Sample records for create binding sites

  1. Regulation of CCL2 expression by an upstream TALE homeodomain protein-binding site that synergizes with the site created by the A-2578G SNP.

    PubMed

    Page, Stephen H; Wright, Edward K; Gama, Lucio; Clements, Janice E

    2011-01-01

    CC Chemokine Ligand 2 (CCL2) is a potent chemoattractant produced by macrophages and activated astrocytes during periods of inflammation within the central nervous system. Increased CCL2 expression is correlated with disease progression and severity, as observed in pulmonary tuberculosis, HCV-related liver disease, and HIV-associated dementia. The CCL2 distal promoter contains an A/G polymorphism at position -2578 and the homozygous -2578 G/G genotype is associated with increased CCL2 production and inflammation. However, the mechanisms that contribute to the phenotypic differences in CCL2 expression are poorly understood. We previously demonstrated that the -2578 G polymorphism creates a TALE homeodomain protein binding site (TALE binding site) for PREP1/PBX2 transcription factors. In this study, we identified the presence of an additional TALE binding site 22 bp upstream of the site created by the -2578 G polymorphism and demonstrated the synergistic effects of the two sites on the activation of the CCL2 promoter. Using chromatin immunoprecipitation (ChIP) assays, we demonstrated increased binding of the TALE proteins PREP1 and PBX2 to the -2578 G allele, and binding of IRF1 to both the A and G alleles. The presence of TALE binding sites that form inverted repeats within the -2578 G allele results in increased transcriptional activation of the CCL2 distal promoter while the presence of only the upstream TALE binding site within the -2578 A allele exerts repression of promoter activity.

  2. A Smad action turnover switch operated by WW domain readers of a phosphoserine code

    PubMed Central

    Aragón, Eric; Goerner, Nina; Zaromytidou, Alexia-Ileana; Xi, Qiaoran; Escobedo, Albert; Massagué, Joan; Macias, Maria J.

    2011-01-01

    When directed to the nucleus by TGF-β or BMP signals, Smad proteins undergo cyclin-dependent kinase 8/9 (CDK8/9) and glycogen synthase kinase-3 (GSK3) phosphorylations that mediate the binding of YAP and Pin1 for transcriptional action, and of ubiquitin ligases Smurf1 and Nedd4L for Smad destruction. Here we demonstrate that there is an order of events—Smad activation first and destruction later—and that it is controlled by a switch in the recognition of Smad phosphoserines by WW domains in their binding partners. In the BMP pathway, Smad1 phosphorylation by CDK8/9 creates binding sites for the WW domains of YAP, and subsequent phosphorylation by GSK3 switches off YAP binding and adds binding sites for Smurf1 WW domains. Similarly, in the TGF-β pathway, Smad3 phosphorylation by CDK8/9 creates binding sites for Pin1 and GSK3, then adds sites to enhance Nedd4L binding. Thus, a Smad phosphoserine code and a set of WW domain code readers provide an efficient solution to the problem of coupling TGF-β signal delivery to turnover of the Smad signal transducers. PMID:21685363

  3. Binding mode of cytochalasin B to F-actin is altered by lateral binding of regulatory proteins.

    PubMed

    Suzuki, N; Mihashi, K

    1991-01-01

    The binding of cytochalasin B (CB) to F-actin was studied using a trace amount of [3H]-cytochalasin B. F-Actin-bound CB was separated from free CB by ultracentrifugation and the amount of F-actin-bound CB was determined by comparing the radioactivity both in the supernatant and in the precipitate. A filament of pure F-actin possessed one high-affinity binding site for CB (Kd = 5.0 nM) at the B-end. When the filament was bound to native tropomyosin (complex of tropomyosin and troponin), two low-affinity binding sites for CB (Kd = 230 nM) were created, while the high-affinity binding site was reserved (Kd = 3.4 nM). It was concluded that the creation of low-affinity binding sites was primarily due to binding of tropomyosin to F-actin, as judged from the following two observations: (1) a filament of F-actin/tropomyosin complex possessed one high-affinity binding site (Kd = 3.9 nM) plus two low-affinity binding sites (Kd = 550 nM); (2) the Ca2(+)-receptive state of troponin C in F-actin/native tropomyosin complex did not affect CB binding.

  4. Rapid comparison of protein binding site surfaces with Property Encoded Shape Distributions (PESD)

    PubMed Central

    Das, Sourav; Kokardekar, Arshad

    2009-01-01

    Patterns in shape and property distributions on the surface of binding sites are often conserved across functional proteins without significant conservation of the underlying amino-acid residues. To explore similarities of these sites from the viewpoint of a ligand, a sequence and fold-independent method was created to rapidly and accurately compare binding sites of proteins represented by property-mapped triangulated Gauss-Connolly surfaces. Within this paradigm, signatures for each binding site surface are produced by calculating their property-encoded shape distributions (PESD), a measure of the probability that a particular property will be at a specific distance to another on the molecular surface. Similarity between the signatures can then be treated as a measure of similarity between binding sites. As postulated, the PESD method rapidly detected high levels of similarity in binding site surface characteristics even in cases where there was very low similarity at the sequence level. In a screening experiment involving each member of the PDBBind 2005 dataset as a query against the rest of the set, PESD was able to retrieve a binding site with identical E.C. (Enzyme Commission) numbers as the top match in 79.5% of cases. The ability of the method in detecting similarity in binding sites with low sequence conservations were compared with state-of-the-art binding site comparison methods. PMID:19919089

  5. Two-Dimensional Wetting of a Stepped Copper Surface

    NASA Astrophysics Data System (ADS)

    Lin, C.; Avidor, N.; Corem, G.; Godsi, O.; Alexandrowicz, G.; Darling, G. R.; Hodgson, A.

    2018-02-01

    Highly corrugated, stepped surfaces present regular 1D arrays of binding sites, creating a complex, heterogeneous environment to water. Rather than decorating the hydrophilic step sites to form 1D chains, water on stepped Cu(511) forms an extended 2D network that binds strongly to the steps but bridges across the intervening hydrophobic Cu(100) terraces. The hydrogen-bonded network contains pentamer, hexamer, and octomer water rings that leave a third of the stable Cu step sites unoccupied in order to bind water H down close to the step dipole and complete three hydrogen bonds per molecule.

  6. The amyloid architecture provides a scaffold for enzyme-like catalysts.

    PubMed

    Al-Garawi, Z S; McIntosh, B A; Neill-Hall, D; Hatimy, A A; Sweet, S M; Bagley, M C; Serpell, L C

    2017-08-03

    Natural biological enzymes possess catalytic sites that are generally surrounded by a large three-dimensional scaffold. However, the proportion of the protein molecule that participates in the catalytic reaction is relatively small. The generation of artificial or miniature enzymes has long been a focus of research because enzyme mimetics can be produced with high activity at low cost. These enzymes aim to mimic the active sites without the additional architecture contributed by the protein chain. Previous work has shown that amyloidogenic peptides are able to self-assemble to create an active site that is capable of binding zinc and catalysing an esterase reaction. Here, we describe the structural characterisation of a set of designed peptides that form an amyloid-like architecture and reveal that their capability to mimic carbonic anhydrase and serve as enzyme-like catalysts is related to their ability to self-assemble. These amyloid fibril structures can bind the metal ion Zn 2+ via a three-dimensional arrangement of His residues created by the amyloid architecture. Our results suggest that the catalytic efficiency of amyloid-like assembly is not only zinc-dependent but also depends on an active centre created by the peptides which is, in turn, dependent on the ordered architecture. These fibrils have good esterase activity, and they may serve as good models for the evolution of modern-day enzymes. Furthermore, they may be useful in designing self-assembling fibrils for applications as metal ion catalysts. This study also demonstrates that the ligands surrounding the catalytic site affect the affinity of the zinc-binding site to bind the substrate contributing to the enzymatic activity of the assembled peptides.

  7. X-Ray Structure of the Human Calreticulin Globular Domain Reveals a Peptide-Binding Area and Suggests a Multi-Molecular Mechanism

    PubMed Central

    Chouquet, Anne; Païdassi, Helena; Ling, Wai Li; Frachet, Philippe; Houen, Gunnar; Arlaud, Gérard J.; Gaboriaud, Christine

    2011-01-01

    In the endoplasmic reticulum, calreticulin acts as a chaperone and a Ca2+-signalling protein. At the cell surface, it mediates numerous important biological effects. The crystal structure of the human calreticulin globular domain was solved at 1.55 Å resolution. Interactions of the flexible N-terminal extension with the edge of the lectin site are consistently observed, revealing a hitherto unidentified peptide-binding site. A calreticulin molecular zipper, observed in all crystal lattices, could further extend this site by creating a binding cavity lined by hydrophobic residues. These data thus provide a first structural insight into the lectin-independent binding properties of calreticulin and suggest new working hypotheses, including that of a multi-molecular mechanism. PMID:21423620

  8. Template-directed covalent conjugation of DNA to native antibodies, transferrin and other metal-binding proteins

    NASA Astrophysics Data System (ADS)

    Rosen, Christian B.; Kodal, Anne L. B.; Nielsen, Jesper S.; Schaffert, David H.; Scavenius, Carsten; Okholm, Anders H.; Voigt, Niels V.; Enghild, Jan J.; Kjems, Jørgen; Tørring, Thomas; Gothelf, Kurt V.

    2014-09-01

    DNA-protein conjugates are important in bioanalytical chemistry, molecular diagnostics and bionanotechnology, as the DNA provides a unique handle to identify, functionalize or otherwise manipulate proteins. To maintain protein activity, conjugation of a single DNA handle to a specific location on the protein is often needed. However, preparing such high-quality site-specific conjugates often requires genetically engineered proteins, which is a laborious and technically challenging approach. Here we demonstrate a simpler method to create site-selective DNA-protein conjugates. Using a guiding DNA strand modified with a metal-binding functionality, we directed a second DNA strand to the vicinity of a metal-binding site of His6-tagged or wild-type metal-binding proteins, such as serotransferrin, where it subsequently reacted with lysine residues at that site. This method, DNA-templated protein conjugation, facilitates the production of site-selective protein conjugates, and also conjugation to IgG1 antibodies via a histidine cluster in the constant domain.

  9. Stability and Sugar Recognition Ability of Ricin-Like Carbohydrate Binding Domains

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yao, Jianzhuang; Nellas, Ricky B; Glover, Mary M

    2011-01-01

    Lectins are a class of proteins known for their novel binding to saccharides. Understanding this sugar recognition process can be crucial in creating structure-based designs of proteins with various biological roles. We focus on the sugar binding of a particular lectin, ricin, which has two -trefoil carbohydrate-binding domains (CRDs) found in several plant protein toxins. The binding ability of possible sites of ricin-like CRD has been puzzling. The apo and various (multiple) ligand-bound forms of the sugar-binding domains of ricin were studied by molecular dynamics simulations. By evaluating structural stability, hydrogen bond dynamics, flexibility, and binding energy, we obtained amore » detailed picture of the sugar recognition of the ricin-like CRD. Unlike what was previously believed, we found that the binding abilities of the two known sites are not independent of each other. The binding ability of one site is positively affected by the other site. While the mean positions of different binding scenarios are not altered significantly, the flexibility of the binding pockets visibly decreases upon multiple ligand binding. This change in flexibility seems to be the origin of the binding cooperativity. All the hydrogen bonds that are strong in the monoligand state are also strong in the double-ligand complex, although the stability is much higher in the latter form due to cooperativity. These strong hydrogen bonds in a monoligand state are deemed to be the essential hydrogen bonds. Furthermore, by examining the structural correlation matrix, the two domains are structurally one entity. Galactose hydroxyl groups, OH4 and OH3, are the most critical parts in both site 1 and site 2 recognition.« less

  10. Physical constraints determine the logic of bacterial promoter architectures

    PubMed Central

    Ezer, Daphne; Zabet, Nicolae Radu; Adryan, Boris

    2014-01-01

    Site-specific transcription factors (TFs) bind to their target sites on the DNA, where they regulate the rate at which genes are transcribed. Bacterial TFs undergo facilitated diffusion (a combination of 3D diffusion around and 1D random walk on the DNA) when searching for their target sites. Using computer simulations of this search process, we show that the organization of the binding sites, in conjunction with TF copy number and binding site affinity, plays an important role in determining not only the steady state of promoter occupancy, but also the order at which TFs bind. These effects can be captured by facilitated diffusion-based models, but not by standard thermodynamics. We show that the spacing of binding sites encodes complex logic, which can be derived from combinations of three basic building blocks: switches, barriers and clusters, whose response alone and in higher orders of organization we characterize in detail. Effective promoter organizations are commonly found in the E. coli genome and are highly conserved between strains. This will allow studies of gene regulation at a previously unprecedented level of detail, where our framework can create testable hypothesis of promoter logic. PMID:24476912

  11. Analysis of an artificial zinc finger epigenetic modulator: widespread binding but limited regulation

    PubMed Central

    Grimmer, Matthew R.; Stolzenburg, Sabine; Ford, Ethan; Lister, Ryan; Blancafort, Pilar; Farnham, Peggy J.

    2014-01-01

    Artificial transcription factors (ATFs) and genomic nucleases based on a DNA binding platform consisting of multiple zinc finger domains are currently being developed for clinical applications. However, no genome-wide investigations into their binding specificity have been performed. We have created six-finger ATFs to target two different 18 nt regions of the human SOX2 promoter; each ATF is constructed such that it contains or lacks a super KRAB domain (SKD) that interacts with a complex containing repressive histone methyltransferases. ChIP-seq analysis of the effector-free ATFs in MCF7 breast cancer cells identified thousands of binding sites, mostly in promoter regions; the addition of an SKD domain increased the number of binding sites ∼5-fold, with a majority of the new sites located outside of promoters. De novo motif analyses suggest that the lack of binding specificity is due to subsets of the finger domains being used for genomic interactions. Although the ATFs display widespread binding, few genes showed expression differences; genes repressed by the ATF-SKD have stronger binding sites and are more enriched for a 12 nt motif. Interestingly, epigenetic analyses indicate that the transcriptional repression caused by the ATF-SKD is not due to changes in active histone modifications. PMID:25122745

  12. A web server for analysis, comparison and prediction of protein ligand binding sites.

    PubMed

    Singh, Harinder; Srivastava, Hemant Kumar; Raghava, Gajendra P S

    2016-03-25

    One of the major challenges in the field of system biology is to understand the interaction between a wide range of proteins and ligands. In the past, methods have been developed for predicting binding sites in a protein for a limited number of ligands. In order to address this problem, we developed a web server named 'LPIcom' to facilitate users in understanding protein-ligand interaction. Analysis, comparison and prediction modules are available in the "LPIcom' server to predict protein-ligand interacting residues for 824 ligands. Each ligand must have at least 30 protein binding sites in PDB. Analysis module of the server can identify residues preferred in interaction and binding motif for a given ligand; for example residues glycine, lysine and arginine are preferred in ATP binding sites. Comparison module of the server allows comparing protein-binding sites of multiple ligands to understand the similarity between ligands based on their binding site. This module indicates that ATP, ADP and GTP ligands are in the same cluster and thus their binding sites or interacting residues exhibit a high level of similarity. Propensity-based prediction module has been developed for predicting ligand-interacting residues in a protein for more than 800 ligands. In addition, a number of web-based tools have been integrated to facilitate users in creating web logo and two-sample between ligand interacting and non-interacting residues. In summary, this manuscript presents a web-server for analysis of ligand interacting residue. This server is available for public use from URL http://crdd.osdd.net/raghava/lpicom .

  13. Theoretical Insights into Methane C–H Bond Activation on Alkaline Metal Oxides

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Aljama, Hassan; Nørskov, Jens K.; Abild-Pedersen, Frank

    Here, we investigate the role of alkaline metal oxides (AMO) (MgO, CaO, and SrO) in activating the C–H bond in methane. We also use Density Functional Theory (DFT) and microkinetic modeling to study the catalytic elementary steps in breaking the C–H bond in methane and creating the methyl radical, a precursor prior to creating C2 products. We also study the effects of surface geometry on the catalytic activity of AMO by examining terrace and step sites. We observe that the process of activating methane depends strongly on the structure of the AMO. When the AMO surface is doped with anmore » alkali metal, the transition state (TS) structure has a methyl radical-like behavior, where the methyl radical interacts weakly with the AMO surface. In this case, the TS energy scales with the hydrogen binding energy. On pure AMO, the TS interacts with AMO surface oxygen as well as the metal atom on the surface, and consequently the TS energy scales with the binding energy of hydrogen and methyl. We study the activity of AMO using a mean-field microkinetic model. The results indicate that terrace sites have similar catalytic activity, with the exception of MgO(100). Step sites bind hydrogen more strongly, making them more active, and this confirms previously reported experimental results. We map the catalytic activity of AMO using a volcano plot with two descriptors: the methyl and the hydrogen binding energies, with the latter being a more significant descriptor. The microkinetic model results suggest that C–H bond dissociation is not always the rate-limiting step. At weak hydrogen binding, the reaction is limited by C–H bond activation. At strong hydrogen binding, the reaction is limited due to poisoning of the active site. We found an increase in activity of AMO as the basicity increased. Finally, the developed microkinetic model allows screening for improved catalysts using simple calculations of the hydrogen binding energy.« less

  14. Theoretical Insights into Methane C–H Bond Activation on Alkaline Metal Oxides

    DOE PAGES

    Aljama, Hassan; Nørskov, Jens K.; Abild-Pedersen, Frank

    2017-07-17

    Here, we investigate the role of alkaline metal oxides (AMO) (MgO, CaO, and SrO) in activating the C–H bond in methane. We also use Density Functional Theory (DFT) and microkinetic modeling to study the catalytic elementary steps in breaking the C–H bond in methane and creating the methyl radical, a precursor prior to creating C2 products. We also study the effects of surface geometry on the catalytic activity of AMO by examining terrace and step sites. We observe that the process of activating methane depends strongly on the structure of the AMO. When the AMO surface is doped with anmore » alkali metal, the transition state (TS) structure has a methyl radical-like behavior, where the methyl radical interacts weakly with the AMO surface. In this case, the TS energy scales with the hydrogen binding energy. On pure AMO, the TS interacts with AMO surface oxygen as well as the metal atom on the surface, and consequently the TS energy scales with the binding energy of hydrogen and methyl. We study the activity of AMO using a mean-field microkinetic model. The results indicate that terrace sites have similar catalytic activity, with the exception of MgO(100). Step sites bind hydrogen more strongly, making them more active, and this confirms previously reported experimental results. We map the catalytic activity of AMO using a volcano plot with two descriptors: the methyl and the hydrogen binding energies, with the latter being a more significant descriptor. The microkinetic model results suggest that C–H bond dissociation is not always the rate-limiting step. At weak hydrogen binding, the reaction is limited by C–H bond activation. At strong hydrogen binding, the reaction is limited due to poisoning of the active site. We found an increase in activity of AMO as the basicity increased. Finally, the developed microkinetic model allows screening for improved catalysts using simple calculations of the hydrogen binding energy.« less

  15. Calorimetric studies of the interactions of metalloenzyme active site mimetics with zinc-binding inhibitors.

    PubMed

    Robinson, Sophia G; Burns, Philip T; Miceli, Amanda M; Grice, Kyle A; Karver, Caitlin E; Jin, Lihua

    2016-07-19

    The binding of drugs to metalloenzymes is an intricate process that involves several interactions, including binding of the drug to the enzyme active site metal, as well as multiple interactions between the drug and the enzyme residues. In order to determine the free energy contribution of Zn(2+) binding by known metalloenzyme inhibitors without the other interactions, valid active site zinc structural mimetics must be formed and binding studies need to be performed in biologically relevant conditions. The potential of each of five ligands to form a structural mimetic with Zn(2+) was investigated in buffer using Isothermal Titration Calorimetry (ITC). All five ligands formed strong 1 : 1 (ligand : Zn(2+)) binary complexes. The complexes were used in further ITC experiments to study their interaction with 8-hydroxyquinoline (8-HQ) and/or acetohydroxamic acid (AHA), two bidentate anionic zinc-chelating enzyme inhibitors. It was found that tetradentate ligands were not suitable for creating zinc structural mimetics for inhibitor binding in solution due to insufficient coordination sites remaining on Zn(2+). A stable binary complex, [Zn(BPA)](2+), which was formed by a tridentate ligand, bis(2-pyridylmethyl)amine (BPA), was found to bind one AHA in buffer or a methanol : buffer mixture (60 : 40 by volume) at pH 7.25 or one 8-HQ in the methanol : buffer mixture at pH 6.80, making it an effective structural mimetic for the active site of zinc metalloenzymes. These results are consistent with the observation that metalloenzyme active site zinc ions have three residues coordinated to them, leaving one or two sites open for inhibitors to bind. Our findings indicate that Zn(BPA)X2 can be used as an active site structural mimetic for zinc metalloenzymes for estimating the free energy contribution of zinc binding to the overall inhibitor active site interactions. Such use will help aid in the rational design of inhibitors to a variety of zinc metalloenzymes.

  16. Membrane Modulates Affinity for Calcium Ion to Create an Apparent Cooperative Binding Response by Annexin a5

    PubMed Central

    Gauer, Jacob W.; Knutson, Kristofer J.; Jaworski, Samantha R.; Rice, Anne M.; Rannikko, Anika M.; Lentz, Barry R.; Hinderliter, Anne

    2013-01-01

    Isothermal titration calorimetry was used to characterize the binding of calcium ion (Ca2+) and phospholipid to the peripheral membrane-binding protein annexin a5. The phospholipid was a binary mixture of a neutral and an acidic phospholipid, specifically phosphatidylcholine and phosphatidylserine in the form of large unilamellar vesicles. To stringently define the mode of binding, a global fit of data collected in the presence and absence of membrane concentrations exceeding protein saturation was performed. A partition function defined the contribution of all heat-evolving or heat-absorbing binding states. We find that annexin a5 binds Ca2+ in solution according to a simple independent-site model (solution-state affinity). In the presence of phosphatidylserine-containing liposomes, binding of Ca2+ differentiates into two classes of sites, both of which have higher affinity compared with the solution-state affinity. As in the solution-state scenario, the sites within each class were described with an independent-site model. Transitioning from a solution state with lower Ca2+ affinity to a membrane-associated, higher Ca2+ affinity state, results in cooperative binding. We discuss how weak membrane association of annexin a5 prior to Ca2+ influx is the basis for the cooperative response of annexin a5 toward Ca2+, and the role of membrane organization in this response. PMID:23746516

  17. Light-driven Na + pump from Gillisia limnaea: A high-affinity Na + binding site is formed transiently in the photocycle

    DOE PAGES

    Balashov, Sergei P.; Imasheva, Eleonora S.; Dioumaev, Andrei K.; ...

    2014-11-06

    A group of microbial retinal proteins most closely related to the proton pump xanthorhodopsin has a novel sequence motif and a novel function. Instead of, or in addition to, proton transport, they perform light-driven sodium ion transport, as reported for one representative of this group (KR2) from Krokinobacter. In this paper, we examine a similar protein, GLR from Gillisia limnaea, expressed in Escherichia coli, which shares some properties with KR2 but transports only Na +. The absorption spectrum of GLR is insensitive to Na + at concentrations of ≤3 M. However, very low concentrations of Na + cause profound differencesmore » in the decay and rise time of photocycle intermediates, consistent with a switch from a “Na +-independent” to a “Na +-dependent” photocycle (or photocycle branch) at ~60 μM Na +. The rates of photocycle steps in the latter, but not the former, are linearly dependent on Na + concentration. This suggests that a high-affinity Na + binding site is created transiently after photoexcitation, and entry of Na + from the bulk to this site redirects the course of events in the remainder of the cycle. A greater concentration of Na + is needed for switching the reaction path at lower pH. The data suggest therefore competition between H + and Na + to determine the two alternative pathways. The idea that a Na + binding site can be created at the Schiff base counterion is supported by the finding that upon perturbation of this region in the D251E mutant, Na + binds without photoexcitation. Furthermore, binding of Na+ to the mutant shifts the chromophore maximum to the red like that of H +, which occurs in the photocycle of the wild type.« less

  18. Sugar-binding sites of the HA1 subcomponent of Clostridium botulinum type C progenitor toxin.

    PubMed

    Nakamura, Toshio; Tonozuka, Takashi; Ide, Azusa; Yuzawa, Takayuki; Oguma, Keiji; Nishikawa, Atsushi

    2008-02-22

    Clostridium botulinum type C 16S progenitor toxin contains a hemagglutinin (HA) subcomponent, designated HA1, which appears to play an important role in the effective internalization of the toxin in gastrointestinal epithelial cells and in creating a broad specificity for the oligosaccharide structure that corresponds to various targets. In this study, using the recombinant protein fused to glutathione S-transferase, we investigated the binding specificity of the HA1 subcomponent to sugars and estimated the binding sites of HA1 based on X-ray crystallography and soaking experiments using various sugars. N-Acetylneuraminic acid, N-acetylgalactosamine, and galactose effectively inhibited the binding that occurs between glutathione S-transferase-HA1 and mucins, whereas N-acetylglucosamine and glucose did not inhibit it. The crystal structures of HA1 complex with N-acetylneuraminic acid, N-acetylgalactosamine, and galactose were also determined. There are two sugar-binding sites, sites I and II. Site I corresponds to the electron densities noted for all sugars and is located at the C-terminal beta-trefoil domain, while site II corresponds to the electron densities noted only for galactose. An aromatic amino acid residue, Trp176, at site I has a stacking interaction with the hexose ring of the sugars. On the other hand, there is no aromatic residue at site II; thus, the interaction with galactose seems to be poor. The double mutant W176A at site I and D271F at site II has no avidity for N-acetylneuraminic acid but has avidity for galactose. In this report, the binding specificity of botulinum C16S toxin HA1 to various sugars is demonstrated based on its structural features.

  19. The High-Affinity Binding Site for Tricyclic Antidepressants Resides in the Outer Vestibule of the Serotonin TransporterⓈ

    PubMed Central

    Sarker, Subhodeep; Weissensteiner, René; Steiner, Ilka; Sitte, Harald H.; Ecker, Gerhard F.; Freissmuth, Michael; Sucic, Sonja

    2015-01-01

    The structure of the bacterial leucine transporter from Aquifex aeolicus (LeuTAa) has been used as a model for mammalian Na+/Cl−-dependent transporters, in particular the serotonin transporter (SERT). The crystal structure of LeuTAa liganded to tricyclic antidepressants predicts simultaneous binding of inhibitor and substrate. This is incompatible with the mutually competitive inhibition of substrates and inhibitors of SERT. We explored the binding modes of tricyclic antidepressants by homology modeling and docking studies. Two approaches were used subsequently to differentiate between three clusters of potential docking poses: 1) a diagnostic SERTY95F mutation, which greatly reduced the affinity for [3H]imipramine but did not affect substrate binding; 2) competition binding experiments in the presence and absence of carbamazepine (i.e., a tricyclic imipramine analog with a short side chain that competes with [3H]imipramine binding to SERT). Binding of releasers (para-chloroamphetamine, methylene-dioxy-methamphetamine/ecstasy) and of carbamazepine were mutually exclusive, but Dixon plots generated in the presence of carbamazepine yielded intersecting lines for serotonin, MPP+, paroxetine, and ibogaine. These observations are consistent with a model, in which 1) the tricyclic ring is docked into the outer vestibule and the dimethyl-aminopropyl side chain points to the substrate binding site; 2) binding of amphetamines creates a structural change in the inner and outer vestibule that precludes docking of the tricyclic ring; 3) simultaneous binding of ibogaine (which binds to the inward-facing conformation) and of carbamazepine is indicative of a second binding site in the inner vestibule, consistent with the pseudosymmetric fold of monoamine transporters. This may be the second low-affinity binding site for antidepressants. PMID:20829432

  20. Rational design of a conformation-switchable Ca2+- and Tb3+-binding protein without the use of multiple coupled metal-binding sites.

    PubMed

    Li, Shunyi; Yang, Wei; Maniccia, Anna W; Barrow, Doyle; Tjong, Harianto; Zhou, Huan-Xiang; Yang, Jenny J

    2008-10-01

    Ca2+, as a messenger of signal transduction, regulates numerous target molecules via Ca2+-induced conformational changes. Investigation into the determinants for Ca2+-induced conformational change is often impeded by cooperativity between multiple metal-binding sites or protein oligomerization in naturally occurring proteins. To dissect the relative contributions of key determinants for Ca2+-dependent conformational changes, we report the design of a single-site Ca2+-binding protein (CD2.trigger) created by altering charged residues at an electrostatically sensitive location on the surface of the host protein rat Cluster of Differentiation 2 (CD2).CD2.trigger binds to Tb3+ and Ca2+ with dissociation constants of 0.3 +/- 0.1 and 90 +/- 25 microM, respectively. This protein is largely unfolded in the absence of metal ions at physiological pH, but Tb3+ or Ca2+ binding results in folding of the native-like conformation. Neutralization of the charged coordination residues, either by mutation or protonation, similarly induces folding of the protein. The control of a major conformational change by a single Ca2+ ion, achieved on a protein designed without reliance on sequence similarity to known Ca2+-dependent proteins and coupled metal-binding sites, represents an important step in the design of trigger proteins.

  1. Pretargeted Molecular Imaging and Radioimmunotherapy

    PubMed Central

    Goldenberg, David M.; Chang, Chien-Hsing; Rossi, Edmund A.; J, William; McBride; Sharkey, Robert M.

    2012-01-01

    Pretargeting is a multi-step process that first has an unlabeled bispecific antibody (bsMAb) localize within a tumor by virtue of its anti-tumor binding site(s) before administering a small, fast-clearing radiolabeled compound that then attaches to the other portion of the bsMAb. The compound's rapid clearance significantly reduces radiation exposure outside of the tumor and its small size permits speedy delivery to the tumor, creating excellent tumor/nontumor ratios in less than 1 hour. Haptens that bind to an anti-hapten antibody, biotin that binds to streptavidin, or an oligonucleotide binding to a complementary oligonucleotide sequence have all been radiolabeled for use by pretargeting. This review will focus on a highly flexible anti-hapten bsMAb platform that has been used to target a variety of radionuclides to image (SPECT and PET) as well as treat tumors. PMID:22737190

  2. Automated docking of ligands to an artificial active site: augmenting crystallographic analysis with computer modeling

    NASA Astrophysics Data System (ADS)

    Rosenfeld, Robin J.; Goodsell, David S.; Musah, Rabi A.; Morris, Garrett M.; Goodin, David B.; Olson, Arthur J.

    2003-08-01

    The W191G cavity of cytochrome c peroxidase is useful as a model system for introducing small molecule oxidation in an artificially created cavity. A set of small, cyclic, organic cations was previously shown to bind in the buried, solvent-filled pocket created by the W191G mutation. We docked these ligands and a set of non-binders in the W191G cavity using AutoDock 3.0. For the ligands, we compared docking predictions with experimentally determined binding energies and X-ray crystal structure complexes. For the ligands, predicted binding energies differed from measured values by ± 0.8 kcal/mol. For most ligands, the docking simulation clearly predicted a single binding mode that matched the crystallographic binding mode within 1.0 Å RMSD. For 2 ligands, where the docking procedure yielded an ambiguous result, solutions matching the crystallographic result could be obtained by including an additional crystallographically observed water molecule in the protein model. For the remaining 2 ligands, docking indicated multiple binding modes, consistent with the original electron density, suggesting disordered binding of these ligands. Visual inspection of the atomic affinity grid maps used in docking calculations revealed two patches of high affinity for hydrogen bond donating groups. Multiple solutions are predicted as these two sites compete for polar hydrogens in the ligand during the docking simulation. Ligands could be distinguished, to some extent, from non-binders using a combination of two trends: predicted binding energy and level of clustering. In summary, AutoDock 3.0 appears to be useful in predicting key structural and energetic features of ligand binding in the W191G cavity.

  3. DNA-Templated Introduction of an Aldehyde Handle in Proteins.

    PubMed

    Kodal, Anne Louise B; Rosen, Christian B; Mortensen, Michael R; Tørring, Thomas; Gothelf, Kurt V

    2016-07-15

    Many medical and biotechnological applications rely on protein labeling, but a key challenge is the production of homogeneous and site-specific conjugates. This can rarely be achieved by simple residue-specific random labeling, but generally requires genetic engineering. Using site-selective DNA-templated reductive amination, we created DNA-protein conjugates with control over labeling stoichiometry and without genetic engineering. A guiding DNA strand with a metal-binding functionality facilitates site-selectivity by directing the coupling of a second reactive DNA strand in the vicinity of a protein metal-binding site. We demonstrate DNA-templated reductive amination for His6 -tagged proteins and metal-binding proteins, including IgG1 antibodies. We also used a cleavable linker between the DNA and the protein to remove the DNA and introduce a single aldehyde on the protein. This functions as a handle for further modifications with desired labels. In addition to directing the aldehyde positioning, the DNA provides a straightforward route for purification between reaction steps. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Novel pppGpp binding site at the C-terminal region of the Rel enzyme from Mycobacterium smegmatis.

    PubMed

    Syal, Kirtimaan; Joshi, Himanshu; Chatterji, Dipankar; Jain, Vikas

    2015-10-01

    Mycobacterium tuberculosis elicits the stringent response under unfavorable growth conditions, such as those encountered by the pathogen inside the host. The hallmark of this response is production of guanosine tetra- and pentaphosphates, collectively termed (p)ppGpp, which have pleiotropic effects on the bacterial physiology. As the stringent response is connected to survival under stress, it is now being targeted for developing inhibitors against bacterial persistence. The Rel enzyme in mycobacteria has two catalytic domains at its N-terminus that are involved in the synthesis and hydrolysis of (p)ppGpp, respectively. However, the function of the C-terminal region of the protein remained unknown. Here, we have identified a binding site for pppGpp in the C-terminal region of Rel. The binding affinity of pppGpp was quantified by isothermal titration calorimetry. The binding site was determined by crosslinking using the nucleotide analog azido-pppGpp, and examining the crosslink product by mass spectrometry. Additionally, mutations in the Rel protein were created to confirm the site of pppGpp binding by isothermal titration calorimetry. These mutants showed increased pppGpp synthesis and reduced hydrolytic activity. We believe that binding of pppGpp to Rel provides a feedback mechanism that allows the protein to detect and adjust the (p)ppGpp level in the cell. Our work suggests that such sites should also be considered while designing inhibitors to target the stringent response. © 2015 FEBS.

  5. A membrane-embedded pathway delivers general anesthetics to two interacting binding sites in the Gloeobacter violaceus ion channel.

