biomarkers were intimately linked to the insulin/TGF-B1 pathway, further strengthening the association of diabetic disorders with colon oncogenic transformation.

  5. DNA methylation profiles of long- and short-term glioblastoma survivors

    PubMed Central

    Shinawi, Thoraia; Hill, Victoria K.; Krex, Dietmar; Schackert, Gabriele; Gentle, Dean; Morris, Mark R.; Wei, Wenbin; Cruickshank, Garth; Maher, Eamonn R.; Latif, Farida

    2013-01-01

    Glioblastoma (GBM) is the most common and malignant type of primary brain tumor in adults and prognosis of most GBM patients is poor. However, a small percentage of patients show a long term survival of 36 mo or longer after diagnosis. Epigenetic profiles can provide molecular markers for patient prognosis: recently, a G-CIMP positive phenotype associated with IDH1 mutations has been described for GBMs with good prognosis. In the present analysis we performed genome-wide DNA methylation profiling of short-term survivors (STS; overall survival < 1 y) and long-term survivors (LTS; overall survival > 3 y) by utilizing the HumanMethylation450K BeadChips to assess quantitative methylation at > 480,000 CpG sites. Cluster analysis has shown that a subset of LTS showed a G-CIMP positive phenotype that was tightly associated with IDH1 mutation status and was confirmed by analysis of the G-CIMP signature genes. Using high stringency criteria for differential hypermethylation between non-cancer brain and tumor samples, we identified 2,638 hypermethylated CpG loci (890 genes) in STS GBMs, 3,101 hypermethylated CpG loci (1,062 genes) in LTS (wild type IDH1) and 11,293 hypermethylated CpG loci in LTS (mutated for IDH1), reflecting the CIMP positive phenotype. The location of differentially hypermethylated CpG loci with respect to CpG content, neighborhood context and functional genomic distribution was similar in our sample set, with the majority of CpG loci residing in CpG islands and in gene promoters. Our preliminary study also identified a set of CpG loci differentially hypermethylated between STS and LTS cases, including members of the homeobox gene family (HOXD8, HOXD13 and HOXC4), the transcription factors NR2F2 and TFAP2A, and Dickkopf 2, a negative regulator of the wnt/β-catenin signaling pathway. PMID:23291739

  6. Bisulfite-independent analysis of CpG island methylation enables genome-scale stratification of single cells

    PubMed Central

    Han, Lin; Wu, Hua-Jun; Zhu, Haiying; Kim, Kun-Yong; Marjani, Sadie L.; Riester, Markus; Euskirchen, Ghia; Zi, Xiaoyuan; Yang, Jennifer; Han, Jasper; Snyder, Michael; Park, In-Hyun; Irizarry, Rafael; Weissman, Sherman M.

    2017-01-01

    Abstract Conventional DNA bisulfite sequencing has been extended to single cell level, but the coverage consistency is insufficient for parallel comparison. Here we report a novel method for genome-wide CpG island (CGI) methylation sequencing for single cells (scCGI-seq), combining methylation-sensitive restriction enzyme digestion and multiple displacement amplification for selective detection of methylated CGIs. We applied this method to analyzing single cells from two types of hematopoietic cells, K562 and GM12878 and small populations of fibroblasts and induced pluripotent stem cells. The method detected 21 798 CGIs (76% of all CGIs) per cell, and the number of CGIs consistently detected from all 16 profiled single cells was 20 864 (72.7%), with 12 961 promoters covered. This coverage represents a substantial improvement over results obtained using single cell reduced representation bisulfite sequencing, with a 66-fold increase in the fraction of consistently profiled CGIs across individual cells. Single cells of the same type were more similar to each other than to other types, but also displayed epigenetic heterogeneity. The method was further validated by comparing the CpG methylation pattern, methylation profile of CGIs/promoters and repeat regions and 41 classes of known regulatory markers to the ENCODE data. Although not every minor methylation differences between cells are detectable, scCGI-seq provides a solid tool for unsupervised stratification of a heterogeneous cell population. PMID:28126923

  7. Conformational characteristics of dimeric subunits of RNA from energy minimization studies. Mixed sugar-puckered ApG, ApU, CpG, and CpU.

    PubMed

    Thiyagarajan, P; Ponnuswamy, P K

    1981-09-01

    Following the procedure described in the preceding article, the low energy conformations located for the four dimeric subunits of RNA, ApG, ApU, CpG, and CpU are presented. The A-RNA type and Watson-Crick type helical conformations and a number of different kinds of loop promoting ones were identified as low energy in all the units. The 3E-3E and 3E-2E pucker sequences are found to be more or less equally preferred; the 2E-2E sequence is occasionally preferred, while the 2E-3E is highly prohibited in all the units. A conformation similar to the one observed in the drug-dinucleoside monophosphate complex crystals becomes a low energy case only for the CpG unit. The low energy conformations obtained for the four model units were used to assess the stability of the conformational states of the dinucleotide segments in the four crystal models of the tRNAPhe molecule. Information on the occurrence of the less preferred sugar-pucker sequences in the various loop regions in the tRNAPhe molecule has been obtained. A detailed comparison of the conformational characteristics of DNA and RNA subunits at the dimeric level is presented on the basis of the results.

  8. Conformational characteristics of dimeric subunits of RNA from energy minimization studies. Mixed sugar-puckered ApG, ApU, CpG, and CpU.

    PubMed Central

    Thiyagarajan, P; Ponnuswamy, P K

    1981-01-01

    Following the procedure described in the preceding article, the low energy conformations located for the four dimeric subunits of RNA, ApG, ApU, CpG, and CpU are presented. The A-RNA type and Watson-Crick type helical conformations and a number of different kinds of loop promoting ones were identified as low energy in all the units. The 3E-3E and 3E-2E pucker sequences are found to be more or less equally preferred; the 2E-2E sequence is occasionally preferred, while the 2E-3E is highly prohibited in all the units. A conformation similar to the one observed in the drug-dinucleoside monophosphate complex crystals becomes a low energy case only for the CpG unit. The low energy conformations obtained for the four model units were used to assess the stability of the conformational states of the dinucleotide segments in the four crystal models of the tRNAPhe molecule. Information on the occurrence of the less preferred sugar-pucker sequences in the various loop regions in the tRNAPhe molecule has been obtained. A detailed comparison of the conformational characteristics of DNA and RNA subunits at the dimeric level is presented on the basis of the results. PMID:6168312

  9. Murine J774 Macrophages Recognize LPS/IFN-g, Non-CpG DNA or Two-CpG DNA-containing Sequences as Immunologically Distinct

    PubMed Central

    Crosby, Lynn; Casey, Warren; Morgan, Kevin; Ni, Hong; Yoon, Lawrence; Easton, Marilyn; Misukonis, Mary; Burleson, Gary; Ghosh, Dipak K.

    2010-01-01

    Specific bacterial lipopolysaccharides (LPS), IFN-γ, and unmethylated cytosine or guanosine-phosphorothioate containing DNAs (CpG) activate host immunity, influencing infectious responses. Macrophages detect, inactivate and destroy infectious particles, and synthetic CpG sequences invoke similar responses of the innate immune system. Previously, murine macrophage J774 cells treated with CpG induced the expression of nitric oxide synthase 2 (NOS2) and cyclo-oxygenase 2 (COX2) mRNA and protein. In this study murine J774 macrophages were exposed to vehicle, interferon γ + lipopolysaccharide (IFN-g/LPS), non-CpG (SAK1), or two-CpG sequence-containing DNA (SAK2) for 0–18 hr and gene expression changes measured. A large number of immunostimulatory and inflammatory changes were observed. SAK2 was a stronger activator of TNFα- and chemokine expression-related changes than LPS/IFN-g. Up regulation included tumor necrosis factor receptor superfamily genes (TNFRSF’s), IL-1 receptor signaling via stress-activated protein kinase (SAPK), NF-κB activation, hemopoietic maturation factors and sonic hedgehog/wingless integration site (SHH/Wnt) pathway genes. Genes of the TGF-β pathway were down regulated. In contrast, LPS/IFN-g -treated cells showed increased levels for TGF-β signaling genes, which may be linked to the observed up regulation of numerous collagens and down regulation of Wnt pathway genes. SAK1 produced distinct changes from LPS/IFN-g or SAK2. Therefore, J774 macrophages recognize LPS/IFN-g, non-CpG DNA or two-CpG DNA-containing sequences as immunologically distinct. PMID:20097302

  10. An automated graphics tool for comparative genomics: the Coulson plot generator

    PubMed Central

    2013-01-01

    Background Comparative analysis is an essential component to biology. When applied to genomics for example, analysis may require comparisons between the predicted presence and absence of genes in a group of genomes under consideration. Frequently, genes can be grouped into small categories based on functional criteria, for example membership of a multimeric complex, participation in a metabolic or signaling pathway or shared sequence features and/or paralogy. These patterns of retention and loss are highly informative for the prediction of function, and hence possible biological context, and can provide great insights into the evolutionary history of cellular functions. However, representation of such information in a standard spreadsheet is a poor visual means from which to extract patterns within a dataset. Results We devised the Coulson Plot, a new graphical representation that exploits a matrix of pie charts to display comparative genomics data. Each pie is used to describe a complex or process from a separate taxon, and is divided into sectors corresponding to the number of proteins (subunits) in a complex/process. The predicted presence or absence of proteins in each complex are delineated by occupancy of a given sector; this format is visually highly accessible and makes pattern recognition rapid and reliable. A key to the identity of each subunit, plus hierarchical naming of taxa and coloring are included. A java-based application, the Coulson plot generator (CPG) automates graphic production, with a tab or comma-delineated text file as input and generating an editable portable document format or svg file. Conclusions CPG software may be used to rapidly convert spreadsheet data to a graphical matrix pie chart format. The representation essentially retains all of the information from the spreadsheet but presents a graphically rich format making comparisons and identification of patterns significantly clearer. While the Coulson plot format is highly useful in comparative genomics, its original purpose, the software can be used to visualize any dataset where entity occupancy is compared between different classes. Availability CPG software is available at sourceforge http://sourceforge.net/projects/coulson and http://dl.dropbox.com/u/6701906/Web/Sites/Labsite/CPG.html PMID:23621955

  11. DNA methylation Landscape of body size variation in sheep.

    PubMed

    Cao, Jiaxue; Wei, Caihong; Liu, Dongming; Wang, Huihua; Wu, Mingming; Xie, Zhiyuan; Capellini, Terence D; Zhang, Li; Zhao, Fuping; Li, Li; Zhong, Tao; Wang, Linjie; Lu, Jian; Liu, Ruizao; Zhang, Shifang; Du, Yongfei; Zhang, Hongping; Du, Lixin

    2015-10-16

    Sub-populations of Chinese Mongolian sheep exhibit significant variance in body mass. In the present study, we sequenced the whole genome DNA methylation in these breeds to detect whether DNA methylation plays a role in determining the body mass of sheep by Methylated DNA immunoprecipitation - sequencing method. A high quality methylation map of Chinese Mongolian sheep was obtained in this study. We identified 399 different methylated regions located in 93 human orthologs, which were previously reported as body size related genes in human genome-wide association studies. We tested three regions in LTBP1, and DNA methylation of two CpG sites showed significant correlation with its RNA expression. Additionally, a particular set of differentially methylated windows enriched in the "development process" (GO: 0032502) was identified as potential candidates for association with body mass variation. Next, we validated small part of these windows in 5 genes; DNA methylation of SMAD1, TSC1 and AKT1 showed significant difference across breeds, and six CpG were significantly correlated with RNA expression. Interestingly, two CpG sites showed significant correlation with TSC1 protein expression. This study provides a thorough understanding of body size variation in sheep from an epigenetic perspective.

  12. Association of Tissue-Specific DNA Methylation Alterations with α-Thalassemia Southeast Asian Deletion

    PubMed Central

    Pangeson, Tanapat; Sanguansermsri, Phanchana; Sanguansermsri, Torpong; Seeratanachot, Teerapat; Suwanakhon, Narutchala; Srikummool, Metawee; Kaewkong, Worasak; Mahingsa, Khwanruedee

    2017-01-01

    In the wild-type allele, DNA methylation levels of 10 consecutive CpG sites adjacent to the upstream 5′-breakpoint of α-thalassemia Southeast Asian (SEA) deletion are not different between placenta and leukocytes. However, no previous study has reported the map of DNA methylation in the SEA allele. This report aims to show that the SEA mutation is associated with DNA methylation changes, resulting in differential methylation between placenta and leukocytes. Methylation-sensitive high-resolution analysis was used to compare DNA methylation among placenta, leukocytes, and unmethylated control DNA. The result indicates that the DNA methylation between placenta and leukocyte DNA is different and shows that the CpG status of both is not fully unmethylated. Mapping of individual CpG sites was performed by targeted bisulfite sequencing. The DNA methylation level of the 10 consecutive CpG sites was different between placenta and leukocyte DNA. When the 10th CpG of the mutation allele was considered as a hallmark for comparing DNA methylation level, it was totally different from the unmethylated 10th CpG of the wild-type allele. Finally, the distinct DNA methylation patterns between both DNA were extracted. In total, 24 patterns were found in leukocyte samples and 9 patterns were found in placenta samples. This report shows that the large deletion is associated with DNA methylation change. In further studies for clinical application, the distinct DNA methylation pattern might be a potential marker for detecting cell-free fetal DNA. PMID:29162979

  13. [The German program for disease management guidelines: evaluation by use of quality indicators].

    PubMed

    Kopp, Ina B; Geraedts, Max; Jäckel, Wilfried H; Altenhofen, Lutz; Thomeczek, Christian; Ollenschläger, Günter

    2007-08-15

    The Program for National Disease Management Guidelines (German DM-CPG Program) in Germany aims at the implementation of best-practice recommendations for prevention, acute care, rehabilitation and chronic care in the setting of disease management programs and integrated health-care systems. Like other guidelines, DM-CPG need to be assessed regarding their influence on structures, processes and outcomes of care. However, quality assessment in integrated health-care systems is challenging. On the one hand, a multitude of potential domains for measurement, actors and perspectives need to be considered. On the other hand, measures need to be identified that assess the function of the diagnostic and therapeutic chain in terms of cooperation and coordination of care. The article reviews methods and use of quality indicators in the context of the German DM-CPG Program.

  14. High-throughput engineering of a mammalian genome reveals building principles of methylation states at CG rich regions.

    PubMed

    Krebs, Arnaud R; Dessus-Babus, Sophie; Burger, Lukas; Schübeler, Dirk

    2014-09-26

    The majority of mammalian promoters are CpG islands; regions of high CG density that require protection from DNA methylation to be functional. Importantly, how sequence architecture mediates this unmethylated state remains unclear. To address this question in a comprehensive manner, we developed a method to interrogate methylation states of hundreds of sequence variants inserted at the same genomic site in mouse embryonic stem cells. Using this assay, we were able to quantify the contribution of various sequence motifs towards the resulting DNA methylation state. Modeling of this comprehensive dataset revealed that CG density alone is a minor determinant of their unmethylated state. Instead, these data argue for a principal role for transcription factor binding sites, a prediction confirmed by testing synthetic mutant libraries. Taken together, these findings establish the hierarchy between the two cis-encoded mechanisms that define the DNA methylation state and thus the transcriptional competence of CpG islands.

  15. Computational Approaches to Identify Promoters and cis-Regulatory Elements in Plant Genomes1

    PubMed Central

    Rombauts, Stephane; Florquin, Kobe; Lescot, Magali; Marchal, Kathleen; Rouzé, Pierre; Van de Peer, Yves

    2003-01-01

    The identification of promoters and their regulatory elements is one of the major challenges in bioinformatics and integrates comparative, structural, and functional genomics. Many different approaches have been developed to detect conserved motifs in a set of genes that are either coregulated or orthologous. However, although recent approaches seem promising, in general, unambiguous identification of regulatory elements is not straightforward. The delineation of promoters is even harder, due to its complex nature, and in silico promoter prediction is still in its infancy. Here, we review the different approaches that have been developed for identifying promoters and their regulatory elements. We discuss the detection of cis-acting regulatory elements using word-counting or probabilistic methods (so-called “search by signal” methods) and the delineation of promoters by considering both sequence content and structural features (“search by content” methods). As an example of search by content, we explored in greater detail the association of promoters with CpG islands. However, due to differences in sequence content, the parameters used to detect CpG islands in humans and other vertebrates cannot be used for plants. Therefore, a preliminary attempt was made to define parameters that could possibly define CpG and CpNpG islands in Arabidopsis, by exploring the compositional landscape around the transcriptional start site. To this end, a data set of more than 5,000 gene sequences was built, including the promoter region, the 5′-untranslated region, and the first introns and coding exons. Preliminary analysis shows that promoter location based on the detection of potential CpG/CpNpG islands in the Arabidopsis genome is not straightforward. Nevertheless, because the landscape of CpG/CpNpG islands differs considerably between promoters and introns on the one side and exons (whether coding or not) on the other, more sophisticated approaches can probably be developed for the successful detection of “putative” CpG and CpNpG islands in plants. PMID:12857799

  16. Bisulfite-independent analysis of CpG island methylation enables genome-scale stratification of single cells.

    PubMed

    Han, Lin; Wu, Hua-Jun; Zhu, Haiying; Kim, Kun-Yong; Marjani, Sadie L; Riester, Markus; Euskirchen, Ghia; Zi, Xiaoyuan; Yang, Jennifer; Han, Jasper; Snyder, Michael; Park, In-Hyun; Irizarry, Rafael; Weissman, Sherman M; Michor, Franziska; Fan, Rong; Pan, Xinghua

    2017-06-02

    Conventional DNA bisulfite sequencing has been extended to single cell level, but the coverage consistency is insufficient for parallel comparison. Here we report a novel method for genome-wide CpG island (CGI) methylation sequencing for single cells (scCGI-seq), combining methylation-sensitive restriction enzyme digestion and multiple displacement amplification for selective detection of methylated CGIs. We applied this method to analyzing single cells from two types of hematopoietic cells, K562 and GM12878 and small populations of fibroblasts and induced pluripotent stem cells. The method detected 21 798 CGIs (76% of all CGIs) per cell, and the number of CGIs consistently detected from all 16 profiled single cells was 20 864 (72.7%), with 12 961 promoters covered. This coverage represents a substantial improvement over results obtained using single cell reduced representation bisulfite sequencing, with a 66-fold increase in the fraction of consistently profiled CGIs across individual cells. Single cells of the same type were more similar to each other than to other types, but also displayed epigenetic heterogeneity. The method was further validated by comparing the CpG methylation pattern, methylation profile of CGIs/promoters and repeat regions and 41 classes of known regulatory markers to the ENCODE data. Although not every minor methylation differences between cells are detectable, scCGI-seq provides a solid tool for unsupervised stratification of a heterogeneous cell population. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  17. Uracil Accumulation and Mutagenesis Dominated by Cytosine Deamination in CpG Dinucleotides in Mice Lacking UNG and SMUG1

    DOE PAGES

    Alsøe, Lene; Sarno, Antonio; Carracedo, Sergio; ...

    2017-08-03

    Both a DNA lesion and an intermediate for antibody maturation, uracil is primarily processed by base excision repair (BER), either initiated by uracil-DNA glycosylase (UNG) or by single-strand selective monofunctional uracil DNA glycosylase (SMUG1). The relative in vivo contributions of each glycosylase remain elusive. To assess the impact of SMUG1 deficiency, we measured uracil and 5-hydroxymethyluracil, another SMUG1 substrate, in Smug1 -/ - mice. Here, we found that 5-hydroxymethyluracil accumulated in Smug1 -/ - tissues and correlated with 5-hydroxymethylcytosine levels. The highest increase was found in brain, which contained about 26-fold higher genomic 5-hydroxymethyluracil levels than the wild type. Smug1more » -/ - mice did not accumulate uracil in their genome and Ung -/ - mice showed slightly elevated uracil levels. Contrastingly, Ung -/ -Smug1 -/ - mice showed a synergistic increase in uracil levels with up to 25-fold higher uracil levels than wild type. Whole genome sequencing of UNG/SMUG1-deficient tumours revealed that combined UNG and SMUG1 deficiency leads to the accumulation of mutations, primarily C to T transitions within CpG sequences. This unexpected sequence bias suggests that CpG dinucleotides are intrinsically more mutation prone. In conclusion, we showed that SMUG1 efficiently prevent genomic uracil accumulation, even in the presence of UNG, and identified mutational signatures associated with combined UNG and SMUG1 deficiency.« less

  18. Uracil Accumulation and Mutagenesis Dominated by Cytosine Deamination in CpG Dinucleotides in Mice Lacking UNG and SMUG1

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Alsøe, Lene; Sarno, Antonio; Carracedo, Sergio

    Both a DNA lesion and an intermediate for antibody maturation, uracil is primarily processed by base excision repair (BER), either initiated by uracil-DNA glycosylase (UNG) or by single-strand selective monofunctional uracil DNA glycosylase (SMUG1). The relative in vivo contributions of each glycosylase remain elusive. To assess the impact of SMUG1 deficiency, we measured uracil and 5-hydroxymethyluracil, another SMUG1 substrate, in Smug1 -/ - mice. Here, we found that 5-hydroxymethyluracil accumulated in Smug1 -/ - tissues and correlated with 5-hydroxymethylcytosine levels. The highest increase was found in brain, which contained about 26-fold higher genomic 5-hydroxymethyluracil levels than the wild type. Smug1more » -/ - mice did not accumulate uracil in their genome and Ung -/ - mice showed slightly elevated uracil levels. Contrastingly, Ung -/ -Smug1 -/ - mice showed a synergistic increase in uracil levels with up to 25-fold higher uracil levels than wild type. Whole genome sequencing of UNG/SMUG1-deficient tumours revealed that combined UNG and SMUG1 deficiency leads to the accumulation of mutations, primarily C to T transitions within CpG sequences. This unexpected sequence bias suggests that CpG dinucleotides are intrinsically more mutation prone. In conclusion, we showed that SMUG1 efficiently prevent genomic uracil accumulation, even in the presence of UNG, and identified mutational signatures associated with combined UNG and SMUG1 deficiency.« less

  19. Novel Insights on Hantavirus Evolution: The Dichotomy in Evolutionary Pressures Acting on Different Hantavirus Segments.

    PubMed

    Sankar, Sathish; Upadhyay, Mohita; Ramamurthy, Mageshbabu; Vadivel, Kumaran; Sagadevan, Kalaiselvan; Nandagopal, Balaji; Vivekanandan, Perumal; Sridharan, Gopalan

    2015-01-01

    Hantaviruses are important emerging zoonotic pathogens. The current understanding of hantavirus evolution is complicated by the lack of consensus on co-divergence of hantaviruses with their animal hosts. In addition, hantaviruses have long-term associations with their reservoir hosts. Analyzing the relative abundance of dinucleotides may shed new light on hantavirus evolution. We studied the relative abundance of dinucleotides and the evolutionary pressures shaping different hantavirus segments. A total of 118 sequences were analyzed; this includes 51 sequences of the S segment, 43 sequences of the M segment and 23 sequences of the L segment. The relative abundance of dinucleotides, effective codon number (ENC), codon usage biases were analyzed. Standard methods were used to investigate the relative roles of mutational pressure and translational selection on the three hantavirus segments. All three segments of hantaviruses are CpG depleted. Mutational pressure is the predominant evolutionary force leading to CpG depletion among hantaviruses. Interestingly, the S segment of hantaviruses is GpU depleted and in contrast to CpG depletion, the depletion of GpU dinucleotides from the S segment is driven by translational selection. Our findings also suggest that mutational pressure is the primary evolutionary pressure acting on the S and the M segments of hantaviruses. While translational selection plays a key role in shaping the evolution of the L segment. Our findings highlight how different evolutionary pressures may contribute disproportionally to the evolution of the three hantavirus segments. These findings provide new insights on the current understanding of hantavirus evolution. There is a dichotomy among evolutionary pressures shaping a) the relative abundance of different dinucleotides in hantavirus genomes b) the evolution of the three hantavirus segments.

  20. Management of convulsive status epilepticus in children: an adapted clinical practice guideline for pediatricians in Saudi Arabia

    PubMed Central

    Bashiri, Fahad A.; Hamad, Muddathir H.; Amer, Yasser S.; Abouelkheir, Manal M.; Mohamed, Sarar; Kentab, Amal Y.; Salih, Mustafa A.; Nasser, Mohammad N. Al; Al-Eyadhy, Ayman A.; Othman, Mohammed A. Al; Al-Ahmadi, Tahani; Iqbal, Shaikh M.; Somily, Ali M.; Wahabi, Hayfaa A.; Hundallah, Khalid J.; Alwadei, Ali H.; Albaradie, Raidah S.; Al-Twaijri, Waleed A.; Jan, Mohammed M.; Al-Otaibi, Faisal; Alnemri, Abdulrahman M.; Al-Ansary, Lubna A.

    2017-01-01

    Objective: To increase the use of evidence-based approaches in the diagnosis, investigations and treatment of Convulsive Status Epilepticus (CSE) in children in relevant care settings. Method: A Clinical Practice Guideline (CPG) adaptation group was formulated at a university hospital in Riyadh. The group utilized 2 CPG validated tools including the ADAPTE method and the AGREE II instrument. Results: The group adapted 3 main categories of recommendations from one Source CPG. The recommendations cover; (i)first-line treatment of CSE in the community; (ii)treatment of CSE in the hospital; and (iii)refractory CSE. Implementation tools were built to enhance knowledge translation of these recommendations including a clinical algorithm, audit criteria, and a computerized provider order entry. Conclusion: A clinical practice guideline for the Saudi healthcare context was formulated using a guideline adaptation process to support relevant clinicians managing CSE in children. PMID:28416791

  1. Deletion and aberrant CpG island methylation of Caspase 8 gene in medulloblastoma.

    PubMed

    Gonzalez-Gomez, Pilar; Bello, M Josefa; Inda, M Mar; Alonso, M Eva; Arjona, Dolores; Amiñoso, Cinthia; Lopez-Marin, Isabel; de Campos, Jose M; Sarasa, Jose L; Castresana, Javier S; Rey, Juan A

    2004-09-01

    Aberrant methylation of promoter CpG islands in human genes is an alternative genetic inactivation mechanism that contributes to the development of human tumors. Nevertheless, few studies have analyzed methylation in medulloblastomas. We determined the frequency of aberrant CpG island methylation for Caspase 8 (CASP8) in a group of 24 medulloblastomas arising in 8 adult and 16 pediatric patients. Complete methylation of CASP8 was found in 15 tumors (62%) and one case displayed hemimethylation. Three samples amplified neither of the two primer sets for methylated or unmethylated alleles, suggesting that genomic deletion occurred in the 5' flanking region of CASP8. Our findings suggest that methylation commonly contributes to CASP8 silencing in medulloblastomas and that homozygous deletion or severe sequence changes involving the promoter region may be another mechanism leading to CASP8 inactivation in this neoplasm.

  2. Differential methylation of the oxytocin receptor gene in patients with anorexia nervosa: a pilot study.

    PubMed

    Kim, Youl-Ri; Kim, Jeong-Hyun; Kim, Mi Jeong; Treasure, Janet

    2014-01-01

    Recent studies in patients with anorexia nervosa suggest that oxytocin may be involved in the pathophysiology of anorexia nervosa. We examined whether there was evidence of variation in methylation status of the oxytocin receptor (OXTR) gene in patients with anorexia nervosa that might account for these findings. We analyzed the methylation status of the CpG sites in a region from the exon 1 to the MT2 regions of the OXTR gene in buccal cells from 15 patients and 36 healthy women using bisulfite sequencing. We further examined whether methylation status was associated with markers of illness severity or form. We identified six CpG sites with significant differences in average methylation levels between the patient and control groups. Among the six differentially methylated CpG sites, five showed higher than average methylation levels in patients than those in the control group (64.9-88.8% vs. 6.6-45.0%). The methylation levels of these five CpG sites were negatively associated with body mass index (BMI). BMI, eating disorders psychopathology, and anxiety were identified in a regression analysis as factors affecting the methylation levels of these CpG sites with more variation accounted for by BMI. Epigenetic misregulation of the OXTR gene may be implicated in anorexia nervosa, which may either be a mechanism linking environmental adversity to risk or may be a secondary consequence of the illness.

  3. The dynamic DNA methylation landscape of the mutL homolog 1 shore is altered by MLH1-93G>A polymorphism in normal tissues and colorectal cancer.

    PubMed

    Savio, Andrea J; Mrkonjic, Miralem; Lemire, Mathieu; Gallinger, Steven; Knight, Julia A; Bapat, Bharat

    2017-01-01

    Colorectal cancers (CRCs) undergo distinct genetic and epigenetic alterations. Expression of mutL homolog 1 ( MLH1 ), a mismatch repair gene that corrects DNA replication errors, is lost in up to 15% of sporadic tumours due to mutation or, more commonly, due to DNA methylation of its promoter CpG island. A single nucleotide polymorphism (SNP) in the CpG island of MLH1 ( MLH1 -93G>A or rs1800734) is associated with CpG island hypermethylation and decreased MLH1 expression in CRC tumours. Further, in peripheral blood mononuclear cell (PBMC) DNA of both CRC cases and non-cancer controls, the variant allele of rs1800734 is associated with hypomethylation at the MLH1 shore, a region upstream of its CpG island that is less dense in CpG sites . To determine whether this genotype-epigenotype association is present in other tissue types, including colorectal tumours, we assessed DNA methylation in matched normal colorectal tissue, tumour, and PBMC DNA from 349 population-based CRC cases recruited from the Ontario Familial Colorectal Cancer Registry. Using the semi-quantitative real-time PCR-based MethyLight assay, MLH1 shore methylation was significantly higher in tumour tissue than normal colon or PBMCs ( P  < 0.01). When shore methylation levels were stratified by SNP genotype, normal colorectal DNA and PBMC DNA were significantly hypomethylated in association with variant SNP genotype ( P  < 0.05). However, this association was lost in tumour DNA. Among distinct stages of CRC, metastatic stage IV CRC tumours incurred significant hypomethylation compared to stage I-III cases, irrespective of genotype status. Shore methylation of MLH1 was not associated with MSI status or promoter CpG island hypermethylation, regardless of genotype. To confirm these results, bisulfite sequencing was performed in matched tumour and normal colorectal specimens from six CRC cases, including two cases per genotype (wildtype, heterozygous, and homozygous variant). Bisulfite sequencing results corroborated the methylation patterns found by MethyLight, with significant hypomethylation in normal colorectal tissue of variant SNP allele carriers. These results indicate that the normal tissue types tested (colorectum and PBMC) experience dynamic genotype-associated epigenetic alterations at the MLH1 shore, whereas tumour DNA incurs aberrant hypermethylation compared to normal DNA.

  4. Crossovers are associated with mutation and biased gene conversion at recombination hotspots.

    PubMed

    Arbeithuber, Barbara; Betancourt, Andrea J; Ebner, Thomas; Tiemann-Boege, Irene

    2015-02-17

    Meiosis is a potentially important source of germline mutations, as sites of meiotic recombination experience recurrent double-strand breaks (DSBs). However, evidence for a local mutagenic effect of recombination from population sequence data has been equivocal, likely because mutation is only one of several forces shaping sequence variation. By sequencing large numbers of single crossover molecules obtained from human sperm for two recombination hotspots, we find direct evidence that recombination is mutagenic: Crossovers carry more de novo mutations than nonrecombinant DNA molecules analyzed for the same donors and hotspots. The observed mutations were primarily CG to TA transitions, with a higher frequency of transitions at CpG than non-CpGs sites. This enrichment of mutations at CpG sites at hotspots could predominate in methylated regions involving frequent single-stranded DNA processing as part of DSB repair. In addition, our data set provides evidence that GC alleles are preferentially transmitted during crossing over, opposing mutation, and shows that GC-biased gene conversion (gBGC) predominates over mutation in the sequence evolution of hotspots. These findings are consistent with the idea that gBGC could be an adaptation to counteract the mutational load of recombination.

  5. Crossovers are associated with mutation and biased gene conversion at recombination hotspots

    PubMed Central

    Arbeithuber, Barbara; Betancourt, Andrea J.; Ebner, Thomas; Tiemann-Boege, Irene

    2015-01-01

    Meiosis is a potentially important source of germline mutations, as sites of meiotic recombination experience recurrent double-strand breaks (DSBs). However, evidence for a local mutagenic effect of recombination from population sequence data has been equivocal, likely because mutation is only one of several forces shaping sequence variation. By sequencing large numbers of single crossover molecules obtained from human sperm for two recombination hotspots, we find direct evidence that recombination is mutagenic: Crossovers carry more de novo mutations than nonrecombinant DNA molecules analyzed for the same donors and hotspots. The observed mutations were primarily CG to TA transitions, with a higher frequency of transitions at CpG than non-CpGs sites. This enrichment of mutations at CpG sites at hotspots could predominate in methylated regions involving frequent single-stranded DNA processing as part of DSB repair. In addition, our data set provides evidence that GC alleles are preferentially transmitted during crossing over, opposing mutation, and shows that GC-biased gene conversion (gBGC) predominates over mutation in the sequence evolution of hotspots. These findings are consistent with the idea that gBGC could be an adaptation to counteract the mutational load of recombination. PMID:25646453

  6. Draft genome of the red harvester ant Pogonomyrmex barbatus.

    PubMed

    Smith, Chris R; Smith, Christopher D; Robertson, Hugh M; Helmkampf, Martin; Zimin, Aleksey; Yandell, Mark; Holt, Carson; Hu, Hao; Abouheif, Ehab; Benton, Richard; Cash, Elizabeth; Croset, Vincent; Currie, Cameron R; Elhaik, Eran; Elsik, Christine G; Favé, Marie-Julie; Fernandes, Vilaiwan; Gibson, Joshua D; Graur, Dan; Gronenberg, Wulfila; Grubbs, Kirk J; Hagen, Darren E; Viniegra, Ana Sofia Ibarraran; Johnson, Brian R; Johnson, Reed M; Khila, Abderrahman; Kim, Jay W; Mathis, Kaitlyn A; Munoz-Torres, Monica C; Murphy, Marguerite C; Mustard, Julie A; Nakamura, Rin; Niehuis, Oliver; Nigam, Surabhi; Overson, Rick P; Placek, Jennifer E; Rajakumar, Rajendhran; Reese, Justin T; Suen, Garret; Tao, Shu; Torres, Candice W; Tsutsui, Neil D; Viljakainen, Lumi; Wolschin, Florian; Gadau, Jürgen

    2011-04-05

    We report the draft genome sequence of the red harvester ant, Pogonomyrmex barbatus. The genome was sequenced using 454 pyrosequencing, and the current assembly and annotation were completed in less than 1 y. Analyses of conserved gene groups (more than 1,200 manually annotated genes to date) suggest a high-quality assembly and annotation comparable to recently sequenced insect genomes using Sanger sequencing. The red harvester ant is a model for studying reproductive division of labor, phenotypic plasticity, and sociogenomics. Although the genome of P. barbatus is similar to other sequenced hymenopterans (Apis mellifera and Nasonia vitripennis) in GC content and compositional organization, and possesses a complete CpG methylation toolkit, its predicted genomic CpG content differs markedly from the other hymenopterans. Gene networks involved in generating key differences between the queen and worker castes (e.g., wings and ovaries) show signatures of increased methylation and suggest that ants and bees may have independently co-opted the same gene regulatory mechanisms for reproductive division of labor. Gene family expansions (e.g., 344 functional odorant receptors) and pseudogene accumulation in chemoreception and P450 genes compared with A. mellifera and N. vitripennis are consistent with major life-history changes during the adaptive radiation of Pogonomyrmex spp., perhaps in parallel with the development of the North American deserts.

  7. Novel epigenetic determinants of type 2 diabetes in Mexican-American families.

    PubMed

    Kulkarni, Hemant; Kos, Mark Z; Neary, Jennifer; Dyer, Thomas D; Kent, Jack W; Göring, Harald H H; Cole, Shelley A; Comuzzie, Anthony G; Almasy, Laura; Mahaney, Michael C; Curran, Joanne E; Blangero, John; Carless, Melanie A

    2015-09-15

    Although DNA methylation is now recognized as an important mediator of complex diseases, the extent to which the genetic basis of such diseases is accounted for by DNA methylation is unknown. In the setting of large, extended families representing a minority, high-risk population of the USA, we aimed to characterize the role of epigenome-wide DNA methylation in type 2 diabetes (T2D). Using Illumina HumanMethylation450 BeadChip arrays, we tested for association of DNA methylation at 446 356 sites with age, sex and phenotypic traits related to T2D in 850 pedigreed Mexican-American individuals. Robust statistical analyses showed that (i) 15% of the methylome is significantly heritable, with a median heritability of 0.14; (ii) DNA methylation at 14% of CpG sites is associated with nearby sequence variants; (iii) 22% and 3% of the autosomal CpG sites are associated with age and sex, respectively; (iv) 53 CpG sites were significantly associated with liability to T2D, fasting blood glucose and insulin resistance; (v) DNA methylation levels at five CpG sites, mapping to three well-characterized genes (TXNIP, ABCG1 and SAMD12) independently explained 7.8% of the heritability of T2D (vi) methylation at these five sites was unlikely to be influenced by neighboring DNA sequence variation. Our study has identified novel epigenetic indicators of T2D risk in Mexican Americans who have increased risk for this disease. These results provide new insights into potential treatment targets of T2D. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  8. Three SRA-Domain Methylcytosine-Binding Proteins Cooperate to Maintain Global CpG Methylation and Epigenetic Silencing in Arabidopsis

    PubMed Central

    Woo, Hye Ryun; Dittmer, Travis A.; Richards, Eric J.

    2008-01-01

    Methylcytosine-binding proteins decipher the epigenetic information encoded by DNA methylation and provide a link between DNA methylation, modification of chromatin structure, and gene silencing. VARIANT IN METHYLATION 1 (VIM1) encodes an SRA (SET- and RING-associated) domain methylcytosine-binding protein in Arabidopsis thaliana, and loss of VIM1 function causes centromere DNA hypomethylation and centromeric heterochromatin decondensation in interphase. In the Arabidopsis genome, there are five VIM genes that share very high sequence similarity and encode proteins containing a PHD domain, two RING domains, and an SRA domain. To gain further insight into the function and potential redundancy among the VIM proteins, we investigated strains combining different vim mutations and transgenic vim knock-down lines that down-regulate multiple VIM family genes. The vim1 vim3 double mutant and the transgenic vim knock-down lines showed decreased DNA methylation primarily at CpG sites in genic regions, as well as repeated sequences in heterochromatic regions. In addition, transcriptional silencing was released in these plants at most heterochromatin regions examined. Interestingly, the vim1 vim3 mutant and vim knock-down lines gained ectopic CpHpH methylation in the 5S rRNA genes against a background of CpG hypomethylation. The vim1 vim2 vim3 triple mutant displayed abnormal morphological phenotypes including late flowering, which is associated with DNA hypomethylation of the 5′ region of FWA and release of FWA gene silencing. Our findings demonstrate that VIM1, VIM2, and VIM3 have overlapping functions in maintenance of global CpG methylation and epigenetic transcriptional silencing. PMID:18704160

  9. Primary care clinical practice guidelines in South Africa: qualitative study exploring perspectives of national stakeholders.

    PubMed

    Kredo, Tamara; Abrams, Amber; Young, Taryn; Louw, Quinette; Volmink, Jimmy; Daniels, Karen

    2017-08-29

    Clinical practice guidelines (CPGs) are common tools in policy and clinical practice informing clinical decisions at the bedside, governance of health facilities, health insurer and government spending, and patient choices. South Africa's health sector is transitioning to a national health insurance system, aiming to build on other primary health care initiatives to transform the previously segregated, inequitable services. Within these plans CPGs are an integral tool for delivering standardised and cost effective care. Currently, there is no accepted standard approach to developing, adapting or implementing CPGs efficiently or effectively in South Africa. We explored the current players; drivers; and the context and processes of primary care CPG development from the perspective of stakeholders operating at national level. We used a qualitative approach. Sampling was initially purposeful, followed by snowballing and further sampling to reach representivity of primary care service providers. Individual in-depth interviews were recorded and transcribed verbatim. We used thematic content analysis to analyse the data. We conducted 37 in-depth interviews from June 2014-July 2015. We found CPG development and implementation were hampered by lack of human and funding resources for technical and methodological work; fragmentation between groups, and between national and provincial health sectors; and lack of agreed systems for CPG development and implementation. Some CPG contributors steadfastly work to improve processes aiming to enhance communication, use of evidence, and transparency to ensure credible guidance is produced. Many interviewed had shared values, and were driven to address inequity, however, resource gaps were perceived to create an enabling environment for commercial interests or personal agendas to drive the CPG development process. Our findings identified strengths and gaps in CPG development processes, and a need for national standards to guide CPG development and implementation. Based on our findings and suggestions from participants, a possible way forward would be for South Africa to have a centrally coordinated CPG unit to address these needs and aspects of fragmentation by devising processes that support collaboration, transparency and credibility across sectors and disciplines. Such an initiative will require adequate resourcing to build capacity and ensure support for the delivery of high quality CPGs for South African primary care.

  10. Experimental murine myopia induces collagen type Iα1 (COL1A1) DNA methylation and altered COL1A1 messenger RNA expression in sclera

    PubMed Central

    Zhou, Xiangtian; Ji, Fengtao; An, Jianhong; Zhao, Fuxin; Shi, Fanjun; Huang, Furong; Li, Yuan; Jiao, Shiming; Yan, Dongsheng; Chen, Xiaoyan; Chen, JiangFan

    2012-01-01

    Purpose To investigate whether myopia development is associated with changes of scleral DNA methylation in cytosine-phosphate-guanine (CpG) sites in the collagen 1A1 (COL1A1) promoter and messenger RNA (mRNA) levels following murine form deprivation myopia. Methods Fifty-seven C57BL/6 mice (postnatal day 23) were randomly assigned to four groups: (1) monocular form deprivation (MD) in which a diffuser lens was placed over one eye for 28 days; (2) normal controls without MD; (3) MD recovery in which the diffuser lens was removed for seven days; and (4) MD recovery normal controls. The DNA methylation pattern in COL1A1 promoter and exon 1 was determined by bisulfite DNA sequencing, and the COL1A1 mRNA level in sclera was determined by quantitative PCR. Results MD was found to induce myopia in the treated eyes. Six CpG sites in the promoter and exon 1 region of COL1A1 were methylated with significantly higher frequency in the treated eyes than normal control eyes (p<0.05), with CpG island methylation in MD-contralateral eyes being intermediate. Consistent with the CpG methylation, scleral COL1A1 mRNA was reduced by 57% in the MD-treated eyes compared to normal controls (p<0.05). After seven days of MD recovery, CpG methylation was significantly reduced (p=0.01). The methylation patterns returned to near normal level in five CpG sites, but the sixth was hypomethylated compared to normal controls. Conclusions In parallel with the development of myopia and the reduced COL1A1 mRNA, the frequency of methylation in CpG sites of the COL1A1 promoter/exon 1 increased during MD and returned to near normal during recovery. Thus, hypermethylation of CpG sites in the promoter/exon 1 of COL1A1 may underlie reduced collagen synthesis at the transcriptional level in myopic scleras. PMID:22690110

  11. Methylated site display (MSD)-AFLP, a sensitive and affordable method for analysis of CpG methylation profiles.

    PubMed

    Aiba, Toshiki; Saito, Toshiyuki; Hayashi, Akiko; Sato, Shinji; Yunokawa, Harunobu; Maruyama, Toru; Fujibuchi, Wataru; Kurita, Hisaka; Tohyama, Chiharu; Ohsako, Seiichiroh

    2017-03-09

    It has been pointed out that environmental factors or chemicals can cause diseases that are developmental in origin. To detect abnormal epigenetic alterations in DNA methylation, convenient and cost-effective methods are required for such research, in which multiple samples are processed simultaneously. We here present methylated site display (MSD), a unique technique for the preparation of DNA libraries. By combining it with amplified fragment length polymorphism (AFLP) analysis, we developed a new method, MSD-AFLP. Methylated site display libraries consist of only DNAs derived from DNA fragments that are CpG methylated at the 5' end in the original genomic DNA sample. To test the effectiveness of this method, CpG methylation levels in liver, kidney, and hippocampal tissues of mice were compared to examine if MSD-AFLP can detect subtle differences in the levels of tissue-specific differentially methylated CpGs. As a result, many CpG sites suspected to be tissue-specific differentially methylated were detected. Nucleotide sequences adjacent to these methyl-CpG sites were identified and we determined the methylation level by methylation-sensitive restriction endonuclease (MSRE)-PCR analysis to confirm the accuracy of AFLP analysis. The differences of the methylation level among tissues were almost identical among these methods. By MSD-AFLP analysis, we detected many CpGs showing less than 5% statistically significant tissue-specific difference and less than 10% degree of variability. Additionally, MSD-AFLP analysis could be used to identify CpG methylation sites in other organisms including humans. MSD-AFLP analysis can potentially be used to measure slight changes in CpG methylation level. Regarding the remarkable precision, sensitivity, and throughput of MSD-AFLP analysis studies, this method will be advantageous in a variety of epigenetics-based research.

  12. PISMA: A Visual Representation of Motif Distribution in DNA Sequences.

    PubMed

    Alcántara-Silva, Rogelio; Alvarado-Hermida, Moisés; Díaz-Contreras, Gibrán; Sánchez-Barrios, Martha; Carrera, Samantha; Galván, Silvia Carolina

    2017-01-01

    Because the graphical presentation and analysis of motif distribution can provide insights for experimental hypothesis, PISMA aims at identifying motifs on DNA sequences, counting and showing them graphically. The motif length ranges from 2 to 10 bases, and the DNA sequences range up to 10 kb. The motif distribution is shown as a bar-code-like, as a gene-map-like, and as a transcript scheme. We obtained graphical schemes of the CpG site distribution from 91 human papillomavirus genomes. Also, we present 2 analyses: one of DNA motifs associated with either methylation-resistant or methylation-sensitive CpG islands and another analysis of motifs associated with exosome RNA secretion. PISMA is developed in Java; it is executable in any type of hardware and in diverse operating systems. PISMA is freely available to noncommercial users. The English version and the User Manual are provided in Supplementary Files 1 and 2, and a Spanish version is available at www.biomedicas.unam.mx/wp-content/software/pisma.zip and www.biomedicas.unam.mx/wp-content/pdf/manual/pisma.pdf.

  13. PISMA: A Visual Representation of Motif Distribution in DNA Sequences

    PubMed Central

    Alcántara-Silva, Rogelio; Alvarado-Hermida, Moisés; Díaz-Contreras, Gibrán; Sánchez-Barrios, Martha; Carrera, Samantha; Galván, Silvia Carolina

    2017-01-01

    Background: Because the graphical presentation and analysis of motif distribution can provide insights for experimental hypothesis, PISMA aims at identifying motifs on DNA sequences, counting and showing them graphically. The motif length ranges from 2 to 10 bases, and the DNA sequences range up to 10 kb. The motif distribution is shown as a bar-code–like, as a gene-map–like, and as a transcript scheme. Results: We obtained graphical schemes of the CpG site distribution from 91 human papillomavirus genomes. Also, we present 2 analyses: one of DNA motifs associated with either methylation-resistant or methylation-sensitive CpG islands and another analysis of motifs associated with exosome RNA secretion. Availability and Implementation: PISMA is developed in Java; it is executable in any type of hardware and in diverse operating systems. PISMA is freely available to noncommercial users. The English version and the User Manual are provided in Supplementary Files 1 and 2, and a Spanish version is available at www.biomedicas.unam.mx/wp-content/software/pisma.zip and www.biomedicas.unam.mx/wp-content/pdf/manual/pisma.pdf. PMID:28469418

  14. Combined study of genetic and epigenetic biomarker risperidone treatment efficacy in Chinese Han schizophrenia patients

    PubMed Central

    Shi, Y; Li, M; Song, C; Xu, Q; Huo, R; Shen, L; Xing, Q; Cui, D; Li, W; Zhao, J; He, L; Qin, S

    2017-01-01

    Nowadays, risperidone is an atypical antipsychotic drug that has been increasingly used for treatment and maintenance therapy in schizophrenia. However, partially affected by genetic or environmental factors, there is significant difference in treatment outcomes among patients. In this study, we aimed to interpret the difference between good and poor responders treated with risperidone in both genetic and epigenetic levels in 288 mainland Chinese patients. We recruited a Henan cohort including 98 patients as initial discovery group and then confirmed our results in Shanghai cohort. In genetic studies, we found 10 candidate single-nucleotide polymorphisms (SNPs) and 2 rare variants in Henan cohort by next-generation sequencing of 100 risperidone-response-related genes. After replication in Shanghai cohort by massarray platform, ultimately, rs6706232 and rs4818 were significantly associated with risperidone response in the two cohort meta-analysis (P=0.024 and 0.04, respectively). Besides, we also selected another reported 17 candidate SNPs associated with risperidone drug response to replicate in our mainland Chinese samples, while, we found no significant SNPs after Bonferroni correction. In epigenetic studies, we investigated the methylation status in promoters or gene-coding region of risperidone drug response-related genes including CYP3A4, CYP2D6, ABCB1, HTR2A, DRD2. Totally we found seven significant CpG sites in the meta-analysis with Bonferroni-corrected PCYP3A4_CpG_-36=0.0014, PCYP3A4_CpG_-258=0.0013, PCYP3A4_CpG_-296=0.0014, PCYP3A4_CpG_-367:-372:-374=0.028, PCYP2D6_CpG_193=0.012, PCYP2D6_CpG_242:244:250=0.00076 and PCYP2D6_CpG_284=0.034, respectively. As genetic and epigenetic factors may interactively affect drug response, we finally carried out a multivariant interaction analysis with multifactor dimensionality reduction and discovered a significant four-locus model (CYP3A4_CpG_-82:-86 +rs6280+rs1800497+rs6265, P=0.038) affecting drug response. These findings could partially explain different risperidone response outcome in Chinese population in a systematic level. PMID:28696411

  15. Realising the Promise of Cancer Predisposition Genes

    PubMed Central

    Rahman, Nazneen

    2016-01-01

    Genes in which germline mutations confer high or moderate increased risks of cancer are called cancer predisposition genes (CPG). Over 100 CPGs have been identified providing important scientific insights in many areas, particularly mechanisms of cancer causation. Moreover, clinical utilisation of CPGs has had substantial impact in diagnosis, optimised management and prevention of cancer. The recent transformative advances in DNA sequencing bring the promise of many more CPG discoveries and greater, broader clinical applications. However, there is also considerable potential for incorrect inferences and inappropriate clinical applications. Realising the promise of cancer predisposition genes for science and medicine will thus require careful navigation. PMID:24429628

  16. Gaining insight into the Clinical Practice Guideline development processes: qualitative study in a workshop to implement the GRADE proposal in Spain

    PubMed Central

    Calderón, Carlos; Rotaeche, Rafael; Etxebarria, Arritxu; Marzo, Mercé; Rico, Rosa; Barandiaran, Marta

    2006-01-01

    Background The GRADE method represents a new approach to grading the quality of evidence and strength of recommendations in the preparation of Clinical Practice Guidelines (CPG). In the context of a pilot study to assess the implementability of the system in Spain, we considered it relevant to gain an insight into the significance of the perceptions and attitudes expressed by the actual experts participating in the system try-out. Methods Qualitative research with an ethnographic approach, through non-participant observation and focus groups within the context of a consensus workshop in which 19 CPG experts participated to evaluate the GRADE proposal using 12 evidence tables taken from hypertension, asthma and arthritis CPGs. The interventions were recorded, under a guarantee of confidentiality. The transcriptions and field notes were analyzed, based on a sociological discourse analysis model, and the provisional findings were re-sent to participants in order to improve their validity. Results 1) Certain problems over procedure and terminology hindered the acceptance of this new method as a common reference system for the preparation of CPGs. 2). A greater closeness to clinical practice was accompanied by concerns over value judgments and subjectivity, with a demand for greater explicitness in the consensus process. 3). The type of "evidence" on which the guidelines are based, how and by whom the evidence is prepared, and what the role of the different actors should be, all constitute unresolved concerns in the CPG preparation and implementation processes. 4). The grading process is not neutral: professional background, prior experience and the degree of leadership all condition the participants' input and interactions. Conclusion The findings obtained allow the quantitative evaluation to be better interpreted and, in turn, go beyond the particularities of the GRADE method. Adaptation to the complexities of clinical practice, the need for carefully designed multi-disciplinary work and the reflexivity present in the CPG preparation process, all represent lines of debate that are necessary to improve the CPG quality in the Spanish health care sector. PMID:17059600

  17. iMETHYL: an integrative database of human DNA methylation, gene expression, and genomic variation.

    PubMed

    Komaki, Shohei; Shiwa, Yuh; Furukawa, Ryohei; Hachiya, Tsuyoshi; Ohmomo, Hideki; Otomo, Ryo; Satoh, Mamoru; Hitomi, Jiro; Sobue, Kenji; Sasaki, Makoto; Shimizu, Atsushi

    2018-01-01

    We launched an integrative multi-omics database, iMETHYL (http://imethyl.iwate-megabank.org). iMETHYL provides whole-DNA methylation (~24 million autosomal CpG sites), whole-genome (~9 million single-nucleotide variants), and whole-transcriptome (>14 000 genes) data for CD4 + T-lymphocytes, monocytes, and neutrophils collected from approximately 100 subjects. These data were obtained from whole-genome bisulfite sequencing, whole-genome sequencing, and whole-transcriptome sequencing, making iMETHYL a comprehensive database.

  18. The Control Region of Mitochondrial DNA Shows an Unusual CpG and Non-CpG Methylation Pattern

    PubMed Central

    Bellizzi, Dina; D'Aquila, Patrizia; Scafone, Teresa; Giordano, Marco; Riso, Vincenzo; Riccio, Andrea; Passarino, Giuseppe

    2013-01-01

    DNA methylation is a common epigenetic modification of the mammalian genome. Conflicting data regarding the possible presence of methylated cytosines within mitochondrial DNA (mtDNA) have been reported. To clarify this point, we analysed the methylation status of mtDNA control region (D-loop) on human and murine DNA samples from blood and cultured cells by bisulphite sequencing and methylated/hydroxymethylated DNA immunoprecipitation assays. We found methylated and hydroxymethylated cytosines in the L-strand of all samples analysed. MtDNA methylation particularly occurs within non-C-phosphate-G (non-CpG) nucleotides, mainly in the promoter region of the heavy strand and in conserved sequence blocks, suggesting its involvement in regulating mtDNA replication and/or transcription. We observed DNA methyltransferases within the mitochondria, but the inactivation of Dnmt1, Dnmt3a, and Dnmt3b in mouse embryonic stem (ES) cells results in a reduction of the CpG methylation, while the non-CpG methylation shows to be not affected. This suggests that D-loop epigenetic modification is only partially established by these enzymes. Our data show that DNA methylation occurs in the mtDNA control region of mammals, not only at symmetrical CpG dinucleotides, typical of nuclear genome, but in a peculiar non-CpG pattern previously reported for plants and fungi. The molecular mechanisms responsible for this pattern remain an open question. PMID:23804556

  19. MMASS: an optimized array-based method for assessing CpG island methylation.

    PubMed

    Ibrahim, Ashraf E K; Thorne, Natalie P; Baird, Katie; Barbosa-Morais, Nuno L; Tavaré, Simon; Collins, V Peter; Wyllie, Andrew H; Arends, Mark J; Brenton, James D

    2006-01-01

    We describe an optimized microarray method for identifying genome-wide CpG island methylation called microarray-based methylation assessment of single samples (MMASS) which directly compares methylated to unmethylated sequences within a single sample. To improve previous methods we used bioinformatic analysis to predict an optimized combination of methylation-sensitive enzymes that had the highest utility for CpG-island probes and different methods to produce unmethylated representations of test DNA for more sensitive detection of differential methylation by hybridization. Subtraction or methylation-dependent digestion with McrBC was used with optimized (MMASS-v2) or previously described (MMASS-v1, MMASS-sub) methylation-sensitive enzyme combinations and compared with a published McrBC method. Comparison was performed using DNA from the cell line HCT116. We show that the distribution of methylation microarray data is inherently skewed and requires exogenous spiked controls for normalization and that analysis of digestion of methylated and unmethylated control sequences together with linear fit models of replicate data showed superior statistical power for the MMASS-v2 method. Comparison with previous methylation data for HCT116 and validation of CpG islands from PXMP4, SFRP2, DCC, RARB and TSEN2 confirmed the accuracy of MMASS-v2 results. The MMASS-v2 method offers improved sensitivity and statistical power for high-throughput microarray identification of differential methylation.

  20. Formaldehyde activation of mitoxantrone yields CpG and CpA specific DNA adducts

    PubMed Central

    Parker, Belinda S.; Cutts, Suzanne M.; Cullinane, Carleen; Phillips, Don R.

    2000-01-01

    Recently we have found that mitoxantrone, like Adriamycin, can be activated by formaldehyde and subsequently form adducts which stabilise double-stranded DNA in vitro. This activation by formaldehyde may be biologically relevant since formaldehyde levels are elevated in those tumours in which mitoxantrone is most cytotoxic. In vitro transcription analysis revealed that these adducts block the progression of RNA polymerase during transcription and cause truncated RNA transcripts. There was an absolute requirement for both mitoxantrone and formaldehyde in transcriptional blockage formation and the activated complex was found to exhibit site specificity, with blockage occurring prior to CpG and CpA sites in the DNA (non-template strand). The stability of the adduct at 37°C was site dependent. The half-lives ranged from 45 min to ~5 h and this was dependent on both the central 2 bp blockage site as well as flanking sequences. The CpG specificity of mitoxantrone adduct sites was also confirmed independently by a λ exonuclease digestion assay. PMID:10648792

  1. Epigenomic alterations define lethal CIMP-positive ependymomas of infancy

    PubMed Central

    Mack, S. C.; Witt, H.; Piro, R. M.; Gu, L.; Zuyderduyn, S.; Stütz, A. M.; Wang, X.; Gallo, M.; Garzia, L.; Zayne, K.; Zhang, X.; Ramaswamy, V.; Jäger, N.; Jones, D. T. W.; Sill, M.; Pugh, T. J.; Ryzhova, M.; Wani, K. M.; Shih, D. J. H.; Head, R.; Remke, M.; Bailey, S. D.; Zichner, T.; Faria, C. C.; Barszczyk, M.; Stark, S.; Seker-Cin, H.; Hutter, S.; Johann, P.; Bender, S.; Hovestadt, V.; Tzaridis, T.; Dubuc, A. M.; Northcott, P. A.; Peacock, J.; Bertrand, K. C.; Agnihotri, S.; Cavalli, F. M. G.; Clarke, I.; Nethery-Brokx, K.; Creasy, C. L.; Verma, S. K.; Koster, J.; Wu, X.; Yao, Y.; Milde, T.; Sin-Chan, P.; Zuccaro, J.; Lau, L.; Pereira, S.; Castelo-Branco, P.; Hirst, M.; Marra, M. A.; Roberts, S. S.; Fults, D.; Massimi, L.; Cho, Y. J.; Van Meter, T.; Grajkowska, W.; Lach, B.; Kulozik, A. E.; von Deimling, A.; Witt, O.; Scherer, S. W.; Fan, X.; Muraszko, K. M.; Kool, M.; Pomeroy, S. L.; Gupta, N.; Phillips, J.; Huang, A.; Tabori, U.; Hawkins, C.; Malkin, D.; Kongkham, P. N.; Weiss, W. A.; Jabado, N.; Rutka, J. T.; Bouffet, E.; Korbel, J. O.; Lupien, M.; Aldape, K. D.; Bader, G. D.; Eils, R.; Lichter, P.; Dirks, P. B.; Pfister, S. M.; Korshunov, A.; Taylor, M. D.

    2014-01-01

    Ependymomas are common childhood brain tumours that occur throughout the nervous system, but are most common in the paediatric hindbrain. Current standard therapy comprises surgery and radiation, but not cytotoxic chemotherapy as it does not further increase survival. Whole-genome and whole-exome sequencing of 47 hindbrain ependymomas reveals an extremely low mutation rate, and zero significant recurrent somatic single nucleotide variants. Although devoid of recurrent single nucleotide variants and focal copy number aberrations, poor-prognosis hindbrain ependymomas exhibit a CpG island methylator phenotype. Transcriptional silencing driven by CpG methylation converges exclusively on targets of the Polycomb repressive complex 2 which represses expression of differentiation genes through trimethylation of H3K27. CpG island methylator phenotype-positive hindbrain ependymomas are responsive to clinical drugs that target either DNA or H3K27 methylation both in vitro and in vivo. We conclude that epigenetic modifiers are the first rational therapeutic candidates for this deadly malignancy, which is epigenetically deregulated but genetically bland. PMID:24553142

  2. Epigenomic alterations define lethal CIMP-positive ependymomas of infancy.

    PubMed

    Mack, S C; Witt, H; Piro, R M; Gu, L; Zuyderduyn, S; Stütz, A M; Wang, X; Gallo, M; Garzia, L; Zayne, K; Zhang, X; Ramaswamy, V; Jäger, N; Jones, D T W; Sill, M; Pugh, T J; Ryzhova, M; Wani, K M; Shih, D J H; Head, R; Remke, M; Bailey, S D; Zichner, T; Faria, C C; Barszczyk, M; Stark, S; Seker-Cin, H; Hutter, S; Johann, P; Bender, S; Hovestadt, V; Tzaridis, T; Dubuc, A M; Northcott, P A; Peacock, J; Bertrand, K C; Agnihotri, S; Cavalli, F M G; Clarke, I; Nethery-Brokx, K; Creasy, C L; Verma, S K; Koster, J; Wu, X; Yao, Y; Milde, T; Sin-Chan, P; Zuccaro, J; Lau, L; Pereira, S; Castelo-Branco, P; Hirst, M; Marra, M A; Roberts, S S; Fults, D; Massimi, L; Cho, Y J; Van Meter, T; Grajkowska, W; Lach, B; Kulozik, A E; von Deimling, A; Witt, O; Scherer, S W; Fan, X; Muraszko, K M; Kool, M; Pomeroy, S L; Gupta, N; Phillips, J; Huang, A; Tabori, U; Hawkins, C; Malkin, D; Kongkham, P N; Weiss, W A; Jabado, N; Rutka, J T; Bouffet, E; Korbel, J O; Lupien, M; Aldape, K D; Bader, G D; Eils, R; Lichter, P; Dirks, P B; Pfister, S M; Korshunov, A; Taylor, M D

    2014-02-27

    Ependymomas are common childhood brain tumours that occur throughout the nervous system, but are most common in the paediatric hindbrain. Current standard therapy comprises surgery and radiation, but not cytotoxic chemotherapy as it does not further increase survival. Whole-genome and whole-exome sequencing of 47 hindbrain ependymomas reveals an extremely low mutation rate, and zero significant recurrent somatic single nucleotide variants. Although devoid of recurrent single nucleotide variants and focal copy number aberrations, poor-prognosis hindbrain ependymomas exhibit a CpG island methylator phenotype. Transcriptional silencing driven by CpG methylation converges exclusively on targets of the Polycomb repressive complex 2 which represses expression of differentiation genes through trimethylation of H3K27. CpG island methylator phenotype-positive hindbrain ependymomas are responsive to clinical drugs that target either DNA or H3K27 methylation both in vitro and in vivo. We conclude that epigenetic modifiers are the first rational therapeutic candidates for this deadly malignancy, which is epigenetically deregulated but genetically bland.

  3. cuRRBS: simple and robust evaluation of enzyme combinations for reduced representation approaches.

    PubMed

    Martin-Herranz, Daniel E; Ribeiro, António J M; Krueger, Felix; Thornton, Janet M; Reik, Wolf; Stubbs, Thomas M

    2017-11-16

    DNA methylation is an important epigenetic modification in many species that is critical for development, and implicated in ageing and many complex diseases, such as cancer. Many cost-effective genome-wide analyses of DNA modifications rely on restriction enzymes capable of digesting genomic DNA at defined sequence motifs. There are hundreds of restriction enzyme families but few are used to date, because no tool is available for the systematic evaluation of restriction enzyme combinations that can enrich for certain sites of interest in a genome. Herein, we present customised Reduced Representation Bisulfite Sequencing (cuRRBS), a novel and easy-to-use computational method that solves this problem. By computing the optimal enzymatic digestions and size selection steps required, cuRRBS generalises the traditional MspI-based Reduced Representation Bisulfite Sequencing (RRBS) protocol to all restriction enzyme combinations. In addition, cuRRBS estimates the fold-reduction in sequencing costs and provides a robustness value for the personalised RRBS protocol, allowing users to tailor the protocol to their experimental needs. Moreover, we show in silico that cuRRBS-defined restriction enzymes consistently out-perform MspI digestion in many biological systems, considering both CpG and CHG contexts. Finally, we have validated the accuracy of cuRRBS predictions for single and double enzyme digestions using two independent experimental datasets. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  4. Developing Guidelines on the Assessment and Treatment of Delirium in Older Adults at the End of Life

    PubMed Central

    Brajtman, Susan; Wright, David; Hogan, David B.; Allard, Pierre; Bruto, Venera; Burne, Deborah; Gage, Laura; Gagnon, Pierre R.; Sadowski, Cheryl A.; Helsdingen, Sherri; Wilson, Kimberley

    2011-01-01

    Background and Purpose Delirium at the end of life is common and can have serious consequences on an older person’s quality of life and death. In spite of the importance of detecting, diagnosing, and managing delirium at the end of life, comprehensive clinical practice guidelines (CPG) are lacking. Our objective was to develop CPG for the assessment and treatment of delirium that would be applicable to seniors receiving end-of-life care in diverse settings. Methods Using as a starting point the 2006 Canadian Coalition for Seniors’ Mental Health CPG on the assessment and treatment of delirium, a team of palliative care researchers and clinicians partnered with members of the original guideline development group to adapt the guidelines for an end-of-life care context. This process was supported by an extensive literature review. The final guidelines were reviewed by external experts. Results Comprehensive CPG on the assessment and treatment of delirium in older adults at the end of life were developed and can be downloaded from http://www.ccsmh.ca. Conclusions Further research is needed on the implementation and evaluation of these adapted delirium guidelines for older patients receiving end-of-life care in various palliative care settings. PMID:23251311

  5. Modulation of transcription factor binding and epigenetic regulation of the MLH1 CpG island and shore by polymorphism rs1800734 in colorectal cancer

    PubMed Central

    Savio, Andrea J.; Bapat, Bharati

    2017-01-01

    ABSTRACT The MLH1 promoter polymorphism rs1800734 is associated with MLH1 CpG island hypermethylation and expression loss in colorectal cancer (CRC). Conversely, variant rs1800734 is associated with MLH1 shore, but not island, hypomethylation in peripheral blood mononuclear cell DNA. To explore these distinct patterns, MLH1 CpG island and shore methylation was assessed in CRC cell lines stratified by rs1800734 genotype. Cell lines containing the variant A allele demonstrated MLH1 shore hypomethylation compared to wild type (GG). There was significant enrichment of transcription factor AP4 at the MLH1 promoter in GG and GA cell lines, but not the AA cell line, by chromatin immunoprecipitation studies. Preferential binding to the G allele was confirmed by sequencing in the GA cell line. The enhancer-associated histone modification H3K4me1 was enriched at the MLH1 shore; however, H3K27ac was not, indicating the shore is an inactive enhancer. These results demonstrate the role of variant rs1800734 in altering transcription factor binding as well as epigenetics at regions beyond the MLH1 CpG island in which it is located. PMID:28304185

  6. Modulation of transcription factor binding and epigenetic regulation of the MLH1 CpG island and shore by polymorphism rs1800734 in colorectal cancer.

    PubMed

    Savio, Andrea J; Bapat, Bharati

    2017-06-03

    The MLH1 promoter polymorphism rs1800734 is associated with MLH1 CpG island hypermethylation and expression loss in colorectal cancer (CRC). Conversely, variant rs1800734 is associated with MLH1 shore, but not island, hypomethylation in peripheral blood mononuclear cell DNA. To explore these distinct patterns, MLH1 CpG island and shore methylation was assessed in CRC cell lines stratified by rs1800734 genotype. Cell lines containing the variant A allele demonstrated MLH1 shore hypomethylation compared to wild type (GG). There was significant enrichment of transcription factor AP4 at the MLH1 promoter in GG and GA cell lines, but not the AA cell line, by chromatin immunoprecipitation studies. Preferential binding to the G allele was confirmed by sequencing in the GA cell line. The enhancer-associated histone modification H3K4me1 was enriched at the MLH1 shore; however, H3K27ac was not, indicating the shore is an inactive enhancer. These results demonstrate the role of variant rs1800734 in altering transcription factor binding as well as epigenetics at regions beyond the MLH1 CpG island in which it is located.

  7. Restoration of CpG Methylation in The Egf Promoter Region during Rat Liver Regeneration.

    PubMed

    Deming, Li; Ziwei, Li; Xueqiang, Guo; Cunshuan, Xu

    2015-01-01

    Epidermal growth factor (EGF) is an important factor for healing after tissue damage in diverse experimental models. It plays an important role in liver regeneration (LR). The objective of this experiment is to investigate the methylation variation of 10 CpG sites in the Egf promoter region and their relevance to Egf expression during rat liver regenera- tion. As a follow up of our previous study, rat liver tissue was collected after rat 2/3 partial hepatectomy (PH) during the re-organization phase (from days 14 to days 28). Liver DNA was extracted and modified by sodium bisulfate. The methylation status of 10 CpG sites in Egf promoter region was determined using bisulfite sequencing polymerase chain reaction (PCR), as BSP method. The results showed that 3 (sites 3, 4 and 9) out of 10 CpG sites have strikingly methylation changes during the re-organization phase compared to the regeneration phase (from 2 hours to 168 hours, P=0.002, 0.048 and 0.018, respectively). Our results showed that methylation modification of CpGs in the Egf promoter region could be restored to the status before PH operation and changes of methylation didn't affect Egf mRNA expression during the re-organization phase.

  8. Restoration of CpG Methylation in The Egf Promoter Region during Rat Liver Regeneration

    PubMed Central

    Deming, Li; Ziwei, Li; Xueqiang, Guo; Cunshuan, Xu

    2015-01-01

    Epidermal growth factor (EGF) is an important factor for healing after tissue damage in diverse experimental models. It plays an important role in liver regeneration (LR). The objective of this experiment is to investigate the methylation variation of 10 CpG sites in the Egf promoter region and their relevance to Egf expression during rat liver regenera- tion. As a follow up of our previous study, rat liver tissue was collected after rat 2/3 partial hepatectomy (PH) during the re-organization phase (from days 14 to days 28). Liver DNA was extracted and modified by sodium bisulfate. The methylation status of 10 CpG sites in Egf promoter region was determined using bisulfite sequencing polymerase chain reaction (PCR), as BSP method. The results showed that 3 (sites 3, 4 and 9) out of 10 CpG sites have strikingly methylation changes during the re-organization phase compared to the regeneration phase (from 2 hours to 168 hours, P=0.002, 0.048 and 0.018, respectively). Our results showed that methylation modification of CpGs in the Egf promoter region could be restored to the status before PH operation and changes of methylation didn’t affect Egf mRNA expression during the re-organization phase. PMID:26464832

  9. CpG methylation of a silent controlling element in the murine Avy allele is incomplete and unresponsive to methyl donor supplementation.

    PubMed

    Cropley, Jennifer E; Suter, Catherine M; Beckman, Kenneth B; Martin, David I K

    2010-02-04

    The viable yellow allele of agouti (A(vy)) is remarkable for its unstable and partially heritable epigenetic state, which produces wide variation in phenotypes of isogenic mice. In the A(vy) allele an inserted intracisternal A particle (IAP) acts as a controlling element which deregulates expression of agouti by transcription from the LTR of the IAP; the phenotypic state has been linked to CpG methylation of the LTR. Phenotypic variation between A(vy) mice indicates that the epigenetic state of the IAP is unstable in the germline. We have made a detailed examination of somatic methylation of the IAP using bisulphite allelic sequencing, and find that the promoter is incompletely methylated even when it is transcriptionally silent. In utero exposure to supplementary methyl donors, which alters the spectrum of A(vy) phenotypes, does not increase the density of CpG methylation in the silent LTR. Our findings suggest that, contrary to previous supposition, methyl donor supplementation acts through an indirect mechanism to silence A(vy). The incomplete cytosine methylation we observe at the somatically silent A(vy) allele may reflect its unstable germline state, and the influence of epigenetic modifications underlying CpG methylation.

  10. CpG Methylation of a Silent Controlling Element in the Murine Avy Allele Is Incomplete and Unresponsive to Methyl Donor Supplementation

    PubMed Central

    Cropley, Jennifer E.; Suter, Catherine M.; Beckman, Kenneth B.; Martin, David I. K.

    2010-01-01

    Background The viable yellow allele of agouti (Avy) is remarkable for its unstable and partially heritable epigenetic state, which produces wide variation in phenotypes of isogenic mice. In the Avy allele an inserted intracisternal A particle (IAP) acts as a controlling element which deregulates expression of agouti by transcription from the LTR of the IAP; the phenotypic state has been linked to CpG methylation of the LTR. Phenotypic variation between Avy mice indicates that the epigenetic state of the IAP is unstable in the germline. Principal Findings We have made a detailed examination of somatic methylation of the IAP using bisulphite allelic sequencing, and find that the promoter is incompletely methylated even when it is transcriptionally silent. In utero exposure to supplementary methyl donors, which alters the spectrum of Avy phenotypes, does not increase the density of CpG methylation in the silent LTR. Conclusions Our findings suggest that, contrary to previous supposition, methyl donor supplementation acts through an indirect mechanism to silence Avy. The incomplete cytosine methylation we observe at the somatically silent Avy allele may reflect its unstable germline state, and the influence of epigenetic modifications underlying CpG methylation. PMID:20140227

  11. Assisted reproduction treatment and epigenetic inheritance

    PubMed Central

    van Montfoort, A.P.A.; Hanssen, L.L.P.; de Sutter, P.; Viville, S.; Geraedts, J.P.M.; de Boer, P.

    2012-01-01

    BACKGROUND The subject of epigenetic risk of assisted reproduction treatment (ART), initiated by reports on an increase of children with the Beckwith–Wiedemann imprinting disorder, is very topical. Hence, there is a growing literature, including mouse studies. METHODS In order to gain information on transgenerational epigenetic inheritance and epigenetic effects induced by ART, literature databases were searched for papers on this topic using relevant keywords. RESULTS At the level of genomic imprinting involving CpG methylation, ART-induced epigenetic defects are convincingly observed in mice, especially for placenta, and seem more frequent than in humans. Data generally provide a warning as to the use of ovulation induction and in vitro culture. In human sperm from compromised spermatogenesis, sequence-specific DNA hypomethylation is observed repeatedly. Transmittance of sperm and oocyte DNA methylation defects is possible but, as deduced from the limited data available, largely prevented by selection of gametes for ART and/or non-viability of the resulting embryos. Some evidence indicates that subfertility itself is a risk factor for imprinting diseases. As in mouse, physiological effects from ART are observed in humans. In the human, indications for a broader target for changes in CpG methylation than imprinted DNA sequences alone have been found. In the mouse, a broader range of CpG sequences has not yet been studied. Also, a multigeneration study of systematic ART on epigenetic parameters is lacking. CONCLUSIONS The field of epigenetic inheritance within the lifespan of an individual and between generations (via mitosis and meiosis, respectively) is growing, driven by the expansion of chromatin research. ART can induce epigenetic variation that might be transmitted to the next generation. PMID:22267841

  12. Transcriptome Analysis of an Insecticide Resistant Housefly Strain: Insights about SNPs and Regulatory Elements in Cytochrome P450 Genes.

    PubMed

    Mahmood, Khalid; Højland, Dorte H; Asp, Torben; Kristensen, Michael

    2016-01-01

    Insecticide resistance in the housefly, Musca domestica, has been investigated for more than 60 years. It will enter a new era after the recent publication of the housefly genome and the development of multiple next generation sequencing technologies. The genetic background of the xenobiotic response can now be investigated in greater detail. Here, we investigate the 454-pyrosequencing transcriptome of the spinosad-resistant 791spin strain in relation to the housefly genome with focus on P450 genes. The de novo assembly of clean reads gave 35,834 contigs consisting of 21,780 sequences of the spinosad resistant strain. The 3,648 sequences were annotated with an enzyme code EC number and were mapped to 124 KEGG pathways with metabolic processes as most highly represented pathway. One hundred and twenty contigs were annotated as P450s covering 44 different P450 genes of housefly. Eight differentially expressed P450s genes were identified and investigated for SNPs, CpG islands and common regulatory motifs in promoter and coding regions. Functional annotation clustering of metabolic related genes and motif analysis of P450s revealed their association with epigenetic, transcription and gene expression related functions. The sequence variation analysis resulted in 12 SNPs and eight of them found in cyp6d1. There is variation in location, size and frequency of CpG islands and specific motifs were also identified in these P450s. Moreover, identified motifs were associated to GO terms and transcription factors using bioinformatic tools. Transcriptome data of a spinosad resistant strain provide together with genome data fundamental support for future research to understand evolution of resistance in houseflies. Here, we report for the first time the SNPs, CpG islands and common regulatory motifs in differentially expressed P450s. Taken together our findings will serve as a stepping stone to advance understanding of the mechanism and role of P450s in xenobiotic detoxification.

  13. Methylation of avpr1a in the cortex of wild prairie voles: effects of CpG position and polymorphism

    PubMed Central

    Maguire, S. M.; Phelps, S. M.

    2017-01-01

    DNA methylation can cause stable changes in neuronal gene expression, but we know little about its role in individual differences in the wild. In this study, we focus on the vasopressin 1a receptor (avpr1a), a gene extensively implicated in vertebrate social behaviour, and explore natural variation in DNA methylation, genetic polymorphism and neuronal gene expression among 30 wild prairie voles (Microtus ochrogaster). Examination of CpG density across 8 kb of the locus revealed two distinct CpG islands overlapping promoter and first exon, characterized by few CpG polymorphisms. We used a targeted bisulfite sequencing approach to measure DNA methylation across approximately 3 kb of avpr1a in the retrosplenial cortex, a brain region implicated in male space use and sexual fidelity. We find dramatic variation in methylation across the avrp1a locus, with pronounced diversity near the exon–intron boundary and in a genetically variable putative enhancer within the intron. Among our wild voles, differences in cortical avpr1a expression correlate with DNA methylation in this putative enhancer, but not with the methylation status of the promoter. We also find an unusually high number of polymorphic CpG sites (polyCpGs) in this focal enhancer. One polyCpG within this enhancer (polyCpG 2170) may drive variation in expression either by disrupting transcription factor binding motifs or by changing local DNA methylation and chromatin silencing. Our results contradict some assumptions made within behavioural epigenetics, but are remarkably concordant with genome-wide studies of gene regulation. PMID:28280564

  14. Region of interest methylation analysis: a comparison of MSP with MS-HRM and direct BSP.

    PubMed

    Akika, Reem; Awada, Zainab; Mogharbil, Nahed; Zgheib, Nathalie K

    2017-07-01

    The aim of this study was to compare and contrast three DNA methylation methods of a specific region of interest (ROI): methylation-specific PCR (MSP), methylation-sensitive high resolution melting (MS-HRM) and direct bisulfite sequencing (BSP). The methylation of a CpG area in the promoter region of Estrogen receptor alpha (ESR1) was evaluated by these three methods with samples and standards of different methylation percentages. MSP data were neither reproducible nor sensitive, and the assay was not specific due to non-specific binding of primers. MS-HRM was highly reproducible and a step forward into categorizing the methylation status of the samples as percent ranges. Direct BSP was the most informative method regarding methylation percentage of each CpG site. Though not perfect, it was reproducible and sensitive. We recommend the use of either method depending on the research question and target amplicon, and provided that the designed primers and expected amplicons are within recommendations. If the research question targets a limited number of CpG sites and simple yes/no results are enough, MSP may be attempted. For short amplicons that are crowded with CpG sites and of single melting domain, MS-HRM may be the method of choice though it only indicates the overall methylation percentage of the entire amplicon. Although the assay is highly reproducible, being semi-quantitative makes it of lesser interest to study ROI methylation of samples with little methylation differences. Direct BSP is a step forward as it gives information about the methylation percentage at each CpG site.

  15. Intensive hypermethylation of the CpG island of Ras association domain family 1A in hepatitis B virus-associated hepatocellular carcinomas.

    PubMed

    Zhong, Sheng; Yeo, Winnie; Tang, Mandy W; Wong, Nathalie; Lai, Paul B S; Johnson, Phillip J

    2003-08-15

    The human Ras association domain family 1A gene (RASSF1A) is a newly isolated tumor suppressor gene. In this study, we analyzed the methylation status of the promoter region of RASSF1A using bisulfite sequencing and PCR-RFLP in four liver cancer cell lines (Hep3B, HepG(2), SK-HEP-1, and Huh-7) and a cohort of 43 hepatitis B virus-associated hepatocellular carcinoma (HCC) tissues and their corresponding nontumor tissue specimens. The methylation of the CpG islands in the RASSF1A promoter was not detected in 4 samples of normal liver tissue or 10 samples of peripheral blood mononuclear cells from normal subjects. However, the CpG islands were completely methylated, and transcription of the RASSF1A was silenced in the four cell lines. Treatment with the DNA methylation inhibitor 5-aza-2'-deoxycytidine reactivated the expression of RASSF1A in the Hep3B and HepG2 cells. In 41 of 43 (95%) HCC specimens studied, the promoter region of RASSF1A was intensively methylated at its CpG sites. Although heterogeneous methylation was also detected in 16 of the 23 (70%) corresponding nontumorous tissues analyzed, the level of methylation was significantly lower than in the corresponding tumor tissues. HCC has the highest incidence of promoter methylation of RASSF1A among all malignancies yet reported suggesting that hypermethylation of the CpG island promoter of RASSF1A may play an important pathological role in this tumor.

  16. Identification of methylation haplotype blocks aids in deconvolution of heterogeneous tissue samples and tumor tissue-of-origin mapping from plasma DNA.

    PubMed

    Guo, Shicheng; Diep, Dinh; Plongthongkum, Nongluk; Fung, Ho-Lim; Zhang, Kang; Zhang, Kun

    2017-04-01

    Adjacent CpG sites in mammalian genomes can be co-methylated owing to the processivity of methyltransferases or demethylases, yet discordant methylation patterns have also been observed, which are related to stochastic or uncoordinated molecular processes. We focused on a systematic search and investigation of regions in the full human genome that show highly coordinated methylation. We defined 147,888 blocks of tightly coupled CpG sites, called methylation haplotype blocks, after analysis of 61 whole-genome bisulfite sequencing data sets and validation with 101 reduced-representation bisulfite sequencing data sets and 637 methylation array data sets. Using a metric called methylation haplotype load, we performed tissue-specific methylation analysis at the block level. Subsets of informative blocks were further identified for deconvolution of heterogeneous samples. Finally, using methylation haplotypes we demonstrated quantitative estimation of tumor load and tissue-of-origin mapping in the circulating cell-free DNA of 59 patients with lung or colorectal cancer.

  17. The survival decrease in gastric cancer is associated with the methylation of B-cell CLL/lymphoma 6 member B promoter.

    PubMed

    Deng, Jingyu; Liang, Han; Dong, Qiuping; Hou, Yachao; Xie, Xingming; Yu, Jun; Fan, Daiming; Hao, Xishan

    2014-07-01

    The methylation of B-cell CLL/lymphoma 6 member B (BCL6B) DNA promoter was detected in several malignancies. Here, we quantitatively detect the methylated status of CpG sites of BCL6B DNA promoter of 459 patients with gastric cancer (GC) by using bisulfite gene sequencing. We show that patients with three or more methylated CpG sites in the BCL6B promoter were significantly associated with poor survival. Furthermore, by using the Akaike information criterion value calculation, we show that the methylated count of BCL6B promoter was identified to be the optimal prognostic predictor of GC patients.

  18. Mechanistic insights into induction of vitellogenin gene expression by estrogens in Sydney rock oysters, Saccostrea glomerata.

