Enhanced sensitivity of CpG island search and primer design based on predicted CpG island position.
Park, Hyun-Chul; Ahn, Eu-Ree; Jung, Ju Yeon; Park, Ji-Hye; Lee, Jee Won; Lim, Si-Keun; Kim, Won
2018-05-01
DNA methylation has important biological roles, such as gene expression regulation, as well as practical applications in forensics, such as in body fluid identification and age estimation. DNA methylation often occurs in the CpG site, and methylation within the CpG islands affects various cellular functions and is related to tissue-specific identification. Several programs have been developed to identify CpG islands; however, the size, location, and number of predicted CpG islands are not identical due to different search algorithms. In addition, they only provide structural information for predicted CpG islands without experimental information, such as primer design. We developed an analysis pipeline package, CpGPNP, to integrate CpG island prediction and primer design. CpGPNP predicts CpG islands more accurately and sensitively than other programs, and designs primers easily based on the predicted CpG island locations. The primer design function included standard, bisulfite, and methylation-specific PCR to identify the methylation of particular CpG sites. In this study, we performed CpG island prediction on all chromosomes and compared CpG island search performance of CpGPNP with other CpG island prediction programs. In addition, we compared the position of primers designed for a specific region within the predicted CpG island using other bisulfite PCR primer programs. The primers designed by CpGPNP were used to experimentally verify the amplification of the target region of markers for body fluid identification and age estimation. CpGPNP is freely available at http://forensicdna.kr/cpgpnp/. Copyright © 2018 Elsevier B.V. All rights reserved.
CpG island mapping by epigenome prediction.
Bock, Christoph; Walter, Jörn; Paulsen, Martina; Lengauer, Thomas
2007-06-01
CpG islands were originally identified by epigenetic and functional properties, namely, absence of DNA methylation and frequent promoter association. However, this concept was quickly replaced by simple DNA sequence criteria, which allowed for genome-wide annotation of CpG islands in the absence of large-scale epigenetic datasets. Although widely used, the current CpG island criteria incur significant disadvantages: (1) reliance on arbitrary threshold parameters that bear little biological justification, (2) failure to account for widespread heterogeneity among CpG islands, and (3) apparent lack of specificity when applied to the human genome. This study is driven by the idea that a quantitative score of "CpG island strength" that incorporates epigenetic and functional aspects can help resolve these issues. We construct an epigenome prediction pipeline that links the DNA sequence of CpG islands to their epigenetic states, including DNA methylation, histone modifications, and chromatin accessibility. By training support vector machines on epigenetic data for CpG islands on human Chromosomes 21 and 22, we identify informative DNA attributes that correlate with open versus compact chromatin structures. These DNA attributes are used to predict the epigenetic states of all CpG islands genome-wide. Combining predictions for multiple epigenetic features, we estimate the inherent CpG island strength for each CpG island in the human genome, i.e., its inherent tendency to exhibit an open and transcriptionally competent chromatin structure. We extensively validate our results on independent datasets, showing that the CpG island strength predictions are applicable and informative across different tissues and cell types, and we derive improved maps of predicted "bona fide" CpG islands. The mapping of CpG islands by epigenome prediction is conceptually superior to identifying CpG islands by widely used sequence criteria since it links CpG island detection to their characteristic epigenetic and functional states. And it is superior to purely experimental epigenome mapping for CpG island detection since it abstracts from specific properties that are limited to a single cell type or tissue. In addition, using computational epigenetics methods we could identify high correlation between the epigenome and characteristics of the DNA sequence, a finding which emphasizes the need for a better understanding of the mechanistic links between genome and epigenome.
Prediction of CpG-island function: CpG clustering vs. sliding-window methods
2010-01-01
Background Unmethylated stretches of CpG dinucleotides (CpG islands) are an outstanding property of mammal genomes. Conventionally, these regions are detected by sliding window approaches using %G + C, CpG observed/expected ratio and length thresholds as main parameters. Recently, clustering methods directly detect clusters of CpG dinucleotides as a statistical property of the genome sequence. Results We compare sliding-window to clustering (i.e. CpGcluster) predictions by applying new ways to detect putative functionality of CpG islands. Analyzing the co-localization with several genomic regions as a function of window size vs. statistical significance (p-value), CpGcluster shows a higher overlap with promoter regions and highly conserved elements, at the same time showing less overlap with Alu retrotransposons. The major difference in the prediction was found for short islands (CpG islets), often exclusively predicted by CpGcluster. Many of these islets seem to be functional, as they are unmethylated, highly conserved and/or located within the promoter region. Finally, we show that window-based islands can spuriously overlap several, differentially regulated promoters as well as different methylation domains, which might indicate a wrong merge of several CpG islands into a single, very long island. The shorter CpGcluster islands seem to be much more specific when concerning the overlap with alternative transcription start sites or the detection of homogenous methylation domains. Conclusions The main difference between sliding-window approaches and clustering methods is the length of the predicted islands. Short islands, often differentially methylated, are almost exclusively predicted by CpGcluster. This suggests that CpGcluster may be the algorithm of choice to explore the function of these short, but putatively functional CpG islands. PMID:20500903
Predicting aberrant CpG island methylation
Feltus, F. A.; Lee, E. K.; Costello, J. F.; Plass, C.; Vertino, P. M.
2003-01-01
Epigenetic silencing associated with aberrant methylation of promoter region CpG islands is one mechanism leading to loss of tumor suppressor function in human cancer. Profiling of CpG island methylation indicates that some genes are more frequently methylated than others, and that each tumor type is associated with a unique set of methylated genes. However, little is known about why certain genes succumb to this aberrant event. To address this question, we used Restriction Landmark Genome Scanning to analyze the susceptibility of 1,749 unselected CpG islands to de novo methylation driven by overexpression of DNA cytosine-5-methyltransferase 1 (DNMT1). We found that although the overall incidence of CpG island methylation was increased in cells overexpressing DNMT1, not all loci were equally affected. The majority of CpG islands (69.9%) were resistant to de novo methylation, regardless of DNMT1 overexpression. In contrast, we identified a subset of methylation-prone CpG islands (3.8%) that were consistently hypermethylated in multiple DNMT1 overexpressing clones. Methylation-prone and methylation-resistant CpG islands were not significantly different with respect to size, C+G content, CpG frequency, chromosomal location, or promoter association. We used DNA pattern recognition and supervised learning techniques to derive a classification function based on the frequency of seven novel sequence patterns that was capable of discriminating methylation-prone from methylation-resistant CpG islands with 82% accuracy. The data indicate that CpG islands differ in their intrinsic susceptibility to de novo methylation, and suggest that the propensity for a CpG island to become aberrantly methylated can be predicted based on its sequence context. PMID:14519846
Predicting aberrant CpG island methylation.
Feltus, F A; Lee, E K; Costello, J F; Plass, C; Vertino, P M
2003-10-14
Epigenetic silencing associated with aberrant methylation of promoter region CpG islands is one mechanism leading to loss of tumor suppressor function in human cancer. Profiling of CpG island methylation indicates that some genes are more frequently methylated than others, and that each tumor type is associated with a unique set of methylated genes. However, little is known about why certain genes succumb to this aberrant event. To address this question, we used Restriction Landmark Genome Scanning to analyze the susceptibility of 1,749 unselected CpG islands to de novo methylation driven by overexpression of DNA cytosine-5-methyltransferase 1 (DNMT1). We found that although the overall incidence of CpG island methylation was increased in cells overexpressing DNMT1, not all loci were equally affected. The majority of CpG islands (69.9%) were resistant to de novo methylation, regardless of DNMT1 overexpression. In contrast, we identified a subset of methylation-prone CpG islands (3.8%) that were consistently hypermethylated in multiple DNMT1 overexpressing clones. Methylation-prone and methylation-resistant CpG islands were not significantly different with respect to size, C+G content, CpG frequency, chromosomal location, or promoter association. We used DNA pattern recognition and supervised learning techniques to derive a classification function based on the frequency of seven novel sequence patterns that was capable of discriminating methylation-prone from methylation-resistant CpG islands with 82% accuracy. The data indicate that CpG islands differ in their intrinsic susceptibility to de novo methylation, and suggest that the propensity for a CpG island to become aberrantly methylated can be predicted based on its sequence context.
The CpG island searcher: a new WWW resource.
Takai, Daiya; Jones, Peter A
2003-01-01
Clusters of CpG dinucleotides in GC rich regions of the genome called "CpG islands" frequently occur in the 5' ends of genes. Methylation of CpG islands plays a role in transcriptional silencing in higher organisms in certain situations. We have established a CpG-island-extraction algorithm, which we previously developed [Takai and Jones, 2002], on a web site which has a simple user interface to identify CpG islands from submitted sequences of up to 50kb. The web site determines the locations of CpG islands using parameters (lower limit of %GC, ObsCpG/ExpCpG, length) set by the user, to display the value of parameters on each CpG island, and provides a graphical map of CpG dinucleotide distribution and borders of CpG islands. A command-line version of the CpG islands searcher has also been developed for larger sequences. The CpG Island Searcher was applied to the latest sequence and mapping information of human chromosomes 20, 21 and 22, and a total of 2345 CpG islands were extracted and 534 (23%) of them contained first coding exons and 650 (28%) contained other exons. The CpG Island Searcher is available on the World Wide Web at http://www.cpgislands.com or http://www.uscnorris.com/cpgislands/cpg.cgi.
GaussianCpG: a Gaussian model for detection of CpG island in human genome sequences.
Yu, Ning; Guo, Xuan; Zelikovsky, Alexander; Pan, Yi
2017-05-24
As crucial markers in identifying biological elements and processes in mammalian genomes, CpG islands (CGI) play important roles in DNA methylation, gene regulation, epigenetic inheritance, gene mutation, chromosome inactivation and nuclesome retention. The generally accepted criteria of CGI rely on: (a) %G+C content is ≥ 50%, (b) the ratio of the observed CpG content and the expected CpG content is ≥ 0.6, and (c) the general length of CGI is greater than 200 nucleotides. Most existing computational methods for the prediction of CpG island are programmed on these rules. However, many experimentally verified CpG islands deviate from these artificial criteria. Experiments indicate that in many cases %G+C is < 50%, CpG obs /CpG exp varies, and the length of CGI ranges from eight nucleotides to a few thousand of nucleotides. It implies that CGI detection is not just a straightly statistical task and some unrevealed rules probably are hidden. A novel Gaussian model, GaussianCpG, is developed for detection of CpG islands on human genome. We analyze the energy distribution over genomic primary structure for each CpG site and adopt the parameters from statistics of Human genome. The evaluation results show that the new model can predict CpG islands efficiently by balancing both sensitivity and specificity over known human CGI data sets. Compared with other models, GaussianCpG can achieve better performance in CGI detection. Our Gaussian model aims to simplify the complex interaction between nucleotides. The model is computed not by the linear statistical method but by the Gaussian energy distribution and accumulation. The parameters of Gaussian function are not arbitrarily designated but deliberately chosen by optimizing the biological statistics. By using the pseudopotential analysis on CpG islands, the novel model is validated on both the real and artificial data sets.
A Hybrid Approach for CpG Island Detection in the Human Genome.
Yang, Cheng-Hong; Lin, Yu-Da; Chiang, Yi-Cheng; Chuang, Li-Yeh
2016-01-01
CpG islands have been demonstrated to influence local chromatin structures and simplify the regulation of gene activity. However, the accurate and rapid determination of CpG islands for whole DNA sequences remains experimentally and computationally challenging. A novel procedure is proposed to detect CpG islands by combining clustering technology with the sliding-window method (PSO-based). Clustering technology is used to detect the locations of all possible CpG islands and process the data, thus effectively obviating the need for the extensive and unnecessary processing of DNA fragments, and thus improving the efficiency of sliding-window based particle swarm optimization (PSO) search. This proposed approach, named ClusterPSO, provides versatile and highly-sensitive detection of CpG islands in the human genome. In addition, the detection efficiency of ClusterPSO is compared with eight CpG island detection methods in the human genome. Comparison of the detection efficiency for the CpG islands in human genome, including sensitivity, specificity, accuracy, performance coefficient (PC), and correlation coefficient (CC), ClusterPSO revealed superior detection ability among all of the test methods. Moreover, the combination of clustering technology and PSO method can successfully overcome their respective drawbacks while maintaining their advantages. Thus, clustering technology could be hybridized with the optimization algorithm method to optimize CpG island detection. The prediction accuracy of ClusterPSO was quite high, indicating the combination of CpGcluster and PSO has several advantages over CpGcluster and PSO alone. In addition, ClusterPSO significantly reduced implementation time.
Belshaw, Nigel J; Elliott, Giles O; Williams, Elizabeth A; Bradburn, David M; Mills, Sarah J; Mathers, John C; Johnson, Ian T
2004-09-01
Hypermethylation of cytosine residues in the CpG islands of tumor suppressor genes is a key mechanism of colorectal carcinogenesis. Detection and quantification of CpG island methylation in human DNA isolated from stools might provide a novel strategy for the detection and investigation of colorectal neoplasia. To explore the feasibility of this approach, colorectal biopsies and fecal samples were obtained from 32 patients attending for colonoscopy or surgery, who were found to have adenomatous polyps, colorectal cancer, or no evidence of neoplasia. A further 18 fecal samples were obtained from healthy volunteers, with no bowel symptoms. Isolated DNA was modified with sodium bisulfite and analyzed by methylation-specific PCR and combined bisulfite restriction analysis for CpG island methylation of ESR1, MGMT, HPP1, p16(INK4a), APC, and MLH1. CpG island methylation was readily detectable in both mucosal and fecal DNA with methylation-specific PCR. Using combined bisulfite restriction analysis, it was established that, in volunteers from whom biopsies were available, the levels of methylation at two CpG sites within ESR1 assayed using fecal DNA were significantly correlated with methylation in DNA from colorectal mucosa. Thus, noninvasive techniques can be used to obtain quantitative information about the level of CpG island methylation in human colorectal mucosa. The methods described here could be applied to a much expanded range of genes and may be valuable both for screening purposes and to provide greater insight into the functional consequences of epigenetic changes in the colorectal mucosa of free-living individuals.
Dimitrova, Emilia; Nakayama, Manabu; Koseki, Yoko; Konietzny, Rebecca; Kessler, Benedikt M; Koseki, Haruhiko
2018-01-01
CpG islands are gene regulatory elements associated with the majority of mammalian promoters, yet how they regulate gene expression remains poorly understood. Here, we identify FBXL19 as a CpG island-binding protein in mouse embryonic stem (ES) cells and show that it associates with the CDK-Mediator complex. We discover that FBXL19 recruits CDK-Mediator to CpG island-associated promoters of non-transcribed developmental genes to prime these genes for activation during cell lineage commitment. We further show that recognition of CpG islands by FBXL19 is essential for mouse development. Together this reveals a new CpG island-centric mechanism for CDK-Mediator recruitment to developmental gene promoters in ES cells and a requirement for CDK-Mediator in priming these developmental genes for activation during cell lineage commitment. PMID:29809150
2013-01-01
Background CpG dinucleotide-rich genomic DNA regions, known as CpG islands (CGIs), can be methylated at their cytosine residues as an epigenetic mark that is stably inherited during cell mitosis. Differentially methylated regions (DMRs) are genomic regions showing different degrees of DNA methylation in multiple samples. In this study, we focused our attention on CGIs showing different DNA methylation between two culture replicas of the same cell line. Results We used methylation data of 35 cell lines from the Encyclopedia of DNA Elements (ENCODE) consortium to identify CpG islands that were differentially methylated between replicas of the same cell line and denoted them Inter Replicas Differentially Methylated CpG islands (IRDM-CGIs). We identified a group of IRDM-CGIs that was consistently shared by different cell lines, and denoted it common IRDM-CGIs. X chromosome CGIs were overrepresented among common IRDM-CGIs. Autosomal IRDM-CGIs were preferentially located in gene bodies and intergenic regions had a lower G + C content, a smaller mean length, and a reduced CpG percentage. Functional analysis of the genes associated with autosomal IRDM-CGIs showed that many of them are involved in DNA binding and development. Conclusions Our results show that several specific functional and structural features characterize common IRDM-CGIs. They may represent a specific subset of CGIs that are more prone to being differentially methylated for their intrinsic characteristics. PMID:24106769
Bonello, Nicolas; Sampson, James; Burn, John; Wilson, Ian J; McGrown, Gail; Margison, Geoff P; Thorncroft, Mary; Crossbie, Philip; Povey, Andrew C; Santibanez-Koref, Mauro; Walters, Kevin
2013-11-07
We exploit model-based Bayesian inference methodologies to analyse lung tumour-derived methylation data from a CpG island in the O6-methylguanine-DNA methyltransferase (MGMT) promoter. Interest is in modelling the changes in methylation patterns in a CpG island in the first exon of the promoter during lung tumour development. We propose four competils of methylation state propagation based on two mechanisms. The first is the location-dependence mechanism in which the probability of a gain or loss of methylation at a CpG within the promoter depends upon its location in the CpG sequence. The second mechanism is that of neighbour-dependence in which gain or loss of methylation at a CpG depends upon the methylation status of the immediately preceding CpG. Our data comprises the methylation status at 12 CpGs near the 5' end of the CpG island in two lung tumour samples for both alleles of a nearby polymorphism. We use approximate Bayesian computation, a computationally intensive rejection-sampling algorithm to infer model parameters and compare models without the need to evaluate the likelihood function. We compare the four proposed models using two criteria: the approximate Bayes factors and the distribution of the Euclidean distance between the summary statistics of the observed and simulated datasets. Our model-based analysis demonstrates compelling evidence for both location and neighbour dependence in the process of aberrant DNA methylation of this MGMT promoter CpG island in lung tumours. We find equivocal evidence to support the hypothesis that the methylation patterns of the two alleles evolve independently. © 2013 Published by Elsevier Ltd. All rights reserved.
DNA motifs associated with aberrant CpG island methylation.
Feltus, F Alex; Lee, Eva K; Costello, Joseph F; Plass, Christoph; Vertino, Paula M
2006-05-01
Epigenetic silencing involving the aberrant methylation of promoter region CpG islands is widely recognized as a tumor suppressor silencing mechanism in cancer. However, the molecular pathways underlying aberrant DNA methylation remain elusive. Recently we showed that, on a genome-wide level, CpG island loci differ in their intrinsic susceptibility to aberrant methylation and that this susceptibility can be predicted based on underlying sequence context. These data suggest that there are sequence/structural features that contribute to the protection from or susceptibility to aberrant methylation. Here we use motif elicitation coupled with classification techniques to identify DNA sequence motifs that selectively define methylation-prone or methylation-resistant CpG islands. Motifs common to 28 methylation-prone or 47 methylation-resistant CpG island-containing genomic fragments were determined using the MEME and MAST algorithms (). The five most discriminatory motifs derived from methylation-prone sequences were found to be associated with CpG islands in general and were nonrandomly distributed throughout the genome. In contrast, the eight most discriminatory motifs derived from the methylation-resistant CpG islands were randomly distributed throughout the genome. Interestingly, this latter group tended to associate with Alu and other repetitive sequences. Used together, the frequency of occurrence of these motifs successfully discriminated methylation-prone and methylation-resistant CpG island groups with an accuracy of 87% after 10-fold cross-validation. The motifs identified here are candidate methylation-targeting or methylation-protection DNA sequences.
Comprehensive analysis of CpG islands in human chromosomes 21 and 22
NASA Astrophysics Data System (ADS)
Takai, Daiya; Jones, Peter A.
2002-03-01
CpG islands are useful markers for genes in organisms containing 5-methylcytosine in their genomes. In addition, CpG islands located in the promoter regions of genes can play important roles in gene silencing during processes such as X-chromosome inactivation, imprinting, and silencing of intragenomic parasites. The generally accepted definition of what constitutes a CpG island was proposed in 1987 by Gardiner-Garden and Frommer [Gardiner-Garden, M. & Frommer, M. (1987) J. Mol. Biol. 196, 261-282] as being a 200-bp stretch of DNA with a C+G content of 50% and an observed CpG/expected CpG in excess of 0.6. Any definition of a CpG island is somewhat arbitrary, and this one, which was derived before the sequencing of mammalian genomes, will include many sequences that are not necessarily associated with controlling regions of genes but rather are associated with intragenomic parasites. We have therefore used the complete genomic sequences of human chromosomes 21 and 22 to examine the properties of CpG islands in different sequence classes by using a search algorithm that we have developed. Regions of DNA of greater than 500 bp with a G+C equal to or greater than 55% and observed CpG/expected CpG of 0.65 were more likely to be associated with the 5' regions of genes and this definition excluded most Alu-repetitive elements. We also used genome sequences to show strong CpG suppression in the human genome and slight suppression in Drosophila melanogaster and Saccharomyces cerevisiae. This finding is compatible with the recent detection of 5-methylcytosine in Drosophila, and might suggest that S. cerevisiae has, or once had, CpG methylation.
Kamalakaran, Sitharthan; Kendall, Jude; Zhao, Xiaoyue; Tang, Chunlao; Khan, Sohail; Ravi, Kandasamy; Auletta, Theresa; Riggs, Michael; Wang, Yun; Helland, Åslaug; Naume, Bjørn; Dimitrova, Nevenka; Børresen-Dale, Anne-Lise; Hicks, Jim; Lucito, Robert
2009-01-01
Methylation of CpG islands associated with genes can affect the expression of the proximal gene, and methylation of non-associated CpG islands correlates to genomic instability. This epigenetic modification has been shown to be important in many pathologies, from development and disease to cancer. We report the development of a novel high-resolution microarray that detects the methylation status of over 25 000 CpG islands in the human genome. Experiments were performed to demonstrate low system noise in the methodology and that the array probes have a high signal to noise ratio. Methylation measurements between different cell lines were validated demonstrating the accuracy of measurement. We then identified alterations in CpG islands, both those associated with gene promoters, as well as non-promoter-associated islands in a set of breast and ovarian tumors. We demonstrate that this methodology accurately identifies methylation profiles in cancer and in principle it can differentiate any CpG methylation alterations and can be adapted to analyze other species. PMID:19474344
CpG island methylator phenotype in colorectal cancer
Toyota, Minoru; Ahuja, Nita; Ohe-Toyota, Mutsumi; Herman, James G.; Baylin, Stephen B.; Issa, Jean-Pierre J.
1999-01-01
Aberrant methylation of promoter region CpG islands is associated with transcriptional inactivation of tumor-suppressor genes in neoplasia. To understand global patterns of CpG island methylation in colorectal cancer, we have used a recently developed technique called methylated CpG island amplification to examine 30 newly cloned differentially methylated DNA sequences. Of these 30 clones, 19 (63%) were progressively methylated in an age-dependent manner in normal colon, 7 (23%) were methylated in a cancer-specific manner, and 4 (13%) were methylated only in cell lines. Thus, a majority of CpG islands methylated in colon cancer are also methylated in a subset of normal colonic cells during the process of aging. In contrast, methylation of the cancer-specific clones was found exclusively in a subset of colorectal cancers, which appear to display a CpG island methylator phenotype (CIMP). CIMP+ tumors also have a high incidence of p16 and THBS1 methylation, and they include the majority of sporadic colorectal cancers with microsatellite instability related to hMLH1 methylation. We thus define a pathway in colorectal cancer that appears to be responsible for the majority of sporadic tumors with mismatch repair deficiency. PMID:10411935
Early demethylation of non-CpG, CpC-rich, elements in the myogenin 5′-flanking region
Fuso, Andrea; Ferraguti, Giampiero; Grandoni, Francesco; Ruggeri, Raffaella; Scarpa, Sigfrido; Strom, Roberto
2010-01-01
The dynamic changes and structural patterns of DNA methylation of genes without CpG islands are poorly characterized. The relevance of CpG to the non-CpG methylation equilibrium in transcriptional repression is unknown. In this work, we analyzed the DNA methylation pattern of the 5′-flanking of the myogenin gene, a positive regulator of muscle differentiation with no CpG island and low CpG density, in both C2C12 muscle satellite cells and embryonic muscle. Embryonic brain was studied as a non-expressing tissue. High levels of both CpG and non-CpG methylation were observed in non-expressing experimental conditions. Both CpG and non-CpG methylation rapidly dropped during muscle differentiation and myogenin transcriptional activation with active demethylation dynamics. Non-CpG demethylation occurred more rapidly than CpG demethylation. Demethylation spread from initially highly methylated short CpC-rich elements to a virtually unmethylated status. These short elements have a high CpC content and density, share some motifs and largely coincide with putative recognition sequences of some differentiation-related transcription factors. Our findings point to a dynamically controlled equilibrium between CpG and non-CpG active demethylation in the transcriptional control of tissue-specific genes. The short CpC-rich elements are new structural features of the methylation machinery, whose functions may include priming the complete demethylation of a transcriptionally crucial DNA region. PMID:20935518
DNA Methylation of Gene Expression in Acanthamoeba castellanii Encystation.
Moon, Eun-Kyung; Hong, Yeonchul; Lee, Hae-Ahm; Quan, Fu-Shi; Kong, Hyun-Hee
2017-04-01
Encystation mediating cyst specific cysteine proteinase (CSCP) of Acanthamoeba castellanii is expressed remarkably during encystation. However, the molecular mechanism involved in the regulation of CSCP gene expression remains unclear. In this study, we focused on epigenetic regulation of gene expression during encystation of Acanthamoeba . To evaluate methylation as a potential mechanism involved in the regulation of CSCP expression, we first investigated the correlation between promoter methylation status of CSCP gene and its expression. A 2,878 bp of promoter sequence of CSCP gene was amplified by PCR. Three CpG islands (island 1-3) were detected in this sequence using bioinformatics tools. Methylation of CpG island in trophozoites and cysts was measured by bisulfite sequence PCR. CSCP promoter methylation of CpG island 1 (1,633 bp) was found in 8.2% of trophozoites and 7.3% of cysts. Methylation of CpG island 2 (625 bp) was observed in 4.2% of trophozoites and 5.8% of cysts. Methylation of CpG island 3 (367 bp) in trophozoites and cysts was both 3.6%. These results suggest that DNA methylation system is present in CSCP gene expression of Acanthamoeba . In addition, the expression of encystation mediating CSCP is correlated with promoter CpG island 1 hypomethylation.
Nucleosome dynamics and maintenance of epigenetic states of CpG islands
NASA Astrophysics Data System (ADS)
Sneppen, Kim; Dodd, Ian B.
2016-06-01
Methylation of mammalian DNA occurs primarily at CG dinucleotides. These CpG sites are located nonrandomly in the genome, tending to occur within high density clusters of CpGs (islands) or within large regions of low CpG density. Cluster methylation tends to be bimodal, being dominantly unmethylated or mostly methylated. For CpG clusters near promoters, low methylation is associated with transcriptional activity, while high methylation is associated with gene silencing. Alternative CpG methylation states are thought to be stable and heritable, conferring localized epigenetic memory that allows transient signals to create long-lived gene expression states. Positive feedback where methylated CpG sites recruit enzymes that methylate nearby CpGs, can produce heritable bistability but does not easily explain that as clusters increase in size or density they change from being primarily methylated to primarily unmethylated. Here, we show that an interaction between the methylation state of a cluster and its occupancy by nucleosomes provides a mechanism to generate these features and explain genome wide systematics of CpG islands.
CpG islands: algorithms and applications in methylation studies.
Zhao, Zhongming; Han, Leng
2009-05-15
Methylation occurs frequently at 5'-cytosine of the CpG dinucleotides in vertebrate genomes; however, this epigenetic feature is rarely observed in CpG islands (CGIs) or CpG clusters in the promoter regions of genes. Aberrant methylation of the promoter-associated CGIs might influence gene expression and cause carcinogenesis. Because of the functional importance, multiple algorithms have been available for identifying CGIs in a genome or a sequence. They can be categorized into the traditional algorithms (e.g., Gardiner-Garden and Frommer (1987), Takai and Jones (2002), and CpGPRoD (2002)) or statistical property based algorithms (CpGcluster (2006) and CG cluster (2007)). We reviewed the features of these algorithms and evaluated their performance on identifying functional CGIs using genome-wide methylation data. Moreover, identification of CGIs is an initial step in many recent studies for predicting methylation status as well as in the design of methylation detection platforms. We reviewed the benchmarks and features used in these studies.
Links between DNA methylation and nucleosome occupancy in the human genome.
Collings, Clayton K; Anderson, John N
2017-01-01
DNA methylation is an epigenetic modification that is enriched in heterochromatin but depleted at active promoters and enhancers. However, the debate on whether or not DNA methylation is a reliable indicator of high nucleosome occupancy has not been settled. For example, the methylation levels of DNA flanking CTCF sites are higher in linker DNA than in nucleosomal DNA, while other studies have shown that the nucleosome core is the preferred site of methylation. In this study, we make progress toward understanding these conflicting phenomena by implementing a bioinformatics approach that combines MNase-seq and NOMe-seq data and by comprehensively profiling DNA methylation and nucleosome occupancy throughout the human genome. The results demonstrated that increasing methylated CpG density is correlated with nucleosome occupancy in the total genome and within nearly all subgenomic regions. Features with elevated methylated CpG density such as exons, SINE-Alu sequences, H3K36-trimethylated peaks, and methylated CpG islands are among the highest nucleosome occupied elements in the genome, while some of the lowest occupancies are displayed by unmethylated CpG islands and unmethylated transcription factor binding sites. Additionally, outside of CpG islands, the density of CpGs within nucleosomes was shown to be important for the nucleosomal location of DNA methylation with low CpG frequencies favoring linker methylation and high CpG frequencies favoring core particle methylation. Prominent exceptions to the correlations between methylated CpG density and nucleosome occupancy include CpG islands marked by H3K27me3 and CpG-poor heterochromatin marked by H3K9me3, and these modifications, along with DNA methylation, distinguish the major silencing mechanisms of the human epigenome. Thus, the relationship between DNA methylation and nucleosome occupancy is influenced by the density of methylated CpG dinucleotides and by other epigenomic components in chromatin.
Kawasaki, Takako; Ohnishi, Mutsuko; Nosho, Katsuhiko; Suemoto, Yuko; Kirkner, Gregory J; Meyerhardt, Jeffrey A; Fuchs, Charles S; Ogino, Shuji
2008-03-01
The CpG island methylator phenotype (CIMP or CIMP-high) with widespread promoter methylation is a distinct phenotype in colorectal cancer. However, the concept of CIMP-low with less extensive CpG island methylation is still evolving. Our aim is to examine whether density of methylation in individual CpG islands was different between CIMP-low and CIMP-high tumors. Utilizing MethyLight technology and 889 population-based colorectal cancers, we quantified DNA methylation (methylation index, percentage of methylated reference) at 14 CpG islands, including 8 CIMP-high-specific loci (CACNA1G, CDKN2A (p16), CRABP1, IGF2, MLH1, NEUROG1, RUNX3 and SOCS1). Methylation positivity in each locus was defined as methylation index>4. Low-level methylation (methylation index>0, <20) in each CIMP-high-specific locus was significantly more common in 340 CIMP-low tumors (1/8-5/8 methylation-positive loci) than 133 CIMP-high tumors (> or =6/8 methylation-positive loci) and 416 CIMP-0 tumors (0/8 methylation-positive loci) (P< or =0.002). In the other six loci (CHFR, HIC1, IGFBP3, MGMT, MINT31 and WRN), which were not highly specific for CIMP-high, low-level methylation, was not persistently more prevalent in CIMP-low tumors. In conclusion, compared to CIMP-high and CIMP-0 tumors, CIMP-low colorectal cancers show not only few methylated CIMP-high-specific CpG islands, but also more frequent low-level methylation at individual loci. Our data may provide supporting evidence for a difference in pathogenesis of DNA methylation between CIMP-low and CIMP-high tumors.
Survival differences of CIMP subtypes integrated with CNA information in human breast cancer.
Wang, Huihan; Yan, Weili; Zhang, Shumei; Gu, Yue; Wang, Yihan; Wei, Yanjun; Liu, Hongbo; Wang, Fang; Wu, Qiong; Zhang, Yan
2017-07-25
CpG island methylator phenotype of breast cancer is associated with widespread aberrant methylation at specified CpG islands and distinct patient outcomes. However, the influence of copy number contributing to the prognosis of tumors with different CpG island methylator phenotypes is still unclear. We analyzed both genetic (copy number) and epigenetic alterations in 765 breast cancers from The Cancer Genome Atlas data portal and got a panel of 15 biomarkers for copy number and methylation status evaluation. The gene panel identified two groups corresponding to distinct copy number profiles. In status of mere-loss copy number, patients were faced with a greater risk if they presented a higher CpG islands methylation pattern in biomarker panels. But for samples presenting merely-gained copy number, higher methylation level of CpG islands was associated with improved viability. In all, the integration of copy number alteration and methylation information enhanced the classification power on prognosis. Moreover, we found the molecular subtypes of breast cancer presented different distributions in two CpG island methylation phenotypes. Generated by the same set of human methylation 450K data, additional copy number information could provide insights into survival prediction of cancers with less heterogeneity and might help to determine the biomarkers for diagnosis and treatment for breast cancer patients in a more personalized approach.
Survival differences of CIMP subtypes integrated with CNA information in human breast cancer
Wang, Huihan; Yan, Weili; Zhang, Shumei; Gu, Yue; Wang, Yihan; Wei, Yanjun; Liu, Hongbo; Wang, Fang; Wu, Qiong; Zhang, Yan
2017-01-01
CpG island methylator phenotype of breast cancer is associated with widespread aberrant methylation at specified CpG islands and distinct patient outcomes. However, the influence of copy number contributing to the prognosis of tumors with different CpG island methylator phenotypes is still unclear. We analyzed both genetic (copy number) and epigenetic alterations in 765 breast cancers from The Cancer Genome Atlas data portal and got a panel of 15 biomarkers for copy number and methylation status evaluation. The gene panel identified two groups corresponding to distinct copy number profiles. In status of mere-loss copy number, patients were faced with a greater risk if they presented a higher CpG islands methylation pattern in biomarker panels. But for samples presenting merely-gained copy number, higher methylation level of CpG islands was associated with improved viability. In all, the integration of copy number alteration and methylation information enhanced the classification power on prognosis. Moreover, we found the molecular subtypes of breast cancer presented different distributions in two CpG island methylation phenotypes. Generated by the same set of human methylation 450K data, additional copy number information could provide insights into survival prediction of cancers with less heterogeneity and might help to determine the biomarkers for diagnosis and treatment for breast cancer patients in a more personalized approach. PMID:28415743
Compositional searching of CpG islands in the human genome
NASA Astrophysics Data System (ADS)
Luque-Escamilla, Pedro Luis; Martínez-Aroza, José; Oliver, José L.; Gómez-Lopera, Juan Francisco; Román-Roldán, Ramón
2005-06-01
We report on an entropic edge detector based on the local calculation of the Jensen-Shannon divergence with application to the search for CpG islands. CpG islands are pieces of the genome related to gene expression and cell differentiation, and thus to cancer formation. Searching for these CpG islands is a major task in genetics and bioinformatics. Some algorithms have been proposed in the literature, based on moving statistics in a sliding window, but its size may greatly influence the results. The local use of Jensen-Shannon divergence is a completely different strategy: the nucleotide composition inside the islands is different from that in their environment, so a statistical distance—the Jensen-Shannon divergence—between the composition of two adjacent windows may be used as a measure of their dissimilarity. Sliding this double window over the entire sequence allows us to segment it compositionally. The fusion of those segments into greater ones that satisfy certain identification criteria must be achieved in order to obtain the definitive results. We find that the local use of Jensen-Shannon divergence is very suitable in processing DNA sequences for searching for compositionally different structures such as CpG islands, as compared to other algorithms in literature.
Ismail, Khaled MK; Haworth, Kim E; Mein, Charles; Carroll, William D
2011-01-01
Supplementation with folic acid during pregnancy is known to reduce the risk of neural tube defects and low birth weight. It is thought that folate and other one-carbon intermediates might secure these clinical effects via DNA methylation. We examined the effects of folate on the human methylome using quantitative interrogation of 27,578 CpG loci associated with 14,496 genes at single-nucleotide resolution across 12 fetal cord blood samples. Consistent with previous studies, the majority of CpG dinucleotides located within CpG islands exhibited hypomethylation while those outside CpG islands showed mid-high methylation. However, for the first time in human samples, unbiased analysis of methylation across samples revealed a significant correlation of methylation patterns with plasma homocysteine, LINE-1 methylation and birth weight centile. Additionally, CpG methylation significantly correlated with either birth weight or LINE-1 methylation were predominantly located in CpG islands. These data indicate that levels of folate-associated intermediates in cord blood reflect their influence and consequences for the fetal epigenome and potentially on pregnancy outcome. In these cases, their influence might be exerted during late gestation or reflect those present during the peri-conceptual period. PMID:20864804
Conserved Role of Intragenic DNA Methylation in Regulating Alternative Promoters
Maunakea, Alika K.; Nagarajan, Raman P.; Bilenky, Mikhail; Ballinger, Tracy J.; D’Souza, Cletus; Fouse, Shaun D.; Johnson, Brett E.; Hong, Chibo; Nielsen, Cydney; Zhao, Yongjun; Turecki, Gustavo; Delaney, Allen; Varhol, Richard; Thiessen, Nina; Shchors, Ksenya; Heine, Vivi M.; Rowitch, David H.; Xing, Xiaoyun; Fiore, Chris; Schillebeeckx, Maximiliaan; Jones, Steven J.M.; Haussler, David; Marra, Marco A.; Hirst, Martin; Wang, Ting; Costello, Joseph F.
2014-01-01
While the methylation of DNA in 5′ promoters suppresses gene expression, the role of DNA methylation in gene bodies is unclear1–5. In mammals, tissue- and cell type-specific methylation is present in a small percentage of 5′ CpG island (CGI) promoters, while a far greater proportion occurs across gene bodies, coinciding with highly conserved sequences5–10. Tissue-specific intragenic methylation might reduce,3 or, paradoxically, enhance transcription elongation efficiency1,2,4,5. Capped analysis of gene expression (CAGE) experiments also indicate that transcription commonly initiates within and between genes11–15. To investigate the role of intragenic methylation, we generated a map of DNA methylation from human brain encompassing 24.7 million of the 28 million CpG sites. From the dense, high-resolution coverage of CpG islands, the majority of methylated CpG islands were revealed to be in intragenic and intergenic regions, while less than 3% of CpG islands in 5′ promoters were methylated. The CpG islands in all three locations overlapped with RNA markers of transcription initiation, and unmethylated CpG islands also overlapped significantly with trimethylation of H3K4, a histone modification enriched at promoters16. The general and CpG-island-specific patterns of methylation are conserved in mouse tissues. An in-depth investigation of the human SHANK3 locus17,18 and its mouse homologue demonstrated that this tissue-specific DNA methylation regulates intragenic promoter activity in vitro and in vivo. These methylation-regulated, alternative transcripts are expressed in a tissue and cell type-specific manner, and are expressed differentially within a single cell type from distinct brain regions. These results support a major role for intragenic methylation in regulating cell context-specific alternative promoters in gene bodies. PMID:20613842
Methylation oligonucleotide microarray: a novel tool to analyze methylation patterns
NASA Astrophysics Data System (ADS)
Hou, Peng; Ji, Meiju; He, Nongyao; Lu, Zuhong
2003-04-01
A new technique to analyze methylation patterns in several adjacent CpG sites was developed and reported here. We selected a 336bp segment of the 5"-untranslated region and the first exon of the p16Ink4a gene, which include the most densely packed CpG fragment of the islands containing 32 CpG dinucleotides, as the investigated target. The probes that include all types of methylation patterns were designed to fabricate a DNA microarray to determine the methylation patterns of seven adjacent CpG dinucleotides sites. High accuracy and reproducibility were observed in several parallel experiments. The results led us to the conclusion that the methylation oligonucleotide microarray can be applied as a novel and powerful tool to map methylation patterns and changes in multiple CpG island loci in a variety of tumors.
Sato, Hiaki; Oka, Takashi; Shinnou, Yoko; Kondo, Takami; Washio, Kana; Takano, Masayuki; Takata, Katsuyoshi; Morito, Toshiaki; Huang, Xingang; Tamura, Maiko; Kitamura, Yuta; Ohara, Nobuya; Ouchida, Mamoru; Ohshima, Koichi; Shimizu, Kenji; Tanimoto, Mitsune; Takahashi, Kiyoshi; Matsuoka, Masao; Utsunomiya, Atae; Yoshino, Tadashi
2010-01-01
Aberrant CpG island methylation contributes to the pathogenesis of various malignancies. However, little is known about the association of epigenetic abnormalities with multistep tumorigenic events in adult T cell leukemia/lymphoma (ATLL). To determine whether epigenetic abnormalities induce the progression of ATLL, we analyzed the methylation profiles of the SHP1, p15, p16, p73, HCAD, DAPK, hMLH-1, and MGMT genes by methylation specific PCR assay in 65 cases with ATLL patients. The number of CpG island methylated genes increased with disease progression and aberrant hypermethylation in specific genes was detected even in HTLV-1 carriers and correlated with progression to ATLL. The CpG island methylator phenotype (CIMP) was observed most frequently in lymphoma type ATLL and was also closely associated with the progression and crisis of ATLL. The high number of methylated genes and increase of CIMP incidence were shown to be unfavorable prognostic factors and correlated with a shorter overall survival by Kaplan-Meyer analysis. The present findings strongly suggest that the multistep accumulation of aberrant CpG methylation in specific target genes and the presence of CIMP are deeply involved in the crisis, progression, and prognosis of ATLL, as well as indicate the value of CpG methylation and CIMP for new diagnostic and prognostic biomarkers.
Sato, Hiaki; Oka, Takashi; Shinnou, Yoko; Kondo, Takami; Washio, Kana; Takano, Masayuki; Takata, Katsuyoshi; Morito, Toshiaki; Huang, Xingang; Tamura, Maiko; Kitamura, Yuta; Ohara, Nobuya; Ouchida, Mamoru; Ohshima, Koichi; Shimizu, Kenji; Tanimoto, Mitsune; Takahashi, Kiyoshi; Matsuoka, Masao; Utsunomiya, Atae; Yoshino, Tadashi
2010-01-01
Aberrant CpG island methylation contributes to the pathogenesis of various malignancies. However, little is known about the association of epigenetic abnormalities with multistep tumorigenic events in adult T cell leukemia/lymphoma (ATLL). To determine whether epigenetic abnormalities induce the progression of ATLL, we analyzed the methylation profiles of the SHP1, p15, p16, p73, HCAD, DAPK, hMLH-1, and MGMT genes by methylation specific PCR assay in 65 cases with ATLL patients. The number of CpG island methylated genes increased with disease progression and aberrant hypermethylation in specific genes was detected even in HTLV-1 carriers and correlated with progression to ATLL. The CpG island methylator phenotype (CIMP) was observed most frequently in lymphoma type ATLL and was also closely associated with the progression and crisis of ATLL. The high number of methylated genes and increase of CIMP incidence were shown to be unfavorable prognostic factors and correlated with a shorter overall survival by Kaplan-Meyer analysis. The present findings strongly suggest that the multistep accumulation of aberrant CpG methylation in specific target genes and the presence of CIMP are deeply involved in the crisis, progression, and prognosis of ATLL, as well as indicate the value of CpG methylation and CIMP for new diagnostic and prognostic biomarkers. PMID:20019193
Kitamoto, Takuya; Kitamoto, Aya; Ogawa, Yuji; Honda, Yasushi; Imajo, Kento; Saito, Satoru; Yoneda, Masato; Nakamura, Takahiro; Nakajima, Atsushi; Hotta, Kikuko
2015-08-01
The pathogenesis of non-alcoholic fatty liver disease (NAFLD) is affected by epigenetic factors as well as by genetic variation. We performed targeted-bisulfite sequencing to determine the levels of DNA methylation of 4 CpG islands (CpG99, CpG71, CpG26, and CpG101) in the regulatory regions of PNPLA3, SAMM50, PARVB variant 1, and PARVB variant 2, respectively. We compared the levels of methylation of DNA in the livers of the first and second sets of patients with mild (fibrosis stages 0 and 1) or advanced (fibrosis stages 2 to 4) NAFLD and in those of patients with mild (F0 to F2) or advanced (F3 and F4) chronic hepatitis C infection. The hepatic mRNA levels of PNPLA3, SAMM50, and PARVB were measured using qPCR. CpG26, which resides in the regulatory region of PARVB variant 1, was markedly hypomethylated in the livers of patients with advanced NAFLD. Conversely, CpG99 in the regulatory region of PNPLA3 was substantially hypermethylated in these patients. These differences in DNA methylation were replicated in a second set of patients with NAFLD or chronic hepatitis C. PNPLA3 mRNA levels in the liver of the same section of a biopsy specimen used for genomic DNA preparation were lower in patients with advanced NAFLD compared with those with mild NAFLD and correlated inversely with CpG99 methylation in liver DNA. Moreover, the levels of CpG99 methylation and PNPLA3 mRNA were affected by the rs738409 genotype. Hypomethylation of CpG26 and hypermethylation of CpG99 may contribute to the severity of fibrosis in patients with NAFLD or chronic hepatitis C infection. Copyright © 2015 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved.
Zhong, Sheng; Tang, Mandy W; Yeo, Winnie; Liu, Cuiling; Lo, Y M Dennis; Johnson, Philip J
2002-04-01
Glutathione S-transferases, enzymes that defend cells against damage mediated by oxidant and electrophilic carcinogens, may be critical determinants of cancer pathogenesis. In this report, we assess the role of epigenetic silencing of the GSTP1 gene, a gene encoding the pi-class glutathione S-transferase, in the pathogenesis of hepatitis B virus (HBV)-associated hepatocellular carcinomas (HCC). The cell lines Hep3B, HepG2, and a cohort of 43 HBV-associated HCC tissue specimens and corresponding nontumor tissues were subjected to analysis for GSTP1 epigenetic alteration and expression. GSTP1 "CpG" island DNA hypermethylation in the liver cell lines, and the tissue specimens were determined by methylation-specific PCR and correlated with expression of the gene using reverse-transcription PCR, immunoblotting, and immunohistochemistry. GSTP1 CpG island DNA hypermethylation was detected in 28 of 43 (65.1%) HCC tissues and 4 of 40 (10%) corresponding nontumor tissues. GSTP1 protein was absent in those cases showing hypermethylation of the gene. Similarly, DNA from Hep3B and HepG2 cell lines displayed complete GSTP1 hypermethylation in the CpG island, and they failed to express GSTP1 mRNA and the corresponding protein product. Treatment of the cell lines with the DNA methyltransferase inhibitor 5-aza-deoxycytidine reversed the hypermethylation, and restored GSTP1 mRNA and polypeptide expression. These data indicate that epigenetic silencing of GSTP1 gene expression by CpG island DNA hypermethylation is common in human HBV-associated HCC. In addition, somatic GSTP1 inactivation via CpG island hypermethylation may contribute to the pathogenesis of this malignancy.
Identification of regions correlating MGMT promoter methylation and gene expression in glioblastomas
Everhard, Sibille; Tost, Jörg; Abdalaoui, Hafida El; Crinière, Emmanuelle; Busato, Florence; Marie, Yannick; Gut, Ivo G.; Sanson, Marc; Mokhtari, Karima; Laigle-Donadey, Florence; Hoang-Xuan, Khê; Delattre, Jean-Yves; Thillet, Joëlle
2009-01-01
The O6-methylguanine-DNA methyltransferase gene (MGMT) is methylated in several cancers, including gliomas. However, the functional role of cysteine-phosphate-guanine (CpG) island (CGI) methylation in MGMT silencing is still controversial. The aim of this study was to investigate whether MGMT CGI methylation correlates inversely with RNA expression of MGMT in glioblastomas and to determine the CpG region whose methylation best reflects the level of expression. The methylation level of CpG sites that are potentially related to expression was investigated in 54 glioblastomas by pyrosequencing, a highly quantitative method, and analyzed with respect to their MGMT mRNA expression status. Three groups of patients were identified according to the methylation pattern of all 52 analyzed CpG sites. Overall, an 85% rate of concordance was observed between methylation and expression (p < 0.0001). When analyzing each CpG separately, six CpG sites were highly correlated with expression (p < 0.0001), and two CpG regions could be used as surrogate markers for RNA expression in 81.5% of the patients. This study indicates that there is good statistical agreement between MGMT methylation and expression, and that some CpG regions better reflect MGMT expression than do others. However, if transcriptional repression is the key mechanism in explaining the higher chemosensitivity of MGMT-methylated tumors, a substantial rate of discordance should lead clinicians to be cautious when deciding on a therapeutic strategy based on MGMT methylation status alone. PMID:19224763
Everhard, Sibille; Tost, Jörg; El Abdalaoui, Hafida; Crinière, Emmanuelle; Busato, Florence; Marie, Yannick; Gut, Ivo G; Sanson, Marc; Mokhtari, Karima; Laigle-Donadey, Florence; Hoang-Xuan, Khê; Delattre, Jean-Yves; Thillet, Joëlle
2009-08-01
The O(6)-methylguanine-DNA methyltransferase gene (MGMT) is methylated in several cancers, including gliomas. However, the functional role of cysteine-phosphate-guanine (CpG) island (CGI) methylation in MGMT silencing is still controversial. The aim of this study was to investigate whether MGMT CGI methylation correlates inversely with RNA expression of MGMT in glioblastomas and to determine the CpG region whose methylation best reflects the level of expression. The methylation level of CpG sites that are potentially related to expression was investigated in 54 glioblastomas by pyrosequencing, a highly quantitative method, and analyzed with respect to their MGMT mRNA expression status. Three groups of patients were identified according to the methylation pattern of all 52 analyzed CpG sites. Overall, an 85% rate of concordance was observed between methylation and expression (p < 0.0001). When analyzing each CpG separately, six CpG sites were highly correlated with expression (p < 0.0001), and two CpG regions could be used as surrogate markers for RNA expression in 81.5% of the patients. This study indicates that there is good statistical agreement between MGMT methylation and expression, and that some CpG regions better reflect MGMT expression than do others. However, if transcriptional repression is the key mechanism in explaining the higher chemosensitivity of MGMT-methylated tumors, a substantial rate of discordance should lead clinicians to be cautious when deciding on a therapeutic strategy based on MGMT methylation status alone.
DNA methylation profiles of donor nuclei cells and tissues of cloned bovine fetuses.
Kremenskoy, Maksym; Kremenska, Yuliya; Suzuki, Masako; Imai, Kei; Takahashi, Seiya; Hashizume, Kazuyoshi; Yagi, Shintaro; Shiota, Kunio
2006-04-01
Methylation of DNA in CpG islands plays an important role during fetal development and differentiation because CpG islands are preferentially located in upstream regions of mammalian genomic DNA, including the transcription start site of housekeeping genes and are also associated with tissue-specific genes. Somatic nuclear transfer (NT) technology has been used to generate live clones in numerous mammalian species, but only a low percentage of nuclear transferred animals develop to term. Abnormal epigenetic changes in the CpG islands of donor nuclei after nuclear transfer could contribute to a high rate of abortion during early gestation and increase perinatal death. These changes have yet to be explored. Thus, we investigated the genome-wide DNA methylation profiles of CpG islands in nuclei donor cells and NT animals. Using Restriction Landmark Genomic Scanning (RLGS), we showed, for the first time, the epigenetic profile formation of tissues from NT bovine fetuses produced from cumulus cells. From approximately 2600 unmethylated NotI sites visualized on the RLGS profile, at least 35 NotI sites showed different methylation statuses. Moreover, we proved that fetal and placental tissues from artificially inseminated and cloned cattle have tissue-specific differences in the genome-wide methylation profiles of the CpG islands. We also found that possible abnormalities occurred in the fetal brain and placental tissues of cloned animals.
Polycomb-like proteins link the PRC2 complex to CpG islands
DOE Office of Scientific and Technical Information (OSTI.GOV)
Li, Haojie; Liefke, Robert; Jiang, Junyi
The Polycomb repressive complex 2 (PRC2) mainly mediates transcriptional repression1,2 and has essential roles in various biological processes including the maintenance of cell identity and proper differentiation. Polycomb-like (PCL) proteins, such as PHF1, MTF2 and PHF19, are PRC2-associated factors that form sub-complexes with PRC2 core components3, and have been proposed to modulate the enzymatic activity of PRC2 or the recruitment of PRC2 to specific genomic loci4,5,6,7,8,9,10,11,12,13. Mammalian PRC2-binding sites are enriched in CG content, which correlates with CpG islands that display a low level of DNA methylation14. However, the mechanism of PRC2 recruitment to CpG islands is not fully understood.more » Here we solve the crystal structures of the N-terminal domains of PHF1 and MTF2 with bound CpG-containing DNAs in the presence of H3K36me3-containing histone peptides. We show that the extended homologous regions of both proteins fold into a winged-helix structure, which specifically binds to the unmethylated CpG motif but in a completely different manner from the canonical winged-helix DNA recognition motif. We also show that the PCL extended homologous domains are required for efficient recruitment of PRC2 to CpG island-containing promoters in mouse embryonic stem cells. Our research provides the first, to our knowledge, direct evidence to demonstrate that PCL proteins are crucial for PRC2 recruitment to CpG islands, and further clarifies the roles of these proteins in transcriptional regulation in vivo.« less
Extensive sequence-influenced DNA methylation polymorphism in the human genome
2010-01-01
Background Epigenetic polymorphisms are a potential source of human diversity, but their frequency and relationship to genetic polymorphisms are unclear. DNA methylation, an epigenetic mark that is a covalent modification of the DNA itself, plays an important role in the regulation of gene expression. Most studies of DNA methylation in mammalian cells have focused on CpG methylation present in CpG islands (areas of concentrated CpGs often found near promoters), but there are also interesting patterns of CpG methylation found outside of CpG islands. Results We compared DNA methylation patterns on both alleles between many pairs (and larger groups) of related and unrelated individuals. Direct observation and simulation experiments revealed that around 10% of common single nucleotide polymorphisms (SNPs) reside in regions with differences in the propensity for local DNA methylation between the two alleles. We further showed that for the most common form of SNP, a polymorphism at a CpG dinucleotide, the presence of the CpG at the SNP positively affected local DNA methylation in cis. Conclusions Taken together with the known effect of DNA methylation on mutation rate, our results suggest an interesting interdependence between genetics and epigenetics underlying diversity in the human genome. PMID:20497546
DNA methylation and exposure to ambient air pollution in two prospective cohorts.
Plusquin, Michelle; Guida, Florence; Polidoro, Silvia; Vermeulen, Roel; Raaschou-Nielsen, Ole; Campanella, Gianluca; Hoek, Gerard; Kyrtopoulos, Soterios A; Georgiadis, Panagiotis; Naccarati, Alessio; Sacerdote, Carlotta; Krogh, Vittorio; Bas Bueno-de-Mesquita, H; Monique Verschuren, W M; Sayols-Baixeras, Sergi; Panni, Tommaso; Peters, Annette; Hebels, Dennie G A J; Kleinjans, Jos; Vineis, Paolo; Chadeau-Hyam, Marc
2017-11-01
Long-term exposure to air pollution has been associated with several adverse health effects including cardiovascular, respiratory diseases and cancers. However, underlying molecular alterations remain to be further investigated. The aim of this study is to investigate the effects of long-term exposure to air pollutants on (a) average DNA methylation at functional regions and, (b) individual differentially methylated CpG sites. An assumption is that omic measurements, including the methylome, are more sensitive to low doses than hard health outcomes. This study included blood-derived DNA methylation (Illumina-HM450 methylation) for 454 Italian and 159 Dutch participants from the European Prospective Investigation into Cancer and Nutrition (EPIC). Long-term air pollution exposure levels, including NO 2 , NO x , PM 2.5 , PM coarse , PM 10 , PM 2.5 absorbance (soot) were estimated using models developed within the ESCAPE project, and back-extrapolated to the time of sampling when possible. We meta-analysed the associations between the air pollutants and global DNA methylation, methylation in functional regions and epigenome-wide methylation. CpG sites found differentially methylated with air pollution were further investigated for functional interpretation in an independent population (EnviroGenoMarkers project), where (N=613) participants had both methylation and gene expression data available. Exposure to NO 2 was associated with a significant global somatic hypomethylation (p-value=0.014). Hypomethylation of CpG island's shores and shelves and gene bodies was significantly associated with higher exposures to NO 2 and NO x . Meta-analysing the epigenome-wide findings of the 2 cohorts did not show genome-wide significant associations at single CpG site level. However, several significant CpG were found if the analyses were separated by countries. By regressing gene expression levels against methylation levels of the exposure-related CpG sites, we identified several significant CpG-transcript pairs and highlighted 5 enriched pathways for NO 2 and 9 for NO x mainly related to the immune system and its regulation. Our findings support results on global hypomethylation associated with air pollution, and suggest that the shores and shelves of CpG islands and gene bodies are mostly affected by higher exposure to NO 2 and NO x . Functional differences in the immune system were suggested by transcriptome analyses. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.
Tian, Ying; Arai, Eri; Gotoh, Masahiro; Komiyama, Motokiyo; Fujimoto, Hiroyuki; Kanai, Yae
2014-10-20
The CpG island methylator phenotype (CIMP) of clear cell renal cell carcinomas (ccRCCs) is characterized by accumulation of DNA methylation at CpG islands and poorer patient outcome. The aim of this study was to establish criteria for prognostication of patients with ccRCCs using the ccRCC-specific CIMP marker genes. DNA methylation levels at 299 CpG sites in the 14 CIMP marker genes were evaluated quantitatively in tissue specimens of 88 CIMP-negative and 14 CIMP-positive ccRCCs in a learning cohort using the MassARRAY system. An additional 100 ccRCCs were also analyzed as a validation cohort. Receiver operating characteristic curve analysis showed that area under the curve values for the 23 CpG units including the 32 CpG sites in the 7 CIMP-marker genes, i.e. FAM150A, ZNF540, ZNF671, ZNF154, PRAC, TRH and SLC13A5, for discrimination of CIMP-positive from CIMP-negative ccRCCs were larger than 0.95. Criteria combining the 23 CpG units discriminated CIMP-positive from CIMP-negative ccRCCs with 100% sensitivity and specificity in the learning cohort. Cancer-free and overall survival rates of patients with CIMP-positive ccRCCs diagnosed using the criteria combining the 23 CpG units in a validation cohort were significantly lower than those of patients with CIMP-negative ccRCCs (P = 1.41 × 10-5 and 2.43 × 10-13, respectively). Patients with CIMP-positive ccRCCs in the validation cohort had a higher likelihood of disease-related death (hazard ratio, 75.8; 95% confidence interval, 7.81 to 735; P = 1.89 × 10-4) than those with CIMP-negative ccRCCs. The established criteria are able to reproducibly diagnose CIMP-positive ccRCCs and may be useful for personalized medicine for patients with ccRCCs.
Langevin, Scott M; Eliot, Melissa; Butler, Rondi A; Cheong, Agnes; Zhang, Xiang; McClean, Michael D; Koestler, Devin C; Kelsey, Karl T
2015-01-01
There are currently no screening tests in routine use for oral and pharyngeal cancer beyond visual inspection and palpation, which are provided on an opportunistic basis, indicating a need for development of novel methods for early detection, particularly in high-risk populations. We sought to address this need through comprehensive interrogation of CpG island methylation in oral rinse samples. We used the Infinium HumanMethylation450 BeadArray to interrogate DNA methylation in oral rinse samples collected from 154 patients with incident oral or pharyngeal carcinoma prior to treatment and 72 cancer-free control subjects. Subjects were randomly allocated to either a training or a testing set. For each subject, average methylation was calculated for each CpG island represented on the array. We applied a semi-supervised recursively partitioned mixture model to the CpG island methylation data to identify a classifier for prediction of case status in the training set. We then applied the resultant classifier to the testing set for validation and to assess the predictive accuracy. We identified a methylation classifier comprised of 22 CpG islands, which predicted oral and pharyngeal carcinoma with a high degree of accuracy (AUC = 0.92, 95 % CI 0.86, 0.98). This novel methylation panel is a strong predictor of oral and pharyngeal carcinoma case status in oral rinse samples and may have utility in early detection and post-treatment follow-up.
Unique DNA methylome profiles in CpG island methylator phenotype colon cancers
Xu, Yaomin; Hu, Bo; Choi, Ae-Jin; Gopalan, Banu; Lee, Byron H.; Kalady, Matthew F.; Church, James M.; Ting, Angela H.
2012-01-01
A subset of colorectal cancers was postulated to have the CpG island methylator phenotype (CIMP), a higher propensity for CpG island DNA methylation. The validity of CIMP, its molecular basis, and its prognostic value remain highly controversial. Using MBD-isolated genome sequencing, we mapped and compared genome-wide DNA methylation profiles of normal, non-CIMP, and CIMP colon specimens. Multidimensional scaling analysis revealed that each specimen could be clearly classified as normal, non-CIMP, and CIMP, thus signifying that these three groups have distinctly different global methylation patterns. We discovered 3780 sites in various genomic contexts that were hypermethylated in both non-CIMP and CIMP colon cancers when compared with normal colon. An additional 2026 sites were found to be hypermethylated in CIMP tumors only; and importantly, 80% of these sites were located in CpG islands. These data demonstrate on a genome-wide level that the additional hypermethylation seen in CIMP tumors occurs almost exclusively at CpG islands and support definitively that these tumors were appropriately named. When these sites were examined more closely, we found that 25% were adjacent to sites that were also hypermethylated in non-CIMP tumors. Thus, CIMP is also characterized by more extensive methylation of sites that are already prone to be hypermethylated in colon cancer. These observations indicate that CIMP tumors have specific defects in controlling both DNA methylation seeding and spreading and serve as an important first step in delineating molecular mechanisms that control these processes. PMID:21990380
Nakayama, Masashi; Bennett, Christina J.; Hicks, Jessica L.; Epstein, Jonathan I.; Platz, Elizabeth A.; Nelson, William G.; De Marzo, Angelo M.
2003-01-01
Somatic inactivation of the glutathione S-transferase-π gene (GSTP1) via CpG island hypermethylation occurs early during prostate carcinogenesis, present in ∼70% of high-grade prostatic intraepithelial neoplasia (high-grade PIN) lesions and more than 90% of adenocarcinomas. Recently, there has been a resurgence of the concept that foci of prostatic atrophy (referred to as proliferative inflammatory atrophy or PIA) may be precursor lesions for the development of prostate cancer and/or high-grade PIN. Many of the cells within PIA lesions contain elevated levels of GSTP1, glutathione S-transferase-α (GSTA1), and cyclooxygenase-II proteins, suggesting a stress response. Because not all PIA cells are positive for GSTP1 protein, we hypothesized that some of the cells within these regions acquire GSTP1 CpG island hypermethylation, increasing the chance of progression to high-grade PIN and/or adenocarcinoma. Separate regions (n =199) from 27 formalin-fixed paraffin-embedded prostates were microdissected by laser-capture microdissection (Arcturus PixCell II). These regions included normal epithelium (n = 48), hyperplasticepithelium from benign prostatic hyperplasia nodules (n = 22), PIA (n = 64), high-grade PIN (n = 32), and adenocarcinoma (n = 33). Genomic DNA was isolated and assessed for GSTP1 CpG island hypermethylation by methylation-specific polymerase chain reaction. GSTP1 CpG island hypermethylation was not detected in normal epithelium (0 of 48) or in hyperplastic epithelium (0 of 22), but was found in 4 of 64 (6.3%) PIA lesions. The difference in the frequency of GSTP1 CpG island hypermethylation between normal or hyperplastic epithelium and PIA was statistically significant (P = 0.049). Similar to studies using nonmicrodissected cases, hypermethylation was found in 22 of 32 (68.8%) high-grade PIN lesions and in 30 of 33 (90.9%) adenocarcinoma lesions. Unlike normal or hyperplastic epithelium, GSTP1 CpG island hypermethylation can be detected in some PIA lesions. These data support the hypothesis that atrophic epithelium in a subset of PIA lesions may lead to high-grade PIN and/or adenocarcinoma. Because these atrophic lesions are so prevalent and extensive, even though only a small subset contains this somatic DNA alteration, the clinical impact may be substantial. PMID:12937133
Nur, I; Pascale, E; Furano, A V
1988-01-01
Here we report that the 600 bp promoter-like region at the left end of a newly isolated and characterized rat L1 DNA element can activate the prokaryotic chloramphenicol acyltransferase gene in a rat cell line. Activation only occurs when the promoter region is oriented to the transferase gene as it is to the L1 protein encoding sequences and is 75% inhibited by methylation of just 5 of the 22 CpGs present in the promoter. The G + C rich promoter contains enough CpGs to qualify it as a CpG island, but in contrast to other CpG islands, genomic L1 promoters are fully methylated in both somatic cell and sperm DNA as judged by restriction enzyme analysis. Partial demethylation of the genomic promoters by treatment with 5-azacytidine failed to produce discrete L1 transcripts. The relationship of methylation to the evolutionary history and fate of the rat L1 promoter is discussed. Images PMID:2459662
Identification of the human homolog of the imprinted mouse Air non-coding RNA
Yotova, Iveta Y.; Vlatkovic, Irena M.; Pauler, Florian M.; Warczok, Katarzyna E.; Ambros, Peter F.; Oshimura, Mitsuo; Theussl, Hans-Christian; Gessler, Manfred; Wagner, Erwin F.; Barlow, Denise P.
2010-01-01
Genomic imprinting is widely conserved amongst placental mammals. Imprinted expression of IGF2R, however, differs between mice and humans. In mice, Igf2r imprinted expression is seen in all fetal and adult tissues. In humans, adult tissues lack IGF2R imprinted expression, but it is found in fetal tissues and Wilms' tumors where it is polymorphic and only seen in a small proportion of tested samples. Mouse Igf2r imprinted expression is controlled by the Air (Airn) ncRNA whose promoter lies in an intronic maternally-methylated CpG island. The human IGF2R gene carries a homologous intronic maternally-methylated CpG island of unknown function. Here, we use transfection and transgenic studies to show that the human IGF2R intronic CpG island is a ncRNA promoter. We also identify the same ncRNA at the endogenous human locus in 16–40% of Wilms' tumors. Thus, the human IGF2R gene shows evolutionary conservation of key features that control imprinted expression in the mouse. PMID:18789384
Singer, Meromit; Engström, Alexander; Schönhuth, Alexander; Pachter, Lior
2011-09-23
Recent experimental and computational work confirms that CpGs can be unmethylated inside coding exons, thereby showing that codons may be subjected to both genomic and epigenomic constraint. It is therefore of interest to identify coding CpG islands (CCGIs) that are regions inside exons enriched for CpGs. The difficulty in identifying such islands is that coding exons exhibit sequence biases determined by codon usage and constraints that must be taken into account. We present a method for finding CCGIs that showcases a novel approach we have developed for identifying regions of interest that are significant (with respect to a Markov chain) for the counts of any pattern. Our method begins with the exact computation of tail probabilities for the number of CpGs in all regions contained in coding exons, and then applies a greedy algorithm for selecting islands from among the regions. We show that the greedy algorithm provably optimizes a biologically motivated criterion for selecting islands while controlling the false discovery rate. We applied this approach to the human genome (hg18) and annotated CpG islands in coding exons. The statistical criterion we apply to evaluating islands reduces the number of false positives in existing annotations, while our approach to defining islands reveals significant numbers of undiscovered CCGIs in coding exons. Many of these appear to be examples of functional epigenetic specialization in coding exons.
DNA methylation profiles of long- and short-term glioblastoma survivors
Shinawi, Thoraia; Hill, Victoria K.; Krex, Dietmar; Schackert, Gabriele; Gentle, Dean; Morris, Mark R.; Wei, Wenbin; Cruickshank, Garth; Maher, Eamonn R.; Latif, Farida
2013-01-01
Glioblastoma (GBM) is the most common and malignant type of primary brain tumor in adults and prognosis of most GBM patients is poor. However, a small percentage of patients show a long term survival of 36 mo or longer after diagnosis. Epigenetic profiles can provide molecular markers for patient prognosis: recently, a G-CIMP positive phenotype associated with IDH1 mutations has been described for GBMs with good prognosis. In the present analysis we performed genome-wide DNA methylation profiling of short-term survivors (STS; overall survival < 1 y) and long-term survivors (LTS; overall survival > 3 y) by utilizing the HumanMethylation450K BeadChips to assess quantitative methylation at > 480,000 CpG sites. Cluster analysis has shown that a subset of LTS showed a G-CIMP positive phenotype that was tightly associated with IDH1 mutation status and was confirmed by analysis of the G-CIMP signature genes. Using high stringency criteria for differential hypermethylation between non-cancer brain and tumor samples, we identified 2,638 hypermethylated CpG loci (890 genes) in STS GBMs, 3,101 hypermethylated CpG loci (1,062 genes) in LTS (wild type IDH1) and 11,293 hypermethylated CpG loci in LTS (mutated for IDH1), reflecting the CIMP positive phenotype. The location of differentially hypermethylated CpG loci with respect to CpG content, neighborhood context and functional genomic distribution was similar in our sample set, with the majority of CpG loci residing in CpG islands and in gene promoters. Our preliminary study also identified a set of CpG loci differentially hypermethylated between STS and LTS cases, including members of the homeobox gene family (HOXD8, HOXD13 and HOXC4), the transcription factors NR2F2 and TFAP2A, and Dickkopf 2, a negative regulator of the wnt/β-catenin signaling pathway. PMID:23291739
Savio, Andrea J.; Bapat, Bharati
2017-01-01
ABSTRACT The MLH1 promoter polymorphism rs1800734 is associated with MLH1 CpG island hypermethylation and expression loss in colorectal cancer (CRC). Conversely, variant rs1800734 is associated with MLH1 shore, but not island, hypomethylation in peripheral blood mononuclear cell DNA. To explore these distinct patterns, MLH1 CpG island and shore methylation was assessed in CRC cell lines stratified by rs1800734 genotype. Cell lines containing the variant A allele demonstrated MLH1 shore hypomethylation compared to wild type (GG). There was significant enrichment of transcription factor AP4 at the MLH1 promoter in GG and GA cell lines, but not the AA cell line, by chromatin immunoprecipitation studies. Preferential binding to the G allele was confirmed by sequencing in the GA cell line. The enhancer-associated histone modification H3K4me1 was enriched at the MLH1 shore; however, H3K27ac was not, indicating the shore is an inactive enhancer. These results demonstrate the role of variant rs1800734 in altering transcription factor binding as well as epigenetics at regions beyond the MLH1 CpG island in which it is located. PMID:28304185
Savio, Andrea J; Bapat, Bharati
2017-06-03
The MLH1 promoter polymorphism rs1800734 is associated with MLH1 CpG island hypermethylation and expression loss in colorectal cancer (CRC). Conversely, variant rs1800734 is associated with MLH1 shore, but not island, hypomethylation in peripheral blood mononuclear cell DNA. To explore these distinct patterns, MLH1 CpG island and shore methylation was assessed in CRC cell lines stratified by rs1800734 genotype. Cell lines containing the variant A allele demonstrated MLH1 shore hypomethylation compared to wild type (GG). There was significant enrichment of transcription factor AP4 at the MLH1 promoter in GG and GA cell lines, but not the AA cell line, by chromatin immunoprecipitation studies. Preferential binding to the G allele was confirmed by sequencing in the GA cell line. The enhancer-associated histone modification H3K4me1 was enriched at the MLH1 shore; however, H3K27ac was not, indicating the shore is an inactive enhancer. These results demonstrate the role of variant rs1800734 in altering transcription factor binding as well as epigenetics at regions beyond the MLH1 CpG island in which it is located.
Aguiar, J; Santurlidis, S; Nowok, J; Alexander, C; Rudnicki, D; Gispert, S; Schulz, W; Auburger, G
1999-01-19
In order to further use the spinocerebellar ataxia 2 (SCA2) promoter for transgenic mice models of "CAG repeat" neurodegeneration, different fragments of this 5' end were ligated into pGL3-Luc plasmid to obtain the better promoter-activity of the physiological promoter for SCA2. Base-par composition of the SCA2-5' region, and promoter prediction algorithms such as TSSW and TSSG, together with the high firefly luciferase expression after 48 hours of transient transfection in mammalian cells lines, showed a typical CpG island for promoter-activity. The promoter activity was specifically localized into the exon 1 of the SCA2 gene. The higher expression of firefly luciferase in the embryonal F9 cells by the use of SCA2 promoter, rather than by the use of CMV promoter may be related with the origin of the nonmethylated CpG island during the early embryogenesis. Analysis of the 5' region from HD gene revealed to a CpG island, which could be containing the physiological promoter for this gene. Copyright 1999 Academic Press.
Zhang, Jinling; Zhu, Xuebin; Li, Yuhong; Zhu, Lingyan; Li, Shiming; Zheng, Guoying; Ren, Qi; Xiao, Yonghong; Feng, Fumin
2016-08-01
This study investigated the role of CpG island methylation of the CYP2E1 and CYP2D6 genes in liver injury induced by anti-TB drugs from an epigenetic perspective in a Chinese cohort. A 1:1 matched nested case-control study design was applied. Pulmonary tuberculosis (TB) patients, who underwent standard anti-TB therapy and developed liver injury were defined as cases, while those who did not develop liver injury were defined as control. The two groups were matched in terms of sex, treatment regimen, and age. In 114 pairs of cases, CpG island methylation levels of the CYP2E1 and CYP2D6 genes in plasma cell-free DNA were found to be significantly correlated with the occurrence of anti-TB drug-induced liver injury (ADLI), with odds ratio (OR) values of 2.429 and 3.500, respectively (p < 0.01). Moreover, through multivariate logistic regression analysis, CpG island methylation of the CYP2E1 and CYP2D6 genes in plasma cell-free DNA were found to be significantly correlated with the occurrence of ADLI, with adjusted OR values of 4.390 (95% confidence interval (CI): 1.982-9.724) and 9.193 (95% CI: 3.624-25.888), respectively (p < 0.001). These results suggest that aberrantly elevated methylation of CpG islands of the CYP2E1 and CYP2D6 genes in plasma cell-free DNA may increase the risk of ADLI in Chinese TB patients.
Brant, Jason O; Riva, Alberto; Resnick, James L; Yang, Thomas P
2014-01-01
Reduced representation bisulfite sequencing (RRBS) was used to analyze DNA methylation patterns across the mouse brain genome in mice carrying a deletion of the Prader-Willi syndrome imprinting center (PWS-IC) on either the maternally- or paternally-inherited chromosome. Within the ∼3.7 Mb imprinted Angelman/Prader-Willi syndrome (AS/PWS) domain, 254 CpG sites were interrogated for changes in methylation due to PWS-IC deletion. Paternally-inherited deletion of the PWS-IC increased methylation levels ∼2-fold at each CpG site (compared to wild-type controls) at differentially methylated regions (DMRs) associated with 5′ CpG island promoters of paternally-expressed genes; these methylation changes extended, to a variable degree, into the adjacent CpG island shores. Maternal PWS-IC deletion yielded little or no changes in methylation at these DMRs, and methylation of CpG sites outside of promoter DMRs also was unchanged upon maternal or paternal PWS-IC deletion. Using stringent ascertainment criteria, ∼750,000 additional CpG sites were also interrogated across the entire mouse genome. This analysis identified 26 loci outside of the imprinted AS/PWS domain showing altered DNA methylation levels of ≥25% upon PWS-IC deletion. Curiously, altered methylation at 9 of these loci was a consequence of maternal PWS-IC deletion (maternal PWS-IC deletion by itself is not known to be associated with a phenotype in either humans or mice), and 10 of these loci exhibited the same changes in methylation irrespective of the parental origin of the PWS-IC deletion. These results suggest that the PWS-IC may affect DNA methylation at these loci by directly interacting with them, or may affect methylation at these loci through indirect downstream effects due to PWS-IC deletion. They further suggest the PWS-IC may have a previously uncharacterized function outside of the imprinted AS/PWS domain. PMID:25482058
Brant, Jason O; Riva, Alberto; Resnick, James L; Yang, Thomas P
2014-11-01
Reduced representation bisulfite sequencing (RRBS) was used to analyze DNA methylation patterns across the mouse brain genome in mice carrying a deletion of the Prader-Willi syndrome imprinting center (PWS-IC) on either the maternally- or paternally-inherited chromosome. Within the ~3.7 Mb imprinted Angelman/Prader-Willi syndrome (AS/PWS) domain, 254 CpG sites were interrogated for changes in methylation due to PWS-IC deletion. Paternally-inherited deletion of the PWS-IC increased methylation levels ~2-fold at each CpG site (compared to wild-type controls) at differentially methylated regions (DMRs) associated with 5' CpG island promoters of paternally-expressed genes; these methylation changes extended, to a variable degree, into the adjacent CpG island shores. Maternal PWS-IC deletion yielded little or no changes in methylation at these DMRs, and methylation of CpG sites outside of promoter DMRs also was unchanged upon maternal or paternal PWS-IC deletion. Using stringent ascertainment criteria, ~750,000 additional CpG sites were also interrogated across the entire mouse genome. This analysis identified 26 loci outside of the imprinted AS/PWS domain showing altered DNA methylation levels of ≥25% upon PWS-IC deletion. Curiously, altered methylation at 9 of these loci was a consequence of maternal PWS-IC deletion (maternal PWS-IC deletion by itself is not known to be associated with a phenotype in either humans or mice), and 10 of these loci exhibited the same changes in methylation irrespective of the parental origin of the PWS-IC deletion. These results suggest that the PWS-IC may affect DNA methylation at these loci by directly interacting with them, or may affect methylation at these loci through indirect downstream effects due to PWS-IC deletion. They further suggest the PWS-IC may have a previously uncharacterized function outside of the imprinted AS/PWS domain.
Global Epigenetic Changes May Underlie Ethnic Differences and susceptibility to Prostate Cancer
2012-09-01
tissues; in the prostate, hypermethylation of the GSTP1 CpG has been detected in PIA lesions [8]. DNA methylation occurs at CpG sites in the human...that the GSTP1 CpG island was frequently hypermethylated in PCa, more than 40 genes have been reported to be targets of DNA hypermethylation-associated...One study demonstrated that GSTP1 hypermethylation was significantly higher in PCa samples from AA men in comparison with EA and Asians [12]. Another
Zhong, Sheng; Yeo, Winnie; Tang, Mandy W; Wong, Nathalie; Lai, Paul B S; Johnson, Phillip J
2003-08-15
The human Ras association domain family 1A gene (RASSF1A) is a newly isolated tumor suppressor gene. In this study, we analyzed the methylation status of the promoter region of RASSF1A using bisulfite sequencing and PCR-RFLP in four liver cancer cell lines (Hep3B, HepG(2), SK-HEP-1, and Huh-7) and a cohort of 43 hepatitis B virus-associated hepatocellular carcinoma (HCC) tissues and their corresponding nontumor tissue specimens. The methylation of the CpG islands in the RASSF1A promoter was not detected in 4 samples of normal liver tissue or 10 samples of peripheral blood mononuclear cells from normal subjects. However, the CpG islands were completely methylated, and transcription of the RASSF1A was silenced in the four cell lines. Treatment with the DNA methylation inhibitor 5-aza-2'-deoxycytidine reactivated the expression of RASSF1A in the Hep3B and HepG2 cells. In 41 of 43 (95%) HCC specimens studied, the promoter region of RASSF1A was intensively methylated at its CpG sites. Although heterogeneous methylation was also detected in 16 of the 23 (70%) corresponding nontumorous tissues analyzed, the level of methylation was significantly lower than in the corresponding tumor tissues. HCC has the highest incidence of promoter methylation of RASSF1A among all malignancies yet reported suggesting that hypermethylation of the CpG island promoter of RASSF1A may play an important pathological role in this tumor.
Computational Approaches to Identify Promoters and cis-Regulatory Elements in Plant Genomes1
Rombauts, Stephane; Florquin, Kobe; Lescot, Magali; Marchal, Kathleen; Rouzé, Pierre; Van de Peer, Yves
2003-01-01
The identification of promoters and their regulatory elements is one of the major challenges in bioinformatics and integrates comparative, structural, and functional genomics. Many different approaches have been developed to detect conserved motifs in a set of genes that are either coregulated or orthologous. However, although recent approaches seem promising, in general, unambiguous identification of regulatory elements is not straightforward. The delineation of promoters is even harder, due to its complex nature, and in silico promoter prediction is still in its infancy. Here, we review the different approaches that have been developed for identifying promoters and their regulatory elements. We discuss the detection of cis-acting regulatory elements using word-counting or probabilistic methods (so-called “search by signal” methods) and the delineation of promoters by considering both sequence content and structural features (“search by content” methods). As an example of search by content, we explored in greater detail the association of promoters with CpG islands. However, due to differences in sequence content, the parameters used to detect CpG islands in humans and other vertebrates cannot be used for plants. Therefore, a preliminary attempt was made to define parameters that could possibly define CpG and CpNpG islands in Arabidopsis, by exploring the compositional landscape around the transcriptional start site. To this end, a data set of more than 5,000 gene sequences was built, including the promoter region, the 5′-untranslated region, and the first introns and coding exons. Preliminary analysis shows that promoter location based on the detection of potential CpG/CpNpG islands in the Arabidopsis genome is not straightforward. Nevertheless, because the landscape of CpG/CpNpG islands differs considerably between promoters and introns on the one side and exons (whether coding or not) on the other, more sophisticated approaches can probably be developed for the successful detection of “putative” CpG and CpNpG islands in plants. PMID:12857799
Bae, J M; Kim, J H; Cho, N-Y; Kim, T-Y; Kang, G H
2013-01-01
Background: Colorectal cancer (CRC) is usually categorised as proximal or distal CRC. Recently, many researchers have tried to determine the molecular heterogeneity of CRCs along bowel subsites. However, the differential effects of the CpG island methylator phenotype (CIMP) and microsatellite instability (MSI) on the clinical outcome according to tumour location are not well-known. Methods: We analysed clinicopathologic and molecular characteristics, including CIMP, MSI, KRAS and BRAF mutations, in 734 CRCs according to bowel subsites. And the prognostic value of CIMP and MSI was analysed according to tumour location. Results: We found a linear increase of female predominance, T, N category, stage, differentiation, absence of luminal necrosis, tumour -infiltrating lymphocytes, Crohn's-like lymphoid reaction, serration and mucin production from the rectum to caecum. CpG island methylator phenotype -high and MSI-high gradually increased from the rectum to caecum. CpG island methylator phenotype is a poor prognostic factor of overall survival (hazard ratio (HR): 4.13, 95% confidence interval (CI): 1.27–13.46) and disease-free survival (HR: 2.90, 95% CI: 1.04–8.08) in rectal cancers. Conclusion: Clinicopathologic and molecular profiles of CRCs gradually change along bowel subsites, and the prognostic implication of CIMP is different according to tumour location. PMID:23900220
CpG island methylator phenotype (CIMP) in cancer: causes and implications.
Teodoridis, Jens M; Hardie, Catriona; Brown, Robert
2008-09-18
Strong evidence exists for a subgroup of tumours, from a variety of tissue types, exhibiting concordant tumour specific DNA methylation: the "CpG island methylator phenotype" (CIMP). Occurrence of CIMP is associated with a range of genetic and environmental factors, although the molecular causes are not well-understood. Both increased expression and aberrant targeting of DNA methyltransferases (DNMTs) could contribute to the occurrence of CIMP. One under-explored area is the possibility that DNA damage may induce or select for CIMP during carcinogenesis or treatment of tumours with chemotherapy. DNA damaging agents can induce DNA damage at guanine rich regions throughout the genome, including CpG islands. This DNA damage can result in stalled DNA synthesis, which will lead to localised increased DNMT1 concentration and therefore potentially increased DNA methylation at these sites. Chemotherapy can select for cells which have increased tolerance to DNA damage due to increased lesion bypass, in some cases by mechanisms which involve inactivation of genes by CpG island methylation. CIMP has been associated with worse patient prognosis, probably due to increased epigenetic plasticity. Therefore, further clinical testing of the diagnostic and prognostic value of the current CIMP markers, as well as increasing our understanding of the molecular causes underlying CIMP are required.
Fu, J; Su, Y; Liu, Y; Zhang, X Y
2018-04-09
Objective: To compare the methylation profiles in tissues of oral leukoplakia (OLK) and oral squamous cell carcinoma (OSCC) with healthy tissues of oral mucosa, in order to identify the role of DNA methylation played in tumorigenesis. Methods: DNA samples extracted from tissues of 4 healthy oral mucosa, 4 OSCC and 4 OLK collected from patients of the Department of Oral Medicine, Capital Medical University School of Stomatology were examined and compared using Methylation 450 Bead Chip. The genes associated with differentially methylated CpG sites were selected for gene ontology (GO) analysis and Kyoto encyclopedia of genes and genomes (KEGG) pathway enrichment. Results: Multiple differentially methylated CpG sites were identified by using the above mentioned assay. Hypermethylation constitutes 86.18% (23 290/27 025) of methylation changes in OLK and hypomethylation accounts for 13.82% (3 734/27 025) of methylation changes. Both hypermethylated and hypomethylated CpG sites were markedly increased in OSCC tissue compared with OLK tissue. The majority of differentially methylated CpG sites were located outside CpG islands, with approximately one-fourth in CpG shores flanking the islands, which were considered highly important for gene regulation and tumorigenesis. Pathway analysis revealed that differentially methylated CpG sites in both OLK and OSCC patients shared the same pathway enrichments, most of which were correlated with carcinogenesis and cancer progression (e.g., DNA repair, cell cycle, and apoptosis). Conclusions: In the present study, methylation-associated alterations affect almost all pathways in the cellular network in both OLK and OSCC. OLK and OSCC shared similar methylation changes whether in pathways or genes, indicating that epigenetically they might have the same molecular basis for disease progression.
Dellett, Margaret; O’Hagan, Kathleen Ann; Colyer, Hilary Ann Alexandra; Mills, Ken I.
2010-01-01
Around 80% of acute myeloid leukemia (AML) patients achieve a complete remission, however many will relapse and ultimately die of their disease. The association between karyotype and prognosis has been studied extensively and identified patient cohorts as having favourable [e.g. t(8; 21), inv (16)/t(16; 16), t(15; 17)], intermediate [e.g. cytogenetically normal (NK-AML)] or adverse risk [e.g. complex karyotypes]. Previous studies have shown that gene expression profiling signatures can classify the sub-types of AML, although few reports have shown a similar feature by using methylation markers. The global methylation patterns in 19 diagnostic AML samples were investigated using the Methylated CpG Island Amplification Microarray (MCAM) method and CpG island microarrays containing 12,000 CpG sites. The first analysis, comparing favourable and intermediate cytogenetic risk groups, revealed significantly differentially methylated CpG sites (594 CpG islands) between the two subgroups. Mutations in the NPM1 gene occur at a high frequency (40%) within the NK-AML subgroup and are associated with a more favourable prognosis in these patients. A second analysis comparing the NPM1 mutant and wild-type research study subjects again identified distinct methylation profiles between these two subgroups. Network and pathway analysis revealed possible molecular mechanisms associated with the different risk and/or mutation sub-groups. This may result in a better classification of the risk groups, improved monitoring targets, or the identification of novel molecular therapies. PMID:24179384
Deletion and aberrant CpG island methylation of Caspase 8 gene in medulloblastoma.
Gonzalez-Gomez, Pilar; Bello, M Josefa; Inda, M Mar; Alonso, M Eva; Arjona, Dolores; Amiñoso, Cinthia; Lopez-Marin, Isabel; de Campos, Jose M; Sarasa, Jose L; Castresana, Javier S; Rey, Juan A
2004-09-01
Aberrant methylation of promoter CpG islands in human genes is an alternative genetic inactivation mechanism that contributes to the development of human tumors. Nevertheless, few studies have analyzed methylation in medulloblastomas. We determined the frequency of aberrant CpG island methylation for Caspase 8 (CASP8) in a group of 24 medulloblastomas arising in 8 adult and 16 pediatric patients. Complete methylation of CASP8 was found in 15 tumors (62%) and one case displayed hemimethylation. Three samples amplified neither of the two primer sets for methylated or unmethylated alleles, suggesting that genomic deletion occurred in the 5' flanking region of CASP8. Our findings suggest that methylation commonly contributes to CASP8 silencing in medulloblastomas and that homozygous deletion or severe sequence changes involving the promoter region may be another mechanism leading to CASP8 inactivation in this neoplasm.
Quantitative Evaluation of MMP-9 and TIMP-1 Promoter Methylation in Chronic Periodontitis.
Li, Xiting; Lu, Jiaxuan; Teng, Wei; Zhao, Chuanjiang; Ye, Xiaolei
2018-03-01
In this study, we investigated the promoter DNA methylation (DNAm) status of the MMP-9 and TIMP-1 genes in patients with chronic periodontitis to evaluate disease progression. Using pyrosequencing technology, DNAm levels of MMP-9 and TIMP-1 CpG islands were measured in 88 chronic periodontitis patients and 15 healthy controls. We found a positive correlation between methylation levels of MMP-9 CpG islands and the severity of chronic periodontitis. Methylated CpG islands were also closely associated with the duration of chronic periodontitis. Moreover, female patients exhibited lower methylation levels of MMP-9 but higher methylation levels of TIMP-1 compared with male patients, and the methylation levels of TIMP-1 gradually decreased with age. The findings of gender disparity in the DNAm of MMP-9 and TIMP-1 genes provide novel insights into chronic periodontitis.
Savio, Andrea J.; Lemire, Mathieu; Mrkonjic, Miralem; Gallinger, Steven; Zanke, Brent W.; Hudson, Thomas J.; Bapat, Bharati
2012-01-01
Single nucleotide polymorphisms (SNPs) are the most common form of genetic variation. We previously demonstrated that SNPs (rs1800734, rs749072, and rs13098279) in the MLH1 gene region are associated with MLH1 promoter island methylation, loss of MLH1 protein expression, and microsatellite instability (MSI) in colorectal cancer (CRC) patients. Recent studies have identified less CpG-dense “shore” regions flanking many CpG islands. These shores often exhibit distinct methylation profiles between different tissues and matched normal versus tumor cells of patients. To date, most epigenetic studies have focused on somatic methylation events occurring within solid tumors; less is known of the contributions of peripheral blood cell (PBC) methylation to processes such as aging and tumorigenesis. To address whether MLH1 methylation in PBCs is correlated with tumorigenesis we utilized the Illumina 450 K microarrays to measure methylation in PBC DNA of 846 healthy controls and 252 CRC patients from Ontario, Canada. Analysis of a region of chromosome 3p21 spanning the MLH1 locus in healthy controls revealed that a CpG island shore 1 kb upstream of the MLH1 gene exhibits different methylation profiles when stratified by SNP genotypes (rs1800734, rs749072, and rs13098279). Individuals with wild-type genotypes incur significantly higher PBC shore methylation than heterozygous or homozygous variant carriers (p<1.1×10−6; ANOVA). This trend is also seen in CRC cases (p<0.096; ANOVA). Shore methylation also decreases significantly with increasing age in cases and controls. This is the first study of its kind to integrate PBC methylation at a CpG island shore with SNP genotype status in CRC cases and controls. These results indicate that CpG island shore methylation in PBCs may be influenced by genotype as well as the normal aging process. PMID:23240038
The evolution of CpG density and lifespan in conserved primate and mammalian promoters
McLain, Adam T.
2018-01-01
Gene promoters are evolutionarily conserved across holozoans and enriched in CpG sites, the target for DNA methylation. As animals age, the epigenetic pattern of DNA methylation degrades, with highly methylated CpG sites gradually becoming demethylated while CpG islands increase in methylation. Across vertebrates, aging is a trait that varies among species. We used this variation to determine whether promoter CpG density correlates with species’ maximum lifespan. Human promoter sequences were used to identify conserved regions in 131 mammals and a subset of 28 primate genomes. We identified approximately 1000 gene promoters (5% of the total), that significantly correlated CpG density with lifespan. The correlations were performed via the phylogenetic least squares method to account for trait similarity by common descent using phylogenetic branch lengths. Gene set enrichment analysis revealed no significantly enriched pathways or processes, consistent with the hypothesis that aging is not under positive selection. However, within both mammals and primates, 95% of the promoters showed a positive correlation between increasing CpG density and species lifespan, and two thirds were shared between the primate subset and mammalian datasets. Thus, these genes may require greater buffering capacity against age-related dysregulation of DNA methylation in longer-lived species. PMID:29661983
Gene silencing of Nox4 by CpG island methylation during hepatocarcinogenesis in rats
López-Álvarez, Guadalupe S.; Wojdacz, Tomasz K.; García-Cuellar, Claudia M.; Monroy-Ramírez, Hugo C.; Rodríguez-Segura, Miguel A.; Pacheco-Rivera, Ruth A.; Valencia-Antúnez, Carlos A.; Cervantes-Anaya, Nancy; Soto-Reyes, Ernesto; Vásquez-Garzón, Verónica R.; Sánchez-Pérez, Yesennia; Villa-Treviño, Saúl
2017-01-01
ABSTRACT The association between the downregulation of genes and DNA methylation in their CpG islands has been extensively studied as a mechanism that favors carcinogenesis. The objective of this study was to analyze the methylation of a set of genes selected based on their microarray expression profiles during the process of hepatocarcinogenesis. Rats were euthanized at: 24 h, 7, 11, 16 and 30 days and 5, 9, 12 and 18 months post-treatment. We evaluated the methylation status in the CpG islands of four deregulated genes (Casp3, Cldn1, Pex11a and Nox4) using methylation-sensitive high-resolution melting technology for the samples obtained from different stages of hepatocarcinogenesis. We did not observe methylation in Casp3, Cldn1 or Pex11a. However, Nox4 exhibited altered methylation patterns, reaching a maximum of 10%, even during the early stages of hepatocarcinogenesis. We observed downregulation of mRNA and protein of Nox4 (97.5% and 40%, respectively) after the first carcinogenic stimulus relative to the untreated samples. Our results suggest that Nox4 downregulation is associated with DNA methylation of the CpG island in its promoter. We propose that methylation is a mechanism that can silence the expression of Nox4, which could contribute to the acquisition of neoplastic characteristics during hepatocarcinogenesis in rats. PMID:27895046
Distinct genetic profiles in colorectal tumors with or without the CpG island methylator phenotype
Toyota, Minoru; Ohe-Toyota, Mutsumi; Ahuja, Nita; Issa, Jean-Pierre J.
2000-01-01
Colorectal cancers (CRCs) are characterized by multiple genetic (mutations) and epigenetic (CpG island methylation) alterations, but it is not known whether these evolve independently through stochastic processes. We have recently described a novel pathway termed CpG island methylator phenotype (CIMP) in CRC, which is characterized by the simultaneous methylation of multiple CpG islands, including several known genes, such as p16, hMLH1, and THBS1. We have now studied mutations in K-RAS, p53, DPC4, and TGFβRII in a panel of colorectal tumors with or without CIMP. We find that CIMP defines two groups of tumors with significantly different genetic lesions: frequent K-RAS mutations were found in CIMP+ CRCs (28/41, 68%) compared with CIMP− cases (14/47, 30%, P = 0.0005). By contrast, p53 mutations were found in 24% (10/41) of CIMP+ CRCs vs. 60% (30/46) of CIMP− cases (P = 0.002). Both of these differences were independent of microsatellite instability. These interactions between CIMP, K-RAS mutations, and p53 mutations were preserved in colorectal adenomas, suggesting that they occur early in carcinogenesis. The distinct combinations of epigenetic and genetic alterations in each group suggest that activation of oncogenes and inactivation of tumor suppressor genes is related to the underlying mechanism of generating molecular diversity in cancer, rather than simply accumulate stochastically during cancer development. PMID:10639144
DNA methylation analysis of phenotype specific stratified Indian population.