    PubMed

    Arcario, Mark J; Mayne, Christopher G; Tajkhorshid, Emad

    2017-06-09

    General anesthetics exert their effects on the central nervous system by acting on ion channels, most notably pentameric ligand-gated ion channels. Although numerous studies have focused on pentameric ligand-gated ion channels, the details of anesthetic binding and channel modulation are still debated. A better understanding of the anesthetic mechanism of action is necessary for the development of safer and more efficacious drugs. Herein, we present a computational study identifying two anesthetic binding sites in the transmembrane domain of the Gloeobacter violaceus ligand-gated ion channel (GLIC) channel, characterize the putative binding pathway, and observe structural changes associated with channel function. Molecular simulations of desflurane reveal a binding pathway to GLIC via a membrane-embedded tunnel using an intrasubunit protein lumen as the conduit, an observation that explains the Meyer-Overton hypothesis, or why the lipophilicity of an anesthetic and its potency are generally proportional. Moreover, employing high concentrations of ligand led to the identification of a second transmembrane site (TM2) that inhibits dissociation of anesthetic from the TM1 site and is consistent with the high concentrations of anesthetics required to achieve clinical effects. Finally, asymmetric binding patterns of anesthetic to the channel were found to promote an iris-like conformational change that constricts and dehydrates the ion pore, creating a 13.5 kcal/mol barrier to ion translocation. Together with previous studies, the simulations presented herein demonstrate a novel anesthetic binding site in GLIC that is accessed through a membrane-embedded tunnel and interacts with a previously known site, resulting in conformational changes that produce a non-conductive state of the channel. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  6. A Novel Fucose-binding Lectin from Photorhabdus luminescens (PLL) with an Unusual Heptabladed β-Propeller Tetrameric Structure*

    PubMed Central

    Kumar, Atul; Sýkorová, Petra; Demo, Gabriel; Dobeš, Pavel; Hyršl, Pavel

    2016-01-01

    Photorhabdus luminescens is known for its symbiosis with the entomopathogenic nematode Heterorhabditis bacteriophora and its pathogenicity toward insect larvae. A hypothetical protein from P. luminescens was identified, purified from the native source, and characterized as an l-fucose-binding lectin, named P. luminescens lectin (PLL). Glycan array and biochemical characterization data revealed PLL to be specific toward l-fucose and the disaccharide glycan 3,6-O-Me2-Glcβ1–4(2,3-O-Me2)Rhaα-O-(p-C6H4)-OCH2CH2NH2. PLL was discovered to be a homotetramer with an intersubunit disulfide bridge. The crystal structures of native and recombinant PLL revealed a seven-bladed β-propeller fold creating seven putative fucose-binding sites per monomer. The crystal structure of the recombinant PLL·l-fucose complex confirmed that at least three sites were fucose-binding. Moreover, the crystal structures indicated that some of the other sites are masked either by the tetrameric nature of the lectin or by incorporation of the C terminus of the lectin into one of these sites. PLL exhibited an ability to bind to insect hemocytes and the cuticular surface of a nematode, H. bacteriophora. PMID:27758853

  7. Tricyclic GyrB/ParE (TriBE) Inhibitors: A New Class of Broad-Spectrum Dual-Targeting Antibacterial Agents

    PubMed Central

    Tari, Leslie W.; Li, Xiaoming; Trzoss, Michael; Bensen, Daniel C.; Chen, Zhiyong; Lam, Thanh; Zhang, Junhu; Lee, Suk Joong; Hough, Grayson; Phillipson, Doug; Akers-Rodriguez, Suzanne; Cunningham, Mark L.; Kwan, Bryan P.; Nelson, Kirk J.; Castellano, Amanda; Locke, Jeff B.; Brown-Driver, Vickie; Murphy, Timothy M.; Ong, Voon S.; Pillar, Chris M.; Shinabarger, Dean L.; Nix, Jay; Lightstone, Felice C.; Wong, Sergio E.; Nguyen, Toan B.; Shaw, Karen J.; Finn, John

    2013-01-01

    Increasing resistance to every major class of antibiotics and a dearth of novel classes of antibacterial agents in development pipelines has created a dwindling reservoir of treatment options for serious bacterial infections. The bacterial type IIA topoisomerases, DNA gyrase and topoisomerase IV, are validated antibacterial drug targets with multiple prospective drug binding sites, including the catalytic site targeted by the fluoroquinolone antibiotics. However, growing resistance to fluoroquinolones, frequently mediated by mutations in the drug-binding site, is increasingly limiting the utility of this antibiotic class, prompting the search for other inhibitor classes that target different sites on the topoisomerase complexes. The highly conserved ATP-binding subunits of DNA gyrase (GyrB) and topoisomerase IV (ParE) have long been recognized as excellent candidates for the development of dual-targeting antibacterial agents with broad-spectrum potential. However, to date, no natural product or small molecule inhibitors targeting these sites have succeeded in the clinic, and no inhibitors of these enzymes have yet been reported with broad-spectrum antibacterial activity encompassing the majority of Gram-negative pathogens. Using structure-based drug design (SBDD), we have created a novel dual-targeting pyrimidoindole inhibitor series with exquisite potency against GyrB and ParE enzymes from a broad range of clinically important pathogens. Inhibitors from this series demonstrate potent, broad-spectrum antibacterial activity against Gram-positive and Gram-negative pathogens of clinical importance, including fluoroquinolone resistant and multidrug resistant strains. Lead compounds have been discovered with clinical potential; they are well tolerated in animals, and efficacious in Gram-negative infection models. PMID:24386374

  8. Transposable Elements and DNA Methylation Create in Embryonic Stem Cells Human-Specific Regulatory Sequences Associated with Distal Enhancers and Noncoding RNAs

    PubMed Central

    Glinsky, Gennadi V.

    2015-01-01

    Despite significant progress in the structural and functional characterization of the human genome, understanding of the mechanisms underlying the genetic basis of human phenotypic uniqueness remains limited. Here, I report that transposable element-derived sequences, most notably LTR7/HERV-H, LTR5_Hs, and L1HS, harbor 99.8% of the candidate human-specific regulatory loci (HSRL) with putative transcription factor-binding sites in the genome of human embryonic stem cells (hESC). A total of 4,094 candidate HSRL display selective and site-specific binding of critical regulators (NANOG [Nanog homeobox], POU5F1 [POU class 5 homeobox 1], CCCTC-binding factor [CTCF], Lamin B1), and are preferentially located within the matrix of transcriptionally active DNA segments that are hypermethylated in hESC. hESC-specific NANOG-binding sites are enriched near the protein-coding genes regulating brain size, pluripotency long noncoding RNAs, hESC enhancers, and 5-hydroxymethylcytosine-harboring regions immediately adjacent to binding sites. Sequences of only 4.3% of hESC-specific NANOG-binding sites are present in Neanderthals’ genome, suggesting that a majority of these regulatory elements emerged in Modern Humans. Comparisons of estimated creation rates of novel TF-binding sites revealed that there was 49.7-fold acceleration of creation rates of NANOG-binding sites in genomes of Chimpanzees compared with the mouse genomes and further 5.7-fold acceleration in genomes of Modern Humans compared with the Chimpanzees genomes. Preliminary estimates suggest that emergence of one novel NANOG-binding site detectable in hESC required 466 years of evolution. Pathway analysis of coding genes that have hESC-specific NANOG-binding sites within gene bodies or near gene boundaries revealed their association with physiological development and functions of nervous and cardiovascular systems, embryonic development, behavior, as well as development of a diverse spectrum of pathological conditions such as cancer, diseases of cardiovascular and reproductive systems, metabolic diseases, multiple neurological and psychological disorders. A proximity placement model is proposed explaining how a 33–47% excess of NANOG, CTCF, and POU5F1 proteins immobilized on a DNA scaffold may play a functional role at distal regulatory elements. PMID:25956794

  9. SNP2TFBS - a database of regulatory SNPs affecting predicted transcription factor binding site affinity.

    PubMed

    Kumar, Sunil; Ambrosini, Giovanna; Bucher, Philipp

    2017-01-04

    SNP2TFBS is a computational resource intended to support researchers investigating the molecular mechanisms underlying regulatory variation in the human genome. The database essentially consists of a collection of text files providing specific annotations for human single nucleotide polymorphisms (SNPs), namely whether they are predicted to abolish, create or change the affinity of one or several transcription factor (TF) binding sites. A SNP's effect on TF binding is estimated based on a position weight matrix (PWM) model for the binding specificity of the corresponding factor. These data files are regenerated at regular intervals by an automatic procedure that takes as input a reference genome, a comprehensive SNP catalogue and a collection of PWMs. SNP2TFBS is also accessible over a web interface, enabling users to view the information provided for an individual SNP, to extract SNPs based on various search criteria, to annotate uploaded sets of SNPs or to display statistics about the frequencies of binding sites affected by selected SNPs. Homepage: http://ccg.vital-it.ch/snp2tfbs/. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  10. Insulator protein Su(Hw) recruits SAGA and Brahma complexes and constitutes part of Origin Recognition Complex-binding sites in the Drosophila genome

    PubMed Central

    Vorobyeva, Nadezhda E.; Mazina, Marina U.; Golovnin, Anton K.; Kopytova, Daria V.; Gurskiy, Dmitriy Y.; Nabirochkina, Elena N.; Georgieva, Sofia G.; Georgiev, Pavel G.; Krasnov, Aleksey N.

    2013-01-01

    Despite increasing data on the properties of replication origins, molecular mechanisms underlying origin recognition complex (ORC) positioning in the genome are still poorly understood. The Su(Hw) protein accounts for the activity of best-studied Drosophila insulators. Here, we show that Su(Hw) recruits the histone acetyltransferase complex SAGA and chromatin remodeler Brahma to Su(Hw)-dependent insulators, which gives rise to regions with low nucleosome density and creates conditions for ORC binding. Depletion in Su(Hw) leads to a dramatic drop in the levels of SAGA, Brahma and ORC subunits and a significant increase in nucleosome density on Su(Hw)-dependent insulators, whereas artificial Su(Hw) recruitment itself is sufficient for subsequent SAGA, Brahma and ORC binding. In contrast to the majority of replication origins that associate with promoters of active genes, Su(Hw)-binding sites constitute a small proportion (6%) of ORC-binding sites that are localized preferentially in transcriptionally inactive chromatin regions termed BLACK and BLUE chromatin. We suggest that the key determinants of ORC positioning in the genome are DNA-binding proteins that constitute different DNA regulatory elements, including insulators, promoters and enhancers. Su(Hw) is the first example of such a protein. PMID:23609538

  11. Steric and thermodynamic limits of design for the incorporation of large unnatural amino acids in aminoacyl-tRNA synthetase enzymes.

    PubMed

    Armen, Roger S; Schiller, Stefan M; Brooks, Charles L

    2010-06-01

    Orthogonal aminoacyl-tRNA synthetase/tRNA pairs from archaea have been evolved to facilitate site specific in vivo incorporation of unnatural amino acids into proteins in Escherichia coli. Using this approach, unnatural amino acids have been successfully incorporated with high translational efficiency and fidelity. In this study, CHARMM-based molecular docking and free energy calculations were used to evaluate rational design of specific protein-ligand interactions for aminoacyl-tRNA synthetases. A series of novel unnatural amino acid ligands were docked into the p-benzoyl-L-phenylalanine tRNA synthetase, which revealed that the binding pocket of the enzyme does not provide sufficient space for significantly larger ligands. Specific binding site residues were mutated to alanine to create additional space to accommodate larger target ligands, and then mutations were introduced to improve binding free energy. This approach was used to redesign binding sites for several different target ligands, which were then tested against the standard 20 amino acids to verify target specificity. Only the synthetase designed to bind Man-alpha-O-Tyr was predicted to be sufficiently selective for the target ligand and also thermodynamically stable. Our study suggests that extensive redesign of the tRNA synthatase binding pocket for large bulky ligands may be quite thermodynamically unfavorable.

  12. The PP1 binding code: a molecular-lego strategy that governs specificity.

    PubMed

    Heroes, Ewald; Lesage, Bart; Görnemann, Janina; Beullens, Monique; Van Meervelt, Luc; Bollen, Mathieu

    2013-01-01

    Ser/Thr protein phosphatase 1 (PP1) is a single-domain hub protein with nearly 200 validated interactors in vertebrates. PP1-interacting proteins (PIPs) are ubiquitously expressed but show an exceptional diversity in brain, testis and white blood cells. The binding of PIPs is mainly mediated by short motifs that dock to surface grooves of PP1. Although PIPs often contain variants of the same PP1 binding motifs, they differ in the number and combination of docking sites. This molecular-lego strategy for binding to PP1 creates holoenzymes with unique properties. The PP1 binding code can be described as specific, universal, degenerate, nonexclusive and dynamic. PIPs control associated PP1 by interference with substrate recruitment or access to the active site. In addition, some PIPs have a subcellular targeting domain that promotes dephosphorylation by increasing the local concentration of PP1. The diversity of the PP1 interactome and the properties of the PP1 binding code account for the exquisite specificity of PP1 in vivo. © 2012 The Authors Journal compilation © 2012 FEBS.

  13. How actin binds and assembles onto plasma membranes from Dictyostelium discoideum

    PubMed Central

    1988-01-01

    We have shown previously (Schwartz, M. A., and E. J. Luna. 1986. J. Cell Biol. 102: 2067-2075) that actin binds with positive cooperativity to plasma membranes from Dictyostelium discoideum. Actin is polymerized at the membrane surface even at concentrations well below the critical concentration for polymerization in solution. Low salt buffer that blocks actin polymerization in solution also prevents actin binding to membranes. To further explore the relationship between actin polymerization and binding to membranes, we prepared four chemically modified actins that appear to be incapable of polymerizing in solution. Three of these derivatives also lost their ability to bind to membranes. The fourth derivative (EF actin), in which histidine-40 is labeled with ethoxyformic anhydride, binds to membranes with reduced affinity. Binding curves exhibit positive cooperativity, and cross- linking experiments show that membrane-bound actin is multimeric. Thus, binding and polymerization are tightly coupled, and the ability of these membranes to polymerize actin is dramatically demonstrated. EF actin coassembles weakly with untreated actin in solution, but coassembles well on membranes. Binding by untreated actin and EF actin are mutually competitive, indicating that they bind to the same membrane sites. Hill plots indicate that an actin trimer is the minimum assembly state required for tight binding to membranes. The best explanation for our data is a model in which actin oligomers assemble by binding to clustered membrane sites with successive monomers on one side of the actin filament bound to the membrane. Individual binding affinities are expected to be low, but the overall actin-membrane avidity is high, due to multivalency. Our results imply that extracellular factors that cluster membrane proteins may create sites for the formation of actin nuclei and thus trigger actin polymerization in the cell. PMID:3392099

  14. In silico analysis of miRNA-mediated gene regulation in OCA and OA genes.

    PubMed

    Kamaraj, Balu; Gopalakrishnan, Chandrasekhar; Purohit, Rituraj

    2014-12-01

    Albinism is an autosomal recessive genetic disorder due to low secretion of melanin. The oculocutaneous albinism (OCA) and ocular albinism (OA) genes are responsible for melanin production and also act as a potential targets for miRNAs. The role of miRNA is to inhibit the protein synthesis partially or completely by binding with the 3'UTR of the mRNA thus regulating gene expression. In this analysis, we predicted the genetic variation that occurred in 3'UTR of the transcript which can be a reason for low melanin production thus causing albinism. The single nucleotide polymorphisms (SNPs) in 3'UTR cause more new binding sites for miRNA which binds with mRNA which leads to inhibit the translation process either partially or completely. The SNPs in the mRNA of OCA and OA genes can create new binding sites for miRNA which may control the gene expression and lead to hypopigmentation. We have developed a computational procedure to determine the SNPs in the 3'UTR region of mRNA of OCA (TYR, OCA2, TYRP1 and SLC45A2) and OA (GPR143) genes which will be a potential cause for albinism. We identified 37 SNPs in five genes that are predicted to create 87 new binding sites on mRNA, which may lead to abrogation of the translation process. Expression analysis confirms that these genes are highly expressed in skin and eye regions. It is well supported by enrichment analysis that these genes are mainly involved in eye pigmentation and melanin biosynthesis process. The network analysis also shows how the genes are interacting and expressing in a complex network. This insight provides clue to wet-lab researches to understand the expression pattern of OCA and OA genes and binding phenomenon of mRNA and miRNA upon mutation, which is responsible for inhibition of translation process at genomic levels.

  15. Evidence for in vivo phosphorylation of the Grb2 SH2-domain binding site on focal adhesion kinase by Src-family protein-tyrosine kinases.

    PubMed

    Schlaepfer, D D; Hunter, T

    1996-10-01

    Focal adhesion kinase (FAK) is a nonreceptor protein-tyrosine kinase (PTK) that associates with integrin receptors and participates in extracellular matrix-mediated signal transduction events. We showed previously that the c-Src nonreceptor PTK and the Grb2 SH2/SH3 adaptor protein bound directly to FAK after fibronectin stimulation (D. D. Schlaepfer, S.K. Hanks, T. Hunter, and P. van der Geer, Nature [London] 372:786-791, 1994). Here, we present evidence that c-Src association with FAK is required for Grb2 binding to FAK. Using a tryptic phosphopeptide mapping approach, the in vivo phosphorylation of the Grb2 binding site on FAK (Tyr-925) was detected after fibronectin stimulation of NIH 3T3 cells and was constitutively phosphorylated in v-Src-transformed NIH 3T3 cells. In vitro, c-Src phosphorylated FAK Tyr-925 in a glutathione S-transferase-FAK C-terminal domain fusion protein, whereas FAK did not. Using epitope-tagged FAK constructs, transiently expressed in human 293 cells, we determined the effect of site-directed mutations on c-Src and Grb2 binding to FAK. Mutation of FAK Tyr-925 disrupted Grb2 binding, whereas mutation of the c-Src binding site on FAK (Tyr-397) disrupted both c-Src and Grb2 binding to FAK in vivo. These results support a model whereby Src-family PTKs are recruited to FAK and focal adhesions following integrin-induced autophosphorylation and exposure of FAK Tyr-397. Src-family binding and phosphorylation of FAK at Tyr-925 creates a Grb2 SH2-domain binding site and provides a link to the activation of the Ras signal transduction pathway. In Src-transformed cells, this pathway may be constitutively activated as a result of FAK Tyr-925 phosphorylation in the absence of integrin stimulation.

  16. Computational Optimization and Characterization of Molecularly Imprinted Polymers

    NASA Astrophysics Data System (ADS)

    Terracina, Jacob J.

    Molecularly imprinted polymers (MIPs) are a class of materials containing sites capable of selectively binding to the imprinted target molecule. Computational chemistry techniques were used to study the effect of different fabrication parameters (the monomer-to-target ratios, pre-polymerization solvent, temperature, and pH) on the formation of the MIP binding sites. Imprinted binding sites were built in silico for the purposes of better characterizing the receptor - ligand interactions. Chiefly, the sites were characterized with respect to their selectivities and the heterogeneity between sites. First, a series of two-step molecular mechanics (MM) and quantum mechanics (QM) computational optimizations of monomer -- target systems was used to determine optimal monomer-to-target ratios for the MIPs. Imidazole- and xanthine-derived target molecules were studied. The investigation included both small-scale models (one-target) and larger scale models (five-targets). The optimal ratios differed between the small and larger scales. For the larger models containing multiple targets, binding-site surface area analysis was used to evaluate the heterogeneity of the sites. The more fully surrounded sites had greater binding energies. Molecular docking was then used to measure the selectivities of the QM-optimized binding sites by comparing the binding energies of the imprinted target to that of a structural analogue. Selectivity was also shown to improve as binding sites become more fully encased by the monomers. For internal sites, docking consistently showed selectivity favoring the molecules that had been imprinted via QM geometry optimizations. The computationally imprinted sites were shown to exhibit size-, shape-, and polarity-based selectivity. This represented a novel approach to investigate the selectivity and heterogeneity of imprinted polymer binding sites, by applying the rapid orientation screening of MM docking to the highly accurate QM-optimized geometries. Next, we sought to computationally construct and investigate binding sites for their enantioselectivity. Again, a two-step MM [special characters removed] QM optimization scheme was used to "computationally imprint" chiral molecules. Using docking techniques, the imprinted binding sites were shown to exhibit an enantioselective preference for the imprinted molecule over its enantiomer. Docking of structurally similar chiral molecules showed that the sites computationally imprinted with R- or S-tBOC-tyrosine were able to differentiate between R- and S-forms of other tyrosine derivatives. The cross-enantioselectivity did not hold for chiral molecules that did not share the tyrosine H-bonding functional group orientations. Further analysis of the individual monomer - target interactions within the binding site led us to conclude that H-bonding functional groups that are located immediately next to the target's chiral center, and therefore spatially fixed relative to the chiral center, will have a stronger contribution to the enantioselectivity of the site than those groups separated from the chiral center by two or more rotatable bonds. These models were the first computationally imprinted binding sites to exhibit this enantioselective preference for the imprinted target molecules. Finally, molecular dynamics (MD) was used to quantify H-bonding interactions between target molecules, monomers, and solvents representative of the pre-polymerization matrix. It was found that both target dimerization and solvent interference decrease the number of monomer - target H-bonds present. Systems were optimized via simulated annealing to create binding sites that were then subjected to molecular docking analysis. Docking showed that the presence of solvent had a detrimental effect on the sensitivity and selectivity of the sites, and that solvents with more H-bonding capabilities were more disruptive to the binding properties of the site. Dynamic simulations also showed that increasing the temperature of the solution can significantly decrease the number of H-bonds formed between the targets and monomers. It is believed that the monomer - target complexes formed within the pre-polymerization matrix are translated into the selective binding cavities formed during polymerization. Elucidating the nature of these interactions in silico improves our understanding of MIPs, ultimately allowing for more optimized sensing materials.

  17. Development of a sugar-binding residue prediction system from protein sequences using support vector machine.

    PubMed

    Banno, Masaki; Komiyama, Yusuke; Cao, Wei; Oku, Yuya; Ueki, Kokoro; Sumikoshi, Kazuya; Nakamura, Shugo; Terada, Tohru; Shimizu, Kentaro

    2017-02-01

    Several methods have been proposed for protein-sugar binding site prediction using machine learning algorithms. However, they are not effective to learn various properties of binding site residues caused by various interactions between proteins and sugars. In this study, we classified sugars into acidic and nonacidic sugars and showed that their binding sites have different amino acid occurrence frequencies. By using this result, we developed sugar-binding residue predictors dedicated to the two classes of sugars: an acid sugar binding predictor and a nonacidic sugar binding predictor. We also developed a combination predictor which combines the results of the two predictors. We showed that when a sugar is known to be an acidic sugar, the acidic sugar binding predictor achieves the best performance, and showed that when a sugar is known to be a nonacidic sugar or is not known to be either of the two classes, the combination predictor achieves the best performance. Our method uses only amino acid sequences for prediction. Support vector machine was used as a machine learning algorithm and the position-specific scoring matrix created by the position-specific iterative basic local alignment search tool was used as the feature vector. We evaluated the performance of the predictors using five-fold cross-validation. We have launched our system, as an open source freeware tool on the GitHub repository (https://doi.org/10.5281/zenodo.61513). Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

  18. Antigen Binding and Site-Directed Labeling of Biosilica-Immobilized Fusion Proteins Expressed in Diatoms.

    PubMed

    Ford, Nicole R; Hecht, Karen A; Hu, DeHong; Orr, Galya; Xiong, Yijia; Squier, Thomas C; Rorrer, Gregory L; Roesijadi, Guritno

    2016-03-18

    The diatom Thalassiosira pseudonana was genetically modified to express biosilica-targeted fusion proteins comprising either enhanced green fluorescent protein (EGFP) or single chain antibodies engineered with a tetracysteine tagging sequence. Of interest were the site-specific binding of (1) the fluorescent biarsenical probe AsCy3 and AsCy3e to the tetracysteine tagged fusion proteins and (2) high and low molecular mass antigens, the Bacillus anthracis surface layer protein EA1 or small molecule explosive trinitrotoluene (TNT), to biosilica-immobilized single chain antibodies. Analysis of biarsenical probe binding using fluorescence and structured illumination microscopy indicated differential colocalization with EGFP in nascent and mature biosilica, supporting the use of either EGFP or bound AsCy3 and AsCy3e in studying biosilica maturation. Large increases in the lifetime of a fluorescent analogue of TNT upon binding single chain antibodies provided a robust signal capable of discriminating binding to immobilized antibodies in the transformed frustule from nonspecific binding to the biosilica matrix. In conclusion, our results demonstrate an ability to engineer diatoms to create antibody-functionalized mesoporous silica able to selectively bind chemical and biological agents for the development of sensing platforms.

  19. Comparative Bioinformatic Analysis of Active Site Structures in Evolutionarily Remote Homologues of α,β-Hydrolase Superfamily Enzymes.

    PubMed

    Suplatov, D A; Arzhanik, V K; Svedas, V K

    2011-01-01

    Comparative bioinformatic analysis is the cornerstone of the study of enzymes' structure-function relationship. However, numerous enzymes that derive from a common ancestor and have undergone substantial functional alterations during natural selection appear not to have a sequence similarity acceptable for a statistically reliable comparative analysis. At the same time, their active site structures, in general, can be conserved, while other parts may largely differ. Therefore, it sounds both plausible and appealing to implement a comparative analysis of the most functionally important structural elements - the active site structures; that is, the amino acid residues involved in substrate binding and the catalytic mechanism. A computer algorithm has been developed to create a library of enzyme active site structures based on the use of the PDB database, together with programs of structural analysis and identification of functionally important amino acid residues and cavities in the enzyme structure. The proposed methodology has been used to compare some α,β-hydrolase superfamily enzymes. The insight has revealed a high structural similarity of catalytic site areas, including the conservative organization of a catalytic triad and oxyanion hole residues, despite the wide functional diversity among the remote homologues compared. The methodology can be used to compare the structural organization of the catalytic and substrate binding sites of various classes of enzymes, as well as study enzymes' evolution and to create of a databank of enzyme active site structures.

  20. Tricyclic GyrB/ParE (TriBE) Inhibitors. A new class of broad-spectrum dual-targeting antibacterial agents

    DOE PAGES

    Tari, Leslie W.; Li, Xiaoming; Trzoss, Michael; ...

    2013-12-26

    Increasing resistance to every major class of antibiotics and a dearth of novel classes of antibacterial agents in development pipelines has created a dwindling reservoir of treatment options for serious bacterial infections. The bacterial type IIA topoisomerases, DNA gyrase and topoisomerase IV, are validated antibacterial drug targets with multiple prospective drug binding sites, including the catalytic site targeted by the fluoroquinolone antibiotics. Growing resistance to fluoroquinolones, frequently mediated by mutations in the drug-binding site, is increasingly limiting the utility of this antibiotic class, prompting the search for other inhibitor classes that target different sites on the topoisomerase complexes. The highlymore » conserved ATP-binding subunits of DNA gyrase (GyrB) and topoisomerase IV (ParE) have long been recognized as excellent candidates for the development of dual-targeting antibacterial agents with broad-spectrum potential. However, to date, no natural product or small molecule inhibitors targeting these sites have succeeded in the clinic, and no inhibitors of these enzymes have yet been reported with broad-spectrum antibacterial activity encompassing the majority of Gram-negative pathogens. Using structure-based drug design (SBDD), we have created a novel dual-targeting pyrimidoindole inhibitor series with exquisite potency against GyrB and ParE enzymes from a broad range of clinically important pathogens. Inhibitors from this series demonstrate potent, broad-spectrum antibacterial activity against Gram-positive and Gram-negative pathogens of clinical importance, including fluoroquinolone resistant and multidrug resistant strains. Moreover, lead compounds have been discovered with clinical potential; they are well tolerated in animals, and efficacious in Gram-negative infection models.« less

  1. Tricyclic GyrB/ParE (TriBE) Inhibitors. A new class of broad-spectrum dual-targeting antibacterial agents

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tari, Leslie W.; Li, Xiaoming; Trzoss, Michael

    Increasing resistance to every major class of antibiotics and a dearth of novel classes of antibacterial agents in development pipelines has created a dwindling reservoir of treatment options for serious bacterial infections. The bacterial type IIA topoisomerases, DNA gyrase and topoisomerase IV, are validated antibacterial drug targets with multiple prospective drug binding sites, including the catalytic site targeted by the fluoroquinolone antibiotics. Growing resistance to fluoroquinolones, frequently mediated by mutations in the drug-binding site, is increasingly limiting the utility of this antibiotic class, prompting the search for other inhibitor classes that target different sites on the topoisomerase complexes. The highlymore » conserved ATP-binding subunits of DNA gyrase (GyrB) and topoisomerase IV (ParE) have long been recognized as excellent candidates for the development of dual-targeting antibacterial agents with broad-spectrum potential. However, to date, no natural product or small molecule inhibitors targeting these sites have succeeded in the clinic, and no inhibitors of these enzymes have yet been reported with broad-spectrum antibacterial activity encompassing the majority of Gram-negative pathogens. Using structure-based drug design (SBDD), we have created a novel dual-targeting pyrimidoindole inhibitor series with exquisite potency against GyrB and ParE enzymes from a broad range of clinically important pathogens. Inhibitors from this series demonstrate potent, broad-spectrum antibacterial activity against Gram-positive and Gram-negative pathogens of clinical importance, including fluoroquinolone resistant and multidrug resistant strains. Moreover, lead compounds have been discovered with clinical potential; they are well tolerated in animals, and efficacious in Gram-negative infection models.« less

  2. Phage diabody repertoires for selection of large numbers of bispecific antibody fragments.

    PubMed

    McGuinness, B T; Walter, G; FitzGerald, K; Schuler, P; Mahoney, W; Duncan, A R; Hoogenboom, H R

    1996-09-01

    Methods for the generation of large numbers of different bispecific antibodies are presented. Cloning strategies are detailed to create repertoires of bispecific diabody molecules with variability on one or both of the antigen binding sites. This diabody format, when combined with the power of phage display technology, allows the generation and analysis of thousands of different bispecific molecules. Selection for binding presumably also selects for more stable diabodies. Phage diabody libraries enable screening or selection of the best combination bispecific molecule with regards to affinity of binding, epitope recognition and pairing before manufacture of the best candidate.

  3. Agonist trapped in ATP-binding sites of the P2X2 receptor.

    PubMed

    Jiang, Ruotian; Lemoine, Damien; Martz, Adeline; Taly, Antoine; Gonin, Sophie; Prado de Carvalho, Lia; Specht, Alexandre; Grutter, Thomas

    2011-05-31

    ATP-gated P2X receptors are trimeric ion channels, as recently confirmed by X-ray crystallography. However, the structure was solved without ATP and even though extracellular intersubunit cavities surrounded by conserved amino acid residues previously shown to be important for ATP function were proposed to house ATP, the localization of the ATP sites remains elusive. Here we localize the ATP-binding sites by creating, through a proximity-dependent "tethering" reaction, covalent bonds between a synthesized ATP-derived thiol-reactive P2X2 agonist (NCS-ATP) and single cysteine mutants engineered in the putative binding cavities of the P2X2 receptor. By combining whole-cell and single-channel recordings, we report that NCS-ATP covalently and specifically labels two previously unidentified positions N140 and L186 from two adjacent subunits separated by about 18 Å in a P2X2 closed state homology model, suggesting the existence of at least two binding modes. Tethering reaction at both positions primes subsequent agonist binding, yet with distinct functional consequences. Labeling of one position impedes subsequent ATP function, which results in inefficient gating, whereas tethering of the other position, although failing to produce gating by itself, enhances subsequent ATP function. Our results thus define a large and dynamic intersubunit ATP-binding pocket and suggest that receptors trapped in covalently agonist-bound states differ in their ability to gate the ion channel.

  4. Steric and Thermodynamic Limits of Design for the Incorporation of Large UnNatural Amino Acids in Aminoacyl-tRNA Synthetase Enzymes

    PubMed Central

    Armen, Roger S.; Schiller, Stefan M.; Brooks, Charles L.

    2015-01-01

    Orthogonal aminoacyl-tRNA synthetase/tRNA pairs from archaea have been evolved to facilitate site specific in vivo incorporation of unnatural amino acids into proteins in Escherichia coli. Using this approach, unnatural amino acids have been successfully incorporated with high translational efficiency and fidelity. In this study, CHARMM-based molecular docking and free energy calculations were used to evaluate rational design of specific protein-ligand interactions for aminoacyl-tRNA synthetases. A series of novel unnatural amino acid ligands were docked into the p-benzoyl-L-phenylalanine tRNA synthetase, which revealed that the binding pocket of the enzyme does not provide sufficient space for significantly larger ligands. Specific binding site residues were mutated to alanine to create additional space to accommodate larger target ligands, and then mutations were introduced to improve binding free energy. This approach was used to redesign binding sites for several different target ligands, which were then tested against the standard 20 amino acids to verify target specificity. Only the synthetase designed to bind Man-α-O-Tyr was predicted to be sufficiently selective for the target ligand and also thermodynamically stable. Our study suggests that extensive redesign of the tRNA synthatase binding pocket for large bulky ligands may be quite thermodynamically unfavorable. PMID:20310065

  5. Smallpox Inhibitor of Complement Enzymes (SPICE): Dissecting Functional Sites and Abrogating Activity1

    PubMed Central

    Liszewski, M. Kathryn; Leung, Marilyn K.; Hauhart, Richard; Fang, Celia J.; Bertram, Paula; Atkinson, John P.

    2010-01-01

    Although smallpox was eradicated as a global illness more than 30 years ago, variola virus and other related pathogenic poxviruses, such as monkeypox, remain potential bioterrorist weapons or could re-emerge as natural infections. Poxviruses express virulence factors that down-modulate the host’s immune system. We previously compared functional profiles of the poxviral complement inhibitors of smallpox, vaccinia, and monkeypox known as SPICE, VCP (or VICE), and MOPICE, respectively. SPICE was the most potent regulator of human complement and attached to cells via glycosaminoglycans. The major goals of the present study were to further characterize the complement regulatory and heparin binding sites of SPICE and to evaluate a mAb that abrogates its function. Using substitution mutagenesis, we established that (1) elimination of the three heparin binding sites severely decreases but does not eliminate glycosaminoglycan binding, (2) there is a hierarchy of activity for heparin binding among the three sites, and (3) complement regulatory sites overlap with each of the three heparin binding motifs. By creating chimeras with interchanges of SPICE and VCP residues, a combination of two SPICE amino acids (H77 plus K120) enhances VCP activity ~200-fold. Also, SPICE residue L131 is critical for both complement regulatory function and accounts for the electrophoretic differences between SPICE and VCP. An evolutionary history for these structure-function adaptations of SPICE is proposed. Finally, we identified and characterized a mAb that inhibits the complement regulatory activity of SPICE, MOPICE, and VCP and thus could be used as a therapeutic agent. PMID:19667083

  6. Size versus polarizability in protein-ligand interactions: binding of noble gases within engineered cavities in phage T4 lysozyme.

    PubMed

    Quillin, M L; Breyer, W A; Griswold, I J; Matthews, B W

    2000-09-29

    To investigate the relative importance of size and polarizability in ligand binding within proteins, we have determined the crystal structures of pseudo wild-type and cavity-containing mutant phage T4 lysozymes in the presence of argon, krypton, and xenon. These proteins provide a representative sample of predominantly apolar cavities of varying size and shape. Even though the volumes of these cavities range up to the equivalent of five xenon atoms, the noble gases bind preferentially at highly localized sites that appear to be defined by constrictions in the walls of the cavities, coupled with the relatively large radii of the noble gases. The cavities within pseudo wild-type and L121A lysozymes each bind only a single atom of noble gas, while the cavities within mutants L133A and F153A have two independent binding sites, and the L99A cavity has three interacting sites. The binding of noble gases within two double mutants was studied to characterize the additivity of binding at such sites. In general, when a cavity in a protein is created by a "large-to-small" substitution, the surrounding residues relax somewhat to reduce the volume of the cavity. The binding of xenon and, to a lesser degree, krypton and argon, tend to expand the volume of the cavity and to return it closer to what it would have been had no relaxation occurred. In nearly all cases, the extent of binding of the noble gases follows the trend xenon>krypton>argon. Pressure titrations of the L99A mutant have confirmed that the crystallographic occupancies accurately reflect fractional saturation of the binding sites. The trend in noble gas affinity can be understood in terms of the effects of size and polarizability on the intermolecular potential. The plasticity of the protein matrix permits repulsion due to increased ligand size to be more than compensated for by attraction due to increased ligand polarizability. These results have implications for the mechanism of general anesthesia, the migration of small ligands within proteins, the detection of water molecules within apolar cavities and the determination of crystallographic phases. Copyright 2000 Academic Press.

  7. Allosteric Regulation of Mammalian Pantothenate Kinase*

    PubMed Central

    Subramanian, Chitra; Yun, Mi-Kyung; Yao, Jiangwei; Sharma, Lalit Kumar; Lee, Richard E.; White, Stephen W.; Jackowski, Suzanne; Rock, Charles O.