    PubMed

    Tran, Thi Kim Anh; MacFarlane, Geoff R; Kong, Richard Yuen Chong; O'Connor, Wayne A; Yu, Richard Man Kit

    2016-05-01

    Marine molluscs, such as oysters, respond to estrogenic compounds with the induction of the egg yolk protein precursor, vitellogenin (Vtg), availing a biomarker for estrogenic pollution. Despite this application, the precise molecular mechanism through which estrogens exert their action to induce molluscan vitellogenesis is unknown. As a first step to address this question, we cloned a gene encoding Vtg from the Sydney rock oyster Saccostrea glomerata (sgVtg). Using primers designed from a partial sgVtg cDNA sequence available in Genbank, a full-length sgVtg cDNA of 8498bp was obtained by 5'- and 3'-RACE. The open reading frame (ORF) of sgVtg was determined to be 7980bp, which is substantially longer than the orthologs of other oyster species. Its deduced protein sequence shares the highest homology at the N- and C-terminal regions with other molluscan Vtgs. The full-length genomic DNA sequence of sgVtg was obtained by genomic PCR and genome walking targeting the gene body and flanking regions, respectively. The genomic sequence spans 20kb and consists of 30 exons and 29 introns. Computer analysis identified three closely spaced half-estrogen responsive elements (EREs) in the promoter region and a 210-bp CpG island 62bp downstream of the transcription start site. Upregulation of sgVtg mRNA expression was observed in the ovaries following in vitro (explants) and in vivo (tank) exposure to 17β-estradiol (E2). Notably, treatment with an estrogen receptor (ER) antagonist in vitro abolished the upregulation, suggesting a requirement for an estrogen-dependent receptor for transcriptional activation. DNA methylation of the 5' CpG island was analysed using bisulfite genomic sequencing of the in vivo exposed ovaries. The CpG island was found to be hypomethylated (with 0-3% methylcytosines) in both control and E2-exposed oysters. However, no significant differential methylation or any correlation between methylation and sgVtg expression levels was observed. Overall, the results support the possible involvement of an ERE-containing promoter and an estrogen-activated receptor in estrogen signalling in marine molluscs. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. Effect of dietary betaine supplementation on lipogenesis gene expression and CpG methylation of lipoprotein lipase gene in broilers.

    PubMed

    Xing, Jinyi; Kang, Li; Jiang, Yunliang

    2011-03-01

    Experiments were conducted to investigate the effect of betaine supplementation on mRNA expression levels of lipogenesis genes and CpG methylation of lipoprotein lipase gene (LPL) in broilers. From 22 days of age, 78 broilers were feed basal diet without betaine and basal diet supplemented with 0.1% betaine, respectively, and at 56 and 66 days of age, the traits of 15 chickens (7 males and 8 females) of each group were recorded and abdominal fat pads were collected. The mRNA expression levels of several lipogenesis gene were analyzed by semi-quantitative RT-PCR and real-time quantitative RT-PCR (qPCR), respectively. The CpG methylation profile at the promoter region of LPL gene in 66-day-old broilers was determined by bisulfite sequencing. The average daily gain and percent abdominal fat traits were slightly improved in 56-day-old and 66-day-old broilers after dietary supplementation of betaine to diet. After adding 0.1% betaine to diet, the mRNA levels of fatty acid synthase (FAS) and adipocyte-type fatty acid-binding protein genes in abdominal adipose were significantly decreased in 56-day-old broilers, and those of LPL and FAS genes in abdominal adipose were significantly decreased in 66-day-old broilers comparing with the control group (P < 0.05 and P < 0.001). Moreover, in 66-day-old broilers fed 0.1% betaine diet, a different CpG methylation pattern was observed: the CpG dinucleotides of 1st, 6th, 7th, 8th and from 10th to 50th were less methylated; however, those of 2nd, 5th and 9th were more heavily methylated. The results suggest that transcription of some lipogenesis genes was decreased by betaine supplementation and betaine may decrease LPL mRNA expression by altering CpG methylation pattern on LPL promoter region.

  20. Distribution of CpG Motifs in Upstream Gene Domains in a Reef Coral and Sea Anemone: Implications for Epigenetics in Cnidarians.

    PubMed

    Marsh, Adam G; Hoadley, Kenneth D; Warner, Mark E

    2016-01-01

    Coral reefs are under assault from stressors including global warming, ocean acidification, and urbanization. Knowing how these factors impact the future fate of reefs requires delineating stress responses across ecological, organismal and cellular scales. Recent advances in coral reef biology have integrated molecular processes with ecological fitness and have identified putative suites of temperature acclimation genes in a Scleractinian coral Acropora hyacinthus. We wondered what unique characteristics of these genes determined their coordinate expression in response to temperature acclimation, and whether or not other corals and cnidarians would likewise possess these features. Here, we focus on cytosine methylation as an epigenetic DNA modification that is responsive to environmental stressors. We identify common conserved patterns of cytosine-guanosine dinucleotide (CpG) motif frequencies in upstream promoter domains of different functional gene groups in two cnidarian genomes: a coral (Acropora digitifera) and an anemone (Nematostella vectensis). Our analyses show that CpG motif frequencies are prominent in the promoter domains of functional genes associated with environmental adaptation, particularly those identified in A. hyacinthus. Densities of CpG sites in upstream promoter domains near the transcriptional start site (TSS) are 1.38x higher than genomic background levels upstream of -2000 bp from the TSS. The increase in CpG usage suggests selection to allow for DNA methylation events to occur more frequently within 1 kb of the TSS. In addition, observed shifts in CpG densities among functional groups of genes suggests a potential role for epigenetic DNA methylation within promoter domains to impact functional gene expression responses in A. digitifera and N. vectensis. Identifying promoter epigenetic sequence motifs among genes within specific functional groups establishes an approach to describe integrated cellular responses to environmental stress in reef corals and potential roles of epigenetics on survival and fitness in the face of global climate change.

  1. Influence of the Prader-Willi syndrome imprinting center on the DNA methylation landscape in the mouse brain

    PubMed Central

    Brant, Jason O; Riva, Alberto; Resnick, James L; Yang, Thomas P

    2014-01-01

    Reduced representation bisulfite sequencing (RRBS) was used to analyze DNA methylation patterns across the mouse brain genome in mice carrying a deletion of the Prader-Willi syndrome imprinting center (PWS-IC) on either the maternally- or paternally-inherited chromosome. Within the ∼3.7 Mb imprinted Angelman/Prader-Willi syndrome (AS/PWS) domain, 254 CpG sites were interrogated for changes in methylation due to PWS-IC deletion. Paternally-inherited deletion of the PWS-IC increased methylation levels ∼2-fold at each CpG site (compared to wild-type controls) at differentially methylated regions (DMRs) associated with 5′ CpG island promoters of paternally-expressed genes; these methylation changes extended, to a variable degree, into the adjacent CpG island shores. Maternal PWS-IC deletion yielded little or no changes in methylation at these DMRs, and methylation of CpG sites outside of promoter DMRs also was unchanged upon maternal or paternal PWS-IC deletion. Using stringent ascertainment criteria, ∼750,000 additional CpG sites were also interrogated across the entire mouse genome. This analysis identified 26 loci outside of the imprinted AS/PWS domain showing altered DNA methylation levels of ≥25% upon PWS-IC deletion. Curiously, altered methylation at 9 of these loci was a consequence of maternal PWS-IC deletion (maternal PWS-IC deletion by itself is not known to be associated with a phenotype in either humans or mice), and 10 of these loci exhibited the same changes in methylation irrespective of the parental origin of the PWS-IC deletion. These results suggest that the PWS-IC may affect DNA methylation at these loci by directly interacting with them, or may affect methylation at these loci through indirect downstream effects due to PWS-IC deletion. They further suggest the PWS-IC may have a previously uncharacterized function outside of the imprinted AS/PWS domain. PMID:25482058

  2. Influence of the Prader-Willi syndrome imprinting center on the DNA methylation landscape in the mouse brain.

    PubMed

    Brant, Jason O; Riva, Alberto; Resnick, James L; Yang, Thomas P

    2014-11-01

    Reduced representation bisulfite sequencing (RRBS) was used to analyze DNA methylation patterns across the mouse brain genome in mice carrying a deletion of the Prader-Willi syndrome imprinting center (PWS-IC) on either the maternally- or paternally-inherited chromosome. Within the ~3.7 Mb imprinted Angelman/Prader-Willi syndrome (AS/PWS) domain, 254 CpG sites were interrogated for changes in methylation due to PWS-IC deletion. Paternally-inherited deletion of the PWS-IC increased methylation levels ~2-fold at each CpG site (compared to wild-type controls) at differentially methylated regions (DMRs) associated with 5' CpG island promoters of paternally-expressed genes; these methylation changes extended, to a variable degree, into the adjacent CpG island shores. Maternal PWS-IC deletion yielded little or no changes in methylation at these DMRs, and methylation of CpG sites outside of promoter DMRs also was unchanged upon maternal or paternal PWS-IC deletion. Using stringent ascertainment criteria, ~750,000 additional CpG sites were also interrogated across the entire mouse genome. This analysis identified 26 loci outside of the imprinted AS/PWS domain showing altered DNA methylation levels of ≥25% upon PWS-IC deletion. Curiously, altered methylation at 9 of these loci was a consequence of maternal PWS-IC deletion (maternal PWS-IC deletion by itself is not known to be associated with a phenotype in either humans or mice), and 10 of these loci exhibited the same changes in methylation irrespective of the parental origin of the PWS-IC deletion. These results suggest that the PWS-IC may affect DNA methylation at these loci by directly interacting with them, or may affect methylation at these loci through indirect downstream effects due to PWS-IC deletion. They further suggest the PWS-IC may have a previously uncharacterized function outside of the imprinted AS/PWS domain.

  3. Methyl-Cytosine-Driven Structural Changes Enhance Adduction Kinetics of an Exon 7 fragment of the p53 Gene

    NASA Astrophysics Data System (ADS)

    Malla, Spundana; Kadimisetty, Karteek; Fu, You-Jun; Choudhary, Dharamainder; Schenkman, John B.; Rusling, James F.

    2017-01-01

    Methylation of cytosine (C) at C-phosphate-guanine (CpG) sites enhances reactivity of DNA towards electrophiles. Mutations at CpG sites on the p53 tumor suppressor gene that can result from these adductions are in turn correlated with specific cancers. Here we describe the first restriction-enzyme-assisted LC-MS/MS sequencing study of the influence of methyl cytosines (MeC) on kinetics of p53 gene adduction by model metabolite benzo[a]pyrene-7,8-dihydrodiol-9,10-epoxide (BPDE), using methodology applicable to correlate gene damage sites for drug and pollutant metabolites with mutation sites. This method allows direct kinetic measurements by LC-MS/MS sequencing for oligonucleotides longer than 20 base pairs (bp). We used MeC and non-MeC (C) versions of a 32 bp exon 7 fragment of the p53 gene. Methylation of 19 cytosines increased the rate constant 3-fold for adduction on G at the major reactive CpG in codon 248 vs. the non-MeC fragment. Rate constants for non-CpG codons 244 and 243 were not influenced significantly by MeC. Conformational and hydrophobicity changes in the MeC-p53 exon 7 fragment revealed by CD spectra and molecular modeling increase the BPDE binding constant to G in codon 248 consistent with a pathway in which preceding reactant binding greatly facilitates the rate of covalent SN2 coupling.

  4. Site-specific methylation of the rat prolactin and growth hormone promoters correlates with gene expression.

    PubMed Central

    Ngô, V; Gourdji, D; Laverrière, J N

    1996-01-01

    The methylation patterns of the rat prolactin (rPRL) (positions -440 to -20) and growth hormone (rGH) (positions -360 to -110) promoters were analyzed by bisulfite genomic sequencing. Two normal tissues, the anterior pituitary and the liver, and three rat pituitary GH3 cell lines that differ considerably in their abilities to express both genes were tested. High levels of rPRL gene expression were correlated with hypomethylation of the CpG dinucleotides located at positions -277 and -97, near or within positive cis-acting regulatory elements. For the nine CpG sites analyzed in the rGH promoter, an overall hypomethylation-expression coupling was also observed for the anterior pituitary, the liver, and two of the cell lines. The effect of DNA methylation was tested by measuring the transient expression of the chloramphenicol acetyltransferase reporter gene driven by a regionally methylated rPRL promoter. CpG methylation resulted in a decrease in the activity of the rPRL promoter which was proportional to the number of modified CpG sites. The extent of the inhibition was also found to be dependent on the position of methylated sites. Taken together, these data suggest that site-specific methylation may modulate the action of transcription factors that dictate the tissue-specific expression of the rPRL and rGH genes in vivo. PMID:8668139

  5. CpG methylation differences between neurons and glia are highly conserved from mouse to human

    USDA-ARS?s Scientific Manuscript database

    Understanding epigenetic differences that distinguish neurons and glia is of fundamental importance to the nascent field of neuroepigenetics. A recent study used genome-wide bisulfite sequencing to survey differences in DNA methylation between these two cell types, in both humans and mice. That stud...

  6. Cloning of the anhidrotic ectodermal dysplasia gene: Identification of cDNAs associated with CpG islands mapped near translocation breakpoint in two female patients

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Srivastava, A.K.; Schlessinger, D.; Kere, J.

    1994-09-01

    The gene for the X chromosomal developmental disorder anhidrotic ectodermal dysplasia (EDA) has been mapped to Xq12-q13 by linkage analysis and is expressed in a few females with chromosomal translocations involving band Xq12-q13. A yeast artificial chromosome (YAC) contig (2.0 Mb) spanning two translocation breakpoints has been assembled by sequence-tagged site (STS)-based chromosomal walking. The two translocation breakpoints (X:autosome translocations from the affected female patients) have been mapped less than 60 kb apart within a YAC contig. Unique probes and intragenic STSs (mapped between the two translocations) have been developed and a somatic cell hybrid carrying the translocated X chromosomemore » from the AK patient has been analyzed by isolating unique probes that span the breakpoint. Several STSs made from intragenic sequences have been found to be conserved in mouse, hamster and monkey, but we have detected no mRNAs in a number of tissues tested. However, a probe and STS developed from the DNA spanning the AK breakpoint is conserved in mouse, hamster and monkey, and we have detected expressed sequences in skin cells and cDNA libraries. In addition, unique sequences have been obtained from two CpG islands in the region that maps proximal to the breakpoints. cDNAs containing these sequences are being studied as candidates for the gene affected in the etiology of EDA.« less

  7. The left end of rat L1 (L1Rn, long interspersed repeated) DNA which is a CpG island can function as a promoter.

    PubMed Central

    Nur, I; Pascale, E; Furano, A V

    1988-01-01

    Here we report that the 600 bp promoter-like region at the left end of a newly isolated and characterized rat L1 DNA element can activate the prokaryotic chloramphenicol acyltransferase gene in a rat cell line. Activation only occurs when the promoter region is oriented to the transferase gene as it is to the L1 protein encoding sequences and is 75% inhibited by methylation of just 5 of the 22 CpGs present in the promoter. The G + C rich promoter contains enough CpGs to qualify it as a CpG island, but in contrast to other CpG islands, genomic L1 promoters are fully methylated in both somatic cell and sperm DNA as judged by restriction enzyme analysis. Partial demethylation of the genomic promoters by treatment with 5-azacytidine failed to produce discrete L1 transcripts. The relationship of methylation to the evolutionary history and fate of the rat L1 promoter is discussed. Images PMID:2459662

  8. DNA methylation signatures of chronic low-grade inflammation are associated with complex diseases.

    PubMed

    Ligthart, Symen; Marzi, Carola; Aslibekyan, Stella; Mendelson, Michael M; Conneely, Karen N; Tanaka, Toshiko; Colicino, Elena; Waite, Lindsay L; Joehanes, Roby; Guan, Weihua; Brody, Jennifer A; Elks, Cathy; Marioni, Riccardo; Jhun, Min A; Agha, Golareh; Bressler, Jan; Ward-Caviness, Cavin K; Chen, Brian H; Huan, Tianxiao; Bakulski, Kelly; Salfati, Elias L; Fiorito, Giovanni; Wahl, Simone; Schramm, Katharina; Sha, Jin; Hernandez, Dena G; Just, Allan C; Smith, Jennifer A; Sotoodehnia, Nona; Pilling, Luke C; Pankow, James S; Tsao, Phil S; Liu, Chunyu; Zhao, Wei; Guarrera, Simonetta; Michopoulos, Vasiliki J; Smith, Alicia K; Peters, Marjolein J; Melzer, David; Vokonas, Pantel; Fornage, Myriam; Prokisch, Holger; Bis, Joshua C; Chu, Audrey Y; Herder, Christian; Grallert, Harald; Yao, Chen; Shah, Sonia; McRae, Allan F; Lin, Honghuang; Horvath, Steve; Fallin, Daniele; Hofman, Albert; Wareham, Nicholas J; Wiggins, Kerri L; Feinberg, Andrew P; Starr, John M; Visscher, Peter M; Murabito, Joanne M; Kardia, Sharon L R; Absher, Devin M; Binder, Elisabeth B; Singleton, Andrew B; Bandinelli, Stefania; Peters, Annette; Waldenberger, Melanie; Matullo, Giuseppe; Schwartz, Joel D; Demerath, Ellen W; Uitterlinden, André G; van Meurs, Joyce B J; Franco, Oscar H; Chen, Yii-Der Ida; Levy, Daniel; Turner, Stephen T; Deary, Ian J; Ressler, Kerry J; Dupuis, Josée; Ferrucci, Luigi; Ong, Ken K; Assimes, Themistocles L; Boerwinkle, Eric; Koenig, Wolfgang; Arnett, Donna K; Baccarelli, Andrea A; Benjamin, Emelia J; Dehghan, Abbas

    2016-12-12

    Chronic low-grade inflammation reflects a subclinical immune response implicated in the pathogenesis of complex diseases. Identifying genetic loci where DNA methylation is associated with chronic low-grade inflammation may reveal novel pathways or therapeutic targets for inflammation. We performed a meta-analysis of epigenome-wide association studies (EWAS) of serum C-reactive protein (CRP), which is a sensitive marker of low-grade inflammation, in a large European population (n = 8863) and trans-ethnic replication in African Americans (n = 4111). We found differential methylation at 218 CpG sites to be associated with CRP (P < 1.15 × 10 -7 ) in the discovery panel of European ancestry and replicated (P < 2.29 × 10 -4 ) 58 CpG sites (45 unique loci) among African Americans. To further characterize the molecular and clinical relevance of the findings, we examined the association with gene expression, genetic sequence variants, and clinical outcomes. DNA methylation at nine (16%) CpG sites was associated with whole blood gene expression in cis (P < 8.47 × 10 -5 ), ten (17%) CpG sites were associated with a nearby genetic variant (P < 2.50 × 10 -3 ), and 51 (88%) were also associated with at least one related cardiometabolic entity (P < 9.58 × 10 -5 ). An additive weighted score of replicated CpG sites accounted for up to 6% inter-individual variation (R2) of age-adjusted and sex-adjusted CRP, independent of known CRP-related genetic variants. We have completed an EWAS of chronic low-grade inflammation and identified many novel genetic loci underlying inflammation that may serve as targets for the development of novel therapeutic interventions for inflammation.

  9. Evaluation of Different Oligonucleotide Base Substitutions at CpG Binding sites in Multiplex Bisulfite-PCR sequencing.

    PubMed

    Lu, Jennifer; Ru, Kelin; Candiloro, Ida; Dobrovic, Alexander; Korbie, Darren; Trau, Matt

    2017-03-22

    Multiplex bisulfite-PCR sequencing is a convenient and scalable method for the quantitative determination of the methylation state of target DNA regions. A challenge of this application is the presence of CpGs in the same region where primers are being placed. A common solution to the presence of CpGs within a primer-binding region is to substitute a base degeneracy at the cytosine position. However, the efficacy of different substitutions and the extent to which bias towards methylated or unmethylated templates may occur has never been evaluated in bisulfite multiplex sequencing applications. In response, we examined the performance of four different primer substitutions at the cytosine position of CpG's contained within the PCR primers. In this study, deoxyinosine-, 5-nitroindole-, mixed-base primers and primers with an abasic site were evaluated across a series of methylated controls. Primers that contained mixed- or deoxyinosine- base modifications performed most robustly. Mixed-base primers were further selected to determine the conditions that induce bias towards methylated templates. This identified an optimized set of conditions where the methylated state of bisulfite DNA templates can be accurately assessed using mixed-base primers, and expands the scope of bisulfite resequencing assays when working with challenging templates.

  10. Variation in DNA methylation is not consistently reflected by CpG depletion or sociality in Hymenoptera

    USDA-ARS?s Scientific Manuscript database

    Changes in gene regulation that underlie phenotypic evolution can be encoded directly in the DNA sequence or mediated by chromatin modifications such as DNA methylation. It has been hypothesized that the evolution of social behavior is associated with enhanced gene regulatory potential, which may in...

  11. New insights into replication origin characteristics in metazoans

    PubMed Central

    Puy, Aurore; Rialle, Stéphanie; Kaplan, Noam; Segal, Eran

    2012-01-01

    We recently reported the identification and characterization of DNA replication origins (Oris) in metazoan cell lines. Here, we describe additional bioinformatic analyses showing that the previously identified GC-rich sequence elements form origin G-rich repeated elements (OGREs) that are present in 67% to 90% of the DNA replication origins from Drosophila to human cells, respectively. Our analyses also show that initiation of DNA synthesis takes place precisely at 160 bp (Drosophila) and 280 bp (mouse) from the OGRE. We also found that in most CpG islands, an OGRE is positioned in opposite orientation on each of the two DNA strands and detected two sites of initiation of DNA synthesis upstream or downstream of each OGRE. Conversely, Oris not associated with CpG islands have a single initiation site. OGRE density along chromosomes correlated with previously published replication timing data. Ori sequences centered on the OGRE are also predicted to have high intrinsic nucleosome occupancy. Finally, OGREs predict G-quadruplex structures at Oris that might be structural elements controlling the choice or activation of replication origins. PMID:22373526

  12. Transcriptome Analysis of an Insecticide Resistant Housefly Strain: Insights about SNPs and Regulatory Elements in Cytochrome P450 Genes

    PubMed Central

    Asp, Torben; Kristensen, Michael

    2016-01-01

    Background Insecticide resistance in the housefly, Musca domestica, has been investigated for more than 60 years. It will enter a new era after the recent publication of the housefly genome and the development of multiple next generation sequencing technologies. The genetic background of the xenobiotic response can now be investigated in greater detail. Here, we investigate the 454-pyrosequencing transcriptome of the spinosad-resistant 791spin strain in relation to the housefly genome with focus on P450 genes. Results The de novo assembly of clean reads gave 35,834 contigs consisting of 21,780 sequences of the spinosad resistant strain. The 3,648 sequences were annotated with an enzyme code EC number and were mapped to 124 KEGG pathways with metabolic processes as most highly represented pathway. One hundred and twenty contigs were annotated as P450s covering 44 different P450 genes of housefly. Eight differentially expressed P450s genes were identified and investigated for SNPs, CpG islands and common regulatory motifs in promoter and coding regions. Functional annotation clustering of metabolic related genes and motif analysis of P450s revealed their association with epigenetic, transcription and gene expression related functions. The sequence variation analysis resulted in 12 SNPs and eight of them found in cyp6d1. There is variation in location, size and frequency of CpG islands and specific motifs were also identified in these P450s. Moreover, identified motifs were associated to GO terms and transcription factors using bioinformatic tools. Conclusion Transcriptome data of a spinosad resistant strain provide together with genome data fundamental support for future research to understand evolution of resistance in houseflies. Here, we report for the first time the SNPs, CpG islands and common regulatory motifs in differentially expressed P450s. Taken together our findings will serve as a stepping stone to advance understanding of the mechanism and role of P450s in xenobiotic detoxification. PMID:27019205

  13. Formulation of vaccines containing CpG oligonucleotides and alum

    PubMed Central

    Aebig, Joan A.; Mullen, Gregory E. D.; Dobrescu, Gelu; Rausch, Kelly; Lambert, Lynn; Ajose-Popoola, Olubunmi; Long, Carole A.; Saul, Allan; Miles, Aaron P.

    2007-01-01

    CpG oligodeoxynucleotides are potent immunostimulants. For parenterally delivered alum based vaccines, the immunostimulatory effect of CpG depends on the association of the CpG and antigen to the alum. We describe effects of buffer components on the binding of CPG 7909 to aluminum hydroxide (Alhydrogel), assays for measuring binding of CPG 7909 to alum and CPG 7909 induced dissociation of antigen from the alum. Free CPG 7909 is a potent inducer of IP-10 in mice. However the lack of IP-10 production from formulations containing bound CPG 7909 suggested that CPG 7909 does not rapidly dissociate from the alum after injection. It also suggests that IP-10 assays are not a good basis for potency assays for alum based vaccines containing CPG 7909. PMID:17512533

  14. ZikaVR: An Integrated Zika Virus Resource for Genomics, Proteomics, Phylogenetic and Therapeutic Analysis

    PubMed Central

    Gupta, Amit Kumar; Kaur, Karambir; Rajput, Akanksha; Dhanda, Sandeep Kumar; Sehgal, Manika; Khan, Md. Shoaib; Monga, Isha; Dar, Showkat Ahmad; Singh, Sandeep; Nagpal, Gandharva; Usmani, Salman Sadullah; Thakur, Anamika; Kaur, Gazaldeep; Sharma, Shivangi; Bhardwaj, Aman; Qureshi, Abid; Raghava, Gajendra Pal Singh; Kumar, Manoj

    2016-01-01

    Current Zika virus (ZIKV) outbreaks that spread in several areas of Africa, Southeast Asia, and in pacific islands is declared as a global health emergency by World Health Organization (WHO). It causes Zika fever and illness ranging from severe autoimmune to neurological complications in humans. To facilitate research on this virus, we have developed an integrative multi-omics platform; ZikaVR (http://bioinfo.imtech.res.in/manojk/zikavr/), dedicated to the ZIKV genomic, proteomic and therapeutic knowledge. It comprises of whole genome sequences, their respective functional information regarding proteins, genes, and structural content. Additionally, it also delivers sophisticated analysis such as whole-genome alignments, conservation and variation, CpG islands, codon context, usage bias and phylogenetic inferences at whole genome and proteome level with user-friendly visual environment. Further, glycosylation sites and molecular diagnostic primers were also analyzed. Most importantly, we also proposed potential therapeutically imperative constituents namely vaccine epitopes, siRNAs, miRNAs, sgRNAs and repurposing drug candidates. PMID:27633273

  15. Computationally expanding infinium HumanMethylation450 BeadChip array data to reveal distinct DNA methylation patterns of rheumatoid arthritis

    PubMed Central

    Li, Chengzhe; Ai, Rizi; Wang, Mengchi; Firestein, Gary S.; Wang, Wei

    2016-01-01

    Motivation: DNA methylation signatures in rheumatoid arthritis (RA) have been identified in fibroblast-like synoviocytes (FLS) with Illumina HumanMethylation450 array. Since <2% of CpG sites are covered by the Illumina 450K array and whole genome bisulfite sequencing is still too expensive for many samples, computationally predicting DNA methylation levels based on 450K data would be valuable to discover more RA-related genes. Results: We developed a computational model that is trained on 14 tissues with both whole genome bisulfite sequencing and 450K array data. This model integrates information derived from the similarity of local methylation pattern between tissues, the methylation information of flanking CpG sites and the methylation tendency of flanking DNA sequences. The predicted and measured methylation values were highly correlated with a Pearson correlation coefficient of 0.9 in leave-one-tissue-out cross-validations. Importantly, the majority (76%) of the top 10% differentially methylated loci among the 14 tissues was correctly detected using the predicted methylation values. Applying this model to 450K data of RA, osteoarthritis and normal FLS, we successfully expanded the coverage of CpG sites 18.5-fold and accounts for about 30% of all the CpGs in the human genome. By integrative omics study, we identified genes and pathways tightly related to RA pathogenesis, among which 12 genes were supported by triple evidences, including 6 genes already known to perform specific roles in RA and 6 genes as new potential therapeutic targets. Availability and implementation: The source code, required data for prediction, and demo data for test are freely available at: http://wanglab.ucsd.edu/star/LR450K/. Contact: wei-wang@ucsd.edu or gfirestein@ucsd.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:26883487

  16. Regulation of the ITGA2 gene by epigenetic mechanisms in prostate cancer.

    PubMed

    Chin, Suyin Paulynn; Marthick, James R; West, Alison C; Short, Annabel K; Chuckowree, Jyoti; Polanowski, Andrea M; Thomson, Russell J; Holloway, Adele F; Dickinson, Joanne L

    2015-05-01

    Integrin alpha2 beta1 (α2 β1 ) plays an integral role in tumour cell invasion, metastasis and angiogenesis, and altered expression of the receptor has been linked to tumour prognosis in several solid tumours. However, the relationship is complex, with both increased and decreased expression associated with different stages of tumour metastases in several tumour types. The ITGA2 gene, which codes for the α2 subunit, was examined to investigate whether a large CpG island associated with its promoter region is involved in the differential expression of ITGA2 observed in prostate cancer. Bisulphite sequencing of the ITGA2 promoter was used to assess methylation in formalin-fixed paraffin-embedded (FFPE) prostate tumour specimens and prostate cancer cell lines, PC3, 22Rv1 and LNCaP. Changes in ITGA2 mRNA expression were measured using quantitative PCR. ITGA2 functionality was interrogated using cell migration scratch assays and siRNA knockdown experiments. Bisulphite sequencing revealed strikingly decreased methylation at key CpG sites within the promoter of tumour samples, when compared with normal prostate tissue. Altered methylation of this CpG island is also associated with differences in expression in the non-invasive LNCaP, and the highly metastatic PC3 and 22Rv1 prostate cancer cell lines. Further bisulphite sequencing confirmed that selected CpGs were highly methylated in LNCaP cells, whilst only low levels of methylation were observed in PC3 and 22Rv1 cells, correlating with ITGA2 transcript levels. Examination of the increased expression of ITGA2 was shown to influence migratory potential via scratch assay in PC3, 22Rv1 and LNCaP cells, and was confirmed by siRNA knockdown experiments. Taken together, our data supports the assertion that epigenetic modification of the ITGA2 promoter is a mechanism by which ITGA2 expression is regulated. © 2015 Wiley Periodicals, Inc.

  17. Analysis of estrogen receptor β gene methylation in autistic males in a Chinese Han population.

    PubMed

    Wang, Xuelai; Liang, Shuang; Sun, Yi; Li, Haixin; Endo, Fumio; Nakao, Mitsuyoshi; Saitoh, Noriko; Wu, Lijie

    2017-08-01

    Autism spectrum disorder (ASD) is a neurodevelopment disorder with abnormalities of social interaction, communication and repetitive behaviors. The higher prevalence of ASD in men implies a potential relationship between sex hormones and ASD etiology. The ESR2 gene encodes estrogen receptor beta (ESR2) and plays an important role during brain development. A relationship between ESR2 and ASD has been suggested by studies on single nucleotide polymorphisms and mRNA and protein expression levels in ASD patients. Here, we explored the possible epigenetic regulation of the ESR2 gene in autism. We collected genomic DNA from the peripheral blood of Chinese Han males with autism and age-matched normal males and measured DNA methylation of CpG islands in the ESR2 gene, which consisted of 41 CpG sites among the proximal promoter region and an untranslated exon, by bisulfite sequencing. We also investigated a relationship between DNA methylation and phenotypic features of autism, as assessed by the Children Autism Rating Scale. We found little overall difference in the DNA methylation of the ESR2 5'-flanking region in individuals with autism compared with normal individuals. However, detailed analyses revealed that eight specific CpG sites were hypermethylated in autistic individuals and that four specific CpG sites were positively associated with the severity of autistic symptoms. Our study indicates that the epigenetic dysregulation of ESR2 may govern the development of autism.

  18. DNA methylation levels in candidate genes associated with chronological age in mammals are not conserved in a long-lived seabird

    PubMed Central

    Polanowski, Andrea M.; McMahon, Clive; Deagle, Bruce E.; Dickinson, Joanne L.; Hindell, Mark A.; Jarman, Simon N.

    2017-01-01

    Most seabirds do not have any outward identifiers of their chronological age, so estimation of seabird population age structure generally requires expensive, long-term banding studies. We investigated the potential to use a molecular age biomarker to estimate age in short-tailed shearwaters (Ardenna tenuirostris). We quantified DNA methylation in several A. tenuirostris genes that have shown age-related methylation changes in mammals. In birds ranging from chicks to 21 years of age, bisulphite treated blood and feather DNA was sequenced and methylation levels analysed in 67 CpG sites in 13 target gene regions. From blood samples, five of the top relationships with age were identified in KCNC3 loci (CpG66: R2 = 0.325, p = 0.019). In feather samples ELOVL2 (CpG42: R2 = 0.285, p = 0.00048) and EDARADD (CpG46: R2 = 0.168, p = 0.0067) were also weakly correlated with age. However, the majority of markers had no clear association with age (of 131 comparisons only 12 had a p-value < 0.05) and statistical analysis using a penalised lasso approach did not produce an accurate ageing model. Our data indicate that some age-related signatures identified in orthologous mammalian genes are not conserved in the long-lived short tailed shearwater. Alternative molecular approaches will be required to identify a reliable biomarker of chronological age in these seabirds. PMID:29216256

  19. Liposomal SLA co-incorporated with PO CpG ODNs or PS CpG ODNs induce the same protection against the murine model of leishmaniasis.

    PubMed

    Shargh, Vahid Heravi; Jaafari, Mahmoud Reza; Khamesipour, Ali; Jaafari, Iman; Jalali, Seyed Amir; Abbasi, Azam; Badiee, Ali

    2012-06-06

    First generation Leishmania vaccines consisting of whole killed parasites with or without adjuvants have reached phase 3 trial and failed to show enough efficacy mainly due to the lack of an appropriate adjuvant. In this study, the nuclease-resistant phosphorothioate CpG oligodeoxynucleotides (PS CpG) or nuclease-sensitive phosphodiester CpG ODNs (PO CpG) were used as adjuvants to enhance immunogenicity and rate of protection against leishmaniasis. Due to the susceptibility of PO CpG to nuclease degradation, an efficient liposomal delivery system was developed to protect them from degradation. 1, 2-dioleoyl-3-trimethylammonium-propane (DOTAP) as a cationic lipid was used because of its unique adjuvanticity and electrostatic interaction with negatively charged CpG ODNs. To evaluate the role of liposomal formulation in protection rate and enhanced immune response, BALB/c mice were immunized subcutaneously with liposomal soluble Leishmania antigens (SLA) co-incorporated with PO CpG (Lip-SLA-PO CpG), Lip-SLA-PS CpG, SLA+PO CpG, SLA+PS CpG, SLA or buffer. As criteria for protection, footpad swelling at the site of challenge, parasite loads, the levels of IFN-γ and IL-4, and the IgG subtypes were evaluated. The groups of mice receiving Lip-SLA-PO CpG or Lip-SLA-PS CpG showed a high protection rate compared with the control groups. In addition, there was no significant difference in immune response generation between mice immunized with PS CpG and the group receiving PO CpG when incorporated into the liposomes. The results suggested that liposomal form of PO CpG might be used instead of PS CpG in future vaccine formulations as an efficient adjuvant. Copyright © 2012 Elsevier Ltd. All rights reserved.

  20. Virus-like nanostructures for tuning immune response

    NASA Astrophysics Data System (ADS)

    Mammadov, Rashad; Cinar, Goksu; Gunduz, Nuray; Goktas, Melis; Kayhan, Handan; Tohumeken, Sehmus; Topal, Ahmet E.; Orujalipoor, Ilghar; Delibasi, Tuncay; Dana, Aykutlu; Ide, Semra; Tekinay, Ayse B.; Guler, Mustafa O.

    2015-11-01

    Synthetic vaccines utilize viral signatures to trigger immune responses. Although the immune responses raised against the biochemical signatures of viruses are well characterized, the mechanism of how they affect immune response in the context of physical signatures is not well studied. In this work, we investigated the ability of zero- and one-dimensional self-assembled peptide nanostructures carrying unmethylated CpG motifs (signature of viral DNA) for tuning immune response. These nanostructures represent the two most common viral shapes, spheres and rods. The nanofibrous structures were found to direct immune response towards Th1 phenotype, which is responsible for acting against intracellular pathogens such as viruses, to a greater extent than nanospheres and CpG ODN alone. In addition, nanofibers exhibited enhanced uptake into dendritic cells compared to nanospheres or the ODN itself. The chemical stability of the ODN against nuclease-mediated degradation was also observed to be enhanced when complexed with the peptide nanostructures. In vivo studies showed that nanofibers promoted antigen-specific IgG production over 10-fold better than CpG ODN alone. To the best of our knowledge, this is the first report showing the modulation of the nature of an immune response through the shape of the carrier system.

  1. Identification and Characterization of Novel Chitin-Binding Proteins from the Larval Cuticle of Silkworm, Bombyx mori.

    PubMed

    Dong, Zhaoming; Zhang, Weiwei; Zhang, Yan; Zhang, Xiaolu; Zhao, Ping; Xia, Qingyou

    2016-05-06

    Cuticle is mainly made of chitin filaments embedded in a matrix of cuticular proteins (CPs). Cuticular chitins have minor differences, whereas CPs are widely variable with respect to their sequences and structures. To understand the molecular basis underlying the mechanical properties of cuticle, it is necessary to know which CPs interact with chitin and how they are assembled into the cuticle structure. In the present study, a chitin-binding assay was performed followed by liquid chromatography-tandem mass spectrometry to identify the extracted proteins from the larval cuticle of silkworm, Bombyx mori. There were 463 proteins identified from the silkworm larval cuticle, 200 of which were recovered in the chitin-binding fraction. A total of 103 proteins were annotated as CPs, which were classified into 11 CP families based on their conserved motifs, including CPR, CPAP, CPT, CPF and CPFL, CPCFC, chitin_bind 3, BmCPH2 homologues, BmCPH9 homologues, BmCPG1 homologues, BmCPG20 homologues, and BmCPG21 homologues. A total of five CP families were newly identified in the chitin-binding fraction, thereby providing new information and insight into the composition, structure, and function of the silkworm larval cuticle.

  2. Triplex-mediated analysis of cytosine methylation at CpA sites in DNA.

    PubMed

    Johannsen, Marie W; Gerrard, Simon R; Melvin, Tracy; Brown, Tom

    2014-01-18

    Modified triplex-forming oligonucleotides distinguish 5-methyl cytosine from unmethylated cytosine in DNA duplexes by differences in triplex melting temperatures. The discrimination is sequence-specific; dramatic differences in stabilisation are seen for CpA methylation, whereas CpG methylation is not detected. This direct detection of DNA methylation constitutes a new approach for epigenetic analysis.

  3. Effect of amino groups of mesoporous silica nanoparticles on CpG oligodexynucleotide delivery

    NASA Astrophysics Data System (ADS)

    Xu, Yi; Claiden, Peter; Zhu, Yufang; Morita, Hiromi; Hanagata, Nobutaka

    2015-08-01

    In this study, we proposed to modify mesoporous silica nanoparticles (MSNs) with 3-aminopropyltriethoxysilane (NH2-TES), aminoethylaminopropyltriethoxysilane (2NH2-TES) and 3-[2-(2-aminoethylamino)ethylamino] propyl-trimethoxysilane (3NH2-TES) for binding of cytosine-phosphate-guanosine oligodexynucleotides (CpG ODN), and investigated the effect of different amino groups of MSNs on the CpG ODN delivery. Serum stability, in vitro cytotoxicity, and cytokine interleukin-6 (IL-6) induction by MSN-NH2/CpG, MSN-2NH2/CpG and MSN-3NH2/CpG complexes were investigated in detail. The results showed that three kinds of aminated-MSN-based CpG ODN delivery systems had no cytotoxicity to RAW264.7 cells, and binding of CpG ODN to MSN-NH2, MSN-2NH2 and MSN-3NH2 nanoparticles enhanced the serum stability of CpG ODN due to protection by the nanoparticles. However, three aminated MSN-based CpG ODN delivery systems exhibited different CpG ODN delivery efficiency, and MSN-NH2/CpG complexes had the highest ability to induce IL-6 secretion.

  4. The effects of cytosine methylation on general transcription factors

    NASA Astrophysics Data System (ADS)

    Jin, Jianshi; Lian, Tengfei; Gu, Chan; Yu, Kai; Gao, Yi Qin; Su, Xiao-Dong

    2016-07-01

    DNA methylation on CpG sites is the most common epigenetic modification. Recently, methylation in a non-CpG context was found to occur widely on genomic DNA. Moreover, methylation of non-CpG sites is a highly controlled process, and its level may vary during cellular development. To study non-CpG methylation effects on DNA/protein interactions, we have chosen three human transcription factors (TFs): glucocorticoid receptor (GR), brain and muscle ARNT-like 1 (BMAL1) - circadian locomotor output cycles kaput (CLOCK) and estrogen receptor (ER) with methylated or unmethylated DNA binding sequences, using single-molecule and isothermal titration calorimetry assays. The results demonstrated that these TFs interact with methylated DNA with different effects compared with their cognate DNA sequences. The effects of non-CpG methylation on transcriptional regulation were validated by cell-based luciferase assay at protein level. The mechanisms of non-CpG methylation influencing DNA-protein interactions were investigated by crystallographic analyses and molecular dynamics simulation. With BisChIP-seq assays in HEK-293T cells, we found that GR can recognize highly methylated sites within chromatin in cells. Therefore, we conclude that non-CpG methylation of DNA can provide a mechanism for regulating gene expression through directly affecting the binding of TFs.

  5. The Composite of Bone Marrow Concentrate and PRP as an Alternative to Autologous Bone Grafting

    PubMed Central

    Hakimi, Mohssen; Grassmann, Jan-Peter; Betsch, Marcel; Schneppendahl, Johannes; Gehrmann, Sebastian; Hakimi, Ahmad-Reza; Kröpil, Patric; Sager, Martin; Herten, Monika; Wild, Michael; Windolf, Joachim; Jungbluth, Pascal

    2014-01-01

    One possible alternative to the application of autologous bone grafts represents the use of autologous bone marrow concentrate (BMC). The purpose of our study was to evaluate the potency of autologous platelet-rich plasma (PRP) in combination with BMC. In 32 mini-pigs a metaphyseal critical-size defect was surgically created at the proximal tibia. The animals were allocated to four treatment groups of eight animals each (1. BMC+CPG group, 2. BMC+CPG+PRP group, 3. autograft group, 4. CPG group). In the BMC+CPG group the defect was filled with autologous BMC in combination with calcium phosphate granules (CPG), whereas in the BMC+CPG+PRP group the defect was filled with the composite of autologous BMC, CPG and autologous PRP. In the autograft group the defect was filled with autologous cancellous graft, whereas in the CPG group the defect was filled with CPG solely. After 6 weeks radiological and histomorphometrical analysis showed significantly more new bone formation in the BMC+CPG+PRP group compared to the BMC+CPG group and the CPG group. There were no significant differences between the BMC+CPG+PRP group and the autograft group. In the PRP platelets were enriched significantly about 4.7-fold compared to native blood. In BMC the count of mononuclear cells increased significantly (3.5-fold) compared to the bone marrow aspirate. This study demonstrates that the composite of BMC+CPG+PRP leads to a significantly higher bone regeneration of critical-size defects at the proximal tibia in mini-pigs than the use of BMC+CPG without PRP. Furthermore, within the limits of the present study the composite BMC+CPG+PRP represents a comparable alternative to autologous bone grafting. PMID:24950251

  6. Analysis and Visualization Tool for Targeted Amplicon Bisulfite Sequencing on Ion Torrent Sequencers

    PubMed Central

    Pabinger, Stephan; Ernst, Karina; Pulverer, Walter; Kallmeyer, Rainer; Valdes, Ana M.; Metrustry, Sarah; Katic, Denis; Nuzzo, Angelo; Kriegner, Albert; Vierlinger, Klemens; Weinhaeusel, Andreas

    2016-01-01

    Targeted sequencing of PCR amplicons generated from bisulfite deaminated DNA is a flexible, cost-effective way to study methylation of a sample at single CpG resolution and perform subsequent multi-target, multi-sample comparisons. Currently, no platform specific protocol, support, or analysis solution is provided to perform targeted bisulfite sequencing on a Personal Genome Machine (PGM). Here, we present a novel tool, called TABSAT, for analyzing targeted bisulfite sequencing data generated on Ion Torrent sequencers. The workflow starts with raw sequencing data, performs quality assessment, and uses a tailored version of Bismark to map the reads to a reference genome. The pipeline visualizes results as lollipop plots and is able to deduce specific methylation-patterns present in a sample. The obtained profiles are then summarized and compared between samples. In order to assess the performance of the targeted bisulfite sequencing workflow, 48 samples were used to generate 53 different Bisulfite-Sequencing PCR amplicons from each sample, resulting in 2,544 amplicon targets. We obtained a mean coverage of 282X using 1,196,822 aligned reads. Next, we compared the sequencing results of these targets to the methylation level of the corresponding sites on an Illumina 450k methylation chip. The calculated average Pearson correlation coefficient of 0.91 confirms the sequencing results with one of the industry-leading CpG methylation platforms and shows that targeted amplicon bisulfite sequencing provides an accurate and cost-efficient method for DNA methylation studies, e.g., to provide platform-independent confirmation of Illumina Infinium 450k methylation data. TABSAT offers a novel way to analyze data generated by Ion Torrent instruments and can also be used with data from the Illumina MiSeq platform. It can be easily accessed via the Platomics platform, which offers a web-based graphical user interface along with sample and parameter storage. TABSAT is freely available under a GNU General Public License version 3.0 (GPLv3) at https://github.com/tadkeys/tabsat/ and http://demo.platomics.com/. PMID:27467908

  7. Exploiting Semantic Web Technologies to Develop OWL-Based Clinical Practice Guideline Execution Engines.

    PubMed

    Jafarpour, Borna; Abidi, Samina Raza; Abidi, Syed Sibte Raza

    2016-01-01

    Computerizing paper-based CPG and then executing them can provide evidence-informed decision support to physicians at the point of care. Semantic web technologies especially web ontology language (OWL) ontologies have been profusely used to represent computerized CPG. Using semantic web reasoning capabilities to execute OWL-based computerized CPG unties them from a specific custom-built CPG execution engine and increases their shareability as any OWL reasoner and triple store can be utilized for CPG execution. However, existing semantic web reasoning-based CPG execution engines suffer from lack of ability to execute CPG with high levels of expressivity, high cognitive load of computerization of paper-based CPG and updating their computerized versions. In order to address these limitations, we have developed three CPG execution engines based on OWL 1 DL, OWL 2 DL and OWL 2 DL + semantic web rule language (SWRL). OWL 1 DL serves as the base execution engine capable of executing a wide range of CPG constructs, however for executing highly complex CPG the OWL 2 DL and OWL 2 DL + SWRL offer additional executional capabilities. We evaluated the technical performance and medical correctness of our execution engines using a range of CPG. Technical evaluations show the efficiency of our CPG execution engines in terms of CPU time and validity of the generated recommendation in comparison to existing CPG execution engines. Medical evaluations by domain experts show the validity of the CPG-mediated therapy plans in terms of relevance, safety, and ordering for a wide range of patient scenarios.

  8. GRASP/Ada 95: Reverse Engineering Tools for Ada

    NASA Technical Reports Server (NTRS)

    Cross, James H., II

    1996-01-01

    The GRASP/Ada project (Graphical Representations of Algorithms, Structures, and Processes for Ada) has successfully created and prototyped an algorithmic level graphical representation for Ada software, the Control Structure Diagram (CSD), and a new visualization for a fine-grained complexity metric called the Complexity Profile Graph (CPG). By synchronizing the CSD and the CPG, the CSD view of control structure, nesting, and source code is directly linked to the corresponding visualization of statement level complexity in the CPG. GRASP has been integrated with GNAT, the GNU Ada 95 Translator to provide a comprehensive graphical user interface and development environment for Ada 95. The user may view, edit, print, and compile source code as a CSD with no discernible addition to storage or computational overhead. The primary impetus for creation of the CSD was to improve the comprehension efficiency of Ada software and, as a result, improve reliability and reduce costs. The emphasis has been on the automatic generation of the CSD from Ada 95 source code to support reverse engineering and maintenance. The CSD has the potential to replace traditional prettyprinted Ada source code. The current update has focused on the design and implementation of a new Motif compliant user interface, and a new CSD generator consisting of a tagger and renderer. The Complexity Profile Graph (CPG) is based on a set of functions that describes the context, content, and the scaling for complexity on a statement by statement basis. When combined graphicafly, the result is a composite profile of complexity for the program unit. Ongoing research includes the development and refinement of the associated functions, and the development of the CPG generator prototype. The current Version 5.0 prototype provides the capability for the user to generate CSDs and CPGs from Ada 95 source code in a reverse engineering as well as forward engineering mode with a level of flexibility suitable for practical application. This report provides an overview of the GRASP/Ada project with an emphasis on the current update.

  9. The CpG Island in the Murine Foxl2 Proximal Promoter Is Differentially Methylated in Primary and Immortalized Cells

    PubMed Central

    Tran, Stella; Wang, Ying; Lamba, Pankaj; Zhou, Xiang; Boehm, Ulrich; Bernard, Daniel J.

    2013-01-01

    Forkhead box L2 (Foxl2), a member of the forkhead transcription factor family, plays important roles in pituitary follicle-stimulating hormone synthesis and in ovarian maintenance and function. Mutations in the human FOXL2 gene cause eyelid malformations and premature ovarian failure. FOXL2/Foxl2 is expressed in pituitary gonadotrope and thyrotrope cells, the perioptic mesenchyme of the developing eyelid, and ovarian granulosa cells. The mechanisms governing this cell-restricted expression have not been described. We mapped the Foxl2 transcriptional start site in immortalized murine gonadotrope-like cells, LβT2, by 5’ rapid amplification of cDNA ends and then PCR amplified approximately 1 kb of 5’ flanking sequence from murine genomic DNA. When ligated into a reporter plasmid, the proximal promoter conferred luciferase activity in both homologous (LβT2) and, unexpectedly, heterologous (NIH3T3) cells. In silico analyses identified a CpG island in the proximal promoter and 5’ untranslated region, suggesting that Foxl2 transcription might be regulated epigenetically. Indeed, pyrosequencing and quantitative analysis of DNA methylation using real-time PCR revealed Foxl2 proximal promoter hypomethylation in homologous compared to some, though not all, heterologous cell lines. The promoter was also hypomethylated in purified murine gonadotropes. In vitro promoter methylation completely silenced reporter activity in heterologous and homologous cells. Collectively, the data suggest that differential proximal promoter DNA methylation may contribute to cell-specific Foxl2 expression in some cellular contexts. However, gonadotrope-specific expression of the gene cannot be explained by promoter hypomethylation alone. PMID:24098544

  10. Synthetic Spike-in Standards Improve Run-Specific Systematic Error Analysis for DNA and RNA Sequencing

    PubMed Central

    Zook, Justin M.; Samarov, Daniel; McDaniel, Jennifer; Sen, Shurjo K.; Salit, Marc

    2012-01-01

    While the importance of random sequencing errors decreases at higher DNA or RNA sequencing depths, systematic sequencing errors (SSEs) dominate at high sequencing depths and can be difficult to distinguish from biological variants. These SSEs can cause base quality scores to underestimate the probability of error at certain genomic positions, resulting in false positive variant calls, particularly in mixtures such as samples with RNA editing, tumors, circulating tumor cells, bacteria, mitochondrial heteroplasmy, or pooled DNA. Most algorithms proposed for correction of SSEs require a data set used to calculate association of SSEs with various features in the reads and sequence context. This data set is typically either from a part of the data set being “recalibrated” (Genome Analysis ToolKit, or GATK) or from a separate data set with special characteristics (SysCall). Here, we combine the advantages of these approaches by adding synthetic RNA spike-in standards to human RNA, and use GATK to recalibrate base quality scores with reads mapped to the spike-in standards. Compared to conventional GATK recalibration that uses reads mapped to the genome, spike-ins improve the accuracy of Illumina base quality scores by a mean of 5 Phred-scaled quality score units, and by as much as 13 units at CpG sites. In addition, since the spike-in data used for recalibration are independent of the genome being sequenced, our method allows run-specific recalibration even for the many species without a comprehensive and accurate SNP database. We also use GATK with the spike-in standards to demonstrate that the Illumina RNA sequencing runs overestimate quality scores for AC, CC, GC, GG, and TC dinucleotides, while SOLiD has less dinucleotide SSEs but more SSEs for certain cycles. We conclude that using these DNA and RNA spike-in standards with GATK improves base quality score recalibration. PMID:22859977

  11. Epigenome-wide cross-tissue predictive modeling and comparison of cord blood and placental methylation in a birth cohort

    PubMed Central

    De Carli, Margherita M; Baccarelli, Andrea A; Trevisi, Letizia; Pantic, Ivan; Brennan, Kasey JM; Hacker, Michele R; Loudon, Holly; Brunst, Kelly J; Wright, Robert O; Wright, Rosalind J; Just, Allan C

    2017-01-01

    Aim: We compared predictive modeling approaches to estimate placental methylation using cord blood methylation. Materials & methods: We performed locus-specific methylation prediction using both linear regression and support vector machine models with 174 matched pairs of 450k arrays. Results: At most CpG sites, both approaches gave poor predictions in spite of a misleading improvement in array-wide correlation. CpG islands and gene promoters, but not enhancers, were the genomic contexts where the correlation between measured and predicted placental methylation levels achieved higher values. We provide a list of 714 sites where both models achieved an R2 ≥0.75. Conclusion: The present study indicates the need for caution in interpreting cross-tissue predictions. Few methylation sites can be predicted between cord blood and placenta. PMID:28234020

  12. Characterization and machine learning prediction of allele-specific DNA methylation.

    PubMed

    He, Jianlin; Sun, Ming-an; Wang, Zhong; Wang, Qianfei; Li, Qing; Xie, Hehuang

    2015-12-01

    A large collection of Single Nucleotide Polymorphisms (SNPs) has been identified in the human genome. Currently, the epigenetic influences of SNPs on their neighboring CpG sites remain elusive. A growing body of evidence suggests that locus-specific information, including genomic features and local epigenetic state, may play important roles in the epigenetic readout of SNPs. In this study, we made use of mouse methylomes with known SNPs to develop statistical models for the prediction of SNP associated allele-specific DNA methylation (ASM). ASM has been classified into parent-of-origin dependent ASM (P-ASM) and sequence-dependent ASM (S-ASM), which comprises scattered-S-ASM (sS-ASM) and clustered-S-ASM (cS-ASM). We found that P-ASM and cS-ASM CpG sites are both enriched in CpG rich regions, promoters and exons, while sS-ASM CpG sites are enriched in simple repeat and regions with high frequent SNP occurrence. Using Lasso-grouped Logistic Regression (LGLR), we selected 21 out of 282 genomic and methylation related features that are powerful in distinguishing cS-ASM CpG sites and trained the classifiers with machine learning techniques. Based on 5-fold cross-validation, the logistic regression classifier was found to be the best for cS-ASM prediction with an ACC of 0.77, an AUC of 0.84 and an MCC of 0.54. Lastly, we applied the logistic regression classifier on human brain methylome and predicted 608 genes associated with cS-ASM. Gene ontology term enrichment analysis indicated that these cS-ASM associated genes are significantly enriched in the category coding for transcripts with alternative splicing forms. In summary, this study provided an analytical procedure for cS-ASM prediction and shed new light on the understanding of different types of ASM events. Published by Elsevier Inc.

  13. VEZF1 Elements Mediate Protection from DNA Methylation

    PubMed Central

    Strogantsev, Ruslan; Gaszner, Miklos; Hair, Alan; Felsenfeld, Gary; West, Adam G.

    2010-01-01

    There is growing consensus that genome organization and long-range gene regulation involves partitioning of the genome into domains of distinct epigenetic chromatin states. Chromatin insulator or barrier elements are key components of these processes as they can establish boundaries between chromatin states. The ability of elements such as the paradigm β-globin HS4 insulator to block the range of enhancers or the spread of repressive histone modifications is well established. Here we have addressed the hypothesis that a barrier element in vertebrates should be capable of defending a gene from silencing by DNA methylation. Using an established stable reporter gene system, we find that HS4 acts specifically to protect a gene promoter from de novo DNA methylation. Notably, protection from methylation can occur in the absence of histone acetylation or transcription. There is a division of labor at HS4; the sequences that mediate protection from methylation are separable from those that mediate CTCF-dependent enhancer blocking and USF-dependent histone modification recruitment. The zinc finger protein VEZF1 was purified as the factor that specifically interacts with the methylation protection elements. VEZF1 is a candidate CpG island protection factor as the G-rich sequences bound by VEZF1 are frequently found at CpG island promoters. Indeed, we show that VEZF1 elements are sufficient to mediate demethylation and protection of the APRT CpG island promoter from DNA methylation. We propose that many barrier elements in vertebrates will prevent DNA methylation in addition to blocking the propagation of repressive histone modifications, as either process is sufficient to direct the establishment of an epigenetically stable silent chromatin state. PMID:20062523

  14. DNA methylation of the filaggrin gene adds to the risk of eczema associated with loss-of-function variants

    PubMed Central

    Ziyab, A. H.; Karmaus, W.; Holloway, J. W.; Zhang, H.; Ewart, S.; Arshad, S. H.

    2012-01-01

    Background Loss-of-function variants within the filaggrin gene (FLG) are associated with a dysfunctional skin barrier that contributes to the development of eczema. Epigenetic modifications, such as DNA methylation, are genetic regulatory mechanisms that modulate gene expression without changing the DAN sequence. Objectives To investigate whether genetic variants and adjacent differential DNA methylation within the FLG gene synergistically act on the development of eczema. Methods A subsample (n = 245, only females aged 18 years) of the Isle of Wight birth cohort participants (n = 1,456) had available information for FLG variants R501X, 2282del4, and S3247X and DNA methylation levels for 10 CpG sites within the FLG gene. Log-binomial regression was used to estimate the risk ratios (RRs) of eczema associated with FLG variants at different methylation levels. Results The period prevalence of eczema was 15.2% at age 18 years and 9.0% of participants were carriers (heterozygous) of FLG variants. Of the 10 CpG sites spanning the genomic region of FLG, methylation levels of CpG site ‘cg07548383’ showed a significant interaction with FLG sequence variants on the risk for eczema. At 86% methylation level, filaggrin haploinsufficient individuals had 5.48-fold increased risk of eczema when compared to those with wild type FLG genotype (p-value = 0.0008). Conclusions Our novel results indicated that the association between FLG loss-of-function variants and eczema is modulated by DNA methylation. Simultaneously assessing the joint effect of genetic and epigenetic factors within the FLG gene further highlights the importance of this genomic region for eczema manifestation. PMID:23003573

  15. Association of mitofusin 2 methylation and essential hypertension: a case-control study in a Chinese population.

    PubMed

    Jin, Fei; Li, Xiao; Wang, Zuoguang; Liu, Ya; Liu, Jielin; Sun, Dongdong; Jin, Yongxin; Wang, Shiqi; Wen, Shaojun; Wei, Yongxiang

    2018-06-07

    Mitofusin 2 (Mfn2), a gene that negatively regulates the proliferation of vascular smooth muscle cells (VSMCs), is expressed at low levels in the VSMCs of hypertensive patients. DNA methylation can inhibit gene expression. The purpose of this study was to investigate the relationship between Mfn2 methylation and essential hypertension (EH). After bioinformatics analysis, five EH patients and five normal control (NC) subjects were selected for methylation chip screening. Then, bisulfite DNA sequencing was used to analyze the methylation status of differentially methylated fragments of Mfn2 in 40 EH patients and 36 NC subjects. Mfn2 mRNA expression in the blood was detected by RT-qPCR. There were three CpG islands in the full length Mfn2 DNA sequence and some transcription factor binding sites in these regions, including Sp1, Ap2, GATA box, NF-κB, etc. The chip screening showed that only the third CpG island had a significantly high degree of methylation. Subsequent verification experiments found that the EH group had a significantly lower C base rate of methylation than the NC group (2.5% vs. 44.44%, P < 0.0001), but a similar CpG methylation rate (P > 0.05). RT-qPCR detection showed that the level of Mfn2 mRNA expression was significantly lower in the EH group than in the NC group (P = 0.013). Further association analysis showed that the level of Mfn2 methylation was associated with systolic blood pressure and diastolic blood pressure (r = -0.902, r = -0.713, respectively) but not the other indexes. The DNA methylation level of Mfn2 was significantly lower in hypertensive patients than in control subjects, which may be an independent risk factor for EH.

  16. COBRA-Seq: Sensitive and Quantitative Methylome Profiling

    PubMed Central

    Varinli, Hilal; Statham, Aaron L.; Clark, Susan J.; Molloy, Peter L.; Ross, Jason P.

    2015-01-01

    Combined Bisulfite Restriction Analysis (COBRA) quantifies DNA methylation at a specific locus. It does so via digestion of PCR amplicons produced from bisulfite-treated DNA, using a restriction enzyme that contains a cytosine within its recognition sequence, such as TaqI. Here, we introduce COBRA-seq, a genome wide reduced methylome method that requires minimal DNA input (0.1–1.0 μg) and can either use PCR or linear amplification to amplify the sequencing library. Variants of COBRA-seq can be used to explore CpG-depleted as well as CpG-rich regions in vertebrate DNA. The choice of enzyme influences enrichment for specific genomic features, such as CpG-rich promoters and CpG islands, or enrichment for less CpG dense regions such as enhancers. COBRA-seq coupled with linear amplification has the additional advantage of reduced PCR bias by producing full length fragments at high abundance. Unlike other reduced representative methylome methods, COBRA-seq has great flexibility in the choice of enzyme and can be multiplexed and tuned, to reduce sequencing costs and to interrogate different numbers of sites. Moreover, COBRA-seq is applicable to non-model organisms without the reference genome and compatible with the investigation of non-CpG methylation by using restriction enzymes containing CpA, CpT, and CpC in their recognition site. PMID:26512698

  17. The Healthy Weight Commitment Foundation Pledge

    PubMed Central

    Ng, Shu Wen; Popkin, Barry M.

    2014-01-01

    Context An independent evaluation of the Healthy Weight Commitment Foundation (HWCF) marketplace pledge found that the participating companies met and exceeded their interim 2012 sales reduction pledge. Evidence acquisition This follow-up study conducted in 2013 used purchase data from 2000–2012 among U.S. households with children and compared trends in calorie purchases of HWCF, non-HWCF name brands, and private label (PL) products in the pre-pledge period (2000–2007) and the post-pledge period (2008–2012); controlled for potential effects of concurrent changes in demographic and economic factors, including the Great Recession and food prices; and assessed whether the HWCF marketplace pledge was associated with reductions in consumer packaged goods (CPG) calorie purchases by households with children. Evidence synthesis There has been a significant per capita decline in average daily CPG caloric purchases between 2000 and 2012 among households with children from all brand categories. Based on pre-pledge trends, declines in CPG caloric purchases were already occurring. However, post-pledge reductions in calories purchased from HWCF brands were less than expected, and reductions in calories purchased from non-HWCF name brands and PLs were greater than expected after economic, sociodemographic, and secular factors were accounted for. Conclusions If the 16 HWCF companies had been able to maintain their pre-pledge trajectory, there should have been an additional 42 kcals/capita/day reduction in calories purchased from HWCF products in 2012 among households with children. A lack of change in total CPG calories purchased between 2011 and 2012 calls into question the sustainability of the decline and a need for continued monitoring. PMID:25240968

  18. Promoter methylation assay of SASH1 gene in hepatocellular carcinoma.

    PubMed

    Peng, Liu; Wei, He; Liren, Li

    2014-01-01

    To analyse the relationship between the expression of SASH1 and its methylation level in human hepatocellular carcinoma. Expression levels of SASH1 were examined with real-time PCR (RT-PCR) in tissues and cells, and methylation analysis was performed with MassArray. The expression levels of SASH1 were strongly reduced in liver cancer tissues compared with adjacent normal tissues. Quantitative methylation analysis by MassArray revealed different CpG sites in SASH1 promoter shared similar methylation pattern between liver cancer tissues and adjacent normal tissues and the CpG sites of significant difference in methylation level were found as follows: CpG_3, CpG_17, CpG_21.22, CpG_25, CpG_26.27, CpG_28, CpG_34.35.36 and CpG_51.52. Moreover, 5-aza-2'-deoxycytidine treatment of Hep-G2 cell line caused significant elevation of SASH1 mRNA. Based on these data, we propose that increase of DNA methylation degree in the promoter region of SASH1 gene, particularly CpG_26.27 sites, possibly repressed SASH1 expression in liver cancer.

  19. Spreadsheet-based program for alignment of overlapping DNA sequences.

    PubMed

    Anbazhagan, R; Gabrielson, E

    1999-06-01

    Molecular biology laboratories frequently face the challenge of aligning small overlapping DNA sequences derived from a long DNA segment. Here, we present a short program that can be used to adapt Excel spreadsheets as a tool for aligning DNA sequences, regardless of their orientation. The program runs on any Windows or Macintosh operating system computer with Excel 97 or Excel 98. The program is available for use as an Excel file, which can be downloaded from the BioTechniques Web site. Upon execution, the program opens a specially designed customized workbook and is capable of identifying overlapping regions between two sequence fragments and displaying the sequence alignment. It also performs a number of specialized functions such as recognition of restriction enzyme cutting sites and CpG island mapping without costly specialized software.

  20. Conserved DNA methylation patterns in healthy blood cells and extensive changes in leukemia measured by a new quantitative technique

    PubMed Central

    Jelinek, Jaroslav; Liang, Shoudan; Lu, Yue; He, Rong; Ramagli, Louis S.; Shpall, Elizabeth J.; Estecio, Marcos R.H.; Issa, Jean-Pierre J.

    2012-01-01

    Genome wide analysis of DNA methylation provides important information in a variety of diseases, including cancer. Here, we describe a simple method, Digital Restriction Enzyme Analysis of Methylation (DREAM), based on next generation sequencing analysis of methylation-specific signatures created by sequential digestion of genomic DNA with SmaI and XmaI enzymes. DREAM provides information on 150,000 unique CpG sites, of which 39,000 are in CpG islands and 30,000 are at transcription start sites of 13,000 RefSeq genes. We analyzed DNA methylation in healthy white blood cells and found methylation patterns to be remarkably uniform. Inter individual differences > 30% were observed only at 227 of 28,331 (0.8%) of autosomal CpG sites. Similarly, > 30% differences were observed at only 59 sites when we comparing the cord and adult blood. These conserved methylation patterns contrasted with extensive changes affecting 18–40% of CpG sites in a patient with acute myeloid leukemia and in two leukemia cell lines. The method is cost effective, quantitative (r2 = 0.93 when compared with bisulfite pyrosequencing) and reproducible (r2 = 0.997). Using 100-fold coverage, DREAM can detect differences in methylation greater than 10% or 30% with a false positive rate below 0.05 or 0.001, respectively. DREAM can be useful in quantifying epigenetic effects of environment and nutrition, correlating developmental epigenetic variation with phenotypes, understanding epigenetics of cancer and chronic diseases, measuring the effects of drugs on DNA methylation or deriving new biological insights into mammalian genomes. PMID:23075513

  1. Enhanced sensitivity of CpG island search and primer design based on predicted CpG island position.

    PubMed

    Park, Hyun-Chul; Ahn, Eu-Ree; Jung, Ju Yeon; Park, Ji-Hye; Lee, Jee Won; Lim, Si-Keun; Kim, Won

    2018-05-01

    DNA methylation has important biological roles, such as gene expression regulation, as well as practical applications in forensics, such as in body fluid identification and age estimation. DNA methylation often occurs in the CpG site, and methylation within the CpG islands affects various cellular functions and is related to tissue-specific identification. Several programs have been developed to identify CpG islands; however, the size, location, and number of predicted CpG islands are not identical due to different search algorithms. In addition, they only provide structural information for predicted CpG islands without experimental information, such as primer design. We developed an analysis pipeline package, CpGPNP, to integrate CpG island prediction and primer design. CpGPNP predicts CpG islands more accurately and sensitively than other programs, and designs primers easily based on the predicted CpG island locations. The primer design function included standard, bisulfite, and methylation-specific PCR to identify the methylation of particular CpG sites. In this study, we performed CpG island prediction on all chromosomes and compared CpG island search performance of CpGPNP with other CpG island prediction programs. In addition, we compared the position of primers designed for a specific region within the predicted CpG island using other bisulfite PCR primer programs. The primers designed by CpGPNP were used to experimentally verify the amplification of the target region of markers for body fluid identification and age estimation. CpGPNP is freely available at http://forensicdna.kr/cpgpnp/. Copyright © 2018 Elsevier B.V. All rights reserved.

  2. Identification of a boron nitride nanosphere-binding peptide for the intracellular delivery of CpG oligodeoxynucleotides

    NASA Astrophysics Data System (ADS)

    Zhang, Huijie; Yamazaki, Tomohiko; Zhi, Chunyi; Hanagata, Nobutaka

    2012-09-01

    CpG oligonucleotides (CpG ODNs) interact with Toll-like receptor 9 (TLR9), which results in the induction of immunostimulatory cytokines. We delivered CpG ODNs intracellularly using boron nitride nanospheres (BNNS). To enhance the loading capacity of CpG ODNs on BNNS, we used a phage display technique to identify a 12-amino acid peptide designated as BP7, with specific affinity for BNNS, and used it as a linker to load CpG ODNs on BNNS. The tyrosine residue (Y) at the eighth position from the N-terminus played a crucial role in the affinity of BP7 to BNNS. BNNS that bound BP7 (BNNS-BP7) were taken up by cells and showed no cytotoxicity, and CpG ODNs were successfully crosslinked with BP7 to create BP7-CpG ODN conjugates. Using BP7 as a linker, the loading efficiency of CpG ODNs on BNNS increased 5-fold compared to the direct binding of CpG ODNs to BNNS. Furthermore, the BP7-CpG ODN conjugate-loaded BNNS had a greater capacity to induce interleukin-6 (IL-6) and tumor necrosis factor-alpha (TNF-α) production from peripheral blood mononuclear cells (PBMCs) than that of CpG ODNs directly loaded on BNNS. The higher amount of cytokine induction by BP7-CpG ODN conjugate-loaded BNNS may be attributed to a higher loading capacity and stronger binding to BNNS of the linker BP7. The greater functionality of BP7-conjugated CpG ODNs on BNNS expands the potential of BNNS for drug delivery applications.CpG oligonucleotides (CpG ODNs) interact with Toll-like receptor 9 (TLR9), which results in the induction of immunostimulatory cytokines. We delivered CpG ODNs intracellularly using boron nitride nanospheres (BNNS). To enhance the loading capacity of CpG ODNs on BNNS, we used a phage display technique to identify a 12-amino acid peptide designated as BP7, with specific affinity for BNNS, and used it as a linker to load CpG ODNs on BNNS. The tyrosine residue (Y) at the eighth position from the N-terminus played a crucial role in the affinity of BP7 to BNNS. BNNS that bound BP7 (BNNS-BP7) were taken up by cells and showed no cytotoxicity, and CpG ODNs were successfully crosslinked with BP7 to create BP7-CpG ODN conjugates. Using BP7 as a linker, the loading efficiency of CpG ODNs on BNNS increased 5-fold compared to the direct binding of CpG ODNs to BNNS. Furthermore, the BP7-CpG ODN conjugate-loaded BNNS had a greater capacity to induce interleukin-6 (IL-6) and tumor necrosis factor-alpha (TNF-α) production from peripheral blood mononuclear cells (PBMCs) than that of CpG ODNs directly loaded on BNNS. The higher amount of cytokine induction by BP7-CpG ODN conjugate-loaded BNNS may be attributed to a higher loading capacity and stronger binding to BNNS of the linker BP7. The greater functionality of BP7-conjugated CpG ODNs on BNNS expands the potential of BNNS for drug delivery applications. Electronic supplementary information (ESI) available. See DOI: 10.1039/c2nr31189e

  3. Methylation analysis of plasma cell-free DNA for breast cancer early detection using bisulfite next-generation sequencing.

    PubMed

    Li, Zibo; Guo, Xinwu; Tang, Lili; Peng, Limin; Chen, Ming; Luo, Xipeng; Wang, Shouman; Xiao, Zhi; Deng, Zhongping; Dai, Lizhong; Xia, Kun; Wang, Jun

    2016-10-01

    Circulating cell-free DNA (cfDNA) has been considered as a potential biomarker for non-invasive cancer detection. To evaluate the methylation levels of six candidate genes (EGFR, GREM1, PDGFRB, PPM1E, SOX17, and WRN) in plasma cfDNA as biomarkers for breast cancer early detection, quantitative analysis of the promoter methylation of these genes from 86 breast cancer patients and 67 healthy controls was performed by using microfluidic-PCR-based target enrichment and next-generation bisulfite sequencing technology. The predictive performance of different logistic models based on methylation status of candidate genes was investigated by means of the area under the ROC curve (AUC) and odds ratio (OR) analysis. Results revealed that EGFR, PPM1E, and 8 gene-specific CpG sites showed significantly hypermethylation in cancer patients' plasma and significantly associated with breast cancer (OR ranging from 2.51 to 9.88). The AUC values for these biomarkers were ranging from 0.66 to 0.75. Combinations of multiple hypermethylated genes or CpG sites substantially improved the predictive performance for breast cancer detection. Our study demonstrated the feasibility of quantitative measurement of candidate gene methylation in cfDNA by using microfluidic-PCR-based target enrichment and bisulfite next-generation sequencing, which is worthy of further validation and potentially benefits a broad range of applications in clinical oncology practice. Quantitative analysis of methylation pattern of plasma cfDNA by next-generation sequencing might be a valuable non-invasive tool for early detection of breast cancer.

  4. Minimal doses of a sequence-optimized transgene mediate high-level and long-term EPO expression in vivo: challenging CpG-free gene design.

    PubMed

    Kosovac, D; Wild, J; Ludwig, C; Meissner, S; Bauer, A P; Wagner, R

    2011-02-01

    Advanced gene delivery techniques can be combined with rational gene design to further improve the efficiency of plasmid DNA (pDNA)-mediated transgene expression in vivo. Herein, we analyzed the influence of intragenic sequence modifications on transgene expression in vitro and in vivo using murine erythropoietin (mEPO) as a transgene model. A single electro-gene transfer of an RNA- and codon-optimized mEPOopt gene into skeletal muscle resulted in a 3- to 4-fold increase of mEPO production sustained for >1 year and triggered a significant increase in hematocrit and hemoglobin without causing adverse effects. mEPO expression and hematologic levels were significantly lower when using comparable amounts of the wild type (mEPOwt) gene and only marginal effects were induced by mEPOΔCpG lacking intragenic CpG dinucleotides, even at high pDNA amounts. Corresponding with these observations, in vitro analysis of transfected cells revealed a 2- to 3-fold increased (mEPOopt) and 50% decreased (mEPOΔCpG) erythropoietin expression compared with mEPOwt, respectively. RNA analyses demonstrated that the specific design of the transgene sequence influenced expression levels by modulating transcriptional activity and nuclear plus cytoplasmic RNA amounts rather than translation. In sum, whereas CpG depletion negatively interferes with efficient expression in postmitotic tissues, mEPOopt doses <0.5 μg were sufficient to trigger optimal long-term hematologic effects encouraging the use of sequence-optimized transgenes to further reduce effective pDNA amounts.

  5. Healthcare professionals' and policy makers' views on implementing a clinical practice guideline of hypertension management: a qualitative study.

    PubMed

    Lee, Ping Yein; Liew, Su May; Abdullah, Adina; Abdullah, Nurdiana; Ng, Chirk Jenn; Hanafi, Nik Sherina; Chia, Yook Chin; Lai, Pauline S M; Wong, Stalia S L; Khoo, Ee Ming

    2015-01-01

    Most studies have reported barriers to guideline usage mainly from doctors' perspective; few have reported the perspective of other stakeholders. This study aimed to determine the views and barriers to adherence of a national clinical practice guideline (CPG) on management of hypertension from the perspectives of policymakers, doctors and allied healthcare professionals. This study used a qualitative approach with purposive sampling. Seven in depth interviews and six focus group discussions were conducted with 35 healthcare professionals (policy makers, doctors, pharmacists and nurses) at a teaching hospital in Kuala Lumpur, Malaysia, between February and June 2013. All interviews were audio-recorded, transcribed verbatim and checked. Thematic approach was used to analyse the data. Two main themes and three sub-themes emerged from this study. The main themes were (1) variation in the use of CPG and (2) barriers to adherence to CPG. The three sub-themes for barriers were issues inherent to the CPG, systems and policy that is not supportive of CPG use, and attitudes and behaviour of stakeholders. The main users of the CPG were the primary care doctors. Pharmacists only partially use the guidelines, while nurses and policy makers were not using the CPG at all. Participants had suggested few strategies to improve usage and adherence to CPG. First, update the CPG regularly and keep its content simple with specific sections for allied health workers. Second, use technology to facilitate CPG accessibility and provide protected time for implementation of CPG recommendations. Third, incorporate local CPG in professional training, link CPG adherence to key performance indicators and provide incentives for its use. Barriers to the use of CPG hypertension management span across all stakeholders. The development and implementation of CPG focused mainly on doctors with lack of involvement of other healthcare stakeholders. Guidelines should be made simple, current, reliable, accessible, inclusive of all stakeholders and with good policy support.

  6. DNA Methylation Pyrosequencing Assay Is Applicable for the Assessment of Epigenetic Active Environmental or Clinical Relevant Chemicals

    PubMed Central

    Florea, Ana-Maria

    2013-01-01

    Exposure of cells and organisms to stressors might result in epigenetic changes. Here it is shown that investigation of DNA methylation using pyrosequencing is an alternative for in vitro and in vivo toxicological testing of epigenetic effects induced by chemicals and drugs. An in vitro evaluation of global and CpG site specific DNA methylation upon treatment of cells with chemicals/drugs is shown. Bisulfite genomic sequencing of methylation controls showed high methylation of LINE1 in methylation positive control and low methylation in the negative controls. The CpG sites within the LINE1 element are methylated at different levels. In vitro cell cultures show a methylation level ranging from 56% to 49%. Cultures of drug resistant tumor cells show significant hypomethylation as compared with the originating nonresistant tumor cells. The in vitro testing of epigenetically active chemicals (5-methyl-2'-deoxycytidine and trichostatin A) revealed a significant change of LINE1 methylation status upon treatment, while specific CpG sites were more prone to demethylation than others (focal methylation). In conclusion, DNA methylation using pyrosequencing might be used not only for testing epigenetic toxins/drugs but also in risk assessment of drugs, food, and environmental relevant pollutants. PMID:24093099

  7. Expression and methylation of BDNF in the human brain in schizophrenia.

    PubMed

    Cheah, Sern-Yih; McLeay, Robert; Wockner, Leesa F; Lawford, Bruce R; Young, Ross McD; Morris, Charles P; Voisey, Joanne

    2017-08-01

    To examine the combined effect of the BDNF Val66Met (rs6265) polymorphism and BDNF DNA methylation on transcriptional regulation of the BDNF gene. DNA methylation profiles were generated for CpG sites proximal to Val66Met, within BDNF promoter I and exon V for prefrontal cortex samples from 25 schizophrenia and 25 control subjects. Val66Met genotypes and BDNF mRNA expression data were generated by transcriptome sequencing. Expression, methylation and genotype data were correlated and examined for association with schizophrenia. There was 43% more of the BDNF V-VIII-IX transcript in schizophrenia samples. BDNF mRNA expression and DNA methylation of seven CpG sites were not associated with schizophrenia after accounting for age and PMI effects. BDNF mRNA expression and DNA methylation were not altered by Val66Met after accounting for age and PMI effects. DNA methylation of one CpG site had a marginally significant positive correlation with mRNA expression in schizophrenia subjects. Schizophrenia risk was not associated with differential BDNF mRNA expression and DNA methylation. A larger age-matched cohort with comprehensive clinical history is required to accurately identify the effects of genotype, mRNA expression and DNA methylation on schizophrenia risk.

  8. A Knowledge-Modeling Approach to Integrate Multiple Clinical Practice Guidelines to Provide Evidence-Based Clinical Decision Support for Managing Comorbid Conditions.

    PubMed

    Abidi, Samina

    2017-10-26

    Clinical management of comorbidities is a challenge, especially in a clinical decision support setting, as it requires the safe and efficient reconciliation of multiple disease-specific clinical procedures to formulate a comorbid therapeutic plan that is both effective and safe for the patient. In this paper we pursue the integration of multiple disease-specific Clinical Practice Guidelines (CPG) in order to manage co-morbidities within a computerized Clinical Decision Support System (CDSS). We present a CPG integration framework-termed as COMET (Comorbidity Ontological Modeling & ExecuTion) that manifests a knowledge management approach to model, computerize and integrate multiple CPG to yield a comorbid CPG knowledge model that upon execution can provide evidence-based recommendations for handling comorbid patients. COMET exploits semantic web technologies to achieve (a) CPG knowledge synthesis to translate a paper-based CPG to disease-specific clinical pathways (CP) that include specialized co-morbidity management procedures based on input from domain experts; (b) CPG knowledge modeling to computerize the disease-specific CP using a Comorbidity CPG ontology; (c) CPG knowledge integration by aligning multiple ontologically-modeled CP to develop a unified comorbid CPG knowledge model; and (e) CPG knowledge execution using reasoning engines to derive CPG-mediated recommendations for managing patients with comorbidities. We present a web-accessible COMET CDSS that provides family physicians with CPG-mediated comorbidity decision support to manage Atrial Fibrillation and Chronic Heart Failure. We present our qualitative and quantitative analysis of the knowledge content and usability of COMET CDSS.

  9. Modeling uncertainty in computerized guidelines using fuzzy logic.

    PubMed Central

    Jaulent, M. C.; Joyaux, C.; Colombet, I.; Gillois, P.; Degoulet, P.; Chatellier, G.

    2001-01-01

    Computerized Clinical Practice Guidelines (CPGs) improve quality of care by assisting physicians in their decision making. A number of problems emerges since patients with close characteristics are given contradictory recommendations. In this article, we propose to use fuzzy logic to model uncertainty due to the use of thresholds in CPGs. A fuzzy classification procedure has been developed that provides for each message of the CPG, a strength of recommendation that rates the appropriateness of the recommendation for the patient under consideration. This work is done in the context of a CPG for the diagnosis and the management of hypertension, published in 1997 by the French agency ANAES. A population of 82 patients with mild to moderate hypertension was selected and the results of the classification system were compared to whose given by a classical decision tree. Observed agreement is 86.6% and the variability of recommendations for patients with close characteristics is reduced. PMID:11825196

  10. An XML-based system for the flexible classification and retrieval of clinical practice guidelines.

    PubMed Central

    Ganslandt, T.; Mueller, M. L.; Krieglstein, C. F.; Senninger, N.; Prokosch, H. U.

    2002-01-01

    Beneficial effects of clinical practice guidelines (CPGs) have not yet reached expectations due to limited routine adoption. Electronic distribution and reminder systems have the potential to overcome implementation barriers. Existing electronic CPG repositories like the National Guideline Clearinghouse (NGC) provide individual access but lack standardized computer-readable interfaces necessary for automated guideline retrieval. The aim of this paper was to facilitate automated context-based selection and presentation of CPGs. Using attributes from the NGC classification scheme, an XML-based metadata repository was successfully implemented, providing document storage, classification and retrieval functionality. Semi-automated extraction of attributes was implemented for the import of XML guideline documents using XPath. A hospital information system interface was exemplarily implemented for diagnosis-based guideline invocation. Limitations of the implemented system are discussed and possible future work is outlined. Integration of standardized computer-readable search interfaces into existing CPG repositories is proposed. PMID:12463831

  11. Characterization of the differentially methylated region of the Impact gene that exhibits Glires-specific imprinting.