Rotti, Harish; Mallya, Sandeep; Kabekkodu, Shama Prasada; Chakrabarty, Sanjiban; Bhale, Sameer; Bharadwaj, Ramachandra; Bhat, Balakrishna K; Dedge, Amrish P; Dhumal, Vikram Ram; Gangadharan, G G; Gopinath, Puthiya M; Govindaraj, Periyasamy; Joshi, Kalpana S; Kondaiah, Paturu; Nair, Sreekumaran; Nair, S N Venugopalan; Nayak, Jayakrishna; Prasanna, B V; Shintre, Pooja; Sule, Mayura; Thangaraj, Kumarasamy; Patwardhan, Bhushan; Valiathan, Marthanda Varma Sankaran; Satyamoorthy, Kapaettu
2015-05-08
DNA methylation and its perturbations are an established attribute to a wide spectrum of phenotypic variations and disease conditions. Indian traditional system practices personalized medicine through indigenous concept of distinctly descriptive physiological, psychological and anatomical features known as prakriti. Here we attempted to establish DNA methylation differences in these three prakriti phenotypes. Following structured and objective measurement of 3416 subjects, whole blood DNA of 147 healthy male individuals belonging to defined prakriti (Vata, Pitta and Kapha) between the age group of 20-30years were subjected to methylated DNA immunoprecipitation (MeDIP) and microarray analysis. After data analysis, prakriti specific signatures were validated through bisulfite DNA sequencing. Differentially methylated regions in CpG islands and shores were significantly enriched in promoters/UTRs and gene body regions. Phenotypes characterized by higher metabolism (Pitta prakriti) in individuals showed distinct promoter (34) and gene body methylation (204), followed by Vata prakriti which correlates to motion showed DNA methylation in 52 promoters and 139 CpG islands and finally individuals with structural attributes (Kapha prakriti) with 23 and 19 promoters and CpG islands respectively. Bisulfite DNA sequencing of prakriti specific multiple CpG sites in promoters and 5'-UTR such as; LHX1 (Vata prakriti), SOX11 (Pitta prakriti) and CDH22 (Kapha prakriti) were validated. Kapha prakriti specific CDH22 5'-UTR CpG methylation was also found to be associated with higher body mass index (BMI). Differential DNA methylation signatures in three distinct prakriti phenotypes demonstrate the epigenetic basis of Indian traditional human classification which may have relevance to personalized medicine.
Savio, Andrea J; Mrkonjic, Miralem; Lemire, Mathieu; Gallinger, Steven; Knight, Julia A; Bapat, Bharat
2017-01-01
Colorectal cancers (CRCs) undergo distinct genetic and epigenetic alterations. Expression of mutL homolog 1 ( MLH1 ), a mismatch repair gene that corrects DNA replication errors, is lost in up to 15% of sporadic tumours due to mutation or, more commonly, due to DNA methylation of its promoter CpG island. A single nucleotide polymorphism (SNP) in the CpG island of MLH1 ( MLH1 -93G>A or rs1800734) is associated with CpG island hypermethylation and decreased MLH1 expression in CRC tumours. Further, in peripheral blood mononuclear cell (PBMC) DNA of both CRC cases and non-cancer controls, the variant allele of rs1800734 is associated with hypomethylation at the MLH1 shore, a region upstream of its CpG island that is less dense in CpG sites . To determine whether this genotype-epigenotype association is present in other tissue types, including colorectal tumours, we assessed DNA methylation in matched normal colorectal tissue, tumour, and PBMC DNA from 349 population-based CRC cases recruited from the Ontario Familial Colorectal Cancer Registry. Using the semi-quantitative real-time PCR-based MethyLight assay, MLH1 shore methylation was significantly higher in tumour tissue than normal colon or PBMCs ( P < 0.01). When shore methylation levels were stratified by SNP genotype, normal colorectal DNA and PBMC DNA were significantly hypomethylated in association with variant SNP genotype ( P < 0.05). However, this association was lost in tumour DNA. Among distinct stages of CRC, metastatic stage IV CRC tumours incurred significant hypomethylation compared to stage I-III cases, irrespective of genotype status. Shore methylation of MLH1 was not associated with MSI status or promoter CpG island hypermethylation, regardless of genotype. To confirm these results, bisulfite sequencing was performed in matched tumour and normal colorectal specimens from six CRC cases, including two cases per genotype (wildtype, heterozygous, and homozygous variant). Bisulfite sequencing results corroborated the methylation patterns found by MethyLight, with significant hypomethylation in normal colorectal tissue of variant SNP allele carriers. These results indicate that the normal tissue types tested (colorectum and PBMC) experience dynamic genotype-associated epigenetic alterations at the MLH1 shore, whereas tumour DNA incurs aberrant hypermethylation compared to normal DNA.
Nullomers and High Order Nullomers in Genomic Sequences
Vergni, Davide; Santoni, Daniele
2016-01-01
A nullomer is an oligomer that does not occur as a subsequence in a given DNA sequence, i.e. it is an absent word of that sequence. The importance of nullomers in several applications, from drug discovery to forensic practice, is now debated in the literature. Here, we investigated the nature of nullomers, whether their absence in genomes has just a statistical explanation or it is a peculiar feature of genomic sequences. We introduced an extension of the notion of nullomer, namely high order nullomers, which are nullomers whose mutated sequences are still nullomers. We studied different aspects of them: comparison with nullomers of random sequences, CpG distribution and mean helical rise. In agreement with previous results we found that the number of nullomers in the human genome is much larger than expected by chance. Nevertheless antithetical results were found when considering a random DNA sequence preserving dinucleotide frequencies. The analysis of CpG frequencies in nullomers and high order nullomers revealed, as expected, a high CpG content but it also highlighted a strong dependence of CpG frequencies on the dinucleotide position, suggesting that nullomers have their own peculiar structure and are not simply sequences whose CpG frequency is biased. Furthermore, phylogenetic trees were built on eleven species based on both the similarities between the dinucleotide frequencies and the number of nullomers two species share, showing that nullomers are fairly conserved among close species. Finally the study of mean helical rise of nullomers sequences revealed significantly high mean rise values, reinforcing the hypothesis that those sequences have some peculiar structural features. The obtained results show that nullomers are the consequence of the peculiar structure of DNA (also including biased CpG frequency and CpGs islands), so that the hypermutability model, also taking into account CpG islands, seems to be not sufficient to explain nullomer phenomenon. Finally, high order nullomers could emphasize those features that already make simple nullomers useful in several applications. PMID:27906971
Neuromodulation intrinsic to the central pattern generator for escape swimming in Tritonia.
Katz, P S
1998-11-16
Extrinsic neuromodulatory inputs to central pattern generators (CPGs) can alter the properties and synaptic interactions of neurons in those circuits and thereby modify the output of the CPG. Recent work in a number of systems has now demonstrated that neurons intrinsic to CPG can also evoke neuromodulatory actions on other members of the CPG. Such "intrinsic neuromodulation" plays a role in controlling the CPG underlying the escape swim response of the nudibrach mollusc, Tritonia diomedea. The dorsal swim interneurons (DSIs) are a bilaterally represented set of three serotonergic neurons that participate in the generation of the rhythmic swim motor program. Serotonin released from these CPG neurons functions both as a fast neurotransmitter and as a slower neuromodulator. In its modulatory role, serotonin enhances the release of neurotransmitter from another CPG neuron, C2, and also increases C2 excitability by decreasing spike frequency adaptation. These neuromodulatory actions intrinsic to the CPG may be important for the initial self-configuration of the system into a function CPG and for experience-dependent changes in the output such as behavioral sensitization and habituation.
NASA Astrophysics Data System (ADS)
Zhang, Huijie; Yamazaki, Tomohiko; Zhi, Chunyi; Hanagata, Nobutaka
2012-09-01
CpG oligonucleotides (CpG ODNs) interact with Toll-like receptor 9 (TLR9), which results in the induction of immunostimulatory cytokines. We delivered CpG ODNs intracellularly using boron nitride nanospheres (BNNS). To enhance the loading capacity of CpG ODNs on BNNS, we used a phage display technique to identify a 12-amino acid peptide designated as BP7, with specific affinity for BNNS, and used it as a linker to load CpG ODNs on BNNS. The tyrosine residue (Y) at the eighth position from the N-terminus played a crucial role in the affinity of BP7 to BNNS. BNNS that bound BP7 (BNNS-BP7) were taken up by cells and showed no cytotoxicity, and CpG ODNs were successfully crosslinked with BP7 to create BP7-CpG ODN conjugates. Using BP7 as a linker, the loading efficiency of CpG ODNs on BNNS increased 5-fold compared to the direct binding of CpG ODNs to BNNS. Furthermore, the BP7-CpG ODN conjugate-loaded BNNS had a greater capacity to induce interleukin-6 (IL-6) and tumor necrosis factor-alpha (TNF-α) production from peripheral blood mononuclear cells (PBMCs) than that of CpG ODNs directly loaded on BNNS. The higher amount of cytokine induction by BP7-CpG ODN conjugate-loaded BNNS may be attributed to a higher loading capacity and stronger binding to BNNS of the linker BP7. The greater functionality of BP7-conjugated CpG ODNs on BNNS expands the potential of BNNS for drug delivery applications.CpG oligonucleotides (CpG ODNs) interact with Toll-like receptor 9 (TLR9), which results in the induction of immunostimulatory cytokines. We delivered CpG ODNs intracellularly using boron nitride nanospheres (BNNS). To enhance the loading capacity of CpG ODNs on BNNS, we used a phage display technique to identify a 12-amino acid peptide designated as BP7, with specific affinity for BNNS, and used it as a linker to load CpG ODNs on BNNS. The tyrosine residue (Y) at the eighth position from the N-terminus played a crucial role in the affinity of BP7 to BNNS. BNNS that bound BP7 (BNNS-BP7) were taken up by cells and showed no cytotoxicity, and CpG ODNs were successfully crosslinked with BP7 to create BP7-CpG ODN conjugates. Using BP7 as a linker, the loading efficiency of CpG ODNs on BNNS increased 5-fold compared to the direct binding of CpG ODNs to BNNS. Furthermore, the BP7-CpG ODN conjugate-loaded BNNS had a greater capacity to induce interleukin-6 (IL-6) and tumor necrosis factor-alpha (TNF-α) production from peripheral blood mononuclear cells (PBMCs) than that of CpG ODNs directly loaded on BNNS. The higher amount of cytokine induction by BP7-CpG ODN conjugate-loaded BNNS may be attributed to a higher loading capacity and stronger binding to BNNS of the linker BP7. The greater functionality of BP7-conjugated CpG ODNs on BNNS expands the potential of BNNS for drug delivery applications. Electronic supplementary information (ESI) available. See DOI: 10.1039/c2nr31189e
Zhang, Huijie; Feng, Shini; Yan, Ting; Zhi, Chunyi; Gao, Xiao-Dong; Hanagata, Nobutaka
2015-01-01
CpG oligodeoxynucleotides (ODNs) stimulate innate and adaptive immune responses. Thus, these molecules are promising therapeutic agents and vaccine adjuvants against various diseases. In this study, we developed a novel CpG ODNs delivery system based on polyethyleneimine (PEI)-functionalized boron nitride nanospheres (BNNS). PEI was coated on the surface of BNNS via electrostatic interactions. The prepared BNNS–PEI complexes had positive zeta potential and exhibited enhanced dispersity and stability in aqueous solution. In vitro cytotoxicity assays revealed that the BNNS–PEI complexes with concentrations up to 100 μg/mL exhibited no obvious cytotoxicity. Furthermore, the positively charged surface of the BNNS–PEI complexes greatly improved the loading capacity and cellular uptake efficiency of CpG ODNs. Class B CpG ODNs loaded on the BNNS–PEI complexes enhanced the production of interleukin-6 and tumor necrosis factor-α from peripheral blood mononuclear cells compared with CpG ODNs directly loaded on BNNS. Contrary to the free CpG ODNs or CpG ODNs directly loaded on BNNS, class B CpG ODNs loaded on the BNNS–PEI complexes induced interferon-α simultaneously. PEI coating may have changed the physical form of class B CpG ODNs on BNNS, which further affected their interaction with Toll-like receptor 9 and induced interferon-α. Therefore, BNNS–PEI complexes can be used to enhance the immunostimulatory effect and therapeutic activity of CpG ODNs and the treatment of diseases requiring interleukin-6, tumor necrosis factor-α, and interferon-α. PMID:26346655
Zhang, Huijie; Feng, Shini; Yan, Ting; Zhi, Chunyi; Gao, Xiao-Dong; Hanagata, Nobutaka
2015-01-01
CpG oligodeoxynucleotides (ODNs) stimulate innate and adaptive immune responses. Thus, these molecules are promising therapeutic agents and vaccine adjuvants against various diseases. In this study, we developed a novel CpG ODNs delivery system based on polyethyleneimine (PEI)-functionalized boron nitride nanospheres (BNNS). PEI was coated on the surface of BNNS via electrostatic interactions. The prepared BNNS-PEI complexes had positive zeta potential and exhibited enhanced dispersity and stability in aqueous solution. In vitro cytotoxicity assays revealed that the BNNS-PEI complexes with concentrations up to 100 μg/mL exhibited no obvious cytotoxicity. Furthermore, the positively charged surface of the BNNS-PEI complexes greatly improved the loading capacity and cellular uptake efficiency of CpG ODNs. Class B CpG ODNs loaded on the BNNS-PEI complexes enhanced the production of interleukin-6 and tumor necrosis factor-α from peripheral blood mononuclear cells compared with CpG ODNs directly loaded on BNNS. Contrary to the free CpG ODNs or CpG ODNs directly loaded on BNNS, class B CpG ODNs loaded on the BNNS-PEI complexes induced interferon-α simultaneously. PEI coating may have changed the physical form of class B CpG ODNs on BNNS, which further affected their interaction with Toll-like receptor 9 and induced interferon-α. Therefore, BNNS-PEI complexes can be used to enhance the immunostimulatory effect and therapeutic activity of CpG ODNs and the treatment of diseases requiring interleukin-6, tumor necrosis factor-α, and interferon-α.
Methylation analysis of p16, SLIT2, SCARA5, and Runx3 genes in hepatocellular carcinoma
Sun, Gaofeng; Zhang, Chen; Feng, Min; Liu, Wensheng; Xie, Huifang; Qin, Qin; Zhao, E.; Wan, Li
2017-01-01
Abstract This study is to investigate the methylation status of multiple tumor suppressor 1 (p16), secreted glycoprotein 2 (SLIT2), scavenger receptor class A, member 5 putative (SCARA5), and human runt-related transcription factor 3 (Runx3) genes in the peripheral blood of hepatocellular carcinoma (HCC). This is a case–control study. The peripheral blood samples were collected from 25 HCC patients, 25 patients with high risk of HCC (defined as “internal control group”), and 25 healthy individuals (defined as “external control group”), respectively. Then the methylation status of p16, SLIT2, SCARA5, and Runx3 genes in the blood samples were analyzed by pyrosequencing. The relationship between the methylation and the clinical features of HCC patients were evaluated. The methylation levels in the 7 CpG loci of p16 gene in HCC patients were low and without statistically significant difference (P > .05) compared to the control groups. Although the methylation levels of CpG3 and CpG4 in SLIT2 gene loci were higher than those of the control groups, there was no statistically significant difference (P > .05). However, the methylation rate of CpG2 locus in SCARA5 gene in HCC patients was significantly higher (P < .05). And the methylation rates of CpG1, CpG2, CpG3, CpG4, CpG5, and CpG8 in Runx3 gene in HCC patients were significantly different to that of control groups (P < .05). We also have analyzed the correlations between the CpG islands methylation of Runx3 or SCARA5 genes and the age, gender, hepatitis B, liver cirrhosis, alpha fetal protein, or hepatitis B surface antigen (HBsAg) of the HCC patients, which all showed no significant correlations (P > .05). The methylation status of SCARA5 and Runx3 genes are abnormal in HCC patients, which may further be used as molecular markers for early auxiliary diagnosis of liver cancer. PMID:29019900
Draht, Muriel X G; Smits, Kim M; Jooste, Valérie; Tournier, Benjamin; Vervoort, Martijn; Ramaekers, Chantal; Chapusot, Caroline; Weijenberg, Matty P; van Engeland, Manon; Melotte, Veerle
2016-01-01
Already since the 1990s, promoter CpG island methylation markers have been considered promising diagnostic, prognostic, and predictive cancer biomarkers. However, so far, only a limited number of DNA methylation markers have been introduced into clinical practice. One reason why the vast majority of methylation markers do not translate into clinical applications is lack of independent validation of methylation markers, often caused by differences in methylation analysis techniques. We recently described RET promoter CpG island methylation as a potential prognostic marker in stage II colorectal cancer (CRC) patients of two independent series. In the current study, we analyzed the RET promoter CpG island methylation of 241 stage II colon cancer patients by direct methylation-specific PCR (MSP), nested-MSP, pyrosequencing, and methylation-sensitive high-resolution melting (MS-HRM). All primers were designed as close as possible to the same genomic region. In order to investigate the effect of different DNA methylation assays on patient outcome, we assessed the clinical sensitivity and specificity as well as the association of RET methylation with overall survival for three and five years of follow-up. Using direct-MSP and nested-MSP, 12.0 % (25/209) and 29.6 % (71/240) of the patients showed RET promoter CpG island methylation. Methylation frequencies detected by pyrosequencing were related to the threshold for positivity that defined RET methylation. Methylation frequencies obtained by pyrosequencing (threshold for positivity at 20 %) and MS-HRM were 13.3 % (32/240) and 13.8 % (33/239), respectively. The pyrosequencing threshold for positivity of 20 % showed the best correlation with MS-HRM and direct-MSP results. Nested-MSP detected RET promoter CpG island methylation in deceased patients with a higher sensitivity (33.1 %) compared to direct-MSP (10.7 %), pyrosequencing (14.4 %), and MS-HRM (15.4 %). While RET methylation frequencies detected by nested-MSP, pyrosequencing, and MS-HRM varied, the prognostic effect seemed similar (HR 1.74, 95 % CI 0.97-3.15; HR 1.85, 95 % CI 0.93-3.86; HR 1.83, 95 % CI 0.92-3.65, respectively). Our results show that upon optimizing and aligning four RET methylation assays with regard to primer location and sensitivity, differences in methylation frequencies and clinical sensitivities are observed; however, the effect on the marker's prognostic outcome is minimal.
Mordecai, Yaniv; Dori, Dov
2017-07-17
The cyber-physical gap (CPG) is the difference between the 'real' state of the world and the way the system perceives it. This discrepancy often stems from the limitations of sensing and data collection technologies and capabilities, and is inevitable at some degree in any cyber-physical system (CPS). Ignoring or misrepresenting such limitations during system modeling, specification, design, and analysis can potentially result in systemic misconceptions, disrupted functionality and performance, system failure, severe damage, and potential detrimental impacts on the system and its environment. We propose CPG-Aware Modeling & Engineering (CPGAME), a conceptual model-based approach to capturing, explaining, and mitigating the CPG. CPGAME enhances the systems engineer's ability to cope with CPGs, mitigate them by design, and prevent erroneous decisions and actions. We demonstrate CPGAME by applying it for modeling and analysis of the 1979 Three Miles Island 2 nuclear accident, and show how its meltdown could be mitigated. We use ISO-19450:2015-Object Process Methodology as our conceptual modeling framework.
Choi, Sun-Shim; Chung, Eunkyung; Jung, Yu-Jin
2010-08-01
Bacterial CpG motifs are known to induce both innate and adaptive immunity in infected hosts via toll-like receptor 9 (TLR9). Because small oligonucleotides (ODNs) mimicking bacterial CpG motifs are easily synthesized, they have found use as immunomodulatory agents in a number of disease models. We have developed a novel bioinformatics approach to identify effective CpG ODN sequences and evaluate their function as TLR9 ligands in a murine system. Among the CpG ODNs we identified, M5-30 and M6-395 showed significant ability to stimulate TNF-alpha and IFN-gamma production in a mouse macrophage cell line and mouse splenocytes, respectively. We also found that these CpG ODNs activated cells through the canonical NF-kappa B signaling pathway. Moreover, both CpG ODNs were able to induce Th1-mediated immunity in Mycobacterium tuberculosis (Mtb)-infected mice. Our results demonstrate that M5-30 and M6-395 function as TLR9-specific ligands, making them useful in the study of TLR9 functionality and signaling in mice.
The Genomic Impact of DNA CpG Methylation on Gene Expression; Relationships in Prostate Cancer.
Long, Mark D; Smiraglia, Dominic J; Campbell, Moray J
2017-02-14
The process of DNA CpG methylation has been extensively investigated for over 50 years and revealed associations between changing methylation status of CpG islands and gene expression. As a result, DNA CpG methylation is implicated in the control of gene expression in developmental and homeostasis processes, as well as being a cancer-driver mechanism. The development of genome-wide technologies and sophisticated statistical analytical approaches has ushered in an era of widespread analyses, for example in the cancer arena, of the relationships between altered DNA CpG methylation, gene expression, and tumor status. The remarkable increase in the volume of such genomic data, for example, through investigators from the Cancer Genome Atlas (TCGA), has allowed dissection of the relationships between DNA CpG methylation density and distribution, gene expression, and tumor outcome. In this manner, it is now possible to test that the genome-wide correlations are measurable between changes in DNA CpG methylation and gene expression. Perhaps surprisingly is that these associations can only be detected for hundreds, but not thousands, of genes, and the direction of the correlations are both positive and negative. This, perhaps, suggests that CpG methylation events in cancer systems can act as disease drivers but the effects are possibly more restricted than suspected. Additionally, the positive and negative correlations suggest direct and indirect events and an incomplete understanding. Within the prostate cancer TCGA cohort, we examined the relationships between expression of genes that control DNA methylation, known targets of DNA methylation and tumor status. This revealed that genes that control the synthesis of S -adenosyl-l-methionine (SAM) associate with altered expression of DNA methylation targets in a subset of aggressive tumors.
Haller, Florian; Zhang, Jitao David; Moskalev, Evgeny A; Braun, Alexander; Otto, Claudia; Geddert, Helene; Riazalhosseini, Yasser; Ward, Aoife; Balwierz, Aleksandra; Schaefer, Inga-Marie; Cameron, Silke; Ghadimi, B Michael; Agaimy, Abbas; Fletcher, Jonathan A; Hoheisel, Jörg; Hartmann, Arndt; Werner, Martin; Wiemann, Stefan; Sahin, Ozgür
2015-03-01
Gastrointestinal stromal tumors (GISTs) have distinct gene expression patterns according to localization, genotype and aggressiveness. DNA methylation at CpG dinucleotides is an important mechanism for regulation of gene expression. We performed targeted DNA methylation analysis of 1.505 CpG loci in 807 cancer-related genes in a cohort of 76 GISTs, combined with genome-wide mRNA expression analysis in 22 GISTs, to identify signatures associated with clinicopathological parameters and prognosis. Principal component analysis revealed distinct DNA methylation patterns associated with anatomical localization, genotype, mitotic counts and clinical follow-up. Methylation of a single CpG dinucleotide in the non-CpG island promoter of SPP1 was significantly correlated with shorter disease-free survival. Hypomethylation of this CpG was an independent prognostic parameter in a multivariate analysis compared to anatomical localization, genotype, tumor size and mitotic counts in a cohort of 141 GISTs with clinical follow-up. The epigenetic regulation of SPP1 was confirmed in vitro, and the functional impact of SPP1 protein on tumorigenesis-related signaling pathways was demonstrated. In summary, SPP1 promoter methylation is a novel and independent prognostic parameter in GISTs, and might be helpful in estimating the aggressiveness of GISTs from the intermediate-risk category. © 2014 UICC.
Phenotype-specific CpG island methylation events in a murine model of prostate cancer.
Camoriano, Marta; Kinney, Shannon R Morey; Moser, Michael T; Foster, Barbara A; Mohler, James L; Trump, Donald L; Karpf, Adam R; Smiraglia, Dominic J
2008-06-01
Aberrant DNA methylation plays a significant role in nearly all human cancers and may contribute to disease progression to advanced phenotypes. Study of advanced prostate cancer phenotypes in the human disease is hampered by limited availability of tissues. We therefore took advantage of the Transgenic Adenocarcinoma of Mouse Prostate (TRAMP) model to study whether three different phenotypes of TRAMP tumors (PRIM, late-stage primary tumors; AIP, androgen-independent primary tumors; and MET, metastases) displayed specific patterns of CpG island hypermethylation using Restriction Landmark Genomic Scanning. Each tumor phenotype displayed numerous hypermethylation events, with the most homogeneous methylation pattern in AIP and the most heterogeneous pattern in MET. Several loci displayed a phenotype-specific methylation pattern; the most striking pattern being loci methylated at high frequency in PRIM and AIP but rarely in MET. Examination of the mRNA expression of three genes, BC058385, Goosecoid, and Neurexin 2, which exhibited nonpromoter methylation, revealed increased expression associated with downstream methylation. Only methylated samples showed mRNA expression, in which tumor phenotype was a key factor determining the level of expression. The CpG island in the human orthologue of BC058385 was methylated in human AIP but not in primary androgen-stimulated prostate cancer or benign prostate. The clinical data show a proof-of-principle that the TRAMP model can be used to identify targets of aberrant CpG island methylation relevant to human disease. In conclusion, phenotype-specific hypermethylation events were associated with the overexpression of different genes and may provide new markers of prostate tumorigenesis.
Diede, Scott J; Yao, Zizhen; Keyes, C Chip; Tyler, Ashlee E; Dey, Joyoti; Hackett, Christopher S; Elsaesser, Katrina; Kemp, Christopher J; Neiman, Paul E; Weiss, William A; Olson, James M; Tapscott, Stephen J
2013-12-01
Genetic and epigenetic alterations are essential for the initiation and progression of human cancer. We previously reported that primary human medulloblastomas showed extensive cancer-specific CpG island DNA hypermethylation in critical developmental pathways. To determine whether genetically engineered mouse models (GEMMs) of medulloblastoma have comparable epigenetic changes, we assessed genome-wide DNA methylation in three mouse models of medulloblastoma. In contrast to human samples, very few loci with cancer-specific DNA hypermethylation were detected, and in almost all cases the degree of methylation was relatively modest compared with the dense hypermethylation in the human cancers. To determine if this finding was common to other GEMMs, we examined a Burkitt lymphoma and breast cancer model and did not detect promoter CpG island DNA hypermethylation, suggesting that human cancers and at least some GEMMs are fundamentally different with respect to this epigenetic modification. These findings provide an opportunity to both better understand the mechanism of aberrant DNA methylation in human cancer and construct better GEMMs to serve as preclinical platforms for therapy development.
Rhee, Ye-Young; Kim, Kyung-Ju; Kang, Gyeong Hoon
2017-01-15
The concept of a CpG island methylator phenotype (CIMP) was first introduced by Toyota and Issa to describe a subset of colorectal cancers (CRCs) with concurrent hypermethylation of multiple CpG island loci. The concept of CIMP as a molecular carcinogenesis mechanism was consolidated by the identification of the serrated neoplasia pathway, in which CIMP participates in the initiation and progression of serrated adenomas. Distinct clinicopathological and molecular features of CIMP-high (CIMP-H) CRCs have been characterized, including proximal colon location, older age of onset, female preponderance, and frequent associations of high-level microsatellite instability and BRAF mutations. CIMP-H CRCs arise in sessile or traditional serrated adenomas and thus tend to display the morphological characteristics of serrated adenomas, including epithelial serration, vesicular nuclei, and abundant cytoplasm. Both the frequent association of CIMP and poor prognosis and different responses of CRCs to adjuvant therapy depending on CIMP status indicate clinical implications. In this review, we present an overview of the literature documenting the relevant findings of CIMP-H CRCs and their relationships with the serrated neoplasia pathway.
DNA Methylation of T1R1 Gene in the Vegetarian Adaptation of Grass Carp Ctenopharyngodon idella.
Cai, Wenjing; He, Shan; Liang, Xu-Fang; Yuan, Xiaochen
2018-05-02
Although previous studies have indicated importance of taste receptors in food habits formation in mammals, little is known about those in fish. Grass carp is an excellent model for studying vegetarian adaptation, as it shows food habit transition from carnivore to herbivore. In the present study, pseudogenization or frameshift mutations of the umami receptors that hypothesized related to dietary switch in vertebrates, were not found in grass carp, suggesting other mechanisms for vegetarian adaptation in grass carp. T1R1 and T1R3 strongly responded to L-Arg and L-Lys, differing from those of zebrafish and medaka, contributing to high species specificity in amino acid preferences and diet selection of grass carp. After food habit transition of grass carp, DNA methylation levels were higher in CPG1 and CPG3 islands of upstream control region of T1R1 gene. Luciferase activity assay of upstream regulatory region of T1R1 (-2500-0 bp) without CPG1 or CPG3 indicated that CPG1 and CPG3 might be involved in transcriptional regulation of T1R1 gene. Subsequently, high DNA methylation decreased expression of T1R1 in intestinal tract. It could be a new mechanism to explain, at least partially, the vegetarian adaptation of grass carp by regulation of expression of umami receptor via epigenetic modification.
Li, Xiaoli; Cen, Yanyan; Cai, Yongqing; Liu, Tao; Liu, Huan; Cao, Guanqun; Liu, Dan; Li, Bin; Peng, Wei; Zou, Jintao; Pang, Xueli; Zheng, Jiang; Zhou, Hong
2016-01-01
Synthetic oligodeoxynucleotides containing unmethylated CpG dinucleotides (CpG ODN) function as potential radiosensitizers for glioma treatment, although the underlying mechanism is unclear. It was observed that CpG ODN107, when combined with irradiation, did not induce apoptosis. Herein, the effect of CpG ODN107 + irradiation on autophagy and the related signaling pathways was investigated. In vitro, CpG ODN107 + irradiation induced autophagosome formation, increased the ratio of LC3 II/LC3 I, beclin 1 and decreased p62 expression in U87 cells. Meanwhile, CpG ODN107 also increased LC3 II/LC3 I expression in U251 and CHG-5 cells. In vivo, CpG ODN107 combined with local radiotherapy induced autophagosome formation in orthotopic transplantation tumor. Investigation of the molecular mechanisms demonstrated that CpG ODN107 + irradiation increased the levels of TLR9 and p-ERK, and decreased the level of p-mTOR in glioma cells. Further, TLR9-specific siRNA could affect the expressions of p-ERK and autophagy-related proteins in glioma cells. Taken together, CpG ODN107 combined with irradiation could induce autophagic cell death, and this effect was closely related to the TLR9-ERK-mTOR signaling pathway in glioma cells, providing new insights into the investigation mechanism of CpG ODN. PMID:27251306
Cadmium exposure and the epigenome
Sanders, Alison P; Smeester, Lisa; Rojas, Daniel; DeBussycher, Tristan; Wu, Michael C; Wright, Fred A; Zhou, Yi-Hui; Laine, Jessica E; Rager, Julia E; Swamy, Geeta K; Ashley-Koch, Allison; Lynn Miranda, Marie; Fry, Rebecca C
2014-01-01
Cadmium (Cd) is prevalent in the environment yet understudied as a developmental toxicant. Cd partially crosses the placental barrier from mother to fetus and is linked to detrimental effects in newborns. Here we examine the relationship between levels of Cd during pregnancy and 5-methylcytosine (5mC) levels in leukocyte DNA collected from 17 mother-newborn pairs. The methylation of cytosines is an epigenetic mechanism known to impact transcriptional signaling and influence health endpoints. A methylated cytosine-guanine (CpG) island recovery assay was used to assess over 4.6 million sites spanning 16,421 CpG islands. Exposure to Cd was classified for each mother-newborn pair according to maternal blood levels and compared with levels of cotinine. Subsets of genes were identified that showed altered DNA methylation levels in their promoter regions in fetal DNA associated with levels of Cd (n = 61), cotinine (n = 366), or both (n = 30). Likewise, in maternal DNA, differentially methylated genes were identified that were associated with Cd (n = 92) or cotinine (n = 134) levels. While the gene sets were largely distinct between maternal and fetal DNA, functional similarities at the biological pathway level were identified including an enrichment of genes that encode for proteins that control transcriptional regulation and apoptosis. Furthermore, conserved DNA motifs with sequence similarity to specific transcription factor binding sites were identified within the CpG islands of the gene sets. This study provides evidence for distinct patterns of DNA methylation or “footprints” in fetal and maternal DNA associated with exposure to Cd. PMID:24169490
Vingron, Martin
2016-01-01
Non-methylated islands (NMIs) of DNA are genomic regions that are important for gene regulation and development. A recent study of genome-wide non-methylation data in vertebrates by Long et al. (eLife 2013;2:e00348) has shown that many experimentally identified non-methylated regions do not overlap with classically defined CpG islands which are computationally predicted using simple DNA sequence features. This is especially true in cold-blooded vertebrates such as Danio rerio (zebrafish). In order to investigate how predictive DNA sequence is of a region’s methylation status, we applied a supervised learning approach using a spectrum kernel support vector machine, to see if a more complex model and supervised learning can be used to improve non-methylated island prediction and to understand the sequence properties of these regions. We demonstrate that DNA sequence is highly predictive of methylation status, and that in contrast to existing CpG island prediction methods our method is able to provide more useful predictions of NMIs genome-wide in all vertebrate organisms that were studied. Our results also show that in cold-blooded vertebrates (Anolis carolinensis, Xenopus tropicalis and Danio rerio) where genome-wide classical CpG island predictions consist primarily of false positives, longer primarily AT-rich DNA sequence features are able to identify these regions much more accurately. PMID:27984582
Epigenomic alterations define lethal CIMP-positive ependymomas of infancy
Mack, S. C.; Witt, H.; Piro, R. M.; Gu, L.; Zuyderduyn, S.; Stütz, A. M.; Wang, X.; Gallo, M.; Garzia, L.; Zayne, K.; Zhang, X.; Ramaswamy, V.; Jäger, N.; Jones, D. T. W.; Sill, M.; Pugh, T. J.; Ryzhova, M.; Wani, K. M.; Shih, D. J. H.; Head, R.; Remke, M.; Bailey, S. D.; Zichner, T.; Faria, C. C.; Barszczyk, M.; Stark, S.; Seker-Cin, H.; Hutter, S.; Johann, P.; Bender, S.; Hovestadt, V.; Tzaridis, T.; Dubuc, A. M.; Northcott, P. A.; Peacock, J.; Bertrand, K. C.; Agnihotri, S.; Cavalli, F. M. G.; Clarke, I.; Nethery-Brokx, K.; Creasy, C. L.; Verma, S. K.; Koster, J.; Wu, X.; Yao, Y.; Milde, T.; Sin-Chan, P.; Zuccaro, J.; Lau, L.; Pereira, S.; Castelo-Branco, P.; Hirst, M.; Marra, M. A.; Roberts, S. S.; Fults, D.; Massimi, L.; Cho, Y. J.; Van Meter, T.; Grajkowska, W.; Lach, B.; Kulozik, A. E.; von Deimling, A.; Witt, O.; Scherer, S. W.; Fan, X.; Muraszko, K. M.; Kool, M.; Pomeroy, S. L.; Gupta, N.; Phillips, J.; Huang, A.; Tabori, U.; Hawkins, C.; Malkin, D.; Kongkham, P. N.; Weiss, W. A.; Jabado, N.; Rutka, J. T.; Bouffet, E.; Korbel, J. O.; Lupien, M.; Aldape, K. D.; Bader, G. D.; Eils, R.; Lichter, P.; Dirks, P. B.; Pfister, S. M.; Korshunov, A.; Taylor, M. D.
2014-01-01
Ependymomas are common childhood brain tumours that occur throughout the nervous system, but are most common in the paediatric hindbrain. Current standard therapy comprises surgery and radiation, but not cytotoxic chemotherapy as it does not further increase survival. Whole-genome and whole-exome sequencing of 47 hindbrain ependymomas reveals an extremely low mutation rate, and zero significant recurrent somatic single nucleotide variants. Although devoid of recurrent single nucleotide variants and focal copy number aberrations, poor-prognosis hindbrain ependymomas exhibit a CpG island methylator phenotype. Transcriptional silencing driven by CpG methylation converges exclusively on targets of the Polycomb repressive complex 2 which represses expression of differentiation genes through trimethylation of H3K27. CpG island methylator phenotype-positive hindbrain ependymomas are responsive to clinical drugs that target either DNA or H3K27 methylation both in vitro and in vivo. We conclude that epigenetic modifiers are the first rational therapeutic candidates for this deadly malignancy, which is epigenetically deregulated but genetically bland. PMID:24553142
Epigenomic alterations define lethal CIMP-positive ependymomas of infancy.
Mack, S C; Witt, H; Piro, R M; Gu, L; Zuyderduyn, S; Stütz, A M; Wang, X; Gallo, M; Garzia, L; Zayne, K; Zhang, X; Ramaswamy, V; Jäger, N; Jones, D T W; Sill, M; Pugh, T J; Ryzhova, M; Wani, K M; Shih, D J H; Head, R; Remke, M; Bailey, S D; Zichner, T; Faria, C C; Barszczyk, M; Stark, S; Seker-Cin, H; Hutter, S; Johann, P; Bender, S; Hovestadt, V; Tzaridis, T; Dubuc, A M; Northcott, P A; Peacock, J; Bertrand, K C; Agnihotri, S; Cavalli, F M G; Clarke, I; Nethery-Brokx, K; Creasy, C L; Verma, S K; Koster, J; Wu, X; Yao, Y; Milde, T; Sin-Chan, P; Zuccaro, J; Lau, L; Pereira, S; Castelo-Branco, P; Hirst, M; Marra, M A; Roberts, S S; Fults, D; Massimi, L; Cho, Y J; Van Meter, T; Grajkowska, W; Lach, B; Kulozik, A E; von Deimling, A; Witt, O; Scherer, S W; Fan, X; Muraszko, K M; Kool, M; Pomeroy, S L; Gupta, N; Phillips, J; Huang, A; Tabori, U; Hawkins, C; Malkin, D; Kongkham, P N; Weiss, W A; Jabado, N; Rutka, J T; Bouffet, E; Korbel, J O; Lupien, M; Aldape, K D; Bader, G D; Eils, R; Lichter, P; Dirks, P B; Pfister, S M; Korshunov, A; Taylor, M D
2014-02-27
Ependymomas are common childhood brain tumours that occur throughout the nervous system, but are most common in the paediatric hindbrain. Current standard therapy comprises surgery and radiation, but not cytotoxic chemotherapy as it does not further increase survival. Whole-genome and whole-exome sequencing of 47 hindbrain ependymomas reveals an extremely low mutation rate, and zero significant recurrent somatic single nucleotide variants. Although devoid of recurrent single nucleotide variants and focal copy number aberrations, poor-prognosis hindbrain ependymomas exhibit a CpG island methylator phenotype. Transcriptional silencing driven by CpG methylation converges exclusively on targets of the Polycomb repressive complex 2 which represses expression of differentiation genes through trimethylation of H3K27. CpG island methylator phenotype-positive hindbrain ependymomas are responsive to clinical drugs that target either DNA or H3K27 methylation both in vitro and in vivo. We conclude that epigenetic modifiers are the first rational therapeutic candidates for this deadly malignancy, which is epigenetically deregulated but genetically bland.
Guideline-Driven Care Improves Outcomes in Patients with Traumatic Rib Fractures.
Flarity, Kathleen; Rhodes, Whitney C; Berson, Andrew J; Leininger, Brian E; Reckard, Paul E; Riley, Keyan D; Shahan, Charles P; Schroeppel, Thomas J
2017-09-01
There is no established national standard for rib fracture management. A clinical practice guideline (CPG) for rib fractures, including monitoring of pulmonary function, early initiation of aggressive loco-regional analgesia, and early identification of deteriorating respiratory function, was implemented in 2013. The objective of the study was to evaluate the effect of the CPG on hospital length of stay. Hospital length of stay (LOS) was compared for adult patients admitted to the hospital with rib fracture(s) two years before and two years after CPG implementation. A separate analysis was done for the patients admitted to the intensive care unit (ICU). Over the 48-month study period, 571 patients met inclusion criteria for the study. Pre-CPG and CPG study groups were well matched with few differences. Multivariable regression did not demonstrate a difference in LOS (B = -0.838; P = 0.095) in the total study cohort. In the ICU cohort (n = 274), patients in the CPG group were older (57 vs 52 years; P = 0.023) and had more rib fractures (4 vs 3; P = 0.003). Multivariable regression identified a significant decrease in LOS for those patients admitted in the CPG period (B = -2.29; P = 0.019). Despite being significantly older with more rib fractures in the ICU cohort, patients admitted after implementation of the CPG had a significantly reduced LOS on multivariable analysis, reducing LOS by over two days. This structured intervention can limit narcotic usage, improve pulmonary function, and decrease LOS in the most injured patients with chest trauma.
Parvovirus B19 DNA CpG Dinucleotide Methylation and Epigenetic Regulation of Viral Expression
Bonvicini, Francesca; Manaresi, Elisabetta; Di Furio, Francesca; De Falco, Luisa; Gallinella, Giorgio
2012-01-01
CpG DNA methylation is one of the main epigenetic modifications playing a role in the control of gene expression. For DNA viruses whose genome has the ability to integrate in the host genome or to maintain as a latent episome, a correlation has been found between the extent of DNA methylation and viral quiescence. No information is available for Parvovirus B19, a human pathogenic virus, which is capable of both lytic and persistent infections. Within Parvovirus B19 genome, the inverted terminal regions display all the characteristic signatures of a genomic CpG island; therefore we hypothesised a role of CpG dinucleotide methylation in the regulation of viral genome expression. The analysis of CpG dinucleotide methylation of Parvovirus B19 DNA was carried out by an aptly designed quantitative real-time PCR assay on bisulfite-modified DNA. The effects of CpG methylation on the regulation of viral genome expression were first investigated by transfection of either unmethylated or in vitro methylated viral DNA in a model cell line, showing that methylation of viral DNA was correlated to lower expression levels of the viral genome. Then, in the course of in vitro infections in different cellular environments, it was observed that absence of viral expression and genome replication were both correlated to increasing levels of CpG methylation of viral DNA. Finally, the presence of CpG methylation was documented in viral DNA present in bioptic samples, indicating the occurrence and a possible role of this epigenetic modification in the course of natural infections. The presence of an epigenetic level of regulation of viral genome expression, possibly correlated to the silencing of the viral genome and contributing to the maintenance of the virus in tissues, can be relevant to the balance and outcome of the different types of infection associated to Parvovirus B19. PMID:22413013
2017-01-01
The cyber-physical gap (CPG) is the difference between the ‘real’ state of the world and the way the system perceives it. This discrepancy often stems from the limitations of sensing and data collection technologies and capabilities, and is inevitable at some degree in any cyber-physical system (CPS). Ignoring or misrepresenting such limitations during system modeling, specification, design, and analysis can potentially result in systemic misconceptions, disrupted functionality and performance, system failure, severe damage, and potential detrimental impacts on the system and its environment. We propose CPG-Aware Modeling & Engineering (CPGAME), a conceptual model-based approach to capturing, explaining, and mitigating the CPG. CPGAME enhances the systems engineer’s ability to cope with CPGs, mitigate them by design, and prevent erroneous decisions and actions. We demonstrate CPGAME by applying it for modeling and analysis of the 1979 Three Miles Island 2 nuclear accident, and show how its meltdown could be mitigated. We use ISO-19450:2015—Object Process Methodology as our conceptual modeling framework. PMID:28714910
NASA Astrophysics Data System (ADS)
Weiner, George J.; Liu, Hsin-Ming; Wooldridge, James E.; Dahle, Christopher E.; Krieg, Arthur M.
1997-09-01
Recent advances in our understanding of the immune response are allowing for the logical design of new approaches to cancer immunization. One area of interest is the development of new immune adjuvants. Immunostimulatory oligodeoxynucleotides containing the CpG motif (CpG ODN) can induce production of a wide variety of cytokines and activate B cells, monocytes, dendritic cells, and NK cells. Using the 38C13 B cell lymphoma model, we assessed whether CpG ODN can function as immune adjuvants in tumor antigen immunization. The idiotype served as the tumor antigen. Select CpG ODN were as effective as complete Freund's adjuvant at inducing an antigen-specific antibody response but were associated with less toxicity. These CpG ODN induced a higher titer of antigen-specific IgG2a than did complete Freund's adjuvant, suggesting an enhanced TH1 response. Mice immunized with CpG ODN as an adjuvant were protected from tumor challenge to a degree similar to that seen in mice immunized with complete Freund's adjuvant. We conclude that CpG ODN are effective as immune adjuvants and are attractive as part of a tumor immunization strategy.
Rhee, Ye-Young; Kim, Kyung-Ju; Kang, Gyeong Hoon
2017-01-01
The concept of a CpG island methylator phenotype (CIMP) was first introduced by Toyota and Issa to describe a subset of colorectal cancers (CRCs) with concurrent hypermethylation of multiple CpG island loci. The concept of CIMP as a molecular carcinogenesis mechanism was consolidated by the identification of the serrated neoplasia pathway, in which CIMP participates in the initiation and progression of serrated adenomas. Distinct clinicopathological and molecular features of CIMP-high (CIMP-H) CRCs have been characterized, including proximal colon location, older age of onset, female preponderance, and frequent associations of high-level microsatellite instability and BRAF mutations. CIMP-H CRCs arise in sessile or traditional serrated adenomas and thus tend to display the morphological characteristics of serrated adenomas, including epithelial serration, vesicular nuclei, and abundant cytoplasm. Both the frequent association of CIMP and poor prognosis and different responses of CRCs to adjuvant therapy depending on CIMP status indicate clinical implications. In this review, we present an overview of the literature documenting the relevant findings of CIMP-H CRCs and their relationships with the serrated neoplasia pathway. PMID:27885175
A DNA methylation fingerprint of 1628 human samples
Fernandez, Agustin F.; Assenov, Yassen; Martin-Subero, Jose Ignacio; Balint, Balazs; Siebert, Reiner; Taniguchi, Hiroaki; Yamamoto, Hiroyuki; Hidalgo, Manuel; Tan, Aik-Choon; Galm, Oliver; Ferrer, Isidre; Sanchez-Cespedes, Montse; Villanueva, Alberto; Carmona, Javier; Sanchez-Mut, Jose V.; Berdasco, Maria; Moreno, Victor; Capella, Gabriel; Monk, David; Ballestar, Esteban; Ropero, Santiago; Martinez, Ramon; Sanchez-Carbayo, Marta; Prosper, Felipe; Agirre, Xabier; Fraga, Mario F.; Graña, Osvaldo; Perez-Jurado, Luis; Mora, Jaume; Puig, Susana; Prat, Jaime; Badimon, Lina; Puca, Annibale A.; Meltzer, Stephen J.; Lengauer, Thomas; Bridgewater, John; Bock, Christoph; Esteller, Manel
2012-01-01
Most of the studies characterizing DNA methylation patterns have been restricted to particular genomic loci in a limited number of human samples and pathological conditions. Herein, we present a compromise between an extremely comprehensive study of a human sample population with an intermediate level of resolution of CpGs at the genomic level. We obtained a DNA methylation fingerprint of 1628 human samples in which we interrogated 1505 CpG sites. The DNA methylation patterns revealed show this epigenetic mark to be critical in tissue-type definition and stemness, particularly around transcription start sites that are not within a CpG island. For disease, the generated DNA methylation fingerprints show that, during tumorigenesis, human cancer cells underwent a progressive gain of promoter CpG-island hypermethylation and a loss of CpG methylation in non-CpG-island promoters. Although transformed cells are those in which DNA methylation disruption is more obvious, we observed that other common human diseases, such as neurological and autoimmune disorders, had their own distinct DNA methylation profiles. Most importantly, we provide proof of principle that the DNA methylation fingerprints obtained might be useful for translational purposes by showing that we are able to identify the tumor type origin of cancers of unknown primary origin (CUPs). Thus, the DNA methylation patterns identified across the largest spectrum of samples, tissues, and diseases reported to date constitute a baseline for developing higher-resolution DNA methylation maps and provide important clues concerning the contribution of CpG methylation to tissue identity and its changes in the most prevalent human diseases. PMID:21613409
Length of paternal lifespan is manifested in the DNA methylome of their nonagenarian progeny
Marttila, Saara; Kananen, Laura; Jylhävä, Juulia; Nevalainen, Tapio; Hervonen, Antti; Jylhä, Marja; Hurme, Mikko
2015-01-01
The heritability of lifespan is 20-30%, but only a few genes associated with longevity have been identified. To explain this discrepancy, the inheritance of epigenetic features, such as DNA methylation, have been proposed to contribute to the heritability of lifespan. We investigated whether parental lifespan is associated with DNA methylation profile in nonagenarians. A regression model, adjusted for differences in blood cell proportions, identified 659 CpG sites where the level of methylation was associated with paternal lifespan. However, no association was observed between maternal lifespan and DNA methylation. The 659 CpG sites associated with paternal lifespan were enriched outside of CpG islands and were located in genes associated with development and morphogenesis, as well as cell signaling. The largest difference in the level of methylation between the progeny of the shortest-lived and longest-lived fathers was identified for CpG sites mapping to CXXC5. In addition, the level of methylation in three Notch-genes (NOTCH1, NOTCH3 and NOTCH4) was also associated with paternal lifespan. There are implications for the inheritance of acquired traits via epigenetic mechanisms in mammals. Here we describe DNA methylation features that are associated with paternal lifespan, and we speculate that the identified CpG sites may represent intergenerational epigenetic inheritance. PMID:26436701
Carbon nanotubes enhance CpG uptake and potentiate antiglioma immunity.
Zhao, Dongchang; Alizadeh, Darya; Zhang, Leying; Liu, Wei; Farrukh, Omar; Manuel, Edwin; Diamond, Don J; Badie, Behnam
2011-02-15
Stimulation of toll-like receptor-9 (TLR9) by CpG oligodeoxynucleotides (CpG) has been shown to counteract the immunosuppressive microenvironment and to inhibit tumor growth in glioma models. Because TLR9 is located intracellularly, we hypothesized that methods that enhance its internalization may also potentiate its immunostimulatory response. The goal of this study was to evaluate carbon nanotubes (CNT) as a CpG delivery vehicle in brain tumor models. Functionalized single-walled CNTs were conjugated with CpG (CNT-CpG) and evaluated in vitro and in mice bearing intracranial GL261 gliomas. Flow cytometry was used to assess CNT-CpG uptake and antiglioma immune response. Tumor growth was measured by bioluminescent imaging, histology, and animal survival. CNT-CpG was nontoxic and enhanced CpG uptake both in vitro and intracranial gliomas. CNT-mediated CpG delivery also potentiated proinflammatory cytokine production by primary monocytes. Interestingly, a single intracranial injection of low-dose CNT-CpG (but not free CpG or blank CNT) eradicated intracranial GL261 gliomas in half of tumor-bearing mice. Moreover, surviving animals exhibited durable tumor-free remission (>3 months), and were protected from intracranial tumor rechallenge, demonstrating induction of long-term antitumor immunity. These findings suggest that CNTs can potentiate CpG immunopotency by enhancing its delivery into tumor-associated inflammatory cells. ©2010 AACR.
Carbon Nanotubes Enhance CpG Uptake and Potentiate Anti-Glioma Immunity
Zhao, Dongchang; Alizadeh, Darya; Zhang, Leying; Liu, Wei; Farrukh, Omar; Manuel, Edwin; Diamond, Don J.; Badie, Behnam
2010-01-01
Purpose Stimulation of toll-like receptor-9 (TLR9) by CpG oligodeoxynucleotides (CpG) has been shown to counteract the immunosuppressive microenvironment and to inhibit tumor growth in glioma models. Since TLR9 is located intracellularly, we hypothesized that methods that enhance its internalization may also potentiate its immunostimulatory response. The goal of this study was to evaluate carbon nanotubes (CNTs) as a CpG delivery vehicle in brain tumor models. Experimental Design Functionalized single-walled CNTs were conjugated with CpG (CNT-CpG) and evaluated in vitro and in mice bearing intracranial GL261 gliomas. Flow cytometry was used to assess CNT-CpG uptake and anti-glioma immune response. Tumor growth was measured by bioluminescent imaging, histology, and animal survival. Results CNT-CpG was nontoxic and enhanced CpG uptake both in vitro and intracranial gliomas. CNT-mediated CpG delivery also potentiated pro-inflammatory cytokine production by primary monocytes. Interestingly, a single intracranial injection of low-dose CNT-CpG (but not free CpG or blank CNT) eradicated intracranial GL261 gliomas in half of tumor-bearing mice. Moreover, surviving animals exhibited durable tumor-free remission (> 3 months), and were protected from intracranial tumor rechallenge, demonstrating induction of long-term anti-tumor immunity. Conclusions These findings suggest that CNTs can potentiate CpG immunopotency by enhancing its delivery into tumor-associated inflammatory cells. PMID:21088258
Degerman, Sofie; Landfors, Mattias; Siwicki, Jan Konrad; Revie, John; Borssén, Magnus; Evelönn, Emma; Forestier, Erik; Chrzanowska, Krystyna H; Rydén, Patrik; Keith, W Nicol; Roos, Göran
2014-07-01
We have previously described gene expression changes during spontaneous immortalization of T-cells, thereby identifying cellular processes important for cell growth crisis escape and unlimited proliferation. Here, we analyze the same model to investigate the role of genome-wide methylation in the immortalization process at different time points pre-crisis and post-crisis using high-resolution arrays. We show that over time in culture there is an overall accumulation of methylation alterations, with preferential increased methylation close to transcription start sites (TSSs), islands, and shore regions. Methylation and gene expression alterations did not correlate for the majority of genes, but for the fraction that correlated, gain of methylation close to TSS was associated with decreased gene expression. Interestingly, the pattern of CpG site methylation observed in immortal T-cell cultures was similar to clinical T-cell acute lymphoblastic leukemia (T-ALL) samples classified as CpG island methylator phenotype positive. These sites were highly overrepresented by polycomb target genes and involved in developmental, cell adhesion, and cell signaling processes. The presence of non-random methylation events in in vitro immortalized T-cell cultures and diagnostic T-ALL samples indicates altered methylation of CpG sites with a possible role in malignant hematopoiesis. Copyright © 2014 Neoplasia Press, Inc. Published by Elsevier Inc. All rights reserved.
Ma, G X; Zhou, R Q; Hu, L; Luo, Y L; Luo, Y F; Zhu, H H
2018-03-01
Toxocara canis is an important but neglected zoonotic parasite, and is the causative agent of human toxocariasis. Chondroitin proteoglycans are biological macromolecules, widely distributed in extracellular matrices, with a great diversity of functions in mammals. However, there is limited information regarding chondroitin proteoglycans in nematode parasites. In the present study, a female-enriched chondroitin proteoglycan 2 gene of T. canis (Tc-cpg-2) was cloned and characterized. Quantitative real-time polymerase chain reaction (qRT-PCR) was employed to measure the transcription levels of Tc-cpg-2 among tissues of male and female adult worms. A 485-amino-acid (aa) polypeptide was predicted from a continuous 1458-nuleotide open reading frame and designated as TcCPG2, which contains a 21-aa signal peptide. Conserved domain searching indicated three chitin-binding peritrophin-A (CBM_14) domains in the amino acid sequence of TcCPG2. Multiple alignment with the inferred amino acid sequences of Caenorhabditis elegans and Ascaris suum showed that CBM_14 domains were well conserved among these species. Phylogenetic analysis suggested that TcCPG2 was closely related to the sequence of chondroitin proteoglycan 2 of A. suum. Interestingly, a high level of Tc-cpg-2 was detected in female germline tissues, particularly in the oviduct, suggesting potential roles of this gene in reproduction (e.g. oogenesis and embryogenesis) of adult T. canis. The functional roles of Tc-cpg-2 in reproduction and development in this parasite and related parasitic nematodes warrant further functional studies.
Formulation of vaccines containing CpG oligonucleotides and alum
Aebig, Joan A.; Mullen, Gregory E. D.; Dobrescu, Gelu; Rausch, Kelly; Lambert, Lynn; Ajose-Popoola, Olubunmi; Long, Carole A.; Saul, Allan; Miles, Aaron P.
2007-01-01
CpG oligodeoxynucleotides are potent immunostimulants. For parenterally delivered alum based vaccines, the immunostimulatory effect of CpG depends on the association of the CpG and antigen to the alum. We describe effects of buffer components on the binding of CPG 7909 to aluminum hydroxide (Alhydrogel), assays for measuring binding of CPG 7909 to alum and CPG 7909 induced dissociation of antigen from the alum. Free CPG 7909 is a potent inducer of IP-10 in mice. However the lack of IP-10 production from formulations containing bound CPG 7909 suggested that CPG 7909 does not rapidly dissociate from the alum after injection. It also suggests that IP-10 assays are not a good basis for potency assays for alum based vaccines containing CPG 7909. PMID:17512533
Global Epigenetic Changes May Underlie Ethnic Differences and Susceptibility to Prostate Cancer
2013-09-01
malignancy and can often be found in non-cancerous tissues; in the prostate, hypermethylation of the GSTP1 CpG has been detected in PIA lesions [8]. DNA...methylcytosine (5-meC; [9, 10]). Since the recognition that the GSTP1 CpG island was frequently hypermethylated in PCa, more than 40 genes have been reported to...has also been identified for several genes. One study demonstrated that GSTP1 hypermethylation was significantly higher in PCa samples from AA men
Krebs, Arnaud R; Dessus-Babus, Sophie; Burger, Lukas; Schübeler, Dirk
2014-09-26
The majority of mammalian promoters are CpG islands; regions of high CG density that require protection from DNA methylation to be functional. Importantly, how sequence architecture mediates this unmethylated state remains unclear. To address this question in a comprehensive manner, we developed a method to interrogate methylation states of hundreds of sequence variants inserted at the same genomic site in mouse embryonic stem cells. Using this assay, we were able to quantify the contribution of various sequence motifs towards the resulting DNA methylation state. Modeling of this comprehensive dataset revealed that CG density alone is a minor determinant of their unmethylated state. Instead, these data argue for a principal role for transcription factor binding sites, a prediction confirmed by testing synthetic mutant libraries. Taken together, these findings establish the hierarchy between the two cis-encoded mechanisms that define the DNA methylation state and thus the transcriptional competence of CpG islands.
Sepulveda, Antonia R.; Jones, Dan; Ogino, Shuji; Samowitz, Wade; Gulley, Margaret L.; Edwards, Robin; Levenson, Victor; Pratt, Victoria M.; Yang, Bin; Nafa, Khedoudja; Yan, Liying; Vitazka, Patrick
2009-01-01
Methylation of CpG islands in gene promoter regions is a major molecular mechanism of gene silencing and underlies both cancer development and progression. In molecular oncology, testing for the CpG methylation of tissue DNA has emerged as a clinically useful tool for tumor detection, outcome prediction, and treatment selection, as well as for assessing the efficacy of treatment with the use of demethylating agents and monitoring for tumor recurrence. In addition, because CpG methylation occurs early in pre-neoplastic tissues, methylation tests may be useful as markers of cancer risk in patients with either infectious or inflammatory conditions. The Methylation Working Group of the Clinical Practice Committee of the Association of Molecular Pathology has reviewed the current state of clinical testing in this area. We report here our summary of both the advantages and disadvantages of various methods, as well as the needs for standardization and reporting. We then conclude by summarizing the most promising areas for future clinical testing in cancer molecular diagnostics. PMID:19541921
Dendritic Cell-Based Immunotherapy of Breast Cancer: Modulation by CpG DNA
2005-09-01
tumor-associated antigens and bacterial DNA oligodeoxynucleotides containing unmethylated CpG sequences (CpG DNA) further augment the immune priming...associated antigens by cytotoxic T lymphocytes, and bacterial DNA oligodeoxy- nucleotides containing unmethylated CpG sequences (CpG DNA) can further...further amplify their immunostimulatory capacity and bacterial DNA oligodeoxynucleotides (ODN) containing unmethylated CpG sequences (CpG DNA) provide such
MMASS: an optimized array-based method for assessing CpG island methylation.
Ibrahim, Ashraf E K; Thorne, Natalie P; Baird, Katie; Barbosa-Morais, Nuno L; Tavaré, Simon; Collins, V Peter; Wyllie, Andrew H; Arends, Mark J; Brenton, James D
2006-01-01
We describe an optimized microarray method for identifying genome-wide CpG island methylation called microarray-based methylation assessment of single samples (MMASS) which directly compares methylated to unmethylated sequences within a single sample. To improve previous methods we used bioinformatic analysis to predict an optimized combination of methylation-sensitive enzymes that had the highest utility for CpG-island probes and different methods to produce unmethylated representations of test DNA for more sensitive detection of differential methylation by hybridization. Subtraction or methylation-dependent digestion with McrBC was used with optimized (MMASS-v2) or previously described (MMASS-v1, MMASS-sub) methylation-sensitive enzyme combinations and compared with a published McrBC method. Comparison was performed using DNA from the cell line HCT116. We show that the distribution of methylation microarray data is inherently skewed and requires exogenous spiked controls for normalization and that analysis of digestion of methylated and unmethylated control sequences together with linear fit models of replicate data showed superior statistical power for the MMASS-v2 method. Comparison with previous methylation data for HCT116 and validation of CpG islands from PXMP4, SFRP2, DCC, RARB and TSEN2 confirmed the accuracy of MMASS-v2 results. The MMASS-v2 method offers improved sensitivity and statistical power for high-throughput microarray identification of differential methylation.
Shargh, Vahid Heravi; Jaafari, Mahmoud Reza; Khamesipour, Ali; Jaafari, Iman; Jalali, Seyed Amir; Abbasi, Azam; Badiee, Ali
2012-06-06
First generation Leishmania vaccines consisting of whole killed parasites with or without adjuvants have reached phase 3 trial and failed to show enough efficacy mainly due to the lack of an appropriate adjuvant. In this study, the nuclease-resistant phosphorothioate CpG oligodeoxynucleotides (PS CpG) or nuclease-sensitive phosphodiester CpG ODNs (PO CpG) were used as adjuvants to enhance immunogenicity and rate of protection against leishmaniasis. Due to the susceptibility of PO CpG to nuclease degradation, an efficient liposomal delivery system was developed to protect them from degradation. 1, 2-dioleoyl-3-trimethylammonium-propane (DOTAP) as a cationic lipid was used because of its unique adjuvanticity and electrostatic interaction with negatively charged CpG ODNs. To evaluate the role of liposomal formulation in protection rate and enhanced immune response, BALB/c mice were immunized subcutaneously with liposomal soluble Leishmania antigens (SLA) co-incorporated with PO CpG (Lip-SLA-PO CpG), Lip-SLA-PS CpG, SLA+PO CpG, SLA+PS CpG, SLA or buffer. As criteria for protection, footpad swelling at the site of challenge, parasite loads, the levels of IFN-γ and IL-4, and the IgG subtypes were evaluated. The groups of mice receiving Lip-SLA-PO CpG or Lip-SLA-PS CpG showed a high protection rate compared with the control groups. In addition, there was no significant difference in immune response generation between mice immunized with PS CpG and the group receiving PO CpG when incorporated into the liposomes. The results suggested that liposomal form of PO CpG might be used instead of PS CpG in future vaccine formulations as an efficient adjuvant. Copyright © 2012 Elsevier Ltd. All rights reserved.
Zhou, Xiangtian; Ji, Fengtao; An, Jianhong; Zhao, Fuxin; Shi, Fanjun; Huang, Furong; Li, Yuan; Jiao, Shiming; Yan, Dongsheng; Chen, Xiaoyan; Chen, JiangFan
2012-01-01
Purpose To investigate whether myopia development is associated with changes of scleral DNA methylation in cytosine-phosphate-guanine (CpG) sites in the collagen 1A1 (COL1A1) promoter and messenger RNA (mRNA) levels following murine form deprivation myopia. Methods Fifty-seven C57BL/6 mice (postnatal day 23) were randomly assigned to four groups: (1) monocular form deprivation (MD) in which a diffuser lens was placed over one eye for 28 days; (2) normal controls without MD; (3) MD recovery in which the diffuser lens was removed for seven days; and (4) MD recovery normal controls. The DNA methylation pattern in COL1A1 promoter and exon 1 was determined by bisulfite DNA sequencing, and the COL1A1 mRNA level in sclera was determined by quantitative PCR. Results MD was found to induce myopia in the treated eyes. Six CpG sites in the promoter and exon 1 region of COL1A1 were methylated with significantly higher frequency in the treated eyes than normal control eyes (p<0.05), with CpG island methylation in MD-contralateral eyes being intermediate. Consistent with the CpG methylation, scleral COL1A1 mRNA was reduced by 57% in the MD-treated eyes compared to normal controls (p<0.05). After seven days of MD recovery, CpG methylation was significantly reduced (p=0.01). The methylation patterns returned to near normal level in five CpG sites, but the sixth was hypomethylated compared to normal controls. Conclusions In parallel with the development of myopia and the reduced COL1A1 mRNA, the frequency of methylation in CpG sites of the COL1A1 promoter/exon 1 increased during MD and returned to near normal during recovery. Thus, hypermethylation of CpG sites in the promoter/exon 1 of COL1A1 may underlie reduced collagen synthesis at the transcriptional level in myopic scleras. PMID:22690110
Ashktorab, Hassan; Daremipouran, M; Goel, Ajay; Varma, Sudhir; Leavitt, R; Sun, Xueguang; Brim, Hassan
2014-04-01
The identification of genes that are differentially methylated in colorectal cancer (CRC) has potential value for both diagnostic and therapeutic interventions specifically in high-risk populations such as African Americans (AAs). However, DNA methylation patterns in CRC, especially in AAs, have not been systematically explored and remain poorly understood. Here, we performed DNA methylome profiling to identify the methylation status of CpG islands within candidate genes involved in critical pathways important in the initiation and development of CRC. We used reduced representation bisulfite sequencing (RRBS) in colorectal cancer and adenoma tissues that were compared with DNA methylome from a healthy AA subject's colon tissue and peripheral blood DNA. The identified methylation markers were validated in fresh frozen CRC tissues and corresponding normal tissues from AA patients diagnosed with CRC at Howard University Hospital. We identified and validated the methylation status of 355 CpG sites located within 16 gene promoter regions associated with CpG islands. Fifty CpG sites located within CpG islands-in genes ATXN7L1 (2), BMP3 (7), EID3 (15), GAS7 (1), GPR75 (24), and TNFAIP2 (1)-were significantly hypermethylated in tumor vs. normal tissues (P<0.05). The methylation status of BMP3, EID3, GAS7, and GPR75 was confirmed in an independent, validation cohort. Ingenuity pathway analysis mapped three of these markers (GAS7, BMP3 and GPR) in the insulin and TGF-β1 network-the two key pathways in CRC. In addition to hypermethylated genes, our analysis also revealed that LINE-1 repeat elements were progressively hypomethylated in the normal-adenoma-cancer sequence. We conclude that DNA methylome profiling based on RRBS is an effective method for screening aberrantly methylated genes in CRC. While previous studies focused on the limited identification of hypermethylated genes, ours is the first study to systematically and comprehensively identify novel hypermethylated genes, as well as hypomethylated LINE-1 sequences, which may serve as potential biomarkers for CRC in African Americans. Our discovered biomarkers were intimately linked to the insulin/TGF-B1 pathway, further strengthening the association of diabetic disorders with colon oncogenic transformation.
Sánchez-Vega, Francisco; Gotea, Valer; Chen, Yun-Ching; Elnitski, Laura
2017-01-01
Over the last two decades, cancer-related alterations in DNA methylation that regulate transcription have been reported for a variety of tumors of the gastrointestinal tract. Due to its relevance for translational research, great emphasis has been placed on the analysis and molecular characterization of the CpG island methylator phenotype (CIMP), defined as widespread hypermethylation of CpG islands in clinically distinct subsets of cancer patients. Here, we present an overview of previous work in this field and also explore some open questions using cross-platform data for esophageal, gastric, and colorectal adenocarcinomas from The Cancer Genome Atlas. We provide a data-driven, pan-gastrointestinal stratification of individual samples based on CIMP status and we investigate correlations with oncogenic alterations, including somatic mutations and epigenetic silencing of tumor suppressor genes. Besides known events in CIMP such as BRAF V600E mutation, CDKN2A silencing or MLH1 inactivation, we discuss the potential role of emerging actors such as Wnt pathway deregulation through truncating mutations in RNF43 and epigenetic silencing of WIF1. Our results highlight the existence of molecular similarities that are superimposed over a larger backbone of tissue-specific features and can be exploited to reduce heterogeneity of response in clinical trials. PMID:28344746
Guo, Hongshan; Zhu, Ping; Guo, Fan; Li, Xianlong; Wu, Xinglong; Fan, Xiaoying; Wen, Lu; Tang, Fuchou
2015-05-01
The heterogeneity of DNA methylation within a population of cells necessitates DNA methylome profiling at single-cell resolution. Recently, we developed a single-cell reduced-representation bisulfite sequencing (scRRBS) technique in which we modified the original RRBS method by integrating all the experimental steps before PCR amplification into a single-tube reaction. These modifications enable scRRBS to provide digitized methylation information on ∼1 million CpG sites within an individual diploid mouse or human cell at single-base resolution. Compared with the single-cell bisulfite sequencing (scBS) technique, scRRBS covers fewer CpG sites, but it provides better coverage for CpG islands (CGIs), which are likely to be the most informative elements for DNA methylation. The entire procedure takes ∼3 weeks, and it requires strong molecular biology skills.
Protection of CpG islands from DNA methylation is DNA-encoded and evolutionarily conserved
Long, Hannah K.; King, Hamish W.; Patient, Roger K.; Odom, Duncan T.; Klose, Robert J.
2016-01-01
DNA methylation is a repressive epigenetic modification that covers vertebrate genomes. Regions known as CpG islands (CGIs), which are refractory to DNA methylation, are often associated with gene promoters and play central roles in gene regulation. Yet how CGIs in their normal genomic context evade the DNA methylation machinery and whether these mechanisms are evolutionarily conserved remains enigmatic. To address these fundamental questions we exploited a transchromosomic animal model and genomic approaches to understand how the hypomethylated state is formed in vivo and to discover whether mechanisms governing CGI formation are evolutionarily conserved. Strikingly, insertion of a human chromosome into mouse revealed that promoter-associated CGIs are refractory to DNA methylation regardless of host species, demonstrating that DNA sequence plays a central role in specifying the hypomethylated state through evolutionarily conserved mechanisms. In contrast, elements distal to gene promoters exhibited more variable methylation between host species, uncovering a widespread dependence on nucleotide frequency and occupancy of DNA-binding transcription factors in shaping the DNA methylation landscape away from gene promoters. This was exemplified by young CpG rich lineage-restricted repeat sequences that evaded DNA methylation in the absence of co-evolved mechanisms targeting methylation to these sequences, and species specific DNA binding events that protected against DNA methylation in CpG poor regions. Finally, transplantation of mouse chromosomal fragments into the evolutionarily distant zebrafish uncovered the existence of a mechanistically conserved and DNA-encoded logic which shapes CGI formation across vertebrate species. PMID:27084945
Xu, Yi-Hua; Manoharan, Herbert T; Pitot, Henry C
2007-09-01
The bisulfite genomic sequencing technique is one of the most widely used techniques to study sequence-specific DNA methylation because of its unambiguous ability to reveal DNA methylation status to the order of a single nucleotide. One characteristic feature of the bisulfite genomic sequencing technique is that a number of sample sequence files will be produced from a single DNA sample. The PCR products of bisulfite-treated DNA samples cannot be sequenced directly because they are heterogeneous in nature; therefore they should be cloned into suitable plasmids and then sequenced. This procedure generates an enormous number of sample DNA sequence files as well as adding extra bases belonging to the plasmids to the sequence, which will cause problems in the final sequence comparison. Finding the methylation status for each CpG in each sample sequence is not an easy job. As a result CpG PatternFinder was developed for this purpose. The main functions of the CpG PatternFinder are: (i) to analyze the reference sequence to obtain CpG and non-CpG-C residue position information. (ii) To tailor sample sequence files (delete insertions and mark deletions from the sample sequence files) based on a configuration of ClustalW multiple alignment. (iii) To align sample sequence files with a reference file to obtain bisulfite conversion efficiency and CpG methylation status. And, (iv) to produce graphics, highlighted aligned sequence text and a summary report which can be easily exported to Microsoft Office suite. CpG PatternFinder is designed to operate cooperatively with BioEdit, a freeware on the internet. It can handle up to 100 files of sample DNA sequences simultaneously, and the total CpG pattern analysis process can be finished in minutes. CpG PatternFinder is an ideal software tool for DNA methylation studies to determine the differential methylation pattern in a large number of individuals in a population. Previously we developed the CpG Analyzer program; CpG PatternFinder is our further effort to create software tools for DNA methylation studies.
Effect of amino groups of mesoporous silica nanoparticles on CpG oligodexynucleotide delivery
NASA Astrophysics Data System (ADS)
Xu, Yi; Claiden, Peter; Zhu, Yufang; Morita, Hiromi; Hanagata, Nobutaka
2015-08-01
In this study, we proposed to modify mesoporous silica nanoparticles (MSNs) with 3-aminopropyltriethoxysilane (NH2-TES), aminoethylaminopropyltriethoxysilane (2NH2-TES) and 3-[2-(2-aminoethylamino)ethylamino] propyl-trimethoxysilane (3NH2-TES) for binding of cytosine-phosphate-guanosine oligodexynucleotides (CpG ODN), and investigated the effect of different amino groups of MSNs on the CpG ODN delivery. Serum stability, in vitro cytotoxicity, and cytokine interleukin-6 (IL-6) induction by MSN-NH2/CpG, MSN-2NH2/CpG and MSN-3NH2/CpG complexes were investigated in detail. The results showed that three kinds of aminated-MSN-based CpG ODN delivery systems had no cytotoxicity to RAW264.7 cells, and binding of CpG ODN to MSN-NH2, MSN-2NH2 and MSN-3NH2 nanoparticles enhanced the serum stability of CpG ODN due to protection by the nanoparticles. However, three aminated MSN-based CpG ODN delivery systems exhibited different CpG ODN delivery efficiency, and MSN-NH2/CpG complexes had the highest ability to induce IL-6 secretion.
Fradin, Delphine; Le Fur, Sophie; Mille, Clémence; Naoui, Nadia; Groves, Chris; Zelenika, Diana; McCarthy, Mark I.; Lathrop, Mark; Bougnères, Pierre
2012-01-01
The insulin (INS) region is the second most important locus associated with Type 1 Diabetes (T1D). The study of the DNA methylation pattern of the 7 CpGs proximal to the TSS in the INS gene promoter revealed that T1D patients have a lower level of methylation of CpG -19, -135 and -234 (p = 2.10−16) and a higher methylation of CpG -180 than controls, while methylation was comparable for CpG -69, -102, -206. The magnitude of the hypomethylation relative to a control population was 8–15% of the corresponding levels in controls and was correlated in CpGs -19 and -135 (r = 0.77) and CpG -135 and -234 (r = 0.65). 70/485 (14%) of T1D patients had a simultaneous decrease in methylation of CpG -19, -135, -234 versus none in 317 controls. CpG methylation did not correlate with glycated hemoglobin or with T1D duration. The methylation of CpG -69, -102, -180, -206, but not CpG -19, -135, -234 was strongly influenced by the cis-genotype at rs689, a SNP known to show a strong association with T1D. We hypothesize that part of this genetic association could in fact be mediated at the statistical and functional level by the underlying changes in neighboring CpG methylation. Our observation of a CpG-specific, locus-specific methylation pattern, although it can provide an epigenetic biomarker of a multifactorial disease, does not indicate whether the reported epigenetic pattern preexists or follows the establishment of T1D. To explore the effect of chronic hyperglycemia on CpG methylation, we studied non obese patients with type 2 diabetes (T2D) who were found to have decreased CpG-19 methylation versus age-matched controls, similar to T1D (p = 2.10−6) but increased CpG-234 methylation (p = 5.10−8), the opposite of T1D. The causality and natural history of the different epigenetic changes associated with T1D or T2D remain to be determined. PMID:22567146
Basu, Amitava; Dasari, Vasanthi; Mishra, Rakesh K; Khosla, Sanjeev
2014-01-01
DNMT3L, a member of DNA methyltransferases family, is present only in mammals. As it provides specificity to the action of de novo methyltransferases, DNMT3A and DNMT3B and interacts with histone H3, DNMT3L has been invoked as the molecule that can read the histone code and translate it into DNA methylation. It plays an important role in the initiation of genomic imprints during gametogenesis and in nuclear reprogramming. With important functions attributed to it, it is imperative that the DNMT3L expression is tightly controlled. Previously, we had identified a CpG island within the human DNMT3L promoter and first exon that showed loss of DNA methylation in cancer samples. Here we show that this Differentially Methylated CpG island within DNMT3L (DNMT3L DMC) acts to repress transcription, is a Polycomb/Trithorax Response Element (PRE) and interacts with both PRC1 and PRC2 Polycomb repressive complexes. In addition, it adopts inactive chromatin conformation and is associated with other inactive chromatin-specific proteins like SUV39H1 and HP1. The presence of DNMT3L DMC also influences the adjacent promoter to adopt repressive histone post-translational modifications. Due to its association with multiple layers of repressive epigenetic modifications, we believe that PRE within the DNMT3L DMC is responsible for the tight regulation of DNMT3L expression and the aberrant epigenetic modifications of this region leading to DNMT3L overexpression could be the reason of nuclear programming during carcinogenesis.
Kakizaki, Fumihiko; Sonoshita, Masahiro; Miyoshi, Hiroyuki; Itatani, Yoshiro; Ito, Shinji; Kawada, Kenji; Sakai, Yoshiharu; Taketo, M Mark
2016-11-01
We recently found that the product of the AES gene functions as a metastasis suppressor of colorectal cancer (CRC) in both humans and mice. Expression of amino-terminal enhancer of split (AES) protein is significantly decreased in liver metastatic lesions compared with primary colon tumors. To investigate its downregulation mechanism in metastases, we searched for transcriptional regulators of AES in human CRC and found that its expression is reduced mainly by transcriptional dysregulation and, in some cases, by additional haploidization of its coding gene. The AES promoter-enhancer is in a typical CpG island, and contains a Yin-Yang transcription factor recognition sequence (YY element). In human epithelial cells of normal colon and primary tumors, transcription factor YY2, a member of the YY family, binds directly to the YY element, and stimulates expression of AES. In a transplantation mouse model of liver metastases, however, expression of Yy2 (and therefore of Aes) is downregulated. In human CRC metastases to the liver, the levels of AES protein are correlated with those of YY2. In addition, we noticed copy-number reduction for the AES coding gene in chromosome 19p13.3 in 12% (5/42) of human CRC cell lines. We excluded other mechanisms such as point or indel mutations in the coding or regulatory regions of the AES gene, CpG methylation in the AES promoter enhancer, expression of microRNAs, and chromatin histone modifications. These results indicate that Aes may belong to a novel family of metastasis suppressors with a CpG-island promoter enhancer, and it is regulated transcriptionally. © 2016 The Authors. Cancer Science published by John Wiley & Sons Australia, Ltd on behalf of Japanese Cancer Association.
Dayeh, Tasnim; Volkov, Petr; Salö, Sofia; Hall, Elin; Nilsson, Emma; Olsson, Anders H.; Kirkpatrick, Clare L.; Wollheim, Claes B.; Eliasson, Lena; Rönn, Tina; Bacos, Karl; Ling, Charlotte
2014-01-01
Impaired insulin secretion is a hallmark of type 2 diabetes (T2D). Epigenetics may affect disease susceptibility. To describe the human methylome in pancreatic islets and determine the epigenetic basis of T2D, we analyzed DNA methylation of 479,927 CpG sites and the transcriptome in pancreatic islets from T2D and non-diabetic donors. We provide a detailed map of the global DNA methylation pattern in human islets, β- and α-cells. Genomic regions close to the transcription start site showed low degrees of methylation and regions further away from the transcription start site such as the gene body, 3′UTR and intergenic regions showed a higher degree of methylation. While CpG islands were hypomethylated, the surrounding 2 kb shores showed an intermediate degree of methylation, whereas regions further away (shelves and open sea) were hypermethylated in human islets, β- and α-cells. We identified 1,649 CpG sites and 853 genes, including TCF7L2, FTO and KCNQ1, with differential DNA methylation in T2D islets after correction for multiple testing. The majority of the differentially methylated CpG sites had an intermediate degree of methylation and were underrepresented in CpG islands (∼7%) and overrepresented in the open sea (∼60%). 102 of the differentially methylated genes, including CDKN1A, PDE7B, SEPT9 and EXOC3L2, were differentially expressed in T2D islets. Methylation of CDKN1A and PDE7B promoters in vitro suppressed their transcriptional activity. Functional analyses demonstrated that identified candidate genes affect pancreatic β- and α-cells as Exoc3l silencing reduced exocytosis and overexpression of Cdkn1a, Pde7b and Sept9 perturbed insulin and glucagon secretion in clonal β- and α-cells, respectively. Together, our data can serve as a reference methylome in human islets. We provide new target genes with altered DNA methylation and expression in human T2D islets that contribute to perturbed insulin and glucagon secretion. These results highlight the importance of epigenetics in the pathogenesis of T2D. PMID:24603685
The Composite of Bone Marrow Concentrate and PRP as an Alternative to Autologous Bone Grafting
Hakimi, Mohssen; Grassmann, Jan-Peter; Betsch, Marcel; Schneppendahl, Johannes; Gehrmann, Sebastian; Hakimi, Ahmad-Reza; Kröpil, Patric; Sager, Martin; Herten, Monika; Wild, Michael; Windolf, Joachim; Jungbluth, Pascal
2014-01-01
One possible alternative to the application of autologous bone grafts represents the use of autologous bone marrow concentrate (BMC). The purpose of our study was to evaluate the potency of autologous platelet-rich plasma (PRP) in combination with BMC. In 32 mini-pigs a metaphyseal critical-size defect was surgically created at the proximal tibia. The animals were allocated to four treatment groups of eight animals each (1. BMC+CPG group, 2. BMC+CPG+PRP group, 3. autograft group, 4. CPG group). In the BMC+CPG group the defect was filled with autologous BMC in combination with calcium phosphate granules (CPG), whereas in the BMC+CPG+PRP group the defect was filled with the composite of autologous BMC, CPG and autologous PRP. In the autograft group the defect was filled with autologous cancellous graft, whereas in the CPG group the defect was filled with CPG solely. After 6 weeks radiological and histomorphometrical analysis showed significantly more new bone formation in the BMC+CPG+PRP group compared to the BMC+CPG group and the CPG group. There were no significant differences between the BMC+CPG+PRP group and the autograft group. In the PRP platelets were enriched significantly about 4.7-fold compared to native blood. In BMC the count of mononuclear cells increased significantly (3.5-fold) compared to the bone marrow aspirate. This study demonstrates that the composite of BMC+CPG+PRP leads to a significantly higher bone regeneration of critical-size defects at the proximal tibia in mini-pigs than the use of BMC+CPG without PRP. Furthermore, within the limits of the present study the composite BMC+CPG+PRP represents a comparable alternative to autologous bone grafting. PMID:24950251
Genome-wide DNA Methylation Profiling of CpG Islands in Hypospadias
Choudhry, Shweta; Deshpande, Archana; Qiao, Liang; Beckman, Kenneth; Sen, Saunak; Baskin, Laurence S.
2013-01-01
Purpose Hypospadias is one of the most frequent genital malformations in the male newborn, and results from abnormal penile and urethral development. The etiology of hypospadias remains largely unknown despite intensive investigations. Fetal androgens have a crucial role in genital differentiation. Recent studies have suggested that molecular mechanisms that underlie the effects of androgens on the fetus may involve disruption of epigenetic programming of gene expression during development. We assessed whether epigenetic modification of DNA methylation is associated with hypospadias in a case-control study of 12 hypospadias and 8 control subjects. Materials and Methods Genome-wide DNA methylation profiling was performed on the study subjects using the Illumina Infinium® HumanMethylation450 Bead-Chip, which enables the direct investigation of methylation status of more than 485,000 individual CpG sites throughout the genome. The methylation level at each CpG site was compared between cases and controls using the t test and logistic regression. Results We identified 14 CpG sites that were associated with hypospadias with p <0.00001. These CpG sites were in or near the SCARB1, MYBPH, SORBS1, LAMA4, HOXD11, MYO1D, EGFL7, C10orf41, LMAN1L and SULF1 genes. Two CpG sites in SCARB1 and MYBPH genes remained statistically significant after correction for multiple testing (p = 2.61×10−09, pcorrected = 0.008; p = 3.06×10−08, pcorrected = 0.02, respectively). Conclusions To our knowledge this is the first study to investigate hypospadias using a unique and novel epigenetic approach. Our findings suggest DNA methylation patterns are useful in identifying new genes such as SCARB1 and MYBPH that may be involved in the etiology of hypospadias. PMID:22906644
Jafarpour, Borna; Abidi, Samina Raza; Abidi, Syed Sibte Raza
2016-01-01
Computerizing paper-based CPG and then executing them can provide evidence-informed decision support to physicians at the point of care. Semantic web technologies especially web ontology language (OWL) ontologies have been profusely used to represent computerized CPG. Using semantic web reasoning capabilities to execute OWL-based computerized CPG unties them from a specific custom-built CPG execution engine and increases their shareability as any OWL reasoner and triple store can be utilized for CPG execution. However, existing semantic web reasoning-based CPG execution engines suffer from lack of ability to execute CPG with high levels of expressivity, high cognitive load of computerization of paper-based CPG and updating their computerized versions. In order to address these limitations, we have developed three CPG execution engines based on OWL 1 DL, OWL 2 DL and OWL 2 DL + semantic web rule language (SWRL). OWL 1 DL serves as the base execution engine capable of executing a wide range of CPG constructs, however for executing highly complex CPG the OWL 2 DL and OWL 2 DL + SWRL offer additional executional capabilities. We evaluated the technical performance and medical correctness of our execution engines using a range of CPG. Technical evaluations show the efficiency of our CPG execution engines in terms of CPU time and validity of the generated recommendation in comparison to existing CPG execution engines. Medical evaluations by domain experts show the validity of the CPG-mediated therapy plans in terms of relevance, safety, and ordering for a wide range of patient scenarios.
Hypermethylation of MST1 in IgG4-related autoimmune pancreatitis and rheumatoid arthritis
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fukuhara, Takataro; Tomiyama, Takashi; Yasuda, Kaneki
The serine/threonine kinase Mst1 plays important roles in the control of immune cell trafficking, proliferation, and differentiation. Previously, we reported that Mst1 was required for thymocyte selection and regulatory T-cell functions, thereby the prevention of autoimmunity in mice. In humans, MST1 null mutations cause T-cell immunodeficiency and hypergammaglobulinemia with autoantibody production. RASSF5C(RAPL) is an activator of MST1 and it is frequently methylated in some tumors. Herein, we investigated methylation of the promoter regions of MST1 and RASSF5C(RAPL) in leukocytes from patients with IgG4-related autoimmune pancreatitis (AIP) and rheumatoid arthritis (RA). Increased number of CpG methylation in the 5′ region ofmore » MST1 was detected in AIP patients with extrapancreatic lesions, whereas AIP patients without extrapancreatic lesions were similar to controls. In RA patients, we detected a slight increased CpG methylation in MST1, although the overall number of methylation sites was lower than that of AIP patients with extrapancreatic lesions. There were no significant changes of the methylation levels of the CpG islands in the 5′ region of RASSF5C(RAPL) in leukocytes from AIP and RA patients. Consistently, we found a significantly down-regulated expression of MST1 in regulatory T cells of AIP patients. Our results suggest that the decreased expression of MST1 in regulatory T cells due to hypermethylation of the promoter contributes to the pathogenesis of IgG4-related AIP. - Highlights: • Mst1 controls immune cells trafficking, cell proliferation and differentiation. • Autoimmune pancreatitis (AIP) is an idiopathic pancreatitis affecting multiple organs. • Decreased MST1 expression and increased CpG methylation of promoter of MST1 in AIP. • Slight increased CpG methylation of MST1 in rheumatoid arthritis patients. • MST1 contributes pathogenesis of IgG4-related AIP.« less
Ko, Eun-Ju; Lee, Young-Tae; Lee, Youri; Kim, Ki-Hye; Kang, Sang-Moo
2017-10-01
Monophosphoryl lipid A (MPL) and oligodeoxynucleotide CpG are toll-like receptor (TLR) 4 and 9 agonist, respectively. Here, we investigated the effects of MPL, CpG, and combination adjuvants on stimulating in vitro dendritic cells (DCs), in vivo innate and adaptive immune responses, and protective efficacy of influenza vaccination. Combination of MPL and CpG was found to exhibit distinct effects on stimulating DCs in vitro to secrete IL-12p70 and tumor necrosis factor (TNF)-α and proliferate allogeneic CD8 T cells. Prime immunization of mice with inactivated split influenza vaccine in the presence of low dose MPL+CpG adjuvants increased the induction of virus-specific IgG and IgG2a isotype antibodies. MPL and CpG adjuvants contribute to improving the efficacy of prime influenza vaccination against lethal influenza challenge as determined by body weight monitoring, lung function, viral titers, and histology. A combination of MPL and CpG adjuvants was effective in improving vaccine efficacy as well as in reducing inflammatory immune responses locally and in inducing cellular immune responses upon lethal influenza virus challenge. This study demonstrates unique adjuvant effects of MPL, CpG, and combination adjuvants on modulating innate and adaptive immune responses to influenza prime vaccination.
Promoter methylation assay of SASH1 gene in hepatocellular carcinoma.
Peng, Liu; Wei, He; Liren, Li
2014-01-01
To analyse the relationship between the expression of SASH1 and its methylation level in human hepatocellular carcinoma. Expression levels of SASH1 were examined with real-time PCR (RT-PCR) in tissues and cells, and methylation analysis was performed with MassArray. The expression levels of SASH1 were strongly reduced in liver cancer tissues compared with adjacent normal tissues. Quantitative methylation analysis by MassArray revealed different CpG sites in SASH1 promoter shared similar methylation pattern between liver cancer tissues and adjacent normal tissues and the CpG sites of significant difference in methylation level were found as follows: CpG_3, CpG_17, CpG_21.22, CpG_25, CpG_26.27, CpG_28, CpG_34.35.36 and CpG_51.52. Moreover, 5-aza-2'-deoxycytidine treatment of Hep-G2 cell line caused significant elevation of SASH1 mRNA. Based on these data, we propose that increase of DNA methylation degree in the promoter region of SASH1 gene, particularly CpG_26.27 sites, possibly repressed SASH1 expression in liver cancer.
Mahmood, Khalid; Højland, Dorte H; Asp, Torben; Kristensen, Michael
2016-01-01
Insecticide resistance in the housefly, Musca domestica, has been investigated for more than 60 years. It will enter a new era after the recent publication of the housefly genome and the development of multiple next generation sequencing technologies. The genetic background of the xenobiotic response can now be investigated in greater detail. Here, we investigate the 454-pyrosequencing transcriptome of the spinosad-resistant 791spin strain in relation to the housefly genome with focus on P450 genes. The de novo assembly of clean reads gave 35,834 contigs consisting of 21,780 sequences of the spinosad resistant strain. The 3,648 sequences were annotated with an enzyme code EC number and were mapped to 124 KEGG pathways with metabolic processes as most highly represented pathway. One hundred and twenty contigs were annotated as P450s covering 44 different P450 genes of housefly. Eight differentially expressed P450s genes were identified and investigated for SNPs, CpG islands and common regulatory motifs in promoter and coding regions. Functional annotation clustering of metabolic related genes and motif analysis of P450s revealed their association with epigenetic, transcription and gene expression related functions. The sequence variation analysis resulted in 12 SNPs and eight of them found in cyp6d1. There is variation in location, size and frequency of CpG islands and specific motifs were also identified in these P450s. Moreover, identified motifs were associated to GO terms and transcription factors using bioinformatic tools. Transcriptome data of a spinosad resistant strain provide together with genome data fundamental support for future research to understand evolution of resistance in houseflies. Here, we report for the first time the SNPs, CpG islands and common regulatory motifs in differentially expressed P450s. Taken together our findings will serve as a stepping stone to advance understanding of the mechanism and role of P450s in xenobiotic detoxification.
KDM2B links the Polycomb Repressive Complex 1 (PRC1) to recognition of CpG islands
Farcas, Anca M; Blackledge, Neil P; Sudbery, Ian; Long, Hannah K; McGouran, Joanna F; Rose, Nathan R; Lee, Sheena; Sims, David; Cerase, Andrea; Sheahan, Thomas W; Koseki, Haruhiko; Brockdorff, Neil; Ponting, Chris P; Kessler, Benedikt M; Klose, Robert J
2012-01-01
CpG islands (CGIs) are associated with most mammalian gene promoters. A subset of CGIs act as polycomb response elements (PREs) and are recognized by the polycomb silencing systems to regulate expression of genes involved in early development. How CGIs function mechanistically as nucleation sites for polycomb repressive complexes remains unknown. Here we discover that KDM2B (FBXL10) specifically recognizes non-methylated DNA in CGIs and recruits the polycomb repressive complex 1 (PRC1). This contributes to histone H2A lysine 119 ubiquitylation (H2AK119ub1) and gene repression. Unexpectedly, we also find that CGIs are occupied by low levels of PRC1 throughout the genome, suggesting that the KDM2B-PRC1 complex may sample CGI-associated genes for susceptibility to polycomb-mediated silencing. These observations demonstrate an unexpected and direct link between recognition of CGIs by KDM2B and targeting of the polycomb repressive system. This provides the basis for a new model describing the functionality of CGIs as mammalian PREs. DOI: http://dx.doi.org/10.7554/eLife.00205.001 PMID:23256043
Protection of CpG islands from DNA methylation is DNA-encoded and evolutionarily conserved.