    2016-01-01

    Pantothenate kinase is the master regulator of CoA biosynthesis and is feedback-inhibited by acetyl-CoA. Comparison of the human PANK3·acetyl-CoA complex to the structures of PANK3 in four catalytically relevant complexes, 5′-adenylyl-β,γ-imidodiphosphate (AMPPNP)·Mg2+, AMPPNP·Mg2+·pantothenate, ADP·Mg2+·phosphopantothenate, and AMP phosphoramidate (AMPPN)·Mg2+, revealed a large conformational change in the dimeric enzyme. The amino-terminal nucleotide binding domain rotates to close the active site, and this allows the P-loop to engage ATP and facilitates required substrate/product interactions at the active site. Biochemical analyses showed that the transition between the inactive and active conformations, as assessed by the binding of either ATP·Mg2+ or acyl-CoA to PANK3, is highly cooperative indicating that both protomers move in concert. PANK3(G19V) cannot bind ATP, and biochemical analyses of an engineered PANK3/PANK3(G19V) heterodimer confirmed that the two active sites are functionally coupled. The communication between the two protomers is mediated by an α-helix that interacts with the ATP-binding site at its amino terminus and with the substrate/inhibitor-binding site of the opposite protomer at its carboxyl terminus. The two α-helices within the dimer together with the bound ligands create a ring that stabilizes the assembly in either the active closed conformation or the inactive open conformation. Thus, both active sites of the dimeric mammalian pantothenate kinases coordinately switch between the on and off states in response to intracellular concentrations of ATP and its key negative regulators, acetyl(acyl)-CoA. PMID:27555321

  8. Stereoselective hydrogenation of olefins using rhodium-substituted carbonic anhydrase--a new reductase.

    PubMed

    Jing, Qing; Okrasa, Krzysztof; Kazlauskas, Romas J

    2009-01-01

    One useful synthetic reaction missing from nature's toolbox is the direct hydrogenation of substrates using hydrogen. Instead nature uses cofactors like NADH to reduce organic substrates, which adds complexity and cost to these reductions. To create an enzyme that can directly reduce organic substrates with hydrogen, researchers have combined metal hydrogenation catalysts with proteins. One approach is an indirect link where a ligand is linked to a protein and the metal binds to the ligand. Another approach is direct linking of the metal to protein, but nonspecific binding of the metal limits this approach. Herein, we report a direct hydrogenation of olefins catalyzed by rhodium(I) bound to carbonic anhydrase (CA-[Rh]). We minimized nonspecific binding of rhodium by replacing histidine residues on the protein surface using site-directed mutagenesis or by chemically modifying the histidine residues. Hydrogenation catalyzed by CA-[Rh] is slightly slower than for uncomplexed rhodium(I), but the protein environment induces stereoselectivity favoring cis- over trans-stilbene by about 20:1. This enzyme is the first cofactor-independent reductase that reduces organic molecules using hydrogen. This catalyst is a good starting point to create variants with tailored reactivity and selectivity. This strategy to insert transition metals in the active site of metalloenzymes opens opportunities to a wider range of enzyme-catalyzed reactions.

  9. Affinity modulation of small-molecule ligands by borrowing endogenous protein surfaces

    PubMed Central

    Briesewitz, Roger; Ray, Gregory T.; Wandless, Thomas J.; Crabtree, Gerald R.

    1999-01-01

    A general strategy is described for improving the binding properties of small-molecule ligands to protein targets. A bifunctional molecule is created by chemically linking a ligand of interest to another small molecule that binds tightly to a second protein. When the ligand of interest is presented to the target protein by the second protein, additional protein–protein interactions outside of the ligand-binding sites serve either to increase or decrease the affinity of the binding event. We have applied this approach to an intractable target, the SH2 domain, and demonstrate a 3-fold enhancement over the natural peptide. This approach provides a way to modulate the potency and specificity of biologically active compounds. PMID:10051576

  10. Structure of Escherichia coli dGTP Triphosphohydrolase: A Hexameric Enzyme with DNA Effector Molecules

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Singh, Deepa; Gawel, Damian; Itsko, Mark

    The Escherichia coli dgt gene encodes a dGTP triphosphohydrolase whose detailed role still remains to be determined. Deletion of dgt creates a mutator phenotype, indicating that the dGTPase has a fidelity role, possibly by affecting the cellular dNTP pool. In the present paper, we have investigated the structure of the Dgt protein at 3.1-Å resolution. One of the obtained structures revealed a protein hexamer that contained two molecules of single-stranded DNA. The presence of DNA caused significant conformational changes in the enzyme, including in the catalytic site of the enzyme. Dgt preparations lacking DNA were able to bind single-stranded DNAmore » with high affinity (K d ~ 50 nM). DNA binding positively affected the activity of the enzyme: dGTPase activity displayed sigmoidal (cooperative) behavior without DNA but hyperbolic (Michaelis-Menten) kinetics in its presence, consistent with a specific lowering of the apparent K m for dGTP. A mutant Dgt enzyme was also created containing residue changes in the DNA binding cleft. This mutant enzyme, whereas still active, was incapable of DNA binding and could no longer be stimulated by addition of DNA. We also created an E. coli strain containing the mutant dgt gene on the chromosome replacing the wild-type gene. The mutant also displayed a mutator phenotype. Finally, our results provide insight into the allosteric regulation of the enzyme and support a physiologically important role of DNA binding.« less

  11. Structure of Escherichia coli dGTP Triphosphohydrolase: A Hexameric Enzyme with DNA Effector Molecules

    DOE PAGES

    Singh, Deepa; Gawel, Damian; Itsko, Mark; ...

    2015-02-18

    The Escherichia coli dgt gene encodes a dGTP triphosphohydrolase whose detailed role still remains to be determined. Deletion of dgt creates a mutator phenotype, indicating that the dGTPase has a fidelity role, possibly by affecting the cellular dNTP pool. In the present paper, we have investigated the structure of the Dgt protein at 3.1-Å resolution. One of the obtained structures revealed a protein hexamer that contained two molecules of single-stranded DNA. The presence of DNA caused significant conformational changes in the enzyme, including in the catalytic site of the enzyme. Dgt preparations lacking DNA were able to bind single-stranded DNAmore » with high affinity (K d ~ 50 nM). DNA binding positively affected the activity of the enzyme: dGTPase activity displayed sigmoidal (cooperative) behavior without DNA but hyperbolic (Michaelis-Menten) kinetics in its presence, consistent with a specific lowering of the apparent K m for dGTP. A mutant Dgt enzyme was also created containing residue changes in the DNA binding cleft. This mutant enzyme, whereas still active, was incapable of DNA binding and could no longer be stimulated by addition of DNA. We also created an E. coli strain containing the mutant dgt gene on the chromosome replacing the wild-type gene. The mutant also displayed a mutator phenotype. Finally, our results provide insight into the allosteric regulation of the enzyme and support a physiologically important role of DNA binding.« less

  12. An Augmented Pocketome: Detection and Analysis of Small-Molecule Binding Pockets in Proteins of Known 3D Structure.

    PubMed

    Bhagavat, Raghu; Sankar, Santhosh; Srinivasan, Narayanaswamy; Chandra, Nagasuma

    2018-03-06

    Protein-ligand interactions form the basis of most cellular events. Identifying ligand binding pockets in proteins will greatly facilitate rationalizing and predicting protein function. Ligand binding sites are unknown for many proteins of known three-dimensional (3D) structure, creating a gap in our understanding of protein structure-function relationships. To bridge this gap, we detect pockets in proteins of known 3D structures, using computational techniques. This augmented pocketome (PocketDB) consists of 249,096 pockets, which is about seven times larger than what is currently known. We deduce possible ligand associations for about 46% of the newly identified pockets. The augmented pocketome, when subjected to clustering based on similarities among pockets, yielded 2,161 site types, which are associated with 1,037 ligand types, together providing fold-site-type-ligand-type associations. The PocketDB resource facilitates a structure-based function annotation, delineation of the structural basis of ligand recognition, and provides functional clues for domains of unknown functions, allosteric proteins, and druggable pockets. Copyright © 2018 Elsevier Ltd. All rights reserved.

  13. Agonist trapped in ATP-binding sites of the P2X2 receptor

    PubMed Central

    Jiang, Ruotian; Lemoine, Damien; Martz, Adeline; Taly, Antoine; Gonin, Sophie; Prado de Carvalho, Lia; Specht, Alexandre; Grutter, Thomas

    2011-01-01

    ATP-gated P2X receptors are trimeric ion channels, as recently confirmed by X-ray crystallography. However, the structure was solved without ATP and even though extracellular intersubunit cavities surrounded by conserved amino acid residues previously shown to be important for ATP function were proposed to house ATP, the localization of the ATP sites remains elusive. Here we localize the ATP-binding sites by creating, through a proximity-dependent “tethering” reaction, covalent bonds between a synthesized ATP-derived thiol-reactive P2X2 agonist (NCS-ATP) and single cysteine mutants engineered in the putative binding cavities of the P2X2 receptor. By combining whole-cell and single-channel recordings, we report that NCS-ATP covalently and specifically labels two previously unidentified positions N140 and L186 from two adjacent subunits separated by about 18 Å in a P2X2 closed state homology model, suggesting the existence of at least two binding modes. Tethering reaction at both positions primes subsequent agonist binding, yet with distinct functional consequences. Labeling of one position impedes subsequent ATP function, which results in inefficient gating, whereas tethering of the other position, although failing to produce gating by itself, enhances subsequent ATP function. Our results thus define a large and dynamic intersubunit ATP-binding pocket and suggest that receptors trapped in covalently agonist-bound states differ in their ability to gate the ion channel. PMID:21576497

  14. Cu(1+) in HKUST-1: selective gas adsorption in the presence of water.

    PubMed

    Nijem, Nour; Bluhm, Hendrik; Ng, May L; Kunz, Martin; Leone, Stephen R; Gilles, Mary K

    2014-09-11

    Spectroscopic evidence for an enhanced binding of Nitric Oxide (NO) to metal centers with lower oxidation states (open Cu(1+) sites) in Cu3(btc)2 (HKUST-1) is presented. The Cu(1+) sites created by thermal treatment or X-ray exposure exhibit a preferential adsorption of NO compared to H2O. This phenomenon demonstrates the potential use of MOFs with lower oxidation state metal centers for selective gas separation.

  15. Protein painting reveals solvent-excluded drug targets hidden within native protein–protein interfaces

    PubMed Central

    Luchini, Alessandra; Espina, Virginia; Liotta, Lance A.

    2014-01-01

    Identifying the contact regions between a protein and its binding partners is essential for creating therapies that block the interaction. Unfortunately, such contact regions are extremely difficult to characterize because they are hidden inside the binding interface. Here we introduce protein painting as a new tool that employs small molecules as molecular paints to tightly coat the surface of protein–protein complexes. The molecular paints, which block trypsin cleavage sites, are excluded from the binding interface. Following mass spectrometry, only peptides hidden in the interface emerge as positive hits, revealing the functional contact regions that are drug targets. We use protein painting to discover contact regions between the three-way interaction of IL1β ligand, the receptor IL1RI and the accessory protein IL1RAcP. We then use this information to create peptides and monoclonal antibodies that block the interaction and abolish IL1β cell signalling. The technology is broadly applicable to discover protein interaction drug targets. PMID:25048602

  16. Deposition of chemically reactive and repellent sites on biosensor chips for reduced non-specific binding.

    PubMed

    Gandhiraman, R P; Gubala, V; Le, N C H; Nam, Le Cao Hoai; Volcke, C; Doyle, C; James, B; Daniels, S; Williams, D E

    2010-08-01

    The performances of new polymeric materials with excellent optical properties and good machinability have led the biomedical diagnostics industry to develop cheap disposable biosensor platforms appropriate for point of care applications. Zeonor, a type of cycloolefin polymer (COP), is one such polymer that presents an excellent platform for biosensor chips. These polymer substrates have to be modified to have suitable physico-chemical properties for immobilizing proteins. In this work, we have demonstrated the amine functionalization of COP substrates, by plasma enhanced chemical vapour deposition (PECVD), through codeposition of ethylene diamine and 3-aminopropyltriethoxysilane precursors, for building chemistries on the plastic chip. The elemental composition, adhesion, ageing and reactivity of the plasma polymerized film were examined. The Si-O functionality present in amino silane contributed for a good interfacial adhesion of the coating to COP substrates and also acted as a network building layer for plasma polymerization. Wet chemical modification was then carried out on the amine functionalized chips to create chemically reactive isothiocyanate sites and protein repellent fluorinated sites on the same chip. The density of the reactive and repellent sites was altered by choosing appropriate mixtures of homofunctional phenyldiisothiocyanate (PDITC), pentafluoroisothiocyanate (5FITC) and phenylisothiocyanate (PITC) compounds. By tailoring the density of reactive binding sites and protein repellent sites, the non-specific binding of ssDNA has been decreased to a significant extent. Copyright 2010 Elsevier B.V. All rights reserved.

  17. DFT Insights into the Competitive Adsorption of Sulfur- and Nitrogen-Containing Compounds and Hydrocarbons on Co-Promoted Molybdenum Sulfide Catalysts

    DOE PAGES

    Rangarajan, Srinivas; Mavrikakis, Manos

    2016-04-07

    The adsorption of 20 nitrogen-/sulfur-containing and hydrocarbon compounds on the sulfur edge of cobalt-promoted molybdenum sulfide (CoMoS) catalyst was studied using density functional theory, accounting for van der Waals interactions, to elicit comparative structure–property trends across different classes of molecules relevant to hydrotreating. Unhindered organosulfur compounds preferentially adsorb on a “CUS-like” site formed by the dimerization of two neighboring sulfur atoms on the edge to create a vacancy. Nitrogen-containing compounds and 4,6-dimethyldibenzothiophene, however, prefer the brim sites. Binding energy trends indicate that nitrogen-containing compounds will inhibit hydrodesulfurization on the brim sites and, relatively weakly, on the CUS-like sites. Edge vacanciesmore » are,thus, likely to be essential for hydrodesulfurization of unhindered organosulfur compounds. Furthermore, van der Waals forces contribute significantly to the binding energy of compounds (up to 1.0 eV for large compounds such as alkyl-substituted acridines) on CoMoS.« less

  18. A dopamine D2 receptor mutant capable of G protein-mediated signaling but deficient in arrestin binding.

    PubMed

    Lan, Hongxiang; Liu, Yong; Bell, Michal I; Gurevich, Vsevolod V; Neve, Kim A

    2009-01-01

    Arrestins mediate G protein-coupled receptor desensitization, internalization, and signaling. Dopamine D(2) and D(3) receptors have similar structures but distinct characteristics of interaction with arrestins. The goals of this study were to compare arrestin-binding determinants in D(2) and D(3) receptors other than phosphorylation sites and to create a D(2) receptor that is deficient in arrestin binding. We first assessed the ability of purified arrestins to bind to glutathione transferase (GST) fusion proteins containing the receptor third intracellular loops (IC3). Arrestin3 bound to IC3 of both D(2) and D(3) receptors, with the affinity and localization of the binding site indistinguishable between the receptor subtypes. Mutagenesis of the GST-IC3 fusion proteins identified an important determinant of the binding of arrestin3 in the N-terminal region of IC3. Alanine mutations of this determinant (IYIV212-215) in the full-length D(2) receptor generated a signaling-biased receptor with intact ligand binding and G-protein coupling and activation, but deficient in receptor-mediated arrestin3 translocation to the membrane, agonist-induced receptor internalization, and agonist-induced desensitization in human embryonic kidney 293 cells. This mutation also decreased arrestin-dependent activation of extracellular signal-regulated kinases. The finding that nonphosphorylated D(2)-IC3 and D(3)-IC3 have similar affinity for arrestin is consistent with previous suggestions that the differential effects of D(2) and D(3) receptor activation on membrane translocation of arrestin and receptor internalization are due, at least in part, to differential phosphorylation of the receptors. In addition, these results imply that the sequence IYIV212-215 at the N terminus of IC3 of the D(2) receptor is a key element of the arrestin binding site.

  19. Molecular flip–flops formed by overlapping Fis sites

    PubMed Central

    Hengen, Paul N.; Lyakhov, Ilya G.; Stewart, Lisa E.; Schneider, Thomas D.

    2003-01-01

    The DNA-binding protein Fis frequently uses pairs of sites 7 or 11 base pairs (bp) apart. Two overlapping Fis sites separated by 11 bp are found in the Escherichia coli origin of chromosomal replication. Only one of these sites is bound by Fis at a time, so the structure is a molecular flip–flop that could direct alternative firing of replication complexes in opposite directions. Alternatively, the flip–flop could represent part of an on–off switch for replication. Because they can be used to create precise switched states, molecular flip–flops could be used as the basis of a novel molecular computer. PMID:14602927

  20. Molecular flip-flops formed by overlapping Fis sites.

    PubMed

    Hengen, Paul N; Lyakhov, Ilya G; Stewart, Lisa E; Schneider, Thomas D

    2003-11-15

    The DNA-binding protein Fis frequently uses pairs of sites 7 or 11 base pairs (bp) apart. Two overlapping Fis sites separated by 11 bp are found in the Escherichia coli origin of chromosomal replication. Only one of these sites is bound by Fis at a time, so the structure is a molecular flip-flop that could direct alternative firing of replication complexes in opposite directions. Alternatively, the flip-flop could represent part of an on-off switch for replication. Because they can be used to create precise switched states, molecular flip-flops could be used as the basis of a novel molecular computer.

  1. Kinetic analysis of site-directed mutants of methionine synthase from Candida albicans

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Prasannan, Priya; Suliman, Huda S.; Robertus, Jon D., E-mail: jrobertus@mail.utexas.edu

    2009-05-15

    Fungal methionine synthase catalyzes the transfer of a methyl group from 5-methyl-tetrahydrofolate to homocysteine to create methionine. The enzyme, called Met6p in fungi, is required for the growth of the pathogen Candida albicans, and is consequently a reasonable target for antifungal drug design. In order to understand the mechanism of this class of enzyme, we created a three-dimensional model of the C. albicans enzyme based on the known structure of the homologous enzyme from Arabidopsis thaliana. A fusion protein was created and shown to have enzyme activity similar to the wild-type Met6p. Fusion proteins containing mutations at eight key sitesmore » were expressed and assayed in this background. The D614 carboxylate appears to ion pair with the amino group of homocysteine and is essential for activity. Similarly, D504 appears to bind to the polar edge of the folate and is also required for activity. Other groups tested have lesser roles in substrate binding and catalysis.« less

  2. Nanolithographic control of the spatial organization of cellular adhesion receptors at the single-molecule level

    PubMed Central

    Schvartzman, Mark; Palma, Matteo; Sable, Julia; Abramson, Justin; Hu, Xian; Sheetz, Michael P.; Wind, Shalom J.

    2011-01-01

    The ability to control the placement of individual molecules promises to enable a wide range of applications and is a key challenge in nanoscience and nanotechnology. Many biological interactions, in particular, are sensitive to the precise geometric arrangement of proteins. We have developed a technique which combines molecular-scale nanolithography with site-selective biochemistry to create biomimetic arrays of individual protein binding sites. The binding sites can be arranged in heterogeneous patterns of virtually any possible geometry with a nearly unlimited number of degrees of freedom. We have used these arrays to explore how the geometric organization of the extracellular matrix (ECM) binding ligand RGD (Arg-Gly-Asp) affects cell adhesion and spreading. Systematic variation of spacing, density and cluster size of individual integrin binding sites was used to elicit different cell behavior. Cell spreading assays on arrays of different geometric arrangements revealed a dramatic increase in spreading efficiency when at least 4 liganded sites were spaced within 60 nm or less, with no dependence on global density. This points to the existence of a minimal matrix adhesion unit for fibronectin defined in space and stoichiometry. Developing an understanding of the ECM geometries that activate specific cellular functional complexes is a critical step toward controlling cell behavior. Potential practical applications range from new therapeutic treatments to the rational design of tissue scaffolds that can optimize healing without scarring. More broadly, spatial control at the single-molecule level can elucidate factors controlling individual molecular interactions and can enable synthesis of new systems based on molecular-scale architectures. PMID:21319842

  3. Characterization of Short Range DNA Looping in Endotoxin-mediated Transcription of the Murine Inducible Nitric-oxide Synthase (iNOS) Gene*

    PubMed Central

    Guo, Hongtao; Mi, Zhiyong; Kuo, Paul C.

    2008-01-01

    The local structural properties and spatial conformations of chromosomes are intimately associated with gene expression. The spatial associations of critical genomic elements in inducible nitric-oxide synthase (iNOS) transcription have not been previously examined. In this regard, the murine iNOS promoter contains 2 NF-κB binding sites (nt –86 and nt –972) that are essential for maximal transactivation of iNOS by LPS. Although AP-1 is commonly listed as an essential transcription factor for LPS-mediated iNOS transactivation, the relationship between AP-1 and NF-κB in this setting is not well studied. In this study using a model of LPS-stimulated ANA-1 murine macrophages, we demonstrate that short range DNA looping occurs at the iNOS promoter. This looping requires the presence of AP-1, c-Jun, NF-κB p65, and p300-associated acetyltransferase activity. The distal AP-1 binding site interacts via p300 with the proximal NF-κB binding site to create this DNA loop to participate in iNOS transcription. Other geographically distant AP-1 and NF-κB sites are certainly occupied, but selected sites are critical for iNOS transcription and the formation of the c-Jun, p65, and p300 transcriptional complex. In this “simplified” model of murine iNOS promoter, numerous transcription factors recognize and bind to various response elements, but these locales do not equally contribute to iNOS gene transcription. PMID:18596035

  4. Interactions of the GM2 activator protein with phosphatidylcholine bilayers: a site-directed spin-labeling power saturation study.

    PubMed

    Mathias, Jordan D; Ran, Yong; Carter, Jeffery D; Fanucci, Gail E

    2009-09-02

    The GM2 activator protein (GM2AP) is an accessory protein that is an essential component in the catabolism of the ganglioside GM2. A function of GM2AP is to bind and extract GM2 from intralysosomal vesicles, forming a soluble protein-lipid complex, which interacts with the hydrolase Hexosaminidase A, the enzyme that cleaves the terminal sugar group of GM2. Here, we used site-directed spin labeling with power saturation electron paramagnetic resonance to determine the surface-bound orientation of GM2AP upon phosphatidylcholine vesicles. Because GM2AP extracts lipid ligands from the vesicle and is undergoing exchange on and off the vesicle surface, we utilized a nickel-chelating lipid to localize the paramagnetic metal collider to the lipid bilayer-aqueous interface. Spin-labeled sites that collide with the lipid-bound metal relaxing agent provide a means for mapping sites of the protein that interact with the lipid bilayer interface. Results show that GM2AP binds to lipid bilayers such that the residues lining the lipid-binding cavity lie on the vesicle surface. This orientation creates a favorable microenvironment that can allow for the lipid tails to flip out of the bilayer directly into the hydrophobic pocket of GM2AP.

  5. A Single Amino Acid Substitution in the Active Site of Escherichia coli Aspartate Transcarbamoylase Prevents the Allosteric Transition

    PubMed Central

    Stieglitz, Kimberly A.; Pastra-Landis, Styliani C.; Xia, Jiarong; Tsuruta, Hiro; Kantrowitz, Evan R.

    2005-01-01

    Modeling of the tetrahedral intermediate within the active site of Escherichia coli aspartate transcarbamoylase revealed a specific interaction with the side chain of Gln137, an interaction not previously observed in the structure of the X-ray enzyme in the presence of N-phosphonacetyl-L-aspartate (PALA). Previous site-specific mutagenesis experiments showed that when Gln137 was replaced by alanine, the resulting mutant enzyme (Q137A) exhibited approximately 50-fold less activity than the wild-type enzyme, exhibited no homotropic cooperativity, and the binding of both carbamoyl phosphate and aspartate were extremely compromised. To elucidate the structural alterations in the mutant enzyme that might lead to such pronounced changes in kinetic and binding properties, the Q137A enzyme was studied by time-resolved small-angle X-ray scattering and its structure was determined in the presence of PALA to 2.7Å resolution. Time-resolved small-angle X-ray scattering established that the natural substrates, carbamoyl phosphate and L-aspartate, do not induce in the Q137A enzyme the same conformational changes as observed for the wild-type enzyme, although the scattering pattern of the Q137A and wild-type enzymes in the presence of PALA were identical. The overall structure of the Q137A enzyme is similar to that of the R-state structure of wild-type enzyme with PALA bound. However, there are differences in the manner by which the Q137A enzyme coordinates PALA, especially in the side chain positions of Arg105 and His134. The replacement of Gln137 by Ala also has a dramatic effect on the electrostatics of the active site. These data taken together suggest that the side chain of Gln137 in the wild-type enzyme is required for the binding of carbamoyl phosphate in the proper orientation so as to induce conformational changes required for the creation of the high-affinity aspartate binding site. The inability of carbamoyl phosphate to create the high-affinity binding site in the Q137A enzyme results in an enzyme locked in the low activity low affinity T state. These results emphasize the absolute requirement of the binding of carbamoyl phosphate for the creation of the high-affinity aspartate binding site and for inducing the homotropic cooperativity in aspartate transcarbamoylase. PMID:15890205

  6. Insights from molecular modeling and dynamics simulation of pathogen resistance (R) protein from brinjal.

    PubMed

    Shrivastava, Dipty; Nain, Vikrant; Sahi, Shakti; Verma, Anju; Sharma, Priyanka; Sharma, Prakash Chand; Kumar, Polumetla Ananda

    2011-01-22

    Resistance (R) protein recognizes molecular signature of pathogen infection and activates downstream hypersensitive response signalling in plants. R protein works as a molecular switch for pathogen defence signalling and represent one of the largest plant gene family. Hence, understanding molecular structure and function of R proteins has been of paramount importance for plant biologists. The present study is aimed at predicting structure of R proteins signalling domains (CC-NBS) by creating a homology model, refining and optimising the model by molecular dynamics simulation and comparing ADP and ATP binding. Based on sequence similarity with proteins of known structures, CC-NBS domains were initially modelled using CED- 4 (cell death abnormality protein) and APAF-1 (apoptotic protease activating factor) as multiple templates. The final CC-NBS structural model was built and optimized by molecular dynamic simulation for 5 nanoseconds (ns). Docking of ADP and ATP at active site shows that both ligand bind specifically with same residues and with minor difference (1 Kcal/mol) in binding energy. Sharing of binding site by ADP and ATP and low difference in their binding site makes CC-NBS suitable for working as molecular switch. Furthermore, structural superimposition elucidate that CC-NBS and CARD (caspase recruitment domains) domain of CED-4 have low RMSD value of 0.9 A° Availability of 3D structural model for both CC and NBS domains will . help in getting deeper insight in these pathogen defence genes.

  7. Generalized theory on the mechanism of site-specific DNA-protein interactions

    NASA Astrophysics Data System (ADS)

    Niranjani, G.; Murugan, R.

    2016-05-01

    We develop a generalized theoretical framework on the binding of transcription factor proteins (TFs) with specific sites on DNA that takes into account the interplay of various factors regarding overall electrostatic potential at the DNA-protein interface, occurrence of kinetic traps along the DNA sequence, presence of other roadblock protein molecules along DNA and crowded environment, conformational fluctuations in the DNA binding domains (DBDs) of TFs, and the conformational state of the DNA. Starting from a Smolochowski type theoretical framework on site-specific binding of TFs we logically build our model by adding the effects of these factors one by one. Our generalized two-step model suggests that the electrostatic attractive forces present inbetween the positively charged DBDs of TFs and the negatively charged phosphate backbone of DNA, along with the counteracting shielding effects of solvent ions, is the core factor that creates a fluidic type environment at the DNA-protein interface. This in turn facilitates various one-dimensional diffusion (1Dd) processes such as sliding, hopping and intersegmental transfers. These facilitating processes as well as flipping dynamics of conformational states of DBDs of TFs between stationary and mobile states can enhance the 1Dd coefficient on a par with three-dimensional diffusion (3Dd). The random coil conformation of DNA also plays critical roles in enhancing the site-specific association rate. The extent of enhancement over the 3Dd controlled rate seems to be directly proportional to the maximum possible 1Dd length. We show that the overall site-specific binding rate scales with the length of DNA in an asymptotic way. For relaxed DNA, the specific binding rate will be independent of the length of DNA as length increases towards infinity. For condensed DNA as in in vivo conditions, the specific binding rate depends on the length of DNA in a turnover way with a maximum. This maximum rate seems to scale with the maximum possible 1Dd length of TFs in a square root manner. Results suggest that 1Dd processes contribute much less to the enhancement of specific binding rate under in vivo conditions for condensed DNA. There exists a critical length of binding stretch of TFs beyond which the probability associated with the random occurrence of similar specific binding sites will be close to zero. TFs in natural systems from prokaryotes to eukaryotes seem to handle sequence-mediated kinetic traps via increasing the length of their recognition stretch or combinatorial binding. TFs overcome the hurdles of roadblocks via switching efficiently between sliding, hopping and intersegmental transfer modes. The site-specific binding rate as well as the maximum possible 1Dd length seem to be directly proportional to the square root of the probability (p R) of finding a nonspecific binding site to be free from dynamic roadblocks. Here p R seems to be a function of the number of nsbs available per DNA binding protein (ϕ) inside the living cell. It seems that p R  >  0.8 when ϕ  >  10 which is true for the Escherichia coli cell system.

  8. Integrin-mediated signal transduction linked to Ras pathway by GRB2 binding to focal adhesion kinase.

    PubMed

    Schlaepfer, D D; Hanks, S K; Hunter, T; van der Geer, P

    The cytoplasmic focal adhesion protein-tyrosine kinase (FAK) localizes with surface integrin receptors at sites where cells attach to the extracellular matrix. Increased FAK tyrosine phosphorylation occurs upon integrin engagement with fibronectin. Here we show that adhesion of murine NIH3T3 fibroblasts to fibronectin promotes SH2-domain-mediated association of the GRB2 adaptor protein and the c-Src protein-tyrosine kinase (PTK) with FAK in vivo, and also results in activation of mitogen-activated protein kinase (MAPK). In v-Src-transformed NIH3T3, the association of v-Src, GRB2 and Sos with FAK is independent of cell adhesion to fibronectin. The GRB2 SH2 domain binds directly to tyrosine-phosphorylated FAK. Mutation of tyrosine residue 925 of FAK (YENV motif) to phenylalanine blocks GRB2 SH2-domain binding to FAK in vitro. Our results show that fibronectin binding to integrins on NIH3T3 fibroblasts promotes c-Src and FAK association and formation of an integrin-activated signalling complex. Phosphorylation of FAK at Tyr 925 upon fibronectin stimulation creates an SH2-binding site for GRB2 which may link integrin engagement to the activation of the Ras/MAPK signal transduction pathway.

  9. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Totoritis, Rachel; Duraiswami, Chaya; Taylor, Amy N.

    The continual bacterial adaptation to antibiotics creates an ongoing medical need for the development of novel therapeutics. Polypeptide deformylase (PDF) is a highly conserved bacterial enzyme, which is essential for viability. It has previously been shown that PDF inhibitors represent a promising new area for the development of antimicrobial agents, and that many of the best PDF inhibitors demonstrate slow, time-dependent binding. To improve our understanding of the mechanistic origin of this time-dependent inhibition, we examined in detail the kinetics of PDF catalysis and inhibition by several different PDF inhibitors. Varying pH and solvent isotope led to clear changes inmore » time-dependent inhibition parameters, as did inclusion of NaCl, which binds to the active site metal of PDF. Quantitative analysis of these results demonstrated that the observed time dependence arises from slow binding of the inhibitors to the active site metal. However, we also found several metal binding inhibitors that exhibited rapid, non-time-dependent onset of inhibition. By a combination of structural and chemical modification studies, we show that metal binding is only slow when the rest of the inhibitor makes optimal hydrogen bonds within the subsites of PDF. Both of these interactions between the inhibitor and enzyme were found to be necessary to observe time-dependent inhibition, as elimination of either leads to its loss.« less

  10. Combining H/D exchange mass spectroscopy and computational docking reveals extended DNA-binding surface on uracil-DNA glycosylase

    PubMed Central

    Roberts, Victoria A.; Pique, Michael E.; Hsu, Simon; Li, Sheng; Slupphaug, Geir; Rambo, Robert P.; Jamison, Jonathan W.; Liu, Tong; Lee, Jun H.; Tainer, John A.; Ten Eyck, Lynn F.; Woods, Virgil L.

    2012-01-01

    X-ray crystallography provides excellent structural data on protein–DNA interfaces, but crystallographic complexes typically contain only small fragments of large DNA molecules. We present a new approach that can use longer DNA substrates and reveal new protein–DNA interactions even in extensively studied systems. Our approach combines rigid-body computational docking with hydrogen/deuterium exchange mass spectrometry (DXMS). DXMS identifies solvent-exposed protein surfaces; docking is used to create a 3-dimensional model of the protein–DNA interaction. We investigated the enzyme uracil-DNA glycosylase (UNG), which detects and cleaves uracil from DNA. UNG was incubated with a 30 bp DNA fragment containing a single uracil, giving the complex with the abasic DNA product. Compared with free UNG, the UNG–DNA complex showed increased solvent protection at the UNG active site and at two regions outside the active site: residues 210–220 and 251–264. Computational docking also identified these two DNA-binding surfaces, but neither shows DNA contact in UNG–DNA crystallographic structures. Our results can be explained by separation of the two DNA strands on one side of the active site. These non-sequence-specific DNA-binding surfaces may aid local uracil search, contribute to binding the abasic DNA product and help present the DNA product to APE-1, the next enzyme on the DNA-repair pathway. PMID:22492624

  11. RDX binds to the convulsant site of the GABAA receptor and increases spontaneous firing rates of cortical neurons in vitro

    EPA Science Inventory

    RDX (hexahydro-1 ,3,5-trinitro-1 ,3,5-triazine, hexogen, Royal Demolition eXplosive) is an explosive widely used by the military and has been found in soil and ground water in and surrounding training ranges, creating potential hazards to the environment and human health. Oral RD...

  12. Dihydroquinazolines as a novel class of Trypanosoma brucei trypanothione reductase inhibitors: discovery, synthesis, and characterization of their binding mode by protein crystallography.

    PubMed

    Patterson, Stephen; Alphey, Magnus S; Jones, Deuan C; Shanks, Emma J; Street, Ian P; Frearson, Julie A; Wyatt, Paul G; Gilbert, Ian H; Fairlamb, Alan H

    2011-10-13

    Trypanothione reductase (TryR) is a genetically validated drug target in the parasite Trypanosoma brucei , the causative agent of human African trypanosomiasis. Here we report the discovery, synthesis, and development of a novel series of TryR inhibitors based on a 3,4-dihydroquinazoline scaffold. In addition, a high resolution crystal structure of TryR, alone and in complex with substrates and inhibitors from this series, is presented. This represents the first report of a high resolution complex between a noncovalent ligand and this enzyme. Structural studies revealed that upon ligand binding the enzyme undergoes a conformational change to create a new subpocket which is occupied by an aryl group on the ligand. Therefore, the inhibitor, in effect, creates its own small binding pocket within the otherwise large, solvent exposed active site. The TryR-ligand structure was subsequently used to guide the synthesis of inhibitors, including analogues that challenged the induced subpocket. This resulted in the development of inhibitors with improved potency against both TryR and T. brucei parasites in a whole cell assay.

  13. Mre11 and Exo1 contribute to the initiation and processivity of resection at meiotic double-strand breaks made independently of Spo11.

    PubMed

    Hodgson, Adam; Terentyev, Yaroslav; Johnson, Rebecca A; Bishop-Bailey, Anna; Angevin, Thibaut; Croucher, Adam; Goldman, Alastair S H

    2011-02-07

    During meiosis DNA double-strand breaks (DSBs) are induced and repaired by homologous recombination to create gene conversion and crossover products. Mostly these DSBs are made by Spo11, which covalently binds to the DSB ends. More rarely in Saccharomyces cerevisiae, other meiotic DSBs are formed by self-homing endonucleases such as VDE, which is site specific and does not covalently bind to the DSB ends. We have used experimentally located VDE-DSB sites to analyse an intermediate step in homologous recombination, resection of the single-strand ending 5' at the DSB site. Analysis of strains with different mutant alleles of MRE11 (mre11-58S and mre11-H125N) and deleted for EXO1 indicated that these two nucleases make significant contributions to repair of VDE-DSBs. Physical analysis of single-stranded repair intermediates indicates that efficient initiation and processivity of resection at VDE-DSBs require both Mre11 and Exo1, with loss of function for either protein causing severe delay in resection. We propose that these experiments model what happens at Spo11-DSBs after removal of the covalently bound protein, and that Mre11 and Exo1 are the major nucleases involved in creating resection tracts of widely varying lengths typical of meiotic recombination. Copyright © 2010 Elsevier B.V. All rights reserved.