    PubMed

    Okamura, Kohji; Wintle, Richard F; Scherer, Stephen W

    2008-01-01

    Imprinted genes are exclusively expressed from one of the two parental alleles in a parent-of-origin-specific manner. In mammals, nearly 100 genes are documented to be imprinted. To understand the mechanism behind this gene regulation and to identify novel imprinted genes, common features of DNA sequences have been analyzed; however, the general features required for genomic imprinting have not yet been identified, possibly due to variability in underlying molecular mechanisms from locus to locus. We performed a thorough comparative genomic analysis of a single locus, Impact, which is imprinted only in Glires (rodents and lagomorphs). The fact that Glires and primates diverged from each other as recent as 70 million years ago makes comparisons between imprinted and non-imprinted orthologues relatively reliable. In species from the Glires clade, Impact bears a differentially methylated region, whereby the maternal allele is hypermethylated. Analysis of this region demonstrated that imprinting was not associated with the presence of direct tandem repeats nor with CpG dinucleotide density. In contrast, a CpG periodicity of 8 bp was observed in this region in species of the Glires clade compared to those of carnivores, artiodactyls, and primates. We show that tandem repeats are dispensable, establishment of the differentially methylated region does not rely on G+C content and CpG density, and the CpG periodicity of 8 bp is meaningful to the imprinting. This interval has recently been reported to be optimal for de novo methylation by the Dnmt3a-Dnmt3L complex, suggesting its importance in the establishment of imprinting in Impact and other genes.

  12. Characterization and expression of cyp19a gene in the Chinese giant salamander Andrias davidianus.

    PubMed

    Hu, Qiaomu; Xiao, Hanbing; Tian, HaiFeng; Meng, Yan

    2016-02-01

    We cloned the full length cyp19a of Chinese giant salamander Andrias davidianus, determined its distribution in tissues and developing gonads, and analyzed the CpG methylation pattern of the cyp19a promoter. The results revealed isoforms of 1706 bp (G arom) and 1698 bp (B arom) in length, differing in the 5' flanking region, both encoding 502 amino acids. The G arom gene was observed mainly in the ovary and kidney, with little in other investigated tissues, while B arom expression was high in the brain, ovary, testis, and pituitary, with low or undetected expression in other examined tissues. Total aromatase expression was high in the ovary; moderate in the kidney, brain, testis, and pituitary; and low in the remaining tissues. G arom expression was significantly higher in the ovary than in the testis and gradually decreased with maturation of the salamander. A single injection of methyltestosterone or letrozole resulted in ovarian G arom expression decreasing over a 12-96 h period. A 1366 bp sequence of the cyp19a promoter was cloned and shown to be conserved in selected species. CpG methylation level was negatively correlated with cyp19a expression in the examined tissues and developing ovaries. Five and three CpG methylation sites positively correlated with DNA methylation levels in tissues and developing ovary, suggesting that they play an important role in regulating cyp19a expression. The aromatase gene showed two isoforms with distinct expression patterns, and the promoter methylation level at specific CpG sites was associated with variation in expression profiles of tissues and developing ovaries. Copyright © 2015 Elsevier Inc. All rights reserved.

  13. SU94. Allele-Specific and Trauma-Related Epigenetic Changes in the FKBP5 Gene: Differences Between Psychotic Patients and Healthy Controls

    PubMed Central

    Mihaljevic, Marina; Franic, Dusica; Soldatovic, Ivan; Andric, Sanja; Mirjanic, Tijana; Novakovic, Ivana; Adzic, Miroslav; Maric, Nadja

    2017-01-01

    Abstract Background: Hypothalamic-pituitary-adrenal (HPA) axis dysregulation is a proposed etiological mechanism of psychosis. Recent studies highlighted impact of the FKBP5 gene and its functional variant rs1360780, which risk (T) allele affects the activity of HPA axis following stress exposure, on psychotic patients exposed to early trauma (1). Additionally, risk allele and trauma dependent FKBP5 demethylation in intron 7 was observed in traumatized individuals (2). Thus, the purpose of this pilot study was to investigate influence of the risk allele and trauma on FKBP5 DNA methylation levels at intron 7 in psychotic patients and to compare it with healthy individuals. Methods: The sample consisted of 24 psychosis spectrum patients and 24 controls matched by age and gender. All participants were genotyped for rs1360780 and divided into 2 groups depending on the presence of the risk allele (risk and nonrisk group). DNA methylation levels at 3 CpG sites (CpG1, CpG2, and CpG3) in intron 7 were analyzed by Sanger sequencing. Early-life adversities were measured by Childhood Trauma Questionnaire. Pearson correlation and t test were performed as appropriate. Results: Analyses revealed decreased FKBP5 methylation at targeted CpG sites and averaged methylation level (AML) at intron 7 in patients compared to controls (P = .026, P = .017, P = .027, and P = .003, respectively). Decreased AML and methylation at CpG3 were observed comparing risk and nonrisk patients’ groups (P = .018 and P = .016, respectively). Additionally, decreased methylation was found in risk patients’ group compared to risk controls’ group. No differences were found comparing nonrisk groups. Furthermore, strong negative associations between trauma and methylation at CpG3 and AML were observed only in risk controls’ group (r = −0.707, P = .007; r = −0.741, P = .004, respectively). Conclusion: Our preliminary results revealed allele-specific epigenetic changes of the FKBP5 gene in psychotic patients, which is in line with previous reports in traumatized individuals. Trauma-related demethylation in risk controls’ group supports the hypothesis that psychotic and stress-related conditions could share common neurobiological underlying mechanism, such as HPA axis dysregulation, particularly in individuals with genetic predisposition for altered stress response. References 1.Daskalakis NP, Binder EB. Schizophrenia in the spectrum of gene-stress interactions: the FKBP5 example. Schizophr Bull. 2015;41:323–329. 2.Klengel T, Mehta D, Anacker C et al. Allele-specific FKBP5 DNA demethylation mediates gene-childhood trauma interactions. Nat Neurosci. 2013;16:33–41.

  14. Effectiveness of guideline dissemination and implementation strategies on health care professionals' behaviour and patient outcomes in the cancer care context: a systematic review protocol.

    PubMed

    Tomasone, Jennifer R; Chaudhary, Rushil; Brouwers, Melissa C

    2015-08-25

    Health care professionals (HCPs) are able to make effective decisions regarding patient care through the use of systematically developed clinical practice guidelines (CPGs). These recommendations are especially important in a cancer health care context as patients are exposed to a multitude of interdisciplinary HCPs offering high-quality care throughout diagnosis, treatment, survivorship and palliative care. Although a large number of CPGs targeted towards cancer are widely disseminated, it is unknown whether implementation strategies targeting the use of these guidelines are effective in effecting HCP behaviour and patient outcomes in the cancer care context. The purpose of this systematic review will be to determine the effectiveness of different CPG dissemination and implementation interventions on HCPs' behaviour and patient outcomes in the cancer health care context. Five electronic databases (CINAHL, the Cochrane Controlled Trials Register, MEDLINE via Ovid, EMBASE via Ovid and PsycINFO via Ovid) will be searched to include all studies examining the dissemination and/or implementation of CPGs in a cancer care setting targeting all HCPs. CPG implementation strategies will be included if the CPGs were systematically developed (e.g. literature review/evidence-informed, expert panel, evidence appraisal). The studies will be limited to randomized controlled trials, controlled clinical trials and quasi-experimental (interrupted time series, controlled before-and-after designs) studies. Two independent reviewers will assess articles for eligibility, data extraction and quality appraisal. The aim of this review is to inform cancer care health care professionals and policymakers about evidence-based implementation strategies that will allow for effective use of CPGs. PROSPERO CRD42015019331.

  15. TLR9-ERK-mTOR signaling is critical for autophagic cell death induced by CpG oligodeoxynucleotide 107 combined with irradiation in glioma cells

    PubMed Central

    Li, Xiaoli; Cen, Yanyan; Cai, Yongqing; Liu, Tao; Liu, Huan; Cao, Guanqun; Liu, Dan; Li, Bin; Peng, Wei; Zou, Jintao; Pang, Xueli; Zheng, Jiang; Zhou, Hong

    2016-01-01

    Synthetic oligodeoxynucleotides containing unmethylated CpG dinucleotides (CpG ODN) function as potential radiosensitizers for glioma treatment, although the underlying mechanism is unclear. It was observed that CpG ODN107, when combined with irradiation, did not induce apoptosis. Herein, the effect of CpG ODN107 + irradiation on autophagy and the related signaling pathways was investigated. In vitro, CpG ODN107 + irradiation induced autophagosome formation, increased the ratio of LC3 II/LC3 I, beclin 1 and decreased p62 expression in U87 cells. Meanwhile, CpG ODN107 also increased LC3 II/LC3 I expression in U251 and CHG-5 cells. In vivo, CpG ODN107 combined with local radiotherapy induced autophagosome formation in orthotopic transplantation tumor. Investigation of the molecular mechanisms demonstrated that CpG ODN107 + irradiation increased the levels of TLR9 and p-ERK, and decreased the level of p-mTOR in glioma cells. Further, TLR9-specific siRNA could affect the expressions of p-ERK and autophagy-related proteins in glioma cells. Taken together, CpG ODN107 combined with irradiation could induce autophagic cell death, and this effect was closely related to the TLR9-ERK-mTOR signaling pathway in glioma cells, providing new insights into the investigation mechanism of CpG ODN. PMID:27251306

  16. Implementation of antibiotic use guidelines for fresh traumatic wound at Siriraj Hospital.

    PubMed

    Sirijatuphat, Rujipas; Choochan, Tanatchon; Siritongtaworn, Preecha; Sripojtham, Vipaporn; Thamlikitkul, Visanu

    2015-03-01

    To determine the effectiveness of implementing a clinical practice guideline (CPG) on antibiotic use for adults with fresh traumatic wounds who attended the trauma center at Siriraj Hospital, Bangkok. A prospective study of 600 adult patients who had fresh traumatic wounds (≤ 6 hours) was conducted at Siriraj Trauma Center from March 2013 to March 2014. The CPG was introduced to physicians, nurses and medical students by posting the CPG at the patient care areas of the trauma center. The outcomes were an appropriate classification of wounds according to the CPG recommendations, prevalence of antibiotic prescribing, incidence of wound infection and compliance with the CPG. Clean-contaminated wounds that did not need antibiotic treatment and clean-contaminated and contaminated wounds that required antibiotics were observed in 63.2, 6.7, and 30.1% ofthe patients, respectively. Antibiotics were given to 512 patients (85.3%). Infections occurred in six patients (1.0%). Antibiotic prescription according to CPG recommendations was observed for 243 patients (40.5%). The prevalence of antibiotic use in the CPG-compliant group (65.8%) was significantly less than that in the CPG-noncompliant group (98.6%) (p < 0.001). The patients in the CPG-compliant group had more contaminated wounds than those in the CPG-noncompliant group (51.4 vs. 15.7%, p < 0.001). The incidences of wound infection were very low in both groups and not significantly different (1.2 vs. 0.8%, p = 0.690). Antibiotic prophylaxis was necessary in less than 36.8% of adults with fresh traumatic wounds who attended Siriraj Trauma Center Compliance to CPG implementation using simple intervention seemed to be low. Adhering to CPG recommendations for antibiotic prophylaxis in adults with fresh traumatic wounds can reduce the unnecessary prescribing of antibiotics without increasing the rate of wound infection.

  17. Methylation Status of the Follistatin Gene at Different Development Stages of Japanese Flounder (Paralichthys olivaceus)

    NASA Astrophysics Data System (ADS)

    Huang, Yajuan; Hu, Nan; Si, Yufeng; Li, Siping; Wu, Shuxian; Zhang, Meizhao; Wen, Haishen; Li, Jifang; Li, Yun; He, Feng

    2018-06-01

    Follistatin (Fst) is a hyperplasia factor that plays a crucial role in muscle development. DNA methylation, a significant process, regulates gene expression. The aim of our study is to examine the DNA methylation and expression patterns of Fst gene at five different development stages of Japanese flounder (stage A, 7 dph; stage B, 90 dph; stage C, about 180 dph; stage D, about 24 months; stage E, about 36 months). The muscle tissue of Japanese flounder was obtained at different development stages in this experiment. DNA methylation levels in the promoter and exon 2 of Fst were determined by bisulfite sequencing, and the relative expression of the Fst gene at the five stages was measured by quantitative PCR. The results showed that the lowest methylation level was at stage A and the highest methylation level was at stage B. Moreover, the highest expression level of the Fst gene was observed at stage A. The mRNA abundance was negatively correlated with DNA methylation level. Three CpG islands in the promoter region and three CpG islands in exon 2 of Fst were found in the binding sequence of the putative transcription factor. These results offered a theoretical basis for the mechanism of Fst gene regulation to muscle development at different development stages.

  18. DNA methylation profiling for a confirmatory test for blood, saliva, semen, vaginal fluid and menstrual blood.

    PubMed

    Lee, Hwan Young; Jung, Sang-Eun; Lee, Eun Hee; Yang, Woo Ick; Shin, Kyoung-Jin

    2016-09-01

    The ability to predict the type of tissues or cells from molecular profiles of crime scene samples has important practical implications in forensics. A previously reported multiplex assay using DNA methylation markers could only discriminate between 4 types of body fluids: blood, saliva, semen, and the body fluid which originates from female reproductive organ. In the present study, we selected 15 menstrual blood-specific CpG marker candidates based on analysis of 12 genome-wide DNA methylation profiles of vaginal fluid and menstrual blood. The menstrual blood-specificity of the candidate markers was confirmed by comparison with HumanMethylation450 BeadChip array data obtained for 58 samples including 12 blood, 12 saliva, 12 semen, 3 vaginal fluid, and 19 skin epidermis samples. Among 15CpG marker candidates, 3 were located in the promoter region of the SLC26A10 gene, and 2 of them (cg09696411 and cg18069290) showed high menstrual blood specificity. DNA methylation at the 2CpG markers was further tested by targeted bisulfite sequencing of 461 additional samples including 49 blood, 52 saliva, 34 semen, 125 vaginal fluid, and 201 menstrual blood. Because the 2 markers showed menstrual blood-specific methylation patterns, we modified our previous multiplex methylation SNaPshot reaction to include these 2 markers. In addition, a blood marker cg01543184 with cross reactivity to semen was replaced with cg08792630, and a semen-specific unmethylation marker cg17621389 was removed. The resultant multiplex methylation SNaPshot allowed positive identification of blood, saliva, semen, vaginal fluid and menstrual blood using the 9CpG markers which show a methylation signal only in the target body fluids. Because of the complexity in cell composition, menstrual bloods produced DNA methylation profiles that vary with menstrual cycle and sample collection methods, which are expected to provide more insight into forensic menstrual blood test. Moreover, because the developed multiplex methylation SNaPshot reaction includes the 4CpG markers of which specificities have been confirmed by multiple studies, it will facilitate confirmatory tests for body fluids that are frequently observed in forensic casework. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  19. Genomic architecture and evolution of clear cell renal cell carcinomas defined by multiregion sequencing

    PubMed Central

    Varela, Ignacio; Fisher, Rosalie; McGranahan, Nicholas; Matthews, Nicholas; Santos, Claudio R; Martinez, Pierre; Phillimore, Benjamin; Begum, Sharmin; Rabinowitz, Adam; Spencer-Dene, Bradley; Gulati, Sakshi; Bates, Paul A; Stamp, Gordon; Pickering, Lisa; Gore, Martin; Nicol, David L; Hazell, Steven; Futreal, P Andrew; Stewart, Aengus; Swanton, Charles

    2015-01-01

    Clear cell renal carcinomas (ccRCCs) can display intratumor heterogeneity (ITH). We applied multiregion exome sequencing (M-seq) to resolve the genetic architecture and evolutionary histories of ten ccRCCs. Ultra-deep sequencing identified ITH in all cases. We found that 73–75% of identified ccRCC driver aberrations were subclonal, confounding estimates of driver mutation prevalence. ITH increased with the number of biopsies analyzed, without evidence of saturation in most tumors. Chromosome 3p loss and VHL aberrations were the only ubiquitous events. The proportion of C>T transitions at CpG sites increased during tumor progression. M-seq permits the temporal resolution of ccRCC evolution and refines mutational signatures occurring during tumor development. PMID:24487277

  20. Chitosan-coated boron nitride nanospheres enhance delivery of CpG oligodeoxynucleotides and induction of cytokines

    PubMed Central

    Zhang, Huijie; Chen, Song; Zhi, Chunyi; Yamazaki, Tomohiko; Hanagata, Nobutaka

    2013-01-01

    Background Cytosine-phosphate-guanine (CpG) oligodeoxynucleotides activate Toll-like receptor 9, leading to induction of proinflammatory cytokines, which play an important role in induction and maintenance of innate and adaptive immune responses. Previously, we have used boron nitride nanospheres (BNNS) as a carrier for delivery of unmodified CpG oligodeoxynucleotides to activate Toll-like receptor 9. However, because CpG oligodeoxynucleotides and BNNS are both negatively charged, electrostatic repulsion between them is likely to reduce the loading of CpG oligodeoxynucleotides onto BNNS. Therefore, the efficiency of uptake of CpG oligodeoxynucleotides is also limited and does not result in induction of a robust cytokine response. To ameliorate these problems, we developed a CpG oligodeoxynucleotide delivery system using chitosan-coated BNNS as a carrier. Methods To facilitate attachment of CpG oligodeoxynucleotides onto the BNNS and improve their loading capacity, we prepared positively charged BNNS by coating them with chitosan preparations of three different molecular weights and used them as carriers for delivery of CpG oligodeoxynucleotides. Results The zeta potentials of the BNNS-CS complexes were positive, and chitosan coating improved their dispersity and stability in aqueous solution compared with BNNS. The positive charge of the BNNS-CS complexes greatly improved the loading capacity and cellular uptake efficiency of CpG oligodeoxynucleotides. The loading capacity of the CpG oligodeoxynucleotides depended on the molecular weight of chitosan, which affected the positive charge density on the surface of the BNNS. CpG oligodeoxynucleotides loaded onto BNNS-CS complexes significantly enhanced production of interleukin-6 and tumor necrosis factor-α by peripheral blood mononuclear cells compared with CpG oligodeoxynucleotides directly loaded onto BNNS, or when Lipofectamine™ 2000 was used as the carrier. The molecular weight of the chitosan used to coat the BNNS affected the magnitude of cytokine induction by varying the strength of condensation of the CpG oligodeoxynucleotides. Conclusion Although the loading capacity of BNNS coated with low molecular weight chitosan preparations was the lowest of all the preparations, they induced the highest levels of cytokines. PMID:23674892

  1. Emergent central pattern generator behavior in chemical coupled two-compartment models with time delay

    NASA Astrophysics Data System (ADS)

    Li, Shanshan; Zhang, Guoshan; Wang, Jiang; Chen, Yingyuan; Deng, Bin

    2018-02-01

    This paper proposes that modified two-compartment Pinsky-Rinzel (PR) neural model can be used to develop the simple form of central pattern generator (CPG). The CPG is called as 'half-central oscillator', which constructed by two inhibitory chemical coupled PR neurons with time delay. Some key properties of PR neural model related to CPG are studied and proved to meet the requirements of CPG. Using the simple CPG network, we first study the relationship between rhythmical output and key factors, including ambient noise, sensory feedback signals, morphological character of single neuron as well as the coupling delay time. We demonstrate that, appropriate intensity noise can enhance synchronization between two coupled neurons. Different output rhythm of CPG network can be entrained by sensory feedback signals. We also show that the morphology of single neuron has strong effect on the output rhythm. The phase synchronization indexes decrease with the increase of morphology parameter's difference. Through adjusting coupled delay time, we can get absolutely phase synchronization and antiphase state of CPG. Those results of simulation show the feasibility of PR neural model as a valid CPG as well as the emergent behaviors of the particularly CPG.

  2. [Clinical practice guidelines for systemic lupus erythematosus: Recommendations for general clinical management].

    PubMed

    Trujillo-Martín, María M; Rúa-Figueroa Fernández de Larrinoa, Iñigo; Ruíz-Irastorza, Guillermo; Pego-Reigosa, José María; Sabio Sánchez, José Mario; Serrano-Aguilar, Pedro

    2016-05-06

    Systemic lupus erythematosus (SLE) is a complex rheumatic multisystemic disease of autoimmune origin with significant potential morbidity and mortality. It is one of the most common autoimmune diseases with an estimated prevalence of 20-150 cases per 100,000 inhabitants. The clinical spectrum of SLE is wide and variable both in clinical manifestations and severity. This prompted the Spanish Ministry of Health, Social Services and Equality to promote and fund the development of a clinical practice guideline (CPG) for the clinical care of SLE patients within the Programme of CPG in the National Health System which coordinates GuiaSalud. This CPG is is intended as the reference tool in the Spanish National Health System in order to support the comprehensive clinical management of people with SLE by all health professionals involved, regardless of specialty and level of care, helping to standardize and improve the quality of clinical decisions in our context in order to improve the health outcomes of the people affected. The purpose of this document is to present and discuss the rationale of the recommendations on the general management of SLE, specifically, clinical follow-up, general therapeutic approach, healthy lifestyles, photoprotection, and training programmes for patients. These recommendations are based on the best available scientific evidence, on discussion and the consensus of expert groups. Copyright © 2016 Elsevier España, S.L.U. All rights reserved.

  3. Combinations of various CpG motifs cloned into plasmid backbone modulate and enhance protective immunity of viral replicon DNA anthrax vaccines.

    PubMed

    Yu, Yun-Zhou; Ma, Yao; Xu, Wen-Hui; Wang, Shuang; Sun, Zhi-Wei

    2015-08-01

    DNA vaccines are generally weak stimulators of the immune system. Fortunately, their efficacy can be improved using a viral replicon vector or by the addition of immunostimulatory CpG motifs, although the design of these engineered DNA vectors requires optimization. Our results clearly suggest that multiple copies of three types of CpG motifs or combinations of various types of CpG motifs cloned into a viral replicon vector backbone with strong immunostimulatory activities on human PBMC are efficient adjuvants for these DNA vaccines to modulate and enhance protective immunity against anthrax, although modifications with these different CpG forms in vivo elicited inconsistent immune response profiles. Modification with more copies of CpG motifs elicited more potent adjuvant effects leading to the generation of enhanced immunity, which indicated a CpG motif dose-dependent enhancement of antigen-specific immune responses. Notably, the enhanced and/or synchronous adjuvant effects were observed in modification with combinations of two different types of CpG motifs, which provides not only a contribution to the knowledge base on the adjuvant activities of CpG motifs combinations but also implications for the rational design of optimal DNA vaccines with combinations of CpG motifs as "built-in" adjuvants. We describe an efficient strategy to design and optimize DNA vaccines by the addition of combined immunostimulatory CpG motifs in a viral replicon DNA plasmid to produce strong immune responses, which indicates that the CpG-modified viral replicon DNA plasmid may be desirable for use as vector of DNA vaccines.

  4. Polyethyleneimine-functionalized boron nitride nanospheres as efficient carriers for enhancing the immunostimulatory effect of CpG oligodeoxynucleotides

    PubMed Central

    Zhang, Huijie; Feng, Shini; Yan, Ting; Zhi, Chunyi; Gao, Xiao-Dong; Hanagata, Nobutaka

    2015-01-01

    CpG oligodeoxynucleotides (ODNs) stimulate innate and adaptive immune responses. Thus, these molecules are promising therapeutic agents and vaccine adjuvants against various diseases. In this study, we developed a novel CpG ODNs delivery system based on polyethyleneimine (PEI)-functionalized boron nitride nanospheres (BNNS). PEI was coated on the surface of BNNS via electrostatic interactions. The prepared BNNS–PEI complexes had positive zeta potential and exhibited enhanced dispersity and stability in aqueous solution. In vitro cytotoxicity assays revealed that the BNNS–PEI complexes with concentrations up to 100 μg/mL exhibited no obvious cytotoxicity. Furthermore, the positively charged surface of the BNNS–PEI complexes greatly improved the loading capacity and cellular uptake efficiency of CpG ODNs. Class B CpG ODNs loaded on the BNNS–PEI complexes enhanced the production of interleukin-6 and tumor necrosis factor-α from peripheral blood mononuclear cells compared with CpG ODNs directly loaded on BNNS. Contrary to the free CpG ODNs or CpG ODNs directly loaded on BNNS, class B CpG ODNs loaded on the BNNS–PEI complexes induced interferon-α simultaneously. PEI coating may have changed the physical form of class B CpG ODNs on BNNS, which further affected their interaction with Toll-like receptor 9 and induced interferon-α. Therefore, BNNS–PEI complexes can be used to enhance the immunostimulatory effect and therapeutic activity of CpG ODNs and the treatment of diseases requiring interleukin-6, tumor necrosis factor-α, and interferon-α. PMID:26346655

  5. Polyethyleneimine-functionalized boron nitride nanospheres as efficient carriers for enhancing the immunostimulatory effect of CpG oligodeoxynucleotides.

    PubMed

    Zhang, Huijie; Feng, Shini; Yan, Ting; Zhi, Chunyi; Gao, Xiao-Dong; Hanagata, Nobutaka

    2015-01-01

    CpG oligodeoxynucleotides (ODNs) stimulate innate and adaptive immune responses. Thus, these molecules are promising therapeutic agents and vaccine adjuvants against various diseases. In this study, we developed a novel CpG ODNs delivery system based on polyethyleneimine (PEI)-functionalized boron nitride nanospheres (BNNS). PEI was coated on the surface of BNNS via electrostatic interactions. The prepared BNNS-PEI complexes had positive zeta potential and exhibited enhanced dispersity and stability in aqueous solution. In vitro cytotoxicity assays revealed that the BNNS-PEI complexes with concentrations up to 100 μg/mL exhibited no obvious cytotoxicity. Furthermore, the positively charged surface of the BNNS-PEI complexes greatly improved the loading capacity and cellular uptake efficiency of CpG ODNs. Class B CpG ODNs loaded on the BNNS-PEI complexes enhanced the production of interleukin-6 and tumor necrosis factor-α from peripheral blood mononuclear cells compared with CpG ODNs directly loaded on BNNS. Contrary to the free CpG ODNs or CpG ODNs directly loaded on BNNS, class B CpG ODNs loaded on the BNNS-PEI complexes induced interferon-α simultaneously. PEI coating may have changed the physical form of class B CpG ODNs on BNNS, which further affected their interaction with Toll-like receptor 9 and induced interferon-α. Therefore, BNNS-PEI complexes can be used to enhance the immunostimulatory effect and therapeutic activity of CpG ODNs and the treatment of diseases requiring interleukin-6, tumor necrosis factor-α, and interferon-α.

  6. Determining coding CpG islands by identifying regions significant for pattern statistics on Markov chains.

    PubMed

    Singer, Meromit; Engström, Alexander; Schönhuth, Alexander; Pachter, Lior

    2011-09-23

    Recent experimental and computational work confirms that CpGs can be unmethylated inside coding exons, thereby showing that codons may be subjected to both genomic and epigenomic constraint. It is therefore of interest to identify coding CpG islands (CCGIs) that are regions inside exons enriched for CpGs. The difficulty in identifying such islands is that coding exons exhibit sequence biases determined by codon usage and constraints that must be taken into account. We present a method for finding CCGIs that showcases a novel approach we have developed for identifying regions of interest that are significant (with respect to a Markov chain) for the counts of any pattern. Our method begins with the exact computation of tail probabilities for the number of CpGs in all regions contained in coding exons, and then applies a greedy algorithm for selecting islands from among the regions. We show that the greedy algorithm provably optimizes a biologically motivated criterion for selecting islands while controlling the false discovery rate. We applied this approach to the human genome (hg18) and annotated CpG islands in coding exons. The statistical criterion we apply to evaluating islands reduces the number of false positives in existing annotations, while our approach to defining islands reveals significant numbers of undiscovered CCGIs in coding exons. Many of these appear to be examples of functional epigenetic specialization in coding exons.

  7. Aging as an Epigenetic Phenomenon

    PubMed Central

    Ashapkin, Vasily V.; Kutueva, Lyudmila I.; Vanyushin, Boris F.

    2017-01-01

    Introduction: Hypermethylation of genes associated with promoter CpG islands, and hypomethylation of CpG poor genes, repeat sequences, transposable elements and intergenic genome sections occur during aging in mammals. Methylation levels of certain CpG sites display strict correlation to age and could be used as “epigenetic clock” to predict biological age. Multi-substrate deacetylases SIRT1 and SIRT6 affect aging via locus-specific modulations of chromatin structure and activity of multiple regulatory proteins involved in aging. Random errors in DNA methylation and other epigenetic marks during aging increase the transcriptional noise, and thus lead to enhanced phenotypic variation between cells of the same tissue. Such variation could cause progressive organ dysfunction observed in aged individuals. Multiple experimental data show that induction of NF-κB regulated gene sets occurs in various tissues of aged mammals. Upregulation of multiple miRNAs occurs at mid age leading to downregulation of enzymes and regulatory proteins involved in basic cellular functions, such as DNA repair, oxidative phosphorylation, intermediate metabolism, and others. Conclusion: Strong evidence shows that all epigenetic systems contribute to the lifespan control in various organisms. Similar to other cell systems, epigenome is prone to gradual degradation due to the genome damage, stressful agents, and other aging factors. But unlike mutations and other kinds of the genome damage, age-related epigenetic changes could be fully or partially reversed to a “young” state. PMID:29081695

  8. Association between DNA methylation in cord blood and maternal smoking: The Hokkaido Study on Environment and Children's Health.

    PubMed

    Miyake, Kunio; Kawaguchi, Akio; Miura, Ryu; Kobayashi, Sachiko; Tran, Nguyen Quoc Vuong; Kobayashi, Sumitaka; Miyashita, Chihiro; Araki, Atsuko; Kubota, Takeo; Yamagata, Zentaro; Kishi, Reiko

    2018-04-04

    Maternal smoking is reported to cause adverse effects on the health of the unborn child, the underlying mechanism for which is thought to involve alterations in DNA methylation. We examined the effects of maternal smoking on DNA methylation in cord blood, in 247 mother-infant pairs in the Sapporo cohort of the Hokkaido Study, using the Infinium HumanMethylation 450K BeadChip. We first identified differentially methylated CpG sites with a false discovery rate (FDR) of <0.05 and the magnitude of DNA methylation changes (|β| >0.02) from the pairwise comparisons of never-smokers (Ne-S), sustained-smokers (Su-S), and stopped-smokers (St-S). Subsequently, secondary comparisons between St-S and Su-S revealed nine common sites that mapped to ACSM3, AHRR, CYP1A1, GFI1, SHANK2, TRIM36, and the intergenic region between ANKRD9 and RCOR1 in Ne-S vs. Su-S, and one common CpG site mapping to EVC2 in Ne-S vs. St-S. Further, we verified these CpG sites and examined neighbouring sites using bisulfite next-generation sequencing, except for AHRR cg21161138. These changes in DNA methylation implicate the effect of smoking cessation. Our findings add to the current knowledge of the association between DNA methylation and maternal smoking and suggest future studies for clarifying this relationship in disease development.

  9. Enhanced mucosal immune responses induced by a combined candidate mucosal vaccine based on Hepatitis A virus and Hepatitis E virus structural proteins linked to tuftsin.

    PubMed

    Gao, Yan; Su, Qiudong; Yi, Yao; Jia, Zhiyuan; Wang, Hao; Lu, Xuexin; Qiu, Feng; Bi, Shengli

    2015-01-01

    Hepatitis A virus (HAV) and Hepatitis E virus (HEV) are the most common causes of infectious hepatitis. These viruses are spread largely by the fecal-oral route and lead to clinically important disease in developing countries. To evaluate the potential of targeting hepatitis A and E infection simultaneously, a combined mucosal candidate vaccine was developed with the partial open reading frame 2 (ORF2) sequence (aa 368-607) of HEV (HE-ORF2) and partial virus protein 1 (VP1) sequence (aa 1-198) of HAV (HA-VP1), which included the viral neutralization epitopes. Tuftsin is an immunostimulatory peptide which can enhance the immunogenicity of a protein by targeting it to macrophages and dendritic cells. Here, we developed a novel combined protein vaccine by conjugating tuftsin to HE-ORF2 and HA-VP1 and used synthetic CpG oligodeoxynucleotides (ODNs) as the adjuvant. Subsequent experiments in BALB/c mice demonstrated that tuftsin enhanced the serum-specific IgG and IgA antibodies against HEV and HAV at the intestinal, vaginal and pulmonary interface when delivered intranasally. Moreover, mice from the intranasally immunized tuftsin group (HE-ORF2-tuftsin + HA-VP1-tuftsin + CpG) showed higher levels of IFN-γ-secreting splenocytes (Th1 response) and ratio of CD4+/CD8+ T cells than those of the no-tuftsin group (HE-ORF2 + HA-VP1 + CpG). Thus, the tuftsin group generated stronger humoral and cellular immune responses compared with the no-tuftsin group. Moreover, enhanced responses to the combined protein vaccine were obtained by intranasal immunization compared with intramuscular injection. By integrating HE-ORF2, HA-VP1 and tuftsin in a vaccine, this study validated an important concept for further development of a combined mucosal vaccine against hepatitis A and E infection.

  10. Neuromodulation intrinsic to the central pattern generator for escape swimming in Tritonia.

    PubMed

    Katz, P S

    1998-11-16

    Extrinsic neuromodulatory inputs to central pattern generators (CPGs) can alter the properties and synaptic interactions of neurons in those circuits and thereby modify the output of the CPG. Recent work in a number of systems has now demonstrated that neurons intrinsic to CPG can also evoke neuromodulatory actions on other members of the CPG. Such "intrinsic neuromodulation" plays a role in controlling the CPG underlying the escape swim response of the nudibrach mollusc, Tritonia diomedea. The dorsal swim interneurons (DSIs) are a bilaterally represented set of three serotonergic neurons that participate in the generation of the rhythmic swim motor program. Serotonin released from these CPG neurons functions both as a fast neurotransmitter and as a slower neuromodulator. In its modulatory role, serotonin enhances the release of neurotransmitter from another CPG neuron, C2, and also increases C2 excitability by decreasing spike frequency adaptation. These neuromodulatory actions intrinsic to the CPG may be important for the initial self-configuration of the system into a function CPG and for experience-dependent changes in the output such as behavioral sensitization and habituation.

  11. Interleukin-12- and Gamma Interferon-Dependent Protection against Malaria Conferred by CpG Oligodeoxynucleotide in Mice

    PubMed Central

    Gramzinski, Robert A.; Doolan, Denise L.; Sedegah, Martha; Davis, Heather L.; Krieg, Arthur M.; Hoffman, Stephen L.

    2001-01-01

    Unmethylated CpG dinucleotides in bacterial DNA or synthetic oligodeoxynucleotides (ODNs) cause B-cell proliferation and immunoglobulin secretion, monocyte cytokine secretion, and activation of natural killer (NK) cell lytic activity and gamma interferon (IFN-γ) secretion in vivo and in vitro. The potent Th1-like immune activation by CpG ODNs suggests a possible utility for enhancing innate immunity against infectious pathogens. We therefore investigated whether the innate immune response could protect against malaria. Treatment of mice with CpG ODN 1826 (TCCATGACGTTCCTGACGTT, with the CpG dinucleotides underlined) or 1585 (ggGGTCAACGTTGAgggggG, with g representing diester linkages and phosphorothioate linkages being to the right of lowercase letters) in the absence of antigen 1 to 2 days prior to challenge with Plasmodium yoelii sporozoites conferred sterile protection against infection. A higher level of protection was consistently induced by CpG ODN 1826 compared with CpG ODN 1585. The protective effects of both CpG ODNs were dependent on interleukin-12, as well as IFN-γ. Moreover, CD8+ T cells (but not CD4+ T cells), NK cells, and nitric oxide were implicated in the CpG ODN 1585-induced protection. These data establish that the protective mechanism induced by administration of CpG ODN 1585 in the absence of parasite antigen is similar in nature to the mechanism induced by immunization with radiation-attenuated P. yoelii sporozoites or with plasmid DNA encoding preerythrocytic-stage P. yoelii antigens. We were unable to confirm whether CD8+ T cells, NK cells, or nitric oxide were required for the CpG ODN 1826-induced protection, but this may reflect differences in the potency of the ODNs rather than a real difference in the mechanism of action of the two ODNs. This is the first report that stimulation of the innate immune system by CpG immunostimulatory motifs can confer sterile protection against malaria. PMID:11179339

  12. Whole-genome fingerprint of the DNA methylome during human B cell differentiation.

    PubMed

    Kulis, Marta; Merkel, Angelika; Heath, Simon; Queirós, Ana C; Schuyler, Ronald P; Castellano, Giancarlo; Beekman, Renée; Raineri, Emanuele; Esteve, Anna; Clot, Guillem; Verdaguer-Dot, Néria; Duran-Ferrer, Martí; Russiñol, Nuria; Vilarrasa-Blasi, Roser; Ecker, Simone; Pancaldi, Vera; Rico, Daniel; Agueda, Lidia; Blanc, Julie; Richardson, David; Clarke, Laura; Datta, Avik; Pascual, Marien; Agirre, Xabier; Prosper, Felipe; Alignani, Diego; Paiva, Bruno; Caron, Gersende; Fest, Thierry; Muench, Marcus O; Fomin, Marina E; Lee, Seung-Tae; Wiemels, Joseph L; Valencia, Alfonso; Gut, Marta; Flicek, Paul; Stunnenberg, Hendrik G; Siebert, Reiner; Küppers, Ralf; Gut, Ivo G; Campo, Elías; Martín-Subero, José I

    2015-07-01

    We analyzed the DNA methylome of ten subpopulations spanning the entire B cell differentiation program by whole-genome bisulfite sequencing and high-density microarrays. We observed that non-CpG methylation disappeared upon B cell commitment, whereas CpG methylation changed extensively during B cell maturation, showing an accumulative pattern and affecting around 30% of all measured CpG sites. Early differentiation stages mainly displayed enhancer demethylation, which was associated with upregulation of key B cell transcription factors and affected multiple genes involved in B cell biology. Late differentiation stages, in contrast, showed extensive demethylation of heterochromatin and methylation gain at Polycomb-repressed areas, and genes with apparent functional impact in B cells were not affected. This signature, which has previously been linked to aging and cancer, was particularly widespread in mature cells with an extended lifespan. Comparing B cell neoplasms with their normal counterparts, we determined that they frequently acquire methylation changes in regions already undergoing dynamic methylation during normal B cell differentiation.

  13. Carbon nanotubes enhance CpG uptake and potentiate antiglioma immunity.

    PubMed

    Zhao, Dongchang; Alizadeh, Darya; Zhang, Leying; Liu, Wei; Farrukh, Omar; Manuel, Edwin; Diamond, Don J; Badie, Behnam

    2011-02-15

    Stimulation of toll-like receptor-9 (TLR9) by CpG oligodeoxynucleotides (CpG) has been shown to counteract the immunosuppressive microenvironment and to inhibit tumor growth in glioma models. Because TLR9 is located intracellularly, we hypothesized that methods that enhance its internalization may also potentiate its immunostimulatory response. The goal of this study was to evaluate carbon nanotubes (CNT) as a CpG delivery vehicle in brain tumor models. Functionalized single-walled CNTs were conjugated with CpG (CNT-CpG) and evaluated in vitro and in mice bearing intracranial GL261 gliomas. Flow cytometry was used to assess CNT-CpG uptake and antiglioma immune response. Tumor growth was measured by bioluminescent imaging, histology, and animal survival. CNT-CpG was nontoxic and enhanced CpG uptake both in vitro and intracranial gliomas. CNT-mediated CpG delivery also potentiated proinflammatory cytokine production by primary monocytes. Interestingly, a single intracranial injection of low-dose CNT-CpG (but not free CpG or blank CNT) eradicated intracranial GL261 gliomas in half of tumor-bearing mice. Moreover, surviving animals exhibited durable tumor-free remission (>3 months), and were protected from intracranial tumor rechallenge, demonstrating induction of long-term antitumor immunity. These findings suggest that CNTs can potentiate CpG immunopotency by enhancing its delivery into tumor-associated inflammatory cells. ©2010 AACR.

  14. CpG Dinucleotide Frequencies Reveal the Role of Host Methylation Capabilities in Parvovirus Evolution

    PubMed Central

    Upadhyay, Mohita; Samal, Jasmine; Kandpal, Manish; Vasaikar, Suhas; Biswas, Banhi; Gomes, James

    2013-01-01

    Parvoviruses are rapidly evolving viruses that infect a wide range of hosts, including vertebrates and invertebrates. Extensive methylation of the parvovirus genome has been recently demonstrated. A global pattern of methylation of CpG dinucleotides is seen in vertebrate genomes, compared to “fractional” methylation patterns in invertebrate genomes. It remains unknown if the loss of CpG dinucleotides occurs in all viruses of a given DNA virus family that infect host species spanning across vertebrates and invertebrates. We investigated the link between the extent of CpG dinucleotide depletion among autonomous parvoviruses and the evolutionary lineage of the infected host. We demonstrate major differences in the relative abundance of CpG dinucleotides among autonomous parvoviruses which share similar genome organization and common ancestry, depending on the infected host species. Parvoviruses infecting vertebrate hosts had significantly lower relative abundance of CpG dinucleotides than parvoviruses infecting invertebrate hosts. The strong correlation of CpG dinucleotide depletion with the gain in TpG/CpA dinucleotides and the loss of TpA dinucleotides among parvoviruses suggests a major role for CpG methylation in the evolution of parvoviruses. Our data present evidence that links the relative abundance of CpG dinucleotides in parvoviruses to the methylation capabilities of the infected host. In sum, our findings support a novel perspective of host-driven evolution among autonomous parvoviruses. PMID:24109231

  15. Nanoparticle conjugation enhances the immunomodulatory effects of intranasally delivered CpG in house dust mite-allergic mice

    DOE PAGES

    Ballester, Marie; Jeanbart, Laura; de Titta, Alexandre; ...

    2015-09-21

    An emerging strategy in preventing and treating airway allergy consists of modulating the immune response induced against allergens in the lungs. CpG oligodeoxynucleotides have been investigated in airway allergy studies, but even if promising, efficacy requires further substantiation. We investigated the effect of pulmonary delivery of nanoparticle (NP)-conjugated CpG on lung immunity and found that NP-CpG led to enhanced recruitment of activated dendritic cells and to Th1 immunity compared to free CpG. We then evaluated if pulmonary delivery of NP-CpG could prevent and treat house dust mite-induced allergy by modulating immunity directly in lungs. When CpG was administered as immunomodulatorymore » therapy prior to allergen sensitization, we found that NP-CpG significantly reduced eosinophilia, IgE levels, mucus production and Th2 cytokines, while free CpG had only a moderate effect on these parameters. In a therapeutic setting where CpG was administered after allergen sensitization, we found that although both free CpG and NP-CpG reduced eosinophilia and IgE levels to the same extent, NP conjugation of CpG significantly enhanced reduction of Th2 cytokines in lungs of allergic mice. Taken together, these data highlight benefits of NP conjugation and the relevance of NP-CpG as allergen-free therapy to modulate lung immunity and treat airway allergy.« less

  16. Carbon Nanotubes Enhance CpG Uptake and Potentiate Anti-Glioma Immunity

    PubMed Central

    Zhao, Dongchang; Alizadeh, Darya; Zhang, Leying; Liu, Wei; Farrukh, Omar; Manuel, Edwin; Diamond, Don J.; Badie, Behnam

    2010-01-01

    Purpose Stimulation of toll-like receptor-9 (TLR9) by CpG oligodeoxynucleotides (CpG) has been shown to counteract the immunosuppressive microenvironment and to inhibit tumor growth in glioma models. Since TLR9 is located intracellularly, we hypothesized that methods that enhance its internalization may also potentiate its immunostimulatory response. The goal of this study was to evaluate carbon nanotubes (CNTs) as a CpG delivery vehicle in brain tumor models. Experimental Design Functionalized single-walled CNTs were conjugated with CpG (CNT-CpG) and evaluated in vitro and in mice bearing intracranial GL261 gliomas. Flow cytometry was used to assess CNT-CpG uptake and anti-glioma immune response. Tumor growth was measured by bioluminescent imaging, histology, and animal survival. Results CNT-CpG was nontoxic and enhanced CpG uptake both in vitro and intracranial gliomas. CNT-mediated CpG delivery also potentiated pro-inflammatory cytokine production by primary monocytes. Interestingly, a single intracranial injection of low-dose CNT-CpG (but not free CpG or blank CNT) eradicated intracranial GL261 gliomas in half of tumor-bearing mice. Moreover, surviving animals exhibited durable tumor-free remission (> 3 months), and were protected from intracranial tumor rechallenge, demonstrating induction of long-term anti-tumor immunity. Conclusions These findings suggest that CNTs can potentiate CpG immunopotency by enhancing its delivery into tumor-associated inflammatory cells. PMID:21088258

  17. CpG dinucleotide frequencies reveal the role of host methylation capabilities in parvovirus evolution.

    PubMed

    Upadhyay, Mohita; Samal, Jasmine; Kandpal, Manish; Vasaikar, Suhas; Biswas, Banhi; Gomes, James; Vivekanandan, Perumal

    2013-12-01

    Parvoviruses are rapidly evolving viruses that infect a wide range of hosts, including vertebrates and invertebrates. Extensive methylation of the parvovirus genome has been recently demonstrated. A global pattern of methylation of CpG dinucleotides is seen in vertebrate genomes, compared to "fractional" methylation patterns in invertebrate genomes. It remains unknown if the loss of CpG dinucleotides occurs in all viruses of a given DNA virus family that infect host species spanning across vertebrates and invertebrates. We investigated the link between the extent of CpG dinucleotide depletion among autonomous parvoviruses and the evolutionary lineage of the infected host. We demonstrate major differences in the relative abundance of CpG dinucleotides among autonomous parvoviruses which share similar genome organization and common ancestry, depending on the infected host species. Parvoviruses infecting vertebrate hosts had significantly lower relative abundance of CpG dinucleotides than parvoviruses infecting invertebrate hosts. The strong correlation of CpG dinucleotide depletion with the gain in TpG/CpA dinucleotides and the loss of TpA dinucleotides among parvoviruses suggests a major role for CpG methylation in the evolution of parvoviruses. Our data present evidence that links the relative abundance of CpG dinucleotides in parvoviruses to the methylation capabilities of the infected host. In sum, our findings support a novel perspective of host-driven evolution among autonomous parvoviruses.

  18. CpG oligodeoxynucleotide nanomedicines for the prophylaxis or treatment of cancers, infectious diseases, and allergies.

    PubMed

    Hanagata, Nobutaka

    2017-01-01

    Unmethylated cytosine-guanine dinucleotide-containing oligodeoxynucleotides (CpG ODNs), which are synthetic agonists of Toll-like receptor 9 (TLR9), activate humoral and cellular immunity and are being developed as vaccine adjuvants to prevent or treat cancers, infectious diseases, and allergies. Free CpG ODNs have been used in many clinical trials implemented to verify their effects. However, recent research has reported that self-assembled CpG ODNs, protein/peptide-CpG ODN conjugates, and nanomaterial-CpG ODN complexes demonstrate higher adjuvant effects than free CpG ODNs, owing to their improved uptake efficiency into cells expressing TLR9. Moreover, protein/peptide-CpG ODN conjugates and nanomaterial-CpG ODN complexes are able to deliver CpG ODNs and antigens (or allergens) to the same types of cells, which enables a higher degree of prophylaxis or therapeutic effect. In this review, the author describes recent trends in the research and development of CpG ODN nanomedicines containing self-assembled CpG ODNs, protein/peptide-CpG ODN conjugates, and nanomaterial-CpG ODN complexes, focusing mainly on the results of preclinical and clinical studies.

  19. Immunostimulatory Oligodeoxynucleotides Containing the CpG Motif are Effective as Immune Adjuvants in Tumor Antigen Immunization

    NASA Astrophysics Data System (ADS)

    Weiner, George J.; Liu, Hsin-Ming; Wooldridge, James E.; Dahle, Christopher E.; Krieg, Arthur M.

    1997-09-01

    Recent advances in our understanding of the immune response are allowing for the logical design of new approaches to cancer immunization. One area of interest is the development of new immune adjuvants. Immunostimulatory oligodeoxynucleotides containing the CpG motif (CpG ODN) can induce production of a wide variety of cytokines and activate B cells, monocytes, dendritic cells, and NK cells. Using the 38C13 B cell lymphoma model, we assessed whether CpG ODN can function as immune adjuvants in tumor antigen immunization. The idiotype served as the tumor antigen. Select CpG ODN were as effective as complete Freund's adjuvant at inducing an antigen-specific antibody response but were associated with less toxicity. These CpG ODN induced a higher titer of antigen-specific IgG2a than did complete Freund's adjuvant, suggesting an enhanced TH1 response. Mice immunized with CpG ODN as an adjuvant were protected from tumor challenge to a degree similar to that seen in mice immunized with complete Freund's adjuvant. We conclude that CpG ODN are effective as immune adjuvants and are attractive as part of a tumor immunization strategy.

  20. DNA containing CpG motifs induces angiogenesis

    NASA Astrophysics Data System (ADS)

    Zheng, Mei; Klinman, Dennis M.; Gierynska, Malgorzata; Rouse, Barry T.

    2002-06-01

    New blood vessel formation in the cornea is an essential step in the pathogenesis of a blinding immunoinflammatory reaction caused by ocular infection with herpes simplex virus (HSV). By using a murine corneal micropocket assay, we found that HSV DNA (which contains a significant excess of potentially bioactive "CpG" motifs when compared with mammalian DNA) induces angiogenesis. Moreover, synthetic oligodeoxynucleotides containing CpG motifs attract inflammatory cells and stimulate the release of vascular endothelial growth factor (VEGF), which in turn triggers new blood vessel formation. In vitro, CpG DNA induces the J774A.1 murine macrophage cell line to produce VEGF. In vivo CpG-induced angiogenesis was blocked by the administration of anti-mVEGF Ab or the inclusion of "neutralizing" oligodeoxynucleotides that specifically oppose the stimulatory activity of CpG DNA. These findings establish that DNA containing bioactive CpG motifs induces angiogenesis, and suggest that CpG motifs in HSV DNA may contribute to the blinding lesions of stromal keratitis.

  1. [Quality and compliance with Clinical Practice Guidelines of Chronic Noncommunicable Diseases in primary care].

    PubMed

    Poblano-Verástegui, Ofelia; Vieyra-Romero, Waldo I; Galván-García, Ángel F; Fernández-Elorriaga, María; Rodríguez-Martínez, Antonia I; Saturno-Hernández, Pedro J

    2017-01-01

    To assess the quality and compliance of clinical practice guidelines (CPG) applicable to chronic non-communicable diseases (CNCD) in primary healthcare (CS), and views of staff on the barriers, facilitators and their use. 18 valued CPG with AGREEII, 3 are selected to develop indicators and assess compliance using lot quality acceptance sample (LQAS, standard 75 / 95% threshold 40 / 75% respectively, α:0. 05, β:0. 10) on 5 CS. 70 professionals surveyed about knowledge and use of CPG. Average quality of the CPG was 57.2%; low rating in domains: "Applicability" (<25%), "Stakeholder involvement" (43.5%) and "Rigour of development" (55.0%). Compliance in CS ranges from 39 to 53.4%. Professionals show uneven knowledge of CPG; 44 to 45% (according to CPG), they declare that they are not used, they identify as main barriers the lack of training, and their difficult accessibility and management. The quality and implementation of evaluated CPG is deficient constituting an opportunity of improvement in health services.

  2. DNA-inorganic hybrid nanovaccine for cancer immunotherapy

    NASA Astrophysics Data System (ADS)

    Zhu, Guizhi; Liu, Yijing; Yang, Xiangyu; Kim, Young-Hwa; Zhang, Huimin; Jia, Rui; Liao, Hsien-Shun; Jin, Albert; Lin, Jing; Aronova, Maria; Leapman, Richard; Nie, Zhihong; Niu, Gang; Chen, Xiaoyuan

    2016-03-01

    Cancer evolves to evade or compromise the surveillance of the immune system, and cancer immunotherapy aims to harness the immune system in order to inhibit cancer development. Unmethylated CpG dinucleotide-containing oligonucleotides (CpG), a class of potent adjuvants that activate the toll-like receptor 9 (TLR9) located in the endolysosome of many antigen-presenting cells (APCs), are promising for cancer immunotherapy. However, clinical application of synthetic CpG confronts many challenges such as suboptimal delivery into APCs, unfavorable pharmacokinetics caused by limited biostability and short in vivo half-life, and side effects associated with leaking of CpG into the systemic circulation. Here we present DNA-inorganic hybrid nanovaccines (hNVs) for efficient uptake into APCs, prolonged tumor retention, and potent immunostimulation and cancer immunotherapy. hNVs were self-assembled from concatemer CpG analogs and magnesium pyrophosphate (Mg2PPi). Mg2PPi renders hNVs resistant to nuclease degradation and thermal denaturation, both of which are demanding characteristics for effective vaccination and the storage and transportation of vaccines. Fluorophore-labeled hNVs were tracked to be efficiently internalized into the endolysosomes of APCs, where Mg2PPi was dissolved in an acidic environment and thus CpG analogs were exposed to hNVs. Internalized hNVs in APCs led to (1) elevated secretion of proinflammatory factors, and (2) elevated expression of co-stimulatory factors. Compared with molecular CpG, hNVs dramatically prolonged the tissue retention of CpG analogs and reduced splenomegaly, a common side effect of CpG. In a melanoma mouse model, two injections of hNVs significantly inhibited the tumor growth and outperformed the molecular CpG. These results suggest hNVs are promising for cancer immunotherapy.Cancer evolves to evade or compromise the surveillance of the immune system, and cancer immunotherapy aims to harness the immune system in order to inhibit cancer development. Unmethylated CpG dinucleotide-containing oligonucleotides (CpG), a class of potent adjuvants that activate the toll-like receptor 9 (TLR9) located in the endolysosome of many antigen-presenting cells (APCs), are promising for cancer immunotherapy. However, clinical application of synthetic CpG confronts many challenges such as suboptimal delivery into APCs, unfavorable pharmacokinetics caused by limited biostability and short in vivo half-life, and side effects associated with leaking of CpG into the systemic circulation. Here we present DNA-inorganic hybrid nanovaccines (hNVs) for efficient uptake into APCs, prolonged tumor retention, and potent immunostimulation and cancer immunotherapy. hNVs were self-assembled from concatemer CpG analogs and magnesium pyrophosphate (Mg2PPi). Mg2PPi renders hNVs resistant to nuclease degradation and thermal denaturation, both of which are demanding characteristics for effective vaccination and the storage and transportation of vaccines. Fluorophore-labeled hNVs were tracked to be efficiently internalized into the endolysosomes of APCs, where Mg2PPi was dissolved in an acidic environment and thus CpG analogs were exposed to hNVs. Internalized hNVs in APCs led to (1) elevated secretion of proinflammatory factors, and (2) elevated expression of co-stimulatory factors. Compared with molecular CpG, hNVs dramatically prolonged the tissue retention of CpG analogs and reduced splenomegaly, a common side effect of CpG. In a melanoma mouse model, two injections of hNVs significantly inhibited the tumor growth and outperformed the molecular CpG. These results suggest hNVs are promising for cancer immunotherapy. Electronic supplementary information (ESI) available: ESI materials and methods, characterization of hNVs. See DOI: 10.1039/c5nr08821f

  3. Aberrant signature methylome by DNMT1 hot spot mutation in hereditary sensory and autonomic neuropathy 1E.

    PubMed

    Sun, Zhifu; Wu, Yanhong; Ordog, Tamas; Baheti, Saurabh; Nie, Jinfu; Duan, Xiaohui; Hojo, Kaori; Kocher, Jean-Pierre; Dyck, Peter J; Klein, Christopher J

    2014-08-01

    DNA methyltransferase 1 (DNMT1) is essential for DNA methylation, gene regulation and chromatin stability. We previously discovered DNMT1 mutations cause hereditary sensory and autonomic neuropathy type 1 with dementia and hearing loss (HSAN1E; OMIM 614116). HSAN1E is the first adult-onset neurodegenerative disorder caused by a defect in a methyltransferase gene. HSAN1E patients appear clinically normal until young adulthood, then begin developing the characteristic symptoms involving central and peripheral nervous systems. Some HSAN1E patients also develop narcolepsy and it has recently been suggested that HSAN1E is allelic to autosomal dominant cerebellar ataxia, deafness, with narcolepsy (ADCA-DN; OMIM 604121), which is also caused by mutations in DNMT1. A hotspot mutation Y495C within the targeting sequence domain of DNMT1 has been identified among HSAN1E patients. The mutant DNMT1 protein shows premature degradation and reduced DNA methyltransferase activity. Herein, we investigate genome-wide DNA methylation at single-base resolution through whole-genome bisulfite sequencing of germline DNA in 3 pairs of HSAN1E patients and their gender- and age-matched siblings. Over 1 billion 75-bp single-end reads were generated for each sample. In the 3 affected siblings, overall methylation loss was consistently found in all chromosomes with X and 18 being most affected. Paired sample analysis identified 564,218 differentially methylated CpG sites (DMCs; P<0.05), of which 300 134 were intergenic and 264 084 genic CpGs. Hypomethylation was predominant in both genic and intergenic regions, including promoters, exons, most CpG islands, L1, L2, Alu, and satellite repeats and simple repeat sequences. In some CpG islands, hypermethylated CpGs outnumbered hypomethylated CpGs. In 201 imprinted genes, there were more DMCs than in non-imprinted genes and most were hypomethylated. Differentially methylated region (DMR) analysis identified 5649 hypomethylated and 1872 hypermethylated regions. Importantly, pathway analysis revealed 1693 genes associated with the identified DMRs were highly associated in diverse neurological disorders and NAD+/NADH metabolism pathways is implicated in the pathogenesis. Our results provide novel insights into the epigenetic mechanism of neurodegeneration arising from a hotspot DNMT1 mutation and reveal pathways potentially important in a broad category of neurological and psychological disorders.

  4. Aberrant signature methylome by DNMT1 hot spot mutation in hereditary sensory and autonomic neuropathy 1E

    PubMed Central

    Sun, Zhifu; Wu, Yanhong; Ordog, Tamas; Baheti, Saurabh; Nie, Jinfu; Duan, Xiaohui; Hojo, Kaori; Kocher, Jean-Pierre; Dyck, Peter J; Klein, Christopher J

    2014-01-01

    DNA methyltransferase 1 (DNMT1) is essential for DNA methylation, gene regulation and chromatin stability. We previously discovered DNMT1 mutations cause hereditary sensory and autonomic neuropathy type 1 with dementia and hearing loss (HSAN1E; OMIM 614116). HSAN1E is the first adult-onset neurodegenerative disorder caused by a defect in a methyltransferase gene. HSAN1E patients appear clinically normal until young adulthood, then begin developing the characteristic symptoms involving central and peripheral nervous systems. Some HSAN1E patients also develop narcolepsy and it has recently been suggested that HSAN1E is allelic to autosomal dominant cerebellar ataxia, deafness, with narcolepsy (ADCA-DN; OMIM 604121), which is also caused by mutations in DNMT1. A hotspot mutation Y495C within the targeting sequence domain of DNMT1 has been identified among HSAN1E patients. The mutant DNMT1 protein shows premature degradation and reduced DNA methyltransferase activity. Herein, we investigate genome-wide DNA methylation at single-base resolution through whole-genome bisulfite sequencing of germline DNA in 3 pairs of HSAN1E patients and their gender- and age-matched siblings. Over 1 billion 75-bp single-end reads were generated for each sample. In the 3 affected siblings, overall methylation loss was consistently found in all chromosomes with X and 18 being most affected. Paired sample analysis identified 564,218 differentially methylated CpG sites (DMCs; P < 0.05), of which 300 134 were intergenic and 264 084 genic CpGs. Hypomethylation was predominant in both genic and intergenic regions, including promoters, exons, most CpG islands, L1, L2, Alu, and satellite repeats and simple repeat sequences. In some CpG islands, hypermethylated CpGs outnumbered hypomethylated CpGs. In 201 imprinted genes, there were more DMCs than in non-imprinted genes and most were hypomethylated. Differentially methylated region (DMR) analysis identified 5649 hypomethylated and 1872 hypermethylated regions. Importantly, pathway analysis revealed 1693 genes associated with the identified DMRs were highly associated in diverse neurological disorders and NAD+/NADH metabolism pathways is implicated in the pathogenesis. Our results provide novel insights into the epigenetic mechanism of neurodegeneration arising from a hotspot DNMT1 mutation and reveal pathways potentially important in a broad category of neurological and psychological disorders. PMID:25033457

  5. Exposure to welding fumes is associated with hypomethylation of the F2RL3 gene: a cardiovascular disease marker

    PubMed Central

    Hossain, Mohammad B; Li, Huiqi; Hedmer, Maria; Tinnerberg, Håkan; Albin, Maria; Broberg, Karin

    2015-01-01

    Background Welders are at risk for cardiovascular disease. Recent studies linked tobacco smoke exposure to hypomethylation of the F2RL3 (coagulation factor II (thrombin) receptor-like 3) gene, a marker for cardiovascular disease prognosis and mortality. However, whether welding fumes cause hypomethylation of F2RL3 remains unknown. Methods We investigated 101 welders (median span of working as a welder: 7 years) and 127 unexposed controls (non-welders with no obvious exposure to respirable dust at work), age range 23–60 years, all currently non-smoking, in Sweden. The participants were interviewed about their work history, lifestyle factors and diseases. Personal sampling of respirable dust was performed for the welders. DNA methylation of F2RL3 in blood was assessed by pyrosequencing of four CpG sites, CpG_2 (corresponds to cg03636183) to CpG_5, in F2RL3. Multivariable linear regression analysis was used to assess the association between exposure to welding fumes and F2RL3 methylation. Results Welders had 2.6% lower methylation of CpG_5 than controls (p<0.001). Higher concentrations of measured respirable dust among the welders were associated with hypomethylation of CpG_2, CpG_4 and CpG_5 (β=−0.49 to −1.4, p<0.012); p<0.029 adjusted for age, previous smoking, passive smoking, education, current residence and respirator use. Increasing the number of years working as a welder was associated with hypomethylation of CpG_4 (linear regression analysis, β=−0.11, p=0.039, adjusted for previous smoking). Previous tobacco smokers had 1.5–4.7% (p<0.014) lower methylation of 3 of the 4 CpG sites in F2RL3 (CpG_2, CpG_4 and CpG_5) compared to never-smokers. A non-significant lower risk of cardiovascular disease with more methylation was observed for all CpG sites. Conclusions Welding fumes exposure and previous smoking were associated with F2RL3 hypomethylation. This finding links low-to-moderate exposure to welding fumes to adverse effects on the cardiovascular system, and suggests a potential mechanistic pathway for this link, via epigenetic effects on F2RL3 expression. PMID:26395445

  6. Association of the CpG Methylation Pattern of the Proximal Insulin Gene Promoter with Type 1 Diabetes

    PubMed Central

    Fradin, Delphine; Le Fur, Sophie; Mille, Clémence; Naoui, Nadia; Groves, Chris; Zelenika, Diana; McCarthy, Mark I.; Lathrop, Mark; Bougnères, Pierre

    2012-01-01

    The insulin (INS) region is the second most important locus associated with Type 1 Diabetes (T1D). The study of the DNA methylation pattern of the 7 CpGs proximal to the TSS in the INS gene promoter revealed that T1D patients have a lower level of methylation of CpG -19, -135 and -234 (p = 2.10−16) and a higher methylation of CpG -180 than controls, while methylation was comparable for CpG -69, -102, -206. The magnitude of the hypomethylation relative to a control population was 8–15% of the corresponding levels in controls and was correlated in CpGs -19 and -135 (r = 0.77) and CpG -135 and -234 (r = 0.65). 70/485 (14%) of T1D patients had a simultaneous decrease in methylation of CpG -19, -135, -234 versus none in 317 controls. CpG methylation did not correlate with glycated hemoglobin or with T1D duration. The methylation of CpG -69, -102, -180, -206, but not CpG -19, -135, -234 was strongly influenced by the cis-genotype at rs689, a SNP known to show a strong association with T1D. We hypothesize that part of this genetic association could in fact be mediated at the statistical and functional level by the underlying changes in neighboring CpG methylation. Our observation of a CpG-specific, locus-specific methylation pattern, although it can provide an epigenetic biomarker of a multifactorial disease, does not indicate whether the reported epigenetic pattern preexists or follows the establishment of T1D. To explore the effect of chronic hyperglycemia on CpG methylation, we studied non obese patients with type 2 diabetes (T2D) who were found to have decreased CpG-19 methylation versus age-matched controls, similar to T1D (p = 2.10−6) but increased CpG-234 methylation (p = 5.10−8), the opposite of T1D. The causality and natural history of the different epigenetic changes associated with T1D or T2D remain to be determined. PMID:22567146

  7. [Comparative evaluation of clinical practice guidelines for the treatment of schizophrenia].

    PubMed

    Delessert, D; Pomini, V; Grasset, F; Baumann, P

    2008-01-01

    Many clinical practice guidelines (CPG) have been published in reply to the development of the concept of "evidence-based medicine" (EBM) and as a solution to the difficulty of synthesizing and selecting relevant medical literature. Taking into account the expansion of new CPG, the question of choice arises: which CPG to consider in a given clinical situation? It is of primary importance to evaluate the quality of the CPG, but until recently, there has been no standardized tool of evaluation or comparison of the quality of the CPG. An instrument of evaluation of the quality of the CPG, called "AGREE" for appraisal of guidelines for research and evaluation was validated in 2002. The six principal CPG concerning the treatment of schizophrenia are compared with the help of the "AGREE" instrument: (1) "the Agence nationale pour le développement de l'évaluation médicale (ANDEM) recommendations"; (2) "The American Psychiatric Association (APA) practice guideline for the treatment of patients with schizophrenia"; (3) "The quick reference guide of APA practice guideline for the treatment of patients with schizophrenia"; (4) "The schizophrenia patient outcomes research team (PORT) treatment recommendations"; (5) "The Texas medication algorithm project (T-MAP)" and (6) "The expert consensus guideline for the treatment of schizophrenia". The results of our study were then compared with those of a similar investigation published in 2005, structured on 24 CPG tackling the treatment of schizophrenia. The "AGREE" tool was also used by two investigators in their study. In general, the scores of the two studies differed little and the two global evaluations of the CPG converged; however, each of the six CPG is perfectible. The rigour of elaboration of the six CPG was in general average. The consideration of the opinion of potential users was incomplete, and an effort made in the presentation of the recommendations would facilitate their clinical use. Moreover, there was little consideration by the authors regarding the applicability of the recommendations. Globally, two CPG are considered as strongly recommended: "the quick reference guide of the APA practice guideline for the treatment of patients with schizophrenia" and "the T-MAP".

  8. Clinical practice guidelines (CPGs) reduce costs in the management of isolated splenic injuries at pediatric trauma centers.

    PubMed

    Gutierrez, Ivan M; Zurakowski, David; Chen, Qiaoli; Mooney, David P

    2013-02-01

    The American Pediatric Surgical Association Trauma Committee proposed the use of a clinical practice guideline (CPG) for the non-operative management of isolated splenic injuries in 1998. An analysis was conducted to determine the financial impact of CPGs on the management of these injuries. The Pediatric Health Information System database, which contains data from 44 children's hospitals, was used to identify children who sustained a graded isolated splenic injury between June 2005 and June 2010. Demographics, length of stay (LOS), readmission rates, and laboratory, imaging, procedural, and total cost data were determined for all hospitals verified as a pediatric trauma center by the American College of Surgeons and/or designated by their local authority. Comparisons were made between facilities self-identifying as having a splenic injury management CPG and those without a CPG. Children (1,154) with isolated splenic injuries (grades 1-4) were cared for in 26 pediatric trauma centers: 20 with a CPG and 6 without (non-CPG). Median costs were significantly lower at CPG than non-CPG centers for imaging (US $163 vs. US $641, P < .001), laboratory (US $629 vs. US $1,044, P < .001), and total hospital stay (US $9,868 vs. US $10,830, P < .001). The median LOS for CPG and non-CPG centers were similar (3 vs. 2 days, P = .38), as were readmission rates within 90 days (3.1 vs. 5.1 %, P = .21). Multiple linear regression indicated that LOS (P < .001) and utilization of a CPG (P = .007) are significant independent predictors of total cost. Utilization of a CPG to manage children with isolated splenic injuries at a pediatric trauma center results in significantly reduced imaging, laboratory, and total hospital costs independent of patient age, gender, grade, and LOS.

  9. Transparency ethics in practice: Revisiting financial conflicts of interest disclosure forms in clinical practice guidelines

    PubMed Central

    Sharara, Nour; Kaltenbach, Tonya; Laine, Loren; McQuaid, Kenneth; Soetikno, Roy; Subramanian, Venkataraman

    2017-01-01

    Background Authors of clinical practice guidelines (CPGs) disclose financial conflicts of interest (FCOIs) to promote transparency ethics. Typically, they do so on standard declaration forms containing generic open-ended questions on FCOIs. Yet, the literature is scant on the format and effect of alternative disclosure forms. Does supplementing a standard form with subsequent detailed disclosure forms tailored to the context of the CPG improve the yield or accuracy of FCOIs declarations? Methods For an international CPG in gastroenterology on the endoscopic surveillance for colorectal neoplasia in inflammatory bowel disease, we compared the use of a standard FCOIs disclosure form with a contextual FCOIs disclosure form that detailed commercial relations related to the CPG topic. This included manufacturers of endoscopes, endoscopy equipment and accessories. Participants completed the generic form early, and the supplementary contextual form six months later. We then compared the FCOI disclosures obtained. Findings 26 participants provided FCOIs disclosures using both disclosure forms. We found discrepancies regarding (1) the disclosure of FCOIs (presence/absence), and (2) the listing of financial entities. While the number of participants who disclosed a FCOI remained the same (30.8%) using the two forms, disclosures were not from the same individuals: two additional participants disclosed a FCOI, whereas two participants withdrew previous disclosures. Among those who reported a FCOI in either form, we noted inconsistencies in disclosures for 70% of the participants. This included changes in FCOIs disclosure status or modifications of "their commercial relations". Discussion Accurate reporting of FCOIs advances the transparency and ethical integrity of CPGs. Our experience suggests that a contextual FCOIs disclosure form tailored to content of the CPG with narrow, detailed questions provides supplementary, more complete FCOIs declarations than generic forms alone. The finding raises challenges on how forms are best written and formatted, optimally timed, and more effectively processed with sensitivity to professional behaviour, so as to heighten transparency. PMID:28841650

  10. Treatment of Tobacco Dependence, a Critical Gap in Czech Clinical Practice Guidelines.

    PubMed

    Zvolská, Kamila; Fraser, Keely; Zvolský, Miroslav; Králíková, Eva

    2017-06-01

    Tobacco related comorbidities and treatment of dependence are relevant to clinicians of all disciplines. Clinicians should provide a brief intervention about tobacco use with smokers at each clinical contact (success rate of 5-10 %). Intensive treatment (success rate >30%) should be available to those who need it. Brief intervention is not yet standard clinical practice. Our aim was to assess clinical practice guidelines (CPG) of selected medical professional societies to determine whether or not tobacco dependence treatment recommendations were included. Between October and December 2013, we conducted a keyword search of CPG for 20 medical professional societies in the Czech Republic. We searched for the keywords "smoking", "tobacco" and "nicotine addiction" in 91 CPG documents, which were freely available on the websites of selected professional societies. We focused specifically on CPG relating to cardiovascular and respiratory diseases as well as cancer. We excluded any CPG focused on acute conditions, diagnostics only, laboratory methods, or administration. There was no mention of smoking in 27.7% (26/94) of CPG documents. Only 16% (15/94) of CPG documents listed smoking as a risk factor. 42.5% (40/94) mentioned smoking related phrases (e.g. "smoking ban"). Only 13.8% (13/94) of CPG included a section on tobacco dependence, referenced tobacco dependence treatment guidelines or mentioned specialized treatment centres where smokers can be referred. Nearly one third of CPG related to cardiovascular and respiratory diseases as well as cancer made no mention of smoking. Despite the clinical significance of smoking, the majority of CPG did not adequately address tobacco dependence and its treatment. Copyright© by the National Institute of Public Health, Prague 2017

  11. DNA-inorganic hybrid nanovaccine for cancer immunotherapy.

    PubMed

    Zhu, Guizhi; Liu, Yijing; Yang, Xiangyu; Kim, Young-Hwa; Zhang, Huimin; Jia, Rui; Liao, Hsien-Shun; Jin, Albert; Lin, Jing; Aronova, Maria; Leapman, Richard; Nie, Zhihong; Niu, Gang; Chen, Xiaoyuan

    2016-03-28

    Cancer evolves to evade or compromise the surveillance of the immune system, and cancer immunotherapy aims to harness the immune system in order to inhibit cancer development. Unmethylated CpG dinucleotide-containing oligonucleotides (CpG), a class of potent adjuvants that activate the toll-like receptor 9 (TLR9) located in the endolysosome of many antigen-presenting cells (APCs), are promising for cancer immunotherapy. However, clinical application of synthetic CpG confronts many challenges such as suboptimal delivery into APCs, unfavorable pharmacokinetics caused by limited biostability and short in vivo half-life, and side effects associated with leaking of CpG into the systemic circulation. Here we present DNA-inorganic hybrid nanovaccines (hNVs) for efficient uptake into APCs, prolonged tumor retention, and potent immunostimulation and cancer immunotherapy. hNVs were self-assembled from concatemer CpG analogs and magnesium pyrophosphate (Mg2PPi). Mg2PPi renders hNVs resistant to nuclease degradation and thermal denaturation, both of which are demanding characteristics for effective vaccination and the storage and transportation of vaccines. Fluorophore-labeled hNVs were tracked to be efficiently internalized into the endolysosomes of APCs, where Mg2PPi was dissolved in an acidic environment and thus CpG analogs were exposed to hNVs. Internalized hNVs in APCs led to (1) elevated secretion of proinflammatory factors, and (2) elevated expression of co-stimulatory factors. Compared with molecular CpG, hNVs dramatically prolonged the tissue retention of CpG analogs and reduced splenomegaly, a common side effect of CpG. In a melanoma mouse model, two injections of hNVs significantly inhibited the tumor growth and outperformed the molecular CpG. These results suggest hNVs are promising for cancer immunotherapy.

  12. Comprehensive analysis of MGMT promoter methylation: correlation with MGMT expression and clinical response in GBM.

    PubMed

    Shah, Nameeta; Lin, Biaoyang; Sibenaller, Zita; Ryken, Timothy; Lee, Hwahyung; Yoon, Jae-Geun; Rostad, Steven; Foltz, Greg

    2011-01-07

    O⁶-methylguanine DNA-methyltransferase (MGMT) promoter methylation has been identified as a potential prognostic marker for glioblastoma patients. The relationship between the exact site of promoter methylation and its effect on gene silencing, and the patient's subsequent response to therapy, is still being defined. The aim of this study was to comprehensively characterize cytosine-guanine (CpG) dinucleotide methylation across the entire MGMT promoter and to correlate individual CpG site methylation patterns to mRNA expression, protein expression, and progression-free survival. To best identify the specific MGMT promoter region most predictive of gene silencing and response to therapy, we determined the methylation status of all 97 CpG sites in the MGMT promoter in tumor samples from 70 GBM patients using quantitative bisulfite sequencing. We next identified the CpG site specific and regional methylation patterns most predictive of gene silencing and improved progression-free survival. Using this data, we propose a new classification scheme utilizing methylation data from across the entire promoter and show that an analysis based on this approach, which we call 3R classification, is predictive of progression-free survival (HR  = 5.23, 95% CI [2.089-13.097], p<0.0001). To adapt this approach to the clinical setting, we used a methylation-specific multiplex ligation-dependent probe amplification (MS-MLPA) test based on the 3R classification and show that this test is both feasible in the clinical setting and predictive of progression free survival (HR  = 3.076, 95% CI [1.301-7.27], p = 0.007). We discuss the potential advantages of a test based on this promoter-wide analysis and compare it to the commonly used methylation-specific PCR test. Further prospective validation of these two methods in a large independent patient cohort will be needed to confirm the added value of promoter wide analysis of MGMT methylation in the clinical setting.

  13. Comprehensive Analysis of MGMT Promoter Methylation: Correlation with MGMT Expression and Clinical Response in GBM

    PubMed Central

    Shah, Nameeta; Lin, Biaoyang; Sibenaller, Zita; Ryken, Timothy; Lee, Hwahyung; Yoon, Jae-Geun; Rostad, Steven; Foltz, Greg

    2011-01-01

    O6-methylguanine DNA-methyltransferase (MGMT) promoter methylation has been identified as a potential prognostic marker for glioblastoma patients. The relationship between the exact site of promoter methylation and its effect on gene silencing, and the patient's subsequent response to therapy, is still being defined. The aim of this study was to comprehensively characterize cytosine-guanine (CpG) dinucleotide methylation across the entire MGMT promoter and to correlate individual CpG site methylation patterns to mRNA expression, protein expression, and progression-free survival. To best identify the specific MGMT promoter region most predictive of gene silencing and response to therapy, we determined the methylation status of all 97 CpG sites in the MGMT promoter in tumor samples from 70 GBM patients using quantitative bisulfite sequencing. We next identified the CpG site specific and regional methylation patterns most predictive of gene silencing and improved progression-free survival. Using this data, we propose a new classification scheme utilizing methylation data from across the entire promoter and show that an analysis based on this approach, which we call 3R classification, is predictive of progression-free survival (HR  = 5.23, 95% CI [2.089–13.097], p<0.0001). To adapt this approach to the clinical setting, we used a methylation-specific multiplex ligation-dependent probe amplification (MS-MLPA) test based on the 3R classification and show that this test is both feasible in the clinical setting and predictive of progression free survival (HR  = 3.076, 95% CI [1.301–7.27], p = 0.007). We discuss the potential advantages of a test based on this promoter-wide analysis and compare it to the commonly used methylation-specific PCR test. Further prospective validation of these two methods in a large independent patient cohort will be needed to confirm the added value of promoter wide analysis of MGMT methylation in the clinical setting. PMID:21249131

  14. Trichloroethylene-induced alterations in DNA methylation were enriched in polycomb protein binding sites in effector/memory CD4+ T cells

    PubMed Central

    Gilbert, Kathleen M.; Blossom, Sarah J.; Reisfeld, Brad; Erickson, Stephen W.; Vyas, Kanan; Maher, Mary; Broadfoot, Brannon; West, Kirk; Bai, Shasha; Cooney, Craig A.; Bhattacharyya, Sudeepa

    2017-01-01

    Abstract Exposure to industrial solvent and water pollutant trichloroethylene (TCE) can promote autoimmunity, and expand effector/memory (CD62L) CD4+ T cells. In order to better understand etiology reduced representation bisulfite sequencing was used to study how a 40-week exposure to TCE in drinking water altered methylation of ∼337 770 CpG sites across the entire genome of effector/memory CD4+ T cells from MRL+/+ mice. Regardless of TCE exposure, 62% of CpG sites in autosomal chromosomes were hypomethylated (0–15% methylation), and 25% were hypermethylated (85–100% methylation). In contrast, only 6% of the CpGs on the X chromosome were hypomethylated, and 51% had mid-range methylation levels. In terms of TCE impact, TCE altered (≥ 10%) the methylation of 233 CpG sites in effector/memory CD4+ T cells. Approximately 31.7% of these differentially methylated sites occurred in regions known to bind one or more Polycomb group (PcG) proteins, namely Ezh2, Suz12, Mtf2 or Jarid2. In comparison, only 23.3% of CpG sites not differentially methylated by TCE were found in PcG protein binding regions. Transcriptomics revealed that TCE altered the expression of ∼560 genes in the same effector/memory CD4+ T cells. At least 80% of the immune genes altered by TCE had binding sites for PcG proteins flanking their transcription start site, or were regulated by other transcription factors that were in turn ordered by PcG proteins at their own transcription start site. Thus, PcG proteins, and the differential methylation of their binding sites, may represent a new mechanism by which TCE could alter the function of effector/memory CD4+ T cells. PMID:29129997

  15. Whole Genome DNA Methylation Analysis of Obstructive Sleep Apnea: IL1R2, NPR2, AR, SP140 Methylation and Clinical Phenotype.

    PubMed

    Chen, Yung-Che; Chen, Ting-Wen; Su, Mao-Chang; Chen, Chung-Jen; Chen, Kuang-Den; Liou, Chia-Wei; Tang, Petrus; Wang, Ting-Ya; Chang, Jen-Chieh; Wang, Chin-Chou; Lin, Hsin-Ching; Chin, Chien-Hung; Huang, Kuo-Tung; Lin, Meng-Chih; Hsiao, Chang-Chun

    2016-04-01

    We hypothesized that DNA methylation patterns may contribute to disease severity or the development of hypertension and excessive daytime sleepiness (EDS) in patients with obstructive sleep apnea (OSA). Illumina's (San Diego, CA, USA) DNA methylation 27-K assay was used to identify differentially methylated loci (DML). DNA methylation levels were validated by pyrosequencing. A discovery cohort of 15 patients with OSA and 6 healthy subjects, and a validation cohort of 72 patients with sleep disordered breathing (SDB). Microarray analysis identified 636 DMLs in patients with OSA versus healthy subjects, and 327 DMLs in patients with OSA and hypertension versus those without hypertension. In the validation cohort, no significant difference in DNA methylation levels of six selected genes was found between the primary snoring subjects and OSA patients (primary outcome). However, a secondary outcome analysis showed that interleukin-1 receptor 2 (IL1R2) promoter methylation (-114 cytosine followed by guanine dinucleotide sequence [CpG] site) was decreased and IL1R2 protein levels were increased in the patients with SDB with an oxygen desaturation index > 30. Androgen receptor (AR) promoter methylation (-531 CpG site) and AR protein levels were both increased in the patients with SDB with an oxygen desaturation index > 30. Natriuretic peptide receptor 2 (NPR2) promoter methylation (-608/-618 CpG sites) were decreased, whereas levels of both NPR2 and serum C type natriuretic peptide protein were increased in the SDB patients with EDS. Speckled protein 140 (SP140) promoter methylation (-194 CpG site) was increased, and SP140 protein levels were decreased in the patients with SDB and EDS. IL1R2 hypomethylation and AR hypermethylation may constitute an important determinant of disease severity, whereas NPR2 hypomethylation and SP140 hypermethylation may provide a biomarker for vulnerability to EDS in OSA. A commentary on this article appears in this issue on page 723. © 2016 Associated Professional Sleep Societies, LLC.

  16. The effect of TLR9 agonist CpG oligodeoxynucleotides on the intestinal immune response of cobia (Rachycentron canadum).

    PubMed

    Byadgi, Omkar; Puteri, Dinda; Lee, Jai-Wei; Chang, Tsung-Chou; Lee, Yan-Horn; Chu, Chun-Yen; Cheng, Ta-Chih

    2014-01-01

    Cytosine-guanine oligodeoxynucleotide (CpG ODN) motifs of bacterial DNA are recognized through toll-like receptor 9 (TLR9) and are potent activators of innate immunity. However, the interaction between TLR9 and CpG ODN in aquatic species has not been well characterized. Hence, cobia TLR9 isoform B (RCTLR9B) was cloned and its expression and induction in intestine were investigated. RCTLR9B cDNA consists of 3113bp encoding 1009 amino acids containing three regions, leucine rich repeats, transmembrane domain, and toll/interleukin-1 receptor (TIR) domain. Intraperitoneal injection of CpG ODN 2395 upregulated RCTLR9 A and B and MyD88 and also induced the expressions of Mx, chemokine CC, and interleukin IL-1 β . Cobia intraperitoneally injected with CpG ODN 1668 and 2395 had increased survival rates after challenge with Photobacterium damselae subsp. piscicida. In addition, formulation of CpG ODN with formalin-killed bacteria (FKB) and aluminum hydroxide gel significantly increased expressions of RCTLR9 A (50 folds) and B (30 folds) isoforms at 10 dpi (CpG ODN 1668) and MyD88 (21 folds) at 6 dpv (CpG ODN 2395). Subsequently, IL-1 β increased at 6 dpv in 1668 group. No histopathological damage and inflammatory responses were observed in the injected cobia. Altogether, these results facilitate CpG ODNs as an adjuvant to increase bacterial disease resistance and efficacy of vaccines in cobia.