Long, Hannah K; King, Hamish W; Patient, Roger K; Odom, Duncan T; Klose, Robert J
2016-08-19
DNA methylation is a repressive epigenetic modification that covers vertebrate genomes. Regions known as CpG islands (CGIs), which are refractory to DNA methylation, are often associated with gene promoters and play central roles in gene regulation. Yet how CGIs in their normal genomic context evade the DNA methylation machinery and whether these mechanisms are evolutionarily conserved remains enigmatic. To address these fundamental questions we exploited a transchromosomic animal model and genomic approaches to understand how the hypomethylated state is formed in vivo and to discover whether mechanisms governing CGI formation are evolutionarily conserved. Strikingly, insertion of a human chromosome into mouse revealed that promoter-associated CGIs are refractory to DNA methylation regardless of host species, demonstrating that DNA sequence plays a central role in specifying the hypomethylated state through evolutionarily conserved mechanisms. In contrast, elements distal to gene promoters exhibited more variable methylation between host species, uncovering a widespread dependence on nucleotide frequency and occupancy of DNA-binding transcription factors in shaping the DNA methylation landscape away from gene promoters. This was exemplified by young CpG rich lineage-restricted repeat sequences that evaded DNA methylation in the absence of co-evolved mechanisms targeting methylation to these sequences, and species specific DNA binding events that protected against DNA methylation in CpG poor regions. Finally, transplantation of mouse chromosomal fragments into the evolutionarily distant zebrafish uncovered the existence of a mechanistically conserved and DNA-encoded logic which shapes CGI formation across vertebrate species. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Shigeyasu, Kunitoshi; Nagasaka, Takeshi; Mori, Yoshiko; Yokomichi, Naosuke; Kawai, Takashi; Fuji, Tomokazu; Kimura, Keisuke; Umeda, Yuzo; Kagawa, Shunsuke; Goel, Ajay; Fujiwara, Toshiyoshi
2015-01-01
Background To improve the outcome of patients suffering from gastric cancer, a better understanding of underlying genetic and epigenetic events in this malignancy is required. Although CpG island methylator phenotype (CIMP) and microsatellite instability (MSI) have been shown to play pivotal roles in gastric cancer pathogenesis, the clinical significance of these events on survival outcomes in patients with gastric cancer remains unknown. Methods This study included a patient cohort with pathologically confirmed gastric cancer who had surgical resections. A cohort of 68 gastric cancers was analyzed. CIMP and MSI statuses were determined by analyzing promoter CpG island methylation status of 28 genes/loci, and genomic instability at 10 microsatellite markers, respectively. A Cox’s proportional hazards model was performed for multivariate analysis including age, stage, tumor differentiation, KRAS mutation status, and combined CIMP/MLH1 methylation status in relation to overall survival (OS). Results By multivariate analysis, longer OS was significantly correlated with lower pathologic stage (P = 0.0088), better tumor differentiation (P = 0.0267) and CIMP-high and MLH1 3' methylated status (P = 0.0312). Stratification of CIMP status with regards to MLH1 methylation status further enabled prediction of gastric cancer prognosis. Conclusions CIMP and/or MLH1 methylation status may have a potential to be prognostic biomarkers for patients with gastric cancer. PMID:26121593
Ko, Eun-Ju; Lee, Young-Tae; Lee, Youri; Kim, Ki-Hye
2017-01-01
Monophosphoryl lipid A (MPL) and oligodeoxynucleotide CpG are toll-like receptor (TLR) 4 and 9 agonist, respectively. Here, we investigated the effects of MPL, CpG, and combination adjuvants on stimulating in vitro dendritic cells (DCs), in vivo innate and adaptive immune responses, and protective efficacy of influenza vaccination. Combination of MPL and CpG was found to exhibit distinct effects on stimulating DCs in vitro to secrete IL-12p70 and tumor necrosis factor (TNF)-α and proliferate allogeneic CD8 T cells. Prime immunization of mice with inactivated split influenza vaccine in the presence of low dose MPL+CpG adjuvants increased the induction of virus-specific IgG and IgG2a isotype antibodies. MPL and CpG adjuvants contribute to improving the efficacy of prime influenza vaccination against lethal influenza challenge as determined by body weight monitoring, lung function, viral titers, and histology. A combination of MPL and CpG adjuvants was effective in improving vaccine efficacy as well as in reducing inflammatory immune responses locally and in inducing cellular immune responses upon lethal influenza virus challenge. This study demonstrates unique adjuvant effects of MPL, CpG, and combination adjuvants on modulating innate and adaptive immune responses to influenza prime vaccination. PMID:29093654
Daniels, Sarah L; Burghel, George J; Chambers, Philip; Al-Baba, Shadi; Connley, Daniel D; Brock, Ian W; Cramp, Helen E; Dotsenko, Olena; Wilks, Octavia; Wyld, Lynda; Cross, Simon S; Cox, Angela
2016-01-01
Triple negative breast cancer is typically an aggressive and difficult to treat subtype. It is often associated with loss of function of the BRCA1 gene, either through mutation, loss of heterozygosity or methylation. This study aimed to measure methylation of the BRCA1 gene promoter at individual CpG sites in blood, tumour and normal breast tissue, to assess whether levels were correlated between different tissues, and with triple negative receptor status, histopathological scoring for BRCA-like features and BRCA1 protein expression. Blood DNA methylation levels were significantly correlated with tumour methylation at 9 of 11 CpG sites examined (p<0.0007). The levels of tumour DNA methylation were significantly higher in triple negative tumours, and in tumours with high BRCA-like histopathological scores (10 of 11 CpG sites; p<0.01 and p<0.007 respectively). Similar results were observed in blood DNA (6 of 11 CpG sites; p<0.03 and 7 of 11 CpG sites; p<0.02 respectively). This study provides insight into the pattern of CpG methylation across the BRCA1 promoter, and supports previous studies suggesting that tumours with BRCA1 promoter methylation have similar features to those with BRCA1 mutations, and therefore may be suitable for the same targeted therapies.
Shaw, Richard J; Hall, Gillian L; Lowe, Derek; Bowers, Naomi L; Liloglou, Triantafillos; Field, John K; Woolgar, Julia A; Risk, Janet M
2007-10-01
Studies in several tumour sites highlight the significance of the CpG island methylation phenotype (CIMP), with distinct features of histology, biological aggression and outcome. We utilise pyrosequencing techniques of quantitative methylation analysis to investigate the presence of CIMP in oral squamous cell carcinoma (OSCC) for the first time, and evaluate its correlation with allelic imbalance, pathology and clinical behaviour. Tumour tissue, control tissue and PBLs were obtained from 74 patients with oral squamous cell carcinoma. Pyrosequencing was used to analyse methylation patterns in 75-200 bp regions of the CpG rich gene promoters of 10 genes with a broad range of cellular functions. Allelic imbalance was investigated using a multiplexed panel of 11 microsatellite markers. Corresponding variables, histopathological staging and grading were correlated with these genetic and epigenetic aberrations. A cluster of tumours with a greater degree of promoter methylation than would be predicted by chance alone (P=0.001) were designated CIMP+ve. This group had less aggressive tumour biology in terms of tumour thickness (p=0.015) and nodal metastasis (P=0.012), this being apparently independent of tumour diameter. Further, it seems that these CIMP+ve tumours excited a greater host inflammatory response (P=0.019). The exact mechanisms underlying CIMP remain obscure but the association with a greater inflammatory host response supports existing theories relating these features in other tumour sites. As CIMP has significant associations with other well documented prognostic indicators, it may prove beneficial to include methylation analyses in molecular risk modelling of tumours.
Lee, Ping Yein; Liew, Su May; Abdullah, Adina; Abdullah, Nurdiana; Ng, Chirk Jenn; Hanafi, Nik Sherina; Chia, Yook Chin; Lai, Pauline S M; Wong, Stalia S L; Khoo, Ee Ming
2015-01-01
Most studies have reported barriers to guideline usage mainly from doctors' perspective; few have reported the perspective of other stakeholders. This study aimed to determine the views and barriers to adherence of a national clinical practice guideline (CPG) on management of hypertension from the perspectives of policymakers, doctors and allied healthcare professionals. This study used a qualitative approach with purposive sampling. Seven in depth interviews and six focus group discussions were conducted with 35 healthcare professionals (policy makers, doctors, pharmacists and nurses) at a teaching hospital in Kuala Lumpur, Malaysia, between February and June 2013. All interviews were audio-recorded, transcribed verbatim and checked. Thematic approach was used to analyse the data. Two main themes and three sub-themes emerged from this study. The main themes were (1) variation in the use of CPG and (2) barriers to adherence to CPG. The three sub-themes for barriers were issues inherent to the CPG, systems and policy that is not supportive of CPG use, and attitudes and behaviour of stakeholders. The main users of the CPG were the primary care doctors. Pharmacists only partially use the guidelines, while nurses and policy makers were not using the CPG at all. Participants had suggested few strategies to improve usage and adherence to CPG. First, update the CPG regularly and keep its content simple with specific sections for allied health workers. Second, use technology to facilitate CPG accessibility and provide protected time for implementation of CPG recommendations. Third, incorporate local CPG in professional training, link CPG adherence to key performance indicators and provide incentives for its use. Barriers to the use of CPG hypertension management span across all stakeholders. The development and implementation of CPG focused mainly on doctors with lack of involvement of other healthcare stakeholders. Guidelines should be made simple, current, reliable, accessible, inclusive of all stakeholders and with good policy support.
Abidi, Samina
2017-10-26
Clinical management of comorbidities is a challenge, especially in a clinical decision support setting, as it requires the safe and efficient reconciliation of multiple disease-specific clinical procedures to formulate a comorbid therapeutic plan that is both effective and safe for the patient. In this paper we pursue the integration of multiple disease-specific Clinical Practice Guidelines (CPG) in order to manage co-morbidities within a computerized Clinical Decision Support System (CDSS). We present a CPG integration framework-termed as COMET (Comorbidity Ontological Modeling & ExecuTion) that manifests a knowledge management approach to model, computerize and integrate multiple CPG to yield a comorbid CPG knowledge model that upon execution can provide evidence-based recommendations for handling comorbid patients. COMET exploits semantic web technologies to achieve (a) CPG knowledge synthesis to translate a paper-based CPG to disease-specific clinical pathways (CP) that include specialized co-morbidity management procedures based on input from domain experts; (b) CPG knowledge modeling to computerize the disease-specific CP using a Comorbidity CPG ontology; (c) CPG knowledge integration by aligning multiple ontologically-modeled CP to develop a unified comorbid CPG knowledge model; and (e) CPG knowledge execution using reasoning engines to derive CPG-mediated recommendations for managing patients with comorbidities. We present a web-accessible COMET CDSS that provides family physicians with CPG-mediated comorbidity decision support to manage Atrial Fibrillation and Chronic Heart Failure. We present our qualitative and quantitative analysis of the knowledge content and usability of COMET CDSS.
Loebrich, Sven; Djukic, Biljana; Tong, Zachary J.; Cottrell, Jeffrey R.; Turrigiano, Gina G.; Nedivi, Elly
2013-01-01
A key neuronal mechanism for adjusting excitatory synaptic strength is clathrin-mediated endocytosis of postsynaptic glutamate receptors (GluRs). The actin cytoskeleton is critical for clathrin-mediated endocytosis, yet we lack a mechanistic understanding of its interaction with the endocytic process and how it may be regulated. Here we show that F-actin in dendritic spines physically binds the synaptic nuclear envelope 1 gene product candidate plasticity gene 2 (CPG2) in a PKA-dependent manner, and that this association is required for synaptic GluR internalization. Mutating two PKA sites on CPG2 disrupts its cytoskeletal association, attenuating GluR endocytosis and affecting the efficacy of synaptic transmission in vivo. These results identify CPG2 as an F-actin binding partner that functionally mediates interaction of the spine cytoskeleton with postsynaptic endocytosis. Further, the regulation of CPG2/F-actin association by PKA provides a gateway for cellular control of synaptic receptor internalization through second messenger signaling pathways. Recent identification of human synaptic nuclear envelope 1 as a risk locus for bipolar disorder suggests that CPG2 could play a role in synaptic dysfunction underlying neuropsychiatric disease. PMID:24191017
CpG Island Methylation in Colorectal Cancer: Past, Present and Future
Curtin, Karen; Slattery, Martha L.; Samowitz, Wade S.
2011-01-01
The concept of a CpG island methylator phenotype, or CIMP, quickly became the focus of several colorectal cancer studies describing its clinical and pathological features after its introduction in 1999 by Toyota and colleagues. Further characterization of CIMP in tumors lead to widespread acceptance of the concept, as expressed by Shen and Issa in their 2005 editorial, “CIMP, at last.” Since that time, extensive research efforts have brought great insights into the epidemiology and prognosis of CIMP+ tumors and other epigenetic mechanisms underlying tumorigenesis. With the advances in technology and subsequent cataloging of the human methylome in cancer and normal tissue, new directions in research to understand CIMP and its role in complex biological systems yield hope for future epigenetically based diagnostics and treatments. PMID:21559209
Immunostimulatory Properties of Lipid Modified CpG Oligonucleotides.
Yu, Chunsong; An, Myunggi; Li, Meng; Liu, Haipeng
2017-08-07
Innate immune responses recognizing pathogen associated molecular patterns play important roles in adaptive immunity. As such, ligands which mimic the conserved products of microbial and activate innate immunity are widely used as adjuvants for vaccines. Synthetic single strand oligodeoxynucleotides (ODNs) containing unmethylated cytosine-guanine (CpG) motifs which bind Toll-like receptor 9 (TLR9) are powerful molecular adjuvants, potentiating both humoral and cellular responses. However, CpG ODN's in vitro potency has not been translated to in vivo settings primarily due to issues associated with delivery and toxicity. A major challenge in clinical application of CpG ODN is the efficient delivery to lymph nodes, the anatomic sites where all the immune responses are initiated. Targeting CpG to the key antigen presenting cells (APC) is essential for its application as a vaccine adjuvant, as it not only enhances CpG's efficacy, but also greatly reduces the systemic toxicity. We recently discovered an "albumin-hitchhiking" approach by which CpG ODNs were conjugated to a lipophilic lipid tail and follow subcutaneous injection, accumulated in lymph nodes by binding and transporting with endogenous albumin. This molecular approach targets CpG to antigen presenting cells in the draining lymph nodes via an endogenous albumin-mediated mechanism and simultaneously improves both the efficacy and safety of CpG as a vaccine adjuvant. Since CpG ODNs can be divided into structurally distinct classes, and each class of CpG ODN activates different types of immune cells and triggers different types of immunostimulatory activities, it is important to thoroughly evaluate the efficacy of this "albumin-hitchhiking" strategy in each class of CpG. Here we compare the immunostimulatory activities of three classes of lipid conjugated CpG ODNs in vitro and in vivo. Three representative sequences of lipid modified CpG ODNs were synthesized and their stimulatory effects as a vaccine adjuvant were evaluated. Our results showed that in vitro, lipid modified class A CpG exhibited enhanced stimulatory activities toward TLR transfected reporter cells or bone-marrow derived dendritic cells, whereas lipid-modification of class B or C CpG reduces the activation of TLR9 by 2-3 fold, as compared with unmodified class B and class C CpG, respectively. However, in vivo coadministration of ovalbumin (OVA) protein antigen mixed with lipid-conjugated class B or C CpG ODNs, but not class A CpGs induced dramatically increased OVA-specific humoral and cytotoxic CD8 + T cells responses compared with OVA mixed with unmodified CpGs. Further, lipid-modification greatly reduces the toxicity associated with CpG by minimizing the systemic dissemination. Taken together, these results demonstrated that amphiphilic modification of three classes of CpG motifs differentially affected and modulated the immunostimulatory activities in vitro and in vivo. Our study highlights the importance of in vivo lymph node targeting of CpG ODNs in fulfilling their use as vaccine adjuvants, providing implications for the rational design of molecular adjuvant for subunit vaccines.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Vrba, Lukas; Jensen, Taylor J.; Garbe, James C.
2009-12-23
BACKGROUND: The microRNA-200 family participates in the maintenance of an epithelial phenotype and loss of its expression can result in epithelial to mesenchymal transition (EMT). Furthermore, the loss of expression of miR-200 family members is linked to an aggressive cancer phenotype. Regulation of the miR-200 family expression in normal and cancer cells is not fully understood. METHODOLOGY/ PRINCIPAL FINDINGS: Epigenetic mechanisms participate in the control of miR-200c and miR-141 expression in both normal and cancer cells. A CpG island near the predicted mir-200c/mir-141 transcription start site shows a striking correlation between miR-200c and miR-141 expression and DNA methylation in bothmore » normal and cancer cells, as determined by MassARRAY technology. The CpG island is unmethylated in human miR-200/miR-141 expressing epithelial cells and in miR-200c/miR-141 positive tumor cells. The CpG island is heavily methylated in human miR-200c/miR-141 negative fibroblasts and miR-200c/miR-141 negative tumor cells. Mouse cells show a similar inverse correlation between DNA methylation and miR-200c expression. Enrichment of permissive histone modifications, H3 acetylation and H3K4 trimethylation, is seen in normal miR-200c/miR-141-positive epithelial cells, as determined by chromatin immunoprecipitation coupled to real-time PCR. In contrast, repressive H3K9 dimethylation marks are present in normal miR-200c/miR-141-negative fibroblasts and miR-200c/miR-141 negative cancer cells and the permissive histone modifications are absent. The epigenetic modifier drug, 5-aza-2'-deoxycytidine, reactivates miR-200c/miR-141 expression showing that epigenetic mechanisms play a functional role in their transcriptional control. CONCLUSIONS/ SIGNIFICANCE: We report that DNA methylation plays a role in the normal cell type-specific expression of miR-200c and miR-141 and this role appears evolutionarily conserved, since similar results were obtained in mouse. Aberrant DNA methylation of the miR-200c/141 CpG island is closely linked to their inappropriate silencing in cancer cells. Since the miR-200c cluster plays a significant role in EMT, our results suggest an important role for DNA methylation in the control of phenotypic conversions in normal cells.« less
Sigalotti, Luca; Fratta, Elisabetta; Bidoli, Ettore; Covre, Alessia; Parisi, Giulia; Colizzi, Francesca; Coral, Sandra; Massarut, Samuele; Kirkwood, John M; Maio, Michele
2011-05-26
The prognosis of cutaneous melanoma (CM) differs for patients with identical clinico-pathological stage, and no molecular markers discriminating the prognosis of stage III individuals have been established. Genome-wide alterations in DNA methylation are a common event in cancer. This study aimed to define the prognostic value of genomic DNA methylation levels in stage III CM patients. Overall level of genomic DNA methylation was measured using bisulfite pyrosequencing at three CpG sites (CpG1, CpG2, CpG3) of the Long Interspersed Nucleotide Element-1 (LINE-1) sequences in short-term CM cultures from 42 stage IIIC patients. The impact of LINE-1 methylation on overall survival (OS) was assessed using Cox regression and Kaplan-Meier analysis. Hypomethylation (i.e., methylation below median) at CpG2 and CpG3 sites significantly associated with improved prognosis of CM, CpG3 showing the strongest association. Patients with hypomethylated CpG3 had increased OS (P = 0.01, log-rank = 6.39) by Kaplan-Meyer analysis. Median OS of patients with hypomethylated or hypermethylated CpG3 were 31.9 and 11.5 months, respectively. The 5 year OS for patients with hypomethylated CpG3 was 48% compared to 7% for patients with hypermethylated sequences. Among the variables examined by Cox regression analysis, LINE-1 methylation at CpG2 and CpG3 was the only predictor of OS (Hazard Ratio = 2.63, for hypermethylated CpG3; 95% Confidence Interval: 1.21-5.69; P = 0.01). LINE-1 methylation is identified as a molecular marker of prognosis for CM patients in stage IIIC. Evaluation of LINE-1 promises to represent a key tool for driving the most appropriate clinical management of stage III CM patients.
Wang, Yong; Li, Fei; Zhang, Guowei; Kang, Lihua; Qin, Bai; Guan, Huaijin
2015-01-01
Oxidative stress and DNA damage contribute to the pathogenesis of age-related cataract (ARC). Most oxidative DNA lesions are repaired via the base excision repair (BER) proteins including 8-oxoguanine DNA glycosylase 1 (OGG1). This study examined DNA methylation of CpG islands upstream of OGG1 and their relation to the gene expression in lens cortex from ARC patients. The clinical case-control study consisted of 15 cortical type of ARC patients and 15 age-matched non-ARC controls who received transparent lens extraction due to vitreoretinal diseases. OGG1 expression in lens cortex was analyzed by qRT-PCR and Western blot. The localization and the proportion of cells positive for OGG1 were determined by immunofluorescence. Bisulfite-sequencing PCR (BSP) was performed to evaluate the methylation status of CpG islands near OGG1 in DNA extracted from lens cortex. To test relationship between the methylation and the expression of the gene of interest, 5-Aza-2'-deoxycytidine (5-Aza-dC) was used to induce demethylation of cultured human lens epithelium B-3 (HLE B-3). To test the role of OGG1 in the repair of cellular damage, HLE B-3 was transfected with OGG1 vector, followed by ultraviolet radiation b (UVB) exposure to induce apoptosis. The mRNA and protein levels of OGG1 were significantly reduced in the lens cortex of ARC. Immunofluorescence showed that the proportion of OGG1-positive cells decreased significantly in ARC cortex in comparison with the control. The CpG island in first exon of OGG1 displayed hypermethylation in the DNA extracted from the lens cortex of ARC. Treatment of HLEB-3 cells with 5-Aza-dC upregulated OGG1 expression. UVB-induced apoptosis was attenuated after transfection with OGG1. A reduced OGG1 expression was correlated with hypermethylation of a CpG island of OGG1 in lens cortex of ARC. The role of epigenetic change in OGG1 gene in the susceptibility to oxidative stress induced cortical ARC is warranted to further study.
Sánchez-Vega, Francisco; Gotea, Valer; Margolin, Gennady; Elnitski, Laura
2015-01-01
The term CpG island methylator phenotype (CIMP) has been used to describe widespread DNA hypermethylation at CpG-rich genomic regions affecting clinically distinct subsets of cancer patients. Even though there have been numerous studies of CIMP in individual cancer types, a uniform analysis across tissues is still lacking. We analyze genome-wide patterns of CpG island hypermethylation in 5,253 solid epithelial tumors from 15 cancer types from TCGA and 23 cancer cell lines from ENCODE. We identify differentially methylated loci that define CIMP+ and CIMP- samples, and we use unsupervised clustering to provide a robust molecular stratification of tumor methylomes for 12 cancer types and all cancer cell lines. With a minimal set of 89 discriminative loci, we demonstrate accurate pan-cancer separation of the 12 CIMP+/- subpopulations, based on their average levels of methylation. Tumor samples in different CIMP subclasses show distinctive correlations with gene expression profiles and recurrence of somatic mutations, copy number variations, and epigenetic silencing. Enrichment analyses indicate shared canonical pathways and upstream regulators for CIMP-targeted regions across cancer types. Furthermore, genomic alterations showing consistent associations with CIMP+/- status include genes involved in DNA repair, chromatin remodeling genes, and several histone methyltransferases. Associations of CIMP status with specific clinical features, including overall survival in several cancer types, highlight the importance of the CIMP+/- designation for individual tumor evaluation and personalized medicine. We present a comprehensive computational study of CIMP that reveals pan-cancer commonalities and tissue-specific differences underlying concurrent hypermethylation of CpG islands across tumors. Our stratification of solid tumors and cancer cell lines based on CIMP status is data-driven and agnostic to tumor type by design, which protects against known biases that have hindered classic methods previously used to define CIMP. The results that we provide can be used to refine existing molecular subtypes of cancer into more homogeneously behaving subgroups, potentially leading to more uniform responses in clinical trials.
Methylation of avpr1a in the cortex of wild prairie voles: effects of CpG position and polymorphism
Maguire, S. M.; Phelps, S. M.
2017-01-01
DNA methylation can cause stable changes in neuronal gene expression, but we know little about its role in individual differences in the wild. In this study, we focus on the vasopressin 1a receptor (avpr1a), a gene extensively implicated in vertebrate social behaviour, and explore natural variation in DNA methylation, genetic polymorphism and neuronal gene expression among 30 wild prairie voles (Microtus ochrogaster). Examination of CpG density across 8 kb of the locus revealed two distinct CpG islands overlapping promoter and first exon, characterized by few CpG polymorphisms. We used a targeted bisulfite sequencing approach to measure DNA methylation across approximately 3 kb of avpr1a in the retrosplenial cortex, a brain region implicated in male space use and sexual fidelity. We find dramatic variation in methylation across the avrp1a locus, with pronounced diversity near the exon–intron boundary and in a genetically variable putative enhancer within the intron. Among our wild voles, differences in cortical avpr1a expression correlate with DNA methylation in this putative enhancer, but not with the methylation status of the promoter. We also find an unusually high number of polymorphic CpG sites (polyCpGs) in this focal enhancer. One polyCpG within this enhancer (polyCpG 2170) may drive variation in expression either by disrupting transcription factor binding motifs or by changing local DNA methylation and chromatin silencing. Our results contradict some assumptions made within behavioural epigenetics, but are remarkably concordant with genome-wide studies of gene regulation. PMID:28280564
Burghel, George J.; Chambers, Philip; Al-Baba, Shadi; Connley, Daniel D.; Brock, Ian W.; Cramp, Helen E.; Dotsenko, Olena; Wilks, Octavia; Wyld, Lynda; Cross, Simon S.; Cox, Angela
2016-01-01
Triple negative breast cancer is typically an aggressive and difficult to treat subtype. It is often associated with loss of function of the BRCA1 gene, either through mutation, loss of heterozygosity or methylation. This study aimed to measure methylation of the BRCA1 gene promoter at individual CpG sites in blood, tumour and normal breast tissue, to assess whether levels were correlated between different tissues, and with triple negative receptor status, histopathological scoring for BRCA-like features and BRCA1 protein expression. Blood DNA methylation levels were significantly correlated with tumour methylation at 9 of 11 CpG sites examined (p<0.0007). The levels of tumour DNA methylation were significantly higher in triple negative tumours, and in tumours with high BRCA-like histopathological scores (10 of 11 CpG sites; p<0.01 and p<0.007 respectively). Similar results were observed in blood DNA (6 of 11 CpG sites; p<0.03 and 7 of 11 CpG sites; p<0.02 respectively). This study provides insight into the pattern of CpG methylation across the BRCA1 promoter, and supports previous studies suggesting that tumours with BRCA1 promoter methylation have similar features to those with BRCA1 mutations, and therefore may be suitable for the same targeted therapies. PMID:27463681
Mapping the zebrafish brain methylome using reduced representation bisulfite sequencing
Chatterjee, Aniruddha; Ozaki, Yuichi; Stockwell, Peter A; Horsfield, Julia A; Morison, Ian M; Nakagawa, Shinichi
2013-01-01
Reduced representation bisulfite sequencing (RRBS) has been used to profile DNA methylation patterns in mammalian genomes such as human, mouse and rat. The methylome of the zebrafish, an important animal model, has not yet been characterized at base-pair resolution using RRBS. Therefore, we evaluated the technique of RRBS in this model organism by generating four single-nucleotide resolution DNA methylomes of adult zebrafish brain. We performed several simulations to show the distribution of fragments and enrichment of CpGs in different in silico reduced representation genomes of zebrafish. Four RRBS brain libraries generated 98 million sequenced reads and had higher frequencies of multiple mapping than equivalent human RRBS libraries. The zebrafish methylome indicates there is higher global DNA methylation in the zebrafish genome compared with its equivalent human methylome. This observation was confirmed by RRBS of zebrafish liver. High coverage CpG dinucleotides are enriched in CpG island shores more than in the CpG island core. We found that 45% of the mapped CpGs reside in gene bodies, and 7% in gene promoters. This analysis provides a roadmap for generating reproducible base-pair level methylomes for zebrafish using RRBS and our results provide the first evidence that RRBS is a suitable technique for global methylation analysis in zebrafish. PMID:23975027
Dual Roles for CXCL4 Chemokines and CXCR3 in Angiogenesis and Invasion of Pancreatic Cancer.
Quemener, Cathy; Baud, Jessica; Boyé, Kevin; Dubrac, Alexandre; Billottet, Clotilde; Soulet, Fabienne; Darlot, Florence; Dumartin, Laurent; Sire, Marie; Grepin, Renaud; Daubon, Thomas; Rayne, Fabienne; Wodrich, Harald; Couvelard, Anne; Pineau, Raphael; Schilling, Martin; Castronovo, Vincent; Sue, Shih-Che; Clarke, Kim; Lomri, Abderrahim; Khatib, Abdel-Majid; Hagedorn, Martin; Prats, Hervé; Bikfalvi, Andreas
2016-11-15
The CXCL4 paralog CXCL4L1 is a less studied chemokine that has been suggested to exert an antiangiogenic function. However, CXCL4L1 is also expressed in patient tumors, tumor cell lines, and murine xenografts, prompting a more detailed analysis of its role in cancer pathogenesis. We used genetic and antibody-based approaches to attenuate CXCL4L1 in models of pancreatic ductal adenocarcinoma (PDAC). Mechanisms of expression were assessed in cell coculture experiments, murine, and avian xenotransplants, including through an evaluation of CpG methylation and mutation of critical CpG residues. CXCL4L1 gene expression was increased greatly in primary and metastatic PDAC. We found that myofibroblasts triggered cues in the tumor microenvironment, which led to induction of CXCL4L1 in tumor cells. CXCL4L1 expression was also controlled by epigenetic modifications at critical CpG islands, which were mapped. CXCL4L1 inhibited angiogenesis but also affected tumor development more directly, depending on the tumor cell type. In vivo administration of an mAb against CXCL4L1 demonstrated a blockade in the growth of tumors positive for CXCR3, a critical receptor for CXCL4 ligands. Our findings define a protumorigenic role in PDAC development for endogenous CXCL4L1, which is independent of its antiangiogenic function. Cancer Res; 76(22); 6507-19. ©2016 AACR. ©2016 American Association for Cancer Research.
Bahar Halpern, Keren; Vana, Tal; Walker, Michael D.
2014-01-01
The transcription factor FoxA2 is a master regulator of endoderm development and pancreatic beta cell gene expression. To elucidate the mechanisms underlying the activation of the FoxA2 gene during differentiation, we have compared the epigenetic status of undifferentiated human embryonic stem cells (hESCs), hESC-derived early endoderm stage cells (CXCR4+ cells), and pancreatic islet cells. Unexpectedly, a CpG island in the promoter region of the FoxA2 gene displayed paradoxically high levels of DNA methylation in expressing tissues (CXCR4+, islets) and low levels in nonexpressing tissues. This CpG island region was found to repress reporter gene expression and bind the Polycomb group protein SUZ12 and the DNA methyltransferase (DNMT)3b preferentially in undifferentiated hESCs as compared with CXCR4+ or islets cells. Consistent with this, activation of FoxA2 gene expression, but not CXCR4 or SOX17, was strongly inhibited by 5-aza-2′-deoxycytidine and by knockdown of DNMT3b. We hypothesize that in nonexpressing tissues, the lack of DNA methylation allows the binding of DNA methyltransferases and repressing proteins, such as Polycomb group proteins; upon differentiation, DNMT activation leads to CpG island methylation, causing loss of repressor protein binding. These results suggest a novel and unexpected role for DNA methylation in the activation of FoxA2 gene expression during differentiation. PMID:25016019
Implementation of antibiotic use guidelines for fresh traumatic wound at Siriraj Hospital.
Sirijatuphat, Rujipas; Choochan, Tanatchon; Siritongtaworn, Preecha; Sripojtham, Vipaporn; Thamlikitkul, Visanu
2015-03-01
To determine the effectiveness of implementing a clinical practice guideline (CPG) on antibiotic use for adults with fresh traumatic wounds who attended the trauma center at Siriraj Hospital, Bangkok. A prospective study of 600 adult patients who had fresh traumatic wounds (≤ 6 hours) was conducted at Siriraj Trauma Center from March 2013 to March 2014. The CPG was introduced to physicians, nurses and medical students by posting the CPG at the patient care areas of the trauma center. The outcomes were an appropriate classification of wounds according to the CPG recommendations, prevalence of antibiotic prescribing, incidence of wound infection and compliance with the CPG. Clean-contaminated wounds that did not need antibiotic treatment and clean-contaminated and contaminated wounds that required antibiotics were observed in 63.2, 6.7, and 30.1% ofthe patients, respectively. Antibiotics were given to 512 patients (85.3%). Infections occurred in six patients (1.0%). Antibiotic prescription according to CPG recommendations was observed for 243 patients (40.5%). The prevalence of antibiotic use in the CPG-compliant group (65.8%) was significantly less than that in the CPG-noncompliant group (98.6%) (p < 0.001). The patients in the CPG-compliant group had more contaminated wounds than those in the CPG-noncompliant group (51.4 vs. 15.7%, p < 0.001). The incidences of wound infection were very low in both groups and not significantly different (1.2 vs. 0.8%, p = 0.690). Antibiotic prophylaxis was necessary in less than 36.8% of adults with fresh traumatic wounds who attended Siriraj Trauma Center Compliance to CPG implementation using simple intervention seemed to be low. Adhering to CPG recommendations for antibiotic prophylaxis in adults with fresh traumatic wounds can reduce the unnecessary prescribing of antibiotics without increasing the rate of wound infection.
Collaborations between CpG sites in DNA methylation
NASA Astrophysics Data System (ADS)
Song, You; Ren, Honglei; Lei, Jinzhi
2017-08-01
DNA methylation patterns have profound impacts on genome stability, gene expression and development. The molecular base of DNA methylation patterns has long been focused at single CpG sites level. Here, we construct a kinetic model of DNA methylation with collaborations between CpG sites, from which a correlation function was established based on experimental data. The function consists of three parts that suggest three possible sources of the correlation: movement of enzymes along DNA, collaboration between DNA methylation and nucleosome modification, and global enzyme concentrations within a cell. Moreover, the collaboration strength between DNA methylation and nucleosome modification is universal for mouse early embryo cells. The obtained correlation function provides insightful understanding for the mechanisms of inheritance of DNA methylation patterns.
Upadhyay, Mohita; Vivekanandan, Perumal
2015-01-01
Papillomaviruses and polyomaviruses are small ds-DNA viruses infecting a wide-range of vertebrate hosts. Evidence supporting co-evolution of the virus with the host does not fully explain the evolutionary path of papillomaviruses and polyomaviruses. Studies analyzing CpG dinucleotide frequencies in virus genomes have provided interesting insights on virus evolution. CpG dinucleotide depletion has not been extensively studied among papillomaviruses and polyomaviruses. We sought to analyze the relative abundance of dinucleotides and the relative roles of evolutionary pressures in papillomaviruses and polyomaviruses. We studied 127 full-length sequences from papillomaviruses and 56 full-length sequences from polyomaviruses. We analyzed the relative abundance of dinucleotides, effective codon number (ENC), differences in synonymous codon usage. We examined the association, if any, between the extent of CpG dinucleotide depletion and the evolutionary lineage of the infected host. We also investigated the contribution of mutational pressure and translational selection to the evolution of papillomaviruses and polyomaviruses. All papillomaviruses and polyomaviruses are CpG depleted. Interestingly, the evolutionary lineage of the infected host determines the extent of CpG depletion among papillomaviruses and polyomaviruses. CpG dinucleotide depletion was more pronounced among papillomaviruses and polyomaviruses infecting human and other mammals as compared to those infecting birds. Our findings demonstrate that CpG depletion among papillomaviruses is linked to mutational pressure; while CpG depletion among polyomaviruses is linked to translational selection. We also present evidence that suggests methylation of CpG dinucleotides may explain, at least in part, the depletion of CpG dinucleotides among papillomaviruses but not polyomaviruses. The extent of CpG depletion among papillomaviruses and polyomaviruses is linked to the evolutionary lineage of the infected host. Our results highlight the existence of divergent evolutionary pressures leading to CpG dinucleotide depletion among small ds-DNA viruses infecting vertebrate hosts.
2011-01-01
Background The prognosis of cutaneous melanoma (CM) differs for patients with identical clinico-pathological stage, and no molecular markers discriminating the prognosis of stage III individuals have been established. Genome-wide alterations in DNA methylation are a common event in cancer. This study aimed to define the prognostic value of genomic DNA methylation levels in stage III CM patients. Methods Overall level of genomic DNA methylation was measured using bisulfite pyrosequencing at three CpG sites (CpG1, CpG2, CpG3) of the Long Interspersed Nucleotide Element-1 (LINE-1) sequences in short-term CM cultures from 42 stage IIIC patients. The impact of LINE-1 methylation on overall survival (OS) was assessed using Cox regression and Kaplan-Meier analysis. Results Hypomethylation (i.e., methylation below median) at CpG2 and CpG3 sites significantly associated with improved prognosis of CM, CpG3 showing the strongest association. Patients with hypomethylated CpG3 had increased OS (P = 0.01, log-rank = 6.39) by Kaplan-Meyer analysis. Median OS of patients with hypomethylated or hypermethylated CpG3 were 31.9 and 11.5 months, respectively. The 5 year OS for patients with hypomethylated CpG3 was 48% compared to 7% for patients with hypermethylated sequences. Among the variables examined by Cox regression analysis, LINE-1 methylation at CpG2 and CpG3 was the only predictor of OS (Hazard Ratio = 2.63, for hypermethylated CpG3; 95% Confidence Interval: 1.21-5.69; P = 0.01). Conclusion LINE-1 methylation is identified as a molecular marker of prognosis for CM patients in stage IIIC. Evaluation of LINE-1 promises to represent a key tool for driving the most appropriate clinical management of stage III CM patients. PMID:21615918
Marsh, Adam G; Hoadley, Kenneth D; Warner, Mark E
2016-01-01
Coral reefs are under assault from stressors including global warming, ocean acidification, and urbanization. Knowing how these factors impact the future fate of reefs requires delineating stress responses across ecological, organismal and cellular scales. Recent advances in coral reef biology have integrated molecular processes with ecological fitness and have identified putative suites of temperature acclimation genes in a Scleractinian coral Acropora hyacinthus. We wondered what unique characteristics of these genes determined their coordinate expression in response to temperature acclimation, and whether or not other corals and cnidarians would likewise possess these features. Here, we focus on cytosine methylation as an epigenetic DNA modification that is responsive to environmental stressors. We identify common conserved patterns of cytosine-guanosine dinucleotide (CpG) motif frequencies in upstream promoter domains of different functional gene groups in two cnidarian genomes: a coral (Acropora digitifera) and an anemone (Nematostella vectensis). Our analyses show that CpG motif frequencies are prominent in the promoter domains of functional genes associated with environmental adaptation, particularly those identified in A. hyacinthus. Densities of CpG sites in upstream promoter domains near the transcriptional start site (TSS) are 1.38x higher than genomic background levels upstream of -2000 bp from the TSS. The increase in CpG usage suggests selection to allow for DNA methylation events to occur more frequently within 1 kb of the TSS. In addition, observed shifts in CpG densities among functional groups of genes suggests a potential role for epigenetic DNA methylation within promoter domains to impact functional gene expression responses in A. digitifera and N. vectensis. Identifying promoter epigenetic sequence motifs among genes within specific functional groups establishes an approach to describe integrated cellular responses to environmental stress in reef corals and potential roles of epigenetics on survival and fitness in the face of global climate change.
Zhang, Huijie; Chen, Song; Zhi, Chunyi; Yamazaki, Tomohiko; Hanagata, Nobutaka
2013-01-01
Background Cytosine-phosphate-guanine (CpG) oligodeoxynucleotides activate Toll-like receptor 9, leading to induction of proinflammatory cytokines, which play an important role in induction and maintenance of innate and adaptive immune responses. Previously, we have used boron nitride nanospheres (BNNS) as a carrier for delivery of unmodified CpG oligodeoxynucleotides to activate Toll-like receptor 9. However, because CpG oligodeoxynucleotides and BNNS are both negatively charged, electrostatic repulsion between them is likely to reduce the loading of CpG oligodeoxynucleotides onto BNNS. Therefore, the efficiency of uptake of CpG oligodeoxynucleotides is also limited and does not result in induction of a robust cytokine response. To ameliorate these problems, we developed a CpG oligodeoxynucleotide delivery system using chitosan-coated BNNS as a carrier. Methods To facilitate attachment of CpG oligodeoxynucleotides onto the BNNS and improve their loading capacity, we prepared positively charged BNNS by coating them with chitosan preparations of three different molecular weights and used them as carriers for delivery of CpG oligodeoxynucleotides. Results The zeta potentials of the BNNS-CS complexes were positive, and chitosan coating improved their dispersity and stability in aqueous solution compared with BNNS. The positive charge of the BNNS-CS complexes greatly improved the loading capacity and cellular uptake efficiency of CpG oligodeoxynucleotides. The loading capacity of the CpG oligodeoxynucleotides depended on the molecular weight of chitosan, which affected the positive charge density on the surface of the BNNS. CpG oligodeoxynucleotides loaded onto BNNS-CS complexes significantly enhanced production of interleukin-6 and tumor necrosis factor-α by peripheral blood mononuclear cells compared with CpG oligodeoxynucleotides directly loaded onto BNNS, or when Lipofectamine™ 2000 was used as the carrier. The molecular weight of the chitosan used to coat the BNNS affected the magnitude of cytokine induction by varying the strength of condensation of the CpG oligodeoxynucleotides. Conclusion Although the loading capacity of BNNS coated with low molecular weight chitosan preparations was the lowest of all the preparations, they induced the highest levels of cytokines. PMID:23674892
CpG DNA in the prevention and treatment of infections.
Dalpke, Alexander; Zimmermann, Stefan; Heeg, Klaus
2002-01-01
Microbial infection is sensed by Toll-like receptors (TLRs) on innate immune cells. Among the ten so far defined TLRs, TLR9 and its ligand are peculiar. TLR9 recognises bacterial DNA characterised by the abundance of unmethylated CpG dinucleotides, which distinguish bacterial DNA (CpG DNA) from mammalian DNA. Moreover, TLR9 shows a restricted cellular and subcellular pattern of expression. In contrast to other TLR agonists, CpG DNA is superior in activation of dendritic dells and induction of costimulatory cytokines such as interleukin (IL)-12 and IL-18. This qualifies CpG DNA as a Th1-promoting adjuvant. During infection, recognition of CpG DNA of intracellular pathogens skews and fine-tunes the ongoing immune response and induces long-lasting Th1 milieus. Thus, CpG DNA might play an important role in driving the immune system to a Th1 profile, preventing undesired Th2 milieus that might favour induction of allergic responses. Since CpG DNA can be synthesised with high purity and sequence fidelity, synthetic CpG DNA will become an important agent for Th1 instruction and be an effective adjuvant during vaccination.
NASA Astrophysics Data System (ADS)
Li, Shanshan; Zhang, Guoshan; Wang, Jiang; Chen, Yingyuan; Deng, Bin
2018-02-01
This paper proposes that modified two-compartment Pinsky-Rinzel (PR) neural model can be used to develop the simple form of central pattern generator (CPG). The CPG is called as 'half-central oscillator', which constructed by two inhibitory chemical coupled PR neurons with time delay. Some key properties of PR neural model related to CPG are studied and proved to meet the requirements of CPG. Using the simple CPG network, we first study the relationship between rhythmical output and key factors, including ambient noise, sensory feedback signals, morphological character of single neuron as well as the coupling delay time. We demonstrate that, appropriate intensity noise can enhance synchronization between two coupled neurons. Different output rhythm of CPG network can be entrained by sensory feedback signals. We also show that the morphology of single neuron has strong effect on the output rhythm. The phase synchronization indexes decrease with the increase of morphology parameter's difference. Through adjusting coupled delay time, we can get absolutely phase synchronization and antiphase state of CPG. Those results of simulation show the feasibility of PR neural model as a valid CPG as well as the emergent behaviors of the particularly CPG.
Yu, Yun-Zhou; Ma, Yao; Xu, Wen-Hui; Wang, Shuang; Sun, Zhi-Wei
2015-08-01
DNA vaccines are generally weak stimulators of the immune system. Fortunately, their efficacy can be improved using a viral replicon vector or by the addition of immunostimulatory CpG motifs, although the design of these engineered DNA vectors requires optimization. Our results clearly suggest that multiple copies of three types of CpG motifs or combinations of various types of CpG motifs cloned into a viral replicon vector backbone with strong immunostimulatory activities on human PBMC are efficient adjuvants for these DNA vaccines to modulate and enhance protective immunity against anthrax, although modifications with these different CpG forms in vivo elicited inconsistent immune response profiles. Modification with more copies of CpG motifs elicited more potent adjuvant effects leading to the generation of enhanced immunity, which indicated a CpG motif dose-dependent enhancement of antigen-specific immune responses. Notably, the enhanced and/or synchronous adjuvant effects were observed in modification with combinations of two different types of CpG motifs, which provides not only a contribution to the knowledge base on the adjuvant activities of CpG motifs combinations but also implications for the rational design of optimal DNA vaccines with combinations of CpG motifs as "built-in" adjuvants. We describe an efficient strategy to design and optimize DNA vaccines by the addition of combined immunostimulatory CpG motifs in a viral replicon DNA plasmid to produce strong immune responses, which indicates that the CpG-modified viral replicon DNA plasmid may be desirable for use as vector of DNA vaccines.
Synergy of anti-CD40, CpG and MPL in activation of mouse macrophages
Shi, Yongyu; Felder, Mildred A.R.; Sondel, Paul M.; Rakhmilevich, Alexander L.
2015-01-01
Activation of macrophages is a prerequisite for their antitumor effects. Several reagents, including agonistic anti-CD40 monoclonal antibody (anti-CD40), CpG oligodeoxynucleotides (CpG) and monophosphoryl lipid A (MPL), can stimulate activation of macrophages. Our previous studies showed synergy between anti-CD40 and CpG and between anti-CD40 and MPL in macrophage activation and antitumor efficacy in mice. In the present study, we asked whether there was synergy among these three reagents. The activation of adherent peritoneal exudate cells (PEC) obtained from mice injected with anti-CD40 and then treated with CpG and/or MPL in vitro was determined by their ability to suppress proliferation of tumor cells and to produce various cytokines and chemokines in vitro. Cell sorting and histology followed by functional testing showed that macrophages were the main cell population in PEC activated by CD40 ligation in vivo. A combination of anti-CD40, CpG or MPL activated PEC to suppress proliferation of B16 cells and produce nitric oxide far greater than the single reagents or any of the double combinations of these reagents. In addition, the combination of all three reagents activated PEC to secrete IL-12, IFN-γ and MCP-1 to a greater degree than any single reagent or any two combined reagents. These results demonstrate that macrophages can be synergistically activated by anti-CD40, CpG and MPL, suggesting that this novel combined approach might be further investigated as potential cancer therapy. PMID:25829245
Synergy of anti-CD40, CpG and MPL in activation of mouse macrophages.
Shi, Yongyu; Felder, Mildred A R; Sondel, Paul M; Rakhmilevich, Alexander L
2015-08-01
Activation of macrophages is a prerequisite for their antitumor effects. Several reagents, including agonistic anti-CD40 monoclonal antibody (anti-CD40), CpG oligodeoxynucleotides (CpG) and monophosphoryl lipid A (MPL), can stimulate activation of macrophages. Our previous studies showed synergy between anti-CD40 and CpG and between anti-CD40 and MPL in macrophage activation and antitumor efficacy in mice. In the present study, we asked whether there was synergy among these three reagents. The activation of adherent peritoneal exudate cells (PEC) obtained from mice injected with anti-CD40 and then treated with CpG and/or MPL in vitro was determined by their ability to suppress proliferation of tumor cells and to produce various cytokines and chemokines in vitro. Cell sorting and histology followed by functional testing showed that macrophages were the main cell population in PEC activated by CD40 ligation in vivo. A combination of anti-CD40, CpG or MPL activated PEC to suppress proliferation of B16 cells and produce nitric oxide far greater than the single reagents or any of the double combinations of these reagents. In addition, the combination of all three reagents activated PEC to secrete IL-12, IFN-γ and MCP-1 to a greater degree than any single reagent or any two combined reagents. These results demonstrate that macrophages can be synergistically activated by anti-CD40, CpG and MPL, suggesting that this novel combined approach might be further investigated as potential cancer therapy. Copyright © 2015 Elsevier Ltd. All rights reserved.
Asp, Torben; Kristensen, Michael
2016-01-01
Background Insecticide resistance in the housefly, Musca domestica, has been investigated for more than 60 years. It will enter a new era after the recent publication of the housefly genome and the development of multiple next generation sequencing technologies. The genetic background of the xenobiotic response can now be investigated in greater detail. Here, we investigate the 454-pyrosequencing transcriptome of the spinosad-resistant 791spin strain in relation to the housefly genome with focus on P450 genes. Results The de novo assembly of clean reads gave 35,834 contigs consisting of 21,780 sequences of the spinosad resistant strain. The 3,648 sequences were annotated with an enzyme code EC number and were mapped to 124 KEGG pathways with metabolic processes as most highly represented pathway. One hundred and twenty contigs were annotated as P450s covering 44 different P450 genes of housefly. Eight differentially expressed P450s genes were identified and investigated for SNPs, CpG islands and common regulatory motifs in promoter and coding regions. Functional annotation clustering of metabolic related genes and motif analysis of P450s revealed their association with epigenetic, transcription and gene expression related functions. The sequence variation analysis resulted in 12 SNPs and eight of them found in cyp6d1. There is variation in location, size and frequency of CpG islands and specific motifs were also identified in these P450s. Moreover, identified motifs were associated to GO terms and transcription factors using bioinformatic tools. Conclusion Transcriptome data of a spinosad resistant strain provide together with genome data fundamental support for future research to understand evolution of resistance in houseflies. Here, we report for the first time the SNPs, CpG islands and common regulatory motifs in differentially expressed P450s. Taken together our findings will serve as a stepping stone to advance understanding of the mechanism and role of P450s in xenobiotic detoxification. PMID:27019205
Methylomics of gene expression in human monocytes
Liu, Yongmei; Ding, Jingzhong; Reynolds, Lindsay M.; Lohman, Kurt; Register, Thomas C.; De La Fuente, Alberto; Howard, Timothy D.; Hawkins, Greg A.; Cui, Wei; Morris, Jessica; Smith, Shelly G.; Barr, R. Graham; Kaufman, Joel D.; Burke, Gregory L.; Post, Wendy; Shea, Steven; Mccall, Charles E.; Siscovick, David; Jacobs, David R.; Tracy, Russell P.; Herrington, David M.; Hoeschele, Ina
2013-01-01
DNA methylation is one of several epigenetic mechanisms that contribute to the regulation of gene expression; however, the extent to which methylation of CpG dinucleotides correlates with gene expression at the genome-wide level is still largely unknown. Using purified primary monocytes from subjects in a large community-based cohort (n = 1264), we characterized methylation (>485 000 CpG sites) and mRNA expression (>48K transcripts) and carried out genome-wide association analyses of 8370 expression phenotypes. We identified 11 203 potential cis-acting CpG loci whose degree of methylation was associated with gene expression (eMS) at a false discovery rate threshold of 0.001. Most of the associations were consistent in effect size and direction of effect across sex and three ethnicities. Contrary to expectation, these eMS were not predominately enriched in promoter regions, or CpG islands, but rather in the 3′ UTR, gene bodies, CpG shores or ‘offshore’ sites, and both positive and negative correlations between methylation and expression were observed across all locations. eMS were enriched for regions predicted to be regulatory by ENCODE (Encyclopedia of DNA Elements) data in multiple cell types, particularly enhancers. One of the strongest association signals detected (P < 2.2 × 10−308) was a methylation probe (cg17005068) in the promoter/enhancer region of the glutathione S-transferase theta 1 gene (GSTT1, encoding the detoxification enzyme) with GSTT1 mRNA expression. Our study provides a detailed description of the epigenetic architecture in human monocytes and its relationship to gene expression. These data may help prioritize interrogation of biologically relevant methylation loci and provide new insights into the epigenetic basis of human health and diseases. PMID:23900078
Riyahi, Sepand; Sánchez-Delgado, Marta; Calafell, Francesc; Monk, David; Senar, Juan Carlos
2015-01-01
DNA methylation is one of the main epigenetic mechanisms that can regulate gene expression and is an important means for creating phenotypic variation. In the present study, we performed methylation profiling of 2 candidate genes for personality traits, namely DRD4 and SERT, in the great tit Parus major to ascertain whether personality traits and behavior within different habitats have evolved with the aid of epigenetic variation. We applied bisulphite PCR and strand-specific sequencing to determine the methylation profile of the CpG dinucleotides in the DRD4 and SERT promoters and also in the CpG island overlapping DRD4 exon 3. Furthermore, we performed pyrosequencing to quantify the total methylation levels at each CpG location. Our results indicated that methylation was ∼1–4% higher in urban than in forest birds, for all loci and tissues analyzed, suggesting that this epigenetic modification is influenced by environmental conditions. Screening of genomic DNA sequence revealed that the SERT promoter is CpG poor region. The methylation at a single CpG dinucleotide located 288 bp from the transcription start site was related to exploration score in urban birds. In addition, the genotypes of the SERT polymorphism SNP234 located within the minimal promoter were significantly correlated with novelty seeking behavior in captivity, with the allele increasing this behavior being more frequent in urban birds. As a conclusion, it seems that both genetic and methylation variability of the SERT gene have an important role in shaping personality traits in great tits, whereas genetic and methylation variation at the DRD4 gene is not strongly involved in behavior and personality traits. PMID:25933062
Aging as an Epigenetic Phenomenon
Ashapkin, Vasily V.; Kutueva, Lyudmila I.; Vanyushin, Boris F.
2017-01-01
Introduction: Hypermethylation of genes associated with promoter CpG islands, and hypomethylation of CpG poor genes, repeat sequences, transposable elements and intergenic genome sections occur during aging in mammals. Methylation levels of certain CpG sites display strict correlation to age and could be used as “epigenetic clock” to predict biological age. Multi-substrate deacetylases SIRT1 and SIRT6 affect aging via locus-specific modulations of chromatin structure and activity of multiple regulatory proteins involved in aging. Random errors in DNA methylation and other epigenetic marks during aging increase the transcriptional noise, and thus lead to enhanced phenotypic variation between cells of the same tissue. Such variation could cause progressive organ dysfunction observed in aged individuals. Multiple experimental data show that induction of NF-κB regulated gene sets occurs in various tissues of aged mammals. Upregulation of multiple miRNAs occurs at mid age leading to downregulation of enzymes and regulatory proteins involved in basic cellular functions, such as DNA repair, oxidative phosphorylation, intermediate metabolism, and others. Conclusion: Strong evidence shows that all epigenetic systems contribute to the lifespan control in various organisms. Similar to other cell systems, epigenome is prone to gradual degradation due to the genome damage, stressful agents, and other aging factors. But unlike mutations and other kinds of the genome damage, age-related epigenetic changes could be fully or partially reversed to a “young” state. PMID:29081695
Pousada, Guillermo; Baloira, Adolfo; Valverde, Diana
2016-06-01
Pulmonary arterial hypertension is characterizated by obstruction of the pulmonary arteries. The gene mainly related to pathology is the bone morphogenetic protein receptor type II (BMPR2). The aim of this study was to analyze the methylation pattern of the BMPR2 promoter region in patients and controls. We used Methyl Primer Express(®) v.1.0 and MatInspector softwares to analyze this region. Genomic DNA obtained from the peripheral blood of patients and controls was modified with sodium bisulphite. Methylation was analyzed using methylation-specific PCR. DNA treated with CpG methyltransferase was used as a positive control for methylation and H1299 cell culture DNA was used as positive control for gene expression. We identified a CpG island, which may have been methylated, in the BMPR2 promoter region, in addition to NIT-2 (global-acting regulatory protein), sex-determining region Y) and heat shock factor transcription factor binding sites. We found no evidence of methylation in patients and controls. No methylated CpG sites were identified in H1299 cells expressing the BMPR2 gene. The BMPR2 promoter region is the most suitable for study because of the high number of transcription factor binding sites that could alter gene function. No evidence of methylation was detected in this region in patients and controls. Copyright © 2015 SEPAR. Published by Elsevier Espana. All rights reserved.
Immunostimulatory CpG on Carbon Nanotubes Selectively Inhibits Migration of Brain Tumor Cells.
Alizadeh, Darya; White, Ethan E; Sanchez, Teresa C; Liu, Shunan; Zhang, Leying; Badie, Behnam; Berlin, Jacob M
2018-05-16
Even when treated with aggressive current therapies, patients with glioblastoma usually survive less than two years and exhibit a high rate of recurrence. CpG is an oligonucleotide that activates the innate immune system via Toll-like receptor 9 (TLR9) activation. Injection of CpG into glioblastoma tumors showed promise as an immunotherapy in mouse models but proved disappointing in human trials. One aspect of glioma that is not addressed by CpG therapy alone is the highly invasive nature of glioma cells, which is associated with resistance to radiation and chemotherapy. Here, we demonstrate that single-walled carbon nanotubes noncovalently functionalized with CpG (SWNT/CpG), which retain the immunostimulatory property of the CpG, selectively inhibit the migration of glioma cells and not macrophages without affecting cell viability or proliferation. SWNT/CpG also selectively decreased NF-κB activation in glioma cells, while activating macrophages by induction of the TLR9/NF-κB pathway, as we have previously reported. The migration inhibition of glioma cells was correlated with selective reduction of intracellular levels of reactive oxygen species (ROS), suggesting that an antioxidant-based mechanism mediates the observed effects. To the best of our knowledge, SWNT/CpG is the first nanomaterial that inhibits the migration of cancer cells while stimulating the immune system.
Non-specific filtering of beta-distributed data.
Wang, Xinhui; Laird, Peter W; Hinoue, Toshinori; Groshen, Susan; Siegmund, Kimberly D
2014-06-19
Non-specific feature selection is a dimension reduction procedure performed prior to cluster analysis of high dimensional molecular data. Not all measured features are expected to show biological variation, so only the most varying are selected for analysis. In DNA methylation studies, DNA methylation is measured as a proportion, bounded between 0 and 1, with variance a function of the mean. Filtering on standard deviation biases the selection of probes to those with mean values near 0.5. We explore the effect this has on clustering, and develop alternate filter methods that utilize a variance stabilizing transformation for Beta distributed data and do not share this bias. We compared results for 11 different non-specific filters on eight Infinium HumanMethylation data sets, selected to span a variety of biological conditions. We found that for data sets having a small fraction of samples showing abnormal methylation of a subset of normally unmethylated CpGs, a characteristic of the CpG island methylator phenotype in cancer, a novel filter statistic that utilized a variance-stabilizing transformation for Beta distributed data outperformed the common filter of using standard deviation of the DNA methylation proportion, or its log-transformed M-value, in its ability to detect the cancer subtype in a cluster analysis. However, the standard deviation filter always performed among the best for distinguishing subgroups of normal tissue. The novel filter and standard deviation filter tended to favour features in different genome contexts; for the same data set, the novel filter always selected more features from CpG island promoters and the standard deviation filter always selected more features from non-CpG island intergenic regions. Interestingly, despite selecting largely non-overlapping sets of features, the two filters did find sample subsets that overlapped for some real data sets. We found two different filter statistics that tended to prioritize features with different characteristics, each performed well for identifying clusters of cancer and non-cancer tissue, and identifying a cancer CpG island hypermethylation phenotype. Since cluster analysis is for discovery, we would suggest trying both filters on any new data sets, evaluating the overlap of features selected and clusters discovered.
Zhang, Zheng Z; Hsieh, Chih-Lin; Okitsu, Cindy Yen; Han, Li; Yu, Kefei; Lieber, Michael R
2015-08-01
Immunoglobulin (Ig) heavy chains undergo class switch recombination (CSR) to change the heavy chain isotype from IgM to IgG, A or E. The switch regions are several kilobases long, repetitive, and G-rich on the nontemplate strand. They are also relatively depleted of CpG (also called CG) sites for unknown reasons. Here we use synthetic switch regions at the IgH switch alpha (Sα) locus to test the effect of CpG sites and to try to understand why the IgH switch sequences evolved to be relatively depleted of CpG. We find that even just two CpG sites within an 80 bp synthetic switch repeat iterated 15 times (total switch region length of 1200 bp containing 30 CpG sites) are sufficient to dramatically reduce both Ig CSR and transcription through the switch region from the upstream Iα sterile transcript promoter, which is the promoter that directs transcripts through the Sα region. De novo DNA methylation occurs at the four CpG sites in and around the Iα promoter when each 80 bp Iα switch repeat contains the two CpG sites. Thus, a relatively low density of CpG sites within the switch repeats can induce upstream CpG methylation at the IgH alpha locus, and cause a substantial decrease in transcription from the sterile transcript promoter. This effect is likely the reason that switch regions evolved to contain very few CpG sites. We discuss these findings as they relate to DNA methylation and to Ig CSR. Copyright © 2015 Elsevier Ltd. All rights reserved.
Gramzinski, Robert A.; Doolan, Denise L.; Sedegah, Martha; Davis, Heather L.; Krieg, Arthur M.; Hoffman, Stephen L.
2001-01-01
Unmethylated CpG dinucleotides in bacterial DNA or synthetic oligodeoxynucleotides (ODNs) cause B-cell proliferation and immunoglobulin secretion, monocyte cytokine secretion, and activation of natural killer (NK) cell lytic activity and gamma interferon (IFN-γ) secretion in vivo and in vitro. The potent Th1-like immune activation by CpG ODNs suggests a possible utility for enhancing innate immunity against infectious pathogens. We therefore investigated whether the innate immune response could protect against malaria. Treatment of mice with CpG ODN 1826 (TCCATGACGTTCCTGACGTT, with the CpG dinucleotides underlined) or 1585 (ggGGTCAACGTTGAgggggG, with g representing diester linkages and phosphorothioate linkages being to the right of lowercase letters) in the absence of antigen 1 to 2 days prior to challenge with Plasmodium yoelii sporozoites conferred sterile protection against infection. A higher level of protection was consistently induced by CpG ODN 1826 compared with CpG ODN 1585. The protective effects of both CpG ODNs were dependent on interleukin-12, as well as IFN-γ. Moreover, CD8+ T cells (but not CD4+ T cells), NK cells, and nitric oxide were implicated in the CpG ODN 1585-induced protection. These data establish that the protective mechanism induced by administration of CpG ODN 1585 in the absence of parasite antigen is similar in nature to the mechanism induced by immunization with radiation-attenuated P. yoelii sporozoites or with plasmid DNA encoding preerythrocytic-stage P. yoelii antigens. We were unable to confirm whether CD8+ T cells, NK cells, or nitric oxide were required for the CpG ODN 1826-induced protection, but this may reflect differences in the potency of the ODNs rather than a real difference in the mechanism of action of the two ODNs. This is the first report that stimulation of the innate immune system by CpG immunostimulatory motifs can confer sterile protection against malaria. PMID:11179339
The CpG island methylator phenotype (CIMP) in colorectal cancer
Mojarad, Ehsan Nazemalhosseini; Kuppen, Peter JK; Aghdaei, Hamid Asadzadeh
2013-01-01
It is clear that colorectal cancer (CRC) develops through multiple genetic and epigenetic pathways. These pathways may be determined on the basis of three molecular features: (i) mutations in DNA mismatch repair genes, leading to a DNA microsatellite instability (MSI) phenotype, (ii) mutations in APC and other genes that activate Wnt pathway, characterized by chromosomal instability (CIN) phenotype, and (iii) global genome hypermethylation, resulting in switch off of tumor suppressor genes, indicated as CpG island methylator phenotype (CIMP). Each of these pathways is characterized by specific pathological features, mechanisms of carcinogenesis and process of tumor development. The molecular aspects of these pathways have been used clinically in the diagnosis, screening and management of patients with colorectal cancer. In this review we especially describe various aspects of CIMP, one of the important and rather recently discovered pathways that lead to colorectal cancer. PMID:24834258
The CpG island methylator phenotype (CIMP) in colorectal cancer.
Nazemalhosseini Mojarad, Ehsan; Kuppen, Peter Jk; Aghdaei, Hamid Asadzadeh; Zali, Mohammad Reza
2013-01-01
It is clear that colorectal cancer (CRC) develops through multiple genetic and epigenetic pathways. These pathways may be determined on the basis of three molecular features: (i) mutations in DNA mismatch repair genes, leading to a DNA microsatellite instability (MSI) phenotype, (ii) mutations in APC and other genes that activate Wnt pathway, characterized by chromosomal instability (CIN) phenotype, and (iii) global genome hypermethylation, resulting in switch off of tumor suppressor genes, indicated as CpG island methylator phenotype (CIMP). Each of these pathways is characterized by specific pathological features, mechanisms of carcinogenesis and process of tumor development. The molecular aspects of these pathways have been used clinically in the diagnosis, screening and management of patients with colorectal cancer. In this review we especially describe various aspects of CIMP, one of the important and rather recently discovered pathways that lead to colorectal cancer.
Han, Lin; Wu, Hua-Jun; Zhu, Haiying; Kim, Kun-Yong; Marjani, Sadie L.; Riester, Markus; Euskirchen, Ghia; Zi, Xiaoyuan; Yang, Jennifer; Han, Jasper; Snyder, Michael; Park, In-Hyun; Irizarry, Rafael; Weissman, Sherman M.
2017-01-01
Abstract Conventional DNA bisulfite sequencing has been extended to single cell level, but the coverage consistency is insufficient for parallel comparison. Here we report a novel method for genome-wide CpG island (CGI) methylation sequencing for single cells (scCGI-seq), combining methylation-sensitive restriction enzyme digestion and multiple displacement amplification for selective detection of methylated CGIs. We applied this method to analyzing single cells from two types of hematopoietic cells, K562 and GM12878 and small populations of fibroblasts and induced pluripotent stem cells. The method detected 21 798 CGIs (76% of all CGIs) per cell, and the number of CGIs consistently detected from all 16 profiled single cells was 20 864 (72.7%), with 12 961 promoters covered. This coverage represents a substantial improvement over results obtained using single cell reduced representation bisulfite sequencing, with a 66-fold increase in the fraction of consistently profiled CGIs across individual cells. Single cells of the same type were more similar to each other than to other types, but also displayed epigenetic heterogeneity. The method was further validated by comparing the CpG methylation pattern, methylation profile of CGIs/promoters and repeat regions and 41 classes of known regulatory markers to the ENCODE data. Although not every minor methylation differences between cells are detectable, scCGI-seq provides a solid tool for unsupervised stratification of a heterogeneous cell population. PMID:28126923
MSH6 G39E Polymorphism and CpG Island Methylator Phenotype in Colon Cancer
Curtin, Karen; Samowitz, Wade S.; Wolff, Roger K.; Caan, Bette J.; Ulrich, Cornelia M.; Potter, John D.; Slattery, Martha L.
2010-01-01
The MSH6 G39E germline polymorphism is not associated with an increased risk of either microsatellite stable or unstable sporadic colorectal cancer. Other than microsatellite instability, however, most genetic and epigenetic changes of tumors associated with this common variant have not been studied. The objective of our investigation was to evaluate associations between the MSH6 G39E (116G>A) polymorphism and CpG island methylator phenotype (CIMP) and BRAF V600E mutations in tumors from a sample of 1048 individuals with colon cancer and 1964 controls from Utah, Northern California, and Minnesota. The G39E polymorphism (rs1042821) was determined by the five prime nuclease assay. CIMP was determined by methylation-specific polymerase chain reaction (PCR) of CpG islands in MLH1, methylated in tumors (MINT)1, MINT2, MINT31, and CDKN2A. The BRAF V600E mutation was determined by sequencing exon 15. In microsatellite stable tumors, homozygous carriers of the G39E polymorphism had an increased risk of CIMP+ colon cancer (odds ratio (OR) 2.2, 95% confidence interval (CI) 1.1, 4.2) and BRAF V600E mutation (OR 3.1, 95% CI 1.01, 9.7) in a case–control comparison. This finding was not observed in unstable tumors; however, power may have been low to detect an association. Age at diagnosis, family history, and alcohol use did not interact with MSH6 G39E and CIMP. The MSH6 G39E germline polymorphism may be associated with CIMP+ colon cancer. PMID:19582761
dbCPG: A web resource for cancer predisposition genes.
Wei, Ran; Yao, Yao; Yang, Wu; Zheng, Chun-Hou; Zhao, Min; Xia, Junfeng
2016-06-21
Cancer predisposition genes (CPGs) are genes in which inherited mutations confer highly or moderately increased risks of developing cancer. Identification of these genes and understanding the biological mechanisms that underlie them is crucial for the prevention, early diagnosis, and optimized management of cancer. Over the past decades, great efforts have been made to identify CPGs through multiple strategies. However, information on these CPGs and their molecular functions is scattered. To address this issue and provide a comprehensive resource for researchers, we developed the Cancer Predisposition Gene Database (dbCPG, Database URL: http://bioinfo.ahu.edu.cn:8080/dbCPG/index.jsp), the first literature-based gene resource for exploring human CPGs. It contains 827 human (724 protein-coding, 23 non-coding, and 80 unknown type genes), 637 rats, and 658 mouse CPGs. Furthermore, data mining was performed to gain insights into the understanding of the CPGs data, including functional annotation, gene prioritization, network analysis of prioritized genes and overlap analysis across multiple cancer types. A user-friendly web interface with multiple browse, search, and upload functions was also developed to facilitate access to the latest information on CPGs. Taken together, the dbCPG database provides a comprehensive data resource for further studies of cancer predisposition genes.
Upadhyay, Mohita; Samal, Jasmine; Kandpal, Manish; Vasaikar, Suhas; Biswas, Banhi; Gomes, James
2013-01-01
Parvoviruses are rapidly evolving viruses that infect a wide range of hosts, including vertebrates and invertebrates. Extensive methylation of the parvovirus genome has been recently demonstrated. A global pattern of methylation of CpG dinucleotides is seen in vertebrate genomes, compared to “fractional” methylation patterns in invertebrate genomes. It remains unknown if the loss of CpG dinucleotides occurs in all viruses of a given DNA virus family that infect host species spanning across vertebrates and invertebrates. We investigated the link between the extent of CpG dinucleotide depletion among autonomous parvoviruses and the evolutionary lineage of the infected host. We demonstrate major differences in the relative abundance of CpG dinucleotides among autonomous parvoviruses which share similar genome organization and common ancestry, depending on the infected host species. Parvoviruses infecting vertebrate hosts had significantly lower relative abundance of CpG dinucleotides than parvoviruses infecting invertebrate hosts. The strong correlation of CpG dinucleotide depletion with the gain in TpG/CpA dinucleotides and the loss of TpA dinucleotides among parvoviruses suggests a major role for CpG methylation in the evolution of parvoviruses. Our data present evidence that links the relative abundance of CpG dinucleotides in parvoviruses to the methylation capabilities of the infected host. In sum, our findings support a novel perspective of host-driven evolution among autonomous parvoviruses. PMID:24109231
Ballester, Marie; Jeanbart, Laura; de Titta, Alexandre; ...
2015-09-21
An emerging strategy in preventing and treating airway allergy consists of modulating the immune response induced against allergens in the lungs. CpG oligodeoxynucleotides have been investigated in airway allergy studies, but even if promising, efficacy requires further substantiation. We investigated the effect of pulmonary delivery of nanoparticle (NP)-conjugated CpG on lung immunity and found that NP-CpG led to enhanced recruitment of activated dendritic cells and to Th1 immunity compared to free CpG. We then evaluated if pulmonary delivery of NP-CpG could prevent and treat house dust mite-induced allergy by modulating immunity directly in lungs. When CpG was administered as immunomodulatorymore » therapy prior to allergen sensitization, we found that NP-CpG significantly reduced eosinophilia, IgE levels, mucus production and Th2 cytokines, while free CpG had only a moderate effect on these parameters. In a therapeutic setting where CpG was administered after allergen sensitization, we found that although both free CpG and NP-CpG reduced eosinophilia and IgE levels to the same extent, NP conjugation of CpG significantly enhanced reduction of Th2 cytokines in lungs of allergic mice. Taken together, these data highlight benefits of NP conjugation and the relevance of NP-CpG as allergen-free therapy to modulate lung immunity and treat airway allergy.« less
Upadhyay, Mohita; Samal, Jasmine; Kandpal, Manish; Vasaikar, Suhas; Biswas, Banhi; Gomes, James; Vivekanandan, Perumal
2013-12-01
Parvoviruses are rapidly evolving viruses that infect a wide range of hosts, including vertebrates and invertebrates. Extensive methylation of the parvovirus genome has been recently demonstrated. A global pattern of methylation of CpG dinucleotides is seen in vertebrate genomes, compared to "fractional" methylation patterns in invertebrate genomes. It remains unknown if the loss of CpG dinucleotides occurs in all viruses of a given DNA virus family that infect host species spanning across vertebrates and invertebrates. We investigated the link between the extent of CpG dinucleotide depletion among autonomous parvoviruses and the evolutionary lineage of the infected host. We demonstrate major differences in the relative abundance of CpG dinucleotides among autonomous parvoviruses which share similar genome organization and common ancestry, depending on the infected host species. Parvoviruses infecting vertebrate hosts had significantly lower relative abundance of CpG dinucleotides than parvoviruses infecting invertebrate hosts. The strong correlation of CpG dinucleotide depletion with the gain in TpG/CpA dinucleotides and the loss of TpA dinucleotides among parvoviruses suggests a major role for CpG methylation in the evolution of parvoviruses. Our data present evidence that links the relative abundance of CpG dinucleotides in parvoviruses to the methylation capabilities of the infected host. In sum, our findings support a novel perspective of host-driven evolution among autonomous parvoviruses.
Nightshift work and genome-wide DNA methylation.
Bhatti, Parveen; Zhang, Yuzheng; Song, Xiaoling; Makar, Karen W; Sather, Cassandra L; Kelsey, Karl T; Houseman, E Andres; Wang, Pei
2015-02-01
The negative health effects of shift work, including carcinogenesis, may be mediated by changes in DNA methylation, particularly in the circadian genes. Using the Infinium HumanMethylation450 Bead Array (Illumina, San Diego, CA), we compared genome-wide methylation between 65 actively working dayshift workers and 59 actively working nightshift workers in the healthcare industry. A total of 473 800 loci, including 391 loci across the 12 core circadian genes, were analyzed to identify methylation markers associated with shift work status using linear regression models adjusted for gender, age, body mass index, race, smoking status and leukocyte cell profile as measured by flow cytometry. Analyses at the level of gene, CpG island and gene region were also conducted. To account for multiple comparisons, we controlled the false discovery rate (FDR ≤0.05). Significant differences between nightshift and dayshift workers were found at 16 135 of 473 800 loci, across 3769 of 20 164 genes, across 7173 of 22 721 CpG islands and across 5508 of 51 843 gene regions. For each significant loci, gene, CpG island or gene region, average methylation was consistently found to be decreased among nightshift workers compared to dayshift workers. Twenty-one loci located in the circadian genes were also found to be significantly hypomethylated among nightshift workers. The largest differences were observed for three loci located in the gene body of PER3. A total of nine significant loci were found in the CSNK1E gene, most of which were located in a CpG island and near the transcription start site of the gene. Methylation changes in these circadian genes may lead to altered expression of these genes which has been associated with cancer in previous studies. Gene ontology enrichment analysis revealed that among the significantly hypomethylated genes, processes related to host defense and immunity were represented. Our results indicate that the health effects of shift work may be mediated by hypomethylation of a wide variety of genes, including those related to circadian rhythms. While these findings need to be followed-up among a considerably expanded group of shift workers, the data generated by this study supports the need for future targeted research into the potential impacts of shift work on specific carcinogenic mechanisms.
Prediction of epigenetically regulated genes in breast cancer cell lines.
Loss, Leandro A; Sadanandam, Anguraj; Durinck, Steffen; Nautiyal, Shivani; Flaucher, Diane; Carlton, Victoria E H; Moorhead, Martin; Lu, Yontao; Gray, Joe W; Faham, Malek; Spellman, Paul; Parvin, Bahram
2010-06-04
Methylation of CpG islands within the DNA promoter regions is one mechanism that leads to aberrant gene expression in cancer. In particular, the abnormal methylation of CpG islands may silence associated genes. Therefore, using high-throughput microarrays to measure CpG island methylation will lead to better understanding of tumor pathobiology and progression, while revealing potentially new biomarkers. We have examined a recently developed high-throughput technology for measuring genome-wide methylation patterns called mTACL. Here, we propose a computational pipeline for integrating gene expression and CpG island methylation profiles to identify epigenetically regulated genes for a panel of 45 breast cancer cell lines, which is widely used in the Integrative Cancer Biology Program (ICBP). The pipeline (i) reduces the dimensionality of the methylation data, (ii) associates the reduced methylation data with gene expression data, and (iii) ranks methylation-expression associations according to their epigenetic regulation. Dimensionality reduction is performed in two steps: (i) methylation sites are grouped across the genome to identify regions of interest, and (ii) methylation profiles are clustered within each region. Associations between the clustered methylation and the gene expression data sets generate candidate matches within a fixed neighborhood around each gene. Finally, the methylation-expression associations are ranked through a logistic regression, and their significance is quantified through permutation analysis. Our two-step dimensionality reduction compressed 90% of the original data, reducing 137,688 methylation sites to 14,505 clusters. Methylation-expression associations produced 18,312 correspondences, which were used to further analyze epigenetic regulation. Logistic regression was used to identify 58 genes from these correspondences that showed a statistically significant negative correlation between methylation profiles and gene expression in the panel of breast cancer cell lines. Subnetwork enrichment of these genes has identified 35 common regulators with 6 or more predicted markers. In addition to identifying epigenetically regulated genes, we show evidence of differentially expressed methylation patterns between the basal and luminal subtypes. Our results indicate that the proposed computational protocol is a viable platform for identifying epigenetically regulated genes. Our protocol has generated a list of predictors including COL1A2, TOP2A, TFF1, and VAV3, genes whose key roles in epigenetic regulation is documented in the literature. Subnetwork enrichment of these predicted markers further suggests that epigenetic regulation of individual genes occurs in a coordinated fashion and through common regulators.
Hanagata, Nobutaka
2017-01-01
Unmethylated cytosine-guanine dinucleotide-containing oligodeoxynucleotides (CpG ODNs), which are synthetic agonists of Toll-like receptor 9 (TLR9), activate humoral and cellular immunity and are being developed as vaccine adjuvants to prevent or treat cancers, infectious diseases, and allergies. Free CpG ODNs have been used in many clinical trials implemented to verify their effects. However, recent research has reported that self-assembled CpG ODNs, protein/peptide-CpG ODN conjugates, and nanomaterial-CpG ODN complexes demonstrate higher adjuvant effects than free CpG ODNs, owing to their improved uptake efficiency into cells expressing TLR9. Moreover, protein/peptide-CpG ODN conjugates and nanomaterial-CpG ODN complexes are able to deliver CpG ODNs and antigens (or allergens) to the same types of cells, which enables a higher degree of prophylaxis or therapeutic effect. In this review, the author describes recent trends in the research and development of CpG ODN nanomedicines containing self-assembled CpG ODNs, protein/peptide-CpG ODN conjugates, and nanomaterial-CpG ODN complexes, focusing mainly on the results of preclinical and clinical studies.
DNA methylation of the BRD2 promoter is associated with juvenile myoclonic epilepsy in Caucasians.
Pathak, Shilpa; Miller, James; Morris, Emily C; Stewart, William C L; Greenberg, David A
2018-05-01
Juvenile myoclonic epilepsy (JME) is a common adolescent-onset genetic generalized epilepsy (GGE) syndrome. Multiple linkage and association studies have found that BRD2 influences the expression of JME. The BRD2-JME connection is further corroborated by our murine model; Brd2 haploinsufficiency produces characteristics that typify the clinical hallmarks of JME. Neither we, nor several large-scale studies of JME, found JME-related BRD2 coding mutations. Therefore, we investigated noncoding BRD2 regions, seeking the origin of BRD2's JME influence. BRD2's promoter harbors a JME-associated single nucleotide polymorphism (rs3918149) and a CpG (C-phosphate-G dinucleotides) island (CpG76), making it a potential "hotspot" for JME-associated epigenetic variants. Methylating promoter CpG sites causes gene silencing, often resulting in reduced gene expression. We tested for differences in DNA methylation at CpG76 in 3 different subgroups: (1) JME patients versus their unaffected family members, (2) JME versus patients with other forms of GGE, and (3) Caucasian versus non-Caucasian JME patients. We used DNA pyrosequencing to analyze the methylation status of 10 BRD2 promoter CpG sites in lymphoblastoid cells from JME patients of Caucasian and non-Caucasian origin, unaffected family members, and also non-JME GGE patients. We also measured global methylation levels and DNA methyl transferase 1 (DNMT1) transcript expression in JME families by standard methods. CpG76 is highly methylated in JME patients compared to unaffected family members. In families with non-JME GGE, we found no relationship between promoter methylation and epilepsy. In non-Caucasian JME families, promoter methylation was mostly not associated with epilepsy. This makes the BRD2 promoter a JME-specific, ethnicity-specific, differentially methylated region. Global methylation was constant across groups. BRD2 promoter methylation in JME, and the lack of methylation in unaffected relatives, in non-JME GGE patients, and in non-Caucasian JME, demonstrate that methylation specificity is a possible seizure susceptibility motif in JME risk and suggests JME therapeutics targeting BRD2. Wiley Periodicals, Inc. © 2018 International League Against Epilepsy.
DNA containing CpG motifs induces angiogenesis
NASA Astrophysics Data System (ADS)
Zheng, Mei; Klinman, Dennis M.; Gierynska, Malgorzata; Rouse, Barry T.
2002-06-01
New blood vessel formation in the cornea is an essential step in the pathogenesis of a blinding immunoinflammatory reaction caused by ocular infection with herpes simplex virus (HSV). By using a murine corneal micropocket assay, we found that HSV DNA (which contains a significant excess of potentially bioactive "CpG" motifs when compared with mammalian DNA) induces angiogenesis. Moreover, synthetic oligodeoxynucleotides containing CpG motifs attract inflammatory cells and stimulate the release of vascular endothelial growth factor (VEGF), which in turn triggers new blood vessel formation. In vitro, CpG DNA induces the J774A.1 murine macrophage cell line to produce VEGF. In vivo CpG-induced angiogenesis was blocked by the administration of anti-mVEGF Ab or the inclusion of "neutralizing" oligodeoxynucleotides that specifically oppose the stimulatory activity of CpG DNA. These findings establish that DNA containing bioactive CpG motifs induces angiogenesis, and suggest that CpG motifs in HSV DNA may contribute to the blinding lesions of stromal keratitis.
Poblano-Verástegui, Ofelia; Vieyra-Romero, Waldo I; Galván-García, Ángel F; Fernández-Elorriaga, María; Rodríguez-Martínez, Antonia I; Saturno-Hernández, Pedro J
2017-01-01
To assess the quality and compliance of clinical practice guidelines (CPG) applicable to chronic non-communicable diseases (CNCD) in primary healthcare (CS), and views of staff on the barriers, facilitators and their use. 18 valued CPG with AGREEII, 3 are selected to develop indicators and assess compliance using lot quality acceptance sample (LQAS, standard 75 / 95% threshold 40 / 75% respectively, α:0. 05, β:0. 10) on 5 CS. 70 professionals surveyed about knowledge and use of CPG. Average quality of the CPG was 57.2%; low rating in domains: "Applicability" (<25%), "Stakeholder involvement" (43.5%) and "Rigour of development" (55.0%). Compliance in CS ranges from 39 to 53.4%. Professionals show uneven knowledge of CPG; 44 to 45% (according to CPG), they declare that they are not used, they identify as main barriers the lack of training, and their difficult accessibility and management. The quality and implementation of evaluated CPG is deficient constituting an opportunity of improvement in health services.
DNA-inorganic hybrid nanovaccine for cancer immunotherapy
NASA Astrophysics Data System (ADS)
Zhu, Guizhi; Liu, Yijing; Yang, Xiangyu; Kim, Young-Hwa; Zhang, Huimin; Jia, Rui; Liao, Hsien-Shun; Jin, Albert; Lin, Jing; Aronova, Maria; Leapman, Richard; Nie, Zhihong; Niu, Gang; Chen, Xiaoyuan
2016-03-01
Cancer evolves to evade or compromise the surveillance of the immune system, and cancer immunotherapy aims to harness the immune system in order to inhibit cancer development. Unmethylated CpG dinucleotide-containing oligonucleotides (CpG), a class of potent adjuvants that activate the toll-like receptor 9 (TLR9) located in the endolysosome of many antigen-presenting cells (APCs), are promising for cancer immunotherapy. However, clinical application of synthetic CpG confronts many challenges such as suboptimal delivery into APCs, unfavorable pharmacokinetics caused by limited biostability and short in vivo half-life, and side effects associated with leaking of CpG into the systemic circulation. Here we present DNA-inorganic hybrid nanovaccines (hNVs) for efficient uptake into APCs, prolonged tumor retention, and potent immunostimulation and cancer immunotherapy. hNVs were self-assembled from concatemer CpG analogs and magnesium pyrophosphate (Mg2PPi). Mg2PPi renders hNVs resistant to nuclease degradation and thermal denaturation, both of which are demanding characteristics for effective vaccination and the storage and transportation of vaccines. Fluorophore-labeled hNVs were tracked to be efficiently internalized into the endolysosomes of APCs, where Mg2PPi was dissolved in an acidic environment and thus CpG analogs were exposed to hNVs. Internalized hNVs in APCs led to (1) elevated secretion of proinflammatory factors, and (2) elevated expression of co-stimulatory factors. Compared with molecular CpG, hNVs dramatically prolonged the tissue retention of CpG analogs and reduced splenomegaly, a common side effect of CpG. In a melanoma mouse model, two injections of hNVs significantly inhibited the tumor growth and outperformed the molecular CpG. These results suggest hNVs are promising for cancer immunotherapy.Cancer evolves to evade or compromise the surveillance of the immune system, and cancer immunotherapy aims to harness the immune system in order to inhibit cancer development. Unmethylated CpG dinucleotide-containing oligonucleotides (CpG), a class of potent adjuvants that activate the toll-like receptor 9 (TLR9) located in the endolysosome of many antigen-presenting cells (APCs), are promising for cancer immunotherapy. However, clinical application of synthetic CpG confronts many challenges such as suboptimal delivery into APCs, unfavorable pharmacokinetics caused by limited biostability and short in vivo half-life, and side effects associated with leaking of CpG into the systemic circulation. Here we present DNA-inorganic hybrid nanovaccines (hNVs) for efficient uptake into APCs, prolonged tumor retention, and potent immunostimulation and cancer immunotherapy. hNVs were self-assembled from concatemer CpG analogs and magnesium pyrophosphate (Mg2PPi). Mg2PPi renders hNVs resistant to nuclease degradation and thermal denaturation, both of which are demanding characteristics for effective vaccination and the storage and transportation of vaccines. Fluorophore-labeled hNVs were tracked to be efficiently internalized into the endolysosomes of APCs, where Mg2PPi was dissolved in an acidic environment and thus CpG analogs were exposed to hNVs. Internalized hNVs in APCs led to (1) elevated secretion of proinflammatory factors, and (2) elevated expression of co-stimulatory factors. Compared with molecular CpG, hNVs dramatically prolonged the tissue retention of CpG analogs and reduced splenomegaly, a common side effect of CpG. In a melanoma mouse model, two injections of hNVs significantly inhibited the tumor growth and outperformed the molecular CpG. These results suggest hNVs are promising for cancer immunotherapy. Electronic supplementary information (ESI) available: ESI materials and methods, characterization of hNVs. See DOI: 10.1039/c5nr08821f
Motor Neurons Tune Premotor Activity in a Vertebrate Central Pattern Generator
2017-01-01
Central patterns generators (CPGs) are neural circuits that drive rhythmic motor output without sensory feedback. Vertebrate CPGs are generally believed to operate in a top-down manner in which premotor interneurons activate motor neurons that in turn drive muscles. In contrast, the frog (Xenopus laevis) vocal CPG contains a functionally unexplored neuronal projection from the motor nucleus to the premotor nucleus, indicating a recurrent pathway that may contribute to rhythm generation. In this study, we characterized the function of this bottom-up connection. The X. laevis vocal CPG produces a 50–60 Hz “fast trill” song used by males during courtship. We recorded “fictive vocalizations” in the in vitro CPG from the laryngeal nerve while simultaneously recording premotor activity at the population and single-cell level. We show that transecting the motor-to-premotor projection eliminated the characteristic firing rate of premotor neurons. Silencing motor neurons with the intracellular sodium channel blocker QX-314 also disrupted premotor rhythms, as did blockade of nicotinic synapses in the motor nucleus (the putative location of motor neuron-to-interneuron connections). Electrically stimulating the laryngeal nerve elicited primarily IPSPs in premotor neurons that could be blocked by a nicotinic receptor antagonist. Our results indicate that an inhibitory signal, activated by motor neurons, is required for proper CPG function. To our knowledge, these findings represent the first example of a CPG in which precise premotor rhythms are tuned by motor neuron activity. SIGNIFICANCE STATEMENT Central pattern generators (CPGs) are neural circuits that produce rhythmic behaviors. In vertebrates, motor neurons are not commonly known to contribute to CPG function, with the exception of a few spinal circuits where the functional significance of motor neuron feedback is still poorly understood. The frog hindbrain vocal circuit contains a previously unexplored connection from the motor to premotor region. Our results indicate that motor neurons activate this bottom-up connection, and blocking this signal eliminates normal premotor activity. These findings may promote increased awareness of potential involvement of motor neurons in a wider range of CPGs, perhaps clarifying our understanding of network principles underlying motor behaviors in numerous organisms, including humans. PMID:28219984
Hossain, Mohammad B; Li, Huiqi; Hedmer, Maria; Tinnerberg, Håkan; Albin, Maria; Broberg, Karin
2015-01-01
Background Welders are at risk for cardiovascular disease. Recent studies linked tobacco smoke exposure to hypomethylation of the F2RL3 (coagulation factor II (thrombin) receptor-like 3) gene, a marker for cardiovascular disease prognosis and mortality. However, whether welding fumes cause hypomethylation of F2RL3 remains unknown. Methods We investigated 101 welders (median span of working as a welder: 7 years) and 127 unexposed controls (non-welders with no obvious exposure to respirable dust at work), age range 23–60 years, all currently non-smoking, in Sweden. The participants were interviewed about their work history, lifestyle factors and diseases. Personal sampling of respirable dust was performed for the welders. DNA methylation of F2RL3 in blood was assessed by pyrosequencing of four CpG sites, CpG_2 (corresponds to cg03636183) to CpG_5, in F2RL3. Multivariable linear regression analysis was used to assess the association between exposure to welding fumes and F2RL3 methylation. Results Welders had 2.6% lower methylation of CpG_5 than controls (p<0.001). Higher concentrations of measured respirable dust among the welders were associated with hypomethylation of CpG_2, CpG_4 and CpG_5 (β=−0.49 to −1.4, p<0.012); p<0.029 adjusted for age, previous smoking, passive smoking, education, current residence and respirator use. Increasing the number of years working as a welder was associated with hypomethylation of CpG_4 (linear regression analysis, β=−0.11, p=0.039, adjusted for previous smoking). Previous tobacco smokers had 1.5–4.7% (p<0.014) lower methylation of 3 of the 4 CpG sites in F2RL3 (CpG_2, CpG_4 and CpG_5) compared to never-smokers. A non-significant lower risk of cardiovascular disease with more methylation was observed for all CpG sites. Conclusions Welding fumes exposure and previous smoking were associated with F2RL3 hypomethylation. This finding links low-to-moderate exposure to welding fumes to adverse effects on the cardiovascular system, and suggests a potential mechanistic pathway for this link, via epigenetic effects on F2RL3 expression. PMID:26395445
[Comparative evaluation of clinical practice guidelines for the treatment of schizophrenia].
Delessert, D; Pomini, V; Grasset, F; Baumann, P
2008-01-01
Many clinical practice guidelines (CPG) have been published in reply to the development of the concept of "evidence-based medicine" (EBM) and as a solution to the difficulty of synthesizing and selecting relevant medical literature. Taking into account the expansion of new CPG, the question of choice arises: which CPG to consider in a given clinical situation? It is of primary importance to evaluate the quality of the CPG, but until recently, there has been no standardized tool of evaluation or comparison of the quality of the CPG. An instrument of evaluation of the quality of the CPG, called "AGREE" for appraisal of guidelines for research and evaluation was validated in 2002. The six principal CPG concerning the treatment of schizophrenia are compared with the help of the "AGREE" instrument: (1) "the Agence nationale pour le développement de l'évaluation médicale (ANDEM) recommendations"; (2) "The American Psychiatric Association (APA) practice guideline for the treatment of patients with schizophrenia"; (3) "The quick reference guide of APA practice guideline for the treatment of patients with schizophrenia"; (4) "The schizophrenia patient outcomes research team (PORT) treatment recommendations"; (5) "The Texas medication algorithm project (T-MAP)" and (6) "The expert consensus guideline for the treatment of schizophrenia". The results of our study were then compared with those of a similar investigation published in 2005, structured on 24 CPG tackling the treatment of schizophrenia. The "AGREE" tool was also used by two investigators in their study. In general, the scores of the two studies differed little and the two global evaluations of the CPG converged; however, each of the six CPG is perfectible. The rigour of elaboration of the six CPG was in general average. The consideration of the opinion of potential users was incomplete, and an effort made in the presentation of the recommendations would facilitate their clinical use. Moreover, there was little consideration by the authors regarding the applicability of the recommendations. Globally, two CPG are considered as strongly recommended: "the quick reference guide of the APA practice guideline for the treatment of patients with schizophrenia" and "the T-MAP".
ERIC Educational Resources Information Center
Ben-Sasson, Ayelet; Lamash, Liron; Gal, Eynat
2013-01-01
The goal of this study was to examine whether a technological touch activated Collaborative Puzzle Game (CPG) increased positive social behaviors in children with high functioning autism spectrum disorder (HFASD). The CPG involved construction of a virtual puzzle by selecting and dragging pieces into the solution area on a touch screen table. The…
Gutierrez, Ivan M; Zurakowski, David; Chen, Qiaoli; Mooney, David P
2013-02-01
The American Pediatric Surgical Association Trauma Committee proposed the use of a clinical practice guideline (CPG) for the non-operative management of isolated splenic injuries in 1998. An analysis was conducted to determine the financial impact of CPGs on the management of these injuries. The Pediatric Health Information System database, which contains data from 44 children's hospitals, was used to identify children who sustained a graded isolated splenic injury between June 2005 and June 2010. Demographics, length of stay (LOS), readmission rates, and laboratory, imaging, procedural, and total cost data were determined for all hospitals verified as a pediatric trauma center by the American College of Surgeons and/or designated by their local authority. Comparisons were made between facilities self-identifying as having a splenic injury management CPG and those without a CPG. Children (1,154) with isolated splenic injuries (grades 1-4) were cared for in 26 pediatric trauma centers: 20 with a CPG and 6 without (non-CPG). Median costs were significantly lower at CPG than non-CPG centers for imaging (US $163 vs. US $641, P < .001), laboratory (US $629 vs. US $1,044, P < .001), and total hospital stay (US $9,868 vs. US $10,830, P < .001). The median LOS for CPG and non-CPG centers were similar (3 vs. 2 days, P = .38), as were readmission rates within 90 days (3.1 vs. 5.1 %, P = .21). Multiple linear regression indicated that LOS (P < .001) and utilization of a CPG (P = .007) are significant independent predictors of total cost. Utilization of a CPG to manage children with isolated splenic injuries at a pediatric trauma center results in significantly reduced imaging, laboratory, and total hospital costs independent of patient age, gender, grade, and LOS.