  14. Biochemical and Structural Characterization of Lysophosphatidic Acid Binding by a Humanized Monoclonal Antibody

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    J Fleming; J Wojciak; M Campbell

    Lysophosphatidic acid (LPA) is a common product of glycerophospholipid metabolism and an important mediator of signal transduction. Aberrantly high LPA concentrations accompany multiple disease states. One potential approach for treatment of these diseases, therefore, is the therapeutic application of antibodies that recognize and bind LPA as their antigen. We have determined the X-ray crystal structure of an anti-LPA antibody (LT3015) Fab fragment in its antigen-free form to 2.15 {angstrom} resolution and in complex with two LPA isotypes (14:0 and 18:2) to resolutions of 1.98 and 2.51 {angstrom}, respectively. The variable CDR (complementarity-determining region) loops at the antigen binding site adoptmore » nearly identical conformations in the free and antigen-bound crystal structures. The crystallographic models reveal that the LT3015 antibody employs both heavy- and light-chain CDR loops to create a network of eight hydrogen bonds with the glycerophosphate head group of its LPA antigen. The head group is almost completely excluded from contact with solvent, while the hydrocarbon tail is partially solvent-exposed. In general, mutation of amino acid residues at the antigen binding site disrupts LPA binding. However, the introduction of particular mutations chosen strategically on the basis of the structures can positively influence LPA binding affinity. Finally, these structures elucidate the exquisite specificity demonstrated by an anti-lipid antibody for binding a structurally simple and seemingly unconstrained target molecule.« less

  15. Local functional descriptors for surface comparison based binding prediction

    PubMed Central

    2012-01-01

    Background Molecular recognition in proteins occurs due to appropriate arrangements of physical, chemical, and geometric properties of an atomic surface. Similar surface regions should create similar binding interfaces. Effective methods for comparing surface regions can be used in identifying similar regions, and to predict interactions without regard to the underlying structural scaffold that creates the surface. Results We present a new descriptor for protein functional surfaces and algorithms for using these descriptors to compare protein surface regions to identify ligand binding interfaces. Our approach uses descriptors of local regions of the surface, and assembles collections of matches to compare larger regions. Our approach uses a variety of physical, chemical, and geometric properties, adaptively weighting these properties as appropriate for different regions of the interface. Our approach builds a classifier based on a training corpus of examples of binding sites of the target ligand. The constructed classifiers can be applied to a query protein providing a probability for each position on the protein that the position is part of a binding interface. We demonstrate the effectiveness of the approach on a number of benchmarks, demonstrating performance that is comparable to the state-of-the-art, with an approach with more generality than these prior methods. Conclusions Local functional descriptors offer a new method for protein surface comparison that is sufficiently flexible to serve in a variety of applications. PMID:23176080

  16. Comprehensive human transcription factor binding site map for combinatory binding motifs discovery.

    PubMed

    Müller-Molina, Arnoldo J; Schöler, Hans R; Araúzo-Bravo, Marcos J

    2012-01-01

    To know the map between transcription factors (TFs) and their binding sites is essential to reverse engineer the regulation process. Only about 10%-20% of the transcription factor binding motifs (TFBMs) have been reported. This lack of data hinders understanding gene regulation. To address this drawback, we propose a computational method that exploits never used TF properties to discover the missing TFBMs and their sites in all human gene promoters. The method starts by predicting a dictionary of regulatory "DNA words." From this dictionary, it distills 4098 novel predictions. To disclose the crosstalk between motifs, an additional algorithm extracts TF combinatorial binding patterns creating a collection of TF regulatory syntactic rules. Using these rules, we narrowed down a list of 504 novel motifs that appear frequently in syntax patterns. We tested the predictions against 509 known motifs confirming that our system can reliably predict ab initio motifs with an accuracy of 81%-far higher than previous approaches. We found that on average, 90% of the discovered combinatorial binding patterns target at least 10 genes, suggesting that to control in an independent manner smaller gene sets, supplementary regulatory mechanisms are required. Additionally, we discovered that the new TFBMs and their combinatorial patterns convey biological meaning, targeting TFs and genes related to developmental functions. Thus, among all the possible available targets in the genome, the TFs tend to regulate other TFs and genes involved in developmental functions. We provide a comprehensive resource for regulation analysis that includes a dictionary of "DNA words," newly predicted motifs and their corresponding combinatorial patterns. Combinatorial patterns are a useful filter to discover TFBMs that play a major role in orchestrating other factors and thus, are likely to lock/unlock cellular functional clusters.

  17. Comprehensive Human Transcription Factor Binding Site Map for Combinatory Binding Motifs Discovery

    PubMed Central

    Müller-Molina, Arnoldo J.; Schöler, Hans R.; Araúzo-Bravo, Marcos J.

    2012-01-01

    To know the map between transcription factors (TFs) and their binding sites is essential to reverse engineer the regulation process. Only about 10%–20% of the transcription factor binding motifs (TFBMs) have been reported. This lack of data hinders understanding gene regulation. To address this drawback, we propose a computational method that exploits never used TF properties to discover the missing TFBMs and their sites in all human gene promoters. The method starts by predicting a dictionary of regulatory “DNA words.” From this dictionary, it distills 4098 novel predictions. To disclose the crosstalk between motifs, an additional algorithm extracts TF combinatorial binding patterns creating a collection of TF regulatory syntactic rules. Using these rules, we narrowed down a list of 504 novel motifs that appear frequently in syntax patterns. We tested the predictions against 509 known motifs confirming that our system can reliably predict ab initio motifs with an accuracy of 81%—far higher than previous approaches. We found that on average, 90% of the discovered combinatorial binding patterns target at least 10 genes, suggesting that to control in an independent manner smaller gene sets, supplementary regulatory mechanisms are required. Additionally, we discovered that the new TFBMs and their combinatorial patterns convey biological meaning, targeting TFs and genes related to developmental functions. Thus, among all the possible available targets in the genome, the TFs tend to regulate other TFs and genes involved in developmental functions. We provide a comprehensive resource for regulation analysis that includes a dictionary of “DNA words,” newly predicted motifs and their corresponding combinatorial patterns. Combinatorial patterns are a useful filter to discover TFBMs that play a major role in orchestrating other factors and thus, are likely to lock/unlock cellular functional clusters. PMID:23209563

  18. Calcium interacts with antifreeze proteins and chitinase from cold-acclimated winter rye.

    PubMed

    Stressmann, Maja; Kitao, Satoshi; Griffith, Marilyn; Moresoli, Christine; Bravo, León A; Marangoni, Alejandro G

    2004-05-01

    During cold acclimation, winter rye (Secale cereale) plants accumulate pathogenesis-related proteins that are also antifreeze proteins (AFPs) because they adsorb onto ice and inhibit its growth. Although they promote winter survival in planta, these dual-function AFPs proteins lose activity when stored at subzero temperatures in vitro, so we examined their stability in solutions containing CaCl2, MgCl2, or NaCl. Antifreeze activity was unaffected by salts before freezing, but decreased after freezing and thawing in CaCl2 and was recovered by adding a chelator. Ca2+ enhanced chitinase activity 3- to 5-fold in unfrozen samples, although hydrolytic activity also decreased after freezing and thawing in CaCl2. Native PAGE, circular dichroism, and Trp fluorescence experiments showed that the AFPs partially unfold after freezing and thawing, but they fold more compactly or aggregate in CaCl2. Ruthenium red, which binds to Ca(2+)-binding sites, readily stained AFPs in the absence of Ca2+, but less stain was visible after freezing and thawing AFPs in CaCl2. We conclude that the structure of AFPs changes during freezing and thawing, creating new Ca(2+)-binding sites. Once Ca2+ binds to those sites, antifreeze activity, chitinase activity and ruthenium red binding are all inhibited. Because free Ca2+ concentrations are typically low in the apoplast, antifreeze activity is probably stable to freezing and thawing in planta. Ca2+ may regulate chitinase activity if concentrations are increased locally by release from pectin or interaction with Ca(2+)-binding proteins. Furthermore, antifreeze activity can be easily maintained in vitro by including a chelator during frozen storage.

  19. Novel approach of fragment-based lead discovery applied to renin inhibitors.

    PubMed

    Tawada, Michiko; Suzuki, Shinkichi; Imaeda, Yasuhiro; Oki, Hideyuki; Snell, Gyorgy; Behnke, Craig A; Kondo, Mitsuyo; Tarui, Naoki; Tanaka, Toshimasa; Kuroita, Takanobu; Tomimoto, Masaki

    2016-11-15

    A novel approach was conducted for fragment-based lead discovery and applied to renin inhibitors. The biochemical screening of a fragment library against renin provided the hit fragment which showed a characteristic interaction pattern with the target protein. The hit fragment bound only to the S1, S3, and S3 SP (S3 subpocket) sites without any interactions with the catalytic aspartate residues (Asp32 and Asp215 (pepsin numbering)). Prior to making chemical modifications to the hit fragment, we first identified its essential binding sites by utilizing the hit fragment's substructures. Second, we created a new and smaller scaffold, which better occupied the identified essential S3 and S3 SP sites, by utilizing library synthesis with high-throughput chemistry. We then revisited the S1 site and efficiently explored a good building block attaching to the scaffold with library synthesis. In the library syntheses, the binding modes of each pivotal compound were determined and confirmed by X-ray crystallography and the library was strategically designed by structure-based computational approach not only to obtain a more active compound but also to obtain informative Structure Activity Relationship (SAR). As a result, we obtained a lead compound offering synthetic accessibility as well as the improved in vitro ADMET profiles. The fragments and compounds possessing a characteristic interaction pattern provided new structural insights into renin's active site and the potential to create a new generation of renin inhibitors. In addition, we demonstrated our FBDD strategy integrating highly sensitive biochemical assay, X-ray crystallography, and high-throughput synthesis and in silico library design aimed at fragment morphing at the initial stage was effective to elucidate a pocket profile and a promising lead compound. Copyright © 2016 Elsevier Ltd. All rights reserved.

  20. Creating Novel Activated Factor XI Inhibitors through Fragment Based Lead Generation and Structure Aided Drug Design

    PubMed Central

    Fjellström, Ola; Akkaya, Sibel; Beisel, Hans-Georg; Eriksson, Per-Olof; Erixon, Karl; Gustafsson, David; Jurva, Ulrik; Kang, Daiwu; Karis, David; Knecht, Wolfgang; Nerme, Viveca; Nilsson, Ingemar; Olsson, Thomas; Redzic, Alma; Roth, Robert; Sandmark, Jenny; Tigerström, Anna; Öster, Linda

    2015-01-01

    Activated factor XI (FXIa) inhibitors are anticipated to combine anticoagulant and profibrinolytic effects with a low bleeding risk. This motivated a structure aided fragment based lead generation campaign to create novel FXIa inhibitor leads. A virtual screen, based on docking experiments, was performed to generate a FXIa targeted fragment library for an NMR screen that resulted in the identification of fragments binding in the FXIa S1 binding pocket. The neutral 6-chloro-3,4-dihydro-1H-quinolin-2-one and the weakly basic quinolin-2-amine structures are novel FXIa P1 fragments. The expansion of these fragments towards the FXIa prime side binding sites was aided by solving the X-ray structures of reported FXIa inhibitors that we found to bind in the S1-S1’-S2’ FXIa binding pockets. Combining the X-ray structure information from the identified S1 binding 6-chloro-3,4-dihydro-1H-quinolin-2-one fragment and the S1-S1’-S2’ binding reference compounds enabled structure guided linking and expansion work to achieve one of the most potent and selective FXIa inhibitors reported to date, compound 13, with a FXIa IC50 of 1.0 nM. The hydrophilicity and large polar surface area of the potent S1-S1’-S2’ binding FXIa inhibitors compromised permeability. Initial work to expand the 6-chloro-3,4-dihydro-1H-quinolin-2-one fragment towards the prime side to yield molecules with less hydrophilicity shows promise to afford potent, selective and orally bioavailable compounds. PMID:25629509

  1. Synthesis of pyridine-fused perylene imides with an amidine moiety for hydrogen bonding.

    PubMed

    Ito, Satoru; Hiroto, Satoru; Shinokubo, Hiroshi

    2013-06-21

    Pyridine-fused perylene tetracarboxylic acid bisimides (PBIs) were synthesized via Suzuki-Miyaura coupling and acid condensation. The fused PBIs with electron-donating substituents exhibited an intramolecular charge transfer interaction. One of the N-alkyl substituents was selectively removed with BBr3 to create an amidine guest binding site. A hydrogen bonding interaction with pentafluorobenzoic acid changed the absorption spectra and enhanced fluorescence.

  2. Array-Based Rational Design of Short Peptide Probe-Derived from an Anti-TNT Monoclonal Antibody.

    PubMed

    Okochi, Mina; Muto, Masaki; Yanai, Kentaro; Tanaka, Masayoshi; Onodera, Takeshi; Wang, Jin; Ueda, Hiroshi; Toko, Kiyoshi

    2017-10-09

    Complementarity-determining regions (CDRs) are sites on the variable chains of antibodies responsible for binding to specific antigens. In this study, a short peptide probe for recognition of 2,4,6-trinitrotoluene (TNT), was identified by testing sequences derived from the CDRs of an anti-TNT monoclonal antibody. The major TNT-binding site in this antibody was identified in the heavy chain CDR3 by antigen docking simulation and confirmed by an immunoassay using a spot-synthesis based peptide array comprising amino acid sequences of six CDRs in the variable region. A peptide derived from heavy chain CDR3 (RGYSSFIYWF) bound to TNT with a dissociation constant of 1.3 μM measured by surface plasmon resonance. Substitution of selected amino acids with basic residues increased TNT binding while substitution with acidic amino acids decreased affinity, an isoleucine to arginine change showed the greatest improvement of 1.8-fold. The ability to create simple peptide binders of volatile organic compounds from sequence information provided by the immune system in the creation of an immune response will be beneficial for sensor developments in the future.

  3. Antigenic peptides containing large PEG loops designed to extend out of the HLA-A2 binding site form stable complexes with class I major histocompatibility complex molecules.

    PubMed Central

    Bouvier, M; Wiley, D C

    1996-01-01

    Recognition of peptides bound to class I major histocompatibility complex (MHC) molecules by specific receptors on T cells regulates the development and activity of the cellular immune system. We have designed and synthesized de novo cyclic peptides that incorporate PEG in the ring structure for binding to class I MHC molecules. The large PEG loops are positioned to extend out of the peptide binding site, thus creating steric effects aimed at preventing the recognition of class I MHC complexes by T-cell receptors. Peptides were synthesized and cyclized on polymer support using high molecular weight symmetrical PEG dicarboxylic acids to link the side chains of lysine residues substituted at positions 4 and 8 in the sequence of the HLA-A2-restricted human T-lymphotrophic virus type I Tax peptide. Cyclic peptides promoted the in vitro folding and assembly of HLA-A2 complexes. Thermal denaturation studies using circular dichroism spectroscopy showed that these complexes are as stable as complexes formed with antigenic peptides. Images Fig. 2 Fig. 4 PMID:8643447

  4. MetaPlotR: a Perl/R pipeline for plotting metagenes of nucleotide modifications and other transcriptomic sites.

    PubMed

    Olarerin-George, Anthony O; Jaffrey, Samie R

    2017-05-15

    An increasing number of studies are mapping protein binding and nucleotide modifications sites throughout the transcriptome. Often, these sites cluster in certain regions of the transcript, giving clues to their function. Hence, it is informative to summarize where in the transcript these sites occur. A metagene is a simple and effective tool for visualizing the distribution of sites along a simplified transcript model. In this work, we introduce MetaPlotR, a Perl/R pipeline for creating metagene plots. The code and associated tutorial are available at https://github.com/olarerin/metaPlotR . srj2003@med.cornell.edu. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

  5. The trehalose/maltose-binding protein as the sensitive element of a glucose biosensor

    NASA Astrophysics Data System (ADS)

    Fonin, A. V.; Povarova, O. I.; Staiano, M.; D'Auria, S.; Turoverov, K. K.; Kuznetsova, I. M.

    2014-08-01

    The promising direction of the development of a modern glucometer is the construction of sensing element on the basis of stained (dyed) protein which changes its fluorescence upon glucose binding. One of the proteins that can be used for this purpose is the D-trehalose/D-maltose-binding protein (TMBP) from the thermophilic bacteria Thermococcus litoralis. We investigated the physical-chemical properties of the protein and evaluated its stability to the denaturing action of GdnHCl and heating. It was confirmed that TMBP is an extremely stable protein. In vivo, the intrinsic ligands of TMBP are trehalose and maltose, but TMBP can also bind glucose. The dissociation constant of the TMBP-glucose complex is in the range of 3-8 mM. The binding of glucose does not noticeably change the intrinsic fluorescence of the TMBP. To register protein-glucose binding, we used the fluorescence of the thiol-reactive dye BADAN attached to TMBP. Because the fluorescence of BADAN attached to the cysteine Cys182 of TMBP does not change upon glucose binding, the mutant forms ТМВР/C182S/X_Cys were created. In these mutant proteins, Cys182 is replaced by Ser, removing intrinsic binding site of BADAN and a new dye binding sites were introduced. The largest increase (by 1.4 times) in the intensity of the dye fluorescence was observed upon TMBP/C182S/A14C-BADAN-Glc complex formation. The dissociation constant of this complex is 3.4 ± 0.1 mM. We consider TMBP/C182S/A14C mutant form with attached fluorescent dye BADAN as a good basis for further research aimed to develop of series of TMBP mutant forms with different affinities to glucose labeled with fluorescent dyes.

  6. Protein-directed self-assembly of a fullerene crystal.

    PubMed

    Kim, Kook-Han; Ko, Dong-Kyun; Kim, Yong-Tae; Kim, Nam Hyeong; Paul, Jaydeep; Zhang, Shao-Qing; Murray, Christopher B; Acharya, Rudresh; DeGrado, William F; Kim, Yong Ho; Grigoryan, Gevorg

    2016-04-26

    Learning to engineer self-assembly would enable the precise organization of molecules by design to create matter with tailored properties. Here we demonstrate that proteins can direct the self-assembly of buckminsterfullerene (C60) into ordered superstructures. A previously engineered tetrameric helical bundle binds C60 in solution, rendering it water soluble. Two tetramers associate with one C60, promoting further organization revealed in a 1.67-Å crystal structure. Fullerene groups occupy periodic lattice sites, sandwiched between two Tyr residues from adjacent tetramers. Strikingly, the assembly exhibits high charge conductance, whereas both the protein-alone crystal and amorphous C60 are electrically insulating. The affinity of C60 for its crystal-binding site is estimated to be in the nanomolar range, with lattices of known protein crystals geometrically compatible with incorporating the motif. Taken together, these findings suggest a new means of organizing fullerene molecules into a rich variety of lattices to generate new properties by design.

  7. Phage display: concept, innovations, applications and future.

    PubMed

    Pande, Jyoti; Szewczyk, Magdalena M; Grover, Ashok K

    2010-01-01

    Phage display is the technology that allows expression of exogenous (poly)peptides on the surface of phage particles. The concept is simple in principle: a library of phage particles expressing a wide diversity of peptides is used to select those that bind the desired target. The filamentous phage M13 is the most commonly used vector to create random peptide display libraries. Several methods including recombinant techniques have been developed to increase the diversity of the library. On the other extreme, libraries with various biases can be created for specific purposes. For instance, when the sequence of the peptide that binds the target is known, its affinity and selectivity can be increased by screening libraries created with limited mutagenesis of the peptide. Phage libraries are screened for binding to synthetic or native targets. The initial screening of library by basic biopanning has been extended to column chromatography including negative screening and competition between selected phage clones to identify high affinity ligands with greater target specificity. The rapid isolation of specific ligands by phage display is advantageous in many applications including selection of inhibitors for the active and allosteric sites of the enzymes, receptor agonists and antagonists, and G-protein binding modulatory peptides. Phage display has been used in epitope mapping and analysis of protein-protein interactions. The specific ligands isolated from phage libraries can be used in therapeutic target validation, drug design and vaccine development. Phage display can also be used in conjunction with other methods. The past innovations and those to come promise a bright future for this field. Copyright © 2010 Elsevier Inc. All rights reserved.

  8. Application of NMR Methods to Identify Detection Reagents for Use in the Development of Robust Nanosensors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cosman, M; Krishnan, V V; Balhorn, R

    2004-04-29

    Nuclear Magnetic Resonance (NMR) spectroscopy is a powerful technique for studying bi-molecular interactions at the atomic scale. Our NMR lab is involved in the identification of small molecules, or ligands that bind to target protein receptors, such as tetanus (TeNT) and botulinum (BoNT) neurotoxins, anthrax proteins and HLA-DR10 receptors on non-Hodgkin's lymphoma cancer cells. Once low affinity binders are identified, they can be linked together to produce multidentate synthetic high affinity ligands (SHALs) that have very high specificity for their target protein receptors. An important nanotechnology application for SHALs is their use in the development of robust chemical sensors ormore » biochips for the detection of pathogen proteins in environmental samples or body fluids. Here, we describe a recently developed NMR competition assay based on transferred nuclear Overhauser effect spectroscopy (trNOESY) that enables the identification of sets of ligands that bind to the same site, or a different site, on the surface of TeNT fragment C (TetC) than a known ''marker'' ligand, doxorubicin. Using this assay, we can identify the optimal pairs of ligands to be linked together for creating detection reagents, as well as estimate the relative binding constants for ligands competing for the same site.« less

  9. Interaction of cesium adatoms with free-standing graphene and graphene-veiled SiO 2 surfaces

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Weck, Philippe F.; Kim, Eunja; Biedermann, Grant W.

    2015-04-21

    In this study, the interaction of Cs adatoms with mono- or bi-layered graphene (MLG and BLG), either free-standing or on a SiO 2 substrate, was investigated using density functional theory. The most stable adsorption sites for Cs are found to be hollow sites on both graphene sheets and graphene-veiled SiO 2(0001). In addition, larger dipole moments are created when a MLG-veiled SiO 2(0001) substrate is used for adsorption of Cs atoms compared to the adsorption on free-standing MLG, due to charge transfer occurring between the MLG and the SiO 2 substrate. For the adsorption of Cs on BLG-veiled SiO 2(0001)more » substrate, these differences are smoothed out and the binding energies corresponding to different sites are nearly degenerate; smaller dipole moments created by the Cs adatoms on BLG compared to MLG are also predicted.« less

  10. Cross-species analysis of Fc engineered anti-Lewis-Y human IgG1 variants in human neonatal receptor transgenic mice reveal importance of S254 and Y436 in binding human neonatal Fc receptor

    PubMed Central

    Burvenich, Ingrid J. G.; Farrugia, William; Lee, Fook T.; Catimel, Bruno; Liu, Zhanqi; Makris, Dahna; Cao, Diana; O'Keefe, Graeme J.; Brechbiel, Martin W.; King, Dylan; Spirkoska, Violeta; Allan, Laura C.; Ramsland, Paul A.; Scott, Andrew M.

    2016-01-01

    ABSTRACT IgG has a long half-life through engagement of its Fc region with the neonatal Fc receptor (FcRn). The FcRn binding site on IgG1 has been shown to contain I253 and H310 in the CH2 domain and H435 in the CH3 domain. Altering the half-life of IgG has been pursued with the aim to prolong or reduce the half-life of therapeutic IgGs. More recent studies have shown that IgGs bind differently to mouse and human FcRn. In this study we characterize a set of hu3S193 IgG1 variants with mutations in the FcRn binding site. A double mutation in the binding site is necessary to abrogate binding to murine FcRn, whereas a single mutation in the FcRn binding site is sufficient to no longer detect binding to human FcRn and create hu3S193 IgG1 variants with a half-life similar to previously studied hu3S193 F(ab')2 (t1/2β, I253A, 12.23 h; H310A, 12.94; H435A, 12.57; F(ab')2, 12.6 h). Alanine substitutions in S254 in the CH2 domain and Y436 in the CH3 domain showed reduced binding in vitro to human FcRn and reduced elimination half-lives in huFcRn transgenic mice (t1/2β, S254A, 37.43 h; Y436A, 39.53 h; wild-type, 83.15 h). These variants had minimal effect on half-life in BALB/c nu/nu mice (t1/2β, S254A, 119.9 h; Y436A, 162.1 h; wild-type, 163.1 h). These results provide insight into the interaction of human Fc by human FcRn, and are important for antibody-based therapeutics with optimal pharmacokinetics for payload strategies used in the clinic. PMID:27030023

  11. Dextran as a Generally Applicable Multivalent Scaffold for Improving Immunoglobulin-Binding Affinities of Peptide and Peptidomimetic Ligands

    PubMed Central

    2015-01-01

    Molecules able to bind the antigen-binding sites of antibodies are of interest in medicine and immunology. Since most antibodies are bivalent, higher affinity recognition can be achieved through avidity effects in which a construct containing two or more copies of the ligand engages both arms of the immunoglobulin simultaneously. This can be achieved routinely by immobilizing antibody ligands at high density on solid surfaces, such as ELISA plates, but there is surprisingly little literature on scaffolds that routinely support bivalent binding of antibody ligands in solution, particularly for the important case of human IgG antibodies. Here we show that the simple strategy of linking two antigens with a polyethylene glycol (PEG) spacer long enough to span the two arms of an antibody results in higher affinity binding in some, but not all, cases. However, we found that the creation of multimeric constructs in which several antibody ligands are displayed on a dextran polymer reliably provides much higher affinity binding than is observed with the monomer in all cases tested. Since these dextran conjugates are simple to construct, they provide a general and convenient strategy to transform modest affinity antibody ligands into high affinity probes. An additional advantage is that the antibody ligands occupy only a small number of the reactive sites on the dextran, so that molecular cargo can be attached easily, creating molecules capable of delivering this cargo to cells displaying antigen-specific receptors. PMID:25073654

  12. Method for Developing Optical Sensors Using a Synthetic Dye-Fluorescent Protein FRET Pair and Computational Modeling and Assessment.

    PubMed

    Mitchell, Joshua A; Zhang, William H; Herde, Michel K; Henneberger, Christian; Janovjak, Harald; O'Mara, Megan L; Jackson, Colin J

    2017-01-01

    Biosensors that exploit Förster resonance energy transfer (FRET) can be used to visualize biological and physiological processes and are capable of providing detailed information in both spatial and temporal dimensions. In a FRET-based biosensor, substrate binding is associated with a change in the relative positions of two fluorophores, leading to a change in FRET efficiency that may be observed in the fluorescence spectrum. As a result, their design requires a ligand-binding protein that exhibits a conformational change upon binding. However, not all ligand-binding proteins produce responsive sensors upon conjugation to fluorescent proteins or dyes, and identifying the optimum locations for the fluorophores often involves labor-intensive iterative design or high-throughput screening. Combining the genetic fusion of a fluorescent protein to the ligand-binding protein with site-specific covalent attachment of a fluorescent dye can allow fine control over the positions of the two fluorophores, allowing the construction of very sensitive sensors. This relies upon the accurate prediction of the locations of the two fluorophores in bound and unbound states. In this chapter, we describe a method for computational identification of dye-attachment sites that allows the use of cysteine modification to attach synthetic dyes that can be paired with a fluorescent protein for the purposes of creating FRET sensors.

  13. Identification of Critical Residues for the Tight Binding of Both Correct and Incorrect Nucleotides to Human DNA Polymerase λ

    PubMed Central

    Brown, Jessica A.; Pack, Lindsey R.; Sherrer, Shanen M.; Kshetry, Ajay K.; Newmister, Sean A.; Fowler, Jason D.; Taylor, John-Stephen; Suo, Zucai

    2010-01-01

    DNA polymerase λ (Pol λ) is a novel X-family DNA polymerase that shares 34% sequence identity with DNA polymerase β (Pol β). Pre-steady state kinetic studies have shown that the Pol λ•DNA complex binds both correct and incorrect nucleotides 130-fold tighter on average than the Pol β•DNA complex, although, the base substitution fidelity of both polymerases is 10−4 to 10−5. To better understand Pol λ’s tight nucleotide binding affinity, we created single- and double-substitution mutants of Pol λ to disrupt interactions between active site residues and an incoming nucleotide or a template base. Single-turnover kinetic assays showed that Pol λ binds to an incoming nucleotide via cooperative interactions with active site residues (R386, R420, K422, Y505, F506, A510, and R514). Disrupting protein interactions with an incoming correct or incorrect nucleotide impacted binding with each of the common structural moieties in the following order: triphosphate ≫ base > ribose. In addition, the loss of Watson-Crick hydrogen bonding between the nucleotide and template base led to a moderate increase in the Kd. The fidelity of Pol λ was maintained predominantly by a single residue, R517, which has minor groove interactions with the DNA template. PMID:20851705

  14. An IFNG SNP with an estrogen-like response element selectively enhances promoter expression in peripheral but not lamina propria T cells.

    PubMed

    Gonsky, R; Deem, R L; Bream, J H; Young, H A; Targan, S R

    2006-07-01

    This study examines mucosa-specific regulatory pathways involved in modulation of interferon-gamma (IFN-gamma) in lamina propria T cells. Previous studies identified mucosa-specific CD2 cis-elements within the -204 to -108 bp IFNG promoter. Within this region, a single-site nucleotide polymorphism, -179G/T, imparts tumor necrosis factor-alpha stimulation of IFNG in peripheral blood lymphocytes, and is linked with accelerated AIDS progression. We discovered a putative estrogen response element (ERE) introduced by the -179T, which displays selective activation in peripheral blood mononuclear cells (PBMC) vs lamina propria mononuclear cells (LPMC). Transfection of PBMC with constructs containing the -179G or -179T site revealed CD2-mediated enhancement of the -179T compared to -179G allele, although, in LPMC, a similar level of expression was detected. Electrophoretic mobility shift assay (EMSA) analysis demonstrated CD2-mediated nucleoprotein binding to the -179T but not the -179G in PBMC. In LPMC, binding is constitutive to both -179G and -179T regions. Sequence and EMSA analysis suggests that the -179T allele creates an ERE-like binding site capable of binding recombinant estrogen receptor. Estrogen response element transactivation is enhanced by CD2 signaling, but inhibited by estrogen in PBMC but not in LPMC, although expression of estrogen receptor was similar. This is the first report to describe a potential molecular mechanism responsible for selectively controlling IFN-gamma production in LPMC.

  15. Simulation of electron-proton coupling with a Monte Carlo method: application to cytochrome c3 using continuum electrostatics.

    PubMed Central

    Baptista, A M; Martel, P J; Soares, C M

    1999-01-01

    A new method is presented for simulating the simultaneous binding equilibrium of electrons and protons on protein molecules, which makes it possible to study the full equilibrium thermodynamics of redox and protonation processes, including electron-proton coupling. The simulations using this method reflect directly the pH and electrostatic potential of the environment, thus providing a much closer and realistic connection with experimental parameters than do usual methods. By ignoring the full binding equilibrium, calculations usually overlook the twofold effect that binding fluctuations have on the behavior of redox proteins: first, they affect the energy of the system by creating partially occupied sites; second, they affect its entropy by introducing an additional empty/occupied site disorder (here named occupational entropy). The proposed method is applied to cytochrome c3 of Desulfovibrio vulgaris Hildenborough to study its redox properties and electron-proton coupling (redox-Bohr effect), using a continuum electrostatic method based on the linear Poisson-Boltzmann equation. Unlike previous studies using other methods, the full reduction order of the four hemes at physiological pH is successfully predicted. The sites more strongly involved in the redox-Bohr effect are identified by analysis of their titration curves/surfaces and the shifts of their midpoint redox potentials and pKa values. Site-site couplings are analyzed using statistical correlations, a method much more realistic than the usual analysis based on direct interactions. The site found to be more strongly involved in the redox-Bohr effect is propionate D of heme I, in agreement with previous studies; other likely candidates are His67, the N-terminus, and propionate D of heme IV. Even though the present study is limited to equilibrium conditions, the possible role of binding fluctuations in the concerted transfer of protons and electrons under nonequilibrium conditions is also discussed. The occupational entropy contributions to midpoint redox potentials and pKa values are computed and shown to be significant. PMID:10354425

  16. Identification of Human Lineage-Specific Transcriptional Coregulators Enabled by a Glossary of Binding Modules and Tunable Genomic Backgrounds.

    PubMed

    Mariani, Luca; Weinand, Kathryn; Vedenko, Anastasia; Barrera, Luis A; Bulyk, Martha L

    2017-09-27

    Transcription factors (TFs) control cellular processes by binding specific DNA motifs to modulate gene expression. Motif enrichment analysis of regulatory regions can identify direct and indirect TF binding sites. Here, we created a glossary of 108 non-redundant TF-8mer "modules" of shared specificity for 671 metazoan TFs from publicly available and new universal protein binding microarray data. Analysis of 239 ENCODE TF chromatin immunoprecipitation sequencing datasets and associated RNA sequencing profiles suggest the 8mer modules are more precise than position weight matrices in identifying indirect binding motifs and their associated tethering TFs. We also developed GENRE (genomically equivalent negative regions), a tunable tool for construction of matched genomic background sequences for analysis of regulatory regions. GENRE outperformed four state-of-the-art approaches to background sequence construction. We used our TF-8mer glossary and GENRE in the analysis of the indirect binding motifs for the co-occurrence of tethering factors, suggesting novel TF-TF interactions. We anticipate that these tools will aid in elucidating tissue-specific gene-regulatory programs. Copyright © 2017 Elsevier Inc. All rights reserved.

  17. Reliable contact fabrication on nanostructured Bi2Te3-based thermoelectric materials.

    PubMed

    Feng, Shien-Ping; Chang, Ya-Huei; Yang, Jian; Poudel, Bed; Yu, Bo; Ren, Zhifeng; Chen, Gang

    2013-05-14

    A cost-effective and reliable Ni-Au contact on nanostructured Bi2Te3-based alloys for a solar thermoelectric generator (STEG) is reported. The use of MPS SAMs creates a strong covalent binding and more nucleation sites with even distribution for electroplating contact electrodes on nanostructured thermoelectric materials. A reliable high-performance flat-panel STEG can be obtained by using this new method.

  18. Development of high-productivity, strong cation-exchange adsorbers for protein capture by graft polymerization from membranes with different pore sizes

    PubMed Central

    Chenette, Heather C.S.; Robinson, Julie R.; Hobley, Eboni; Husson, Scott M.

    2012-01-01

    This paper describes the surface modification of macroporous membranes using ATRP (atom transfer radical polymerization) to create cation-exchange adsorbers with high protein binding capacity at high product throughput. The work is motivated by the need for a more economical and rapid capture step in downstream processing of protein therapeutics. Membranes with three reported nominal pore sizes (0.2, 0.45, 1.0 μm) were modified with poly(3-sulfopropyl methacrylate, potassium salt) tentacles, to create a high density of protein binding sites. A special formulation was used in which the monomer was protected by a crown ether to enable surface-initiated ATRP of this cationic polyelectrolyte. Success with modification was supported by chemical analysis using Fourier-transform infrared spectroscopy and indirectly by measurement of pure water flux as a function of polymerization time. Uniformity of modification within the membranes was visualized with confocal laser scanning microscopy. Static and dynamic binding capacities were measured using lysozyme protein to allow comparisons with reported performance data for commercial cation-exchange materials. Dynamic binding capacities were measured for flow rates ranging from 13 to 109 column volumes (CV)/min. Results show that this unique ATRP formulation can be used to fabricate cation-exchange membrane adsorbers with dynamic binding capacities as high as 70 mg/mL at a throughput of 100 CV/min and unprecedented productivity of 300 mg/mL/min. PMID:23175597

  19. Gamma-aminobutyric acid-modulated benzodiazepine binding sites in bacteria

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lummis, S.C.R.; Johnston, G.A.R.; Nicoletti, G.