  17. The Effect of TLR9 Agonist CpG Oligodeoxynucleotides on the Intestinal Immune Response of Cobia (Rachycentron canadum)

    PubMed Central

    Byadgi, Omkar; Puteri, Dinda; Lee, Jai-Wei; Chang, Tsung-Chou; Lee, Yan-Horn; Chu, Chun-Yen; Cheng, Ta-Chih

    2014-01-01

    Cytosine-guanine oligodeoxynucleotide (CpG ODN) motifs of bacterial DNA are recognized through toll-like receptor 9 (TLR9) and are potent activators of innate immunity. However, the interaction between TLR9 and CpG ODN in aquatic species has not been well characterized. Hence, cobia TLR9 isoform B (RCTLR9B) was cloned and its expression and induction in intestine were investigated. RCTLR9B cDNA consists of 3113bp encoding 1009 amino acids containing three regions, leucine rich repeats, transmembrane domain, and toll/interleukin-1 receptor (TIR) domain. Intraperitoneal injection of CpG ODN 2395 upregulated RCTLR9 A and B and MyD88 and also induced the expressions of Mx, chemokine CC, and interleukin IL-1β. Cobia intraperitoneally injected with CpG ODN 1668 and 2395 had increased survival rates after challenge with Photobacterium damselae subsp. piscicida. In addition, formulation of CpG ODN with formalin-killed bacteria (FKB) and aluminum hydroxide gel significantly increased expressions of RCTLR9 A (50 folds) and B (30 folds) isoforms at 10 dpi (CpG ODN 1668) and MyD88 (21 folds) at 6 dpv (CpG ODN 2395). Subsequently, IL-1β increased at 6 dpv in 1668 group. No histopathological damage and inflammatory responses were observed in the injected cobia. Altogether, these results facilitate CpG ODNs as an adjuvant to increase bacterial disease resistance and efficacy of vaccines in cobia. PMID:24991578

  18. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ballester, Marie; Jeanbart, Laura; de Titta, Alexandre

    An emerging strategy in preventing and treating airway allergy consists of modulating the immune response induced against allergens in the lungs. CpG oligodeoxynucleotides have been investigated in airway allergy studies, but even if promising, efficacy requires further substantiation. We investigated the effect of pulmonary delivery of nanoparticle (NP)-conjugated CpG on lung immunity and found that NP-CpG led to enhanced recruitment of activated dendritic cells and to Th1 immunity compared to free CpG. We then evaluated if pulmonary delivery of NP-CpG could prevent and treat house dust mite-induced allergy by modulating immunity directly in lungs. When CpG was administered as immunomodulatorymore » therapy prior to allergen sensitization, we found that NP-CpG significantly reduced eosinophilia, IgE levels, mucus production and Th2 cytokines, while free CpG had only a moderate effect on these parameters. In a therapeutic setting where CpG was administered after allergen sensitization, we found that although both free CpG and NP-CpG reduced eosinophilia and IgE levels to the same extent, NP conjugation of CpG significantly enhanced reduction of Th2 cytokines in lungs of allergic mice. Taken together, these data highlight benefits of NP conjugation and the relevance of NP-CpG as allergen-free therapy to modulate lung immunity and treat airway allergy.« less

  19. Cadmium exposure and the epigenome

    PubMed Central

    Sanders, Alison P; Smeester, Lisa; Rojas, Daniel; DeBussycher, Tristan; Wu, Michael C; Wright, Fred A; Zhou, Yi-Hui; Laine, Jessica E; Rager, Julia E; Swamy, Geeta K; Ashley-Koch, Allison; Lynn Miranda, Marie; Fry, Rebecca C

    2014-01-01

    Cadmium (Cd) is prevalent in the environment yet understudied as a developmental toxicant. Cd partially crosses the placental barrier from mother to fetus and is linked to detrimental effects in newborns. Here we examine the relationship between levels of Cd during pregnancy and 5-methylcytosine (5mC) levels in leukocyte DNA collected from 17 mother-newborn pairs. The methylation of cytosines is an epigenetic mechanism known to impact transcriptional signaling and influence health endpoints. A methylated cytosine-guanine (CpG) island recovery assay was used to assess over 4.6 million sites spanning 16,421 CpG islands. Exposure to Cd was classified for each mother-newborn pair according to maternal blood levels and compared with levels of cotinine. Subsets of genes were identified that showed altered DNA methylation levels in their promoter regions in fetal DNA associated with levels of Cd (n = 61), cotinine (n = 366), or both (n = 30). Likewise, in maternal DNA, differentially methylated genes were identified that were associated with Cd (n = 92) or cotinine (n = 134) levels. While the gene sets were largely distinct between maternal and fetal DNA, functional similarities at the biological pathway level were identified including an enrichment of genes that encode for proteins that control transcriptional regulation and apoptosis. Furthermore, conserved DNA motifs with sequence similarity to specific transcription factor binding sites were identified within the CpG islands of the gene sets. This study provides evidence for distinct patterns of DNA methylation or “footprints” in fetal and maternal DNA associated with exposure to Cd. PMID:24169490

  20. Comprehensive analysis of genome-wide DNA methylation across human polycystic ovary syndrome ovary granulosa cell.

    PubMed

    Xu, Jiawei; Bao, Xiao; Peng, Zhaofeng; Wang, Linlin; Du, Linqing; Niu, Wenbin; Sun, Yingpu

    2016-05-10

    Polycystic ovary syndrome (PCOS) affects approximately 7% of the reproductive-age women. A growing body of evidence indicated that epigenetic mechanisms contributed to the development of PCOS. The role of DNA modification in human PCOS ovary granulosa cell is still unknown in PCOS progression. Global DNA methylation and hydroxymethylation were detected between PCOS' and controls' granulosa cell. Genome-wide DNA methylation was profiled to investigate the putative function of DNA methylaiton. Selected genes expressions were analyzed between PCOS' and controls' granulosa cell. Our results showed that the granulosa cell global DNA methylation of PCOS patients was significant higher than the controls'. The global DNA hydroxymethylation showed low level and no statistical difference between PCOS and control. 6936 differentially methylated CpG sites were identified between control and PCOS-obesity. 12245 differential methylated CpG sites were detected between control and PCOS-nonobesity group. 5202 methylated CpG sites were significantly differential between PCOS-obesity and PCOS-nonobesity group. Our results showed that DNA methylation not hydroxymethylation altered genome-wide in PCOS granulosa cell. The different methylation genes were enriched in development protein, transcription factor activity, alternative splicing, sequence-specific DNA binding and embryonic morphogenesis. YWHAQ, NCF2, DHRS9 and SCNA were up-regulation in PCOS-obesity patients with no significance different between control and PCOS-nonobesity patients, which may be activated by lower DNA methylaiton. Global and genome-wide DNA methylation alteration may contribute to different genes expression and PCOS clinical pathology.

  1. Genome-Wide Estimates of Mutation Rates and Spectrum in Schizosaccharomyces pombe Indicate CpG Sites are Highly Mutagenic Despite the Absence of DNA Methylation

    PubMed Central

    Behringer, Megan G.; Hall, David W.

    2015-01-01

    We accumulated mutations for 1952 generations in 79 initially identical, haploid lines of the fission yeast Schizosaccharomyces pombe, and then performed whole-genome sequencing to determine the mutation rates and spectrum. We captured 696 spontaneous mutations across the 79 mutation accumulation (MA) lines. We compared the mutation spectrum and rate to a recently published equivalent experiment on the same species, and to another model ascomycetous yeast, the budding yeast Saccharomyces cerevisiae. While the two species are approximately 600 million years diverged from each other, they share similar life histories, genome size and genomic G/C content. We found that Sc. pombe and S. cerevisiae have similar mutation rates, but Sc. pombe exhibits a stronger insertion bias. Intriguingly, we observed an increased mutation rate at cytosine nucleotides, specifically CpG nucleotides, which is also seen in S. cerevisiae. However, the absence of methylation in Sc. pombe and the pattern of mutation at these sites, primarily C → A as opposed to C → T, strongly suggest that the increased mutation rate is not caused by deamination of methylated cytosines. This result implies that the high mutability of CpG dinucleotides in other species may be caused in part by a methylation-independent mechanism. Many of our findings mirror those seen in the recent study, despite the use of different passaging conditions, indicating that MA is a reliable method for estimating mutation rates and spectra. PMID:26564949

  2. Purification and DNA-binding properties of the cro-type regulatory repressor protein cng encoded by the Lactobacillus plantarum phage phi g1e.

    PubMed

    Kakikawa, M; Ohkubo, S; Sakate, T; Sayama, M; Taketo, A; Kodaira, K

    2000-05-16

    The putative repressor protein Cng (10kDa on an SDS gel) for the lytic pathway of Lactobacillus plantarum phage φg1e was purified using the Escherichia coli Pt7 system, and its DNA-binding ability for the seven operator-like sequences, the GATAC-boxes (Gb1 to Gb7), was investigated in vitro. In gel-shift assays, Cng selectively bound to the DNA fragments containing the GATAC-box(es). In addition, DNase I footprinting analysis with supercoiled DNA demonstrated that Cng can specifically cover about a 25bp region centered around each of the GATAC-boxes, although two boxes, Gb4 and Gb6, were only partially protected. Moreover, protein crosslinking experiments using glutaraldehyde suggested that Cng most likely functions as a dimer. On the other hand, the binding ability of Cpg for the GATAC-boxes in supercoiled DNA was also examined under the same conditions as in Cng; unlike Cng, Cpg covered Gb4 and Gb6 completely sufficiently as well as the other five boxes. Thus, the present and previous [Kakikawa et al., Gene 215 (1998) 371-379; 242 (2000) 155-166] results indicate a possibility that the two proteins Cng and Cpg selectively bind to the GATAC-boxes that act as operators, and can decide between the lytic or lysogenic pathways through repression of the promoter activity of P(R) as well as P(L).

  3. Methylation pattern of fish lymphocystis disease virus DNA.

    PubMed

    Wagner, H; Simon, D; Werner, E; Gelderblom, H; Darai, C; Flügel, R M

    1985-03-01

    The content and distribution of 5-methylcytosine in DNA from fish lymphocystis disease virus was analyzed by high-pressure liquid chromatography, nearest-neighbor analysis, and with restriction endonucleases. We found that 22% of all C residues were methylated, including methylation of the following dinucleotide sequences: CpG to 75%, CpC to ca. 1%, and CpA to 2 to 5%. Comparison of relative digestion of viral DNA with MspI and HpaII indicated that CCGG sequences were almost completely methylated at the inner C. The degree of methylation of GCGC was much lower. The methylation pattern of fish lymphocystis disease virus DNA differed from that of the host cell DNA.

  4. Methylation pattern of fish lymphocystis disease virus DNA.

    PubMed Central

    Wagner, H; Simon, D; Werner, E; Gelderblom, H; Darai, C; Flügel, R M

    1985-01-01

    The content and distribution of 5-methylcytosine in DNA from fish lymphocystis disease virus was analyzed by high-pressure liquid chromatography, nearest-neighbor analysis, and with restriction endonucleases. We found that 22% of all C residues were methylated, including methylation of the following dinucleotide sequences: CpG to 75%, CpC to ca. 1%, and CpA to 2 to 5%. Comparison of relative digestion of viral DNA with MspI and HpaII indicated that CCGG sequences were almost completely methylated at the inner C. The degree of methylation of GCGC was much lower. The methylation pattern of fish lymphocystis disease virus DNA differed from that of the host cell DNA. Images PMID:3973962

  5. Pattern generating and reflex-like processes controlling aiming movements in the presence of inertia, damping and gravity. A theoretical note.

    PubMed

    Kalveram, K T

    1991-01-01

    A model is proposed, in which goal-directed movements of the forearm are controlled by a central pattern generator (CPG) initiated for exactly one period, and by reflex-analogous processes. Movement width is proportional to the amplitude factor of the CPG's output, and to the square of the CPG's period length. The period duration can be freely selected, thus enabling the CPG to accommodate its time scale to the period of others CPG's. Parameters which influence movement accuracy can be adjusted by means of closed control loop, which are discrete with respect to time: The time unit corresponds to the period of the CPG. For instance, momentum adjustment balances the CPG in such a manner that the velocity of the arm becomes zero on termination of the period, while gain adjustment serves to attain a correct movement length in the presence of an inertial load. Friction, stiffness and gravitational force are neutralized by additional reflex-type processes, interpretable as positive feedback loops with adjustable gain factors, using position and velocity signals.

  6. Nucleosome dynamics and maintenance of epigenetic states of CpG islands

    NASA Astrophysics Data System (ADS)

    Sneppen, Kim; Dodd, Ian B.

    2016-06-01

    Methylation of mammalian DNA occurs primarily at CG dinucleotides. These CpG sites are located nonrandomly in the genome, tending to occur within high density clusters of CpGs (islands) or within large regions of low CpG density. Cluster methylation tends to be bimodal, being dominantly unmethylated or mostly methylated. For CpG clusters near promoters, low methylation is associated with transcriptional activity, while high methylation is associated with gene silencing. Alternative CpG methylation states are thought to be stable and heritable, conferring localized epigenetic memory that allows transient signals to create long-lived gene expression states. Positive feedback where methylated CpG sites recruit enzymes that methylate nearby CpGs, can produce heritable bistability but does not easily explain that as clusters increase in size or density they change from being primarily methylated to primarily unmethylated. Here, we show that an interaction between the methylation state of a cluster and its occupancy by nucleosomes provides a mechanism to generate these features and explain genome wide systematics of CpG islands.

  7. FBXL19 recruits CDK-Mediator to CpG islands of developmental genes priming them for activation during lineage commitment

    PubMed Central

    Dimitrova, Emilia; Nakayama, Manabu; Koseki, Yoko; Konietzny, Rebecca; Kessler, Benedikt M; Koseki, Haruhiko

    2018-01-01

    CpG islands are gene regulatory elements associated with the majority of mammalian promoters, yet how they regulate gene expression remains poorly understood. Here, we identify FBXL19 as a CpG island-binding protein in mouse embryonic stem (ES) cells and show that it associates with the CDK-Mediator complex. We discover that FBXL19 recruits CDK-Mediator to CpG island-associated promoters of non-transcribed developmental genes to prime these genes for activation during cell lineage commitment. We further show that recognition of CpG islands by FBXL19 is essential for mouse development. Together this reveals a new CpG island-centric mechanism for CDK-Mediator recruitment to developmental gene promoters in ES cells and a requirement for CDK-Mediator in priming these developmental genes for activation during cell lineage commitment. PMID:29809150

  8. Exposure to welding fumes is associated with hypomethylation of the F2RL3 gene: a cardiovascular disease marker.

    PubMed

    Hossain, Mohammad B; Li, Huiqi; Hedmer, Maria; Tinnerberg, Håkan; Albin, Maria; Broberg, Karin

    2015-12-01

    Welders are at risk for cardiovascular disease. Recent studies linked tobacco smoke exposure to hypomethylation of the F2RL3 (coagulation factor II (thrombin) receptor-like 3) gene, a marker for cardiovascular disease prognosis and mortality. However, whether welding fumes cause hypomethylation of F2RL3 remains unknown. We investigated 101 welders (median span of working as a welder: 7 years) and 127 unexposed controls (non-welders with no obvious exposure to respirable dust at work), age range 23-60 years, all currently non-smoking, in Sweden. The participants were interviewed about their work history, lifestyle factors and diseases. Personal sampling of respirable dust was performed for the welders. DNA methylation of F2RL3 in blood was assessed by pyrosequencing of four CpG sites, CpG_2 (corresponds to cg03636183) to CpG_5, in F2RL3. Multivariable linear regression analysis was used to assess the association between exposure to welding fumes and F2RL3 methylation. Welders had 2.6% lower methylation of CpG_5 than controls (p<0.001). Higher concentrations of measured respirable dust among the welders were associated with hypomethylation of CpG_2, CpG_4 and CpG_5 (β=-0.49 to -1.4, p<0.012); p<0.029 adjusted for age, previous smoking, passive smoking, education, current residence and respirator use. Increasing the number of years working as a welder was associated with hypomethylation of CpG_4 (linear regression analysis, β=-0.11, p=0.039, adjusted for previous smoking). Previous tobacco smokers had 1.5-4.7% (p<0.014) lower methylation of 3 of the 4 CpG sites in F2RL3 (CpG_2, CpG_4 and CpG_5) compared to never-smokers. A non-significant lower risk of cardiovascular disease with more methylation was observed for all CpG sites. Welding fumes exposure and previous smoking were associated with F2RL3 hypomethylation. This finding links low-to-moderate exposure to welding fumes to adverse effects on the cardiovascular system, and suggests a potential mechanistic pathway for this link, via epigenetic effects on F2RL3 expression. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

  9. Rare k-mer DNA: Identification of sequence motifs and prediction of CpG island and promoter.

    PubMed

    Mohamed Hashim, Ezzeddin Kamil; Abdullah, Rosni

    2015-12-21

    Empirical analysis on k-mer DNA has been proven as an effective tool in finding unique patterns in DNA sequences which can lead to the discovery of potential sequence motifs. In an extensive study of empirical k-mer DNA on hundreds of organisms, the researchers found unique multi-modal k-mer spectra occur in the genomes of organisms from the tetrapod clade only which includes all mammals. The multi-modality is caused by the formation of the two lowest modes where k-mers under them are referred as the rare k-mers. The suppression of the two lowest modes (or the rare k-mers) can be attributed to the CG dinucleotide inclusions in them. Apart from that, the rare k-mers are selectively distributed in certain genomic features of CpG Island (CGI), promoter, 5' UTR, and exon. We correlated the rare k-mers with hundreds of annotated features using several bioinformatic tools, performed further intrinsic rare k-mer analyses within the correlated features, and modeled the elucidated rare k-mer clustering feature into a classifier to predict the correlated CGI and promoter features. Our correlation results show that rare k-mers are highly associated with several annotated features of CGI, promoter, 5' UTR, and open chromatin regions. Our intrinsic results show that rare k-mers have several unique topological, compositional, and clustering properties in CGI and promoter features. Finally, the performances of our RWC (rare-word clustering) method in predicting the CGI and promoter features are ranked among the top three, in eight of the CGI and promoter evaluations, among eight of the benchmarked datasets. Crown Copyright © 2015. Published by Elsevier Ltd. All rights reserved.

  10. MsLDR-creator: a web service to design msLDR assays.

    PubMed

    Bormann, Felix; Dahl, Andreas; Sers, Christine

    2012-03-01

    MsLDR-creator is a free web service to design assays for the new DNA methylation detection method msLDR. The service provides the user with all necessary information about the oligonucleotides required for the measurement of a given CpG within a sequence of interest. The parameters are calculated by the nearest neighbour approach to achieve optimal behaviour during the experimental procedure. In addition, to guarantee a good start using msLDR, further information, like protocols and hints and tricks, are provided.

  11. Growth Suppression and Therapy Sensitization of Breast Cancer

    DTIC Science & Technology

    2001-07-01

    toxlo wrub n th reold le e s ta bean ed dt o ia n ceth dotell fcel groth fa-Ctor andr Nunitublsoisnhedaa.Tse)gliia pposis.tse resuths areonsiten with...o p5 aenoiru i cobi fomadhyefie tmr etin frth asuaredohlilnain ih oorbci n ratn mtsttc ras ane, h cell~~~~ surac protei PECM(u.nulse aa.Ti u-ciia...Z.47 otide composition closely approximating the average of antisense JNK1 and .-48 JNK2 but contains three CpG dinucleotide sequences thereby

  12. The molecular landscape of pediatric acute myeloid leukemia reveals recurrent structural alterations and age-specific mutational interactions | Office of Cancer Genomics

    Cancer.gov

    We present the molecular landscape of pediatric acute myeloid leukemia (AML) and characterize nearly 1,000 participants in Children’s Oncology Group (COG) AML trials. The COG–National Cancer Institute (NCI) TARGET AML initiative assessed cases by whole-genome, targeted DNA, mRNA and microRNA sequencing and CpG methylation profiling. Validated DNA variants corresponded to diverse, infrequent mutations, with fewer than 40 genes mutated in >2% of cases.

  13. A CpG Oligonucleotide Can Protect Mice from a Low Aerosol Challenge Dose of Burkholderia mallei

    PubMed Central

    Waag, David M.; McCluskie, Michael J.; Zhang, Ningli; Krieg, Arthur M.

    2006-01-01

    Treatment with an oligodeoxynucleotide (ODN) containing CPG motifs (CpG ODN 7909) was found to protect BALB/c mice from lung infection or death after aerosol challenge with Burkholderia mallei. Protection was associated with enhanced levels of gamma interferon (IFN-γ)-inducible protein 10, interleukin-12 (IL-12), IFN-γ, and IL-6. Preexposure therapy with CpG ODNs may protect victims of a biological attack from glanders. PMID:16495571

  14. A CpG oligonucleotide can protect mice from a low aerosol challenge dose of Burkholderia mallei.

    PubMed

    Waag, David M; McCluskie, Michael J; Zhang, Ningli; Krieg, Arthur M

    2006-03-01

    Treatment with an oligodeoxynucleotide (ODN) containing CPG motifs (CpG ODN 7909) was found to protect BALB/c mice from lung infection or death after aerosol challenge with Burkholderia mallei. Protection was associated with enhanced levels of gamma interferon (IFN-gamma)-inducible protein 10, interleukin-12 (IL-12), IFN-gamma, and IL-6. Preexposure therapy with CpG ODNs may protect victims of a biological attack from glanders.

  15. Lack of chart reminder effectiveness on family medicine resident JNC-VI and NCEP III guideline knowledge and attitudes.

    PubMed

    Echlin, Paul S; Upshur, Ross E G; Markova, Tsveti P

    2004-07-05

    The literature demonstrates that medical residents and practicing physicians have an attitudinal-behavioral discordance concerning their positive attitudes towards clinical practice guidelines (CPG), and the implementation of these guidelines into clinical practice patterns. A pilot study was performed to determine if change in a previously identified CPG compliance factor (accessibility) would produce a significant increase in family medicine resident knowledge and attitude toward the guidelines. The primary study intervention involved placing a summary of the Sixth Report of the Joint National Committee on Prevention, Detection, Evaluation, and Treatment of High Blood Pressure (JNC VI) and the National Cholesterol Education Program Expert Panel on Detection, Evaluation, and Treatment of High Blood Cholesterol in Adults (NCEP III) CPGs in all patient (>18 yr.) charts for a period of three months. The JNC VI and NCEP III CPGs were also distributed to each Wayne State family medicine resident, and a copy of each CPG was placed in the preceptor's area of the involved clinics. Identical pre- and post- intervention questionnaires were administered to all residents concerning CPG knowledge and attitude. Post-intervention analysis failed to demonstrate a significant difference in CPG knowledge. A statistically significant post-intervention difference was found in only on attitude question. The barriers to CPG compliance were identified as 1) lack of CPG instruction; 2) lack of critical appraisal ability; 3) insufficient time; 4) lack of CPG accessibility; and 5) lack of faculty modeling. This study demonstrated no significant post intervention changes in CPG knowledge, and only one question that reflected attitude change. Wider resident access to dedicated clinic time, increased faculty modeling, and the implementation of an electronic record/reminder system that uses a team-based approach are compliance factors that should be considered for further investigation. The interpretation of CPG non-compliance will benefit from a causal matrix focused on physician knowledge, attitudes, and behavior. Recent findings in resident knowledge-behavior discordance may direct the future investigation of physician CPG non-compliance away from generalized barrier research, and toward the development of information that maximizes the sense of individual practitioner urgency and certainty.

  16. Methylation analysis of p16, SLIT2, SCARA5, and Runx3 genes in hepatocellular carcinoma

    PubMed Central

    Sun, Gaofeng; Zhang, Chen; Feng, Min; Liu, Wensheng; Xie, Huifang; Qin, Qin; Zhao, E.; Wan, Li

    2017-01-01

    Abstract This study is to investigate the methylation status of multiple tumor suppressor 1 (p16), secreted glycoprotein 2 (SLIT2), scavenger receptor class A, member 5 putative (SCARA5), and human runt-related transcription factor 3 (Runx3) genes in the peripheral blood of hepatocellular carcinoma (HCC). This is a case–control study. The peripheral blood samples were collected from 25 HCC patients, 25 patients with high risk of HCC (defined as “internal control group”), and 25 healthy individuals (defined as “external control group”), respectively. Then the methylation status of p16, SLIT2, SCARA5, and Runx3 genes in the blood samples were analyzed by pyrosequencing. The relationship between the methylation and the clinical features of HCC patients were evaluated. The methylation levels in the 7 CpG loci of p16 gene in HCC patients were low and without statistically significant difference (P > .05) compared to the control groups. Although the methylation levels of CpG3 and CpG4 in SLIT2 gene loci were higher than those of the control groups, there was no statistically significant difference (P > .05). However, the methylation rate of CpG2 locus in SCARA5 gene in HCC patients was significantly higher (P < .05). And the methylation rates of CpG1, CpG2, CpG3, CpG4, CpG5, and CpG8 in Runx3 gene in HCC patients were significantly different to that of control groups (P < .05). We also have analyzed the correlations between the CpG islands methylation of Runx3 or SCARA5 genes and the age, gender, hepatitis B, liver cirrhosis, alpha fetal protein, or hepatitis B surface antigen (HBsAg) of the HCC patients, which all showed no significant correlations (P > .05). The methylation status of SCARA5 and Runx3 genes are abnormal in HCC patients, which may further be used as molecular markers for early auxiliary diagnosis of liver cancer. PMID:29019900

  17. Spatiotemporal clustering of the epigenome reveals rules of dynamic gene regulation

    PubMed Central

    Yu, Pengfei; Xiao, Shu; Xin, Xiaoyun; Song, Chun-Xiao; Huang, Wei; McDee, Darina; Tanaka, Tetsuya; Wang, Ting; He, Chuan; Zhong, Sheng

    2013-01-01

    Spatial organization of different epigenomic marks was used to infer functions of the epigenome. It remains unclear what can be learned from the temporal changes of the epigenome. Here, we developed a probabilistic model to cluster genomic sequences based on the similarity of temporal changes of multiple epigenomic marks during a cellular differentiation process. We differentiated mouse embryonic stem (ES) cells into mesendoderm cells. At three time points during this differentiation process, we used high-throughput sequencing to measure seven histone modifications and variants—H3K4me1/2/3, H3K27ac, H3K27me3, H3K36me3, and H2A.Z; two DNA modifications—5-mC and 5-hmC; and transcribed mRNAs and noncoding RNAs (ncRNAs). Genomic sequences were clustered based on the spatiotemporal epigenomic information. These clusters not only clearly distinguished gene bodies, promoters, and enhancers, but also were predictive of bidirectional promoters, miRNA promoters, and piRNAs. This suggests specific epigenomic patterns exist on piRNA genes much earlier than germ cell development. Temporal changes of H3K4me2, unmethylated CpG, and H2A.Z were predictive of 5-hmC changes, suggesting unmethylated CpG and H3K4me2 as potential upstream signals guiding TETs to specific sequences. Several rules on combinatorial epigenomic changes and their effects on mRNA expression and ncRNA expression were derived, including a simple rule governing the relationship between 5-hmC and gene expression levels. A Sox17 enhancer containing a FOXA2 binding site and a Foxa2 enhancer containing a SOX17 binding site were identified, suggesting a positive feedback loop between the two mesendoderm transcription factors. These data illustrate the power of using epigenome dynamics to investigate regulatory functions. PMID:23033340

  18. Clinical practice guideline for Sjögren's syndrome 2017.

    PubMed

    Sumida, Takayuki; Azuma, Naoto; Moriyama, Masafumi; Takahashi, Hiroyuki; Asashima, Hiromitsu; Honda, Fumika; Abe, Saori; Ono, Yuko; Hirota, Tomoya; Hirata, Shintaro; Tanaka, Yoshiya; Shimizu, Toshimasa; Nakamura, Hideki; Kawakami, Atsushi; Sano, Hajime; Ogawa, Yoko; Tsubota, Kazuo; Ryo, Koufuchi; Saito, Ichiro; Tanaka, Akihiko; Nakamura, Seiji; Takamura, Etsuko; Tanaka, Masao; Suzuki, Katsuya; Takeuchi, Tsutomu; Yamakawa, Noriyuki; Mimori, Tsuneyo; Ohta, Akiko; Nishiyama, Susumu; Yoshihara, Toshio; Suzuki, Yasunori; Kawano, Mitsuhiro; Tomiita, Minako; Tsuboi, Hiroto

    2018-05-01

    The objective of this study is to develop clinical practice guideline (CPG) for Sjögren's syndrome (SS) based on recently available clinical and therapeutic evidences. The CPG committee for SS was organized by the Research Team for Autoimmune Diseases, Research Program for Intractable Disease of the Ministry of Health, Labor and Welfare (MHLW), Japan. The committee completed a systematic review of evidences for several clinical questions and developed CPG for SS 2017 according to the procedure proposed by the Medical Information Network Distribution Service (Minds). The recommendations and their strength were checked by the modified Delphi method. The CPG for SS 2017 has been officially approved by both Japan College of Rheumatology and the Japanese Society for SS. The CPG committee set 38 clinical questions for clinical symptoms, signs, treatment, and management of SS in pediatric, adult and pregnant patients, using the PICO (P: patients, problem, population, I: interventions, C: comparisons, controls, comparators, O: outcomes) format. A summary of evidence, development of recommendation, recommendation, and strength for these 38 clinical questions are presented in the CPG. The CPG for SS 2017 should contribute to improvement and standardization of diagnosis and treatment of SS.

  19. Substantial reduction in hospital stay of children and adolescents with diabetic ketoacidosis after implementation of Clinical Practice Guidelines in a university hospital in Saudi Arabia.

    PubMed

    Al Nemri, Abdulrahman; Amer, Yasser Sami; Gasim, Hala; Osman, Mohamed Elfaki; Aleyadhy, Ayman; Al Otaibi, Hessah; Iqbal, Shaikh Mohammed; Aljurayyan, Nasir Abdullah; Assiri, Asaad M; Babiker, Amir; Mohamed, Sarar

    2017-02-01

    We aimed to determine the effect of Clinical Practice Guideline (CPG) implementation on length of hospital stay of children and adolescents with diabetic ketoacidosis (DKA). This was a 6-year (2008-2014) case-control retrospective study conducted at King Khalid University Hospital, Riyadh, that compared patients with DKA managed using CPG with those treated before CPG implementation. There were 63 episodes of DKA in 41 patients managed using CPG compared with 40 episodes in 33 patients treated before implementation of CPG. Baseline characteristics of the 2 groups were similar (age, sex, newly diagnosed patients, recurrent DKA, DKA severity, and mean glycosylated hemoglobin). The mean length of hospital stay (±SD) was 68.6 ± 53.1 hours after implementation of CPG compared with 107.4 ± 65.6 hours before implementation (P < .001). The reduction in length of hospital stay equals to 1700 bed days saved per year per 1000 patients. Implementation of CPG for DKA decreased the length of hospital stay. © 2016 John Wiley & Sons, Ltd.

  20. [Web Visit Patterns for the Clinical Practice Guidelines for Management of Depressive Disorder and Alcohol Abuse-Dependence].

    PubMed

    Suárez-Obando, Fernando; Restrepo, Carlos Gómez

    Clinical practice guidelines (CPG) are a set of recommendations for professionals, patients, and families, in order to make decisions about health care. The CPG respond to the need for concise, accurate, practical, and up to date information. In the field of mental health, Colombia has developed three GPC; alcohol (GPC-OH), depression (GPC-TDA), and schizophrenia. To describe the Web Portal traffic related to psychiatry guidelines, with emphasis on the number of visits, distribution throughout Colombian cities, and estimating user behaviour patterns. An evaluation was made of the traffic at the Clinical Practice Guidelines Web Portal of the Ministry of Health and Social Protection between 2013 and 2015 (two years of observation since the inauguration of the Portal). Out of the 45 GPC published on the website, the CPG-OH represented 1.21% of all page views of the Portal. CPG-TDA reached 1.52% (accumulated percentage of 2.73%), being the eighth most consulted guideline, with CPG-OH being number 16. The highest mean monthly number of visits for this group of guideliness was for the CPG-OH for health professionals (353 visits/month), and the lowest was for the CPG-AD for patients and relatives (24 single visits/month). Bogotá D.C. was the city where health carers accessed the guidelines more often. The guidelines for patients and relatives were consulted more in Villavicencio, Cúcuta, Manizales, Pereira, and Pasto. The web portal partially fulfills the purpose of circulating the CPG in Colombia. The visits to the CPG of mental health is quite low, and requires better dissemination strategies that allow the use of information and communication technology. Copyright © 2016 Asociación Colombiana de Psiquiatría. Publicado por Elsevier España. All rights reserved.

  1. Intratumoral delivery of CpG-conjugated anti-MUC1 antibody enhances NK cell anti-tumor activity.

    PubMed

    Schettini, Jorge; Kidiyoor, Amritha; Besmer, Dahlia M; Tinder, Teresa L; Roy, Lopamudra Das; Lustgarten, Joseph; Gendler, Sandra J; Mukherjee, Pinku

    2012-11-01

    Monoclonal antibodies (mAbs) against tumor-associated antigens are useful anticancer agents. Antibody-dependent cellular cytotoxicity (ADCC) is one of the major mechanisms responsible for initiating natural killer cell (NK)-mediated killing of tumors. However, the regulation of ADCC via NK cells is poorly understood. We have investigated the cytolytic activity of NK cells against pancreatic cancer cells that were coated with an antibody directed against the human tumor antigen, Mucin-1 designated HMFG-2, either alone or conjugated to CpG oligodeoxynucleotide (CpG ODN). Conjugated antibodies were tested for their ability to elicit ADCC in vitro and in vivo against pancreatic cancer cells. NK cells cultured in the presence of immobilized CpG ODN, HMFG-2 Ab, or CpG ODN-conjugated HMFG-2 Ab were able to up-regulate perforin similarly. Interestingly, a significant higher ADCC was observed when CpG ODN-conjugated HMFG-2-coated tumor cells were co-cultured with NK cells compared to unconjugated HMFG-2 Ab or CpG ODN alone. Moreover, MyD88-deficient NK cells can perform ADCC in vitro. Furthermore, intratumoral injections of CpG ODN-conjugated HMFG-2 induced a significant reduction in tumor burden in vivo in an established model of pancreatic tumor in nude mice compared to CpG ODN or the HMFG-2 alone. Depletion of macrophages or NK cells before treatment confirmed that both cells were required for the anti-tumor response in vivo. Results also suggest that CpG ODN and HMFG-2 Ab could be sensed by NK cells on the mAb-coated tumor cells triggering enhanced ADCC in vitro and in vivo.

  2. Intratumoral delivery of CpG-conjugated anti-MUC1 antibody enhances NK cell anti-tumor activity

    PubMed Central

    Schettini, Jorge; Kidiyoor, Amritha; Besmer, Dahlia M.; Tinder, Teresa L.; Roy, Lopamudra Das; Lustgarten, Joseph; Gendler, Sandra J.

    2013-01-01

    Monoclonal antibodies (mAbs) against tumor-associated antigens are useful anticancer agents. Antibody-dependent cellular cytotoxicity (ADCC) is one of the major mechanisms responsible for initiating natural killer cell (NK)-mediated killing of tumors. However, the regulation of ADCC via NK cells is poorly understood. We have investigated the cytolytic activity of NK cells against pancreatic cancer cells that were coated with an antibody directed against the human tumor antigen, Mucin-1 designated HMFG-2, either alone or conjugated to CpG oligodeoxynucleotide (CpG ODN). Conjugated antibodies were tested for their ability to elicit ADCC in vitro and in vivo against pancreatic cancer cells. NK cells cultured in the presence of immobilized CpG ODN, HMFG-2 Ab, or CpG ODN-conjugated HMFG-2 Ab were able to up-regulate perforin similarly. Interestingly, a significant higher ADCC was observed when CpG ODN-conjugated HMFG-2-coated tumor cells were co-cultured with NK cells compared to unconjugated HMFG-2 Ab or CpG ODN alone. Moreover, MyD88-deficient NK cells can perform ADCC in vitro. Furthermore, intratumoral injections of CpG ODN-conjugated HMFG-2 induced a significant reduction in tumor burden in vivo in an established model of pancreatic tumor in nude mice compared to CpG ODN or the HMFG-2 alone. Depletion of macrophages or NK cells before treatment confirmed that both cells were required for the anti-tumor response in vivo. Results also suggest that CpG ODN and HMFG-2 Ab could be sensed by NK cells on the mAb-coated tumor cells triggering enhanced ADCC in vitro and in vivo. PMID:22543528

  3. Assessing the efficacy of Duddingtonia flagrans chlamydospores per gram of faeces to control Haemonchus contortus larvae.

    PubMed

    Ojeda-Robertos, Nadia Florencia; Torres-Acosta, Juan Felipe de Jesus; Aguilar-Caballero, Armando Jacinto; Ayala-Burgos, Armín; Cob-Galera, Ligia Amira; Sandoval-Castro, Carlos Alfredo; Barrientos-Medina, Roberto Carlos; de Gives, Pedro Mendoza

    2008-12-20

    The aims were (a) to quantify the number of Duddingtonia flagrans chlamydospores per gram of faeces (CPG) recovered from sheep administered with different oral doses and, (b) to describe the relationship between CPG and eggs per gram of faeces (EPG) on the efficacy to reduce Haemonchus contortus infective larvae. Three doses of chlamydospores per kg BW were orally administered during seven days: (T1) non treated control group, (T2) 1 x 10(6), (T3) 2.5 x 10(6) and (T4) 5 x 10(6). Three lambs, infected with H. contortus, were used per group. Faeces were obtained from the rectum of each lamb during the fungal administration period (days 0-6) and for six days after that period. Four coproculture replicates were made from each animal in days 2, 4, 6, 8 and 10. A higher chlamydospore dose produced higher CPG in faeces (p < 0.05), but a clear dose dependent effect was not found either in the larvae reduction or in the CPG:EPG ratio. When ratios were re-analyzed, independently of the treatment groups of origin, a better efficacy was obtained with a ratio from 5 to 10 CPG:EPG and a higher ratio (> 10 per egg) showed a lower reduction efficacy (p < 0.05). The binomial analysis showed that for each unit of increment in CPG:EPG ratio there was a reduction of larvae number until a point (between 5 and 10 CPG:EPG) where no further reduction was detected. The surface response test indicated that the number of larvae was reduced by CPG until possible saturation. The highest CPG:EPG ratios did not necessarily improve efficacy of D. flagrans.

  4. Interaction of DRD4 Methylation and Phthalate Metabolites Affects Continuous Performance Test Performance in ADHD.

    PubMed

    Kim, Johanna Inhyang; Kim, Jae-Won; Shin, Inkyung; Kim, Bung-Nyun

    2018-05-01

    We investigated the interaction effect between the methylation of dopamine receptor D4 (DRD4) and phthalate exposure in ADHD on continuous performance test (CPT) variables. Urine concentrations of mono-(2-ethyl-5-hydroxyhexyl) phthalate (MEHHP), mono-(2-ethyl-5-oxohexyl) phthalate (MEOHP), and mono-n-butyl phthalate (MBP) were tested. The methylation status was analyzed for CpG sites of DRD4. Multivariable linear regression models were applied to investigate the interaction effects of methylation and phthalate levels. There was a significant interaction effect of the methylation of CpG26 and CpG28 with the MEHHP level on omission errors in ADHD patients, but not in controls. The post hoc analysis revealed a significant correlation between the MEHHP concentration and omission errors in the methylated group, but not in the unmethylated group. The interaction between the methylation status of CpG sites of DRD4, particularly CpG26 and CpG28, and phthalate metabolite levels affects the attention level in ADHD patients.

  5. Impact of the Location of CpG Methylation within the GSTP1 Gene on Its Specificity as a DNA Marker for Hepatocellular Carcinoma

    PubMed Central

    Jain, Surbhi; Boldbaatar, Batbold; Hamilton, James P.; Lin, Selena Y.; Chang, Ting-Tsung; Chen, Shun-Hua; Song, Wei; Meltzer, Stephen J.; Block, Timothy M.; Su, Ying-Hsiu

    2012-01-01

    Hypermethylation of the glutathione S-transferase π 1 (GSTP1) gene promoter region has been reported to be a potential biomarker to distinguish hepatocellular carcinoma (HCC) from other liver diseases. However, reports regarding how specific a marker it is have ranged from 100% to 0%. We hypothesized that, to a large extent, the variation of specificity depends on the location of the CpG sites analyzed. To test this hypothesis, we compared the methylation status of the GSTP1 promoter region of the DNA isolated from HCC, cirrhosis, hepatitis, and normal liver tissues by bisulfite–PCR sequencing. We found that the 5′ region of the position −48 nt from the transcription start site of the GSTP1 gene is selectively methylated in HCC, whereas the 3′ region is methylated in all liver tissues examined, including normal liver and the HCC tissue. Interestingly, when DNA derived from fetal liver and 11 nonhepatic normal tissue was also examined by bisulfite-PCR sequencing, we found that methylation of the 3′ region of the promoter appeared to be liver-specific. A methylation-specific PCR assay targeting the 5′ region of the promoter was developed and used to quantify the methylated GSTP1 gene in various diseased liver tissues including HCC. When we used an assay targeting the 3′ region, we found that the methylation of the 5′-end of the GSTP1 promoter was significantly more specific than that of the 3′-end (97.1% vs. 60%, p<0.0001 by Fisher's exact test) for distinguishing HCC (n = 120) from hepatitis (n = 35) and cirrhosis (n = 35). Encouragingly, 33.8% of the AFP-negative HCC contained the methylated GSTP1 gene. This study clearly demonstrates the importance of the location of CpG site methylation for HCC specificity and how liver-specific DNA methylation should be considered when an epigenetic DNA marker is studied for detection of HCC. PMID:22536438

  6. Immunostimulation of bronchoalveolar lavage cells from recurrent airway obstruction-affected horses by different CpG-classes bound to gelatin nanoparticles.

    PubMed

    Klier, John; May, Anna; Fuchs, Sebastian; Schillinger, Ulrike; Plank, Christian; Winter, Gerhard; Gehlen, Heidrun; Coester, Conrad

    2011-11-15

    Recurrent airway obstruction (RAO) in horses has become a common problem in stabled horses in industrialized countries and deserves new therapeutic strategies. CpG-oligodeoxynucleotides (CpG-ODNs) were developed as effective immunostimulating agents to induce a Th2/Th1 shift. These agents showed a beneficial therapeutic effect in allergic diseases with predominant Th2 immunoresponse. CpG-ODN delivery by gelatin nanoparticles (GNPs) resulted in enhanced cellular uptake in murine and human in vitro studies and was a starting point for the present trial. The aim of this study was to identify an optimal stimulating CpG motif in horses with regard to species specificity on equine bronchoalveolar lavage (BAL) cells, in terms of a possible specific immunomodulation effect (Th2/Th1 shift) by used CpG-ODN. Accordingly, GNPs were evaluated as a delivery system to improve CpG-ODN immunostimulation in equine BAL cells. BAL fluid (BALF) was obtained from seven horses with moderate RAO and from four healthy horses and was subsequently incubated with five different CpG-ODN sequences (from A-, B- and C-class) and one ODN without any CpG motif. Release of three key cytokines (IL-4, IL-10 and IFN-γ) was quantified by ELISA to detect an allergy mediated Th2 immunoresponse (IL-4) as well as a proinflammatory Th1 response (IFN-γ). Due to its specific anti-inflammatory and anti-allergic effects, IL-10 was considered as a beneficial agent in pathophysiology of RAO. Results showed a significant upregulation of IL-10 and IFN-γ on the one hand and a downregulation of IL-4 on the other hand in RAO affected horses. Cell cultures from healthy horses had a significantly stronger response in cytokine release to all the applied stimuli in contrast to RAO derived cells. Comparing all five CpG sequences, A-class 2216 significantly showed the highest immunomodulatory effects on equine BALF cells and, hence, was chosen for follow-up preliminary clinical studies. Copyright © 2011 Elsevier B.V. All rights reserved.

  7. Characterization of Immune Responses to an Inactivated Avian Influenza Virus Vaccine Adjuvanted with Nanoparticles Containing CpG ODN.

    PubMed

    Singh, Shirene M; Alkie, Tamiru N; Abdelaziz, Khaled Taha; Hodgins, Douglas C; Novy, Anastasia; Nagy, Éva; Sharif, Shayan

    2016-06-01

    Avian influenza virus (AIV), a mucosal pathogen, gains entry into host chickens through respiratory and gastrointestinal routes. Most commercial AIV vaccines for poultry consist of inactivated, whole virus with adjuvant, delivered by parenteral administration. Recent advances in vaccine development have led to the application of nanoparticle emulsion delivery systems, such as poly (d,l-lactic-co-glycolic acid) (PLGA) nanoparticles to enhance antigen-specific immune responses. In chickens, the Toll-like receptor 21 ligand, CpG oligodeoxynucleotides (ODNs), have been demonstrated to be immunostimulatory. The objective of this study was to compare the adjuvant potential of CpG ODN 2007 encapsulated in PLGA nanoparticles with nonencapsulated CpG ODN 2007 when combined with a formalin-inactivated H9N2 virus, through intramuscular and aerosol delivery routes. Chickens were vaccinated at days 7 and 21 posthatch for the intramuscular route and at days 7, 21, and 35 for the aerosol route. Antibody-mediated responses were evaluated weekly in sera and lacrimal secretions in specific pathogen-free chickens. The results indicate that nonencapsulated CpG ODN 2007 in inactivated AIV vaccines administered by the intramuscular route generated higher antibody responses compared to the encapsulated CpG ODN 2007 formulation by the same route. Additionally, encapsulated CpG ODN 2007 in AIV vaccines administered by the aerosol route elicited higher mucosal responses compared to nonencapsulated CpG ODN 2007. Future studies may be aimed at evaluating protective immune responses induced with PLGA encapsulation of AIV and adjuvants.

  8. Identification of regions correlating MGMT promoter methylation and gene expression in glioblastomas

    PubMed Central

    Everhard, Sibille; Tost, Jörg; Abdalaoui, Hafida El; Crinière, Emmanuelle; Busato, Florence; Marie, Yannick; Gut, Ivo G.; Sanson, Marc; Mokhtari, Karima; Laigle-Donadey, Florence; Hoang-Xuan, Khê; Delattre, Jean-Yves; Thillet, Joëlle

    2009-01-01

    The O6-methylguanine-DNA methyltransferase gene (MGMT) is methylated in several cancers, including gliomas. However, the functional role of cysteine-phosphate-guanine (CpG) island (CGI) methylation in MGMT silencing is still controversial. The aim of this study was to investigate whether MGMT CGI methylation correlates inversely with RNA expression of MGMT in glioblastomas and to determine the CpG region whose methylation best reflects the level of expression. The methylation level of CpG sites that are potentially related to expression was investigated in 54 glioblastomas by pyrosequencing, a highly quantitative method, and analyzed with respect to their MGMT mRNA expression status. Three groups of patients were identified according to the methylation pattern of all 52 analyzed CpG sites. Overall, an 85% rate of concordance was observed between methylation and expression (p < 0.0001). When analyzing each CpG separately, six CpG sites were highly correlated with expression (p < 0.0001), and two CpG regions could be used as surrogate markers for RNA expression in 81.5% of the patients. This study indicates that there is good statistical agreement between MGMT methylation and expression, and that some CpG regions better reflect MGMT expression than do others. However, if transcriptional repression is the key mechanism in explaining the higher chemosensitivity of MGMT-methylated tumors, a substantial rate of discordance should lead clinicians to be cautious when deciding on a therapeutic strategy based on MGMT methylation status alone. PMID:19224763

  9. Identification of regions correlating MGMT promoter methylation and gene expression in glioblastomas.

    PubMed

    Everhard, Sibille; Tost, Jörg; El Abdalaoui, Hafida; Crinière, Emmanuelle; Busato, Florence; Marie, Yannick; Gut, Ivo G; Sanson, Marc; Mokhtari, Karima; Laigle-Donadey, Florence; Hoang-Xuan, Khê; Delattre, Jean-Yves; Thillet, Joëlle

    2009-08-01

    The O(6)-methylguanine-DNA methyltransferase gene (MGMT) is methylated in several cancers, including gliomas. However, the functional role of cysteine-phosphate-guanine (CpG) island (CGI) methylation in MGMT silencing is still controversial. The aim of this study was to investigate whether MGMT CGI methylation correlates inversely with RNA expression of MGMT in glioblastomas and to determine the CpG region whose methylation best reflects the level of expression. The methylation level of CpG sites that are potentially related to expression was investigated in 54 glioblastomas by pyrosequencing, a highly quantitative method, and analyzed with respect to their MGMT mRNA expression status. Three groups of patients were identified according to the methylation pattern of all 52 analyzed CpG sites. Overall, an 85% rate of concordance was observed between methylation and expression (p < 0.0001). When analyzing each CpG separately, six CpG sites were highly correlated with expression (p < 0.0001), and two CpG regions could be used as surrogate markers for RNA expression in 81.5% of the patients. This study indicates that there is good statistical agreement between MGMT methylation and expression, and that some CpG regions better reflect MGMT expression than do others. However, if transcriptional repression is the key mechanism in explaining the higher chemosensitivity of MGMT-methylated tumors, a substantial rate of discordance should lead clinicians to be cautious when deciding on a therapeutic strategy based on MGMT methylation status alone.

  10. A recombinant fusion protein and DNA vaccines against foot-and-mouth disease virus type Asia 1 infection in guinea pigs.

    PubMed

    Zhang, Q; Zhu, M W; Yang, Y Q; Shao, M; Zhang, Z Y; Lan, H Y; Yan, W Y; Wu, J J; Zheng, Z X

    2003-01-01

    On the basis of amino acid (aa) sequence of the tandem repeat 133-158-20-34-133-158 which consisted of aa 133-158 of VP1 and aa 20-34 of VP4 of Foot-and-mouth disease virus (FMDV) type Asia 1 a recombinant prokaryotic expression vector pAS1-P encoding a fusion protein and eukaryotic expression vectors pAS1-E and pAS1-EdeltaCpG-ODN representing DNA vaccines were constructed. Guinea pigs immunized with these vaccines showed both neutralizing antibody and T cell proliferation responses. FMDV challenge tests for the first time showed that the recombinant fusion protein and pAS1-E and pAS1-EdeltaCpG-ODN vaccines protected 86%, 60% and 43% of guinea pigs from FMDV type Asia1 challenge, respectively. The results also indicated that the immune response of animals treated with the vector pAS1-E containing an oligodeoxynucleotide (ODN), which consisted of immunostimulatory cytosine-phosphate-guanosine (CpG) motifs, was augmented by CpG ODN.

  11. DNA Methylation Errors in Cloned Mouse Sperm by Germ Line Barrier Evasion.

    PubMed

    Koike, Tasuku; Wakai, Takuya; Jincho, Yuko; Sakashita, Akihiko; Kobayashi, Hisato; Mizutani, Eiji; Wakayama, Sayaka; Miura, Fumihito; Ito, Takashi; Kono, Tomohiro

    2016-06-01

    The germ line reprogramming barrier resets parental epigenetic modifications according to sex, conferring totipotency to mammalian embryos upon fertilization. However, it is not known whether epigenetic errors are committed during germ line reprogramming that are then transmitted to germ cells, and consequently to offspring. We addressed this question in the present study by performing a genome-wide DNA methylation analysis using a target postbisulfite sequencing method in order to identify DNA methylation errors in cloned mouse sperm. The sperm genomes of two somatic cell-cloned mice (CL1 and CL7) contained significantly higher numbers of differentially methylated CpG sites (P = 0.0045 and P = 0.0116). As a result, they had higher numbers of differentially methylated CpG islands. However, there was no evidence that these sites were transmitted to the sperm genome of offspring. These results suggest that DNA methylation errors resulting from embryo cloning are transmitted to the sperm genome by evading the germ line reprogramming barrier. © 2016 by the Society for the Study of Reproduction, Inc.

  12. Genetic and Epigenetic Inactivation of Kruppel-like Factor 4 in Medulloblastoma1

    PubMed Central

    Nakahara, Yukiko; Northcott, Paul A; Li, Meihua; Kongkham, Paul N; Smith, Christian; Yan, Hai; Croul, Sidney; Ra, Young-Shin; Eberhart, Charles; Huang, Annie; Bigner, Darell; Grajkowska, Wesia; Van Meter, Timothy; Rutka, James T; Taylor, Michael D

    2010-01-01

    Although medulloblastoma is the most common pediatric malignant brain tumor, its molecular underpinnings are largely unknown. We have identified rare, recurrent homozygous deletions of Kruppel-like Factor 4 (KLF4) in medulloblastoma using high-resolution single nucleotide polymorphism arrays, digital karyotyping, and genomic real-time polymerase chain reaction (PCR). Furthermore, we show that there is loss of physiological KLF4 expression in more than 40% of primary medulloblastomas both at the RNA and protein levels. Medulloblastoma cell lines drastically increase the expression of KLF4 in response to the demethylating agent 5-azacytidine and demonstrate dense methylation of the promoter CpG island by bisulfite sequencing. Methylation-specific PCR targeting the KLF4 promoter demonstrates CpG methylation in approximately 16% of primary medulloblastomas. Reexpression of KLF4 in the D283 medulloblastoma cell line results in significant growth suppression both in vitro and in vivo. We conclude that KLF4 is inactivated by either genetic or epigenetic mechanisms in a large subset of medulloblastomas and that it likely functions as a tumor suppressor gene in the pathogenesis of medulloblastoma. PMID:20072650

  13. Genetic recombination is targeted towards gene promoter regions in dogs.

    PubMed

    Auton, Adam; Rui Li, Ying; Kidd, Jeffrey; Oliveira, Kyle; Nadel, Julie; Holloway, J Kim; Hayward, Jessica J; Cohen, Paula E; Greally, John M; Wang, Jun; Bustamante, Carlos D; Boyko, Adam R

    2013-01-01

    The identification of the H3K4 trimethylase, PRDM9, as the gene responsible for recombination hotspot localization has provided considerable insight into the mechanisms by which recombination is initiated in mammals. However, uniquely amongst mammals, canids appear to lack a functional version of PRDM9 and may therefore provide a model for understanding recombination that occurs in the absence of PRDM9, and thus how PRDM9 functions to shape the recombination landscape. We have constructed a fine-scale genetic map from patterns of linkage disequilibrium assessed using high-throughput sequence data from 51 free-ranging dogs, Canis lupus familiaris. While broad-scale properties of recombination appear similar to other mammalian species, our fine-scale estimates indicate that canine highly elevated recombination rates are observed in the vicinity of CpG rich regions including gene promoter regions, but show little association with H3K4 trimethylation marks identified in spermatocytes. By comparison to genomic data from the Andean fox, Lycalopex culpaeus, we show that biased gene conversion is a plausible mechanism by which the high CpG content of the dog genome could have occurred.

  14. Cloning of polymorphisms (COP): enrichment of polymorphic sequences from complex genomes

    PubMed Central

    Li, Jingfeng; Wang, Fuli; Zabarovska, Veronika; Wahlestedt, Claes; Zabarovsky, Eugene R.

    2000-01-01

    Here we describe a new procedure (cloning of polymorphisms, COP) for enrichment of single nucleotide polymorphisms (SNPs) that represent restriction fragment length polymorphisms (RFLPs). COP would be applicable to the isolation of SNPs from particular regions of the genome, e.g. CpG islands, chromosomal bands, YACs or PAC contigs. A combination of digestion with restriction enzymes, treatment with uracil-DNA glycosylase and mung bean nuclease, PCR amplification and purification with streptavidin magnetic beads was used to isolate polymorphic sequences from the genomes of two human samples. After only two cycles of enrichment, 80% of the isolated clones were found to contain RFLPs. A simple method for the PCR detection of these polymorphisms was also developed. PMID:10606669

  15. The influence of aging on the methylation status of brain-derived neurotrophic factor gene in blood.

    PubMed

    Ihara, Kazushige; Fuchikami, Manabu; Hashizume, Masahiro; Okada, Satoshi; Kawai, Hisashi; Obuchi, Shuichi; Hirano, Hirohiko; Fujiwara, Yoshinori; Hachisu, Mitsugu; Hongyong, Kim; Morinobu, Shigeru

    2018-06-28

    Brain-derived neurotrophic factor (BDNF) is involved in the pathophysiology of psychiatric disorders in adults and elderly individuals, and as a result, the DNA methylation (DNAm) of the BDNF gene in peripheral tissues including blood has been extensively examined to develop a useful biomarker for psychiatric disorders. However, studies to date have not previously investigated the effect of age on DNAm of the BDNF gene in blood. In this context, we measured DNAm of 39 CpG units in the CpG island at the promoter of exon I of the BDNF gene. We analyzed genomic DNA from peripheral blood of 105 health Japanese women 20 to 80 years of age to identify aging-associated change in DNAm of the BDNF gene. In addition, we examined the relationship between total MMSE scores, numbers of stressful life events, and serum BDNF levels on DNAm of the BDNF gene. The DNAm rate at each CpG unit was measured using a MassArray ® system (Agena Bioscience), and serum BDNF levels were measured by ELISA. There was a significant correlation between DNAm and age in 13 CpGs. However, there was no significant correlation between DNAm and total MMSE scores, numbers of life events, or serum BDNF levels. Despite the small number of subjects and the inclusion of only female subjects, our results suggest that DNAm of 13 CpGs of the BDNF gene may be an appropriate biomarker for aging and useful for predicting increased susceptibility to age-related psychiatric disorders. © 2018 John Wiley & Sons, Ltd.

  16. Encapsulating Immunostimulatory CpG Oligonucleotides in Listeriolysin O-Liposomes Promotes a Th1-Type Response and CTL Activity

    PubMed Central

    Andrews, Chasity D.; Huh, Myung-Sook; Patton, Kathryn; Higgins, Debbie; Van Nest, Gary; Ott, Gary; Lee, Kyung-Dall

    2013-01-01

    Immunostimulatory sequences (ISS) are short DNA sequences containing unmethylated CpG dimers that have multiple effects on the host immune system, including the ability to stimulate antigen-specific cytotoxic T lymphocytes (CTLs) and drive Th1-type immune responses. Listeriolysin O (LLO)-containing pH-sensitive liposomes have been shown to efficiently deliver macromolecules to the cytosol of APCs and efficiently stimulate CTLs. We hypothesized that encapsulating ISS-oligodeoxyribonucleotides (ODNs) in this delivery system would enhance the cell-mediated immune response and skew Th1-type responses in protein antigen-based vaccination utilizing LLO-liposomes. In vitro studies indicated that co-encapsulation of ISS in LLO-liposomes engendered activation of the NF-κB pathway while maintaining the efficient cytosolic delivery of antigen mediated by the co-encapsulated LLO. Antigen-specific CTL responses monitored by using the model antigen ovalbumin (OVA) in mice were enhanced when mice were immunized with OVA and ISS-ODN-containing LLO-liposomes compared with those immunized with either OVA-containing LLO-liposomes or OVA-ISS conjugates. The enhanced immune responses were of the Th1-type as monitored by the robust OVA-specific IgG2a induction and the OVA CD8 peptide-stimulated IFN-γ secretion. Our study suggests that including ISS-ODN in LLO-containing pH-sensitive liposomes yields a vaccine delivery system that enhances the cell-mediated immune response and skews this response toward the Th1-type. PMID:22376145

  17. PlantPAN 2.0: an update of plant promoter analysis navigator for reconstructing transcriptional regulatory networks in plants.

    PubMed

    Chow, Chi-Nga; Zheng, Han-Qin; Wu, Nai-Yun; Chien, Chia-Hung; Huang, Hsien-Da; Lee, Tzong-Yi; Chiang-Hsieh, Yi-Fan; Hou, Ping-Fu; Yang, Tien-Yi; Chang, Wen-Chi

    2016-01-04

    Transcription factors (TFs) are sequence-specific DNA-binding proteins acting as critical regulators of gene expression. The Plant Promoter Analysis Navigator (PlantPAN; http://PlantPAN2.itps.ncku.edu.tw) provides an informative resource for detecting transcription factor binding sites (TFBSs), corresponding TFs, and other important regulatory elements (CpG islands and tandem repeats) in a promoter or a set of plant promoters. Additionally, TFBSs, CpG islands, and tandem repeats in the conserve regions between similar gene promoters are also identified. The current PlantPAN release (version 2.0) contains 16 960 TFs and 1143 TF binding site matrices among 76 plant species. In addition to updating of the annotation information, adding experimentally verified TF matrices, and making improvements in the visualization of transcriptional regulatory networks, several new features and functions are incorporated. These features include: (i) comprehensive curation of TF information (response conditions, target genes, and sequence logos of binding motifs, etc.), (ii) co-expression profiles of TFs and their target genes under various conditions, (iii) protein-protein interactions among TFs and their co-factors, (iv) TF-target networks, and (v) downstream promoter elements. Furthermore, a dynamic transcriptional regulatory network under various conditions is provided in PlantPAN 2.0. The PlantPAN 2.0 is a systematic platform for plant promoter analysis and reconstructing transcriptional regulatory networks. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  18. Metronomic Doses of Temozolomide Enhance the Efficacy of Carbon Nanotube CpG Immunotherapy in an Invasive Glioma Model.

    PubMed

    Ouyang, Mao; White, Ethan E; Ren, Hui; Guo, Qin; Zhang, Ian; Gao, Hang; Yanyan, Song; Chen, Xuebo; Weng, Yiming; Da Fonseca, Anna; Shah, Sunny; Manuel, Edwin R; Zhang, Leying; Vonderfecht, Steven L; Alizadeh, Darya; Berlin, Jacob M; Badie, Behnam

    2016-01-01

    Even when treated with aggressive current therapies, most patients with glioblastoma survive less than two years. Rapid tumor growth, an invasive nature, and the blood-brain barrier, which limits the penetration of large molecules into the brain, all contribute to the poor tumor response associated with conventional therapies. Immunotherapy has emerged as a therapeutic approach that may overcome these challenges. We recently reported that single-walled carbon nanotubes (SWCNTs) can be used to dramatically increase the immunotherapeutic efficacy of CpG oligonucleotides in a mouse model of glioma. Following implantation in the mouse brain, the tumor cell line used in these previous studies (GL261) tends to form a spherical tumor with limited invasion into healthy brain. In order to evaluate SWCNT/CpG therapy under more clinically-relevant conditions, here we report the treatment of a more invasive mouse glioma model (K-Luc) that better recapitulates human disease. In addition, a CpG sequence previously tested in humans was used to formulate the SWCNT/CpG which was combined with temozolomide, the standard of care chemotherapy for glioblastoma patients. We found that, following two intracranial administrations, SWCNT/CpG is well-tolerated and improves the survival of mice bearing invasive gliomas. Interestingly, the efficacy of SWCNT/CpG was enhanced when combined with temozolomide. This enhanced anti-tumor efficacy was correlated to an increase of tumor-specific cytotoxic activity in splenocytes. These results reinforce the emerging understanding that immunotherapy can be enhanced by combining it with chemotherapy and support the continued development of SWCNT/CpG.

  19. MSH6 G39E Polymorphism and CpG Island Methylator Phenotype in Colon Cancer

    PubMed Central

    Curtin, Karen; Samowitz, Wade S.; Wolff, Roger K.; Caan, Bette J.; Ulrich, Cornelia M.; Potter, John D.; Slattery, Martha L.

    2010-01-01

    The MSH6 G39E germline polymorphism is not associated with an increased risk of either microsatellite stable or unstable sporadic colorectal cancer. Other than microsatellite instability, however, most genetic and epigenetic changes of tumors associated with this common variant have not been studied. The objective of our investigation was to evaluate associations between the MSH6 G39E (116G>A) polymorphism and CpG island methylator phenotype (CIMP) and BRAF V600E mutations in tumors from a sample of 1048 individuals with colon cancer and 1964 controls from Utah, Northern California, and Minnesota. The G39E polymorphism (rs1042821) was determined by the five prime nuclease assay. CIMP was determined by methylation-specific polymerase chain reaction (PCR) of CpG islands in MLH1, methylated in tumors (MINT)1, MINT2, MINT31, and CDKN2A. The BRAF V600E mutation was determined by sequencing exon 15. In microsatellite stable tumors, homozygous carriers of the G39E polymorphism had an increased risk of CIMP+ colon cancer (odds ratio (OR) 2.2, 95% confidence interval (CI) 1.1, 4.2) and BRAF V600E mutation (OR 3.1, 95% CI 1.01, 9.7) in a case–control comparison. This finding was not observed in unstable tumors; however, power may have been low to detect an association. Age at diagnosis, family history, and alcohol use did not interact with MSH6 G39E and CIMP. The MSH6 G39E germline polymorphism may be associated with CIMP+ colon cancer. PMID:19582761

  20. DNA methylation of ANKK1 and response to aripiprazole in patients with acute schizophrenia: A preliminary study.

    PubMed

    Miura, Itaru; Kunii, Yasuto; Hino, Mizuki; Hoshino, Hiroshi; Matsumoto, Junya; Kanno-Nozaki, Keiko; Horikoshi, Sho; Kaneko, Haruka; Bundo, Miki; Iwamoto, Kazuya; Yabe, Hirooki

    2018-05-01

    Epigenetic modification including DNA methylation may affect pathophysiology and the response to antipsychotic drugs in patients with schizophrenia. The objective of the present study was to investigate the effect of the DNA methylation of ANKK1 (ankyrin repeat and kinase domain containing 1) on the response to aripiprazole and plasma levels of monoamine metabolites in antipsychotic-free acute schizophrenia patients. The subjects were 34 Japanese patients with schizophrenia who had been treated with aripiprazole for 6 weeks. Comprehensive DNA methylation of ANKK1 was determined using a next-generation sequencer. DNA methylation levels at CpG site 387 of ANKK1 were higher in responders to treatment with aripiprazole and correlated with the changes in Positive and Negative Syndrome Scale scores, although the associations did not remain significant after Bonferroni correction. In responders, methylation at all CpG sites was significantly correlated with plasma levels of homovanillic acid (r = 0.587, p = 0.035) and 3-methoxy-4hydroxyphenylglycol (r = 0.684, p = 0.010) at baseline. Despite our non-significant results after multiple correction, our preliminary findings suggest that methylation levels at CpG site 387 of ANKK1 may be associated with treatment response to aripiprazole. Furthermore, methylation of ANKK1 may affect dopaminergic neural transmission in the treatment of schizophrenia, and may influence treatment response. Caution is needed in interpreting these findings because of the small sample size, and further studies are needed to confirm and expand our preliminary results. Copyright © 2018. Published by Elsevier Ltd.

  1. 75 FR 13555 - Compliance Policy Guide Sec. 540.375 Canned Salmon - Adulteration Involving Decomposition (CPG...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-03-22

    ...] (Formerly Docket No. 1998N-0046) Compliance Policy Guide Sec. 540.375 Canned Salmon -- Adulteration... of Compliance Policy Guide Sec. 540.375 Canned Salmon -- Adulteration Involving Decomposition (CPG... relating to decomposition in fish and fishery products, including canned salmon, is provided in CPG Sec...

  2. Distinct Effects of Monophosphoryl Lipid A, Oligodeoxynucleotide CpG, and Combination Adjuvants on Modulating Innate and Adaptive Immune Responses to Influenza Vaccination.

    PubMed

    Ko, Eun-Ju; Lee, Young-Tae; Lee, Youri; Kim, Ki-Hye; Kang, Sang-Moo

    2017-10-01

    Monophosphoryl lipid A (MPL) and oligodeoxynucleotide CpG are toll-like receptor (TLR) 4 and 9 agonist, respectively. Here, we investigated the effects of MPL, CpG, and combination adjuvants on stimulating in vitro dendritic cells (DCs), in vivo innate and adaptive immune responses, and protective efficacy of influenza vaccination. Combination of MPL and CpG was found to exhibit distinct effects on stimulating DCs in vitro to secrete IL-12p70 and tumor necrosis factor (TNF)-α and proliferate allogeneic CD8 T cells. Prime immunization of mice with inactivated split influenza vaccine in the presence of low dose MPL+CpG adjuvants increased the induction of virus-specific IgG and IgG2a isotype antibodies. MPL and CpG adjuvants contribute to improving the efficacy of prime influenza vaccination against lethal influenza challenge as determined by body weight monitoring, lung function, viral titers, and histology. A combination of MPL and CpG adjuvants was effective in improving vaccine efficacy as well as in reducing inflammatory immune responses locally and in inducing cellular immune responses upon lethal influenza virus challenge. This study demonstrates unique adjuvant effects of MPL, CpG, and combination adjuvants on modulating innate and adaptive immune responses to influenza prime vaccination.

  3. Quantitative, high-resolution epigenetic profiling of CpG loci identifies associations with cord blood plasma homocysteine and birth weight in humans

    PubMed Central

    Ismail, Khaled MK; Haworth, Kim E; Mein, Charles; Carroll, William D

    2011-01-01

    Supplementation with folic acid during pregnancy is known to reduce the risk of neural tube defects and low birth weight. It is thought that folate and other one-carbon intermediates might secure these clinical effects via DNA methylation. We examined the effects of folate on the human methylome using quantitative interrogation of 27,578 CpG loci associated with 14,496 genes at single-nucleotide resolution across 12 fetal cord blood samples. Consistent with previous studies, the majority of CpG dinucleotides located within CpG islands exhibited hypomethylation while those outside CpG islands showed mid-high methylation. However, for the first time in human samples, unbiased analysis of methylation across samples revealed a significant correlation of methylation patterns with plasma homocysteine, LINE-1 methylation and birth weight centile. Additionally, CpG methylation significantly correlated with either birth weight or LINE-1 methylation were predominantly located in CpG islands. These data indicate that levels of folate-associated intermediates in cord blood reflect their influence and consequences for the fetal epigenome and potentially on pregnancy outcome. In these cases, their influence might be exerted during late gestation or reflect those present during the peri-conceptual period. PMID:20864804

  4. Role of Replication and CpG Methylation in Fragile X Syndrome CGG Deletions in Primate Cells

    PubMed Central

    Nichol Edamura, Kerrie; Leonard, Michelle R.; Pearson, Christopher E.

    2005-01-01

    Instability of the fragile X CGG repeat involves both maternally derived expansions and deletions in the gametes of full-mutation males. It has also been suggested that the absence of aberrant CpG methylation may enhance repeat deletions through an unknown process. The effect of CGG tract length, DNA replication direction, location of replication initiation, and CpG methylation upon CGG stability were investigated using an SV40 primate replication system. Replication-dependant deletions with 53 CGG repeats were observed when replication was initiated proximal to the repeat, with CGG as the lagging-strand template. When we initiated replication further from the repeat, while maintaining CGG as the lagging-strand template or using CCG as the lagging-strand template, significant instability was not observed. CpG methylation of the unstable template stabilized the repeat, decreasing both the frequency and the magnitude of deletion events. Furthermore, CpG methylation slowed the efficiency of replication for all templates. Interestingly, replication forks displayed no evidence of a block at the CGG repeat tract, regardless of replication direction or CpG methylation status. Templates with 20 CGG repeats were stable under all circumstances. These results reveal that CGG deletions occur during replication and are sensitive to replication-fork dynamics, tract length, and CpG methylation. PMID:15625623

  5. Topical CpG enhances the response of murine malignant melanoma to dacarbazine.

    PubMed

    Najar, Hossain M; Dutz, Jan P

    2008-09-01

    Malignant melanoma is a potentially fatal skin cancer that is increasing in incidence. Standard chemoimmunotherapy consisting of dacarbazine (DTIC) given with IFN-alpha has had disappointing results. We describe a chemoimmunotherapy protocol for cutaneous melanoma that combines the administration of DTIC with the topical application of CpG oligodinucleotide (ODN). Subcutaneous B16 melanoma tumors in C57BL/6 mice were treated with intraperitoneal injections of DTIC followed by the topical application of CpG-ODN over the tumors. This therapeutic approach abrogated the growth of established tumors and significantly enhanced survival. Topical CpG application was more effective than intratumoral CpG. Cell depletion studies indicated that the antitumor effect was dependent on both CD4(+) and CD8(+) cells but not on natural killer (NK) cells. Tumor-specific cytotoxic T-lymphocyte activity was generated in treated animals and was highest in topically treated animals. Immunohistochemical analysis revealed that DTIC, but not CpG, enhanced tumor cell apoptosis. Further, topical CpG induced an expansion of a B220(+)CD8(+) subset of dendritic cells and a subset of NK1.1(+) CD11c(+) cells within the tumors. By enhancing both tumor cell death and local immune activation, DTIC/topical CpG chemoimmunotherapy induced an effective T-cell-dependent host-immune response against melanoma.

  6. CpG oligodeoxynucleotides augment the murine immune response to the Yersinia pestis F1-V vaccine in bubonic and pneumonic models of plague.

    PubMed

    Amemiya, Kei; Meyers, Jennifer L; Rogers, Taralyn E; Fast, Randy L; Bassett, Anthony D; Worsham, Patricia L; Powell, Bradford S; Norris, Sarah L; Krieg, Arthur M; Adamovicz, Jeffrey J

    2009-04-06

    The current U.S. Department of Defense candidate plague vaccine is a fusion between two Yersinia pestis proteins: the F1 capsular protein, and the low calcium response (Lcr) V-protein. We hypothesized that an immunomodulator, such as CpG oligodeoxynucleotide (ODN)s, could augment the immune response to the plague F1-V vaccine in a mouse model for plague. CpG ODNs significantly augmented the antibody response and efficacy of a single dose of the plague vaccine in murine bubonic and pneumonic models of plague. In the latter study, we also found an overall significant augmentation the immune response to the individual subunits of the plague vaccine by CpG ODN 2006. In a long-term, prime-boost study, CpG ODN induced a significant early augmentation of the IgG response to the vaccine. The presence of CpG ODN induced a significant increase in the IgG2a subclass response to the vaccine up to 5 months after the boost. Our studies showed that CpG ODNs significantly augmented the IgG antibody response to the plague vaccine, which increased the probability of survival in murine models of plague (P<0.0001).

  7. Methyl-CpG island-associated genome signature tags

    DOEpatents

    Dunn, John J

    2014-05-20

    Disclosed is a method for analyzing the organismic complexity of a sample through analysis of the nucleic acid in the sample. In the disclosed method, through a series of steps, including digestion with a type II restriction enzyme, ligation of capture adapters and linkers and digestion with a type IIS restriction enzyme, genome signature tags are produced. The sequences of a statistically significant number of the signature tags are determined and the sequences are used to identify and quantify the organisms in the sample. Various embodiments of the invention described herein include methods for using single point genome signature tags to analyze the related families present in a sample, methods for analyzing sequences associated with hyper- and hypo-methylated CpG islands, methods for visualizing organismic complexity change in a sampling location over time and methods for generating the genome signature tag profile of a sample of fragmented DNA.

  8. Isolation and bioinformatics analysis of differentially methylated genomic fragments in human gastric cancer

    PubMed Central

    Liao, Ai-Jun; Su, Qi; Wang, Xun; Zeng, Bin; Shi, Wei

    2008-01-01

    AIM: To isolate and analyze the DNA sequences which are methylated differentially between gastric cancer and normal gastric mucosa. METHODS: The differentially methylated DNA sequences between gastric cancer and normal gastric mucosa were isolated by methylation-sensitive representational difference analysis (MS-RDA). Similarities between the separated fragments and the human genomic DNA were analyzed with Basic Local Alignment Search Tool (BLAST). RESULTS: Three differentially methylated DNA sequences were obtained, two of which have been accepted by GenBank. The accession numbers are AY887106 and AY887107. AY887107 was highly similar to the 11th exon of LOC440683 (98%), 3’ end of LOC440887 (99%), and promoter and exon regions of DRD5 (94%). AY887106 was consistent (98%) with a CpG island in ribosomal RNA isolated from colorectal cancer by Minoru Toyota in 1999. CONCLUSION: The methylation degree is different between gastric cancer and normal gastric mucosa. The differentially methylated DNA sequences can be isolated effectively by MS-RDA. PMID:18322944

  9. DNA methylation-based forensic age prediction using artificial neural networks and next generation sequencing.

    PubMed

    Vidaki, Athina; Ballard, David; Aliferi, Anastasia; Miller, Thomas H; Barron, Leon P; Syndercombe Court, Denise

    2017-05-01

    The ability to estimate the age of the donor from recovered biological material at a crime scene can be of substantial value in forensic investigations. Aging can be complex and is associated with various molecular modifications in cells that accumulate over a person's lifetime including epigenetic patterns. The aim of this study was to use age-specific DNA methylation patterns to generate an accurate model for the prediction of chronological age using data from whole blood. In total, 45 age-associated CpG sites were selected based on their reported age coefficients in a previous extensive study and investigated using publicly available methylation data obtained from 1156 whole blood samples (aged 2-90 years) analysed with Illumina's genome-wide methylation platforms (27K/450K). Applying stepwise regression for variable selection, 23 of these CpG sites were identified that could significantly contribute to age prediction modelling and multiple regression analysis carried out with these markers provided an accurate prediction of age (R 2 =0.92, mean absolute error (MAE)=4.6 years). However, applying machine learning, and more specifically a generalised regression neural network model, the age prediction significantly improved (R 2 =0.96) with a MAE=3.3 years for the training set and 4.4 years for a blind test set of 231 cases. The machine learning approach used 16 CpG sites, located in 16 different genomic regions, with the top 3 predictors of age belonged to the genes NHLRC1, SCGN and CSNK1D. The proposed model was further tested using independent cohorts of 53 monozygotic twins (MAE=7.1 years) and a cohort of 1011 disease state individuals (MAE=7.2 years). Furthermore, we highlighted the age markers' potential applicability in samples other than blood by predicting age with similar accuracy in 265 saliva samples (R 2 =0.96) with a MAE=3.2 years (training set) and 4.0 years (blind test). In an attempt to create a sensitive and accurate age prediction test, a next generation sequencing (NGS)-based method able to quantify the methylation status of the selected 16 CpG sites was developed using the Illumina MiSeq ® platform. The method was validated using DNA standards of known methylation levels and the age prediction accuracy has been initially assessed in a set of 46 whole blood samples. Although the resulted prediction accuracy using the NGS data was lower compared to the original model (MAE=7.5years), it is expected that future optimization of our strategy to account for technical variation as well as increasing the sample size will improve both the prediction accuracy and reproducibility. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  10. In ovo CpG DNA delivery increases innate and adaptive immune cells in respiratory, gastrointestinal and immune systems post-hatch correlating with lower infectious laryngotracheitis virus infection.

    PubMed

    Abdul-Cader, Mohamed Sarjoon; Amarasinghe, Aruna; Palomino-Tapia, Victor; Ahmed-Hassan, Hanaa; Bakhtawar, Khawaja; Nagy, Eva; Sharif, Shayan; Gomis, Susantha; Abdul-Careem, Mohamed Faizal

    2018-01-01

    Cytosine-guanosine deoxynucleotides (CpG) DNA can be delivered in ovo at embryo day (ED)18 for the stimulation of toll-like receptor (TLR)21 signaling pathway that ultimately protects chickens against a number of bacterial and viral infections. There is a dearth of information understanding the mechanisms of protection induced by in ovo delivered CpG DNA. The objective of this study was to determine the immune cell changes post-hatch following in ovo delivery of the TLR21 ligand, CpG DNA. In order to quantify changes of percentage of KUL01+, IgM+ B, cluster of differentiation (CD)4+ and CD8α+ cells, trachea, lung, duodenum, large intestine, spleen and bursa of Fabricius were collected on day 1 post-hatch. We found increased recruitments of KUL01+ cells, in organs of these body systems post-hatch following in ovo delivery of CpG DNA. Although IgM+ B cells, CD4+ and CD8α+ cells were increased in lungs and immune system organs, these cells were not quantifiable from the trachea, duodenum and large intestine immediately following the hatch. Furthermore, when CpG DNA is delivered in ovo and subsequently infected with infectious laryngotracheitis virus (ILTV) post-hatch on day 1, CpG DNA reduces morbidity and mortality resulting from ILTV infection. This study provides insights into the mechanisms of host responses elicited following in ovo delivery of CpG DNA in avian species.

  11. Rolling Thunder -- Integration of the Solo 161 Stirling engine with the CPG-460 solar concentrator at Ft. Huachuca

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Diver, R.B.; Moss, T.A.; Goldberg, V.

    Project Rolling Thunder is a dish/Stirling demonstration project at Ft. Huachuca, a US Army fort in southeastern Arizona (Huachuca means rolling thunder in Apache). It has been supported by the Strategic Environmental Research and Development Program (SERDP), a cooperative program between the Department of Defense (DoD) and the Department of Energy (DOE). As part of a 1992 SERDP project, Cummins Power Generation, Inc. (CPG) installed a CPG 7 kW(c) dish/Stirling system at the Joint Interoperability Test Command (JITC) in Ft. Huachuca, Arizona. The primary objective of the SERDP Dish/Stirling for DoD Applications project was to demonstrate a CPG 7-kW(c) dish/Stirlingmore » system at a military facility. Unfortunately, Cummins Engine Company decided to divest its solar operations. As a direct result of Ft. Huachuca`s interest in the Cummins dish/Stirling technology, Sandia explored the possibility of installing a SOLO 161 Stirling power conversion unit (PCU) on the Ft. Huachuca CPG-460. In January 1997, a decision was made to retrofit a SOLO 161 Stirling engine on the CPG-460 at Ft. Huachuca. Project Rolling Thunder. The SOLO 161 Demonstration at Ft. Huachuca has been a challenge. Although, the SOLO 161 PCU has operated nearly flawlessly and the CPG-460 has been, for the most part, a solid and reliable component, integration of the SOLO PCU with the CPG-460 has required significant attention. In this paper, the integration issues and technical approaches of project Rolling Thunder are presented. Lessons of the project are also discussed.« less

  12. Guideline-Driven Care Improves Outcomes in Patients with Traumatic Rib Fractures.

    PubMed

    Flarity, Kathleen; Rhodes, Whitney C; Berson, Andrew J; Leininger, Brian E; Reckard, Paul E; Riley, Keyan D; Shahan, Charles P; Schroeppel, Thomas J

    2017-09-01

    There is no established national standard for rib fracture management. A clinical practice guideline (CPG) for rib fractures, including monitoring of pulmonary function, early initiation of aggressive loco-regional analgesia, and early identification of deteriorating respiratory function, was implemented in 2013. The objective of the study was to evaluate the effect of the CPG on hospital length of stay. Hospital length of stay (LOS) was compared for adult patients admitted to the hospital with rib fracture(s) two years before and two years after CPG implementation. A separate analysis was done for the patients admitted to the intensive care unit (ICU). Over the 48-month study period, 571 patients met inclusion criteria for the study. Pre-CPG and CPG study groups were well matched with few differences. Multivariable regression did not demonstrate a difference in LOS (B = -0.838; P = 0.095) in the total study cohort. In the ICU cohort (n = 274), patients in the CPG group were older (57 vs 52 years; P = 0.023) and had more rib fractures (4 vs 3; P = 0.003). Multivariable regression identified a significant decrease in LOS for those patients admitted in the CPG period (B = -2.29; P = 0.019). Despite being significantly older with more rib fractures in the ICU cohort, patients admitted after implementation of the CPG had a significantly reduced LOS on multivariable analysis, reducing LOS by over two days. This structured intervention can limit narcotic usage, improve pulmonary function, and decrease LOS in the most injured patients with chest trauma.

  13. Energetic study of cardioplegic hearts under ischaemia/reperfusion and [Ca(2+)] changes in cardiomyocytes of guinea-pig: mitochondrial role.