Grasso, Chiara; Trevisan, Morena; Fiano, Valentina; Tarallo, Valentina; De Marco, Laura; Sacerdote, Carlotta; Richiardi, Lorenzo; Merletti, Franco; Gillio-Tos, Anna
2016-01-01
Pyrosequencing has emerged as an alternative method of nucleic acid sequencing, well suited for many applications which aim to characterize single nucleotide polymorphisms, mutations, microbial types and CpG methylation in the target DNA. The commercially available pyrosequencing systems can harbor two different types of software which allow analysis in AQ or CpG mode, respectively, both widely employed for DNA methylation analysis. Aim of the study was to assess the performance for DNA methylation analysis at CpG sites of the two pyrosequencing software which allow analysis in AQ or CpG mode, respectively. Despite CpG mode having been specifically generated for CpG methylation quantification, many investigations on this topic have been carried out with AQ mode. As proof of equivalent performance of the two software for this type of analysis is not available, the focus of this paper was to evaluate if the two modes currently used for CpG methylation assessment by pyrosequencing may give overlapping results. We compared the performance of the two software in quantifying DNA methylation in the promoter of selected genes (GSTP1, MGMT, LINE-1) by testing two case series which include DNA from paraffin embedded prostate cancer tissues (PC study, N = 36) and DNA from blood fractions of healthy people (DD study, N = 28), respectively. We found discrepancy in the two pyrosequencing software-based quality assignment of DNA methylation assays. Compared to the software for analysis in the AQ mode, less permissive criteria are supported by the Pyro Q-CpG software, which enables analysis in CpG mode. CpG mode warns the operators about potential unsatisfactory performance of the assay and ensures a more accurate quantitative evaluation of DNA methylation at CpG sites. The implementation of CpG mode is strongly advisable in order to improve the reliability of the methylation analysis results achievable by pyrosequencing.
Treatment of Tobacco Dependence, a Critical Gap in Czech Clinical Practice Guidelines.
Zvolská, Kamila; Fraser, Keely; Zvolský, Miroslav; Králíková, Eva
2017-06-01
Tobacco related comorbidities and treatment of dependence are relevant to clinicians of all disciplines. Clinicians should provide a brief intervention about tobacco use with smokers at each clinical contact (success rate of 5-10 %). Intensive treatment (success rate >30%) should be available to those who need it. Brief intervention is not yet standard clinical practice. Our aim was to assess clinical practice guidelines (CPG) of selected medical professional societies to determine whether or not tobacco dependence treatment recommendations were included. Between October and December 2013, we conducted a keyword search of CPG for 20 medical professional societies in the Czech Republic. We searched for the keywords "smoking", "tobacco" and "nicotine addiction" in 91 CPG documents, which were freely available on the websites of selected professional societies. We focused specifically on CPG relating to cardiovascular and respiratory diseases as well as cancer. We excluded any CPG focused on acute conditions, diagnostics only, laboratory methods, or administration. There was no mention of smoking in 27.7% (26/94) of CPG documents. Only 16% (15/94) of CPG documents listed smoking as a risk factor. 42.5% (40/94) mentioned smoking related phrases (e.g. "smoking ban"). Only 13.8% (13/94) of CPG included a section on tobacco dependence, referenced tobacco dependence treatment guidelines or mentioned specialized treatment centres where smokers can be referred. Nearly one third of CPG related to cardiovascular and respiratory diseases as well as cancer made no mention of smoking. Despite the clinical significance of smoking, the majority of CPG did not adequately address tobacco dependence and its treatment. Copyright© by the National Institute of Public Health, Prague 2017
DNA-inorganic hybrid nanovaccine for cancer immunotherapy.
Zhu, Guizhi; Liu, Yijing; Yang, Xiangyu; Kim, Young-Hwa; Zhang, Huimin; Jia, Rui; Liao, Hsien-Shun; Jin, Albert; Lin, Jing; Aronova, Maria; Leapman, Richard; Nie, Zhihong; Niu, Gang; Chen, Xiaoyuan
2016-03-28
Cancer evolves to evade or compromise the surveillance of the immune system, and cancer immunotherapy aims to harness the immune system in order to inhibit cancer development. Unmethylated CpG dinucleotide-containing oligonucleotides (CpG), a class of potent adjuvants that activate the toll-like receptor 9 (TLR9) located in the endolysosome of many antigen-presenting cells (APCs), are promising for cancer immunotherapy. However, clinical application of synthetic CpG confronts many challenges such as suboptimal delivery into APCs, unfavorable pharmacokinetics caused by limited biostability and short in vivo half-life, and side effects associated with leaking of CpG into the systemic circulation. Here we present DNA-inorganic hybrid nanovaccines (hNVs) for efficient uptake into APCs, prolonged tumor retention, and potent immunostimulation and cancer immunotherapy. hNVs were self-assembled from concatemer CpG analogs and magnesium pyrophosphate (Mg2PPi). Mg2PPi renders hNVs resistant to nuclease degradation and thermal denaturation, both of which are demanding characteristics for effective vaccination and the storage and transportation of vaccines. Fluorophore-labeled hNVs were tracked to be efficiently internalized into the endolysosomes of APCs, where Mg2PPi was dissolved in an acidic environment and thus CpG analogs were exposed to hNVs. Internalized hNVs in APCs led to (1) elevated secretion of proinflammatory factors, and (2) elevated expression of co-stimulatory factors. Compared with molecular CpG, hNVs dramatically prolonged the tissue retention of CpG analogs and reduced splenomegaly, a common side effect of CpG. In a melanoma mouse model, two injections of hNVs significantly inhibited the tumor growth and outperformed the molecular CpG. These results suggest hNVs are promising for cancer immunotherapy.
Yu, Da-Hai; Ware, Carol; Waterland, Robert A.; Zhang, Jiexin; Chen, Miao-Hsueh; Gadkari, Manasi; Kunde-Ramamoorthy, Govindarajan; Nosavanh, Lagina M.
2013-01-01
During development, a small but significant number of CpG islands (CGIs) become methylated. The timing of developmentally programmed CGI methylation and associated mechanisms of transcriptional regulation during cellular differentiation, however, remain poorly characterized. Here, we used genome-wide DNA methylation microarrays to identify epigenetic changes during human embryonic stem cell (hESC) differentiation. We discovered a group of CGIs associated with developmental genes that gain methylation after hESCs differentiate. Conversely, erasure of methylation was observed at the identified CGIs during subsequent reprogramming to induced pluripotent stem cells (iPSCs), further supporting a functional role for the CGI methylation. Both global gene expression profiling and quantitative reverse transcription-PCR (RT-PCR) validation indicated opposing effects of CGI methylation in transcriptional regulation during differentiation, with promoter CGI methylation repressing and 3′ CGI methylation activating transcription. By studying diverse human tissues and mouse models, we further confirmed that developmentally programmed 3′ CGI methylation confers tissue- and cell-type-specific gene activation in vivo. Importantly, luciferase reporter assays provided evidence that 3′ CGI methylation regulates transcriptional activation via a CTCF-dependent enhancer-blocking mechanism. These findings expand the classic view of mammalian CGI methylation as a mechanism for transcriptional silencing and indicate a functional role for 3′ CGI methylation in developmental gene regulation. PMID:23459939
Byadgi, Omkar; Puteri, Dinda; Lee, Jai-Wei; Chang, Tsung-Chou; Lee, Yan-Horn; Chu, Chun-Yen; Cheng, Ta-Chih
2014-01-01
Cytosine-guanine oligodeoxynucleotide (CpG ODN) motifs of bacterial DNA are recognized through toll-like receptor 9 (TLR9) and are potent activators of innate immunity. However, the interaction between TLR9 and CpG ODN in aquatic species has not been well characterized. Hence, cobia TLR9 isoform B (RCTLR9B) was cloned and its expression and induction in intestine were investigated. RCTLR9B cDNA consists of 3113bp encoding 1009 amino acids containing three regions, leucine rich repeats, transmembrane domain, and toll/interleukin-1 receptor (TIR) domain. Intraperitoneal injection of CpG ODN 2395 upregulated RCTLR9 A and B and MyD88 and also induced the expressions of Mx, chemokine CC, and interleukin IL-1 β . Cobia intraperitoneally injected with CpG ODN 1668 and 2395 had increased survival rates after challenge with Photobacterium damselae subsp. piscicida. In addition, formulation of CpG ODN with formalin-killed bacteria (FKB) and aluminum hydroxide gel significantly increased expressions of RCTLR9 A (50 folds) and B (30 folds) isoforms at 10 dpi (CpG ODN 1668) and MyD88 (21 folds) at 6 dpv (CpG ODN 2395). Subsequently, IL-1 β increased at 6 dpv in 1668 group. No histopathological damage and inflammatory responses were observed in the injected cobia. Altogether, these results facilitate CpG ODNs as an adjuvant to increase bacterial disease resistance and efficacy of vaccines in cobia.
Byadgi, Omkar; Puteri, Dinda; Lee, Jai-Wei; Chang, Tsung-Chou; Lee, Yan-Horn; Chu, Chun-Yen; Cheng, Ta-Chih
2014-01-01
Cytosine-guanine oligodeoxynucleotide (CpG ODN) motifs of bacterial DNA are recognized through toll-like receptor 9 (TLR9) and are potent activators of innate immunity. However, the interaction between TLR9 and CpG ODN in aquatic species has not been well characterized. Hence, cobia TLR9 isoform B (RCTLR9B) was cloned and its expression and induction in intestine were investigated. RCTLR9B cDNA consists of 3113bp encoding 1009 amino acids containing three regions, leucine rich repeats, transmembrane domain, and toll/interleukin-1 receptor (TIR) domain. Intraperitoneal injection of CpG ODN 2395 upregulated RCTLR9 A and B and MyD88 and also induced the expressions of Mx, chemokine CC, and interleukin IL-1β. Cobia intraperitoneally injected with CpG ODN 1668 and 2395 had increased survival rates after challenge with Photobacterium damselae subsp. piscicida. In addition, formulation of CpG ODN with formalin-killed bacteria (FKB) and aluminum hydroxide gel significantly increased expressions of RCTLR9 A (50 folds) and B (30 folds) isoforms at 10 dpi (CpG ODN 1668) and MyD88 (21 folds) at 6 dpv (CpG ODN 2395). Subsequently, IL-1β increased at 6 dpv in 1668 group. No histopathological damage and inflammatory responses were observed in the injected cobia. Altogether, these results facilitate CpG ODNs as an adjuvant to increase bacterial disease resistance and efficacy of vaccines in cobia. PMID:24991578
Analysis of estrogen receptor β gene methylation in autistic males in a Chinese Han population.
Wang, Xuelai; Liang, Shuang; Sun, Yi; Li, Haixin; Endo, Fumio; Nakao, Mitsuyoshi; Saitoh, Noriko; Wu, Lijie
2017-08-01
Autism spectrum disorder (ASD) is a neurodevelopment disorder with abnormalities of social interaction, communication and repetitive behaviors. The higher prevalence of ASD in men implies a potential relationship between sex hormones and ASD etiology. The ESR2 gene encodes estrogen receptor beta (ESR2) and plays an important role during brain development. A relationship between ESR2 and ASD has been suggested by studies on single nucleotide polymorphisms and mRNA and protein expression levels in ASD patients. Here, we explored the possible epigenetic regulation of the ESR2 gene in autism. We collected genomic DNA from the peripheral blood of Chinese Han males with autism and age-matched normal males and measured DNA methylation of CpG islands in the ESR2 gene, which consisted of 41 CpG sites among the proximal promoter region and an untranslated exon, by bisulfite sequencing. We also investigated a relationship between DNA methylation and phenotypic features of autism, as assessed by the Children Autism Rating Scale. We found little overall difference in the DNA methylation of the ESR2 5'-flanking region in individuals with autism compared with normal individuals. However, detailed analyses revealed that eight specific CpG sites were hypermethylated in autistic individuals and that four specific CpG sites were positively associated with the severity of autistic symptoms. Our study indicates that the epigenetic dysregulation of ESR2 may govern the development of autism.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ballester, Marie; Jeanbart, Laura; de Titta, Alexandre
An emerging strategy in preventing and treating airway allergy consists of modulating the immune response induced against allergens in the lungs. CpG oligodeoxynucleotides have been investigated in airway allergy studies, but even if promising, efficacy requires further substantiation. We investigated the effect of pulmonary delivery of nanoparticle (NP)-conjugated CpG on lung immunity and found that NP-CpG led to enhanced recruitment of activated dendritic cells and to Th1 immunity compared to free CpG. We then evaluated if pulmonary delivery of NP-CpG could prevent and treat house dust mite-induced allergy by modulating immunity directly in lungs. When CpG was administered as immunomodulatorymore » therapy prior to allergen sensitization, we found that NP-CpG significantly reduced eosinophilia, IgE levels, mucus production and Th2 cytokines, while free CpG had only a moderate effect on these parameters. In a therapeutic setting where CpG was administered after allergen sensitization, we found that although both free CpG and NP-CpG reduced eosinophilia and IgE levels to the same extent, NP conjugation of CpG significantly enhanced reduction of Th2 cytokines in lungs of allergic mice. Taken together, these data highlight benefits of NP conjugation and the relevance of NP-CpG as allergen-free therapy to modulate lung immunity and treat airway allergy.« less
Olsson, Anders H.; Volkov, Petr; Bacos, Karl; Dayeh, Tasnim; Hall, Elin; Nilsson, Emma A.; Ladenvall, Claes; Rönn, Tina; Ling, Charlotte
2014-01-01
Genetic and epigenetic mechanisms may interact and together affect biological processes and disease development. However, most previous studies have investigated genetic and epigenetic mechanisms independently, and studies examining their interactions throughout the human genome are lacking. To identify genetic loci that interact with the epigenome, we performed the first genome-wide DNA methylation quantitative trait locus (mQTL) analysis in human pancreatic islets. We related 574,553 single nucleotide polymorphisms (SNPs) with genome-wide DNA methylation data of 468,787 CpG sites targeting 99% of RefSeq genes in islets from 89 donors. We identified 67,438 SNP-CpG pairs in cis, corresponding to 36,783 SNPs (6.4% of tested SNPs) and 11,735 CpG sites (2.5% of tested CpGs), and 2,562 significant SNP-CpG pairs in trans, corresponding to 1,465 SNPs (0.3% of tested SNPs) and 383 CpG sites (0.08% of tested CpGs), showing significant associations after correction for multiple testing. These include reported diabetes loci, e.g. ADCY5, KCNJ11, HLA-DQA1, INS, PDX1 and GRB10. CpGs of significant cis-mQTLs were overrepresented in the gene body and outside of CpG islands. Follow-up analyses further identified mQTLs associated with gene expression and insulin secretion in human islets. Causal inference test (CIT) identified SNP-CpG pairs where DNA methylation in human islets is the potential mediator of the genetic association with gene expression or insulin secretion. Functional analyses further demonstrated that identified candidate genes (GPX7, GSTT1 and SNX19) directly affect key biological processes such as proliferation and apoptosis in pancreatic β-cells. Finally, we found direct correlations between DNA methylation of 22,773 (4.9%) CpGs with mRNA expression of 4,876 genes, where 90% of the correlations were negative when CpGs were located in the region surrounding transcription start site. Our study demonstrates for the first time how genome-wide genetic and epigenetic variation interacts to influence gene expression, islet function and potential diabetes risk in humans. PMID:25375650
Kalveram, K T
1991-01-01
A model is proposed, in which goal-directed movements of the forearm are controlled by a central pattern generator (CPG) initiated for exactly one period, and by reflex-analogous processes. Movement width is proportional to the amplitude factor of the CPG's output, and to the square of the CPG's period length. The period duration can be freely selected, thus enabling the CPG to accommodate its time scale to the period of others CPG's. Parameters which influence movement accuracy can be adjusted by means of closed control loop, which are discrete with respect to time: The time unit corresponds to the period of the CPG. For instance, momentum adjustment balances the CPG in such a manner that the velocity of the arm becomes zero on termination of the period, while gain adjustment serves to attain a correct movement length in the presence of an inertial load. Friction, stiffness and gravitational force are neutralized by additional reflex-type processes, interpretable as positive feedback loops with adjustable gain factors, using position and velocity signals.
Association between promoter hypermethylation of the DACT2 gene and tumor stages in breast cancer.
Marusa Borgonio-Cuadra, Veronica; Miranda-Duarte, Antonio; Rojas-Toledo, Xochitl; Garcia-Hernandez, Normand; Alfredo Sierra-Ramirez, Jose; Cardenas-Garcia, Maura; Elena Hernandez-Caballero, Marta
2018-01-01
Aberrant methylation of CpG islands in the promoter is a hallmark of cancer, leading to transcriptional silencing of tumor suppressor genes. The aim of this work was to evaluate the promoter methylation status of the DACT2 gene in breast cancer (BC) tissue and to analyze its possible effect on tumor type or grade. CpG island from the DACT2 promoter in region -240 to -14 from transcriptional start site (TSS) were obtained. Through the use of sodium bisulfite DNA conversion analysis, followed by detection with MSP (methylation specific PCR), we analyzed 79 BC and 15 adjacent healthy samples. T he c ases a nalyzed w ere i n s tage I ( 2.5%), I I (38%), or III (59.5%). The most frequent tumor type was invasive ductal carcinoma (71.4%). Methylation analysis comparing tumor tissues with adjacent non-cancerous tissues showed statistical significance. Methylation was observed in 32.9% (26/79) of the samples; no methylation was found in adjacent healthy tissue. DACT2 methylation was associated with tumor stage I-II (p=0.03) and stage III (p=0.004). An association was found of DACT2 promoter methylation with advanced tumor stages. This gene has been suggested as a potential biomarker, however, more investigation is required to validate this function.
Hossain, Mohammad B; Li, Huiqi; Hedmer, Maria; Tinnerberg, Håkan; Albin, Maria; Broberg, Karin
2015-12-01
Welders are at risk for cardiovascular disease. Recent studies linked tobacco smoke exposure to hypomethylation of the F2RL3 (coagulation factor II (thrombin) receptor-like 3) gene, a marker for cardiovascular disease prognosis and mortality. However, whether welding fumes cause hypomethylation of F2RL3 remains unknown. We investigated 101 welders (median span of working as a welder: 7 years) and 127 unexposed controls (non-welders with no obvious exposure to respirable dust at work), age range 23-60 years, all currently non-smoking, in Sweden. The participants were interviewed about their work history, lifestyle factors and diseases. Personal sampling of respirable dust was performed for the welders. DNA methylation of F2RL3 in blood was assessed by pyrosequencing of four CpG sites, CpG_2 (corresponds to cg03636183) to CpG_5, in F2RL3. Multivariable linear regression analysis was used to assess the association between exposure to welding fumes and F2RL3 methylation. Welders had 2.6% lower methylation of CpG_5 than controls (p<0.001). Higher concentrations of measured respirable dust among the welders were associated with hypomethylation of CpG_2, CpG_4 and CpG_5 (β=-0.49 to -1.4, p<0.012); p<0.029 adjusted for age, previous smoking, passive smoking, education, current residence and respirator use. Increasing the number of years working as a welder was associated with hypomethylation of CpG_4 (linear regression analysis, β=-0.11, p=0.039, adjusted for previous smoking). Previous tobacco smokers had 1.5-4.7% (p<0.014) lower methylation of 3 of the 4 CpG sites in F2RL3 (CpG_2, CpG_4 and CpG_5) compared to never-smokers. A non-significant lower risk of cardiovascular disease with more methylation was observed for all CpG sites. Welding fumes exposure and previous smoking were associated with F2RL3 hypomethylation. This finding links low-to-moderate exposure to welding fumes to adverse effects on the cardiovascular system, and suggests a potential mechanistic pathway for this link, via epigenetic effects on F2RL3 expression. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/
dbCPG: A web resource for cancer predisposition genes
Wei, Ran; Yao, Yao; Yang, Wu; Zheng, Chun-Hou; Zhao, Min; Xia, Junfeng
2016-01-01
Cancer predisposition genes (CPGs) are genes in which inherited mutations confer highly or moderately increased risks of developing cancer. Identification of these genes and understanding the biological mechanisms that underlie them is crucial for the prevention, early diagnosis, and optimized management of cancer. Over the past decades, great efforts have been made to identify CPGs through multiple strategies. However, information on these CPGs and their molecular functions is scattered. To address this issue and provide a comprehensive resource for researchers, we developed the Cancer Predisposition Gene Database (dbCPG, Database URL: http://bioinfo.ahu.edu.cn:8080/dbCPG/index.jsp), the first literature-based gene resource for exploring human CPGs. It contains 827 human (724 protein-coding, 23 non-coding, and 80 unknown type genes), 637 rats, and 658 mouse CPGs. Furthermore, data mining was performed to gain insights into the understanding of the CPGs data, including functional annotation, gene prioritization, network analysis of prioritized genes and overlap analysis across multiple cancer types. A user-friendly web interface with multiple browse, search, and upload functions was also developed to facilitate access to the latest information on CPGs. Taken together, the dbCPG database provides a comprehensive data resource for further studies of cancer predisposition genes. PMID:27192119
van Doorn, Remco; Zoutman, Willem H; Dijkman, Remco; de Menezes, Renee X; Commandeur, Suzan; Mulder, Aat A; van der Velden, Pieter A; Vermeer, Maarten H; Willemze, Rein; Yan, Pearlly S; Huang, Tim H; Tensen, Cornelis P
2005-06-10
To analyze the occurrence of promoter hypermethylation in primary cutaneous T-cell lymphoma (CTCL) on a genome-wide scale, focusing on epigenetic alterations with pathogenetic significance. DNA isolated from biopsy specimens of 28 patients with CTCL, including aggressive CTCL entities (transformed mycosis fungoides and CD30-negative large T-cell lymphoma) and an indolent entity (CD30-positive large T-cell lymphoma), were investigated. For genome-wide DNA methylation screening, differential methylation hybridization using CpG island microarrays was applied, which allows simultaneous detection of the methylation status of 8640 CpG islands. Bisulfite sequence analysis was applied for confirmation and detection of hypermethylation of eight selected tumor suppressor genes. The DNA methylation patterns of CTCLs emerging from differential methylation hybridization analysis included 35 CpG islands hypermethylated in at least four of the 28 studied CTCL samples when compared with benign T-cell samples. Hypermethylation of the putative tumor suppressor genes BCL7a (in 48% of CTCL samples), PTPRG (27%), and thrombospondin 4 (52%) was confirmed and demonstrated to be associated with transcriptional downregulation. BCL7a was hypermethylated at a higher frequency in aggressive (64%) than in indolent (14%) CTCL entities. In addition, the promoters of the selected tumor suppressor genes p73 (48%), p16 (33%), CHFR (19%), p15 (10%), and TMS1 (10%) were hypermethylated in CTCL. Malignant T cells of patients with CTCL display widespread promoter hypermethylation associated with inactivation of several tumor suppressor genes involved in DNA repair, cell cycle, and apoptosis signaling pathways. In view of this, CTCL may be amenable to treatment with demethylating agents.
VEZF1 Elements Mediate Protection from DNA Methylation
Strogantsev, Ruslan; Gaszner, Miklos; Hair, Alan; Felsenfeld, Gary; West, Adam G.
2010-01-01
There is growing consensus that genome organization and long-range gene regulation involves partitioning of the genome into domains of distinct epigenetic chromatin states. Chromatin insulator or barrier elements are key components of these processes as they can establish boundaries between chromatin states. The ability of elements such as the paradigm β-globin HS4 insulator to block the range of enhancers or the spread of repressive histone modifications is well established. Here we have addressed the hypothesis that a barrier element in vertebrates should be capable of defending a gene from silencing by DNA methylation. Using an established stable reporter gene system, we find that HS4 acts specifically to protect a gene promoter from de novo DNA methylation. Notably, protection from methylation can occur in the absence of histone acetylation or transcription. There is a division of labor at HS4; the sequences that mediate protection from methylation are separable from those that mediate CTCF-dependent enhancer blocking and USF-dependent histone modification recruitment. The zinc finger protein VEZF1 was purified as the factor that specifically interacts with the methylation protection elements. VEZF1 is a candidate CpG island protection factor as the G-rich sequences bound by VEZF1 are frequently found at CpG island promoters. Indeed, we show that VEZF1 elements are sufficient to mediate demethylation and protection of the APRT CpG island promoter from DNA methylation. We propose that many barrier elements in vertebrates will prevent DNA methylation in addition to blocking the propagation of repressive histone modifications, as either process is sufficient to direct the establishment of an epigenetically stable silent chromatin state. PMID:20062523
Association between folate levels and CpG island hypermethylation in normal colorectal mucosa
Wallace, Kristin; Grau, Maria V.; Levine, Joan A.; Shen, Lanlan; Hamdan, Randala; Chen, Xinli; Gui, Jiang; Haile, Robert W.; Barry, Elizabeth L.; Ahnen, Dennis; McKeown-Eyssen, Gail; Baron, John A.; Issa, Jean Pierre J.
2010-01-01
Background Gene-specific promoter methylation of several genes occurs in aging normal tissues and may predispose to tumorigenesis. In the present study, we investigate the association among blood folate levels, and dietary and lifestyle factors with CpG island methylation in normal colorectal mucosa. Methods Subjects were enrolled in a multi-center chemoprevention trial of aspirin or folic acid for the prevention of large bowel adenomas. We collected 1000 biopsies from 389 patients, 501 samples from the right colon and 499 from the rectum at the follow-up colonoscopy. We measured DNA methylation of estrogen receptor alpha (ERα) and secreted frizzled related protein-1 (SFRP1) using bisulfite pyrosequencing. We used Generalized Estimating Equations regression analysis to examine the association between methylation and selected variables. Results For both ERα and SFRP1, percent methylation was significantly higher in the rectum compared to the right colon (p = 0.001). For each 10 years of age, we observed a 1.7 % increase in methylation level for ERα and a 2.9 % increase for SFRP1 (P < 0.0001). African Americans had a significantly lower level of ERα and SFRP1 methylation compared to Caucasians and Hispanics. Higher RBC folate levels were associated with higher levels of both ERα (p=0.03) and SFRP1 methylation (p=0.01). Conclusions Our results suggest that CpG island methylation in normal colorectal mucosa is related to advancing age, race, rectal location, and RBC folate levels. These data have important implications regarding the safety of supplementary folate administration in healthy adults given the hypothesis that methylation in normal mucosa may predispose to colorectal neoplasia. PMID:21149331
Curtin, Karen; Slattery, Martha L.; Ulrich, Cornelia M.; Bigler, Jeannette; Levin, Theodore R.; Wolff, Roger K.; Albertsen, Hans; Potter, John D.; Samowitz, Wade S.
2008-01-01
This study investigated associations between CpG island methylator phenotype (CIMP) colon cancer and genetic polymorphisms relevant to one-carbon metabolism and thus, potentially the provision of methyl groups and risk of colon cancer. Data from a large, population-based case–control study (916 incident colon cancer cases and 1972 matched controls) were used. Candidate polymorphisms in methylenetetrahydrofolate reductase (MTHFR), thymidylate synthase (TS), transcobalamin II (TCNII), methionine synthase (MTR), reduced folate carrier (RFC), methylene-tetrahydrofolate dehydrogenase 1 (MTHFD1), dihydrofolate reductase (DHFR) and alcohol dehydrogenase 3 (ADH3) were evaluated. CIMP− or CIMP+ phenotype was based on five CpG island markers: MINT1, MINT2, MINT31, p16 and MLH1. The influence of specific dietary factors (folate, methionine, vitamin B12 and alcohol) on these associations was also analyzed. We hypothesized that polymorphisms involved in the provision of methyl groups would be associated with CIMP+ tumors (two or more of five markers methylated), potentially modified by diet. Few associations specific to CIMP+ tumors were observed overall, which does not support the hypothesis that the provision of methyl groups is important in defining a methylator phenotype. However, our data suggest that genetic polymorphisms in MTHFR 1298A > C, interacting with diet, may be involved in the development of highly CpG-methylated colon cancers. AC and CC genotypes in conjunction with a high-risk dietary pattern (low folate and methionine intake and high alcohol use) were associated with CIMP+ (OR = 2.1, 95% CI = 1.3–3.4 versus AA/high risk; P-interaction = 0.03). These results provide only limited support for a role of polymorphisms in one-carbon metabolism in the etiology of CIMP colon cancer. PMID:17449906
Jia, Min; Jansen, Lina; Walter, Viola; Tagscherer, Katrin; Roth, Wilfried; Herpel, Esther; Kloor, Matthias; Bläker, Hendrik; Chang-Claude, Jenny; Brenner, Hermann; Hoffmeister, Michael
2016-11-22
Previous studies have shown adverse effects of CpG island methylator phenotype (CIMP) on colorectal cancer (CRC) prognosis. However, sample sizes were often limited and only few studies were able to adjust for relevant molecular features associated with CIMP. The aim of this study was to investigate the impact of CIMP on CRC survival in a large population-based study with comprehensive adjustment. The CIMP status and other molecular tumour features were analysed in 1385 CRC patients diagnosed between 2003 and 2010. Detailed information were obtained from standardised personal interviews and medical records. During follow-up (median: 4.9 years), we assessed vital status, cause of death and therapy details. Cox proportional hazard regression models were used to estimate adjusted hazard ratios (HRs) and 95% confidence intervals (CIs) of survival after CRC. The CIMP-H occurred more frequently in patients with older age, female gender, cancer in the proximal colon, BRAF mutation and microsatellite instability-high (MSI-H). However, CIMP status was not associated with CRC prognosis in CRC patients (HR=1.00; 95% CI=0.72-1.40 for overall survival; HR=0.96; 95% CI=0.65-1.41 for disease-specific survival) or in any of the subgroups. Although CIMP status was associated with the presence of MSI-H and BRAF mutation, the prognostic effects of MSI-H (HR=0.49; 95% CI=0.27-0.90) and BRAF mutation (HR=1.78; 95% CI=1.10-2.84) were independent of CIMP status. Similar benefit of chemotherapy was found for CRC outcomes in both the CIMP-low/negative group and the CIMP-high group. CpG island methylator phenotype was not associated with CRC prognosis after adjusting for other important clinical factors and associated mutations.
Koh, Young Wha; Chun, Sung-Min; Park, Young-Soo; Song, Joon Seon; Lee, Geon Kook; Khang, Shin Kwang; Jang, Se Jin
2016-08-01
Aberrant methylation of promoter CpG islands is one of the most important inactivation mechanisms for tumor suppressor and tumor-related genes. Previous studies using genome-wide DNA methylation microarray analysis have suggested the existence of a CpG island methylator phenotype (CIMP) in lung adenocarcinomas. Although the biological behavior of these tumors varies according to tumor stage, no large-scale study has examined the CIMP in lung adenocarcinoma patients according to tumor stage. Furthermore, there have been no reported results regarding the clinical significance of each of the six CIMP markers. To examine the CIMP in patients with pulmonary adenocarcinoma after a surgical resection, we performed methylation analysis of six genes (CCNA1, ACAN, GFRA1, EDARADD, MGC45800, and p16 (INK4A)) in 230 pulmonary adenocarcinoma cases using the SEQUENOM MassARRAY platform. Fifty-four patients (28 %, 54/191) were in the CIMP-high (CIMP-H) group associated with high nodal stage (P = 0.007), the presence of micropapillary or solid histology (P = 0.003), and the absence of an epidermal growth factor receptor (EGFR) mutation (P = 0.002). By multivariate analysis, CIMP was an independent prognostic marker for overall survival (OS) and disease-specific survival (P = 0.03 and P = 0.43, respectively). In the stage I subgroups alone, CIMP-H patients had lower OS rates than the CIMP-low (CIMP-L) group (P = 0.041). Of the six CIMP markers, ACAN alone was significantly associated with patient survival. CIMP predicted the risk of progression independently of clinicopathological variables and enables the stratification of pulmonary adenocarcinoma patients, particularly among stage I cases.
Curtin, Karen; Slattery, Martha L; Ulrich, Cornelia M; Bigler, Jeannette; Levin, Theodore R; Wolff, Roger K; Albertsen, Hans; Potter, John D; Samowitz, Wade S
2007-08-01
This study investigated associations between CpG island methylator phenotype (CIMP) colon cancer and genetic polymorphisms relevant to one-carbon metabolism and thus, potentially the provision of methyl groups and risk of colon cancer. Data from a large, population-based case-control study (916 incident colon cancer cases and 1,972 matched controls) were used. Candidate polymorphisms in methylenetetrahydrofolate reductase (MTHFR), thymidylate synthase (TS), transcobalamin II (TCNII), methionine synthase (MTR), reduced folate carrier (RFC), methylenetetrahydrofolate dehydrogenase 1 (MTHFD1), dihydrofolate reductase (DHFR) and alcohol dehydrogenase 3 (ADH3) were evaluated. CIMP- or CIMP+ phenotype was based on five CpG island markers: MINT1, MINT2, MINT31, p16 and MLH1. The influence of specific dietary factors (folate, methionine, vitamin B(12) and alcohol) on these associations was also analyzed. We hypothesized that polymorphisms involved in the provision of methyl groups would be associated with CIMP+ tumors (two or more of five markers methylated), potentially modified by diet. Few associations specific to CIMP+ tumors were observed overall, which does not support the hypothesis that the provision of methyl groups is important in defining a methylator phenotype. However, our data suggest that genetic polymorphisms in MTHFR 1,298A > C, interacting with diet, may be involved in the development of highly CpG-methylated colon cancers. AC and CC genotypes in conjunction with a high-risk dietary pattern (low folate and methionine intake and high alcohol use) were associated with CIMP+ (OR = 2.1, 95% CI = 1.3-3.4 versus AA/high risk; P-interaction = 0.03). These results provide only limited support for a role of polymorphisms in one-carbon metabolism in the etiology of CIMP colon cancer.
Genetics and epigenetics of small bowel adenocarcinoma: the interactions of CIN, MSI, and CIMP.
Warth, Arne; Kloor, Matthias; Schirmacher, Peter; Bläker, Hendrik
2011-04-01
Characterization of tumor genetics and epigenetics allows to stratify a tumor entity according to molecular pathways and may shed light on the interactions of different types of DNA alterations during tumorigenesis. Small intestinal adenocarcinoma is rare, and to date the interrelation of genomic instability and epigenetics has not been investigated in this tumor type. We therefore analyzed 37 primary small bowel carcinomas with known microsatellite instability and KRAS status for chromosomal instability using comparative genomic hybridization, for the presence of aberrant methylation (CpG island methylation phenotype) by methylation-specific polymerase chain reaction, and for BRAF mutations. Chromosomal instability was detected in 22 of 37 (59%) tumors (3 of 9 microsatellite instable, and 19 of 28 microsatellite stable carcinomas). Nine carcinomas (24%) were microsatellite and chromosomally stable. High-level DNA methylation was found in 16% of chromosomal instable tumors and in 44% of both microsatellite instable and microsatellite and chromosomally stable carcinomas. KRAS was mutated in 55, 0, and 10% of chromosomal instable, microsatellite instable, and microsatellite and chromosomally stable tumors, respectively whereas the frequencies of BRAF mutations were 6% for chromosomal instable and 22% for both microsatellite instable and microsatellite and chromosomally stable carcinomas. In conclusion, in this study we show that chromosomal instable carcinomas of the small intestine are distinguished from microsatellite instable and microsatellite and chromosomally stable tumors by a high frequency of KRAS mutations, low frequencies of CpG island methylation phenotype, and BRAF mutations. In microsatellite instable and microsatellite and chromosomally stable cancers, CpG island methylation phenotype and BRAF/KRAS mutations are similarly distributed, indicating common mechanisms of tumor initiation or progression in their molecular pathogenesis.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lee, Jong Cheol; Department of Biomedical Research Center, Ulsan University Hospital, University of Ulsan College of Medicine, Ulsan; Lee, Won Hyeok
2014-04-01
Purpose: There are limited therapeutic options for patients with recurrent head and neck cancer after radiation therapy failure. To assess the use of tumor necrosis factor–related apoptosis-inducing ligand (TRAIL) as a salvage chemotherapeutic agent for recurrent cancer after radiation failure, we investigated the effect of clinically relevant cumulative irradiation on TRAIL-induced apoptosis. Methods and Materials: Using a previously established HN3 cell line from a laryngeal carcinoma patient, we generated a chronically irradiated HN3R isogenic cell line. Viability and apoptosis in HN3 and HN3R cells treated with TRAIL were analyzed with MTS and PI/annexin V-FITC assays. Western blotting and flow cytometry weremore » used to determine the underlying mechanism of TRAIL resistance. DR4 expression was semiquantitatively scored in a tissue microarray with 107 laryngeal cancer specimens. Methylation-specific polymerase chain reaction and bisulfite sequencing for DR4 were performed for genomic DNA isolated from each cell line. Results: HN3R cells were more resistant than HN3 cells to TRAIL-induced apoptosis because of significantly reduced levels of the DR4 receptor. The DR4 staining score in 37 salvage surgical specimens after radiation failure was lower in 70 surgical specimens without radiation treatment (3.03 ± 2.75 vs 5.46 ± 3.30, respectively; P<.001). HN3R cells had a methylated DR4 CpG island that was partially demethylated by the DNA demethylating agent 5-aza-2′-deoxycytidine. Conclusion: Epigenetic silencing of the TRAIL receptor by hypermethylation of a DR4 CpG island might be an underlying mechanism for TRAIL resistance in recurrent laryngeal carcinoma treated with radiation.« less
Kawaguchi, Koichiro; Kinameri, Ayumi; Suzuki, Shunsuke; Senga, Shogo; Ke, Youqiang; Fujii, Hiroshi
2016-02-15
FABPs (fatty-acid-binding proteins) are a family of low-molecular-mass intracellular lipid-binding proteins consisting of ten isoforms. FABPs are involved in binding and storing hydrophobic ligands such as long-chain fatty acids, as well as transporting these ligands to the appropriate compartments in the cell. FABP5 is overexpressed in multiple types of tumours. Furthermore, up-regulation of FABP5 is strongly associated with poor survival in triple-negative breast cancer. However, the mechanisms underlying the specific up-regulation of the FABP5 gene in these cancers remain poorly characterized. In the present study, we determined that FABP5 has a typical CpG island around its promoter region. The DNA methylation status of the CpG island in the FABP5 promoter of benign prostate cells (PNT2), prostate cancer cells (PC-3, DU-145, 22Rv1 and LNCaP) and human normal or tumour tissue was assessed by bisulfite sequencing analysis, and then confirmed by COBRA (combined bisulfite restriction analysis) and qAMP (quantitative analysis of DNA methylation using real-time PCR). These results demonstrated that overexpression of FABP5 in prostate cancer cells can be attributed to hypomethylation of the CpG island in its promoter region, along with up-regulation of the direct trans-acting factors Sp1 (specificity protein 1) and c-Myc. Together, these mechanisms result in the transcriptional activation of FABP5 expression during human prostate carcinogenesis. Importantly, silencing of Sp1, c-Myc or FABP5 expression led to a significant decrease in cell proliferation, indicating that up-regulation of FABP5 expression by Sp1 and c-Myc is critical for the proliferation of prostate cancer cells. © 2016 Authors; published by Portland Press Limited.
Han, Lin; Wu, Hua-Jun; Zhu, Haiying; Kim, Kun-Yong; Marjani, Sadie L; Riester, Markus; Euskirchen, Ghia; Zi, Xiaoyuan; Yang, Jennifer; Han, Jasper; Snyder, Michael; Park, In-Hyun; Irizarry, Rafael; Weissman, Sherman M; Michor, Franziska; Fan, Rong; Pan, Xinghua
2017-06-02
Conventional DNA bisulfite sequencing has been extended to single cell level, but the coverage consistency is insufficient for parallel comparison. Here we report a novel method for genome-wide CpG island (CGI) methylation sequencing for single cells (scCGI-seq), combining methylation-sensitive restriction enzyme digestion and multiple displacement amplification for selective detection of methylated CGIs. We applied this method to analyzing single cells from two types of hematopoietic cells, K562 and GM12878 and small populations of fibroblasts and induced pluripotent stem cells. The method detected 21 798 CGIs (76% of all CGIs) per cell, and the number of CGIs consistently detected from all 16 profiled single cells was 20 864 (72.7%), with 12 961 promoters covered. This coverage represents a substantial improvement over results obtained using single cell reduced representation bisulfite sequencing, with a 66-fold increase in the fraction of consistently profiled CGIs across individual cells. Single cells of the same type were more similar to each other than to other types, but also displayed epigenetic heterogeneity. The method was further validated by comparing the CpG methylation pattern, methylation profile of CGIs/promoters and repeat regions and 41 classes of known regulatory markers to the ENCODE data. Although not every minor methylation differences between cells are detectable, scCGI-seq provides a solid tool for unsupervised stratification of a heterogeneous cell population. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Marasco, Emiliano; Farroni, Chiara; Cascioli, Simona; Marcellini, Valentina; Scarsella, Marco; Giorda, Ezio; Piano Mortari, Eva; Leonardi, Lucia; Scarselli, Alessia; Valentini, Diletta; Cancrini, Caterina; Duse, Marzia; Grimsholm, Ola; Carsetti, Rita
2017-01-01
Around 65% of primary immunodeficiencies are antibody deficiencies. Functional tests are useful tools to study B-cell functions in vitro. However, no accepted guidelines for performing and evaluating functional tests have been issued yet. Here, we report our experience on the study of B-cell functions in infancy and throughout childhood. We show that T-independent stimulation with CpG measures proliferation and differentiation potential of memory B cells. Switched memory B cells respond better than IgM memory B cells. On the other hand, CD40L, a T-dependent stimulus, does not induce plasma cell differentiation, but causes proliferation of naïve and memory B cells. During childhood, the production of plasmablasts in response to CpG increases with age mirroring the development of memory B cells. The response to CD40L does not change with age. In patients with selective IgA deficiency (SIgAD), we observed that switched memory B cells are reduced due to the absence of IgA memory B cells. In agreement, IgA plasma cells are not generated in response to CpG. Unexpectedly, B cells from SIgAD patients show a reduced proliferative response to CD40L. Our results demonstrate that functional tests are an important tool to assess the functions of the humoral immune system. © 2016 The Authors. European Journal of Immunology published by WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
A CpG Oligonucleotide Can Protect Mice from a Low Aerosol Challenge Dose of Burkholderia mallei
Waag, David M.; McCluskie, Michael J.; Zhang, Ningli; Krieg, Arthur M.
2006-01-01
Treatment with an oligodeoxynucleotide (ODN) containing CPG motifs (CpG ODN 7909) was found to protect BALB/c mice from lung infection or death after aerosol challenge with Burkholderia mallei. Protection was associated with enhanced levels of gamma interferon (IFN-γ)-inducible protein 10, interleukin-12 (IL-12), IFN-γ, and IL-6. Preexposure therapy with CpG ODNs may protect victims of a biological attack from glanders. PMID:16495571
A CpG oligonucleotide can protect mice from a low aerosol challenge dose of Burkholderia mallei.
Waag, David M; McCluskie, Michael J; Zhang, Ningli; Krieg, Arthur M
2006-03-01
Treatment with an oligodeoxynucleotide (ODN) containing CPG motifs (CpG ODN 7909) was found to protect BALB/c mice from lung infection or death after aerosol challenge with Burkholderia mallei. Protection was associated with enhanced levels of gamma interferon (IFN-gamma)-inducible protein 10, interleukin-12 (IL-12), IFN-gamma, and IL-6. Preexposure therapy with CpG ODNs may protect victims of a biological attack from glanders.
Echlin, Paul S; Upshur, Ross E G; Markova, Tsveti P
2004-07-05
The literature demonstrates that medical residents and practicing physicians have an attitudinal-behavioral discordance concerning their positive attitudes towards clinical practice guidelines (CPG), and the implementation of these guidelines into clinical practice patterns. A pilot study was performed to determine if change in a previously identified CPG compliance factor (accessibility) would produce a significant increase in family medicine resident knowledge and attitude toward the guidelines. The primary study intervention involved placing a summary of the Sixth Report of the Joint National Committee on Prevention, Detection, Evaluation, and Treatment of High Blood Pressure (JNC VI) and the National Cholesterol Education Program Expert Panel on Detection, Evaluation, and Treatment of High Blood Cholesterol in Adults (NCEP III) CPGs in all patient (>18 yr.) charts for a period of three months. The JNC VI and NCEP III CPGs were also distributed to each Wayne State family medicine resident, and a copy of each CPG was placed in the preceptor's area of the involved clinics. Identical pre- and post- intervention questionnaires were administered to all residents concerning CPG knowledge and attitude. Post-intervention analysis failed to demonstrate a significant difference in CPG knowledge. A statistically significant post-intervention difference was found in only on attitude question. The barriers to CPG compliance were identified as 1) lack of CPG instruction; 2) lack of critical appraisal ability; 3) insufficient time; 4) lack of CPG accessibility; and 5) lack of faculty modeling. This study demonstrated no significant post intervention changes in CPG knowledge, and only one question that reflected attitude change. Wider resident access to dedicated clinic time, increased faculty modeling, and the implementation of an electronic record/reminder system that uses a team-based approach are compliance factors that should be considered for further investigation. The interpretation of CPG non-compliance will benefit from a causal matrix focused on physician knowledge, attitudes, and behavior. Recent findings in resident knowledge-behavior discordance may direct the future investigation of physician CPG non-compliance away from generalized barrier research, and toward the development of information that maximizes the sense of individual practitioner urgency and certainty.
McInnes, Tyler; Zou, Donghui; Rao, Dasari S; Munro, Francesca M; Phillips, Vicky L; McCall, John L; Black, Michael A; Reeve, Anthony E; Guilford, Parry J
2017-03-28
Aberrant DNA methylation profiles are a characteristic of all known cancer types, epitomized by the CpG island methylator phenotype (CIMP) in colorectal cancer (CRC). Hypermethylation has been observed at CpG islands throughout the genome, but it is unclear which factors determine whether an individual island becomes methylated in cancer. DNA methylation in CRC was analysed using the Illumina HumanMethylation450K array. Differentially methylated loci were identified using Significance Analysis of Microarrays (SAM) and the Wilcoxon Signed Rank (WSR) test. Unsupervised hierarchical clustering was used to identify methylation subtypes in CRC. In this study we characterized the DNA methylation profiles of 94 CRC tissues and their matched normal counterparts. Consistent with previous studies, unsupervized hierarchical clustering of genome-wide methylation data identified three subtypes within the tumour samples, designated CIMP-H, CIMP-L and CIMP-N, that showed high, low and very low methylation levels, respectively. Differential methylation between normal and tumour samples was analysed at the individual CpG level, and at the gene level. The distribution of hypermethylation in CIMP-N tumours showed high inter-tumour variability and appeared to be highly stochastic in nature, whereas CIMP-H tumours exhibited consistent hypermethylation at a subset of genes, in addition to a highly variable background of hypermethylated genes. EYA4, TFPI2 and TLX1 were hypermethylated in more than 90% of all tumours examined. One-hundred thirty-two genes were hypermethylated in 100% of CIMP-H tumours studied and these were highly enriched for functions relating to skeletal system development (Bonferroni adjusted p value =2.88E-15), segment specification (adjusted p value =9.62E-11), embryonic development (adjusted p value =1.52E-04), mesoderm development (adjusted p value =1.14E-20), and ectoderm development (adjusted p value =7.94E-16). Our genome-wide characterization of DNA methylation in colorectal cancer has identified 132 genes hypermethylated in 100% of CIMP-H samples. Three genes, EYA4, TLX1 and TFPI2 are hypermethylated in >90% of all tumour samples, regardless of CIMP subtype.
Cimino, Silvia; Cerniglia, Luca; Ballarotto, Giulia; Marzilli, Eleonora; Pascale, Esterina; D'Addario, Claudio; Adriani, Walter; Tambelli, Renata
2017-01-01
The effect of gene polymorphisms and promoter methylation, associated with maladaptive developmental outcomes, vary depending on environmental factors (e.g., parental psychopathology). Most studies have focused on 0- to 5-year-old children, adolescents, or adults, whereas there is dearth of research on school-age youths and pre-adolescents. In a sample of 21 families recruited at schools, we addressed parents' psychopathological symptoms (through SCL-90-R); offspring emotional-behavioral functioning (through CBCL-6-18); dopamine transporter gene (DAT1) for epigenetic status of the 5'-untranslated region (UTR) and for genotype, i.e., variable number of tandem repeats polymorphism at the 3'-UTR. Possible associations were explored between bio-genetic and psychological characteristics within the same individual and between triplets of children, mothers, and fathers. DAT methylation of CpG at positions M1, M6, and M7 in mothers was correlated with maternal (phobic) anxiety, whereas in fathers' position M6 was related to paternal depression, anxiety, hostility, psychoticism, and higher Global Severity Index (GSI). No significant correlations were found between maternal and offspring DAT methylation. Significant correlations were found between fathers' methylation at CpG M1 and children's methylation at CpG M6. Linear regressions showed that mothers and fathers' GSI predicted children's methylation at CpG sites M2, M3, and M6, whereas fathers' GSI predicted children's methylation at CpG sites, particularly M1, M2, and M6. Moreover, offspring methylation of DAT at CpG M2 predicted somatic complaint, internalizing and attention problems; methylation of DAT at CpG M6 predicted withdraw. This study may have important clinical implication for the prevention and treatment of emotional-behavioral difficulties in children, as it adds to previous knowledge about the role of genetic and environmental factors in predicting psychopathological symptoms within non-clinical populations.
Chu, Pinpin; Ma, Miaopeng; Shi, Juqing; Cai, Haiming; Huang, Chaoyuan; Li, Huazhou; Jiang, Zhenggu; Wang, Houguang; Wang, Weifang; Zhang, Shuiqing; Zhang, Linghua
2013-01-01
Background and Aims Attempts to immunize aged subjects often result in the failure to elicit a protective immune response. Murine model studies have shown that oligonucleotides containing CpG motifs (CpG ODN) can stimulate immune system in aged mice as effectively as in young mice. Since many physiological and pathophysiological data of pigs can be transferred to humans, research in pigs is important to confirm murine data. Here we investigated whether immunization of aged pig model with attenuated pseudorabies virus vaccine (PRV vaccine) formulated with CpG ODN could promote a successful development of immune responses that were comparable to those induced in young pigs in a similar manner. Methodology Young and aged pigs were immunized IM with PRV vaccine alone, or in combination with CpG ODN respectively. At days 3, 7, 14 post immunization sera were assayed by ELISA for IgG titres, at day 7 for IgG1 and IgG2 subtypes titres. All blood samples collected in evacuated test tubes with K-EDTA at day 7 were analyzed for flow cytometer assay. Blood samples at day 7 collected in evacuated test tubes with heparin were analysed for antigen-specific cytokines production and peripheral blood mononuclear cells (PBMCs) proliferative responses. Results CpG ODN could enhance Th1 responses (PRV-specific IgG2/IgG1 ratio, proliferative responses, Th1 cytokines production) when used as an adjuvant for the vaccination of aged pigs, which were correlated with enhanced CD4+ T cells percentage, decreased CD4+CD8+CD45RO+ T cells percentage and improved PRV-specific CD4+ T cells activation. Conclusions Our results demonstrate a utility for CpG ODN, as a safe vaccine adjuvant for promoting effective systemic immune responses in aged pig model. This agent could have important clinical uses in overcoming some of age-associated depressions in immune function that occur in response to vaccination. PMID:23785433
Superior diastolic function with KATP channel opener diazoxide in a novel mouse Langendorff model.
Makepeace, Carol M; Suarez-Pierre, Alejandro; Kanter, Evelyn M; Schuessler, Richard B; Nichols, Colin G; Lawton, Jennifer S
2018-07-01
Adenosine triphosphate-sensitive potassium (K ATP ) channel openers have been found to be cardioprotective in multiple animal models via an unknown mechanism. Mouse models allow genetic manipulation of K ATP channel components for the investigation of this mechanism. Mouse Langendorff models using 30 min of global ischemia are known to induce measurable myocardial infarction and injury. Prolongation of global ischemia in a mouse Langendorff model could allow the determination of the mechanisms involved in K ATP channel opener cardioprotection. Mouse hearts (C57BL/6) underwent baseline perfusion with Krebs-Henseleit buffer (30 min), assessment of function using a left ventricular balloon, delivery of test solution, and prolonged global ischemia (90 min). Hearts underwent reperfusion (30 min) and functional assessment. Coronary flow was measured using an inline probe. Test solutions included were as follows: hyperkalemic cardioplegia alone (CPG, n = 11) or with diazoxide (CPG + DZX, n = 12). Although the CPG + DZX group had greater percent recovery of developed pressure and coronary flow, this was not statistically significant. Following a mean of 74 min (CPG) and 77 min (CPG + DZX), an additional increase in end-diastolic pressure was noted (plateau), which was significantly higher in the CPG group. Similarly, the end-diastolic pressure (at reperfusion and at the end of experiment) was significantly higher in the CPG group. Prolongation of global ischemia demonstrated added benefit when DZX was added to traditional hyperkalemic CPG. This model will allow the investigation of DZX mechanism of cardioprotection following manipulation of targeted K ATP channel components. This model will also allow translation to prolonged ischemic episodes associated with cardiac surgery. Copyright © 2018 Elsevier Inc. All rights reserved.
PCFT/SLC46A1 promoter methylation and restoration of gene expression in human leukemia cells
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gonen, Nitzan; Bram, Eran E.; Assaraf, Yehuda G.
2008-11-28
The proton-coupled folate transporter (PCFT/SLC46A1) displays optimal and prominent folate and antifolate transport activity at acidic pH in human carcinoma cells but poor activity in leukemia cells. Consistently herein, human leukemia cell lines expressed poor PCFT transcript levels, whereas various carcinoma cell lines showed substantial PCFT gene expression. We identified a CpG island with high density at nucleotides -200 through +100 and explored its role in PCFT promoter silencing. Leukemia cells with barely detectable PCFT transcripts consistently harbored 85-100% methylation of this CpG island, whereas no methylation was found in carcinoma cells. Treatment with 5-Aza-2'-deoxycytidine which induced demethylation but notmore » with the histone deacetylase inhibitor trichostatin A, restored 50-fold PCFT expression only in leukemia cells. These findings constitute the first demonstration of the dominant epigenetic silencing of the PCFT gene in leukemia cells. The potential translational implications of the restoration of PCFT expression in chemotherapy of leukemia are discussed.« less
MethPrimer: designing primers for methylation PCRs.
Li, Long-Cheng; Dahiya, Rajvir
2002-11-01
DNA methylation is an epigenetic mechanism of gene regulation. Bisulfite- conversion-based PCR methods, such as bisulfite sequencing PCR (BSP) and methylation specific PCR (MSP), remain the most commonly used techniques for methylation mapping. Existing primer design programs developed for standard PCR cannot handle primer design for bisulfite-conversion-based PCRs due to changes in DNA sequence context caused by bisulfite treatment and many special constraints both on the primers and the region to be amplified for such experiments. Therefore, the present study was designed to develop a program for such applications. MethPrimer, based on Primer 3, is a program for designing PCR primers for methylation mapping. It first takes a DNA sequence as its input and searches the sequence for potential CpG islands. Primers are then picked around the predicted CpG islands or around regions specified by users. MethPrimer can design primers for BSP and MSP. Results of primer selection are delivered through a web browser in text and in graphic view.
Moarii, Matahi; Reyal, Fabien; Vert, Jean-Philippe
2015-10-13
The CpG island methylator phenotype (CIMP) was first characterized in colorectal cancer but since has been extensively studied in several other tumor types such as breast, bladder, lung, and gastric. CIMP is of clinical importance as it has been reported to be associated with prognosis or response to treatment. However, the identification of a universal molecular basis to define CIMP across tumors has remained elusive. We perform a genome-wide methylation analysis of over 2000 tumor samples from 5 cancer sites to assess the existence of a CIMP with common molecular basis across cancers. We then show that the CIMP phenotype is associated with specific gene expression variations. However, we do not find a common genetic signature in all tissues associated with CIMP. Our results suggest the existence of a universal epigenetic and transcriptomic signature that defines the CIMP across several tumor types but does not indicate the existence of a common genetic signature of CIMP.
Polycomb Responds to Low Levels of Transcription.
Berrozpe, Georgina; Bryant, Gene O; Warpinski, Katherine; Spagna, Dan; Narayan, Santosh; Shah, Shivangi; Ptashne, Mark
2017-07-25
How is Polycomb (Pc), a eukaryotic negative regulator of transcription, targeted to specific mammalian genes? Our genome-wide analysis of the Pc mark H3K27me3 in murine cells revealed that Pc is preferentially associated with CpG island promoters of genes that are transcribed at a low level and less so with promoters of genes that are either silent or more highly expressed. Studies of the CpG island promoter of the Kit gene demonstrate that Pc is largely absent when the gene is silent in myeloid cells, as well as when the gene is highly expressed in mast cells. Manipulations that increase transcription in the former case, and reduce it in the latter, increase Pc occupancy. The average negative effect of Pc, we infer, is about 2-fold. We suggest possible biological roles for such negative effects and propose a mechanism by which Pc might be recruited to weakly transcribed genes. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.
Regulation of a mammalian gene bearing a CpG island promoter and a distal enhancer.
Berrozpe, Georgina; Bryant, Gene O; Warpinski, Katherine; Ptashne, Mark
2013-08-15
A quantitative nucleosome occupancy assay revealed rules for nucleosome disposition in yeast and showed how disposition affects regulation of the GAL genes. Here, we show how those findings apply to the control of Kit, a mammalian gene. The Kit promoter lies in a CpG island, and its enhancer (active in mast cells) lies some 150 kb upstream. Nucleosomes form with especially high avidities at the Kit promoter, a reaction that, we surmise, ensures extremely low basal expression. In mast cells, transcriptional activators displace nucleosomes that are less tightly formed at the Kit enhancer. In turn, the active enhancer replaces a single Kit promoter nucleosome with the transcriptional machinery, thereby inducing transcription over 1,000-fold. As at the yeast GAL genes, the inhibitory effects of nucleosomes facilitate high factors of induction by mammalian activators working in the absence of specific repressors. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.
Clinical practice guideline for Sjögren's syndrome 2017.
Sumida, Takayuki; Azuma, Naoto; Moriyama, Masafumi; Takahashi, Hiroyuki; Asashima, Hiromitsu; Honda, Fumika; Abe, Saori; Ono, Yuko; Hirota, Tomoya; Hirata, Shintaro; Tanaka, Yoshiya; Shimizu, Toshimasa; Nakamura, Hideki; Kawakami, Atsushi; Sano, Hajime; Ogawa, Yoko; Tsubota, Kazuo; Ryo, Koufuchi; Saito, Ichiro; Tanaka, Akihiko; Nakamura, Seiji; Takamura, Etsuko; Tanaka, Masao; Suzuki, Katsuya; Takeuchi, Tsutomu; Yamakawa, Noriyuki; Mimori, Tsuneyo; Ohta, Akiko; Nishiyama, Susumu; Yoshihara, Toshio; Suzuki, Yasunori; Kawano, Mitsuhiro; Tomiita, Minako; Tsuboi, Hiroto
2018-05-01
The objective of this study is to develop clinical practice guideline (CPG) for Sjögren's syndrome (SS) based on recently available clinical and therapeutic evidences. The CPG committee for SS was organized by the Research Team for Autoimmune Diseases, Research Program for Intractable Disease of the Ministry of Health, Labor and Welfare (MHLW), Japan. The committee completed a systematic review of evidences for several clinical questions and developed CPG for SS 2017 according to the procedure proposed by the Medical Information Network Distribution Service (Minds). The recommendations and their strength were checked by the modified Delphi method. The CPG for SS 2017 has been officially approved by both Japan College of Rheumatology and the Japanese Society for SS. The CPG committee set 38 clinical questions for clinical symptoms, signs, treatment, and management of SS in pediatric, adult and pregnant patients, using the PICO (P: patients, problem, population, I: interventions, C: comparisons, controls, comparators, O: outcomes) format. A summary of evidence, development of recommendation, recommendation, and strength for these 38 clinical questions are presented in the CPG. The CPG for SS 2017 should contribute to improvement and standardization of diagnosis and treatment of SS.
Al Nemri, Abdulrahman; Amer, Yasser Sami; Gasim, Hala; Osman, Mohamed Elfaki; Aleyadhy, Ayman; Al Otaibi, Hessah; Iqbal, Shaikh Mohammed; Aljurayyan, Nasir Abdullah; Assiri, Asaad M; Babiker, Amir; Mohamed, Sarar
2017-02-01
We aimed to determine the effect of Clinical Practice Guideline (CPG) implementation on length of hospital stay of children and adolescents with diabetic ketoacidosis (DKA). This was a 6-year (2008-2014) case-control retrospective study conducted at King Khalid University Hospital, Riyadh, that compared patients with DKA managed using CPG with those treated before CPG implementation. There were 63 episodes of DKA in 41 patients managed using CPG compared with 40 episodes in 33 patients treated before implementation of CPG. Baseline characteristics of the 2 groups were similar (age, sex, newly diagnosed patients, recurrent DKA, DKA severity, and mean glycosylated hemoglobin). The mean length of hospital stay (±SD) was 68.6 ± 53.1 hours after implementation of CPG compared with 107.4 ± 65.6 hours before implementation (P < .001). The reduction in length of hospital stay equals to 1700 bed days saved per year per 1000 patients. Implementation of CPG for DKA decreased the length of hospital stay. © 2016 John Wiley & Sons, Ltd.
Regulation of the ITGA2 gene by epigenetic mechanisms in prostate cancer.
Chin, Suyin Paulynn; Marthick, James R; West, Alison C; Short, Annabel K; Chuckowree, Jyoti; Polanowski, Andrea M; Thomson, Russell J; Holloway, Adele F; Dickinson, Joanne L
2015-05-01
Integrin alpha2 beta1 (α2 β1 ) plays an integral role in tumour cell invasion, metastasis and angiogenesis, and altered expression of the receptor has been linked to tumour prognosis in several solid tumours. However, the relationship is complex, with both increased and decreased expression associated with different stages of tumour metastases in several tumour types. The ITGA2 gene, which codes for the α2 subunit, was examined to investigate whether a large CpG island associated with its promoter region is involved in the differential expression of ITGA2 observed in prostate cancer. Bisulphite sequencing of the ITGA2 promoter was used to assess methylation in formalin-fixed paraffin-embedded (FFPE) prostate tumour specimens and prostate cancer cell lines, PC3, 22Rv1 and LNCaP. Changes in ITGA2 mRNA expression were measured using quantitative PCR. ITGA2 functionality was interrogated using cell migration scratch assays and siRNA knockdown experiments. Bisulphite sequencing revealed strikingly decreased methylation at key CpG sites within the promoter of tumour samples, when compared with normal prostate tissue. Altered methylation of this CpG island is also associated with differences in expression in the non-invasive LNCaP, and the highly metastatic PC3 and 22Rv1 prostate cancer cell lines. Further bisulphite sequencing confirmed that selected CpGs were highly methylated in LNCaP cells, whilst only low levels of methylation were observed in PC3 and 22Rv1 cells, correlating with ITGA2 transcript levels. Examination of the increased expression of ITGA2 was shown to influence migratory potential via scratch assay in PC3, 22Rv1 and LNCaP cells, and was confirmed by siRNA knockdown experiments. Taken together, our data supports the assertion that epigenetic modification of the ITGA2 promoter is a mechanism by which ITGA2 expression is regulated. © 2015 Wiley Periodicals, Inc.
Suárez-Obando, Fernando; Restrepo, Carlos Gómez
Clinical practice guidelines (CPG) are a set of recommendations for professionals, patients, and families, in order to make decisions about health care. The CPG respond to the need for concise, accurate, practical, and up to date information. In the field of mental health, Colombia has developed three GPC; alcohol (GPC-OH), depression (GPC-TDA), and schizophrenia. To describe the Web Portal traffic related to psychiatry guidelines, with emphasis on the number of visits, distribution throughout Colombian cities, and estimating user behaviour patterns. An evaluation was made of the traffic at the Clinical Practice Guidelines Web Portal of the Ministry of Health and Social Protection between 2013 and 2015 (two years of observation since the inauguration of the Portal). Out of the 45 GPC published on the website, the CPG-OH represented 1.21% of all page views of the Portal. CPG-TDA reached 1.52% (accumulated percentage of 2.73%), being the eighth most consulted guideline, with CPG-OH being number 16. The highest mean monthly number of visits for this group of guideliness was for the CPG-OH for health professionals (353 visits/month), and the lowest was for the CPG-AD for patients and relatives (24 single visits/month). Bogotá D.C. was the city where health carers accessed the guidelines more often. The guidelines for patients and relatives were consulted more in Villavicencio, Cúcuta, Manizales, Pereira, and Pasto. The web portal partially fulfills the purpose of circulating the CPG in Colombia. The visits to the CPG of mental health is quite low, and requires better dissemination strategies that allow the use of information and communication technology. Copyright © 2016 Asociación Colombiana de Psiquiatría. Publicado por Elsevier España. All rights reserved.
Intratumoral delivery of CpG-conjugated anti-MUC1 antibody enhances NK cell anti-tumor activity.
Schettini, Jorge; Kidiyoor, Amritha; Besmer, Dahlia M; Tinder, Teresa L; Roy, Lopamudra Das; Lustgarten, Joseph; Gendler, Sandra J; Mukherjee, Pinku
2012-11-01
Monoclonal antibodies (mAbs) against tumor-associated antigens are useful anticancer agents. Antibody-dependent cellular cytotoxicity (ADCC) is one of the major mechanisms responsible for initiating natural killer cell (NK)-mediated killing of tumors. However, the regulation of ADCC via NK cells is poorly understood. We have investigated the cytolytic activity of NK cells against pancreatic cancer cells that were coated with an antibody directed against the human tumor antigen, Mucin-1 designated HMFG-2, either alone or conjugated to CpG oligodeoxynucleotide (CpG ODN). Conjugated antibodies were tested for their ability to elicit ADCC in vitro and in vivo against pancreatic cancer cells. NK cells cultured in the presence of immobilized CpG ODN, HMFG-2 Ab, or CpG ODN-conjugated HMFG-2 Ab were able to up-regulate perforin similarly. Interestingly, a significant higher ADCC was observed when CpG ODN-conjugated HMFG-2-coated tumor cells were co-cultured with NK cells compared to unconjugated HMFG-2 Ab or CpG ODN alone. Moreover, MyD88-deficient NK cells can perform ADCC in vitro. Furthermore, intratumoral injections of CpG ODN-conjugated HMFG-2 induced a significant reduction in tumor burden in vivo in an established model of pancreatic tumor in nude mice compared to CpG ODN or the HMFG-2 alone. Depletion of macrophages or NK cells before treatment confirmed that both cells were required for the anti-tumor response in vivo. Results also suggest that CpG ODN and HMFG-2 Ab could be sensed by NK cells on the mAb-coated tumor cells triggering enhanced ADCC in vitro and in vivo.
Intratumoral delivery of CpG-conjugated anti-MUC1 antibody enhances NK cell anti-tumor activity
Schettini, Jorge; Kidiyoor, Amritha; Besmer, Dahlia M.; Tinder, Teresa L.; Roy, Lopamudra Das; Lustgarten, Joseph; Gendler, Sandra J.
2013-01-01
Monoclonal antibodies (mAbs) against tumor-associated antigens are useful anticancer agents. Antibody-dependent cellular cytotoxicity (ADCC) is one of the major mechanisms responsible for initiating natural killer cell (NK)-mediated killing of tumors. However, the regulation of ADCC via NK cells is poorly understood. We have investigated the cytolytic activity of NK cells against pancreatic cancer cells that were coated with an antibody directed against the human tumor antigen, Mucin-1 designated HMFG-2, either alone or conjugated to CpG oligodeoxynucleotide (CpG ODN). Conjugated antibodies were tested for their ability to elicit ADCC in vitro and in vivo against pancreatic cancer cells. NK cells cultured in the presence of immobilized CpG ODN, HMFG-2 Ab, or CpG ODN-conjugated HMFG-2 Ab were able to up-regulate perforin similarly. Interestingly, a significant higher ADCC was observed when CpG ODN-conjugated HMFG-2-coated tumor cells were co-cultured with NK cells compared to unconjugated HMFG-2 Ab or CpG ODN alone. Moreover, MyD88-deficient NK cells can perform ADCC in vitro. Furthermore, intratumoral injections of CpG ODN-conjugated HMFG-2 induced a significant reduction in tumor burden in vivo in an established model of pancreatic tumor in nude mice compared to CpG ODN or the HMFG-2 alone. Depletion of macrophages or NK cells before treatment confirmed that both cells were required for the anti-tumor response in vivo. Results also suggest that CpG ODN and HMFG-2 Ab could be sensed by NK cells on the mAb-coated tumor cells triggering enhanced ADCC in vitro and in vivo. PMID:22543528
Chu, Chun-Yen; Lee, Shang-Chun; Liu, Shyh-Shyan; Lin, Yu-Ming; Shen, Perng-Chi; Yu, Chi; Lee, Kuo-Hua; Zhao, Xin; Lee, Jai-Wei
2011-10-01
Adjuvants are important components of vaccine formulations. Effective adjuvants line innate and adaptive immunity by signaling through pathogen recognition receptors. Synthetic cytosine-phosphate-guanine (CpG) oligodeoxynucleotides (ODNs) have been shown to have potentials as adjuvants for vaccines. However, the immunostimulatory effect of CpG is species-specific and depends on the sequence of CpG motifs. A CpG ODN (2135), containing 3 identical copies of GTCGTT motif, was previously reported to have the strongest effects on bovine peripheral blood mononuclear cells (PBMC). Based on the sequence of 2135, we replaced the GTCGTT motif with 11 other sequences containing CG and investigated their effects on bovine lymphocyte proliferation. Results showed that the CpG ODNs containing 3 copies of GACGTT motif had the highest lymphocyte stimulation index (7.91±1.18), which was significantly (P<0.05) higher than that of 2135 (4.25±0.56). The CpG ODNs containing 3 copies of GACGTT motif also significantly increased the mRNA expression of interferon (IFN)-α, interleukin (IL)-12, and IL-21 in bovine PBMC. When dairy cows were immunized with the keyhole limpet hemocyanin (KLH) antigen formulated with CpG ODNs containing 3 copies of GACGTT, production of KLH-specific antibodies in serum and in milk whey was significantly (P<0.05) enhanced. IFN-γ in whole blood stimulated by KLH was also significantly (P<0.05) increased in cows immunized with KLH plus CpG ODNs. Our results indicate that CpG ODNs containing 3 copies of the GACGTT motifs is a potential adjuvant for bovine vaccines.
Ojeda-Robertos, Nadia Florencia; Torres-Acosta, Juan Felipe de Jesus; Aguilar-Caballero, Armando Jacinto; Ayala-Burgos, Armín; Cob-Galera, Ligia Amira; Sandoval-Castro, Carlos Alfredo; Barrientos-Medina, Roberto Carlos; de Gives, Pedro Mendoza
2008-12-20
The aims were (a) to quantify the number of Duddingtonia flagrans chlamydospores per gram of faeces (CPG) recovered from sheep administered with different oral doses and, (b) to describe the relationship between CPG and eggs per gram of faeces (EPG) on the efficacy to reduce Haemonchus contortus infective larvae. Three doses of chlamydospores per kg BW were orally administered during seven days: (T1) non treated control group, (T2) 1 x 10(6), (T3) 2.5 x 10(6) and (T4) 5 x 10(6). Three lambs, infected with H. contortus, were used per group. Faeces were obtained from the rectum of each lamb during the fungal administration period (days 0-6) and for six days after that period. Four coproculture replicates were made from each animal in days 2, 4, 6, 8 and 10. A higher chlamydospore dose produced higher CPG in faeces (p < 0.05), but a clear dose dependent effect was not found either in the larvae reduction or in the CPG:EPG ratio. When ratios were re-analyzed, independently of the treatment groups of origin, a better efficacy was obtained with a ratio from 5 to 10 CPG:EPG and a higher ratio (> 10 per egg) showed a lower reduction efficacy (p < 0.05). The binomial analysis showed that for each unit of increment in CPG:EPG ratio there was a reduction of larvae number until a point (between 5 and 10 CPG:EPG) where no further reduction was detected. The surface response test indicated that the number of larvae was reduced by CPG until possible saturation. The highest CPG:EPG ratios did not necessarily improve efficacy of D. flagrans.
Salamon, Sylwia; Flisikowski, Krzysztof; Switonski, Marek
2017-01-01
Ovotesticular or testicular disorder of sexual development in dogs with female karyotype and lack of SRY (XX DSD) is a common sexual anomaly diagnosed in numerous breeds. The molecular background, however, remains unclear, and epigenetic mechanisms, including DNA methylation, have not been studied. The aim of our study was comparative methylation analysis of CpG islands in promoters of candidate genes for XX DSD: SOX9, SOX3, and WNT4. Methylation studies were performed on DNA extracted from formalin-fixed/paraffin-embedded or frozen gonads from 2 dogs with ovotesticular and 2 dogs with testicular XX DSD as well as control females (n = 4) and males (n = 2). Bisulfite-converted DNA was used for CpG methylation analysis using quantitative pyrosequencing. Promoter regions of SOX9 and WNT4 showed similar CpG methylation in each group, ranging from 0 to 5.5% and from 39 to 74%, respectively. The SOX3 promoter showed significantly higher methylation in the ovotesticular XX DSD cases and the testicular XX DSD and control males, suggesting that SOX3 methylation may play a role in canine XX DSD pathogenesis. © 2017 S. Karger AG, Basel.
Kim, Johanna Inhyang; Kim, Jae-Won; Shin, Inkyung; Kim, Bung-Nyun
2018-05-01
We investigated the interaction effect between the methylation of dopamine receptor D4 (DRD4) and phthalate exposure in ADHD on continuous performance test (CPT) variables. Urine concentrations of mono-(2-ethyl-5-hydroxyhexyl) phthalate (MEHHP), mono-(2-ethyl-5-oxohexyl) phthalate (MEOHP), and mono-n-butyl phthalate (MBP) were tested. The methylation status was analyzed for CpG sites of DRD4. Multivariable linear regression models were applied to investigate the interaction effects of methylation and phthalate levels. There was a significant interaction effect of the methylation of CpG26 and CpG28 with the MEHHP level on omission errors in ADHD patients, but not in controls. The post hoc analysis revealed a significant correlation between the MEHHP concentration and omission errors in the methylated group, but not in the unmethylated group. The interaction between the methylation status of CpG sites of DRD4, particularly CpG26 and CpG28, and phthalate metabolite levels affects the attention level in ADHD patients.
Modulation of aerial respiratory behaviour in a pond snail.
Lukowiak, Ken; Martens, Kara; Orr, Mike; Parvez, Kashif; Rosenegger, David; Sangha, Susan
2006-11-01
Aerial respiratory in Lymnaea is driven by a three-neuron CPG whose sufficiency and necessity has been directly demonstrated. While this CPG is 'hard-wired' it displays a tremendous amount of plasticity. That is, it is possible by employing specific training procedures to alter how it functions in a specific hypoxic environment. Thus, it is possible to study directly the causal mechanisms of long-term memory formation, forgetting, and modulation of the memory at a single cell level. Thus, it is possible to use a relatively simple three-neuron CPG to study not only important questions concerning regulation of important homeostatic mechanisms but to also use it to study how learning and non-declarative memory are mediated at a cellular level.
Jelinek, Jaroslav; Liang, Shoudan; Lu, Yue; He, Rong; Ramagli, Louis S.; Shpall, Elizabeth J.; Estecio, Marcos R.H.; Issa, Jean-Pierre J.
2012-01-01
Genome wide analysis of DNA methylation provides important information in a variety of diseases, including cancer. Here, we describe a simple method, Digital Restriction Enzyme Analysis of Methylation (DREAM), based on next generation sequencing analysis of methylation-specific signatures created by sequential digestion of genomic DNA with SmaI and XmaI enzymes. DREAM provides information on 150,000 unique CpG sites, of which 39,000 are in CpG islands and 30,000 are at transcription start sites of 13,000 RefSeq genes. We analyzed DNA methylation in healthy white blood cells and found methylation patterns to be remarkably uniform. Inter individual differences > 30% were observed only at 227 of 28,331 (0.8%) of autosomal CpG sites. Similarly, > 30% differences were observed at only 59 sites when we comparing the cord and adult blood. These conserved methylation patterns contrasted with extensive changes affecting 18–40% of CpG sites in a patient with acute myeloid leukemia and in two leukemia cell lines. The method is cost effective, quantitative (r2 = 0.93 when compared with bisulfite pyrosequencing) and reproducible (r2 = 0.997). Using 100-fold coverage, DREAM can detect differences in methylation greater than 10% or 30% with a false positive rate below 0.05 or 0.001, respectively. DREAM can be useful in quantifying epigenetic effects of environment and nutrition, correlating developmental epigenetic variation with phenotypes, understanding epigenetics of cancer and chronic diseases, measuring the effects of drugs on DNA methylation or deriving new biological insights into mammalian genomes. PMID:23075513
Zhang, Guicheng; Wang, Kui; Schultz, Ennee; Khoo, Siew-Kim; Zhang, Xiaopeng; Annamalay, Alicia; Laing, Ingrid A; Hales, Belinda J; Goldblatt, Jack; Le Souëf, Peter N
2016-01-01
Several human diseases and conditions are disproportionally distributed in the world with a significant "Western-developed" vs. "Eastern-developing" gradient. We compared genome-wide DNA methylation of peripheral blood mononuclear cells in 25 newly arrived Chinese immigrants living in a Western environment for less than 6 months ("Newly arrived") with 23 Chinese immigrants living in the Western environment for more than two years ("Long-term") with a mean of 8.7 years, using the Infinium HumanMethylation450 BeadChip. In a sub-group of both subject groups (n = 12 each) we also investigated genome-wide gene expression using a Human HT-12 v4 expression beadChip. There were 62.5% probes among the total number of 382,250 valid CpG sites with greater mean Beta (β) in "Long-term" than in "Newly arrived". In the regions of CpG islands and gene promoters, compared with the CpG sites in all other regions, lower percentages of CpG sites with mean methylation levels in "Long-term" greater than "Newly arrived" were observed, but still >50%. The increase of methylation was associated with a general decrease of gene expression in Chinese immigrants living in the Western environment for a longer period of time. After adjusting for age, gender and other confounding factors the findings remained. Chinese immigrants living in Australia for a longer period of time have increased overall genome methylation and decreased overall gene expression compared with newly arrived immigrants. © 2015 Wiley Periodicals, Inc.
Singh, Shirene M; Alkie, Tamiru N; Abdelaziz, Khaled Taha; Hodgins, Douglas C; Novy, Anastasia; Nagy, Éva; Sharif, Shayan
2016-06-01
Avian influenza virus (AIV), a mucosal pathogen, gains entry into host chickens through respiratory and gastrointestinal routes. Most commercial AIV vaccines for poultry consist of inactivated, whole virus with adjuvant, delivered by parenteral administration. Recent advances in vaccine development have led to the application of nanoparticle emulsion delivery systems, such as poly (d,l-lactic-co-glycolic acid) (PLGA) nanoparticles to enhance antigen-specific immune responses. In chickens, the Toll-like receptor 21 ligand, CpG oligodeoxynucleotides (ODNs), have been demonstrated to be immunostimulatory. The objective of this study was to compare the adjuvant potential of CpG ODN 2007 encapsulated in PLGA nanoparticles with nonencapsulated CpG ODN 2007 when combined with a formalin-inactivated H9N2 virus, through intramuscular and aerosol delivery routes. Chickens were vaccinated at days 7 and 21 posthatch for the intramuscular route and at days 7, 21, and 35 for the aerosol route. Antibody-mediated responses were evaluated weekly in sera and lacrimal secretions in specific pathogen-free chickens. The results indicate that nonencapsulated CpG ODN 2007 in inactivated AIV vaccines administered by the intramuscular route generated higher antibody responses compared to the encapsulated CpG ODN 2007 formulation by the same route. Additionally, encapsulated CpG ODN 2007 in AIV vaccines administered by the aerosol route elicited higher mucosal responses compared to nonencapsulated CpG ODN 2007. Future studies may be aimed at evaluating protective immune responses induced with PLGA encapsulation of AIV and adjuvants.
Martin, Elizabeth M.; Fry, Rebecca C.
2016-01-01
Abstract A biological mechanism by which exposure to environmental contaminants results in gene-specific CpG methylation patterning is currently unknown. We hypothesize that gene-specific CpG methylation is related to environmentally perturbed transcription factor occupancy. To test this hypothesis, a database of 396 genes with altered CpG methylation either in cord blood leukocytes or placental tissue was compiled from 14 studies representing assessments of six environmental contaminants. Subsequently, an in silico approach was used to identify transcription factor binding sites enriched among the genes with altered CpG methylation in relationship to the suite of environmental contaminants. For each study, the sequences of the promoter regions (representing −1000 to +500 bp from the transcription start site) of all genes with altered CpG methylation were analyzed for enrichment of transcription factor binding sites. Binding sites for a total of 56 unique transcription factors were identified to be enriched within the promoter regions of the genes. Binding sites for the Kidney-Enriched Krupple-like Factor 15, a known responder to endogenous stress, were enriched ( P < 0.001–0.041) among the genes with altered CpG methylation associated for five of the six environmental contaminants. These data support the transcription factor occupancy theory as a potential mechanism underlying environmentally-induced gene-specific CpG methylation. PMID:27066266
Prediction of epigenetically regulated genes in breast cancer cell lines
DOE Office of Scientific and Technical Information (OSTI.GOV)
Loss, Leandro A; Sadanandam, Anguraj; Durinck, Steffen
Methylation of CpG islands within the DNA promoter regions is one mechanism that leads to aberrant gene expression in cancer. In particular, the abnormal methylation of CpG islands may silence associated genes. Therefore, using high-throughput microarrays to measure CpG island methylation will lead to better understanding of tumor pathobiology and progression, while revealing potentially new biomarkers. We have examined a recently developed high-throughput technology for measuring genome-wide methylation patterns called mTACL. Here, we propose a computational pipeline for integrating gene expression and CpG island methylation profles to identify epigenetically regulated genes for a panel of 45 breast cancer cell lines,more » which is widely used in the Integrative Cancer Biology Program (ICBP). The pipeline (i) reduces the dimensionality of the methylation data, (ii) associates the reduced methylation data with gene expression data, and (iii) ranks methylation-expression associations according to their epigenetic regulation. Dimensionality reduction is performed in two steps: (i) methylation sites are grouped across the genome to identify regions of interest, and (ii) methylation profles are clustered within each region. Associations between the clustered methylation and the gene expression data sets generate candidate matches within a fxed neighborhood around each gene. Finally, the methylation-expression associations are ranked through a logistic regression, and their significance is quantified through permutation analysis. Our two-step dimensionality reduction compressed 90% of the original data, reducing 137,688 methylation sites to 14,505 clusters. Methylation-expression associations produced 18,312 correspondences, which were used to further analyze epigenetic regulation. Logistic regression was used to identify 58 genes from these correspondences that showed a statistically signifcant negative correlation between methylation profles and gene expression in the panel of breast cancer cell lines. Subnetwork enrichment of these genes has identifed 35 common regulators with 6 or more predicted markers. In addition to identifying epigenetically regulated genes, we show evidence of differentially expressed methylation patterns between the basal and luminal subtypes. Our results indicate that the proposed computational protocol is a viable platform for identifying epigenetically regulated genes. Our protocol has generated a list of predictors including COL1A2, TOP2A, TFF1, and VAV3, genes whose key roles in epigenetic regulation is documented in the literature. Subnetwork enrichment of these predicted markers further suggests that epigenetic regulation of individual genes occurs in a coordinated fashion and through common regulators.« less
Genetic and Epigenetic Inactivation of Kruppel-like Factor 4 in Medulloblastoma1
Nakahara, Yukiko; Northcott, Paul A; Li, Meihua; Kongkham, Paul N; Smith, Christian; Yan, Hai; Croul, Sidney; Ra, Young-Shin; Eberhart, Charles; Huang, Annie; Bigner, Darell; Grajkowska, Wesia; Van Meter, Timothy; Rutka, James T; Taylor, Michael D
2010-01-01
Although medulloblastoma is the most common pediatric malignant brain tumor, its molecular underpinnings are largely unknown. We have identified rare, recurrent homozygous deletions of Kruppel-like Factor 4 (KLF4) in medulloblastoma using high-resolution single nucleotide polymorphism arrays, digital karyotyping, and genomic real-time polymerase chain reaction (PCR). Furthermore, we show that there is loss of physiological KLF4 expression in more than 40% of primary medulloblastomas both at the RNA and protein levels. Medulloblastoma cell lines drastically increase the expression of KLF4 in response to the demethylating agent 5-azacytidine and demonstrate dense methylation of the promoter CpG island by bisulfite sequencing. Methylation-specific PCR targeting the KLF4 promoter demonstrates CpG methylation in approximately 16% of primary medulloblastomas. Reexpression of KLF4 in the D283 medulloblastoma cell line results in significant growth suppression both in vitro and in vivo. We conclude that KLF4 is inactivated by either genetic or epigenetic mechanisms in a large subset of medulloblastomas and that it likely functions as a tumor suppressor gene in the pathogenesis of medulloblastoma. PMID:20072650
Functional characterization of the human phosphodiesterase 7A1 promoter.
Torras-Llort, Mònica; Azorín, Fernando
2003-01-01
In this paper, the human phosphodiesterase 7A1 (h PDE7A1 ) promoter region was identified and functionally characterized. Transient transfection experiments indicated that a 2.9 kb fragment of the h PDE7A1 5'-flanking region, to position -2907, has strong promoter activity in Jurkat T-cells. Deletion analysis showed that the proximal region, up to position -988, contains major cis -regulatory elements of the h PDE7A1 promoter. This minimal promoter region contains a regulatory CpG island which is essential for promoter activity. The CpG island contains three potential cAMP-response-element-binding protein (CREB)-binding sites that, as judged by in vivo dimethyl sulphate (DMS) footprinting, are occupied in Jurkat T-cells. Moreover, over-expression of CREB results in increased promoter activity, but, on the other hand, promoter activity decreases when a dominant-negative form of CREB (KCREB) is over-expressed. In vivo DMS footprinting strongly indicates that other transcription factors, such Ets-2, nuclear factor of activated T-cells 1 (NFAT-1) and nuclear factor kappaB (NF-kappaB), might also contribute to the regulation of h PDE7A1 promoter. Finally, h PDE7A1 promoter was found to be induced by treatment with PMA, but not by treatment with dibutyryl cAMP or forskolin. These results provide insights into the factors and mechanisms that regulate expression of the h PDE7A gene. PMID:12737631
Federal Register 2010, 2011, 2012, 2013, 2014
2010-03-22
...] (Formerly Docket No. 1998N-0046) Compliance Policy Guide Sec. 540.375 Canned Salmon -- Adulteration... of Compliance Policy Guide Sec. 540.375 Canned Salmon -- Adulteration Involving Decomposition (CPG... relating to decomposition in fish and fishery products, including canned salmon, is provided in CPG Sec...
Role of Replication and CpG Methylation in Fragile X Syndrome CGG Deletions in Primate Cells
Nichol Edamura, Kerrie; Leonard, Michelle R.; Pearson, Christopher E.
2005-01-01
Instability of the fragile X CGG repeat involves both maternally derived expansions and deletions in the gametes of full-mutation males. It has also been suggested that the absence of aberrant CpG methylation may enhance repeat deletions through an unknown process. The effect of CGG tract length, DNA replication direction, location of replication initiation, and CpG methylation upon CGG stability were investigated using an SV40 primate replication system. Replication-dependant deletions with 53 CGG repeats were observed when replication was initiated proximal to the repeat, with CGG as the lagging-strand template. When we initiated replication further from the repeat, while maintaining CGG as the lagging-strand template or using CCG as the lagging-strand template, significant instability was not observed. CpG methylation of the unstable template stabilized the repeat, decreasing both the frequency and the magnitude of deletion events. Furthermore, CpG methylation slowed the efficiency of replication for all templates. Interestingly, replication forks displayed no evidence of a block at the CGG repeat tract, regardless of replication direction or CpG methylation status. Templates with 20 CGG repeats were stable under all circumstances. These results reveal that CGG deletions occur during replication and are sensitive to replication-fork dynamics, tract length, and CpG methylation. PMID:15625623
Topical CpG enhances the response of murine malignant melanoma to dacarbazine.
Najar, Hossain M; Dutz, Jan P
2008-09-01
Malignant melanoma is a potentially fatal skin cancer that is increasing in incidence. Standard chemoimmunotherapy consisting of dacarbazine (DTIC) given with IFN-alpha has had disappointing results. We describe a chemoimmunotherapy protocol for cutaneous melanoma that combines the administration of DTIC with the topical application of CpG oligodinucleotide (ODN). Subcutaneous B16 melanoma tumors in C57BL/6 mice were treated with intraperitoneal injections of DTIC followed by the topical application of CpG-ODN over the tumors. This therapeutic approach abrogated the growth of established tumors and significantly enhanced survival. Topical CpG application was more effective than intratumoral CpG. Cell depletion studies indicated that the antitumor effect was dependent on both CD4(+) and CD8(+) cells but not on natural killer (NK) cells. Tumor-specific cytotoxic T-lymphocyte activity was generated in treated animals and was highest in topically treated animals. Immunohistochemical analysis revealed that DTIC, but not CpG, enhanced tumor cell apoptosis. Further, topical CpG induced an expansion of a B220(+)CD8(+) subset of dendritic cells and a subset of NK1.1(+) CD11c(+) cells within the tumors. By enhancing both tumor cell death and local immune activation, DTIC/topical CpG chemoimmunotherapy induced an effective T-cell-dependent host-immune response against melanoma.
Amemiya, Kei; Meyers, Jennifer L; Rogers, Taralyn E; Fast, Randy L; Bassett, Anthony D; Worsham, Patricia L; Powell, Bradford S; Norris, Sarah L; Krieg, Arthur M; Adamovicz, Jeffrey J
2009-04-06
The current U.S. Department of Defense candidate plague vaccine is a fusion between two Yersinia pestis proteins: the F1 capsular protein, and the low calcium response (Lcr) V-protein. We hypothesized that an immunomodulator, such as CpG oligodeoxynucleotide (ODN)s, could augment the immune response to the plague F1-V vaccine in a mouse model for plague. CpG ODNs significantly augmented the antibody response and efficacy of a single dose of the plague vaccine in murine bubonic and pneumonic models of plague. In the latter study, we also found an overall significant augmentation the immune response to the individual subunits of the plague vaccine by CpG ODN 2006. In a long-term, prime-boost study, CpG ODN induced a significant early augmentation of the IgG response to the vaccine. The presence of CpG ODN induced a significant increase in the IgG2a subclass response to the vaccine up to 5 months after the boost. Our studies showed that CpG ODNs significantly augmented the IgG antibody response to the plague vaccine, which increased the probability of survival in murine models of plague (P<0.0001).
Aging effects on DNA methylation modules in human brain and blood tissue
2012-01-01
Background Several recent studies reported aging effects on DNA methylation levels of individual CpG dinucleotides. But it is not yet known whether aging-related consensus modules, in the form of clusters of correlated CpG markers, can be found that are present in multiple human tissues. Such a module could facilitate the understanding of aging effects on multiple tissues. Results We therefore employed weighted correlation network analysis of 2,442 Illumina DNA methylation arrays from brain and blood tissues, which enabled the identification of an age-related co-methylation module. Module preservation analysis confirmed that this module can also be found in diverse independent data sets. Biological evaluation showed that module membership is associated with Polycomb group target occupancy counts, CpG island status and autosomal chromosome location. Functional enrichment analysis revealed that the aging-related consensus module comprises genes that are involved in nervous system development, neuron differentiation and neurogenesis, and that it contains promoter CpGs of genes known to be down-regulated in early Alzheimer's disease. A comparison with a standard, non-module based meta-analysis revealed that selecting CpGs based on module membership leads to significantly increased gene ontology enrichment, thus demonstrating that studying aging effects via consensus network analysis enhances the biological insights gained. Conclusions Overall, our analysis revealed a robustly defined age-related co-methylation module that is present in multiple human tissues, including blood and brain. We conclude that blood is a promising surrogate for brain tissue when studying the effects of age on DNA methylation profiles. PMID:23034122
Leveraging workflow control patterns in the domain of clinical practice guidelines.
Kaiser, Katharina; Marcos, Mar
2016-02-10
Clinical practice guidelines (CPGs) include recommendations describing appropriate care for the management of patients with a specific clinical condition. A number of representation languages have been developed to support executable CPGs, with associated authoring/editing tools. Even with tool assistance, authoring of CPG models is a labor-intensive task. We aim at facilitating the early stages of CPG modeling task. In this context, we propose to support the authoring of CPG models based on a set of suitable procedural patterns described in an implementation-independent notation that can be then semi-automatically transformed into one of the alternative executable CPG languages. We have started with the workflow control patterns which have been identified in the fields of workflow systems and business process management. We have analyzed the suitability of these patterns by means of a qualitative analysis of CPG texts. Following our analysis we have implemented a selection of workflow patterns in the Asbru and PROforma CPG languages. As implementation-independent notation for the description of patterns we have chosen BPMN 2.0. Finally, we have developed XSLT transformations to convert the BPMN 2.0 version of the patterns into the Asbru and PROforma languages. We showed that although a significant number of workflow control patterns are suitable to describe CPG procedural knowledge, not all of them are applicable in the context of CPGs due to their focus on single-patient care. Moreover, CPGs may require additional patterns not included in the set of workflow control patterns. We also showed that nearly all the CPG-suitable patterns can be conveniently implemented in the Asbru and PROforma languages. Finally, we demonstrated that individual patterns can be semi-automatically transformed from a process specification in BPMN 2.0 to executable implementations in these languages. We propose a pattern and transformation-based approach for the development of CPG models. Such an approach can form the basis of a valid framework for the authoring of CPG models. The identification of adequate patterns and the implementation of transformations to convert patterns from a process specification into different executable implementations are the first necessary steps for our approach.
Abdul-Cader, Mohamed Sarjoon; Amarasinghe, Aruna; Palomino-Tapia, Victor; Ahmed-Hassan, Hanaa; Bakhtawar, Khawaja; Nagy, Eva; Sharif, Shayan; Gomis, Susantha; Abdul-Careem, Mohamed Faizal
2018-01-01
Cytosine-guanosine deoxynucleotides (CpG) DNA can be delivered in ovo at embryo day (ED)18 for the stimulation of toll-like receptor (TLR)21 signaling pathway that ultimately protects chickens against a number of bacterial and viral infections. There is a dearth of information understanding the mechanisms of protection induced by in ovo delivered CpG DNA. The objective of this study was to determine the immune cell changes post-hatch following in ovo delivery of the TLR21 ligand, CpG DNA. In order to quantify changes of percentage of KUL01+, IgM+ B, cluster of differentiation (CD)4+ and CD8α+ cells, trachea, lung, duodenum, large intestine, spleen and bursa of Fabricius were collected on day 1 post-hatch. We found increased recruitments of KUL01+ cells, in organs of these body systems post-hatch following in ovo delivery of CpG DNA. Although IgM+ B cells, CD4+ and CD8α+ cells were increased in lungs and immune system organs, these cells were not quantifiable from the trachea, duodenum and large intestine immediately following the hatch. Furthermore, when CpG DNA is delivered in ovo and subsequently infected with infectious laryngotracheitis virus (ILTV) post-hatch on day 1, CpG DNA reduces morbidity and mortality resulting from ILTV infection. This study provides insights into the mechanisms of host responses elicited following in ovo delivery of CpG DNA in avian species.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Diver, R.B.; Moss, T.A.; Goldberg, V.