    1991-01-01

    Benzodiazepine binding sites, which were once considered to exist only in higher vertebrates, are here demonstrated in the bacteria E. coli. The bacterial ({sup 3}H)diazepam binding sites are modulated by GABA; the modulation is dose dependent and is reduced at high concentrations. The most potent competitors of E.Coli ({sup 3}H)diazepam binding are those that are active in displacing ({sup 3}H)benzodiazepines from vertebrate peripheral benzodiazepine binding sites. These vertebrate sites are not modulated by GABA, in contrast to vertebrate neuronal benzodiazepine binding sites. The E.coli benzodiazepine binding sites therefore differ from both classes of vertebrate benzodiazepine binding sites; however the ligandmore » spectrum and GABA-modulatory properties of the E.coli sites are similar to those found in insects. This intermediate type of receptor in lower species suggests a precursor for at least one class of vertebrate benzodiazepine binding sites may have existed.« less

  20. Multiple binding sites for transcriptional repressors can produce regular bursting and enhance noise suppression

    NASA Astrophysics Data System (ADS)

    Lengyel, Iván M.; Morelli, Luis G.

    2017-04-01

    Cells may control fluctuations in protein levels by means of negative autoregulation, where transcription factors bind DNA sites to repress their own production. Theoretical studies have assumed a single binding site for the repressor, while in most species it is found that multiple binding sites are arranged in clusters. We study a stochastic description of negative autoregulation with multiple binding sites for the repressor. We find that increasing the number of binding sites induces regular bursting of gene products. By tuning the threshold for repression, we show that multiple binding sites can also suppress fluctuations. Our results highlight possible roles for the presence of multiple binding sites of negative autoregulators.

  1. New insights into the catalytic mechanism of Bombyx mori prostaglandin E synthase gained from structure–function analysis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yamamoto, Kohji, E-mail: yamamok@agr.kyushu-u.ac.jp; Suzuki, Mamoru; Higashiura, Akifumi

    2013-11-01

    Highlights: •Structure of Bombyx mori prostaglandin E synthase is determined. •Bound glutathione sulfonic acid is located at the glutathione-binding site. •Electron-sharing network is present in this protein. •This network includes Asn95, Asp96, and Arg98. •Site-directed mutagenesis reveals that the residues contribute to the catalytic activity. -- Abstract: Prostaglandin E synthase (PGES) catalyzes the isomerization of PGH{sub 2} to PGE{sub 2}. We previously reported the identification and structural characterization of Bombyx mori PGES (bmPGES), which belongs to Sigma-class glutathione transferase. Here, we extend these studies by determining the structure of bmPGES in complex with glutathione sulfonic acid (GTS) at a resolutionmore » of 1.37 Å using X-ray crystallography. GTS localized to the glutathione-binding site. We found that electron-sharing network of bmPGES includes Asn95, Asp96, and Arg98. Site-directed mutagenesis of these residues to create mutant forms of bmPGES mutants indicate that they contribute to catalytic activity. These results are, to our knowledge, the first to reveal the presence of an electron-sharing network in bmPGES.« less

  2. Multifunctional Nutrient-Binding Proteins Adapt Human Symbiotic Bacteria for Glycan Competition in the Gut by Separately Promoting Enhanced Sensing and Catalysis

    PubMed Central

    Cameron, Elizabeth A.; Kwiatkowski, Kurt J.; Lee, Byung-Hoo; Hamaker, Bruce R.; Koropatkin, Nicole M.

    2014-01-01

    ABSTRACT To compete for the dynamic stream of nutrients flowing into their ecosystem, colonic bacteria must respond rapidly to new resources and then catabolize them efficiently once they are detected. The Bacteroides thetaiotaomicron starch utilization system (Sus) is a model for nutrient acquisition by symbiotic gut bacteria, which harbor thousands of related Sus-like systems. Structural investigation of the four Sus outer membrane proteins (SusD, -E, -F, and -G) revealed that they contain a total of eight starch-binding sites that we demonstrated, using genetic and biochemical approaches, to play distinct roles in starch metabolism in vitro and in vivo in gnotobiotic mice. SusD, whose homologs are abundant in the human microbiome, is critical for the initial sensing of available starch, allowing sus transcriptional activation at much lower concentrations than without this function. In contrast, seven additional binding sites across SusE, -F, and -G are dispensable for sus activation. However, they optimize the rate of growth on starch in a manner dependent on the expression of the bacterial polysaccharide capsule, suggesting that they have evolved to offset the diffusion barrier created by this structure. These findings demonstrate how proteins with similar biochemical behavior can serve orthogonal functions during different stages of cellular adaptation to nutrients. Finally, we demonstrated in gnotobiotic mice fed a starch-rich diet that the Sus binding sites confer a competitive advantage to B. thetaiotaomicron in vivo in a manner that is dependent on other colonizing microbes. This study reveals how numerically dominant families of carbohydrate-binding proteins in the human microbiome fulfill separate and sometimes cooperative roles to optimize gut commensal bacteria for nutrient acquisition. PMID:25205092

  3. Uncoupling PIP2-calmodulin regulation of Kv7.2 channels by an assembly destabilizing epileptogenic mutation.

    PubMed

    Alberdi, Araitz; Gomis-Perez, Carolina; Bernardo-Seisdedos, Ganeko; Alaimo, Alessandro; Malo, Covadonga; Aldaregia, Juncal; Lopez-Robles, Carlos; Areso, Pilar; Butz, Elisabeth; Wahl-Schott, Christian; Villarroel, Alvaro

    2015-11-01

    We show that the combination of an intracellular bi-partite calmodulin (CaM)-binding site and a distant assembly region affect how an ion channel is regulated by a membrane lipid. Our data reveal that regulation by phosphatidylinositol(4,5)bisphosphate (PIP2) and stabilization of assembled Kv7.2 subunits by intracellular coiled-coil regions far from the membrane are coupled molecular processes. Live-cell fluorescence energy transfer measurements and direct binding studies indicate that remote coiled-coil formation creates conditions for different CaM interaction modes, each conferring different PIP2 dependency to Kv7.2 channels. Disruption of coiled-coil formation by epilepsy-causing mutation decreases apparent CaM-binding affinity and interrupts CaM influence on PIP2 sensitivity. © 2015. Published by The Company of Biologists Ltd.

  4. Integrative analysis of the Caenorhabditis elegans genome by the modENCODE project.

    PubMed

    Gerstein, Mark B; Lu, Zhi John; Van Nostrand, Eric L; Cheng, Chao; Arshinoff, Bradley I; Liu, Tao; Yip, Kevin Y; Robilotto, Rebecca; Rechtsteiner, Andreas; Ikegami, Kohta; Alves, Pedro; Chateigner, Aurelien; Perry, Marc; Morris, Mitzi; Auerbach, Raymond K; Feng, Xin; Leng, Jing; Vielle, Anne; Niu, Wei; Rhrissorrakrai, Kahn; Agarwal, Ashish; Alexander, Roger P; Barber, Galt; Brdlik, Cathleen M; Brennan, Jennifer; Brouillet, Jeremy Jean; Carr, Adrian; Cheung, Ming-Sin; Clawson, Hiram; Contrino, Sergio; Dannenberg, Luke O; Dernburg, Abby F; Desai, Arshad; Dick, Lindsay; Dosé, Andréa C; Du, Jiang; Egelhofer, Thea; Ercan, Sevinc; Euskirchen, Ghia; Ewing, Brent; Feingold, Elise A; Gassmann, Reto; Good, Peter J; Green, Phil; Gullier, Francois; Gutwein, Michelle; Guyer, Mark S; Habegger, Lukas; Han, Ting; Henikoff, Jorja G; Henz, Stefan R; Hinrichs, Angie; Holster, Heather; Hyman, Tony; Iniguez, A Leo; Janette, Judith; Jensen, Morten; Kato, Masaomi; Kent, W James; Kephart, Ellen; Khivansara, Vishal; Khurana, Ekta; Kim, John K; Kolasinska-Zwierz, Paulina; Lai, Eric C; Latorre, Isabel; Leahey, Amber; Lewis, Suzanna; Lloyd, Paul; Lochovsky, Lucas; Lowdon, Rebecca F; Lubling, Yaniv; Lyne, Rachel; MacCoss, Michael; Mackowiak, Sebastian D; Mangone, Marco; McKay, Sheldon; Mecenas, Desirea; Merrihew, Gennifer; Miller, David M; Muroyama, Andrew; Murray, John I; Ooi, Siew-Loon; Pham, Hoang; Phippen, Taryn; Preston, Elicia A; Rajewsky, Nikolaus; Rätsch, Gunnar; Rosenbaum, Heidi; Rozowsky, Joel; Rutherford, Kim; Ruzanov, Peter; Sarov, Mihail; Sasidharan, Rajkumar; Sboner, Andrea; Scheid, Paul; Segal, Eran; Shin, Hyunjin; Shou, Chong; Slack, Frank J; Slightam, Cindie; Smith, Richard; Spencer, William C; Stinson, E O; Taing, Scott; Takasaki, Teruaki; Vafeados, Dionne; Voronina, Ksenia; Wang, Guilin; Washington, Nicole L; Whittle, Christina M; Wu, Beijing; Yan, Koon-Kiu; Zeller, Georg; Zha, Zheng; Zhong, Mei; Zhou, Xingliang; Ahringer, Julie; Strome, Susan; Gunsalus, Kristin C; Micklem, Gos; Liu, X Shirley; Reinke, Valerie; Kim, Stuart K; Hillier, LaDeana W; Henikoff, Steven; Piano, Fabio; Snyder, Michael; Stein, Lincoln; Lieb, Jason D; Waterston, Robert H

    2010-12-24

    We systematically generated large-scale data sets to improve genome annotation for the nematode Caenorhabditis elegans, a key model organism. These data sets include transcriptome profiling across a developmental time course, genome-wide identification of transcription factor-binding sites, and maps of chromatin organization. From this, we created more complete and accurate gene models, including alternative splice forms and candidate noncoding RNAs. We constructed hierarchical networks of transcription factor-binding and microRNA interactions and discovered chromosomal locations bound by an unusually large number of transcription factors. Different patterns of chromatin composition and histone modification were revealed between chromosome arms and centers, with similarly prominent differences between autosomes and the X chromosome. Integrating data types, we built statistical models relating chromatin, transcription factor binding, and gene expression. Overall, our analyses ascribed putative functions to most of the conserved genome.

  5. Structure-based CoMFA as a predictive model - CYP2C9 inhibitors as a test case.

    PubMed

    Yasuo, Kazuya; Yamaotsu, Noriyuki; Gouda, Hiroaki; Tsujishita, Hideki; Hirono, Shuichi

    2009-04-01

    In this study, we tried to establish a general scheme to create a model that could predict the affinity of small compounds to their target proteins. This scheme consists of a search for ligand-binding sites on a protein, a generation of bound conformations (poses) of ligands in each of the sites by docking, identifications of the correct poses of each ligand by consensus scoring and MM-PBSA analysis, and a construction of a CoMFA model with the obtained poses to predict the affinity of the ligands. By using a crystal structure of CYP 2C9 and the twenty known CYP inhibitors as a test case, we obtained a CoMFA model with a good statistics, which suggested that the classification of the binding sites as well as the predicted bound poses of the ligands should be reasonable enough. The scheme described here would give a method to predict the affinity of small compounds with a reasonable accuracy, which is expected to heighten the value of computational chemistry in the drug design process.

  6. Insights into the surface topology of polyhydroxyalkanoate synthase: self-assembly of functionalized inclusions.

    PubMed

    Hooks, David O; Rehm, Bernd H A

    2015-10-01

    The polyhydroxyalkanoate (PHA) synthase catalyzes the synthesis of PHA and remains attached to the hydrophobic PHA inclusions it creates. Although this feature is actively exploited to generate functionalized biobeads via protein engineering, little is known about the structure of the PHA synthase. Here, the surface topology of Ralstonia eutropha PHA synthase was probed to inform rational protein engineering toward the production of functionalized PHA beads. Surface-exposed residues were detected by conjugating biotin to inclusion-bound PHA synthase and identifying the biotin-conjugated lysine and cysteine residues using peptide fingerprinting analysis. The identified sites (K77, K90, K139, C382, C459, and K518) were investigated as insertion sites for the generation of new protein fusions. Insertions of FLAG epitopes into exposed sites K77, K90, K139, and K518 were tolerated, retaining >65 % of in vivo activity. Sites K90, K139, and K518 were also tested by insertion of the immunoglobulin G (IgG)-binding domain (ZZ), successfully producing PHA inclusions able to bind human IgG in vitro. Although simultaneous insertions of the ZZ domain into two sites was permissive, insertion at all three lysine sites inactivated the synthase. The K90/K139 double ZZ insertion had the optimum IgG-binding capacity of 16 mg IgG/g wet PHA beads and could selectively purify the IgG fraction from human serum. Overall, this study identified surface-exposed flexible regions of the PHA synthase which either tolerate protein/peptide insertions or are critical for protein function. This further elucidates the structure and function of PHA synthase and provides new opportunities for generating functionalized PHA biobeads.

  7. Identification of a novel cell culture adaptation site on the capsid of foot-and-mouth disease virus.

    PubMed

    Chamberlain, Kyle; Fowler, Veronica L; Barnett, Paul V; Gold, Sarah; Wadsworth, Jemma; Knowles, Nick J; Jackson, Terry

    2015-09-01

    Vaccination remains the most effective tool for control of foot-and-mouth disease both in endemic countries and as an emergency preparedness for new outbreaks. Foot-and-mouth disease vaccines are chemically inactivated virus preparations and the production of new vaccines is critically dependent upon cell culture adaptation of field viruses, which can prove problematic. A major driver of cell culture adaptation is receptor availability. Field isolates of foot-and-mouth disease virus (FMDV) use RGD-dependent integrins as receptors, whereas cell culture adaptation often selects for variants with altered receptor preferences. Previously, two independent sites on the capsid have been identified where mutations are associated with improved cell culture growth. One is a shallow depression formed by the three major structural proteins (VP1-VP3) where mutations create a heparan sulphate (HS)-binding site (the canonical HS-binding site). The other involves residues of VP1 and is located at the fivefold symmetry axis. For some viruses, changes at this site result in HS binding; for others, the receptors are unknown. Here, we report the identification of a novel site on VP2 where mutations resulted in an expanded cell tropism of a vaccine variant of A/IRN/87 (called A - ). Furthermore, we show that introducing the same mutations into a different type A field virus (A/TUR/2/2006) resulted in the same expanded cell culture tropism as the A/IRN/87 A -  vaccine variant. These observations add to the evidence for multiple cell attachment mechanisms for FMDV and may be useful for vaccine manufacture when cell culture adaptation proves difficult.

  8. Identification of a novel cell culture adaptation site on the capsid of foot-and-mouth disease virus

    PubMed Central

    Chamberlain, Kyle; Fowler, Veronica L.; Barnett, Paul V.; Gold, Sarah; Wadsworth, Jemma; Knowles, Nick J.

    2015-01-01

    Vaccination remains the most effective tool for control of foot-and-mouth disease both in endemic countries and as an emergency preparedness for new outbreaks. Foot-and-mouth disease vaccines are chemically inactivated virus preparations and the production of new vaccines is critically dependent upon cell culture adaptation of field viruses, which can prove problematic. A major driver of cell culture adaptation is receptor availability. Field isolates of foot-and-mouth disease virus (FMDV) use RGD-dependent integrins as receptors, whereas cell culture adaptation often selects for variants with altered receptor preferences. Previously, two independent sites on the capsid have been identified where mutations are associated with improved cell culture growth. One is a shallow depression formed by the three major structural proteins (VP1–VP3) where mutations create a heparan sulphate (HS)-binding site (the canonical HS-binding site). The other involves residues of VP1 and is located at the fivefold symmetry axis. For some viruses, changes at this site result in HS binding; for others, the receptors are unknown. Here, we report the identification of a novel site on VP2 where mutations resulted in an expanded cell tropism of a vaccine variant of A/IRN/87 (called A − ). Furthermore, we show that introducing the same mutations into a different type A field virus (A/TUR/2/2006) resulted in the same expanded cell culture tropism as the A/IRN/87 A −  vaccine variant. These observations add to the evidence for multiple cell attachment mechanisms for FMDV and may be useful for vaccine manufacture when cell culture adaptation proves difficult. PMID:26296881

  9. mRNA–mRNA duplexes that auto-elicit Staufen1-mediated mRNA decay

    PubMed Central

    Gong, Chenguang; Tang, Yalan; Maquat, Lynne E.

    2013-01-01

    We report a new mechanism by which human mRNAs crosstalk: an Alu element in the 3'-untranslated region (3' UTR) of one mRNA can base-pair with a partially complementary Alu element in the 3' UTR of a different mRNA thereby creating a Staufen1 (STAU1)-binding site (SBS). STAU1 binding to a 3' UTR SBS was previously shown to trigger STAU1-mediated mRNA decay (SMD) by directly recruiting the ATP-dependent RNA helicase UPF1, which is also a key factor in the mechanistically related nonsense-mediated mRNA decay (NMD) pathway. In the case of a 3' UTR SBS created via mRNA–mRNA base-pairing, we show that SMD targets both mRNAs in the duplex provided that both mRNAs are translated. If only one mRNA is translated, then it alone is targeted for SMD. We demonstrate the importance of mRNA–mRNA-triggered SMD to the processes of cell migration and invasion. PMID:24056942

  10. Characterization of nicotine binding to the rat brain P/sub 2/ preparation: the identification of multiple binding sites which include specific up-regulatory site(s)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sloan, J.W.

    1984-01-01

    These studies show that nicotine binds to the rat brain P/sub 2/ preparation by saturable and reversible processes. Multiple binding sites were revealed by the configuration of saturation, kinetic and Scatchard plots. A least squares best fit of Scatchard data using nonlinear curve fitting programs confirmed the presence of a very high affinity site, an up-regulatory site, a high affinity site and one or two low affinity sites. Stereospecificity was demonstrated for the up-regulatory site where (+)-nicotine was more effective and for the high affinity site where (-)-nicotine had a higher affinity. Drugs which selectively up-regulate nicotine binding site(s) havemore » been identified. Further, separate very high and high affinity sites were identified for (-)- and (+)-(/sup 3/H)nicotine, based on evidence that the site density for the (-)-isomer is 10 times greater than that for the (+)-isomer at these sites. Enhanced nicotine binding has been shown to be a statistically significant phenomenon which appears to be a consequence of drugs binding to specific site(s) which up-regulate binding at other site(s). Although Scatchard and Hill plots indicate positive cooperatively, up-regulation more adequately describes the function of these site(s). A separate up-regulatory site is suggested by the following: (1) Drugs vary markedly in their ability to up-regulate binding. (2) Both the affinity and the degree of up-regulation can be altered by structural changes in ligands. (3) Drugs with specificity for up-regulation have been identified. (4) Some drugs enhance binding in a dose-related manner. (5) Competition studies employing cold (-)- and (+)-nicotine against (-)- and (+)-(/sup 3/H)nicotine show that the isomers bind to separate sites which up-regulate binding at the (-)- and (+)-nicotine high affinity sites and in this regard (+)-nicotine is more specific and efficacious than (-)-nicotine.« less

  11. Discovery and information-theoretic characterization of transcription factor binding sites that act cooperatively.

    PubMed

    Clifford, Jacob; Adami, Christoph

    2015-09-02

    Transcription factor binding to the surface of DNA regulatory regions is one of the primary causes of regulating gene expression levels. A probabilistic approach to model protein-DNA interactions at the sequence level is through position weight matrices (PWMs) that estimate the joint probability of a DNA binding site sequence by assuming positional independence within the DNA sequence. Here we construct conditional PWMs that depend on the motif signatures in the flanking DNA sequence, by conditioning known binding site loci on the presence or absence of additional binding sites in the flanking sequence of each site's locus. Pooling known sites with similar flanking sequence patterns allows for the estimation of the conditional distribution function over the binding site sequences. We apply our model to the Dorsal transcription factor binding sites active in patterning the Dorsal-Ventral axis of Drosophila development. We find that those binding sites that cooperate with nearby Twist sites on average contain about 0.5 bits of information about the presence of Twist transcription factor binding sites in the flanking sequence. We also find that Dorsal binding site detectors conditioned on flanking sequence information make better predictions about what is a Dorsal site relative to background DNA than detection without information about flanking sequence features.

  12. Molecular Mechanism of Wide Photoabsorption Spectral Shifts of Color Variants of Human Cellular Retinol Binding Protein II.

    PubMed

    Cheng, Cheng; Kamiya, Motoshi; Uchida, Yoshihiro; Hayashi, Shigehiko

    2015-10-21

    Color variants of human cellular retinol binding protein II (hCRBPII) created by protein engineering were recently shown to exhibit anomalously wide photoabsorption spectral shifts over ∼200 nm across the visible region. The remarkable phenomenon provides a unique opportunity to gain insight into the molecular basis of the color tuning of retinal binding proteins for understanding of color vision as well as for engineering of novel color variants of retinal binding photoreceptor proteins employed in optogenetics. Here, we report a theoretical investigation of the molecular mechanism underlying the anomalously wide spectral shifts of the color variants of hCRBPII. Computational modeling of the color variants with hybrid molecular simulations of free energy geometry optimization succeeded in reproducing the experimentally observed wide spectral shifts, and revealed that protein flexibility, through which the active site structure of the protein and bound water molecules is altered by remote mutations, plays a significant role in inducing the large spectral shifts.

  13. Binding Energy calculation of GSK-3 protein of Human against some anti-diabetic compounds of Momordica charantia linn (Bitter melon)

    PubMed Central

    Hazarika, Ridip; Parida, Pratap; Neog, Bijoy; Yadav, Raj Narain Singh

    2012-01-01

    Diabetes is one of the major life threatening diseases worldwide. It creates major health problems in urban India. Glycogen Synthase Kinase-3 (GSK-3) protein of human is known for phosphorylating and inactivating glycogen synthase which also acts as a negative regulator in the hormonal control of glucose homeostasis. In traditional medicine, Momordica charantia is used as antidiabetic plant because of its hypoglycemic effect. Hence to block the active site of the GSK-3 protein three anti-diabetic compounds namely, charantin, momordenol & momordicilin were taken from Momordica charantia for docking study and calculation of binding energy. The aim of present investigation is to find the binding energy of three major insulin-like active compounds against glycogen synthase kinase-3 (GSK-3), one of the key proteins involved in carbohydrate metabolism, with the help of molecular docking using ExomeTM Horizon suite. The study recorded minimum binding energy by momordicilin in comparison to the others. PMID:22493531

  14. Binding Energy calculation of GSK-3 protein of Human against some anti-diabetic compounds of Momordica charantia linn (Bitter melon).

    PubMed

    Hazarika, Ridip; Parida, Pratap; Neog, Bijoy; Yadav, Raj Narain Singh

    2012-01-01

    Diabetes is one of the major life threatening diseases worldwide. It creates major health problems in urban India. Glycogen Synthase Kinase-3 (GSK-3) protein of human is known for phosphorylating and inactivating glycogen synthase which also acts as a negative regulator in the hormonal control of glucose homeostasis. In traditional medicine, Momordica charantia is used as antidiabetic plant because of its hypoglycemic effect. Hence to block the active site of the GSK-3 protein three anti-diabetic compounds namely, charantin, momordenol & momordicilin were taken from Momordica charantia for docking study and calculation of binding energy. The aim of present investigation is to find the binding energy of three major insulin-like active compounds against glycogen synthase kinase-3 (GSK-3), one of the key proteins involved in carbohydrate metabolism, with the help of molecular docking using ExomeTM Horizon suite. The study recorded minimum binding energy by momordicilin in comparison to the others.

  15. BLSSpeller: exhaustive comparative discovery of conserved cis-regulatory elements.

    PubMed

    De Witte, Dieter; Van de Velde, Jan; Decap, Dries; Van Bel, Michiel; Audenaert, Pieter; Demeester, Piet; Dhoedt, Bart; Vandepoele, Klaas; Fostier, Jan

    2015-12-01

    The accurate discovery and annotation of regulatory elements remains a challenging problem. The growing number of sequenced genomes creates new opportunities for comparative approaches to motif discovery. Putative binding sites are then considered to be functional if they are conserved in orthologous promoter sequences of multiple related species. Existing methods for comparative motif discovery usually rely on pregenerated multiple sequence alignments, which are difficult to obtain for more diverged species such as plants. As a consequence, misaligned regulatory elements often remain undetected. We present a novel algorithm that supports both alignment-free and alignment-based motif discovery in the promoter sequences of related species. Putative motifs are exhaustively enumerated as words over the IUPAC alphabet and screened for conservation using the branch length score. Additionally, a confidence score is established in a genome-wide fashion. In order to take advantage of a cloud computing infrastructure, the MapReduce programming model is adopted. The method is applied to four monocotyledon plant species and it is shown that high-scoring motifs are significantly enriched for open chromatin regions in Oryza sativa and for transcription factor binding sites inferred through protein-binding microarrays in O.sativa and Zea mays. Furthermore, the method is shown to recover experimentally profiled ga2ox1-like KN1 binding sites in Z.mays. BLSSpeller was written in Java. Source code and manual are available at http://bioinformatics.intec.ugent.be/blsspeller Klaas.Vandepoele@psb.vib-ugent.be or jan.fostier@intec.ugent.be. Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press.

  16. BLSSpeller: exhaustive comparative discovery of conserved cis-regulatory elements

    PubMed Central

    De Witte, Dieter; Van de Velde, Jan; Decap, Dries; Van Bel, Michiel; Audenaert, Pieter; Demeester, Piet; Dhoedt, Bart; Vandepoele, Klaas; Fostier, Jan

    2015-01-01

    Motivation: The accurate discovery and annotation of regulatory elements remains a challenging problem. The growing number of sequenced genomes creates new opportunities for comparative approaches to motif discovery. Putative binding sites are then considered to be functional if they are conserved in orthologous promoter sequences of multiple related species. Existing methods for comparative motif discovery usually rely on pregenerated multiple sequence alignments, which are difficult to obtain for more diverged species such as plants. As a consequence, misaligned regulatory elements often remain undetected. Results: We present a novel algorithm that supports both alignment-free and alignment-based motif discovery in the promoter sequences of related species. Putative motifs are exhaustively enumerated as words over the IUPAC alphabet and screened for conservation using the branch length score. Additionally, a confidence score is established in a genome-wide fashion. In order to take advantage of a cloud computing infrastructure, the MapReduce programming model is adopted. The method is applied to four monocotyledon plant species and it is shown that high-scoring motifs are significantly enriched for open chromatin regions in Oryza sativa and for transcription factor binding sites inferred through protein-binding microarrays in O.sativa and Zea mays. Furthermore, the method is shown to recover experimentally profiled ga2ox1-like KN1 binding sites in Z.mays. Availability and implementation: BLSSpeller was written in Java. Source code and manual are available at http://bioinformatics.intec.ugent.be/blsspeller Contact: Klaas.Vandepoele@psb.vib-ugent.be or jan.fostier@intec.ugent.be Supplementary information: Supplementary data are available at Bioinformatics online. PMID:26254488

  17. Directing stem cell trafficking via GPS.

    PubMed

    Sackstein, Robert

    2010-01-01

    The success of stem-cell-based regenerative therapeutics critically hinges on delivering relevant stem/progenitor cells to sites of tissue injury. To achieve adequate parenchymal infiltration following intravascular administration, it is first necessary that circulating cells bind to target tissue endothelium with sufficient strength to overcome the prevailing forces of hemodynamic shear. The principal mediators of these shear-resistant binding interactions consist of a family of C-type lectins known as "selectins" that bind discrete sialofucosylated glycans on their respective ligands. One member of this family, E-selectin, is an endothelial molecule that is inducibly expressed on postcapillary venules at all sites of tissue injury, but is also constitutively expressed on the luminal surface of bone marrow and dermal microvascular endothelium. Most stem/progenitor cells express high levels of CD44, and, in particular, human hematopoietic stem cells express a specialized sialofucosylated glycoform of CD44 known as "hematopoietic cell E-/L-selectin ligand" (HCELL) that functions as a potent E-selectin ligand. This chapter describes a method called "glycosyltransferase-programmed stereosubstitution" (GPS) for custom-modifying CD44 glycans to create HCELL on the surface of living cells that natively lack HCELL. Ex vivo glycan engineering of HCELL via GPS licenses trafficking of infused cells to endothelial beds that express E-selectin, thereby enabling efficient vascular delivery of stem/progenitor cells to sites where they are needed. Copyright (c) 2010 Elsevier Inc. All rights reserved.

  18. A new method for the construction of a mutant library with a predictable occurrence rate using Poisson distribution.

    PubMed

    Seong, Ki Moon; Park, Hweon; Kim, Seong Jung; Ha, Hyo Nam; Lee, Jae Yung; Kim, Joon

    2007-06-01

    A yeast transcriptional activator, Gcn4p, induces the expression of genes that are involved in amino acid and purine biosynthetic pathways under amino acid starvation. Gcn4p has an acidic activation domain in the central region and a bZIP domain in the C-terminus that is divided into the DNA-binding motif and dimerization leucine zipper motif. In order to identify amino acids in the DNA-binding motif of Gcn4p which are involved in transcriptional activation, we constructed mutant libraries in the DNA-binding motif through an innovative application of random mutagenesis. Mutant library made by oligonucleotides which were mutated randomly using the Poisson distribution showed that the actual mutation frequency was in good agreement with expected values. This method could save the time and effort to create a mutant library with a predictable mutation frequency. Based on the studies using the mutant libraries constructed by the new method, the specific residues of the DNA-binding domain in Gcn4p appear to be involved in the transcriptional activities on a conserved binding site.

  19. Deconvoluting AMP-activated protein kinase (AMPK) adenine nucleotide binding and sensing

    PubMed Central

    Gu, Xin; Yan, Yan; Novick, Scott J.; Kovach, Amanda; Goswami, Devrishi; Ke, Jiyuan; Tan, M. H. Eileen; Wang, Lili; Li, Xiaodan; de Waal, Parker W.; Webb, Martin R.; Griffin, Patrick R.; Xu, H. Eric

    2017-01-01

    AMP-activated protein kinase (AMPK) is a central cellular energy sensor that adapts metabolism and growth to the energy state of the cell. AMPK senses the ratio of adenine nucleotides (adenylate energy charge) by competitive binding of AMP, ADP, and ATP to three sites (CBS1, CBS3, and CBS4) in its γ-subunit. Because these three binding sites are functionally interconnected, it remains unclear how nucleotides bind to individual sites, which nucleotides occupy each site under physiological conditions, and how binding to one site affects binding to the other sites. Here, we comprehensively analyze nucleotide binding to wild-type and mutant AMPK protein complexes by quantitative competition assays and by hydrogen-deuterium exchange MS. We also demonstrate that NADPH, in addition to the known AMPK ligand NADH, directly and competitively binds AMPK at the AMP-sensing CBS3 site. Our findings reveal how AMP binding to one site affects the conformation and adenine nucleotide binding at the other two sites and establish CBS3, and not CBS1, as the high affinity exchangeable AMP/ADP/ATP-binding site. We further show that AMP binding at CBS4 increases AMP binding at CBS3 by 2 orders of magnitude and reverses the AMP/ATP preference of CBS3. Together, these results illustrate how the three CBS sites collaborate to enable highly sensitive detection of cellular energy states to maintain the tight ATP homeostastis required for cellular metabolism. PMID:28615457

  20. Engineering the Substrate Specificity of a Thermophilic Penicillin Acylase from Thermus thermophilus

    PubMed Central

    Torres, Leticia L.; Cantero, Ángel; del Valle, Mercedes; Marina, Anabel; López-Gallego, Fernando; Guisán, José M.

    2013-01-01

    A homologue of the Escherichia coli penicillin acylase is encoded in the genomes of several thermophiles, including in different Thermus thermophilus strains. Although the natural substrate of this enzyme is not known, this acylase shows a marked preference for penicillin K over penicillin G. Three-dimensional models were created in which the catalytic residues and the substrate binding pocket were identified. Through rational redesign, residues were replaced to mimic the aromatic binding site of the E. coli penicillin G acylase. A set of enzyme variants containing between one and four amino acid replacements was generated, with altered catalytic properties in the hydrolyses of penicillins K and G. The introduction of a single phenylalanine residue in position α188, α189, or β24 improved the Km for penicillin G between 9- and 12-fold, and the catalytic efficiency of these variants for penicillin G was improved up to 6.6-fold. Structural models, as well as docking analyses, can predict the positioning of penicillins G and K for catalysis and can demonstrate how binding in a productive pose is compromised when more than one bulky phenylalanine residue is introduced into the active site. PMID:23263966

  1. An Electrostatic Funnel in the GABA-Binding Pathway

    PubMed Central

    Lightstone, Felice C.

    2016-01-01

    The γ-aminobutyric acid type A receptor (GABAA-R) is a major inhibitory neuroreceptor that is activated by the binding of GABA. The structure of the GABAA-R is well characterized, and many of the binding site residues have been identified. However, most of these residues are obscured behind the C-loop that acts as a cover to the binding site. Thus, the mechanism by which the GABA molecule recognizes the binding site, and the pathway it takes to enter the binding site are both unclear. Through the completion and detailed analysis of 100 short, unbiased, independent molecular dynamics simulations, we have investigated this phenomenon of GABA entering the binding site. In each system, GABA was placed quasi-randomly near the binding site of a GABAA-R homology model, and atomistic simulations were carried out to observe the behavior of the GABA molecules. GABA fully entered the binding site in 19 of the 100 simulations. The pathway taken by these molecules was consistent and non-random; the GABA molecules approach the binding site from below, before passing up behind the C-loop and into the binding site. This binding pathway is driven by long-range electrostatic interactions, whereby the electrostatic field acts as a ‘funnel’ that sweeps the GABA molecules towards the binding site, at which point more specific atomic interactions take over. These findings define a nuanced mechanism whereby the GABAA-R uses the general zwitterionic features of the GABA molecule to identify a potential ligand some 2 nm away from the binding site. PMID:27119953

  2. Modeling Complex Equilibria in ITC Experiments: Thermodynamic Parameters Estimation for a Three Binding Site Model

    PubMed Central

    Le, Vu H.; Buscaglia, Robert; Chaires, Jonathan B.; Lewis, Edwin A.

    2013-01-01

    Isothermal Titration Calorimetry, ITC, is a powerful technique that can be used to estimate a complete set of thermodynamic parameters (e.g. Keq (or ΔG), ΔH, ΔS, and n) for a ligand binding interaction described by a thermodynamic model. Thermodynamic models are constructed by combination of equilibrium constant, mass balance, and charge balance equations for the system under study. Commercial ITC instruments are supplied with software that includes a number of simple interaction models, for example one binding site, two binding sites, sequential sites, and n-independent binding sites. More complex models for example, three or more binding sites, one site with multiple binding mechanisms, linked equilibria, or equilibria involving macromolecular conformational selection through ligand binding need to be developed on a case by case basis by the ITC user. In this paper we provide an algorithm (and a link to our MATLAB program) for the non-linear regression analysis of a multiple binding site model with up to four overlapping binding equilibria. Error analysis demonstrates that fitting ITC data for multiple parameters (e.g. up to nine parameters in the three binding site model) yields thermodynamic parameters with acceptable accuracy. PMID:23262283

  3. Theoretical Analysis of Allosteric and Operator Binding for Cyclic-AMP Receptor Protein Mutants

    NASA Astrophysics Data System (ADS)

    Einav, Tal; Duque, Julia; Phillips, Rob

    2018-02-01

    Allosteric transcription factors undergo binding events both at their inducer binding sites as well as at distinct DNA binding domains, and it is often difficult to disentangle the structural and functional consequences of these two classes of interactions. In this work, we compare the ability of two statistical mechanical models - the Monod-Wyman-Changeux (MWC) and the Koshland-N\\'emethy-Filmer (KNF) models of protein conformational change - to characterize the multi-step activation mechanism of the broadly acting cyclic-AMP receptor protein (CRP). We first consider the allosteric transition resulting from cyclic-AMP binding to CRP, then analyze how CRP binds to its operator, and finally investigate the ability of CRP to activate gene expression. In light of these models, we examine data from a beautiful recent experiment that created a single-chain version of the CRP homodimer, thereby enabling each subunit to be mutated separately. Using this construct, six mutants were created using all possible combinations of the wild type subunit, a D53H mutant subunit, and an S62F mutant subunit. We demonstrate that both the MWC and KNF models can explain the behavior of all six mutants using a small, self-consistent set of parameters. In comparing the results, we find that the MWC model slightly outperforms the KNF model in the quality of its fits, but more importantly the parameters inferred by the MWC model are more in line with structural knowledge of CRP. In addition, we discuss how the conceptual framework developed here for CRP enables us to not merely analyze data retrospectively, but has the predictive power to determine how combinations of mutations will interact, how double mutants will behave, and how each construct would regulate gene expression.