    PubMed

    Ragone, M I; Torres, N S; Consolini, A E

    2013-02-01

    To study the role of mitochondria in the recovery of guinea-pig hearts exposed to high-K(+)-cardioplegia (CPG) and ischaemia/reperfusion (I/R) METHODS: We measured contractility and heat release in perfused guinea-pig hearts and cytosolic and mitochondrial Ca(2+) by epifluorescence and confocal microscopy in isolated cardiomyocytes loaded with Fluo-4 or Rhod-2. In hearts, CPG increased the postischaemic contractile recovery, and this was potentiated by the mNCX blocker clonazepam and the mKATP opener diazoxide, which also prevented the fall in muscle economy. Moreover, CPG prevented the stunning induced by ouabain, which was reduced by clonazepam. In cardiomyocytes, CPG increased fluorescent signals of cytosolic and mitochondrial Ca(2+), while the addition of a mNCX blocker (CGP37157) increased cytosolic but reduced mitochondrial [Ca(2+)]. Ouabain in CPG increased cytosolic Ca(2+) and resting heat, but the addition of CGP37157 reduced them, as well as mitochondrial Ca(2+). CPG, diazoxide and clonazepam improve postischaemic recovery, respectively, by increasing the Ca(2+) cycling and by reducing the mitochondrial Ca(2+) uptake either by uniporter or by mNCX. The mitochondria compete with the leaky sarcoplasmic reticulum (SR) as sink of Ca(2+) in guinea-pig hearts, affecting the postischaemic contractility. CPG also prevented the ouabain-induced dysfunction by avoiding the Ca(2+) overload. Ouabain reduced the synergism between CPG and clonazepam suggesting that [Na(+)]i and SR load influence the mNCX role. © 2012 The Authors Acta Physiologica © 2012 Scandinavian Physiological Society.

  14. 75 FR 60761 - Government-Owned Inventions; Availability for Licensing

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-10-01

    ... cells conjugated to a K-type CpG oligodeoxynucleotide (ODN) to a subject. Methods for treating a tumor... therapeutically effective amount of apoptotic tumor cells conjugated to a K-type CpG oligodeoxynucleotide (ODN) to... the prevention of cancer and other indications Use of CpG oligonucleotides for prophylaxis and/or...

  15. 78 FR 46594 - Prospective Grant of Start-up Exclusive License: Topical Antibiotic With Immune Stimulating...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-08-01

    ... Speed Wound Healing; and Use of CpG Oligodeoxynucleotides To Induce Epithelial Cell Growth AGENCY... CpG Oligodeoxynucleotides to Induce Epithelial Cell Growth'' to Tollgene having a place of business... 37 CFR part 404. These technologies relate to relate to use of CpG oligodeoxynucleotides (ODNs) to...

  16. Promoter methylation assay of SASH1 gene in breast cancer.

    PubMed

    Sheyu, Lin; Hui, Liu; Junyu, Zhang; Jiawei, Xu; Honglian, Wang; Qing, Sang; Hengwei, Zhang; Xuhui, Guo; Qinghe, Xing; Lin, He

    2013-01-01

    To analyze the relationship between the expression of SASH1 and its methylation level of SASH1 gene promoter in human breast cancer. Expression levels of SASH1 were examined in breast cancer tissues and adjacent normal tissues with immunohistochemistry and with real time PCR (RT-PCR) methylation analysis was performed with MassArray. Immunohistochemistry showed that SASH1 expression was strongly reduced in breast cancer compared with adjacent normal tissues. Quantitative methylation analysis by MassArray revealed that CpG sites in SASH1 promoter shared similar methylation pattern in tumor tissue and adjacent normal tissue. The CpG sites with significant difference in methylation level were CpG_26.27 and CpG_54.55. Moreover, 5-aza-2'-deoxycytidine (5-Aza-dc) treatment of tumor cell line MDA-MB-231 caused significant elevation of SASH1 mRNA. Based on these data, we propose that increase of DNA methylation level in the promoter region of gene SASH1, particularly CpG_26.27 or CpG_54.55 sites, possibly repressed SASH1 expression in breast cancer.

  17. Methylation detection oligonucleotide microarray analysis: a high-resolution method for detection of CpG island methylation

    PubMed Central

    Kamalakaran, Sitharthan; Kendall, Jude; Zhao, Xiaoyue; Tang, Chunlao; Khan, Sohail; Ravi, Kandasamy; Auletta, Theresa; Riggs, Michael; Wang, Yun; Helland, Åslaug; Naume, Bjørn; Dimitrova, Nevenka; Børresen-Dale, Anne-Lise; Hicks, Jim; Lucito, Robert

    2009-01-01

    Methylation of CpG islands associated with genes can affect the expression of the proximal gene, and methylation of non-associated CpG islands correlates to genomic instability. This epigenetic modification has been shown to be important in many pathologies, from development and disease to cancer. We report the development of a novel high-resolution microarray that detects the methylation status of over 25 000 CpG islands in the human genome. Experiments were performed to demonstrate low system noise in the methodology and that the array probes have a high signal to noise ratio. Methylation measurements between different cell lines were validated demonstrating the accuracy of measurement. We then identified alterations in CpG islands, both those associated with gene promoters, as well as non-promoter-associated islands in a set of breast and ovarian tumors. We demonstrate that this methodology accurately identifies methylation profiles in cancer and in principle it can differentiate any CpG methylation alterations and can be adapted to analyze other species. PMID:19474344

  18. The Use of Chlorhexidine/n-Propyl Gallate (CPG) as an Ambient-Temperature Urine Preservative

    NASA Technical Reports Server (NTRS)

    Nillen, Jeannie L.; Smith, Scott M.

    2003-01-01

    A safe, effective ambient temperature urine preservative, chlorhexidine/n-propyl gallate (CPG), has been formulated for use during spacefli ght that reduces the effects of oxidation and bacterial contamination on sample integrity while maintaining urine pH. The ability of this preservative to maintain stability of nine key analytes was evaluated for a period of one year. CPG effectively maintained stability of a mmonia, total nitrogen, 3-methylhistidine, chloride, sodium, potassiu m, and urea; however, creatinine and osmolality were not preserved by CPG. These data indicate that CPG offers prolonged room-temperature storage for multiple urine analytes, reducing the requirements for f rozen urine storage on future spaceflights. Iii medical applications on Earth, this technology can allow urine samples to be collected in remote settings and eliminate the need to ship frozen samples.

  19. Reinforcement learning for a biped robot based on a CPG-actor-critic method.

    PubMed

    Nakamura, Yutaka; Mori, Takeshi; Sato, Masa-aki; Ishii, Shin

    2007-08-01

    Animals' rhythmic movements, such as locomotion, are considered to be controlled by neural circuits called central pattern generators (CPGs), which generate oscillatory signals. Motivated by this biological mechanism, studies have been conducted on the rhythmic movements controlled by CPG. As an autonomous learning framework for a CPG controller, we propose in this article a reinforcement learning method we call the "CPG-actor-critic" method. This method introduces a new architecture to the actor, and its training is roughly based on a stochastic policy gradient algorithm presented recently. We apply this method to an automatic acquisition problem of control for a biped robot. Computer simulations show that training of the CPG can be successfully performed by our method, thus allowing the biped robot to not only walk stably but also adapt to environmental changes.

  20. Methylation oligonucleotide microarray: a novel tool to analyze methylation patterns

    NASA Astrophysics Data System (ADS)

    Hou, Peng; Ji, Meiju; He, Nongyao; Lu, Zuhong

    2003-04-01

    A new technique to analyze methylation patterns in several adjacent CpG sites was developed and reported here. We selected a 336bp segment of the 5"-untranslated region and the first exon of the p16Ink4a gene, which include the most densely packed CpG fragment of the islands containing 32 CpG dinucleotides, as the investigated target. The probes that include all types of methylation patterns were designed to fabricate a DNA microarray to determine the methylation patterns of seven adjacent CpG dinucleotides sites. High accuracy and reproducibility were observed in several parallel experiments. The results led us to the conclusion that the methylation oligonucleotide microarray can be applied as a novel and powerful tool to map methylation patterns and changes in multiple CpG island loci in a variety of tumors.

  1. Association between Promoter Methylation of Gene ERCC3 and Benzene Hematotoxicity.

    PubMed

    Zheng, Min; Lin, Feiliang; Hou, Fenxia; Li, Guilan; Zhu, Caiying; Xu, Peiyu; Xing, Caihong; Wang, Qianfei

    2017-08-16

    Benzene is a primary industrial chemical and a ubiquitous environmental pollutant. ERCC3 is a key player in nucleotide excision repair. Recent studies suggested that site-specific methylation is a possible mechanism of the transcriptional dysregulation by blocking transcription factors binding. We previously found that the average promoter methylation level of ERCC3 was increased in benzene-exposed workers. In order to test whether specific CpG sites of ERCC3 play an important role in benzene-induced epigenetic changes and whether the specific methylation patterns are associated with benzene hematotoxicity, we analyzed the promoter methylation levels of individual CpG sites, transcription factor binding motif and the correlation between aberrant CpG methylation and hematotoxicity in 76 benzene-exposed workers and 24 unexposed controls in China. Out of all the CpGs analyzed, two CpG units located 43 bp upstream and 99 bp downstream of the transcription start site of ERCC3 (CpG 2-4 and CpG 17-18, respectively), showed the most pronounced increase in methylation levels in benzene-exposed workers, compared with unexposed controls (Mean ± SD: 5.86 ± 2.77% vs. 4.92 ± 1.53%, p = 0.032; 8.45 ± 4.09% vs. 6.79 ± 2.50%, p = 0.024, respectively). Using the JASPAR CORE Database, we found that CpG 2-4 and CpG 17-18 were bound by three putative transcription factors (TFAP2A, E2F4 and MZF1). Furthermore, the methylation levels for CpG 2-4 were correlated negatively with the percentage of neutrophils ( β = -0.676, p = 0.005) in benzene-exposed workers. This study demonstrates that CpG-specific DNA methylation in the ERCC3 promoter region may be involved in benzene-induced epigenetic modification and it may contribute to benzene-induced hematotoxicity.

  2. Association between Promoter Methylation of Gene ERCC3 and Benzene Hematotoxicity

    PubMed Central

    Lin, Feiliang; Hou, Fenxia; Li, Guilan; Zhu, Caiying; Xu, Peiyu; Xing, Caihong; Wang, Qianfei

    2017-01-01

    Benzene is a primary industrial chemical and a ubiquitous environmental pollutant. ERCC3 is a key player in nucleotide excision repair. Recent studies suggested that site-specific methylation is a possible mechanism of the transcriptional dysregulation by blocking transcription factors binding. We previously found that the average promoter methylation level of ERCC3 was increased in benzene-exposed workers. In order to test whether specific CpG sites of ERCC3 play an important role in benzene-induced epigenetic changes and whether the specific methylation patterns are associated with benzene hematotoxicity, we analyzed the promoter methylation levels of individual CpG sites, transcription factor binding motif and the correlation between aberrant CpG methylation and hematotoxicity in 76 benzene-exposed workers and 24 unexposed controls in China. Out of all the CpGs analyzed, two CpG units located 43 bp upstream and 99 bp downstream of the transcription start site of ERCC3 (CpG 2–4 and CpG 17–18, respectively), showed the most pronounced increase in methylation levels in benzene-exposed workers, compared with unexposed controls (Mean ± SD: 5.86 ± 2.77% vs. 4.92 ± 1.53%, p = 0.032; 8.45 ± 4.09% vs. 6.79 ± 2.50%, p = 0.024, respectively). Using the JASPAR CORE Database, we found that CpG 2–4 and CpG 17–18 were bound by three putative transcription factors (TFAP2A, E2F4 and MZF1). Furthermore, the methylation levels for CpG 2–4 were correlated negatively with the percentage of neutrophils (β = −0.676, p = 0.005) in benzene-exposed workers. This study demonstrates that CpG-specific DNA methylation in the ERCC3 promoter region may be involved in benzene-induced epigenetic modification and it may contribute to benzene-induced hematotoxicity. PMID:28813025

  3. Vitamin D dose response is underestimated by Endocrine Society's Clinical Practice Guideline.

    PubMed

    McKenna, Malachi J; Murray, Barbara F

    2013-06-01

    The recommended daily intakes of vitamin D according to the recent Clinical Practice Guideline (CPG) of the Endocrine Society are three- to fivefold higher than the Institute of Medicine (IOM) report. We speculated that these differences could be explained by different mathematical approaches to the vitamin D dose response. Studies were selected if the daily dose was ≤2000 IU/day, the duration exceeded 3 months, and 25-hydroxyvitamin D (25OHD) concentrations were measured at baseline and post-therapy. The rate constant was estimated according to the CPG approach. The achieved 25OHD result was estimated according to the following: i) the regression equation approach of the IOM; ii) the regression approach of the Vitamin D Supplementation in Older Subjects (ViDOS) study; and iii) the CPG approach using a rate constant of 2.5 (CPG2.5) and a rate constant of 5.0 (CPG5.0). The difference between the expected and the observed 25OHD result was expressed as a percentage of observed and analyzed for significance against a value of 0% for the four groups. Forty-one studies were analyzed. The mean (95% CI) rate constant was 5.3 (4.4-6.2) nmol/l per 100 IU per day, on average twofold higher than the CPG rate constant. The mean (95% CI) for the difference between the expected and observed expressed as a percentage of observed was as follows: i) IOM, -7 (-16,+2)% (t=1.64, P=0.110); ii) ViDOS, +2 (-8,+12)% (t=0.40, P=0.69); iii) CPG2.5, -21 (-27,-15)% (t=7.2, P<0.0001); and iv) CPG5.0+3 (-4,+10)% (t=0.91, P=0.366). The CPG 'rule of thumb' should be doubled to 5.0 nmol/l (2.0 ng/ml) per 100 IU per day, adopting a more risk-averse position.

  4. The complete DNA sequence of lymphocystis disease virus.

    PubMed

    Tidona, C A; Darai, G

    1997-04-14

    Lymphocystis disease virus (LCDV) is the causative agent of lymphocystis disease, which has been reported to occur in over 100 different fish species worldwide. LCDV is a member of the family Iridoviridae and the type species of the genus Lymphocystivirus. The virions contain a single linear double-stranded DNA molecule, which is circularly permuted, terminally redundant, and heavily methylated at cytosines in CpG sequences. The complete nucleotide sequence of LCDV-1 (flounder isolate) was determined by automated cycle sequencing and primer walking. The genome of LCDV-1 is 102.653 bp in length and contains 195 open reading frames with coding capacities ranging from 40 to 1199 amino acids. Computer-assisted analyses of the deduced amino acid sequences led to the identification of several putative gene products with significant homologies to entries in protein data banks, such as the two major subunits of the viral DNA-dependent RNA polymerase, DNA polymerase, several protein kinases, two subunits of the ribonucleoside diphosphate reductase, DNA methyltransferase, the viral major capsid protein, insulin-like growth factor, and tumor necrosis factor receptor homolog.

  5. Analysis of the association between CIMP and BRAF in colorectal cancer by DNA methylation profiling.

    PubMed

    Hinoue, Toshinori; Weisenberger, Daniel J; Pan, Fei; Campan, Mihaela; Kim, Myungjin; Young, Joanne; Whitehall, Vicki L; Leggett, Barbara A; Laird, Peter W

    2009-12-21

    A CpG island methylator phenotype (CIMP) is displayed by a distinct subset of colorectal cancers with a high frequency of DNA hypermethylation in a specific group of CpG islands. Recent studies have shown that an activating mutation of BRAF (BRAF(V600E)) is tightly associated with CIMP, raising the question of whether BRAF(V600E) plays a causal role in the development of CIMP or whether CIMP provides a favorable environment for the acquisition of BRAF(V600E). We employed Illumina GoldenGate DNA methylation technology, which interrogates 1,505 CpG sites in 807 different genes, to further study this association. We first examined whether expression of BRAF(V600E) causes DNA hypermethylation by stably expressing BRAF(V600E) in the CIMP-negative, BRAF wild-type COLO 320DM colorectal cancer cell line. We determined 100 CIMP-associated CpG sites and examined changes in DNA methylation in eight stably transfected clones over multiple passages. We found that BRAF(V600E) is not sufficient to induce CIMP in our system. Secondly, considering the alternative possibility, we identified genes whose DNA hypermethylation was closely linked to BRAF(V600E) and CIMP in 235 primary colorectal tumors. Interestingly, genes that showed the most significant link include those that mediate various signaling pathways implicated in colorectal tumorigenesis, such as BMP3 and BMP6 (BMP signaling), EPHA3, KIT, and FLT1 (receptor tyrosine kinases) and SMO (Hedgehog signaling). Furthermore, we identified CIMP-dependent DNA hypermethylation of IGFBP7, which has been shown to mediate BRAF(V600E)-induced cellular senescence and apoptosis. Promoter DNA hypermethylation of IGFBP7 was associated with silencing of the gene. CIMP-specific inactivation of BRAF(V600E)-induced senescence and apoptosis pathways by IGFBP7 DNA hypermethylation might create a favorable context for the acquisition of BRAF(V600E) in CIMP+ colorectal cancer. Our data will be useful for future investigations toward understanding CIMP in colorectal cancer and gaining insights into the role of aberrant DNA hypermethylation in colorectal tumorigenesis.

  6. CpG methylation patterns and decitabine treatment response in acute myeloid leukemia cells and normal hematopoietic precursors

    PubMed Central

    Negrotto, Soledad; Ng, Kwok Peng; Jankowska, Ania M.; Bodo, Juraj; Gopalan, Banu; Guinta, Kathryn; Mulloy, James C.; Hsi, Eric; Maciejewski, Jaroslaw; Saunthararajah, Yogen

    2011-01-01

    The DNA hypomethylating drug decitabine maintains normal hematopoietic stem cell (HSC) self-renewal but induces terminal differentiation in acute myeloid leukemia (AML) cells. The basis for these contrasting cell-fates, and for selective CpG hypomethylation by decitabine, is poorly understood. Promoter CpGs, with methylation measured by microarray, were classified by the direction of methylation change with normal myeloid maturation. In AML cells, the methylation pattern at maturation-responsive CpG suggested at least partial maturation. Consistent with partial maturation, in gene expression analyses, AML cells expressed high levels of the key lineage-specifying factor CEBPA, but relatively low levels of the key late-differentiation driver CEBPE. In methylation analysis by mass-spectrometry, CEBPE promoter CpG that are usually hypomethylated during granulocyte maturation were significantly hypermethylated in AML cells. Decitabine treatment induced cellular differentiation of AML cells, and the largest methylation decreases were at CpG that are hypomethylated with myeloid maturation, including CEBPE promoter CpG. In contrast, decitabine-treated normal HSC retained immature morphology, and methylation significantly decreased at CpG that are less methylated in immature cells. High expression of lineage-specifying factor and aberrant epigenetic repression of some key late-differentiation genes distinguishes AML cells from normal HSC and could explain the contrasting differentiation and methylation responses to decitabine. PMID:21836612

  7. Distinct Effects of Monophosphoryl Lipid A, Oligodeoxynucleotide CpG, and Combination Adjuvants on Modulating Innate and Adaptive Immune Responses to Influenza Vaccination

    PubMed Central

    Ko, Eun-Ju; Lee, Young-Tae; Lee, Youri; Kim, Ki-Hye

    2017-01-01

    Monophosphoryl lipid A (MPL) and oligodeoxynucleotide CpG are toll-like receptor (TLR) 4 and 9 agonist, respectively. Here, we investigated the effects of MPL, CpG, and combination adjuvants on stimulating in vitro dendritic cells (DCs), in vivo innate and adaptive immune responses, and protective efficacy of influenza vaccination. Combination of MPL and CpG was found to exhibit distinct effects on stimulating DCs in vitro to secrete IL-12p70 and tumor necrosis factor (TNF)-α and proliferate allogeneic CD8 T cells. Prime immunization of mice with inactivated split influenza vaccine in the presence of low dose MPL+CpG adjuvants increased the induction of virus-specific IgG and IgG2a isotype antibodies. MPL and CpG adjuvants contribute to improving the efficacy of prime influenza vaccination against lethal influenza challenge as determined by body weight monitoring, lung function, viral titers, and histology. A combination of MPL and CpG adjuvants was effective in improving vaccine efficacy as well as in reducing inflammatory immune responses locally and in inducing cellular immune responses upon lethal influenza virus challenge. This study demonstrates unique adjuvant effects of MPL, CpG, and combination adjuvants on modulating innate and adaptive immune responses to influenza prime vaccination. PMID:29093654

  8. Levels of DNA Methylation Vary at CpG Sites across the BRCA1 Promoter, and Differ According to Triple Negative and "BRCA-Like" Status, in Both Blood and Tumour DNA.

    PubMed

    Daniels, Sarah L; Burghel, George J; Chambers, Philip; Al-Baba, Shadi; Connley, Daniel D; Brock, Ian W; Cramp, Helen E; Dotsenko, Olena; Wilks, Octavia; Wyld, Lynda; Cross, Simon S; Cox, Angela

    2016-01-01

    Triple negative breast cancer is typically an aggressive and difficult to treat subtype. It is often associated with loss of function of the BRCA1 gene, either through mutation, loss of heterozygosity or methylation. This study aimed to measure methylation of the BRCA1 gene promoter at individual CpG sites in blood, tumour and normal breast tissue, to assess whether levels were correlated between different tissues, and with triple negative receptor status, histopathological scoring for BRCA-like features and BRCA1 protein expression. Blood DNA methylation levels were significantly correlated with tumour methylation at 9 of 11 CpG sites examined (p<0.0007). The levels of tumour DNA methylation were significantly higher in triple negative tumours, and in tumours with high BRCA-like histopathological scores (10 of 11 CpG sites; p<0.01 and p<0.007 respectively). Similar results were observed in blood DNA (6 of 11 CpG sites; p<0.03 and 7 of 11 CpG sites; p<0.02 respectively). This study provides insight into the pattern of CpG methylation across the BRCA1 promoter, and supports previous studies suggesting that tumours with BRCA1 promoter methylation have similar features to those with BRCA1 mutations, and therefore may be suitable for the same targeted therapies.

  9. Altered DNA Methylation and Expression Profiles of 8-Oxoguanine DNA Glycosylase 1 in Lens Tissue from Age-related Cataract Patients.

    PubMed

    Wang, Yong; Li, Fei; Zhang, Guowei; Kang, Lihua; Qin, Bai; Guan, Huaijin

    2015-01-01

    Oxidative stress and DNA damage contribute to the pathogenesis of age-related cataract (ARC). Most oxidative DNA lesions are repaired via the base excision repair (BER) proteins including 8-oxoguanine DNA glycosylase 1 (OGG1). This study examined DNA methylation of CpG islands upstream of OGG1 and their relation to the gene expression in lens cortex from ARC patients. The clinical case-control study consisted of 15 cortical type of ARC patients and 15 age-matched non-ARC controls who received transparent lens extraction due to vitreoretinal diseases. OGG1 expression in lens cortex was analyzed by qRT-PCR and Western blot. The localization and the proportion of cells positive for OGG1 were determined by immunofluorescence. Bisulfite-sequencing PCR (BSP) was performed to evaluate the methylation status of CpG islands near OGG1 in DNA extracted from lens cortex. To test relationship between the methylation and the expression of the gene of interest, 5-Aza-2'-deoxycytidine (5-Aza-dC) was used to induce demethylation of cultured human lens epithelium B-3 (HLE B-3). To test the role of OGG1 in the repair of cellular damage, HLE B-3 was transfected with OGG1 vector, followed by ultraviolet radiation b (UVB) exposure to induce apoptosis. The mRNA and protein levels of OGG1 were significantly reduced in the lens cortex of ARC. Immunofluorescence showed that the proportion of OGG1-positive cells decreased significantly in ARC cortex in comparison with the control. The CpG island in first exon of OGG1 displayed hypermethylation in the DNA extracted from the lens cortex of ARC. Treatment of HLEB-3 cells with 5-Aza-dC upregulated OGG1 expression. UVB-induced apoptosis was attenuated after transfection with OGG1. A reduced OGG1 expression was correlated with hypermethylation of a CpG island of OGG1 in lens cortex of ARC. The role of epigenetic change in OGG1 gene in the susceptibility to oxidative stress induced cortical ARC is warranted to further study.

  10. Genome-Wide Locations of Potential Epimutations Associated with Environmentally Induced Epigenetic Transgenerational Inheritance of Disease Using a Sequential Machine Learning Prediction Approach.

    PubMed

    Haque, M Muksitul; Holder, Lawrence B; Skinner, Michael K

    2015-01-01

    Environmentally induced epigenetic transgenerational inheritance of disease and phenotypic variation involves germline transmitted epimutations. The primary epimutations identified involve altered differential DNA methylation regions (DMRs). Different environmental toxicants have been shown to promote exposure (i.e., toxicant) specific signatures of germline epimutations. Analysis of genomic features associated with these epimutations identified low-density CpG regions (<3 CpG / 100bp) termed CpG deserts and a number of unique DNA sequence motifs. The rat genome was annotated for these and additional relevant features. The objective of the current study was to use a machine learning computational approach to predict all potential epimutations in the genome. A number of previously identified sperm epimutations were used as training sets. A novel machine learning approach using a sequential combination of Active Learning and Imbalance Class Learner analysis was developed. The transgenerational sperm epimutation analysis identified approximately 50K individual sites with a 1 kb mean size and 3,233 regions that had a minimum of three adjacent sites with a mean size of 3.5 kb. A select number of the most relevant genomic features were identified with the low density CpG deserts being a critical genomic feature of the features selected. A similar independent analysis with transgenerational somatic cell epimutation training sets identified a smaller number of 1,503 regions of genome-wide predicted sites and differences in genomic feature contributions. The predicted genome-wide germline (sperm) epimutations were found to be distinct from the predicted somatic cell epimutations. Validation of the genome-wide germline predicted sites used two recently identified transgenerational sperm epimutation signature sets from the pesticides dichlorodiphenyltrichloroethane (DDT) and methoxychlor (MXC) exposure lineage F3 generation. Analysis of this positive validation data set showed a 100% prediction accuracy for all the DDT-MXC sperm epimutations. Observations further elucidate the genomic features associated with transgenerational germline epimutations and identify a genome-wide set of potential epimutations that can be used to facilitate identification of epigenetic diagnostics for ancestral environmental exposures and disease susceptibility.

  11. CpA/CpG methylation of CiMDA5 possesses tight association with the resistance against GCRV and negatively regulates mRNA expression in grass carp, Ctenopharyngodon idella.

    PubMed

    Shang, Xueying; Su, Jianguo; Wan, Quanyuan; Su, Juanjuan

    2015-01-01

    Melanoma differentiation-associated gene 5 (MDA5) plays a crucial role in recognizing intracellular viral infection, activating the interferon regulatory factor pathways as well as inducing antiviral response. While the antiviral regulatory mechanism of MDA5 remains unclear. In the present study, CiMDA5 (Ctenopharyngodon idella MDA5) against grass carp reovirus (GCRV) would be initially revealed from the perspective of DNA methylation, a pivotal epigenetic modification. Two CpG islands (CGIs) were predicted located in the first exon of CiMDA5, of which the first CpG island was 427 bp in length possessed 29 candidate CpG loci and 34 CpA loci, and the second one was 130 bp in length involving 7 CpG loci as well as 10 CpA loci. By bisulfite sequencing PCR (BSP), the methylation statuses were detected in spleen of 70 individuals divided into resistant/susceptible groups post challenge experiment, and the resistance-association analysis was performed with Chi-square test. Quantitative real-time RT-PCR (qRT-PCR) was carried out to explore the relationship between DNA methylation and gene expression in CiMDA5. Results indicated that the methylation levels of CpA/CpG sites at +200, +202, +204, +207 nt, which consisted of a putative densely methylated element (DME), were significantly higher in the susceptible group than those in the resistant group. Meanwhile, the average transcription of CiMDA5 was down-regulated in the susceptible individuals compared with the resistant individuals. Evidently, the DNA methylation may be the negative modulator of CiMDA5 antiviral expression. Collectively, the methylation levels of CiMDA5 demonstrated the tight association with the resistance against GCRV and the negative-regulated roles in mRNA expression. This study first discovered the resistance-associated gene modulated by DNA methylation in teleost, preliminary revealed the underlying regulatory mechanism of CiMDA5 transcription against GCRV as well as laid a theoretical foundation on molecular nosogenesis of hemorrhagic diseases in C. idella. Copyright © 2014 Elsevier Ltd. All rights reserved.

  12. Reconstruction of Toll-like receptor 9-mediated responses in HEK-Blue hTLR9 cells by transfection of human macrophage scavenger receptor 1 gene.

    PubMed

    Ohtsuki, Shozo; Takahashi, Yuki; Inoue, Takao; Takakura, Yoshinobu; Nishikawa, Makiya

    2017-10-20

    We used human Toll-like receptor 9 (hTLR9)-expressing HEK-Blue hTLR9 cells, which release secreted embryonic alkaline phosphatase (SEAP) upon response to CpG DNA, to evaluate the immunological properties of nucleic acid drug candidates. Our preliminary studies showed that phosphodiester CpG DNA hardly induced any SEAP secretion in HEK-Blue hTLR9 cells. In the current study, therefore, we developed HEK-Blue hTLR9 cells transduced with human macrophage scavenger receptor-1 (hMSR1), a cell-surface DNA receptor, and determined whether HEK-Blue hTLR9/hMSR1 cells respond to phosphorothioate (PS) CpG DNA and phosphodiester (PO) CpG DNA. We selected PS CpG2006, a single-stranded PO CpG DNA (ssCpG), and a tetrapod-like structured DNA (tetrapodna) containing ssCpG (tetraCpG) as model TLR9 ligands. Alexa Fluor 488-labeled ligands were used for flow cytometry. Unlike the mock-transfected HEK-Blue hTLR9 cells, the HEK-Blue hTLR9/hMSR1 cells efficiently took up all three CpG DNAs. SEAP release was almost proportional to the uptake. Treatment of HEK-Blue hTLR9/hMSR1 cells with an anti-hMSR1 antibody significantly reduced the uptake of ssCpG and tetraCpG. Collectively, reconstruction of TLR9-mediated responses to CpG DNA in HEK-Blue hTLR9 cells can be used to evaluate the toxicity of nucleic acid drug candidates with diverse physicochemical properties.

  13. Extended Plasticity of Visual Cortex in Dark-Reared Animals May Result from Prolonged Expression of cpg15-Like Genes

    PubMed Central

    Lee, Wei-Chung Allen; Nedivi, Elly

    2011-01-01

    cpg15 is an activity-regulated gene that encodes a membrane-bound ligand that coordinately regulates growth of apposing dendritic and axonal arbors and the maturation of their synapses. These properties make it an attractive candidate for participating in plasticity of the mammalian visual system. Here we compare cpg15 expression during normal development of the rat visual system with that seen in response to dark rearing, monocular blockade of retinal action potentials, or monocular deprivation. Our results show that the onset of cpg15 expression in the visual cortex is coincident with eye opening, and it increases until the peak of the critical period at postnatal day 28 (P28). This early expression is independent of both retinal activity and visual experience. After P28, a component of cpg15 expression in the visual cortex, lateral geniculate nucleus (LGN), and superior colliculus (SC) develops a progressively stronger dependence on retinally driven action potentials. Dark rearing does not affect cpg15 mRNA expression in the LGN and SC at any age, but it does significantly affect its expression in the visual cortex from the peak of the critical period and into adulthood. In dark-reared rats, the peak level of cpg15 expression in the visual cortex at P28 is lower than in controls. Rather than showing the normal decline with maturation, these levels are maintained in dark-reared animals. We suggest that the prolonged plasticity in the visual cortex that is seen in dark-reared animals may result from failure to downregulate genes such as cpg15 that could promote structural remodeling and synaptic maturation. PMID:11880509

  14. Evidence-based clinical practice guideline for adult Still's disease.

    PubMed

    Mimura, Toshihide; Kondo, Yuya; Ohta, Akihide; Iwamoto, Masahiro; Ota, Akiko; Okamoto, Nami; Kawaguchi, Yasushi; Kono, Hajime; Takasaki, Yoshinari; Takei, Shuji; Nishimoto, Norihiro; Fujimoto, Manabu; Asanuma, Yu Funakubo; Mimori, Akio; Okiyama, Naoko; Kaneko, Shunta; Takahashi, Hiroyuki; Yokosawa, Masahiro; Sumida, Takayuki

    2018-05-09

    Using an expert- and data-driven methodology, we have constructed the first clinical practice guidelines (CPGs) for adult Still's disease (ASD) after complete systematic review (SR) of the literature based upon the Medical Information Network Distribution Service (Minds) procedure. The CPG committee for ASD organized by the Research Team for Autoimmune Diseases, the Research Program for Intractable Disease of the Japanese Ministry of Health, Labour, and Welfare has developed CPG for ASD 2017, according to the procedure proposed by Minds. The CPG development process includes (1) clarification of the purpose of CPG, (2) organization of the steering committee, (3) organization of the CPG committee and secretariat, (4) defining the scope (setting of clinical questions (CQs)), (5) SR, (6) development of recommendations, (7) drafting the CPG, (8) external evaluation and public comments, and (9) release. Because we wanted to construct CPG for ASD to encompass both adult-onset Still's disease (AOSD) and adult patients with systemic juvenile idiopathic arthritis (sJIA), we also included SR data from sJIA in this study. Twenty-six CQs were selected and roughly divided into the following items: (1) clinical findings (CQs 1-4), (2) laboratory findings (CQs 5-8), (3) complications (CQs 9-13), (4) treatment with oral medicine (CQs 14-19), (5) treatment with biological reagents (CQs 20-23), and (6) treatments for sJIA (CQs 25-26). Recommendations and the strength of the recommendations for these CQs were decided by a modified Delphi method. We have developed the first published CPG for ASD including AOSD and sJIA, which includes 26 CQs and recommendations. This guideline will help rheumatologists, non-specialized physicians, other healthcare providers, medical and health-related students, and patients and their family members to understand and treat ASD.

  15. Provider Adherence to Implementation of Clinical Practice Guidelines for Neurogenic Bowel in Adults With Spinal Cord Injury

    PubMed Central

    Goetz, Lance L; Nelson, Audrey L; Guihan, Marylou; Bosshart, Helen T; Harrow, Jeffrey J; Gerhart, Kevin D; Krasnicka, Barbara; Burns, Stephen P

    2005-01-01

    Background/Objectives: Clinical Practice Guidelines (CPGs) have been published on a number of topics in spinal cord injury (SCI) medicine. Research in the general medical literature shows that the distribution of CPGs has a minimal effect on physician practice without targeted implementation strategies. The purpose of this study was to determine (a) whether dissemination of an SCI CPG improved the likelihood that patients would receive CPG recommended care and (b) whether adherence to CPG recommendations could be improved through a targeted implementation strategy. Specifically, this study addressed the “Neurogenic Bowel Management in Adults with Spinal Cord Injury” Clinical Practice Guideline published in March 1998 by the Consortium for Spinal Cord Medicine Methods: CPG adherence was determined from medical record review at 6 Veterans Affairs SCI centers for 3 time periods: before guideline publication (T1), after guideline publication but before CPG implementation (T2), and after targeted CPG implementation (T3). Specific implementation strategies to enhance guideline adherence were chosen to address the barriers identified by SCI providers in focus groups before the intervention. Results: Overall adherence to recommendations related to neurogenic bowel did not change between T1 and T2 (P = not significant) but increased significantly between T2 and T3 (P < 0.001) for 3 of 6 guideline recommendations. For the other 3 guideline recommendations, adherence rates were noted to be high at T1. Conclusions: While publication of the CPG alone did not alter rates of provider adherence, the use of a targeted implementation plan resulted in increases in adherence rates with some (3 of 6) CPG recommendations for neurogenic bowel management. PMID:16869086

  16. The Genomic Impact of DNA CpG Methylation on Gene Expression; Relationships in Prostate Cancer.

    PubMed

    Long, Mark D; Smiraglia, Dominic J; Campbell, Moray J

    2017-02-14

    The process of DNA CpG methylation has been extensively investigated for over 50 years and revealed associations between changing methylation status of CpG islands and gene expression. As a result, DNA CpG methylation is implicated in the control of gene expression in developmental and homeostasis processes, as well as being a cancer-driver mechanism. The development of genome-wide technologies and sophisticated statistical analytical approaches has ushered in an era of widespread analyses, for example in the cancer arena, of the relationships between altered DNA CpG methylation, gene expression, and tumor status. The remarkable increase in the volume of such genomic data, for example, through investigators from the Cancer Genome Atlas (TCGA), has allowed dissection of the relationships between DNA CpG methylation density and distribution, gene expression, and tumor outcome. In this manner, it is now possible to test that the genome-wide correlations are measurable between changes in DNA CpG methylation and gene expression. Perhaps surprisingly is that these associations can only be detected for hundreds, but not thousands, of genes, and the direction of the correlations are both positive and negative. This, perhaps, suggests that CpG methylation events in cancer systems can act as disease drivers but the effects are possibly more restricted than suspected. Additionally, the positive and negative correlations suggest direct and indirect events and an incomplete understanding. Within the prostate cancer TCGA cohort, we examined the relationships between expression of genes that control DNA methylation, known targets of DNA methylation and tumor status. This revealed that genes that control the synthesis of S -adenosyl-l-methionine (SAM) associate with altered expression of DNA methylation targets in a subset of aggressive tumors.

  17. A terahertz EO detector with large dynamical range, high modulation depth and signal-noise ratio

    NASA Astrophysics Data System (ADS)

    Pan, Xinjian; Cai, Yi; Zeng, Xuanke; Zheng, Shuiqin; Li, Jingzhen; Xu, Shixiang

    2017-05-01

    The paper presents a novel design for terahertz (THz) free-space time domain electro-optic (EO) detection where the static birefringent phases of the two balanced arms are set close to zero but opposite to each other. Our theoretical and numerical analyses show this design has much stronger ability to cancel the optical background noise than both THz ellipsometer and traditional crossed polarizer geometry (CPG). Its optical modulation depth is about twice as high as that of traditional CPG, but about ten times as high as that of THz ellipsometer. As for the dynamical range, our improved design is comparable to the THz ellipsometer but obviously larger than the traditional CPG. Some experiments for comparing our improved CPG with traditional CPG agree well with the corresponding theoretical predictions. Our experiments also show that the splitting ratio of the used non-polarization beam splitter is critical for the performance of our design.

  18. CpG oligodeoxyribonucleotides protect mice from Burkholderia pseudomallei but not Francisella tularensis Schu S4 aerosols

    PubMed Central

    2010-01-01

    Studies have shown that CpG oligodeoxyribonucleotides (ODN) protect mice from various bacterial pathogens, including Burkholderia pseudomallei and Francisella tularensis live vaccine strain (LVS), when administered before parenteral challenge. Given the potential to develop CpG ODN as a pre-treatment for multiple bacterial biological warfare agents, we examined survival, histopathology, and cytokine data from CpG ODN-treated C57BL/6 mice to determine whether previously-reported protection extended to aerosolized B. pseudomallei 1026b and highly virulent F. tularensis Schu S4 infections. We found that, although CpG ODN protected mice from aerosolized B. pseudomallei challenges, the immunostimulant failed to benefit the animals exposed to F. tularensis Schu S4 aerosols. Our results, which contrast with earlier F. tularensis LVS studies, highlight potential differences in Francisella species pathogenesis and underscore the need to evaluate immunotherapies against human pathogenic species. PMID:20181102

  19. CpG oligodeoxyribonucleotides protect mice from Burkholderia pseudomallei but not Francisella tularensis Schu S4 aerosols.

    PubMed

    Rozak, David A; Gelhaus, Herbert C; Smith, Mark; Zadeh, Mojgan; Huzella, Louis; Waag, David; Adamovicz, Jeffrey J

    2010-02-05

    Studies have shown that CpG oligodeoxyribonucleotides (ODN) protect mice from various bacterial pathogens, including Burkholderia pseudomallei and Francisella tularensis live vaccine strain (LVS), when administered before parenteral challenge. Given the potential to develop CpG ODN as a pre-treatment for multiple bacterial biological warfare agents, we examined survival, histopathology, and cytokine data from CpG ODN-treated C57BL/6 mice to determine whether previously-reported protection extended to aerosolized B. pseudomallei 1026b and highly virulent F. tularensis Schu S4 infections. We found that, although CpG ODN protected mice from aerosolized B. pseudomallei challenges, the immunostimulant failed to benefit the animals exposed to F. tularensis Schu S4 aerosols. Our results, which contrast with earlier F. tularensis LVS studies, highlight potential differences in Francisella species pathogenesis and underscore the need to evaluate immunotherapies against human pathogenic species.

  20. Wheat hybridization and polyploidization results in deregulation of small RNAs.

    PubMed

    Kenan-Eichler, Michal; Leshkowitz, Dena; Tal, Lior; Noor, Elad; Melamed-Bessudo, Cathy; Feldman, Moshe; Levy, Avraham A

    2011-06-01

    Speciation via interspecific or intergeneric hybridization and polyploidization triggers genomic responses involving genetic and epigenetic alterations. Such modifications may be induced by small RNAs, which affect key cellular processes, including gene expression, chromatin structure, cytosine methylation and transposable element (TE) activity. To date, the role of small RNAs in the context of wide hybridization and polyploidization has received little attention. In this work, we performed high-throughput sequencing of small RNAs of parental, intergeneric hybrid, and allopolyploid plants that mimic the genomic changes occurring during bread wheat speciation. We found that the percentage of small RNAs corresponding to miRNAs increased with ploidy level, while the percentage of siRNAs corresponding to TEs decreased. The abundance of most miRNA species was similar to midparent values in the hybrid, with some deviations, as seen in overrepresentation of miR168, in the allopolyploid. In contrast, the number of siRNAs corresponding to TEs strongly decreased upon allopolyploidization, but not upon hybridization. The reduction in corresponding siRNAs, together with decreased CpG methylation, as shown here for the Veju element, represent hallmarks of TE activation. TE-siRNA downregulation in the allopolyploid may contribute to genome destabilization at the initial stages of speciation. This phenomenon is reminiscent of hybrid dysgenesis in Drosophila.

  1. [Evaluation of the quality of clinical practice guidelines published in the Annales de Biologie Clinique with the help of the EFLM checklist].

    PubMed

    Wils, Julien; Fonfrède, Michèle; Augereau, Christine; Watine, Joseph

    2014-01-01

    Several tools are available to help evaluate the quality of clinical practice guidelines (CPG). The AGREE instrument (Appraisal of guidelines for research & evaluation) is the most consensual tool but it has been designed to assess CPG methodology only. The European federation of laboratory medicine (EFLM) recently designed a check-list dedicated to laboratory medicine which is supposed to be comprehensive and which therefore makes it possible to evaluate more thoroughly the quality of CPG in laboratory medicine. In the present work we test the comprehensiveness of this check-list on a sample of CPG written in French and published in Annales de biologie clinique (ABC). Thus we show that some work remains to be achieved before a truly comprehensive check-list is designed. We also show that there is some room for improvement for the CPG published in ABC, for example regarding the fact that some of these CPG do not provide any information about allowed durations of transport and of storage of biological samples before analysis, or about standards of minimal analytical performance, or about the sensitivities or the specificities of the recommended tests.

  2. Immunotherapeutic potential of CpG oligodeoxynucleotides in veterinary species.

    PubMed

    Manuja, Anju; Manuja, Balvinder K; Kaushik, Jyoti; Singha, Harisankar; Singh, Raj Kumar

    2013-10-01

    Innate immunity plays a critical role in host defense against infectious diseases by discriminating between self and infectious non-self. The recognition of infectious non-self involves germ-line encoded pattern recognition receptors (PRRs) that recognize pathogen-associated molecular patterns (PAMPs). The PAMPs are the components of pathogenic microbes which include not only the cell wall constituents but also the unmethylated 2'-deoxy-ribo-cytosine-phosphate-guanosine (CpG) motifs. These CpG motifs present within bacterial and viral DNA are recognized by toll-like receptor 9 (TLR9), and signaling by this receptor triggers a proinflammatory cytokine response which, in turn, influences both innate and adaptive immune responses. The activation of TLR9 with synthetic CpG oligodeoxynucleotides (ODNs) induces powerful Th1-like immune responses. It has been shown to provide protection against infectious diseases, allergy and cancer in laboratory animal models and some domestic animal species. With better understanding of the basic biology and immune mechanisms, it would be possible to exploit the potential of CpG motifs for animal welfare. The research developments in the area of CpG and TLR9 and the potential applications in animal health have been reviewed in this article.

  3. Regulation of glutamate receptor internalization by the spine cytoskeleton is mediated by its PKA-dependent association with CPG2

    PubMed Central

    Loebrich, Sven; Djukic, Biljana; Tong, Zachary J.; Cottrell, Jeffrey R.; Turrigiano, Gina G.; Nedivi, Elly

    2013-01-01

    A key neuronal mechanism for adjusting excitatory synaptic strength is clathrin-mediated endocytosis of postsynaptic glutamate receptors (GluRs). The actin cytoskeleton is critical for clathrin-mediated endocytosis, yet we lack a mechanistic understanding of its interaction with the endocytic process and how it may be regulated. Here we show that F-actin in dendritic spines physically binds the synaptic nuclear envelope 1 gene product candidate plasticity gene 2 (CPG2) in a PKA-dependent manner, and that this association is required for synaptic GluR internalization. Mutating two PKA sites on CPG2 disrupts its cytoskeletal association, attenuating GluR endocytosis and affecting the efficacy of synaptic transmission in vivo. These results identify CPG2 as an F-actin binding partner that functionally mediates interaction of the spine cytoskeleton with postsynaptic endocytosis. Further, the regulation of CPG2/F-actin association by PKA provides a gateway for cellular control of synaptic receptor internalization through second messenger signaling pathways. Recent identification of human synaptic nuclear envelope 1 as a risk locus for bipolar disorder suggests that CPG2 could play a role in synaptic dysfunction underlying neuropsychiatric disease. PMID:24191017

  4. Towards autonomous locomotion: CPG-based control of smooth 3D slithering gait transition of a snake-like robot.

    PubMed

    Bing, Zhenshan; Cheng, Long; Chen, Guang; Röhrbein, Florian; Huang, Kai; Knoll, Alois

    2017-04-04

    Snake-like robots with 3D locomotion ability have significant advantages of adaptive travelling in diverse complex terrain over traditional legged or wheeled mobile robots. Despite numerous developed gaits, these snake-like robots suffer from unsmooth gait transitions by changing the locomotion speed, direction, and body shape, which would potentially cause undesired movement and abnormal torque. Hence, there exists a knowledge gap for snake-like robots to achieve autonomous locomotion. To address this problem, this paper presents the smooth slithering gait transition control based on a lightweight central pattern generator (CPG) model for snake-like robots. First, based on the convergence behavior of the gradient system, a lightweight CPG model with fast computing time was designed and compared with other widely adopted CPG models. Then, by reshaping the body into a more stable geometry, the slithering gait was modified, and studied based on the proposed CPG model, including the gait transition of locomotion speed, moving direction, and body shape. In contrast to sinusoid-based method, extensive simulations and prototype experiments finally demonstrated that smooth slithering gait transition can be effectively achieved using the proposed CPG-based control method without generating undesired locomotion and abnormal torque.

  5. CpG Oligodeoxynucleotide and Montanide ISA 51 Adjuvant Combination Enhanced the Protective Efficacy of a Subunit Malaria Vaccine

    PubMed Central

    Kumar, Sanjai; Jones, Trevor R.; Oakley, Miranda S.; Zheng, Hong; Kuppusamy, Shanmuga P.; Taye, Alem; Krieg, Arthur M.; Stowers, Anthony W.; Kaslow, David C.; Hoffman, Stephen L.

    2004-01-01

    Unmethylated CpG dinucleotide motifs present in bacterial genomes or synthetic oligodeoxynucleotides (ODNs) serve as strong immunostimulatory agents in mice, monkeys and humans. We determined the adjuvant effect of murine CpG ODN 1826 on the immunogenicity and protective efficacy of the Saccharomyces cerevisiae-expressed 19-kDa C-terminal region of merozoite surface protein 1 (yMSP119) of the murine malaria parasite Plasmodium yoelii. We found that in C57BL/6 mice, following sporozoite challenge, the degree of protective immunity against malaria induced by yMSP119 in a formulation of Montanide ISA 51 (ISA) plus CpG ODN 1826 was similar or superior to that conferred by yMSP119 emulsified in complete Freund's adjuvant (CFA/incomplete Freund's adjuvant). In total, among mice immunized with yMSP119, 22 of 32 (68.7%) with ISA plus CpG 1826, 0 of 4 (0%) with CFA/incomplete Freund’s adjuvant, 0 of 4 (0%) with CpG 1826 mixed with ISA (no yMSP119), and 0 of 11 (0%) with CpG 1826 alone were completely protected against development of erythrocytic stage infection after sporozoite challenge. The adjuvant effect of CpG ODN 1826 was manifested as both significantly improved complete protection from malaria (defined as the absence of detectable erythrocytic form parasites) (P = 0.007, chi square) and reduced parasite burden in infected mice. In vivo depletions of interleukin-12 and gamma interferon cytokines and CD4+ and CD8+ T cells in vaccinated mice had no significant effect on immunity. On the other hand, immunoglobulin G (IgG) isotype levels appeared to correlate with protection. Inclusion of CpG ODN 1826 in the yMSP119 plus ISA vaccine contributed towards the induction of higher levels of IgG2a and IgG2b (Th1 type) antibodies, suggesting that CpG ODN 1826 caused a shift towards a Th1 type of immune response that could be responsible for the higher degree of protective immunity. Our results indicate that this potent adjuvant formulation should be further evaluated for use in clinical trials of recombinant malarial vaccine candidates. PMID:14742540

  6. 5meCpG epigenetic marks neighboring a primate-conserved core promoter short tandem repeat indicate X-chromosome inactivation.

    PubMed

    Machado, Filipe Brum; Machado, Fabricio Brum; Faria, Milena Amendro; Lovatel, Viviane Lamim; Alves da Silva, Antonio Francisco; Radic, Claudia Pamela; De Brasi, Carlos Daniel; Rios, Álvaro Fabricio Lopes; de Sousa Lopes, Susana Marina Chuva; da Silveira, Leonardo Serafim; Ruiz-Miranda, Carlos Ramon; Ramos, Ester Silveira; Medina-Acosta, Enrique

    2014-01-01

    X-chromosome inactivation (XCI) is the epigenetic transcriptional silencing of an X-chromosome during the early stages of embryonic development in female eutherian mammals. XCI assures monoallelic expression in each cell and compensation for dosage-sensitive X-linked genes between females (XX) and males (XY). DNA methylation at the carbon-5 position of the cytosine pyrimidine ring in the context of a CpG dinucleotide sequence (5meCpG) in promoter regions is a key epigenetic marker for transcriptional gene silencing. Using computational analysis, we revealed an extragenic tandem GAAA repeat 230-bp from the landmark CpG island of the human X-linked retinitis pigmentosa 2 RP2 promoter whose 5meCpG status correlates with XCI. We used this RP2 onshore tandem GAAA repeat to develop an allele-specific 5meCpG-based PCR assay that is highly concordant with the human androgen receptor (AR) exonic tandem CAG repeat-based standard HUMARA assay in discriminating active (Xa) from inactive (Xi) X-chromosomes. The RP2 onshore tandem GAAA repeat contains neutral features that are lacking in the AR disease-linked tandem CAG repeat, is highly polymorphic (heterozygosity rates approximately 0.8) and shows minimal variation in the Xa/Xi ratio. The combined informativeness of RP2/AR is approximately 0.97, and this assay excels at determining the 5meCpG status of alleles at the Xp (RP2) and Xq (AR) chromosome arms in a single reaction. These findings are relevant and directly translatable to nonhuman primate models of XCI in which the AR CAG-repeat is monomorphic. We conducted the RP2 onshore tandem GAAA repeat assay in the naturally occurring chimeric New World monkey marmoset (Callitrichidae) and found it to be informative. The RP2 onshore tandem GAAA repeat will facilitate studies on the variable phenotypic expression of dominant and recessive X-linked diseases, epigenetic changes in twins, the physiology of aging hematopoiesis, the pathogenesis of age-related hematopoietic malignancies and the clonality of cancers in human and nonhuman primates.

  7. 5meCpG Epigenetic Marks Neighboring a Primate-Conserved Core Promoter Short Tandem Repeat Indicate X-Chromosome Inactivation

    PubMed Central

    Machado, Filipe Brum; Machado, Fabricio Brum; Faria, Milena Amendro; Lovatel, Viviane Lamim; Alves da Silva, Antonio Francisco; Radic, Claudia Pamela; De Brasi, Carlos Daniel; Rios, Álvaro Fabricio Lopes; de Sousa Lopes, Susana Marina Chuva; da Silveira, Leonardo Serafim; Ruiz-Miranda, Carlos Ramon; Ramos, Ester Silveira; Medina-Acosta, Enrique

    2014-01-01

    X-chromosome inactivation (XCI) is the epigenetic transcriptional silencing of an X-chromosome during the early stages of embryonic development in female eutherian mammals. XCI assures monoallelic expression in each cell and compensation for dosage-sensitive X-linked genes between females (XX) and males (XY). DNA methylation at the carbon-5 position of the cytosine pyrimidine ring in the context of a CpG dinucleotide sequence (5meCpG) in promoter regions is a key epigenetic marker for transcriptional gene silencing. Using computational analysis, we revealed an extragenic tandem GAAA repeat 230-bp from the landmark CpG island of the human X-linked retinitis pigmentosa 2 RP2 promoter whose 5meCpG status correlates with XCI. We used this RP2 onshore tandem GAAA repeat to develop an allele-specific 5meCpG-based PCR assay that is highly concordant with the human androgen receptor (AR) exonic tandem CAG repeat-based standard HUMARA assay in discriminating active (Xa) from inactive (Xi) X-chromosomes. The RP2 onshore tandem GAAA repeat contains neutral features that are lacking in the AR disease-linked tandem CAG repeat, is highly polymorphic (heterozygosity rates approximately 0.8) and shows minimal variation in the Xa/Xi ratio. The combined informativeness of RP2/AR is approximately 0.97, and this assay excels at determining the 5meCpG status of alleles at the Xp (RP2) and Xq (AR) chromosome arms in a single reaction. These findings are relevant and directly translatable to nonhuman primate models of XCI in which the AR CAG-repeat is monomorphic. We conducted the RP2 onshore tandem GAAA repeat assay in the naturally occurring chimeric New World monkey marmoset (Callitrichidae) and found it to be informative. The RP2 onshore tandem GAAA repeat will facilitate studies on the variable phenotypic expression of dominant and recessive X-linked diseases, epigenetic changes in twins, the physiology of aging hematopoiesis, the pathogenesis of age-related hematopoietic malignancies and the clonality of cancers in human and nonhuman primates. PMID:25078280

  8. Intra- and intersegmental influences among central pattern generating networks in the walking system of the stick insect.

    PubMed

    Mantziaris, Charalampos; Bockemühl, Till; Holmes, Philip; Borgmann, Anke; Daun, Silvia; Büschges, Ansgar

    2017-10-01

    To efficiently move around, animals need to coordinate their limbs. Proper, context-dependent coupling among the neural networks underlying leg movement is necessary for generating intersegmental coordination. In the slow-walking stick insect, local sensory information is very important for shaping coordination. However, central coupling mechanisms among segmental central pattern generators (CPGs) may also contribute to this. Here, we analyzed the interactions between contralateral networks that drive the depressor trochanteris muscle of the legs in both isolated and interconnected deafferented thoracic ganglia of the stick insect on application of pilocarpine, a muscarinic acetylcholine receptor agonist. Our results show that depressor CPG activity is only weakly coupled between all segments. Intrasegmental phase relationships differ between the three isolated ganglia, and they are modified and stabilized when ganglia are interconnected. However, the coordination patterns that emerge do not resemble those observed during walking. Our findings are in line with recent studies and highlight the influence of sensory input on coordination in slowly walking insects. Finally, as a direct interaction between depressor CPG networks and contralateral motoneurons could not be observed, we hypothesize that coupling is based on interactions at the level of CPG interneurons. NEW & NOTEWORTHY Maintaining functional interleg coordination is vitally important as animals locomote through changing environments. The relative importance of central mechanisms vs. sensory feedback in this process is not well understood. We analyzed coordination among the neural networks generating leg movements in stick insect preparations lacking phasic sensory feedback. Under these conditions, the networks governing different legs were only weakly coupled. In stick insect, central connections alone are thus insufficient to produce the leg coordination observed behaviorally. Copyright © 2017 the American Physiological Society.

  9. Evaluation of all African clinical practice guidelines for hypertension: Quality and opportunities for improvement.

    PubMed

    Okwen, Patrick Mbah; Maweu, Irene; Grimmer, Karen; Margarita Dizon, Janine

    2018-06-14

    Good-quality clinical practice guidelines (CPGs) provide recommendations based on current best-evidence summaries. Hypertension is a prevalent noncommunicable disease in Africa, with disastrous sequelae (stroke, heart, and kidney disease). Its effective management relies on good quality, current, locally relevant evidence. This paper reports on an all African review of the guidance documents currently informing hypertension management. Attempts were made to contact 62 African countries for formal guidance documents used nationally to inform diagnosis and management of hypertension. Their quality was assessed by using Appraisal of Guidelines for Research & Evaluation (AGREE) II, scored by 2 independent reviewers. Differences in domain scores were compared between documents written prior to 2011 and 2011 onward. Findings were compared with earlier African CPG reviews. Guidelines and protocols were provided by 26 countries. Six used country-specific stand-alone hypertension guidelines, and 10 used protocols embedded in Standard Treatment Guidelines for multiple conditions. Six used guidelines developed by the World Health Organization, and 4 indicated ad hoc use of international guidance (US, Portugal, and Brazil). Only 1 guidance document met CPG construction criteria, and none scored well on all AGREE domain scores. The lowest-scoring domain was rigour of development. There was no significant quality difference between pre-2011 and post-2011 guidance documents, and there were variable AGREE II scores for the same CPGs when comparing the African reviews. The quality of hypertension guidance used by African nations could be improved. The need for so many guidance documents is questioned. Adopting a common evidence base from international good-quality CPGs and layering it with local contexts offer 1 way to efficiently improve African hypertension CPG quality and implementation. © 2018 John Wiley & Sons, Ltd.

  10. Adapting evidence-based clinical practice guidelines at university teaching hospitals: A model for the Eastern Mediterranean Region.

    PubMed

    Amer, Yasser S; Wahabi, Hayfaa A; Abou Elkheir, Manal M; Bawazeer, Ghada A; Iqbal, Shaikh M; Titi, Maher A; Ekhzaimy, Aishah; Alswat, Khalid A; Alzeidan, Rasmieh A; Al-Ansary, Lubna A

    2018-04-24

    Clinical practice guidelines (CPGs) are significant tools for evidence-based health care quality improvement. The CPG program at King Saud University was launched as a quality improvement program to fulfil the international accreditation standards. This program was a collaboration between the Research Chair for Evidence-Based Healthcare and Knowledge Translation and the Quality Management Department. This study aims to develop a fast-track method for adaptation of evidence-based CPGs and describe results of the program. Twenty-two clinical departments participated in the program. Following a CPGs awareness week directed to all health care professionals (HCPs), 22 teams were trained to set priorities, search, screen, assess, select, and customize the best available CPGs. The teams were technically supported by the program's CPG advisors. To address the local health care context, a modified version of the ADAPTE was used where recommendations were either accepted or rejected but not changed. A strict peer-review process for clinical content and methodology was employed. In addition to raising awareness and building capacity, 35 CPGs were approved for implementation by March 2018. These CPGs were integrated with other existing projects such as accreditation, electronic medical records, performance management, and training and education. Preliminary implementation audits suggest a positive impact on patient outcomes. Leadership commitment was a strength, but the high turnover of the team members required frequent and extensive training for HCPs. This model for CPG adaptation represents a quick, practical, economical method with a sense of ownership by staff. Using this modified version can be replicated in other countries to assess its validity. © 2018 John Wiley & Sons, Ltd.

  11. Genomic Distribution and Inter-Sample Variation of Non-CpG Methylation across Human Cell Types

    PubMed Central

    Liao, Jing; Zhang, Yingying; Gu, Hongcang; Bock, Christoph; Boyle, Patrick; Epstein, Charles B.; Bernstein, Bradley E.; Lengauer, Thomas; Gnirke, Andreas; Meissner, Alexander

    2011-01-01

    DNA methylation plays an important role in development and disease. The primary sites of DNA methylation in vertebrates are cytosines in the CpG dinucleotide context, which account for roughly three quarters of the total DNA methylation content in human and mouse cells. While the genomic distribution, inter-individual stability, and functional role of CpG methylation are reasonably well understood, little is known about DNA methylation targeting CpA, CpT, and CpC (non-CpG) dinucleotides. Here we report a comprehensive analysis of non-CpG methylation in 76 genome-scale DNA methylation maps across pluripotent and differentiated human cell types. We confirm non-CpG methylation to be predominantly present in pluripotent cell types and observe a decrease upon differentiation and near complete absence in various somatic cell types. Although no function has been assigned to it in pluripotency, our data highlight that non-CpG methylation patterns reappear upon iPS cell reprogramming. Intriguingly, the patterns are highly variable and show little conservation between different pluripotent cell lines. We find a strong correlation of non-CpG methylation and DNMT3 expression levels while showing statistical independence of non-CpG methylation from pluripotency associated gene expression. In line with these findings, we show that knockdown of DNMTA and DNMT3B in hESCs results in a global reduction of non-CpG methylation. Finally, non-CpG methylation appears to be spatially correlated with CpG methylation. In summary these results contribute further to our understanding of cytosine methylation patterns in human cells using a large representative sample set. PMID:22174693

  12. Inhibitory and modulatory inputs to the vocal central pattern generator of a teleost fish

    PubMed Central

    Rosner, Elisabeth; Rohmann, Kevin N.; Bass, Andrew H.

    2018-01-01

    Abstract Vocalization is a behavioral feature that is shared among multiple vertebrate lineages, including fish. The temporal patterning of vocal communication signals is set, in part, by central pattern generators (CPGs). Toadfishes are well‐established models for CPG coding of vocalization at the hindbrain level. The vocal CPG comprises three topographically separate nuclei: pre‐pacemaker, pacemaker, motor. While the connectivity between these nuclei is well understood, their neurochemical profile remains largely unexplored. The highly vocal Gulf toadfish, Opsanus beta, has been the subject of previous behavioral, neuroanatomical and neurophysiological studies. Combining transneuronal neurobiotin‐labeling with immunohistochemistry, we map the distribution of inhibitory neurotransmitters and neuromodulators along with gap junctions in the vocal CPG of this species. Dense GABAergic and glycinergic label is found throughout the CPG, with labeled somata immediately adjacent to or within CPG nuclei, including a distinct subset of pacemaker neurons co‐labeled with neurobiotin and glycine. Neurobiotin‐labeled motor and pacemaker neurons are densely co‐labeled with the gap junction protein connexin 35/36, supporting the hypothesis that transneuronal neurobiotin‐labeling occurs, at least in part, via gap junction coupling. Serotonergic and catecholaminergic label is also robust within the entire vocal CPG, with additional cholinergic label in pacemaker and prepacemaker nuclei. Likely sources of these putative modulatory inputs are neurons within or immediately adjacent to vocal CPG neurons. Together with prior neurophysiological investigations, the results reveal potential mechanisms for generating multiple classes of social context‐dependent vocalizations with widely divergent temporal and spectral properties. PMID:29424431

  13. Validation of DAB2IP methylation and its relative significance in predicting outcome in renal cell carcinoma

    PubMed Central

    Zhao, Liang-Yun; Kapur, Payal; Wu, Kai-Jie; Wang, Bin; Yu, Yan-Hong; Liao, Bing; He, Da-Lin; Chen, Wei; Margulis, Vitaly; Hsieh, Jer-Tsong; Luo, Jun-Hang

    2016-01-01

    We have recently reported tumor suppressive role of DAB2IP in RCC development. In this study, We identified one CpG methylation biomarker (DAB2IP CpG1) located UTSS of DAB2IP that was associated with poor overall survival in a cohort of 318 ccRCC patients from the Cancer Genome Atlas (TCGA). We further validated the prognostic accuracy of DAB2IP CpG methylation by pyrosequencing quantitative methylation assay in 224 ccRCC patients from multiple Chinese centers (MCHC set), and 239 patients from University of Texas Southwestern Medical Center at Dallas (UTSW set) by using FFPE samples. DAB2IP CpG1 can predict the overall survival of patients in TCGA, MCHC, and UTSW sets independent of patient age, Fuhrman grade and TNM stage (all p<0.05). DAB2IP CpG1 successfully categorized patients into high-risk and low-risk groups with significant differences of clinical outcome in respective clinical subsets, regardless of age, sex, grade, stage, or race (HR: 1.63-7.83; all p<0.05). The detection of DAB2IP CpG1 methylation was minimally affected by ITH in ccRCC. DAB2IP mRNA expression was regulated by DNA methylation in vitro. DAB2IP CpG1 methylation is a practical and repeatable biomarker for ccRCC, which can provide prognostic value that complements the current staging system. PMID:27129174

  14. CpG Distribution and Methylation Pattern in Porcine Parvovirus

    PubMed Central

    Tóth, Renáta; Mészáros, István; Stefancsik, Rajmund; Bartha, Dániel; Bálint, Ádám; Zádori, Zoltán

    2013-01-01

    Based on GC content and the observed/expected CpG ratio (oCpGr), we found three major groups among the members of subfamily Parvovirinae: Group I parvoviruses with low GC content and low oCpGr values, Group II with low GC content and high oCpGr values and Group III with high GC content and high oCpGr values. Porcine parvovirus belongs to Group I and it features an ascendant CpG distribution by position in its coding regions similarly to the majority of the parvoviruses. The entire PPV genome remains hypomethylated during the viral lifecycle independently from the tissue of origin. In vitro CpG methylation of the genome has a modest inhibitory effect on PPV replication. The in vitro hypermethylation disappears from the replicating PPV genome suggesting that beside the maintenance DNMT1 the de novo DNMT3a and DNMT3b DNA methyltransferases can’t methylate replicating PPV DNA effectively either, despite that the PPV infection does not seem to influence the expression, translation or localization of the DNA methylases. SNP analysis revealed high mutability of the CpG sites in the PPV genome, while introduction of 29 extra CpG sites into the genome has no significant biological effects on PPV replication in vitro. These experiments raise the possibility that beyond natural selection mutational pressure may also significantly contribute to the low level of the CpG sites in the PPV genome. PMID:24392033

  15. Levels of DNA Methylation Vary at CpG Sites across the BRCA1 Promoter, and Differ According to Triple Negative and “BRCA-Like” Status, in Both Blood and Tumour DNA

    PubMed Central

    Burghel, George J.; Chambers, Philip; Al-Baba, Shadi; Connley, Daniel D.; Brock, Ian W.; Cramp, Helen E.; Dotsenko, Olena; Wilks, Octavia; Wyld, Lynda; Cross, Simon S.; Cox, Angela

    2016-01-01

    Triple negative breast cancer is typically an aggressive and difficult to treat subtype. It is often associated with loss of function of the BRCA1 gene, either through mutation, loss of heterozygosity or methylation. This study aimed to measure methylation of the BRCA1 gene promoter at individual CpG sites in blood, tumour and normal breast tissue, to assess whether levels were correlated between different tissues, and with triple negative receptor status, histopathological scoring for BRCA-like features and BRCA1 protein expression. Blood DNA methylation levels were significantly correlated with tumour methylation at 9 of 11 CpG sites examined (p<0.0007). The levels of tumour DNA methylation were significantly higher in triple negative tumours, and in tumours with high BRCA-like histopathological scores (10 of 11 CpG sites; p<0.01 and p<0.007 respectively). Similar results were observed in blood DNA (6 of 11 CpG sites; p<0.03 and 7 of 11 CpG sites; p<0.02 respectively). This study provides insight into the pattern of CpG methylation across the BRCA1 promoter, and supports previous studies suggesting that tumours with BRCA1 promoter methylation have similar features to those with BRCA1 mutations, and therefore may be suitable for the same targeted therapies. PMID:27463681

  16. LINE1 CpG-DNA Hypomethylation in Granulosa Cells and Blood Leukocytes Is Associated With PCOS and Related Traits.

    PubMed

    Sagvekar, Pooja; Mangoli, Vijay; Desai, Sadhana; Patil, Anushree; Mukherjee, Srabani

    2017-04-01

    Altered global DNA methylation is indicative of epigenomic instability concerning chronic diseases. Investigating its incidence and association with polycystic ovary syndrome (PCOS) is essential to understand the etiopathogenesis of this disorder. We assessed global DNA methylation differences in peripheral blood leukocytes (PBLs) and cumulus granulosa cells (CGCs) of controls and women with PCOS; and their association with PCOS and its traits. This study included a total of 102 controls and women with PCOS. Forty-one women undergoing controlled ovarian hyperstimulation (COH) and 61 women not undergoing COH were recruited from in vitro fertilization (IVF) and infertility clinics. DNA methylation was measured by ELISA for 5'-methyl-cytosine content and bisulfite sequencing of 5'-untranslated region (5'-UTR) of long interspersed nucleotide element-1 (LINE1/L1). Total 5'-methyl-cytosine and L1 methylation levels in PBLs and CGCs were similar between controls and women with PCOS. Methylation assessed at CpG sites of L1 5'-UTR revealed a single CpG-site (CpG-4) to be consistently hypomethylated in PBLs of both PCOS groups and CGCs of stimulated PCOS group. In unstimulated women, hypomethylation at CpG-4 was strongly associated with PCOS susceptibility, whereas in stimulated group it showed strong associations with PCOS and its hormonal traits. Furthermore, CGCs demonstrated consistent global and CpG-DNA hypomethylation relative to PBLs, irrespective of normal or disease states. Our study revealed strong association of single hypomethylated CpG-site with PCOS. Identification and characterization of more such methyl-CpG signatures in repetitive elements in larger study populations would provide valuable epigenetic insights into PCOS. Copyright © 2017 by the Endocrine Society

  17. Epigenetic DNA Methylation Profiling with MSRE: A Quantitative NGS Approach Using a Parkinson's Disease Test Case

    PubMed Central

    Marsh, Adam G.; Cottrell, Matthew T.; Goldman, Morton F.

    2016-01-01

    Epigenetics is a rapidly developing field focused on deciphering chemical fingerprints that accumulate on human genomes over time. As the nascent idea of precision medicine expands to encompass epigenetic signatures of diagnostic and prognostic relevance, there is a need for methodologies that provide high-throughput DNA methylation profiling measurements. Here we report a novel quantification methodology for computationally reconstructing site-specific CpG methylation status from next generation sequencing (NGS) data using methyl-sensitive restriction endonucleases (MSRE). An integrated pipeline efficiently incorporates raw NGS metrics into a statistical discrimination platform to identify functional linkages between shifts in epigenetic DNA methylation and disease phenotypes in samples being analyzed. In this pilot proof-of-concept study we quantify and compare DNA methylation in blood serum of individuals with Parkinson's Disease relative to matched healthy blood profiles. Even with a small study of only six samples, a high degree of statistical discrimination was achieved based on CpG methylation profiles between groups, with 1008 statistically different CpG sites (p < 0.0025, after false discovery rate correction). A methylation load calculation was used to assess higher order impacts of methylation shifts on genes and pathways and most notably identified FGF3, FGF8, HTT, KMTA5, MIR8073, and YWHAG as differentially methylated genes with high relevance to Parkinson's Disease and neurodegeneration (based on PubMed literature citations). Of these, KMTA5 is a histone methyl-transferase gene and HTT is Huntington Disease Protein or Huntingtin, for which there are well established neurodegenerative impacts. The future need for precision diagnostics now requires more tools for exploring epigenetic processes that may be linked to cellular dysfunction and subsequent disease progression. PMID:27853465

  18. Quantitative DNA Methylation Analysis Identifies a Single CpG Dinucleotide Important for ZAP-70 Expression and Predictive of Prognosis in Chronic Lymphocytic Leukemia

    PubMed Central

    Claus, Rainer; Lucas, David M.; Stilgenbauer, Stephan; Ruppert, Amy S.; Yu, Lianbo; Zucknick, Manuela; Mertens, Daniel; Bühler, Andreas; Oakes, Christopher C.; Larson, Richard A.; Kay, Neil E.; Jelinek, Diane F.; Kipps, Thomas J.; Rassenti, Laura Z.; Gribben, John G.; Döhner, Hartmut; Heerema, Nyla A.; Marcucci, Guido; Plass, Christoph; Byrd, John C.

    2012-01-01

    Purpose Increased ZAP-70 expression predicts poor prognosis in chronic lymphocytic leukemia (CLL). Current methods for accurately measuring ZAP-70 expression are problematic, preventing widespread application of these tests in clinical decision making. We therefore used comprehensive DNA methylation profiling of the ZAP-70 regulatory region to identify sites important for transcriptional control. Patients and Methods High-resolution quantitative DNA methylation analysis of the entire ZAP-70 gene regulatory regions was conducted on 247 samples from patients with CLL from four independent clinical studies. Results Through this comprehensive analysis, we identified a small area in the 5′ regulatory region of ZAP-70 that showed large variability in methylation in CLL samples but was universally methylated in normal B cells. High correlation with mRNA and protein expression, as well as activity in promoter reporter assays, revealed that within this differentially methylated region, a single CpG dinucleotide and neighboring nucleotides are particularly important in ZAP-70 transcriptional regulation. Furthermore, by using clustering approaches, we identified a prognostic role for this site in four independent data sets of patients with CLL using time to treatment, progression-free survival, and overall survival as clinical end points. Conclusion Comprehensive quantitative DNA methylation analysis of the ZAP-70 gene in CLL identified important regions responsible for transcriptional regulation. In addition, loss of methylation at a specific single CpG dinucleotide in the ZAP-70 5′ regulatory sequence is a highly predictive and reproducible biomarker of poor prognosis in this disease. This work demonstrates the feasibility of using quantitative specific ZAP-70 methylation analysis as a relevant clinically applicable prognostic test in CLL. PMID:22564988

  19. Epigenetic profiling of cutaneous T-cell lymphoma: promoter hypermethylation of multiple tumor suppressor genes including BCL7a, PTPRG, and p73.

    PubMed

    van Doorn, Remco; Zoutman, Willem H; Dijkman, Remco; de Menezes, Renee X; Commandeur, Suzan; Mulder, Aat A; van der Velden, Pieter A; Vermeer, Maarten H; Willemze, Rein; Yan, Pearlly S; Huang, Tim H; Tensen, Cornelis P

    2005-06-10

    To analyze the occurrence of promoter hypermethylation in primary cutaneous T-cell lymphoma (CTCL) on a genome-wide scale, focusing on epigenetic alterations with pathogenetic significance. DNA isolated from biopsy specimens of 28 patients with CTCL, including aggressive CTCL entities (transformed mycosis fungoides and CD30-negative large T-cell lymphoma) and an indolent entity (CD30-positive large T-cell lymphoma), were investigated. For genome-wide DNA methylation screening, differential methylation hybridization using CpG island microarrays was applied, which allows simultaneous detection of the methylation status of 8640 CpG islands. Bisulfite sequence analysis was applied for confirmation and detection of hypermethylation of eight selected tumor suppressor genes. The DNA methylation patterns of CTCLs emerging from differential methylation hybridization analysis included 35 CpG islands hypermethylated in at least four of the 28 studied CTCL samples when compared with benign T-cell samples. Hypermethylation of the putative tumor suppressor genes BCL7a (in 48% of CTCL samples), PTPRG (27%), and thrombospondin 4 (52%) was confirmed and demonstrated to be associated with transcriptional downregulation. BCL7a was hypermethylated at a higher frequency in aggressive (64%) than in indolent (14%) CTCL entities. In addition, the promoters of the selected tumor suppressor genes p73 (48%), p16 (33%), CHFR (19%), p15 (10%), and TMS1 (10%) were hypermethylated in CTCL. Malignant T cells of patients with CTCL display widespread promoter hypermethylation associated with inactivation of several tumor suppressor genes involved in DNA repair, cell cycle, and apoptosis signaling pathways. In view of this, CTCL may be amenable to treatment with demethylating agents.

  20. Distinctive Klf4 mutants determine preference for DNA methylation status

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hashimoto, Hideharu; Wang, Dongxue; Steves, Alyse N.

    Reprogramming of mammalian genome methylation is critically important but poorly understood. Klf4, a transcription factor directing reprogramming, contains a DNA binding domain with three consecutive C2H2 zinc fingers. Klf4 recognizes CpG or TpG within a specific sequence. Mouse Klf4 DNA binding domain has roughly equal affinity for methylated CpG or TpG, and slightly lower affinity for unmodified CpG. The structural basis for this key preference is unclear, though the side chain of Glu446 is known to contact the methyl group of 5-methylcytosine (5mC) or thymine (5-methyluracil). We examined the role of Glu446 by mutagenesis. Substituting Glu446 with aspartate (E446D) resultedmore » in preference for unmodified cytosine, due to decreased affinity for 5mC. In contrast, substituting Glu446 with proline (E446P) increased affinity for 5mC by two orders of magnitude. Structural analysis revealed hydrophobic interaction between the proline's aliphatic cyclic structure and the 5-methyl group of the pyrimidine (5mC or T). As in wild-type Klf4 (E446), the proline at position 446 does not interact directly with either the 5mC N4 nitrogen or the thymine O4 oxygen. In contrast, the unmethylated cytosine's exocyclic N4 amino group (NH2) and its ring carbon C5 atom hydrogen bond directly with the aspartate carboxylate of the E446D variant. Both of these interactions would provide a preference for cytosine over thymine, and the latter one could explain the E446D preference for unmethylated cytosine. Finally, we evaluated the ability of these Klf4 mutants to regulate transcription of methylated and unmethylated promoters in a luciferase reporter assay.« less

  1. Expression of metastasis suppressor gene AES driven by a Yin Yang (YY) element in a CpG island promoter and transcription factor YY2.

    PubMed

    Kakizaki, Fumihiko; Sonoshita, Masahiro; Miyoshi, Hiroyuki; Itatani, Yoshiro; Ito, Shinji; Kawada, Kenji; Sakai, Yoshiharu; Taketo, M Mark

    2016-11-01

    We recently found that the product of the AES gene functions as a metastasis suppressor of colorectal cancer (CRC) in both humans and mice. Expression of amino-terminal enhancer of split (AES) protein is significantly decreased in liver metastatic lesions compared with primary colon tumors. To investigate its downregulation mechanism in metastases, we searched for transcriptional regulators of AES in human CRC and found that its expression is reduced mainly by transcriptional dysregulation and, in some cases, by additional haploidization of its coding gene. The AES promoter-enhancer is in a typical CpG island, and contains a Yin-Yang transcription factor recognition sequence (YY element). In human epithelial cells of normal colon and primary tumors, transcription factor YY2, a member of the YY family, binds directly to the YY element, and stimulates expression of AES. In a transplantation mouse model of liver metastases, however, expression of Yy2 (and therefore of Aes) is downregulated. In human CRC metastases to the liver, the levels of AES protein are correlated with those of YY2. In addition, we noticed copy-number reduction for the AES coding gene in chromosome 19p13.3 in 12% (5/42) of human CRC cell lines. We excluded other mechanisms such as point or indel mutations in the coding or regulatory regions of the AES gene, CpG methylation in the AES promoter enhancer, expression of microRNAs, and chromatin histone modifications. These results indicate that Aes may belong to a novel family of metastasis suppressors with a CpG-island promoter enhancer, and it is regulated transcriptionally. © 2016 The Authors. Cancer Science published by John Wiley & Sons Australia, Ltd on behalf of Japanese Cancer Association.

  2. Development of TRAIL Resistance by Radiation-Induced Hypermethylation of DR4 CpG Island in Recurrent Laryngeal Squamous Cell Carcinoma

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lee, Jong Cheol; Department of Biomedical Research Center, Ulsan University Hospital, University of Ulsan College of Medicine, Ulsan; Lee, Won Hyeok

    2014-04-01

    Purpose: There are limited therapeutic options for patients with recurrent head and neck cancer after radiation therapy failure. To assess the use of tumor necrosis factor–related apoptosis-inducing ligand (TRAIL) as a salvage chemotherapeutic agent for recurrent cancer after radiation failure, we investigated the effect of clinically relevant cumulative irradiation on TRAIL-induced apoptosis. Methods and Materials: Using a previously established HN3 cell line from a laryngeal carcinoma patient, we generated a chronically irradiated HN3R isogenic cell line. Viability and apoptosis in HN3 and HN3R cells treated with TRAIL were analyzed with MTS and PI/annexin V-FITC assays. Western blotting and flow cytometry weremore » used to determine the underlying mechanism of TRAIL resistance. DR4 expression was semiquantitatively scored in a tissue microarray with 107 laryngeal cancer specimens. Methylation-specific polymerase chain reaction and bisulfite sequencing for DR4 were performed for genomic DNA isolated from each cell line. Results: HN3R cells were more resistant than HN3 cells to TRAIL-induced apoptosis because of significantly reduced levels of the DR4 receptor. The DR4 staining score in 37 salvage surgical specimens after radiation failure was lower in 70 surgical specimens without radiation treatment (3.03 ± 2.75 vs 5.46 ± 3.30, respectively; P<.001). HN3R cells had a methylated DR4 CpG island that was partially demethylated by the DNA demethylating agent 5-aza-2′-deoxycytidine. Conclusion: Epigenetic silencing of the TRAIL receptor by hypermethylation of a DR4 CpG island might be an underlying mechanism for TRAIL resistance in recurrent laryngeal carcinoma treated with radiation.« less

  3. Immune stimulation by a CpG-containing oligodeoxynucleotide is enhanced when encapsulated and delivered in lipid particles.

    PubMed

    Mui, B; Raney, S G; Semple, S C; Hope, M J

    2001-09-01

    The therapeutic benefit from phosphorothioate oligodeoxynucleotides (PS ODN) containing immune stimulatory sequences (ISS) has been demonstrated in animal models of cancer and infection. In particular, when CpG-containing PS ODN are administered to mice, activation of macrophages and dendritic, NK, T, and B cells occurs, resulting in the release of an array of cytokines, including interleukin-12 (IL-12), interferon-gamma (IFN-gamma), and tumor necrosis factor-alpha (TNF-alpha). We have previously described stabilized antisense-lipid particles (SALP) for the i.v. administration of antisense ODN [Biochim Biophys Acta (2001) 1510:152--166]. Given the propensity for SALP to target macrophages in vivo it was of interest to determine whether they could enhance the potency of CpG ODN to induce an immune response. In this report we show that when CpG-containing SALP are administered intravenously to ICR mice the plasma concentrations of IL-12, IFN-gamma, IL-6, monocyte chemoattractant protein-1, and TNF-alpha are greatly increased compared with the same dose of free ODN. The pattern of cytokine induction indicates that the immune response is T helper cell type 1-biased, similar to that observed for PS CpG ODN ISS in general. Furthermore, when phosphodiester (PO) ODN is substituted for PS ODN in the SALP formulation cytokine induction is even greater at the early time points, in marked contrast to free PO ODN, which is inactive. These results demonstrate that the immunogenicity of ISS is not only enhanced by encapsulation in lipid particles, which more closely mimic the way ISS DNA would normally be presented to antigen presenting cells by pathogens in vivo, but also SALP enable unmodified PO CpG ODN to be used as immune stimulants.

  4. The cancer-promoting gene fatty acid-binding protein 5 (FABP5) is epigenetically regulated during human prostate carcinogenesis.

    PubMed

    Kawaguchi, Koichiro; Kinameri, Ayumi; Suzuki, Shunsuke; Senga, Shogo; Ke, Youqiang; Fujii, Hiroshi

    2016-02-15

    FABPs (fatty-acid-binding proteins) are a family of low-molecular-mass intracellular lipid-binding proteins consisting of ten isoforms. FABPs are involved in binding and storing hydrophobic ligands such as long-chain fatty acids, as well as transporting these ligands to the appropriate compartments in the cell. FABP5 is overexpressed in multiple types of tumours. Furthermore, up-regulation of FABP5 is strongly associated with poor survival in triple-negative breast cancer. However, the mechanisms underlying the specific up-regulation of the FABP5 gene in these cancers remain poorly characterized. In the present study, we determined that FABP5 has a typical CpG island around its promoter region. The DNA methylation status of the CpG island in the FABP5 promoter of benign prostate cells (PNT2), prostate cancer cells (PC-3, DU-145, 22Rv1 and LNCaP) and human normal or tumour tissue was assessed by bisulfite sequencing analysis, and then confirmed by COBRA (combined bisulfite restriction analysis) and qAMP (quantitative analysis of DNA methylation using real-time PCR). These results demonstrated that overexpression of FABP5 in prostate cancer cells can be attributed to hypomethylation of the CpG island in its promoter region, along with up-regulation of the direct trans-acting factors Sp1 (specificity protein 1) and c-Myc. Together, these mechanisms result in the transcriptional activation of FABP5 expression during human prostate carcinogenesis. Importantly, silencing of Sp1, c-Myc or FABP5 expression led to a significant decrease in cell proliferation, indicating that up-regulation of FABP5 expression by Sp1 and c-Myc is critical for the proliferation of prostate cancer cells. © 2016 Authors; published by Portland Press Limited.