Project Rolling Thunder is a dish/Stirling demonstration project at Ft. Huachuca, a US Army fort in southeastern Arizona (Huachuca means rolling thunder in Apache). It has been supported by the Strategic Environmental Research and Development Program (SERDP), a cooperative program between the Department of Defense (DoD) and the Department of Energy (DOE). As part of a 1992 SERDP project, Cummins Power Generation, Inc. (CPG) installed a CPG 7 kW(c) dish/Stirling system at the Joint Interoperability Test Command (JITC) in Ft. Huachuca, Arizona. The primary objective of the SERDP Dish/Stirling for DoD Applications project was to demonstrate a CPG 7-kW(c) dish/Stirlingmore » system at a military facility. Unfortunately, Cummins Engine Company decided to divest its solar operations. As a direct result of Ft. Huachuca`s interest in the Cummins dish/Stirling technology, Sandia explored the possibility of installing a SOLO 161 Stirling power conversion unit (PCU) on the Ft. Huachuca CPG-460. In January 1997, a decision was made to retrofit a SOLO 161 Stirling engine on the CPG-460 at Ft. Huachuca. Project Rolling Thunder. The SOLO 161 Demonstration at Ft. Huachuca has been a challenge. Although, the SOLO 161 PCU has operated nearly flawlessly and the CPG-460 has been, for the most part, a solid and reliable component, integration of the SOLO PCU with the CPG-460 has required significant attention. In this paper, the integration issues and technical approaches of project Rolling Thunder are presented. Lessons of the project are also discussed.« less
Ragone, M I; Torres, N S; Consolini, A E
2013-02-01
To study the role of mitochondria in the recovery of guinea-pig hearts exposed to high-K(+)-cardioplegia (CPG) and ischaemia/reperfusion (I/R) METHODS: We measured contractility and heat release in perfused guinea-pig hearts and cytosolic and mitochondrial Ca(2+) by epifluorescence and confocal microscopy in isolated cardiomyocytes loaded with Fluo-4 or Rhod-2. In hearts, CPG increased the postischaemic contractile recovery, and this was potentiated by the mNCX blocker clonazepam and the mKATP opener diazoxide, which also prevented the fall in muscle economy. Moreover, CPG prevented the stunning induced by ouabain, which was reduced by clonazepam. In cardiomyocytes, CPG increased fluorescent signals of cytosolic and mitochondrial Ca(2+), while the addition of a mNCX blocker (CGP37157) increased cytosolic but reduced mitochondrial [Ca(2+)]. Ouabain in CPG increased cytosolic Ca(2+) and resting heat, but the addition of CGP37157 reduced them, as well as mitochondrial Ca(2+). CPG, diazoxide and clonazepam improve postischaemic recovery, respectively, by increasing the Ca(2+) cycling and by reducing the mitochondrial Ca(2+) uptake either by uniporter or by mNCX. The mitochondria compete with the leaky sarcoplasmic reticulum (SR) as sink of Ca(2+) in guinea-pig hearts, affecting the postischaemic contractility. CPG also prevented the ouabain-induced dysfunction by avoiding the Ca(2+) overload. Ouabain reduced the synergism between CPG and clonazepam suggesting that [Na(+)]i and SR load influence the mNCX role. © 2012 The Authors Acta Physiologica © 2012 Scandinavian Physiological Society.
75 FR 60761 - Government-Owned Inventions; Availability for Licensing
Federal Register 2010, 2011, 2012, 2013, 2014
2010-10-01
... cells conjugated to a K-type CpG oligodeoxynucleotide (ODN) to a subject. Methods for treating a tumor... therapeutically effective amount of apoptotic tumor cells conjugated to a K-type CpG oligodeoxynucleotide (ODN) to... the prevention of cancer and other indications Use of CpG oligonucleotides for prophylaxis and/or...
Federal Register 2010, 2011, 2012, 2013, 2014
2013-08-01
... Speed Wound Healing; and Use of CpG Oligodeoxynucleotides To Induce Epithelial Cell Growth AGENCY... CpG Oligodeoxynucleotides to Induce Epithelial Cell Growth'' to Tollgene having a place of business... 37 CFR part 404. These technologies relate to relate to use of CpG oligodeoxynucleotides (ODNs) to...
Promoter methylation assay of SASH1 gene in breast cancer.
Sheyu, Lin; Hui, Liu; Junyu, Zhang; Jiawei, Xu; Honglian, Wang; Qing, Sang; Hengwei, Zhang; Xuhui, Guo; Qinghe, Xing; Lin, He
2013-01-01
To analyze the relationship between the expression of SASH1 and its methylation level of SASH1 gene promoter in human breast cancer. Expression levels of SASH1 were examined in breast cancer tissues and adjacent normal tissues with immunohistochemistry and with real time PCR (RT-PCR) methylation analysis was performed with MassArray. Immunohistochemistry showed that SASH1 expression was strongly reduced in breast cancer compared with adjacent normal tissues. Quantitative methylation analysis by MassArray revealed that CpG sites in SASH1 promoter shared similar methylation pattern in tumor tissue and adjacent normal tissue. The CpG sites with significant difference in methylation level were CpG_26.27 and CpG_54.55. Moreover, 5-aza-2'-deoxycytidine (5-Aza-dc) treatment of tumor cell line MDA-MB-231 caused significant elevation of SASH1 mRNA. Based on these data, we propose that increase of DNA methylation level in the promoter region of gene SASH1, particularly CpG_26.27 or CpG_54.55 sites, possibly repressed SASH1 expression in breast cancer.
The Use of Chlorhexidine/n-Propyl Gallate (CPG) as an Ambient-Temperature Urine Preservative
NASA Technical Reports Server (NTRS)
Nillen, Jeannie L.; Smith, Scott M.
2003-01-01
A safe, effective ambient temperature urine preservative, chlorhexidine/n-propyl gallate (CPG), has been formulated for use during spacefli ght that reduces the effects of oxidation and bacterial contamination on sample integrity while maintaining urine pH. The ability of this preservative to maintain stability of nine key analytes was evaluated for a period of one year. CPG effectively maintained stability of a mmonia, total nitrogen, 3-methylhistidine, chloride, sodium, potassiu m, and urea; however, creatinine and osmolality were not preserved by CPG. These data indicate that CPG offers prolonged room-temperature storage for multiple urine analytes, reducing the requirements for f rozen urine storage on future spaceflights. Iii medical applications on Earth, this technology can allow urine samples to be collected in remote settings and eliminate the need to ship frozen samples.
Reinforcement learning for a biped robot based on a CPG-actor-critic method.
Nakamura, Yutaka; Mori, Takeshi; Sato, Masa-aki; Ishii, Shin
2007-08-01
Animals' rhythmic movements, such as locomotion, are considered to be controlled by neural circuits called central pattern generators (CPGs), which generate oscillatory signals. Motivated by this biological mechanism, studies have been conducted on the rhythmic movements controlled by CPG. As an autonomous learning framework for a CPG controller, we propose in this article a reinforcement learning method we call the "CPG-actor-critic" method. This method introduces a new architecture to the actor, and its training is roughly based on a stochastic policy gradient algorithm presented recently. We apply this method to an automatic acquisition problem of control for a biped robot. Computer simulations show that training of the CPG can be successfully performed by our method, thus allowing the biped robot to not only walk stably but also adapt to environmental changes.
Analysis of the association between CIMP and BRAF in colorectal cancer by DNA methylation profiling.
Hinoue, Toshinori; Weisenberger, Daniel J; Pan, Fei; Campan, Mihaela; Kim, Myungjin; Young, Joanne; Whitehall, Vicki L; Leggett, Barbara A; Laird, Peter W
2009-12-21
A CpG island methylator phenotype (CIMP) is displayed by a distinct subset of colorectal cancers with a high frequency of DNA hypermethylation in a specific group of CpG islands. Recent studies have shown that an activating mutation of BRAF (BRAF(V600E)) is tightly associated with CIMP, raising the question of whether BRAF(V600E) plays a causal role in the development of CIMP or whether CIMP provides a favorable environment for the acquisition of BRAF(V600E). We employed Illumina GoldenGate DNA methylation technology, which interrogates 1,505 CpG sites in 807 different genes, to further study this association. We first examined whether expression of BRAF(V600E) causes DNA hypermethylation by stably expressing BRAF(V600E) in the CIMP-negative, BRAF wild-type COLO 320DM colorectal cancer cell line. We determined 100 CIMP-associated CpG sites and examined changes in DNA methylation in eight stably transfected clones over multiple passages. We found that BRAF(V600E) is not sufficient to induce CIMP in our system. Secondly, considering the alternative possibility, we identified genes whose DNA hypermethylation was closely linked to BRAF(V600E) and CIMP in 235 primary colorectal tumors. Interestingly, genes that showed the most significant link include those that mediate various signaling pathways implicated in colorectal tumorigenesis, such as BMP3 and BMP6 (BMP signaling), EPHA3, KIT, and FLT1 (receptor tyrosine kinases) and SMO (Hedgehog signaling). Furthermore, we identified CIMP-dependent DNA hypermethylation of IGFBP7, which has been shown to mediate BRAF(V600E)-induced cellular senescence and apoptosis. Promoter DNA hypermethylation of IGFBP7 was associated with silencing of the gene. CIMP-specific inactivation of BRAF(V600E)-induced senescence and apoptosis pathways by IGFBP7 DNA hypermethylation might create a favorable context for the acquisition of BRAF(V600E) in CIMP+ colorectal cancer. Our data will be useful for future investigations toward understanding CIMP in colorectal cancer and gaining insights into the role of aberrant DNA hypermethylation in colorectal tumorigenesis.
Shang, Xueying; Su, Jianguo; Wan, Quanyuan; Su, Juanjuan
2015-01-01
Melanoma differentiation-associated gene 5 (MDA5) plays a crucial role in recognizing intracellular viral infection, activating the interferon regulatory factor pathways as well as inducing antiviral response. While the antiviral regulatory mechanism of MDA5 remains unclear. In the present study, CiMDA5 (Ctenopharyngodon idella MDA5) against grass carp reovirus (GCRV) would be initially revealed from the perspective of DNA methylation, a pivotal epigenetic modification. Two CpG islands (CGIs) were predicted located in the first exon of CiMDA5, of which the first CpG island was 427 bp in length possessed 29 candidate CpG loci and 34 CpA loci, and the second one was 130 bp in length involving 7 CpG loci as well as 10 CpA loci. By bisulfite sequencing PCR (BSP), the methylation statuses were detected in spleen of 70 individuals divided into resistant/susceptible groups post challenge experiment, and the resistance-association analysis was performed with Chi-square test. Quantitative real-time RT-PCR (qRT-PCR) was carried out to explore the relationship between DNA methylation and gene expression in CiMDA5. Results indicated that the methylation levels of CpA/CpG sites at +200, +202, +204, +207 nt, which consisted of a putative densely methylated element (DME), were significantly higher in the susceptible group than those in the resistant group. Meanwhile, the average transcription of CiMDA5 was down-regulated in the susceptible individuals compared with the resistant individuals. Evidently, the DNA methylation may be the negative modulator of CiMDA5 antiviral expression. Collectively, the methylation levels of CiMDA5 demonstrated the tight association with the resistance against GCRV and the negative-regulated roles in mRNA expression. This study first discovered the resistance-associated gene modulated by DNA methylation in teleost, preliminary revealed the underlying regulatory mechanism of CiMDA5 transcription against GCRV as well as laid a theoretical foundation on molecular nosogenesis of hemorrhagic diseases in C. idella. Copyright © 2014 Elsevier Ltd. All rights reserved.
Association between Promoter Methylation of Gene ERCC3 and Benzene Hematotoxicity.
Zheng, Min; Lin, Feiliang; Hou, Fenxia; Li, Guilan; Zhu, Caiying; Xu, Peiyu; Xing, Caihong; Wang, Qianfei
2017-08-16
Benzene is a primary industrial chemical and a ubiquitous environmental pollutant. ERCC3 is a key player in nucleotide excision repair. Recent studies suggested that site-specific methylation is a possible mechanism of the transcriptional dysregulation by blocking transcription factors binding. We previously found that the average promoter methylation level of ERCC3 was increased in benzene-exposed workers. In order to test whether specific CpG sites of ERCC3 play an important role in benzene-induced epigenetic changes and whether the specific methylation patterns are associated with benzene hematotoxicity, we analyzed the promoter methylation levels of individual CpG sites, transcription factor binding motif and the correlation between aberrant CpG methylation and hematotoxicity in 76 benzene-exposed workers and 24 unexposed controls in China. Out of all the CpGs analyzed, two CpG units located 43 bp upstream and 99 bp downstream of the transcription start site of ERCC3 (CpG 2-4 and CpG 17-18, respectively), showed the most pronounced increase in methylation levels in benzene-exposed workers, compared with unexposed controls (Mean ± SD: 5.86 ± 2.77% vs. 4.92 ± 1.53%, p = 0.032; 8.45 ± 4.09% vs. 6.79 ± 2.50%, p = 0.024, respectively). Using the JASPAR CORE Database, we found that CpG 2-4 and CpG 17-18 were bound by three putative transcription factors (TFAP2A, E2F4 and MZF1). Furthermore, the methylation levels for CpG 2-4 were correlated negatively with the percentage of neutrophils ( β = -0.676, p = 0.005) in benzene-exposed workers. This study demonstrates that CpG-specific DNA methylation in the ERCC3 promoter region may be involved in benzene-induced epigenetic modification and it may contribute to benzene-induced hematotoxicity.
Association between Promoter Methylation of Gene ERCC3 and Benzene Hematotoxicity
Lin, Feiliang; Hou, Fenxia; Li, Guilan; Zhu, Caiying; Xu, Peiyu; Xing, Caihong; Wang, Qianfei
2017-01-01
Benzene is a primary industrial chemical and a ubiquitous environmental pollutant. ERCC3 is a key player in nucleotide excision repair. Recent studies suggested that site-specific methylation is a possible mechanism of the transcriptional dysregulation by blocking transcription factors binding. We previously found that the average promoter methylation level of ERCC3 was increased in benzene-exposed workers. In order to test whether specific CpG sites of ERCC3 play an important role in benzene-induced epigenetic changes and whether the specific methylation patterns are associated with benzene hematotoxicity, we analyzed the promoter methylation levels of individual CpG sites, transcription factor binding motif and the correlation between aberrant CpG methylation and hematotoxicity in 76 benzene-exposed workers and 24 unexposed controls in China. Out of all the CpGs analyzed, two CpG units located 43 bp upstream and 99 bp downstream of the transcription start site of ERCC3 (CpG 2–4 and CpG 17–18, respectively), showed the most pronounced increase in methylation levels in benzene-exposed workers, compared with unexposed controls (Mean ± SD: 5.86 ± 2.77% vs. 4.92 ± 1.53%, p = 0.032; 8.45 ± 4.09% vs. 6.79 ± 2.50%, p = 0.024, respectively). Using the JASPAR CORE Database, we found that CpG 2–4 and CpG 17–18 were bound by three putative transcription factors (TFAP2A, E2F4 and MZF1). Furthermore, the methylation levels for CpG 2–4 were correlated negatively with the percentage of neutrophils (β = −0.676, p = 0.005) in benzene-exposed workers. This study demonstrates that CpG-specific DNA methylation in the ERCC3 promoter region may be involved in benzene-induced epigenetic modification and it may contribute to benzene-induced hematotoxicity. PMID:28813025
Vitamin D dose response is underestimated by Endocrine Society's Clinical Practice Guideline.
McKenna, Malachi J; Murray, Barbara F
2013-06-01
The recommended daily intakes of vitamin D according to the recent Clinical Practice Guideline (CPG) of the Endocrine Society are three- to fivefold higher than the Institute of Medicine (IOM) report. We speculated that these differences could be explained by different mathematical approaches to the vitamin D dose response. Studies were selected if the daily dose was ≤2000 IU/day, the duration exceeded 3 months, and 25-hydroxyvitamin D (25OHD) concentrations were measured at baseline and post-therapy. The rate constant was estimated according to the CPG approach. The achieved 25OHD result was estimated according to the following: i) the regression equation approach of the IOM; ii) the regression approach of the Vitamin D Supplementation in Older Subjects (ViDOS) study; and iii) the CPG approach using a rate constant of 2.5 (CPG2.5) and a rate constant of 5.0 (CPG5.0). The difference between the expected and the observed 25OHD result was expressed as a percentage of observed and analyzed for significance against a value of 0% for the four groups. Forty-one studies were analyzed. The mean (95% CI) rate constant was 5.3 (4.4-6.2) nmol/l per 100 IU per day, on average twofold higher than the CPG rate constant. The mean (95% CI) for the difference between the expected and observed expressed as a percentage of observed was as follows: i) IOM, -7 (-16,+2)% (t=1.64, P=0.110); ii) ViDOS, +2 (-8,+12)% (t=0.40, P=0.69); iii) CPG2.5, -21 (-27,-15)% (t=7.2, P<0.0001); and iv) CPG5.0+3 (-4,+10)% (t=0.91, P=0.366). The CPG 'rule of thumb' should be doubled to 5.0 nmol/l (2.0 ng/ml) per 100 IU per day, adopting a more risk-averse position.
Zhang, Yi; Kent, Jack W; Lee, Adam; Cerjak, Diana; Ali, Omar; Diasio, Robert; Olivier, Michael; Blangero, John; Carless, Melanie A; Kissebah, Ahmed H
2013-03-19
Fatty acid-binding proteins (FABPs) play regulatory roles at the nexus of lipid metabolism and signaling. Dyslipidemia in clinical manifestation frequently co-occurs with obesity, insulin resistance and hypertension in the Metabolic Syndrome (MetS). Animal studies have suggested FABPs play regulatory roles in expressing MetS phenotypes. In our family cohort of Northern European descent, transcript levels in peripheral white blood cells (PWBCs) of a key FABPs, FABP3, is correlated with the MetS leading components. However, evidence supporting the functions of FABPs in humans using genetic approaches has been scarce, suggesting FABPs may be under epigenetic regulation. The objective of this study was to test the hypothesis that CpG methylation status of a key regulator of lipid homeostasis, FABP3, is a quantitative trait associated with status of MetS phenotypes in humans. We used a mass-spec based quantitative method, EpiTYPER®, to profile a CpG island that extends from the promoter to the first exon of the FABP3 gene in our family-based cohort of Northern European descent (n=517). We then conducted statistical analysis of the quantitative relationship of CpG methylation and MetS measures following the variance-component association model. Heritability of each methylation and the effect of age and sex on CpG methylation were also assessed in our families. We find that methylation levels of individual CpG units and the regional average are heritable and significantly influenced by age and sex. Regional methylation was strongly associated with plasma total cholesterol (p=0.00028) and suggestively associated with LDL-cholesterol (p=0.00495). Methylation at individual units was significantly associated with insulin sensitivity, lipid particle sizing and diastolic blood pressure (p<0.0028, corrected for multiple testing for each trait). Peripheral white blood cell (PWBC) expression of FABP3 in a separate group of subjects (n=128) negatively correlated with adverse profiles of metabolism (βWHR=-0.72; βLDL-c=-0.53) while positively correlated with plasma adiponectin (β=0.24). Further, we show that differential methylation of FABP3 affects binding activity with nuclear proteins from heart tissue. This region that we found under methylation regulation overlaps with a region actively modified by histone codes in the newly available ENCODE data. Our findings suggest that DNA methylation of FABP3 strongly influences MetS, and this may have important implications for cardiovascular disease.
Rojas, Daniel; Rager, Julia E; Smeester, Lisa; Bailey, Kathryn A; Drobná, Zuzana; Rubio-Andrade, Marisela; Stýblo, Miroslav; García-Vargas, Gonzalo; Fry, Rebecca C
2015-01-01
Prenatal exposure to inorganic arsenic (iAs) is detrimental to the health of newborns and increases the risk of disease development later in life. Here we examined a subset of newborn cord blood leukocyte samples collected from subjects enrolled in the Biomarkers of Exposure to ARsenic (BEAR) pregnancy cohort in Gómez Palacio, Mexico, who were exposed to a range of drinking water arsenic concentrations (0.456-236 µg/l). Changes in iAs-associated DNA 5-methylcytosine methylation were assessed across 424,935 CpG sites representing 18,761 genes and compared with corresponding mRNA expression levels and birth outcomes. In the context of arsenic exposure, a total of 2919 genes were identified with iAs-associated differences in DNA methylation. Site-specific analyses identified DNA methylation changes that were most predictive of gene expression levels where CpG methylation within CpG islands positioned within the first exon, the 5' untranslated region and 200 bp upstream of the transcription start site yielded the most significant association with gene expression levels. A set of 16 genes was identified with correlated iAs-associated changes in DNA methylation and mRNA expression and all were highly enriched for binding sites of the early growth response (EGR) and CCCTC-binding factor (CTCF) transcription factors. Furthermore, DNA methylation levels of 7 of these genes were associated with differences in birth outcomes including gestational age and head circumference.These data highlight the complex interplay between DNA methylation, functional changes in gene expression and health outcomes and underscore the need for functional analyses coupled to epigenetic assessments. © The Author 2014. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Negrotto, Soledad; Ng, Kwok Peng; Jankowska, Ania M.; Bodo, Juraj; Gopalan, Banu; Guinta, Kathryn; Mulloy, James C.; Hsi, Eric; Maciejewski, Jaroslaw; Saunthararajah, Yogen
2011-01-01
The DNA hypomethylating drug decitabine maintains normal hematopoietic stem cell (HSC) self-renewal but induces terminal differentiation in acute myeloid leukemia (AML) cells. The basis for these contrasting cell-fates, and for selective CpG hypomethylation by decitabine, is poorly understood. Promoter CpGs, with methylation measured by microarray, were classified by the direction of methylation change with normal myeloid maturation. In AML cells, the methylation pattern at maturation-responsive CpG suggested at least partial maturation. Consistent with partial maturation, in gene expression analyses, AML cells expressed high levels of the key lineage-specifying factor CEBPA, but relatively low levels of the key late-differentiation driver CEBPE. In methylation analysis by mass-spectrometry, CEBPE promoter CpG that are usually hypomethylated during granulocyte maturation were significantly hypermethylated in AML cells. Decitabine treatment induced cellular differentiation of AML cells, and the largest methylation decreases were at CpG that are hypomethylated with myeloid maturation, including CEBPE promoter CpG. In contrast, decitabine-treated normal HSC retained immature morphology, and methylation significantly decreased at CpG that are less methylated in immature cells. High expression of lineage-specifying factor and aberrant epigenetic repression of some key late-differentiation genes distinguishes AML cells from normal HSC and could explain the contrasting differentiation and methylation responses to decitabine. PMID:21836612
Dopamine receptor D4 promoter hypermethylation increases the risk of drug addiction.
Ji, Huihui; Xu, Xuting; Liu, Guili; Liu, Huifen; Wang, Qinwen; Shen, Wenwen; Li, Longhui; Xie, Xiaohu; Hu, Haochang; Xu, Lei; Zhou, Wenhua; Duan, Shiwei
2018-02-01
Heroin and methylamphetamine (METH) are two addictive drugs that cause serious problems for society. Dopamine receptor D4 (DRD4), a key receptor in the dopaminergic system, may facilitate the development of drug addiction. The aim of the present study was to investigate the association between the promoter methylation level of DRD4 gene and drug addiction. Bisulfite pyrosequencing technology was used to measure the methylation levels of DRD4 promoter in 60 drug addicts and 52 matched controls. Significantly higher levels of DRD4 CpG1 and CpG4 methylation were detected in METH and heroin drug addicts compared with controls (P<0.05). Male METH addicts exhibited significantly higher DRD4 CpG1, CpG2 and CpG4 methylation levels compared with sex-matched controls (P<0.05). In heroin addicts, a positive correlation was observed between depression-dejection and DRD4 CpG5 methylation (r=0.537, P=0.039) whereas there was a negative correlation between drug usage frequency and CpG1 methylation (r=-0.632, P=0.011). In METH addicts, methylation levels were not significantly associated with depression-dejection and drug usage frequency. In addition, luciferase assays demonstrated that the target sequence of the DRD4 promoter upregulates gene expression. The results of the present study suggest that DNA methylation of DRD4 may be responsible for the pathophysiology of drug addiction.
Performances of Different Fragment Sizes for Reduced Representation Bisulfite Sequencing in Pigs.
Yuan, Xiao-Long; Zhang, Zhe; Pan, Rong-Yang; Gao, Ning; Deng, Xi; Li, Bin; Zhang, Hao; Sangild, Per Torp; Li, Jia-Qi
2017-01-01
Reduced representation bisulfite sequencing (RRBS) has been widely used to profile genome-scale DNA methylation in mammalian genomes. However, the applications and technical performances of RRBS with different fragment sizes have not been systematically reported in pigs, which serve as one of the important biomedical models for humans. The aims of this study were to evaluate capacities of RRBS libraries with different fragment sizes to characterize the porcine genome. We found that the Msp I-digested segments between 40 and 220 bp harbored a high distribution peak at 74 bp, which were highly overlapped with the repetitive elements and might reduce the unique mapping alignment. The RRBS library of 110-220 bp fragment size had the highest unique mapping alignment and the lowest multiple alignment. The cost-effectiveness of the 40-110 bp, 110-220 bp and 40-220 bp fragment sizes might decrease when the dataset size was more than 70, 50 and 110 million reads for these three fragment sizes, respectively. Given a 50-million dataset size, the average sequencing depth of the detected CpG sites in the 110-220 bp fragment size appeared to be deeper than in the 40-110 bp and 40-220 bp fragment sizes, and these detected CpG sties differently located in gene- and CpG island-related regions. In this study, our results demonstrated that selections of fragment sizes could affect the numbers and sequencing depth of detected CpG sites as well as the cost-efficiency. No single solution of RRBS is optimal in all circumstances for investigating genome-scale DNA methylation. This work provides the useful knowledge on designing and executing RRBS for investigating the genome-wide DNA methylation in tissues from pigs.
Ohtsuki, Shozo; Takahashi, Yuki; Inoue, Takao; Takakura, Yoshinobu; Nishikawa, Makiya
2017-10-20
We used human Toll-like receptor 9 (hTLR9)-expressing HEK-Blue hTLR9 cells, which release secreted embryonic alkaline phosphatase (SEAP) upon response to CpG DNA, to evaluate the immunological properties of nucleic acid drug candidates. Our preliminary studies showed that phosphodiester CpG DNA hardly induced any SEAP secretion in HEK-Blue hTLR9 cells. In the current study, therefore, we developed HEK-Blue hTLR9 cells transduced with human macrophage scavenger receptor-1 (hMSR1), a cell-surface DNA receptor, and determined whether HEK-Blue hTLR9/hMSR1 cells respond to phosphorothioate (PS) CpG DNA and phosphodiester (PO) CpG DNA. We selected PS CpG2006, a single-stranded PO CpG DNA (ssCpG), and a tetrapod-like structured DNA (tetrapodna) containing ssCpG (tetraCpG) as model TLR9 ligands. Alexa Fluor 488-labeled ligands were used for flow cytometry. Unlike the mock-transfected HEK-Blue hTLR9 cells, the HEK-Blue hTLR9/hMSR1 cells efficiently took up all three CpG DNAs. SEAP release was almost proportional to the uptake. Treatment of HEK-Blue hTLR9/hMSR1 cells with an anti-hMSR1 antibody significantly reduced the uptake of ssCpG and tetraCpG. Collectively, reconstruction of TLR9-mediated responses to CpG DNA in HEK-Blue hTLR9 cells can be used to evaluate the toxicity of nucleic acid drug candidates with diverse physicochemical properties.
Lee, Wei-Chung Allen; Nedivi, Elly
2011-01-01
cpg15 is an activity-regulated gene that encodes a membrane-bound ligand that coordinately regulates growth of apposing dendritic and axonal arbors and the maturation of their synapses. These properties make it an attractive candidate for participating in plasticity of the mammalian visual system. Here we compare cpg15 expression during normal development of the rat visual system with that seen in response to dark rearing, monocular blockade of retinal action potentials, or monocular deprivation. Our results show that the onset of cpg15 expression in the visual cortex is coincident with eye opening, and it increases until the peak of the critical period at postnatal day 28 (P28). This early expression is independent of both retinal activity and visual experience. After P28, a component of cpg15 expression in the visual cortex, lateral geniculate nucleus (LGN), and superior colliculus (SC) develops a progressively stronger dependence on retinally driven action potentials. Dark rearing does not affect cpg15 mRNA expression in the LGN and SC at any age, but it does significantly affect its expression in the visual cortex from the peak of the critical period and into adulthood. In dark-reared rats, the peak level of cpg15 expression in the visual cortex at P28 is lower than in controls. Rather than showing the normal decline with maturation, these levels are maintained in dark-reared animals. We suggest that the prolonged plasticity in the visual cortex that is seen in dark-reared animals may result from failure to downregulate genes such as cpg15 that could promote structural remodeling and synaptic maturation. PMID:11880509
Evidence-based clinical practice guideline for adult Still's disease.
Mimura, Toshihide; Kondo, Yuya; Ohta, Akihide; Iwamoto, Masahiro; Ota, Akiko; Okamoto, Nami; Kawaguchi, Yasushi; Kono, Hajime; Takasaki, Yoshinari; Takei, Shuji; Nishimoto, Norihiro; Fujimoto, Manabu; Asanuma, Yu Funakubo; Mimori, Akio; Okiyama, Naoko; Kaneko, Shunta; Takahashi, Hiroyuki; Yokosawa, Masahiro; Sumida, Takayuki
2018-05-09
Using an expert- and data-driven methodology, we have constructed the first clinical practice guidelines (CPGs) for adult Still's disease (ASD) after complete systematic review (SR) of the literature based upon the Medical Information Network Distribution Service (Minds) procedure. The CPG committee for ASD organized by the Research Team for Autoimmune Diseases, the Research Program for Intractable Disease of the Japanese Ministry of Health, Labour, and Welfare has developed CPG for ASD 2017, according to the procedure proposed by Minds. The CPG development process includes (1) clarification of the purpose of CPG, (2) organization of the steering committee, (3) organization of the CPG committee and secretariat, (4) defining the scope (setting of clinical questions (CQs)), (5) SR, (6) development of recommendations, (7) drafting the CPG, (8) external evaluation and public comments, and (9) release. Because we wanted to construct CPG for ASD to encompass both adult-onset Still's disease (AOSD) and adult patients with systemic juvenile idiopathic arthritis (sJIA), we also included SR data from sJIA in this study. Twenty-six CQs were selected and roughly divided into the following items: (1) clinical findings (CQs 1-4), (2) laboratory findings (CQs 5-8), (3) complications (CQs 9-13), (4) treatment with oral medicine (CQs 14-19), (5) treatment with biological reagents (CQs 20-23), and (6) treatments for sJIA (CQs 25-26). Recommendations and the strength of the recommendations for these CQs were decided by a modified Delphi method. We have developed the first published CPG for ASD including AOSD and sJIA, which includes 26 CQs and recommendations. This guideline will help rheumatologists, non-specialized physicians, other healthcare providers, medical and health-related students, and patients and their family members to understand and treat ASD.
Goetz, Lance L; Nelson, Audrey L; Guihan, Marylou; Bosshart, Helen T; Harrow, Jeffrey J; Gerhart, Kevin D; Krasnicka, Barbara; Burns, Stephen P
2005-01-01
Background/Objectives: Clinical Practice Guidelines (CPGs) have been published on a number of topics in spinal cord injury (SCI) medicine. Research in the general medical literature shows that the distribution of CPGs has a minimal effect on physician practice without targeted implementation strategies. The purpose of this study was to determine (a) whether dissemination of an SCI CPG improved the likelihood that patients would receive CPG recommended care and (b) whether adherence to CPG recommendations could be improved through a targeted implementation strategy. Specifically, this study addressed the “Neurogenic Bowel Management in Adults with Spinal Cord Injury” Clinical Practice Guideline published in March 1998 by the Consortium for Spinal Cord Medicine Methods: CPG adherence was determined from medical record review at 6 Veterans Affairs SCI centers for 3 time periods: before guideline publication (T1), after guideline publication but before CPG implementation (T2), and after targeted CPG implementation (T3). Specific implementation strategies to enhance guideline adherence were chosen to address the barriers identified by SCI providers in focus groups before the intervention. Results: Overall adherence to recommendations related to neurogenic bowel did not change between T1 and T2 (P = not significant) but increased significantly between T2 and T3 (P < 0.001) for 3 of 6 guideline recommendations. For the other 3 guideline recommendations, adherence rates were noted to be high at T1. Conclusions: While publication of the CPG alone did not alter rates of provider adherence, the use of a targeted implementation plan resulted in increases in adherence rates with some (3 of 6) CPG recommendations for neurogenic bowel management. PMID:16869086
Zandarashvili, Levani; White, Mark A; Esadze, Alexandre; Iwahara, Junji
2015-07-08
The inducible transcription factor Egr-1 binds specifically to 9-bp target sequences containing two CpG sites that can potentially be methylated at four cytosine bases. Although it appears that complete CpG methylation would make an unfavorable steric clash in the previous crystal structures of the complexes with unmethylated or partially methylated DNA, our affinity data suggest that DNA recognition by Egr-1 is insensitive to CpG methylation. We have determined, at a 1.4-Å resolution, the crystal structure of the Egr-1 zinc-finger complex with completely methylated target DNA. Structural comparison of the three different methylation states reveals why Egr-1 can recognize the target sequences regardless of CpG methylation. Copyright © 2015 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.
A terahertz EO detector with large dynamical range, high modulation depth and signal-noise ratio
NASA Astrophysics Data System (ADS)
Pan, Xinjian; Cai, Yi; Zeng, Xuanke; Zheng, Shuiqin; Li, Jingzhen; Xu, Shixiang
2017-05-01
The paper presents a novel design for terahertz (THz) free-space time domain electro-optic (EO) detection where the static birefringent phases of the two balanced arms are set close to zero but opposite to each other. Our theoretical and numerical analyses show this design has much stronger ability to cancel the optical background noise than both THz ellipsometer and traditional crossed polarizer geometry (CPG). Its optical modulation depth is about twice as high as that of traditional CPG, but about ten times as high as that of THz ellipsometer. As for the dynamical range, our improved design is comparable to the THz ellipsometer but obviously larger than the traditional CPG. Some experiments for comparing our improved CPG with traditional CPG agree well with the corresponding theoretical predictions. Our experiments also show that the splitting ratio of the used non-polarization beam splitter is critical for the performance of our design.
2010-01-01
Studies have shown that CpG oligodeoxyribonucleotides (ODN) protect mice from various bacterial pathogens, including Burkholderia pseudomallei and Francisella tularensis live vaccine strain (LVS), when administered before parenteral challenge. Given the potential to develop CpG ODN as a pre-treatment for multiple bacterial biological warfare agents, we examined survival, histopathology, and cytokine data from CpG ODN-treated C57BL/6 mice to determine whether previously-reported protection extended to aerosolized B. pseudomallei 1026b and highly virulent F. tularensis Schu S4 infections. We found that, although CpG ODN protected mice from aerosolized B. pseudomallei challenges, the immunostimulant failed to benefit the animals exposed to F. tularensis Schu S4 aerosols. Our results, which contrast with earlier F. tularensis LVS studies, highlight potential differences in Francisella species pathogenesis and underscore the need to evaluate immunotherapies against human pathogenic species. PMID:20181102
Rozak, David A; Gelhaus, Herbert C; Smith, Mark; Zadeh, Mojgan; Huzella, Louis; Waag, David; Adamovicz, Jeffrey J
2010-02-05
Studies have shown that CpG oligodeoxyribonucleotides (ODN) protect mice from various bacterial pathogens, including Burkholderia pseudomallei and Francisella tularensis live vaccine strain (LVS), when administered before parenteral challenge. Given the potential to develop CpG ODN as a pre-treatment for multiple bacterial biological warfare agents, we examined survival, histopathology, and cytokine data from CpG ODN-treated C57BL/6 mice to determine whether previously-reported protection extended to aerosolized B. pseudomallei 1026b and highly virulent F. tularensis Schu S4 infections. We found that, although CpG ODN protected mice from aerosolized B. pseudomallei challenges, the immunostimulant failed to benefit the animals exposed to F. tularensis Schu S4 aerosols. Our results, which contrast with earlier F. tularensis LVS studies, highlight potential differences in Francisella species pathogenesis and underscore the need to evaluate immunotherapies against human pathogenic species.
De Carli, Margherita M; Baccarelli, Andrea A; Trevisi, Letizia; Pantic, Ivan; Brennan, Kasey JM; Hacker, Michele R; Loudon, Holly; Brunst, Kelly J; Wright, Robert O; Wright, Rosalind J; Just, Allan C
2017-01-01
Aim: We compared predictive modeling approaches to estimate placental methylation using cord blood methylation. Materials & methods: We performed locus-specific methylation prediction using both linear regression and support vector machine models with 174 matched pairs of 450k arrays. Results: At most CpG sites, both approaches gave poor predictions in spite of a misleading improvement in array-wide correlation. CpG islands and gene promoters, but not enhancers, were the genomic contexts where the correlation between measured and predicted placental methylation levels achieved higher values. We provide a list of 714 sites where both models achieved an R2 ≥0.75. Conclusion: The present study indicates the need for caution in interpreting cross-tissue predictions. Few methylation sites can be predicted between cord blood and placenta. PMID:28234020
USDA-ARS?s Scientific Manuscript database
Selective methylation of CpG islands at imprinting control regions (ICR) determines the monoparental expression of a subset of genes. The imprinting marks are protected from global demethylation taking place during pre-implantation development before being reset in primordial germ cells. However, it...
New insights into replication origin characteristics in metazoans
Puy, Aurore; Rialle, Stéphanie; Kaplan, Noam; Segal, Eran
2012-01-01
We recently reported the identification and characterization of DNA replication origins (Oris) in metazoan cell lines. Here, we describe additional bioinformatic analyses showing that the previously identified GC-rich sequence elements form origin G-rich repeated elements (OGREs) that are present in 67% to 90% of the DNA replication origins from Drosophila to human cells, respectively. Our analyses also show that initiation of DNA synthesis takes place precisely at 160 bp (Drosophila) and 280 bp (mouse) from the OGRE. We also found that in most CpG islands, an OGRE is positioned in opposite orientation on each of the two DNA strands and detected two sites of initiation of DNA synthesis upstream or downstream of each OGRE. Conversely, Oris not associated with CpG islands have a single initiation site. OGRE density along chromosomes correlated with previously published replication timing data. Ori sequences centered on the OGRE are also predicted to have high intrinsic nucleosome occupancy. Finally, OGREs predict G-quadruplex structures at Oris that might be structural elements controlling the choice or activation of replication origins. PMID:22373526
Lee, Seung-Tae; Wiemels, Joseph L
2016-02-18
The epigenetic landscape of cancer includes both focal hypermethylation and broader hypomethylation in a genome-wide manner. By means of a comprehensive genomic analysis on 6637 tissues of 21 tumor types, we here show that the degrees of overall methylation in CpG island (CGI) and demethylation in intergenic regions, defined as 'backbone', largely vary among different tumors. Depending on tumor type, both CGI methylation and backbone demethylation are often associated with clinical, epidemiological and biological features such as age, sex, smoking history, anatomic location, histological type and grade, stage, molecular subtype and biological pathways. We found connections between CGI methylation and hypermutability, microsatellite instability, IDH1 mutation, 19p gain and polycomb features, and backbone demethylation with chromosomal instability, NSD1 and TP53 mutations, 5q and 19p loss and long repressive domains. These broad epigenetic patterns add a new dimension to our understanding of tumor biology and its clinical implications. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Wong, Rebecca Lee Yean; Wang, Quan; Treviño, Lindsey S; Bosland, Maarten C; Chen, Jing; Medvedovic, Mario; Prins, Gail S; Kannan, Kurunthachalam; Ho, Shuk-Mei; Walker, Cheryl Lyn
2015-01-01
Secretoglobins are a superfamily of secreted proteins thought to participate in inflammation, tissue repair, and tumorigenesis. Secretoglobin family 2A member 1 (Scgb2a1) is a component of prostatein, a major androgen-binding protein secreted by the rat prostate. Using a rat model for developmental reprogramming of susceptibility to prostate carcinogenesis, we identified, by RNA-seq, that Scgb2a1 is significantly upregulated (>100-fold) in the prostate of adult rats neonatally exposed to bisphenol A (BPA), with increased gene expression confirmed by quantitative RT-PCR and chromatin immunoprecipitation for histone H3 lysine 9 acetylation. Bisulfite analysis of both CpG islands located within 10 kb of the Scgb2a1 promoter identified significant hypomethylation of the CpG island upstream of the transcription start site of this gene in the reprogrammed prostate. These data suggest that expression of Scgb2a1 in the adult prostate could be epigenetically reprogrammed by BPA exposure during prostate development, with potential implications for cancer risk and response to chemotherapeutics associated with prostatein binding.
DNA activates human immune cells through a CpG sequence-dependent manner
Bauer, M; Heeg, K; Wagner, H; Lipford, G B
1999-01-01
While bacterial DNA and cytosine–guanosine-dinucleotide-containing oligonucleotides (CpG ODN) are well described activators of murine immune cells, their effect on human cells is inconclusive. We investigated their properties on human peripheral blood mononuclear cells (PBMC) and subsets thereof, such as purified monocytes, T and B cells. Here we demonstrate that bacterial DNA and CpG ODN induce proliferation of B cells, while other subpopulations, such as monocytes and T cells, did not proliferate. PBMC mixed cell cultures, as well as purified monocytes, produced interleukin-6 (IL-6), IL-12 and tumour necrosis factor-α upon stimulation with bacterial DNA; however, only IL-6 and IL-12 secretion became induced upon CpG ODN stimulation. We conclude that monocytes, but not B or T cells, represent the prime source of cytokines. Monocytes up-regulated expression of antigen-presenting, major histocompatibility complex class I and class II molecules in response to CpG DNA. In addition, both monocytes and B cells up-regulate costimulatory CD86 and CD40 molecules. The activation by CpG ODN depended on sequence motifs containing the core dinucleotide CG since destruction of the motif strongly reduced immunostimulatory potential. PMID:10457226
Wils, Julien; Fonfrède, Michèle; Augereau, Christine; Watine, Joseph
2014-01-01
Several tools are available to help evaluate the quality of clinical practice guidelines (CPG). The AGREE instrument (Appraisal of guidelines for research & evaluation) is the most consensual tool but it has been designed to assess CPG methodology only. The European federation of laboratory medicine (EFLM) recently designed a check-list dedicated to laboratory medicine which is supposed to be comprehensive and which therefore makes it possible to evaluate more thoroughly the quality of CPG in laboratory medicine. In the present work we test the comprehensiveness of this check-list on a sample of CPG written in French and published in Annales de biologie clinique (ABC). Thus we show that some work remains to be achieved before a truly comprehensive check-list is designed. We also show that there is some room for improvement for the CPG published in ABC, for example regarding the fact that some of these CPG do not provide any information about allowed durations of transport and of storage of biological samples before analysis, or about standards of minimal analytical performance, or about the sensitivities or the specificities of the recommended tests.
Immunotherapeutic potential of CpG oligodeoxynucleotides in veterinary species.
Manuja, Anju; Manuja, Balvinder K; Kaushik, Jyoti; Singha, Harisankar; Singh, Raj Kumar
2013-10-01
Innate immunity plays a critical role in host defense against infectious diseases by discriminating between self and infectious non-self. The recognition of infectious non-self involves germ-line encoded pattern recognition receptors (PRRs) that recognize pathogen-associated molecular patterns (PAMPs). The PAMPs are the components of pathogenic microbes which include not only the cell wall constituents but also the unmethylated 2'-deoxy-ribo-cytosine-phosphate-guanosine (CpG) motifs. These CpG motifs present within bacterial and viral DNA are recognized by toll-like receptor 9 (TLR9), and signaling by this receptor triggers a proinflammatory cytokine response which, in turn, influences both innate and adaptive immune responses. The activation of TLR9 with synthetic CpG oligodeoxynucleotides (ODNs) induces powerful Th1-like immune responses. It has been shown to provide protection against infectious diseases, allergy and cancer in laboratory animal models and some domestic animal species. With better understanding of the basic biology and immune mechanisms, it would be possible to exploit the potential of CpG motifs for animal welfare. The research developments in the area of CpG and TLR9 and the potential applications in animal health have been reviewed in this article.
Bing, Zhenshan; Cheng, Long; Chen, Guang; Röhrbein, Florian; Huang, Kai; Knoll, Alois
2017-04-04
Snake-like robots with 3D locomotion ability have significant advantages of adaptive travelling in diverse complex terrain over traditional legged or wheeled mobile robots. Despite numerous developed gaits, these snake-like robots suffer from unsmooth gait transitions by changing the locomotion speed, direction, and body shape, which would potentially cause undesired movement and abnormal torque. Hence, there exists a knowledge gap for snake-like robots to achieve autonomous locomotion. To address this problem, this paper presents the smooth slithering gait transition control based on a lightweight central pattern generator (CPG) model for snake-like robots. First, based on the convergence behavior of the gradient system, a lightweight CPG model with fast computing time was designed and compared with other widely adopted CPG models. Then, by reshaping the body into a more stable geometry, the slithering gait was modified, and studied based on the proposed CPG model, including the gait transition of locomotion speed, moving direction, and body shape. In contrast to sinusoid-based method, extensive simulations and prototype experiments finally demonstrated that smooth slithering gait transition can be effectively achieved using the proposed CPG-based control method without generating undesired locomotion and abnormal torque.
CpG methylation increases the DNA binding of 9-aminoacridine carboxamide Pt analogues.
Kava, Hieronimus W; Murray, Vincent
2016-10-01
This study investigated the effect of CpG methylation on the DNA binding of cisplatin analogues with an attached aminoacridine intercalator. DNA-targeted 9-aminoacridine carboxamide Pt complexes are known to bind at 5'-CpG sequences. Their binding to methylated and non-methylated 5'-CpG sequences was determined and compared with cisplatin. The damage profiles of each platinum compound were quantified via a polymerase stop assay with fluorescently labelled primers and capillary electrophoresis. Methylation at 5'-CpG was shown to significantly increase the binding intensity for the 9-aminoacridine carboxamide compounds, whereas no significant increase was found for cisplatin. 5'-CpG methylation had the largest effect on the 9-ethanolamine-acridine carboxamide Pt complex, followed by the 9-aminoacridine carboxamide Pt complex and the 7-fluoro complex. The methylation state of a cell's genome is important in maintaining normal gene expression, and is often aberrantly altered in cancer cells. An analogue of cisplatin which differentially targets methylated DNA may be able to improve its therapeutic activity, or alter its range of targets and evade the chemoresistance which hampers cisplatin efficacy in clinical use. Copyright © 2016 Elsevier Ltd. All rights reserved.
Kumar, Sanjai; Jones, Trevor R.; Oakley, Miranda S.; Zheng, Hong; Kuppusamy, Shanmuga P.; Taye, Alem; Krieg, Arthur M.; Stowers, Anthony W.; Kaslow, David C.; Hoffman, Stephen L.
2004-01-01
Unmethylated CpG dinucleotide motifs present in bacterial genomes or synthetic oligodeoxynucleotides (ODNs) serve as strong immunostimulatory agents in mice, monkeys and humans. We determined the adjuvant effect of murine CpG ODN 1826 on the immunogenicity and protective efficacy of the Saccharomyces cerevisiae-expressed 19-kDa C-terminal region of merozoite surface protein 1 (yMSP119) of the murine malaria parasite Plasmodium yoelii. We found that in C57BL/6 mice, following sporozoite challenge, the degree of protective immunity against malaria induced by yMSP119 in a formulation of Montanide ISA 51 (ISA) plus CpG ODN 1826 was similar or superior to that conferred by yMSP119 emulsified in complete Freund's adjuvant (CFA/incomplete Freund's adjuvant). In total, among mice immunized with yMSP119, 22 of 32 (68.7%) with ISA plus CpG 1826, 0 of 4 (0%) with CFA/incomplete Freund’s adjuvant, 0 of 4 (0%) with CpG 1826 mixed with ISA (no yMSP119), and 0 of 11 (0%) with CpG 1826 alone were completely protected against development of erythrocytic stage infection after sporozoite challenge. The adjuvant effect of CpG ODN 1826 was manifested as both significantly improved complete protection from malaria (defined as the absence of detectable erythrocytic form parasites) (P = 0.007, chi square) and reduced parasite burden in infected mice. In vivo depletions of interleukin-12 and gamma interferon cytokines and CD4+ and CD8+ T cells in vaccinated mice had no significant effect on immunity. On the other hand, immunoglobulin G (IgG) isotype levels appeared to correlate with protection. Inclusion of CpG ODN 1826 in the yMSP119 plus ISA vaccine contributed towards the induction of higher levels of IgG2a and IgG2b (Th1 type) antibodies, suggesting that CpG ODN 1826 caused a shift towards a Th1 type of immune response that could be responsible for the higher degree of protective immunity. Our results indicate that this potent adjuvant formulation should be further evaluated for use in clinical trials of recombinant malarial vaccine candidates. PMID:14742540
Brumley, Michele R; Guertin, Pierre A; Taccola, Giuliano
2017-01-01
Locomotion is one of the most complex motor behaviors. Locomotor patterns change during early life, reflecting development of numerous peripheral and hierarchically organized central structures. Among them, the spinal cord is of particular interest since it houses the central pattern generator (CPG) for locomotion. This main command center is capable of eliciting and coordinating complex series of rhythmic neural signals sent to motoneurons and to corresponding target-muscles for basic locomotor activity. For a long-time, the CPG has been considered a black box. In recent years, complementary insights from in vitro and in vivo animal models have contributed significantly to a better understanding of its constituents, properties and ways to recover locomotion after a spinal cord injury (SCI). This review discusses key findings made by comparing the results of in vitro isolated spinal cord preparations and spinal-transected in vivo models from neonatal animals. Pharmacological, electrical, and sensory stimulation approaches largely used to further understand CPG function may also soon become therapeutic tools for potent CPG reactivation and locomotor movement induction in persons with SCI or developmental neuromuscular disorder. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
[The German program for disease management guidelines: evaluation by use of quality indicators].
Kopp, Ina B; Geraedts, Max; Jäckel, Wilfried H; Altenhofen, Lutz; Thomeczek, Christian; Ollenschläger, Günter
2007-08-15
The Program for National Disease Management Guidelines (German DM-CPG Program) in Germany aims at the implementation of best-practice recommendations for prevention, acute care, rehabilitation and chronic care in the setting of disease management programs and integrated health-care systems. Like other guidelines, DM-CPG need to be assessed regarding their influence on structures, processes and outcomes of care. However, quality assessment in integrated health-care systems is challenging. On the one hand, a multitude of potential domains for measurement, actors and perspectives need to be considered. On the other hand, measures need to be identified that assess the function of the diagnostic and therapeutic chain in terms of cooperation and coordination of care. The article reviews methods and use of quality indicators in the context of the German DM-CPG Program.
Inhibitory and modulatory inputs to the vocal central pattern generator of a teleost fish
Rosner, Elisabeth; Rohmann, Kevin N.; Bass, Andrew H.
2018-01-01
Abstract Vocalization is a behavioral feature that is shared among multiple vertebrate lineages, including fish. The temporal patterning of vocal communication signals is set, in part, by central pattern generators (CPGs). Toadfishes are well‐established models for CPG coding of vocalization at the hindbrain level. The vocal CPG comprises three topographically separate nuclei: pre‐pacemaker, pacemaker, motor. While the connectivity between these nuclei is well understood, their neurochemical profile remains largely unexplored. The highly vocal Gulf toadfish, Opsanus beta, has been the subject of previous behavioral, neuroanatomical and neurophysiological studies. Combining transneuronal neurobiotin‐labeling with immunohistochemistry, we map the distribution of inhibitory neurotransmitters and neuromodulators along with gap junctions in the vocal CPG of this species. Dense GABAergic and glycinergic label is found throughout the CPG, with labeled somata immediately adjacent to or within CPG nuclei, including a distinct subset of pacemaker neurons co‐labeled with neurobiotin and glycine. Neurobiotin‐labeled motor and pacemaker neurons are densely co‐labeled with the gap junction protein connexin 35/36, supporting the hypothesis that transneuronal neurobiotin‐labeling occurs, at least in part, via gap junction coupling. Serotonergic and catecholaminergic label is also robust within the entire vocal CPG, with additional cholinergic label in pacemaker and prepacemaker nuclei. Likely sources of these putative modulatory inputs are neurons within or immediately adjacent to vocal CPG neurons. Together with prior neurophysiological investigations, the results reveal potential mechanisms for generating multiple classes of social context‐dependent vocalizations with widely divergent temporal and spectral properties. PMID:29424431
Zhao, Liang-Yun; Kapur, Payal; Wu, Kai-Jie; Wang, Bin; Yu, Yan-Hong; Liao, Bing; He, Da-Lin; Chen, Wei; Margulis, Vitaly; Hsieh, Jer-Tsong; Luo, Jun-Hang
2016-01-01
We have recently reported tumor suppressive role of DAB2IP in RCC development. In this study, We identified one CpG methylation biomarker (DAB2IP CpG1) located UTSS of DAB2IP that was associated with poor overall survival in a cohort of 318 ccRCC patients from the Cancer Genome Atlas (TCGA). We further validated the prognostic accuracy of DAB2IP CpG methylation by pyrosequencing quantitative methylation assay in 224 ccRCC patients from multiple Chinese centers (MCHC set), and 239 patients from University of Texas Southwestern Medical Center at Dallas (UTSW set) by using FFPE samples. DAB2IP CpG1 can predict the overall survival of patients in TCGA, MCHC, and UTSW sets independent of patient age, Fuhrman grade and TNM stage (all p<0.05). DAB2IP CpG1 successfully categorized patients into high-risk and low-risk groups with significant differences of clinical outcome in respective clinical subsets, regardless of age, sex, grade, stage, or race (HR: 1.63-7.83; all p<0.05). The detection of DAB2IP CpG1 methylation was minimally affected by ITH in ccRCC. DAB2IP mRNA expression was regulated by DNA methylation in vitro. DAB2IP CpG1 methylation is a practical and repeatable biomarker for ccRCC, which can provide prognostic value that complements the current staging system. PMID:27129174
CpG Distribution and Methylation Pattern in Porcine Parvovirus
Tóth, Renáta; Mészáros, István; Stefancsik, Rajmund; Bartha, Dániel; Bálint, Ádám; Zádori, Zoltán
2013-01-01
Based on GC content and the observed/expected CpG ratio (oCpGr), we found three major groups among the members of subfamily Parvovirinae: Group I parvoviruses with low GC content and low oCpGr values, Group II with low GC content and high oCpGr values and Group III with high GC content and high oCpGr values. Porcine parvovirus belongs to Group I and it features an ascendant CpG distribution by position in its coding regions similarly to the majority of the parvoviruses. The entire PPV genome remains hypomethylated during the viral lifecycle independently from the tissue of origin. In vitro CpG methylation of the genome has a modest inhibitory effect on PPV replication. The in vitro hypermethylation disappears from the replicating PPV genome suggesting that beside the maintenance DNMT1 the de novo DNMT3a and DNMT3b DNA methyltransferases can’t methylate replicating PPV DNA effectively either, despite that the PPV infection does not seem to influence the expression, translation or localization of the DNA methylases. SNP analysis revealed high mutability of the CpG sites in the PPV genome, while introduction of 29 extra CpG sites into the genome has no significant biological effects on PPV replication in vitro. These experiments raise the possibility that beyond natural selection mutational pressure may also significantly contribute to the low level of the CpG sites in the PPV genome. PMID:24392033
Saito, Kuniaki; Mukasa, Akitake; Nagae, Genta; Aihara, Koki; Otani, Ryohei; Takayanagi, Shunsaku; Omata, Mayu; Tanaka, Shota; Shibahara, Junji; Takahashi, Miwako; Momose, Toshimitsu; Shimamura, Teppei; Miyano, Satoru; Narita, Yoshitaka; Ueki, Keisuke; Nishikawa, Ryo; Nagane, Motoo; Aburatani, Hiroyuki; Saito, Nobuhito
2014-01-01
Low-grade gliomas often undergo malignant progression, and these transformations are a leading cause of death in patients with low-grade gliomas. However, the molecular mechanisms underlying malignant tumor progression are still not well understood. Recent evidence indicates that epigenetic deregulation is an important cause of gliomagenesis; therefore, we examined the impact of epigenetic changes during malignant progression of low-grade gliomas. Specifically, we used the Illumina Infinium Human Methylation 450K BeadChip to perform genome-wide DNA methylation analysis of 120 gliomas and four normal brains. This study sample included 25 matched-pairs of initial low-grade gliomas and recurrent tumors (temporal heterogeneity) and 20 of the 25 recurring tumors recurred as malignant progressions, and one matched-pair of newly emerging malignant lesions and pre-existing lesions (spatial heterogeneity). Analyses of methylation profiles demonstrated that most low-grade gliomas in our sample (43/51; 84%) had a CpG island methylator phenotype (G-CIMP). Remarkably, approximately 50% of secondary glioblastomas that had progressed from low-grade tumors with the G-CIMP status exhibited a characteristic partial demethylation of genomic DNA during malignant progression, but other recurrent gliomas showed no apparent change in DNA methylation pattern. Interestingly, we found that most loci that were demethylated during malignant progression were located outside of CpG islands. The information of histone modifications patterns in normal human astrocytes and embryonal stem cells also showed that the ratio of active marks at the site corresponding to DNA demethylated loci in G-CIMP-demethylated tumors was significantly lower; this finding indicated that most demethylated loci in G-CIMP-demethylated tumors were likely transcriptionally inactive. A small number of the genes that were upregulated and had demethylated CpG islands were associated with cell cycle-related pathway. In summary, we demonstrated that characteristic DNA demethylation occurred during malignant progression of a subset of low-grade gliomas. The mechanisms underlying and consequences of such DNA demethylation should be studied further.
Bae, Jeong Mo; Rhee, Ye-Young; Kim, Kyung Ju; Wen, Xianyu; Song, Young Seok; Cho, Nam-Yun; Kim, Jung Ho; Kang, Gyeong Hoon
2016-01-01
CpG island methylator phenotype (CIMP)-high (CIMP-H) colorectal cancer (CRC) is defined when a tumor shows methylation at greater than or equal to 60% of CIMP panel markers. Although CRCs with methylation at 50% of panel markers are classified as CIMP-low/CIMP-0 tumors, little is known regarding the clinicopathological and molecular features of CRCs with methylation at 4/8 panel markers (4/8 methylated markers) and whether they are akin to CIMP-H or CIMP-low/CIMP-0 CRCs in terms of their clinicopathological or molecular features. A total of 1164 cases of surgically resected CRC were analyzed for their methylation status in 8 CIMP panel markers, and the frequencies of various clinicopathological and molecular features were compared between CRCs with 0/8, 1/8 to 3/8, 4/8, and 5/8 to 8/8 methylated markers. CRCs with 4/8 methylated markers were closer to CRCs with 5/8 to 8/8 methylated markers in terms of sex distribution, mucin production, serration, nodal metastasis, CK7 expression, CK20 loss, and CDX2 loss frequencies and overall survival rate. CRCs with methylation at 4/8 markers were closer to CRCs with 1/8 to 3/8 methylated markers in terms of less frequent right colon location and poor differentiation. CRCs with 4/8 methylated markers showed the shortest overall survival time compared with CRCs with 0/8, 1/8 to 3/8, 4/8, or 5/8 to 8/8 methylated markers. In terms of clinicopathological and molecular features, CRCs with 4/8 methylated markers appeared to be closer to CIMP-H than to CIMP-low/CIMP-0 and would thus be better classified as CIMP-H if the CRCs require classification into either CIMP-H or CIMP-low/CIMP-0. Copyright © 2015 Elsevier Inc. All rights reserved.
Schernhammer, Eva S; Giovannucci, Edward; Baba, Yoshifumi; Fuchs, Charles S; Ogino, Shuji
2011-01-01
One-carbon metabolism appears to play an important role in DNA methylation reaction. Evidence suggests that a low intake of B vitamins or high alcohol consumption increases colorectal cancer risk. How one-carbon nutrients affect the CpG island methylator phenotype (CIMP) or BRAF mutation status in colon cancer remains uncertain. Utilizing incident colon cancers in a large prospective cohort of women (the Nurses' Health Study), we determined BRAF status (N = 386) and CIMP status (N = 375) by 8 CIMP-specific markers [CACNA1G, CDKN2A (p16), CRABP1, IGF2, MLH1, NEUROG1, RUNX3, and SOCS1], and 8 other CpG islands (CHFR, HIC1, IGFBP3, MGMT, MINT-1, MINT-31, p14, and WRN). We examined the relationship between intake of one-carbon nutrients and alcohol and colon cancer risk, by BRAF mutation or CIMP status. Higher folate intake was associated with a trend towards low risk of CIMP-low/0 tumors [total folate intake ≥400 µg/day vs. <200 µg/day; the multivariate relative risk = 0.73; 95% CI = 0.53-1.02], whereas total folate intake had no influence on CIMP-high tumor risks (P(heterogeneity) = 0.73). Neither vitamin B(6), methionine or alcohol intake appeared to differentially influence risks for CIMP-high and CIMP-low/0 tumors. Using the 16-marker CIMP panel did not substantially alter our results. B vitamins, methionine or alcohol intake did not affect colon cancer risk differentially by BRAF status. This molecular pathological epidemiology study suggests that low level intake of folate may be associated with an increased risk of CIMP-low/0 colon tumors, but not that of CIMP-high tumors. However, the difference between CIMP-high and CIMP-low/0 cancer risks was not statistically significant, and additional studies are necessary to confirm these observations.
Jia, Min; Jansen, Lina; Walter, Viola; Tagscherer, Katrin; Roth, Wilfried; Herpel, Esther; Kloor, Matthias; Bläker, Hendrik; Chang-Claude, Jenny; Brenner, Hermann; Hoffmeister, Michael
2016-01-01
Background: Previous studies have shown adverse effects of CpG island methylator phenotype (CIMP) on colorectal cancer (CRC) prognosis. However, sample sizes were often limited and only few studies were able to adjust for relevant molecular features associated with CIMP. The aim of this study was to investigate the impact of CIMP on CRC survival in a large population-based study with comprehensive adjustment. Methods: The CIMP status and other molecular tumour features were analysed in 1385 CRC patients diagnosed between 2003 and 2010. Detailed information were obtained from standardised personal interviews and medical records. During follow-up (median: 4.9 years), we assessed vital status, cause of death and therapy details. Cox proportional hazard regression models were used to estimate adjusted hazard ratios (HRs) and 95% confidence intervals (CIs) of survival after CRC. Results: The CIMP-H occurred more frequently in patients with older age, female gender, cancer in the proximal colon, BRAF mutation and microsatellite instability-high (MSI-H). However, CIMP status was not associated with CRC prognosis in CRC patients (HR=1.00; 95% CI=0.72–1.40 for overall survival; HR=0.96; 95% CI=0.65–1.41 for disease-specific survival) or in any of the subgroups. Although CIMP status was associated with the presence of MSI-H and BRAF mutation, the prognostic effects of MSI-H (HR=0.49; 95% CI=0.27–0.90) and BRAF mutation (HR=1.78; 95% CI=1.10–2.84) were independent of CIMP status. Similar benefit of chemotherapy was found for CRC outcomes in both the CIMP-low/negative group and the CIMP-high group. Conclusions: CpG island methylator phenotype was not associated with CRC prognosis after adjusting for other important clinical factors and associated mutations. PMID:27811854
Long, Tiffany I.; Buchanan, Daniel D.; Walters, Rhiannon; Clendenning, Mark; Rosty, Christophe; Joshi, Amit D.; Stern, Mariana C.; LeMarchand, Loic; Lindor, Noralane M.; Daftary, Darshana; Gallinger, Steven; Selander, Teresa; Bapat, Bharati; Newcomb, Polly A.; Campbell, Peter T.; Casey, Graham; Ahnen, Dennis J.; Baron, John A.; Haile, Robert W.; Hopper, John L.; Young, Joanne P.; Laird, Peter W.; Siegmund, Kimberly D.
2015-01-01
Background The CpG Island Methylator Phenotype (CIMP) represents a subset of colorectal cancers (CRCs) characterized by widespread aberrant DNA hypermethylation at select CpG islands. The risk factors and environmental exposures contributing to etiologic heterogeneity between CIMP and non-CIMP tumors are not known. Methods We measured the CIMP status of 3,119 primary population-based CRC tumors from the multinational Colon Cancer Family Registry. Etiologic heterogeneity was assessed by a case-case study comparing risk factor frequency of CRC cases with CIMP and non-CIMP tumors using logistic regression to estimate the case-case odds ratio (ccOR). Results We found associations between tumor CIMP status and MSI-H (ccOR=7.6), BRAF V600E mutation (ccOR=59.8), proximal tumor site (ccOR=9) (all p<0.0001), female sex (ccOR=1.8; 95% CI=1.5-2.1), older age (ccOR=4.0 comparing over 70 years vs under 50; 95% CI=3.0-5.5) and family history of CRC (ccOR=0.6, 95% CI=0.5-0.7). While use of NSAIDs varied by tumor CIMP status for both males and females (p=0.0001 and p=0.02, respectively), use of multi-vitamin or calcium supplements did not. Only for female CRCs was CIMP status associated with increased pack-years of smoking (trend p < 0.001) and body mass index (BMI) (trend p = 0.03). Conclusions The frequency of several CRC risk factors varied by CIMP status, and the associations of smoking and obesity with tumor subtype were evident only for females. Impact Differences in the associations of a unique DNA methylation-based subgroup of CRC with important lifestyle and environmental exposures increase understanding of the molecular pathologic epidemiology of this heavily methylated subset of CRCs. PMID:25587051
Weisenberger, Daniel J; Levine, A Joan; Long, Tiffany I; Buchanan, Daniel D; Walters, Rhiannon; Clendenning, Mark; Rosty, Christophe; Joshi, Amit D; Stern, Mariana C; LeMarchand, Loic; Lindor, Noralane M; Daftary, Darshana; Gallinger, Steven; Selander, Teresa; Bapat, Bharati; Newcomb, Polly A; Campbell, Peter T; Casey, Graham; Ahnen, Dennis J; Baron, John A; Haile, Robert W; Hopper, John L; Young, Joanne P; Laird, Peter W; Siegmund, Kimberly D
2015-03-01
The CpG island methylator phenotype (CIMP) represents a subset of colorectal cancers characterized by widespread aberrant DNA hypermethylation at select CpG islands. The risk factors and environmental exposures contributing to etiologic heterogeneity between CIMP and non-CIMP tumors are not known. We measured the CIMP status of 3,119 primary population-based colorectal cancer tumors from the multinational Colon Cancer Family Registry. Etiologic heterogeneity was assessed by a case-case study comparing risk factor frequency of colorectal cancer cases with CIMP and non-CIMP tumors using logistic regression to estimate the case-case odds ratio (ccOR). We found associations between tumor CIMP status and MSI-H (ccOR = 7.6), BRAF V600E mutation (ccOR = 59.8), proximal tumor site (ccOR = 9; all P < 0.0001), female sex [ccOR = 1.8; 95% confidence interval (CI), 1.5-2.1], older age (ccOR = 4.0 comparing over 70 years vs. under 50; 95% CI, 3.0-5.5), and family history of CRC (ccOR = 0.6; 95% CI, 0.5-0.7). While use of NSAIDs varied by tumor CIMP status for both males and females (P = 0.0001 and P = 0.02, respectively), use of multivitamin or calcium supplements did not. Only for female colorectal cancer was CIMP status associated with increased pack-years of smoking (Ptrend < 0.001) and body mass index (BMI; Ptrend = 0.03). The frequency of several colorectal cancer risk factors varied by CIMP status, and the associations of smoking and obesity with tumor subtype were evident only for females. Differences in the associations of a unique DNA methylation-based subgroup of colorectal cancer with important lifestyle and environmental exposures increase understanding of the molecular pathologic epidemiology of this heavily methylated subset of colorectal cancer. Cancer Epidemiol Biomarkers Prev; 24(3); 512-9. ©2015 AACR. ©2015 American Association for Cancer Research.
Lintas, Carla; Sacco, Roberto; Persico, Antonio M
2016-01-01
Reelin plays a pivotal role in neurodevelopment and in post-natal synaptic plasticity and has been implicated in the pathogenesis of autism spectrum disorder (ASD). The reelin (RELN) gene expression is significantly decreased in ASD, both in the brain and peripherally. Methylation at the RELN gene promoter is largely triggered at puberty, and hypermethylation has been found in post-mortem brains of schizophrenic and bipolar patients. In this study, we assessed RELN gene methylation status in post-mortem temporocortical tissue samples (BA41/42 or 22) of six pairs of post-puberal individuals with ASD and typically developing subjects, matched for sex (male:female, M:F = 5:1), age, and post-mortem interval. ASD patients display a significantly higher number of methylated CpG islands and heavier methylation in the 5' region of the RELN gene promoter, spanning from -458 to -223 bp, whereas controls have more methylated CpG positions and greater extent of methylation at the 3' promoter region, spanning from -222 to +1 bp. The most upstream promoter region (-458 to -364 bp) is methylated only in ASD brains, while the most downstream region (-131 to +1 bp) is methylated exclusively in control brains. Within this general framework, three different methylation patterns are discernible, each correlated with different extents of reduction in reelin gene expression among ASD individuals compared to controls. The methylation pattern is different in ASD and control post-mortem brains. ASD-specific CpG positions, located in the most upstream gene promoter region, may exert a functional role potentially conferring ASD risk by blunting RELN gene expression.
Jung, Myung-Hwa; Lee, Jehee; Ortega-Villaizan, M; Perez, Luis; Jung, Sung-Ju
2017-06-27
Rock bream iridovirus (RBIV) disease in rock bream (Oplegnathus fasciatus) remains an unsolved problem in Korea aquaculture farms. CpG ODNs are known as immunostimulant, can improve the innate immune system of fish providing resistance to diseases. In this study, we evaluated the potential of CpG ODNs to induce anti-viral status protecting rock bream from different RBIV infection conditions. We found that, when administered into rock bream, CpG ODN 1668 induces better antiviral immune responses compared to other 5 CpG ODNs (2216, 1826, 2133, 2395 and 1720). All CpG ODN 1668 administered fish (1/5µg) at 2days before infection (1.1×10 7 ) held at 26°C died even though mortality was delayed from 8days (1µg) and 4days (5µg). Similarly, CpG ODN 1668 administered (5µg) at 2days before infection (1.2×10 6 ) held at 23/20°C had 100% mortality; the mortality was delayed from 9days (23°C) and 11days (20°C). Moreover, when CpG ODN 1668 administered (1/5/10µg) at 2/4/7days before infection or virus concentration was decreased to 1.1×10 4 and held at 20°C had mortality rates of 20/60/30% (2days), 30/40/60% (4days) and 60/60/20% (7days), respectively, for the respective administration dose, through 100 dpi. To investigate the development of a protective immune response, survivors were re-infected with RBIV (1.1×10 7 ) at 100 and 400 dpi, respectively. While 100% of the previously unexposed fish died, 100% of the previously infected fish survived. The high survival rate of fish following re-challenge with RBIV indicates that protective immunity was established in the surviving rock bream. Our results showed the possibility of developing preventive measures against RBIV using CpG ODN 1668 by reducing RBIV replication speed (i.e. water temperature of 20°C and infection dose of 1.1×10 4 ). Copyright © 2017 Elsevier Ltd. All rights reserved.
Minang, Jacob T; Inglefield, Jon R; Harris, Andrea M; Lathey, Janet L; Alleva, David G; Sweeney, Diane L; Hopkins, Robert J; Lacy, Michael J; Bernton, Edward W
2014-11-28
NuThrax™ (Anthrax Vaccine Adsorbed with CPG 7909 Adjuvant) (AV7909) is in development. Samples obtained in a phase Ib clinical trial were tested to confirm biomarkers of innate immunity and evaluate effects of CPG 7909 (PF-03512676) on adaptive immunity. Subjects received two intramuscular doses of commercial BioThrax(®) (Anthrax Vaccine Adsorbed, AVA), or two intramuscular doses of one of four formulations of AV7909. IP-10, IL-6, and C-reactive protein (CRP) levels were elevated 24-48 h after administration of AV7909 formulations, returning to baseline by Day 7. AVA (no CPG 7909) resulted in elevated IL-6 and CRP, but not IP-10. Another marker of CpG, transiently decreased absolute lymphocyte counts (ALCs), correlated with transiently increased IP-10. Cellular recall responses to anthrax protective antigen (PA) or PA peptides were assessed by IFN-γ ELISpot assay performed on cryopreserved PBMCs obtained from subjects prior to immunization and 7 days following the second immunization (study day 21). One-half of subjects that received AV7909 with low-dose (0.25mg/dose) CPG 7909 possessed positive Day 21 T cell responses to PA. In contrast, positive T cell responses occurred at an 11% average rate (1/9) for AVA-treated subjects. Differences in cellular responses due to dose level of CPG 7909 were not associated with differences in humoral anti-PA IgG responses, which were elevated for recipients of AV7909 compared to recipients of AVA. Serum markers at 24 or 48 h (i.e. % ALC decrease, or increase in IL-6, IP-10, or CRP) correlated with the humoral (antibody) responses 1 month later, but did not correlate with cellular ELISpot responses. In summary, biomarkers of early responses to CPG 7909 were confirmed, and adding a CpG adjuvant to a vaccine administered twice resulted in increased T cell effects relative to vaccine alone. Changes in early biomarkers correlated with subsequent adaptive humoral immunity but not cellular immunity. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.
Deregulation of RB1 expression by loss of imprinting in human hepatocellular carcinoma.
Anwar, Sumadi Lukman; Krech, Till; Hasemeier, Britta; Schipper, Elisa; Schweitzer, Nora; Vogel, Arndt; Kreipe, Hans; Lehmann, Ulrich
2014-08-01
The tumour suppressor gene RB1 is frequently silenced in many different types of human cancer, including hepatocellular carcinoma (HCC). However, mutations of the RB1 gene are relatively rare in HCC. A systematic screen for the identification of imprinted genes deregulated in human HCC revealed that RB1 shows imprint abnormalities in a high proportion of primary patient samples. Altogether, 40% of the HCC specimens (16/40) showed hyper- or hypomethylation at the CpG island in intron 2 of the RB1 gene. Re-analysis of publicly available genome-wide DNA methylation data confirmed these findings in two independent HCC cohorts. Loss of correct DNA methylation patterns at the RB1 locus leads to the aberrant expression of an alternative RB1-E2B transcript, as measured by quantitative real-time PCR. Demethylation at the intron 2 CpG island by DNMT1 knock-down or aza-deoxycytidine (DAC) treatment stimulated expression of the RB1-E2B transcript, accompanied by diminished RB1 main transcript expression. No aberrant DNA methylation was found at the RB1 locus in hepatocellular adenoma (HCA, n = 10), focal nodular hyperplasia (FNH, n = 5) and their corresponding adjacent liver tissue specimens. Deregulated RB1 expression due to hyper- or hypomethylation in intron 2 of the RB1 gene is found in tumours without loss of heterozygosity and is associated with a decrease in overall survival (p = 0.032) if caused by hypermethylation of CpG85. This unequivocally demonstrates that loss of imprinting represents an important additional mechanism for RB1 pathway inactivation in human HCC, complementing well-described molecular defects. Copyright © 2014 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.
Tahara, Tomomitsu; Yamazaki, Jumpei; Tahara, Sayumi; Okubo, Masaaki; Kawamura, Tomohiko; Horiguchi, Noriyuki; Ishizuka, Takamitsu; Nagasaka, Mitsuo; Nakagawa, Yoshihito; Shibata, Tomoyuki; Kuroda, Makoto; Ohmiya, Naoki
2017-06-08
DNA methylation is associated with "field defect" in the gastric mucosa. To characterize "field defect" morphologically, we examined DNA methylation of non-neoplastic gastric mucosa in relation to their morphology seen by narrow-band imaging (NBI) with magnifying endoscopy. Magnifying NBI of non-neoplastic gastric body was classified as follows: normal-small and round pits with uniform subepithelial capillary networks; type 1-a little enlarged round pits with indistinct subepithelial capillary networks; type 2-remarkably enlarged pits with irregular vessels; and type 3-clearly demarcated oval or tubulovillous pits with bulky coiled or wavy vessels. Methylation of nine candidate genes (MYOD1, SLC16A12, GDNF, IGF2, MIR 124A1, CDH1, PRDM5, RORA and MLF1) were determined by bisulfite pyrosequencing. Infinium HumanMethylation450 array was used to characterize the methylation of >450,000 CpG sites. Mean Z score methylation of nine genes positively correlated with the changes of mucosal patterns from normal to types 1, 2, and 3 (P < 0.0001). Genome-wide analysis showed that development of mucosal patterns correlated with methylation accumulation especially at CpG islands. Genes with promoter CpG islands that were gradually methylated with the development of mucosal patterns significantly enriched the genes involved in zinc-related pathways. The results indicates that gastric mucosal morphology predicts a "field defect" in this tissue type. Accumulation of DNA methylation is associated with "field defect" in the non-neoplastic gastric mucosa. Endoscopic identification of "field defect" has important implications for preventing gastric cancer. Our results suggest that magnifying NBI of gastric mucosal morphology predicts a "field defect" in the gastric mucosa.
Jin, Fei; Li, Xiao; Wang, Zuoguang; Liu, Ya; Liu, Jielin; Sun, Dongdong; Jin, Yongxin; Wang, Shiqi; Wen, Shaojun; Wei, Yongxiang
2018-06-07
Mitofusin 2 (Mfn2), a gene that negatively regulates the proliferation of vascular smooth muscle cells (VSMCs), is expressed at low levels in the VSMCs of hypertensive patients. DNA methylation can inhibit gene expression. The purpose of this study was to investigate the relationship between Mfn2 methylation and essential hypertension (EH). After bioinformatics analysis, five EH patients and five normal control (NC) subjects were selected for methylation chip screening. Then, bisulfite DNA sequencing was used to analyze the methylation status of differentially methylated fragments of Mfn2 in 40 EH patients and 36 NC subjects. Mfn2 mRNA expression in the blood was detected by RT-qPCR. There were three CpG islands in the full length Mfn2 DNA sequence and some transcription factor binding sites in these regions, including Sp1, Ap2, GATA box, NF-κB, etc. The chip screening showed that only the third CpG island had a significantly high degree of methylation. Subsequent verification experiments found that the EH group had a significantly lower C base rate of methylation than the NC group (2.5% vs. 44.44%, P < 0.0001), but a similar CpG methylation rate (P > 0.05). RT-qPCR detection showed that the level of Mfn2 mRNA expression was significantly lower in the EH group than in the NC group (P = 0.013). Further association analysis showed that the level of Mfn2 methylation was associated with systolic blood pressure and diastolic blood pressure (r = -0.902, r = -0.713, respectively) but not the other indexes. The DNA methylation level of Mfn2 was significantly lower in hypertensive patients than in control subjects, which may be an independent risk factor for EH.
Scheiermann, Julia; Klinman, Dennis M.
2014-01-01
Synthetic oligonucleotides (ODN) that express unmethylated “CpG motifs” trigger cells that express Toll-like receptor 9. In humans this includes plasmacytoid dendritic cells and B cells. CpG ODN induce an innate immune response characterized by the production of Th1 and pro-inflammatory cytokines. Their utility as vaccine adjuvants was evaluated in a number of clinical trials. Results indicate that CpG ODN improve antigen presentation and the generation of vaccine-specific cellular and humoral responses. This work provides an up-to-date overview of the utility of CpG ODN as adjuvants for vaccines targeting infectious agents and cancer. PMID:24975812
Transcultural Endocrinology: Adapting Type-2 Diabetes Guidelines on a Global Scale.
Nieto-Martínez, Ramfis; González-Rivas, Juan P; Florez, Hermes; Mechanick, Jeffrey I
2016-12-01
Type-2 diabetes (T2D) needs to be prevented and treated effectively to reduce its burden and consequences. White papers, such as evidence-based clinical practice guidelines (CPG) and their more portable versions, clinical practice algorithms and clinical checklists, may improve clinical decision-making and diabetes outcomes. However, CPG are underused and poorly validated. Protocols that translate and implement these CPG are needed. This review presents the global dimension of T2D, details the importance of white papers in the transculturalization process, compares relevant international CPG, analyzes cultural variables, and summarizes translation strategies that can improve care. Specific protocols and algorithmic tools are provided. Copyright © 2016 Elsevier Inc. All rights reserved.
Sina, Abu Ali Ibn; Howell, Sidney; Carrascosa, Laura G; Rauf, Sakandar; Shiddiky, Muhammad J A; Trau, Matt
2014-11-07
We report a simple electrochemical method referred to as "eMethylsorb" for the detection of DNA methylation. The method relies on the base dependent affinity interaction of DNA with gold. The methylation status of DNA is quantified by monitoring the electrochemical current as a function of the relative adsorption level of bisulphite treated DNA samples onto a bare gold electrode. This method can successfully distinguish methylated and unmethylated epigenotypes at single CpG resolution.
In Vivo Control of CpG and Non-CpG DNA Methylation by DNA Methyltransferases
Arand, Julia; Spieler, David; Karius, Tommy; Branco, Miguel R.; Meilinger, Daniela; Meissner, Alexander; Jenuwein, Thomas; Xu, Guoliang; Leonhardt, Heinrich; Wolf, Verena; Walter, Jörn
2012-01-01
The enzymatic control of the setting and maintenance of symmetric and non-symmetric DNA methylation patterns in a particular genome context is not well understood. Here, we describe a comprehensive analysis of DNA methylation patterns generated by high resolution sequencing of hairpin-bisulfite amplicons of selected single copy genes and repetitive elements (LINE1, B1, IAP-LTR-retrotransposons, and major satellites). The analysis unambiguously identifies a substantial amount of regional incomplete methylation maintenance, i.e. hemimethylated CpG positions, with variant degrees among cell types. Moreover, non-CpG cytosine methylation is confined to ESCs and exclusively catalysed by Dnmt3a and Dnmt3b. This sequence position–, cell type–, and region-dependent non-CpG methylation is strongly linked to neighboring CpG methylation and requires the presence of Dnmt3L. The generation of a comprehensive data set of 146,000 CpG dyads was used to apply and develop parameter estimated hidden Markov models (HMM) to calculate the relative contribution of DNA methyltransferases (Dnmts) for de novo and maintenance DNA methylation. The comparative modelling included wild-type ESCs and mutant ESCs deficient for Dnmt1, Dnmt3a, Dnmt3b, or Dnmt3a/3b, respectively. The HMM analysis identifies a considerable de novo methylation activity for Dnmt1 at certain repetitive elements and single copy sequences. Dnmt3a and Dnmt3b contribute de novo function. However, both enzymes are also essential to maintain symmetrical CpG methylation at distinct repetitive and single copy sequences in ESCs. PMID:22761581
Tsiagkas, Giannis; Nikolaou, Christoforos; Almirantis, Yannis
2014-12-01
CpG Islands (CGIs) are compositionally defined short genomic stretches, which have been studied in the human, mouse, chicken and later in several other genomes. Initially, they were assigned the role of transcriptional regulation of protein-coding genes, especially the house-keeping ones, while more recently there is found evidence that they are involved in several other functions as well, which might include regulation of the expression of RNA genes, DNA replication etc. Here, an investigation of their distributional characteristics in a variety of genomes is undertaken for both whole CGI populations as well as for CGI subsets that lie away from known genes (gene-unrelated or "orphan" CGIs). In both cases power-law-like linearity in double logarithmic scale is found. An evolutionary model, initially put forward for the explanation of a similar pattern found in gene populations is implemented. It includes segmental duplication events and eliminations of most of the duplicated CGIs, while a moderate rate of non-duplicated CGI eliminations is also applied in some cases. Simulations reproduce all the main features of the observed inter-CGI chromosomal size distributions. Our results on power-law-like linearity found in orphan CGI populations suggest that the observed distributional pattern is independent of the analogous pattern that protein coding segments were reported to follow. The power-law-like patterns in the genomic distributions of CGIs described herein are found to be compatible with several other features of the composition, abundance or functional role of CGIs reported in the current literature across several genomes, on the basis of the proposed evolutionary model. Copyright © 2014 Elsevier Ltd. All rights reserved.
Tierney, Rob; Beignon, Anne-Sophie; Rappuoli, Rino; Muller, Sylviane; Sesardic, Dorothea; Partidos, Charalambos D
2003-09-01
In this study, the adjuvanticity of 2 nontoxic derivatives (LTK63 and LTR72) of heat-labile enterotoxin of Escherichia coli (LT) was evaluated and was compared with that of a cytosine phosphodiester-guanine (CpG) motif, after transcutaneous immunization with tetanus toxoid (TT). TT plus LTR72 elicited the strongest antibody responses, compared with those elicited by the other vaccines (TT, TT plus LTK63, TT plus CpG, and TT plus LTK63 plus CpG); it neutralized the toxin and conferred full protection after passive transfer in mice. Preexisting immunity to LT mutants did not adversely affect their adjuvant potency. Both LTK63 and LTR72 promoted the induction of IgG1 antibodies. In contrast, mice receiving either CpG motif alone or CpG motif plus LTK63 produced strong IgG2a anti-TT antibody responses. Overall, these findings demonstrate that mutants of enterotoxins with reduced toxicity are effective adjuvants for transcutaneous immunization.
On the Role of Sensory Feedbacks in Rowat–Selverston CPG to Improve Robot Legged Locomotion
Amrollah, Elmira; Henaff, Patrick
2010-01-01
This paper presents the use of Rowat and Selverston-type of central pattern generator (CPG) to control locomotion. It focuses on the role of afferent exteroceptive and proprioceptive signals in the dynamic phase synchronization in CPG legged robots. The sensori-motor neural network architecture is evaluated to control a two-joint planar robot leg that slips on a rail. Then, the closed loop between the CPG and the mechanical system allows to study the modulation of rhythmic patterns and the effect of the sensing loop via sensory neurons during the locomotion task. Firstly simulations show that the proposed architecture easily allows to modulate rhythmic patterns of the leg, and therefore the velocity of the robot. Secondly, simulations show that sensori-feedbacks from foot/ground contact of the leg make the hip velocity smoother and larger. The results show that the Rowat–Selverston-type CPG with sensory feedbacks is an effective choice for building adaptive neural CPGs for legged robots. PMID:21228904
Wu, Mei; Shi, Ling; Liu, Shigui; Li, Jiangling; Wu, Kaiyuan; Wang, Lihuan; Shen, Yi; Liu, Kun; Zheng, Yong; Zhang, Xinshen; Gao, Rong
2005-10-01
Cationic PLG nanoparticles and liposome were prepared and used as package molecules to pack up pUC18-CpG. The effects of the packed pUC18-CpG on the cellular and humoral immune responses were detected in the mice that were inoculated with pig paratyphoid vaccine. The results showed that compared with the control, the amount of IgG and the titre of specific antibody were significantly increased in the sera of mice immunized with the CpG plasmid entrapped by cationic PLG nanoparticles; the proliferation and induced IL-2 bioactivity of lymphocytes were significantly enhanced in the spleen of the immunized mice; the stimulatory effect of cationic PLG nanoparticles was similar to or stronger than that of cationic liposome. These indicated that cationic PLG nanoparticle could be employed as an effective package molecule to promote the immunostimulatory effect of pUC18-CpG.
Morishita, Masaki; Takahashi, Yuki; Matsumoto, Akihiro; Nishikawa, Makiya; Takakura, Yoshinobu
2016-12-01
For cancer immunotherapy via tumor antigen vaccination in combination with an adjuvant, major challenges include the identification of a particular tumor antigen and efficient delivery of the antigen as well as adjuvant to antigen-presenting cells. In this study, we proposed an efficient exosome-based tumor antigens-adjuvant co-delivery system using genetically engineered tumor cell-derived exosomes containing endogenous tumor antigens and immunostimulatory CpG DNA. Murine melanoma B16BL6 cells were transfected with a plasmid vector encoding a fusion streptavidin (SAV; a protein that binds to biotin with high affinity)-lactadherin (LA; an exosome-tropic protein) protein, yielding genetically engineered SAV-LA-expressing exosomes (SAV-exo). SAV-exo were combined with biotinylated CpG DNA to prepare CpG DNA-modified exosomes (CpG-SAV-exo). Fluorescent microscopic observation revealed the successful modification of exosomes with CpG DNA by SAV-biotin interaction. CpG-SAV-exo showed efficient and simultaneous delivery of exosomes with CpG DNA to murine dendritic DC2.4 cells in culture. Treatment with CpG-SAV-exo effectively activated DC2.4 cells and enhanced tumor antigen presentation capacity. Immunization with CpG-SAV-exo exhibited stronger in vivo antitumor effects in B16BL6 tumor-bearing mice than simple co-administration of exosomes and CpG DNA. Thus, genetically engineered CpG-SAV-exo is an effective exosome-based tumor antigens-adjuvant co-delivery system that will be useful for cancer immunotherapy. Copyright © 2016 Elsevier Ltd. All rights reserved.
Cheng, Wing Ki; Wee, Kathleen; Kollmann, Tobias R.
2014-01-01
Robust CD8+ T cell responses are essential for immune protection against intracellular pathogens. Using parenteral administration of ovalbumin (OVA) protein as a model antigen, the effect of the Toll-like receptor 9 (TLR9) agonist, CpG oligodeoxynucleotide (ODN) 1826, as an adjuvant delivered either topically, subcutaneously, or intramuscularly on antigen-specific CD8+ T cell responses in a mouse model was evaluated. Topical CpG adjuvant increased the frequency of OVA-specific CD8+ T cells in the peripheral blood and in the spleen. The more effective strategy to administer topical CpG adjuvant to enhance CD8+ T cell responses was single-dose administration at the time of antigen injection with a prime-boost regimen. Topical CpG adjuvant conferred both rapid and long-lasting protection against systemic challenge with recombinant Listeria monocytogenes expressing the cytotoxic T lymphocyte (CTL) epitope of OVA257–264 (strain Lm-OVA) in a TLR9-dependent manner. Topical CpG adjuvant induced a higher proportion of CD8+ effector memory T cells than parenteral administration of the adjuvant. Although traditional vaccination strategies involve coformulation of antigen and adjuvant, split administration using topical adjuvant is effective and has advantages of safety and flexibility. Split administration of topical CpG ODN 1826 with parenteral protein antigen is superior to other administration strategies in enhancing both acute and memory protective CD8+ T cell immune responses to subcutaneous protein vaccines. This vaccination strategy induces rapid and persistent protective immune responses against the intracellular organism L. monocytogenes. PMID:24391136
NASA Astrophysics Data System (ADS)
Sharma, Gaurav; Friedenberg, David A.; Annetta, Nicholas; Glenn, Bradley; Bockbrader, Marcie; Majstorovic, Connor; Domas, Stephanie; Mysiw, W. Jerry; Rezai, Ali; Bouton, Chad
2016-09-01
Neuroprosthetic technology has been used to restore cortical control of discrete (non-rhythmic) hand movements in a paralyzed person. However, cortical control of rhythmic movements which originate in the brain but are coordinated by Central Pattern Generator (CPG) neural networks in the spinal cord has not been demonstrated previously. Here we show a demonstration of an artificial neural bypass technology that decodes cortical activity and emulates spinal cord CPG function allowing volitional rhythmic hand movement. The technology uses a combination of signals recorded from the brain, machine-learning algorithms to decode the signals, a numerical model of CPG network, and a neuromuscular electrical stimulation system to evoke rhythmic movements. Using the neural bypass, a quadriplegic participant was able to initiate, sustain, and switch between rhythmic and discrete finger movements, using his thoughts alone. These results have implications in advancing neuroprosthetic technology to restore complex movements in people living with paralysis.
Rynkiewicz, Dianna; Rathkopf, Melinda; Sim, Iain; Waytes, A Thomas; Hopkins, Robert J; Giri, Lallan; DeMuria, Deborah; Ransom, Janet; Quinn, James; Nabors, Gary S; Nielsen, Carl J
2011-08-26
Immunization with BioThrax(®) (Anthrax Vaccine Adsorbed) is a safe and effective means of preventing anthrax. Animal studies have demonstrated that the addition of CpG DNA adjuvants to BioThrax can markedly increase the immunogenicity of the vaccine, increasing both serum anti-protective antigen (PA) antibody and anthrax toxin-neutralizing antibody (TNA) concentrations. The immune response to CpG-adjuvanted BioThrax in animals was not only stronger, but was also more rapid and led to higher levels of protection in spore challenge models. The B-class CpG DNA adjuvant CPG 7909, a 24-base synthetic, single-strand oligodeoxynucleotide, was evaluated for its safety profile and adjuvant properties in a Phase 1 clinical trial. A double-blind study was performed in which 69 healthy subjects, age 18-45 years, were randomized to receive three doses of either: (1) BioThrax alone, (2) 1 mg of CPG 7909 alone or (3) BioThrax plus 1 mg of CPG 7909, all given intramuscularly on study days 0, 14 and 28. Subjects were monitored for IgG to PA by ELISA and for TNA titers through study day 56 and for safety through month 6. CPG 7909 increased the antibody response by 6-8-fold at peak, and accelerated the response by 3 weeks compared to the response seen in subjects vaccinated with BioThrax alone. No serious adverse events related to study agents were reported, and the combination was considered to be reasonably well tolerated. The marked acceleration and enhancement of the immune response seen by combining BioThrax and CPG 7909 offers the potential to shorten the course of immunization and reduce the time to protection, and may be particularly useful in the setting of post-exposure prophylaxis. Copyright © 2011 Elsevier Ltd. All rights reserved.
Prater, M Renee; Johnson, Victor J; Germolec, Dori R; Luster, Michael I; Holladay, Steven D
2006-01-16
Synthetic oligodeoxynucleotides (ODN) containing CpG motifs, characteristic of bacterial DNA, are currently being evaluated as vaccine adjuvants for inducing protective immunity. Recently, there is increasing pressure to vaccinate pregnant women against maternally transmitted diseases including AIDS and tetanus, as well as against potential bio-weapons such as anthrax. CpG vaccines are effective because they trigger transient increases in T(H)1 cytokine production. Recent literature suggests, however, that a shift toward a T(H)1 cytokine profile during pregnancy may increase the risk of fetal morphologic defects. On this basis, we hypothesized that exposure to CpG motifs during pregnancy could result in T(H)1 inflammation leading to adverse effects on fetal development. To address this hypothesis, pregnant C57BL/6 mice were injected with CpG ODN (0-300 microg/dam) and maternal and fetal outcomes were determined. Injection of dams with the highest dose of CpG ODN resulted in markedly increased fetal resorptions and craniofacial/limb defects, while lower doses had little, if any effects. Histological examination of placentas revealed cellular necrosis with mixed inflammation and calcification in the spongiotrophoblast layer and dysregulation of labyrinthine vascular development. Concomitant elevations in maternal serum cytokine levels were observed including interleukin (IL)-2, IL-10 and IL-12. Treatment with 300 microg of non-CpG ODN did not cause any adverse effects. The 300 microg dose of CpG ODN used in the present study is 30-fold higher than the highest dose that has been administered to humans during clinical trials. These results suggest that the induction of T(H)1 cytokines during pregnancy by CpG motifs may potentially increase the risk of fetal loss and morphologic defects in mice, at least at high doses, and support the need for further investigation of teratogenesis that may result from exposure to vaccine adjuvants designed to produce T(H)1 cytokine profile shifts.