  4. Unified superresolution experiments and stochastic theory provide mechanistic insight into protein ion-exchange adsorptive separations

    PubMed Central

    Kisley, Lydia; Chen, Jixin; Mansur, Andrea P.; Shuang, Bo; Kourentzi, Katerina; Poongavanam, Mohan-Vivekanandan; Chen, Wen-Hsiang; Dhamane, Sagar; Willson, Richard C.; Landes, Christy F.

    2014-01-01

    Chromatographic protein separations, immunoassays, and biosensing all typically involve the adsorption of proteins to surfaces decorated with charged, hydrophobic, or affinity ligands. Despite increasingly widespread use throughout the pharmaceutical industry, mechanistic detail about the interactions of proteins with individual chromatographic adsorbent sites is available only via inference from ensemble measurements such as binding isotherms, calorimetry, and chromatography. In this work, we present the direct superresolution mapping and kinetic characterization of functional sites on ion-exchange ligands based on agarose, a support matrix routinely used in protein chromatography. By quantifying the interactions of single proteins with individual charged ligands, we demonstrate that clusters of charges are necessary to create detectable adsorption sites and that even chemically identical ligands create adsorption sites of varying kinetic properties that depend on steric availability at the interface. Additionally, we relate experimental results to the stochastic theory of chromatography. Simulated elution profiles calculated from the molecular-scale data suggest that, if it were possible to engineer uniform optimal interactions into ion-exchange systems, separation efficiencies could be improved by as much as a factor of five by deliberately exploiting clustered interactions that currently dominate the ion-exchange process only accidentally. PMID:24459184

  5. Unified superresolution experiments and stochastic theory provide mechanistic insight into protein ion-exchange adsorptive separations.

    PubMed

    Kisley, Lydia; Chen, Jixin; Mansur, Andrea P; Shuang, Bo; Kourentzi, Katerina; Poongavanam, Mohan-Vivekanandan; Chen, Wen-Hsiang; Dhamane, Sagar; Willson, Richard C; Landes, Christy F

    2014-02-11

    Chromatographic protein separations, immunoassays, and biosensing all typically involve the adsorption of proteins to surfaces decorated with charged, hydrophobic, or affinity ligands. Despite increasingly widespread use throughout the pharmaceutical industry, mechanistic detail about the interactions of proteins with individual chromatographic adsorbent sites is available only via inference from ensemble measurements such as binding isotherms, calorimetry, and chromatography. In this work, we present the direct superresolution mapping and kinetic characterization of functional sites on ion-exchange ligands based on agarose, a support matrix routinely used in protein chromatography. By quantifying the interactions of single proteins with individual charged ligands, we demonstrate that clusters of charges are necessary to create detectable adsorption sites and that even chemically identical ligands create adsorption sites of varying kinetic properties that depend on steric availability at the interface. Additionally, we relate experimental results to the stochastic theory of chromatography. Simulated elution profiles calculated from the molecular-scale data suggest that, if it were possible to engineer uniform optimal interactions into ion-exchange systems, separation efficiencies could be improved by as much as a factor of five by deliberately exploiting clustered interactions that currently dominate the ion-exchange process only accidentally.

  6. A tool for calculating binding-site residues on proteins from PDB structures.

    PubMed

    Hu, Jing; Yan, Changhui

    2009-08-03

    In the research on protein functional sites, researchers often need to identify binding-site residues on a protein. A commonly used strategy is to find a complex structure from the Protein Data Bank (PDB) that consists of the protein of interest and its interacting partner(s) and calculate binding-site residues based on the complex structure. However, since a protein may participate in multiple interactions, the binding-site residues calculated based on one complex structure usually do not reveal all binding sites on a protein. Thus, this requires researchers to find all PDB complexes that contain the protein of interest and combine the binding-site information gleaned from them. This process is very time-consuming. Especially, combing binding-site information obtained from different PDB structures requires tedious work to align protein sequences. The process becomes overwhelmingly difficult when researchers have a large set of proteins to analyze, which is usually the case in practice. In this study, we have developed a tool for calculating binding-site residues on proteins, TCBRP http://yanbioinformatics.cs.usu.edu:8080/ppbindingsubmit. For an input protein, TCBRP can quickly find all binding-site residues on the protein by automatically combining the information obtained from all PDB structures that consist of the protein of interest. Additionally, TCBRP presents the binding-site residues in different categories according to the interaction type. TCBRP also allows researchers to set the definition of binding-site residues. The developed tool is very useful for the research on protein binding site analysis and prediction.

  7. Mutation of the C/EBP binding sites in the Rous sarcoma virus long terminal repeat and gag enhancers.

    PubMed Central

    Ryden, T A; de Mars, M; Beemon, K

    1993-01-01

    Several C/EBP binding sites within the Rous sarcoma virus (RSV) long terminal repeat (LTR) and gag enhancers were mutated, and the effect of these mutations on viral gene expression was assessed. Minimal site-specific mutations in each of three adjacent C/EBP binding sites in the LTR reduced steady-state viral RNA levels. Double mutation of the two 5' proximal LTR binding sites resulted in production of 30% of wild-type levels of virus. DNase I footprinting analysis of mutant DNAs indicated that the mutations blocked C/EBP binding at the affected sites. Additional C/EBP binding sites were identified upstream of the 3' LTR and within the 5' end of the LTRs. Point mutations in the RSV gag intragenic enhancer region, which blocked binding of C/EBP at two of three adjacent C/EBP sites, also reduced virus production significantly. Nuclear extracts prepared from both chicken embryo fibroblasts (CEFs) and chicken muscle contained proteins binding to the same RSV DNA sites as did C/EBP, and mutations that prevented C/EBP binding also blocked binding of these chicken proteins. It appears that CEFs and chicken muscle contain distinct proteins binding to these RSV DNA sites; the CEF binding protein was heat stable, as is C/EBP, while the chicken muscle protein was heat sensitive. Images PMID:8386280

  8. The Binding Sites of miR-619-5p in the mRNAs of Human and Orthologous Genes.

    PubMed

    Atambayeva, Shara; Niyazova, Raigul; Ivashchenko, Anatoliy; Pyrkova, Anna; Pinsky, Ilya; Akimniyazova, Aigul; Labeit, Siegfried

    2017-06-01

    Normally, one miRNA interacts with the mRNA of one gene. However, there are miRNAs that can bind to many mRNAs, and one mRNA can be the target of many miRNAs. This significantly complicates the study of the properties of miRNAs and their diagnostic and medical applications. The search of 2,750 human microRNAs (miRNAs) binding sites in 12,175 mRNAs of human genes using the MirTarget program has been completed. For the binding sites of the miR-619-5p the hybridization free energy of the bonds was equal to 100% of the maximum potential free energy. The mRNAs of 201 human genes have complete complementary binding sites of miR-619-5p in the 3'UTR (214 sites), CDS (3 sites), and 5'UTR (4 sites). The mRNAs of CATAD1, ICA1L, GK5, POLH, and PRR11 genes have six miR-619-5p binding sites, and the mRNAs of OPA3 and CYP20A1 genes have eight and ten binding sites, respectively. All of these miR-619-5p binding sites are located in the 3'UTRs. The miR-619-5p binding site in the 5'UTR of mRNA of human USP29 gene is found in the mRNAs of orthologous genes of primates. Binding sites of miR-619-5p in the coding regions of mRNAs of C8H8orf44, C8orf44, and ISY1 genes encode the WLMPVIP oligopeptide, which is present in the orthologous proteins. Binding sites of miR-619-5p in the mRNAs of transcription factor genes ZNF429 and ZNF429 encode the AHACNP oligopeptide in another reading frame. Binding sites of miR-619-5p in the 3'UTRs of all human target genes are also present in the 3'UTRs of orthologous genes of mammals. The completely complementary binding sites for miR-619-5p are conservative in the orthologous mammalian genes. The majority of miR-619-5p binding sites are located in the 3'UTRs but some genes have miRNA binding sites in the 5'UTRs of mRNAs. Several genes have binding sites for miRNAs in the CDSs that are read in different open reading frames. Identical nucleotide sequences of binding sites encode different amino acids in different proteins. The binding sites of miR-619-5p in 3'UTRs, 5'UTRs and CDSs are conservative in the orthologous mammalian genes.

  9. Cyclin-dependent kinase (CDK) phosphorylation destabilizes somatic Wee1 via multiple pathways

    PubMed Central

    Watanabe, Nobumoto; Arai, Harumi; Iwasaki, Jun-ichi; Shiina, Masaaki; Ogata, Kazuhiro; Hunter, Tony; Osada, Hiroyuki

    2005-01-01

    At the onset of M phase, the activity of somatic Wee1 (Wee1A), the inhibitory kinase for cyclin-dependent kinase (CDK), is down-regulated primarily through proteasome-dependent degradation after ubiquitination by the E3 ubiquitin ligase SCFβ-TrCP. The F-box protein β-TrCP (β-transducin repeat-containing protein), the substrate recognition component of the ubiquitin ligase, binds to its substrates through a conserved binding motif (phosphodegron) containing two phosphoserines, DpSGXXpS. Although Wee1A lacks this motif, phosphorylation of serines 53 and 123 (S53 and S123) of Wee1A by polo-like kinase 1 (Plk1) and CDK, respectively, are required for binding to β-TrCP. The sequence surrounding phosphorylated S53 (DpSAFQE) is similar to the conserved β-TrCP-binding motif; however, the role of S123 phosphorylation (EEGFGSSpSPVK) in β-TrCP binding was not elucidated. In the present study, we show that phosphorylation of S123 (pS123) by CDK promoted the binding of Wee1A to β-TrCP through three independent mechanisms. The pS123 not only directly interacted with basic residues in the WD40 repeat domain of β-TrCP but also primed phosphorylation by two independent protein kinases, Plk1 and CK2 (formerly casein kinase 2), to create two phosphodegrons on Wee1A. In the case of Plk1, S123 phosphorylation created a polo box domain-binding motif (SpSP) on Wee1A to accelerate phosphorylation of S53 by Plk1. CK2 could phosphorylate S121, but only if S123 was phosphorylated first, thereby generating the second β-TrCP-binding site (EEGFGpS121). Using a specific inhibitor of CK2, we showed that the phosphorylation-dependent degradation of Wee1A is important for the proper onset of mitosis. PMID:16085715

  10. Structure of GlnK1 with bound effectors indicates regulatory mechanism for ammonia uptake.

    PubMed

    Yildiz, Ozkan; Kalthoff, Christoph; Raunser, Stefan; Kühlbrandt, Werner

    2007-01-24

    A binary complex of the ammonia channel Amt1 from Methanococcus jannaschii and its cognate P(II) signalling protein GlnK1 has been produced and characterized. Complex formation is prevented specifically by the effector molecules Mg-ATP and 2-ketoglutarate. Single-particle electron microscopy of the complex shows that GlnK1 binds on the cytoplasmic side of Amt1. Three high-resolution X-ray structures of GlnK1 indicate that the functionally important T-loop has an extended, flexible conformation in the absence of Mg-ATP, but assumes a compact, tightly folded conformation upon Mg-ATP binding, which in turn creates a 2-ketoglutarate-binding site. We propose a regulatory mechanism by which nitrogen uptake is controlled by the binding of both effector molecules to GlnK1. At normal effector levels, a 2-ketoglutarate molecule binding at the apex of the compact T-loop would prevent complex formation, ensuring uninhibited ammonia uptake. At low levels of Mg-ATP, the extended loops would seal the ammonia channels in the complex. Binding of both effector molecules to P(II) signalling proteins may thus represent an effective feedback mechanism for regulating ammonium uptake through the membrane.

  11. The Role of Glycine Residues 140 and 141 of Subunit B in the Functional Ubiquinone Binding Site of the Na+-pumping NADH:quinone Oxidoreductase from Vibrio cholerae*

    PubMed Central

    Juárez, Oscar; Neehaul, Yashvin; Turk, Erin; Chahboun, Najat; DeMicco, Jessica M.; Hellwig, Petra; Barquera, Blanca

    2012-01-01

    The Na+-pumping NADH:quinone oxidoreductase (Na+-NQR) is the main entrance for electrons into the respiratory chain of many marine and pathogenic bacteria. The enzyme accepts electrons from NADH and donates them to ubiquinone, and the free energy released by this redox reaction is used to create an electrochemical gradient of sodium across the cell membrane. Here we report the role of glycine 140 and glycine 141 of the NqrB subunit in the functional binding of ubiquinone. Mutations at these residues altered the affinity of the enzyme for ubiquinol. Moreover, mutations in residue NqrB-G140 almost completely abolished the electron transfer to ubiquinone. Thus, NqrB-G140 and -G141 are critical for the binding and reaction of Na+-NQR with its electron acceptor, ubiquinone. PMID:22645140

  12. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nishino, Tomonori G.; Department of Biotechnology, University of Tokyo, Bunkyo-ku, Tokyo 113-8657; Miyazaki, Masaya

    Class IIa histone deacetylases (HDACs) form complexes with a class of transcriptional repressors in the nucleus. While screening for compounds that could block the association of HDAC4 with the BTB domain-containing transcriptional repressor Bach2, we discovered that phorbol 12-myristate 13-acetate (PMA) induced the cytoplasmic retention of HDAC4 mutants lacking a nuclear export signal (NES). Although PMA treatment and PKD overexpression has been proposed to facilitate the nuclear export of class IIa HDACs by creating 14-3-3 binding sites containing phosphoserines, our experiments using HDAC mutants demonstrated that PMA greatly reduces nuclear import. PMA treatment repressed the NLS activity in a mannermore » dependent on 14-3-3 binding. These results suggest that nuclear HDAC4 is not tethered in the nucleus, but instead shuttles between the nucleus and the cytoplasm. Phosphorylation-induced 14-3-3 binding biases the balance of nucleo-cytoplasmic shuttling toward the cytoplasm by inhibiting nuclear import.« less

  13. Regulation of chromatin organization and inducible gene expression by a Drosophila insulator

    PubMed Central

    Wood, Ashley M.; Van Bortle, Kevin; Ramos, Edward; Takenaka, Naomi; Rohrbaugh, Margaret; Jones, Brian C.; Jones, Keith C.; Corces, Victor G.

    2011-01-01

    SUMMARY Insulators are multi-protein-DNA complexes thought to affect gene expression by mediating inter- and intra-chromosomal interactions. Drosophila insulators contain specific DNA binding proteins plus common components, such as CP190, that facilitate these interactions. Here we examine changes in the distribution of Drosophila insulator proteins during the heat-shock and ecdysone responses. We find that CP190 recruitment to insulator sites is the main regulatable step in controlling insulator function during heat shock. In contrast, both CP190 and DNA binding protein recruitment are regulated during the ecdysone response. CP190 is necessary to stabilize specific chromatin loops and for proper activation of transcription of genes regulated by this hormone. These findings suggest that cells may regulate recruitment of insulator proteins to the DNA in order to activate insulator activity at specific sites and create distinct patterns of nuclear organization that are necessary to achieve proper gene expression in response to different stimuli. PMID:21981916

  14. Regulation of chromatin organization and inducible gene expression by a Drosophila insulator.

    PubMed

    Wood, Ashley M; Van Bortle, Kevin; Ramos, Edward; Takenaka, Naomi; Rohrbaugh, Margaret; Jones, Brian C; Jones, Keith C; Corces, Victor G

    2011-10-07

    Insulators are multiprotein-DNA complexes thought to affect gene expression by mediating inter- and intrachromosomal interactions. Drosophila insulators contain specific DNA-binding proteins plus common components, such as CP190, that facilitate these interactions. Here, we examine changes in the distribution of Drosophila insulator proteins during the heat-shock and ecdysone responses. We find that CP190 recruitment to insulator sites is the main regulatable step in controlling insulator function during heat shock. In contrast, both CP190 and DNA-binding protein recruitment are regulated during the ecdysone response. CP190 is necessary to stabilize specific chromatin loops and for proper activation of transcription of genes regulated by this hormone. These findings suggest that cells may regulate recruitment of insulator proteins to DNA to activate insulator activity at specific sites and create distinct patterns of nuclear organization that are necessary to achieve proper gene expression in response to different stimuli. Copyright © 2011 Elsevier Inc. All rights reserved.

  15. Comparison of crystal structures of human type 3 3α-hydroxysteroid dehydrogenase reveals an “induced-fit” mechanism and a conserved basic motif involved in the binding of androgen

    PubMed Central

    Couture, Jean-François; Pereira De Jésus-Tran, Karine; Roy, Anne-Marie; Cantin, Line; Côté, Pierre-Luc; Legrand, Pierre; Luu-The, Van; Labrie, Fernand; Breton, Rock

    2005-01-01

    The aldo-keto reductase (AKR) human type 3 3α-hydroxysteroid dehydrogenase (h3α–HSD3, AKR1C2) plays a crucial role in the regulation of the intracellular concentrations of testosterone and 5α-dihydrotestosterone (5α-DHT), two steroids directly linked to the etiology and the progression of many prostate diseases and cancer. This enzyme also binds many structurally different molecules such as 4-hydroxynonenal, polycyclic aromatic hydrocarbons, and indanone. To understand the mechanism underlying the plasticity of its substrate-binding site, we solved the binary complex structure of h3α–HSD3-NADP(H) at 1.9 Å resolution. During the refinement process, we found acetate and citrate molecules deeply engulfed in the steroid-binding cavity. Superimposition of this structure with the h3α–HSD3-NADP(H)-testosterone/acetate ternary complex structure reveals that one of themobile loops forming the binding cavity operates a slight contraction movement against the citrate molecule while the side chains of many residues undergo numerous conformational changes, probably to create an optimal binding site for the citrate. These structural changes, which altogether cause a reduction of the substrate-binding cavity volume (from 776 Å3 in the presence of testosterone/acetate to 704 Å3 in the acetate/citratecomplex), are reminiscent of the “induced-fit” mechanism previously proposed for the aldose reductase, another member of the AKR superfamily. We also found that the replacement of residues Arg301 and Arg304, localized near the steroid-binding cavity, significantly affects the 3α–HSD activity of this enzyme toward 5α-DHT and completely abolishes its 17β–HSD activity on 4-dione. All these results have thus been used to reevaluate the binding mode of this enzyme for androgens. PMID:15929998

  16. Virtual screening with AutoDock Vina and the common pharmacophore engine of a low diversity library of fragments and hits against the three allosteric sites of HIV integrase: participation in the SAMPL4 protein-ligand binding challenge

    NASA Astrophysics Data System (ADS)

    Perryman, Alexander L.; Santiago, Daniel N.; Forli, Stefano; Santos-Martins, Diogo; Olson, Arthur J.

    2014-04-01

    To rigorously assess the tools and protocols that can be used to understand and predict macromolecular recognition, and to gain more structural insight into three newly discovered allosteric binding sites on a critical drug target involved in the treatment of HIV infections, the Olson and Levy labs collaborated on the SAMPL4 challenge. This computational blind challenge involved predicting protein-ligand binding against the three allosteric sites of HIV integrase (IN), a viral enzyme for which two drugs (that target the active site) have been approved by the FDA. Positive control cross-docking experiments were utilized to select 13 receptor models out of an initial ensemble of 41 different crystal structures of HIV IN. These 13 models of the targets were selected using our new "Rank Difference Ratio" metric. The first stage of SAMPL4 involved using virtual screens to identify 62 active, allosteric IN inhibitors out of a set of 321 compounds. The second stage involved predicting the binding site(s) and crystallographic binding mode(s) for 57 of these inhibitors. Our team submitted four entries for the first stage that utilized: (1) AutoDock Vina (AD Vina) plus visual inspection; (2) a new common pharmacophore engine; (3) BEDAM replica exchange free energy simulations, and a Consensus approach that combined the predictions of all three strategies. Even with the SAMPL4's very challenging compound library that displayed a significantly lower amount of structural diversity than most libraries that are conventionally employed in prospective virtual screens, these approaches produced hit rates of 24, 25, 34, and 27 %, respectively, on a set with 19 % declared binders. Our only entry for the second stage challenge was based on the results of AD Vina plus visual inspection, and it ranked third place overall according to several different metrics provided by the SAMPL4 organizers. The successful results displayed by these approaches highlight the utility of the computational structure-based drug discovery tools and strategies that are being developed to advance the goals of the newly created, multi-institution, NIH-funded center called the "HIV Interaction and Viral Evolution Center".

  17. Virtual screening with AutoDock Vina and the common pharmacophore engine of a low diversity library of fragments and hits against the three allosteric sites of HIV integrase: participation in the SAMPL4 protein-ligand binding challenge.

    PubMed

    Perryman, Alexander L; Santiago, Daniel N; Forli, Stefano; Martins, Diogo Santos; Olson, Arthur J

    2014-04-01

    To rigorously assess the tools and protocols that can be used to understand and predict macromolecular recognition, and to gain more structural insight into three newly discovered allosteric binding sites on a critical drug target involved in the treatment of HIV infections, the Olson and Levy labs collaborated on the SAMPL4 challenge. This computational blind challenge involved predicting protein-ligand binding against the three allosteric sites of HIV integrase (IN), a viral enzyme for which two drugs (that target the active site) have been approved by the FDA. Positive control cross-docking experiments were utilized to select 13 receptor models out of an initial ensemble of 41 different crystal structures of HIV IN. These 13 models of the targets were selected using our new "Rank Difference Ratio" metric. The first stage of SAMPL4 involved using virtual screens to identify 62 active, allosteric IN inhibitors out of a set of 321 compounds. The second stage involved predicting the binding site(s) and crystallographic binding mode(s) for 57 of these inhibitors. Our team submitted four entries for the first stage that utilized: (1) AutoDock Vina (AD Vina) plus visual inspection; (2) a new common pharmacophore engine; (3) BEDAM replica exchange free energy simulations, and a Consensus approach that combined the predictions of all three strategies. Even with the SAMPL4's very challenging compound library that displayed a significantly lower amount of structural diversity than most libraries that are conventionally employed in prospective virtual screens, these approaches produced hit rates of 24, 25, 34, and 27 %, respectively, on a set with 19 % declared binders. Our only entry for the second stage challenge was based on the results of AD Vina plus visual inspection, and it ranked third place overall according to several different metrics provided by the SAMPL4 organizers. The successful results displayed by these approaches highlight the utility of the computational structure-based drug discovery tools and strategies that are being developed to advance the goals of the newly created, multi-institution, NIH-funded center called the "HIV Interaction and Viral Evolution Center".

  18. Allosteric Inhibitory Molecular Recognition of a Photochromic Dye by a Digestive Enzyme: Dihydroindolizine makes α-chymotrypsin Photo-responsive

    NASA Astrophysics Data System (ADS)

    Bagchi, Damayanti; Ghosh, Abhijit; Singh, Priya; Dutta, Shreyasi; Polley, Nabarun; Althagafi, Ismail. I.; Jassas, Rabab S.; Ahmed, Saleh A.; Pal, Samir Kumar

    2016-09-01

    The structural-functional regulation of enzymes by the administration of an external stimulus such as light could create photo-switches that exhibit unique biotechnological applications. However, molecular recognition of small ligands is a central phenomenon involved in all biological processes. We demonstrate herein that the molecular recognition of a photochromic ligand, dihydroindolizine (DHI), by serine protease α-chymotrypsin (CHT) leads to the photo-control of enzymatic activity. We synthesized and optically characterized the photochromic DHI. Light-induced reversible pyrroline ring opening and a consequent thermal back reaction via 1,5-electrocyclization are responsible for the photochromic behavior. Furthermore, DHI inhibits the enzymatic activity of CHT in a photo-controlled manner. Simultaneous binding of the well-known inhibitors 4-nitrophenyl anthranilate (NPA) or proflavin (PF) in the presence of DHI displays spectral overlap between the emission of CHT-NPA or CHT-PF with the respective absorption of cis or trans DHI. The results suggest an opportunity to explore the binding site of DHI using Förster resonance energy transfer (FRET). Moreover, to more specifically evaluate the DHI binding interactions, we employed molecular docking calculations, which suggested binding near the hydrophobic site of Cys-1-Cys-122 residues. Variations in the electrostatic interactions of the two conformers of DHI adopt unfavorable conformations, leading to the allosteric inhibition of enzymatic activity.

  19. Developmental regulation of collagenase-3 mRNA in normal, differentiating osteoblasts through the activator protein-1 and the runt domain binding sites

    NASA Technical Reports Server (NTRS)

    Winchester, S. K.; Selvamurugan, N.; D'Alonzo, R. C.; Partridge, N. C.

    2000-01-01

    Collagenase-3 mRNA is initially detectable when osteoblasts cease proliferation, increasing during differentiation and mineralization. We showed that this developmental expression is due to an increase in collagenase-3 gene transcription. Mutation of either the activator protein-1 or the runt domain binding site decreased collagenase-3 promoter activity, demonstrating that these sites are responsible for collagenase-3 gene transcription. The activator protein-1 and runt domain binding sites bind members of the activator protein-1 and core-binding factor family of transcription factors, respectively. We identified core-binding factor a1 binding to the runt domain binding site and JunD in addition to a Fos-related antigen binding to the activator protein-1 site. Overexpression of both c-Fos and c-Jun in osteoblasts or core-binding factor a1 increased collagenase-3 promoter activity. Furthermore, overexpression of c-Fos, c-Jun, and core-binding factor a1 synergistically increased collagenase-3 promoter activity. Mutation of either the activator protein-1 or the runt domain binding site resulted in the inability of c-Fos and c-Jun or core-binding factor a1 to increase collagenase-3 promoter activity, suggesting that there is cooperative interaction between the sites and the proteins. Overexpression of Fra-2 and JunD repressed core-binding factor a1-induced collagenase-3 promoter activity. Our results suggest that members of the activator protein-1 and core-binding factor families, binding to the activator protein-1 and runt domain binding sites are responsible for the developmental regulation of collagenase-3 gene expression in osteoblasts.

  20. New insight into the binding modes of TNP-AMP to human liver fructose-1,6-bisphosphatase

    NASA Astrophysics Data System (ADS)

    Han, Xinya; Huang, Yunyuan; Zhang, Rui; Xiao, San; Zhu, Shuaihuan; Qin, Nian; Hong, Zongqin; Wei, Lin; Feng, Jiangtao; Ren, Yanliang; Feng, Lingling; Wan, Jian

    2016-08-01

    Human liver fructose-1,6-bisphosphatase (FBPase) contains two binding sites, a substrate fructose-1,6-bisphosphate (FBP) active site and an adenosine monophosphate (AMP) allosteric site. The FBP active site works by stabilizing the FBPase, and the allosteric site impairs the activity of FBPase through its binding of a nonsubstrate molecule. The fluorescent AMP analogue, 2‧,3‧-O-(2,4,6-trinitrophenyl)adenosine 5‧-monophosphate (TNP-AMP) has been used as a fluorescent probe as it is able to competitively inhibit AMP binding to the AMP allosteric site and, therefore, could be used for exploring the binding modes of inhibitors targeted on the allosteric site. In this study, we have re-examined the binding modes of TNP-AMP to FBPase. However, our present enzyme kinetic assays show that AMP and FBP both can reduce the fluorescence from the bound TNP-AMP through competition for FBPase, suggesting that TNP-AMP binds not only to the AMP allosteric site but also to the FBP active site. Mutagenesis assays of K274L (located in the FBP active site) show that the residue K274 is very important for TNP-AMP to bind to the active site of FBPase. The results further prove that TNP-AMP is able to bind individually to the both sites. Our present study provides a new insight into the binding mechanism of TNP-AMP to the FBPase. The TNP-AMP fluorescent probe can be used to exam the binding site of an inhibitor (the active site or the allosteric site) using FBPase saturated by AMP and FBP, respectively, or the K247L mutant FBPase.

  1. New insight into the binding modes of TNP-AMP to human liver fructose-1,6-bisphosphatase.

    PubMed

    Han, Xinya; Huang, Yunyuan; Zhang, Rui; Xiao, San; Zhu, Shuaihuan; Qin, Nian; Hong, Zongqin; Wei, Lin; Feng, Jiangtao; Ren, Yanliang; Feng, Lingling; Wan, Jian

    2016-08-05

    Human liver fructose-1,6-bisphosphatase (FBPase) contains two binding sites, a substrate fructose-1,6-bisphosphate (FBP) active site and an adenosine monophosphate (AMP) allosteric site. The FBP active site works by stabilizing the FBPase, and the allosteric site impairs the activity of FBPase through its binding of a nonsubstrate molecule. The fluorescent AMP analogue, 2',3'-O-(2,4,6-trinitrophenyl)adenosine 5'-monophosphate (TNP-AMP) has been used as a fluorescent probe as it is able to competitively inhibit AMP binding to the AMP allosteric site and, therefore, could be used for exploring the binding modes of inhibitors targeted on the allosteric site. In this study, we have re-examined the binding modes of TNP-AMP to FBPase. However, our present enzyme kinetic assays show that AMP and FBP both can reduce the fluorescence from the bound TNP-AMP through competition for FBPase, suggesting that TNP-AMP binds not only to the AMP allosteric site but also to the FBP active site. Mutagenesis assays of K274L (located in the FBP active site) show that the residue K274 is very important for TNP-AMP to bind to the active site of FBPase. The results further prove that TNP-AMP is able to bind individually to the both sites. Our present study provides a new insight into the binding mechanism of TNP-AMP to the FBPase. The TNP-AMP fluorescent probe can be used to exam the binding site of an inhibitor (the active site or the allosteric site) using FBPase saturated by AMP and FBP, respectively, or the K247L mutant FBPase. Copyright © 2016 Elsevier B.V. All rights reserved.

  2. Mechanism of Metal Ion Activation of the Diphtheria Toxin Repressor DtxR

    NASA Astrophysics Data System (ADS)

    D'Aquino, J. Alejandro; Ringe, Dagmar

    2006-08-01

    The diphtheria toxin repressor, DtxR, is a metal ion-activated transcriptional regulator that has been linked to the virulence of Corynebacterium diphtheriae. Structure determination has shown that there are two metal ion binding sites per repressor monomer, and site-directed mutagenesis has demonstrated that binding site 2 (primary) is essential for recognition of the target DNA repressor, leaving the role of binding site 1 (ancillary) unclear (1 - 3). Calorimetric techniques have demonstrated that while binding site 1 (ancillary) has high affinity for metal ion with a binding constant of 2 × 10-7, binding site 2 (primary) is a low affinity binding site with a binding constant of 6.3 × 10-4. These two binding sites act independently and their contribution can be easily dissected by traditional mutational analysis. Our results clearly demonstrate that binding site 1 (ancillary) is the first one to be occupied during metal ion activation, playing a critical role in stabilization of the repressor. In addition, structural data obtained for the mutants Ni-DtxR(H79A,C102D), reported here and the previously reported DtxR(H79A) (4) has allowed us to propose a mechanism of metal ion activation for DtxR.

  3. Allosteric binding sites in Rab11 for potential drug candidates

    PubMed Central

    2018-01-01

    Rab11 is an important protein subfamily in the RabGTPase family. These proteins physiologically function as key regulators of intracellular membrane trafficking processes. Pathologically, Rab11 proteins are implicated in many diseases including cancers, neurodegenerative diseases and type 2 diabetes. Although they are medically important, no previous study has found Rab11 allosteric binding sites where potential drug candidates can bind to. In this study, by employing multiple clustering approaches integrating principal component analysis, independent component analysis and locally linear embedding, we performed structural analyses of Rab11 and identified eight representative structures. Using these representatives to perform binding site mapping and virtual screening, we identified two novel binding sites in Rab11 and small molecules that can preferentially bind to different conformations of these sites with high affinities. After identifying the binding sites and the residue interaction networks in the representatives, we computationally showed that these binding sites may allosterically regulate Rab11, as these sites communicate with switch 2 region that binds to GTP/GDP. These two allosteric binding sites in Rab11 are also similar to two allosteric pockets in Ras that we discovered previously. PMID:29874286

  4. Laminar and regional distribution of galanin binding sites in cat and monkey visual cortex determined by in vitro receptor autoradiography

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rosier, A.M.; Vandesande, F.; Orban, G.A.

    1991-03-08

    The distribution of galanin (GAL) binding sites in the visual cortex of cat and monkey was determined by autoradiographic visualization of ({sup 125}I)-GAL binding to tissue sections. Binding conditions were optimized and, as a result, the binding was saturable and specific. In cat visual cortex, GAL binding sites were concentrated in layers I, IVc, V, and VI. Areas 17, 18, and 19 exhibited a similar distribution pattern. In monkey primary visual cortex, the highest density of GAL binding sites was observed in layers II/III, lower IVc, and upper V. Layers IVA and VI contained moderate numbers of GAL binding sites,more » while layer I and the remaining parts of layer IV displayed the lowest density. In monkey secondary visual cortex, GAL binding sites were mainly concentrated in layers V-VI. Layer IV exhibited a moderate density, while the supragranular layers contained the lowest proportion of GAL binding sites. In both cat and monkey, we found little difference between regions subserving central and those subserving peripheral vision. Similarities in the distribution of GAL and acetylcholine binding sites are discussed.« less

  5. Identification and characterization of a novel high affinity metal-binding site in the hammerhead ribozyme.

    PubMed Central

    Hansen, M R; Simorre, J P; Hanson, P; Mokler, V; Bellon, L; Beigelman, L; Pardi, A

    1999-01-01

    A novel metal-binding site has been identified in the hammerhead ribozyme by 31P NMR. The metal-binding site is associated with the A13 phosphate in the catalytic core of the hammerhead ribozyme and is distinct from any previously identified metal-binding sites. 31P NMR spectroscopy was used to measure the metal-binding affinity for this site and leads to an apparent dissociation constant of 250-570 microM at 25 degrees C for binding of a single Mg2+ ion. The NMR data also show evidence of a structural change at this site upon metal binding and these results are compared with previous data on metal-induced structural changes in the core of the hammerhead ribozyme. These NMR data were combined with the X-ray structure of the hammerhead ribozyme (Pley HW, Flaherty KM, McKay DB. 1994. Nature 372:68-74) to model RNA ligands involved in binding the metal at this A13 site. In this model, the A13 metal-binding site is structurally similar to the previously identified A(g) metal-binding site and illustrates the symmetrical nature of the tandem G x A base pairs in domain 2 of the hammerhead ribozyme. These results demonstrate that 31P NMR represents an important method for both identification and characterization of metal-binding sites in nucleic acids. PMID:10445883

  6. Identification of the quinolinedione inhibitor binding site in Cdc25 phosphatase B through docking and molecular dynamics simulations.