  5. Differential SLC1A2 Promoter Methylation in Bipolar Disorder With or Without Addiction

    PubMed Central

    Jia, Yun-Fang; Choi, YuBin; Ayers-Ringler, Jennifer R.; Biernacka, Joanna M.; Geske, Jennifer R.; Lindberg, Daniel R.; McElroy, Susan L.; Frye, Mark A.; Choi, Doo-Sup; Veldic, Marin

    2017-01-01

    While downregulation of excitatory amino acid transporter 2 (EAAT2), the main transporter removing glutamate from the synapse, has been recognized in bipolar disorder (BD), the underlying mechanisms of downregulation have not been elucidated. BD is influenced by environmental factors, which may, via epigenetic modulation of gene expression, differentially affect illness presentation. This study thus focused on epigenetic DNA methylation regulation of SLC1A2, encoding for EAAT2, in BD with variable environmental influences of addiction. High resolution melting PCR (HRM-PCR) and thymine–adenine (TA) cloning with sequence analysis were conducted to examine methylation of the promoter region of the SLC1A2. DNA was isolated from blood samples drawn from BD patients (N = 150) with or without addiction to alcohol, nicotine, or food, defined as binge eating, and matched controls (N = 32). In comparison to controls, the SLC1A2 promoter region was hypermethylated in BD without addiction but was hypomethylated in BD with addiction. After adjusting for age and sex, the association of methylation levels with nicotine addiction (p = 0.0009) and binge eating (p = 0.0002) remained significant. Consistent with HRM-PCR, direct sequencing revealed increased methylation in CpG site 6 in BD, but decreased methylation in three CpG sites (6, 48, 156) in BD with alcohol and nicotine addictions. These results suggest that individual point methylation within the SLC1A2 promoter region may be modified by exogenous addiction and may have a potential for developing clinically valuable epigenetic biomarkers for BD diagnosis and monitoring. PMID:28785205

  6. Differential SLC1A2 Promoter Methylation in Bipolar Disorder With or Without Addiction.

    PubMed

    Jia, Yun-Fang; Choi, YuBin; Ayers-Ringler, Jennifer R; Biernacka, Joanna M; Geske, Jennifer R; Lindberg, Daniel R; McElroy, Susan L; Frye, Mark A; Choi, Doo-Sup; Veldic, Marin

    2017-01-01

    While downregulation of excitatory amino acid transporter 2 (EAAT2), the main transporter removing glutamate from the synapse, has been recognized in bipolar disorder (BD), the underlying mechanisms of downregulation have not been elucidated. BD is influenced by environmental factors, which may, via epigenetic modulation of gene expression, differentially affect illness presentation. This study thus focused on epigenetic DNA methylation regulation of SLC1A2 , encoding for EAAT2, in BD with variable environmental influences of addiction. High resolution melting PCR (HRM-PCR) and thymine-adenine (TA) cloning with sequence analysis were conducted to examine methylation of the promoter region of the SLC1A2 . DNA was isolated from blood samples drawn from BD patients ( N = 150) with or without addiction to alcohol, nicotine, or food, defined as binge eating, and matched controls ( N = 32). In comparison to controls, the SLC1A2 promoter region was hypermethylated in BD without addiction but was hypomethylated in BD with addiction. After adjusting for age and sex, the association of methylation levels with nicotine addiction ( p = 0.0009) and binge eating ( p = 0.0002) remained significant. Consistent with HRM-PCR, direct sequencing revealed increased methylation in CpG site 6 in BD, but decreased methylation in three CpG sites (6, 48, 156) in BD with alcohol and nicotine addictions. These results suggest that individual point methylation within the SLC1A2 promoter region may be modified by exogenous addiction and may have a potential for developing clinically valuable epigenetic biomarkers for BD diagnosis and monitoring.

  7. Protective immunity against Megalocytivirus infection in rock bream (Oplegnathus fasciatus) following CpG ODN administration.

    PubMed

    Jung, Myung-Hwa; Lee, Jehee; Ortega-Villaizan, M; Perez, Luis; Jung, Sung-Ju

    2017-06-27

    Rock bream iridovirus (RBIV) disease in rock bream (Oplegnathus fasciatus) remains an unsolved problem in Korea aquaculture farms. CpG ODNs are known as immunostimulant, can improve the innate immune system of fish providing resistance to diseases. In this study, we evaluated the potential of CpG ODNs to induce anti-viral status protecting rock bream from different RBIV infection conditions. We found that, when administered into rock bream, CpG ODN 1668 induces better antiviral immune responses compared to other 5 CpG ODNs (2216, 1826, 2133, 2395 and 1720). All CpG ODN 1668 administered fish (1/5µg) at 2days before infection (1.1×10 7 ) held at 26°C died even though mortality was delayed from 8days (1µg) and 4days (5µg). Similarly, CpG ODN 1668 administered (5µg) at 2days before infection (1.2×10 6 ) held at 23/20°C had 100% mortality; the mortality was delayed from 9days (23°C) and 11days (20°C). Moreover, when CpG ODN 1668 administered (1/5/10µg) at 2/4/7days before infection or virus concentration was decreased to 1.1×10 4 and held at 20°C had mortality rates of 20/60/30% (2days), 30/40/60% (4days) and 60/60/20% (7days), respectively, for the respective administration dose, through 100 dpi. To investigate the development of a protective immune response, survivors were re-infected with RBIV (1.1×10 7 ) at 100 and 400 dpi, respectively. While 100% of the previously unexposed fish died, 100% of the previously infected fish survived. The high survival rate of fish following re-challenge with RBIV indicates that protective immunity was established in the surviving rock bream. Our results showed the possibility of developing preventive measures against RBIV using CpG ODN 1668 by reducing RBIV replication speed (i.e. water temperature of 20°C and infection dose of 1.1×10 4 ). Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. Enhanced early innate and T cell-mediated responses in subjects immunized with Anthrax Vaccine Adsorbed Plus CPG 7909 (AV7909).

    PubMed

    Minang, Jacob T; Inglefield, Jon R; Harris, Andrea M; Lathey, Janet L; Alleva, David G; Sweeney, Diane L; Hopkins, Robert J; Lacy, Michael J; Bernton, Edward W

    2014-11-28

    NuThrax™ (Anthrax Vaccine Adsorbed with CPG 7909 Adjuvant) (AV7909) is in development. Samples obtained in a phase Ib clinical trial were tested to confirm biomarkers of innate immunity and evaluate effects of CPG 7909 (PF-03512676) on adaptive immunity. Subjects received two intramuscular doses of commercial BioThrax(®) (Anthrax Vaccine Adsorbed, AVA), or two intramuscular doses of one of four formulations of AV7909. IP-10, IL-6, and C-reactive protein (CRP) levels were elevated 24-48 h after administration of AV7909 formulations, returning to baseline by Day 7. AVA (no CPG 7909) resulted in elevated IL-6 and CRP, but not IP-10. Another marker of CpG, transiently decreased absolute lymphocyte counts (ALCs), correlated with transiently increased IP-10. Cellular recall responses to anthrax protective antigen (PA) or PA peptides were assessed by IFN-γ ELISpot assay performed on cryopreserved PBMCs obtained from subjects prior to immunization and 7 days following the second immunization (study day 21). One-half of subjects that received AV7909 with low-dose (0.25mg/dose) CPG 7909 possessed positive Day 21 T cell responses to PA. In contrast, positive T cell responses occurred at an 11% average rate (1/9) for AVA-treated subjects. Differences in cellular responses due to dose level of CPG 7909 were not associated with differences in humoral anti-PA IgG responses, which were elevated for recipients of AV7909 compared to recipients of AVA. Serum markers at 24 or 48 h (i.e. % ALC decrease, or increase in IL-6, IP-10, or CRP) correlated with the humoral (antibody) responses 1 month later, but did not correlate with cellular ELISpot responses. In summary, biomarkers of early responses to CPG 7909 were confirmed, and adding a CpG adjuvant to a vaccine administered twice resulted in increased T cell effects relative to vaccine alone. Changes in early biomarkers correlated with subsequent adaptive humoral immunity but not cellular immunity. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.

  9. The Network Spinal Wave as a Central Pattern Generator.

    PubMed

    Senzon, Simon A; Epstein, Donald M; Lemberger, Daniel

    2016-07-01

    This article explains the research on a unique spinal wave visibly observed in association with network spinal analysis care. Since 1997, the network wave has been studied using surface electromyography (sEMG), characterized mathematically, and determined to be a unique and repeatable phenomenon. The authors provide a narrative review of the research and a context for the network wave's development. The sEMG research demonstrates that the movement of the musculature of the spine during the wave phenomenon is electromagnetic and mechanical. The changes running along the spine were characterized mathematically at three distinct levels of care. Additionally, the wave has the mathematical properties of a central pattern generator (CPG). The network wave may be the first CPG discovered in the spine unrelated to locomotion. The mathematical characterization of the signal also demonstrates coherence at a distance between the sacral to cervical spine. According to mathematical engineers, based on studies conducted a decade apart, the wave itself is a robust phenomenon and the detection methods for this coherence may represent a new measure for central nervous system health. This phenomenon has implications for recovery from spinal cord injury and for reorganizational healing development.

  10. The Network Spinal Wave as a Central Pattern Generator

    PubMed Central

    Epstein, Donald M.; Lemberger, Daniel

    2016-01-01

    Abstract Objectives: This article explains the research on a unique spinal wave visibly observed in association with network spinal analysis care. Since 1997, the network wave has been studied using surface electromyography (sEMG), characterized mathematically, and determined to be a unique and repeatable phenomenon. Methods: The authors provide a narrative review of the research and a context for the network wave's development. Results: The sEMG research demonstrates that the movement of the musculature of the spine during the wave phenomenon is electromagnetic and mechanical. The changes running along the spine were characterized mathematically at three distinct levels of care. Additionally, the wave has the mathematical properties of a central pattern generator (CPG). Conclusions: The network wave may be the first CPG discovered in the spine unrelated to locomotion. The mathematical characterization of the signal also demonstrates coherence at a distance between the sacral to cervical spine. According to mathematical engineers, based on studies conducted a decade apart, the wave itself is a robust phenomenon and the detection methods for this coherence may represent a new measure for central nervous system health. This phenomenon has implications for recovery from spinal cord injury and for reorganizational healing development. PMID:27243963

  11. Depleting tumor-specific Tregs at a single site eradicates disseminated tumors

    PubMed Central

    Marabelle, Aurélien; Kohrt, Holbrook; Sagiv-Barfi, Idit; Ajami, Bahareh; Axtell, Robert C.; Zhou, Gang; Rajapaksa, Ranjani; Green, Michael R.; Torchia, James; Brody, Joshua; Luong, Richard; Rosenblum, Michael D.; Steinman, Lawrence; Levitsky, Hyam I.; Tse, Victor; Levy, Ronald

    2013-01-01

    Activation of TLR9 by direct injection of unmethylated CpG nucleotides into a tumor can induce a therapeutic immune response; however, Tregs eventually inhibit the antitumor immune response and thereby limit the power of cancer immunotherapies. In tumor-bearing mice, we found that Tregs within the tumor preferentially express the cell surface markers CTLA-4 and OX40. We show that intratumoral coinjection of anti–CTLA-4 and anti-OX40 together with CpG depleted tumor-infiltrating Tregs. This in situ immunomodulation, which was performed with low doses of antibodies in a single tumor, generated a systemic antitumor immune response that eradicated disseminated disease in mice. Further, this treatment modality was effective against established CNS lymphoma with leptomeningeal metastases, sites that are usually considered to be tumor cell sanctuaries in the context of conventional systemic therapy. These results demonstrate that antitumor immune effectors elicited by local immunomodulation can eradicate tumor cells at distant sites. We propose that, rather than using mAbs to target cancer cells systemically, mAbs could be used to target the tumor infiltrative immune cells locally, thereby eliciting a systemic immune response. PMID:23728179

  12. Integrating prior knowledge in multiple testing under dependence with applications to detecting differential DNA methylation.

    PubMed

    Kuan, Pei Fen; Chiang, Derek Y

    2012-09-01

    DNA methylation has emerged as an important hallmark of epigenetics. Numerous platforms including tiling arrays and next generation sequencing, and experimental protocols are available for profiling DNA methylation. Similar to other tiling array data, DNA methylation data shares the characteristics of inherent correlation structure among nearby probes. However, unlike gene expression or protein DNA binding data, the varying CpG density which gives rise to CpG island, shore and shelf definition provides exogenous information in detecting differential methylation. This article aims to introduce a robust testing and probe ranking procedure based on a nonhomogeneous hidden Markov model that incorporates the above-mentioned features for detecting differential methylation. We revisit the seminal work of Sun and Cai (2009, Journal of the Royal Statistical Society: Series B (Statistical Methodology)71, 393-424) and propose modeling the nonnull using a nonparametric symmetric distribution in two-sided hypothesis testing. We show that this model improves probe ranking and is robust to model misspecification based on extensive simulation studies. We further illustrate that our proposed framework achieves good operating characteristics as compared to commonly used methods in real DNA methylation data that aims to detect differential methylation sites. © 2012, The International Biometric Society.

  13. Genetic Recombination Is Targeted towards Gene Promoter Regions in Dogs

    PubMed Central

    Auton, Adam; Rui Li, Ying; Kidd, Jeffrey; Oliveira, Kyle; Nadel, Julie; Holloway, J. Kim; Hayward, Jessica J.; Cohen, Paula E.; Greally, John M.; Wang, Jun; Bustamante, Carlos D.; Boyko, Adam R.

    2013-01-01

    The identification of the H3K4 trimethylase, PRDM9, as the gene responsible for recombination hotspot localization has provided considerable insight into the mechanisms by which recombination is initiated in mammals. However, uniquely amongst mammals, canids appear to lack a functional version of PRDM9 and may therefore provide a model for understanding recombination that occurs in the absence of PRDM9, and thus how PRDM9 functions to shape the recombination landscape. We have constructed a fine-scale genetic map from patterns of linkage disequilibrium assessed using high-throughput sequence data from 51 free-ranging dogs, Canis lupus familiaris. While broad-scale properties of recombination appear similar to other mammalian species, our fine-scale estimates indicate that canine highly elevated recombination rates are observed in the vicinity of CpG rich regions including gene promoter regions, but show little association with H3K4 trimethylation marks identified in spermatocytes. By comparison to genomic data from the Andean fox, Lycalopex culpaeus, we show that biased gene conversion is a plausible mechanism by which the high CpG content of the dog genome could have occurred. PMID:24348265

  14. Clinical evaluation of CpG oligonucleotides as adjuvants for vaccines targeting infectious diseases and cancer

    PubMed Central

    Scheiermann, Julia; Klinman, Dennis M.

    2014-01-01

    Synthetic oligonucleotides (ODN) that express unmethylated “CpG motifs” trigger cells that express Toll-like receptor 9. In humans this includes plasmacytoid dendritic cells and B cells. CpG ODN induce an innate immune response characterized by the production of Th1 and pro-inflammatory cytokines. Their utility as vaccine adjuvants was evaluated in a number of clinical trials. Results indicate that CpG ODN improve antigen presentation and the generation of vaccine-specific cellular and humoral responses. This work provides an up-to-date overview of the utility of CpG ODN as adjuvants for vaccines targeting infectious agents and cancer. PMID:24975812

  15. Transcultural Endocrinology: Adapting Type-2 Diabetes Guidelines on a Global Scale.

    PubMed

    Nieto-Martínez, Ramfis; González-Rivas, Juan P; Florez, Hermes; Mechanick, Jeffrey I

    2016-12-01

    Type-2 diabetes (T2D) needs to be prevented and treated effectively to reduce its burden and consequences. White papers, such as evidence-based clinical practice guidelines (CPG) and their more portable versions, clinical practice algorithms and clinical checklists, may improve clinical decision-making and diabetes outcomes. However, CPG are underused and poorly validated. Protocols that translate and implement these CPG are needed. This review presents the global dimension of T2D, details the importance of white papers in the transculturalization process, compares relevant international CPG, analyzes cultural variables, and summarizes translation strategies that can improve care. Specific protocols and algorithmic tools are provided. Copyright © 2016 Elsevier Inc. All rights reserved.

  16. Transcutaneous immunization with tetanus toxoid and mutants of Escherichia coli heat-labile enterotoxin as adjuvants elicits strong protective antibody responses.

    PubMed

    Tierney, Rob; Beignon, Anne-Sophie; Rappuoli, Rino; Muller, Sylviane; Sesardic, Dorothea; Partidos, Charalambos D

    2003-09-01

    In this study, the adjuvanticity of 2 nontoxic derivatives (LTK63 and LTR72) of heat-labile enterotoxin of Escherichia coli (LT) was evaluated and was compared with that of a cytosine phosphodiester-guanine (CpG) motif, after transcutaneous immunization with tetanus toxoid (TT). TT plus LTR72 elicited the strongest antibody responses, compared with those elicited by the other vaccines (TT, TT plus LTK63, TT plus CpG, and TT plus LTK63 plus CpG); it neutralized the toxin and conferred full protection after passive transfer in mice. Preexisting immunity to LT mutants did not adversely affect their adjuvant potency. Both LTK63 and LTR72 promoted the induction of IgG1 antibodies. In contrast, mice receiving either CpG motif alone or CpG motif plus LTK63 produced strong IgG2a anti-TT antibody responses. Overall, these findings demonstrate that mutants of enterotoxins with reduced toxicity are effective adjuvants for transcutaneous immunization.

  17. On the Role of Sensory Feedbacks in Rowat–Selverston CPG to Improve Robot Legged Locomotion

    PubMed Central

    Amrollah, Elmira; Henaff, Patrick

    2010-01-01

    This paper presents the use of Rowat and Selverston-type of central pattern generator (CPG) to control locomotion. It focuses on the role of afferent exteroceptive and proprioceptive signals in the dynamic phase synchronization in CPG legged robots. The sensori-motor neural network architecture is evaluated to control a two-joint planar robot leg that slips on a rail. Then, the closed loop between the CPG and the mechanical system allows to study the modulation of rhythmic patterns and the effect of the sensing loop via sensory neurons during the locomotion task. Firstly simulations show that the proposed architecture easily allows to modulate rhythmic patterns of the leg, and therefore the velocity of the robot. Secondly, simulations show that sensori-feedbacks from foot/ground contact of the leg make the hip velocity smoother and larger. The results show that the Rowat–Selverston-type CPG with sensory feedbacks is an effective choice for building adaptive neural CPGs for legged robots. PMID:21228904

  18. Exosome-based tumor antigens-adjuvant co-delivery utilizing genetically engineered tumor cell-derived exosomes with immunostimulatory CpG DNA.

    PubMed

    Morishita, Masaki; Takahashi, Yuki; Matsumoto, Akihiro; Nishikawa, Makiya; Takakura, Yoshinobu

    2016-12-01

    For cancer immunotherapy via tumor antigen vaccination in combination with an adjuvant, major challenges include the identification of a particular tumor antigen and efficient delivery of the antigen as well as adjuvant to antigen-presenting cells. In this study, we proposed an efficient exosome-based tumor antigens-adjuvant co-delivery system using genetically engineered tumor cell-derived exosomes containing endogenous tumor antigens and immunostimulatory CpG DNA. Murine melanoma B16BL6 cells were transfected with a plasmid vector encoding a fusion streptavidin (SAV; a protein that binds to biotin with high affinity)-lactadherin (LA; an exosome-tropic protein) protein, yielding genetically engineered SAV-LA-expressing exosomes (SAV-exo). SAV-exo were combined with biotinylated CpG DNA to prepare CpG DNA-modified exosomes (CpG-SAV-exo). Fluorescent microscopic observation revealed the successful modification of exosomes with CpG DNA by SAV-biotin interaction. CpG-SAV-exo showed efficient and simultaneous delivery of exosomes with CpG DNA to murine dendritic DC2.4 cells in culture. Treatment with CpG-SAV-exo effectively activated DC2.4 cells and enhanced tumor antigen presentation capacity. Immunization with CpG-SAV-exo exhibited stronger in vivo antitumor effects in B16BL6 tumor-bearing mice than simple co-administration of exosomes and CpG DNA. Thus, genetically engineered CpG-SAV-exo is an effective exosome-based tumor antigens-adjuvant co-delivery system that will be useful for cancer immunotherapy. Copyright © 2016 Elsevier Ltd. All rights reserved.

  19. Topical CpG Adjuvantation of a Protein-Based Vaccine Induces Protective Immunity to Listeria monocytogenes

    PubMed Central

    Cheng, Wing Ki; Wee, Kathleen; Kollmann, Tobias R.

    2014-01-01

    Robust CD8+ T cell responses are essential for immune protection against intracellular pathogens. Using parenteral administration of ovalbumin (OVA) protein as a model antigen, the effect of the Toll-like receptor 9 (TLR9) agonist, CpG oligodeoxynucleotide (ODN) 1826, as an adjuvant delivered either topically, subcutaneously, or intramuscularly on antigen-specific CD8+ T cell responses in a mouse model was evaluated. Topical CpG adjuvant increased the frequency of OVA-specific CD8+ T cells in the peripheral blood and in the spleen. The more effective strategy to administer topical CpG adjuvant to enhance CD8+ T cell responses was single-dose administration at the time of antigen injection with a prime-boost regimen. Topical CpG adjuvant conferred both rapid and long-lasting protection against systemic challenge with recombinant Listeria monocytogenes expressing the cytotoxic T lymphocyte (CTL) epitope of OVA257–264 (strain Lm-OVA) in a TLR9-dependent manner. Topical CpG adjuvant induced a higher proportion of CD8+ effector memory T cells than parenteral administration of the adjuvant. Although traditional vaccination strategies involve coformulation of antigen and adjuvant, split administration using topical adjuvant is effective and has advantages of safety and flexibility. Split administration of topical CpG ODN 1826 with parenteral protein antigen is superior to other administration strategies in enhancing both acute and memory protective CD8+ T cell immune responses to subcutaneous protein vaccines. This vaccination strategy induces rapid and persistent protective immune responses against the intracellular organism L. monocytogenes. PMID:24391136

  20. Synergy of anti-CD40, CpG and MPL in activation of mouse macrophages

    PubMed Central

    Shi, Yongyu; Felder, Mildred A.R.; Sondel, Paul M.; Rakhmilevich, Alexander L.

    2015-01-01

    Activation of macrophages is a prerequisite for their antitumor effects. Several reagents, including agonistic anti-CD40 monoclonal antibody (anti-CD40), CpG oligodeoxynucleotides (CpG) and monophosphoryl lipid A (MPL), can stimulate activation of macrophages. Our previous studies showed synergy between anti-CD40 and CpG and between anti-CD40 and MPL in macrophage activation and antitumor efficacy in mice. In the present study, we asked whether there was synergy among these three reagents. The activation of adherent peritoneal exudate cells (PEC) obtained from mice injected with anti-CD40 and then treated with CpG and/or MPL in vitro was determined by their ability to suppress proliferation of tumor cells and to produce various cytokines and chemokines in vitro. Cell sorting and histology followed by functional testing showed that macrophages were the main cell population in PEC activated by CD40 ligation in vivo. A combination of anti-CD40, CpG or MPL activated PEC to suppress proliferation of B16 cells and produce nitric oxide far greater than the single reagents or any of the double combinations of these reagents. In addition, the combination of all three reagents activated PEC to secrete IL-12, IFN-γ and MCP-1 to a greater degree than any single reagent or any two combined reagents. These results demonstrate that macrophages can be synergistically activated by anti-CD40, CpG and MPL, suggesting that this novel combined approach might be further investigated as potential cancer therapy. PMID:25829245

  1. Synergy of anti-CD40, CpG and MPL in activation of mouse macrophages.

    PubMed

    Shi, Yongyu; Felder, Mildred A R; Sondel, Paul M; Rakhmilevich, Alexander L

    2015-08-01

    Activation of macrophages is a prerequisite for their antitumor effects. Several reagents, including agonistic anti-CD40 monoclonal antibody (anti-CD40), CpG oligodeoxynucleotides (CpG) and monophosphoryl lipid A (MPL), can stimulate activation of macrophages. Our previous studies showed synergy between anti-CD40 and CpG and between anti-CD40 and MPL in macrophage activation and antitumor efficacy in mice. In the present study, we asked whether there was synergy among these three reagents. The activation of adherent peritoneal exudate cells (PEC) obtained from mice injected with anti-CD40 and then treated with CpG and/or MPL in vitro was determined by their ability to suppress proliferation of tumor cells and to produce various cytokines and chemokines in vitro. Cell sorting and histology followed by functional testing showed that macrophages were the main cell population in PEC activated by CD40 ligation in vivo. A combination of anti-CD40, CpG or MPL activated PEC to suppress proliferation of B16 cells and produce nitric oxide far greater than the single reagents or any of the double combinations of these reagents. In addition, the combination of all three reagents activated PEC to secrete IL-12, IFN-γ and MCP-1 to a greater degree than any single reagent or any two combined reagents. These results demonstrate that macrophages can be synergistically activated by anti-CD40, CpG and MPL, suggesting that this novel combined approach might be further investigated as potential cancer therapy. Copyright © 2015 Elsevier Ltd. All rights reserved.

  2. Use of DNA from human stools to detect aberrant CpG island methylation of genes implicated in colorectal cancer.

    PubMed

    Belshaw, Nigel J; Elliott, Giles O; Williams, Elizabeth A; Bradburn, David M; Mills, Sarah J; Mathers, John C; Johnson, Ian T

    2004-09-01

    Hypermethylation of cytosine residues in the CpG islands of tumor suppressor genes is a key mechanism of colorectal carcinogenesis. Detection and quantification of CpG island methylation in human DNA isolated from stools might provide a novel strategy for the detection and investigation of colorectal neoplasia. To explore the feasibility of this approach, colorectal biopsies and fecal samples were obtained from 32 patients attending for colonoscopy or surgery, who were found to have adenomatous polyps, colorectal cancer, or no evidence of neoplasia. A further 18 fecal samples were obtained from healthy volunteers, with no bowel symptoms. Isolated DNA was modified with sodium bisulfite and analyzed by methylation-specific PCR and combined bisulfite restriction analysis for CpG island methylation of ESR1, MGMT, HPP1, p16(INK4a), APC, and MLH1. CpG island methylation was readily detectable in both mucosal and fecal DNA with methylation-specific PCR. Using combined bisulfite restriction analysis, it was established that, in volunteers from whom biopsies were available, the levels of methylation at two CpG sites within ESR1 assayed using fecal DNA were significantly correlated with methylation in DNA from colorectal mucosa. Thus, noninvasive techniques can be used to obtain quantitative information about the level of CpG island methylation in human colorectal mucosa. The methods described here could be applied to a much expanded range of genes and may be valuable both for screening purposes and to provide greater insight into the functional consequences of epigenetic changes in the colorectal mucosa of free-living individuals.

  3. Marked enhancement of the immune response to BioThrax® (Anthrax Vaccine Adsorbed) by the TLR9 agonist CPG 7909 in healthy volunteers.

    PubMed

    Rynkiewicz, Dianna; Rathkopf, Melinda; Sim, Iain; Waytes, A Thomas; Hopkins, Robert J; Giri, Lallan; DeMuria, Deborah; Ransom, Janet; Quinn, James; Nabors, Gary S; Nielsen, Carl J

    2011-08-26

    Immunization with BioThrax(®) (Anthrax Vaccine Adsorbed) is a safe and effective means of preventing anthrax. Animal studies have demonstrated that the addition of CpG DNA adjuvants to BioThrax can markedly increase the immunogenicity of the vaccine, increasing both serum anti-protective antigen (PA) antibody and anthrax toxin-neutralizing antibody (TNA) concentrations. The immune response to CpG-adjuvanted BioThrax in animals was not only stronger, but was also more rapid and led to higher levels of protection in spore challenge models. The B-class CpG DNA adjuvant CPG 7909, a 24-base synthetic, single-strand oligodeoxynucleotide, was evaluated for its safety profile and adjuvant properties in a Phase 1 clinical trial. A double-blind study was performed in which 69 healthy subjects, age 18-45 years, were randomized to receive three doses of either: (1) BioThrax alone, (2) 1 mg of CPG 7909 alone or (3) BioThrax plus 1 mg of CPG 7909, all given intramuscularly on study days 0, 14 and 28. Subjects were monitored for IgG to PA by ELISA and for TNA titers through study day 56 and for safety through month 6. CPG 7909 increased the antibody response by 6-8-fold at peak, and accelerated the response by 3 weeks compared to the response seen in subjects vaccinated with BioThrax alone. No serious adverse events related to study agents were reported, and the combination was considered to be reasonably well tolerated. The marked acceleration and enhancement of the immune response seen by combining BioThrax and CPG 7909 offers the potential to shorten the course of immunization and reduce the time to protection, and may be particularly useful in the setting of post-exposure prophylaxis. Copyright © 2011 Elsevier Ltd. All rights reserved.

  4. Maternal treatment with a high dose of CpG ODN during gestation alters fetal craniofacial and distal limb development in C57BL/6 mice.

    PubMed

    Prater, M Renee; Johnson, Victor J; Germolec, Dori R; Luster, Michael I; Holladay, Steven D

    2006-01-16

    Synthetic oligodeoxynucleotides (ODN) containing CpG motifs, characteristic of bacterial DNA, are currently being evaluated as vaccine adjuvants for inducing protective immunity. Recently, there is increasing pressure to vaccinate pregnant women against maternally transmitted diseases including AIDS and tetanus, as well as against potential bio-weapons such as anthrax. CpG vaccines are effective because they trigger transient increases in T(H)1 cytokine production. Recent literature suggests, however, that a shift toward a T(H)1 cytokine profile during pregnancy may increase the risk of fetal morphologic defects. On this basis, we hypothesized that exposure to CpG motifs during pregnancy could result in T(H)1 inflammation leading to adverse effects on fetal development. To address this hypothesis, pregnant C57BL/6 mice were injected with CpG ODN (0-300 microg/dam) and maternal and fetal outcomes were determined. Injection of dams with the highest dose of CpG ODN resulted in markedly increased fetal resorptions and craniofacial/limb defects, while lower doses had little, if any effects. Histological examination of placentas revealed cellular necrosis with mixed inflammation and calcification in the spongiotrophoblast layer and dysregulation of labyrinthine vascular development. Concomitant elevations in maternal serum cytokine levels were observed including interleukin (IL)-2, IL-10 and IL-12. Treatment with 300 microg of non-CpG ODN did not cause any adverse effects. The 300 microg dose of CpG ODN used in the present study is 30-fold higher than the highest dose that has been administered to humans during clinical trials. These results suggest that the induction of T(H)1 cytokines during pregnancy by CpG motifs may potentially increase the risk of fetal loss and morphologic defects in mice, at least at high doses, and support the need for further investigation of teratogenesis that may result from exposure to vaccine adjuvants designed to produce T(H)1 cytokine profile shifts.

  5. Prognostication of patients with clear cell renal cell carcinomas based on quantification of DNA methylation levels of CpG island methylator phenotype marker genes.

    PubMed

    Tian, Ying; Arai, Eri; Gotoh, Masahiro; Komiyama, Motokiyo; Fujimoto, Hiroyuki; Kanai, Yae

    2014-10-20

    The CpG island methylator phenotype (CIMP) of clear cell renal cell carcinomas (ccRCCs) is characterized by accumulation of DNA methylation at CpG islands and poorer patient outcome. The aim of this study was to establish criteria for prognostication of patients with ccRCCs using the ccRCC-specific CIMP marker genes. DNA methylation levels at 299 CpG sites in the 14 CIMP marker genes were evaluated quantitatively in tissue specimens of 88 CIMP-negative and 14 CIMP-positive ccRCCs in a learning cohort using the MassARRAY system. An additional 100 ccRCCs were also analyzed as a validation cohort. Receiver operating characteristic curve analysis showed that area under the curve values for the 23 CpG units including the 32 CpG sites in the 7 CIMP-marker genes, i.e. FAM150A, ZNF540, ZNF671, ZNF154, PRAC, TRH and SLC13A5, for discrimination of CIMP-positive from CIMP-negative ccRCCs were larger than 0.95. Criteria combining the 23 CpG units discriminated CIMP-positive from CIMP-negative ccRCCs with 100% sensitivity and specificity in the learning cohort. Cancer-free and overall survival rates of patients with CIMP-positive ccRCCs diagnosed using the criteria combining the 23 CpG units in a validation cohort were significantly lower than those of patients with CIMP-negative ccRCCs (P = 1.41 × 10-5 and 2.43 × 10-13, respectively). Patients with CIMP-positive ccRCCs in the validation cohort had a higher likelihood of disease-related death (hazard ratio, 75.8; 95% confidence interval, 7.81 to 735; P = 1.89 × 10-4) than those with CIMP-negative ccRCCs. The established criteria are able to reproducibly diagnose CIMP-positive ccRCCs and may be useful for personalized medicine for patients with ccRCCs.

  6. Parvovirus B19 DNA CpG Dinucleotide Methylation and Epigenetic Regulation of Viral Expression

    PubMed Central

    Bonvicini, Francesca; Manaresi, Elisabetta; Di Furio, Francesca; De Falco, Luisa; Gallinella, Giorgio

    2012-01-01

    CpG DNA methylation is one of the main epigenetic modifications playing a role in the control of gene expression. For DNA viruses whose genome has the ability to integrate in the host genome or to maintain as a latent episome, a correlation has been found between the extent of DNA methylation and viral quiescence. No information is available for Parvovirus B19, a human pathogenic virus, which is capable of both lytic and persistent infections. Within Parvovirus B19 genome, the inverted terminal regions display all the characteristic signatures of a genomic CpG island; therefore we hypothesised a role of CpG dinucleotide methylation in the regulation of viral genome expression. The analysis of CpG dinucleotide methylation of Parvovirus B19 DNA was carried out by an aptly designed quantitative real-time PCR assay on bisulfite-modified DNA. The effects of CpG methylation on the regulation of viral genome expression were first investigated by transfection of either unmethylated or in vitro methylated viral DNA in a model cell line, showing that methylation of viral DNA was correlated to lower expression levels of the viral genome. Then, in the course of in vitro infections in different cellular environments, it was observed that absence of viral expression and genome replication were both correlated to increasing levels of CpG methylation of viral DNA. Finally, the presence of CpG methylation was documented in viral DNA present in bioptic samples, indicating the occurrence and a possible role of this epigenetic modification in the course of natural infections. The presence of an epigenetic level of regulation of viral genome expression, possibly correlated to the silencing of the viral genome and contributing to the maintenance of the virus in tissues, can be relevant to the balance and outcome of the different types of infection associated to Parvovirus B19. PMID:22413013

  7. DNA methylation assessment from human slow- and fast-twitch skeletal muscle fibers

    PubMed Central

    Begue, Gwénaëlle; Raue, Ulrika; Jemiolo, Bozena

    2017-01-01

    A new application of the reduced representation bisulfite sequencing method was developed using low-DNA input to investigate the epigenetic profile of human slow- and fast-twitch skeletal muscle fibers. Successful library construction was completed with as little as 15 ng of DNA, and high-quality sequencing data were obtained with 32 ng of DNA. Analysis identified 143,160 differentially methylated CpG sites across 14,046 genes. In both fiber types, selected genes predominantly expressed in slow or fast fibers were hypomethylated, which was supported by the RNA-sequencing analysis. These are the first fiber type-specific methylation data from human skeletal muscle and provide a unique platform for future research. NEW & NOTEWORTHY This study validates a low-DNA input reduced representation bisulfite sequencing method for human muscle biopsy samples to investigate the methylation patterns at a fiber type-specific level. These are the first fiber type-specific methylation data reported from human skeletal muscle and thus provide initial insight into basal state differences in myosin heavy chain I and IIa muscle fibers among young, healthy men. PMID:28057818

  8. Promoter classifier: software package for promoter database analysis.

    PubMed

    Gershenzon, Naum I; Ioshikhes, Ilya P

    2005-01-01

    Promoter Classifier is a package of seven stand-alone Windows-based C++ programs allowing the following basic manipulations with a set of promoter sequences: (i) calculation of positional distributions of nucleotides averaged over all promoters of the dataset; (ii) calculation of the averaged occurrence frequencies of the transcription factor binding sites and their combinations; (iii) division of the dataset into subsets of sequences containing or lacking certain promoter elements or combinations; (iv) extraction of the promoter subsets containing or lacking CpG islands around the transcription start site; and (v) calculation of spatial distributions of the promoter DNA stacking energy and bending stiffness. All programs have a user-friendly interface and provide the results in a convenient graphical form. The Promoter Classifier package is an effective tool for various basic manipulations with eukaryotic promoter sequences that usually are necessary for analysis of large promoter datasets. The program Promoter Divider is described in more detail as a representative component of the package.

  9. A CpG Oligonucleotide Can Protect Mice From a Low Aerosol Challenge Dose of Burkholderia mallei

    DTIC Science & Technology

    2006-03-01

    may protect victims of a biological attack from glanders . Burkholderia mallei , the causative agent of glanders , natu- rally infects equines, but it can...attack from glanders . 15. SUBJECT TERMS Burkholderia mallei , glanders , oligonucleotides, CpG motif, efficacy, laboratory animals, mice 16...Society for Microbiology. All Rights Reserved. A CpG Oligonucleotide Can Protect Mice from a Low Aerosol Challenge Dose of Burkholderia mallei David M

  10. [Similarity of cycloprolylglycine to piracetam in antihypoxic and neuroprotective effects].

    PubMed

    Kolisnikova, K N; Gudasheva, T A; Nazarova, G A; Antipov, T A; Voronina, T A; Seredenin, S B

    2012-01-01

    The antihypoxic activity of the endogenous cyclic dipeptide cycloprolylglycine (CPG) has been studied on a model of normobaric hypoxia with hypercapnia and its neuroprotective activity has been studied on a model of human neuroblastoma SH-SY5Y cell damage by 6-hydroxydopamine. It is established that CPG exhibits the antihypoxic activity at doses of 0.5 and 1.0 mg/kg (i.p.) on outbred and BALB/c mice, but not on C57B1/6 mice. The neuroprotective activity of CPG was detected in 10(-5) - 10(-8) M concentration range only when the treatment was carried out 24h before toxin introduction. The obtained data confirm the hypothesis that piracetam is a mimetic of the endogenous CPG neuropeptide.

  11. CpG oligodeoxynucleotides containing GACGTT motifs enhance the immune responses elicited by a goose parvovirus vaccine in ducks.

    PubMed

    Lee, Jai-Wei; Lin, Yu-Ming; Yen, Ting-Ying; Yang, Wen-Jen; Chu, Chun-Yen

    2010-11-23

    Recombinant parvovirus VP2 (rVP2) was formulated with different types of adjuvant, including aluminum adjuvant and CpG oligodeoxynucleotides (ODNs), and the immunological responses after vaccination in ducks were examined. In comparison with the control group, production of rVP2-specific antibodies, expression of cytokines in peripheral blood mononuclear cells (PBMC) stimulated by rVP2, and percentage of CD4(+)/CD8(+) cells in PBMC were significantly increased in ducks immunized with rVP2 formulated with CpG ODNs containing 3 copies of GACGTT motif. CpG ODNs with GACGTT motifs might be used to improve the efficacy of vaccines for ducks. Copyright © 2010 Elsevier Ltd. All rights reserved.

  12. Comparative analysis of DNA methylation polymorphism in drought sensitive (HPKC2) and tolerant (HPK4) genotypes of horse Gram (Macrotyloma uniflorum).

    PubMed

    Bhardwaj, Jyoti; Mahajan, Monika; Yadav, Sudesh Kumar

    2013-08-01

    DNA methylation is known as an epigenetic modification that affects gene expression in plants. Variation in CpG methylation behavior was studied in two natural horse gram (Macrotyloma uniflorum [Lam.] Verdc.) genotypes, HPKC2 (drought-sensitive) and HPK4 (drought-tolerant). The methylation pattern in both genotypes was studied through methylation-sensitive amplified polymorphism. The results revealed that methylation was higher in HPKC2 (10.1%) than in HPK4 (8.6%). Sequencing demonstrated sequence homology with the DRE binding factor (cbf1), the POZ/BTB protein, and the Ty1-copia retrotransposon among some of the polymorphic fragments showing alteration in methylation behavior. Differences in DNA methylation patterns could explain the differential drought tolerance and the epigenetic signature of these two horse gram genotypes.

  13. Evolutionary Consequences of DNA Methylation in a Basal Metazoan

    PubMed Central

    Dixon, Groves B.; Bay, Line K.; Matz, Mikhail V.

    2016-01-01

    Gene body methylation (gbM) is an ancestral and widespread feature in Eukarya, yet its adaptive value and evolutionary implications remain unresolved. The occurrence of gbM within protein-coding sequences is particularly puzzling, because methylation causes cytosine hypermutability and hence is likely to produce deleterious amino acid substitutions. We investigate this enigma using an evolutionarily basal group of Metazoa, the stony corals (order Scleractinia, class Anthozoa, phylum Cnidaria). We show that patterns of coral gbM are similar to other invertebrate species, predicting wide and active transcription and slower sequence evolution. We also find a strong correlation between gbM and codon bias, resulting from systematic replacement of CpG bearing codons. We conclude that gbM has strong effects on codon evolution and speculate that this may influence establishment of optimal codons. PMID:27189563

  14. Impacts of Chromatin States and Long-Range Genomic Segments on Aging and DNA Methylation

    PubMed Central

    Sun, Dan; Yi, Soojin V.

    2015-01-01

    Understanding the fundamental dynamics of epigenome variation during normal aging is critical for elucidating key epigenetic alterations that affect development, cell differentiation and diseases. Advances in the field of aging and DNA methylation strongly support the aging epigenetic drift model. Although this model aligns with previous studies, the role of other epigenetic marks, such as histone modification, as well as the impact of sampling specific CpGs, must be evaluated. Ultimately, it is crucial to investigate how all CpGs in the human genome change their methylation with aging in their specific genomic and epigenomic contexts. Here, we analyze whole genome bisulfite sequencing DNA methylation maps of brain frontal cortex from individuals of diverse ages. Comparisons with blood data reveal tissue-specific patterns of epigenetic drift. By integrating chromatin state information, divergent degrees and directions of aging-associated methylation in different genomic regions are revealed. Whole genome bisulfite sequencing data also open a new door to investigate whether adjacent CpG sites exhibit coordinated DNA methylation changes with aging. We identified significant ‘aging-segments’, which are clusters of nearby CpGs that respond to aging by similar DNA methylation changes. These segments not only capture previously identified aging-CpGs but also include specific functional categories of genes with implications on epigenetic regulation of aging. For example, genes associated with development are highly enriched in positive aging segments, which are gradually hyper-methylated with aging. On the other hand, regions that are gradually hypo-methylated with aging (‘negative aging segments’) in the brain harbor genes involved in metabolism and protein ubiquitination. Given the importance of protein ubiquitination in proteome homeostasis of aging brains and neurodegenerative disorders, our finding suggests the significance of epigenetic regulation of this posttranslational modification pathway in the aging brain. Utilizing aging segments rather than individual CpGs will provide more comprehensive genomic and epigenomic contexts to understand the intricate associations between genomic neighborhoods and developmental and aging processes. These results complement the aging epigenetic drift model and provide new insights. PMID:26091484

  15. Functional analyses of PtRDM1 gene overexpression in poplars and evaluation of its effect on DNA methylation and response to salt stress.

    PubMed

    Movahedi, Ali; Zhang, Jiaxin; Sun, Weibo; Mohammadi, Kourosh; Almasi Zadeh Yaghuti, Amir; Wei, Hui; Wu, Xiaolong; Yin, Tongming; Zhuge, Qiang

    2018-06-01

    Epigenetic modification by DNA methylation is necessary for all cellular processes, including genetic expression events, DNA repair, genomic imprinting and regulation of tissue development. It occurs almost exclusively at the C5 position of symmetric CpG and asymmetric CpHpG and CpHpH sites in genomic DNA. The RNA-directed DNA methylation (RDM1) gene is crucial for heterochromatin and DNA methylation. We overexpressed PtRDM1 gene from Populus trichocarpa to amplify transcripts of orthologous RDM1 in 'Nanlin895' (P. deltoides × P. euramericana 'Nanlin895'). This overexpression resulted in increasing RDM1 transcript levels: by ∼150% at 0 mM NaCl treatment and by ∼300% at 60 mM NaCl treatment compared to WT (control) poplars. Genomic cytosine methylation was monitored within 5.8S rDNA and histone H3 loci by bisulfite sequencing. In total, transgenic poplars revealed more DNA methylation than WT plants. In our results, roots revealed more methylated CG contexts than stems and leaves whereas, histone H3 presented more DNA methylation than 5.8S rDNA in both WT and transgenic poplars. The NaCl stresses enhanced more DNA methylation in transgenic poplars than WT plants through histone H3 and 5.8 rDNA loci. Also, the overexpression of PtRDM1 resulted in hyper-methylation, which affected plant phenotype. Transgenic poplars revealed significantly more regeneration of roots than WT poplars via NaCl treatments. Our results proved that RDM1 protein enhanced the DNA methylation by chromatin remodeling (e.g. histone H3) more than repetitive DNA sequences (e.g. 5.8S rDNA). Copyright © 2018 Elsevier Masson SAS. All rights reserved.

  16. Improvement of the Immunogenicity of Porcine Circovirus Type 2 DNA Vaccine by Recombinant ORF2 Gene and CpG Motifs.

    PubMed

    Li, Jun; Shi, Jian-Li; Wu, Xiao-Yan; Fu, Fang; Yu, Jiang; Yuan, Xiao-Yuan; Peng, Zhe; Cong, Xiao-Yan; Xu, Shao-Jian; Sun, Wen-Bo; Cheng, Kai-Hui; Du, Yi-Jun; Wu, Jia-Qiang; Wang, Jin-Bao; Huang, Bao-Hua

    2015-06-01

    Nowadays, adjuvant is still important for boosting immunity and improving resistance in animals. In order to boost the immunity of porcine circovirus type 2 (PCV2) DNA vaccine, CpG motifs were inserted. In this study, the dose-effect was studied, and the immunity of PCV2 DNA vaccines by recombinant open reading frame 2 (ORF2) gene and CpG motifs was evaluated. Three-week-old Changbai piglets were inoculated intramuscularly with 200 μg, 400 μg, and 800 μg DNA vaccines containing 14 and 18 CpG motifs, respectively. Average gain and rectum temperature were recorded everyday during the experiments. Blood was collected from the piglets after vaccination to detect the changes of specific antibodies, interleukin-2, and immune cells every week. Tissues were collected for histopathology and polymerase chain reaction. The results indicated that compared to those of the control piglets, all concentrations of two DNA vaccines could induce PCV2-specific antibodies. A cellular immunity test showed that PCV2-specific lymphocytes proliferated the number of TH, TC, and CD3+ positive T-cells raised in the blood of DNA vaccine immune groups. There was no distinct pathological damage and viremia occurring in pigs that were inoculated with DNA vaccines, but there was some minor pathological damage in the control group. The results demonstrated that CpG motifs as an adjuvant could boost the humoral and cellular immunity of pigs to PCV2, especially in terms of cellular immunity. Comparing two DNA vaccines that were constructed, the one containing 18 CpG motifs was more effective. This is the first report that CpG motifs as an adjuvant insert to the PCV2 DNA vaccine could boost immunity.

  17. Potential for diagnosis versus therapy monitoring of attention deficit hyperactivity disorder: a new epigenetic biomarker interacting with both genotype and auto-immunity.

    PubMed

    Adriani, Walter; Romano, Emilia; Pucci, Mariangela; Pascale, Esterina; Cerniglia, Luca; Cimino, Silvia; Tambelli, Renata; Curatolo, Paolo; Granstrem, Oleg; Maccarrone, Mauro; Laviola, Giovanni; D'Addario, Claudio

    2018-02-01

    In view of the need for easily accessible biomarkers, we evaluated in ADHD children the epigenetic status of the 5'-untranslated region (UTR) in the SLC6A3 gene, coding for human dopamine transporter (DAT). We analysed buccal swabs and sera from 30 children who met DSM-IV-TR criteria for ADHD, assigned to treatment according to severity. Methylation levels at six-selected CpG sites (among which, a CGGCGGCGG and a CGCG motif), alone or in combination with serum titers in auto-antibodies against dopamine transporter (DAT aAbs), were analysed for correlation with CGAS scores (by clinicians) and Conners' scales (by parents), collected at recruitment and after 6 weeks. In addition, we characterized the DAT genotype, i.e., the variable number tandem repeat (VNTR) polymorphisms at the 3'-UTR of the gene. DAT methylation levels were greatly reduced in ADHD patients compared to control, healthy children. Within patients carrying at least one DAT 9 allele (DAT 9/x), methylation at positions CpG2 and/or CpG6 correlated with recovery, as evident from delta-CGAS scores as well as delta Conners' scales ('inattentive' and 'hyperactive' subscales). Moreover, hypermethylation at CpG1 position denoted severity, specifically for those patients carrying a DAT 10/10 genotype. Intriguingly, high serum DAT-aAbs titers appeared to corroborate indications from high CpG1 versus high CpG2/CpG6 levels, likewise denoting severity versus recovery in DAT 10/10 versus 9/x patients, respectively. These profiles suggest that DAT 5'UTR epigenetics plus serum aAbs can serve as suitable biomarkers, to confirm ADHD diagnosis and/or to predict the efficacy of treatment.

  18. Perception, attitude, and satisfaction of paediatric physicians and nurses towards clinical practice guidelines at a university teaching hospital.

    PubMed

    Amer, Yasser Sami; Al Nemri, Abdulrahman; Osman, Mohamed Elfaki; Saeed, Elshazaly; Assiri, Asaad Mohamed; Mohamed, Sarar

    2018-04-03

    To explore perception, attitude, and satisfaction of paediatric clinicians, trainees, and nurses at King Khalid University Hospital towards clinical practice guidelines (CPGs) including the locally adapted diabetic ketoacidosis CPG (DKA-CPG). A cross-sectional survey was distributed to 260 doctors and nurses working in the paediatrics department. The response rate was 95.4%. The respondents had a positive perception and attitude towards general CPGs and specifically for the DKA-CPG; 98.7% thought CPGs were useful sources of advice, improved safety, and decreased risk, and reduced variation in practice. A total of 99.2% thought CPGs were good clinical tools, 98.3% satisfied with, had confidence in well-developed CPGs, and would recommend them to their colleagues to use, and 94.6% agreed they were cost-effective. The preferred format for CPGs was paper (46.6%) and electronic (42.9%). The DKA-CPG helped in managing patients and respondents were all satisfied and had confidence with it (100%). The rationale and objectives of the DKA-CPG were clear for 99.25%; 98.5% thought the layout was clear and well organized and user-friendly (96.2%). Compared with nurses, physicians had a higher perception towards CPGs in general (P < .05) and the DKA-CPG (P < .05). The paediatric doctors, and nurses have a great perception and satisfaction and positive attitude towards CPGs in general, towards the paediatric diabetic ketoacidosis CPG in particular, which in turn had a positive impact on the acceptability and implementation of the CPGs. These findings could help in sustaining a safe and high-quality health care environment through implementation of evidence-based CPGs. © 2018 John Wiley & Sons, Ltd.

  19. CpG island methylator phenotype-low (CIMP-low) colorectal cancer shows not only few methylated CIMP-high-specific CpG islands, but also low-level methylation at individual loci.

    PubMed

    Kawasaki, Takako; Ohnishi, Mutsuko; Nosho, Katsuhiko; Suemoto, Yuko; Kirkner, Gregory J; Meyerhardt, Jeffrey A; Fuchs, Charles S; Ogino, Shuji

    2008-03-01

    The CpG island methylator phenotype (CIMP or CIMP-high) with widespread promoter methylation is a distinct phenotype in colorectal cancer. However, the concept of CIMP-low with less extensive CpG island methylation is still evolving. Our aim is to examine whether density of methylation in individual CpG islands was different between CIMP-low and CIMP-high tumors. Utilizing MethyLight technology and 889 population-based colorectal cancers, we quantified DNA methylation (methylation index, percentage of methylated reference) at 14 CpG islands, including 8 CIMP-high-specific loci (CACNA1G, CDKN2A (p16), CRABP1, IGF2, MLH1, NEUROG1, RUNX3 and SOCS1). Methylation positivity in each locus was defined as methylation index>4. Low-level methylation (methylation index>0, <20) in each CIMP-high-specific locus was significantly more common in 340 CIMP-low tumors (1/8-5/8 methylation-positive loci) than 133 CIMP-high tumors (> or =6/8 methylation-positive loci) and 416 CIMP-0 tumors (0/8 methylation-positive loci) (P< or =0.002). In the other six loci (CHFR, HIC1, IGFBP3, MGMT, MINT31 and WRN), which were not highly specific for CIMP-high, low-level methylation, was not persistently more prevalent in CIMP-low tumors. In conclusion, compared to CIMP-high and CIMP-0 tumors, CIMP-low colorectal cancers show not only few methylated CIMP-high-specific CpG islands, but also more frequent low-level methylation at individual loci. Our data may provide supporting evidence for a difference in pathogenesis of DNA methylation between CIMP-low and CIMP-high tumors.

  20. [Comparative analysis of methylation profiles in tissues of oral leukoplakia and oral squamous cell carcinoma].

    PubMed

    Fu, J; Su, Y; Liu, Y; Zhang, X Y

    2018-04-09

    Objective: To compare the methylation profiles in tissues of oral leukoplakia (OLK) and oral squamous cell carcinoma (OSCC) with healthy tissues of oral mucosa, in order to identify the role of DNA methylation played in tumorigenesis. Methods: DNA samples extracted from tissues of 4 healthy oral mucosa, 4 OSCC and 4 OLK collected from patients of the Department of Oral Medicine, Capital Medical University School of Stomatology were examined and compared using Methylation 450 Bead Chip. The genes associated with differentially methylated CpG sites were selected for gene ontology (GO) analysis and Kyoto encyclopedia of genes and genomes (KEGG) pathway enrichment. Results: Multiple differentially methylated CpG sites were identified by using the above mentioned assay. Hypermethylation constitutes 86.18% (23 290/27 025) of methylation changes in OLK and hypomethylation accounts for 13.82% (3 734/27 025) of methylation changes. Both hypermethylated and hypomethylated CpG sites were markedly increased in OSCC tissue compared with OLK tissue. The majority of differentially methylated CpG sites were located outside CpG islands, with approximately one-fourth in CpG shores flanking the islands, which were considered highly important for gene regulation and tumorigenesis. Pathway analysis revealed that differentially methylated CpG sites in both OLK and OSCC patients shared the same pathway enrichments, most of which were correlated with carcinogenesis and cancer progression (e.g., DNA repair, cell cycle, and apoptosis). Conclusions: In the present study, methylation-associated alterations affect almost all pathways in the cellular network in both OLK and OSCC. OLK and OSCC shared similar methylation changes whether in pathways or genes, indicating that epigenetically they might have the same molecular basis for disease progression.

  1. The Antimalarial Artemisinin Synergizes with Antibiotics To Protect against Lethal Live Escherichia coli Challenge by Decreasing Proinflammatory Cytokine Release

    PubMed Central

    Wang, Jun; Zhou, Hong; Zheng, Jiang; Cheng, Juan; Liu, Wei; Ding, Guofu; Wang, Liangxi; Luo, Ping; Lu, Yongling; Cao, Hongwei; Yu, Shuangjiang; Li, Bin; Zhang, Lezhi

    2006-01-01

    In the present study artemisinin (ART) was found to have potent anti-inflammatory effects in animal models of sepsis induced by CpG-containing oligodeoxy-nucleotides (CpG ODN), lipopolysaccharide (LPS), heat-killed Escherichia coli 35218 or live E. coli. Furthermore, we found that ART protected mice from a lethal challenge by CpG ODN, LPS, or heat-killed E. coli in a dose-dependent manner and that the protection was related to a reduction in serum tumor necrosis factor alpha (TNF-α). More significantly, the administration of ART together with ampicillin or unasyn (a complex of ampicillin and sulbactam) decreased mortality from 100 to 66.7% or 33.3%, respectively, in mice subjected to a lethal live E. coli challenge. Together with the observation that ART alone does not inhibit bacterial growth, this result suggests that ART protection is achieved as a result of its anti-inflammatory activity rather than an antimicrobial effect. In RAW264.7 cells, pretreatment with ART potently inhibited TNF-α and interleukin-6 release induced by CpG ODN, LPS, or heat-killed E. coli in a dose- and time-dependent manner. Experiments utilizing affinity sensor technology revealed no direct binding of ART with CpG ODN or LPS. Flow cytometry further showed that ART did not alter binding of CpG ODN to cell surfaces or the internalization of CpG ODN. In addition, upregulated levels of TLR9 and TLR4 mRNA were not attenuated by ART treatment. ART treatment did, however, block the NF-κB activation induced by CpG ODN, LPS, or heat-killed E. coli. These findings provide compelling evidence that ART may be an important potential drug for sepsis treatment. PMID:16801421

  2. Intraperitoneal prophylaxis with CpG oligodeoxynucleotides protects neutropenic mice against intracerebral Escherichia coli K1 infection.

    PubMed

    Ribes, Sandra; Meister, Tanja; Ott, Martina; Redlich, Sandra; Janova, Hana; Hanisch, Uwe-Karsten; Nessler, Stefan; Nau, Roland

    2014-01-23

    Prophylaxis with unmethylated cytosine phosphate guanidine (CpG) oligodeoxynucleotides (ODN) protects against several systemic experimental infections. Escherichia coli is a major cause of Gram-negative neonatal bacterial meningitis and also causes meningitis and meningoencephalitis in older and immunocompromised patients. Wild-type (wt) and Toll-like receptor 9 (TLR9)-deficient mice were rendered neutropenic by intraperitoneal administration of the anti-Ly-6G monoclonal antibody. Immunocompetent and neutropenic mice received intraperitoneal CpG ODN or vehicle 72 h prior to induction of E. coli K1 meningoencephalitis. Pre-treatment with CpG ODN significantly increased survival of neutropenic wt mice from 33% to 75% (P = 0.0003) but did not protect neutropenic TLR9-/- mice. The protective effect of CpG ODN was associated with an enhanced production of interleukin (IL)-12/IL-23p40 with sustained increased levels in serum and spleen at least for 17 days after conditioning compared to buffer-treated animals. CpG-treated neutropenic wt mice showed reduced bacterial concentrations and increased recruitment of Ly6ChighCCR2+ monocytes in brain and spleen 42 h after infection. The levels of macrophage inflammatory protein 1α (MIP-1α) and interferon gamma (IFN-γ) in spleen were higher 42 h after infection in CpG-treated compared to buffer-treated neutropenic animals. In immunocompetent mice, prophylaxis with CpG ODN did not significantly increase survival compared to the buffer group (60% vs. 45%, P = 0.2). These findings suggest that systemic administration of CpG ODN may help to prevent bacterial CNS infections in immunocompromised individuals.

  3. Multi-step aberrant CpG island hyper-methylation is associated with the progression of adult T-cell leukemia/lymphoma.

    PubMed

    Sato, Hiaki; Oka, Takashi; Shinnou, Yoko; Kondo, Takami; Washio, Kana; Takano, Masayuki; Takata, Katsuyoshi; Morito, Toshiaki; Huang, Xingang; Tamura, Maiko; Kitamura, Yuta; Ohara, Nobuya; Ouchida, Mamoru; Ohshima, Koichi; Shimizu, Kenji; Tanimoto, Mitsune; Takahashi, Kiyoshi; Matsuoka, Masao; Utsunomiya, Atae; Yoshino, Tadashi

    2010-01-01

    Aberrant CpG island methylation contributes to the pathogenesis of various malignancies. However, little is known about the association of epigenetic abnormalities with multistep tumorigenic events in adult T cell leukemia/lymphoma (ATLL). To determine whether epigenetic abnormalities induce the progression of ATLL, we analyzed the methylation profiles of the SHP1, p15, p16, p73, HCAD, DAPK, hMLH-1, and MGMT genes by methylation specific PCR assay in 65 cases with ATLL patients. The number of CpG island methylated genes increased with disease progression and aberrant hypermethylation in specific genes was detected even in HTLV-1 carriers and correlated with progression to ATLL. The CpG island methylator phenotype (CIMP) was observed most frequently in lymphoma type ATLL and was also closely associated with the progression and crisis of ATLL. The high number of methylated genes and increase of CIMP incidence were shown to be unfavorable prognostic factors and correlated with a shorter overall survival by Kaplan-Meyer analysis. The present findings strongly suggest that the multistep accumulation of aberrant CpG methylation in specific target genes and the presence of CIMP are deeply involved in the crisis, progression, and prognosis of ATLL, as well as indicate the value of CpG methylation and CIMP for new diagnostic and prognostic biomarkers.

  4. Multi-Step Aberrant CpG Island Hyper-Methylation Is Associated with the Progression of Adult T–Cell Leukemia/Lymphoma

    PubMed Central

    Sato, Hiaki; Oka, Takashi; Shinnou, Yoko; Kondo, Takami; Washio, Kana; Takano, Masayuki; Takata, Katsuyoshi; Morito, Toshiaki; Huang, Xingang; Tamura, Maiko; Kitamura, Yuta; Ohara, Nobuya; Ouchida, Mamoru; Ohshima, Koichi; Shimizu, Kenji; Tanimoto, Mitsune; Takahashi, Kiyoshi; Matsuoka, Masao; Utsunomiya, Atae; Yoshino, Tadashi

    2010-01-01

    Aberrant CpG island methylation contributes to the pathogenesis of various malignancies. However, little is known about the association of epigenetic abnormalities with multistep tumorigenic events in adult T cell leukemia/lymphoma (ATLL). To determine whether epigenetic abnormalities induce the progression of ATLL, we analyzed the methylation profiles of the SHP1, p15, p16, p73, HCAD, DAPK, hMLH-1, and MGMT genes by methylation specific PCR assay in 65 cases with ATLL patients. The number of CpG island methylated genes increased with disease progression and aberrant hypermethylation in specific genes was detected even in HTLV-1 carriers and correlated with progression to ATLL. The CpG island methylator phenotype (CIMP) was observed most frequently in lymphoma type ATLL and was also closely associated with the progression and crisis of ATLL. The high number of methylated genes and increase of CIMP incidence were shown to be unfavorable prognostic factors and correlated with a shorter overall survival by Kaplan-Meyer analysis. The present findings strongly suggest that the multistep accumulation of aberrant CpG methylation in specific target genes and the presence of CIMP are deeply involved in the crisis, progression, and prognosis of ATLL, as well as indicate the value of CpG methylation and CIMP for new diagnostic and prognostic biomarkers. PMID:20019193

  5. Immunostimulatory CpG on Carbon Nanotubes Selectively Inhibits Migration of Brain Tumor Cells.

    PubMed

    Alizadeh, Darya; White, Ethan E; Sanchez, Teresa C; Liu, Shunan; Zhang, Leying; Badie, Behnam; Berlin, Jacob M

    2018-05-16

    Even when treated with aggressive current therapies, patients with glioblastoma usually survive less than two years and exhibit a high rate of recurrence. CpG is an oligonucleotide that activates the innate immune system via Toll-like receptor 9 (TLR9) activation. Injection of CpG into glioblastoma tumors showed promise as an immunotherapy in mouse models but proved disappointing in human trials. One aspect of glioma that is not addressed by CpG therapy alone is the highly invasive nature of glioma cells, which is associated with resistance to radiation and chemotherapy. Here, we demonstrate that single-walled carbon nanotubes noncovalently functionalized with CpG (SWNT/CpG), which retain the immunostimulatory property of the CpG, selectively inhibit the migration of glioma cells and not macrophages without affecting cell viability or proliferation. SWNT/CpG also selectively decreased NF-κB activation in glioma cells, while activating macrophages by induction of the TLR9/NF-κB pathway, as we have previously reported. The migration inhibition of glioma cells was correlated with selective reduction of intracellular levels of reactive oxygen species (ROS), suggesting that an antioxidant-based mechanism mediates the observed effects. To the best of our knowledge, SWNT/CpG is the first nanomaterial that inhibits the migration of cancer cells while stimulating the immune system.

  6. Survival differences of CIMP subtypes integrated with CNA information in human breast cancer.

    PubMed

    Wang, Huihan; Yan, Weili; Zhang, Shumei; Gu, Yue; Wang, Yihan; Wei, Yanjun; Liu, Hongbo; Wang, Fang; Wu, Qiong; Zhang, Yan

    2017-07-25

    CpG island methylator phenotype of breast cancer is associated with widespread aberrant methylation at specified CpG islands and distinct patient outcomes. However, the influence of copy number contributing to the prognosis of tumors with different CpG island methylator phenotypes is still unclear. We analyzed both genetic (copy number) and epigenetic alterations in 765 breast cancers from The Cancer Genome Atlas data portal and got a panel of 15 biomarkers for copy number and methylation status evaluation. The gene panel identified two groups corresponding to distinct copy number profiles. In status of mere-loss copy number, patients were faced with a greater risk if they presented a higher CpG islands methylation pattern in biomarker panels. But for samples presenting merely-gained copy number, higher methylation level of CpG islands was associated with improved viability. In all, the integration of copy number alteration and methylation information enhanced the classification power on prognosis. Moreover, we found the molecular subtypes of breast cancer presented different distributions in two CpG island methylation phenotypes. Generated by the same set of human methylation 450K data, additional copy number information could provide insights into survival prediction of cancers with less heterogeneity and might help to determine the biomarkers for diagnosis and treatment for breast cancer patients in a more personalized approach.

  7. Survival differences of CIMP subtypes integrated with CNA information in human breast cancer

    PubMed Central

    Wang, Huihan; Yan, Weili; Zhang, Shumei; Gu, Yue; Wang, Yihan; Wei, Yanjun; Liu, Hongbo; Wang, Fang; Wu, Qiong; Zhang, Yan

    2017-01-01

    CpG island methylator phenotype of breast cancer is associated with widespread aberrant methylation at specified CpG islands and distinct patient outcomes. However, the influence of copy number contributing to the prognosis of tumors with different CpG island methylator phenotypes is still unclear. We analyzed both genetic (copy number) and epigenetic alterations in 765 breast cancers from The Cancer Genome Atlas data portal and got a panel of 15 biomarkers for copy number and methylation status evaluation. The gene panel identified two groups corresponding to distinct copy number profiles. In status of mere-loss copy number, patients were faced with a greater risk if they presented a higher CpG islands methylation pattern in biomarker panels. But for samples presenting merely-gained copy number, higher methylation level of CpG islands was associated with improved viability. In all, the integration of copy number alteration and methylation information enhanced the classification power on prognosis. Moreover, we found the molecular subtypes of breast cancer presented different distributions in two CpG island methylation phenotypes. Generated by the same set of human methylation 450K data, additional copy number information could provide insights into survival prediction of cancers with less heterogeneity and might help to determine the biomarkers for diagnosis and treatment for breast cancer patients in a more personalized approach. PMID:28415743

  8. DNA Methylation of T1R1 Gene in the Vegetarian Adaptation of Grass Carp Ctenopharyngodon idella.

    PubMed

    Cai, Wenjing; He, Shan; Liang, Xu-Fang; Yuan, Xiaochen

    2018-05-02

    Although previous studies have indicated importance of taste receptors in food habits formation in mammals, little is known about those in fish. Grass carp is an excellent model for studying vegetarian adaptation, as it shows food habit transition from carnivore to herbivore. In the present study, pseudogenization or frameshift mutations of the umami receptors that hypothesized related to dietary switch in vertebrates, were not found in grass carp, suggesting other mechanisms for vegetarian adaptation in grass carp. T1R1 and T1R3 strongly responded to L-Arg and L-Lys, differing from those of zebrafish and medaka, contributing to high species specificity in amino acid preferences and diet selection of grass carp. After food habit transition of grass carp, DNA methylation levels were higher in CPG1 and CPG3 islands of upstream control region of T1R1 gene. Luciferase activity assay of upstream regulatory region of T1R1 (-2500-0 bp) without CPG1 or CPG3 indicated that CPG1 and CPG3 might be involved in transcriptional regulation of T1R1 gene. Subsequently, high DNA methylation decreased expression of T1R1 in intestinal tract. It could be a new mechanism to explain, at least partially, the vegetarian adaptation of grass carp by regulation of expression of umami receptor via epigenetic modification.

  9. A crucial role for plasmacytoid dendritic cells in antiviral protection by CpG ODN–based vaginal microbicide

    PubMed Central

    Shen, Hong; Iwasaki, Akiko

    2006-01-01

    Topical microbicides represent a promising new approach to preventing HIV and other sexually transmitted infections. TLR agonists are ideal candidates for microbicides, as they trigger a multitude of antiviral genes effective against a broad range of viruses. Although vaginal application of CpG oligodeoxynucleotides (ODNs) and poly I:C has been shown to protect mice from genital herpes infection, the mechanism by which these agents provide protection remains unclear. Here, we show that plasmacytoid DCs (pDCs) are required for CpG ODN–mediated protection against lethal vaginal challenge with herpes simplex virus type 2 (HSV-2). Moreover, we demonstrate that cells of both the hematopoietic and stromal compartments must respond to CpG ODN via TLR9 and to type I IFNs through IFN-αβ receptor (IFN-αβR) for protection. Thus, crosstalk between pDCs and vaginal stromal cells provides for optimal microbicide efficacy. Our results imply that temporally and spatially controlled targeting of CpG ODN to pDCs and epithelial cells can potentially maximize their effectiveness as microbicides while minimizing the associated inflammatory responses. PMID:16878177

  10. The contribution of a central pattern generator in a reflex-based neuromuscular model

    PubMed Central

    Dzeladini, Florin; van den Kieboom, Jesse; Ijspeert, Auke

    2014-01-01

    Although the concept of central pattern generators (CPGs) controlling locomotion in vertebrates is widely accepted, the presence of specialized CPGs in human locomotion is still a matter of debate. An interesting numerical model developed in the 90s’ demonstrated the important role CPGs could play in human locomotion, both in terms of stability against perturbations, and in terms of speed control. Recently, a reflex-based neuro-musculo-skeletal model has been proposed, showing a level of stability to perturbations similar to the previous model, without any CPG components. Although exhibiting striking similarities with human gaits, the lack of CPG makes the control of speed/step length in the model difficult. In this paper, we hypothesize that a CPG component will offer a meaningful way of controlling the locomotion speed. After introducing the CPG component in the reflex model, and taking advantage of the resulting properties, a simple model for gait modulation is presented. The results highlight the advantages of a CPG as feedforward component in terms of gait modulation. PMID:25018712

  11. Impact of the implementation of an evidence-based guideline on diagnostic testing, management, and clinical outcomes for infants with bronchiolitis

    PubMed Central

    Henao-Villada, Ricardo; Sossa-Briceño, Monica P.; Rodríguez-Martínez, Carlos E.

    2016-01-01

    Background: Although bronchiolitis poses a significant health problem in low- and middle-income countries (LMICs), to the best of our knowledge, to date it has not been determined whether evidence-based bronchiolitis clinical practice guidelines (CPGs) complemented by standardized educational strategies reduce the use of unnecessary diagnostic tests and medications and improve clinically important outcomes in LMICs. Methods: In an uncontrolled before and after study, we assessed the impact of the implementation of an evidence-based bronchiolitis CPG on physician behavior and the care of infants with bronchiolitis by comparing pre-guideline (March to August 2014) and post-guideline (March to August 2015) use of diagnostic tests and medications through an electronic medical record review in a children’s hospital in Bogota, Colombia. We also sought to assess the impact of the implementation of the CPG on clinically important outcomes such as lengths of stay, hospital admissions, intensive care admissions, and hospital readmissions. Results: Data from 662 cases of bronchiolitis (pre-guideline period) were compared with the data from 703 cases (post-guideline period). On comparing the pre- and post-guideline periods, it was seen that there was a significant increase in the proportion of patients with an appropriate diagnosis and treatment of bronchiolitis (36.4% versus 44.5%, p = 0.003), and there were statistically significant decreases in the use of a hemogram (33.2% versus 26.6%, p=0.010), procalcitonin (3.9% versus 1.6%, p=0.018), nebulized beta-2 agonists (45.6% versus 3.4%, p < 0.001), nebulized anticholinergics (3.3% versus 1.4%, p= 0.029), and nebulized epinephrine (16.2% versus 7.8%, p < 0.001). Likewise, a significant increase in the use of nebulized hypertonic saline was seen (79.6% versus 91.7%, p < 0.001). However, implementation of the CPG for bronchiolitis was not associated with significant changes in clinically important outcomes. Conclusions: The development and implementation of a good quality bronchiolitis CPG is associated with a significant increase in the proportion of cases with an appropriate diagnosis and treatment of the disease in the context of a university-based hospital located in the capital of an LMIC. However, we could not demonstrate an improvement in clinically important outcomes such as any of the bronchiolitis severity parameters. PMID:27492738

  12. DHA-rich n-3 fatty acid supplementation decreases DNA methylation in blood leukocytes: the OmegAD study.

    PubMed

    Karimi, Mohsen; Vedin, Inger; Freund Levi, Yvonne; Basun, Hans; Faxén Irving, Gerd; Eriksdotter, Maria; Wahlund, Lars-Olof; Schultzberg, Marianne; Hjorth, Erik; Cederholm, Tommy; Palmblad, Jan

    2017-10-01

    Background: Dietary fish oils, rich in long-chain n-3 (ω-3) fatty acids (FAs) [e.g., docosahexaenoic acid (DHA, 22:6n-3) and eicosapentaenoic acid (EPA, 20:5n-3)], modulate inflammatory reactions through various mechanisms, including gene expression, which is measured as messenger RNA concentration. However, the effects of long-term treatment of humans with DHA and EPA on various epigenetic factors-such as DNA methylation, which controls messenger RNA generation-are poorly described. Objective: We wanted to determine the effects of 6 mo of dietary supplementation with an n-3 FA preparation rich in DHA on global DNA methylation of peripheral blood leukocytes (PBLs) and the relation to plasma EPA and DHA concentrations in Alzheimer disease (AD) patients. Design: In the present study, DNA methylation in four 5'-cytosine-phosphate-guanine-3' (CpG) sites of long interspersed nuclear element-1 repetitive sequences was assessed in a group of 63 patients (30 given the n-3 FA preparation and 33 given placebo) as an estimation of the global DNA methylation in blood cells. Patients originated from the randomized, double-blind, placebo-controlled OmegAD study, in which 174 AD patients received either 1.7 g DHA and 0.6 g EPA (the n-3 FA group) or placebo daily for 6 mo. Results: At 6 mo, the n-3 FA group displayed marked increases in DHA and EPA plasma concentrations (2.6- and 3.5-fold), as well as decreased methylation in 2 out of 4 CpG sites ( P < 0.05 for all), respectively. This hypomethylation in CpG2 and CpG4 sites showed a reverse correlation to changes in plasma EPA concentration ( r = -0.25, P = 0.045; and r = -0.26, P = 0.041, respectively), but not to changes in plasma DHA concentration, and were not related to apolipoprotein E-4 allele frequency. Conclusion: Supplementation with n-3 FA for 6 mo was associated with global DNA hypomethylation in PBLs. Our data may be of importance in measuring various effects of marine oils, including gene expression, in patients with AD and in other patients taking n-3 FA supplements. This trial was registered at clinicaltrials.gov as NCT00211159. © 2017 American Society for Nutrition.

  13. [Using routine data for quality of care assessments: a critical review, taking quality indicators for the "National Disease Management Guideline for Chronic Heart Failure" as an example].

    PubMed

    Laux, Gunter; Nothacker, Monika; Weinbrenner, Susanne; Störk, Stefan; Blozik, Eva; Peters-Klimm, Frank; Szecsenyi, Jürgen; Scherer, Martin

    2011-01-01

    In December 2009, the first version of the German Disease Management Guideline (DM-CPG) for chronic heart failure was completed, including a set of proposed quality indicators for heart failure. This article explores whether proposed indicators can be derived from data collected routinely in general practices. For this purpose, previous experiences and data from the research project CONTENT (CONTinuous morbidity registration Epidemiologic NeTwork) conducted under guidance of the Department of General Medicine and Health Services Research at the University of Heidelberg, Germany, were applied. The availability of numerators and denominators needed for calculating the four quality indicators for diagnosis and pharmacotherapy proposed in the DM-CPG was checked within so-called "routine data" from the existing dataset of the CONTENT project. Within the given context, routine data are defined as data that are periodically transmitted from health care providers to cost units within the health care system. A thorough assessment has revealed that within the given context only one indicator could be deduced from routine data collection. This was the indicator measuring the proportion of patients receiving beta receptor antagonists, compared to all patients with heart failure NYHA class II to IV. Indeed, this single indicator will only be computable if the NYHA grade of heart failure severity and the presence or absence of contraindications to beta receptor antagonist therapy are routinely collected and the data merged into a central database. Against the background of these results it is obvious that a fully developed, transsectoral concept for data collection and data transfer needs to be implemented.

  14. A pyrosequencing assay for the quantitative methylation analysis of the PCDHB gene cluster, the major factor in neuroblastoma methylator phenotype.

    PubMed

    Banelli, Barbara; Brigati, Claudio; Di Vinci, Angela; Casciano, Ida; Forlani, Alessandra; Borzì, Luana; Allemanni, Giorgio; Romani, Massimo

    2012-03-01

    Epigenetic alterations are hallmarks of cancer and powerful biomarkers, whose clinical utilization is made difficult by the absence of standardization and of common methods of data interpretation. The coordinate methylation of many loci in cancer is defined as 'CpG island methylator phenotype' (CIMP) and identifies clinically distinct groups of patients. In neuroblastoma (NB), CIMP is defined by a methylation signature, which includes different loci, but its predictive power on outcome is entirely recapitulated by the PCDHB cluster only. We have developed a robust and cost-effective pyrosequencing-based assay that could facilitate the clinical application of CIMP in NB. This assay permits the unbiased simultaneous amplification and sequencing of 17 out of 19 genes of the PCDHB cluster for quantitative methylation analysis, taking into account all the sequence variations. As some of these variations were at CpG doublets, we bypassed the data interpretation conducted by the methylation analysis software to assign the corrected methylation value at these sites. The final result of the assay is the mean methylation level of 17 gene fragments in the protocadherin B cluster (PCDHB) cluster. We have utilized this assay to compare the methylation levels of the PCDHB cluster between high-risk and very low-risk NB patients, confirming the predictive value of CIMP. Our results demonstrate that the pyrosequencing-based assay herein described is a powerful instrument for the analysis of this gene cluster that may simplify the data comparison between different laboratories and, in perspective, could facilitate its clinical application. Furthermore, our results demonstrate that, in principle, pyrosequencing can be efficiently utilized for the methylation analysis of gene clusters with high internal homologies.

  15. Epigenetic Inactivation of GALR1 in Head and Neck Cancer

    PubMed Central

    Misawa, Kiyoshi; Ueda, Yo; Kanazawa, Takeharu; Misawa, Yuki; Jang, Ilwhan; Brenner, John Chadwick; Ogawa, Tetsuya; Takebayashi, Satoru; Grenman, Reidar A.; Herman, James G.; Mineta, Hiroyuki; Carey, Thomas E.

    2011-01-01

    Purpose One copy of the GALR1 locus on 18q is often deleted and expression is absent in some head and neck squamous cell carcinoma (HNSCC) cell lines. To determine if LOH and hypermethylation might silence the GALR1 gene, promoter methylation status and gene expression were assessed in a large panel of HNSCC cell lines and tumors. Experimental Design Promoter methylation of GALR1 in 72 cell lines and 100 primary tumor samples was analyzed using methylation-specific PCR (MSP). GALR1 expression and methylation status were analyzed further by real-time PCR and bisulfite sequencing analysis. Results The GALR1 promoter was fully or partially methylated in 38 of 72 HNSCC cell lines (52.7%) but not in the majority 18/20 (90.0%) of non-malignant lines. GALR1 methylation was also found in 38/100 (38%) primary tumor specimens. Methylation correlated with decreased GALR1 expression. In tumors methylation was significantly correlated with increased tumor size (P=0.0036), lymph-node status (P=0.0414), tumor stage (P=0.0037), cyclin D1 expression (P=0.0420), and p16 methylation (P=0.0494) and survival (P=0.045). Bisulfite sequencing of 36 CpG sites upstream of the transcription start site revealed that CpG methylation within transcription factor binding sites correlated with complete suppression of GALR1 mRNA. Treatment with TSA and 5-azacytidine restored GALR1 expression. In UM-SCC-23 cells that have total silencing of GALR1, exogenous GALR1 expression and stimulation with galanin suppressed cell proliferation. Conclusions Frequent promoter hypermethylation, gene silencing, association with prognosis, and growth suppression after re-expression support the hypothesis that GALR1 is a tumor suppressor gene in HNSCC. PMID:19047085

  16. Global Epigenetic Changes May Underlie Ethnic Differences and susceptibility to Prostate Cancer

    DTIC Science & Technology

    2012-09-01

    tissues; in the prostate, hypermethylation of the GSTP1 CpG has been detected in PIA lesions [8]. DNA methylation occurs at CpG sites in the human...that the GSTP1 CpG island was frequently hypermethylated in PCa, more than 40 genes have been reported to be targets of DNA hypermethylation-associated...One study demonstrated that GSTP1 hypermethylation was significantly higher in PCa samples from AA men in comparison with EA and Asians [12]. Another

  17. DNA methylation levels at chromosome 8q24 in peripheral blood are associated with 8q24 cancer susceptibility loci.

    PubMed

    Barry, Kathryn Hughes; Moore, Lee E; Sampson, Joshua; Yan, Liying; Meyer, Ann; Oler, Andrew J; Chung, Charles C; Wang, Zhaoming; Yeager, Meredith; Amundadottir, Laufey; Berndt, Sonja I

    2014-12-01

    Chromosome 8q24 has emerged as an important region for genetic susceptibility to various cancers, but little is known about the contribution of DNA methylation at 8q24. To evaluate variability in DNA methylation levels at 8q24 and the relationship with cancer susceptibility single nucleotide polymorphisms (SNPs) in this region, we quantified DNA methylation levels in peripheral blood at 145 CpG sites nearby 8q24 cancer susceptibility SNPs or MYC using pyrosequencing among 80 Caucasian men in the Prostate, Lung, Colorectal, and Ovarian Cancer Screening Trial. For the 60 CpG sites meeting quality control, which also demonstrated temporal stability over a 5-year period, we calculated pairwise Spearman correlations for DNA methylation levels at each CpG site with 42 8q24 cancer susceptibility SNPs. To account for multiple testing, we adjusted P values into q values reflecting the false discovery rate (FDR). In contrast to the MYC CpG sites, most sites nearby the SNPs demonstrated good reproducibility, high methylation levels, and moderate-high between-individual variation. We observed 10 statistically significant (FDR < 0.05) CpG site-SNP correlations. These included correlations between an intergenic CpG site at Chr8:128393157 and the prostate cancer SNP rs16902094 (ρ = -0.54; P = 9.7 × 10(-7); q = 0.002), a PRNCR1 CpG site at Chr8:128167809 and the prostate cancer SNP rs1456315 (ρ = 0.52; P = 1.4 × 10(-6); q = 0.002), and two POU5F1B CpG sites and several prostate/colorectal cancer SNPs (for Chr8:128498051 and rs6983267, ρ = 0.46; P = 2.0 × 10(-5); q = 0.01). This is the first report of correlations between blood DNA methylation levels and cancer susceptibility SNPs at 8q24, suggesting that DNA methylation at this important susceptibility locus may contribute to cancer risk. ©2014 American Association for Cancer Research.