Integrated Multiregional Analysis Proposing a New Model of Colorectal Cancer Evolution.
Uchi, Ryutaro; Takahashi, Yusuke; Niida, Atsushi; Shimamura, Teppei; Hirata, Hidenari; Sugimachi, Keishi; Sawada, Genta; Iwaya, Takeshi; Kurashige, Junji; Shinden, Yoshiaki; Iguchi, Tomohiro; Eguchi, Hidetoshi; Chiba, Kenichi; Shiraishi, Yuichi; Nagae, Genta; Yoshida, Kenichi; Nagata, Yasunobu; Haeno, Hiroshi; Yamamoto, Hirofumi; Ishii, Hideshi; Doki, Yuichiro; Iinuma, Hisae; Sasaki, Shin; Nagayama, Satoshi; Yamada, Kazutaka; Yachida, Shinichi; Kato, Mamoru; Shibata, Tatsuhiro; Oki, Eiji; Saeki, Hiroshi; Shirabe, Ken; Oda, Yoshinao; Maehara, Yoshihiko; Komune, Shizuo; Mori, Masaki; Suzuki, Yutaka; Yamamoto, Ken; Aburatani, Hiroyuki; Ogawa, Seishi; Miyano, Satoru; Mimori, Koshi
2016-02-01
Understanding intratumor heterogeneity is clinically important because it could cause therapeutic failure by fostering evolutionary adaptation. To this end, we profiled the genome and epigenome in multiple regions within each of nine colorectal tumors. Extensive intertumor heterogeneity is observed, from which we inferred the evolutionary history of the tumors. First, clonally shared alterations appeared, in which C>T transitions at CpG site and CpG island hypermethylation were relatively enriched. Correlation between mutation counts and patients' ages suggests that the early-acquired alterations resulted from aging. In the late phase, a parental clone was branched into numerous subclones. Known driver alterations were observed frequently in the early-acquired alterations, but rarely in the late-acquired alterations. Consistently, our computational simulation of the branching evolution suggests that extensive intratumor heterogeneity could be generated by neutral evolution. Collectively, we propose a new model of colorectal cancer evolution, which is useful for understanding and confronting this heterogeneous disease.
Chow, Chi-Nga; Zheng, Han-Qin; Wu, Nai-Yun; Chien, Chia-Hung; Huang, Hsien-Da; Lee, Tzong-Yi; Chiang-Hsieh, Yi-Fan; Hou, Ping-Fu; Yang, Tien-Yi; Chang, Wen-Chi
2016-01-04
Transcription factors (TFs) are sequence-specific DNA-binding proteins acting as critical regulators of gene expression. The Plant Promoter Analysis Navigator (PlantPAN; http://PlantPAN2.itps.ncku.edu.tw) provides an informative resource for detecting transcription factor binding sites (TFBSs), corresponding TFs, and other important regulatory elements (CpG islands and tandem repeats) in a promoter or a set of plant promoters. Additionally, TFBSs, CpG islands, and tandem repeats in the conserve regions between similar gene promoters are also identified. The current PlantPAN release (version 2.0) contains 16 960 TFs and 1143 TF binding site matrices among 76 plant species. In addition to updating of the annotation information, adding experimentally verified TF matrices, and making improvements in the visualization of transcriptional regulatory networks, several new features and functions are incorporated. These features include: (i) comprehensive curation of TF information (response conditions, target genes, and sequence logos of binding motifs, etc.), (ii) co-expression profiles of TFs and their target genes under various conditions, (iii) protein-protein interactions among TFs and their co-factors, (iv) TF-target networks, and (v) downstream promoter elements. Furthermore, a dynamic transcriptional regulatory network under various conditions is provided in PlantPAN 2.0. The PlantPAN 2.0 is a systematic platform for plant promoter analysis and reconstructing transcriptional regulatory networks. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Genome-wide mapping and analysis of active promoters in mouse embryonic stem cells and adult organs
Barrera, Leah O.; Li, Zirong; Smith, Andrew D.; Arden, Karen C.; Cavenee, Webster K.; Zhang, Michael Q.; Green, Roland D.; Ren, Bing
2008-01-01
By integrating genome-wide maps of RNA polymerase II (Polr2a) binding with gene expression data and H3ac and H3K4me3 profiles, we characterized promoters with enriched activity in mouse embryonic stem cells (mES) as well as adult brain, heart, kidney, and liver. We identified ∼24,000 promoters across these samples, including 16,976 annotated mRNA 5′ ends and 5153 additional sites validating cap-analysis of gene expression (CAGE) 5′ end data. We showed that promoters with CpG islands are typically non-tissue specific, with the majority associated with Polr2a and the active chromatin modifications in nearly all the tissues examined. By contrast, the promoters without CpG islands are generally associated with Polr2a and the active chromatin marks in a tissue-dependent way. We defined 4396 tissue-specific promoters by adapting a quantitative index of tissue-specificity based on Polr2a occupancy. While there is a general correspondence between Polr2a occupancy and active chromatin modifications at the tissue-specific promoters, a subset of them appear to be persistently marked by active chromatin modifications in the absence of detectable Polr2a binding, highlighting the complexity of the functional relationship between chromatin modification and gene expression. Our results provide a resource for exploring promoter Polr2a binding and epigenetic states across pluripotent and differentiated cell types in mammals. PMID:18042645
Kelly, Andrew D.; Kroeger, Heike; Yamazaki, Jumpei; Taby, Rodolphe; Neumann, Frank; Yu, Sijia; Lee, Justin T.; Patel, Bela; Li, Yuesheng; He, Rong; Liang, Shoudan; Lu, Yue; Cesaroni, Matteo; Pierce, Sherry A.; Kornblau, Steven M.; Bueso-Ramos, Carlos E.; Ravandi, Farhad; Kantarjian, Hagop M.; Jelinek, Jaroslav; Issa, Jean-Pierre J.
2016-01-01
Genetic changes are infrequent in acute myeloid leukemia (AML) compared to other malignancies and often involve epigenetic regulators, suggesting that an altered epigenome may underlie AML biology and outcomes. In 96 AML cases including 65 pilot samples selected for cured/not-cured, we found higher CpG island (CGI) promoter methylation in cured patients. Expanded genome-wide digital restriction enzyme analysis of methylation (DREAM) data revealed a CGI methylator phenotype independent of IDH1/2 mutations we term AML-CIMP (A-CIMP+). A-CIMP was associated with longer overall survival (OS) in this dataset (median OS, years: A-CIMP+ = Not reached, A-CIMP− =1.17; P=0.08). For validation we used 194 samples from The Cancer Genome Atlas interrogated with Illumina 450k methylation arrays where we confirmed longer OS in A-CIMP (median OS, years: A-CIMP+ =2.34, A-CIMP− =1.00; P=0.01). Hypermethylation in A-CIMP favored CGIs (OR: CGI/non-CGI=5.21), and while A-CIMP was enriched in CEBPA (P=0.002) and WT1 mutations (P=0.02), 70% of cases lacked either mutation. Hypermethylated genes in A-CIMP function in pluripotency maintenance, and a gene expression signature of A-CIMP was associated with outcomes in multiple datasets. We conclude that CIMP in AML cannot be explained solely by gene mutations (e.g. IDH1/2, TET2), and that curability in A-CIMP+ AML should be validated prospectively. PMID:28074068
Kelly, A D; Kroeger, H; Yamazaki, J; Taby, R; Neumann, F; Yu, S; Lee, J T; Patel, B; Li, Y; He, R; Liang, S; Lu, Y; Cesaroni, M; Pierce, S A; Kornblau, S M; Bueso-Ramos, C E; Ravandi, F; Kantarjian, H M; Jelinek, J; Issa, J-Pj
2017-10-01
Genetic changes are infrequent in acute myeloid leukemia (AML) compared with other malignancies and often involve epigenetic regulators, suggesting that an altered epigenome may underlie AML biology and outcomes. In 96 AML cases including 65 pilot samples selected for cured/not-cured, we found higher CpG island (CGI) promoter methylation in cured patients. Expanded genome-wide digital restriction enzyme analysis of methylation data revealed a CGI methylator phenotype independent of IDH1/2 mutations we term AML-CGI methylator phenotype (CIMP) (A-CIMP + ). A-CIMP was associated with longer overall survival (OS) in this data set (median OS, years: A-CIMP + =not reached, CIMP - =1.17; P=0.08). For validation we used 194 samples from The Cancer Genome Atlas interrogated with Illumina 450k methylation arrays where we confirmed longer OS in A-CIMP (median OS, years: A-CIMP + =2.34, A-CIMP - =1.00; P=0.01). Hypermethylation in A-CIMP + favored CGIs (OR: CGI/non-CGI=5.21), and while A-CIMP + was enriched in CEBPA (P=0.002) and WT1 mutations (P=0.02), 70% of cases lacked either mutation. Hypermethylated genes in A-CIMP + function in pluripotency maintenance, and a gene expression signature of A-CIMP was associated with outcomes in multiple data sets. We conclude that CIMP in AML cannot be explained solely by gene mutations (for example, IDH1/2, TET2), and that curability in A-CIMP + AML should be validated prospectively.
[Association between obesity and DNA methylation among the 7-16 year-old twins].
Li, C X; Gao, Y; Gao, W J; Yu, C Q; Lyu, J; Lyu, R R; Duan, J L; Sun, Y; Guo, X H; Wang, S F; Zhou, B; Wang, G; Cao, W H; Li, L M
2018-04-10
Objective: On whole-genome scale, we tried to explore the correlation between obesity-related traits and DNA methylation sites, based on discordant monozygotic twin pairs. Methods: A total of 90 pairs of 6-17 year-old twins were recruited in Chaoyang district, Yanqing district and Fangshan district in Beijing in 2016. Information on twins was gathered through a self-designed questionnaire and results: from physical examination, including height, weight and waist circumference of the subjects under study. DNA methylation detection was chosen on the Illumina Human Methylation EPIC BeadChip. R 3.3.1 language was used to read the DNA methylation signal under quality control on samples and probes. Ebayes function of empirical Bayes paired moderated t -test was used to identify the differential methylated CpG sites (DMCs). VarFit function of empirical Bayes paired moderated Levene test was used to identify the differentially variables CpG sits (DVCs) in obese and normal groups. Results According to the obesity discordance criteria, we collected 23 pairs of twins (age range 7 to 16 years), including 12 male pairs. A total of 817 471 qualified CpG loci were included in the genome-wide correlation analysis. According to the significance level of FDR set as <0.05, no positive sites would meet this standard. When DMC CpG site cg05684382, with the smallest P value (1.26E-06) as on chromosome 12, the DVC CpG site cg26188191 with the smallest P value (6.44E-06) appeared in CMIP gene on chromosome 16. Conclusions: In this study, we analyzed the genome-wide DNA methylation and its correlation with obesity traits. After multiple testing corrections, no positive sites were found to have associated with obesity. However, results from the correlation analysis demonstrated sites cg05684382 (chr: 12) and cg26188191 (chr: 16) might have played a role in the development of obesity. This study provides a methodologic reference for the studies on discordance twins related problems.
GRASP/Ada 95: Reverse Engineering Tools for Ada
NASA Technical Reports Server (NTRS)
Cross, James H., II
1996-01-01
The GRASP/Ada project (Graphical Representations of Algorithms, Structures, and Processes for Ada) has successfully created and prototyped an algorithmic level graphical representation for Ada software, the Control Structure Diagram (CSD), and a new visualization for a fine-grained complexity metric called the Complexity Profile Graph (CPG). By synchronizing the CSD and the CPG, the CSD view of control structure, nesting, and source code is directly linked to the corresponding visualization of statement level complexity in the CPG. GRASP has been integrated with GNAT, the GNU Ada 95 Translator to provide a comprehensive graphical user interface and development environment for Ada 95. The user may view, edit, print, and compile source code as a CSD with no discernible addition to storage or computational overhead. The primary impetus for creation of the CSD was to improve the comprehension efficiency of Ada software and, as a result, improve reliability and reduce costs. The emphasis has been on the automatic generation of the CSD from Ada 95 source code to support reverse engineering and maintenance. The CSD has the potential to replace traditional prettyprinted Ada source code. The current update has focused on the design and implementation of a new Motif compliant user interface, and a new CSD generator consisting of a tagger and renderer. The Complexity Profile Graph (CPG) is based on a set of functions that describes the context, content, and the scaling for complexity on a statement by statement basis. When combined graphicafly, the result is a composite profile of complexity for the program unit. Ongoing research includes the development and refinement of the associated functions, and the development of the CPG generator prototype. The current Version 5.0 prototype provides the capability for the user to generate CSDs and CPGs from Ada 95 source code in a reverse engineering as well as forward engineering mode with a level of flexibility suitable for practical application. This report provides an overview of the GRASP/Ada project with an emphasis on the current update.
A CpG Oligonucleotide Can Protect Mice From a Low Aerosol Challenge Dose of Burkholderia mallei
2006-03-01
may protect victims of a biological attack from glanders . Burkholderia mallei , the causative agent of glanders , natu- rally infects equines, but it can...attack from glanders . 15. SUBJECT TERMS Burkholderia mallei , glanders , oligonucleotides, CpG motif, efficacy, laboratory animals, mice 16...Society for Microbiology. All Rights Reserved. A CpG Oligonucleotide Can Protect Mice from a Low Aerosol Challenge Dose of Burkholderia mallei David M
Liu, Jiaxuan; Zhao, Wei; Ware, Erin B; Turner, Stephen T; Mosley, Thomas H; Smith, Jennifer A
2018-05-08
Genetic variations in apolipoprotein E (APOE) and proximal genes (PVRL2, TOMM40, and APOC1) are associated with cognitive function and dementia, particularly Alzheimer's disease. Epigenetic mechanisms such as DNA methylation play a central role in the regulation of gene expression. Recent studies have found evidence that DNA methylation may contribute to the pathogenesis of dementia, but its association with cognitive function in populations without dementia remains unclear. We assessed DNA methylation levels of 48 CpG sites in the APOE genomic region in peripheral blood leukocytes collected from 289 African Americans (mean age = 67 years) from the Genetic Epidemiology Network of Arteriopathy (GENOA) study. Using linear regression, we examined the relationship between methylation in the APOE genomic region and multiple cognitive measures including learning, memory, processing speed, concentration, language and global cognitive function. We identified eight CpG sites in three genes (PVRL2, TOMM40, and APOE) that showed an inverse association between methylation level and delayed recall, a measure of memory, after adjusting for age and sex (False Discovery Rate q-value < 0.1). All eight CpGs are located in either CpG islands (CGIs) or CGI shelves, and six of them are in promoter regions. Education and APOE ε4 carrier status significantly modified the effect of methylation in cg08583001 (PVRL2) and cg22024783 (TOMM40), respectively. Together, methylation of the eight CpGs explained an additional 8.7% of the variance in delayed recall, after adjustment for age, sex, education, and APOE ε4 carrier status. Methylation was not significantly associated with any other cognitive measures. Our results suggest that methylation levels at multiple CpGs in the APOE genomic region are inversely associated with delayed recall during normal cognitive aging, even after accounting for known genetic predictors for cognition. Our findings highlight the important role of epigenetic mechanisms in influencing cognitive performance, and suggest that changes in blood methylation may be an early indicator of individuals at risk for dementia as well as potential targets for intervention in asymptomatic populations.
[Similarity of cycloprolylglycine to piracetam in antihypoxic and neuroprotective effects].
Kolisnikova, K N; Gudasheva, T A; Nazarova, G A; Antipov, T A; Voronina, T A; Seredenin, S B
2012-01-01
The antihypoxic activity of the endogenous cyclic dipeptide cycloprolylglycine (CPG) has been studied on a model of normobaric hypoxia with hypercapnia and its neuroprotective activity has been studied on a model of human neuroblastoma SH-SY5Y cell damage by 6-hydroxydopamine. It is established that CPG exhibits the antihypoxic activity at doses of 0.5 and 1.0 mg/kg (i.p.) on outbred and BALB/c mice, but not on C57B1/6 mice. The neuroprotective activity of CPG was detected in 10(-5) - 10(-8) M concentration range only when the treatment was carried out 24h before toxin introduction. The obtained data confirm the hypothesis that piracetam is a mimetic of the endogenous CPG neuropeptide.
Lee, Jai-Wei; Lin, Yu-Ming; Yen, Ting-Ying; Yang, Wen-Jen; Chu, Chun-Yen
2010-11-23
Recombinant parvovirus VP2 (rVP2) was formulated with different types of adjuvant, including aluminum adjuvant and CpG oligodeoxynucleotides (ODNs), and the immunological responses after vaccination in ducks were examined. In comparison with the control group, production of rVP2-specific antibodies, expression of cytokines in peripheral blood mononuclear cells (PBMC) stimulated by rVP2, and percentage of CD4(+)/CD8(+) cells in PBMC were significantly increased in ducks immunized with rVP2 formulated with CpG ODNs containing 3 copies of GACGTT motif. CpG ODNs with GACGTT motifs might be used to improve the efficacy of vaccines for ducks. Copyright © 2010 Elsevier Ltd. All rights reserved.
Qiao, Huan; May, James M.
2013-01-01
SVCT2 is the major transporter mediating vitamin C uptake in most organs. Its expression is driven by two promoters (CpG-poor exon 1a promoter and CpG-rich exon 1b promoter). In this work we mapped discrete elements within the proximal CpG-poor promoter responsible for the exon 1a transcription. We identified two E boxes for USF binding and one Y box for NF-Y binding. We further show that the formation of an NFY/USF complex on the exon 1a promoter amplifies each other's ability to bind to the promoter in a cooperativity-dependent manner and is absolutely required for the full activity of the exon 1a promoter. The analysis of the CpG site located at the upstream USF binding site in the promoter showed a strong correlation between expression and demethylation. It was also shown that the exon 1a transcription was induced in cell culture treated with demethylating agent decitabine. The specific methylation of this CpG site impaired both the binding of USF and the formation of the functional NF-Y/USF complex as well as promoter activity, suggesting its importance for the cell-specific transcription. Thus CpG methylation at the upstream USF binding site functions in establishing and maintaining cell-specific transcription from the CpG-poor SVCT2 exon 1a promoter. PMID:21770893
Toward robust phase-locking in Melibe swim central pattern generator models
NASA Astrophysics Data System (ADS)
Jalil, Sajiya; Allen, Dane; Youker, Joseph; Shilnikov, Andrey
2013-12-01
Small groups of interneurons, abbreviated by CPG for central pattern generators, are arranged into neural networks to generate a variety of core bursting rhythms with specific phase-locked states, on distinct time scales, which govern vital motor behaviors in invertebrates such as chewing and swimming. These movements in lower level animals mimic motions of organs in higher animals due to evolutionarily conserved mechanisms. Hence, various neurological diseases can be linked to abnormal movement of body parts that are regulated by a malfunctioning CPG. In this paper, we, being inspired by recent experimental studies of neuronal activity patterns recorded from a swimming motion CPG of the sea slug Melibe leonina, examine a mathematical model of a 4-cell network that can plausibly and stably underlie the observed bursting rhythm. We develop a dynamical systems framework for explaining the existence and robustness of phase-locked states in activity patterns produced by the modeled CPGs. The proposed tools can be used for identifying core components for other CPG networks with reliable bursting outcomes and specific phase relationships between the interneurons. Our findings can be employed for identifying or implementing the conditions for normal and pathological functioning of basic CPGs of animals and artificially intelligent prosthetics that can regulate various movements.
Promoter DNA methylation regulates progranulin expression and is altered in FTLD
2013-01-01
Background Frontotemporal lobar degeneration (FTLD) is a heterogeneous group of neurodegenerative diseases associated with personality changes and progressive dementia. Loss-of-function mutations in the growth factor progranulin (GRN) cause autosomal dominant FTLD, but so far the pathomechanism of sporadic FTLD is unclear. Results We analyzed whether DNA methylation in the GRN core promoter restricts GRN expression and, thus, might promote FTLD in the absence of GRN mutations. GRN expression in human lymphoblast cell lines is negatively correlated with methylation at several CpG units within the GRN promoter. Chronic treatment with the DNA methyltransferase inhibitor 5-aza-2′-deoxycytidine (DAC) strongly induces GRN mRNA and protein levels. In a reporter assay, CpG methylation blocks transcriptional activity of the GRN core promoter. In brains of FTLD patients several CpG units in the GRN promoter are significantly hypermethylated compared to age-matched healthy controls, Alzheimer and Parkinson patients. These CpG motifs are critical for GRN promoter activity in reporter assays. Furthermore, DNA methyltransferase 3a (DNMT3a) is upregulated in FTLD patients and overexpression of DNMT3a reduces GRN promoter activity and expression. Conclusion These data suggest that altered DNA methylation is a novel pathomechanism for FTLD that is potentially amenable to targeted pharmacotherapy. PMID:24252647
Humanoids Learning to Walk: A Natural CPG-Actor-Critic Architecture.
Li, Cai; Lowe, Robert; Ziemke, Tom
2013-01-01
The identification of learning mechanisms for locomotion has been the subject of much research for some time but many challenges remain. Dynamic systems theory (DST) offers a novel approach to humanoid learning through environmental interaction. Reinforcement learning (RL) has offered a promising method to adaptively link the dynamic system to the environment it interacts with via a reward-based value system. In this paper, we propose a model that integrates the above perspectives and applies it to the case of a humanoid (NAO) robot learning to walk the ability of which emerges from its value-based interaction with the environment. In the model, a simplified central pattern generator (CPG) architecture inspired by neuroscientific research and DST is integrated with an actor-critic approach to RL (cpg-actor-critic). In the cpg-actor-critic architecture, least-square-temporal-difference based learning converges to the optimal solution quickly by using natural gradient learning and balancing exploration and exploitation. Futhermore, rather than using a traditional (designer-specified) reward it uses a dynamic value function as a stability indicator that adapts to the environment. The results obtained are analyzed using a novel DST-based embodied cognition approach. Learning to walk, from this perspective, is a process of integrating levels of sensorimotor activity and value.
Humanoids Learning to Walk: A Natural CPG-Actor-Critic Architecture
Li, Cai; Lowe, Robert; Ziemke, Tom
2013-01-01
The identification of learning mechanisms for locomotion has been the subject of much research for some time but many challenges remain. Dynamic systems theory (DST) offers a novel approach to humanoid learning through environmental interaction. Reinforcement learning (RL) has offered a promising method to adaptively link the dynamic system to the environment it interacts with via a reward-based value system. In this paper, we propose a model that integrates the above perspectives and applies it to the case of a humanoid (NAO) robot learning to walk the ability of which emerges from its value-based interaction with the environment. In the model, a simplified central pattern generator (CPG) architecture inspired by neuroscientific research and DST is integrated with an actor-critic approach to RL (cpg-actor-critic). In the cpg-actor-critic architecture, least-square-temporal-difference based learning converges to the optimal solution quickly by using natural gradient learning and balancing exploration and exploitation. Futhermore, rather than using a traditional (designer-specified) reward it uses a dynamic value function as a stability indicator that adapts to the environment. The results obtained are analyzed using a novel DST-based embodied cognition approach. Learning to walk, from this perspective, is a process of integrating levels of sensorimotor activity and value. PMID:23675345
Fernández, Olga L.; Rodriguez-Pinto, Daniel; Castilho, Tiago M.; Corral Caridad, Maria J.; Goldsmith-Pestana, Karen; Saravia, Nancy Gore; McMahon-Pratt, Diane
2017-01-01
ABSTRACT Infection by Leishmania (Viannia) panamensis, the predominant etiologic agent for cutaneous leishmaniasis in Colombia, is characterized by a chronic mixed inflammatory response. Current treatment options are plagued by toxicity, lengthy treatment regimens, and growing evidence of drug resistance. Immunotherapy, modulating the immune system to mount a protective response, may provide an alternate therapeutic approach. We investigated the ability of the Toll-like receptor 9 (TLR9) ligand CpG to modulate established disease in the L. (V.) panamensis mouse model. Treatment of established infection with a high dose (50 μg) of CpG ameliorated disease and lowered parasite burden. Interestingly, immediately after treatment there was a significant increase in transforming growth factor β (TGF-β) and concomitantly an increase in T regulatory cell (Treg) function. Although a general reduction in cell-mediated immune cytokine and chemokine (gamma interferon [IFN-γ], interleukin 10 [IL-10], IL-13, IL-6, granulocyte-macrophage colony-stimulating factor [GM-CSF], IL-4, and MIP-1α) responses of the treated mice was observed, certain chemokines (RANTES, monocyte chemoattractant protein 1[MCP-1], and IP-10) were increased. Further, in peripheral blood mononuclear cells (PBMCs) from patients with cutaneous leishmaniasis, CpG treatment similarly exhibited a dose-response effect on the production of IFN-γ, IL-17, IL-10, and IL-13, with reductions observed at higher doses. To further understand the underlying mechanisms and cell populations driving the CpG mediated response, we examined the ex vivo dose effects mediated by the TLR9+ cell populations (dendritic cells, macrophages, and B cells) found to accumulate labeled CpG in vivo. Notably, B cells altered the production of IL-17, IL-13, and IFN-γ, supporting a role for B cells functioning as antigen-presenting cells (APCs) and/or regulatory cells during infection. Interestingly, B cells have been previously demonstrated as a primary type of APC in patients infected with L. (V.) panamensis and thus may be useful targets of immunotherapy. Collectively, our results show that CpG-induced immune regulation leads to a dampening of the host immune response and healing in the mouse model, and it may provide an alternate approach to treatment of cutaneous leishmaniasis caused by L. (V.) panamensis. PMID:28052994
TET1 Depletion Induces Aberrant CpG Methylation in Colorectal Cancer Cells
Yamamoto, Eiichiro; Harada, Taku; Aoki, Hironori; Maruyama, Reo; Toyota, Mutsumi; Sasaki, Yasushi; Sugai, Tamotsu; Tokino, Takashi; Nakase, Hiroshi
2016-01-01
Aberrant DNA methylation is commonly observed in colorectal cancer (CRC), but the underlying mechanism is not fully understood. 5-hydroxymethylcytosine levels and TET1 expression are both reduced in CRC, while epigenetic silencing of TET1 is reportedly associated with the CpG island methylator phenotype. In the present study, we aimed to clarify the relationship between loss of TET1 and aberrant DNA methylation in CRC. Stable TET1 knockdown clones were established using Colo320DM cells, which express high levels of TET1, and HCT116 cells, which express TET1 at a level similar to that in normal colonic tissue. Infinium HumanMethylation450 BeadChip assays revealed increased levels of 5-methylcytosine at more than 10,000 CpG sites in TET1-depleted Colo320DM cells. Changes in DNA methylation were observed at various positions within the genome, including promoters, gene bodies and intergenic regions, and the altered methylation affected expression of a subset of genes. By contrast, TET1 knockdown did not significantly affect DNA methylation in HCT116 cells. However, TET1 depletion was associated with attenuated effects of 5-aza-2’-deoxycytidine on gene expression profiles in both cell lines. These results suggest that loss of TET1 may induce aberrant DNA methylation and may attenuate the effect of 5-aza-2’-deoxycytidine in CRC cells. PMID:27977763
Shi, Y; Li, M; Song, C; Xu, Q; Huo, R; Shen, L; Xing, Q; Cui, D; Li, W; Zhao, J; He, L; Qin, S
2017-01-01
Nowadays, risperidone is an atypical antipsychotic drug that has been increasingly used for treatment and maintenance therapy in schizophrenia. However, partially affected by genetic or environmental factors, there is significant difference in treatment outcomes among patients. In this study, we aimed to interpret the difference between good and poor responders treated with risperidone in both genetic and epigenetic levels in 288 mainland Chinese patients. We recruited a Henan cohort including 98 patients as initial discovery group and then confirmed our results in Shanghai cohort. In genetic studies, we found 10 candidate single-nucleotide polymorphisms (SNPs) and 2 rare variants in Henan cohort by next-generation sequencing of 100 risperidone-response-related genes. After replication in Shanghai cohort by massarray platform, ultimately, rs6706232 and rs4818 were significantly associated with risperidone response in the two cohort meta-analysis (P=0.024 and 0.04, respectively). Besides, we also selected another reported 17 candidate SNPs associated with risperidone drug response to replicate in our mainland Chinese samples, while, we found no significant SNPs after Bonferroni correction. In epigenetic studies, we investigated the methylation status in promoters or gene-coding region of risperidone drug response-related genes including CYP3A4, CYP2D6, ABCB1, HTR2A, DRD2. Totally we found seven significant CpG sites in the meta-analysis with Bonferroni-corrected PCYP3A4_CpG_-36=0.0014, PCYP3A4_CpG_-258=0.0013, PCYP3A4_CpG_-296=0.0014, PCYP3A4_CpG_-367:-372:-374=0.028, PCYP2D6_CpG_193=0.012, PCYP2D6_CpG_242:244:250=0.00076 and PCYP2D6_CpG_284=0.034, respectively. As genetic and epigenetic factors may interactively affect drug response, we finally carried out a multivariant interaction analysis with multifactor dimensionality reduction and discovered a significant four-locus model (CYP3A4_CpG_-82:-86 +rs6280+rs1800497+rs6265, P=0.038) affecting drug response. These findings could partially explain different risperidone response outcome in Chinese population in a systematic level. PMID:28696411
Li, Jun; Shi, Jian-Li; Wu, Xiao-Yan; Fu, Fang; Yu, Jiang; Yuan, Xiao-Yuan; Peng, Zhe; Cong, Xiao-Yan; Xu, Shao-Jian; Sun, Wen-Bo; Cheng, Kai-Hui; Du, Yi-Jun; Wu, Jia-Qiang; Wang, Jin-Bao; Huang, Bao-Hua
2015-06-01
Nowadays, adjuvant is still important for boosting immunity and improving resistance in animals. In order to boost the immunity of porcine circovirus type 2 (PCV2) DNA vaccine, CpG motifs were inserted. In this study, the dose-effect was studied, and the immunity of PCV2 DNA vaccines by recombinant open reading frame 2 (ORF2) gene and CpG motifs was evaluated. Three-week-old Changbai piglets were inoculated intramuscularly with 200 μg, 400 μg, and 800 μg DNA vaccines containing 14 and 18 CpG motifs, respectively. Average gain and rectum temperature were recorded everyday during the experiments. Blood was collected from the piglets after vaccination to detect the changes of specific antibodies, interleukin-2, and immune cells every week. Tissues were collected for histopathology and polymerase chain reaction. The results indicated that compared to those of the control piglets, all concentrations of two DNA vaccines could induce PCV2-specific antibodies. A cellular immunity test showed that PCV2-specific lymphocytes proliferated the number of TH, TC, and CD3+ positive T-cells raised in the blood of DNA vaccine immune groups. There was no distinct pathological damage and viremia occurring in pigs that were inoculated with DNA vaccines, but there was some minor pathological damage in the control group. The results demonstrated that CpG motifs as an adjuvant could boost the humoral and cellular immunity of pigs to PCV2, especially in terms of cellular immunity. Comparing two DNA vaccines that were constructed, the one containing 18 CpG motifs was more effective. This is the first report that CpG motifs as an adjuvant insert to the PCV2 DNA vaccine could boost immunity.
Adriani, Walter; Romano, Emilia; Pucci, Mariangela; Pascale, Esterina; Cerniglia, Luca; Cimino, Silvia; Tambelli, Renata; Curatolo, Paolo; Granstrem, Oleg; Maccarrone, Mauro; Laviola, Giovanni; D'Addario, Claudio
2018-02-01
In view of the need for easily accessible biomarkers, we evaluated in ADHD children the epigenetic status of the 5'-untranslated region (UTR) in the SLC6A3 gene, coding for human dopamine transporter (DAT). We analysed buccal swabs and sera from 30 children who met DSM-IV-TR criteria for ADHD, assigned to treatment according to severity. Methylation levels at six-selected CpG sites (among which, a CGGCGGCGG and a CGCG motif), alone or in combination with serum titers in auto-antibodies against dopamine transporter (DAT aAbs), were analysed for correlation with CGAS scores (by clinicians) and Conners' scales (by parents), collected at recruitment and after 6 weeks. In addition, we characterized the DAT genotype, i.e., the variable number tandem repeat (VNTR) polymorphisms at the 3'-UTR of the gene. DAT methylation levels were greatly reduced in ADHD patients compared to control, healthy children. Within patients carrying at least one DAT 9 allele (DAT 9/x), methylation at positions CpG2 and/or CpG6 correlated with recovery, as evident from delta-CGAS scores as well as delta Conners' scales ('inattentive' and 'hyperactive' subscales). Moreover, hypermethylation at CpG1 position denoted severity, specifically for those patients carrying a DAT 10/10 genotype. Intriguingly, high serum DAT-aAbs titers appeared to corroborate indications from high CpG1 versus high CpG2/CpG6 levels, likewise denoting severity versus recovery in DAT 10/10 versus 9/x patients, respectively. These profiles suggest that DAT 5'UTR epigenetics plus serum aAbs can serve as suitable biomarkers, to confirm ADHD diagnosis and/or to predict the efficacy of treatment.
Amer, Yasser Sami; Al Nemri, Abdulrahman; Osman, Mohamed Elfaki; Saeed, Elshazaly; Assiri, Asaad Mohamed; Mohamed, Sarar
2018-04-03
To explore perception, attitude, and satisfaction of paediatric clinicians, trainees, and nurses at King Khalid University Hospital towards clinical practice guidelines (CPGs) including the locally adapted diabetic ketoacidosis CPG (DKA-CPG). A cross-sectional survey was distributed to 260 doctors and nurses working in the paediatrics department. The response rate was 95.4%. The respondents had a positive perception and attitude towards general CPGs and specifically for the DKA-CPG; 98.7% thought CPGs were useful sources of advice, improved safety, and decreased risk, and reduced variation in practice. A total of 99.2% thought CPGs were good clinical tools, 98.3% satisfied with, had confidence in well-developed CPGs, and would recommend them to their colleagues to use, and 94.6% agreed they were cost-effective. The preferred format for CPGs was paper (46.6%) and electronic (42.9%). The DKA-CPG helped in managing patients and respondents were all satisfied and had confidence with it (100%). The rationale and objectives of the DKA-CPG were clear for 99.25%; 98.5% thought the layout was clear and well organized and user-friendly (96.2%). Compared with nurses, physicians had a higher perception towards CPGs in general (P < .05) and the DKA-CPG (P < .05). The paediatric doctors, and nurses have a great perception and satisfaction and positive attitude towards CPGs in general, towards the paediatric diabetic ketoacidosis CPG in particular, which in turn had a positive impact on the acceptability and implementation of the CPGs. These findings could help in sustaining a safe and high-quality health care environment through implementation of evidence-based CPGs. © 2018 John Wiley & Sons, Ltd.
Wang, Jun; Zhou, Hong; Zheng, Jiang; Cheng, Juan; Liu, Wei; Ding, Guofu; Wang, Liangxi; Luo, Ping; Lu, Yongling; Cao, Hongwei; Yu, Shuangjiang; Li, Bin; Zhang, Lezhi
2006-01-01
In the present study artemisinin (ART) was found to have potent anti-inflammatory effects in animal models of sepsis induced by CpG-containing oligodeoxy-nucleotides (CpG ODN), lipopolysaccharide (LPS), heat-killed Escherichia coli 35218 or live E. coli. Furthermore, we found that ART protected mice from a lethal challenge by CpG ODN, LPS, or heat-killed E. coli in a dose-dependent manner and that the protection was related to a reduction in serum tumor necrosis factor alpha (TNF-α). More significantly, the administration of ART together with ampicillin or unasyn (a complex of ampicillin and sulbactam) decreased mortality from 100 to 66.7% or 33.3%, respectively, in mice subjected to a lethal live E. coli challenge. Together with the observation that ART alone does not inhibit bacterial growth, this result suggests that ART protection is achieved as a result of its anti-inflammatory activity rather than an antimicrobial effect. In RAW264.7 cells, pretreatment with ART potently inhibited TNF-α and interleukin-6 release induced by CpG ODN, LPS, or heat-killed E. coli in a dose- and time-dependent manner. Experiments utilizing affinity sensor technology revealed no direct binding of ART with CpG ODN or LPS. Flow cytometry further showed that ART did not alter binding of CpG ODN to cell surfaces or the internalization of CpG ODN. In addition, upregulated levels of TLR9 and TLR4 mRNA were not attenuated by ART treatment. ART treatment did, however, block the NF-κB activation induced by CpG ODN, LPS, or heat-killed E. coli. These findings provide compelling evidence that ART may be an important potential drug for sepsis treatment. PMID:16801421
Ribes, Sandra; Meister, Tanja; Ott, Martina; Redlich, Sandra; Janova, Hana; Hanisch, Uwe-Karsten; Nessler, Stefan; Nau, Roland
2014-01-23
Prophylaxis with unmethylated cytosine phosphate guanidine (CpG) oligodeoxynucleotides (ODN) protects against several systemic experimental infections. Escherichia coli is a major cause of Gram-negative neonatal bacterial meningitis and also causes meningitis and meningoencephalitis in older and immunocompromised patients. Wild-type (wt) and Toll-like receptor 9 (TLR9)-deficient mice were rendered neutropenic by intraperitoneal administration of the anti-Ly-6G monoclonal antibody. Immunocompetent and neutropenic mice received intraperitoneal CpG ODN or vehicle 72 h prior to induction of E. coli K1 meningoencephalitis. Pre-treatment with CpG ODN significantly increased survival of neutropenic wt mice from 33% to 75% (P = 0.0003) but did not protect neutropenic TLR9-/- mice. The protective effect of CpG ODN was associated with an enhanced production of interleukin (IL)-12/IL-23p40 with sustained increased levels in serum and spleen at least for 17 days after conditioning compared to buffer-treated animals. CpG-treated neutropenic wt mice showed reduced bacterial concentrations and increased recruitment of Ly6ChighCCR2+ monocytes in brain and spleen 42 h after infection. The levels of macrophage inflammatory protein 1α (MIP-1α) and interferon gamma (IFN-γ) in spleen were higher 42 h after infection in CpG-treated compared to buffer-treated neutropenic animals. In immunocompetent mice, prophylaxis with CpG ODN did not significantly increase survival compared to the buffer group (60% vs. 45%, P = 0.2). These findings suggest that systemic administration of CpG ODN may help to prevent bacterial CNS infections in immunocompromised individuals.
Ni, ZhouXian; Ye, YouJu; Bai, Tiandao; Xu, Meng; Xu, Li-An
2017-09-11
The chloroplast genome (CPG) of Pinus massoniana belonging to the genus Pinus (Pinaceae), which is a primary source of turpentine, was sequenced and analyzed in terms of gene rearrangements, ndh genes loss, and the contraction and expansion of short inverted repeats (IRs). P. massoniana CPG has a typical quadripartite structure that includes large single copy (LSC) (65,563 bp), small single copy (SSC) (53,230 bp) and two IRs (IRa and IRb, 485 bp). The 108 unique genes were identified, including 73 protein-coding genes, 31 tRNAs, and 4 rRNAs. Most of the 81 simple sequence repeats (SSRs) identified in CPG were mononucleotides motifs of A/T types and located in non-coding regions. Comparisons with related species revealed an inversion (21,556 bp) in the LSC region; P. massoniana CPG lacks all 11 intact ndh genes (four ndh genes lost completely; the five remained truncated as pseudogenes; and the other two ndh genes remain as pseudogenes because of short insertions or deletions). A pair of short IRs was found instead of large IRs, and size variations among pine species were observed, which resulted from short insertions or deletions and non-synchronized variations between "IRa" and "IRb". The results of phylogenetic analyses based on whole CPG sequences of 16 conifers indicated that the whole CPG sequences could be used as a powerful tool in phylogenetic analyses.
2013-01-01
Background There is now compelling evidence that epigenetic modifications link adult disease susceptibility to environmental exposures during specific life stages, including pre-pubertal development. Animal studies indicate that bisphenol A (BPA), the monomer used in epoxy resins and polycarbonate plastics, may impact health through epigenetic mechanisms, and epidemiological data associate BPA levels with metabolic disorders, behavior changes, and reproductive effects. Thus, we conducted an environmental epidemiology study of BPA exposure and CpG methylation in pre-adolescent girls from Gharbiah, Egypt hypothesizing that methylation profiles exhibit exposure-dependent trends. Methods Urinary concentrations of total (free plus conjugated) species of BPA in spot samples were quantified for 60 girls aged 10 to 13. Genome-wide CpG methylation was concurrently measured in bisulfite-converted saliva DNA using the Infinium HumanMethylation27 BeadChip (N = 46). CpG sites from four candidate genes were validated via quantitative bisulfite pyrosequencing. Results CpG methylation varied widely among girls, and higher urinary BPA concentrations were generally associated with less genomic methylation. Based on pathway analyses, genes exhibiting reduced methylation with increasing urinary BPA were involved in immune function, transport activity, metabolism, and caspase activity. In particular, hypomethylation of CpG targets on chromosome X was associated with higher urinary BPA. Using the Comparative Toxicogenomics Database, we identified a number of candidate genes in our sample that previously have been associated with BPA-related expression change. Conclusions These data indicate that BPA may affect human health through specific epigenomic modification of genes in relevant pathways. Thus, epigenetic epidemiology holds promise for the identification of biomarkers from previous exposures and the development of epigenetic-based diagnostic strategies. PMID:23590724
Turró-Garriga, Oriol; Calvó-Perxas, Laia; Vilalta-Franch, Joan; Hernández-Ferrándiz, Marta; Flaqué, Margarita; Linares, Marta; Cullell, Marta; Gich, Jordi; Casas, Isabel; Perkal, Héctor; Garre-Olmo, Josep
2017-01-01
There are several position statements and clinical practice guidelines (CPG) for diagnosing dementia. Our aims were to evaluate the adherence to CPG among specialists in the 7 memory clinics included in the Registry of Dementias of Girona (ReDeGi), and to compare the results between 2007-2011 and 2012-2015. We also determined the time and number of visits required to achieve a diagnosis, the supplementary tests ordered, and the drugs prescribed according to dementia subtypes. Medical charts of a stratified random sample of 475 ReDeGi cases were reviewed. Basic dementia work-up was evaluated using as a reference evidence-based CPG. An Index of Adherence (AI) was calculated using the following items in the medical chart: cognitive symptomatology; functional disability evaluation; physical examination; neurological examination; psychiatric examination; brief cognitive examination; activities of daily living performance examination; blood test; structural neuroimaging (CT-scan or MRI). The mean AI to CPG among specialists was of 8.2 points, and it improved from 7.9 points in 2007-2011 to 8.5 points in 2012-2015 (Cohen's d = 0.46). A lower adherence was detected in the most severe cases. A dementia diagnosis required 3.5 visits, regardless of the subtype of dementia, although milder cases required more time, more visits, and more supplementary tests than severe cases. The adherence to CPG in the catchment area of the ReDeGi is high, and an epidemiological surveillance system such as the ReDeGi may help in improving it. Dementia guidelines should establish procedures adapted to clinical practice, with simplified recommendations for most severe cases.
Shen, Hong; Iwasaki, Akiko
2006-01-01
Topical microbicides represent a promising new approach to preventing HIV and other sexually transmitted infections. TLR agonists are ideal candidates for microbicides, as they trigger a multitude of antiviral genes effective against a broad range of viruses. Although vaginal application of CpG oligodeoxynucleotides (ODNs) and poly I:C has been shown to protect mice from genital herpes infection, the mechanism by which these agents provide protection remains unclear. Here, we show that plasmacytoid DCs (pDCs) are required for CpG ODN–mediated protection against lethal vaginal challenge with herpes simplex virus type 2 (HSV-2). Moreover, we demonstrate that cells of both the hematopoietic and stromal compartments must respond to CpG ODN via TLR9 and to type I IFNs through IFN-αβ receptor (IFN-αβR) for protection. Thus, crosstalk between pDCs and vaginal stromal cells provides for optimal microbicide efficacy. Our results imply that temporally and spatially controlled targeting of CpG ODN to pDCs and epithelial cells can potentially maximize their effectiveness as microbicides while minimizing the associated inflammatory responses. PMID:16878177
The contribution of a central pattern generator in a reflex-based neuromuscular model
Dzeladini, Florin; van den Kieboom, Jesse; Ijspeert, Auke
2014-01-01
Although the concept of central pattern generators (CPGs) controlling locomotion in vertebrates is widely accepted, the presence of specialized CPGs in human locomotion is still a matter of debate. An interesting numerical model developed in the 90s’ demonstrated the important role CPGs could play in human locomotion, both in terms of stability against perturbations, and in terms of speed control. Recently, a reflex-based neuro-musculo-skeletal model has been proposed, showing a level of stability to perturbations similar to the previous model, without any CPG components. Although exhibiting striking similarities with human gaits, the lack of CPG makes the control of speed/step length in the model difficult. In this paper, we hypothesize that a CPG component will offer a meaningful way of controlling the locomotion speed. After introducing the CPG component in the reflex model, and taking advantage of the resulting properties, a simple model for gait modulation is presented. The results highlight the advantages of a CPG as feedforward component in terms of gait modulation. PMID:25018712
Jeziorska, Danuta M.; Murray, Robert J. S.; De Gobbi, Marco; Gaentzsch, Ricarda; Garrick, David; Ayyub, Helena; Chen, Taiping; Li, En; Telenius, Jelena; Lynch, Magnus; Graham, Bryony; Smith, Andrew J. H.; Lund, Jonathan N.; Hughes, Jim R.; Higgs, Douglas R.
2017-01-01
The human genome contains ∼30,000 CpG islands (CGIs). While CGIs associated with promoters nearly always remain unmethylated, many of the ∼9,000 CGIs lying within gene bodies become methylated during development and differentiation. Both promoter and intragenic CGIs may also become abnormally methylated as a result of genome rearrangements and in malignancy. The epigenetic mechanisms by which some CGIs become methylated but others, in the same cell, remain unmethylated in these situations are poorly understood. Analyzing specific loci and using a genome-wide analysis, we show that transcription running across CGIs, associated with specific chromatin modifications, is required for DNA methyltransferase 3B (DNMT3B)-mediated DNA methylation of many naturally occurring intragenic CGIs. Importantly, we also show that a subgroup of intragenic CGIs is not sensitive to this process of transcription-mediated methylation and that this correlates with their individual intrinsic capacity to initiate transcription in vivo. We propose a general model of how transcription could act as a primary determinant of the patterns of CGI methylation in normal development and differentiation, and in human disease. PMID:28827334
Greig syndrome: Analysis of the GL13 gene
DOE Office of Scientific and Technical Information (OSTI.GOV)
Grzeschik, K.H.; Gessler, M.; Heid, C.
1994-09-01
Disruption of the zinc finger gene GL13 by translocation events has been implicated as the cause for cephalopolysyndactyly syndrome (GCPS) in several patients. To characterize this genomic region on human chromosome 7p13, we have isolated a YAC contig of more than 1000 kb including the GL13 gene. About 550 kb from this area were subdivided into a cosmid contig with a two- to ten-fold clone coverage. In this region the cloned GL13 cDNA appears to correspond to at least 14 exons spread over a distance of 280 kb. A CpG island defined by two NotI sites and several BssHII andmore » KspI sites is located in a genomic fragment covering the most proximal exon of the cloned GL13 cDNA. Further upstream, five segments conserved between man and mouse were found. In the mouse this region has been characterized as the transgene integration site resulting in the add phenotype. Both the CpG islands and the conserved regions are likely candidates to search for GL13 promoter and control elements. Intron-exon boundaries and breakpoints of the translocation events within the gene region of patients were identified and characterized.« less
Doi, Akiko; Park, In-Hyun; Wen, Bo; Murakami, Peter; Aryee, Martin J; Irizarry, Rafael; Herb, Brian; Ladd-Acosta, Christine; Rho, Junsung; Loewer, Sabine; Miller, Justine; Schlaeger, Thorsten; Daley, George Q; Feinberg, Andrew P
2010-01-01
Induced pluripotent stem (iPS) cells are derived by epigenetic reprogramming, but their DNA methylation patterns have not yet been analyzed on a genome-wide scale. Here, we find substantial hypermethylation and hypomethylation of cytosine-phosphate-guanine (CpG) island shores in nine human iPS cell lines as compared to their parental fibroblasts. The differentially methylated regions (DMRs) in the reprogrammed cells (denoted R-DMRs) were significantly enriched in tissue-specific (T-DMRs; 2.6-fold, P < 10−4) and cancer-specific DMRs (C-DMRs; 3.6-fold, P < 10−4). Notably, even though the iPS cells are derived from fibroblasts, their R-DMRs can distinguish between normal brain, liver and spleen cells and between colon cancer and normal colon cells. Thus, many DMRs are broadly involved in tissue differentiation, epigenetic reprogramming and cancer. We observed colocalization of hypomethylated R-DMRs with hypermethylated C-DMRs and bivalent chromatin marks, and colocalization of hypermethylated R-DMRs with hypomethylated C-DMRs and the absence of bivalent marks, suggesting two mechanisms for epigenetic reprogramming in iPS cells and cancer. PMID:19881528
Environment, diet and CpG island methylation: epigenetic signals in gastrointestinal neoplasia.
Johnson, Ian T; Belshaw, Nigel J
2008-04-01
The epithelial surfaces of the mammalian alimentary tract are characterised by very high rates of cell proliferation and DNA synthesis, and in humans they are highly susceptible to cancer. The role of somatic mutations as drivers of carcinogenesis in the alimentary tract is well established, but the importance of gene silencing by epigenetic mechanisms is increasingly recognised. Methylation of CpG islands is an important component of the epigenetic code that regulates gene expression during development and normal cellular differentiation, and a number of genes are well known to become abnormally methylated during the development of tumours of the oesophagus, stomach and colorectum. Aberrant patterns of DNA methylation develop as a result of pathological processes such as chronic inflammation, and in response to various dietary factors, including imbalances in the supply of methyl donors, particularly folates, and exposure to DNA methyltransferase inhibitors, which include polyphenols and possibly isothiocyanates from plant foods. However the importance of these environmental interactions in human health and disease remains to be established. Recent moves to modify the exposure of human populations to folate, by mandatory supplementation of cereal foods, emphasise the importance of understanding the susceptibility of the human epigenome to dietary and other environmental effects.
CpG island methylator phenotype and its association with malignancy in sporadic duodenal adenomas.
Sun, Lifeng; Guzzetta, Angela A; Fu, Tao; Chen, Jinming; Jeschke, Jana; Kwak, Ruby; Vatapalli, Rajita; Baylin, Stephen B; Iacobuzio-Donahue, Christine A; Wolfgang, Christopher L; Ahuja, Nita
2014-05-01
CpG island methylator phenotype (CIMP) has been found in multiple precancerous and cancerous lesions, including colorectal adenomas, colorectal cancers, and duodenal adenocarcinomas. There are no reports in the literature of a relationship between CIMP status and clinicopathologic features of sporadic duodenal adenomas. This study sought to elucidate the role of methylation in duodenal adenomas and correlate it with KRAS and BRAF mutations. CIMP+ (with more than 2 markers methylated) was seen in 33.3% of duodenal adenomas; 61% of these CIMP+ adenomas were CIMP-high (with more than 3 markers methylated). Furthermore, CIMP+ status significantly correlated with older age of patients, larger size and villous type of tumor, coexistent dysplasia and periampullary location. MLH1 methylation was seen in 11.1% of duodenal adenomas and was significantly associated with CIMP+ tumors, while p16 methylation was an infrequent event. KRAS mutations were frequent and seen in 26.3% of adenomas; however, no BRAF mutations were detected. Furthermore, CIMP-high status was associated with larger size and villous type of tumor and race (non-white). These results suggest that CIMP+ duodenal adenomas may have a higher risk for developing malignancy and may require more aggressive management and surveillance.
CpG island methylator phenotype and its association with malignancy in sporadic duodenal adenomas
Sun, Lifeng; Guzzetta, Angela A; Fu, Tao; Chen, Jinming; Jeschke, Jana; Kwak, Ruby; Vatapalli, Rajita; Baylin, Stephen B; Iacobuzio-Donahue, Christine A; Wolfgang, Christopher L; Ahuja, Nita
2014-01-01
CpG island methylator phenotype (CIMP) has been found in multiple precancerous and cancerous lesions, including colorectal adenomas, colorectal cancers, and duodenal adenocarcinomas. There are no reports in the literature of a relationship between CIMP status and clinicopathologic features of sporadic duodenal adenomas. This study sought to elucidate the role of methylation in duodenal adenomas and correlate it with KRAS and BRAF mutations. CIMP+ (with more than 2 markers methylated) was seen in 33.3% of duodenal adenomas; 61% of these CIMP+ adenomas were CIMP-high (with more than 3 markers methylated). Furthermore, CIMP+ status significantly correlated with older age of patients, larger size and villous type of tumor, coexistent dysplasia and periampullary location. MLH1 methylation was seen in 11.1% of duodenal adenomas and was significantly associated with CIMP+ tumors, while p16 methylation was an infrequent event. KRAS mutations were frequent and seen in 26.3% of adenomas; however, no BRAF mutations were detected. Furthermore, CIMP-high status was associated with larger size and villous type of tumor and race (non-white). These results suggest that CIMP+ duodenal adenomas may have a higher risk for developing malignancy and may require more aggressive management and surveillance. PMID:24518818
Woo, Hye Ryun; Dittmer, Travis A.; Richards, Eric J.
2008-01-01
Methylcytosine-binding proteins decipher the epigenetic information encoded by DNA methylation and provide a link between DNA methylation, modification of chromatin structure, and gene silencing. VARIANT IN METHYLATION 1 (VIM1) encodes an SRA (SET- and RING-associated) domain methylcytosine-binding protein in Arabidopsis thaliana, and loss of VIM1 function causes centromere DNA hypomethylation and centromeric heterochromatin decondensation in interphase. In the Arabidopsis genome, there are five VIM genes that share very high sequence similarity and encode proteins containing a PHD domain, two RING domains, and an SRA domain. To gain further insight into the function and potential redundancy among the VIM proteins, we investigated strains combining different vim mutations and transgenic vim knock-down lines that down-regulate multiple VIM family genes. The vim1 vim3 double mutant and the transgenic vim knock-down lines showed decreased DNA methylation primarily at CpG sites in genic regions, as well as repeated sequences in heterochromatic regions. In addition, transcriptional silencing was released in these plants at most heterochromatin regions examined. Interestingly, the vim1 vim3 mutant and vim knock-down lines gained ectopic CpHpH methylation in the 5S rRNA genes against a background of CpG hypomethylation. The vim1 vim2 vim3 triple mutant displayed abnormal morphological phenotypes including late flowering, which is associated with DNA hypomethylation of the 5′ region of FWA and release of FWA gene silencing. Our findings demonstrate that VIM1, VIM2, and VIM3 have overlapping functions in maintenance of global CpG methylation and epigenetic transcriptional silencing. PMID:18704160
Barry, Kathryn Hughes; Moore, Lee E; Sampson, Joshua; Yan, Liying; Meyer, Ann; Oler, Andrew J; Chung, Charles C; Wang, Zhaoming; Yeager, Meredith; Amundadottir, Laufey; Berndt, Sonja I
2014-12-01
Chromosome 8q24 has emerged as an important region for genetic susceptibility to various cancers, but little is known about the contribution of DNA methylation at 8q24. To evaluate variability in DNA methylation levels at 8q24 and the relationship with cancer susceptibility single nucleotide polymorphisms (SNPs) in this region, we quantified DNA methylation levels in peripheral blood at 145 CpG sites nearby 8q24 cancer susceptibility SNPs or MYC using pyrosequencing among 80 Caucasian men in the Prostate, Lung, Colorectal, and Ovarian Cancer Screening Trial. For the 60 CpG sites meeting quality control, which also demonstrated temporal stability over a 5-year period, we calculated pairwise Spearman correlations for DNA methylation levels at each CpG site with 42 8q24 cancer susceptibility SNPs. To account for multiple testing, we adjusted P values into q values reflecting the false discovery rate (FDR). In contrast to the MYC CpG sites, most sites nearby the SNPs demonstrated good reproducibility, high methylation levels, and moderate-high between-individual variation. We observed 10 statistically significant (FDR < 0.05) CpG site-SNP correlations. These included correlations between an intergenic CpG site at Chr8:128393157 and the prostate cancer SNP rs16902094 (ρ = -0.54; P = 9.7 × 10(-7); q = 0.002), a PRNCR1 CpG site at Chr8:128167809 and the prostate cancer SNP rs1456315 (ρ = 0.52; P = 1.4 × 10(-6); q = 0.002), and two POU5F1B CpG sites and several prostate/colorectal cancer SNPs (for Chr8:128498051 and rs6983267, ρ = 0.46; P = 2.0 × 10(-5); q = 0.01). This is the first report of correlations between blood DNA methylation levels and cancer susceptibility SNPs at 8q24, suggesting that DNA methylation at this important susceptibility locus may contribute to cancer risk. ©2014 American Association for Cancer Research.
Kredo, Tamara; Abrams, Amber; Young, Taryn; Louw, Quinette; Volmink, Jimmy; Daniels, Karen
2017-08-29
Clinical practice guidelines (CPGs) are common tools in policy and clinical practice informing clinical decisions at the bedside, governance of health facilities, health insurer and government spending, and patient choices. South Africa's health sector is transitioning to a national health insurance system, aiming to build on other primary health care initiatives to transform the previously segregated, inequitable services. Within these plans CPGs are an integral tool for delivering standardised and cost effective care. Currently, there is no accepted standard approach to developing, adapting or implementing CPGs efficiently or effectively in South Africa. We explored the current players; drivers; and the context and processes of primary care CPG development from the perspective of stakeholders operating at national level. We used a qualitative approach. Sampling was initially purposeful, followed by snowballing and further sampling to reach representivity of primary care service providers. Individual in-depth interviews were recorded and transcribed verbatim. We used thematic content analysis to analyse the data. We conducted 37 in-depth interviews from June 2014-July 2015. We found CPG development and implementation were hampered by lack of human and funding resources for technical and methodological work; fragmentation between groups, and between national and provincial health sectors; and lack of agreed systems for CPG development and implementation. Some CPG contributors steadfastly work to improve processes aiming to enhance communication, use of evidence, and transparency to ensure credible guidance is produced. Many interviewed had shared values, and were driven to address inequity, however, resource gaps were perceived to create an enabling environment for commercial interests or personal agendas to drive the CPG development process. Our findings identified strengths and gaps in CPG development processes, and a need for national standards to guide CPG development and implementation. Based on our findings and suggestions from participants, a possible way forward would be for South Africa to have a centrally coordinated CPG unit to address these needs and aspects of fragmentation by devising processes that support collaboration, transparency and credibility across sectors and disciplines. Such an initiative will require adequate resourcing to build capacity and ensure support for the delivery of high quality CPGs for South African primary care.
NASA Astrophysics Data System (ADS)
Frederickson, Lee Thomas
Much of combustion research focuses on reducing soot particulates in emissions. However, current research at San Diego State University (SDSU) Combustion and Solar Energy Laboratory (CSEL) is underway to develop a high temperature solar receiver which will utilize carbon nanoparticles as a solar absorption medium. To produce carbon nanoparticles for the small particle heat exchange receiver (SPHER), a lab-scale carbon particle generator (CPG) has been built and tested. The CPG is a heated ceramic tube reactor with a set point wall temperature of 1100-1300°C operating at 5-6 bar pressure. Natural gas and nitrogen are fed to the CPG where natural gas undergoes pyrolysis resulting in carbon particles. The gas-particle mixture is met downstream with dilution air and sent to the lab scale solar receiver. To predict soot yield and general trends in CPG performance, a model has been setup in Reaction Design CHEMKIN-PRO software. One of the primary goals of this research is to accurately measure particle properties. Mean particle diameter, size distribution, and index of refraction are calculated using Scanning Electron Microscopy (SEM) and a Diesel Particulate Scatterometer (DPS). Filter samples taken during experimentation are analyzed to obtain a particle size distribution with SEM images processed in ImageJ software. These results are compared with the DPS, which calculates the particle size distribution and the index of refraction from light scattering using Mie theory. For testing with the lab scale receiver, a particle diameter range of 200-500 nm is desired. Test conditions are varied to understand effects of operating parameters on particle size and the ability to obtain the size range. Analysis of particle loading is the other important metric for this research. Particle loading is measured downstream of the CPG outlet and dilution air mixing point. The air-particle mixture flows through an extinction tube where opacity of the mixture is measured with a 532 nm laser and detector. Beer's law is then used to calculate particle loading. The CPG needs to produce a certain particle loading for a corresponding receiver test. By obtaining the particle loading in the system, the reaction conversion to solid carbon in the CPG can be calculated to measure the efficiency of the CPG. To predict trends in reaction conversion and particle size from experimentation, the CHEMKIN-PRO computer model for the CPG is run for various flow rates and wall temperature profiles. These predictions were a reason for testing at higher wall set point temperatures. Based on these research goals, it was shown that the CPG consistently produces a mean particle diameter of 200-400 nm at the conditions tested, fitting perfectly inside the desired range. This led to successful lab scale SPHER testing which produced a 10-point efficiency increase and 150°C temperature difference with particles present. Also, at 3 g/s dilution air flow rate, an efficiency of 80% at an outlet temperature above 800°C was obtained. Promise was shown at higher CPG experimental temperatures to produce higher reaction conversion, both experimentally and in the model. However, based on wall temperature data taken during experimentation, it is apparent that the CPG needs to have multiple heating zones with separate temperature controllers in order to have an isothermal zone rather than a parabolic temperature profile. As for the computer model, it predicted much higher reaction conversion at higher temperature. The mass fraction of fuel in the inlet stream was shown to not affect conversion while increasing residence time led to increasing conversion. Particle size distribution in the model was far off and showed a bimodal distribution for one of the statistical methods. Using the results from experimentation and modeling, a preliminary CPG design is presented that will operate in a 5MWth receiver system.
Ben-Sasson, Ayelet; Lamash, Liron; Gal, Eynat
2013-09-01
The goal of this stud was to examine whether a technological touch activated Collaborative Puzzle Game (CPG) increased positive social behaviors in children with high functioning autism spectrum disorder (HFASD). The CPG involved construction of a virtual puzzle by selecting and dragging pieces into the solution area on a touch screen table. The target picture was presented on the top of the screen. Six dyads of children with HFASD (aged 8-11 years) engaged in the CPG in a Free Play (FP) mode in which partners could independently move puzzle pieces versus in an Enforced Collaboration (EC) mode in which partners could only move puzzle pieces together. Videos of the dames were coded for the frequencies of positive and negative social interaction, affect, play, and autistic behaviors. Parents completed the Social Responsiveness Scale (SRS). Wilcoxon Signed-ranks tests indicated that children with HFASD showed significantly higher frequencies of positive social interaction and collaborative play in the EC versus FP modes but there were no differences in negative social behaviors. Differences in social behaviors between partners during the puzzle games were not significant; however there were differences within pair in the severity of social deficits as assessed by the SRS questionnaire. The CPG in an EC mode was effective in promoting positive social interaction by requiring children to work together towards a mutual goal. However, the increased challenge in this mode, particularly for children with lower social-communication skills, suggests the need for establishing selection criteria and mediation steps for such interventions.
Central pattern generation involved in oral and respiratory control for feeding in the term infant
Barlow, Steven M.
2009-01-01
Purpose of review Drinking and eating are essential skills for survival and benefit from the coordination of several pattern generating networks and their musculoskeletal effectors to achieve safe swallows. Oral-pharyngo-esophageal motility develops during infancy and early childhood, and is influenced by various factors, including neuromuscular maturation, dietary and postural habits, arousal state, ongoing illnesses, congenital anomalies, and the effects of medical or surgical interventions. Gastroesophageal reflux is frequent in neonates and infants, and its role in neonatal morbidity including dysphagia, chronic lung disease, or apparent life-threatening events is not well understood. This review highlights recent studies aimed at understanding the development of oral feeding skills, and cross-system interactions among the brainstem, spinal, and cerebral networks involved in feeding. Recent Findings Functional linkages between suck-swallow and swallow-respiration manifest transitional forms during late gestation through the first year of life which can be delayed or modified by sensory experience and/or disease processes. Relevant central pattern generator (CPG) networks and their neuromuscular targets attain functional status at different rates, which ultimately influences cross-system CPG interactions. Entrainment of trigeminal primary afferents accelerates pattern genesis for the suck CPG and transition-to-oral feed in the RDS preterm infant. Summary The genesis of within-system CPG control for rate and amplitude scaling matures differentially for suck, mastication, swallow, and respiration. Cross-system interactions among these CPGs represent targets of opportunity for new interventions which optimize experience-dependent mechanisms to promote safe swallows among newborn and pediatric patients. PMID:19417662
1999-05-14
The Food and Drug Administration (FDA) is announcing the availability of a new compliance policy guide (CPG) entitled "Year 2000 (Y2K) Computer Compliance" (section 160-800). This guidance document represents the agency's current thinking on the manufacturing and distribution of domestic and imported products regulated by FDA using computer systems that may not perform properly before, or during, the transition to the year 2000 (Y2K). The text of the CPG is included in this notice. This compliance guidance document is an update to the Compliance Policy Guides Manual (August 1996 edition). It is a new CPG, and it will be included in the next printing of the Compliance Policy Guides Manual. This CPG is intended for FDA personnel, and it is available electronically to the public.
CPG-inspired workspace trajectory generation and adaptive locomotion control for quadruped robots.
Liu, Chengju; Chen, Qijun; Wang, Danwei
2011-06-01
This paper deals with the locomotion control of quadruped robots inspired by the biological concept of central pattern generator (CPG). A control architecture is proposed with a 3-D workspace trajectory generator and a motion engine. The workspace trajectory generator generates adaptive workspace trajectories based on CPGs, and the motion engine realizes joint motion imputes. The proposed architecture is able to generate adaptive workspace trajectories online by tuning the parameters of the CPG network to adapt to various terrains. With feedback information, a quadruped robot can walk through various terrains with adaptive joint control signals. A quadruped platform AIBO is used to validate the proposed locomotion control system. The experimental results confirm the effectiveness of the proposed control architecture. A comparison by experiments shows the superiority of the proposed method against the traditional CPG-joint-space control method.
Loebrich, Sven; Benoit, Marc Robert; Konopka, Jaclyn Aleksandra; Cottrell, Jeffrey Richard; Gibson, Joanne; Nedivi, Elly
2016-02-08
Internalization of glutamate receptors at the postsynaptic membrane via clathrin-mediated endocytosis (CME) is a key mechanism for regulating synaptic strength. A role for the F-actin cytoskeleton in CME is well established, and recently, PKA-dependent association of candidate plasticity gene 2 (CPG2) with the spine-cytoskeleton has been shown to mediate synaptic glutamate receptor internalization. Yet, how the endocytic machinery is physically coupled to the actin cytoskeleton to facilitate glutamate receptor internalization has not been demonstrated. Moreover, there has been no distinction of endocytic-machinery components that are specific to activity-dependent versus constitutive glutamate receptor internalization. Here, we show that CPG2, through a direct physical interaction, recruits endophilin B2 (EndoB2) to F-actin, thus anchoring the endocytic machinery to the spine cytoskeleton and facilitating glutamate receptor internalization. Regulation of CPG2 binding to the actin cytoskeleton by protein kinase A directly impacts recruitment of EndoB2 and clathrin. Specific disruption of EndoB2 or the CPG2-EndoB2 interaction impairs activity-dependent, but not constitutive, internalization of both NMDA- and AMPA-type glutamate receptors. These results demonstrate that, through direct interactions with F-actin and EndoB2, CPG2 physically bridges the spine cytoskeleton and the endocytic machinery, and this tripartite association is critical specifically for activity-dependent CME of synaptic glutamate receptors. Copyright © 2016 Elsevier Ltd. All rights reserved.
Pangeson, Tanapat; Sanguansermsri, Phanchana; Sanguansermsri, Torpong; Seeratanachot, Teerapat; Suwanakhon, Narutchala; Srikummool, Metawee; Kaewkong, Worasak; Mahingsa, Khwanruedee
2017-01-01
In the wild-type allele, DNA methylation levels of 10 consecutive CpG sites adjacent to the upstream 5′-breakpoint of α-thalassemia Southeast Asian (SEA) deletion are not different between placenta and leukocytes. However, no previous study has reported the map of DNA methylation in the SEA allele. This report aims to show that the SEA mutation is associated with DNA methylation changes, resulting in differential methylation between placenta and leukocytes. Methylation-sensitive high-resolution analysis was used to compare DNA methylation among placenta, leukocytes, and unmethylated control DNA. The result indicates that the DNA methylation between placenta and leukocyte DNA is different and shows that the CpG status of both is not fully unmethylated. Mapping of individual CpG sites was performed by targeted bisulfite sequencing. The DNA methylation level of the 10 consecutive CpG sites was different between placenta and leukocyte DNA. When the 10th CpG of the mutation allele was considered as a hallmark for comparing DNA methylation level, it was totally different from the unmethylated 10th CpG of the wild-type allele. Finally, the distinct DNA methylation patterns between both DNA were extracted. In total, 24 patterns were found in leukocyte samples and 9 patterns were found in placenta samples. This report shows that the large deletion is associated with DNA methylation change. In further studies for clinical application, the distinct DNA methylation pattern might be a potential marker for detecting cell-free fetal DNA. PMID:29162979
The role of system Xc- in methamphetamine-induced dopaminergic neurotoxicity in mice.
Dang, Duy-Khanh; Shin, Eun-Joo; Tran, Hai-Quyen; Kim, Dae-Joong; Jeong, Ji Hoon; Jang, Choon-Gon; Nah, Seung-Yeol; Sato, Hideyo; Nabeshima, Toshitaka; Yoneda, Yukio; Kim, Hyoung-Chun
2017-09-01
The cystine/glutamate antiporter (system Xc - , Sxc) transports cystine into cell in exchange for glutamate. Since xCT is a specific subunit of Sxc, we employed xCT knockout mice and investigated whether this antiporter affected methamphetamine (MA)-induced dopaminergic neurotoxicity. MA treatment significantly increased striatal oxidative burdens in wild type mice. xCT inhibitor [i.e., S-4-carboxy-phenylglycine (CPG), sulfasalazine] or an xCT knockout significantly protected against these oxidative burdens. MA-induced increases in Iba-1 expression and Iba-1-labeled microglial immunoreactivity (Iba-1-IR) were significantly attenuated by CPG or sulfasalazine administration or xCT knockout. CPG or sulfasalazine significantly attenuated MA-induced TUNEL-positive cell populations in the striatum of Taconic ICR mice. The decrease in excitatory amino acid transporter-2 (or glutamate transporter-1) expression and increase in glutamate release were attenuated by CPG, sulfasalazine or xCT knockout. In addition, CPG, sulfasalazine or xCT knockout significantly protected against dopaminergic loss (i.e., decreases in tyrosine hydroxylase expression and immunoreactivity, and an increase in dopamine turnover rate) induced by MA. However, CPG, sulfasalazine or xCT knockout did not significantly affect the impaired glutathione system [i.e., decrease in reduced glutathione (GSH) and increase in oxidized glutathione (GSSG)] induced by MA. Our results suggest that Sxc mediates MA-induced neurotoxicity via facilitating oxidative stress, microgliosis, proapoptosis, and glutamate-related toxicity. Copyright © 2017 Elsevier Ltd. All rights reserved.
An epigenome-wide association analysis of cardiac autonomic responses among a population of welders.
Zhang, Jinming; Liu, Zhonghua; Umukoro, Peter E; Cavallari, Jennifer M; Fang, Shona C; Weisskopf, Marc G; Lin, Xihong; Mittleman, Murray A; Christiani, David C
2017-02-01
DNA methylation is one of the potential epigenetic mechanisms associated with various adverse cardiovascular effects; however, its association with cardiac autonomic dysfunction, in particular, is unknown. In the current study, we aimed to identify epigenetic variants associated with alterations in cardiac autonomic responses. Cardiac autonomic responses were measured with two novel markers: acceleration capacity (AC) and deceleration capacity (DC). We examined DNA methylation levels at more than 472,506 CpG probes through the Illumina Infinium HumanMethylation450 BeadChip assay. We conducted separate linear mixed models to examine associations of DNA methylation levels at each CpG with AC and DC. One CpG (cg26829071) located in the GPR133 gene was negatively associated with DC values after multiple testing corrections through false discovery rate. Our study suggests the potential functional importance of methylation in cardiac autonomic responses. Findings from the current study need to be replicated in future studies in a larger population.
Structure of the MLL CXXC domain – DNA complex and its functional role in MLL-AF9 leukemia
Cierpicki, Tomasz; Risner, Laurie E.; Grembecka, Jolanta; Lukasik, Stephen M.; Popovic, Relja; Omonkowska, Monika; Shultis, David S.; Zeleznik-Le, Nancy J.; Bushweller, John H.
2010-01-01
MLL (Mixed Lineage Leukemia) is the target of chromosomal translocations which cause leukemias with poor prognosis. All leukemogenic MLL fusion proteins retain the CXXC domain which binds to nonmethylated CpG DNA. We present the solution structure of the MLL CXXC domain in complex with DNA, showing for the first time how the CXXC domain distinguishes nonmethylated from methylated CpG DNA. Based on the structure, we designed point mutations which disrupt DNA binding. Introduction of these mutations into MLL-AF9 results in increased DNA methylation of specific CpG nucleotides in Hoxa9, increased H3K9 methylation, decreased expression of Hoxa9 locus transcripts, loss of immortalization potential, and inability to induce leukemia in mice. These results establish that DNA binding by the CXXC domain and protection against DNA methylation is essential for MLL fusion leukemia. They also provide support for this interaction as a potential target for therapeutic intervention. PMID:20010842
Sharma, Gaurav; Friedenberg, David A.; Annetta, Nicholas; Glenn, Bradley; Bockbrader, Marcie; Majstorovic, Connor; Domas, Stephanie; Mysiw, W. Jerry; Rezai, Ali; Bouton, Chad
2016-01-01
Neuroprosthetic technology has been used to restore cortical control of discrete (non-rhythmic) hand movements in a paralyzed person. However, cortical control of rhythmic movements which originate in the brain but are coordinated by Central Pattern Generator (CPG) neural networks in the spinal cord has not been demonstrated previously. Here we show a demonstration of an artificial neural bypass technology that decodes cortical activity and emulates spinal cord CPG function allowing volitional rhythmic hand movement. The technology uses a combination of signals recorded from the brain, machine-learning algorithms to decode the signals, a numerical model of CPG network, and a neuromuscular electrical stimulation system to evoke rhythmic movements. Using the neural bypass, a quadriplegic participant was able to initiate, sustain, and switch between rhythmic and discrete finger movements, using his thoughts alone. These results have implications in advancing neuroprosthetic technology to restore complex movements in people living with paralysis. PMID:27658585
Gnanapragasam, V J; Bratt, O; Muir, K; Lee, L S; Huang, H H; Stattin, P; Lophatananon, A
2018-02-28
The purpose of this study is to validate a new five-tiered prognostic classification system to better discriminate cancer-specific mortality in men diagnosed with primary non-metastatic prostate cancer. We applied a recently described five-strata model, the Cambridge Prognostic Groups (CPGs 1-5), in two international cohorts and tested prognostic performance against the current standard three-strata classification of low-, intermediate- or high-risk disease. Diagnostic clinico-pathological data for men obtained from the Prostate Cancer data Base Sweden (PCBaSe) and the Singapore Health Study were used. The main outcome measure was prostate cancer mortality (PCM) stratified by age group and treatment modality. The PCBaSe cohort included 72,337 men, of whom 7162 died of prostate cancer. The CPG model successfully classified men with different risks of PCM with competing risk regression confirming significant intergroup distinction (p < 0.0001). The CPGs were significantly better at stratified prediction of PCM compared to the current three-tiered system (concordance index (C-index) 0.81 vs. 0.77, p < 0.0001). This superiority was maintained for every age group division (p < 0.0001). Also in the ethnically different Singapore cohort of 2550 men with 142 prostate cancer deaths, the CPG model outperformed the three strata categories (C-index 0.79 vs. 0.76, p < 0.0001). The model also retained superior prognostic discrimination in the treatment sub-groups: radical prostatectomy (n = 20,586), C-index 0.77 vs. 074; radiotherapy (n = 11,872), C-index 0.73 vs. 0.69; and conservative management (n = 14,950), C-index 0.74 vs. 0.73. The CPG groups that sub-divided the old intermediate-risk (CPG2 vs. CPG3) and high-risk categories (CPG4 vs. CPG5) significantly discriminated PCM outcomes after radical therapy or conservative management (p < 0.0001). This validation study of nearly 75,000 men confirms that the CPG five-tiered prognostic model has superior discrimination compared to the three-tiered model in predicting prostate cancer death across different age and treatment groups. Crucially, it identifies distinct sub-groups of men within the old intermediate-risk and high-risk criteria who have very different prognostic outcomes. We therefore propose adoption of the CPG model as a simple-to-use but more accurate prognostic stratification tool to help guide management for men with newly diagnosed prostate cancer.
Lawless, Oliver J; Bellanti, Joseph A; Brown, Milton L; Sandberg, Kathryn; Umans, Jason G; Zhou, Li; Chen, Weiqian; Wang, Julie; Wang, Kan; Zheng, Song Guo
2018-03-01
Allergic and autoimmune diseases comprise a group of inflammatory disorders caused by aberrant immune responses in which CD25+ Forkhead box P3-positive (FOXP3+) T regulatory (Treg) cells that normally suppress inflammatory events are often poorly functioning. This has stimulated an intensive investigative effort to find ways of increasing Tregs as a method of therapy for these conditions. One such line of investigation includes the study of how ligation of Toll-like receptors (TLRs) by CpG oligonucleotides (ODN) results in an immunostimulatory cascade that leads to induction of T-helper (Th) type 1 and Treg-type immune responses. The present study investigated the mechanisms by which calf thymus mammalian double-stranded DNA (CT-DNA) and a synthetic methylated DNA CpG ODN sequence suppress in vitro lymphoproliferative responses to antigens, mitogens, and alloantigens when measured by [3H]-thymidine incorporation and promote FoxP3 expression in human CD4+ T cells in the presence of transforming growth factor (TGF) beta and interleukin-2 (IL-2). Lymphoproliferative responses of peripheral blood mononuclear cells from four healthy subjects or nine subjects with systemic lupus erythematosus to CT-DNA or phytohemagglutinin (PHA) was measured by tritiated thymidine ([3H]-TdR) incorporation expressed as a stimulation index. Mechanisms of immunosuppressive effects of CT-DNA were evaluated by measurement of the degree of inhibition to lymphoproliferative responses to streptokinase-streptodornase, phytohemagglutinin (PHA), concanavalin A (Con A), pokeweed mitogen (PWM), or alloantigens by a Con A suppressor assay. The effects of CpG methylation on induction of FoxP3 expression in human T cells were measured by comparing inhibitory responses of synthetic methylated and nonmethylated 8-mer CpG ODN sequences by using cell sorting, in vitro stimulation, and suppressor assay. Here, we showed that CT-DNA and a synthetic methylated DNA 8-mer sequence could suppress antigen-, mitogen-, and alloantigen-induced lymphoproliferation in vitro when measured by [3H]-thymidine. The synthetic methylated DNA CpG ODN but not an unmethylated CpG ODN sequence was shown to promote FoxP3 expression in human CD4+ T cells in the presence of TGF beta and IL-2. The induction of FoxP3+ suppressor cells is dose dependent and offers a potential clinical therapeutic application in allergic and autoimmune and inflammatory diseases. The use of this methylated CpG ODN offers a broad clinical application as a novel therapeutic method for Treg induction and, because of its low cost and small size, should facilitate delivery via nasal, respiratory, gastrointestinal routes, and/or by injection, routes of administration important for vaccine delivery to target sites responsible for respiratory, gastrointestinal, and systemic forms of allergic and autoimmune disease.
Zhang, Lei; Li, Hongyong; Hai, Yan; Yin, Wei; Li, Wenjian; Zheng, Boyang; Du, Xiaomin; Li, Na; Zhang, Zhengzheng; Deng, Yuqing; Zeng, Ruihong; Wei, Lin
2017-05-15
Respiratory syncytial virus (RSV) is the leading cause of childhood hospitalizations. The formalin-inactivated RSV (FI-RSV) vaccine-enhanced respiratory disease (ERD) has been an obstacle to the development of a safe and effective killed RSV vaccine. Agonists of Toll-like receptor (TLR) have been shown to regulate immune responses induced by FI-RSV. Notch signaling plays critical roles during the differentiation and effector function phases of innate and adaptive immune responses. Cross talk between TLR and Notch signaling pathways results in fine-tuning of TLR-triggered innate inflammatory responses. We evaluated the impact of TLR and Notch signaling on ERD in a murine model by administering CpG, an agonist of TLR9, in combination with L685,458, an inhibitor of Notch signaling during FI-RSV immunization. Activation with CpG or deficiency of MyD88-dependent TLR signaling did not alleviate airway inflammation in FI-RSV-immunized mice. Activation or inhibition of Notch signaling with Dll4, one of the Notch ligands, or L685,458 did not suppress FI-RSV-enhanced airway inflammation either. However, the CpG together with L685,458 markedly inhibited FI-RSV-enhanced airway hyperresponsiveness, weight loss, and lung inflammation. Interestingly, CpG plus L685,458 completely inhibited FI-RSV-associated Th17 and Th17-associated proinflammatory chemokine responses in lungs following RSV challenge but not Th1 or Th2, memory responses. In addition, FI-RSV plus CpG plus L685,458 promoted protective CD8 + lung tissue-resident memory (TRM) cells. These results indicate that activation of TLR signaling combined with inhibition of Notch signaling prevent FI-RSV ERD, and the mechanism appears to involve suppressing proinflammatory Th17 memory responses and promoting protective TRM in lungs. IMPORTANCE RSV is the most important cause of lower respiratory tract infections in infants. The FI-RSV-enhanced respiratory disease (ERD) is a major impediment to the development of a safe and effective killed RSV vaccine. Using adjuvants to regulate innate and adaptive immune responses could be an effective method to prevent ERD. We evaluated the impact of TLR and Notch signaling on ERD by administering CpG, an agonist of TLR9, in combination with L685,458, an inhibitor of Notch signaling, during FI-RSV immunization. The data showed that treatment of TLR or Notch signaling alone did not suppress FI-RSV-enhanced airway inflammation, while CpG plus L685,458 markedly inhibited ERD. The mechanism appears to involve suppressing Th17 memory responses and promoting tissue-resident memory cells. Moreover, these results suggest that regulation of lung immune memory with adjuvant compounds containing more than one immune-stimulatory molecule may be a good strategy to prevent FI-RSV ERD. Copyright © 2017 American Society for Microbiology.
Zhang, Lei; Li, Hongyong; Hai, Yan; Yin, Wei; Li, Wenjian; Zheng, Boyang; Du, Xiaomin; Li, Na; Zhang, Zhengzheng; Deng, Yuqing
2017-01-01
ABSTRACT Respiratory syncytial virus (RSV) is the leading cause of childhood hospitalizations. The formalin-inactivated RSV (FI-RSV) vaccine-enhanced respiratory disease (ERD) has been an obstacle to the development of a safe and effective killed RSV vaccine. Agonists of Toll-like receptor (TLR) have been shown to regulate immune responses induced by FI-RSV. Notch signaling plays critical roles during the differentiation and effector function phases of innate and adaptive immune responses. Cross talk between TLR and Notch signaling pathways results in fine-tuning of TLR-triggered innate inflammatory responses. We evaluated the impact of TLR and Notch signaling on ERD in a murine model by administering CpG, an agonist of TLR9, in combination with L685,458, an inhibitor of Notch signaling during FI-RSV immunization. Activation with CpG or deficiency of MyD88-dependent TLR signaling did not alleviate airway inflammation in FI-RSV-immunized mice. Activation or inhibition of Notch signaling with Dll4, one of the Notch ligands, or L685,458 did not suppress FI-RSV-enhanced airway inflammation either. However, the CpG together with L685,458 markedly inhibited FI-RSV-enhanced airway hyperresponsiveness, weight loss, and lung inflammation. Interestingly, CpG plus L685,458 completely inhibited FI-RSV-associated Th17 and Th17-associated proinflammatory chemokine responses in lungs following RSV challenge but not Th1 or Th2, memory responses. In addition, FI-RSV plus CpG plus L685,458 promoted protective CD8+ lung tissue-resident memory (TRM) cells. These results indicate that activation of TLR signaling combined with inhibition of Notch signaling prevent FI-RSV ERD, and the mechanism appears to involve suppressing proinflammatory Th17 memory responses and promoting protective TRM in lungs. IMPORTANCE RSV is the most important cause of lower respiratory tract infections in infants. The FI-RSV-enhanced respiratory disease (ERD) is a major impediment to the development of a safe and effective killed RSV vaccine. Using adjuvants to regulate innate and adaptive immune responses could be an effective method to prevent ERD. We evaluated the impact of TLR and Notch signaling on ERD by administering CpG, an agonist of TLR9, in combination with L685,458, an inhibitor of Notch signaling, during FI-RSV immunization. The data showed that treatment of TLR or Notch signaling alone did not suppress FI-RSV-enhanced airway inflammation, while CpG plus L685,458 markedly inhibited ERD. The mechanism appears to involve suppressing Th17 memory responses and promoting tissue-resident memory cells. Moreover, these results suggest that regulation of lung immune memory with adjuvant compounds containing more than one immune-stimulatory molecule may be a good strategy to prevent FI-RSV ERD. PMID:28275186
Deckers, Ivette Ag; van Engeland, Manon; van den Brandt, Piet A; Van Neste, Leander; Soetekouw, Patricia Mmb; Aarts, Maureen Jb; Baldewijns, Marcella Mll; Keszei, András P; Schouten, Leo J
2017-04-01
Sodium intake, but not potassium or fluid intake, has been associated with higher renal cell cancer (RCC) risk. However, risk factors may differ by molecular subtypes of the tumour. In renal physiology, electrolyte and water homeostasis is facilitated by ion transport mechanisms (ITM). Aberrant regulation of ITM genes, for example by promoter CpG island methylation, may modify associations between sodium, potassium and fluid intake and RCC risk. We identified ARHGDIG , ATP1A1 , SCNN1B and SLC8A3 as ITM genes exhibiting RCC-specific promoter methylation and down-regulation. Methylation-specific polymerase chain reaction (PCR) was used to analyse promoter CpG island methylation in tumour DNA of 453 RCC cases from the Netherlands Cohort Study ( n = 120 852) after 20.3 years of follow-up. Diet was measured at baseline using food-frequency questionnaires. Cox regression analyses were restricted to clear-cell (cc)RCC ( n = 306) and stratified by tumours with no, low (1 gene) and high (≥ 2 genes) methylation. Sodium intake (high vs low) increased ccRCC risk particularly in tumours with a high methylation index: hazard ratio (HR) [95% confidence interval (CI)]: 2.04 (1.16-3.58), whereas heterogeneity across the methylation index was not significant ( P -heterogeneity = 0.26). Potassium intake was differentially associated with ccRCC risk ( P -heterogeneity = 0.008); the risk for high (vs low) potassium intake was low for unmethylated tumours [HR (95% CI): 0.60 (0.36-1.01)], but high for tumours with a high methylation index [HR (95% CI): 1.60 (0.96-2.65)]. Risks similarly differed for fluid intake, though not significantly ( P -heterogeneity = 0.54). Our findings suggest for the first time that dietary intakes are differentially associated with ccRCC risk according to molecular subtypes defined by ITM gene-specific promoter methylation. © The Author 2016; all rights reserved. Published by Oxford University Press on behalf of the International Epidemiological Association
Tran, Thi Kim Anh; MacFarlane, Geoff R; Kong, Richard Yuen Chong; O'Connor, Wayne A; Yu, Richard Man Kit
2016-05-01
Marine molluscs, such as oysters, respond to estrogenic compounds with the induction of the egg yolk protein precursor, vitellogenin (Vtg), availing a biomarker for estrogenic pollution. Despite this application, the precise molecular mechanism through which estrogens exert their action to induce molluscan vitellogenesis is unknown. As a first step to address this question, we cloned a gene encoding Vtg from the Sydney rock oyster Saccostrea glomerata (sgVtg). Using primers designed from a partial sgVtg cDNA sequence available in Genbank, a full-length sgVtg cDNA of 8498bp was obtained by 5'- and 3'-RACE. The open reading frame (ORF) of sgVtg was determined to be 7980bp, which is substantially longer than the orthologs of other oyster species. Its deduced protein sequence shares the highest homology at the N- and C-terminal regions with other molluscan Vtgs. The full-length genomic DNA sequence of sgVtg was obtained by genomic PCR and genome walking targeting the gene body and flanking regions, respectively. The genomic sequence spans 20kb and consists of 30 exons and 29 introns. Computer analysis identified three closely spaced half-estrogen responsive elements (EREs) in the promoter region and a 210-bp CpG island 62bp downstream of the transcription start site. Upregulation of sgVtg mRNA expression was observed in the ovaries following in vitro (explants) and in vivo (tank) exposure to 17β-estradiol (E2). Notably, treatment with an estrogen receptor (ER) antagonist in vitro abolished the upregulation, suggesting a requirement for an estrogen-dependent receptor for transcriptional activation. DNA methylation of the 5' CpG island was analysed using bisulfite genomic sequencing of the in vivo exposed ovaries. The CpG island was found to be hypomethylated (with 0-3% methylcytosines) in both control and E2-exposed oysters. However, no significant differential methylation or any correlation between methylation and sgVtg expression levels was observed. Overall, the results support the possible involvement of an ERE-containing promoter and an estrogen-activated receptor in estrogen signalling in marine molluscs. Copyright © 2016 Elsevier B.V. All rights reserved.
McCaul, Michael; de Waal, Ben; Hodkinson, Peter; Pigoga, Jennifer L; Young, Taryn; Wallis, Lee A
2018-02-05
Methods on developing new (de novo) clinical practice guidelines (CPGs) have received substantial attention. However, the volume of literature is not matched by research into alternative methods of CPG development using existing CPG documents-a specific issue for guideline development groups in low- and middle-income countries. We report on how we developed a context specific prehospital CPG using an alternative guideline development method. Difficulties experienced and lessons learnt in applying existing global guidelines' recommendations to a national context are highlighted. The project produced the first emergency care CPG for prehospital providers in Africa. It included > 270 CPGs and produced over 1000 recommendations for prehospital emergency care. We encountered various difficulties, including (1) applicability issues: few pre-hospital CPGs applicable to Africa, (2) evidence synthesis: heterogeneous levels of evidence classifications and (3) guideline quality. Learning points included (1) focusing on key CPGs and evidence mapping, (2) searching other resources for CPGs, (3) broad representation on CPG advisory boards and (4) transparency and knowledge translation. Re-inventing the wheel to produce CPGs is not always feasible. We hope this paper will encourage further projects to use existing CPGs in developing guidance to improve patient care in resource-limited settings.
Hirotani, Makoto; Niino, Masaaki; Fukazawa, Toshiyuki; Yaguchi, Hiroaki; Nakamura, Masakazu; Kikuchi, Seiji; Sasaki, Hidenao
2012-05-01
Type I interferons (IFNs), represented by IFN-α and β, activate immune effector cells belonging to the innate and adaptive immune systems. Plasmacytoid dendritic cells (pDCs) produce IFN-α in response to CpG DNA. We aimed to examine the impact of pDC-produced IFN-α on the adaptive immune system in Multiple Sclerosis (MS). Our results demonstrated that CpG DNA-induced IFN-α production was significantly decreased in PBMCs from MS patients. Decreased levels of IL-12 p70, IFN-γ, and IL-17 and increased level of IL-10 were found in CpG DNA-treated PBMCs of healthy subjects unlike in those from MS patients. In samples pre-treated with IFN-α and IFN-β, decreased levels of IL-12 p70, IFN-γ, and IL-17 and increased level of IL-10 were detected in PBMCs from MS patients. These results suggest that CpG DNA-induced decreased IFN-α production causes pro-inflammatory cytokine secretion, and either IFN-α or IFN-β induces anti-inflammatory cytokine secretion in the adaptive immune system in MS. Copyright © 2012 Elsevier Inc. All rights reserved.
NASA Astrophysics Data System (ADS)
Bai, Zhiyuan; Du, Jiangfeng; Xin, Qi; Li, Ruonan; Yu, Qi
2017-11-01
In this paper, a novel high-K/low-K compound passivation AlGaN/GaN Schottky Barrier Diode (CPG-SBD) is proposed to improve the off-state characteristics of AlGaN/GaN schottky barrier diode with gated edge termination (GET-SBD) by adding low-K blocks in to the high-K passivation layer. The reverse leakage current of CPG-SBD can be reduced to 1.6 nA/mm by reducing the thickness of high-K dielectric under GET region to 5 nm, while the forward voltage and on-state resistance keep 1 V and 3.8 Ω mm, respectively. Breakdown voltage of CPG-SBDs can be improved by inducing discontinuity of the electric field at the high-K/low-K interface. The breakdown voltage of the optimized CPG-SBD with 4 blocks of low-K can reach 1084 V with anode to cathode distance of 5 μm yielding a high FOM of 5.9 GW/cm2. From the C-V simulation results, CPG-SBDs induce no parasitic capacitance by comparison of the GET-SBDs.