    PubMed

    Ge, Yushu; van der Kamp, Marc; Malaisree, Maturos; Liu, Dan; Liu, Yi; Mulholland, Adrian J

    2017-11-01

    Cdc25 phosphatase B, a potential target for cancer therapy, is inhibited by a series of quinones. The binding site and mode of quinone inhibitors to Cdc25B remains unclear, whereas this information is important for structure-based drug design. We investigated the potential binding site of NSC663284 [DA3003-1 or 6-chloro-7-(2-morpholin-4-yl-ethylamino)-quinoline-5, 8-dione] through docking and molecular dynamics simulations. Of the two main binding sites suggested by docking, the molecular dynamics simulations only support one site for stable binding of the inhibitor. Binding sites in and near the Cdc25B catalytic site that have been suggested previously do not lead to stable binding in 50 ns molecular dynamics (MD) simulations. In contrast, a shallow pocket between the C-terminal helix and the catalytic site provides a favourable binding site that shows high stability. Two similar binding modes featuring protein-inhibitor interactions involving Tyr428, Arg482, Thr547 and Ser549 are identified by clustering analysis of all stable MD trajectories. The relatively flexible C-terminal region of Cdc25B contributes to inhibitor binding. The binding mode of NSC663284, identified through MD simulation, likely prevents the binding of protein substrates to Cdc25B. The present results provide useful information for the design of quinone inhibitors and their mechanism of inhibition.

  7. Identification of the quinolinedione inhibitor binding site in Cdc25 phosphatase B through docking and molecular dynamics simulations

    NASA Astrophysics Data System (ADS)

    Ge, Yushu; van der Kamp, Marc; Malaisree, Maturos; Liu, Dan; Liu, Yi; Mulholland, Adrian J.

    2017-11-01

    Cdc25 phosphatase B, a potential target for cancer therapy, is inhibited by a series of quinones. The binding site and mode of quinone inhibitors to Cdc25B remains unclear, whereas this information is important for structure-based drug design. We investigated the potential binding site of NSC663284 [DA3003-1 or 6-chloro-7-(2-morpholin-4-yl-ethylamino)-quinoline-5, 8-dione] through docking and molecular dynamics simulations. Of the two main binding sites suggested by docking, the molecular dynamics simulations only support one site for stable binding of the inhibitor. Binding sites in and near the Cdc25B catalytic site that have been suggested previously do not lead to stable binding in 50 ns molecular dynamics (MD) simulations. In contrast, a shallow pocket between the C-terminal helix and the catalytic site provides a favourable binding site that shows high stability. Two similar binding modes featuring protein-inhibitor interactions involving Tyr428, Arg482, Thr547 and Ser549 are identified by clustering analysis of all stable MD trajectories. The relatively flexible C-terminal region of Cdc25B contributes to inhibitor binding. The binding mode of NSC663284, identified through MD simulation, likely prevents the binding of protein substrates to Cdc25B. The present results provide useful information for the design of quinone inhibitors and their mechanism of inhibition.

  8. ATP and AMP Mutually Influence Their Interaction with the ATP-binding Cassette (ABC) Adenylate Kinase Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) at Separate Binding Sites*

    PubMed Central

    Randak, Christoph O.; Dong, Qian; Ver Heul, Amanda R.; Elcock, Adrian H.; Welsh, Michael J.

    2013-01-01

    Cystic fibrosis transmembrane conductance regulator (CFTR) is an anion channel in the ATP-binding cassette (ABC) transporter protein family. In the presence of ATP and physiologically relevant concentrations of AMP, CFTR exhibits adenylate kinase activity (ATP + AMP ⇆ 2 ADP). Previous studies suggested that the interaction of nucleotide triphosphate with CFTR at ATP-binding site 2 is required for this activity. Two other ABC proteins, Rad50 and a structural maintenance of chromosome protein, also have adenylate kinase activity. All three ABC adenylate kinases bind and hydrolyze ATP in the absence of other nucleotides. However, little is known about how an ABC adenylate kinase interacts with ATP and AMP when both are present. Based on data from non-ABC adenylate kinases, we hypothesized that ATP and AMP mutually influence their interaction with CFTR at separate binding sites. We further hypothesized that only one of the two CFTR ATP-binding sites is involved in the adenylate kinase reaction. We found that 8-azidoadenosine 5′-triphosphate (8-N3-ATP) and 8-azidoadenosine 5′-monophosphate (8-N3-AMP) photolabeled separate sites in CFTR. Labeling of the AMP-binding site with 8-N3-AMP required the presence of ATP. Conversely, AMP enhanced photolabeling with 8-N3-ATP at ATP-binding site 2. The adenylate kinase active center probe P1,P5-di(adenosine-5′) pentaphosphate interacted simultaneously with an AMP-binding site and ATP-binding site 2. These results show that ATP and AMP interact with separate binding sites but mutually influence their interaction with the ABC adenylate kinase CFTR. They further indicate that the active center of the adenylate kinase comprises ATP-binding site 2. PMID:23921386

  9. Chromatin-Specific Regulation of Mammalian rDNA Transcription by Clustered TTF-I Binding Sites

    PubMed Central

    Diermeier, Sarah D.; Németh, Attila; Rehli, Michael; Grummt, Ingrid; Längst, Gernot

    2013-01-01

    Enhancers and promoters often contain multiple binding sites for the same transcription factor, suggesting that homotypic clustering of binding sites may serve a role in transcription regulation. Here we show that clustering of binding sites for the transcription termination factor TTF-I downstream of the pre-rRNA coding region specifies transcription termination, increases the efficiency of transcription initiation and affects the three-dimensional structure of rRNA genes. On chromatin templates, but not on free rDNA, clustered binding sites promote cooperative binding of TTF-I, loading TTF-I to the downstream terminators before it binds to the rDNA promoter. Interaction of TTF-I with target sites upstream and downstream of the rDNA transcription unit connects these distal DNA elements by forming a chromatin loop between the rDNA promoter and the terminators. The results imply that clustered binding sites increase the binding affinity of transcription factors in chromatin, thus influencing the timing and strength of DNA-dependent processes. PMID:24068958

  10. A ternary metal binding site in the C2 domain of phosphoinositide-specific phospholipase C-delta1.

    PubMed

    Essen, L O; Perisic, O; Lynch, D E; Katan, M; Williams, R L

    1997-03-11

    We have determined the crystal structures of complexes of phosphoinositide-specific phospholipase C-delta1 from rat with calcium, barium, and lanthanum at 2.5-2.6 A resolution. Binding of these metal ions is observed in the active site of the catalytic TIM barrel and in the calcium binding region (CBR) of the C2 domain. The C2 domain of PLC-delta1 is a circularly permuted topological variant (P-variant) of the synaptotagmin I C2A domain (S-variant). On the basis of sequence analysis, we propose that both the S-variant and P-variant topologies are present among other C2 domains. Multiple adjacent binding sites in the C2 domain were observed for calcium and the other metal/enzyme complexes. The maximum number of binding sites observed was for the calcium analogue lanthanum. This complex shows an array-like binding of three lanthanum ions (sites I-III) in a crevice on one end of the C2 beta-sandwich. Residues involved in metal binding are contained in three loops, CBR1, CBR2, and CBR3. Sites I and II are maintained in the calcium and barium complexes, whereas sites II and III coincide with a binary calcium binding site in the C2A domain of synaptotagmin I. Several conformers for CBR1 are observed. The conformation of CBR1 does not appear to be strictly dependent on metal binding; however, metal binding may stabilize certain conformers. No significant structural changes are observed for CBR2 or CBR3. The surface of this ternary binding site provides a cluster of freely accessible liganding positions for putative phospholipid ligands of the C2 domain. It may be that the ternary metal binding site is also a feature of calcium-dependent phospholipid binding in solution. A ternary metal binding site might be a conserved feature among C2 domains that contain the critical calcium ligands in their CBR's. The high cooperativity of calcium-mediated lipid binding by C2 domains described previously is explained by this novel type of calcium binding site.

  11. Mapping epitopes and antigenicity by site-directed masking

    NASA Astrophysics Data System (ADS)

    Paus, Didrik; Winter, Greg

    2006-06-01

    Here we describe a method for mapping the binding of antibodies to the surface of a folded antigen. We first created a panel of mutant antigens (-lactamase) in which single surface-exposed residues were mutated to cysteine. We then chemically tethered the cysteine residues to a solid phase, thereby masking a surface patch centered on each cysteine residue and blocking the binding of antibodies to this region of the surface. By these means we mapped the epitopes of several mAbs directed to -lactamase. Furthermore, by depleting samples of polyclonal antisera to the masked antigens and measuring the binding of each depleted sample of antisera to unmasked antigen, we mapped the antigenicity of 23 different epitopes. After immunization of mice and rabbits with -lactamase in Freund's adjuvant, we found that the antisera reacted with both native and denatured antigen and that the antibody response was mainly directed to an exposed and flexible loop region of the native antigen. By contrast, after immunization in PBS, we found that the antisera reacted only weakly with denatured antigen and that the antibody response was more evenly distributed over the antigenic surface. We suggest that denatured antigen (created during emulsification in Freund's adjuvant) elicits antibodies that bind mainly to the flexible regions of the native protein and that this explains the correlation between antigenicity and backbone flexibility. Denaturation of antigen during vaccination or natural infections would therefore be expected to focus the antibody response to the flexible loops. backbone flexibility | Freund's adjuvant | conformational epitope | antisera

  12. Molecular investigation of active binding site of isoniazid (INH) and insight into resistance mechanism of S315T-MtKatG in Mycobacterium tuberculosis.

    PubMed

    Srivastava, Gaurava; Tripathi, Shubhandra; Kumar, Akhil; Sharma, Ashok

    2017-07-01

    Multi drug resistant tuberculosis is a major threat for mankind. Resistance against Isoniazid (INH), targeting MtKatG protein, is one of the most commonly occurring resistances in MDR TB strains. S315T-MtKatG mutation is widely reported for INH resistance. Despite having knowledge about the mechanism of INH, exact binding site of INH to MtKatG is still uncertain and proposed to have three presumable binding sites (site-1, site-2, and site-3). In the current study docking, molecular dynamics simulation, binding free energy estimation, principal component analysis and free energy landscape analysis were performed to get molecular level details of INH binding site on MtKatG, and to probe the effect of S315T mutation on INH binding. Molecular docking and MD analysis suggested site-1 as active binding site of INH, where the effects of S315T mutation were observed on both access tunnel as well as molecular interaction between INH and its neighboring residues. MMPBSA also supported site-1 as potential binding site with lowest binding energy of -44.201 kJ/mol. Moreover, PCA and FEL revealed that S315T mutation not only reduces the dimension of heme access tunnel but also showed that extra methyl group at 315 position altered heme cavity, enforcing heme group distantly from INH, and thus preventing INH activation. The present study not only investigated the active binding site of INH but also provides a new insight about the conformational changes in the binding site of S315T-MtKatG. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Mechanism of Metal Ion Activation of the Diphtheria Toxin Repressor DtxR

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    D'Aquino,J.; Tetenbaum-Novatt, J.; White, A.

    2005-01-01

    The diphtheria toxin repressor (DtxR) is a metal ion-activated transcriptional regulator that has been linked to the virulence of Corynebacterium diphtheriae. Structure determination has shown that there are two metal ion binding sites per repressor monomer, and site-directed mutagenesis has demonstrated that binding site 2 (primary) is essential for recognition of the target DNA repressor, leaving the role of binding site 1 (ancillary) unclear. Calorimetric techniques have demonstrated that although binding site 1 (ancillary) has high affinity for metal ion with a binding constant of 2 x 10{sup -7}, binding site 2 (primary) is a low-affinity binding site with amore » binding constant of 6.3 x 10{sup -4}. These two binding sites act in an independent fashion, and their contribution can be easily dissected by traditional mutational analysis. Our results clearly demonstrate that binding site 1 (ancillary) is the first one to be occupied during metal ion activation, playing a critical role in stabilization of the repressor. In addition, structural data obtained for the mutants Ni-DtxR(H79A, C102D), reported here, and the previously reported DtxR(H79A) have allowed us to propose a mechanism of metal activation for DtxR.« less

  14. Microelectronic electroporation array

    NASA Astrophysics Data System (ADS)

    Johnson, Lee J.; Shaffer, Kara J.; Skeath, Perry; Perkins, Frank K.; Pancrazio, Joseph; Scribner, Dean

    2004-06-01

    Gene Array technology has allowed for the study of gene binding by creating thousands of potential binding sites on a single device. A limitation of the current technology is that the effects of the gene and the gene-derived proteins cannot be studied in situ the same way, thousand site cell arrays are not readily available. We propose a new device structure to study the effects of gene modification on cells. This new array technology uses electroporation to target specific areas within a cell culture for transfection of genes. Electroporation arrays will allow high throughput analysis of gene effects on a given cell's response to a stress or a genes ability to restore normal cell function in disease modeling cells. Fluorescent imaging of dye labeled indicator molecules or cell viability will provide results indicating the most effective genes. The electroporation array consists of a microelectronic circuit, ancillary electronics, protecting electrode surface for cell culturing and a perfusion system for gene or drug delivery. The advantages of the current device are that there are 3200 sites for electroporation, all or any subsets of the electrodes can be activated. The cells are held in place by the electrode material. This technology could also be applied to high throughput screening of cell impermeant drugs.

  15. Identification of a Second Substrate-binding Site in Solute-Sodium Symporters*

    PubMed Central

    Li, Zheng; Lee, Ashley S. E.; Bracher, Susanne; Jung, Heinrich; Paz, Aviv; Kumar, Jay P.; Abramson, Jeff; Quick, Matthias; Shi, Lei

    2015-01-01

    The structure of the sodium/galactose transporter (vSGLT), a solute-sodium symporter (SSS) from Vibrio parahaemolyticus, shares a common structural fold with LeuT of the neurotransmitter-sodium symporter family. Structural alignments between LeuT and vSGLT reveal that the crystallographically identified galactose-binding site in vSGLT is located in a more extracellular location relative to the central substrate-binding site (S1) in LeuT. Our computational analyses suggest the existence of an additional galactose-binding site in vSGLT that aligns to the S1 site of LeuT. Radiolabeled galactose saturation binding experiments indicate that, like LeuT, vSGLT can simultaneously bind two substrate molecules under equilibrium conditions. Mutating key residues in the individual substrate-binding sites reduced the molar substrate-to-protein binding stoichiometry to ∼1. In addition, the related and more experimentally tractable SSS member PutP (the Na+/proline transporter) also exhibits a binding stoichiometry of 2. Targeting residues in the proposed sites with mutations results in the reduction of the binding stoichiometry and is accompanied by severely impaired translocation of proline. Our data suggest that substrate transport by SSS members requires both substrate-binding sites, thereby implying that SSSs and neurotransmitter-sodium symporters share common mechanistic elements in substrate transport. PMID:25398883

  16. A Chrysin Derivative Suppresses Skin Cancer Growth by Inhibiting Cyclin-dependent Kinases*

    PubMed Central

    Liu, Haidan; Liu, Kangdong; Huang, Zunnan; Park, Chan-Mi; Thimmegowda, N. R.; Jang, Jae-Hyuk; Ryoo, In-Ja; He, Long; Kim, Sun-Ok; Oi, Naomi; Lee, Ki Won; Soung, Nak-Kyun; Bode, Ann M.; Yang, Yifeng; Zhou, Xinmin; Erikson, Raymond L.; Ahn, Jong-Seog; Hwang, Joonsung; Kim, Kyoon Eon; Dong, Zigang; Kim, Bo-Yeon

    2013-01-01

    Chrysin (5,7-dihydroxyflavone), a natural flavonoid widely distributed in plants, reportedly has chemopreventive properties against various cancers. However, the anticancer activity of chrysin observed in in vivo studies has been disappointing. Here, we report that a chrysin derivative, referred to as compound 69407, more strongly inhibited EGF-induced neoplastic transformation of JB6 P+ cells compared with chrysin. It attenuated cell cycle progression of EGF-stimulated cells at the G1 phase and inhibited the G1/S transition. It caused loss of retinoblastoma phosphorylation at both Ser-795 and Ser-807/811, the preferred sites phosphorylated by Cdk4/6 and Cdk2, respectively. It also suppressed anchorage-dependent and -independent growth of A431 human epidermoid carcinoma cells. Compound 69407 reduced tumor growth in the A431 mouse xenograft model and retinoblastoma phosphorylation at Ser-795 and Ser-807/811. Immunoprecipitation kinase assay results showed that compound 69407 attenuated endogenous Cdk4 and Cdk2 kinase activities in EGF-stimulated JB6 P+ cells. Pulldown and in vitro kinase assay results indicated that compound 69407 directly binds with Cdk2 and Cdk4 in an ATP-independent manner and inhibited their kinase activities. A binding model between compound 69407 and a crystal structure of Cdk2 predicted that compound 69407 was located inside the Cdk2 allosteric binding site. The binding was further verified by a point mutation binding assay. Overall results indicated that compound 69407 is an ATP-noncompetitive cyclin-dependent kinase inhibitor with anti-tumor effects, which acts by binding inside the Cdk2 allosteric pocket. This study provides new insights for creating a general pharmacophore model to design and develop novel ATP-noncompetitive agents with chemopreventive or chemotherapeutic potency. PMID:23888052

  17. Microfluidic affinity and ChIP-seq analyses converge on a conserved FOXP2-binding motif in chimp and human, which enables the detection of evolutionarily novel targets.

    PubMed

    Nelson, Christopher S; Fuller, Chris K; Fordyce, Polly M; Greninger, Alexander L; Li, Hao; DeRisi, Joseph L

    2013-07-01

    The transcription factor forkhead box P2 (FOXP2) is believed to be important in the evolution of human speech. A mutation in its DNA-binding domain causes severe speech impairment. Humans have acquired two coding changes relative to the conserved mammalian sequence. Despite intense interest in FOXP2, it has remained an open question whether the human protein's DNA-binding specificity and chromatin localization are conserved. Previous in vitro and ChIP-chip studies have provided conflicting consensus sequences for the FOXP2-binding site. Using MITOMI 2.0 microfluidic affinity assays, we describe the binding site of FOXP2 and its affinity profile in base-specific detail for all substitutions of the strongest binding site. We find that human and chimp FOXP2 have similar binding sites that are distinct from previously suggested consensus binding sites. Additionally, through analysis of FOXP2 ChIP-seq data from cultured neurons, we find strong overrepresentation of a motif that matches our in vitro results and identifies a set of genes with FOXP2 binding sites. The FOXP2-binding sites tend to be conserved, yet we identified 38 instances of evolutionarily novel sites in humans. Combined, these data present a comprehensive portrait of FOXP2's-binding properties and imply that although its sequence specificity has been conserved, some of its genomic binding sites are newly evolved.

  18. Microfluidic affinity and ChIP-seq analyses converge on a conserved FOXP2-binding motif in chimp and human, which enables the detection of evolutionarily novel targets

    PubMed Central

    Nelson, Christopher S.; Fuller, Chris K.; Fordyce, Polly M.; Greninger, Alexander L.; Li, Hao; DeRisi, Joseph L.

    2013-01-01

    The transcription factor forkhead box P2 (FOXP2) is believed to be important in the evolution of human speech. A mutation in its DNA-binding domain causes severe speech impairment. Humans have acquired two coding changes relative to the conserved mammalian sequence. Despite intense interest in FOXP2, it has remained an open question whether the human protein’s DNA-binding specificity and chromatin localization are conserved. Previous in vitro and ChIP-chip studies have provided conflicting consensus sequences for the FOXP2-binding site. Using MITOMI 2.0 microfluidic affinity assays, we describe the binding site of FOXP2 and its affinity profile in base-specific detail for all substitutions of the strongest binding site. We find that human and chimp FOXP2 have similar binding sites that are distinct from previously suggested consensus binding sites. Additionally, through analysis of FOXP2 ChIP-seq data from cultured neurons, we find strong overrepresentation of a motif that matches our in vitro results and identifies a set of genes with FOXP2 binding sites. The FOXP2-binding sites tend to be conserved, yet we identified 38 instances of evolutionarily novel sites in humans. Combined, these data present a comprehensive portrait of FOXP2’s-binding properties and imply that although its sequence specificity has been conserved, some of its genomic binding sites are newly evolved. PMID:23625967

  19. Evolution of Metal(Loid) Binding Sites in Transcriptional Regulators

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ordonez, E.; Thiyagarajan, S.; Cook, J.D.

    2009-05-22

    Expression of the genes for resistance to heavy metals and metalloids is transcriptionally regulated by the toxic ions themselves. Members of the ArsR/SmtB family of small metalloregulatory proteins respond to transition metals, heavy metals, and metalloids, including As(III), Sb(III), Cd(II), Pb(II), Zn(II), Co(II), and Ni(II). These homodimeric repressors bind to DNA in the absence of inducing metal(loid) ion and dissociate from the DNA when inducer is bound. The regulatory sites are often three- or four-coordinate metal binding sites composed of cysteine thiolates. Surprisingly, in two different As(III)-responsive regulators, the metalloid binding sites were in different locations in the repressor, andmore » the Cd(II) binding sites were in two different locations in two Cd(II)-responsive regulators. We hypothesize that ArsR/SmtB repressors have a common backbone structure, that of a winged helix DNA-binding protein, but have considerable plasticity in the location of inducer binding sites. Here we show that an As(III)-responsive member of the family, CgArsR1 from Corynebacterium glutamicum, binds As(III) to a cysteine triad composed of Cys{sup 15}, Cys{sup 16}, and Cys{sup 55}. This binding site is clearly unrelated to the binding sites of other characterized ArsR/SmtB family members. This is consistent with our hypothesis that metal(loid) binding sites in DNA binding proteins evolve convergently in response to persistent environmental pressures.« less

  20. Combining fragment homology modeling with molecular dynamics aims at prediction of Ca2+ binding sites in CaBPs

    NASA Astrophysics Data System (ADS)

    Pang, ChunLi; Cao, TianGuang; Li, JunWei; Jia, MengWen; Zhang, SuHua; Ren, ShuXi; An, HaiLong; Zhan, Yong

    2013-08-01

    The family of calcium-binding proteins (CaBPs) consists of dozens of members and contributes to all aspects of the cell's function, from homeostasis to learning and memory. However, the Ca2+-binding mechanism is still unclear for most of CaBPs. To identify the Ca2+-binding sites of CaBPs, this study presented a computational approach which combined the fragment homology modeling with molecular dynamics simulation. For validation, we performed a two-step strategy as follows: first, the approach is used to identify the Ca2+-binding sites of CaBPs, which have the EF-hand Ca2+-binding site and the detailed binding mechanism. To accomplish this, eighteen crystal structures of CaBPs with 49 Ca2+-binding sites are selected to be analyzed including calmodulin. The computational method identified 43 from 49 Ca2+-binding sites. Second, we performed the approach to large-conductance Ca2+-activated K+ (BK) channels which don't have clear Ca2+-binding mechanism. The simulated results are consistent with the experimental data. The computational approach may shed some light on the identification of Ca2+-binding sites in CaBPs.

  1. Autoradiographic evidence for two classes of mu opioid binding sites in rat brain using (/sup 125/I)FK33824

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rothman, R.B.; Jacobson, A.E.; Rice, K.C.

    1987-11-01

    Previous studies demonstrated that pretreatment of brain membranes with the irreversible mu antagonist, beta-funaltrexamine (beta-FNA), partially eliminated mu binding sites (25,35), consistent with the existence of two mu binding sites distinguished by beta-FNA. This paper tests the hypothesis that the FNA-sensitive and FNA-insensitive mu binding sites have different anatomical distributions in rat brain. Prior to autoradiographic visualization of mu binding sites, (/sup 3/H)oxymorphone, (/sup 3/H)D-ala2-MePhe4, Gly-ol5-enkephalin (DAGO), and (/sup 125/I)D-ala2-Me-Phe4-met(o)-ol)enkephalin (FK33824) were shown to selectively label mu binding sites using slide mounted sections of molded minced rat brain. As found using membranes, beta-FNA eliminated only a portion of mu bindingmore » sites. Autoradiographic visualization of mu binding sites using the mu-selective ligand (/sup 125/I)FK33824 in control and FNA-treated sections of rat brain demonstrated that the proportion of mu binding sites sensitive to beta-FNA varied across regions of the brain, particularly the dorsal thalamus, ventrobasal complex and the hypothalamus, providing anatomical data supporting the existence of two classes of mu binding sites in rat brain.« less

  2. Widespread evidence of cooperative DNA binding by transcription factors in Drosophila development

    PubMed Central

    Kazemian, Majid; Pham, Hannah; Wolfe, Scot A.; Brodsky, Michael H.; Sinha, Saurabh

    2013-01-01

    Regulation of eukaryotic gene transcription is often combinatorial in nature, with multiple transcription factors (TFs) regulating common target genes, often through direct or indirect mutual interactions. Many individual examples of cooperative binding by directly interacting TFs have been identified, but it remains unclear how pervasive this mechanism is during animal development. Cooperative TF binding should be manifest in genomic sequences as biased arrangements of TF-binding sites. Here, we explore the extent and diversity of such arrangements related to gene regulation during Drosophila embryogenesis. We used the DNA-binding specificities of 322 TFs along with chromatin accessibility information to identify enriched spacing and orientation patterns of TF-binding site pairs. We developed a new statistical approach for this task, specifically designed to accurately assess inter-site spacing biases while accounting for the phenomenon of homotypic site clustering commonly observed in developmental regulatory regions. We observed a large number of short-range distance preferences between TF-binding site pairs, including examples where the preference depends on the relative orientation of the binding sites. To test whether these binding site patterns reflect physical interactions between the corresponding TFs, we analyzed 27 TF pairs whose binding sites exhibited short distance preferences. In vitro protein–protein binding experiments revealed that >65% of these TF pairs can directly interact with each other. For five pairs, we further demonstrate that they bind cooperatively to DNA if both sites are present with the preferred spacing. This study demonstrates how DNA-binding motifs can be used to produce a comprehensive map of sequence signatures for different mechanisms of combinatorial TF action. PMID:23847101

  3. Widespread evidence of cooperative DNA binding by transcription factors in Drosophila development.

    PubMed

    Kazemian, Majid; Pham, Hannah; Wolfe, Scot A; Brodsky, Michael H; Sinha, Saurabh

    2013-09-01

    Regulation of eukaryotic gene transcription is often combinatorial in nature, with multiple transcription factors (TFs) regulating common target genes, often through direct or indirect mutual interactions. Many individual examples of cooperative binding by directly interacting TFs have been identified, but it remains unclear how pervasive this mechanism is during animal development. Cooperative TF binding should be manifest in genomic sequences as biased arrangements of TF-binding sites. Here, we explore the extent and diversity of such arrangements related to gene regulation during Drosophila embryogenesis. We used the DNA-binding specificities of 322 TFs along with chromatin accessibility information to identify enriched spacing and orientation patterns of TF-binding site pairs. We developed a new statistical approach for this task, specifically designed to accurately assess inter-site spacing biases while accounting for the phenomenon of homotypic site clustering commonly observed in developmental regulatory regions. We observed a large number of short-range distance preferences between TF-binding site pairs, including examples where the preference depends on the relative orientation of the binding sites. To test whether these binding site patterns reflect physical interactions between the corresponding TFs, we analyzed 27 TF pairs whose binding sites exhibited short distance preferences. In vitro protein-protein binding experiments revealed that >65% of these TF pairs can directly interact with each other. For five pairs, we further demonstrate that they bind cooperatively to DNA if both sites are present with the preferred spacing. This study demonstrates how DNA-binding motifs can be used to produce a comprehensive map of sequence signatures for different mechanisms of combinatorial TF action.

  4. Cooperative activation of cardiac transcription through myocardin bridging of paired MEF2 sites

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Anderson, Courtney M.; Hu, Jianxin; Thomas, Reuben

    2017-03-28

    Enhancers frequently contain multiple binding sites for the same transcription factor. These homotypic binding sites often exhibit synergy, whereby the transcriptional output from two or more binding sites is greater than the sum of the contributions of the individual binding sites alone. Although this phenomenon is frequently observed, the mechanistic basis for homotypic binding site synergy is poorly understood. Here in this paper, we identify a bona fide cardiac-specific Prkaa2 enhancer that is synergistically activated by homotypic MEF2 binding sites. We show that two MEF2 sites in the enhancer function cooperatively due to bridging of the MEF2C-bound sites by themore » SAP domain-containing co-activator protein myocardin, and we show that paired sites buffer the enhancer from integration site-dependent effects on transcription in vivo. Paired MEF2 sites are prevalent in cardiac enhancers, suggesting that this might be a common mechanism underlying synergy in the control of cardiac gene expression in vivo.« less

  5. Construction of proteins with molecular recognition capabilities using α3β3 de novo protein scaffolds.

    PubMed

    Okura, Hiromichi; Mihara, Hisakazu; Takahashi, Tsuyoshi

    2013-10-01

    The molecular recognition ability of proteins is essential in biological systems, and therefore a considerable amount of effort has been devoted to constructing desired target-binding proteins using a variety of naturally occurring proteins as scaffolds. However, since generating a binding site in a native protein can often affect its structural properties, highly stable de novo protein scaffolds may be more amenable than the native proteins. We previously reported the generation of de novo proteins comprising three α-helices and three β-strands (α3β3) from a genetic library coding simplified amino acid sets. Two α3β3 de novo proteins, vTAJ13 and vTAJ36, fold into a native-like stable and molten globule-like structures, respectively, even though the proteins have similar amino acid compositions. Here, we attempted to create binding sites for the vTAJ13 and vTAJ36 proteins to prove the utility of de novo designed artificial proteins as a molecular recognition tool. Randomization of six amino acids at two linker sites of vTAJ13 and vTAJ36 followed by biopanning generated binding proteins that recognize the target molecules, fluorescein and green fluorescent protein, with affinities of 10(-7)-10(-8) M. Of note, the selected proteins from the vTAJ13-based library tended to recognize the target molecules with high specificity, probably due to the native-like stable structure of vTAJ13. Our studies provide an example of the potential of de novo protein scaffolds, which are composed of a simplified amino acid set, to recognize a variety of target compounds.

  6. The Chromodomain of Tf1 Integrase Promotes Binding to cDNA and Mediates Target Site Selection▿ †

    PubMed Central

    Chatterjee, Atreyi Ghatak; Leem, Young Eun; Kelly, Felice D.; Levin, Henry L.

    2009-01-01

    The long terminal repeat (LTR) retrotransposon Tf1 of Schizosaccharomyces pombe integrates specifically into the promoters of pol II-transcribed genes. Its integrase (IN) contains a C-terminal chromodomain related to the chromodomains that bind to the N-terminal tail of histone H3. Although we have been unable to detect an interaction between histone tails and the chromodomain of Tf1 IN, it is possible that the chromodomain plays a role in directing IN to its target sites. To test this idea, we generated transposons with single amino acid substitutions in highly conserved residues of the chromodomain and created a chromodomain-deleted mutant. The mutations, V1290A, Y1292A, W1305A, and CHDΔ, substantially reduced transposition activity in vivo. Blotting assays showed that there was little or no reduction in the levels of IN or cDNA. By measuring the homologous recombination between cDNA and the plasmid copy of Tf1, we found that two of the mutations did not reduce the import of cDNA into the nucleus, while another caused a 33% reduction. Chromatin immunoprecipitation assays revealed that CHDΔ caused an approximately threefold reduction in the binding of IN to the downstream LTR of the cDNA. These data indicate that the chromodomain contributed directly to integration. We therefore tested whether the chromodomain contributed to selecting insertion sites. Results of a target plasmid assay showed that the deletion of the chromodomain resulted in a drastic reduction in the preference for pol II promoters. Collectively, these data indicate that the chromodomain promotes binding of cDNA and plays a key role in efficient targeting. PMID:19109383

  7. The chromodomain of Tf1 integrase promotes binding to cDNA and mediates target site selection.

    PubMed

    Chatterjee, Atreyi Ghatak; Leem, Young Eun; Kelly, Felice D; Levin, Henry L

    2009-03-01

    The long terminal repeat (LTR) retrotransposon Tf1 of Schizosaccharomyces pombe integrates specifically into the promoters of pol II-transcribed genes. Its integrase (IN) contains a C-terminal chromodomain related to the chromodomains that bind to the N-terminal tail of histone H3. Although we have been unable to detect an interaction between histone tails and the chromodomain of Tf1 IN, it is possible that the chromodomain plays a role in directing IN to its target sites. To test this idea, we generated transposons with single amino acid substitutions in highly conserved residues of the chromodomain and created a chromodomain-deleted mutant. The mutations, V1290A, Y1292A, W1305A, and CHDDelta, substantially reduced transposition activity in vivo. Blotting assays showed that there was little or no reduction in the levels of IN or cDNA. By measuring the homologous recombination between cDNA and the plasmid copy of Tf1, we found that two of the mutations did not reduce the import of cDNA into the nucleus, while another caused a 33% reduction. Chromatin immunoprecipitation assays revealed that CHDDelta caused an approximately threefold reduction in the binding of IN to the downstream LTR of the cDNA. These data indicate that the chromodomain contributed directly to integration. We therefore tested whether the chromodomain contributed to selecting insertion sites. Results of a target plasmid assay showed that the deletion of the chromodomain resulted in a drastic reduction in the preference for pol II promoters. Collectively, these data indicate that the chromodomain promotes binding of cDNA and plays a key role in efficient targeting.

  8. Stability and function of interdomain linker variants of glucoamylase 1 from Aspergillus niger.

    PubMed

    Sauer, J; Christensen, T; Frandsen, T P; Mirgorodskaya, E; McGuire, K A; Driguez, H; Roepstorff, P; Sigurskjold, B W; Svensson, B

    2001-08-07

    Several variants of glucoamylase 1 (GA1) from Aspergillus niger were created in which the highly O-glycosylated peptide (aa 468--508) connecting the (alpha/alpha)(6)-barrel catalytic domain and the starch binding domain was substituted at the gene level by equivalent segments of glucoamylases from Hormoconis resinae, Humicola grisea, and Rhizopus oryzae encoding 5, 19, and 36 amino acid residues. Variants were constructed in which the H. resinae linker was elongated by proline-rich sequences as this linker itself apparently was too short to allow formation of the corresponding protein variant. Size and isoelectric point of GA1 variants reflected differences in linker length, posttranslational modification, and net charge. While calculated polypeptide chain molecular masses for wild-type GA1, a nonnatural proline-rich linker variant, H. grisea, and R. oryzae linker variants were 65,784, 63,777, 63,912, and 65,614 Da, respectively, MALDI-TOF-MS gave values of 82,042, 73,800, 73,413, and 90,793 Da, respectively, where the latter value could partly be explained by an N-glycosylation site introduced near the linker C-terminus. The k(cat) and K(m) for hydrolysis of maltooligodextrins and soluble starch, and the rate of hydrolysis of barley starch granules were essentially the same for the variants as for wild-type GA1. beta-Cyclodextrin, acarbose, and two heterobidentate inhibitors were found by isothermal titration calorimetry to bind to the catalytic and starch binding domains of the linker variants, indicating that the function of the active site and the starch binding site was maintained. The stability of GA1 linker variants toward GdnHCl and heat, however, was reduced compared to wild-type.

  9. Understanding the physical and chemical nature of the warfarin drug binding site in human serum albumin: experimental and theoretical studies.

    PubMed

    Abou-Zied, Osama K

    2015-01-01

    Human serum albumin (HSA) is one of the major carrier proteins in the body and constitutes approximately half of the protein found in blood plasma. It plays an important role in lipid metabolism, and its ability to reversibly bind a large variety of pharmaceutical compounds makes it a crucial determinant of drug pharmacokinetics and pharmacodynamics. This review deals with one of the protein's major binding sites "Sudlow I" which includes a binding pocket for the drug warfarin (WAR). The binding nature of this important site can be characterized by measuring the spectroscopic changes when a ligand is bound. Using several drugs, including WAR, and other drug-like molecules as ligands, the results emphasize the nature of Sudlow I as a flexible binding site, capable of binding a variety of ligands by adapting its binding pockets. The high affinity of the WAR pocket for binding versatile molecular structures stems from the flexibility of the amino acids forming the pocket. The binding site is shown to have an ionization ability which is important to consider when using drugs that are known to bind in Sudlow I. Several studies point to the important role of water molecules trapped inside the binding site in molecular recognition and ligand binding. Water inside the protein's cavity is crucial in maintaining the balance between the hydrophobic and hydrophilic nature of the binding site. Upon the unfolding and refolding of HSA, more water molecules are trapped inside the binding site which cause some swelling that prevents a full recovery from the denatured state. Better understanding of the mechanism of binding in macromolecules such as HSA and other proteins can be achieved by combining experimental and theoretical studies which produce significant synergies in studying complex biochemical phenomena.