  18. Hydrocarbon pyrolysis reactor experimentation and modeling for the production of solar absorbing carbon nanoparticles

    NASA Astrophysics Data System (ADS)

    Frederickson, Lee Thomas

    Much of combustion research focuses on reducing soot particulates in emissions. However, current research at San Diego State University (SDSU) Combustion and Solar Energy Laboratory (CSEL) is underway to develop a high temperature solar receiver which will utilize carbon nanoparticles as a solar absorption medium. To produce carbon nanoparticles for the small particle heat exchange receiver (SPHER), a lab-scale carbon particle generator (CPG) has been built and tested. The CPG is a heated ceramic tube reactor with a set point wall temperature of 1100-1300°C operating at 5-6 bar pressure. Natural gas and nitrogen are fed to the CPG where natural gas undergoes pyrolysis resulting in carbon particles. The gas-particle mixture is met downstream with dilution air and sent to the lab scale solar receiver. To predict soot yield and general trends in CPG performance, a model has been setup in Reaction Design CHEMKIN-PRO software. One of the primary goals of this research is to accurately measure particle properties. Mean particle diameter, size distribution, and index of refraction are calculated using Scanning Electron Microscopy (SEM) and a Diesel Particulate Scatterometer (DPS). Filter samples taken during experimentation are analyzed to obtain a particle size distribution with SEM images processed in ImageJ software. These results are compared with the DPS, which calculates the particle size distribution and the index of refraction from light scattering using Mie theory. For testing with the lab scale receiver, a particle diameter range of 200-500 nm is desired. Test conditions are varied to understand effects of operating parameters on particle size and the ability to obtain the size range. Analysis of particle loading is the other important metric for this research. Particle loading is measured downstream of the CPG outlet and dilution air mixing point. The air-particle mixture flows through an extinction tube where opacity of the mixture is measured with a 532 nm laser and detector. Beer's law is then used to calculate particle loading. The CPG needs to produce a certain particle loading for a corresponding receiver test. By obtaining the particle loading in the system, the reaction conversion to solid carbon in the CPG can be calculated to measure the efficiency of the CPG. To predict trends in reaction conversion and particle size from experimentation, the CHEMKIN-PRO computer model for the CPG is run for various flow rates and wall temperature profiles. These predictions were a reason for testing at higher wall set point temperatures. Based on these research goals, it was shown that the CPG consistently produces a mean particle diameter of 200-400 nm at the conditions tested, fitting perfectly inside the desired range. This led to successful lab scale SPHER testing which produced a 10-point efficiency increase and 150°C temperature difference with particles present. Also, at 3 g/s dilution air flow rate, an efficiency of 80% at an outlet temperature above 800°C was obtained. Promise was shown at higher CPG experimental temperatures to produce higher reaction conversion, both experimentally and in the model. However, based on wall temperature data taken during experimentation, it is apparent that the CPG needs to have multiple heating zones with separate temperature controllers in order to have an isothermal zone rather than a parabolic temperature profile. As for the computer model, it predicted much higher reaction conversion at higher temperature. The mass fraction of fuel in the inlet stream was shown to not affect conversion while increasing residence time led to increasing conversion. Particle size distribution in the model was far off and showed a bimodal distribution for one of the statistical methods. Using the results from experimentation and modeling, a preliminary CPG design is presented that will operate in a 5MWth receiver system.

  19. Year 2000 (Y2K) computer compliance guide; guidance for FDA personnel. Food and Drug Administration. Notice.

    PubMed

    1999-05-14

    The Food and Drug Administration (FDA) is announcing the availability of a new compliance policy guide (CPG) entitled "Year 2000 (Y2K) Computer Compliance" (section 160-800). This guidance document represents the agency's current thinking on the manufacturing and distribution of domestic and imported products regulated by FDA using computer systems that may not perform properly before, or during, the transition to the year 2000 (Y2K). The text of the CPG is included in this notice. This compliance guidance document is an update to the Compliance Policy Guides Manual (August 1996 edition). It is a new CPG, and it will be included in the next printing of the Compliance Policy Guides Manual. This CPG is intended for FDA personnel, and it is available electronically to the public.

  20. CPG-inspired workspace trajectory generation and adaptive locomotion control for quadruped robots.

    PubMed

    Liu, Chengju; Chen, Qijun; Wang, Danwei

    2011-06-01

    This paper deals with the locomotion control of quadruped robots inspired by the biological concept of central pattern generator (CPG). A control architecture is proposed with a 3-D workspace trajectory generator and a motion engine. The workspace trajectory generator generates adaptive workspace trajectories based on CPGs, and the motion engine realizes joint motion imputes. The proposed architecture is able to generate adaptive workspace trajectories online by tuning the parameters of the CPG network to adapt to various terrains. With feedback information, a quadruped robot can walk through various terrains with adaptive joint control signals. A quadruped platform AIBO is used to validate the proposed locomotion control system. The experimental results confirm the effectiveness of the proposed control architecture. A comparison by experiments shows the superiority of the proposed method against the traditional CPG-joint-space control method.

  1. CPG2 Recruits Endophilin B2 to the Cytoskeleton for Activity-Dependent Endocytosis of Synaptic Glutamate Receptors.

    PubMed

    Loebrich, Sven; Benoit, Marc Robert; Konopka, Jaclyn Aleksandra; Cottrell, Jeffrey Richard; Gibson, Joanne; Nedivi, Elly

    2016-02-08

    Internalization of glutamate receptors at the postsynaptic membrane via clathrin-mediated endocytosis (CME) is a key mechanism for regulating synaptic strength. A role for the F-actin cytoskeleton in CME is well established, and recently, PKA-dependent association of candidate plasticity gene 2 (CPG2) with the spine-cytoskeleton has been shown to mediate synaptic glutamate receptor internalization. Yet, how the endocytic machinery is physically coupled to the actin cytoskeleton to facilitate glutamate receptor internalization has not been demonstrated. Moreover, there has been no distinction of endocytic-machinery components that are specific to activity-dependent versus constitutive glutamate receptor internalization. Here, we show that CPG2, through a direct physical interaction, recruits endophilin B2 (EndoB2) to F-actin, thus anchoring the endocytic machinery to the spine cytoskeleton and facilitating glutamate receptor internalization. Regulation of CPG2 binding to the actin cytoskeleton by protein kinase A directly impacts recruitment of EndoB2 and clathrin. Specific disruption of EndoB2 or the CPG2-EndoB2 interaction impairs activity-dependent, but not constitutive, internalization of both NMDA- and AMPA-type glutamate receptors. These results demonstrate that, through direct interactions with F-actin and EndoB2, CPG2 physically bridges the spine cytoskeleton and the endocytic machinery, and this tripartite association is critical specifically for activity-dependent CME of synaptic glutamate receptors. Copyright © 2016 Elsevier Ltd. All rights reserved.

  2. A distinct group of CpG islands shows differential DNA methylation between replicas of the same cell line in vitro

    PubMed Central

    2013-01-01

    Background CpG dinucleotide-rich genomic DNA regions, known as CpG islands (CGIs), can be methylated at their cytosine residues as an epigenetic mark that is stably inherited during cell mitosis. Differentially methylated regions (DMRs) are genomic regions showing different degrees of DNA methylation in multiple samples. In this study, we focused our attention on CGIs showing different DNA methylation between two culture replicas of the same cell line. Results We used methylation data of 35 cell lines from the Encyclopedia of DNA Elements (ENCODE) consortium to identify CpG islands that were differentially methylated between replicas of the same cell line and denoted them Inter Replicas Differentially Methylated CpG islands (IRDM-CGIs). We identified a group of IRDM-CGIs that was consistently shared by different cell lines, and denoted it common IRDM-CGIs. X chromosome CGIs were overrepresented among common IRDM-CGIs. Autosomal IRDM-CGIs were preferentially located in gene bodies and intergenic regions had a lower G + C content, a smaller mean length, and a reduced CpG percentage. Functional analysis of the genes associated with autosomal IRDM-CGIs showed that many of them are involved in DNA binding and development. Conclusions Our results show that several specific functional and structural features characterize common IRDM-CGIs. They may represent a specific subset of CGIs that are more prone to being differentially methylated for their intrinsic characteristics. PMID:24106769

  3. The role of system Xc- in methamphetamine-induced dopaminergic neurotoxicity in mice.

    PubMed

    Dang, Duy-Khanh; Shin, Eun-Joo; Tran, Hai-Quyen; Kim, Dae-Joong; Jeong, Ji Hoon; Jang, Choon-Gon; Nah, Seung-Yeol; Sato, Hideyo; Nabeshima, Toshitaka; Yoneda, Yukio; Kim, Hyoung-Chun

    2017-09-01

    The cystine/glutamate antiporter (system Xc - , Sxc) transports cystine into cell in exchange for glutamate. Since xCT is a specific subunit of Sxc, we employed xCT knockout mice and investigated whether this antiporter affected methamphetamine (MA)-induced dopaminergic neurotoxicity. MA treatment significantly increased striatal oxidative burdens in wild type mice. xCT inhibitor [i.e., S-4-carboxy-phenylglycine (CPG), sulfasalazine] or an xCT knockout significantly protected against these oxidative burdens. MA-induced increases in Iba-1 expression and Iba-1-labeled microglial immunoreactivity (Iba-1-IR) were significantly attenuated by CPG or sulfasalazine administration or xCT knockout. CPG or sulfasalazine significantly attenuated MA-induced TUNEL-positive cell populations in the striatum of Taconic ICR mice. The decrease in excitatory amino acid transporter-2 (or glutamate transporter-1) expression and increase in glutamate release were attenuated by CPG, sulfasalazine or xCT knockout. In addition, CPG, sulfasalazine or xCT knockout significantly protected against dopaminergic loss (i.e., decreases in tyrosine hydroxylase expression and immunoreactivity, and an increase in dopamine turnover rate) induced by MA. However, CPG, sulfasalazine or xCT knockout did not significantly affect the impaired glutathione system [i.e., decrease in reduced glutathione (GSH) and increase in oxidized glutathione (GSSG)] induced by MA. Our results suggest that Sxc mediates MA-induced neurotoxicity via facilitating oxidative stress, microgliosis, proapoptosis, and glutamate-related toxicity. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. The Cambridge Prognostic Groups for improved prediction of disease mortality at diagnosis in primary non-metastatic prostate cancer: a validation study.

    PubMed

    Gnanapragasam, V J; Bratt, O; Muir, K; Lee, L S; Huang, H H; Stattin, P; Lophatananon, A

    2018-02-28

    The purpose of this study is to validate a new five-tiered prognostic classification system to better discriminate cancer-specific mortality in men diagnosed with primary non-metastatic prostate cancer. We applied a recently described five-strata model, the Cambridge Prognostic Groups (CPGs 1-5), in two international cohorts and tested prognostic performance against the current standard three-strata classification of low-, intermediate- or high-risk disease. Diagnostic clinico-pathological data for men obtained from the Prostate Cancer data Base Sweden (PCBaSe) and the Singapore Health Study were used. The main outcome measure was prostate cancer mortality (PCM) stratified by age group and treatment modality. The PCBaSe cohort included 72,337 men, of whom 7162 died of prostate cancer. The CPG model successfully classified men with different risks of PCM with competing risk regression confirming significant intergroup distinction (p < 0.0001). The CPGs were significantly better at stratified prediction of PCM compared to the current three-tiered system (concordance index (C-index) 0.81 vs. 0.77, p < 0.0001). This superiority was maintained for every age group division (p < 0.0001). Also in the ethnically different Singapore cohort of 2550 men with 142 prostate cancer deaths, the CPG model outperformed the three strata categories (C-index 0.79 vs. 0.76, p < 0.0001). The model also retained superior prognostic discrimination in the treatment sub-groups: radical prostatectomy (n = 20,586), C-index 0.77 vs. 074; radiotherapy (n = 11,872), C-index 0.73 vs. 0.69; and conservative management (n = 14,950), C-index 0.74 vs. 0.73. The CPG groups that sub-divided the old intermediate-risk (CPG2 vs. CPG3) and high-risk categories (CPG4 vs. CPG5) significantly discriminated PCM outcomes after radical therapy or conservative management (p < 0.0001). This validation study of nearly 75,000 men confirms that the CPG five-tiered prognostic model has superior discrimination compared to the three-tiered model in predicting prostate cancer death across different age and treatment groups. Crucially, it identifies distinct sub-groups of men within the old intermediate-risk and high-risk criteria who have very different prognostic outcomes. We therefore propose adoption of the CPG model as a simple-to-use but more accurate prognostic stratification tool to help guide management for men with newly diagnosed prostate cancer.

  5. Stress-related methylation of the catechol-O-methyltransferase Val 158 allele predicts human prefrontal cognition and activity.

    PubMed

    Ursini, Gianluca; Bollati, Valentina; Fazio, Leonardo; Porcelli, Annamaria; Iacovelli, Luisa; Catalani, Assia; Sinibaldi, Lorenzo; Gelao, Barbara; Romano, Raffaella; Rampino, Antonio; Taurisano, Paolo; Mancini, Marina; Di Giorgio, Annabella; Popolizio, Teresa; Baccarelli, Andrea; De Blasi, Antonio; Blasi, Giuseppe; Bertolino, Alessandro

    2011-05-04

    DNA methylation at CpG dinucleotides is associated with gene silencing, stress, and memory. The catechol-O-methyltransferase (COMT) Val(158) allele in rs4680 is associated with differential enzyme activity, stress responsivity, and prefrontal activity during working memory (WM), and it creates a CpG dinucleotide. We report that methylation of the Val(158) allele measured from peripheral blood mononuclear cells (PBMCs) of Val/Val humans is associated negatively with lifetime stress and positively with WM performance; it interacts with stress to modulate prefrontal activity during WM, such that greater stress and lower methylation are related to reduced cortical efficiency; and it is inversely related to mRNA expression and protein levels, potentially explaining the in vivo effects. Finally, methylation of COMT in prefrontal cortex and that in PBMCs of rats are correlated. The relationship of methylation of the COMT Val(158) allele with stress, gene expression, WM performance, and related brain activity suggests that stress-related methylation is associated with silencing of the gene, which partially compensates the physiological role of the high-activity Val allele in prefrontal cognition and activity. Moreover, these results demonstrate how stress-related DNA methylation of specific functional alleles impacts directly on human brain physiology beyond sequence variation.

  6. T cells are influenced by a long non-coding RNA in the autoimmune associated PTPN2 locus.

    PubMed

    Houtman, Miranda; Shchetynsky, Klementy; Chemin, Karine; Hensvold, Aase Haj; Ramsköld, Daniel; Tandre, Karolina; Eloranta, Maija-Leena; Rönnblom, Lars; Uebe, Steffen; Catrina, Anca Irinel; Malmström, Vivianne; Padyukov, Leonid

    2018-06-01

    Non-coding SNPs in the protein tyrosine phosphatase non-receptor type 2 (PTPN2) locus have been linked with several autoimmune diseases, including rheumatoid arthritis, type I diabetes, and inflammatory bowel disease. However, the functional consequences of these SNPs are poorly characterized. Herein, we show in blood cells that SNPs in the PTPN2 locus are highly correlated with DNA methylation levels at four CpG sites downstream of PTPN2 and expression levels of the long non-coding RNA (lncRNA) LINC01882 downstream of these CpG sites. We observed that LINC01882 is mainly expressed in T cells and that anti-CD3/CD28 activated naïve CD4 + T cells downregulate the expression of LINC01882. RNA sequencing analysis of LINC01882 knockdown in Jurkat T cells, using a combination of antisense oligonucleotides and RNA interference, revealed the upregulation of the transcription factor ZEB1 and kinase MAP2K4, both involved in IL-2 regulation. Overall, our data suggests the involvement of LINC01882 in T cell activation and hints towards an auxiliary role of these non-coding SNPs in autoimmunity associated with the PTPN2 locus. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

  7. Genome-wide DNA methylomes from discrete developmental stages reveal the predominance of non-CpG methylation in Tribolium castaneum

    PubMed Central

    Song, Xiaowen; Huang, Fei; Liu, Juanjuan; Li, Chengjun; Gao, Shanshan; Wu, Wei; Zhai, Mengfan; Yu, Xiaojuan; Xiong, Wenfeng; Xie, Jia

    2017-01-01

    Abstract Cytosine DNA methylation is a vital epigenetic regulator of eukaryotic development. Whether this epigenetic modification occurs in Tribolium castaneum has been controversial, its distribution pattern and functions have not been established. Here, using bisulphite sequencing (BS-Seq), we confirmed the existence of DNA methylation and described the methylation profiles of the four life stages of T. castaneum. In the T. castaneum genome, both symmetrical CpG and non-CpG methylcytosines were observed. Symmetrical CpG methylation, which was catalysed by DNMT1 and occupied a small part in T. castaneum methylome, was primarily enriched in gene bodies and was positively correlated with gene expression levels. Asymmetrical non-CpG methylation, which was predominant in the methylome, was strongly concentrated in intergenic regions and introns but absent from exons. Gene body methylation was negatively correlated with gene expression levels. The distribution pattern and functions of this type of methylation were similar only to the methylome of Drosophila melanogaster, which further supports the existence of a novel methyltransferase in the two species responsible for this type of methylation. This first life-cycle methylome of T. castaneum reveals a novel and unique methylation pattern, which will contribute to the further understanding of the variety and functions of DNA methylation in eukaryotes. PMID:28449092

  8. Analysis of DNA methylation in FFPE tissues using the MethyLight technology.

    PubMed

    Dallol, Ashraf; Al-Ali, Waleed; Al-Shaibani, Amina; Al-Mulla, Fahd

    2011-01-01

    Novel biomarkers are sought after by mining DNA extracted from formalin-fixed, paraffin-embedded (FFPE) tissues. Such tissues offer the great advantage of often having complete clinical data (including survival), as well as the tissues are amenable for laser microdissection targeting specific tissue areas. Downstream analysis of such DNA includes mutational screens and methylation profiling. Screening for mutations by sequencing requires a significant amount of DNA for PCR and cycle sequencing. This is self-inhibitory if the gene screened has a large number of exons. Profiling DNA methylation using the MethyLight technology circumvents this problem and allows for the mining of several biomarkers from DNA extracted from a single microscope slide of the tissue of interest. We describe in this chapter a detailed protocol for MethyLight and its use in the determination of CpG Island Methylator Phenotype status in FFPE colorectal cancer samples.

  9. Organization, chromosomal localization and promoter analysis of the gene encoding human acidic fibroblast growth factor intracellular binding protein.

    PubMed Central

    Kolpakova, E; Frengen, E; Stokke, T; Olsnes, S

    2000-01-01

    Acidic fibroblast growth factor (aFGF) intracellular binding protein (FIBP) is a protein found mainly in the nucleus that might be involved in the intracellular function of aFGF. Here we present a comparative analysis of the deduced amino acid sequences of human, murine and Drosophila FIBP analogues and demonstrate that FIBP is an evolutionarily conserved protein. The human gene spans more than 5 kb, comprising ten exons and nine introns, and maps to chromosome 11q13.1. Two slightly different splice variants found in different tissues were isolated and characterized. Sequence analysis of the region surrounding the translation start revealed a CpG island, a classical feature of widely expressed genes. Functional studies of the promoter region with a luciferase reporter system suggested a strong transcriptional activity residing within 600 bp of the 5' flanking region. PMID:11104667

  10. X-derived marker chromosome in patient with mosaic Turner syndrome and Dandy-Walker syndrome: a case report.

    PubMed

    Telepova, Alena S; Romanenko, Svetlana A; Lemskaya, Natalya A; Maksimova, Yulia V; Shorina, Asia R; Yudkin, Dmitry V

    2017-01-01

    Small supernumerary marker chromosomes can be derived from autosomes and sex chromosomes and can accompany chromosome pathologies, such as Turner syndrome. Here, we present a case report of a patient with mosaic Turner syndrome and Dandy-Walker syndrome carrying a marker chromosome. We showed the presence of the marker chromosome in 33.8% of blood cells. FISH of the probe derived from the marker chromosome by microdissection revealed that it originated from the centromeric region of chromosome X. Additionally, we showed no telomeric sequences and no XIST sequence in the marker chromosome. This is the first report of these two syndromes accompanied by the presence of a marker chromosome. Marker chromosome was X-derived and originated from centromeric region. Patient has mild symptoms but there is no XIST gene in marker chromosome. CPG137. Registered 03 March 2017.

  11. Alu repeated DNAs are differentially methylated in primate germ cells.

    PubMed Central

    Rubin, C M; VandeVoort, C A; Teplitz, R L; Schmid, C W

    1994-01-01

    A significant fraction of Alu repeats in human sperm DNA, previously found to be unmethylated, is nearly completely methylated in DNA from many somatic tissues. A similar fraction of unmethylated Alus is observed here in sperm DNA from rhesus monkey. However, Alus are almost completely methylated at the restriction sites tested in monkey follicular oocyte DNA. The Alu methylation patterns in mature male and female monkey germ cells are consistent with Alu methylation in human germ cell tumors. Alu sequences are hypomethylated in seminoma DNAs and more methylated in a human ovarian dysgerminoma. These results contrast with methylation patterns reported for germ cell single-copy, CpG island, satellite, and L1 sequences. The function of Alu repeats is not known, but differential methylation of Alu repeats in the male and female germ lines suggests that they may serve as markers for genomic imprinting or in maintaining differences in male and female meiosis. Images PMID:7800508

  12. Epigenetics in Prostate Cancer

    PubMed Central

    Albany, Costantine; Alva, Ajjai S.; Aparicio, Ana M.; Singal, Rakesh; Yellapragada, Sarvari; Sonpavde, Guru; Hahn, Noah M.

    2011-01-01

    Prostate cancer (PC) is the most commonly diagnosed nonskin malignancy and the second most common cause of cancer death among men in the United States. Epigenetics is the study of heritable changes in gene expression caused by mechanisms other than changes in the underlying DNA sequences. Two common epigenetic mechanisms, DNA methylation and histone modification, have demonstrated critical roles in prostate cancer growth and metastasis. DNA hypermethylation of cytosine-guanine (CpG) rich sequence islands within gene promoter regions is widespread during neoplastic transformation of prostate cells, suggesting that treatment-induced restoration of a “normal” epigenome could be clinically beneficial. Histone modification leads to altered tumor gene function by changing chromosome structure and the level of gene transcription. The reversibility of epigenetic aberrations and restoration of tumor suppression gene function have made them attractive targets for prostate cancer treatment with modulators that demethylate DNA and inhibit histone deacetylases. PMID:22191037

  13. Epigenetics in prostate cancer.

    PubMed

    Albany, Costantine; Alva, Ajjai S; Aparicio, Ana M; Singal, Rakesh; Yellapragada, Sarvari; Sonpavde, Guru; Hahn, Noah M

    2011-01-01

    Prostate cancer (PC) is the most commonly diagnosed nonskin malignancy and the second most common cause of cancer death among men in the United States. Epigenetics is the study of heritable changes in gene expression caused by mechanisms other than changes in the underlying DNA sequences. Two common epigenetic mechanisms, DNA methylation and histone modification, have demonstrated critical roles in prostate cancer growth and metastasis. DNA hypermethylation of cytosine-guanine (CpG) rich sequence islands within gene promoter regions is widespread during neoplastic transformation of prostate cells, suggesting that treatment-induced restoration of a "normal" epigenome could be clinically beneficial. Histone modification leads to altered tumor gene function by changing chromosome structure and the level of gene transcription. The reversibility of epigenetic aberrations and restoration of tumor suppression gene function have made them attractive targets for prostate cancer treatment with modulators that demethylate DNA and inhibit histone deacetylases.

  14. Decreased interferon-α production in response to CpG DNA dysregulates cytokine responses in patients with multiple sclerosis.

    PubMed

    Hirotani, Makoto; Niino, Masaaki; Fukazawa, Toshiyuki; Yaguchi, Hiroaki; Nakamura, Masakazu; Kikuchi, Seiji; Sasaki, Hidenao

    2012-05-01

    Type I interferons (IFNs), represented by IFN-α and β, activate immune effector cells belonging to the innate and adaptive immune systems. Plasmacytoid dendritic cells (pDCs) produce IFN-α in response to CpG DNA. We aimed to examine the impact of pDC-produced IFN-α on the adaptive immune system in Multiple Sclerosis (MS). Our results demonstrated that CpG DNA-induced IFN-α production was significantly decreased in PBMCs from MS patients. Decreased levels of IL-12 p70, IFN-γ, and IL-17 and increased level of IL-10 were found in CpG DNA-treated PBMCs of healthy subjects unlike in those from MS patients. In samples pre-treated with IFN-α and IFN-β, decreased levels of IL-12 p70, IFN-γ, and IL-17 and increased level of IL-10 were detected in PBMCs from MS patients. These results suggest that CpG DNA-induced decreased IFN-α production causes pro-inflammatory cytokine secretion, and either IFN-α or IFN-β induces anti-inflammatory cytokine secretion in the adaptive immune system in MS. Copyright © 2012 Elsevier Inc. All rights reserved.

  15. Simulation design of high reverse blocking high-K/low-K compound passivation AlGaN/GaN Schottky barrier diode with gated edge termination

    NASA Astrophysics Data System (ADS)

    Bai, Zhiyuan; Du, Jiangfeng; Xin, Qi; Li, Ruonan; Yu, Qi

    2017-11-01

    In this paper, a novel high-K/low-K compound passivation AlGaN/GaN Schottky Barrier Diode (CPG-SBD) is proposed to improve the off-state characteristics of AlGaN/GaN schottky barrier diode with gated edge termination (GET-SBD) by adding low-K blocks in to the high-K passivation layer. The reverse leakage current of CPG-SBD can be reduced to 1.6 nA/mm by reducing the thickness of high-K dielectric under GET region to 5 nm, while the forward voltage and on-state resistance keep 1 V and 3.8 Ω mm, respectively. Breakdown voltage of CPG-SBDs can be improved by inducing discontinuity of the electric field at the high-K/low-K interface. The breakdown voltage of the optimized CPG-SBD with 4 blocks of low-K can reach 1084 V with anode to cathode distance of 5 μm yielding a high FOM of 5.9 GW/cm2. From the C-V simulation results, CPG-SBDs induce no parasitic capacitance by comparison of the GET-SBDs.

  16. Hypermethylation of brain natriuretic peptide gene is associated with the risk of rheumatic heart disease

    PubMed Central

    Li, Ni; Zheng, Dawei; Sun, Lebo; Shi, Huoshun; Zhu, Xiuying; Xu, Guodong; Wang, Qinning; Zhu, Caimin

    2016-01-01

    To investigate the contribution of brain natriuretic peptide (BNP) promoter DNA methylation to the risk of rheumatic heart disease (RHD) and the influence of warfarin anticoagulant therapy on BNP methylation levels for RHD patients after surgery. BNP methylation levels were determined by bisulfite pyrosequencing from plasma samples of RHD patients compared with healthy controls. Several factors influencing the RHD patients were included like age, smoking and cholesterol levels. A fragment of five CG sites (CpG1–5) in the promoter region of BNP gene was measured. BNP gene hypermethylation was found in CpG4 and CpG5 in RHD patients compared with non-RHD controls. A significant difference was also observed between RHD patients with long-term administration of warfarin and RHD patients who had recently undergone an operation. Moreover, single CpG4 and CpG5 analysis revealed a significant increase in methylation levels in men. BNP gene body hypermethylation is associated with the risk of RHD, and also influenced by the warfarin anticoagulant therapy of RHD patients after surgery, which could represent novel and promising targets for therapeutic development. PMID:27920275

  17. Retention of the Native Epigenome in Purified Mammalian Chromatin

    PubMed Central

    Ehrensberger, Andreas H.; Franchini, Don-Marc; East, Philip; George, Roger; Matthews, Nik; Maslen, Sarah L.; Svejstrup, Jesper Q.

    2015-01-01

    A protocol is presented for the isolation of native mammalian chromatin as fibers of 25–250 nucleosomes under conditions that preserve the natural epigenetic signature. The material is composed almost exclusively of histones and DNA and conforms to the structure expected by electron microscopy. All sequences probed for were retained, indicating that the material is representative of the majority of the genome. DNA methylation marks and histone marks resembled the patterns observed in vivo. Importantly, nucleosome positions also remained largely unchanged, except on CpG islands, where nucleosomes were found to be unstable. The technical challenges of reconstituting biochemical reactions with native mammalian chromatin are discussed. PMID:26248330

  18. Genome-Wide Assessment of Differential DNA Methylation Associated with Autoantibody Production in Systemic Lupus Erythematosus.

    PubMed

    Chung, Sharon A; Nititham, Joanne; Elboudwarej, Emon; Quach, Hong L; Taylor, Kimberly E; Barcellos, Lisa F; Criswell, Lindsey A

    2015-01-01

    Systemic lupus erythematosus (SLE) is characterized by the development of autoantibodies associated with specific clinical manifestations. Previous studies have shown an association between differential DNA methylation and SLE susceptibility, but have not investigated SLE-related autoantibodies. Our goal was to determine whether DNA methylation is associated with production of clinically relevant SLE-related autoantibodies, with an emphasis on the anti-dsDNA autoantibody. In this study, we characterized the methylation status of 467,314 CpG sites in 326 women with SLE. Using a discovery and replication study design, we identified and replicated significant associations between anti-dsDNA autoantibody production and the methylation status of 16 CpG sites (pdiscovery<1.07E-07 and preplication<0.0029) in 11 genes. Associations were further investigated using multivariable regression to adjust for estimated leukocyte cell proportions and population substructure. The adjusted mean DNA methylation difference between anti-dsDNA positive and negative cases ranged from 1.2% to 19%, and the adjusted odds ratio for anti-dsDNA autoantibody production comparing the lowest and highest methylation tertiles ranged from 6.8 to 18.2. Differential methylation for these CpG sites was also associated with anti-SSA, anti-Sm, and anti-RNP autoantibody production. Overall, associated CpG sites were hypomethylated in autoantibody positive compared to autoantibody negative cases. Differential methylation of CpG sites within the major histocompatibility region was not strongly associated with autoantibody production. Genes with differentially methylated CpG sites represent multiple biologic pathways, and have not been associated with autoantibody production in genetic association studies. In conclusion, hypomethylation of CpG sites within genes from different pathways is associated with anti-dsDNA, anti-SSA, anti-Sm, and anti-RNP production in SLE, and these associations are not explained by genetic variation. Thus, studies of epigenetic mechanisms such as DNA methylation represent a complementary method to genetic association studies to identify biologic pathways that may contribute to the clinical heterogeneity of autoimmune diseases.

  19. Asymmetric Operation of the Locomotor Central Pattern Generator in the Neonatal Mouse Spinal Cord

    PubMed Central

    Endo, Toshiaki; Kiehn, Ole

    2008-01-01

    The rhythmic voltage oscillations in motor neurons (MNs) during locomotor movements reflect the operation of the pre-MN central pattern generator (CPG) network. Recordings from MNs can thus be used as a method to deduct the organization of CPGs. Here, we use continuous conductance measurements and decomposition methods to quantitatively assess the weighting and phase tuning of synaptic inputs to different flexor and extensor MNs during locomotor-like activity in the isolated neonatal mice lumbar spinal cord preparation. Whole cell recordings were obtained from 22 flexor and 18 extensor MNs in rostral and caudal lumbar segments. In all flexor and the large majority of extensor MNs the extracted excitatory and inhibitory synaptic conductances alternate but with a predominance of inhibitory conductances, most pronounced in extensors. These conductance changes are consistent with a “push–pull” operation of locomotor CPG. The extracted excitatory and inhibitory synaptic conductances varied between 2 and 56% of the mean total conductance. Analysis of the phase tuning of the extracted synaptic conductances in flexor and extensor MNs in the rostral lumbar cord showed that the flexor-phase–related synaptic conductance changes have sharper locomotor-phase tuning than the extensor-phase–related conductances, suggesting a modular organization of premotor CPG networks consisting of reciprocally coupled, but differently composed, flexor and extensor CPG networks. There was a clear difference between phase tuning in rostral and caudal MNs, suggesting a distinct operation of CPG networks in different lumbar segments. The highly asymmetric features were preserved throughout all ranges of locomotor frequencies investigated and with different combinations of locomotor-inducing drugs. The asymmetric nature of CPG operation and phase tuning of the conductance profiles provide important clues to the organization of the rodent locomotor CPG and are compatible with a multilayered and distributed structure of the network. PMID:18829847

  20. Design and pilot evaluation of a system to develop computer-based site-specific practice guidelines from decision models.

    PubMed

    Sanders, G D; Nease, R F; Owens, D K

    2000-01-01

    Local tailoring of clinical practice guidelines (CPGs) requires experts in medicine and evidence synthesis unavailable in many practice settings. The authors' computer-based system enables developers and users to create, disseminate, and tailor CPGs, using normative decision models (DMs). ALCHEMIST, a web-based system, analyzes a DM, creates a CPG in the form of an annotated algorithm, and displays for the guideline user the optimal strategy. ALCHEMIST'S interface enables remote users to tailor the guideline by changing underlying input variables and observing the new annotated algorithm that is developed automatically. In a pilot evaluation of the system, a DM was used to evaluate strategies for staging non-small-cell lung cancer. Subjects (n = 15) compared the automatically created CPG with published guidelines for this staging and critiqued both using a previously developed instrument to rate the CPGs' usability, accountability, and accuracy on a scale of 0 (worst) to 2 (best), with higher scores reflecting higher quality. The mean overall score for the ALCHEMIST CPG was 1.502, compared with the published-CPG score of 0.987 (p = 0.002). The ALCHEMIST CPG scores for usability, accountability, and accuracy were 1.683, 1.393, and 1.430, respectively; the published CPG scores were 1.192, 0.941, and 0.830 (each comparison p < 0.05). On a scale of 1 (worst) to 5 (best), users' mean ratings of ALCHEMIST'S ease of use, usefulness of content, and presentation format were 4.76, 3.98, and 4.64, respectively. The results demonstrate the feasibility of a web-based system that automatically analyzes a DM and creates a CPG as an annotated algorithm, enabling remote users to develop site-specific CPGs. In the pilot evaluation, the ALCHEMIST guidelines met established criteria for quality and compared favorably with national CPGs. The high usability and usefulness ratings suggest that such systems can be a good tool for guideline development.

  1. DNA Methylation at the DAT Promoter and Risk for Psychopathology: Intergenerational Transmission between School-Age Youths and Their Parents in a Community Sample.

    PubMed

    Cimino, Silvia; Cerniglia, Luca; Ballarotto, Giulia; Marzilli, Eleonora; Pascale, Esterina; D'Addario, Claudio; Adriani, Walter; Tambelli, Renata

    2017-01-01

    The effect of gene polymorphisms and promoter methylation, associated with maladaptive developmental outcomes, vary depending on environmental factors (e.g., parental psychopathology). Most studies have focused on 0- to 5-year-old children, adolescents, or adults, whereas there is dearth of research on school-age youths and pre-adolescents. In a sample of 21 families recruited at schools, we addressed parents' psychopathological symptoms (through SCL-90-R); offspring emotional-behavioral functioning (through CBCL-6-18); dopamine transporter gene (DAT1) for epigenetic status of the 5'-untranslated region (UTR) and for genotype, i.e., variable number of tandem repeats polymorphism at the 3'-UTR. Possible associations were explored between bio-genetic and psychological characteristics within the same individual and between triplets of children, mothers, and fathers. DAT methylation of CpG at positions M1, M6, and M7 in mothers was correlated with maternal (phobic) anxiety, whereas in fathers' position M6 was related to paternal depression, anxiety, hostility, psychoticism, and higher Global Severity Index (GSI). No significant correlations were found between maternal and offspring DAT methylation. Significant correlations were found between fathers' methylation at CpG M1 and children's methylation at CpG M6. Linear regressions showed that mothers and fathers' GSI predicted children's methylation at CpG sites M2, M3, and M6, whereas fathers' GSI predicted children's methylation at CpG sites, particularly M1, M2, and M6. Moreover, offspring methylation of DAT at CpG M2 predicted somatic complaint, internalizing and attention problems; methylation of DAT at CpG M6 predicted withdraw. This study may have important clinical implication for the prevention and treatment of emotional-behavioral difficulties in children, as it adds to previous knowledge about the role of genetic and environmental factors in predicting psychopathological symptoms within non-clinical populations.

  2. Production and quality of clinical practice guidelines in Argentina (1994–2004): a cross-sectional study

    PubMed Central

    Esandi, María Eugenia; Ortiz, Zulma; Chapman, Evelina; Dieguez, Marcelo García; Mejía, Raúl; Bernztein, Ricardo

    2008-01-01

    Background In the last decades, a sustained increment of Clinical Practice Guidelines (CPG) production in the world has been accompanied by a growing concern about their quality. Many studies related to quality assessment of guidelines produced in High Income Countries were published; however, evidence on this topic is scarce in Low and Middle Income Countries (LMIC). The objectives of this research were: a) to describe guideline production in Argentina at different levels of the health system (macro, meso and micro) from 1994 to 2004; and b) to assess their quality by using the AGREE instrument. Methods A cross-sectional study was undertaken to describe guidelines production in Argentina between 1994 and 2004. CPG were identified through Internet and electronic databases (MEDLINE and LILACS). Explicit inclusion and exclusion criteria were used to select guidelines. Each CPG was independently assessed by two reviewers using the AGREE instrument. Domain scores were calculated as recommended by the AGREE Collaboration. The internal consistency of each domain was evaluated using Cronbach's alpha and inter-observer agreement by the Intraclass Correlation Coefficient (ICC). Results A total amount of 431 potential CPG were identified, but only 144 were considered CPG. At the end, 101 CPG were included for further assessment. Median standardized score for each domain were: scope = 39%; stakeholder involvement = 13%; rigour of development = 10%; clarity = 42%; applicability = 6%; editorial independence = 0%. Only 22 CPG were recommended with modifications by both appraisers. ICC and Cronbach's alpha for each domain were in all cases moderate or high (greater than 0.40), except for editorial independence. Conclusion This study has systematically employed the AGREE instrument for the critical assessment of guidelines produced in a LMIC. Guideline development and diffusion in Argentina from 1994 to 2004 shows a constant increment, although quality of reporting did not improve; moreover, in some aspects it seemed to decline. Much room for improvement of the guideline development process was found at all levels of the health system. PMID:18851739

  3. Immunization of Aged Pigs with Attenuated Pseudorabies Virus Vaccine Combined with CpG Oligodeoxynucleotide Restores Defective Th1 Immune Responses

    PubMed Central

    Chu, Pinpin; Ma, Miaopeng; Shi, Juqing; Cai, Haiming; Huang, Chaoyuan; Li, Huazhou; Jiang, Zhenggu; Wang, Houguang; Wang, Weifang; Zhang, Shuiqing; Zhang, Linghua

    2013-01-01

    Background and Aims Attempts to immunize aged subjects often result in the failure to elicit a protective immune response. Murine model studies have shown that oligonucleotides containing CpG motifs (CpG ODN) can stimulate immune system in aged mice as effectively as in young mice. Since many physiological and pathophysiological data of pigs can be transferred to humans, research in pigs is important to confirm murine data. Here we investigated whether immunization of aged pig model with attenuated pseudorabies virus vaccine (PRV vaccine) formulated with CpG ODN could promote a successful development of immune responses that were comparable to those induced in young pigs in a similar manner. Methodology Young and aged pigs were immunized IM with PRV vaccine alone, or in combination with CpG ODN respectively. At days 3, 7, 14 post immunization sera were assayed by ELISA for IgG titres, at day 7 for IgG1 and IgG2 subtypes titres. All blood samples collected in evacuated test tubes with K-EDTA at day 7 were analyzed for flow cytometer assay. Blood samples at day 7 collected in evacuated test tubes with heparin were analysed for antigen-specific cytokines production and peripheral blood mononuclear cells (PBMCs) proliferative responses. Results CpG ODN could enhance Th1 responses (PRV-specific IgG2/IgG1 ratio, proliferative responses, Th1 cytokines production) when used as an adjuvant for the vaccination of aged pigs, which were correlated with enhanced CD4+ T cells percentage, decreased CD4+CD8+CD45RO+ T cells percentage and improved PRV-specific CD4+ T cells activation. Conclusions Our results demonstrate a utility for CpG ODN, as a safe vaccine adjuvant for promoting effective systemic immune responses in aged pig model. This agent could have important clinical uses in overcoming some of age-associated depressions in immune function that occur in response to vaccination. PMID:23785433

  4. Automating Guidelines for Clinical Decision Support: Knowledge Engineering and Implementation.

    PubMed

    Tso, Geoffrey J; Tu, Samson W; Oshiro, Connie; Martins, Susana; Ashcraft, Michael; Yuen, Kaeli W; Wang, Dan; Robinson, Amy; Heidenreich, Paul A; Goldstein, Mary K

    2016-01-01

    As utilization of clinical decision support (CDS) increases, it is important to continue the development and refinement of methods to accurately translate the intention of clinical practice guidelines (CPG) into a computable form. In this study, we validate and extend the 13 steps that Shiffman et al. 5 identified for translating CPG knowledge for use in CDS. During an implementation project of ATHENA-CDS, we encoded complex CPG recommendations for five common chronic conditions for integration into an existing clinical dashboard. Major decisions made during the implementation process were recorded and categorized according to the 13 steps. During the implementation period, we categorized 119 decisions and identified 8 new categories required to complete the project. We provide details on an updated model that outlines all of the steps used to translate CPG knowledge into a CDS integrated with existing health information technology.

  5. Neonatal testosterone suppresses a neuroendocrine pulse generator required for reproduction

    NASA Astrophysics Data System (ADS)

    Israel, Jean-Marc; Cabelguen, Jean-Marie; Le Masson, Gwendal; Oliet, Stéphane H.; Ciofi, Philippe

    2014-02-01

    The pituitary gland releases hormones in a pulsatile fashion guaranteeing signalling efficiency. The determinants of pulsatility are poorly circumscribed. Here we show in magnocellular hypothalamo-neurohypophyseal oxytocin (OT) neurons that the bursting activity underlying the neurohormonal pulses necessary for parturition and the milk-ejection reflex is entirely driven by a female-specific central pattern generator (CPG). Surprisingly, this CPG is active in both male and female neonates, but is inactivated in males after the first week of life. CPG activity can be restored in males by orchidectomy or silenced in females by exogenous testosterone. This steroid effect is aromatase and caspase dependent, and is mediated via oestrogen receptor-α. This indicates the apoptosis of the CPG network during hypothalamic sexual differentiation, explaining why OT neurons do not burst in adult males. This supports the view that stereotypic neuroendocrine pulsatility is governed by CPGs, some of which are subjected to gender-specific perinatal programming.

  6. Output variability across animals and levels in a motor system

    PubMed Central

    Norris, Brian J; Günay, Cengiz; Kueh, Daniel

    2018-01-01

    Rhythmic behaviors vary across individuals. We investigated the sources of this output variability across a motor system, from the central pattern generator (CPG) to the motor plant. In the bilaterally symmetric leech heartbeat system, the CPG orchestrates two coordinations in the bilateral hearts with different intersegmental phase relations (Δϕ) and periodic side-to-side switches. Population variability is large. We show that the system is precise within a coordination, that differences in repetitions of a coordination contribute little to population output variability, but that differences between bilaterally homologous cells may contribute to some of this variability. Nevertheless, much output variability is likely associated with genetic and life history differences among individuals. Variability of Δϕ were coordination-specific: similar at all levels in one, but significantly lower for the motor pattern than the CPG pattern in the other. Mechanisms that transform CPG output to motor neurons may limit output variability in the motor pattern. PMID:29345614

  7. Prenatal arsenic exposure and the epigenome: identifying sites of 5-methylcytosine alterations that predict functional changes in gene expression in newborn cord blood and subsequent birth outcomes.

    PubMed

    Rojas, Daniel; Rager, Julia E; Smeester, Lisa; Bailey, Kathryn A; Drobná, Zuzana; Rubio-Andrade, Marisela; Stýblo, Miroslav; García-Vargas, Gonzalo; Fry, Rebecca C

    2015-01-01

    Prenatal exposure to inorganic arsenic (iAs) is detrimental to the health of newborns and increases the risk of disease development later in life. Here we examined a subset of newborn cord blood leukocyte samples collected from subjects enrolled in the Biomarkers of Exposure to ARsenic (BEAR) pregnancy cohort in Gómez Palacio, Mexico, who were exposed to a range of drinking water arsenic concentrations (0.456-236 µg/l). Changes in iAs-associated DNA 5-methylcytosine methylation were assessed across 424,935 CpG sites representing 18,761 genes and compared with corresponding mRNA expression levels and birth outcomes. In the context of arsenic exposure, a total of 2919 genes were identified with iAs-associated differences in DNA methylation. Site-specific analyses identified DNA methylation changes that were most predictive of gene expression levels where CpG methylation within CpG islands positioned within the first exon, the 5' untranslated region and 200 bp upstream of the transcription start site yielded the most significant association with gene expression levels. A set of 16 genes was identified with correlated iAs-associated changes in DNA methylation and mRNA expression and all were highly enriched for binding sites of the early growth response (EGR) and CCCTC-binding factor (CTCF) transcription factors. Furthermore, DNA methylation levels of 7 of these genes were associated with differences in birth outcomes including gestational age and head circumference.These data highlight the complex interplay between DNA methylation, functional changes in gene expression and health outcomes and underscore the need for functional analyses coupled to epigenetic assessments. © The Author 2014. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  8. MGMT methylation analysis of glioblastoma on the Infinium methylation BeadChip identifies two distinct CpG regions associated with gene silencing and outcome, yielding a prediction model for comparisons across datasets, tumor grades, and CIMP-status.

    PubMed

    Bady, Pierre; Sciuscio, Davide; Diserens, Annie-Claire; Bloch, Jocelyne; van den Bent, Martin J; Marosi, Christine; Dietrich, Pierre-Yves; Weller, Michael; Mariani, Luigi; Heppner, Frank L; Mcdonald, David R; Lacombe, Denis; Stupp, Roger; Delorenzi, Mauro; Hegi, Monika E

    2012-10-01

    The methylation status of the O(6)-methylguanine-DNA methyltransferase (MGMT) gene is an important predictive biomarker for benefit from alkylating agent therapy in glioblastoma. Recent studies in anaplastic glioma suggest a prognostic value for MGMT methylation. Investigation of pathogenetic and epigenetic features of this intriguingly distinct behavior requires accurate MGMT classification to assess high throughput molecular databases. Promoter methylation-mediated gene silencing is strongly dependent on the location of the methylated CpGs, complicating classification. Using the HumanMethylation450 (HM-450K) BeadChip interrogating 176 CpGs annotated for the MGMT gene, with 14 located in the promoter, two distinct regions in the CpG island of the promoter were identified with high importance for gene silencing and outcome prediction. A logistic regression model (MGMT-STP27) comprising probes cg12434587 [corrected] and cg12981137 provided good classification properties and prognostic value (kappa = 0.85; log-rank p < 0.001) using a training-set of 63 glioblastomas from homogenously treated patients, for whom MGMT methylation was previously shown to be predictive for outcome based on classification by methylation-specific PCR. MGMT-STP27 was successfully validated in an independent cohort of chemo-radiotherapy-treated glioblastoma patients (n = 50; kappa = 0.88; outcome, log-rank p < 0.001). Lower prevalence of MGMT methylation among CpG island methylator phenotype (CIMP) positive tumors was found in glioblastomas from The Cancer Genome Atlas than in low grade and anaplastic glioma cohorts, while in CIMP-negative gliomas MGMT was classified as methylated in approximately 50 % regardless of tumor grade. The proposed MGMT-STP27 prediction model allows mining of datasets derived on the HM-450K or HM-27K BeadChip to explore effects of distinct epigenetic context of MGMT methylation suspected to modulate treatment resistance in different tumor types.

  9. Co-delivery of Dual Toll-Like Receptor Agonists and Antigen in Poly(Lactic-Co-Glycolic) Acid/Polyethylenimine Cationic Hybrid Nanoparticles Promote Efficient In Vivo Immune Responses.

    PubMed

    Ebrahimian, Mahboubeh; Hashemi, Maryam; Maleki, Mohsen; Hashemitabar, Gholamreza; Abnous, Khalil; Ramezani, Mohammad; Haghparast, Alireza

    2017-01-01

    Strategies to design delivery vehicles are critical in modern vaccine-adjuvant development. Nanoparticles (NPs) encapsulating antigen(s) and adjuvant(s) are promising vehicles to deliver antigen(s) and adjuvant(s) to antigen-presenting cells (APCs), allowing optimal immune responses against a specific pathogen. In this study, we developed a novel adjuvant delivery approach for induction of efficient in vivo immune responses. Polyethylenimine (PEI) was physically conjugated to poly(lactic-co-glycolic) acid (PLGA) to form PLGA/PEI NPs. This complex was encapsulated with resiquimod (R848) as toll-like receptor (TLR) 7/8 agonist, or monophosphoryl lipid A (MPLA) as TLR4 agonist and co-assembled with cytosine-phosphorothioate-guanine oligodeoxynucleotide (CpG ODN) as TLR9 agonist to form a tripartite formulation [two TLR agonists (inside and outside NPs) and PLGA/PEI NPs as delivery system]. The physicochemical characteristics, cytotoxicity and cellular uptake of these synthesized delivery vehicles were investigated. Cellular viability test revealed no pronounced cytotoxicity as well as increased cellular uptake compared to control groups in murine macrophage cells (J774 cell line). In the next step, PLGA (MPLA or R848)/PEI (CpG ODN) were co-delivered with ovalbumin (OVA) encapsulated into PLGA NPs to enhance the induction of immune responses. The immunogenicity properties of these co-delivery formulations were examined in vivo by evaluating the cytokine (IFN-γ, IL-4, and IL-1β) secretion and antibody (IgG1, IgG2a) production. Robust and efficient immune responses were achieved after in vivo administration of PLGA (MPLA or R848)/PEI (CpG ODN) co-delivered with OVA encapsulated in PLGA NPs in BALB/c mice. Our results demonstrate a rational design of using dual TLR agonists in a context-dependent manner for efficient nanoparticulate adjuvant-vaccine development.

  10. Monoamine Oxidase A Gene Methylation and Its Role in Posttraumatic Stress Disorder: First Evidence from the South Eastern Europe (SEE)-PTSD Study

    PubMed Central

    Ziegler, Christiane; Wolf, Christiane; Schiele, Miriam A; Feric Bojic, Elma; Kucukalic, Sabina; Sabic Dzananovic, Emina; Goci Uka, Aferdita; Hoxha, Blerina; Haxhibeqiri, Valdete; Haxhibeqiri, Shpend; Kravic, Nermina; Muminovic Umihanic, Mirnesa; Cima Franc, Ana; Jaksic, Nenad; Babic, Romana; Pavlovic, Marko; Warrings, Bodo; Bravo Mehmedbasic, Alma; Rudan, Dusko; Aukst-Margetic, Branka; Kucukalic, Abdulah; Marjanovic, Damir; Babic, Dragan; Bozina, Nada; Jakovljevic, Miro; Sinanovic, Osman; Avdibegovic, Esmina; Agani, Ferid; Dzubur-Kulenovic, Alma; Deckert, Jürgen; Domschke, Katharina

    2018-01-01

    Abstract Background Posttraumatic stress disorder is characterized by an overactive noradrenergic system conferring core posttraumatic stress disorder symptoms such as hyperarousal and reexperiencing. Monoamine oxidase A is one of the key enzymes mediating the turnover of noradrenaline. Here, DNA methylation of the monoamine oxidase A gene exonI/intronI region was investigated for the first time regarding its role in posttraumatic stress disorder risk and severity. Methods Monoamine oxidase A methylation was analyzed via direct sequencing of sodium bisulfite-treated DNA extracted from blood cells in a total sample of N=652 (441 male) patients with current posttraumatic stress disorder, patients with remitted posttraumatic stress disorder, and healthy probands (comparison group) recruited at 5 centers in Bosnia-Herzegovina, Croatia, and the Republic of Kosovo. Posttraumatic stress disorder severity was measured by means of the Clinician-Administered Posttraumatic Stress Disorder Scale and its respective subscores representing distinct symptom clusters. Results In the male, but not the female sample, patients with current posttraumatic stress disorder displayed hypermethylation of 3 CpGs (CpG3=43656362; CpG12=43656514; CpG13=43656553, GRCh38.p2 Assembly) as compared with remitted Posttraumatic Stress Disorder patients and healthy probands. Symptom severity (Clinician-Administered Posttraumatic Stress Disorder Scale scores) in male patients with current posttraumatic stress disorder significantly correlated with monoamine oxidase A methylation. This applied particularly to symptom clusters related to reexperiencing of trauma (cluster B) and hyperarousal (cluster D). Conclusions The present findings suggest monoamine oxidase A gene hypermethylation, potentially resulting in enhanced noradrenergic signalling, as a disease status and severity marker of current posttraumatic stress disorder in males. If replicated, monoamine oxidase A hypermethylation might serve as a surrogate marker of a hyperadrenergic subtype of posttraumatic stress disorder guiding personalized treatment decisions on the use of antiadrenergic agents. PMID:29186431

  11. NOVEL EPIGENETIC CHANGES IN CDKN2A ARE ASSOCIATED WITH PROGRESSION OF CERVICAL INTRAEPITHELIAL NEOPLASIA

    PubMed Central

    Wijetunga, N. Ari; Belbin, Thomas J.; Burk, Robert D.; Whitney, Kathleen; Abadi, Maria; Greally, John M.; Einstein, Mark H.; Schlecht, Nicolas F.

    2016-01-01

    Objective To conduct a comprehensive mapping of the genomic DNA methylation in CDKN2A, which codes for the p16INK4A and p14ARF proteins, and 14 of the most promising DNA methylation marker candidates previously reported to be associated with progression of low-grade cervical intraepithelial neoplasia (CIN1) to cervical cancer. Methods We analyzed DNA methylation in 68 HIV-seropositive and negative women with incident CIN1, CIN2, CIN3 and invasive cervical cancer, assaying 120 CpG dinucleotide sites spanning APC, CDH1, CDH13, CDKN2A, CDKN2B, DAPK1, FHIT, GSTP1, HIC1, MGMT, MLH1, RARB, RASSF1, TERT and TIMP3 using the Illumina Infinium array. Validation was performed using high resolution mapping of the target genes with HELP-tagging for 286 CpGs, followed by fine mapping of candidate genes with targeted bisulfite sequencing. We assessed for statistical differences in DNA methylation levels for each CpG loci assayed using univariate and multivariate methods correcting for multiple comparisons. Results In our discovery sample set, we identified dose dependent differences in DNA methylation with grade of disease in CDKN2A, APC, MGMT, MLH1 and HIC1, whereas single CpG locus differences between CIN2/3 and cancer groups were seen for CDH13, DAPK1 and TERT. Only those CpGs in the gene body of CDKN2A showed a monotonic increase in methylation between persistent CIN1, CIN2, CIN3 and cancers. Conclusion Our data suggests a novel link between early cervical disease progression and DNA methylation in a region downstream of the CDKN2A transcription start site that may lead to increased p16INK4A/p14ARF expression prior to development of malignant disease. PMID:27401842

  12. DNA methylation patterns in tissues from mid-gestation bovine foetuses produced by somatic cell nuclear transfer show subtle abnormalities in nuclear reprogramming.

    PubMed

    Couldrey, Christine; Lee, Rita Sf

    2010-03-07

    Cloning of cattle by somatic cell nuclear transfer (SCNT) is associated with a high incidence of pregnancy failure characterized by abnormal placental and foetal development. These abnormalities are thought to be due, in part, to incomplete re-setting of the epigenetic state of DNA in the donor somatic cell nucleus to a state that is capable of driving embryonic and foetal development to completion. Here, we tested the hypothesis that DNA methylation patterns were not appropriately established during nuclear reprogramming following SCNT. A panel of imprinted, non-imprinted genes and satellite repeat sequences was examined in tissues collected from viable and failing mid-gestation SCNT foetuses and compared with similar tissues from gestation-matched normal foetuses generated by artificial insemination (AI). Most of the genomic regions examined in tissues from viable and failing SCNT foetuses had DNA methylation patterns similar to those in comparable tissues from AI controls. However, statistically significant differences were found between SCNT and AI at specific CpG sites in some regions of the genome, particularly those associated with SNRPN and KCNQ1OT1, which tended to be hypomethylated in SCNT tissues. There was a high degree of variation between individuals in methylation levels at almost every CpG site in these two regions, even in AI controls. In other genomic regions, methylation levels at specific CpG sites were tightly controlled with little variation between individuals. Only one site (HAND1) showed a tissue-specific pattern of DNA methylation. Overall, DNA methylation patterns in tissues of failing foetuses were similar to apparently viable SCNT foetuses, although there were individuals showing extreme deviant patterns. These results show that SCNT foetuses that had developed to mid-gestation had largely undergone nuclear reprogramming and that the epigenetic signature at this stage was not a good predictor of whether the foetus would develop to term or not.

  13. DNA methylation patterns in tissues from mid-gestation bovine foetuses produced by somatic cell nuclear transfer show subtle abnormalities in nuclear reprogramming

    PubMed Central

    2010-01-01

    Background Cloning of cattle by somatic cell nuclear transfer (SCNT) is associated with a high incidence of pregnancy failure characterized by abnormal placental and foetal development. These abnormalities are thought to be due, in part, to incomplete re-setting of the epigenetic state of DNA in the donor somatic cell nucleus to a state that is capable of driving embryonic and foetal development to completion. Here, we tested the hypothesis that DNA methylation patterns were not appropriately established during nuclear reprogramming following SCNT. A panel of imprinted, non-imprinted genes and satellite repeat sequences was examined in tissues collected from viable and failing mid-gestation SCNT foetuses and compared with similar tissues from gestation-matched normal foetuses generated by artificial insemination (AI). Results Most of the genomic regions examined in tissues from viable and failing SCNT foetuses had DNA methylation patterns similar to those in comparable tissues from AI controls. However, statistically significant differences were found between SCNT and AI at specific CpG sites in some regions of the genome, particularly those associated with SNRPN and KCNQ1OT1, which tended to be hypomethylated in SCNT tissues. There was a high degree of variation between individuals in methylation levels at almost every CpG site in these two regions, even in AI controls. In other genomic regions, methylation levels at specific CpG sites were tightly controlled with little variation between individuals. Only one site (HAND1) showed a tissue-specific pattern of DNA methylation. Overall, DNA methylation patterns in tissues of failing foetuses were similar to apparently viable SCNT foetuses, although there were individuals showing extreme deviant patterns. Conclusion These results show that SCNT foetuses that had developed to mid-gestation had largely undergone nuclear reprogramming and that the epigenetic signature at this stage was not a good predictor of whether the foetus would develop to term or not. PMID:20205951

  14. Monoamine Oxidase A Gene Methylation and Its Role in Posttraumatic Stress Disorder: First Evidence from the South Eastern Europe (SEE)-PTSD Study.

    PubMed

    Ziegler, Christiane; Wolf, Christiane; Schiele, Miriam A; Feric Bojic, Elma; Kucukalic, Sabina; Sabic Dzananovic, Emina; Goci Uka, Aferdita; Hoxha, Blerina; Haxhibeqiri, Valdete; Haxhibeqiri, Shpend; Kravic, Nermina; Muminovic Umihanic, Mirnesa; Cima Franc, Ana; Jaksic, Nenad; Babic, Romana; Pavlovic, Marko; Warrings, Bodo; Bravo Mehmedbasic, Alma; Rudan, Dusko; Aukst-Margetic, Branka; Kucukalic, Abdulah; Marjanovic, Damir; Babic, Dragan; Bozina, Nada; Jakovljevic, Miro; Sinanovic, Osman; Avdibegovic, Esmina; Agani, Ferid; Dzubur-Kulenovic, Alma; Deckert, Jürgen; Domschke, Katharina

    2018-05-01

    Posttraumatic stress disorder is characterized by an overactive noradrenergic system conferring core posttraumatic stress disorder symptoms such as hyperarousal and reexperiencing. Monoamine oxidase A is one of the key enzymes mediating the turnover of noradrenaline. Here, DNA methylation of the monoamine oxidase A gene exonI/intronI region was investigated for the first time regarding its role in posttraumatic stress disorder risk and severity. Monoamine oxidase A methylation was analyzed via direct sequencing of sodium bisulfite-treated DNA extracted from blood cells in a total sample of N=652 (441 male) patients with current posttraumatic stress disorder, patients with remitted posttraumatic stress disorder, and healthy probands (comparison group) recruited at 5 centers in Bosnia-Herzegovina, Croatia, and the Republic of Kosovo. Posttraumatic stress disorder severity was measured by means of the Clinician-Administered Posttraumatic Stress Disorder Scale and its respective subscores representing distinct symptom clusters. In the male, but not the female sample, patients with current posttraumatic stress disorder displayed hypermethylation of 3 CpGs (CpG3=43656362; CpG12=43656514; CpG13=43656553, GRCh38.p2 Assembly) as compared with remitted Posttraumatic Stress Disorder patients and healthy probands. Symptom severity (Clinician-Administered Posttraumatic Stress Disorder Scale scores) in male patients with current posttraumatic stress disorder significantly correlated with monoamine oxidase A methylation. This applied particularly to symptom clusters related to reexperiencing of trauma (cluster B) and hyperarousal (cluster D). The present findings suggest monoamine oxidase A gene hypermethylation, potentially resulting in enhanced noradrenergic signalling, as a disease status and severity marker of current posttraumatic stress disorder in males. If replicated, monoamine oxidase A hypermethylation might serve as a surrogate marker of a hyperadrenergic subtype of posttraumatic stress disorder guiding personalized treatment decisions on the use of antiadrenergic agents.

  15. Comprehensive Cancer-Predisposition Gene Testing in an Adult Multiple Primary Tumor Series Shows a Broad Range of Deleterious Variants and Atypical Tumor Phenotypes.

    PubMed

    Whitworth, James; Smith, Philip S; Martin, Jose-Ezequiel; West, Hannah; Luchetti, Andrea; Rodger, Faye; Clark, Graeme; Carss, Keren; Stephens, Jonathan; Stirrups, Kathleen; Penkett, Chris; Mapeta, Rutendo; Ashford, Sofie; Megy, Karyn; Shakeel, Hassan; Ahmed, Munaza; Adlard, Julian; Barwell, Julian; Brewer, Carole; Casey, Ruth T; Armstrong, Ruth; Cole, Trevor; Evans, Dafydd Gareth; Fostira, Florentia; Greenhalgh, Lynn; Hanson, Helen; Henderson, Alex; Hoffman, Jonathan; Izatt, Louise; Kumar, Ajith; Kwong, Ava; Lalloo, Fiona; Ong, Kai Ren; Paterson, Joan; Park, Soo-Mi; Chen-Shtoyerman, Rakefet; Searle, Claire; Side, Lucy; Skytte, Anne-Bine; Snape, Katie; Woodward, Emma R; Tischkowitz, Marc D; Maher, Eamonn R

    2018-06-12

    Multiple primary tumors (MPTs) affect a substantial proportion of cancer survivors and can result from various causes, including inherited predisposition. Currently, germline genetic testing of MPT-affected individuals for variants in cancer-predisposition genes (CPGs) is mostly targeted by tumor type. We ascertained pre-assessed MPT individuals (with at least two primary tumors by age 60 years or at least three by 70 years) from genetics centers and performed whole-genome sequencing (WGS) on 460 individuals from 440 families. Despite previous negative genetic assessment and molecular investigations, pathogenic variants in moderate- and high-risk CPGs were detected in 67/440 (15.2%) probands. WGS detected variants that would not be (or were not) detected by targeted resequencing strategies, including low-frequency structural variants (6/440 [1.4%] probands). In most individuals with a germline variant assessed as pathogenic or likely pathogenic (P/LP), at least one of their tumor types was characteristic of variants in the relevant CPG. However, in 29 probands (42.2% of those with a P/LP variant), the tumor phenotype appeared discordant. The frequency of individuals with truncating or splice-site CPG variants and at least one discordant tumor type was significantly higher than in a control population (χ 2 = 43.642; p ≤ 0.0001). 2/67 (3%) probands with P/LP variants had evidence of multiple inherited neoplasia allele syndrome (MINAS) with deleterious variants in two CPGs. Together with variant detection rates from a previous series of similarly ascertained MPT-affected individuals, the present results suggest that first-line comprehensive CPG analysis in an MPT cohort referred to clinical genetics services would detect a deleterious variant in about a third of individuals. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

  16. Novel epigenetic changes in CDKN2A are associated with progression of cervical intraepithelial neoplasia.

    PubMed

    Wijetunga, N Ari; Belbin, Thomas J; Burk, Robert D; Whitney, Kathleen; Abadi, Maria; Greally, John M; Einstein, Mark H; Schlecht, Nicolas F

    2016-09-01

    To conduct a comprehensive mapping of the genomic DNA methylation in CDKN2A, which codes for the p16(INK4A) and p14(ARF) proteins, and 14 of the most promising DNA methylation marker candidates previously reported to be associated with progression of low-grade cervical intraepithelial neoplasia (CIN1) to cervical cancer. We analyzed DNA methylation in 68 HIV-seropositive and negative women with incident CIN1, CIN2, CIN3 and invasive cervical cancer, assaying 120 CpG dinucleotide sites spanning APC, CDH1, CDH13, CDKN2A, CDKN2B, DAPK1, FHIT, GSTP1, HIC1, MGMT, MLH1, RARB, RASSF1, TERT and TIMP3 using the Illumina Infinium array. Validation was performed using high resolution mapping of the target genes with HELP-tagging for 286 CpGs, followed by fine mapping of candidate genes with targeted bisulfite sequencing. We assessed for statistical differences in DNA methylation levels for each CpG loci assayed using univariate and multivariate methods correcting for multiple comparisons. In our discovery sample set, we identified dose dependent differences in DNA methylation with grade of disease in CDKN2A, APC, MGMT, MLH1 and HIC1, whereas single CpG locus differences between CIN2/3 and cancer groups were seen for CDH13, DAPK1 and TERT. Only those CpGs in the gene body of CDKN2A showed a monotonic increase in methylation between persistent CIN1, CIN2, CIN3 and cancers. Our data suggests a novel link between early cervical disease progression and DNA methylation in a region downstream of the CDKN2A transcription start site that may lead to increased p16(INK4A)/p14(ARF) expression prior to development of malignant disease. Copyright © 2016 Elsevier Inc. All rights reserved.

  17. Tumor suppressor function of PGP9.5 is associated with epigenetic regulation in prostate cancer--novel predictor of biochemical recurrence after radical surgery.

    PubMed

    Mitsui, Yozo; Shiina, Hiroaki; Hiraki, Miho; Arichi, Naoko; Hiraoka, Takeo; Sumura, Masahiro; Honda, Satoshi; Yasumoto, Hiroaki; Igawa, Mikio

    2012-03-01

    The expression level of protein G product 9.5 (PGP9.5) is downregulated because of promoter CpG hypermethylation in several tumors. We speculated that impaired regulation of PGP9.5 through epigenetic pathways is associated with the pathogenesis of prostate cancer. CpG methylation of the PGP9.5 gene was analyzed in cultured prostate cancer cell lines, 226 localized prostate cancer samples from radical prostatectomy cases, and 80 benign prostate hyperplasia (BPH) tissues. Following 5-aza-2'-deoxycytidune treatment, increased PGP9.5 mRNA transcript expression was found in the LNCaP and PC3 cell lines. With bisulfite DNA sequencing, partial methylation of the PGP9.5 promoter was shown in LNCaP whereas complete methylation was found in PC3 cells. After transfection of PGP9.5 siRNA, cell viability was significantly accelerated in LNCaP but not in PC3 cells as compared with control siRNA transfection. Promoter methylation of PGP9.5 was extremely low in only one of 80 BPH tissues, whereas it was found in 37 of 226 prostate cancer tissues. Expression of the mRNA transcript of PGP9.5 was significantly lower in methylation (+) than methylation (-) prostate cancer tissues. Multivariate analysis of biochemical recurrence (BCR) after an radical prostatectomy revealed pT category and PGP9.5 methylation as prognostically relevant. Further stratification with the pT category in addition to methylation status identified a stepwise reduction of BCR-free probability. This is the first clinical and comprehensive study of inactivation of the PGP9.5 gene via epigenetic pathways in primary prostate cancer. CpG methylation of PGP9.5 in primary prostate cancer might become useful as a molecular marker for early clinical prediction of BCR after radical prostatectomy. ©2012 AACR.

  18. The Healthy Weight Commitment Foundation Pledge

    PubMed Central

    Ng, Shu Wen; Slining, Meghan M.; Popkin, Barry M.

    2014-01-01

    Corporate voluntary pledges to improve the health of Americans have not been held to either explicit measurable outcomes or a framework for independent evaluation. The Healthy Weight Commitment Foundation (HWCF), whose members include 16 of the nation’s leading consumer packaged goods (CPG) food and beverage manufacturers, voluntarily pledged to collectively sell 1 trillion fewer calories in the U.S. marketplace by 2012 (against a 2007 baseline), and sell 1.5 trillion fewer calories by 2015. This paper presents the findings of an independent evaluation of the 2012 HWCF marketplace pledge, conducted in 2013. The 16 HWCF companies collectively sold approximately 6.4 trillion fewer calories (−10.6%) in 2012 than in the baseline year of 2007. Taking into account population changes over the 5-year period of 2007–2012, CPG caloric sales from brands included in the HWCF pledge declined by an average of 78 kcals/capita/day. CPG caloric sales from non-HWCF national brands during the same period declined by 11 kcals/capita/day, but there was little change in calories from private label products. Thus, the total reduction in CPG caloric sales between 2007 and 2012 was 87 kcals/capita/day. This independent evaluation is the first to evaluate food industry compliance with its calorie reduction pledges and to assess how sales from the CPG food and beverage sector are changing. An accompanying paper investigates the extent to which the HWCF pledge affected household-level changes in CPG calories purchased, controlling for important economic and sociodemographic factors affecting household food purchases over this period. PMID:25240967

  19. Genome-wide determination of on-target and off-target characteristics for RNA-guided DNA methylation by dCas9 methyltransferases

    PubMed Central

    Lin, Lin; Liu, Yong; Xu, Fengping; Huang, Jinrong; Daugaard, Tina Fuglsang; Petersen, Trine Skov; Hansen, Bettina; Ye, Lingfei; Zhou, Qing; Fang, Fang; Yang, Ling; Li, Shengting; Fløe, Lasse; Jensen, Kristopher Torp; Shrock, Ellen; Chen, Fang; Yang, Huanming; Wang, Jian; Liu, Xin; Xu, Xun; Bolund, Lars; Nielsen, Anders Lade; Luo, Yonglun

    2018-01-01

    Abstract Background Fusion of DNA methyltransferase domains to the nuclease-deficient clustered regularly interspaced short palindromic repeat (CRISPR) associated protein 9 (dCas9) has been used for epigenome editing, but the specificities of these dCas9 methyltransferases have not been fully investigated. Findings We generated CRISPR-guided DNA methyltransferases by fusing the catalytic domain of DNMT3A or DNMT3B to the C terminus of the dCas9 protein from Streptococcus pyogenes and validated its on-target and global off-target characteristics. Using targeted quantitative bisulfite pyrosequencing, we prove that dCas9-BFP-DNMT3A and dCas9-BFP-DNMT3B can efficiently methylate the CpG dinucleotides flanking its target sites at different genomic loci (uPA and TGFBR3) in human embryonic kidney cells (HEK293T). Furthermore, we conducted whole genome bisulfite sequencing (WGBS) to address the specificity of our dCas9 methyltransferases. WGBS revealed that although dCas9-BFP-DNMT3A and dCas9-BFP-DNMT3B did not cause global methylation changes, a substantial number (more than 1000) of the off-target differentially methylated regions (DMRs) were identified. The off-target DMRs, which were hypermethylated in cells expressing dCas9 methyltransferase and guide RNAs, were predominantly found in promoter regions, 5΄ untranslated regions, CpG islands, and DNase I hypersensitivity sites, whereas unexpected hypomethylated off-target DMRs were significantly enriched in repeated sequences. Through chromatin immunoprecipitation with massive parallel DNA sequencing analysis, we further revealed that these off-target DMRs were weakly correlated with dCas9 off-target binding sites. Using quantitative polymerase chain reaction, RNA sequencing, and fluorescence reporter cells, we also found that dCas9-BFP-DNMT3A and dCas9-BFP-DNMT3B can mediate transient inhibition of gene expression, which might be caused by dCas9-mediated de novo DNA methylation as well as interference with transcription. Conclusion Our results prove that dCas9 methyltransferases cause efficient RNA-guided methylation of specific endogenous CpGs. However, there is significant off-target methylation indicating that further improvements of the specificity of CRISPR-dCas9 based DNA methylation modifiers are required. PMID:29635374

  20. Genome-wide determination of on-target and off-target characteristics for RNA-guided DNA methylation by dCas9 methyltransferases.

    PubMed

    Lin, Lin; Liu, Yong; Xu, Fengping; Huang, Jinrong; Daugaard, Tina Fuglsang; Petersen, Trine Skov; Hansen, Bettina; Ye, Lingfei; Zhou, Qing; Fang, Fang; Yang, Ling; Li, Shengting; Fløe, Lasse; Jensen, Kristopher Torp; Shrock, Ellen; Chen, Fang; Yang, Huanming; Wang, Jian; Liu, Xin; Xu, Xun; Bolund, Lars; Nielsen, Anders Lade; Luo, Yonglun

    2018-03-01

    Fusion of DNA methyltransferase domains to the nuclease-deficient clustered regularly interspaced short palindromic repeat (CRISPR) associated protein 9 (dCas9) has been used for epigenome editing, but the specificities of these dCas9 methyltransferases have not been fully investigated. We generated CRISPR-guided DNA methyltransferases by fusing the catalytic domain of DNMT3A or DNMT3B to the C terminus of the dCas9 protein from Streptococcus pyogenes and validated its on-target and global off-target characteristics. Using targeted quantitative bisulfite pyrosequencing, we prove that dCas9-BFP-DNMT3A and dCas9-BFP-DNMT3B can efficiently methylate the CpG dinucleotides flanking its target sites at different genomic loci (uPA and TGFBR3) in human embryonic kidney cells (HEK293T). Furthermore, we conducted whole genome bisulfite sequencing (WGBS) to address the specificity of our dCas9 methyltransferases. WGBS revealed that although dCas9-BFP-DNMT3A and dCas9-BFP-DNMT3B did not cause global methylation changes, a substantial number (more than 1000) of the off-target differentially methylated regions (DMRs) were identified. The off-target DMRs, which were hypermethylated in cells expressing dCas9 methyltransferase and guide RNAs, were predominantly found in promoter regions, 5΄ untranslated regions, CpG islands, and DNase I hypersensitivity sites, whereas unexpected hypomethylated off-target DMRs were significantly enriched in repeated sequences. Through chromatin immunoprecipitation with massive parallel DNA sequencing analysis, we further revealed that these off-target DMRs were weakly correlated with dCas9 off-target binding sites. Using quantitative polymerase chain reaction, RNA sequencing, and fluorescence reporter cells, we also found that dCas9-BFP-DNMT3A and dCas9-BFP-DNMT3B can mediate transient inhibition of gene expression, which might be caused by dCas9-mediated de novo DNA methylation as well as interference with transcription. Our results prove that dCas9 methyltransferases cause efficient RNA-guided methylation of specific endogenous CpGs. However, there is significant off-target methylation indicating that further improvements of the specificity of CRISPR-dCas9 based DNA methylation modifiers are required.

  1. CpG ODN 1668 induce innate and adaptive immune responses in rock bream (Oplegnathus fasciatus) against rock bream iridovirus (RBIV) infection.

    PubMed

    Jung, Myung-Hwa; Jung, Sung-Ju

    2017-10-01

    Rock bream iridovirus (RBIV) causes severe mass mortalities in rock bream in Korea. CpG ODN 1668 showed promise as immunoprotective agents against RBIV infection in rock bream. In this study, we assessed innate/adaptive-related gene expression patterns in RBIV-infected rock bream with and without CpG ODN 1668 administration to determine important immune defense related factors that may affect fish survival. In the CpG ODN 1668+virus-injected group, virus copies were more than 7.4- to 790591-fold lower than in the virus-injected group at 4 d (8.79 × 10 4 and 6.58 × 10 5 /μl, respectively), 7 d (5.30 × 10 2 and 2.29 × 10 7 /μl, respectively) and 10 dpi (7.79 × 10 1 and 6.16 × 10 7 /μl, respectively). Furthermore, in the CpG ODN 1668+virus-injected group, significantly higher levels of MyD88 (6 h, 1 d, 4 d and 7 dpi), IL1β (1 d, 2 d and 7 dpi) and perforin/granzyme (1 dpi) expression were observed, whereas these genes were not significantly expressed in the virus-injected group at that time points. Mx, ISG15 and PKR were significantly highly expressed at 4 d and 7 dpi and reduced when low viral loads at 10 dpi in the CpG ODN 1668+virus-injected group. Conversely, in the virus-injected group, Mx, ISG15 and PKR expression were significantly higher than the control group until 10 dpi. However, MHC class I, CD8, Fas, Fas ligand and caspases (3, 8 and 9) expression levels showed no statistically significant differences between virus- and CpG ODN 1668+virus-injected group. In summary, CpG ODN 1668 administration in fish induces innate immune response or cell death pathway, which could be a major contributing factor to effective fish control over viral transcription on 4 d to 10 dpi. Expression of MyD88, IL1β, perforin and granzyme-related immune gene response is critical factor for inhibition of RBIV replication. Copyright © 2017 Elsevier Ltd. All rights reserved.

  2. 76 FR 28308 - Compliance Policy Guide: Surgeons' Gloves and Patient Examination Gloves; Defects-Criteria for...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-05-17

    ... quality levels (AQLs) for leaks and visual defects observed during FDA testing of medical gloves. The CPG... practices regulation (21 CFR 10.115). The CPG represents FDA's current thinking on the criteria for direct...

  3. Adjuvant-Loaded Spiky Gold Nanoparticles for Activation of Innate Immune Cells.

    PubMed

    Nam, Jutaek; Son, Sejin; Moon, James J

    2017-10-01

    Gold nanoparticles are versatile carriers for delivery of biomacromolecules. Here, we have developed spiky gold nanoparticles (SGNPs) that can efficiently deliver immunostimulatory agents. Our goal was to develop a platform technology for co-delivery of multiple adjuvant molecules for synergistic stimulation and maturation of innate immune cells. SGNPs were synthesized by a seed-mediated, surfactant-free synthesis method and incorporated with polyinosinic-polycytidylic acid (pIC) and DNA oligonucleotide containing unmethylated CpG motif (CpG) by an electrostatic layer-by-layer approach. Adjuvant-loaded SGNP nano-complexes were examined for their biophysical and biochemical properties and studied for immune activation using bone marrow-derived dendritic cells (BMDCs). We have synthesized SGNPs with branched nano-spikes layered with pIC and/or CpG. Adjuvant-loaded SGNP nano-complexes promoted cellular uptake of the adjuvants. Importantly, we achieved spatio-temporal control over co-delivery of pIC and CpG via SGNPs, which produced synergistic enhancement in cytokine release (IL-6, TNF-α) and upregulation of co-stimulatory markers (CD40, CD80, CD86) in BMDCs, compared with pIC, CpG, or their admixtures. SGNPs serve as a versatile delivery platform that allows flexible and on-demand cargo fabrication for strong activation of innate immune cells.

  4. A multifaceted knowledge translation strategy can increase compliance with guideline recommendations for mechanical bowel preparation.

    PubMed

    Eskicioglu, Cagla; Pearsall, Emily; Victor, J Charles; Aarts, Mary-Anne; Okrainec, Allan; McLeod, Robin S

    2015-01-01

    The successful transfer of evidence into clinical practice is a slow and haphazard process. We report the outcome of a 5-year knowledge translation (KT) strategy to increase adherence with a clinical practice guideline (CPG) for mechanical bowel preparation (MBP) for elective colorectal surgery patients. A locally tailored CPG recommending MBP practices was developed. Data on MBP practices were collected at six University of Toronto hospitals before CPG implementation as well as after two separate KT strategies. KT strategy #1 included development of the CPG, education by opinion leaders, reminder cards, and presentations of data. KT strategy #2 included selection of hospital champions, development of communities of practice, education, reminder cards, electronic updates, pre-printed standardized orders, and audit and feedback. A total of 744 patients (400 males, 344 females, mean age 57.0) were included. Compliance increased from 58.6 to 70.4% after KT strategy #1 and to 81.1% after KT strategy #2 (p < 0.001). Using a tailored KT strategy, increased compliance was observed with CPG recommendations over time suggesting that a longitudinal KT strategy is required to increase and sustain compliance with recommendations. Furthermore, different strategies may be required at different times (i.e., educational sessions initially and reminders and standardized orders to maintain adherence).

  5. Length of paternal lifespan is manifested in the DNA methylome of their nonagenarian progeny

    PubMed Central

    Marttila, Saara; Kananen, Laura; Jylhävä, Juulia; Nevalainen, Tapio; Hervonen, Antti; Jylhä, Marja; Hurme, Mikko

    2015-01-01

    The heritability of lifespan is 20-30%, but only a few genes associated with longevity have been identified. To explain this discrepancy, the inheritance of epigenetic features, such as DNA methylation, have been proposed to contribute to the heritability of lifespan. We investigated whether parental lifespan is associated with DNA methylation profile in nonagenarians. A regression model, adjusted for differences in blood cell proportions, identified 659 CpG sites where the level of methylation was associated with paternal lifespan. However, no association was observed between maternal lifespan and DNA methylation. The 659 CpG sites associated with paternal lifespan were enriched outside of CpG islands and were located in genes associated with development and morphogenesis, as well as cell signaling. The largest difference in the level of methylation between the progeny of the shortest-lived and longest-lived fathers was identified for CpG sites mapping to CXXC5. In addition, the level of methylation in three Notch-genes (NOTCH1, NOTCH3 and NOTCH4) was also associated with paternal lifespan. There are implications for the inheritance of acquired traits via epigenetic mechanisms in mammals. Here we describe DNA methylation features that are associated with paternal lifespan, and we speculate that the identified CpG sites may represent intergenerational epigenetic inheritance. PMID:26436701

  6. Synthetic Poly(L-Glutamic Acid)-conjugated CpG Exhibits Antitumor Efficacy With Increased Retention in Tumor and Draining Lymph Nodes After Intratumoral Injection in a Mouse Model of Melanoma.

    PubMed

    Ma, Qing; Zhou, Dapeng; DeLyria, Elizabeth S; Wen, Xiaoxia; Lu, Wei; Thapa, Prakash; Liu, Chengwen; Li, Dan; Bassett, Roland L; Overwijk, Willem W; Hwu, Patrick; Li, Chun

    2017-01-01

    There is an urgent need for new clinically applicable drug-delivery methods to enhance accumulation of immune-activating drugs in tumors. We synthesized a poly(L-glutamic acid)-CpG ODN2216 conjugate (PG-CpG) and injected it intratumorally into C57BL/6 mice bearing subcutaneous B16-ovalbumin melanoma. PG-CpG elicited the same potent antitumoral activity as CpG with respect to reducing tumor growth and triggering antigen-specific CD8 T-cell responses in this well-established solid tumor model. Moreover, PG-CpG was retained significantly longer in both tumor and draining lymph nodes than was free CpG after intratumoral injection. Specifically, 48 hours after injection, 26.5%±16.9% of the injected PG-CpG dose versus 4.72%±2.61% of free CpG remained at the tumor, and 1.53%±1.22% of the injected PG-CpG versus 0.37%±0.33% of free CpG was retained in the draining inguinal lymph nodes. These findings indicate that PG is an effective synthetic polymeric carrier for delivery of immunostimulatory agents to tumors and lymph nodes.