Li, Ni; Zheng, Dawei; Sun, Lebo; Shi, Huoshun; Zhu, Xiuying; Xu, Guodong; Wang, Qinning; Zhu, Caimin
2016-01-01
To investigate the contribution of brain natriuretic peptide (BNP) promoter DNA methylation to the risk of rheumatic heart disease (RHD) and the influence of warfarin anticoagulant therapy on BNP methylation levels for RHD patients after surgery. BNP methylation levels were determined by bisulfite pyrosequencing from plasma samples of RHD patients compared with healthy controls. Several factors influencing the RHD patients were included like age, smoking and cholesterol levels. A fragment of five CG sites (CpG1–5) in the promoter region of BNP gene was measured. BNP gene hypermethylation was found in CpG4 and CpG5 in RHD patients compared with non-RHD controls. A significant difference was also observed between RHD patients with long-term administration of warfarin and RHD patients who had recently undergone an operation. Moreover, single CpG4 and CpG5 analysis revealed a significant increase in methylation levels in men. BNP gene body hypermethylation is associated with the risk of RHD, and also influenced by the warfarin anticoagulant therapy of RHD patients after surgery, which could represent novel and promising targets for therapeutic development. PMID:27920275
Yeung, Chi Lam Au; Tsang, Tsun Yee; Yau, Pak Lun; Kwok, Tim Tak
2017-02-14
Oncogenic protein E6 of human papillomavirus type 16 (HPV-16) is believed to involve in the aberrant methylation in cervical cancer as it upregulates DNA methyltransferase 1 (DNMT1) through tumor suppressor p53. In addition, DNA demethylating agent induces the expression of one of the HPV-16 E6 regulated microRNAs (miRs), miR-23b, in human cervical carcinoma SiHa cells. Thus, the importance of DNA methylation and miR-23b in HPV-16 E6 associated cervical cancer development is investigated. In the present study, however, it is found that miR-23b is not embedded in any typical CpG island. Nevertheless, a functional CpG island is predicted in the promoter region of C9orf3, the host gene of miR-23b, and is validated by methylation-specific PCR and bisulfite genomic sequencing analyses. Besides, c-MET is confirmed to be a target gene of miR-23b. Silencing of HPV-16 E6 is found to increase the expression of miR-23b, decrease the expression of c-MET and thus induce the apoptosis of SiHa cells through the c-MET downstream signaling pathway. Taken together, the tumor suppressive miR-23b is epigenetically inactivated through its host gene C9orf3 and this is probably a critical pathway during HPV-16 E6 associated cervical cancer development.
REST–Mediated Recruitment of Polycomb Repressor Complexes in Mammalian Cells
Landt, Eskild; Agrawal-Singh, Shuchi; Bak, Mads; Tommerup, Niels; Rappsilber, Juri; Södersten, Erik; Hansen, Klaus
2012-01-01
Polycomb Repressive Complex (PRC) 1 and PRC2 regulate genes involved in differentiation and development. However, the mechanism for how PRC1 and PRC2 are recruited to genes in mammalian cells is unclear. Here we present evidence for an interaction between the transcription factor REST, PRC1, and PRC2 and show that RNF2 and REST co-regulate a number of neuronal genes in human teratocarcinoma cells (NT2-D1). Using NT2-D1 cells as a model of neuronal differentiation, we furthermore showed that retinoic-acid stimulation led to displacement of PRC1 at REST binding sites, reduced H3K27Me3, and increased gene expression. Genome-wide analysis of Polycomb binding in Rest−/− and Eed−/− mouse embryonic stem (mES) cells showed that Rest was required for PRC1 recruitment to a subset of Polycomb regulated neuronal genes. Furthermore, we found that PRC1 can be recruited to Rest binding sites independently of CpG islands and the H3K27Me3 mark. Surprisingly, PRC2 was frequently increased around Rest binding sites located in CpG-rich regions in the Rest−/− mES cells, indicating a more complex interplay where Rest also can limit PRC2 recruitment. Therefore, we propose that Rest has context-dependent functions for PRC1- and PRC2- recruitment, which allows this transcription factor to act both as a recruiter of Polycomb as well as a limiting factor for PRC2 recruitment at CpG islands. PMID:22396653
Ambrosone, Christine B.; Young, Allyson C.; Sucheston, Lara E.; Wang, Dan; Li, Yan; Liu, Song; Tang, Li; Hu, Quang; Freudenheim, Jo L.; Shields, Peter G.; Morrison, Carl D.; Demissie, Kitaw; Higgins, Michael J.
2014-01-01
American women of African ancestry (AA) are more likely than European-Americans (EA) to be diagnosed with aggressive, estrogen receptor (ER) negative breast tumors; mechanisms underlying these disparities are poorly understood. We conducted a genome wide (450K loci) methylation analysis to determine if there were differences in DNA methylation patterns between tumors from AA and EA women and if these differences were similar for both ER positive and ER negative breast cancer. Methylation levels at CpG loci within CpG islands (CGI)s and CGI-shores were significantly higher in tumors (n=138) than in reduction mammoplasty samples (n=124). In hierarchical cluster analysis, there was separation between tumor and normal samples, and in tumors, there was delineation by ER status, but not by ancestry. However, differential methylation analysis identified 157 CpG loci with a mean β value difference of at least 0.17 between races, with almost twice as many differences in ER-negative tumors compared to ER-positive cancers. This first genome-wide methylation study to address disparities indicates that there are likely differing etiologic pathways for the development of ER negative breast cancer between AA and EA women. Further investigation of the genes most differentially methylated by race in ER negative tumors can guide new approaches for cancer prevention and targeted therapies, and elucidate the biologic basis of breast cancer disparities. PMID:24368439
Chung, Sharon A; Nititham, Joanne; Elboudwarej, Emon; Quach, Hong L; Taylor, Kimberly E; Barcellos, Lisa F; Criswell, Lindsey A
2015-01-01
Systemic lupus erythematosus (SLE) is characterized by the development of autoantibodies associated with specific clinical manifestations. Previous studies have shown an association between differential DNA methylation and SLE susceptibility, but have not investigated SLE-related autoantibodies. Our goal was to determine whether DNA methylation is associated with production of clinically relevant SLE-related autoantibodies, with an emphasis on the anti-dsDNA autoantibody. In this study, we characterized the methylation status of 467,314 CpG sites in 326 women with SLE. Using a discovery and replication study design, we identified and replicated significant associations between anti-dsDNA autoantibody production and the methylation status of 16 CpG sites (pdiscovery<1.07E-07 and preplication<0.0029) in 11 genes. Associations were further investigated using multivariable regression to adjust for estimated leukocyte cell proportions and population substructure. The adjusted mean DNA methylation difference between anti-dsDNA positive and negative cases ranged from 1.2% to 19%, and the adjusted odds ratio for anti-dsDNA autoantibody production comparing the lowest and highest methylation tertiles ranged from 6.8 to 18.2. Differential methylation for these CpG sites was also associated with anti-SSA, anti-Sm, and anti-RNP autoantibody production. Overall, associated CpG sites were hypomethylated in autoantibody positive compared to autoantibody negative cases. Differential methylation of CpG sites within the major histocompatibility region was not strongly associated with autoantibody production. Genes with differentially methylated CpG sites represent multiple biologic pathways, and have not been associated with autoantibody production in genetic association studies. In conclusion, hypomethylation of CpG sites within genes from different pathways is associated with anti-dsDNA, anti-SSA, anti-Sm, and anti-RNP production in SLE, and these associations are not explained by genetic variation. Thus, studies of epigenetic mechanisms such as DNA methylation represent a complementary method to genetic association studies to identify biologic pathways that may contribute to the clinical heterogeneity of autoimmune diseases.
Asymmetric Operation of the Locomotor Central Pattern Generator in the Neonatal Mouse Spinal Cord
Endo, Toshiaki; Kiehn, Ole
2008-01-01
The rhythmic voltage oscillations in motor neurons (MNs) during locomotor movements reflect the operation of the pre-MN central pattern generator (CPG) network. Recordings from MNs can thus be used as a method to deduct the organization of CPGs. Here, we use continuous conductance measurements and decomposition methods to quantitatively assess the weighting and phase tuning of synaptic inputs to different flexor and extensor MNs during locomotor-like activity in the isolated neonatal mice lumbar spinal cord preparation. Whole cell recordings were obtained from 22 flexor and 18 extensor MNs in rostral and caudal lumbar segments. In all flexor and the large majority of extensor MNs the extracted excitatory and inhibitory synaptic conductances alternate but with a predominance of inhibitory conductances, most pronounced in extensors. These conductance changes are consistent with a “push–pull” operation of locomotor CPG. The extracted excitatory and inhibitory synaptic conductances varied between 2 and 56% of the mean total conductance. Analysis of the phase tuning of the extracted synaptic conductances in flexor and extensor MNs in the rostral lumbar cord showed that the flexor-phase–related synaptic conductance changes have sharper locomotor-phase tuning than the extensor-phase–related conductances, suggesting a modular organization of premotor CPG networks consisting of reciprocally coupled, but differently composed, flexor and extensor CPG networks. There was a clear difference between phase tuning in rostral and caudal MNs, suggesting a distinct operation of CPG networks in different lumbar segments. The highly asymmetric features were preserved throughout all ranges of locomotor frequencies investigated and with different combinations of locomotor-inducing drugs. The asymmetric nature of CPG operation and phase tuning of the conductance profiles provide important clues to the organization of the rodent locomotor CPG and are compatible with a multilayered and distributed structure of the network. PMID:18829847
Sanders, G D; Nease, R F; Owens, D K
2000-01-01
Local tailoring of clinical practice guidelines (CPGs) requires experts in medicine and evidence synthesis unavailable in many practice settings. The authors' computer-based system enables developers and users to create, disseminate, and tailor CPGs, using normative decision models (DMs). ALCHEMIST, a web-based system, analyzes a DM, creates a CPG in the form of an annotated algorithm, and displays for the guideline user the optimal strategy. ALCHEMIST'S interface enables remote users to tailor the guideline by changing underlying input variables and observing the new annotated algorithm that is developed automatically. In a pilot evaluation of the system, a DM was used to evaluate strategies for staging non-small-cell lung cancer. Subjects (n = 15) compared the automatically created CPG with published guidelines for this staging and critiqued both using a previously developed instrument to rate the CPGs' usability, accountability, and accuracy on a scale of 0 (worst) to 2 (best), with higher scores reflecting higher quality. The mean overall score for the ALCHEMIST CPG was 1.502, compared with the published-CPG score of 0.987 (p = 0.002). The ALCHEMIST CPG scores for usability, accountability, and accuracy were 1.683, 1.393, and 1.430, respectively; the published CPG scores were 1.192, 0.941, and 0.830 (each comparison p < 0.05). On a scale of 1 (worst) to 5 (best), users' mean ratings of ALCHEMIST'S ease of use, usefulness of content, and presentation format were 4.76, 3.98, and 4.64, respectively. The results demonstrate the feasibility of a web-based system that automatically analyzes a DM and creates a CPG as an annotated algorithm, enabling remote users to develop site-specific CPGs. In the pilot evaluation, the ALCHEMIST guidelines met established criteria for quality and compared favorably with national CPGs. The high usability and usefulness ratings suggest that such systems can be a good tool for guideline development.
Esandi, María Eugenia; Ortiz, Zulma; Chapman, Evelina; Dieguez, Marcelo García; Mejía, Raúl; Bernztein, Ricardo
2008-01-01
Background In the last decades, a sustained increment of Clinical Practice Guidelines (CPG) production in the world has been accompanied by a growing concern about their quality. Many studies related to quality assessment of guidelines produced in High Income Countries were published; however, evidence on this topic is scarce in Low and Middle Income Countries (LMIC). The objectives of this research were: a) to describe guideline production in Argentina at different levels of the health system (macro, meso and micro) from 1994 to 2004; and b) to assess their quality by using the AGREE instrument. Methods A cross-sectional study was undertaken to describe guidelines production in Argentina between 1994 and 2004. CPG were identified through Internet and electronic databases (MEDLINE and LILACS). Explicit inclusion and exclusion criteria were used to select guidelines. Each CPG was independently assessed by two reviewers using the AGREE instrument. Domain scores were calculated as recommended by the AGREE Collaboration. The internal consistency of each domain was evaluated using Cronbach's alpha and inter-observer agreement by the Intraclass Correlation Coefficient (ICC). Results A total amount of 431 potential CPG were identified, but only 144 were considered CPG. At the end, 101 CPG were included for further assessment. Median standardized score for each domain were: scope = 39%; stakeholder involvement = 13%; rigour of development = 10%; clarity = 42%; applicability = 6%; editorial independence = 0%. Only 22 CPG were recommended with modifications by both appraisers. ICC and Cronbach's alpha for each domain were in all cases moderate or high (greater than 0.40), except for editorial independence. Conclusion This study has systematically employed the AGREE instrument for the critical assessment of guidelines produced in a LMIC. Guideline development and diffusion in Argentina from 1994 to 2004 shows a constant increment, although quality of reporting did not improve; moreover, in some aspects it seemed to decline. Much room for improvement of the guideline development process was found at all levels of the health system. PMID:18851739
Automating Guidelines for Clinical Decision Support: Knowledge Engineering and Implementation.
Tso, Geoffrey J; Tu, Samson W; Oshiro, Connie; Martins, Susana; Ashcraft, Michael; Yuen, Kaeli W; Wang, Dan; Robinson, Amy; Heidenreich, Paul A; Goldstein, Mary K
2016-01-01
As utilization of clinical decision support (CDS) increases, it is important to continue the development and refinement of methods to accurately translate the intention of clinical practice guidelines (CPG) into a computable form. In this study, we validate and extend the 13 steps that Shiffman et al. 5 identified for translating CPG knowledge for use in CDS. During an implementation project of ATHENA-CDS, we encoded complex CPG recommendations for five common chronic conditions for integration into an existing clinical dashboard. Major decisions made during the implementation process were recorded and categorized according to the 13 steps. During the implementation period, we categorized 119 decisions and identified 8 new categories required to complete the project. We provide details on an updated model that outlines all of the steps used to translate CPG knowledge into a CDS integrated with existing health information technology.
Neonatal testosterone suppresses a neuroendocrine pulse generator required for reproduction
NASA Astrophysics Data System (ADS)
Israel, Jean-Marc; Cabelguen, Jean-Marie; Le Masson, Gwendal; Oliet, Stéphane H.; Ciofi, Philippe
2014-02-01
The pituitary gland releases hormones in a pulsatile fashion guaranteeing signalling efficiency. The determinants of pulsatility are poorly circumscribed. Here we show in magnocellular hypothalamo-neurohypophyseal oxytocin (OT) neurons that the bursting activity underlying the neurohormonal pulses necessary for parturition and the milk-ejection reflex is entirely driven by a female-specific central pattern generator (CPG). Surprisingly, this CPG is active in both male and female neonates, but is inactivated in males after the first week of life. CPG activity can be restored in males by orchidectomy or silenced in females by exogenous testosterone. This steroid effect is aromatase and caspase dependent, and is mediated via oestrogen receptor-α. This indicates the apoptosis of the CPG network during hypothalamic sexual differentiation, explaining why OT neurons do not burst in adult males. This supports the view that stereotypic neuroendocrine pulsatility is governed by CPGs, some of which are subjected to gender-specific perinatal programming.
Output variability across animals and levels in a motor system
Norris, Brian J; Günay, Cengiz; Kueh, Daniel
2018-01-01
Rhythmic behaviors vary across individuals. We investigated the sources of this output variability across a motor system, from the central pattern generator (CPG) to the motor plant. In the bilaterally symmetric leech heartbeat system, the CPG orchestrates two coordinations in the bilateral hearts with different intersegmental phase relations (Δϕ) and periodic side-to-side switches. Population variability is large. We show that the system is precise within a coordination, that differences in repetitions of a coordination contribute little to population output variability, but that differences between bilaterally homologous cells may contribute to some of this variability. Nevertheless, much output variability is likely associated with genetic and life history differences among individuals. Variability of Δϕ were coordination-specific: similar at all levels in one, but significantly lower for the motor pattern than the CPG pattern in the other. Mechanisms that transform CPG output to motor neurons may limit output variability in the motor pattern. PMID:29345614
Integrated Multiregional Analysis Proposing a New Model of Colorectal Cancer Evolution
Niida, Atsushi; Shimamura, Teppei; Hirata, Hidenari; Sugimachi, Keishi; Sawada, Genta; Iwaya, Takeshi; Kurashige, Junji; Shinden, Yoshiaki; Iguchi, Tomohiro; Eguchi, Hidetoshi; Chiba, Kenichi; Shiraishi, Yuichi; Nagae, Genta; Yoshida, Kenichi; Nagata, Yasunobu; Haeno, Hiroshi; Yamamoto, Hirofumi; Ishii, Hideshi; Doki, Yuichiro; Iinuma, Hisae; Sasaki, Shin; Nagayama, Satoshi; Yamada, Kazutaka; Yachida, Shinichi; Kato, Mamoru; Shibata, Tatsuhiro; Oki, Eiji; Saeki, Hiroshi; Shirabe, Ken; Oda, Yoshinao; Maehara, Yoshihiko; Komune, Shizuo; Mori, Masaki; Suzuki, Yutaka; Yamamoto, Ken; Aburatani, Hiroyuki; Ogawa, Seishi; Miyano, Satoru; Mimori, Koshi
2016-01-01
Understanding intratumor heterogeneity is clinically important because it could cause therapeutic failure by fostering evolutionary adaptation. To this end, we profiled the genome and epigenome in multiple regions within each of nine colorectal tumors. Extensive intertumor heterogeneity is observed, from which we inferred the evolutionary history of the tumors. First, clonally shared alterations appeared, in which C>T transitions at CpG site and CpG island hypermethylation were relatively enriched. Correlation between mutation counts and patients’ ages suggests that the early-acquired alterations resulted from aging. In the late phase, a parental clone was branched into numerous subclones. Known driver alterations were observed frequently in the early-acquired alterations, but rarely in the late-acquired alterations. Consistently, our computational simulation of the branching evolution suggests that extensive intratumor heterogeneity could be generated by neutral evolution. Collectively, we propose a new model of colorectal cancer evolution, which is useful for understanding and confronting this heterogeneous disease. PMID:26890883
Chatterjee, Aniruddha; Lagisz, Malgorzata; Rodger, Euan J; Zhen, Li; Stockwell, Peter A; Duncan, Elizabeth J; Horsfield, Julia A; Jeyakani, Justin; Mathavan, Sinnakaruppan; Ozaki, Yuichi; Nakagawa, Shinichi
2016-09-30
The sex drive hypothesis predicts that stronger selection on male traits has resulted in masculinization of the genome. Here we test whether such masculinizing effects can be detected at the level of the transcriptome and methylome in the adult zebrafish brain. Although methylation is globally similar, we identified 914 specific differentially methylated CpGs (DMCs) between males and females (435 were hypermethylated and 479 were hypomethylated in males compared to females). These DMCs were prevalent in gene body, intergenic regions and CpG island shores. We also discovered 15 distinct CpG clusters with striking sex-specific DNA methylation differences. In contrast, at transcriptome level, more female-biased genes than male-biased genes were expressed, giving little support for the male sex drive hypothesis. Our study provides genome-wide methylome and transcriptome assessment and sheds light on sex-specific epigenetic patterns and in zebrafish for the first time. Copyright © 2016 Elsevier B.V. All rights reserved.
Stern, Josh Lewis; Paucek, Richard D.; Huang, Franklin W.; Ghandi, Mahmoud; Nwumeh, Ronald; Costello, James C.; Cech, Thomas R.
2017-01-01
SUMMARY A mutation in the promoter of the Telomerase Reverse Transcriptase (TERT) gene is the most frequent noncoding mutation in cancer. The mutation drives unusual monoallelic expression of TERT, allowing immortalization. Here we find that DNA methylation of the TERT CpG Island (CGI) is also allele-specific in multiple cancers. The expressed allele is hypomethylated, which is opposite to cancers without TERT promoter mutations. The continued presence of Polycomb repressive complex 2 (PRC2) on the inactive allele suggests that histone marks of repressed chromatin may be causally linked to high DNA methylation. Consistent with this hypothesis, TERT promoter DNA containing 5-methyl-CpG has much increased affinity for PRC2 in vitro. Thus, CpG methylation and histone marks appear to collaborate to maintain the two TERT alleles in different epigenetic states in TERT promoter-mutant cancers. Finally, in several cancers DNA methylation levels at the TERT CGI correlate with altered patient survival. PMID:29281820
Factors affecting the persistence of drug-induced reprogramming of the cancer methylome
Bell, Joshua S. K.; Kagey, Jacob D.; Barwick, Benjamin G.; Dwivedi, Bhakti; McCabe, Michael T.; Kowalski, Jeanne; Vertino, Paula M.
2016-01-01
ABSTRACT Aberrant DNA methylation is a critical feature of cancer. Epigenetic therapy seeks to reverse these changes to restore normal gene expression. DNA demethylating agents, including 5-aza-2′-deoxycytidine (DAC), are currently used to treat certain leukemias, and can sensitize solid tumors to chemotherapy and immunotherapy. However, it has been difficult to pin the clinical efficacy of these agents to specific demethylation events, and the factors that contribute to the durability of response remain largely unknown. Here we examined the genome-wide kinetics of DAC-induced DNA demethylation and subsequent remethylation after drug withdrawal in breast cancer cells. We find that CpGs differ in both their susceptibility to demethylation and propensity for remethylation after drug removal. DAC-induced demethylation was most apparent at CpGs with higher initial methylation levels and further from CpG islands. Once demethylated, such sites exhibited varied remethylation potentials. The most rapidly remethylating CpGs regained >75% of their starting methylation within a month of drug withdrawal. These sites had higher pretreatment methylation levels, were enriched in gene bodies, marked by H3K36me3, and tended to be methylated in normal breast cells. In contrast, a more resistant class of CpG sites failed to regain even 20% of their initial methylation after 3 months. These sites had lower pretreatment methylation levels, were within or near CpG islands, marked by H3K79me2 or H3K4me2/3, and were overrepresented in sites that become aberrantly hypermethylated in breast cancers. Thus, whereas DAC-induced demethylation affects both endogenous and aberrantly methylated sites, tumor-specific hypermethylation is more slowly regained, even as normal methylation promptly recovers. Taken together, these data suggest that the durability of DAC response is linked to its selective ability to stably reset at least a portion of the cancer methylome. PMID:27082926
Berg, Marianne; Hagland, Hanne R; Søreide, Kjetil
2014-01-01
In colorectal cancer a distinct subgroup of tumours demonstrate the CpG island methylator phenotype (CIMP). However, a consensus of how to score CIMP is not reached, and variation in definition may influence the reported CIMP prevalence in tumours. Thus, we sought to compare currently suggested definitions and cut-offs for methylation markers and how they influence CIMP classification in colon cancer. Methylation-specific multiplex ligation-dependent probe amplification (MS-MLPA), with subsequent fragment analysis, was used to investigate methylation of tumour samples. In total, 31 CpG sites, located in 8 different genes (RUNX3, MLH1, NEUROG1, CDKN2A, IGF2, CRABP1, SOCS1 and CACNA1G) were investigated in 64 distinct colon cancers and 2 colon cancer cell lines. The Ogino gene panel includes all 8 genes, in addition to the Weisenberger panel of which only 5 of the 8 genes included were investigated. In total, 18 alternative combinations of scoring of CIMP positivity on probe-, gene-, and panel-level were analysed and compared. For 47 samples (71%), the CIMP status was constant and independent of criteria used for scoring; 34 samples were constantly scored as CIMP negative, and 13 (20%) consistently scored as CIMP positive. Only four of 31 probes (13%) investigated showed no difference in the numbers of positive samples using the different cut-offs. Within the panels a trend was observed that increasing the gene-level stringency resulted in a larger difference in CIMP positive samples than increasing the probe-level stringency. A significant difference between positive samples using 'the most stringent' as compared to 'the least stringent' criteria (20% vs 46%, respectively; p<0.005) was demonstrated. A statistical significant variation in the frequency of CIMP depending on the cut-offs and genes included in a panel was found, with twice as many positives samples by least compared to most stringent definition used.
Bady, Pierre; Sciuscio, Davide; Diserens, Annie-Claire; Bloch, Jocelyne; van den Bent, Martin J; Marosi, Christine; Dietrich, Pierre-Yves; Weller, Michael; Mariani, Luigi; Heppner, Frank L; Mcdonald, David R; Lacombe, Denis; Stupp, Roger; Delorenzi, Mauro; Hegi, Monika E
2012-10-01
The methylation status of the O(6)-methylguanine-DNA methyltransferase (MGMT) gene is an important predictive biomarker for benefit from alkylating agent therapy in glioblastoma. Recent studies in anaplastic glioma suggest a prognostic value for MGMT methylation. Investigation of pathogenetic and epigenetic features of this intriguingly distinct behavior requires accurate MGMT classification to assess high throughput molecular databases. Promoter methylation-mediated gene silencing is strongly dependent on the location of the methylated CpGs, complicating classification. Using the HumanMethylation450 (HM-450K) BeadChip interrogating 176 CpGs annotated for the MGMT gene, with 14 located in the promoter, two distinct regions in the CpG island of the promoter were identified with high importance for gene silencing and outcome prediction. A logistic regression model (MGMT-STP27) comprising probes cg12434587 [corrected] and cg12981137 provided good classification properties and prognostic value (kappa = 0.85; log-rank p < 0.001) using a training-set of 63 glioblastomas from homogenously treated patients, for whom MGMT methylation was previously shown to be predictive for outcome based on classification by methylation-specific PCR. MGMT-STP27 was successfully validated in an independent cohort of chemo-radiotherapy-treated glioblastoma patients (n = 50; kappa = 0.88; outcome, log-rank p < 0.001). Lower prevalence of MGMT methylation among CpG island methylator phenotype (CIMP) positive tumors was found in glioblastomas from The Cancer Genome Atlas than in low grade and anaplastic glioma cohorts, while in CIMP-negative gliomas MGMT was classified as methylated in approximately 50 % regardless of tumor grade. The proposed MGMT-STP27 prediction model allows mining of datasets derived on the HM-450K or HM-27K BeadChip to explore effects of distinct epigenetic context of MGMT methylation suspected to modulate treatment resistance in different tumor types.
Allele-Specific, Age-Dependent and BMI-Associated DNA Methylation of Human MCHR1
Stepanow, Stefanie; Reichwald, Kathrin; Huse, Klaus; Gausmann, Ulrike; Nebel, Almut; Rosenstiel, Philip; Wabitsch, Martin; Fischer-Posovszky, Pamela; Platzer, Matthias
2011-01-01
Background Melanin-concentrating hormone receptor 1 (MCHR1) plays a significant role in regulation of energy balance, food intake, physical activity and body weight in humans and rodents. Several association studies for human obesity showed contrary results concerning the SNPs rs133072 (G/A) and rs133073 (T/C), which localize to the first exon of MCHR1. The variations constitute two main haplotypes (GT, AC). Both SNPs affect CpG dinucleotides, whereby each haplotype contains a potential methylation site at one of the two SNP positions. In addition, 15 CpGs in close vicinity of these SNPs constitute a weak CpG island. Here, we studied whether DNA methylation in this sequence context may contribute to population- and age-specific effects of MCHR1 alleles in obesity. Principal Findings We analyzed DNA methylation of a 315 bp region of MCHR1 encompassing rs133072 and rs133073 and the CpG island in blood samples of 49 individuals by bisulfite sequencing. The AC haplotype shows a significantly higher methylation level than the GT haplotype. This allele-specific methylation is age-dependent. In young individuals (20–30 years) the difference in DNA methylation between haplotypes is significant; whereas in individuals older than 60 years it is not detectable. Interestingly, the GT allele shows a decrease in methylation status with increasing BMI, whereas the methylation of the AC allele is not associated with this phenotype. Heterozygous lymphoblastoid cell lines show the same pattern of allele-specific DNA methylation. The cell line, which exhibits the highest difference in methylation levels between both haplotypes, also shows allele-specific transcription of MCHR1, which can be abolished by treatment with the DNA methylase inhibitor 5-aza-2′-deoxycytidine. Conclusions We show that DNA methylation at MCHR1 is allele-specific, age-dependent, BMI-associated and affects transcription. Conceivably, this epigenetic regulation contributes to the age- and/or population specific effects reported for MCHR1 in several human obesity studies. PMID:21637341
The Healthy Weight Commitment Foundation Pledge
Ng, Shu Wen; Slining, Meghan M.; Popkin, Barry M.
2014-01-01
Corporate voluntary pledges to improve the health of Americans have not been held to either explicit measurable outcomes or a framework for independent evaluation. The Healthy Weight Commitment Foundation (HWCF), whose members include 16 of the nation’s leading consumer packaged goods (CPG) food and beverage manufacturers, voluntarily pledged to collectively sell 1 trillion fewer calories in the U.S. marketplace by 2012 (against a 2007 baseline), and sell 1.5 trillion fewer calories by 2015. This paper presents the findings of an independent evaluation of the 2012 HWCF marketplace pledge, conducted in 2013. The 16 HWCF companies collectively sold approximately 6.4 trillion fewer calories (−10.6%) in 2012 than in the baseline year of 2007. Taking into account population changes over the 5-year period of 2007–2012, CPG caloric sales from brands included in the HWCF pledge declined by an average of 78 kcals/capita/day. CPG caloric sales from non-HWCF national brands during the same period declined by 11 kcals/capita/day, but there was little change in calories from private label products. Thus, the total reduction in CPG caloric sales between 2007 and 2012 was 87 kcals/capita/day. This independent evaluation is the first to evaluate food industry compliance with its calorie reduction pledges and to assess how sales from the CPG food and beverage sector are changing. An accompanying paper investigates the extent to which the HWCF pledge affected household-level changes in CPG calories purchased, controlling for important economic and sociodemographic factors affecting household food purchases over this period. PMID:25240967
Jung, Myung-Hwa; Jung, Sung-Ju
2017-10-01
Rock bream iridovirus (RBIV) causes severe mass mortalities in rock bream in Korea. CpG ODN 1668 showed promise as immunoprotective agents against RBIV infection in rock bream. In this study, we assessed innate/adaptive-related gene expression patterns in RBIV-infected rock bream with and without CpG ODN 1668 administration to determine important immune defense related factors that may affect fish survival. In the CpG ODN 1668+virus-injected group, virus copies were more than 7.4- to 790591-fold lower than in the virus-injected group at 4 d (8.79 × 10 4 and 6.58 × 10 5 /μl, respectively), 7 d (5.30 × 10 2 and 2.29 × 10 7 /μl, respectively) and 10 dpi (7.79 × 10 1 and 6.16 × 10 7 /μl, respectively). Furthermore, in the CpG ODN 1668+virus-injected group, significantly higher levels of MyD88 (6 h, 1 d, 4 d and 7 dpi), IL1β (1 d, 2 d and 7 dpi) and perforin/granzyme (1 dpi) expression were observed, whereas these genes were not significantly expressed in the virus-injected group at that time points. Mx, ISG15 and PKR were significantly highly expressed at 4 d and 7 dpi and reduced when low viral loads at 10 dpi in the CpG ODN 1668+virus-injected group. Conversely, in the virus-injected group, Mx, ISG15 and PKR expression were significantly higher than the control group until 10 dpi. However, MHC class I, CD8, Fas, Fas ligand and caspases (3, 8 and 9) expression levels showed no statistically significant differences between virus- and CpG ODN 1668+virus-injected group. In summary, CpG ODN 1668 administration in fish induces innate immune response or cell death pathway, which could be a major contributing factor to effective fish control over viral transcription on 4 d to 10 dpi. Expression of MyD88, IL1β, perforin and granzyme-related immune gene response is critical factor for inhibition of RBIV replication. Copyright © 2017 Elsevier Ltd. All rights reserved.
Longitudinal study of DNA methylation during the first 5 years of life.
Urdinguio, Rocio G; Torró, María Isabel; Bayón, Gustavo F; Álvarez-Pitti, Julio; Fernández, Agustín F; Redon, Pau; Fraga, Mario F; Lurbe, Empar
2016-06-03
Early life epigenetic programming influences adult health outcomes. Moreover, DNA methylation levels have been found to change more rapidly during the first years of life. Our aim was the identification and characterization of the CpG sites that are modified with time during the first years of life. We hypothesize that these DNA methylation changes would lead to the detection of genes that might be epigenetically modulated by environmental factors during early childhood and which, if disturbed, might contribute to susceptibility to diseases later in life. The study of the DNA methylation pattern of 485577 CpG sites was performed on 30 blood samples from 15 subjects, collected both at birth and at 5 years old, using Illumina(®) Infinium 450 k array. To identify differentially methylated CpG (dmCpG) sites, the methylation status of each probe was examined using linear models and the Empirical Bayes Moderated t test implemented in the limma package of R/Bioconductor. Surogate variable analysis was used to account for batch effects. DNA methylation levels significantly changed from birth to 5 years of age in 6641 CpG sites. Of these, 36.79 % were hypermethylated and were associated with genes related mainly to developmental ontology terms, while 63.21 % were hypomethylated probes and associated with genes related to immune function. Our results suggest that DNA methylation alterations with age during the first years of life might play a significant role in development and the regulation of leukocyte-specific functions. This supports the idea that blood leukocytes experience genome remodeling related to their interaction with environmental factors, underlining the importance of environmental exposures during the first years of life and suggesting that new strategies should be take into consideration for disease prevention.
Fu, Tao; Liu, Yanliang; Li, Kai; Wan, Weiwei; Pappou, Emmanouil P.; Iacobuzio-Donahue, Christine A.; Kerner, Zachary; Baylin, Stephen B.; Wolfgang, Christopher L.; Ahuja, Nita
2016-01-01
We previously developed a novel tumor subtype classification model for duodenal adenocarcinomas based on a combination of the CpG island methylator phenotype (CIMP) and MLH1 methylation status. Here, we tested the prognostic value of this model in stage II colorectal cancer (CRC) patients. Tumors were assigned to CIMP+/MLH1-unmethylated (MLH1-U), CIMP+/MLH1-methylated (MLH1-M), CIMP−/MLH1-U, or CIMP−/MLH1-M groups. Age, tumor location, lymphovascular invasion, and mucin production differed among the four patient subgroups, and CIMP+/MLH1-U tumors were more likely to have lymphovascular invasion and mucin production. Kaplan-Meier analyses revealed differences in both disease-free survival (DFS) and overall survival (OS) among the four groups. In a multivariate analysis, CIMP/MLH1 methylation status was predictive of both DFS and OS, and DFS and OS were shortest in CIMP+/MLH1-U stage II CRC patients. These results suggest that tumor subtype classification based on the combination of CIMP and MLH1 methylation status is informative in stage II CRC patients, and that CIMP+/MLH1-U tumors exhibit aggressive features and are associated with poor clinical outcomes. PMID:27880934
Fu, Tao; Liu, Yanliang; Li, Kai; Wan, Weiwei; Pappou, Emmanouil P; Iacobuzio-Donahue, Christine A; Kerner, Zachary; Baylin, Stephen B; Wolfgang, Christopher L; Ahuja, Nita
2016-12-27
We previously developed a novel tumor subtype classification model for duodenal adenocarcinomas based on a combination of the CpG island methylator phenotype (CIMP) and MLH1 methylation status. Here, we tested the prognostic value of this model in stage II colorectal cancer (CRC) patients. Tumors were assigned to CIMP+/MLH1-unmethylated (MLH1-U), CIMP+/MLH1-methylated (MLH1-M), CIMP-/MLH1-U, or CIMP-/MLH1-M groups. Age, tumor location, lymphovascular invasion, and mucin production differed among the four patient subgroups, and CIMP+/MLH1-U tumors were more likely to have lymphovascular invasion and mucin production. Kaplan-Meier analyses revealed differences in both disease-free survival (DFS) and overall survival (OS) among the four groups. In a multivariate analysis, CIMP/MLH1 methylation status was predictive of both DFS and OS, and DFS and OS were shortest in CIMP+/MLH1-U stage II CRC patients. These results suggest that tumor subtype classification based on the combination of CIMP and MLH1 methylation status is informative in stage II CRC patients, and that CIMP+/MLH1-U tumors exhibit aggressive features and are associated with poor clinical outcomes.
Epigenetic Regulation of Werner Syndrome Gene in Age-Related Cataract
Guan, Huaijin
2015-01-01
Purpose. To examine the promoter methylation and histone modification of WRN (Werner syndrome gene), a DNA repair gene, and their relationship with the gene expression in age-related cataract (ARC) lens. Methods. We collected the lenses after cataract surgery from 117ARC patients and 39 age-matched non-ARC. WRN expression, DNA methylation and histone modification around the CpG island were assessed. The methylation status of Human-lens-epithelium cell (HLEB-3) was chemically altered to observe the relationship between methylation and expression of WRN. Results. The WRN expression was significantly decreased in the ARC anterior lens capsules comparing with the control. The CpG island of WRN promoter in the ARC anterior lens capsules displayed hypermethylation comparing with the controls. The WRN promoter was almost fully methylated in the cortex of ARC and control lens. Acetylated H3 was lower while methylated H3-K9 was higher in ARC anterior lens capsules than that of the controls. The expression of WRN in HLEB-3 increased after demethylation of the cells. Conclusions. A hypermethylation in WRN promoter and altered histone modification in anterior lens capsules might contribute to the ARC mechanism. The data suggest an association of altered DNA repair capability in lens with ARC pathogenesis. PMID:26509079
VanderKraats, Nathan D.; Hiken, Jeffrey F.; Decker, Keith F.; Edwards, John R.
2013-01-01
Methylation of the CpG-rich region (CpG island) overlapping a gene’s promoter is a generally accepted mechanism for silencing expression. While recent technological advances have enabled measurement of DNA methylation and expression changes genome-wide, only modest correlations between differential methylation at gene promoters and expression have been found. We hypothesize that stronger associations are not observed because existing analysis methods oversimplify their representation of the data and do not capture the diversity of existing methylation patterns. Recently, other patterns such as CpG island shore methylation and long partially hypomethylated domains have also been linked with gene silencing. Here, we detail a new approach for discovering differential methylation patterns associated with expression change using genome-wide high-resolution methylation data: we represent differential methylation as an interpolated curve, or signature, and then identify groups of genes with similarly shaped signatures and corresponding expression changes. Our technique uncovers a diverse set of patterns that are conserved across embryonic stem cell and cancer data sets. Overall, we find strong associations between these methylation patterns and expression. We further show that an extension of our method also outperforms other approaches by generating a longer list of genes with higher quality associations between differential methylation and expression. PMID:23748561
Pathogenesis and Management of Serrated Polyps: Current Status and Future Directions
Anderson, Joseph C.
2014-01-01
Hyperplastic or serrated polyps were once believed to have little to no clinical significance. A subset of these polyps are now considered to be precursors to colorectal cancers (CRC) in the serrated pathway that may account for at least 15% of all tumors. The serrated pathway is distinct from the two other CRC pathways and involves an epigenetic hypermethylation mechanism of CpG islands within promoter regions of tumor suppressor genes. This process results in the formation of CpG island methylator phenotype tumors. Serrated polyps are divided into hyperplastic polyps, sessile serrated adenomas/polyps (SSA/Ps), and traditional serrated adenomas (TSAs). The SSA/P and the TSA have the potential for dysplasia and subsequent malignant transformation. The SSA/Ps are more common and are more likely to be flat than TSAs. Their flat morphology may make them difficult to detect and thus explain the variation in detection rates among endoscopists. Challenges for endoscopists also include the difficulty in pathological interpretation as well surveillance of these lesions. Furthermore, serrated polyps may be inadequately resected by endoscopists. Thus, it is not surprising that the serrated pathway has been linked with interval cancers. This review will provide the physician or clinician with the knowledge to manage patients with serrated polyps. PMID:25368744
α-Synuclein Sequesters Dnmt1 from the Nucleus
Desplats, Paula; Spencer, Brian; Coffee, Elizabeth; Patel, Pruthul; Michael, Sarah; Patrick, Christina; Adame, Anthony; Rockenstein, Edward; Masliah, Eliezer
2011-01-01
DNA methylation is a major epigenetic modification that regulates gene expression. Dnmt1, the maintenance DNA methylation enzyme, is abundantly expressed in the adult brain and is mainly located in the nuclear compartment, where it has access to chromatin. Hypomethylation of CpG islands at intron 1 of the SNCA gene has recently been reported to result in overexpression of α-synuclein in Parkinson disease (PD) and related disorders. We therefore investigated the mechanisms underlying altered DNA methylation in PD and dementia with Lewy bodies (DLB). We present evidence of reduction of nuclear Dnmt1 levels in human postmortem brain samples from PD and DLB patients as well as in the brains of α-synuclein transgenic mice models. Furthermore, sequestration of Dnmt1 in the cytoplasm results in global DNA hypomethylation in human and mouse brains, involving CpG islands upstream of SNCA, SEPW1, and PRKAR2A genes. We report that association of Dnmt1 and α-synuclein might mediate aberrant subcellular localization of Dnmt1. Nuclear Dnmt1 levels were partially rescued by overexpression of Dnmt1 in neuronal cell cultures and in α-synuclein transgenic mice brains. Our results underscore a novel mechanism for epigenetic dysregulation in Lewy body diseases, which might underlie the decrease in DNA methylation reported for PD and DLB. PMID:21296890
2010-01-01
To overcome loss of stem-like properties and spontaneous differentiation those hinder the expansion and application of human mesenchymal stem cells (hMSCs), we have clonally isolated permanent and stable human MSC lines by ectopic overexpression of primary cell cultures of hMSCs with HPV 16 E6E7 and human telomerase reverse transcriptase (hTERT) genes. These cells were found to have a differentiation potential far beyond the ordinary hMSCs. They expressed trophoectoderm and germline specific markers upon differentiation with BMP4 and retinoic acid, respectively. Furthermore, they displayed higher osteogenic and neural differentiation efficiency than primary hMSCs or hMSCs expressed HPV16 E6E7 alone with a decrease in methylation level as proven by a global CpG island methylation profile analysis. Notably, the demethylated CpG islands were highly associated with development and differentiation associated genes. Principal component analysis further pointed out the expression profile of the cells converged toward embryonic stem cells. These data demonstrate these cells not only are a useful tool for the studies of cell differentiation both for the mesenchymal and neurogenic lineages, but also provide a valuable source of cells for cell therapy studies in animal models of skeletal and neurological disorders. PMID:20670406
Glioma CpG island methylator phenotype (G-CIMP): biological and clinical implications.
Malta, Tathiane M; de Souza, Camila F; Sabedot, Thais S; Silva, Tiago C; Mosella, Maritza S; Kalkanis, Steven N; Snyder, James; Castro, Ana Valeria B; Noushmehr, Houtan
2018-04-09
Gliomas are a heterogeneous group of brain tumors with distinct biological and clinical properties. Despite advances in surgical techniques and clinical regimens, treatment of high-grade glioma remains challenging and carries dismal rates of therapeutic success and overall survival. Challenges include the molecular complexity of gliomas, as well as inconsistencies in histopathological grading, resulting in an inaccurate prediction of disease progression and failure in the use of standard therapy. The updated 2016 World Health Organization (WHO) classification of tumors of the central nervous system reflects a refinement of tumor diagnostics by integrating the genotypic and phenotypic features, thereby narrowing the defined subgroups. The new classification recommends molecular diagnosis of isocitrate dehydrogenase (IDH) mutational status in gliomas. IDH-mutant gliomas manifest the cytosine-phosphate-guanine (CpG) island methylator phenotype (G-CIMP). Notably, the recent identification of clinically relevant subsets of G-CIMP tumors (G-CIMP-high and G-CIMP-low) provides a further refinement in glioma classification that is independent of grade and histology. This scheme may be useful for predicting patient outcome and may be translated into effective therapeutic strategies tailored to each patient. In this review, we highlight the evolution of our understanding of the G-CIMP subsets and how recent advances in characterizing the genome and epigenome of gliomas may influence future basic and translational research.
Epigenetics and Breast Cancers
Vo, An T.; Millis, Richard M.
2012-01-01
Several of the active compounds in foods, poisons, drugs, and industrial chemicals may, by epigenetic mechanisms, increase or decrease the risk of breast cancers. Enzymes that are involved in DNA methylation and histone modifications have been shown to be altered in several types of breast and other cancers resulting in abnormal patterns of methylation and/or acetylation. Hypermethylation at the CpG islands found in estrogen response element (ERE) promoters occurs in conjunction with ligand-bonded alpha subunit estrogen receptor (Erα) dimers wherein the ligand ERα dimer complex acts as a transcription factor and binds to the ERE promoter. Ligands could be 17-β-estradiol (E2), phytoestrogens, heterocyclic amines, and many other identified food additives and heavy metals. The dimer recruits DNA methyltransferases which catalyze the transfer of methyl groups from S-adenosyl-L-methionine (SAM) to 5′-cytosine on CpG islands. Other enzymes are recruited to the region by ligand-ERα dimers which activate DNA demethylases to act simultaneously to increase gene expression of protooncogenes and growth-promoting genes. Ligand-ERα dimers also recruit histone acetyltransferase to the ERE promoter region. Histone demethylases such as JMJD2B and histone methyltransferases are enzymes which demethylate lysine residues on histones H3 and/or H4. This makes the chromatin accessible for transcription factors and enzymes. PMID:22567014
NASA Astrophysics Data System (ADS)
Huang, Yajuan; Hu, Nan; Si, Yufeng; Li, Siping; Wu, Shuxian; Zhang, Meizhao; Wen, Haishen; Li, Jifang; Li, Yun; He, Feng
2018-06-01
Follistatin (Fst) is a hyperplasia factor that plays a crucial role in muscle development. DNA methylation, a significant process, regulates gene expression. The aim of our study is to examine the DNA methylation and expression patterns of Fst gene at five different development stages of Japanese flounder (stage A, 7 dph; stage B, 90 dph; stage C, about 180 dph; stage D, about 24 months; stage E, about 36 months). The muscle tissue of Japanese flounder was obtained at different development stages in this experiment. DNA methylation levels in the promoter and exon 2 of Fst were determined by bisulfite sequencing, and the relative expression of the Fst gene at the five stages was measured by quantitative PCR. The results showed that the lowest methylation level was at stage A and the highest methylation level was at stage B. Moreover, the highest expression level of the Fst gene was observed at stage A. The mRNA abundance was negatively correlated with DNA methylation level. Three CpG islands in the promoter region and three CpG islands in exon 2 of Fst were found in the binding sequence of the putative transcription factor. These results offered a theoretical basis for the mechanism of Fst gene regulation to muscle development at different development stages.
Federal Register 2010, 2011, 2012, 2013, 2014
2011-05-17
... quality levels (AQLs) for leaks and visual defects observed during FDA testing of medical gloves. The CPG... practices regulation (21 CFR 10.115). The CPG represents FDA's current thinking on the criteria for direct...
Adjuvant-Loaded Spiky Gold Nanoparticles for Activation of Innate Immune Cells.
Nam, Jutaek; Son, Sejin; Moon, James J
2017-10-01
Gold nanoparticles are versatile carriers for delivery of biomacromolecules. Here, we have developed spiky gold nanoparticles (SGNPs) that can efficiently deliver immunostimulatory agents. Our goal was to develop a platform technology for co-delivery of multiple adjuvant molecules for synergistic stimulation and maturation of innate immune cells. SGNPs were synthesized by a seed-mediated, surfactant-free synthesis method and incorporated with polyinosinic-polycytidylic acid (pIC) and DNA oligonucleotide containing unmethylated CpG motif (CpG) by an electrostatic layer-by-layer approach. Adjuvant-loaded SGNP nano-complexes were examined for their biophysical and biochemical properties and studied for immune activation using bone marrow-derived dendritic cells (BMDCs). We have synthesized SGNPs with branched nano-spikes layered with pIC and/or CpG. Adjuvant-loaded SGNP nano-complexes promoted cellular uptake of the adjuvants. Importantly, we achieved spatio-temporal control over co-delivery of pIC and CpG via SGNPs, which produced synergistic enhancement in cytokine release (IL-6, TNF-α) and upregulation of co-stimulatory markers (CD40, CD80, CD86) in BMDCs, compared with pIC, CpG, or their admixtures. SGNPs serve as a versatile delivery platform that allows flexible and on-demand cargo fabrication for strong activation of innate immune cells.
Eskicioglu, Cagla; Pearsall, Emily; Victor, J Charles; Aarts, Mary-Anne; Okrainec, Allan; McLeod, Robin S
2015-01-01
The successful transfer of evidence into clinical practice is a slow and haphazard process. We report the outcome of a 5-year knowledge translation (KT) strategy to increase adherence with a clinical practice guideline (CPG) for mechanical bowel preparation (MBP) for elective colorectal surgery patients. A locally tailored CPG recommending MBP practices was developed. Data on MBP practices were collected at six University of Toronto hospitals before CPG implementation as well as after two separate KT strategies. KT strategy #1 included development of the CPG, education by opinion leaders, reminder cards, and presentations of data. KT strategy #2 included selection of hospital champions, development of communities of practice, education, reminder cards, electronic updates, pre-printed standardized orders, and audit and feedback. A total of 744 patients (400 males, 344 females, mean age 57.0) were included. Compliance increased from 58.6 to 70.4% after KT strategy #1 and to 81.1% after KT strategy #2 (p < 0.001). Using a tailored KT strategy, increased compliance was observed with CPG recommendations over time suggesting that a longitudinal KT strategy is required to increase and sustain compliance with recommendations. Furthermore, different strategies may be required at different times (i.e., educational sessions initially and reminders and standardized orders to maintain adherence).
Ma, Qing; Zhou, Dapeng; DeLyria, Elizabeth S; Wen, Xiaoxia; Lu, Wei; Thapa, Prakash; Liu, Chengwen; Li, Dan; Bassett, Roland L; Overwijk, Willem W; Hwu, Patrick; Li, Chun
2017-01-01
There is an urgent need for new clinically applicable drug-delivery methods to enhance accumulation of immune-activating drugs in tumors. We synthesized a poly(L-glutamic acid)-CpG ODN2216 conjugate (PG-CpG) and injected it intratumorally into C57BL/6 mice bearing subcutaneous B16-ovalbumin melanoma. PG-CpG elicited the same potent antitumoral activity as CpG with respect to reducing tumor growth and triggering antigen-specific CD8 T-cell responses in this well-established solid tumor model. Moreover, PG-CpG was retained significantly longer in both tumor and draining lymph nodes than was free CpG after intratumoral injection. Specifically, 48 hours after injection, 26.5%±16.9% of the injected PG-CpG dose versus 4.72%±2.61% of free CpG remained at the tumor, and 1.53%±1.22% of the injected PG-CpG versus 0.37%±0.33% of free CpG was retained in the draining inguinal lymph nodes. These findings indicate that PG is an effective synthetic polymeric carrier for delivery of immunostimulatory agents to tumors and lymph nodes.
Mihaljevic, Marina; Franic, Dusica; Soldatovic, Ivan; Andric, Sanja; Mirjanic, Tijana; Novakovic, Ivana; Adzic, Miroslav; Maric, Nadja
2017-01-01
Abstract Background: Hypothalamic-pituitary-adrenal (HPA) axis dysregulation is a proposed etiological mechanism of psychosis. Recent studies highlighted impact of the FKBP5 gene and its functional variant rs1360780, which risk (T) allele affects the activity of HPA axis following stress exposure, on psychotic patients exposed to early trauma (1). Additionally, risk allele and trauma dependent FKBP5 demethylation in intron 7 was observed in traumatized individuals (2). Thus, the purpose of this pilot study was to investigate influence of the risk allele and trauma on FKBP5 DNA methylation levels at intron 7 in psychotic patients and to compare it with healthy individuals. Methods: The sample consisted of 24 psychosis spectrum patients and 24 controls matched by age and gender. All participants were genotyped for rs1360780 and divided into 2 groups depending on the presence of the risk allele (risk and nonrisk group). DNA methylation levels at 3 CpG sites (CpG1, CpG2, and CpG3) in intron 7 were analyzed by Sanger sequencing. Early-life adversities were measured by Childhood Trauma Questionnaire. Pearson correlation and t test were performed as appropriate. Results: Analyses revealed decreased FKBP5 methylation at targeted CpG sites and averaged methylation level (AML) at intron 7 in patients compared to controls (P = .026, P = .017, P = .027, and P = .003, respectively). Decreased AML and methylation at CpG3 were observed comparing risk and nonrisk patients’ groups (P = .018 and P = .016, respectively). Additionally, decreased methylation was found in risk patients’ group compared to risk controls’ group. No differences were found comparing nonrisk groups. Furthermore, strong negative associations between trauma and methylation at CpG3 and AML were observed only in risk controls’ group (r = −0.707, P = .007; r = −0.741, P = .004, respectively). Conclusion: Our preliminary results revealed allele-specific epigenetic changes of the FKBP5 gene in psychotic patients, which is in line with previous reports in traumatized individuals. Trauma-related demethylation in risk controls’ group supports the hypothesis that psychotic and stress-related conditions could share common neurobiological underlying mechanism, such as HPA axis dysregulation, particularly in individuals with genetic predisposition for altered stress response. References 1.Daskalakis NP, Binder EB. Schizophrenia in the spectrum of gene-stress interactions: the FKBP5 example. Schizophr Bull. 2015;41:323–329. 2.Klengel T, Mehta D, Anacker C et al. Allele-specific FKBP5 DNA demethylation mediates gene-childhood trauma interactions. Nat Neurosci. 2013;16:33–41.
Genome-wide screen of ovary-specific DNA methylation in polycystic ovary syndrome.
Yu, Ying-Ying; Sun, Cui-Xiang; Liu, Yin-Kun; Li, Yan; Wang, Li; Zhang, Wei
2015-07-01
To compare genome-wide DNA methylation profiles in ovary tissue from women with polycystic ovary syndrome (PCOS) and healthy controls. Case-control study matched for age and body mass index. University-affiliated hospital. Ten women with PCOS who underwent ovarian drilling to induce ovulation and 10 healthy women who were undergoing laparoscopic sterilization, hysterectomy for benign conditions, diagnostic laparoscopy for pelvic pain, or oophorectomy for nonovarian indications. None. Genome-wide DNA methylation patterns determined by immunoprecipitation and microarray (MeDIP-chip) analysis. The methylation levels were statistically significantly higher in CpG island shores (CGI shores), which lie outside of core promoter regions, and lower within gene bodies in women with PCOS relative to the controls. In addition, high CpG content promoters were the most frequently hypermethylated promoters in PCOS ovaries but were more often hypomethylated in controls. Second, 872 CGIs, specifically methylated in PCOS, represented 342 genes that could be associated with various molecular functions, including protein binding, hormone activity, and transcription regulator activity. Finally, methylation differences were validated in seven genes by methylation-specific polymerase chain reaction. These genes correlated to several functional families related to the pathogenesis of PCOS and may be potential biomarkers for this disease. Our results demonstrated that epigenetic modification differs between PCOS and normal ovaries, which may help to further understand the pathophysiology of this disease. Copyright © 2015 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.
Effects of CPG ODN on biological behavior of PANC-1 and expression of TLR9 in pancreatic cancer.
Wu, Han-Qing; Wang, Bo; Zhu, Shi-Kai; Tian, Yuan; Zhang, Jing-Hui; Wu, He-Shui
2011-02-28
To determine the expression of toll-like receptor 9 (TLR9) in pancreatic tumor and the effects of cytosine phosphate-guanosine oligodeoxynucleotides 2216 (CPG ODN2216) on biological behavior of pancreatic carcinoma cell line PANC-1 and explore their clinical significance. The immunohistochemistry and Western blot were used to determine the expression of TLR9 protein in pancreatic cancer tissues, and immunofluorescence staining was performed to detect the TLR9 protein expression in pancreatic carcinoma cell line PANC-1. To assess the effects of CPG ODN2216 on the invasive property of Panc-1 cells, in vitro cell adhesion, wound-healing scrape, and invasion and cell colony formation were evaluated. TLR9 was highly expressed in pancreatic cancer tissues and PANC-1 cells. The percentage of positive cells expressing TLR9 protein in human pancreatic tissues, paracancerous tissues and normal tissues were 73.3%, 33.3% and 20.0%, respectively, and the protein expression level of TLR9 was gradually descending (P < 0.05). In vitro tests in wound-healing scrape, cell adhesion, colony formation and matrigel invasion showed that the adhesion and motility of PANC-1 cells in CPG ODN 2216 treatment group were significantly lower than in the control group (P < 0.05). The cell growth assay showed that the proliferative ability of PANC-1 cells in treatment group was significantly decreased and CPG ODN2216 had an inhibitive effect in the growth of Panc-1 cells in a dose and time-dependent manner (P < 0.05). The gene of TLR9 is correlated with the invasive and metastatic potential of human pancreatic carcinoma, and CPG ODN2216 induces the inhibition of migration and invasion of Panc-1 cells.
Siniscalchi, Michael J.; Jing, Jian; Weiss, Klaudiusz R.
2016-01-01
Repetition priming is characterized by increased performance as a behavior is repeated. Although this phenomenon is ubiquitous, mediating mechanisms are poorly understood. We address this issue in a model system, the feeding network of Aplysia. This network generates both ingestive and egestive motor programs. Previous data suggest a chemical coding model: ingestive and egestive inputs to the feeding central pattern generator (CPG) release different modulators, which act via different second messengers to prime motor activity in different ways. The ingestive input to the CPG (neuron CBI-2) releases the peptides feeding circuit activating peptide and cerebral peptide 2, which produce an ingestive pattern of activity. The egestive input to the CPG (the esophageal nerve) releases the peptide small cardioactive peptide. This model is based on research that focused on a single aspect of motor control (radula opening). Here we ask whether repetition priming is observed if activity is triggered with a neuron within the core CPG itself and demonstrate that it is not. Moreover, previous studies demonstrated that effects of modulatory neurotransmitters that induce repetition priming persist. This suggests that it should be possible to “prime” motor programs triggered from within the CPG by first stimulating extrinsic modulatory inputs. We demonstrate that programs triggered after ingestive input activation are ingestive and programs triggered after egestive input activation are egestive. We ask where this priming occurs and demonstrate modifications within the CPG itself. This arrangement is likely to have important consequences for “task” switching, i.e., the cessation of one type of motor activity and the initiation of another. PMID:27466134
Comprehensive DNA methylation analysis of human neuroblastoma cells treated with blonanserin.
Murata, Yui; Nishioka, Masaki; Bundo, Miki; Sunaga, Fumiko; Kasai, Kiyoto; Iwamoto, Kazuya
2014-03-20
Blonanserin is a second-generation antipsychotic drug for schizophrenia. The pharmacological actions of blonanserin are shown to be the antagonism of dopamine receptor 2 and serotonin receptors. However, its molecular mechanisms in brain cells have not been fully characterized. Accumulating evidence suggests that antipsychotic drugs and mood stabilizers show epigenetic effects on a wide range of genes in animal and cellular models. We performed genome-wide DNA methylation analysis targeting 479,814 CpG sites of cultured human neuroblastoma cells administered with blonanserin. We found that 3,057 CpG sites showed statistically significant changes in DNA methylation at two different doses of blonanserin (1.36 nM and 13.6 nM). These included hypermethylated CpG sites that were enriched in genes related to axonogenesis and cell morphogenesis involved in neuron differentiation. We also showed that the global effect on DNA methylome depends on the concentration of the drug. With a high dose of blonanserin, the overall methylation levels across all CpG sites significantly increased. These increases in DNA methylation were prominent in the CpG sites distant from promoter regions. We further examined DNA methylation changes in specific genes implicated for the actions of antipsychotic drugs, such as the dopamine receptor 2 (DRD2) gene and the serotonin receptor 2A (HTR2A) gene. We observed that CpG sites that were located within DRD2 and HTR2A genes were significantly hypermethylated by blonanserin. The DNA methylation changes induced by the treatment with blonanserin will be useful for understanding its pharmacological actions at the cellular level. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Syncope Best Practices: A Syncope Clinical Practice Guideline to Improve Quality.
Phelps, Heather M; Sachdeva, Ritu; Mahle, William T; McCracken, Courtney E; Kelleman, Michael; McConnell, Michael; Fischbach, Peter S; Cardis, Brian M; Campbell, Robert M; Oster, Matthew E
2016-05-01
To determine whether implementation of a standardized clinical practice guideline (CPG) for the evaluation of syncope would decrease practice variability and resource utilization. A retrospective review of medical records of patients presenting to our practice for outpatient evaluation of syncope before and after implementation of the CPG. The guideline included elements of history, physical exam, electrocardiogram, and "red flags" for further testing. Outpatient pediatric cardiology offices of a large pediatric cardiology practice. All new patients between 3 and 21 years old, who presented to cardiology clinic with a chief complaint of syncope. The CPG for the evaluation of pediatric syncope was presented to the providers. Resource utilization was determined by the tests ordered by individual physicians before and after initiation of the CPG. Patient final diagnoses were recorded and the medical records were subsequently reviewed to determine if any patients, who presented again to the system, were ultimately diagnosed with cardiac disease. Of the 1496 patients with an initial visit for syncope, there was no significant difference in the diagnosis of cardiac disease before or after initiation of the CPG: (0.6% vs. 0.4%, P = .55). Electrocardiography provides the highest yield in the evaluation of pediatric syncope. Despite high compliance (86.9%), there were no overall changes in costs ($346.31 vs. $348.53, P = .85) or in resource utilization. There was, however, a decrease in the variability of ordering of echocardiograms among physicians, particularly among those at the extremes of utilization. Although the CPG did not decrease already low costs, it did decrease the wide variability in echo utilization. Evaluation beyond detailed history, physical exam, and electrocardiography provides no additional benefit in the evaluations of pediatric patients presenting with syncope. © 2015 Wiley Periodicals, Inc.
Aiba, Toshiki; Saito, Toshiyuki; Hayashi, Akiko; Sato, Shinji; Yunokawa, Harunobu; Maruyama, Toru; Fujibuchi, Wataru; Kurita, Hisaka; Tohyama, Chiharu; Ohsako, Seiichiroh
2017-03-09
It has been pointed out that environmental factors or chemicals can cause diseases that are developmental in origin. To detect abnormal epigenetic alterations in DNA methylation, convenient and cost-effective methods are required for such research, in which multiple samples are processed simultaneously. We here present methylated site display (MSD), a unique technique for the preparation of DNA libraries. By combining it with amplified fragment length polymorphism (AFLP) analysis, we developed a new method, MSD-AFLP. Methylated site display libraries consist of only DNAs derived from DNA fragments that are CpG methylated at the 5' end in the original genomic DNA sample. To test the effectiveness of this method, CpG methylation levels in liver, kidney, and hippocampal tissues of mice were compared to examine if MSD-AFLP can detect subtle differences in the levels of tissue-specific differentially methylated CpGs. As a result, many CpG sites suspected to be tissue-specific differentially methylated were detected. Nucleotide sequences adjacent to these methyl-CpG sites were identified and we determined the methylation level by methylation-sensitive restriction endonuclease (MSRE)-PCR analysis to confirm the accuracy of AFLP analysis. The differences of the methylation level among tissues were almost identical among these methods. By MSD-AFLP analysis, we detected many CpGs showing less than 5% statistically significant tissue-specific difference and less than 10% degree of variability. Additionally, MSD-AFLP analysis could be used to identify CpG methylation sites in other organisms including humans. MSD-AFLP analysis can potentially be used to measure slight changes in CpG methylation level. Regarding the remarkable precision, sensitivity, and throughput of MSD-AFLP analysis studies, this method will be advantageous in a variety of epigenetics-based research.
Ng, Shu Wen; Slining, Meghan M; Popkin, Barry M
2014-10-01
Corporate voluntary pledges to improve the health of Americans have not been held to either explicit measurable outcomes or a framework for independent evaluation. The Healthy Weight Commitment Foundation (HWCF), whose members include 16 of the nation's leading consumer packaged goods (CPG) food and beverage manufacturers, voluntarily pledged to collectively sell 1 trillion fewer calories in the U.S. marketplace by 2012 (against a 2007 baseline), and sell 1.5 trillion fewer calories by 2015. This paper presents the findings of an independent evaluation of the 2012 HWCF marketplace pledge, conducted in 2013. The 16 HWCF companies collectively sold approximately 6.4 trillion fewer calories (-10.6%) in 2012 than in the baseline year of 2007. Taking into account population changes over the 5-year period of 2007-2012, CPG caloric sales from brands included in the HWCF pledge declined by an average of 78 kcal/capita/day. CPG caloric sales from non-HWCF national brands during the same period declined by 11 kcal/capita/day, and there were similar declines in calories from private label products. Thus, the total reduction in CPG caloric sales between 2007 and 2012 was 99 kcal/capita/day. This independent evaluation is the first to evaluate food industry compliance with its calorie reduction pledges and to assess how sales from the CPG food and beverage sector are changing. An accompanying paper investigates the extent to which the HWCF pledge affected household-level changes in CPG calories purchased, controlling for important economic and sociodemographic factors affecting household food purchases over this period. Copyright © 2014 American Journal of Preventive Medicine. Published by Elsevier Inc. All rights reserved.
Ghebremeskel, K; Min, Y; Crawford, M A; Nam, J H; Kim, A; Koo, J N; Suzuki, H
2000-05-01
Relative fatty acid composition of plasma and red blood cell (RBC) choline phosphoglycerides (CPG), and RBC ethanolamine phosphoglycerides (EPG) of pregnant (n = 40) and nonpregnant, nonlactating (n = 40), healthy Korean women was compared. The two groups were of the same ethnic origin and comparable in age and parity. Levels of arachidonic (AA) and docosahexaenoic (DHA) acids were lower (P < 0.05) and palmitic and oleic acids higher (P < 0.0001) in plasma CPG of the pregnant women. Similarly, the RBC CPG and EPG of the pregnant women had lower AA and DHA (P < 0.05) and higher palmitic and oleic acids (P < 0.01). The reduction in DHA and total n-3 fatty acids in plasma CPG of the pregnant women was paralleled by an increase in docosatetraenoic (DTA) and docosapentaenoic (DPA) acids of the n-6 series and in DPA/DTA ratio. In the RBC phospholipids (CPG and EPG) of the pregnant women, DTA and DPA acids of the n-6 series and DPA/DTA ratio did not increase with the decrease of the n-3 metabolites (eicosapentaenoic acid, DPA, and DHA) and total n-3. Since pregnancy was the main identifiable variable between the two groups, the lower levels of AA and DHA in RBC CPG and EPG of the pregnant women suggest that the mothers were mobilizing membrane AA and DHA to meet the high fetal requirement for these nutrients. It may also suggest that RBC play a role as a potential store of AA and DHA and as a vehicle for the transport of these fatty acids from maternal circulation to the placenta to be utilized by the developing fetus.
Adopting Health Behavior Change Theory throughout the Clinical Practice Guideline Process
ERIC Educational Resources Information Center
Ceccato, Natalie E.; Ferris, Lorraine E.; Manuel, Douglas; Grimshaw, Jeremy M.
2007-01-01
Adopting a theoretical framework throughout the clinical practice guideline (CPG) process (development, dissemination, implementation, and evaluation) can be useful in systematically identifying, addressing, and explaining behavioral influences impacting CPG uptake and effectiveness. This article argues that using a theoretical framework should…
Federal Register 2010, 2011, 2012, 2013, 2014
2013-07-16
... DEPARTMENT OF HEALTH AND HUMAN SERVICES Food and Drug Administration [Docket No. FDA-2013-D-0254] Salmonella Contamination of Dry Dog Food; Withdrawal of Compliance Policy Guide AGENCY: Food and Drug... entitled ``Sec. 690.700 Salmonella Contamination of Dry Dog Food (CPG 690.700)'' on October 1, 1980. CPG...
Gait Planning and Stability Control of a Quadruped Robot
Li, Junmin; Wang, Jinge; Yang, Simon X.; Zhou, Kedong; Tang, Huijuan
2016-01-01
In order to realize smooth gait planning and stability control of a quadruped robot, a new controller algorithm based on CPG-ZMP (central pattern generator-zero moment point) is put forward in this paper. To generate smooth gait and shorten the adjusting time of the model oscillation system, a new CPG model controller and its gait switching strategy based on Wilson-Cowan model are presented in the paper. The control signals of knee-hip joints are obtained by the improved multi-DOF reduced order control theory. To realize stability control, the adaptive speed adjustment and gait switch are completed by the real-time computing of ZMP. Experiment results show that the quadruped robot's gaits are efficiently generated and the gait switch is smooth in the CPG control algorithm. Meanwhile, the stability of robot's movement is improved greatly with the CPG-ZMP algorithm. The algorithm in this paper has good practicability, which lays a foundation for the production of the robot prototype. PMID:27143959
Gait Planning and Stability Control of a Quadruped Robot.
Li, Junmin; Wang, Jinge; Yang, Simon X; Zhou, Kedong; Tang, Huijuan
2016-01-01
In order to realize smooth gait planning and stability control of a quadruped robot, a new controller algorithm based on CPG-ZMP (central pattern generator-zero moment point) is put forward in this paper. To generate smooth gait and shorten the adjusting time of the model oscillation system, a new CPG model controller and its gait switching strategy based on Wilson-Cowan model are presented in the paper. The control signals of knee-hip joints are obtained by the improved multi-DOF reduced order control theory. To realize stability control, the adaptive speed adjustment and gait switch are completed by the real-time computing of ZMP. Experiment results show that the quadruped robot's gaits are efficiently generated and the gait switch is smooth in the CPG control algorithm. Meanwhile, the stability of robot's movement is improved greatly with the CPG-ZMP algorithm. The algorithm in this paper has good practicability, which lays a foundation for the production of the robot prototype.
Cancer immunotherapeutic effects of novel CpG ODN in murine tumor model.
Cho, Hyeon Cheol; Kim, Bo Hwan; Kim, Kyunghoon; Park, Ju Youn; Chang, Jae-Ho; Kim, Soo-Ki
2008-10-01
While CpG oligodeoxynucleotides (ODN) are excellent candidates for cancer immunotherapeutics, the numbers of usable CpG ODNs are limited in current clinical settings. To resolve this, we investigated whether novel CpG ODN (KSK-CpG) would be an effective immunotherapeutic in a murine tumor model by affecting in vivo and in vitro parameters, such as survival span, the number of tumor nodules, natural killer (NK) cell and cytotoxic T lymphocyte (CTL) activity and interleukin (IL)-6 or IL-12 cytokine release in splenocytes. We found that KSK-CpG was effective in the murine cancer model by way of prolonging survival span, reducing the number of tumor nodules, augmenting NK cell and CTL cytotoxicity, as well as evoking IL-6 and IL-12 cytokine release in splenocytes. Collectively, these data demonstrate that KSK-CpG is active against the highly malignant B16BL6 and EL4 tumor mouse model via innate immune augmentation.
Identification and expression analysis of cobia (Rachycentron canadum) Toll-like receptor 9 gene.
Byadgi, Omkar; Puteri, Dinda; Lee, Yan-Horn; Lee, Jai-Wei; Cheng, Ta-Chih
2014-02-01
Cobia culture is hindered by bacterial infection (Photobacterium damselae subsp. piscicida) and in order to study the effect of P. damselae subsp. piscicida challenge and CpG ODN stimulation on cobia Toll like receptor 9 (RCTLR9), we used PCR to clone RCTLR9 gene and qRT-PCR to quantify gene expression. The results indicated that RCTLR9 cDNA contains 3141 bp. It encodes 1047 amino acids containing 16 typical structures of leucine-rich repeats (LRRs) including an LRRTYP, LRRCT and a motif involved in PAMP binding was identified at position 240-253 amino acid. Broad expression of RCTLR9 was found in larval, juvenile and adult stages irrespective of the tissues. In larval stage, RCTLR9 mRNA expression decreased at 5 d and then increased at 10 dph. At juvenile stage cobia, the expression was significantly high (p < 0.05) in spleen and intestine compared to gill, kidney, liver and skin. However, at adult stage, the significant high expression was found in gill and intestine. Cobia challenged with P. damselae subsp. piscicida showed significant increase in RCTLR9 expression at 24 h post challenge in intestine, spleen and liver, while in kidney the expression was peak at 12 h and later it decreased at 24 h. The highest expression was 40 fold increase in spleen and the lowest expression was ∼3.6 fold increase in liver. Cobia stimulated with CpG oligonucleotides showed that the induction of these genes was CpG ODN type and time dependent. In spleen and liver, CpG ODNs 1668 and 2006 injected group showed high expression of RCTLR9, IL-1β, chemokine CC compared to other groups. Meanwhile, CpG ODN 2006 has induced high expression of IgM. The CpG ODNs 2395 have induced significant high expression of Mx in spleen and liver. These results demonstrates the potential of using CpG ODN to enhance cobia resistance to P. damselae subsp. piscicida infection and use as an adjuvant in vaccine development. Copyright © 2013 Elsevier Ltd. All rights reserved.
CpG Sites Associated with Cigarette Smoking: Analysis of Epigenome-Wide Data from the Sister Study
Harlid, Sophia; Xu, Zongli; Panduri, Vijayalakshmi; Sandler, Dale P.
2014-01-01
Background: Smoking increases the risk of many diseases, and it is also linked to blood DNA methylation changes that may be important in disease etiology. Objectives: We sought to identify novel CpG sites associated with cigarette smoking. Methods: We used two epigenome-wide data sets from the Sister Study to identify and confirm CpG sites associated with smoking. One included 908 women with methylation measurements at 27,578 CpG sites using the HumanMethylation27 BeadChip; the other included 200 women with methylation measurements for 473,844 CpG sites using the HumanMethylation450 BeadChip. Significant CpGs from the second data set that were not included in the 27K assay were validated by pyrosequencing in a subset of 476 samples from the first data set. Results: Our study successfully confirmed smoking associations for 9 previously established CpGs and identified 2 potentially novel CpGs: cg26764244 in GNG12 (p = 9.0 × 10–10) and cg22335340 in PTPN6 (p = 2.9 × 10–05). We also found strong evidence of an association between smoking status and cg02657160 in CPOX (p = 7.3 × 10–7), which has not been previously reported. All 12 CpGs were undermethylated in current smokers and showed an increasing percentage of methylation in former and never-smokers. Conclusions: We identified 2 potentially novel smoking related CpG sites, and provided independent replication of 10 previously reported CpGs sites related to smoking, one of which is situated in the gene CPOX. The corresponding enzyme is involved in heme biosynthesis, and smoking is known to increase heme production. Our study extends the evidence base for smoking-related changes in DNA methylation. Citation: Harlid S, Xu Z, Panduri V, Sandler DP, Taylor JA. 2014. CpG sites associated with cigarette smoking: analysis of epigenome-wide data from the Sister Study. Environ Health Perspect 122:673–678; http://dx.doi.org/10.1289/ehp.1307480 PMID:24704585
Wilson, John T.; Keller, Salka; Manganiello, Matthew J.; Cheng, Connie; Lee, Chen-Chang; Opara, Chinonso; Convertine, Anthony; Stayton, Patrick S.
2013-01-01
Protein subunit vaccines offer important potential advantages over live vaccine vectors, but generally elicit weaker and shorter-lived cellular immune responses. Here we investigate the use of pH-responsive, endosomolytic polymer nanoparticles that were originally developed for RNA delivery as vaccine delivery vehicles for enhancing cellular and humoral immune responses. Micellar nanoparticles were assembled from amphiphilic diblock copolymers composed of an ampholytic core-forming block and a re-designed polycationic corona block doped with thiol-reactive pyridyl disulfide groups to enable dual-delivery of antigens and immunostimulatory CpG oligodeoxynucleotide (CpG ODN) adjuvants. Polymers assembled into 23 nm particles with simultaneous packaging of CpG ODN and a thiolated protein antigen, ovalbumin (ova). Conjugation of ova to nanoparticles significantly enhanced antigen cross-presentation in vitro relative to free ova or an unconjugated, physical mixture of the parent compounds. Subcutaneous vaccination of mice with ova-nanoparticle conjugates elicited a significantly higher CD8+ T cell response (0.5% IFN-ɣ+ of CD8+) compared to mice vaccinated with free ova or a physical mixture of the two components. Significantly, immunization with ova-nanoparticle conjugates electrostatically complexed with CpG ODN (dual-delivery) enhanced CD8+ T cell responses (3.4% IFN-ɣ+ of CD8+) 7-, 18-, and 8-fold relative to immunization with conjugates, ova administered with free CpG, or a formulation containing free ova and CpG complexed to micelles, respectively. Similarly, dual-delivery carriers significantly increased CD4+IFN-ɣ+ (Th1) responses, and elicited a balanced IgG1/IgG2c antibody response. Intradermal administration further augmented cellular immune responses, with dual-delivery carriers inducing ~7% antigen-specific CD8+ T cells. This work demonstrates the ability of pH-responsive, endosomolytic nanoparticles to actively promote antigen cross-presentation and augment cellular and humoral immune responses via dual-delivery of protein antigens and CpG ODN. Hence, pH-responsive polymeric nanoparticles offer promise as a delivery platform for protein subunit vaccines. PMID:23590591
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wang, Tingting; Department of Pharmacology, Uniformed Services University of the Health Sciences, Bethesda, Maryland; Chen, Man
Steroidogenic acute regulatory protein (StAR) mediates the rate-limiting step in the synthesis of steroid hormones, essential to fetal development. We have reported that the StAR expression in fetal adrenal is inhibited in a rat model of nicotine-induced intrauterine growth retardation (IUGR). Here using primary human fetal adrenal cortex (pHFAC) cells and a human fetal adrenal cell line NCI-H295A, we show that nicotine inhibits StAR expression and cortisol production in a dose- and time-dependent manner, and prolongs the inhibitory effect on cells proliferating over 5 passages after termination of nicotine treatment. Methylation detection within the StAR promoter region uncovers a singlemore » site CpG methylation at nt -377 that is sensitive to nicotine treatment. Nicotine-induced alterations in frequency of this point methylation correlates well with the levels of StAR expression, suggesting an important role of the single site in regulating StAR expression. Further studies using bioinformatics analysis and siRNA approach reveal that the single CpG site is part of the Pax6 binding motif (CGCCTGA) in the StAR promoter. The luciferase activity assays validate that Pax6 increases StAR gene expression by binding to the glucagon G3-like motif (CGCCTGA) and methylation of this site blocks Pax6 binding and thus suppresses StAR expression. These data identify a nicotine-sensitive CpG site at the Pax6 binding motif in the StAR promoter that may play a central role in regulating StAR expression. The results suggest an epigenetic mechanism that may explain how nicotine contributes to onset of adult diseases or disorders such as metabolic syndrome via fetal programming. -- Highlights: Black-Right-Pointing-Pointer Nicotine-induced StAR inhibition in two human adrenal cell models. Black-Right-Pointing-Pointer Nicotine-induced single CpG site methylation in StAR promoter. Black-Right-Pointing-Pointer Persistent StAR inhibition and single CpG methylation after nicotine termination. Black-Right-Pointing-Pointer Single CpG methylation located at Pax6 binding motif regulates StAR expression.« less
Sang, Qing; Li, Xin; Wang, Haojue; Wang, Huan; Zhang, Shaozhen; Feng, Ruizhi; Xu, Yao; Li, Qiaoli; Zhao, Xinzhi; Xing, Qinghe; Jin, Li; He, Lin; Wang, Lei
2014-01-01
Steroid synthesis and metabolic pathways play important roles in the pathophysiology of PCOS, but until now there have been no studies on the methylation profiles of specific genes in steroid synthesis pathways that are known to be associated with PCOS. Here we used MassARRAY quantitative methylation analysis to determine the methylation levels of each CpG site or cluster in the promoters of EPHX1, SRD5A1, and CYP11A1 in 64 peripheral blood samples. We further examined the methylation level of EPHX1 in an independent cohort consisting of 116 people. Finally, we investigated the role of EPHX1 in steroidogenesis in the KGN cell line. For SRD5A1 and CYP11A1, there was no significant difference in methylation level between patients and controls. For EPHX1, however, the methylation levels of a few consecutive CpG sites and clusters were found to be significantly associated with PCOS. The methylation levels of a number of CpG clusters or sites were significantly lower in patients than in controls in the first cohort consisting of 64 people, such as clusters 13-14 (P<0.05), 15-16 (P<0.001), and 19-24 (P<0.001) and sites CpG_53 (P<0.01) and CpG_54 (P<0.05). Among differentiated methylation sites and clusters, the methylation levels of the CpG cluster 13-14 and CpG cluster 19-24 in PCOS patients were significantly lower than in controls in the second cohort of 116 people (P<0.05 for both). In addition, knockdown and overexpression experiments in KGN cells showed that EPHX1 can regulate estradiol concentrations, and this indicates a role for EPHX1 in steroidogenesis. Our study has demonstrated that methylation of the EPHX1 promoter might be associated with PCOS. This study provides direct evidence that methylation plays an important role in PCOS and demonstrates a novel role for EPHX1 in female reproduction.
Wang, Huan; Zhang, Shaozhen; Feng, Ruizhi; Xu, Yao; Li, Qiaoli; Zhao, Xinzhi; Xing, Qinghe; Jin, Li; He, Lin; Wang, Lei
2014-01-01
Steroid synthesis and metabolic pathways play important roles in the pathophysiology of PCOS, but until now there have been no studies on the methylation profiles of specific genes in steroid synthesis pathways that are known to be associated with PCOS. Here we used MassARRAY quantitative methylation analysis to determine the methylation levels of each CpG site or cluster in the promoters of EPHX1, SRD5A1, and CYP11A1 in 64 peripheral blood samples. We further examined the methylation level of EPHX1 in an independent cohort consisting of 116 people. Finally, we investigated the role of EPHX1 in steroidogenesis in the KGN cell line. For SRD5A1 and CYP11A1, there was no significant difference in methylation level between patients and controls. For EPHX1, however, the methylation levels of a few consecutive CpG sites and clusters were found to be significantly associated with PCOS. The methylation levels of a number of CpG clusters or sites were significantly lower in patients than in controls in the first cohort consisting of 64 people, such as clusters 13–14 (P<0.05), 15–16 (P<0.001), and 19–24 (P<0.001) and sites CpG_53 (P<0.01) and CpG_54 (P<0.05). Among differentiated methylation sites and clusters, the methylation levels of the CpG cluster 13–14 and CpG cluster 19–24 in PCOS patients were significantly lower than in controls in the second cohort of 116 people (P<0.05 for both). In addition, knockdown and overexpression experiments in KGN cells showed that EPHX1 can regulate estradiol concentrations, and this indicates a role for EPHX1 in steroidogenesis. Our study has demonstrated that methylation of the EPHX1 promoter might be associated with PCOS. This study provides direct evidence that methylation plays an important role in PCOS and demonstrates a novel role for EPHX1 in female reproduction. PMID:24505354
Nguyen, Minh; Boutinaud, Marion; Pétridou, Barbara; Gabory, Anne; Pannetier, Maëlle; Chat, Sophie; Bouet, Stephan; Jouneau, Luc; Jaffrezic, Florence; Laloë, Denis; Klopp, Christophe; Brun, Nicolas; Kress, Clémence; Jammes, Hélène; Charlier, Madia; Devinoy, Eve
2014-01-01
Once daily milking (ODM) induces a reduction in milk production when compared to twice daily milking (TDM). Unilateral ODM of one udder half and TDM of the other half, enables the study of underlying mechanisms independently of inter-individual variability (same genetic background) and of environmental factors. Our results show that in first-calf heifers three CpG, located 10 kb upstream from the CSN1S1 gene were methylated to 33, 34 and 28%, respectively, after TDM but these levels were higher after ODM, 38, 38 and 33%, respectively. These methylation levels were much lower than those observed in the mammary gland during pregnancy (57, 59 and 50%, respectively) or in the liver (74, 78 and 61%, respectively). The methylation level of a fourth CpG (CpG4), located close by (29% during TDM) was not altered after ODM. CpG4 methylation reached 39.7% and 59.5%, during pregnancy or in the liver, respectively. CpG4 is located within a weak STAT5 binding element, arranged in tandem with a second high affinity STAT5 element. STAT5 binding is only marginally modulated by CpG4 methylation, but it may be altered by the methylation levels of the three other CpG nearby. Our results therefore shed light on mechanisms that help to explain how milk production is almost, but not fully, restored when TDM is resumed (15.1 ± 0.2 kg/day instead of 16.2 ± 0.2 kg/day, p<0.01). The STAT5 elements are 100 bp away from a region transcribed in the antisense orientation, in the mammary gland during lactation, but not during pregnancy or in other reproductive organs (ovary or testes). We now need to clarify whether the transcription of this novel RNA is a consequence of STAT5 interacting with the CSN1S1 distal region, or whether it plays a role in the chromatin structure of this region.
The influence of aging on the methylation status of brain-derived neurotrophic factor gene in blood.
Ihara, Kazushige; Fuchikami, Manabu; Hashizume, Masahiro; Okada, Satoshi; Kawai, Hisashi; Obuchi, Shuichi; Hirano, Hirohiko; Fujiwara, Yoshinori; Hachisu, Mitsugu; Hongyong, Kim; Morinobu, Shigeru
2018-06-28
Brain-derived neurotrophic factor (BDNF) is involved in the pathophysiology of psychiatric disorders in adults and elderly individuals, and as a result, the DNA methylation (DNAm) of the BDNF gene in peripheral tissues including blood has been extensively examined to develop a useful biomarker for psychiatric disorders. However, studies to date have not previously investigated the effect of age on DNAm of the BDNF gene in blood. In this context, we measured DNAm of 39 CpG units in the CpG island at the promoter of exon I of the BDNF gene. We analyzed genomic DNA from peripheral blood of 105 health Japanese women 20 to 80 years of age to identify aging-associated change in DNAm of the BDNF gene. In addition, we examined the relationship between total MMSE scores, numbers of stressful life events, and serum BDNF levels on DNAm of the BDNF gene. The DNAm rate at each CpG unit was measured using a MassArray ® system (Agena Bioscience), and serum BDNF levels were measured by ELISA. There was a significant correlation between DNAm and age in 13 CpGs. However, there was no significant correlation between DNAm and total MMSE scores, numbers of life events, or serum BDNF levels. Despite the small number of subjects and the inclusion of only female subjects, our results suggest that DNAm of 13 CpGs of the BDNF gene may be an appropriate biomarker for aging and useful for predicting increased susceptibility to age-related psychiatric disorders. © 2018 John Wiley & Sons, Ltd.
New Approaches for Prostate Cancer Combination Therapy
2009-04-01
promoter methylation have been frequently observed in several types of human cancer (60, 61). In conclusion, the ability of NSAIDs to induce apoptosis...drug. Clin Pharmacokinet 1999; 36:115–26. 31. Yin MJ, Yamamoto Y, Gaynor RB. The anti- inflammatory agents aspirin and salicylate inhibit the activity...expression of the growth inhibitory gene GADD45g, in human pituitary adenomas, is asso- ciated with CpG island methylation . Oncogene 2004;23: 936–44. 61
Comparative Analyses of DNA Methylation and Sequence Evolution Using Nasonia Genomes
Park, Jungsun; Peng, Zuogang; Zeng, Jia; Elango, Navin; Park, Taesung; Wheeler, Dave; Werren, John H.; Yi, Soojin V.
2011-01-01
The functional and evolutionary significance of DNA methylation in insect genomes remains to be resolved. Nasonia is well situated for comparative analyses of DNA methylation and genome evolution, since the genomes of a moderately distant outgroup species as well as closely related sibling species are available. Using direct sequencing of bisulfite-converted DNA, we uncovered a substantial level of DNA methylation in 17 of 18 Nasonia vitripennis genes and a strong correlation between methylation level and CpG depletion. Notably, in the sex-determining locus transformer, the exon that is alternatively spliced between the sexes is heavily methylated in both males and females, whereas other exons are only sparsely methylated. Orthologous genes of the honeybee and Nasonia show highly similar relative levels of CpG depletion, despite ∼190 My divergence. Densely and sparsely methylated genes in these species also exhibit similar functional enrichments. We found that the degree of CpG depletion is negatively correlated with substitution rates between closely related Nasonia species for synonymous, nonsynonymous, and intron sites. This suggests that mutation rates increase with decreasing levels of germ line methylation. Thus, DNA methylation is prevalent in the Nasonia genome, may participate in regulatory processes such as sex determination and alternative splicing, and is correlated with several aspects of genome and sequence evolution. PMID:21693438
Dai, Wei; Siddiq, Afshan; Walley, Andrew J; Limpaiboon, Temduang; Brown, Robert
2013-01-01
Genetic abnormalities of cholangiocarcinoma have been widely studied; however, epigenomic changes related to cholangiocarcinogenesis have been less well characterised. We have profiled the DNA methylomes of 28 primary cholangiocarcinoma and six matched adjacent normal tissues using Infinium’s HumanMethylation27 BeadChips with the aim of identifying gene sets aberrantly epigenetically regulated in this tumour type. Using a linear model for microarray data we identified 1610 differentially methylated autosomal CpG sites with 809 CpG sites (representing 603 genes) being hypermethylated and 801 CpG sites (representing 712 genes) being hypomethylated in cholangiocarcinoma versus adjacent normal tissues (false discovery rate ≤ 0.05). Gene ontology and gene set enrichment analyses identified gene sets significantly associated with hypermethylation at linked CpG sites in cholangiocarcinoma including homeobox genes and target genes of PRC2, EED, SUZ12 and histone H3 trimethylation at lysine 27. We confirmed frequent hypermethylation at the homeobox genes HOXA9 and HOXD9 by bisulfite pyrosequencing in a larger cohort of cholangiocarcinoma (n = 102). Our findings indicate a key role for hypermethylation of multiple CpG sites at genes associated with a stem cell-like phenotype as a common molecular aberration in cholangiocarcinoma. These data have implications for cholangiocarcinogenesis, as well as possible novel treatment options using histone methyltransferase inhibitors. PMID:24089088
Kim, Youl-Ri; Kim, Jeong-Hyun; Kim, Mi Jeong; Treasure, Janet
2014-01-01
Recent studies in patients with anorexia nervosa suggest that oxytocin may be involved in the pathophysiology of anorexia nervosa. We examined whether there was evidence of variation in methylation status of the oxytocin receptor (OXTR) gene in patients with anorexia nervosa that might account for these findings. We analyzed the methylation status of the CpG sites in a region from the exon 1 to the MT2 regions of the OXTR gene in buccal cells from 15 patients and 36 healthy women using bisulfite sequencing. We further examined whether methylation status was associated with markers of illness severity or form. We identified six CpG sites with significant differences in average methylation levels between the patient and control groups. Among the six differentially methylated CpG sites, five showed higher than average methylation levels in patients than those in the control group (64.9-88.8% vs. 6.6-45.0%). The methylation levels of these five CpG sites were negatively associated with body mass index (BMI). BMI, eating disorders psychopathology, and anxiety were identified in a regression analysis as factors affecting the methylation levels of these CpG sites with more variation accounted for by BMI. Epigenetic misregulation of the OXTR gene may be implicated in anorexia nervosa, which may either be a mechanism linking environmental adversity to risk or may be a secondary consequence of the illness.
The influence of providing a clinical practice guideline on dental students' decision making.
van der Sanden, Wil J M; Mettes, Dirk G; Plasschaert, Alphons J M; Mulder, Jan; Verdonschot, Emiel H
2004-02-01
The aim of this study was to assess the effect of the provision of a clinical practice guideline (CPG) on dental students' decisions to remove asymptomatic, impacted lower third molars. All dental students, who in 2001 were in the 3rd, 4th or 5th (final) year of their study at the Nijmegen College of Dental Sciences, were invited to participate. A pre-test-post-test control group design was used. Given 36 patient cases, all dental students were asked to assess the need for removal of asymptomatic, impacted lower third molars. All pre-test respondents were randomly allocated to the control or intervention group. After the provision of a CPG to the intervention group, both groups were asked to assess the same cases again. Frequencies of decisions to remove the third molars were calculated. Chi-square tests and anova were used to test the influence of study year and gender on the drop-out rate and on the effect of the provision of a CPG on students' treatment decisions. The decrease in indications to remove third molars by the intervention group was statistically significant (P < 0.05). In the control group, no significant decrease was observed. It was concluded that the provision of a CPG significantly influences dental students' decision making about treatment in a third-molar decision task. Students who used the CPG showed more guideline-conformed decision making.
Magiri, R B; Lai, K; Chaffey, A M; Wilson, H L; Berry, W E; Szafron, M L; Mutwiri, G K
2016-07-01
Understanding the mechanisms by which adjuvants mediate their effects provide critical information on how innate immunity influences the development of adaptive immunity. Despite being a critical vaccine component, the mechanisms by which adjuvants mediate their effects are not fully understood and this is especially true when they are used in large animals. This lack of understanding limits our ability to design effective vaccines. In the present study, we administered polyphosphazene (PCEP), CpG oligodeoxynucleotides (CpG), emulsigen or saline via an intradermal injection into pigs and assessed the impact on the expression of reported 'adjuvant response genes' over time. CpG induced a strong upregulation of the chemokine CXL10 several 'Interferon Response Genes', as well as TNFα, and IL-10, and a down-regulation of IL-17 genes. Emulsigen upregulated expression of chemokines CCL2 and CCL5, proinflammatory cytokines IL-6 and TNFα, as well as TLR9, and several IFN response genes. PCEP induced the expression of chemokine CCL2 and proinflammatory cytokine IL-6. These results suggest that emulsigen and CpG may promote recruitment of innate immune cells and Th1 type cytokine production but that PCEP may promote a Th-2 type immune response through the induction of IL-6, an inducer of B cell activity and differentiation. Copyright © 2016 Elsevier B.V. All rights reserved.
Traub, Roger D.; Whittington, Miles A.; Hall, Stephen P.
2017-01-01
Rhythmic motor patterns in invertebrates are often driven by specialized “central pattern generators” (CPGs), containing small numbers of neurons, which are likely to be “identifiable” in one individual compared with another. The dynamics of any particular CPG lies under the control of modulatory substances, amines, or peptides, entering the CPG from outside it, or released by internal constituent neurons; consequently, a particular CPG can generate a given rhythm at different frequencies and amplitudes, and perhaps even generate a repertoire of distinctive patterns. The mechanisms exploited by neuromodulators in this respect are manifold: Intrinsic conductances (e.g., calcium, potassium channels), conductance state of postsynaptic receptors, degree of plasticity, and magnitude and kinetics of transmitter release can all be affected. The CPG concept has been generalized to vertebrate motor pattern generating circuits (e.g., for locomotion), which may contain large numbers of neurons – a construct that is sensible, if there is enough redundancy: that is, the large number of neurons consists of only a small number of classes, and the cells within any one class act stereotypically. Here we suggest that CPG and modulator ideas may also help to understand cortical oscillations, normal ones, and particularly transition to epileptiform pathology. Furthermore, in the case illustrated, the mechanism of the transition appears to be an exaggerated form of a normal modulatory action used to influence sensory processing. PMID:29093667
Sun, Z-B; Wang, J-W; Xiao, H; Zhang, Q-S; Kan, W-S; Mo, F-B; Hu, S; Ye, S-N
2015-01-01
In this study, we found out a previously undefined function of icariin which restored the dynamic balance between osteogenic and adipogenic differentiation of mesenchymal stem cells (MSCs) in patients with osteonecrosis of femoral head (ONFH) via ABCB1-promoter demethylation. These findings provided important information regarding potential implication of icariin targeting epigenetic changes for the treatment of steroid -associated ONFH. Here, we investigated whether icariin can also exert a beneficial role in the reactivation of MSCs in the patients with steroid-associated ONFH via ABCB1-promoter demethylation. Bone marrow was collected from the proximal femur in patients with steroid-associated ONFH (n = 20) and patients with new femoral neck fractures (n = 22), and then MSCs were isolated. We investigated cell viability, intracellular reactive oxygen species (ROS) level, mitochondrial membrane potential (MMP), P-glycoprotein (P-gp) activity, the transcript levels of ABCB1 and oxidative stress-related genes, methylation extent at CpG islands of ABCB1 promoter, and osteogenic and adipogenic differentiation ability of MSCs from the femoral neck fractures group and from the steroid-associated ONFH group treated with or without icariin. We observed that MSCs from the steroid-associated ONFH group showed reduced proliferation ability, elevated ROS level, depressed MMP, weakened osteogenesis, and enhanced adipogenesis while low P-gp activity, transcription level of ABCB1, and oxidative stress-related genes as well as aberrant CpG islands hypermethylation of ABCB1 were also noted in steroid-associated ONFH group. Treatment with icariin obviously induced de novo P-gp expression, decreased oxidative stress, and promoted osteogenesis. Icariin may be a potential drug targeting epigenetic changes for the treatment of steroid-associated ONFH.
Ceccarelli, Veronica; Valentini, Virginia; Ronchetti, Simona; Cannarile, Lorenza; Billi, Monia; Riccardi, Carlo; Ottini, Laura; Talesa, Vincenzo Nicola; Grignani, Francesco; Vecchini, Alba
2018-05-14
In cancer cells, global genomic hypomethylation is found together with localized hypermethylation of CpG islands within the promoters and regulatory regions of silenced tumor suppressor genes. Demethylating agents may reverse hypermethylation, thus promoting gene re-expression. Unfortunately, demethylating strategies are not efficient in solid tumor cells. DNA demethylation is mediated by ten-eleven translocation enzymes (TETs). They sequentially convert 5-methylcytosine (5mC) to 5-hydroxymethylcytosine (5hmC), which is associated with active transcription; 5-formylcytosine; and finally, 5-carboxylcytosine. Although α-linolenic acid, eicosapentaenoic acid (EPA), and docosahexaenoic acid, the major n-3 polyunsaturated fatty acids, have anti-cancer effects, their action, as DNA-demethylating agents, has never been investigated in solid tumor cells. Here, we report that EPA demethylates DNA in hepatocarcinoma cells. EPA rapidly increases 5hmC on DNA, inducing p21 Waf1/Cip1 gene expression, which slows cancer cell-cycle progression. We show that the underlying molecular mechanism involves TET1. EPA simultaneously binds peroxisome proliferator-activated receptor γ (PPARγ) and retinoid X receptor α (RXRα), thus promoting their heterodimer and inducing a PPARγ-TET1 interaction. They generate a TET1-PPARγ-RXRα protein complex, which binds to a hypermethylated CpG island on the p21 gene, where TET1 converts 5mC to 5hmC. In an apparent shuttling motion, PPARγ and RXRα leave the DNA, whereas TET1 associates stably. Overall, EPA directly regulates DNA methylation levels, permitting TET1 to exert its anti-tumoral function.-Ceccarelli, V., Valentini, V., Ronchetti, S., Cannarile, L., Billi, M., Riccardi, C., Ottini, L., Talesa, V. N., Grignani, F., Vecchini, A., Eicosapentaenoic acid induces DNA demethylation in carcinoma cells through a TET1-dependent mechanism.
Tran, Stella; Wang, Ying; Lamba, Pankaj; Zhou, Xiang; Boehm, Ulrich; Bernard, Daniel J.
2013-01-01
Forkhead box L2 (Foxl2), a member of the forkhead transcription factor family, plays important roles in pituitary follicle-stimulating hormone synthesis and in ovarian maintenance and function. Mutations in the human FOXL2 gene cause eyelid malformations and premature ovarian failure. FOXL2/Foxl2 is expressed in pituitary gonadotrope and thyrotrope cells, the perioptic mesenchyme of the developing eyelid, and ovarian granulosa cells. The mechanisms governing this cell-restricted expression have not been described. We mapped the Foxl2 transcriptional start site in immortalized murine gonadotrope-like cells, LβT2, by 5’ rapid amplification of cDNA ends and then PCR amplified approximately 1 kb of 5’ flanking sequence from murine genomic DNA. When ligated into a reporter plasmid, the proximal promoter conferred luciferase activity in both homologous (LβT2) and, unexpectedly, heterologous (NIH3T3) cells. In silico analyses identified a CpG island in the proximal promoter and 5’ untranslated region, suggesting that Foxl2 transcription might be regulated epigenetically. Indeed, pyrosequencing and quantitative analysis of DNA methylation using real-time PCR revealed Foxl2 proximal promoter hypomethylation in homologous compared to some, though not all, heterologous cell lines. The promoter was also hypomethylated in purified murine gonadotropes. In vitro promoter methylation completely silenced reporter activity in heterologous and homologous cells. Collectively, the data suggest that differential proximal promoter DNA methylation may contribute to cell-specific Foxl2 expression in some cellular contexts. However, gonadotrope-specific expression of the gene cannot be explained by promoter hypomethylation alone. PMID:24098544
Aberrant DNA methylation of miR-219 promoter in long-term night shiftworkers.
Shi, Fengqin; Chen, Xinyi; Fu, Alan; Hansen, Johnni; Stevens, Richard; Tjonneland, Anne; Vogel, Ulla B; Zheng, Tongzhang; Zhu, Yong
2013-07-01
The idea that shiftwork may be carcinogenic in humans has gained widespread attention since the pioneering work linking shiftwork to breast cancer over two decades ago. However, the biomolecular consequences of long-term shiftwork exposure have not been fully explored. In this study, we performed a genome-wide CpG island methylation assay of microRNA (miRNA) promoters in long-term night shiftworkers and day workers. This analysis indicated that 50 CpG loci corresponding to 31 miRNAs were differentially methylated in night shiftworkers compared to day workers, including the circadian-relevant miR-219, the expression of which has been implicated in several cancers. A genome-wide expression microarray assay was carried out in a miR-219-overexpressed MCF-7 breast cancer cell line, which identified 319 differentially expressed transcripts. The identified transcriptional targets were analyzed for network and functional interrelatedness using the Ingenuity Pathway Analysis (IPA) software. Overexpression of miR-219 in MCF-7 breast cancer cells resulted in accentuated expression of apoptosis- and proliferation-related anti-viral immunodulators of the Jak-STAT and NF-κβ pathways. These findings suggest that long-term night shiftwork exposure may lead to the methylation-dependent downregulation of miR-219, which may in turn lead to the downregulation of immunomediated antitumor activity and increased breast cancer risk. © 2013 Wiley Periodicals, Inc.
The Spanish Neurological Society official clinical practice guidelines in epilepsy.
Mercadé Cerdá, J M; Toledo Argani, M; Mauri Llerda, J A; López Gonzalez, F J; Salas Puig, X; Sancho Rieger, J
2016-03-01
Previous Official Clinical Practice Guidelines (CPGs) in Epilepsy were based on expert opinions and developed by the Epilepsy Study Group of the Spanish Neurological Society (GE-SEN). The current CPG in epilepsy is based on the scientific method, which extracts recommendations from published scientific evidence. A reduction in the variability in clinical practice through standardization of medical practice has become its main function. This CPG is focused on comprehensive care for individuals affected by epilepsy as a primary and predominant symptom, regardless of the age of onset and medical policy. 1. Creation of GE-SEN neurologists working group, in collaboration with Neuropediatricians, Neurophysiologists and Neuroradiologists. 2. Identification of clinical areas to be covered: diagnosis, prognosis and treatment. 3. Search and selection of the relevant scientific evidence. 4. Formulation of recommendations based on the classification of the available scientific evidence. It contains 161 recommendations of which 57% are consensus between authors and publishers, due to an important lack of awareness in many fields of this pathology. This Epilepsy CPG formulates recommendations based on explicit scientific evidence as a result of a formal and rigorous methodology, according to the current knowledge in the pre-selected areas. This paper includes the CPG chapter dedicated to emergency situations in seizures and epilepsy, which may present as a first seizure, an unfavorable outcome in a patient with known epilepsy, or status epilepticus as the most severe manifestation. Copyright © 2013 Sociedad Española de Neurología. Published by Elsevier España, S.L.U. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Palsamy, Periyasamy; Ayaki, Masahiko; Elanchezhian, Rajan
Highlights: Black-Right-Pointing-Pointer We found significant Keap1 promoter demethylation in diabetic cataractous lenses. Black-Right-Pointing-Pointer Demethylation of Keap1 gene upregulated the expression of Keap1 mRNA and protein. Black-Right-Pointing-Pointer Elevated levels of Keap1 are known to decrease the levels of Nrf2. Black-Right-Pointing-Pointer Thereby, the levels of antioxidant enzymes are suppressed by decreased Nrf2 level. -- Abstract: Age-related cataracts (ARCs) are the major cause of visual impairments worldwide, and diabetic adults tend to have an earlier onset of ARCs. Although age is the strongest risk factor for cataracts, little is known how age plays a role in the development of ARCs. It is knownmore » that oxidative stress in the lens increases with age and more so in the lenses of diabetics. One of the central adaptive responses against the oxidative stresses is the activation of the nuclear transcriptional factor, NF-E2-related factor 2 (Nrf2), which then activates more than 20 different antioxidative enzymes. Kelch-like ECH associated protein 1 (Keap1) targets and binds to Nrf2 for proteosomal degradation. We hypothesized that hyperglycemia will lead to a dysfunction of the Nrf2-dependent antioxidative protection in the lens of diabetics. We studied the methylation status of the CpG islands in 15 clear and 21 diabetic cataractous lenses. Our results showed significant levels of demethylated DNA in the Keap1 promoter in the cataractous lenses from diabetic patients. In contrast, highly methylated DNA was found in the clear lens and tumorized human lens epithelial cell (HLEC) lines (SRA01/04). HLECs treated with a demethylation agent, 5-aza-2 Prime deoxycytidine (5-Aza), had a 10-fold higher levels of Keap1 mRNA, 3-fold increased levels of Keap1 protein, produced higher levels of ROS, and increased cell death. Our results indicated that demethylation of the CpG islands in the Keap1 promoter will activate the expression of Keap1 protein, which then increases the targeting of Nrf2 for proteosomal degradation. Decreased Nrf2 activity represses the transcription of many antioxidant enzyme genes and alters the redox-balance towards lens oxidation. Thus, the failure of antioxidant protection due to demethylation of the CpG islands in the Keap1 promoter is linked to the diabetic cataracts and possibly ARCs.« less
Overman, M J; Adam, L; Raghav, K; Wang, J; Kee, B; Fogelman, D; Eng, C; Vilar, E; Shroff, R; Dasari, A; Wolff, R; Morris, J; Karunasena, E; Pisanic, R; Azad, N; Kopetz, S
2018-01-01
Hypermethylation of promoter CpG islands [CpG island methylator phenotype (CIMP)] represents a unique pathway for the development of colorectal cancer (CRC), characterized by lack of chromosomal instability and a low rate of adenomatous polyposis coli (APC) mutations, which have both been correlated with taxane resistance. Similarly, small bowel adenocarcinoma (SBA), a rare tumor, also has a low rate of APC mutations. This phase II study evaluated taxane sensitivity in SBA and CIMP-high CRC. The primary objective was Response Evaluation Criteria in Solid Tumors version 1.1 response rate. Eligibility included Eastern Cooperative Oncology Group performance status 0/1, refractory disease, and SBA or CIMP-high metastatic CRC. Nab-paclitaxel was initially administered at a dose of 260 mg/m2 every 3 weeks but was reduced to 220 mg/m2 owing to toxicity. A total of 21 patients with CIMP-high CRC and 13 with SBA were enrolled from November 2012 to October 2014. The efficacy-assessable population (patients who received at least three doses of the treatment) comprised 15 CIMP-high CRC patients and 10 SBA patients. Common grade 3 or 4 toxicities were fatigue (12%), neutropenia (9%), febrile neutropenia (9%), dehydration (6%), and thrombocytopenia (6%). No responses were seen in the CIMP-high CRC cohort and two partial responses were seen in the SBA cohort. Median progression-free survival was significantly greater in the SBA cohort than in the CIMP-high CRC cohort (3.2 months compared with 2.1 months, P = 0.03). Neither APC mutation status nor CHFR methylation status correlated with efficacy in the CIMP-high CRC cohort. In vivo testing of paclitaxel in an SBA patient-derived xenograft validated the activity of taxanes in this disease type. Although preclinical studies suggested taxane sensitivity was associated with chromosomal stability and wild-type APC, we found that nab-paclitaxel was inactive in CIMP-high metastatic CRC. Nab-paclitaxel may represent a novel therapeutic option for SBA. © The Author 2017. Published by Oxford University Press on behalf of the European Society for Medical Oncology. All rights reserved. For permissions, please email: journals.permissions@oup.com.
Ibrahim, Ashraf E K; Arends, Mark J; Silva, Ana-Luisa; Wyllie, Andrew H; Greger, Liliana; Ito, Yoko; Vowler, Sarah L; Huang, Tim H-M; Tavaré, Simon; Murrell, Adele; Brenton, James D
2011-04-01
Although aberrant methylation of key genes in the progression of colorectal neoplasia has been reported, no model-based analysis of the incremental changes through the intermediate adenoma stage has been described. In addition, the biological drivers for these methylation changes have yet to be defined. Linear mixed-effects modelling was used in this study to understand the onset and patterns of the methylation changes of SFRP2, IGF2 DMR0, H19, LINE-1 and a CpG island methylator phenotype (CIMP) marker panel, and they were correlated with DNA methyltransferase 3B (DNMT3B) levels of expression in a sample set representative of colorectal neoplastic progression. Methylation of the above CpG islands was measured using quantitative pyrosequencing assays in 261 tissue samples. This included a prospective collection of 44 colectomy specimens with concurrent normal mucosa, adenoma and invasive cancer tissues. Tissue microarrays from a subset of 64 cases were used for immunohistochemical analysis of DNMT3B expression. It is shown that the onset and pattern of methylation changes during colorectal neoplastic progression are locus dependent. The CIMP marker RUNX3 was the earliest CpG island showing significant change, followed by the CIMP markers NEUROG1 and CACNA1G at the hyperplastic polyp stage. SFRP2 and IGF2 DMR0 showed significant methylation changes at the adenomatous polyp stage, followed by the CIMP markers CDKN2A and hMLH1 at the adenocarcinoma stage. DNMT3B levels of immunohistochemical expression increased significantly (p < 0.001) from normal to hyperplastic and from adenomatous polyps to carcinoma samples. DNMT3B expression correlated positively with SFRP2 methylation (r = 0.42, p < 0.001, 95% CI 0.25 to 0.56), but correlated negatively with IGF2 DMR0 methylation (r = 0.26, p = 0.01, 95% CI -0.45 to -0.05). A subset of the CIMP panel (NEUROG1, CACNA1G and CDKN2A) positively correlated with DNMT3B levels of expression (p < 0.05). Hierarchical epigenetic alterations occur at transition points during colorectal neoplastic progression. These cumulative changes are closely correlated with a gain of DNMT3B expression, suggesting a causal relationship.
PISMA: A Visual Representation of Motif Distribution in DNA Sequences.
Alcántara-Silva, Rogelio; Alvarado-Hermida, Moisés; Díaz-Contreras, Gibrán; Sánchez-Barrios, Martha; Carrera, Samantha; Galván, Silvia Carolina
2017-01-01
Because the graphical presentation and analysis of motif distribution can provide insights for experimental hypothesis, PISMA aims at identifying motifs on DNA sequences, counting and showing them graphically. The motif length ranges from 2 to 10 bases, and the DNA sequences range up to 10 kb. The motif distribution is shown as a bar-code-like, as a gene-map-like, and as a transcript scheme. We obtained graphical schemes of the CpG site distribution from 91 human papillomavirus genomes. Also, we present 2 analyses: one of DNA motifs associated with either methylation-resistant or methylation-sensitive CpG islands and another analysis of motifs associated with exosome RNA secretion. PISMA is developed in Java; it is executable in any type of hardware and in diverse operating systems. PISMA is freely available to noncommercial users. The English version and the User Manual are provided in Supplementary Files 1 and 2, and a Spanish version is available at www.biomedicas.unam.mx/wp-content/software/pisma.zip and www.biomedicas.unam.mx/wp-content/pdf/manual/pisma.pdf.
DNA Methylation Errors in Cloned Mouse Sperm by Germ Line Barrier Evasion.
Koike, Tasuku; Wakai, Takuya; Jincho, Yuko; Sakashita, Akihiko; Kobayashi, Hisato; Mizutani, Eiji; Wakayama, Sayaka; Miura, Fumihito; Ito, Takashi; Kono, Tomohiro
2016-06-01
The germ line reprogramming barrier resets parental epigenetic modifications according to sex, conferring totipotency to mammalian embryos upon fertilization. However, it is not known whether epigenetic errors are committed during germ line reprogramming that are then transmitted to germ cells, and consequently to offspring. We addressed this question in the present study by performing a genome-wide DNA methylation analysis using a target postbisulfite sequencing method in order to identify DNA methylation errors in cloned mouse sperm. The sperm genomes of two somatic cell-cloned mice (CL1 and CL7) contained significantly higher numbers of differentially methylated CpG sites (P = 0.0045 and P = 0.0116). As a result, they had higher numbers of differentially methylated CpG islands. However, there was no evidence that these sites were transmitted to the sperm genome of offspring. These results suggest that DNA methylation errors resulting from embryo cloning are transmitted to the sperm genome by evading the germ line reprogramming barrier. © 2016 by the Society for the Study of Reproduction, Inc.
Bunker, Suresh Kumar; Dandapat, Jagneshwar; Sahoo, Sunil Kumar; Roy, Anita; Chainy, Gagan B N
2016-02-01
Persistent exposure of rats to 6-propyl-2-thiouracil (PTU) from birth resulted in decreases in plasma thyroid hormone (TH) levels and hepatic expression of catalase and CCAAT enhancer binding protein β (C/EBP-β). Catalase promoter region (-185 to +52) that contains binding sites for C/EBP-β showed an augmentation in the methylation level along with a change in methylation pattern of CpG islands in response to PTU treatment. PTU withdrawal on 30 days of birth restored TH levels and C/EBP-β to control rats in adulthood. Although catalase expression was restored to some extent in adult rats in response to PTU withdrawal, a permanent change in its promoter CpG methylation pattern was recorded. The results suggest that downregulation of adult hepatic catalase gene in response to persistent neonatal PTU exposure may not solely be attributed to thyroid-disrupting properties of PTU. It is possible that besides thyroid-disrupting behavior, PTU may impair expression of hepatic catalase by altering methylation pattern of its promoter. © 2015 Wiley Periodicals, Inc.
Fischer, Alexandra; Gaedicke, Sonja; Frank, Jan; Döring, Frank; Rimbach, Gerald
2010-10-01
The aim of the present study was to determine the effects of a 6-month dietary vitamin E (VE) deficiency on DNA methylation and gene expression in rat liver. Two enzymes, 5-α-steroid reductase type 1 (SRD5A1) and the regulatory subunit of γ-glutamylcysteinyl synthetase (GCLM), which are differentially expressed on the mRNA level, were analysed for promoter methylation in putative cytosine-phospho-guanine (CpG) island regions located at the 5' end using base-specific cleavage and matrix-assisted laser desorption ionisation time-of-flight MS. A twofold increase in the mRNA level of SRD5A1 gene and a twofold decrease in the mRNA level of GCLM gene in VE-deficient animals were not associated with different CpG methylation of the analysed promoter region. Furthermore, global DNA methylation was not significantly different in these two groups. Thus, the present results indicate that the VE-induced regulation of SRD5A1 and GCLM in rat liver is not directly mediated by changes in promoter DNA methylation.
Stern, Josh Lewis; Paucek, Richard D; Huang, Franklin W; Ghandi, Mahmoud; Nwumeh, Ronald; Costello, James C; Cech, Thomas R
2017-12-26
A mutation in the promoter of the Telomerase Reverse Transcriptase (TERT) gene is the most frequent noncoding mutation in cancer. The mutation drives unusual monoallelic expression of TERT, allowing immortalization. Here, we find that DNA methylation of the TERT CpG island (CGI) is also allele-specific in multiple cancers. The expressed allele is hypomethylated, which is opposite to cancers without TERT promoter mutations. The continued presence of Polycomb repressive complex 2 (PRC2) on the inactive allele suggests that histone marks of repressed chromatin may be causally linked to high DNA methylation. Consistent with this hypothesis, TERT promoter DNA containing 5-methyl-CpG has much increased affinity for PRC2 in vitro. Thus, CpG methylation and histone marks appear to collaborate to maintain the two TERT alleles in different epigenetic states in TERT promoter mutant cancers. Finally, in several cancers, DNA methylation levels at the TERT CGI correlate with altered patient survival. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.
PISMA: A Visual Representation of Motif Distribution in DNA Sequences
Alcántara-Silva, Rogelio; Alvarado-Hermida, Moisés; Díaz-Contreras, Gibrán; Sánchez-Barrios, Martha; Carrera, Samantha; Galván, Silvia Carolina
2017-01-01
Background: Because the graphical presentation and analysis of motif distribution can provide insights for experimental hypothesis, PISMA aims at identifying motifs on DNA sequences, counting and showing them graphically. The motif length ranges from 2 to 10 bases, and the DNA sequences range up to 10 kb. The motif distribution is shown as a bar-code–like, as a gene-map–like, and as a transcript scheme. Results: We obtained graphical schemes of the CpG site distribution from 91 human papillomavirus genomes. Also, we present 2 analyses: one of DNA motifs associated with either methylation-resistant or methylation-sensitive CpG islands and another analysis of motifs associated with exosome RNA secretion. Availability and Implementation: PISMA is developed in Java; it is executable in any type of hardware and in diverse operating systems. PISMA is freely available to noncommercial users. The English version and the User Manual are provided in Supplementary Files 1 and 2, and a Spanish version is available at www.biomedicas.unam.mx/wp-content/software/pisma.zip and www.biomedicas.unam.mx/wp-content/pdf/manual/pisma.pdf. PMID:28469418
Immunoregulation of GVHD by triggering the innate immune system with CpG.
Morecki, Shoshana; Slavin, Shimon
2009-08-01
Stimulation of Toll-like receptors by oligodeoxynucleotide sequences containing a CpG motif provides signals capable of triggering the innate and adaptive immune systems, thereby leading either to stimulation or suppression of immunoreactivities. Similar immunoregulatory capabilities are necessary for achieving the fine balance between engraftment and graft-versus-host disease required in the setup of allogeneic cell therapy. Ligation of CpG to its Toll-like receptors can be accomplished by treatment of the host or pretransplant treatment of the donor in vivo. These different strategies are presented in this review, which summarizes the attempts to maximize beneficial alloreactivity against malignant or other undesirable host cells, while controlling graft-versus-host disease.
László, Brigitta; Ferenczi, Annamária; Madar, László; Gyöngyösi, Eszter; Szalmás, Anita; Szakács, Levente; Veress, György; Kónya, József
2016-08-01
The mechanisms that regulate papillomavirus gene expression include DNA methylation. The transcription of papillomavirus oncogenes E6 and E7 is controlled by certain regulatory elements in the LCR, which include binding sites for the E2 protein, a viral regulator of oncogene expression. In HPV-31-infected exfoliated cervical cells, the CpG methylation of the entire LCR was determined by next-generation sequencing after bisulfite modification. Six of the 22 cases had methylated CpG sites in the HPV-31 LCR, including position 7479 and/or 7485, at the promoter distal E2 binding site, thus suggesting a potential regulatory mechanism for papillomavirus transcription.
Understanding the relationship between DNA methylation and histone lysine methylation☆
Rose, Nathan R.; Klose, Robert J.
2014-01-01
DNA methylation acts as an epigenetic modification in vertebrate DNA. Recently it has become clear that the DNA and histone lysine methylation systems are highly interrelated and rely mechanistically on each other for normal chromatin function in vivo. Here we examine some of the functional links between these systems, with a particular focus on several recent discoveries suggesting how lysine methylation may help to target DNA methylation during development, and vice versa. In addition, the emerging role of non-methylated DNA found in CpG islands in defining histone lysine methylation profiles at gene regulatory elements will be discussed in the context of gene regulation. This article is part of a Special Issue entitled: Methylation: A Multifaceted Modification — looking at transcription and beyond. PMID:24560929
Coleman, M P; Németh, A H; Campbell, L; Raut, C P; Weissenbach, J; Davies, K E
1994-05-15
The genes ARAF1, SYN1, TIMP, and PFC are clustered within 70 kb of one another, and, as reported in the accompanying paper (J. Knight et al., 1994, Genomics 21: 180-187), at least four more genes map within 400 kb: a cluster of Krüppel-type zinc finger genes (including ZNF21, ZNF41, and ZNF81) and ELK-1, a member of the ets oncogene superfamily. This gene-rich region is of particular interest because of the large number of disease genes mapping to Xp11.23: at least three eye diseases (retinitis pigmentosa type 2, congenital stationary night blindness CSNB1, and Aland Island eye disease), Wiskott-Aldrich syndrome, X-linked nephrolithiasis, and a translocation breakpoint associated with synovial sarcoma. We have constructed a 1.8-Mb YAC contig in this region, confirming the link between TIMP and OATL1 reported by Knight et al. (1994) and extending the map in the distal direction. To investigate the likelihood that more genes are located within this region, we have carried out detailed mapping of rare-cutter restriction sites in these YACs and identified seven CpG islands. At least six of these islands are located over 50 kb from any known gene locations, suggesting that the region contains at least this many as yet unidentified genes. We have also mapped the physical locations of six highly polymorphic CA repeats within the contig, thus integrating the physical, genetic, and transcriptional maps of the region and facilitating the mapping and identification of disease genes.(ABSTRACT TRUNCATED AT 250 WORDS)
Suijker, Johnny; Oosting, Jan; Koornneef, Annemarie; Struys, Eduard A; Salomons, Gajja S; Schaap, Frank G; Waaijer, Cathelijn J F; Wijers-Koster, Pauline M; Briaire-de Bruijn, Inge H; Haazen, Lizette; Riester, Scott M; Dudakovic, Amel; Danen, Erik; Cleton-Jansen, Anne-Marie; van Wijnen, Andre J; Bovée, Judith V M G
2015-05-20
Mutations in isocitrate dehydrogenase 1 (IDH1) and IDH2 are found in a subset of benign and malignant cartilage tumors, gliomas and leukaemias. The mutant enzyme causes the production of D-2-hydroxyglutarate (D-2-HG), affecting CpG island and histone methylation. While mutations in IDH1/2 are early events in benign cartilage tumors, we evaluated whether these mutations play a role in malignant chondrosarcomas. Compared to IDH1/2 wildtype cell lines, chondrosarcoma cell lines harboring an endogenous IDH1 (n=3) or IDH2 mutation (n=2) showed up to a 100-fold increase in intracellular and extracellular D-2-HG levels. Specific inhibition of mutant IDH1 using AGI-5198 decreased levels of D-2-HG in a dose dependent manner. After 72 hours of treatment one out of three mutant IDH1 cell lines showed a moderate decrease in viability , while D-2-HG levels decreased >90%. Likewise, prolonged treatment (up to 20 passages) did not affect proliferation and migration. Furthermore, global gene expression, CpG island methylation as well as histone H3K4, -9, and -27 trimethylation levels remained unchanged. Thus, while IDH1/2 mutations cause enchondroma, malignant progression towards central chondrosarcoma renders chondrosarcoma growth independent of these mutations. Thus, monotherapy based on inhibition of mutant IDH1 appears insufficient for treatment of inoperable or metastasized chondrosarcoma patients.
Procainamide Is a Specific Inhibitor of DNA Methyltransferase 1*
Lee, Byron H.; Yegnasubramanian, Srinivasan; Lin, Xiaohui; Nelson, William G.
2007-01-01
CpG island hypermethylation occurs in most cases of cancer, typically resulting in the transcriptional silencing of critical cancer genes. Procainamide has been shown to inhibit DNA methyltransferase activity and reactivate silenced gene expression in cancer cells by reversing CpG island hypermethylation. We report here that procainamide specifically inhibits the hemimethylase activity of DNA methyltransferase 1 (DNMT1), the mammalian enzyme thought to be responsible for maintaining DNA methylation patterns during replication. At micromolar concentrations, procainamide was found to be a partial competitive inhibitor of DNMT1, reducing the affinity of the enzyme for its two substrates, hemimethylated DNA and S-adenosyl-l-methionine. By doing so, procainamide significantly decreased the processivity of DNMT1 on hemimethylated DNA. Procainamide was not a potent inhibitor of the de novo methyltransferases DNMT3a and DNMT3b2. As further evidence of the specificity of procainamide for DNMT1, procainamide failed to lower genomic 5-methyl-2′-deoxycytidine levels in HCT116 colorectal cancer cells when DNMT1 was genetically deleted but significantly reduced genomic 5-methyl-2′-deoxycyti-dine content in parental HCT116 cells and in HCT116 cells where DNMT3b was genetically deleted. Because many reports have strongly linked DNMT1 with epigenetic alterations in carcinogenesis, procainamide may be a useful drug in the prevention of cancer. PMID:16230360
2010-01-01
Background CpG island methylator phenotype (CIMP), in which multiple genes concordantly methylated, has been demonstrated to be associated with progression, recurrence, as well as overall survival in some types of cancer. Methods We examined the promoter methylation status of seven genes including P16, CDH1, GSTP1, DAPK, XAF1, SOCS1 and SYK in 65 cases of HCC treated with LT by methylation-specific PCR. CIMP+ was defined as having three or more genes that are concordantly methylated. The relationship between CIMP status and clinicopathological parameters, as well as tumor recurrence was further analyzed. Results CIMP+ was more frequent in HCC with AFP > 400 ng/ml than those with AFP ≤ 400 ng/ml (P = 0.017). In addition, patients with CIMP+ were prone to have multiple tumor numbers than those with CIMP- (P = 0.007). Patients with CIMP+ tumors had significantly worse recurrence-free survival (RFS) than patients with CIMP-tumors by Kaplan-Meier estimates (P = 0.004). Multivariate analysis also revealed that CIMP status might be a novel independent prognostic factor of RFS for HCC patients treated with LT (HR: 3.581; 95% CI: 1.473-8.710, P = 0.005). Conclusion Our results suggested that CIMP could serve as a new prognostic biomarker to predict the risk of tumor recurrence in HCC after transplantation. PMID:20678188
Induction of anti-aging gene klotho with a small chemical compound that demethylates CpG islands
Jung, Dongju; Xu, Yuechi; Sun, Zhongjie
2017-01-01
Klotho (KL) is described as an anti-aging gene because mutation of Kl gene leads to multiple pre-mature aging phenotypes and shortens lifespan in mice. Growing evidence suggests that an increase in KL expression may be beneficial for age-related diseases such as arteriosclerosis and diabetes. It remains largely unknown, however, how Kl expression could be induced. Here we discovered novel molecular mechanism for induction of Kl expression with a small molecule ‘Compound H’, N-(2-chlorophenyl)-1H-indole-3-caboxamide. Compound H was originally identified through a high-throughput screening of small molecules for identifying Kl inducers. However, how Compound H induces Kl expression has never been investigated. We found that Compound H increased Kl expression via demethylation in CpG islands of the Kl gene. The demethylation was accomplished by activating demethylases rather than inhibiting methylases. Due to demethylation, Compound H enhanced binding of transcription factors, Pax4 and Kid3, to the promoter of the Kl gene. Pax4 and Kid3 regulated Kl promoter activity positively and negatively, respectively. Thus, our results show that demethylation is an important molecular mechanism that mediates Compound H-induced Kl expression. Further investigation is warranted to determine whether Compound H demethylates the Kl gene in vivo and whether it can serve as a therapeutic agent for repressing or delaying the onset of age-related diseases. PMID:28657902
Profile analysis and prediction of tissue-specific CpG island methylation classes
2009-01-01
Background The computational prediction of DNA methylation has become an important topic in the recent years due to its role in the epigenetic control of normal and cancer-related processes. While previous prediction approaches focused merely on differences between methylated and unmethylated DNA sequences, recent experimental results have shown the presence of much more complex patterns of methylation across tissues and time in the human genome. These patterns are only partially described by a binary model of DNA methylation. In this work we propose a novel approach, based on profile analysis of tissue-specific methylation that uncovers significant differences in the sequences of CpG islands (CGIs) that predispose them to a tissue- specific methylation pattern. Results We defined CGI methylation profiles that separate not only between constitutively methylated and unmethylated CGIs, but also identify CGIs showing a differential degree of methylation across tissues and cell-types or a lack of methylation exclusively in sperm. These profiles are clearly distinguished by a number of CGI attributes including their evolutionary conservation, their significance, as well as the evolutionary evidence of prior methylation. Additionally, we assess profile functionality with respect to the different compartments of protein coding genes and their possible use in the prediction of DNA methylation. Conclusion Our approach provides new insights into the biological features that determine if a CGI has a functional role in the epigenetic control of gene expression and the features associated with CGI methylation susceptibility. Moreover, we show that the ability to predict CGI methylation is based primarily on the quality of the biological information used and the relationships uncovered between different sources of knowledge. The strategy presented here is able to predict, besides the constitutively methylated and unmethylated classes, two more tissue specific methylation classes conserving the accuracy provided by leading binary methylation classification methods. PMID:19383127
76 FR 24493 - Statement of Organization, Functions, and Delegations of Authority
Federal Register 2010, 2011, 2012, 2013, 2014
2011-05-02
... reorganization of the Laboratory Science, Policy, and Practice Program Office, Office of Surveillance... Laboratory Policy and Practice (CPGB), Laboratory Science, Policy, and Practice Program Office (CPG), and...
USDA-ARS?s Scientific Manuscript database
The potential of using a QCDCR (quilA:cholesterol:dimethyl dioctadecyl ammonium bromide:carbopol:R1005 glycolipid) formulated CpG oligodeoxynucleotide (ODN), ODN 2007, to confer protection in Nile tilapia against Streptococcus iniae infection was evaluated in this study. At two days post treatment, ...
CpG DNA: A pathogenic factor in systemic lupus erythematosus?
DOE Office of Scientific and Technical Information (OSTI.GOV)
Krieg, A.M.
1995-11-01
Systemic lupus erythematosus (SLE) is a multifactorial disease of unknown etiology. Characteristic features of SLE include (1) polyclonal B cell activation, (2) overexpression of the immune stimulatory cytokine interleukin-6 (IL-6), (3) defective tolerance to self antigens, and (4) production of anti-DNA antibodies (Ab). Bacterial infection has been suspected as a triggering factor for lupus. Bacterial DNA differs from vertebrate DNA in the frequency and methylation of CpG dinucleotides. These CpG motifs in bacterial DNA induce a variety of immune effects, including (1) polyclonal activation of murine and human B cells, (2) IL-6 secretion, and (3) resistance to apoptosis, thereby potentiallymore » allowing the survival of autoreactive cells. These results suggest that microbial DNA could therefore be a pathogenic factor in SLE. SLE patients have elevated levels of circulating plasma DNA which is reportedly enriched in hypomethylated CpGs. Genomic DNA is also hypomethylated in SLE. The purpose of this review is to summarize the immune effects of CpG motifs and to present the evidence for their possible involvement in the pathogenesis of SLE. 77 refs.« less
Malheiro, Adriana; Aníbal, Fernanda F; Martins-Filho, Olindo Assis; Teixeira-Carvalho, Andréa; Perini, Adenir; Martins, Milton A; Medeiros, Alexandra I; Turato, Walter M; Acencio, Milene P M; Brandão, Izaíra T; Nomizo, Auro; Silva, Célio L; Faccioli, Lúcia H
2008-01-17
We have investigated the effect of pcDNA3-CpG and pcDNA-IL-12, delivered by intradermal gene gun administration, on the blood/lung eosinophilia, airway hyperresponsiveness as well as the immune response in a murine model of toxocariasis. Our results demonstrated that pcDNA-IL-12 but not pcDNA3-CpG vaccination led to a persistent lower blood/bronchoalveolar eosinophilia following Toxocara canis infection, as pcDNA3-CpG led only to an early transient blockage of eosinophil transmigration into bronchoalveolar fluid following T. canis infection. Prominent Type-1 immune response was pointed out as the hallmark of T. canis infection following pcDNA-IL-12 vaccination. Outstanding IFN-gamma/IL-4 ratio besides low levels of IgG1 with subsequent high IgG2a/IgG1 ratio further characterized a Type-1 polarized immunological profile in pcDNA-IL-12-vaccinated animals. Nevertheless, only pcDNA3-CpG was able to prevent airway hyperresponsiveness induced by T. canis infection. The persistent airway hyperresponsiveness observed in pcDNA-IL-12-vaccinated animals demonstrated that the airway constriction involved other immunological mediator than those blocked by pcDNA-IL-12. Together, these data indicated that pcDNA-IL-12 and pcDNA3-CpG vaccines have distinct therapeutic benefits regarding the eosinophilic inflammation/airway hyperresponsiveness triggered by T. canis infection, suggesting their possible use in further combined therapeutic interventions.
Smearman, Erica L; Almli, Lynn M; Conneely, Karen N; Brody, Gene H; Sales, Jessica M; Bradley, Bekh; Ressler, Kerry J; Smith, Alicia K
2016-01-01
Childhood abuse can alter biological systems and increase risk for adult psychopathology. Epigenetic mechanisms, alterations in DNA structure that regulate the gene expression, are a potential mechanism underlying this risk. While abuse associates with methylation of certain genes, particularly those in the stress response system, no study to date has evaluated abuse and methylation of the oxytocin receptor (OXTR). However, studies support a role for OXTR in the link between abuse and adverse adult outcomes, showing that abuse can confer greater risk for psychiatric symptoms in those with specific OXTR genotypes. This study therefore sought to (a) assess the role of epigenetics in the link between abuse and psychopathology and (b) begin to integrate the genetic and epigenetic literature by exploring associations between OXTR genotypes and DNA CpG methylation. Data on 18 OXTR CpG sites, 44 single nucleotide polymorphisms, childhood abuse, and adult depression and anxiety symptoms were assessed in 393 African American adults (age = 41 ± 12.8 years). Overall, 68% of genotypes were associated with methylation of nearby CpG sites, with a subset surviving multiple test correction. Child abuse associated with higher methylation of two CpG sites yet did not survive correction or serve as a mediator of psychopathology. However, abuse interacted with CpG methylation to predict psychopathology. These findings suggest a role for OXTR in understanding the influence of early environments on adult psychiatric symptoms. © 2016 The Authors. Child Development © 2016 Society for Research in Child Development, Inc.
Saluz, H P; Feavers, I M; Jiricny, J; Jost, J P
1988-01-01
Genomic sequencing was used to study the in vivo methylation pattern of two CpG sites in the promoter region of the avian vitellogenin gene. The CpG at position +10 was fully methylated in DNA isolated from tissues that do not express the gene but was unmethylated in the liver of mature hens and estradiol-treated roosters. In the latter tissue, this site became demethylated and DNase I hypersensitive after estradiol treatment. A second CpG (position -52) was unmethylated in all tissues examined. In vivo genomic footprinting with dimethyl sulfate revealed different patterns of DNA protection in silent and expressed genes. In rooster liver cells, at least 10 base pairs of DNA, including the methylated CpG, were protected by protein(s). Gel-shift assays indicated that a protein factor, present in rooster liver nuclear extract, bound at this site only when it was methylated. In hen liver cells, the same unmethylated CpG lies within a protected region of approximately equal to 20 base pairs. In vitro DNase I protection and gel-shift assays indicate that this sequence is bound by a protein, which binds both double- and single-stranded DNA. For the latter substrate, this factor was shown to bind solely the noncoding (i.e., mRNA-like) strand. Images PMID:3413118
Spencer, Gaynor E; Kazmi, Mustapha H; Syed, Naweed I; Lukowiak, Ken
2002-10-01
We have previously shown that the aerial respiratory behavior of the mollusk Lymnaea stagnalis can be operantly conditioned, and the central pattern generating (CPG) neurons underlying this behavior have been identified. As neural correlates of operant conditioning remain poorly defined in both vertebrates and invertebrates, we have used the Lymnaea respiratory CPG to investigate neuronal changes associated with the change in behavior after conditioning. After operant conditioning of the intact animals, semi-intact preparations were dissected, so that changes in the respiratory behavior (pneumostome openings) and underlying activity of the identified CPG neuron, right pedal dorsal 1 (RPeD1), could be monitored simultaneously. RPeD1 was studied because it initiates the rhythmic activity of the CPG and receives chemo-sensory input from the pneumostome area. Pneumostome openings and RPeD1 activity were monitored both before and after a reinforcing training stimulus applied to the open pneumostome of operantly conditioned and yoked control preparations. After presentation of the reinforcing stimulus, there was a significant reduction in both breathing behavior and RPeD1 activity in operant preparations but not in yoked and naïve controls. Furthermore these changes were only significant in the subgroup of operantly conditioned animals described as good learners and not in poor learners. These data strongly suggest that changes in RPeD1 activity may underlie the behavioral changes associated with the reinforcement of operant conditioning of the respiratory behavior.
Zhang, Wei; Yan, Wei; You, Gan; Bao, Zhaoshi; Wang, Yongzhi; Liu, Yanwei; You, Yongping; Jiang, Tao
2013-01-01
To date, the aberrations in the DNA methylation patterns that are associated with different prognoses of G-CIMP- primary GBMs remain to be elucidated. Here, DNA methylation profiling of primary GBM tissues from 13 long-term survivors (LTS; overall survival ⩾18months) and 20 short-term survivors (STS; overall survival ⩽9months) was performed. Then G-CIMP+ samples were excluded. The differentially expressed CpG loci were identified between residual 18 STS and 9 LTS G-CIMP- samples. Methylation levels of 11 CpG loci (10genes) were statistically significantly lower, and 43 CpG loci (40genes) were statistically significantly higher in the tumor tissues of LTS than those of STS G-CIMP- samples (P<0.01). Of the 43 CpG loci that were hypermethylated in LTS G-CIMP- samples, 3 CpG loci localized in the promoter of ALDH1A3. Furthermore, using an independent validation cohort containing 37 primary GBM samples without IDH1 mutation and MGMT promoter methylation, the hypermethylation status of ALDH1A3 promoter predicted a better prognosis with an accompanied low expression of ALDH1A3 protein. Taken together, our results defined prognosis-related methylation signatures systematically for the first time in G-CIMP- primary GBMs. ALDH1A3 promoter methylation conferred a favorable prognosis in G-CIMP- primary GBMs. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.
Qiu, Qi; Wang, Richard Yuan-Hu; Jiao, Xuanmao; Jin, Bo; Sugauchi, Fuminaka; Grandinetti, Teresa; Alter, Harvey J.; Shih, J. Wai-Kuo
2017-01-01
Recent studies demonstrate that Th1-type immune responses against a broad spectrum of hepatitis C virus (HCV) gene products are crucial to the resolution of acute HCV infection. We investigated new vaccine approaches to augment the strength of HCV-specific Th1-type immune responses. ELISPOT assay revealed that single or multiple protein immunization using both CpG ODN and Montanide ISA 720 as adjuvants induced much stronger IFN-γ-producing Th1 responses against core, NS3 and NS5b targets than did the formulation without these adjuvants. Protein vaccination using CpG ODN and Montanide ISA 720 as adjuvants also greatly enhanced humoral responses to HCV core, E1/E2 and NS3. When specific IgG isotypes were assayed, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants produced higher titers of IgG2a dominant antibodies than did protein immunization alone, indicating a more Th1-biasedpathway. This increase in IgG2a is consistent with the induction of Th1 cells secreting IFN-γ demonstrated by ELISPOT assay. In conclusion, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants greatly enhanced cellular (Th1 type) as well as humoral immune responses against HCV in Balb/c mice. The use of adjuvants appears critical to the induction of Th1 immune responses during HCV vaccination with recombinant proteins. PMID:18675871
Qiu, Qi; Wang, Richard Yuan-Hu; Jiao, Xuanmao; Jin, Bo; Sugauchi, Fuminaka; Grandinetti, Teresa; Alter, Harvey J; Shih, J Wai-Kuo
2008-10-09
Recent studies demonstrate that Th1-type immune responses against a broad spectrum of hepatitis C virus (HCV) gene products are crucial to the resolution of acute HCV infection. We investigated new vaccine approaches to augment the strength of HCV-specific Th1-type immune responses. ELISPOT assay revealed that single or multiple protein immunization using both CpG ODN and Montanide ISA 720 as adjuvants induced much stronger IFN-gamma-producing Th1 responses against core, NS3 and NS5b targets than did the formulation without these adjuvants. Protein vaccination using CpG ODN and Montanide ISA 720 as adjuvants also greatly enhanced humoral responses to HCV core, E1/E2 and NS3. When specific IgG isotypes were assayed, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants produced higher titers of IgG2a dominant antibodies than did protein immunization alone, indicating a more Th1-biased pathway. This increase in IgG2a is consistent with the induction of Th1 cells secreting IFN-gamma demonstrated by ELISPOT assay. In conclusion, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants greatly enhanced cellular (Th1 type) as well as humoral immune responses against HCV in Balb/c mice. The use of adjuvants appears critical to the induction of Th1 immune responses during HCV vaccination with recombinant proteins.
Bell, Harold J; Inoue, Takuya; Shum, Kelly; Luk, Collin; Syed, Naweed I
2007-06-01
Breathing is an essential homeostatic behavior regulated by central neuronal networks, often called central pattern generators (CPGs). Despite ongoing advances in our understanding of the neural control of breathing, the basic mechanisms by which peripheral input modulates the activities of the central respiratory CPG remain elusive. This lack of fundamental knowledge vis-à-vis the role of peripheral influences in the control of the respiratory CPG is due in large part to the complexity of mammalian respiratory control centres. We have therefore developed a simpler invertebrate model to study the basic cellular and synaptic mechanisms by which a peripheral chemosensory input affects the central respiratory CPG. Here we report on the identification and characterization of peripheral chemoreceptor cells (PCRCs) that relay hypoxia-sensitive chemosensory information to the known respiratory CPG neuron right pedal dorsal 1 in the mollusk Lymnaea stagnalis. Selective perfusion of these PCRCs with hypoxic saline triggered bursting activity in these neurons and when isolated in cell culture these cells also demonstrated hypoxic sensitivity that resulted in membrane depolarization and spiking activity. When cocultured with right pedal dorsal 1, the PCRCs developed synapses that exhibited a form of short-term synaptic plasticity in response to hypoxia. Finally, osphradial denervation in intact animals significantly perturbed respiratory activity compared with their sham counterparts. This study provides evidence for direct synaptic connectivity between a peripheral regulatory element and a central respiratory CPG neuron, revealing a potential locus for hypoxia-induced synaptic plasticity underlying breathing behavior.
Guntrum, Megan; Vlasova, Ekaterina; Davis, Tamara L
2017-01-01
Differential DNA methylation plays a critical role in the regulation of imprinted genes. The differentially methylated state of the imprinting control region is inherited via the gametes at fertilization, and is stably maintained in somatic cells throughout development, influencing the expression of genes across the imprinting cluster. In contrast, DNA methylation patterns are more labile at secondary differentially methylated regions which are established at imprinted loci during post-implantation development. To investigate the nature of these more variably methylated secondary differentially methylated regions, we adopted a hairpin linker bisulfite mutagenesis approach to examine CpG dyad methylation at differentially methylated regions associated with the murine Dlk1/Gtl2 imprinting cluster on both complementary strands. We observed homomethylation at greater than 90% of the methylated CpG dyads at the IG-DMR, which serves as the imprinting control element. In contrast, homomethylation was only observed at 67-78% of the methylated CpG dyads at the secondary differentially methylated regions; the remaining 22-33% of methylated CpG dyads exhibited hemimethylation. We propose that this high degree of hemimethylation could explain the variability in DNA methylation patterns at secondary differentially methylated regions associated with imprinted loci. We further suggest that the presence of 5-hydroxymethylation at secondary differentially methylated regions may result in hemimethylation and methylation variability as a result of passive and/or active demethylation mechanisms.
Xing, Jinyi; Kang, Li; Jiang, Yunliang
2011-03-01
Experiments were conducted to investigate the effect of betaine supplementation on mRNA expression levels of lipogenesis genes and CpG methylation of lipoprotein lipase gene (LPL) in broilers. From 22 days of age, 78 broilers were feed basal diet without betaine and basal diet supplemented with 0.1% betaine, respectively, and at 56 and 66 days of age, the traits of 15 chickens (7 males and 8 females) of each group were recorded and abdominal fat pads were collected. The mRNA expression levels of several lipogenesis gene were analyzed by semi-quantitative RT-PCR and real-time quantitative RT-PCR (qPCR), respectively. The CpG methylation profile at the promoter region of LPL gene in 66-day-old broilers was determined by bisulfite sequencing. The average daily gain and percent abdominal fat traits were slightly improved in 56-day-old and 66-day-old broilers after dietary supplementation of betaine to diet. After adding 0.1% betaine to diet, the mRNA levels of fatty acid synthase (FAS) and adipocyte-type fatty acid-binding protein genes in abdominal adipose were significantly decreased in 56-day-old broilers, and those of LPL and FAS genes in abdominal adipose were significantly decreased in 66-day-old broilers comparing with the control group (P < 0.05 and P < 0.001). Moreover, in 66-day-old broilers fed 0.1% betaine diet, a different CpG methylation pattern was observed: the CpG dinucleotides of 1st, 6th, 7th, 8th and from 10th to 50th were less methylated; however, those of 2nd, 5th and 9th were more heavily methylated. The results suggest that transcription of some lipogenesis genes was decreased by betaine supplementation and betaine may decrease LPL mRNA expression by altering CpG methylation pattern on LPL promoter region.
Taha-Abdelaziz, Khaled; Alkie, Tamiru Negash; Hodgins, Douglas C; Yitbarek, Alexander; Shojadoost, Bahram; Sharif, Shayan
2017-12-01
Campylobacter jejuni (C. jejuni) is a leading bacterial cause of food-borne illness in humans. Contaminated chicken meat is an important source of infection for humans. Chickens are not clinically affected by colonization, and immune responses following natural infection have limited effects on bacterial load in the gut. Induction of intestinal immune responses may possibly lead to a breakdown of the commensal relationship of chickens with Campylobacter. We have recently shown that soluble and poly D, L-lactic-co-glycolic acid (PLGA)-encapsulated CpG oligodeoxynucleotide (ODN) as well as C. jejuni lysate, are effective in reducing the intestinal burden of C. jejuni in chickens; however, the mechanisms behind this protection have yet to be determined. The present study was undertaken to investigate the mechanisms of host responses conferred by these treatments. Chickens were treated orally with soluble CpG ODN, or PLGA-encapsulated CpG ODN, or C. jejuni lysate, and expression of cytokines and antimicrobial peptides was evaluated in cecal tonsils and ileum using quantitative RT-PCR. Oral administration of soluble CpG ODN upregulated the expression of interferon (IFN)-γ, interleukin (IL)-1β, CXCLi2, transforming growth factor (TGF)-β4/1, IL-10 and IL-13, while treatment with PLGA-encapsulated CpG ODN upregulated the expression of IL-1β, CXCLi2, TGF-β4/1, IL-13, avian β-defensin (AvBD) 1, AvBD2 and cathelicidin 3 (CATHL-3). C. jejuni lysate upregulated the expression of IFN-γ, IL-1β, TGF-β4/1, IL-13, AvBD1, and CATHL-3. In conclusion, induction of cytokine and antimicrobial peptides expression in intestinal microenvironments may provide a means of reducing C. jejuni colonization in broiler chickens, a key step in reducing the incidence of campylobacteriosis in humans. Copyright © 2017 Elsevier B.V. All rights reserved.
Tenayuca, John; Cousins, Kimberley; Yang, Shumei; Zhang, Lubo
2017-01-01
Cytosine methylation at CpG dinucleotides is a chief mechanism in epigenetic modification of gene expression patterns. Previous studies demonstrated that increased CpG methylation of Sp1 sites at -268 and -346 of protein kinase C ε promoter repressed the gene expression. The present study investigated the impact of CpG methylation on the Sp1 binding via molecular modeling and electrophoretic mobility shift assay. Each of the Sp1 sites contain two CpGs. Methylation of either CpG lowered the binding affinity of Sp1, whereas methylation of both CpGs produced a greater decrease in the binding affinity. Computation of van der Waals (VDW) energy of Sp1 in complex with the Sp1 sites demonstrated increased VDW values from one to two sites of CpG methylation. Molecular modeling indicated that single CpG methylation caused underwinding of the DNA fragment, with the phosphate groups at C1, C4 and C5 reoriented from their original positions. Methylation of both CpGs pinched the minor groove and increased the helical twist concomitant with a shallow, hydrophobic major groove. Additionally, double methylation eliminated hydrogen bonds on recognition helix residues located at positions -1 and 1, which were essential for interaction with O6/N7 of G-bases. Bonding from linker residues Arg565, Lys595 and Lys596 were also reduced. Methylation of single or both CpGs significantly affected hydrogen bonding from all three Sp1 DNA binding domains, demonstrating that the consequences of cytosine modification extend beyond the neighboring nucleotides. The results indicate that cytosine methylation causes subtle structural alterations in Sp1 binding sites consequently resulting in inhibition of side chain interactions critical for specific base recognition and reduction of the binding affinity of Sp1. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Shi, Rui; Hong, Liu; Wu, Daocheng; Ning, Xiaoxuan; Chen, Yu; Lin, Tao; Fan, Daiming; Wu, Kaichun
2005-02-01
CpG oligodeoxynucleotides (CpG ODN) have been shown to have potent adjuvant activity for a wide range of antigens. Of particular interest is their improved activity when closely associated with the antigen. The purpose of this study is to construct a nanovaccine coencapsulated with a gastric cancer specific antigen MG7 mimotope peptide and adjuvant CpG ODN 1645 using new nanotechnology as nanoemulsion and evaluate its immunocompetence. Nanoemulsion vaccine was prepared using magnetic ultrasound methods. BALB/c mice were immunized and the in vivo effectiveness was evaluated using tumor challenge assay. It was shown that the tumor masses formed in the mice immunized with coencapsulated nanovaccine (0.0825 g) markedly smaller (P < 0.01) than those formed in the mice immunized with nanovaccine encapsulated with antigen peptide alone (0.4465 g). A tumor inhibiting rate as high as 82.5% of the coencapsulated nanovaccine was obtained, while nanovaccine encapsulated with peptide only could not achieve the same effect (28.5%) (P < 0.01). Enzyme-linked immunospot assay (ELISPOT) showed that immunization using MG7 mimotope peptide coencapsulated with CpG ODN within the same nanoemulsion enhanced the frequency of splenocytes secreting IFN-gamma significantly (P < 0.01) when compared with immunization using MG7 peptide encapsulated in nanoemulsion alone (197spots/1 x 10(6) vs. 73 spots/1 x 10(6)). Cellular ELISA indicated that serum titer of antibody against MG7-Ag was significantly higher (P < 0.01) in mice immunized with coencapsulation form nanovaccine (0.7884) than that in the group immunized with nanovaccine encapsulated with MG7 peptide alone (0.3616). Using intracellular flow cytometric analysis, it was found that the IFN-gamma response was contributed by CD4+ T-cells. Our experiments suggest that a vaccinal approach using nano-delivery system carrying in tumoral epitope and CpG ODN as adjuvant may have important implications for cancer therapy.
Dong, Zhaoming; Zhang, Weiwei; Zhang, Yan; Zhang, Xiaolu; Zhao, Ping; Xia, Qingyou
2016-05-06
Cuticle is mainly made of chitin filaments embedded in a matrix of cuticular proteins (CPs). Cuticular chitins have minor differences, whereas CPs are widely variable with respect to their sequences and structures. To understand the molecular basis underlying the mechanical properties of cuticle, it is necessary to know which CPs interact with chitin and how they are assembled into the cuticle structure. In the present study, a chitin-binding assay was performed followed by liquid chromatography-tandem mass spectrometry to identify the extracted proteins from the larval cuticle of silkworm, Bombyx mori. There were 463 proteins identified from the silkworm larval cuticle, 200 of which were recovered in the chitin-binding fraction. A total of 103 proteins were annotated as CPs, which were classified into 11 CP families based on their conserved motifs, including CPR, CPAP, CPT, CPF and CPFL, CPCFC, chitin_bind 3, BmCPH2 homologues, BmCPH9 homologues, BmCPG1 homologues, BmCPG20 homologues, and BmCPG21 homologues. A total of five CP families were newly identified in the chitin-binding fraction, thereby providing new information and insight into the composition, structure, and function of the silkworm larval cuticle.
Sherlock Holmes and the Curious Case of the Human Locomotor Central Pattern Generator.
Klarner, Taryn; Zehr, E Paul
2018-03-14
Evidence first described in reduced animal models over 100 years ago led to deductions about the control of locomotion through spinal locomotor central pattern generating (CPG) networks. These discoveries in nature were contemporaneous with another form of deductive reasoning found in popular culture-that of Arthur Conan Doyle's detective "Sherlock Holmes". Since the invasive methods used in reduced non-human animal preparations are not amenable to study in humans, we are left instead with deducing from other measures and observations. Using the deductive reasoning approach of Sherlock Holmes as a metaphor for framing research into human CPGs, we speculate and weigh the evidence that should be observable in humans based on knowledge from other species. This review summarizes indirect inference to assess "observable evidence" of pattern generating activity which leads to the logical deduction of CPG contributions to arm and leg activity during locomotion in humans. The question of where a CPG may be housed in the human nervous system remains incompletely resolved at this time. Ongoing understanding, elaboration and application of functioning locomotor CPGs in humans is important for gait rehabilitation strategies in those with neurological injuries.
The type of adjuvant strongly influences the T-cell response during nanoparticle-based immunization
Knuschke, Torben; Epple, Matthias; Westendorf, Astrid M
2014-01-01
Potent vaccines require the ability to effectively induce immune responses. Especially for the control of infectious diseases with intracellular pathogens, like viruses or bacteria, potent T-cell responses are indispensable. Several delivery systems such as nanoparticles have been considered to boost the immunogenicity of pathogen derived peptides or subunits for the induction of potent T-cell responses. Since they can be further functionalized with immunostimulants, like Toll-like receptor (TLR) agonists, they improve the response by enhanced activation of the innate immune system. Currently, TLR agonists like unmethylated CpG oligonucleotides and the synthetic dsRNA derivate polyriboinosinic acid-polyribocytidylic acid (poly[I:C]) are widely used as vaccine adjuvants. CpG and poly(I:C) trigger different TLRs and therefore show differential signal transduction. Recently, we established biodegradable calcium phosphate (CaP) nanoparticles as potent T cell inducing vaccination vehicles. In this commentary we discuss the role of CpG and poly(I:C) for the effective induction of virus-specific T cells during immunization with CaP nanoparticles. The presented results underline the importance of the right formulation of vaccines for specific immunization purpose. PMID:23982325
Cross, Alan S; Greenberg, Nancy; Billington, Melissa; Zhang, Lei; DeFilippi, Christopher; May, Ryan C; Bajwa, Kanwaldeep K
2015-11-27
Gram-negative bacteria (GNB) are a leading cause of nosocomial infection and sepsis. Increasing multi-antibiotic resistance has left clinicians with fewer therapeutic options. Antibodies to GNB lipopolysaccharide (LPS, or endotoxin) have reduced morbidity and mortality as a result of infection and are not subject to the resistance mechanisms deployed by bacteria against antibiotics. In this phase 1 study, we administered a vaccine that elicits antibodies against a highly conserved portion of LPS with and without a CpG oligodeoxynucleotide (ODN) TLR9 agonist as adjuvant. A vaccine composed of the detoxified LPS (dLPS) from E. coli O111:B4 (J5 mutant) non-covalently complexed to group B meningococcal outer membrane protein (OMP). Twenty healthy adult subjects received three doses at 0, 29 and 59 days of antigen (10 μg dLPS) with or without CPG 7909 (250 or 500 μg). Subjects were evaluated for local and systemic adverse effects and laboratory findings. Anti-J5 LPS IgG and IgM antibody levels were measured by electrochemiluminesence. Due to premature study termination, not all subjects received all three doses. All vaccine formulations were well-tolerated with no local or systemic events of greater than moderate severity. The vaccine alone group achieved a ≥ 4-fold "responder" response in IgG and IgM antibody in only one of 6 subjects. In contrast, the vaccine plus CPG 7909 groups appeared to have earlier and more sustained (to 180 days) responses, greater mean-fold increases, and a higher proportion of "responders" achieving ≥ 4-fold increases over baseline. Although the study was halted before all enrolled subjects received all three doses, the J5dLPS/OMP vaccine, with or without CpG adjuvant, was safe and well-tolerated. The inclusion of CpG increased the number of subjects with a ≥ 4-fold antibody response, evident even after the second of three planned doses. A vaccine comprising J5dLPS/OMP antigen with CpG adjuvant merits further investigation. ClinicalTrials.gov Identifier: NCT01164514. Copyright © 2015 Elsevier Ltd. All rights reserved.
Osikoya, Oluwatobiloba; Jaini, Paresh A; Nguyen, An; Valdes, Melissa; Goulopoulou, Styliani
2017-06-01
Daily intake of low-dose aspirin after 12weeks of gestation is currently recommended as a preventative intervention in pregnancies in high risk of developing preeclampsia. This recommendation is based on epidemiological evidence, whereas experimental studies investigating the exact mechanisms of aspirin action during pregnancy are lacking. We previously showed that treating pregnant rats with a synthetic mimetic of unmethylated CpG DNA (bacterial DNA) caused preeclampsia-like characteristics such as maternal hypertension and increased cyclooxygenase (COX) expression and activity. In this study, we tested the hypothesis that daily maternal treatment with low-dose aspirin would prevent the development of maternal hypertension, reduce COX activity and thromboxane A 2 (TxA 2 ) production, and improve maternal vascular function in pregnant rats exposed to CpG ODN during gestation. Pregnant rats were treated with ODN2395 (synthetic CpG DNA) or saline (vehicle) on gestational days (GD) 14, 16, 18. Daily low-dose aspirin treatment (1.5mg/kgBW) started on GD10 and continued throughout gestation. Pregnant rats treated with ODN2395 had greater systolic blood pressure compared to controls (120±4mmHg vs. 100±5mmHg, p=0.03) and aspirin did not prevent this increase (p=0.86). Aspirin prevented ODN2395-induced increases of TxB 2 (TxA 2 metabolite) in serum and mesenteric arteries. ODN2395 increased expression of COX-1 and COX-2 in mesenteric and uterine arteries and aspirin abolished these effects. Aspirin reduced contractile responses to phenylephrine and U46619 (TxA 2 mimetic) in mesenteric arteries from control rats but not from ODN2395-treated rats. In conclusion, treatment with low-dose aspirin reduced systemic and vascular COX expression and activity but did not prevent the development of maternal hypertension induced by exposure to unmethylated CpG DNA (bacterial DNA). Copyright © 2017 Elsevier Ltd. All rights reserved.
Characterization of tumor cells and stem cells by differential nuclear methylation imaging
NASA Astrophysics Data System (ADS)
Tajbakhsh, Jian; Wawrowsky, Kolja A.; Gertych, Arkadiusz; Bar-Nur, Ori; Vishnevsky, Eugene; Lindsley, Erik H.; Farkas, Daniel L.
2008-02-01
DNA methylation plays a key role in cellular differentiation. Aberrant global methylation patterns are associated with several cancer types, as a result of changes in long-term activation status of up to 50% of genes, including oncogenes and tumor-suppressor genes, which are regulated by methylation and demethylation of promoter region CpG dinucleotides (CpG islands). Furthermore, DNA methylation also occurs in nonisland CpG sites (> 95% of the genome), present once per 80 dinucleotides on average. Nuclear DNA methylation increases during the course of cellular differentiation while cancer cells usually show a net loss in methylation. Given the large dynamic range in DNA methylation load, the methylation pattern of a cell can provide a valuable distinction as to its status during differentiation versus the disease state. By applying immunofluorescence, confocal microscopy and 3D image analysis we assessed the potential of differential nuclear distribution of methylated DNA to be utilized as a biomarker to characterize cells during development and when diseased. There are two major fields that may immediately benefit from this development: (1) the search for factors that contribute to pluripotency and cell fate in human embryonic stem cell expansion and differentiation, and (2) the characterization of tumor cells with regard to their heterogeneity in molecular composition and behavior. We performed topological analysis of the distribution of methylated CpG-sites (MeC) versus heterochromatin. This innovative approach revealed significant differences in colocalization patterns of MeC and heterochromatin-derived signals between undifferentiated and differentiated human embryonic stem cells, as well as untreated AtT20 mouse pituitary tumor cells compared to a subpopulation of these cells treated with 5-azacytidine for 48 hours.
Functional characterization of dI6 interneurons in the neonatal mouse spinal cord.
Dyck, Jason; Lanuza, Guillermo M; Gosgnach, Simon
2012-06-01
Our understanding of the neural control of locomotion has been greatly enhanced by the ability to identify and manipulate genetically defined populations of interneurons that comprise the locomotor central pattern generator (CPG). To date, the dI6 interneurons are one of the few populations that settle in the ventral region of the postnatal spinal cord that have not been investigated. In the present study, we utilized a novel transgenic mouse line to electrophysiologically characterize dI6 interneurons located close to the central canal and study their function during fictive locomotion. The majority of dI6 cells investigated were found to be rhythmically active during fictive locomotion and could be divided into two electrophysiologically distinct populations of interneurons. The first population fired rhythmic trains of action potentials that were loosely coupled to ventral root output and contained several intrinsic membrane properties of rhythm-generating neurons, raising the possibility that these cells may be involved in the generation of rhythmic activity in the locomotor CPG. The second population fired rhythmic trains of action potentials that were tightly coupled to ventral root output and lacked intrinsic oscillatory mechanisms, indicating that these neurons may be driven by a rhythm-generating network. Together these results indicate that dI6 neurons comprise an important component of the locomotor CPG that participate in multiple facets of motor behavior.
Functional characterization of dI6 interneurons in the neonatal mouse spinal cord
Dyck, Jason; Lanuza, Guillermo M.
2012-01-01
Our understanding of the neural control of locomotion has been greatly enhanced by the ability to identify and manipulate genetically defined populations of interneurons that comprise the locomotor central pattern generator (CPG). To date, the dI6 interneurons are one of the few populations that settle in the ventral region of the postnatal spinal cord that have not been investigated. In the present study, we utilized a novel transgenic mouse line to electrophysiologically characterize dI6 interneurons located close to the central canal and study their function during fictive locomotion. The majority of dI6 cells investigated were found to be rhythmically active during fictive locomotion and could be divided into two electrophysiologically distinct populations of interneurons. The first population fired rhythmic trains of action potentials that were loosely coupled to ventral root output and contained several intrinsic membrane properties of rhythm-generating neurons, raising the possibility that these cells may be involved in the generation of rhythmic activity in the locomotor CPG. The second population fired rhythmic trains of action potentials that were tightly coupled to ventral root output and lacked intrinsic oscillatory mechanisms, indicating that these neurons may be driven by a rhythm-generating network. Together these results indicate that dI6 neurons comprise an important component of the locomotor CPG that participate in multiple facets of motor behavior. PMID:22442567
USDA-ARS?s Scientific Manuscript database
DNA methylation at CpG sites is both heritable and influenced by environment, but the relative contributions of each to DNA methylation levels are unclear. We conducted a heritability analysis of CpG methylation in human CD4+ cells across 975 individuals from 163 families in the Genetics of Lipid-lo...
Federal Register 2010, 2011, 2012, 2013, 2014
2011-09-21
... enforcement action at any time, without prior notice and without regard to the enforcement priorities set... the enforcement priorities set forth in CPG 440.100 for unapproved new drugs marketed prior to September 19, 2011. The revision to CPG 440.100 excludes from the enforcement priorities set forth in the...
Regulation of ventral surface chemoreceptors by the central respiratory pattern generator.
Guyenet, Patrice G; Mulkey, Daniel K; Stornetta, Ruth L; Bayliss, Douglas A
2005-09-28
The rat retrotrapezoid nucleus (RTN) contains neurons described as central chemoreceptors in the adult and respiratory rhythm-generating pacemakers in neonates [parafacial respiratory group (pfRG)]. Here we test the hypothesis that both RTN and pfRG neurons are intrinsically chemosensitive and tonically firing neurons whose respiratory rhythmicity is caused by a synaptic feedback from the central respiratory pattern generator (CPG). In halothane-anesthetized adults, RTN neurons were silent below 4.5% end-expiratory (e-exp) CO2. Their activity increased linearly (3.2 Hz/1% CO2) up to 6.5% (CPG threshold) and then more slowly to peak approximately 10 Hz at 10% CO2. Respiratory modulation of RTN neurons was absent below CPG threshold, gradually stronger beyond, and, like pfRG neurons, typically (42%) characterized by twin periods of reduced activity near phrenic inspiration. After CPG inactivation with kynurenate (KYN), RTN neurons discharged linearly as a function of e-exp CO2 (slope, +1.7 Hz/1% CO2) and arterial pH (threshold, 7.48; slope, 39 Hz/pH unit). In coronal brain slices (postnatal days 7-12), RTN chemosensitive neurons were silent at pH 7.55. Their activity increased linearly with acidification up to pH 7.2 (17 Hz/pH unit at 35 degrees C) and was always tonic. In conclusion, consistent with their postulated central chemoreceptor role, RTN/pfRG neurons encode pH linearly and discharge tonically when disconnected from the rest of the respiratory centers in vivo (KYN treatment) and in vitro. In vivo, RTN neurons receive respiratory synchronous inhibitory inputs that may serve as feedback and impart these neurons with their characteristic respiratory modulation.
Smoking-Associated Site-Specific Differential Methylation in Buccal Mucosa in the COPDGene Study
Qiu, Weiliang; Carey, Vincent J.; Morrow, Jarrett; Bacherman, Helene; Foreman, Marilyn G.; Hokanson, John E.; Bowler, Russell P.; Crapo, James D.; DeMeo, Dawn L.
2015-01-01
DNA methylation is a complex, tissue-specific phenomenon that can reflect both endogenous factors and exogenous exposures. Buccal brushings represent an easily accessible source of DNA, which may be an appropriate surrogate tissue in the study of environmental exposures and chronic respiratory diseases. Buccal brushings were obtained from a subset of current and former smokers from the COPDGene study. Genome-wide DNA methylation data were obtained in the discovery cohort (n = 82) using the Illumina HumanMethylation450K array. Empirical Bayes methods were used to test for differential methylation by current smoking status at 468,219 autosomal CpG sites using linear models adjusted for age, sex, and race. Pyrosequencing was performed in a nonoverlapping replication cohort (n = 130). Current smokers were significantly younger than former smokers in both the discovery and replication cohorts. Seven CpG sites were associated with current smoking at a false discovery rate less than 0.05 in the discovery cohort. Six of the seven significant sites were pyrosequenced in the replication cohort; five CpG sites, including sites annotated to CYP1B1 and PARVA, were replicated. Correlations between cumulative smoke exposure and time since smoking cessation were observed in a subset of the significantly associated CpG sites. A significant correlation between reduced lung function and increased radiographic emphysema with methylation at cg02162897 (CYP1B1) was observed among female subjects. Site-specific methylation of DNA isolated from buccal mucosa is associated with exposure to cigarette smoke, and may provide insights into the mechanisms underlying differential susceptibility toward the development of smoking-related chronic respiratory diseases. PMID:25517428
Veenstra, Jesse J; Gibson, Heather M; Littrup, Peter J; Reyes, Joyce D; Cher, Michael L; Takashima, Akira; Wei, Wei-Zen
2014-10-01
Percutaneous cryoablation is a minimally invasive procedure for tumor destruction, which can potentially initiate or amplify antitumor immunity through the release of tumor-associated antigens. However, clinically efficacious immunity is lacking and regional recurrences are a limiting factor relative to surgical excision. To understand the mechanism of immune activation by cryoablation, comprehensive analyses of innate immunity and HER2/neu humoral and cellular immunity following cryoablation with or without peritumoral CpG injection were conducted using two HER2/neu(+) tumor systems in wild-type (WT), neu-tolerant, and SCID mice. Cryoablation of neu(+) TUBO tumor in BALB/c mice resulted in systemic immune priming, but not in neu-tolerant BALB NeuT mice. Cryoablation of human HER2(+) D2F2/E2 tumor enabled the functionality of tumor-induced immunity, but secondary tumors were refractory to antitumor immunity if rechallenge occurred during the resolution phase of the cryoablated tumor. A step-wise increase in local recurrence was observed in WT, neu-tolerant, and SCID mice, indicating a role of adaptive immunity in controlling residual tumor foci. Importantly, local recurrences were eliminated or greatly reduced in WT, neu tolerant, and SCID mice when CpG was incorporated in the cryoablation regimen, showing significant local control by innate immunity. For long-term protection, however, adaptive immunity was required because most SCID mice eventually succumbed to local tumor recurrence even with combined cryoablation and CpG treatment. This improved understanding of the mechanisms by which cryoablation affects innate and adaptive immunity will help guide appropriate combination of therapeutic interventions to improve treatment outcomes. ©2014 American Association for Cancer Research.
A modeling approach on why simple central pattern generators are built of irregular neurons.
Reyes, Marcelo Bussotti; Carelli, Pedro Valadão; Sartorelli, José Carlos; Pinto, Reynaldo Daniel
2015-01-01
The crustacean pyloric Central Pattern Generator (CPG) is a nervous circuit that endogenously provides periodic motor patterns. Even after about 40 years of intensive studies, the rhythm genesis is still not rigorously understood in this CPG, mainly because it is made of neurons with irregular intrinsic activity. Using mathematical models we addressed the question of using a network of irregularly behaving elements to generate periodic oscillations, and we show some advantages of using non-periodic neurons with intrinsic behavior in the transition from bursting to tonic spiking (as found in biological pyloric CPGs) as building components. We studied two- and three-neuron model CPGs built either with Hindmarsh-Rose or with conductance-based Hodgkin-Huxley-like model neurons. By changing a model's parameter we could span the neuron's intrinsic dynamical behavior from slow periodic bursting to fast tonic spiking, passing through a transition where irregular bursting was observed. Two-neuron CPG, half center oscillator (HCO), was obtained for each intrinsic behavior of the neurons by coupling them with mutual symmetric synaptic inhibition. Most of these HCOs presented regular antiphasic bursting activity and the changes of the bursting frequencies was studied as a function of the inhibitory synaptic strength. Among all HCOs, those made of intrinsic irregular neurons presented a wider burst frequency range while keeping a reliable regular oscillatory (bursting) behavior. HCOs of periodic neurons tended to be either hard to change their behavior with synaptic strength variations (slow periodic burster neurons) or unable to perform a physiologically meaningful rhythm (fast tonic spiking neurons). Moreover, 3-neuron CPGs with connectivity and output similar to those of the pyloric CPG presented the same results.
Epigenetic programming alterations in alligators from environmentally contaminated lakes
Guillette, Louis J.; Parrott, Benjamin B.; Nilsson, Eric; Haque, M.M.; Skinner, Michael K.
2016-01-01
Previous studies examining the reproductive health of alligators in Florida lakes indicate that a variety of developmental and health impacts can be attributed to a combination of environmental quality and exposures to environmental contaminants. The majority of these environmental contaminants have been shown to disrupt normal endocrine signaling. The potential that these environmental conditions and contaminants may influence epigenetic status and correlate to the health abnormalities was investigated in the current study. The red blood cell (RBC) (erythrocyte) in the alligator is nucleated so was used as an easily purified marker cell to investigate epigenetic programming. RBCs were collected from adult male alligators captured at three sites in Florida, each characterized by varying degrees of contamination. While Lake Woodruff (WO) has remained relatively pristine, Lake Apopka (AP) and Merritt Island (MI) convey exposures to different suites of contaminants. DNA was isolated and methylated DNA immuno-precipitation (MeDIP) was used to isolate methylated DNA that was then analyzed in a competitive hybridization using a genome-wide alligator tiling array for a MeDIP-Chip analysis. Pairwise comparisons of alligators from AP and MI to WO revealed alterations in the DNA methylome. The AP vs. WO comparison identified 85 differential DNA methylation regions (DMRs) with ⩾3 adjacent oligonucleotide tiling array probes and 15,451 DMRs with a single oligo probe analysis. The MI vs. WO comparison identified 75 DMRs with the ⩾3 oligo probe and 17,411 DMRs with the single oligo probe analysis. There was negligible overlap between the DMRs identified in AP vs. WO and MI vs. WO comparisons. In both comparisons DMRs were primarily associated with CpG deserts which are regions of low CpG density (1–2 CpG/100 bp). Although the alligator genome is not fully annotated, gene associations were identified and correlated to major gene class functional categories and pathways of endocrine relevance. Observations demonstrate that environmental quality may be associated with epigenetic programming and health status in the alligator. The epigenetic alterations may provide biomarkers to assess the environmental exposures and health impacts on these populations of alligators. PMID:27080547
Heßelbach, Katharina; Kim, Gwang-Jin; Flemming, Stephan; Häupl, Thomas; Bonin, Marc; Dornhof, Regina; Günther, Stefan; Merfort, Irmgard; Humar, Matjaz
2017-09-01
Exposure to particulate matter (PM) is recognized as a major health hazard, but molecular responses are still insufficiently described. We analyzed the epigenetic impact of ambient PM 2.5 from biomass combustion on the methylome of primary human bronchial epithelial BEAS-2B cells using the Illumina HumanMethylation450 BeadChip. The transcriptome was determined by the Affymetrix HG-U133 Plus 2.0 Array. PM 2.5 induced genome wide alterations of the DNA methylation pattern, including differentially methylated CpGs in the promoter region associated with CpG islands. Gene ontology analysis revealed that differentially methylated genes were significantly clustered in pathways associated with the extracellular matrix, cellular adhesion, function of GTPases, and responses to extracellular stimuli, or were involved in ion binding and shuttling. Differential methylations also affected tandem repeats. Additionally, 45 different miRNA CpG loci showed differential DNA methylation, most of them proximal to their promoter. These miRNAs are functionally relevant for lung cancer, inflammation, asthma, and other PM-associated diseases. Correlation of the methylome and transcriptome demonstrated a clear bias toward transcriptional activation by hypomethylation. Genes that exhibited both differential methylation and expression were functionally linked to cytokine and immune responses, cellular motility, angiogenesis, inflammation, wound healing, cell growth, differentiation and development, or responses to exogenous matter. Disease ontology of differentially methylated and expressed genes indicated their prominent role in lung cancer and their participation in dominant cancer related signaling pathways. Thus, in lung epithelial cells, PM 2.5 alters the methylome of genes and noncoding transcripts or elements that might be relevant for PM- and lung-associated diseases.
Heßelbach, Katharina; Kim, Gwang-Jin; Flemming, Stephan; Häupl, Thomas; Bonin, Marc; Dornhof, Regina; Günther, Stefan; Merfort, Irmgard; Humar, Matjaz
2017-01-01
ABSTRACT Exposure to particulate matter (PM) is recognized as a major health hazard, but molecular responses are still insufficiently described. We analyzed the epigenetic impact of ambient PM2.5 from biomass combustion on the methylome of primary human bronchial epithelial BEAS-2B cells using the Illumina HumanMethylation450 BeadChip. The transcriptome was determined by the Affymetrix HG-U133 Plus 2.0 Array. PM2.5 induced genome wide alterations of the DNA methylation pattern, including differentially methylated CpGs in the promoter region associated with CpG islands. Gene ontology analysis revealed that differentially methylated genes were significantly clustered in pathways associated with the extracellular matrix, cellular adhesion, function of GTPases, and responses to extracellular stimuli, or were involved in ion binding and shuttling. Differential methylations also affected tandem repeats. Additionally, 45 different miRNA CpG loci showed differential DNA methylation, most of them proximal to their promoter. These miRNAs are functionally relevant for lung cancer, inflammation, asthma, and other PM-associated diseases. Correlation of the methylome and transcriptome demonstrated a clear bias toward transcriptional activation by hypomethylation. Genes that exhibited both differential methylation and expression were functionally linked to cytokine and immune responses, cellular motility, angiogenesis, inflammation, wound healing, cell growth, differentiation and development, or responses to exogenous matter. Disease ontology of differentially methylated and expressed genes indicated their prominent role in lung cancer and their participation in dominant cancer related signaling pathways. Thus, in lung epithelial cells, PM2.5 alters the methylome of genes and noncoding transcripts or elements that might be relevant for PM- and lung-associated diseases. PMID:28742980
Preclinical Studies of Induced Pluripotent Stem Cell-Derived Astrocyte Transplantation in ALS
2014-12-01
fast-frozen in liquid nitrogen. RNAwas iso- lated using TRIzol, followed by DNase treatment and RNA cleanup using RNeasy columns (Qiagen, Hilden, Germany...J Neurochem 2001;79:737–746. 34 Doi A, Park IH, Wen B et al. Differential methylation of tissue- and cancer-specific CpG island shores distinguishes...2008, Sreedharan et al., 2008, Kwiatkowski et al., 2009, Vance et al., 2009, Johnson et al., 2010, Maruyama et al., 2010, DeJesus-Hernandez et al
An automated graphics tool for comparative genomics: the Coulson plot generator
2013-01-01
Background Comparative analysis is an essential component to biology. When applied to genomics for example, analysis may require comparisons between the predicted presence and absence of genes in a group of genomes under consideration. Frequently, genes can be grouped into small categories based on functional criteria, for example membership of a multimeric complex, participation in a metabolic or signaling pathway or shared sequence features and/or paralogy. These patterns of retention and loss are highly informative for the prediction of function, and hence possible biological context, and can provide great insights into the evolutionary history of cellular functions. However, representation of such information in a standard spreadsheet is a poor visual means from which to extract patterns within a dataset. Results We devised the Coulson Plot, a new graphical representation that exploits a matrix of pie charts to display comparative genomics data. Each pie is used to describe a complex or process from a separate taxon, and is divided into sectors corresponding to the number of proteins (subunits) in a complex/process. The predicted presence or absence of proteins in each complex are delineated by occupancy of a given sector; this format is visually highly accessible and makes pattern recognition rapid and reliable. A key to the identity of each subunit, plus hierarchical naming of taxa and coloring are included. A java-based application, the Coulson plot generator (CPG) automates graphic production, with a tab or comma-delineated text file as input and generating an editable portable document format or svg file. Conclusions CPG software may be used to rapidly convert spreadsheet data to a graphical matrix pie chart format. The representation essentially retains all of the information from the spreadsheet but presents a graphically rich format making comparisons and identification of patterns significantly clearer. While the Coulson plot format is highly useful in comparative genomics, its original purpose, the software can be used to visualize any dataset where entity occupancy is compared between different classes. Availability CPG software is available at sourceforge http://sourceforge.net/projects/coulson and http://dl.dropbox.com/u/6701906/Web/Sites/Labsite/CPG.html PMID:23621955
Cognitive skills assessment during robot-assisted surgery: separating the wheat from the chaff.
Guru, Khurshid A; Esfahani, Ehsan T; Raza, Syed J; Bhat, Rohit; Wang, Katy; Hammond, Yana; Wilding, Gregory; Peabody, James O; Chowriappa, Ashirwad J
2015-01-01
To investigate the utility of cognitive assessment during robot-assisted surgery (RAS) to define skills in terms of cognitive engagement, mental workload, and mental state; while objectively differentiating between novice and expert surgeons. In all, 10 surgeons with varying operative experience were assigned to beginner (BG), combined competent and proficient (CPG), and expert (EG) groups based on the Dreyfus model. The participants performed tasks for basic, intermediate and advanced skills on the da Vinci Surgical System. Participant performance was assessed using both tool-based and cognitive metrics. Tool-based metrics showed significant differences between the BG vs CPG and the BG vs EG, in basic skills. While performing intermediate skills, there were significant differences only on the instrument-to-instrument collisions between the BG vs CPG (2.0 vs 0.2, P = 0.028), and the BG vs EG (2.0 vs 0.1, P = 0.018). There were no significant differences between the CPG and EG for both basic and intermediate skills. However, using cognitive metrics, there were significant differences between all groups for the basic and intermediate skills. In advanced skills, there were no significant differences between the CPG and the EG except time (1116 vs 599.6 s), using tool-based metrics. However, cognitive metrics revealed significant differences between both groups. Cognitive assessment of surgeons may aid in defining levels of expertise performing complex surgical tasks once competence is achieved. Cognitive assessment may be used as an adjunct to the traditional methods for skill assessment during RAS. © 2014 The Authors. BJU International © 2014 BJU International.
Differential DNA Methylation in Relation to Age and Health Risks of Obesity.
Mansego, María Luisa; Milagro, Fermín I; Zulet, María Ángeles; Moreno-Aliaga, María J; Martínez, José Alfredo
2015-07-24
The aim of this study was to evaluate whether genome-wide levels of DNA methylation are associated with age and the health risks of obesity (HRO); defined according to BMI categories as "Low HRO" (overweight and class 1 obesity) versus "High HRO" (class 2 and class 3 obesity). Anthropometric measurements were assessed in a subsample of 48 volunteers from the Metabolic Syndrome Reduction in Navarra (RESMENA) study and 24 women from another independent study, Effects of Lipoic Acid and Eicosapentaenoic Acid in Human Obesity (OBEPALIP study). In the pooled population; the methylation levels of 55 CpG sites were significantly associated with age after Benjamini-Hochberg correction. In addition, DNA methylation of three CpG sites located in ELOVL2; HOXC4 and PI4KB were further negatively associated with their mRNA levels. Although no differentially methylated CpG sites were identified in relation to HRO after multiple testing correction; several nominally significant CpG sites were identified in genes related to insulin signaling; energy and lipid metabolism. Moreover, statistically significant associations between BMI or mRNA levels and two HRO-related CpG sites located in GPR133 and ITGB5 are reported. As a conclusion, these findings from two Spanish cohorts add knowledge about the important role of DNA methylation in the age-related regulation of gene expression. In addition; a relevant influence of age on DNA methylation in white blood cells was found, as well as, on a trend level, novel associations between DNA methylation and obesity.
Base Excision Repair of Tandem Modifications in a Methylated CpG Dinucleotide*
Sassa, Akira; Çağlayan, Melike; Dyrkheeva, Nadezhda S.; Beard, William A.; Wilson, Samuel H.
2014-01-01
Cytosine methylation and demethylation in tracks of CpG dinucleotides is an epigenetic mechanism for control of gene expression. The initial step in the demethylation process can be deamination of 5-methylcytosine producing the TpG alteration and T:G mispair, and this step is followed by thymine DNA glycosylase (TDG) initiated base excision repair (BER). A further consideration is that guanine in the CpG dinucleotide may become oxidized to 7,8-dihydro-8-oxoguanine (8-oxoG), and this could affect the demethylation process involving TDG-initiated BER. However, little is known about the enzymology of BER of altered in-tandem CpG dinucleotides; e.g. Tp8-oxoG. Here, we investigated interactions between this altered dinucleotide and purified BER enzymes, the DNA glycosylases TDG and 8-oxoG DNA glycosylase 1 (OGG1), apurinic/apyrimidinic (AP) endonuclease 1, DNA polymerase β, and DNA ligases. The overall TDG-initiated BER of the Tp8-oxoG dinucleotide is significantly reduced. Specifically, TDG and DNA ligase activities are reduced by a 3′-flanking 8-oxoG. In contrast, the OGG1-initiated BER pathway is blocked due to the 5′-flanking T:G mispair; this reduces OGG1, AP endonuclease 1, and DNA polymerase β activities. Furthermore, in TDG-initiated BER, TDG remains bound to its product AP site blocking OGG1 access to the adjacent 8-oxoG. These results reveal BER enzyme specificities enabling suppression of OGG1-initiated BER and coordination of TDG-initiated BER at this tandem alteration in the CpG dinucleotide. PMID:24695738
Real-time biomimetic Central Pattern Generators in an FPGA for hybrid experiments
Ambroise, Matthieu; Levi, Timothée; Joucla, Sébastien; Yvert, Blaise; Saïghi, Sylvain
2013-01-01
This investigation of the leech heartbeat neural network system led to the development of a low resources, real-time, biomimetic digital hardware for use in hybrid experiments. The leech heartbeat neural network is one of the simplest central pattern generators (CPG). In biology, CPG provide the rhythmic bursts of spikes that form the basis for all muscle contraction orders (heartbeat) and locomotion (walking, running, etc.). The leech neural network system was previously investigated and this CPG formalized in the Hodgkin–Huxley neural model (HH), the most complex devised to date. However, the resources required for a neural model are proportional to its complexity. In response to this issue, this article describes a biomimetic implementation of a network of 240 CPGs in an FPGA (Field Programmable Gate Array), using a simple model (Izhikevich) and proposes a new synapse model: activity-dependent depression synapse. The network implementation architecture operates on a single computation core. This digital system works in real-time, requires few resources, and has the same bursting activity behavior as the complex model. The implementation of this CPG was initially validated by comparing it with a simulation of the complex model. Its activity was then matched with pharmacological data from the rat spinal cord activity. This digital system opens the way for future hybrid experiments and represents an important step toward hybridization of biological tissue and artificial neural networks. This CPG network is also likely to be useful for mimicking the locomotion activity of various animals and developing hybrid experiments for neuroprosthesis development. PMID:24319408
Region of interest methylation analysis: a comparison of MSP with MS-HRM and direct BSP.
Akika, Reem; Awada, Zainab; Mogharbil, Nahed; Zgheib, Nathalie K
2017-07-01
The aim of this study was to compare and contrast three DNA methylation methods of a specific region of interest (ROI): methylation-specific PCR (MSP), methylation-sensitive high resolution melting (MS-HRM) and direct bisulfite sequencing (BSP). The methylation of a CpG area in the promoter region of Estrogen receptor alpha (ESR1) was evaluated by these three methods with samples and standards of different methylation percentages. MSP data were neither reproducible nor sensitive, and the assay was not specific due to non-specific binding of primers. MS-HRM was highly reproducible and a step forward into categorizing the methylation status of the samples as percent ranges. Direct BSP was the most informative method regarding methylation percentage of each CpG site. Though not perfect, it was reproducible and sensitive. We recommend the use of either method depending on the research question and target amplicon, and provided that the designed primers and expected amplicons are within recommendations. If the research question targets a limited number of CpG sites and simple yes/no results are enough, MSP may be attempted. For short amplicons that are crowded with CpG sites and of single melting domain, MS-HRM may be the method of choice though it only indicates the overall methylation percentage of the entire amplicon. Although the assay is highly reproducible, being semi-quantitative makes it of lesser interest to study ROI methylation of samples with little methylation differences. Direct BSP is a step forward as it gives information about the methylation percentage at each CpG site.
Wagner, I; Geh, K J; Hubert, M; Winter, G; Weber, K; Classen, J; Klinger, C; Mueller, R S
2017-07-29
Cytosine-phosphate-guanine oligodeoxynucleotides (CpG ODN) are a promising new immunotherapeutic treatment option for canine atopic dermatitis (AD). The aim of this uncontrolled pilot study was to evaluate clinical and immunological effects of gelatine nanoparticle (GNP)-bound CpG ODN (CpG GNP) on atopic dogs. Eighteen dogs with AD were treated for 8 weeks (group 1, n=8) or 18 weeks (group 2, n=10). Before inclusion and after 2 weeks, 4 weeks, 6 weeks (group 1+2), 8 weeks, 12 weeks and 16 weeks (group 2) 75 µg CpG ODN/dog (bound to 1.5 mg GNP) were injected subcutaneously. Pruritus was evaluated daily by the owner. Lesions were evaluated and serum concentrations and mRNA expressions of interferon-γ, tumour necrosis factor-α, transforming growth factor-β, interleukin (IL) 10 and IL-4 (only mRNA expression) were determined at inclusion and after 8 weeks (group 1+2) and 18 weeks (group 2). Lesions and pruritus improved significantly from baseline to week 8. Mean improvements from baseline to week 18 were 23 per cent and 44 per cent for lesions and pruritus, respectively, an improvement of ≥50 per cent was seen in six out of nine and three out of six dogs, respectively. IL-4 mRNA expression decreased significantly. The results of this study show a clinical improvement of canine AD with CpG GNP comparable to allergen immunotherapy. Controlled studies are needed to confirm these findings. British Veterinary Association.
Racial Differences in DNA-Methylation of CpG Sites Within Preterm-Promoting Genes and Gene Variants.
Salihu, H M; Das, R; Morton, L; Huang, H; Paothong, A; Wilson, R E; Aliyu, M H; Salemi, J L; Marty, P J
2016-08-01
Objective To evaluate the role DNA methylation may play in genes associated with preterm birth for higher rates of preterm births in African-American women. Methods Fetal cord blood samples from births collected at delivery and maternal demographic and medical information were used in a cross-sectional study to examine fetal DNA methylation of genes implicated in preterm birth among black and non-black infants. Allele-specific DNA methylation analysis was performed using a methylation bead array. Targeted maximum likelihood estimation was applied to examine the relationship between race and fetal DNA methylation of candidate preterm birth genes. Receiver-operating characteristic analyses were then conducted to validate the CpG site methylation marker within the two racial groups. Bootstrapping, a method of validation and replication, was employed. Results 42 CpG sites were screened within 20 candidate gene variants reported consistently in the literature as being associated with preterm birth. Of these, three CpG sites on TNFAIP8 and PON1 genes (corresponding to: cg23917399; cg07086380; and cg07404485, respectively) were significantly differentially methylated between black and non-black individuals. The three CpG sites showed lower methylation status among infants of black women. Bootstrapping validated and replicated results. Conclusion for Practice Our study identified significant differences in levels of methylation on specific genes between black and non-black individuals. Understanding the genetic/epigenetic mechanisms that lead to preterm birth may lead to enhanced prevention strategies to reduce morbidity and mortality by eventually providing a means to identify individuals with a genetic predisposition to preterm labor.
Enhancement of infectious disease vaccines through TLR9-dependent recognition of CpG DNA.
McCluskie, M J; Krieg, A M
2006-01-01
The adaptive immune system-with its remarkable ability to generate antigen-specific antibodies and T lymphocytes against pathogens never before "seen" by an organism-is one of the marvels of evolution. However, to generate these responses, the adaptive immune system requires activation by the innate immune system. Toll-like receptors (TLRs) are perhaps the best-understood family of innate immune receptors for detecting infections and stimulating adaptive immune responses. TLR9 appears to have evolved to recognize infections by a subtle structural difference between eukaryotic and prokaryotic/viral DNA; only the former frequently methylates CpG dinucleotides. Used as vaccine adjuvants, synthetic oligodeoxynucleotide (ODN) ligands for TLR9--CpG ODN--greatly enhance the speed and strength of the immune responses to vaccination.
Zhao, Yongzhong; Epstein, Richard J
2013-01-01
Methylation-prone CpG dinucleotides are strongly conserved in the germline, yet are also predisposed to somatic mutation. Here we quantify the relationship between germline codon mutability and somatic carcinogenesis by comparing usage of the nonsense-prone CGA (→TGA) codons in gene groups that differ in apoptotic function; to this end, suppressor genes were subclassified as either apoptotic (gatekeepers) or repair (caretakers). Mutations affecting CGA codons in sporadic tumors proved to be highly asymmetric. Moreover, nonsense mutations were 3-fold more likely to affect gatekeepers than caretakers. In addition, intragenic CGA clustering nonrandomly affected functionally critical regions of gatekeepers. We conclude that human gatekeeper suppressor genes are enriched for nonsense-prone codons, and submit that this germline vulnerability to tumors could reflect in utero selection for a methylation-dependent capability to short-circuit environmental insults that otherwise trigger apoptosis and fetal loss.