  7. Effects of CPG ODN on biological behavior of PANC-1 and expression of TLR9 in pancreatic cancer.

    PubMed

    Wu, Han-Qing; Wang, Bo; Zhu, Shi-Kai; Tian, Yuan; Zhang, Jing-Hui; Wu, He-Shui

    2011-02-28

    To determine the expression of toll-like receptor 9 (TLR9) in pancreatic tumor and the effects of cytosine phosphate-guanosine oligodeoxynucleotides 2216 (CPG ODN2216) on biological behavior of pancreatic carcinoma cell line PANC-1 and explore their clinical significance. The immunohistochemistry and Western blot were used to determine the expression of TLR9 protein in pancreatic cancer tissues, and immunofluorescence staining was performed to detect the TLR9 protein expression in pancreatic carcinoma cell line PANC-1. To assess the effects of CPG ODN2216 on the invasive property of Panc-1 cells, in vitro cell adhesion, wound-healing scrape, and invasion and cell colony formation were evaluated. TLR9 was highly expressed in pancreatic cancer tissues and PANC-1 cells. The percentage of positive cells expressing TLR9 protein in human pancreatic tissues, paracancerous tissues and normal tissues were 73.3%, 33.3% and 20.0%, respectively, and the protein expression level of TLR9 was gradually descending (P < 0.05). In vitro tests in wound-healing scrape, cell adhesion, colony formation and matrigel invasion showed that the adhesion and motility of PANC-1 cells in CPG ODN 2216 treatment group were significantly lower than in the control group (P < 0.05). The cell growth assay showed that the proliferative ability of PANC-1 cells in treatment group was significantly decreased and CPG ODN2216 had an inhibitive effect in the growth of Panc-1 cells in a dose and time-dependent manner (P < 0.05). The gene of TLR9 is correlated with the invasive and metastatic potential of human pancreatic carcinoma, and CPG ODN2216 induces the inhibition of migration and invasion of Panc-1 cells.

  8. Genome-wide DNA Methylation Profiling of CpG Islands in Hypospadias

    PubMed Central

    Choudhry, Shweta; Deshpande, Archana; Qiao, Liang; Beckman, Kenneth; Sen, Saunak; Baskin, Laurence S.

    2013-01-01

    Purpose Hypospadias is one of the most frequent genital malformations in the male newborn, and results from abnormal penile and urethral development. The etiology of hypospadias remains largely unknown despite intensive investigations. Fetal androgens have a crucial role in genital differentiation. Recent studies have suggested that molecular mechanisms that underlie the effects of androgens on the fetus may involve disruption of epigenetic programming of gene expression during development. We assessed whether epigenetic modification of DNA methylation is associated with hypospadias in a case-control study of 12 hypospadias and 8 control subjects. Materials and Methods Genome-wide DNA methylation profiling was performed on the study subjects using the Illumina Infinium® HumanMethylation450 Bead-Chip, which enables the direct investigation of methylation status of more than 485,000 individual CpG sites throughout the genome. The methylation level at each CpG site was compared between cases and controls using the t test and logistic regression. Results We identified 14 CpG sites that were associated with hypospadias with p <0.00001. These CpG sites were in or near the SCARB1, MYBPH, SORBS1, LAMA4, HOXD11, MYO1D, EGFL7, C10orf41, LMAN1L and SULF1 genes. Two CpG sites in SCARB1 and MYBPH genes remained statistically significant after correction for multiple testing (p = 2.61×10−09, pcorrected = 0.008; p = 3.06×10−08, pcorrected = 0.02, respectively). Conclusions To our knowledge this is the first study to investigate hypospadias using a unique and novel epigenetic approach. Our findings suggest DNA methylation patterns are useful in identifying new genes such as SCARB1 and MYBPH that may be involved in the etiology of hypospadias. PMID:22906644

  9. Repetition priming of motor activity mediated by a central pattern generator: the importance of extrinsic vs. intrinsic program initiators

    PubMed Central

    Siniscalchi, Michael J.; Jing, Jian; Weiss, Klaudiusz R.

    2016-01-01

    Repetition priming is characterized by increased performance as a behavior is repeated. Although this phenomenon is ubiquitous, mediating mechanisms are poorly understood. We address this issue in a model system, the feeding network of Aplysia. This network generates both ingestive and egestive motor programs. Previous data suggest a chemical coding model: ingestive and egestive inputs to the feeding central pattern generator (CPG) release different modulators, which act via different second messengers to prime motor activity in different ways. The ingestive input to the CPG (neuron CBI-2) releases the peptides feeding circuit activating peptide and cerebral peptide 2, which produce an ingestive pattern of activity. The egestive input to the CPG (the esophageal nerve) releases the peptide small cardioactive peptide. This model is based on research that focused on a single aspect of motor control (radula opening). Here we ask whether repetition priming is observed if activity is triggered with a neuron within the core CPG itself and demonstrate that it is not. Moreover, previous studies demonstrated that effects of modulatory neurotransmitters that induce repetition priming persist. This suggests that it should be possible to “prime” motor programs triggered from within the CPG by first stimulating extrinsic modulatory inputs. We demonstrate that programs triggered after ingestive input activation are ingestive and programs triggered after egestive input activation are egestive. We ask where this priming occurs and demonstrate modifications within the CPG itself. This arrangement is likely to have important consequences for “task” switching, i.e., the cessation of one type of motor activity and the initiation of another. PMID:27466134

  10. Comprehensive DNA methylation analysis of human neuroblastoma cells treated with blonanserin.

    PubMed

    Murata, Yui; Nishioka, Masaki; Bundo, Miki; Sunaga, Fumiko; Kasai, Kiyoto; Iwamoto, Kazuya

    2014-03-20

    Blonanserin is a second-generation antipsychotic drug for schizophrenia. The pharmacological actions of blonanserin are shown to be the antagonism of dopamine receptor 2 and serotonin receptors. However, its molecular mechanisms in brain cells have not been fully characterized. Accumulating evidence suggests that antipsychotic drugs and mood stabilizers show epigenetic effects on a wide range of genes in animal and cellular models. We performed genome-wide DNA methylation analysis targeting 479,814 CpG sites of cultured human neuroblastoma cells administered with blonanserin. We found that 3,057 CpG sites showed statistically significant changes in DNA methylation at two different doses of blonanserin (1.36 nM and 13.6 nM). These included hypermethylated CpG sites that were enriched in genes related to axonogenesis and cell morphogenesis involved in neuron differentiation. We also showed that the global effect on DNA methylome depends on the concentration of the drug. With a high dose of blonanserin, the overall methylation levels across all CpG sites significantly increased. These increases in DNA methylation were prominent in the CpG sites distant from promoter regions. We further examined DNA methylation changes in specific genes implicated for the actions of antipsychotic drugs, such as the dopamine receptor 2 (DRD2) gene and the serotonin receptor 2A (HTR2A) gene. We observed that CpG sites that were located within DRD2 and HTR2A genes were significantly hypermethylated by blonanserin. The DNA methylation changes induced by the treatment with blonanserin will be useful for understanding its pharmacological actions at the cellular level. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  11. Syncope Best Practices: A Syncope Clinical Practice Guideline to Improve Quality.

    PubMed

    Phelps, Heather M; Sachdeva, Ritu; Mahle, William T; McCracken, Courtney E; Kelleman, Michael; McConnell, Michael; Fischbach, Peter S; Cardis, Brian M; Campbell, Robert M; Oster, Matthew E

    2016-05-01

    To determine whether implementation of a standardized clinical practice guideline (CPG) for the evaluation of syncope would decrease practice variability and resource utilization. A retrospective review of medical records of patients presenting to our practice for outpatient evaluation of syncope before and after implementation of the CPG. The guideline included elements of history, physical exam, electrocardiogram, and "red flags" for further testing. Outpatient pediatric cardiology offices of a large pediatric cardiology practice. All new patients between 3 and 21 years old, who presented to cardiology clinic with a chief complaint of syncope. The CPG for the evaluation of pediatric syncope was presented to the providers. Resource utilization was determined by the tests ordered by individual physicians before and after initiation of the CPG. Patient final diagnoses were recorded and the medical records were subsequently reviewed to determine if any patients, who presented again to the system, were ultimately diagnosed with cardiac disease. Of the 1496 patients with an initial visit for syncope, there was no significant difference in the diagnosis of cardiac disease before or after initiation of the CPG: (0.6% vs. 0.4%, P = .55). Electrocardiography provides the highest yield in the evaluation of pediatric syncope. Despite high compliance (86.9%), there were no overall changes in costs ($346.31 vs. $348.53, P = .85) or in resource utilization. There was, however, a decrease in the variability of ordering of echocardiograms among physicians, particularly among those at the extremes of utilization. Although the CPG did not decrease already low costs, it did decrease the wide variability in echo utilization. Evaluation beyond detailed history, physical exam, and electrocardiography provides no additional benefit in the evaluations of pediatric patients presenting with syncope. © 2015 Wiley Periodicals, Inc.

  12. Polycomb-like proteins link the PRC2 complex to CpG islands

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, Haojie; Liefke, Robert; Jiang, Junyi

    The Polycomb repressive complex 2 (PRC2) mainly mediates transcriptional repression1,2 and has essential roles in various biological processes including the maintenance of cell identity and proper differentiation. Polycomb-like (PCL) proteins, such as PHF1, MTF2 and PHF19, are PRC2-associated factors that form sub-complexes with PRC2 core components3, and have been proposed to modulate the enzymatic activity of PRC2 or the recruitment of PRC2 to specific genomic loci4,5,6,7,8,9,10,11,12,13. Mammalian PRC2-binding sites are enriched in CG content, which correlates with CpG islands that display a low level of DNA methylation14. However, the mechanism of PRC2 recruitment to CpG islands is not fully understood.more » Here we solve the crystal structures of the N-terminal domains of PHF1 and MTF2 with bound CpG-containing DNAs in the presence of H3K36me3-containing histone peptides. We show that the extended homologous regions of both proteins fold into a winged-helix structure, which specifically binds to the unmethylated CpG motif but in a completely different manner from the canonical winged-helix DNA recognition motif. We also show that the PCL extended homologous domains are required for efficient recruitment of PRC2 to CpG island-containing promoters in mouse embryonic stem cells. Our research provides the first, to our knowledge, direct evidence to demonstrate that PCL proteins are crucial for PRC2 recruitment to CpG islands, and further clarifies the roles of these proteins in transcriptional regulation in vivo.« less

  13. Silencing of GSTP1 gene by CpG island DNA hypermethylation in HBV-associated hepatocellular carcinomas.

    PubMed

    Zhong, Sheng; Tang, Mandy W; Yeo, Winnie; Liu, Cuiling; Lo, Y M Dennis; Johnson, Philip J

    2002-04-01

    Glutathione S-transferases, enzymes that defend cells against damage mediated by oxidant and electrophilic carcinogens, may be critical determinants of cancer pathogenesis. In this report, we assess the role of epigenetic silencing of the GSTP1 gene, a gene encoding the pi-class glutathione S-transferase, in the pathogenesis of hepatitis B virus (HBV)-associated hepatocellular carcinomas (HCC). The cell lines Hep3B, HepG2, and a cohort of 43 HBV-associated HCC tissue specimens and corresponding nontumor tissues were subjected to analysis for GSTP1 epigenetic alteration and expression. GSTP1 "CpG" island DNA hypermethylation in the liver cell lines, and the tissue specimens were determined by methylation-specific PCR and correlated with expression of the gene using reverse-transcription PCR, immunoblotting, and immunohistochemistry. GSTP1 CpG island DNA hypermethylation was detected in 28 of 43 (65.1%) HCC tissues and 4 of 40 (10%) corresponding nontumor tissues. GSTP1 protein was absent in those cases showing hypermethylation of the gene. Similarly, DNA from Hep3B and HepG2 cell lines displayed complete GSTP1 hypermethylation in the CpG island, and they failed to express GSTP1 mRNA and the corresponding protein product. Treatment of the cell lines with the DNA methyltransferase inhibitor 5-aza-deoxycytidine reversed the hypermethylation, and restored GSTP1 mRNA and polypeptide expression. These data indicate that epigenetic silencing of GSTP1 gene expression by CpG island DNA hypermethylation is common in human HBV-associated HCC. In addition, somatic GSTP1 inactivation via CpG island hypermethylation may contribute to the pathogenesis of this malignancy.

  14. The Healthy Weight Commitment Foundation pledge: calories sold from U.S. consumer packaged goods, 2007-2012.

    PubMed

    Ng, Shu Wen; Slining, Meghan M; Popkin, Barry M

    2014-10-01

    Corporate voluntary pledges to improve the health of Americans have not been held to either explicit measurable outcomes or a framework for independent evaluation. The Healthy Weight Commitment Foundation (HWCF), whose members include 16 of the nation's leading consumer packaged goods (CPG) food and beverage manufacturers, voluntarily pledged to collectively sell 1 trillion fewer calories in the U.S. marketplace by 2012 (against a 2007 baseline), and sell 1.5 trillion fewer calories by 2015. This paper presents the findings of an independent evaluation of the 2012 HWCF marketplace pledge, conducted in 2013. The 16 HWCF companies collectively sold approximately 6.4 trillion fewer calories (-10.6%) in 2012 than in the baseline year of 2007. Taking into account population changes over the 5-year period of 2007-2012, CPG caloric sales from brands included in the HWCF pledge declined by an average of 78 kcal/capita/day. CPG caloric sales from non-HWCF national brands during the same period declined by 11 kcal/capita/day, and there were similar declines in calories from private label products. Thus, the total reduction in CPG caloric sales between 2007 and 2012 was 99 kcal/capita/day. This independent evaluation is the first to evaluate food industry compliance with its calorie reduction pledges and to assess how sales from the CPG food and beverage sector are changing. An accompanying paper investigates the extent to which the HWCF pledge affected household-level changes in CPG calories purchased, controlling for important economic and sociodemographic factors affecting household food purchases over this period. Copyright © 2014 American Journal of Preventive Medicine. Published by Elsevier Inc. All rights reserved.

  15. Blood fatty acid composition of pregnant and nonpregnant Korean women: red cells may act as a reservoir of arachidonic acid and docosahexaenoic acid for utilization by the developing fetus.

    PubMed

    Ghebremeskel, K; Min, Y; Crawford, M A; Nam, J H; Kim, A; Koo, J N; Suzuki, H

    2000-05-01

    Relative fatty acid composition of plasma and red blood cell (RBC) choline phosphoglycerides (CPG), and RBC ethanolamine phosphoglycerides (EPG) of pregnant (n = 40) and nonpregnant, nonlactating (n = 40), healthy Korean women was compared. The two groups were of the same ethnic origin and comparable in age and parity. Levels of arachidonic (AA) and docosahexaenoic (DHA) acids were lower (P < 0.05) and palmitic and oleic acids higher (P < 0.0001) in plasma CPG of the pregnant women. Similarly, the RBC CPG and EPG of the pregnant women had lower AA and DHA (P < 0.05) and higher palmitic and oleic acids (P < 0.01). The reduction in DHA and total n-3 fatty acids in plasma CPG of the pregnant women was paralleled by an increase in docosatetraenoic (DTA) and docosapentaenoic (DPA) acids of the n-6 series and in DPA/DTA ratio. In the RBC phospholipids (CPG and EPG) of the pregnant women, DTA and DPA acids of the n-6 series and DPA/DTA ratio did not increase with the decrease of the n-3 metabolites (eicosapentaenoic acid, DPA, and DHA) and total n-3. Since pregnancy was the main identifiable variable between the two groups, the lower levels of AA and DHA in RBC CPG and EPG of the pregnant women suggest that the mothers were mobilizing membrane AA and DHA to meet the high fetal requirement for these nutrients. It may also suggest that RBC play a role as a potential store of AA and DHA and as a vehicle for the transport of these fatty acids from maternal circulation to the placenta to be utilized by the developing fetus.

  16. Whole Genome DNA Methylation Analysis of Obstructive Sleep Apnea: IL1R2, NPR2, AR, SP140 Methylation and Clinical Phenotype

    PubMed Central

    Chen, Yung-Che; Chen, Ting-Wen; Su, Mao-Chang; Chen, Chung-Jen; Chen, Kuang-Den; Liou, Chia-Wei; Tang, Petrus; Wang, Ting-Ya; Chang, Jen-Chieh; Wang, Chin-Chou; Lin, Hsin-Ching; Chin, Chien-Hung; Huang, Kuo-Tung; Lin, Meng-Chih; Hsiao, Chang-Chun

    2016-01-01

    Study Objectives: We hypothesized that DNA methylation patterns may contribute to disease severity or the development of hypertension and excessive daytime sleepiness (EDS) in patients with obstructive sleep apnea (OSA). Methods: Illumina's (San Diego, CA, USA) DNA methylation 27-K assay was used to identify differentially methylated loci (DML). DNA methylation levels were validated by pyrosequencing. A discovery cohort of 15 patients with OSA and 6 healthy subjects, and a validation cohort of 72 patients with sleep disordered breathing (SDB). Results: Microarray analysis identified 636 DMLs in patients with OSA versus healthy subjects, and 327 DMLs in patients with OSA and hypertension versus those without hypertension. In the validation cohort, no significant difference in DNA methylation levels of six selected genes was found between the primary snoring subjects and OSA patients (primary outcome). However, a secondary outcome analysis showed that interleukin-1 receptor 2 (IL1R2) promoter methylation (−114 cytosine followed by guanine dinucleotide sequence [CpG] site) was decreased and IL1R2 protein levels were increased in the patients with SDB with an oxygen desaturation index > 30. Androgen receptor (AR) promoter methylation (−531 CpG site) and AR protein levels were both increased in the patients with SDB with an oxygen desaturation index > 30. Natriuretic peptide receptor 2 (NPR2) promoter methylation (−608/−618 CpG sites) were decreased, whereas levels of both NPR2 and serum C type natriuretic peptide protein were increased in the SDB patients with EDS. Speckled protein 140 (SP140) promoter methylation (−194 CpG site) was increased, and SP140 protein levels were decreased in the patients with SDB and EDS. Conclusions: IL1R2 hypomethylation and AR hypermethylation may constitute an important determinant of disease severity, whereas NPR2 hypomethylation and SP140 hypermethylation may provide a biomarker for vulnerability to EDS in OSA. Commentary: A commentary on this article appears in this issue on page 723. Citation: Chen YC, Chen TW, Su MC, Chen CJ, Chen KD, Liou CW, Tang P, Wang TY, Chang JC, Wang CC, Lin HC, Chin CH, Huang KT, Lin MC, Hsiao CC. Whole genome DNA methylation analysis of obstructive sleep apnea: IL1R2, NPR2, AR, SP140 methylation and clinical phenotype. SLEEP 2016;39(4):743–755. PMID:26888452

  17. Adopting Health Behavior Change Theory throughout the Clinical Practice Guideline Process

    ERIC Educational Resources Information Center

    Ceccato, Natalie E.; Ferris, Lorraine E.; Manuel, Douglas; Grimshaw, Jeremy M.

    2007-01-01

    Adopting a theoretical framework throughout the clinical practice guideline (CPG) process (development, dissemination, implementation, and evaluation) can be useful in systematically identifying, addressing, and explaining behavioral influences impacting CPG uptake and effectiveness. This article argues that using a theoretical framework should…

  18. 78 FR 42526 - Salmonella

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-07-16

    ... DEPARTMENT OF HEALTH AND HUMAN SERVICES Food and Drug Administration [Docket No. FDA-2013-D-0254] Salmonella Contamination of Dry Dog Food; Withdrawal of Compliance Policy Guide AGENCY: Food and Drug... entitled ``Sec. 690.700 Salmonella Contamination of Dry Dog Food (CPG 690.700)'' on October 1, 1980. CPG...

  19. Gait Planning and Stability Control of a Quadruped Robot

    PubMed Central

    Li, Junmin; Wang, Jinge; Yang, Simon X.; Zhou, Kedong; Tang, Huijuan

    2016-01-01

    In order to realize smooth gait planning and stability control of a quadruped robot, a new controller algorithm based on CPG-ZMP (central pattern generator-zero moment point) is put forward in this paper. To generate smooth gait and shorten the adjusting time of the model oscillation system, a new CPG model controller and its gait switching strategy based on Wilson-Cowan model are presented in the paper. The control signals of knee-hip joints are obtained by the improved multi-DOF reduced order control theory. To realize stability control, the adaptive speed adjustment and gait switch are completed by the real-time computing of ZMP. Experiment results show that the quadruped robot's gaits are efficiently generated and the gait switch is smooth in the CPG control algorithm. Meanwhile, the stability of robot's movement is improved greatly with the CPG-ZMP algorithm. The algorithm in this paper has good practicability, which lays a foundation for the production of the robot prototype. PMID:27143959

  20. Gait Planning and Stability Control of a Quadruped Robot.

    PubMed

    Li, Junmin; Wang, Jinge; Yang, Simon X; Zhou, Kedong; Tang, Huijuan

    2016-01-01

    In order to realize smooth gait planning and stability control of a quadruped robot, a new controller algorithm based on CPG-ZMP (central pattern generator-zero moment point) is put forward in this paper. To generate smooth gait and shorten the adjusting time of the model oscillation system, a new CPG model controller and its gait switching strategy based on Wilson-Cowan model are presented in the paper. The control signals of knee-hip joints are obtained by the improved multi-DOF reduced order control theory. To realize stability control, the adaptive speed adjustment and gait switch are completed by the real-time computing of ZMP. Experiment results show that the quadruped robot's gaits are efficiently generated and the gait switch is smooth in the CPG control algorithm. Meanwhile, the stability of robot's movement is improved greatly with the CPG-ZMP algorithm. The algorithm in this paper has good practicability, which lays a foundation for the production of the robot prototype.

  1. Cancer immunotherapeutic effects of novel CpG ODN in murine tumor model.

    PubMed

    Cho, Hyeon Cheol; Kim, Bo Hwan; Kim, Kyunghoon; Park, Ju Youn; Chang, Jae-Ho; Kim, Soo-Ki

    2008-10-01

    While CpG oligodeoxynucleotides (ODN) are excellent candidates for cancer immunotherapeutics, the numbers of usable CpG ODNs are limited in current clinical settings. To resolve this, we investigated whether novel CpG ODN (KSK-CpG) would be an effective immunotherapeutic in a murine tumor model by affecting in vivo and in vitro parameters, such as survival span, the number of tumor nodules, natural killer (NK) cell and cytotoxic T lymphocyte (CTL) activity and interleukin (IL)-6 or IL-12 cytokine release in splenocytes. We found that KSK-CpG was effective in the murine cancer model by way of prolonging survival span, reducing the number of tumor nodules, augmenting NK cell and CTL cytotoxicity, as well as evoking IL-6 and IL-12 cytokine release in splenocytes. Collectively, these data demonstrate that KSK-CpG is active against the highly malignant B16BL6 and EL4 tumor mouse model via innate immune augmentation.

  2. Identification and expression analysis of cobia (Rachycentron canadum) Toll-like receptor 9 gene.

    PubMed

    Byadgi, Omkar; Puteri, Dinda; Lee, Yan-Horn; Lee, Jai-Wei; Cheng, Ta-Chih

    2014-02-01

    Cobia culture is hindered by bacterial infection (Photobacterium damselae subsp. piscicida) and in order to study the effect of P. damselae subsp. piscicida challenge and CpG ODN stimulation on cobia Toll like receptor 9 (RCTLR9), we used PCR to clone RCTLR9 gene and qRT-PCR to quantify gene expression. The results indicated that RCTLR9 cDNA contains 3141 bp. It encodes 1047 amino acids containing 16 typical structures of leucine-rich repeats (LRRs) including an LRRTYP, LRRCT and a motif involved in PAMP binding was identified at position 240-253 amino acid. Broad expression of RCTLR9 was found in larval, juvenile and adult stages irrespective of the tissues. In larval stage, RCTLR9 mRNA expression decreased at 5 d and then increased at 10 dph. At juvenile stage cobia, the expression was significantly high (p < 0.05) in spleen and intestine compared to gill, kidney, liver and skin. However, at adult stage, the significant high expression was found in gill and intestine. Cobia challenged with P. damselae subsp. piscicida showed significant increase in RCTLR9 expression at 24 h post challenge in intestine, spleen and liver, while in kidney the expression was peak at 12 h and later it decreased at 24 h. The highest expression was 40 fold increase in spleen and the lowest expression was ∼3.6 fold increase in liver. Cobia stimulated with CpG oligonucleotides showed that the induction of these genes was CpG ODN type and time dependent. In spleen and liver, CpG ODNs 1668 and 2006 injected group showed high expression of RCTLR9, IL-1β, chemokine CC compared to other groups. Meanwhile, CpG ODN 2006 has induced high expression of IgM. The CpG ODNs 2395 have induced significant high expression of Mx in spleen and liver. These results demonstrates the potential of using CpG ODN to enhance cobia resistance to P. damselae subsp. piscicida infection and use as an adjuvant in vaccine development. Copyright © 2013 Elsevier Ltd. All rights reserved.

  3. CpG Sites Associated with Cigarette Smoking: Analysis of Epigenome-Wide Data from the Sister Study

    PubMed Central

    Harlid, Sophia; Xu, Zongli; Panduri, Vijayalakshmi; Sandler, Dale P.

    2014-01-01

    Background: Smoking increases the risk of many diseases, and it is also linked to blood DNA methylation changes that may be important in disease etiology. Objectives: We sought to identify novel CpG sites associated with cigarette smoking. Methods: We used two epigenome-wide data sets from the Sister Study to identify and confirm CpG sites associated with smoking. One included 908 women with methylation measurements at 27,578 CpG sites using the HumanMethylation27 BeadChip; the other included 200 women with methylation measurements for 473,844 CpG sites using the HumanMethylation450 BeadChip. Significant CpGs from the second data set that were not included in the 27K assay were validated by pyrosequencing in a subset of 476 samples from the first data set. Results: Our study successfully confirmed smoking associations for 9 previously established CpGs and identified 2 potentially novel CpGs: cg26764244 in GNG12 (p = 9.0 × 10–10) and cg22335340 in PTPN6 (p = 2.9 × 10–05). We also found strong evidence of an association between smoking status and cg02657160 in CPOX (p = 7.3 × 10–7), which has not been previously reported. All 12 CpGs were undermethylated in current smokers and showed an increasing percentage of methylation in former and never-smokers. Conclusions: We identified 2 potentially novel smoking related CpG sites, and provided independent replication of 10 previously reported CpGs sites related to smoking, one of which is situated in the gene CPOX. The corresponding enzyme is involved in heme biosynthesis, and smoking is known to increase heme production. Our study extends the evidence base for smoking-related changes in DNA methylation. Citation: Harlid S, Xu Z, Panduri V, Sandler DP, Taylor JA. 2014. CpG sites associated with cigarette smoking: analysis of epigenome-wide data from the Sister Study. Environ Health Perspect 122:673–678; http://dx.doi.org/10.1289/ehp.1307480 PMID:24704585

  4. pH-Responsive Nanoparticle Vaccines for Dual-Delivery of Antigens and Immunostimulatory Oligonucleotides

    PubMed Central

    Wilson, John T.; Keller, Salka; Manganiello, Matthew J.; Cheng, Connie; Lee, Chen-Chang; Opara, Chinonso; Convertine, Anthony; Stayton, Patrick S.

    2013-01-01

    Protein subunit vaccines offer important potential advantages over live vaccine vectors, but generally elicit weaker and shorter-lived cellular immune responses. Here we investigate the use of pH-responsive, endosomolytic polymer nanoparticles that were originally developed for RNA delivery as vaccine delivery vehicles for enhancing cellular and humoral immune responses. Micellar nanoparticles were assembled from amphiphilic diblock copolymers composed of an ampholytic core-forming block and a re-designed polycationic corona block doped with thiol-reactive pyridyl disulfide groups to enable dual-delivery of antigens and immunostimulatory CpG oligodeoxynucleotide (CpG ODN) adjuvants. Polymers assembled into 23 nm particles with simultaneous packaging of CpG ODN and a thiolated protein antigen, ovalbumin (ova). Conjugation of ova to nanoparticles significantly enhanced antigen cross-presentation in vitro relative to free ova or an unconjugated, physical mixture of the parent compounds. Subcutaneous vaccination of mice with ova-nanoparticle conjugates elicited a significantly higher CD8+ T cell response (0.5% IFN-ɣ+ of CD8+) compared to mice vaccinated with free ova or a physical mixture of the two components. Significantly, immunization with ova-nanoparticle conjugates electrostatically complexed with CpG ODN (dual-delivery) enhanced CD8+ T cell responses (3.4% IFN-ɣ+ of CD8+) 7-, 18-, and 8-fold relative to immunization with conjugates, ova administered with free CpG, or a formulation containing free ova and CpG complexed to micelles, respectively. Similarly, dual-delivery carriers significantly increased CD4+IFN-ɣ+ (Th1) responses, and elicited a balanced IgG1/IgG2c antibody response. Intradermal administration further augmented cellular immune responses, with dual-delivery carriers inducing ~7% antigen-specific CD8+ T cells. This work demonstrates the ability of pH-responsive, endosomolytic nanoparticles to actively promote antigen cross-presentation and augment cellular and humoral immune responses via dual-delivery of protein antigens and CpG ODN. Hence, pH-responsive polymeric nanoparticles offer promise as a delivery platform for protein subunit vaccines. PMID:23590591

  5. Nicotine induced CpG methylation of Pax6 binding motif in StAR promoter reduces the gene expression and cortisol production

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Tingting; Department of Pharmacology, Uniformed Services University of the Health Sciences, Bethesda, Maryland; Chen, Man

    Steroidogenic acute regulatory protein (StAR) mediates the rate-limiting step in the synthesis of steroid hormones, essential to fetal development. We have reported that the StAR expression in fetal adrenal is inhibited in a rat model of nicotine-induced intrauterine growth retardation (IUGR). Here using primary human fetal adrenal cortex (pHFAC) cells and a human fetal adrenal cell line NCI-H295A, we show that nicotine inhibits StAR expression and cortisol production in a dose- and time-dependent manner, and prolongs the inhibitory effect on cells proliferating over 5 passages after termination of nicotine treatment. Methylation detection within the StAR promoter region uncovers a singlemore » site CpG methylation at nt -377 that is sensitive to nicotine treatment. Nicotine-induced alterations in frequency of this point methylation correlates well with the levels of StAR expression, suggesting an important role of the single site in regulating StAR expression. Further studies using bioinformatics analysis and siRNA approach reveal that the single CpG site is part of the Pax6 binding motif (CGCCTGA) in the StAR promoter. The luciferase activity assays validate that Pax6 increases StAR gene expression by binding to the glucagon G3-like motif (CGCCTGA) and methylation of this site blocks Pax6 binding and thus suppresses StAR expression. These data identify a nicotine-sensitive CpG site at the Pax6 binding motif in the StAR promoter that may play a central role in regulating StAR expression. The results suggest an epigenetic mechanism that may explain how nicotine contributes to onset of adult diseases or disorders such as metabolic syndrome via fetal programming. -- Highlights: Black-Right-Pointing-Pointer Nicotine-induced StAR inhibition in two human adrenal cell models. Black-Right-Pointing-Pointer Nicotine-induced single CpG site methylation in StAR promoter. Black-Right-Pointing-Pointer Persistent StAR inhibition and single CpG methylation after nicotine termination. Black-Right-Pointing-Pointer Single CpG methylation located at Pax6 binding motif regulates StAR expression.« less

  6. Quantitative methylation level of the EPHX1 promoter in peripheral blood DNA is associated with polycystic ovary syndrome.

    PubMed

    Sang, Qing; Li, Xin; Wang, Haojue; Wang, Huan; Zhang, Shaozhen; Feng, Ruizhi; Xu, Yao; Li, Qiaoli; Zhao, Xinzhi; Xing, Qinghe; Jin, Li; He, Lin; Wang, Lei

    2014-01-01

    Steroid synthesis and metabolic pathways play important roles in the pathophysiology of PCOS, but until now there have been no studies on the methylation profiles of specific genes in steroid synthesis pathways that are known to be associated with PCOS. Here we used MassARRAY quantitative methylation analysis to determine the methylation levels of each CpG site or cluster in the promoters of EPHX1, SRD5A1, and CYP11A1 in 64 peripheral blood samples. We further examined the methylation level of EPHX1 in an independent cohort consisting of 116 people. Finally, we investigated the role of EPHX1 in steroidogenesis in the KGN cell line. For SRD5A1 and CYP11A1, there was no significant difference in methylation level between patients and controls. For EPHX1, however, the methylation levels of a few consecutive CpG sites and clusters were found to be significantly associated with PCOS. The methylation levels of a number of CpG clusters or sites were significantly lower in patients than in controls in the first cohort consisting of 64 people, such as clusters 13-14 (P<0.05), 15-16 (P<0.001), and 19-24 (P<0.001) and sites CpG_53 (P<0.01) and CpG_54 (P<0.05). Among differentiated methylation sites and clusters, the methylation levels of the CpG cluster 13-14 and CpG cluster 19-24 in PCOS patients were significantly lower than in controls in the second cohort of 116 people (P<0.05 for both). In addition, knockdown and overexpression experiments in KGN cells showed that EPHX1 can regulate estradiol concentrations, and this indicates a role for EPHX1 in steroidogenesis. Our study has demonstrated that methylation of the EPHX1 promoter might be associated with PCOS. This study provides direct evidence that methylation plays an important role in PCOS and demonstrates a novel role for EPHX1 in female reproduction.

  7. Quantitative Methylation Level of the EPHX1 Promoter in Peripheral Blood DNA Is Associated with Polycystic Ovary Syndrome

    PubMed Central

    Wang, Huan; Zhang, Shaozhen; Feng, Ruizhi; Xu, Yao; Li, Qiaoli; Zhao, Xinzhi; Xing, Qinghe; Jin, Li; He, Lin; Wang, Lei

    2014-01-01

    Steroid synthesis and metabolic pathways play important roles in the pathophysiology of PCOS, but until now there have been no studies on the methylation profiles of specific genes in steroid synthesis pathways that are known to be associated with PCOS. Here we used MassARRAY quantitative methylation analysis to determine the methylation levels of each CpG site or cluster in the promoters of EPHX1, SRD5A1, and CYP11A1 in 64 peripheral blood samples. We further examined the methylation level of EPHX1 in an independent cohort consisting of 116 people. Finally, we investigated the role of EPHX1 in steroidogenesis in the KGN cell line. For SRD5A1 and CYP11A1, there was no significant difference in methylation level between patients and controls. For EPHX1, however, the methylation levels of a few consecutive CpG sites and clusters were found to be significantly associated with PCOS. The methylation levels of a number of CpG clusters or sites were significantly lower in patients than in controls in the first cohort consisting of 64 people, such as clusters 13–14 (P<0.05), 15–16 (P<0.001), and 19–24 (P<0.001) and sites CpG_53 (P<0.01) and CpG_54 (P<0.05). Among differentiated methylation sites and clusters, the methylation levels of the CpG cluster 13–14 and CpG cluster 19–24 in PCOS patients were significantly lower than in controls in the second cohort of 116 people (P<0.05 for both). In addition, knockdown and overexpression experiments in KGN cells showed that EPHX1 can regulate estradiol concentrations, and this indicates a role for EPHX1 in steroidogenesis. Our study has demonstrated that methylation of the EPHX1 promoter might be associated with PCOS. This study provides direct evidence that methylation plays an important role in PCOS and demonstrates a novel role for EPHX1 in female reproduction. PMID:24505354

  8. DNA methylation and transcription in a distal region upstream from the bovine AlphaS1 casein gene after once or twice daily milking.

    PubMed

    Nguyen, Minh; Boutinaud, Marion; Pétridou, Barbara; Gabory, Anne; Pannetier, Maëlle; Chat, Sophie; Bouet, Stephan; Jouneau, Luc; Jaffrezic, Florence; Laloë, Denis; Klopp, Christophe; Brun, Nicolas; Kress, Clémence; Jammes, Hélène; Charlier, Madia; Devinoy, Eve

    2014-01-01

    Once daily milking (ODM) induces a reduction in milk production when compared to twice daily milking (TDM). Unilateral ODM of one udder half and TDM of the other half, enables the study of underlying mechanisms independently of inter-individual variability (same genetic background) and of environmental factors. Our results show that in first-calf heifers three CpG, located 10 kb upstream from the CSN1S1 gene were methylated to 33, 34 and 28%, respectively, after TDM but these levels were higher after ODM, 38, 38 and 33%, respectively. These methylation levels were much lower than those observed in the mammary gland during pregnancy (57, 59 and 50%, respectively) or in the liver (74, 78 and 61%, respectively). The methylation level of a fourth CpG (CpG4), located close by (29% during TDM) was not altered after ODM. CpG4 methylation reached 39.7% and 59.5%, during pregnancy or in the liver, respectively. CpG4 is located within a weak STAT5 binding element, arranged in tandem with a second high affinity STAT5 element. STAT5 binding is only marginally modulated by CpG4 methylation, but it may be altered by the methylation levels of the three other CpG nearby. Our results therefore shed light on mechanisms that help to explain how milk production is almost, but not fully, restored when TDM is resumed (15.1 ± 0.2 kg/day instead of 16.2 ± 0.2 kg/day, p<0.01). The STAT5 elements are 100 bp away from a region transcribed in the antisense orientation, in the mammary gland during lactation, but not during pregnancy or in other reproductive organs (ovary or testes). We now need to clarify whether the transcription of this novel RNA is a consequence of STAT5 interacting with the CSN1S1 distal region, or whether it plays a role in the chromatin structure of this region.

  9. GABA-like immunoreactivity in Biomphalaria: Colocalization with tyrosine hydroxylase-like immunoreactivity in the feeding motor systems of panpulmonate snails.

    PubMed

    Vaasjo, Lee O; Quintana, Alexandra M; Habib, Mohamed R; Mendez de Jesus, Paola A; Croll, Roger P; Miller, Mark W

    2018-08-01

    The simpler nervous systems of certain invertebrates provide opportunities to examine colocalized classical neurotransmitters in the context of identified neurons and well defined neural circuits. This study examined the distribution of γ-aminobutyric acid-like immunoreactivity (GABAli) in the nervous system of the panpulmonates Biomphalaria glabrata and Biomphalaria alexandrina, major intermediate hosts for intestinal schistosomiasis. GABAli neurons were localized in the cerebral, pedal, and buccal ganglia of each species. With the exception of a projection to the base of the tentacle, GABAli fibers were confined to the CNS. As GABAli was previously reported to be colocalized with markers for dopamine (DA) in five neurons in the feeding network of the euopisthobranch gastropod Aplysia californica (Díaz-Ríos, Oyola, & Miller, 2002), double-labeling protocols were used to compare the distribution of GABAli with tyrosine hydroxylase immunoreactivity (THli). As in Aplysia, GABAli-THli colocalization was limited to five neurons, all of which were located in the buccal ganglion. Five GABAli-THli cells were also observed in the buccal ganglia of two other intensively studied panpulmonate species, Lymnaea stagnalis and Helisoma trivolvis. These findings indicate that colocalization of the classical neurotransmitters GABA and DA in feeding central pattern generator (CPG) interneurons preceded the divergence of euopisthobranch and panpulmonate taxa. These observations also support the hypothesis that heterogastropod feeding CPG networks exhibit a common universal design. © 2018 Wiley Periodicals, Inc.

  10. Plasticity of DNA methylation and gene expression under zinc deficiency in Arabidopsis roots.

    PubMed

    Chen, Xiaochao; Schönberger, Brigitte; Menz, Jochen; Ludewig, Uwe

    2018-05-25

    DNA methylation is a heritable chromatin modification that maintains chromosome stability, regulates transposon silencing and appears to be involved in gene expression in response to environmental conditions. Environmental stress alters DNA methylation patterns that are correlated with gene expression differences. Here, genome-wide differential DNA-methylation was identified upon prolonged Zn deficiency, leading to hypo- and hyper-methylated chromosomal regions. Preferential CpG methylation changes occurred in gene promoters and gene bodies, but did not overlap with transcriptional start sites. Methylation changes were also prominent in transposable elements. By contrast, non-CG methylation differences were exclusively found in promoters of protein coding genes and in transposable elements. Strongly Zn deficiency-induced genes and their promoters were mostly non-methylated, irrespective of Zn supply. Differential DNA methylation in the CpG and CHG, but not in the CHH context, was found close to a few up-regulated Zn-deficiency genes. However, the transcriptional Zn-deficiency response in roots appeared little correlated with associated DNA methylation changes in promoters or gene bodies. Furthermore, under Zn deficiency, developmental defects were identified in an Arabidopsis mutant lacking non-CpG methylation. The root methylome thus responds specifically to a micro-nutrient deficiency and is important for efficient Zn utilization at low availability, but the relationship of differential methylation and differentially expressed genes is surprisingly poor.

  11. Epigenetic Control of Gonadal Aromatase (cyp19a1) in Temperature-Dependent Sex Determination of Red-Eared Slider Turtles

    PubMed Central

    Matsumoto, Yuiko; Buemio, Alvin; Chu, Randy; Vafaee, Mozhgon; Crews, David

    2013-01-01

    In the red-eared slider turtle (Trachemys scripta), a species with temperature-dependent sex determination (TSD), the expression of the aromatase gene during gonad development is strictly limited to the female-producing temperature. The underlying mechanism remains unknown. In this study, we identified the upstream 5′-flanking region of the aromatase gene, gonad-specific promoter, and the temperature-dependent DNA methylation signatures during gonad development in the red-eared slider turtle. The 5′-flanking region of the slider aromatase exhibited sequence similarities to the aromatase genes of the American alligator, chicken, quail, and zebra finch. A putative TATA box was located 31 bp upstream of the gonad-specific transcription start site. DNA methylation at the CpG sites between the putative binding sites of the fork head domain factor (FOX) and vertebrate steroidogenic factor 1 (SF1) and adjacent TATA box in the promoter region were significantly lower in embryonic gonads at the female-producing temperature compared the male-producing temperature. A shift from male- to female-, but not from female- to male-, producing temperature changed the level of DNA methylation in gonads. Taken together these results indicate that the temperature, particularly female-producing temperature, allows demethylation at the specific CpG sites of the promoter region which leads the temperature-specific expression of aromatase during gonad development. PMID:23762231

  12. Predicting DNA Methylation State of CpG Dinucleotide Using Genome Topological Features and Deep Networks

    NASA Astrophysics Data System (ADS)

    Wang, Yiheng; Liu, Tong; Xu, Dong; Shi, Huidong; Zhang, Chaoyang; Mo, Yin-Yuan; Wang, Zheng

    2016-01-01

    The hypo- or hyper-methylation of the human genome is one of the epigenetic features of leukemia. However, experimental approaches have only determined the methylation state of a small portion of the human genome. We developed deep learning based (stacked denoising autoencoders, or SdAs) software named “DeepMethyl” to predict the methylation state of DNA CpG dinucleotides using features inferred from three-dimensional genome topology (based on Hi-C) and DNA sequence patterns. We used the experimental data from immortalised myelogenous leukemia (K562) and healthy lymphoblastoid (GM12878) cell lines to train the learning models and assess prediction performance. We have tested various SdA architectures with different configurations of hidden layer(s) and amount of pre-training data and compared the performance of deep networks relative to support vector machines (SVMs). Using the methylation states of sequentially neighboring regions as one of the learning features, an SdA achieved a blind test accuracy of 89.7% for GM12878 and 88.6% for K562. When the methylation states of sequentially neighboring regions are unknown, the accuracies are 84.82% for GM12878 and 72.01% for K562. We also analyzed the contribution of genome topological features inferred from Hi-C. DeepMethyl can be accessed at http://dna.cs.usm.edu/deepmethyl/.

  13. A Nanoparticle Based Sp17 Peptide Vaccine Exposes New Immuno-Dominant and Species Cross-reactive B Cell Epitopes

    PubMed Central

    Xiang, Sue D.; Gao, Qian; Wilson, Kirsty L.; Heyerick, Arne; Plebanski, Magdalena

    2015-01-01

    Sperm protein antigen 17 (Sp17), expressed in primary as well as in metastatic lesions in >83% of patients with ovarian cancer, is a promising ovarian cancer vaccine candidate. Herein we describe the formulation of nanoparticle based vaccines based on human Sp17 (hSp17) sequence derived peptides, and map the immuno-dominant T cell and antibody epitopes induced using such formulations. The primary T and B cell immuno-dominant region within Sp17 was found to be the same when using biocompatible nanoparticle carriers or the conventional “mix-in” pro-inflammatory adjuvant CpG, both mapping to amino acids (aa) 111–142. However, delivery of hSp17111–142 as a nanoparticle conjugate promoted a number of new properties, changing the dominant antibody isotype induced from IgG2a to IgG1 and the fine specificity of the B cell epitopes within hSp17111–142, from an immuno-dominant region 134–142 aa for CpG, to region 121–138 aa for nanoparticles. Associated with this change in specificity was a substantial increase in antibody cross-reactivity between mouse and human Sp17. These results indicate conjugation of antigen to nanoparticles can have major effects on fine antigen specificity, which surprisingly could be beneficially used to increase the cross-reactivity of antibody responses. PMID:26529027

  14. Detection of Turner syndrome using X-chromosome inactivation specific differentially methylated CpG sites: A pilot study.

    PubMed

    Zhang, Qiang; Guo, Xiaohong; Tian, Tian; Wang, Teng; Li, Qiaoli; Wang, Lei; Liu, Yun; Xing, Qinghe; He, Lin; Zhao, Xinzhi

    2017-05-01

    Early diagnosis of Turner syndrome (TS) may improve preventive measures and treatment. X-chromosome inactivation specific differentially methylated CpG sites (XIDMSs) that are high methylated in inactive X chromosomes (Xi) and unmethylated in active X chromosomes (Xa) may be potential makers for TS detection. The candidate XIDMSs were screened from 9 male and 12 female DNA samples with normal karyotypes using the Illumina 450k array and validated by bisulfite sequencing PCR and pyrosequencing assay. X chromosome dosage was calculated according to the methylation level of multiple XIDMSs. Overall, 108 candidate XIDMSs were screened by the 450k array. Validations indicated that XIDMSs gathered and formed the X-chromosome inactivation specific differentially methylated regions (XIDMRs). Using 3 XIDMRs at SAT1, UXT and UTP14A loci, 36 TS, 22 normal female and 6 male samples were analyzed. Methylation levels of the 20 XIDMSs in the XIDMRs could distinguish between TS and normal female DNA samples, the X chromosome dosage was consistent with karyotyping data. Analyzing samples of 2 triple X syndrome and 3 Klinefelter syndrome patients suggested that this method could be used to detect X chromosome aneuploids other than TS. XIDMSs are widely spread along the X chromosome and might be effective markers for detection of TS and other X chromosome aneuploids. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Predicting DNA Methylation State of CpG Dinucleotide Using Genome Topological Features and Deep Networks.

    PubMed

    Wang, Yiheng; Liu, Tong; Xu, Dong; Shi, Huidong; Zhang, Chaoyang; Mo, Yin-Yuan; Wang, Zheng

    2016-01-22

    The hypo- or hyper-methylation of the human genome is one of the epigenetic features of leukemia. However, experimental approaches have only determined the methylation state of a small portion of the human genome. We developed deep learning based (stacked denoising autoencoders, or SdAs) software named "DeepMethyl" to predict the methylation state of DNA CpG dinucleotides using features inferred from three-dimensional genome topology (based on Hi-C) and DNA sequence patterns. We used the experimental data from immortalised myelogenous leukemia (K562) and healthy lymphoblastoid (GM12878) cell lines to train the learning models and assess prediction performance. We have tested various SdA architectures with different configurations of hidden layer(s) and amount of pre-training data and compared the performance of deep networks relative to support vector machines (SVMs). Using the methylation states of sequentially neighboring regions as one of the learning features, an SdA achieved a blind test accuracy of 89.7% for GM12878 and 88.6% for K562. When the methylation states of sequentially neighboring regions are unknown, the accuracies are 84.82% for GM12878 and 72.01% for K562. We also analyzed the contribution of genome topological features inferred from Hi-C. DeepMethyl can be accessed at http://dna.cs.usm.edu/deepmethyl/.

  16. Genome-wide DNA methylomes from discrete developmental stages reveal the predominance of non-CpG methylation in Tribolium castaneum.

    PubMed

    Song, Xiaowen; Huang, Fei; Liu, Juanjuan; Li, Chengjun; Gao, Shanshan; Wu, Wei; Zhai, Mengfan; Yu, Xiaojuan; Xiong, Wenfeng; Xie, Jia; Li, Bin

    2017-10-01

    Cytosine DNA methylation is a vital epigenetic regulator of eukaryotic development. Whether this epigenetic modification occurs in Tribolium castaneum has been controversial, its distribution pattern and functions have not been established. Here, using bisulphite sequencing (BS-Seq), we confirmed the existence of DNA methylation and described the methylation profiles of the four life stages of T. castaneum. In the T. castaneum genome, both symmetrical CpG and non-CpG methylcytosines were observed. Symmetrical CpG methylation, which was catalysed by DNMT1 and occupied a small part in T. castaneum methylome, was primarily enriched in gene bodies and was positively correlated with gene expression levels. Asymmetrical non-CpG methylation, which was predominant in the methylome, was strongly concentrated in intergenic regions and introns but absent from exons. Gene body methylation was negatively correlated with gene expression levels. The distribution pattern and functions of this type of methylation were similar only to the methylome of Drosophila melanogaster, which further supports the existence of a novel methyltransferase in the two species responsible for this type of methylation. This first life-cycle methylome of T. castaneum reveals a novel and unique methylation pattern, which will contribute to the further understanding of the variety and functions of DNA methylation in eukaryotes. © The Author 2017. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  17. Aberrant DNA methylation at genes associated with a stem cell-like phenotype in cholangiocarcinoma tumours

    PubMed Central

    Dai, Wei; Siddiq, Afshan; Walley, Andrew J; Limpaiboon, Temduang; Brown, Robert

    2013-01-01

    Genetic abnormalities of cholangiocarcinoma have been widely studied; however, epigenomic changes related to cholangiocarcinogenesis have been less well characterised. We have profiled the DNA methylomes of 28 primary cholangiocarcinoma and six matched adjacent normal tissues using Infinium’s HumanMethylation27 BeadChips with the aim of identifying gene sets aberrantly epigenetically regulated in this tumour type. Using a linear model for microarray data we identified 1610 differentially methylated autosomal CpG sites with 809 CpG sites (representing 603 genes) being hypermethylated and 801 CpG sites (representing 712 genes) being hypomethylated in cholangiocarcinoma versus adjacent normal tissues (false discovery rate ≤ 0.05). Gene ontology and gene set enrichment analyses identified gene sets significantly associated with hypermethylation at linked CpG sites in cholangiocarcinoma including homeobox genes and target genes of PRC2, EED, SUZ12 and histone H3 trimethylation at lysine 27. We confirmed frequent hypermethylation at the homeobox genes HOXA9 and HOXD9 by bisulfite pyrosequencing in a larger cohort of cholangiocarcinoma (n = 102). Our findings indicate a key role for hypermethylation of multiple CpG sites at genes associated with a stem cell-like phenotype as a common molecular aberration in cholangiocarcinoma. These data have implications for cholangiocarcinogenesis, as well as possible novel treatment options using histone methyltransferase inhibitors. PMID:24089088

  18. DNA methylation profiles of donor nuclei cells and tissues of cloned bovine fetuses.

    PubMed

    Kremenskoy, Maksym; Kremenska, Yuliya; Suzuki, Masako; Imai, Kei; Takahashi, Seiya; Hashizume, Kazuyoshi; Yagi, Shintaro; Shiota, Kunio

    2006-04-01

    Methylation of DNA in CpG islands plays an important role during fetal development and differentiation because CpG islands are preferentially located in upstream regions of mammalian genomic DNA, including the transcription start site of housekeeping genes and are also associated with tissue-specific genes. Somatic nuclear transfer (NT) technology has been used to generate live clones in numerous mammalian species, but only a low percentage of nuclear transferred animals develop to term. Abnormal epigenetic changes in the CpG islands of donor nuclei after nuclear transfer could contribute to a high rate of abortion during early gestation and increase perinatal death. These changes have yet to be explored. Thus, we investigated the genome-wide DNA methylation profiles of CpG islands in nuclei donor cells and NT animals. Using Restriction Landmark Genomic Scanning (RLGS), we showed, for the first time, the epigenetic profile formation of tissues from NT bovine fetuses produced from cumulus cells. From approximately 2600 unmethylated NotI sites visualized on the RLGS profile, at least 35 NotI sites showed different methylation statuses. Moreover, we proved that fetal and placental tissues from artificially inseminated and cloned cattle have tissue-specific differences in the genome-wide methylation profiles of the CpG islands. We also found that possible abnormalities occurred in the fetal brain and placental tissues of cloned animals.

  19. The influence of providing a clinical practice guideline on dental students' decision making.

    PubMed

    van der Sanden, Wil J M; Mettes, Dirk G; Plasschaert, Alphons J M; Mulder, Jan; Verdonschot, Emiel H

    2004-02-01

    The aim of this study was to assess the effect of the provision of a clinical practice guideline (CPG) on dental students' decisions to remove asymptomatic, impacted lower third molars. All dental students, who in 2001 were in the 3rd, 4th or 5th (final) year of their study at the Nijmegen College of Dental Sciences, were invited to participate. A pre-test-post-test control group design was used. Given 36 patient cases, all dental students were asked to assess the need for removal of asymptomatic, impacted lower third molars. All pre-test respondents were randomly allocated to the control or intervention group. After the provision of a CPG to the intervention group, both groups were asked to assess the same cases again. Frequencies of decisions to remove the third molars were calculated. Chi-square tests and anova were used to test the influence of study year and gender on the drop-out rate and on the effect of the provision of a CPG on students' treatment decisions. The decrease in indications to remove third molars by the intervention group was statistically significant (P < 0.05). In the control group, no significant decrease was observed. It was concluded that the provision of a CPG significantly influences dental students' decision making about treatment in a third-molar decision task. Students who used the CPG showed more guideline-conformed decision making.

  20. Response of immune response genes to adjuvants poly [di(sodium carboxylatoethylphenoxy)phosphazene] (PCEP), CpG oligodeoxynucleotide and emulsigen at intradermal injection site in pigs.

    PubMed

    Magiri, R B; Lai, K; Chaffey, A M; Wilson, H L; Berry, W E; Szafron, M L; Mutwiri, G K

    2016-07-01

    Understanding the mechanisms by which adjuvants mediate their effects provide critical information on how innate immunity influences the development of adaptive immunity. Despite being a critical vaccine component, the mechanisms by which adjuvants mediate their effects are not fully understood and this is especially true when they are used in large animals. This lack of understanding limits our ability to design effective vaccines. In the present study, we administered polyphosphazene (PCEP), CpG oligodeoxynucleotides (CpG), emulsigen or saline via an intradermal injection into pigs and assessed the impact on the expression of reported 'adjuvant response genes' over time. CpG induced a strong upregulation of the chemokine CXL10 several 'Interferon Response Genes', as well as TNFα, and IL-10, and a down-regulation of IL-17 genes. Emulsigen upregulated expression of chemokines CCL2 and CCL5, proinflammatory cytokines IL-6 and TNFα, as well as TLR9, and several IFN response genes. PCEP induced the expression of chemokine CCL2 and proinflammatory cytokine IL-6. These results suggest that emulsigen and CpG may promote recruitment of innate immune cells and Th1 type cytokine production but that PCEP may promote a Th-2 type immune response through the induction of IL-6, an inducer of B cell activity and differentiation. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. Does Epileptiform Activity Represent a Failure of Neuromodulation to Control Central Pattern Generator-Like Neocortical Behavior?

    PubMed Central

    Traub, Roger D.; Whittington, Miles A.; Hall, Stephen P.

    2017-01-01

    Rhythmic motor patterns in invertebrates are often driven by specialized “central pattern generators” (CPGs), containing small numbers of neurons, which are likely to be “identifiable” in one individual compared with another. The dynamics of any particular CPG lies under the control of modulatory substances, amines, or peptides, entering the CPG from outside it, or released by internal constituent neurons; consequently, a particular CPG can generate a given rhythm at different frequencies and amplitudes, and perhaps even generate a repertoire of distinctive patterns. The mechanisms exploited by neuromodulators in this respect are manifold: Intrinsic conductances (e.g., calcium, potassium channels), conductance state of postsynaptic receptors, degree of plasticity, and magnitude and kinetics of transmitter release can all be affected. The CPG concept has been generalized to vertebrate motor pattern generating circuits (e.g., for locomotion), which may contain large numbers of neurons – a construct that is sensible, if there is enough redundancy: that is, the large number of neurons consists of only a small number of classes, and the cells within any one class act stereotypically. Here we suggest that CPG and modulator ideas may also help to understand cortical oscillations, normal ones, and particularly transition to epileptiform pathology. Furthermore, in the case illustrated, the mechanism of the transition appears to be an exaggerated form of a normal modulatory action used to influence sensory processing. PMID:29093667

  2. RAD tag sequencing as a source of SNP markers in Cynara cardunculus L

    PubMed Central

    2012-01-01

    Background The globe artichoke (Cynara cardunculus L. var. scolymus) genome is relatively poorly explored, especially compared to those of the other major Asteraceae crops sunflower and lettuce. No SNP markers are in the public domain. We have combined the recently developed restriction-site associated DNA (RAD) approach with the Illumina DNA sequencing platform to effect the rapid and mass discovery of SNP markers for C. cardunculus. Results RAD tags were sequenced from the genomic DNA of three C. cardunculus mapping population parents, generating 9.7 million reads, corresponding to ~1 Gbp of sequence. An assembly based on paired ends produced ~6.0 Mbp of genomic sequence, separated into ~19,000 contigs (mean length 312 bp), of which ~21% were fragments of putative coding sequence. The shared sequences allowed for the discovery of ~34,000 SNPs and nearly 800 indels, equivalent to a SNP frequency of 5.6 per 1,000 nt, and an indel frequency of 0.2 per 1,000 nt. A sample of heterozygous SNP loci was mapped by CAPS assays and this exercise provided validation of our mining criteria. The repetitive fraction of the genome had a high representation of retrotransposon sequence, followed by simple repeats, AT-low complexity regions and mobile DNA elements. The genomic k-mers distribution and CpG rate of C. cardunculus, compared with data derived from three whole genome-sequenced dicots species, provided a further evidence of the random representation of the C. cardunculus genome generated by RAD sampling. Conclusion The RAD tag sequencing approach is a cost-effective and rapid method to develop SNP markers in a highly heterozygous species. Our approach permitted to generate a large and robust SNP datasets by the adoption of optimized filtering criteria. PMID:22214349

  3. Context and meter enhance long-range planning in music performance

    PubMed Central

    Mathias, Brian; Pfordresher, Peter Q.; Palmer, Caroline

    2015-01-01

    Neural responses demonstrate evidence of resonance, or oscillation, during the production of periodic auditory events. Music contains periodic auditory events that give rise to a sense of beat, which in turn generates a sense of meter on the basis of multiple periodicities. Metrical hierarchies may aid memory for music by facilitating similarity-based associations among sequence events at different periodic distances that unfold in longer contexts. A fundamental question is how metrical associations arising from a musical context influence memory during music performance. Longer contexts may facilitate metrical associations at higher hierarchical levels more than shorter contexts, a prediction of the range model, a formal model of planning processes in music performance (Palmer and Pfordresher, 2003; Pfordresher et al., 2007). Serial ordering errors, in which intended sequence events are produced in incorrect sequence positions, were measured as skilled pianists performed musical pieces that contained excerpts embedded in long or short musical contexts. Pitch errors arose from metrically similar positions and further sequential distances more often when the excerpt was embedded in long contexts compared to short contexts. Musicians’ keystroke intensities and error rates also revealed influences of metrical hierarchies, which differed for performances in long and short contexts. The range model accounted for contextual effects and provided better fits to empirical findings when metrical associations between sequence events were included. Longer sequence contexts may facilitate planning during sequence production by increasing conceptual similarity between hierarchically associated events. These findings are consistent with the notion that neural oscillations at multiple periodicities may strengthen metrical associations across sequence events during planning. PMID:25628550

  4. Evolutionary pattern of mutation in the factor IX genes of great apes: How does it compare to the pattern of recent germline mutation in patients with hemophilia B?

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Grouse, L.H.; Ketterling, R.P.; Sommer, S.S.

    Most mutations causing hemophilia B have arisen within the past 150 years. By correcting for multiple biases, the underlying rates of spontaneous germline mutation have been estimated in the factor IX gene. From these rates, an underlying pattern of mutation has emerged. To determine if this pattern compares to a underlying pattern found in the great apes, sequence changes were determined in intronic regions of the factor IX gene. The following species were studied: Gorilla gorilla, Pan troglodytes (chimpanzee), Pongo pygmacus (orangutan) and Homo sapiens. Intronic sequences at least 200 bp from a splice junction were randomly chosen, amplified bymore » cross-species PCR, and sequenced. These regions are expected to be subject to little if any selective pressure. Early diverged species of Old World monkeys were also studied to help determine the direction of mutational changes. A total of 62 sequence changes were observed. Initial data suggest that the average pattern since evolution of the great apes has a paucity of transitions at CpG dinucleotides and an excess of microinsertions to microdeletions when compared to the pattern observed in humans during the past 150 years (p<.05). A larger study is in progress to confirm these results.« less

  5. Analysis of alkaptonuria (AKU) mutations and polymorphisms reveals that the CCC sequence motif is a mutational hot spot in the homogentisate 1,2 dioxygenase gene (HGO).

    PubMed Central

    Beltrán-Valero de Bernabé, D; Jimenez, F J; Aquaron, R; Rodríguez de Córdoba, S

    1999-01-01

    We recently showed that alkaptonuria (AKU) is caused by loss-of-function mutations in the homogentisate 1,2 dioxygenase gene (HGO). Herein we describe haplotype and mutational analyses of HGO in seven new AKU pedigrees. These analyses identified two novel single-nucleotide polymorphisms (INV4+31A-->G and INV11+18A-->G) and six novel AKU mutations (INV1-1G-->A, W60G, Y62C, A122D, P230T, and D291E), which further illustrates the remarkable allelic heterogeneity found in AKU. Reexamination of all 29 mutations and polymorphisms thus far described in HGO shows that these nucleotide changes are not randomly distributed; the CCC sequence motif and its inverted complement, GGG, are preferentially mutated. These analyses also demonstrated that the nucleotide substitutions in HGO do not involve CpG dinucleotides, which illustrates important differences between HGO and other genes for the occurrence of mutation at specific short-sequence motifs. Because the CCC sequence motifs comprise a significant proportion (34.5%) of all mutated bases that have been observed in HGO, we conclude that the CCC triplet is a mutational hot spot in HGO. PMID:10205262

  6. Methylation-sensitive amplified polymorphism-based genome-wide analysis of cytosine methylation profiles in Nicotiana tabacum cultivars.

    PubMed

    Jiao, J; Wu, J; Lv, Z; Sun, C; Gao, L; Yan, X; Cui, L; Tang, Z; Yan, B; Jia, Y

    2015-11-26

    This study aimed to investigate cytosine methylation profiles in different tobacco (Nicotiana tabacum) cultivars grown in China. Methylation-sensitive amplified polymorphism was used to analyze genome-wide global methylation profiles in four tobacco cultivars (Yunyan 85, NC89, K326, and Yunyan 87). Amplicons with methylated C motifs were cloned by reamplified polymerase chain reaction, sequenced, and analyzed. The results show that geographical location had a greater effect on methylation patterns in the tobacco genome than did sampling time. Analysis of the CG dinucleotide distribution in methylation-sensitive polymorphic restriction fragments suggested that a CpG dinucleotide cluster-enriched area is a possible site of cytosine methylation in the tobacco genome. The sequence alignments of the Nia1 gene (that encodes nitrate reductase) in Yunyan 87 in different regions indicate that a C-T transition might be responsible for the tobacco phenotype. T-C nucleotide replacement might also be responsible for the tobacco phenotype and may be influenced by geographical location.

  7. Insights into social insects from the genome of the honeybee Apis mellifera

    PubMed Central

    2007-01-01

    Here we report the genome sequence of the honeybee Apis mellifera, a key model for social behaviour and essential to global ecology through pollination. Compared with other sequenced insect genomes, the A. mellifera genome has high A+T and CpG contents, lacks major transposon families, evolves more slowly, and is more similar to vertebrates for circadian rhythm, RNA interference and DNA methylation genes, among others. Furthermore, A. mellifera has fewer genes for innate immunity, detoxification enzymes, cuticle-forming proteins and gustatory receptors, more genes for odorant receptors, and novel genes for nectar and pollen utilization, consistent with its ecology and social organization. Compared to Drosophila, genes in early developmental pathways differ in Apis, whereas similarities exist for functions that differ markedly, such as sex determination, brain function and behaviour. Population genetics suggests a novel African origin for the species A. mellifera and insights into whether Africanized bees spread throughout the New World via hybridization or displacement. PMID:17073008

  8. Genome-wide methylation analysis identified sexually dimorphic methylated regions in hybrid tilapia

    PubMed Central

    Wan, Zi Yi; Xia, Jun Hong; Lin, Grace; Wang, Le; Lin, Valerie C. L.; Yue, Gen Hua

    2016-01-01

    Sexual dimorphism is an interesting biological phenomenon. Previous studies showed that DNA methylation might play a role in sexual dimorphism. However, the overall picture of the genome-wide methylation landscape in sexually dimorphic species remains unclear. We analyzed the DNA methylation landscape and transcriptome in hybrid tilapia (Oreochromis spp.) using whole genome bisulfite sequencing (WGBS) and RNA-sequencing (RNA-seq). We found 4,757 sexually dimorphic differentially methylated regions (DMRs), with significant clusters of DMRs located on chromosomal regions associated with sex determination. CpG methylation in promoter regions was negatively correlated with the gene expression level. MAPK/ERK pathway was upregulated in male tilapia. We also inferred active cis-regulatory regions (ACRs) in skeletal muscle tissues from WGBS datasets, revealing sexually dimorphic cis-regulatory regions. These results suggest that DNA methylation contribute to sex-specific phenotypes and serve as resources for further investigation to analyze the functions of these regions and their contributions towards sexual dimorphisms. PMID:27782217

  9. The Replication Focus Targeting Sequence (RFTS) Domain Is a DNA-competitive Inhibitor of Dnmt1

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Syeda, Farisa; Fagan, Rebecca L.; Wean, Matthew

    Dnmt1 (DNA methyltransferase 1) is the principal enzyme responsible for maintenance of cytosine methylation at CpG dinucleotides in the mammalian genome. The N-terminal replication focus targeting sequence (RFTS) domain of Dnmt1 has been implicated in subcellular localization, protein association, and catalytic function. However, progress in understanding its function has been limited by the lack of assays for and a structure of this domain. Here, we show that the naked DNA- and polynucleosome-binding activities of Dnmt1 are inhibited by the RFTS domain, which functions by virtue of binding the catalytic domain to the exclusion of DNA. Kinetic analysis with a fluorogenicmore » DNA substrate established the RFTS domain as a 600-fold inhibitor of Dnmt1 enzymatic activity. The crystal structure of the RFTS domain reveals a novel fold and supports a mechanism in which an RFTS-targeted Dnmt1-binding protein, such as Uhrf1, may activate Dnmt1 for DNA binding.« less

  10. HMG-CoA lyase (HL) gene: Cloning and characterization of the 5{prime} end of the mouse gene, gene targeting in ES cells, and demonstration of large deletions in three HL-deficient patients

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, S.; Robert, M.F.; Mitchell, G.A.

    1994-09-01

    3-hydroxy-3-methylglutaryl CoA lyase (HL) is a mitochondrial matrix enzyme which catalyzes the last step of leucine catabolism and of ketogenesis. Autosomal recessive HL deficiency in humans results in episodes of hypoglycemia and coma. We are interested in the pathophysiology of HL deficiency as a model for both amino acid and fatty acid inborn errors. We have cloned the human and mouse HL genes. In order to analyze the 5{prime} nontranslated region of mouse HL gene, we cloned and sequenced a 1.8 kb fragment containing the 5{prime} extremity including exon 1 and about 1.6 kb of 5{prime} nontranslated sequence. The regionmore » surrounding exon 1 is CpG-rich (66.4%). Using the criteria of West, the Observed/Expected ratio for CpG dinucleotides is 0.7 ({ge}0.6 is consistent with a CpG island). We are carrying out primer extension and RNase protection experiments to determine the transcription initiation site. We constructed a gene targeting vector by introducing the neomycin resistance gene into exon 2 of a 7.5 kb genomic subclone of the mouse HL gene. Targeting was performed by electroporating 10 mg linearized vector into 10{sup 7} ES cells and selecting for 12 days with G418. 5/228 colonies (2.2%) had homologous recombination as shown by PCR screening and Southern analysis. We are microinjecting the 5 targeted clones into blastocysts to create an HL-deficient mouse. To date we have obtained two chimeras with contributions of 95% and 55% from 129, by coat color estimates. Three of 27 (11%) of the HL-deficient patients studied were suggested by genomic Southern analysis to be homozygous for large intragenic deletions. We confirmed this and defined the boundaries using exonic PCR.« less

  11. Profile analysis and prediction of tissue-specific CpG island methylation classes

    PubMed Central

    2009-01-01

    Background The computational prediction of DNA methylation has become an important topic in the recent years due to its role in the epigenetic control of normal and cancer-related processes. While previous prediction approaches focused merely on differences between methylated and unmethylated DNA sequences, recent experimental results have shown the presence of much more complex patterns of methylation across tissues and time in the human genome. These patterns are only partially described by a binary model of DNA methylation. In this work we propose a novel approach, based on profile analysis of tissue-specific methylation that uncovers significant differences in the sequences of CpG islands (CGIs) that predispose them to a tissue- specific methylation pattern. Results We defined CGI methylation profiles that separate not only between constitutively methylated and unmethylated CGIs, but also identify CGIs showing a differential degree of methylation across tissues and cell-types or a lack of methylation exclusively in sperm. These profiles are clearly distinguished by a number of CGI attributes including their evolutionary conservation, their significance, as well as the evolutionary evidence of prior methylation. Additionally, we assess profile functionality with respect to the different compartments of protein coding genes and their possible use in the prediction of DNA methylation. Conclusion Our approach provides new insights into the biological features that determine if a CGI has a functional role in the epigenetic control of gene expression and the features associated with CGI methylation susceptibility. Moreover, we show that the ability to predict CGI methylation is based primarily on the quality of the biological information used and the relationships uncovered between different sources of knowledge. The strategy presented here is able to predict, besides the constitutively methylated and unmethylated classes, two more tissue specific methylation classes conserving the accuracy provided by leading binary methylation classification methods. PMID:19383127

  12. CpG island methylator phenotype is associated with the efficacy of sequential oxaliplatin- and irinotecan-based chemotherapy and EGFR-related gene mutation in Japanese patients with metastatic colorectal cancer.

    PubMed

    Zhang, Xiaofei; Shimodaira, Hideki; Soeda, Hiroshi; Komine, Keigo; Takahashi, Hidekazu; Ouchi, Kota; Inoue, Masahiro; Takahashi, Masanobu; Takahashi, Shin; Ishioka, Chikashi

    2016-12-01

    The CpG island methylator phenotype (CIMP) with multiple promoter methylated loci has been observed in a subset of human colorectal cancer (CRC) cases. CIMP status, which is closely associated with specific clinicopathological and molecular characteristics, is considered a potential predictive biomarker for efficacy of cancer treatment. However, the relationship between the effect of standard chemotherapy, including cytotoxic drugs and anti-epidermal growth factor receptor (EGFR) antibodies, and CIMP status has not been elucidated. In 125 metastatic colorectal cancer (mCRC) patients, we investigated how clinical outcome of chemotherapy was related to CIMP status as detected by methylation-specific PCR (MSP) and to genetic status in five EGFR-related genes (KRAS, BRAF, PIK3CA, NRAS, and AKT1) as detected by direct sequencing. CIMP-positive status was significantly associated with proximal tumor location and peritoneum metastasis (all P values <0.05). The progression-free survival of patients with CIMP-positive tumors receiving sequential therapy with FOLFOX as the first-line treatment followed by irinotecan-based therapy as the second-line treatment (median = 6.6 months) was inferior to that of such patients receiving the reverse sequence (median = 15.2 months; P = 0.043). Furthermore, CIMP-positive tumors showed higher mutation frequencies for the five EGFR-related genes (74.1 %) than the CIMP-negative tumors did (50.0 %). Among the KRAS wild-type tumors, CIMP-positive tumors were associated with a worse clinical outcome than CIMP-negative tumors following anti-EGFR antibody therapy. Sequential FOLFOX followed by an irinotecan-based regimen is unfavorable in patients with CIMP-positive tumors. High frequencies of mutation in EGFR-related genes in CIMP-positive tumors may cause the lower response to anti-EGFR antibody therapy seen in patients with wild-type KRAS and CIMP-positive tumors.

  13. Potential interaction between the GARS-AIRS-GART Gene and CP2/LBP-1c/LSF transcription factor in Down syndrome-related Alzheimer disease.

    PubMed

    Banerjee, Disha; Nandagopal, Krishnadas

    2007-12-01

    (1) GARS-AIRS-GART is an important candidate gene in studies of Down syndrome (DS)-related Alzheimer's disease (AD), due to its chromosomal localization (21q22.1) in the Down syndrome critical region, involvement in de novo purine biosynthesis, and over-expression in DS brain. The aim of this study was to identify factor(s) likely to enhance transcription of GARS-AIRS-GART in DS-related AD. (2) Based on a bio-informatics approach, the PromoterInspector, Promoter Scan II, and EBI toolbox CpG plot software programs were used to identify GARS-AIRS-GART sequences important for gene transcription. Transcription factor binding motifs within these regions were mapped with the help of the MatInspector and TFSEARCH programs. Factors implicated in neurodevelopment or neurodegeneration were the focus of attention, and mining of human (T1Dbase) and murine (GNF) expression databases revealed information on the regional distribution of these factors and their relative abundance vis-a-vis GARS-AIRS-GART. (3) The Leader-binding protein 1-c (LBP-1c/CP2/LSF) emerged as a promising candidate from these studies, as MatInspector and TFSEARCH analyses revealed a total of four CP2 binding sites with potential for functional interaction(s) within the promoter and CpG islands of GARS-AIRS-GART. Furthermore, two of these sites harbor sequences for methylation-sensitive restriction enzymes, which suggest that methylation status may, in part, regulate CP2-mediated transcription of GARS-AIRS-GART. A search of T1Dbase and GNF expression databases reveals co-expression of CP2 and GARS-AIRS-GART in brain regions relevant to DS-related AD. (4) The virtual screen identified CP2/LBP-1c/LSF as a factor that likely mediates enhanced transcription of GARS-AIRS-GART in DS-related AD.

  14. PBOV1 Is a Human De Novo Gene with Tumor-Specific Expression That Is Associated with a Positive Clinical Outcome of Cancer

    PubMed Central

    Samusik, Nikolay; Krukovskaya, Larisa; Meln, Irina; Shilov, Evgeny; Kozlov, Andrey P.

    2013-01-01

    PBOV1 is a known human protein-coding gene with an uncharacterized function. We have previously found that PBOV1 lacks orthologs in non-primate genomes and is expressed in a wide range of tumor types. Here we report that PBOV1 protein-coding sequence is human-specific and has originated de novo in the primate evolution through a series of frame-shift and stop codon mutations. We profiled PBOV1 expression in multiple cancer and normal tissue samples and found that it was expressed in 19 out of 34 tumors of various origins but completely lacked expression in any of the normal adult or fetal human tissues. We found that, unlike the cancer/testis antigens that are typically controlled by CpG island-containing promoters, PBOV1 was expressed from a GC-poor TATA-containing promoter which was not influenced by CpG demethylation and was inactive in testis. Our analysis of public microarray data suggests that PBOV1 activation in tumors could be dependent on the Hedgehog signaling pathway. Despite the recent de novo origin and the lack of identifiable functional signatures, a missense SNP in the PBOV1 coding sequence has been previously associated with an increased risk of breast cancer. Using publicly available microarray datasets, we found that high levels of PBOV1 expression in breast cancer and glioma samples were significantly associated with a positive outcome of the cancer disease. We also found that PBOV1 was highly expressed in primary but not in recurrent high-grade gliomas, suggesting the presence of a negative selection against PBOV1-expressing cancer cells. Our findings could contribute to the understanding of the mechanisms behind de novo gene origin and the possible role of tumors in this process. PMID:23418531

  15. Context-Dependent Learning in People With Parkinson's Disease.

    PubMed

    Lee, Ya-Yun; Winstein, Carolee J; Gordon, James; Petzinger, Giselle M; Zelinski, Elizabeth M; Fisher, Beth E

    2016-01-01

    Context-dependent learning is a phenomenon in which people demonstrate superior performance in the context in which they originally learned a skill but perform less well in a novel context. This study investigated context-dependent learning in people with Parkinson's disease (PD) and age-matched nondisabled adults. All participants practiced 3 finger sequences, each embedded within a unique context (colors and locations on a computer screen). One day after practice, the participants were tested either under the sequence-context associations remained the same as during practice, or the sequence-context associations were changed (SWITCH). Compared with nondisabled adults, people with PD demonstrated significantly greater decrement in performance (especially movement time) under the SWITCH condition, suggesting that individuals with PD are more context dependent than nondisabled adults.

  16. A comparison of the effects of temporary hippocampal lesions on single and dual context versions of the olfactory sequence memory task.

    PubMed

    Sill, Orriana C; Smith, David M

    2012-08-01

    In recent years, many animal models of memory have focused on one or more of the various components of episodic memory. For example, the odor sequence memory task requires subjects to remember individual items and events (the odors) and the temporal aspects of the experience (the sequence of odor presentation). The well-known spatial context coding function of the hippocampus, as exemplified by place cell firing, may reflect the "where" component of episodic memory. In the present study, we added a contextual component to the odor sequence memory task by training rats to choose the earlier odor in one context and the later odor in another context and we compared the effects of temporary hippocampal lesions on performance of the original single context task and the new dual context task. Temporary lesions significantly impaired the single context task, although performance remained significantly above chance levels. In contrast, performance dropped all the way to chance when temporary lesions were used in the dual context task. These results demonstrate that rats can learn a dual context version of the odor sequence learning task that requires the use of contextual information along with the requirement to remember the "what" and "when" components of the odor sequence. Moreover, the addition of the contextual component made the task fully dependent on the hippocampus.

  17. Efficacy of QCDCR formulated CpG ODN 2007 in Nile tilapia against Streptococcus iniae and identification of upregulated genes

    USDA-ARS?s Scientific Manuscript database

    The potential of using a QCDCR (quilA:cholesterol:dimethyl dioctadecyl ammonium bromide:carbopol:R1005 glycolipid) formulated CpG oligodeoxynucleotide (ODN), ODN 2007, to confer protection in Nile tilapia against Streptococcus iniae infection was evaluated in this study. At two days post treatment, ...

  18. CpG DNA: A pathogenic factor in systemic lupus erythematosus?

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Krieg, A.M.

    1995-11-01

    Systemic lupus erythematosus (SLE) is a multifactorial disease of unknown etiology. Characteristic features of SLE include (1) polyclonal B cell activation, (2) overexpression of the immune stimulatory cytokine interleukin-6 (IL-6), (3) defective tolerance to self antigens, and (4) production of anti-DNA antibodies (Ab). Bacterial infection has been suspected as a triggering factor for lupus. Bacterial DNA differs from vertebrate DNA in the frequency and methylation of CpG dinucleotides. These CpG motifs in bacterial DNA induce a variety of immune effects, including (1) polyclonal activation of murine and human B cells, (2) IL-6 secretion, and (3) resistance to apoptosis, thereby potentiallymore » allowing the survival of autoreactive cells. These results suggest that microbial DNA could therefore be a pathogenic factor in SLE. SLE patients have elevated levels of circulating plasma DNA which is reportedly enriched in hypomethylated CpGs. Genomic DNA is also hypomethylated in SLE. The purpose of this review is to summarize the immune effects of CpG motifs and to present the evidence for their possible involvement in the pathogenesis of SLE. 77 refs.« less

  19. CpG Methylation Analysis—Current Status of Clinical Assays and Potential Applications in Molecular Diagnostics

    PubMed Central

    Sepulveda, Antonia R.; Jones, Dan; Ogino, Shuji; Samowitz, Wade; Gulley, Margaret L.; Edwards, Robin; Levenson, Victor; Pratt, Victoria M.; Yang, Bin; Nafa, Khedoudja; Yan, Liying; Vitazka, Patrick

    2009-01-01

    Methylation of CpG islands in gene promoter regions is a major molecular mechanism of gene silencing and underlies both cancer development and progression. In molecular oncology, testing for the CpG methylation of tissue DNA has emerged as a clinically useful tool for tumor detection, outcome prediction, and treatment selection, as well as for assessing the efficacy of treatment with the use of demethylating agents and monitoring for tumor recurrence. In addition, because CpG methylation occurs early in pre-neoplastic tissues, methylation tests may be useful as markers of cancer risk in patients with either infectious or inflammatory conditions. The Methylation Working Group of the Clinical Practice Committee of the Association of Molecular Pathology has reviewed the current state of clinical testing in this area. We report here our summary of both the advantages and disadvantages of various methods, as well as the needs for standardization and reporting. We then conclude by summarizing the most promising areas for future clinical testing in cancer molecular diagnostics. PMID:19541921

  20. High sensitivity 5-hydroxymethylcytosine detection in Balb/C brain tissue.

    PubMed

    Davis, Theodore; Vaisvila, Romualdas

    2011-02-01

    DNA hydroxymethylation is a long known modification of DNA, but has recently become a focus in epigenetic research. Mammalian DNA is enzymatically modified at the 5(th) carbon position of cytosine (C) residues to 5-mC, predominately in the context of CpG dinucleotides. 5-mC is amenable to enzymatic oxidation to 5-hmC by the Tet family of enzymes, which are believed to be involved in development and disease. Currently, the biological role of 5-hmC is not fully understood, but is generating a lot of interest due to its potential as a biomarker. This is due to several groundbreaking studies identifying 5-hydroxymethylcytosine in mouse embryonic stem (ES) and neuronal cells. Research techniques, including bisulfite sequencing methods, are unable to easily distinguish between 5-mC and 5-hmC . A few protocols exist that can measure global amounts of 5-hydroxymethylcytosine in the genome, including liquid chromatography coupled with mass spectrometry analysis or thin layer chromatography of single nucleosides digested from genomic DNA. Antibodies that target 5-hydroxymethylcytosine also exist, which can be used for dot blot analysis, immunofluorescence, or precipitation of hydroxymethylated DNA, but these antibodies do not have single base resolution.In addition, resolution depends on the size of the immunoprecipitated DNA and for microarray experiments, depends on probe design. Since it is unknown exactly where 5-hydroxymethylcytosine exists in the genome or its role in epigenetic regulation, new techniques are required that can identify locus specific hydroxymethylation. The EpiMark 5-hmC and 5-mC Analysis Kit provides a solution for distinguishing between these two modifications at specific loci. The EpiMark 5-hmC and 5-mC Analysis Kit is a simple and robust method for the identification and quantitation of 5-methylcytosine and 5-hydroxymethylcytosine within a specific DNA locus. This enzymatic approach utilizes the differential methylation sensitivity of the isoschizomers MspI and HpaII in a simple 3-step protocol. Genomic DNA of interest is treated with T4-BGT, adding a glucose moeity to 5-hydroxymethylcytosine. This reaction is sequence-independent, therefore all 5-hmC will be glucosylated; unmodified or 5-mC containing DNA will not be affected. This glucosylation is then followed by restriction endonuclease digestion. MspI and HpaII recognize the same sequence (CCGG) but are sensitive to different methylation states. HpaII cleaves only a completely unmodified site: any modification (5-mC, 5-hmC or 5-ghmC) at either cytosine blocks cleavage. MspI recognizes and cleaves 5-mC and 5-hmC, but not 5-ghmC. The third part of the protocol is interrogation of the locus by PCR. As little as 20 ng of input DNA can be used. Amplification of the experimental (glucosylated and digested) and control (mock glucosylated and digested) target DNA with primers flanking a CCGG site of interest (100-200 bp) is performed. If the CpG site contains 5-hydroxymethylcytosine, a band is detected after glucosylation and digestion, but not in the non-glucosylated control reaction. Real time PCR will give an approximation of how much hydroxymethylcytosine is in this particular site. In this experiment, we will analyze the 5-hydroxymethylcytosine amount in a mouse Babl/C brain sample by end point PCR.

Top