  10. Nuclear binding of progesterone in hen oviduct. Binding to multiple sites in vitro.

    PubMed Central

    Pikler, G M; Webster, R A; Spelsberg, T C

    1976-01-01

    Steroid hormones, including progesterone, are known to bind with high affinity (Kd approximately 1x10(-10)M) to receptor proteins once they enter target cells. This complex (the progesterone-receptor) then undergoes a temperature-and/or salt-dependent activation which allows it to migrate to the cell nucleus and to bind to the deoxyribonucleoproteins. The present studies demonstrate that binding the hormone-receptor complex in vitro to isolated nuclei from the oviducts of laying hens required the same conditions as do other studies of bbinding in vitro reported previously, e.g. the hormone must be complexed to intact and activated receptor. The assay of the nuclear binding by using multiple concentrations of progesterone receptor reveals the presence of more than one class of binding site in the oviduct nuclei. The affinity of each of these classes of binding sites range from Kd approximately 1x10(-9)-1x10(-8)M. Assays using free steroid (not complexed with receptor) show no binding to these sites. The binding to each of the classes of sites, displays a differential stability to increasing ionic concentrations, suggesting primarily an ionic-type interaction for all classes. Only the highest-affinity class of binding site is capable of binding progesterone receptor under physioligical-saline conditions. This class represent 6000-10000 sites per cell nucleus and resembles the sites detected in vivo (Spelsberg, 1976, Biochem. J. 156, 391-398) which cause maximal transcriptional response when saturated with the progesterone receptor. The multiple binding sites for the progesterone receptor either are not present or are found in limited numbers in the nuclei of non-target organs. Differences in extent of binding to the nuclear material between a target tissue (oviduct) and other tissues (spleen or erythrocyte) are markedly dependent on the ionic conditions, and are probably due to binding to different classes of sites in the nuclei. PMID:182147

  11. Disruption of key NADH-binding pocket residues of the Mycobacterium tuberculosis InhA affects DD-CoA binding ability.

    PubMed

    Shaw, Daniel J; Robb, Kirsty; Vetter, Beatrice V; Tong, Madeline; Molle, Virginie; Hunt, Neil T; Hoskisson, Paul A

    2017-07-05

    Tuberculosis (TB) is a global health problem that affects over 10 million people. There is an urgent need to develop novel antimicrobial therapies to combat TB. To achieve this, a thorough understanding of key validated drug targets is required. The enoyl reductase InhA, responsible for synthesis of essential mycolic acids in the mycobacterial cell wall, is the target for the frontline anti-TB drug isoniazid. To better understand the activity of this protein a series of mutants, targeted to the NADH co-factor binding pocket were created. Residues P193 and W222 comprise a series of hydrophobic residues surrounding the cofactor binding site and mutation of both residues negatively affect InhA function. Construction of an M155A mutant of InhA results in increased affinity for NADH and DD-CoA turnover but with a reduction in V max for DD-CoA, impairing overall activity. This suggests that NADH-binding geometry of InhA likely permits long-range interactions between residues in the NADH-binding pocket to facilitate substrate turnover in the DD-CoA binding region of the protein. Understanding the precise details of substrate binding and turnover in InhA and how this may affect protein-protein interactions may facilitate the development of improved inhibitors enabling the development of novel anti-TB drugs.

  12. Nicotinic Cholinergic Receptor Binding Sites in the Brain: Regulation in vivo

    NASA Astrophysics Data System (ADS)

    Schwartz, Rochelle D.; Kellar, Kenneth J.

    1983-04-01

    Tritiated acetylcholine was used to measure binding sites with characteristics of nicotinic cholinergic receptors in rat brain. Regulation of the binding sites in vivo was examined by administering two drugs that stimulate nicotinic receptors directly or indirectly. After 10 days of exposure to the cholinesterase inhibitor diisopropyl fluorophosphate, binding of tritiated acetylcholine in the cerebral cortex was decreased. However, after repeated administration of nicotine for 10 days, binding of tritiated acetylcholine in the cortex was increased. Saturation analysis of tritiated acetylcholine binding in the cortices of rats treated with diisopropyl fluorophosphate or nicotine indicated that the number of binding sites decreased and increased, respectively, while the affinity of the sites was unaltered.

  13. Preparation of a functional fluorescent human Fas ligand extracellular domain derivative using a three-dimensional structure guided site-specific fluorochrome conjugation.

    PubMed

    Muraki, Michiro

    2016-01-01

    Human Fas ligand extracellular domain has been investigated as an important target protein in the field of medical biotechnology. In a recent study, the author developed an effective method to produce biologically active human Fas ligand extracellular domain derivatives using site-specific chemical modifications. A human Fas ligand extracellular domain derivative containing a reactive cysteine residue within its N-terminal tag sequence, which locates not proximal to the binding interface between the ligand and the receptor in terms of the three-dimensional structure, was modified by Fluorescein-5-Maleimide without impairing the specific binding activity toward human Fas receptor extracellular domain. The purified protein sample free of low molecular-weight contaminants showed a characteristic fluorescence spectrum derived from the attached Fluorescein moieties, and formed a stable binding complex with human Fas receptor extracellular domain-human IgG1 Fc domain fusion protein in solution. The conjugation number of the fluorochrome was estimated to be 2.5 per a single human Fas ligand extracellular domain trimer from the ratio of the absorbance value at 280 nm to that at 495 nm. A functional fluorescent human Fas ligand extracellular domain derivative was prepared via a site-specific conjugation of fluorochrome, which was guided by the three-dimensional structure information on the ligand-receptor complex. Fluorescent derivatives created by this method may contribute to the development of an improved diagnosis system for the diseases related to Fas receptor.

  14. A murine host cell factor required for nicking of the dimer bridge of MVM recognizes two CG nucleotides displaced by 10 basepairs.

    PubMed

    Liu, Q; Astell, C R

    1996-10-01

    During replication of the minute virus of mice (MVM) genome, a dimer replicative form (RF) intermediate is resolved into two monomer RF molecules in such a way as to retain a unique sequence within the left hand hairpin terminus of the viral genome. Although the proposed mechanism for resolution of the dimer RF remains uncertain, it likely involves site-specific nicking of the dimer bridge. The RF contains two double-stranded copies of the viral genome joined by the extended 3' hairpin. Minor sequence asymmetries within the 3' hairpin allow the two halves of the dimer bridge to be distinguished. The A half contains the sequence [sequence: see text], whereas the B half contains the sequence [sequence: see text]. Using an in vitro assay, we show that only the B half of the MVM dimer bridge is nicked site-specifically when incubated with crude NS-1 protein (expressed in insect cells) and mouse LA9 cellular extract. When highly purified NS-1, the major nonstructural protein of MVM, is used in this nicking reaction, there is an absolute requirement for the LA9 cellular extract, suggesting a cellular factor (or factors) is (are) required. A series of mutations were created in the putative host factor binding region (HFBR) on the B half of the MVM dimer bridge adjacent to the NS-1 binding site. Nicking assays of these B half mutants showed that two CG motifs displaced by 10 nucleotides are important for nicking. Gel mobility shift assays demonstrated that a host factor(s) can bind to the HFBR of the B half of the dimer bridge and efficient binding depends on the presence of both CG motifs. Competitor DNA containing the wild-type HFBR sequence is able to specifically inhibit nicking of the B half, indicating that the host factor(s) bound to the HFBR is(are) essential for site-specific nicking to occur.

  15. Substance P binding sites in the nucleus tractus solitarius of the cat

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maley, B.E.; Sasek, C.A.; Seybold, V.S.

    1988-11-01

    Substance P binding sites in the nucleus tractus solitarius were visualized with receptor autoradiography using Bolton-Hunter (/sup 125/I)substance P. Substance P binding sites were found to have distinct patterns within the cat nucleus tractus solitarius. The majority of substance P binding sites were present in the medial, intermediate and the peripheral rim of the parvocellular subdivisions. Lower amounts of substance P binding sites were present in the commissural, ventrolateral, interstitial and dorsolateral subdivisions. No substance P binding sites were present in the central region of the parvocellular subdivision or the solitary tract. The localization of substance P binding sites inmore » the nucleus tractus solitarius is very similar to the patterns of substance P immunoreactive fibers previously described for this region. Results of this study add further support for a functional role of substance P in synaptic circuits of the nucleus tractus solitarius.« less

  16. Structural analysis of substrate recognition by glucose isomerase in Mn2+ binding mode at M2 site in S. rubiginosus.

    PubMed

    Bae, Ji-Eun; Hwang, Kwang Yeon; Nam, Ki Hyun

    2018-06-16

    Glucose isomerase (GI) catalyzes the reversible enzymatic isomerization of d-glucose and d-xylose to d-fructose and d-xylulose, respectively. This is one of the most important enzymes in the production of high-fructose corn syrup (HFCS) and biofuel. We recently determined the crystal structure of GI from S. rubiginosus (SruGI) complexed with a xylitol inhibitor in one metal binding mode. Although we assessed inhibitor binding at the M1 site, the metal binding at the M2 site and the substrate recognition mechanism for SruGI remains the unclear. Here, we report the crystal structure of the two metal binding modes of SruGI and its complex with glucose. This study provides a snapshot of metal binding at the SruGI M2 site in the presence of Mn 2+ , but not in the presence of Mg 2+ . Metal binding at the M2 site elicits a configuration change at the M1 site. Glucose molecule can only bind to the M1 site in presence of Mn 2+ at the M2 site. Glucose and Mn 2+ at the M2 site were bridged by water molecules using a hydrogen bonding network. The metal binding geometry of the M2 site indicates a distorted octahedral coordination with an angle of 55-110°, whereas the M1 site has a relatively stable octahedral coordination with an angle of 85-95°. We suggest a two-step sequential process for SruGI substrate recognition, in Mn 2+ binding mode, at the M2 site. Our results provide a better understanding of the molecular role of the M2 site in GI substrate recognition. Copyright © 2018. Published by Elsevier Inc.

  17. Characterization of diadenosine tetraphosphate (Ap4A) binding sites in cultured chromaffin cells: evidence for a P2y site.

    PubMed Central

    Pintor, J.; Torres, M.; Castro, E.; Miras-Portugal, M. T.

    1991-01-01

    1. Diadenosine tetraphosphate (Ap4A) a dinucleotide, which is stored in secretory granules, presents two types of high affinity binding sites in chromaffin cells. A Kd value of 8 +/- 0.65 x 10(-11) M and Bmax value of 5420 +/- 450 sites per cell were obtained for the high affinity binding site. A Kd value of 5.6 +/- 0.53 x 10(-9) M and a Bmax value close to 70,000 sites per cell were obtained for the second binding site with high affinity. 2. The diadenosine polyphosphates, Ap3A, Ap4A, Ap5A and Ap6A, displaced [3H]-Ap4A from the two binding sites, the Ki values being 1.0 nM, 0.013 nM, 0.013 nM and 0.013 nM for the very high affinity binding site and 0.5 microM, 0.13 microM, 0.062 microM and 0.75 microM for the second binding site. 3. The ATP analogues displaced [3H]-Ap4A with the potency order of the P2y receptors, adenosine 5'-O-(2 thiodiphosphate) (ADP-beta-S) greater than 5'-adenylyl imidodiphosphate (AMP-PNP) greater than alpha, beta-methylene ATP (alpha, beta-MeATP), in both binding sites. The Ki values were respectively 0.075 nM, 0.2 nM and 0.75 nM for the very high affinity binding site and 0.125 microM, 0.5 microM and 0.9 microM for the second binding site. PMID:1912985

  18. Distinct roles of beta1 metal ion-dependent adhesion site (MIDAS), adjacent to MIDAS (ADMIDAS), and ligand-associated metal-binding site (LIMBS) cation-binding sites in ligand recognition by integrin alpha2beta1.

    PubMed

    Valdramidou, Dimitra; Humphries, Martin J; Mould, A Paul

    2008-11-21

    Integrin-ligand interactions are regulated in a complex manner by divalent cations, and previous studies have identified ligand-competent, stimulatory, and inhibitory cation-binding sites. In collagen-binding integrins, such as alpha2beta1, ligand recognition takes place exclusively at the alpha subunit I domain. However, activation of the alphaI domain depends on its interaction with a structurally similar domain in the beta subunit known as the I-like or betaI domain. The top face of the betaI domain contains three cation-binding sites: the metal-ion dependent adhesion site (MIDAS), the ADMIDAS (adjacent to MIDAS), and LIMBS (ligand-associated metal-binding site). The role of these sites in controlling ligand binding to the alphaI domain has yet to be elucidated. Mutation of the MIDAS or LIMBS completely blocked collagen binding to alpha2beta1; in contrast mutation of the ADMIDAS reduced ligand recognition but this effect could be overcome by the activating monoclonal antibody TS2/16. Hence, the MIDAS and LIMBS appear to be essential for the interaction between alphaI and betaI, whereas occupancy of the ADMIDAS has an allosteric effect on the conformation of betaI. An activating mutation in the alpha2 I domain partially restored ligand binding to the MIDAS and LIMBS mutants. Analysis of the effects of Ca(2+), Mg(2+), and Mn(2+) on ligand binding to these mutants showed that the MIDAS is a ligand-competent site through which Mn(2+) stimulates ligand binding, whereas the LIMBS is a stimulatory Ca(2+)-binding site, occupancy of which increases the affinity of Mg(2+) for the MIDAS.

  19. Identification and partial characterization of a low affinity metal-binding site in the light chain of tetanus toxin.

    PubMed

    Wright, J F; Pernollet, M; Reboul, A; Aude, C; Colomb, M G

    1992-05-05

    Tetanus toxin was shown to contain a metal-binding site for zinc and copper. Equilibrium dialysis binding experiments using 65Zn indicated an association constant of 9-15 microM, with one zinc-binding site/toxin molecule. The zinc-binding site was localized to the toxin light chain as determined by binding of 65Zn to the light chain but not to the heavy chain after separation by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transfer to Immobilon membranes. Copper was an efficient inhibitor of 65Zn binding to tetanus toxin and caused two peptide bond cleavages in the toxin light chain in the presence of ascorbate. These metal-catalyzed oxidative cleavages were inhibited by the presence of zinc. Partial characterization of metal-catalyzed oxidative modifications of a peptide based on a putative metal-binding site (HELIH) in the toxin light chain was used to map the metal-binding site in the protein.

  20. A site-directed mutagenesis method particularly useful for creating otherwise difficult-to-make mutants and alanine scanning.

    PubMed

    Wan, Haisu; Li, Yongwen; Fan, Yu; Meng, Fanrong; Chen, Chen; Zhou, Qinghua

    2012-01-15

    Site-directed mutagenesis has become routine in molecular biology. However, many mutants can still be very difficult to create. Complicated chimerical mutations, tandem repeats, inverted sequences, GC-rich regions, and/or heavy secondary structures can cause inefficient or incorrect binding of the mutagenic primer to the target sequence and affect the subsequent amplification. In theory, these problems can be avoided by introducing the mutations into the target sequence using mutagenic fragments and so removing the need for primer-template annealing. The cassette mutagenesis uses the mutagenic fragment in its protocol; however, in most cases it needs to perform two rounds of mutagenic primer-based mutagenesis to introduce suitable restriction enzyme sites into templates and is not suitable for routine mutagenesis. Here we describe a highly efficient method in which the template except the region to be mutated is amplified by polymerase chain reaction (PCR) and the type IIs restriction enzyme-digested PCR product is directly ligated with the mutagenic fragment. Our method requires no assistance of mutagenic primers. We have used this method to create various types of difficult-to-make mutants with mutagenic frequencies of nearly 100%. Our protocol has many advantages over the prevalent QuikChange method and is a valuable tool for studies on gene structure and function. Copyright © 2011 Elsevier Inc. All rights reserved.

  1. Mechanism of the Dual Activities of Human CYP17A1 and Binding to Anti-Prostate Cancer Drug Abiraterone Revealed by a Novel V366M Mutation Causing 17,20 Lyase Deficiency.

    PubMed

    Fernández-Cancio, Mónica; Camats, Núria; Flück, Christa E; Zalewski, Adam; Dick, Bernhard; Frey, Brigitte M; Monné, Raquel; Torán, Núria; Audí, Laura; Pandey, Amit V

    2018-04-29

    The CYP17A1 gene regulates sex steroid biosynthesis in humans through 17α-hydroxylase/17,20 lyase activities and is a target of anti-prostate cancer drug abiraterone. In a 46, XY patient with female external genitalia, together with a loss of function mutation S441P, we identified a novel missense mutation V366M at the catalytic center of CYP17A1 which preferentially impaired 17,20 lyase activity. Kinetic experiments with bacterially expressed proteins revealed that V366M mutant enzyme can bind and metabolize pregnenolone to 17OH-pregnenolone, but 17OH-pregnenolone binding and conversion to dehydroepiandrosterone (DHEA) was impaired, explaining the patient’s steroid profile. Abiraterone could not bind and inhibit the 17α-hydroxylase activity of the CYP17A1-V366M mutant. Molecular dynamics (MD) simulations showed that V366M creates a “one-way valve” and suggests a mechanism for dual activities of human CYP17A1 where, after the conversion of pregnenolone to 17OH-pregnenolone, the product exits the active site and re-enters for conversion to dehydroepiandrosterone. The V366M mutant also explained the effectiveness of the anti-prostate cancer drug abiraterone as a potent inhibitor of CYP17A1 by binding tightly at the active site in the WT enzyme. The V366M is the first human mutation to be described at the active site of CYP17A1 that causes isolated 17,20 lyase deficiency. Knowledge about the specificity of CYP17A1 activities is of importance for the development of treatments for polycystic ovary syndrome and inhibitors for prostate cancer therapy.

  2. CORE_TF: a user-friendly interface to identify evolutionary conserved transcription factor binding sites in sets of co-regulated genes

    PubMed Central

    Hestand, Matthew S; van Galen, Michiel; Villerius, Michel P; van Ommen, Gert-Jan B; den Dunnen, Johan T; 't Hoen, Peter AC

    2008-01-01

    Background The identification of transcription factor binding sites is difficult since they are only a small number of nucleotides in size, resulting in large numbers of false positives and false negatives in current approaches. Computational methods to reduce false positives are to look for over-representation of transcription factor binding sites in a set of similarly regulated promoters or to look for conservation in orthologous promoter alignments. Results We have developed a novel tool, "CORE_TF" (Conserved and Over-REpresented Transcription Factor binding sites) that identifies common transcription factor binding sites in promoters of co-regulated genes. To improve upon existing binding site predictions, the tool searches for position weight matrices from the TRANSFACR database that are over-represented in an experimental set compared to a random set of promoters and identifies cross-species conservation of the predicted transcription factor binding sites. The algorithm has been evaluated with expression and chromatin-immunoprecipitation on microarray data. We also implement and demonstrate the importance of matching the random set of promoters to the experimental promoters by GC content, which is a unique feature of our tool. Conclusion The program CORE_TF is accessible in a user friendly web interface at . It provides a table of over-represented transcription factor binding sites in the users input genes' promoters and a graphical view of evolutionary conserved transcription factor binding sites. In our test data sets it successfully predicts target transcription factors and their binding sites. PMID:19036135

  3. [The role of glycine binding site in NMDA receptor--interactions between NMDA and D-serine in artificial anoxia/agycemia rat hippocampus].

    PubMed

    Kawasaki, Kazuyoshi; Ogawa, Seturou

    2003-01-01

    NMDA receptor contributes to cause neuronal death in anoxic condition. It is not known how a part of NMDA receptors, NMDA-binding site and/or glycine-binding site, influence neuronal damage in rats' hippocampus in vitro. Rats' hippocampus, labeled with norepinephrine (3H-NE), was incubated in artificial cerebrospinal fluid (aCSF) and we measured 3H-NE in superfusion solution and remaining tissue. Glucose was eliminated from aCSF and 95% N2 + 5% CO2 produced the anoxic state. The amount of 3H-NE release increased in anoxia with NMDA (NMDA-binding site agonist), while there was no influence on NMDA receptor in non-anoxic state even after D-serine (glycine-binding site agonist) has been administered. The 3H-NE was released more when D-serine (100 mu mM) and NMDA (100 mu mM) were administered together than when only D-serine (10 mu mM, 100 mu mM, 1000 mu mM) in anoxia or NMDA (10 mu mM, 100 mu mM, 1000 mu mM) in anoxia was administered. Glycine-binding site agonist alone does not act significantly but ion channels in NMDA receptor open more and become more effective when both glycine-binding site agonist and NMDA-binding site agonist exist, suggesting that there are interactions between NMDA-binding site and glycine-binding site in NMDA-receptor during anoxia.

  4. CaMELS: In silico prediction of calmodulin binding proteins and their binding sites.

    PubMed

    Abbasi, Wajid Arshad; Asif, Amina; Andleeb, Saiqa; Minhas, Fayyaz Ul Amir Afsar

    2017-09-01

    Due to Ca 2+ -dependent binding and the sequence diversity of Calmodulin (CaM) binding proteins, identifying CaM interactions and binding sites in the wet-lab is tedious and costly. Therefore, computational methods for this purpose are crucial to the design of such wet-lab experiments. We present an algorithm suite called CaMELS (CalModulin intEraction Learning System) for predicting proteins that interact with CaM as well as their binding sites using sequence information alone. CaMELS offers state of the art accuracy for both CaM interaction and binding site prediction and can aid biologists in studying CaM binding proteins. For CaM interaction prediction, CaMELS uses protein sequence features coupled with a large-margin classifier. CaMELS models the binding site prediction problem using multiple instance machine learning with a custom optimization algorithm which allows more effective learning over imprecisely annotated CaM-binding sites during training. CaMELS has been extensively benchmarked using a variety of data sets, mutagenic studies, proteome-wide Gene Ontology enrichment analyses and protein structures. Our experiments indicate that CaMELS outperforms simple motif-based search and other existing methods for interaction and binding site prediction. We have also found that the whole sequence of a protein, rather than just its binding site, is important for predicting its interaction with CaM. Using the machine learning model in CaMELS, we have identified important features of protein sequences for CaM interaction prediction as well as characteristic amino acid sub-sequences and their relative position for identifying CaM binding sites. Python code for training and evaluating CaMELS together with a webserver implementation is available at the URL: http://faculty.pieas.edu.pk/fayyaz/software.html#camels. © 2017 Wiley Periodicals, Inc.

  5. Smoke-derived karrikin perception by the α/β-hydrolase KAI2 from Arabidopsis

    PubMed Central

    Guo, Yongxia; Zheng, Zuyu; La Clair, James J.; Chory, Joanne; Noel, Joseph P.

    2013-01-01

    Genetic studies in Arabidopsis implicate an α/β-hydrolase, KARRIKIN-INSENSITIVE 2 (KAI2) as a receptor for karrikins, germination-promoting butenolide small molecules found in the smoke of burned plants. However, direct biochemical evidence for the interaction between KAI2 and karrikin and for the mechanism of downstream signaling by a KAI2–karrikin complex remain elusive. We report crystallographic analyses and ligand-binding experiments for KAI2 recognition of karrikins. The karrikin-1 (KAR1) ligand sits in the opening to the active site abutting a helical domain insert but distal from the canonical catalytic triad (Ser95-His246-Asp217) of α/β-hydrolases, consistent with the lack of detectable hydrolytic activity by purified KAI2. The closest approach of KAR1 to Ser95-His246-Asp217 is 3.8 Å from His246. Six aromatic side chains, including His246, encapsulate KAR1 through geometrically defined aromatic–aromatic interactions. KAR1 binding induces a conformational change in KAI2 at the active site entrance. A crevice of hydrophobic residues linking the polar edge of KAR1 and the helical domain insert suggests that KAI2–KAR1 creates a contiguous interface for binding signaling partners in a ligand-dependent manner. PMID:23613584

  6. Smoke-derived karrikin perception by the α/β-hydrolase KAI2 from Arabidopsis.

    PubMed

    Guo, Yongxia; Zheng, Zuyu; La Clair, James J; Chory, Joanne; Noel, Joseph P

    2013-05-14

    Genetic studies in Arabidopsis implicate an α/β-hydrolase, KARRIKIN-INSENSITIVE 2 (KAI2) as a receptor for karrikins, germination-promoting butenolide small molecules found in the smoke of burned plants. However, direct biochemical evidence for the interaction between KAI2 and karrikin and for the mechanism of downstream signaling by a KAI2-karrikin complex remain elusive. We report crystallographic analyses and ligand-binding experiments for KAI2 recognition of karrikins. The karrikin-1 (KAR1) ligand sits in the opening to the active site abutting a helical domain insert but distal from the canonical catalytic triad (Ser95-His246-Asp217) of α/β-hydrolases, consistent with the lack of detectable hydrolytic activity by purified KAI2. The closest approach of KAR1 to Ser95-His246-Asp217 is 3.8 Å from His246. Six aromatic side chains, including His246, encapsulate KAR1 through geometrically defined aromatic-aromatic interactions. KAR1 binding induces a conformational change in KAI2 at the active site entrance. A crevice of hydrophobic residues linking the polar edge of KAR1 and the helical domain insert suggests that KAI2-KAR1 creates a contiguous interface for binding signaling partners in a ligand-dependent manner.

  7. Cloning and characterization of GETS-1, a goldfish Ets family member that functions as a transcriptional repressor in muscle.

    PubMed

    Goldman, D; Sapru, M K; Stewart, S; Plotkin, J; Libermann, T A; Wasylyk, B; Guan, K

    1998-10-15

    An Ets transcription factor family member, GETS-1, was cloned from a goldfish retina cDNA library. GETS-1 contains a conserved Ets DNA-binding domain at its N-terminus and is most similar to ternary complex factor (TCF) serum-response-factor protein-1a (SAP-1a). GETS-1 is expressed in many tissues, but is enriched in retina and brain. As with the TCFs SAP-1a and ets-related protein (ERP), overexpression of the GETS-1 promoter suppresses nicotinic acetylcholine receptor epsilon-subunit gene expression in cultured muscle cells. A consensus Ets binding site sequence in the promoter of the epsilon-subunit gene is required for GETS-1-mediated repression. GETS-1 repressor activity is abrogated by overexpression of an activated Ras/mitogen-activated protein kinase (MAP kinase) or by mutation of Ser-405, a MAP kinase phosphorylation site in GETS-1. Fusion proteins created between GETS-1 and the Gal4 DNA-binding domain show that, like other TCFs, GETS-1 contains a C-terminal activation domain that is activated by a Ras/MAP kinase signalling cascade. Interestingly, mutation of Ser-405 located within this activation domain abrogated transcriptional activation of the fusion protein.

  8. Substitutions of PrP N-terminal histidine residues modulate scrapie disease pathogenesis and incubation time in transgenic mice

    PubMed Central

    Eigenbrod, Sabina; Frick, Petra; Bertsch, Uwe; Mitteregger-Kretzschmar, Gerda; Mielke, Janina; Maringer, Marko; Piening, Niklas; Hepp, Alexander; Daude, Nathalie; Windl, Otto; Levin, Johannes; Giese, Armin; Sakthivelu, Vignesh; Tatzelt, Jörg

    2017-01-01

    Prion diseases have been linked to impaired copper homeostasis and copper induced-oxidative damage to the brain. Divalent metal ions, such as Cu2+ and Zn2+, bind to cellular prion protein (PrPC) at octapeptide repeat (OR) and non-OR sites within the N-terminal half of the protein but information on the impact of such binding on conversion to the misfolded isoform often derives from studies using either OR and non-OR peptides or bacterially-expressed recombinant PrP. Here we created new transgenic mouse lines expressing PrP with disrupted copper binding sites within all four histidine-containing OR's (sites 1–4, H60G, H68G, H76G, H84G, "TetraH>G" allele) or at site 5 (composed of residues His-95 and His-110; "H95G" allele) and monitored the formation of misfolded PrP in vivo. Novel transgenic mice expressing PrP(TetraH>G) at levels comparable to wild-type (wt) controls were susceptible to mouse-adapted scrapie strain RML but showed significantly prolonged incubation times. In contrast, amino acid replacement at residue 95 accelerated disease progression in corresponding PrP(H95G) mice. Neuropathological lesions in terminally ill transgenic mice were similar to scrapie-infected wt controls, but less severe. The pattern of PrPSc deposition, however, was not synaptic as seen in wt animals, but instead dense globular plaque-like accumulations of PrPSc in TgPrP(TetraH>G) mice and diffuse PrPSc deposition in (TgPrP(H95G) mice), were observed throughout all brain sections. We conclude that OR and site 5 histidine substitutions have divergent phenotypic impacts and that cis interactions between the OR region and the site 5 region modulate pathogenic outcomes by affecting the PrP globular domain. PMID:29220360

  9. Synergistic Interactions of Sugars/Polyols and Monovalent Salts with Phospholipids Depend upon Sugar/Polyol Complexity and Anion Identity.

    PubMed

    Clark, Ginevra A; Henderson, J Michael; Heffern, Charles; Akgün, Bülent; Majewski, Jaroslaw; Lee, Ka Yee C

    2015-11-24

    We found that interactions of dipalmitoylphosphatidylcholine (DPPC) lipid monolayers with sugars are influenced by addition of NaCl. This work is of general importance in understanding how sugar-lipid-salt interactions impact biological systems. Using Langmuir isothermal compressions, fluorescence microscopy, atomic force microscopy, and neutron reflectometry, we examined DPPC monolayers upon addition of sugars/polyols and/or monovalent salts. Sugar-lipid interactions in the presence of NaCl increased with increasing complexity of the sugar/polyol in the order glycerol ≪ glucose < trehalose. When the anion was altered in the series NaF, NaCl, and NaBr, only minor differences were observed. When comparing LiCl, NaCl, and KCl, sodium chloride had the greatest influence on glucose and trehalose interactions with DPPC. We propose that heterogeneity created by cation binding allows for sugars to bind the lipid headgroups. While cation binding increases in the order K(+) < Na(+) < Li(+), lithium ions may also compete with glucose for binding sites. Thus, both cooperative and competitive factors contribute to the overall influence of salts on sugar-lipid interactions.

  10. An APOA5 3′ UTR Variant Associated with Plasma Triglycerides Triggers APOA5 Downregulation by Creating a Functional miR-485-5p Binding Site

    PubMed Central

    Caussy, Cyrielle; Charrière, Sybil; Marçais, Christophe; Di Filippo, Mathilde; Sassolas, Agnès; Delay, Mireille; Euthine, Vanessa; Jalabert, Audrey; Lefai, Etienne; Rome, Sophie; Moulin, Philippe

    2014-01-01

    APOA5 c.∗158C>T (rs2266788), located in the 3′ UTR, belongs to APOA5 haplotype 2 (APOA5∗2), which is strongly associated with plasma triglyceride levels and modulates the occurrence of both moderate and severe hypertriglyceridemia. Individuals with APOA5∗2 display reduced APOA5 expression at the posttranscriptional level. However, the functionality of this haplotype remains unclear. We hypothesized that the hypertriglyceridemic effects of APOA5∗2 could involve miRNA regulation in the APOA5 3′ UTR. Bioinformatic studies have identified the creation of a potential miRNA binding site for liver-expressed miR-485-5p (MIRN485-5p) in the mutant APOA5 3′ UTR with the c.∗158C allele. In human embryonic kidney 293T (HEK293T) cells cotransfected with an APOA5 3′ UTR luciferase reporter vector and a miR485-5p precursor, c.∗158C allele expression was significantly decreased. Moreover, in HuH-7 cells endogenously expressing miR-485-5p, we observed that luciferase activity was significantly lower in the presence of the c.∗158C allele than in the presence of the c.∗158T allele, which was completely reversed by a miR-485-5p inhibitor. We demonstrated that the rare c.∗158C APOA5 allele creates a functional target site for liver-expressed miR-485-5p. Therefore, we propose that the well-documented hypertriglyceridemic effect of APOA5∗2 involves an APOA5 posttranscriptional downregulation mediated by miR-485-5p. PMID:24387992

  11. Correlation between Heart-type Fatty Acid-binding Protein Gene Polymorphism and mRNA Expression with Intramuscular Fat in Baicheng-oil Chicken

    PubMed Central

    Wang, Yong; He, Jianzhong; Yang, Wenxuan; Muhantay, Gemenggul; Chen, Ying; Xing, Jinming; Liu, Jianzhu

    2015-01-01

    This study aims to determine the polymorphism and mRNA expression pattern of the heart-type fatty acid-binding protein (H-FABP) gene and their association with intramuscular fat (IMF) content in the breast and leg muscles of Baicheng oil chicken (BOC). A total of 720 chickens, including 240 black Baicheng oil chicken (BBOC), 240 silky Baicheng oil chicken (SBOC), and 240 white Baicheng oil chicken (WBOC) were raised. Three genotypes of H-FABP gene second extron following AA, AB, and BB were detected by polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) strategy. The G939A site created AA genotype and G956A site created BB genotype. The content of IMF in AA genotype in breast muscle of BBOC was significantly higher than that of AB (p = 0.0176) and the genotype in leg muscle of WBOC was significantly higher than that of AB (p = 0.0145). The G939A site could be taken as genetic marker for higher IMF content selecting for breast muscle of BBOC and leg muscle of WBOC. The relative mRNA expression of H-FABP was measured by real-time PCR at 30, 60, 90, and 120 d. The IMF content significantly increased with age in both muscles. The mRNA expression level of H-FABP significantly decreased with age in both muscles of the three types of chickens. Moreover, a significant negative correlation between H-FABP abundance and IMF content in the leg muscles of WBOC (p = 0.035) was observed. The mRNA expression of H-FABP negatively correlated with the IMF content in both breast and leg muscles of BOC sat slaughter time. PMID:26323394

  12. Platelet binding sites for factor VIII in relation to fibrin and phosphatidylserine

    PubMed Central

    Novakovic, Valerie A.; Shi, Jialan; Rasmussen, Jan; Pipe, Steven W.

    2015-01-01

    Thrombin-stimulated platelets expose very little phosphatidylserine (PS) but express binding sites for factor VIII (fVIII), casting doubt on the role of exposed PS as the determinant of binding sites. We previously reported that fVIII binding sites are increased three- to sixfold when soluble fibrin (SF) binds the αIIbβ3 integrin. This study focuses on the hypothesis that platelet-bound SF is the major source of fVIII binding sites. Less than 10% of fVIII was displaced from thrombin-stimulated platelets by lactadherin, a PS-binding protein, and an fVIII mutant defective in PS-dependent binding retained platelet affinity. Therefore, PS is not the determinant of most binding sites. FVIII bound immobilized SF and paralleled platelet binding in affinity, dependence on separation from von Willebrand factor, and mediation by the C2 domain. SF also enhanced activity of fVIII in the factor Xase complex by two- to fourfold. Monoclonal antibody (mAb) ESH8, against the fVIII C2 domain, inhibited binding of fVIII to SF and platelets but not to PS-containing vesicles. Similarly, mAb ESH4 against the C2 domain, inhibited >90% of platelet-dependent fVIII activity vs 35% of vesicle-supported activity. These results imply that platelet-bound SF is a component of functional fVIII binding sites. PMID:26162408

  13. Differences between high-affinity forskolin binding sites in dopamine-riche and other regions of rat brain

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Poat, J.A.; Cripps, H.E.; Iversen, L.L.

    1988-05-01

    Forskolin labelled with (/sup 3/H) bound to high- and low-affinity sites in the rat brain. The high-affinity site was discretely located, with highest densities in the striatum, nucleus accumbens, olfactory tubercule, substantia nigra, hippocampus, and the molecular layers of the cerebellum. This site did not correlate well with the distribution of adenylate cyclase. The high-affinity striatal binding site may be associated with a stimulatory guanine nucleotide-binding protein. Thus, the number of sites was increased by the addition of Mg/sup 2 +/ and guanylyl imidodiphosphate. Cholera toxin stereotaxically injected into rat striatum increased the number of binding sites, and no furthermore » increase was noted following the subsequent addition of guanyl nucleotide. High-affinity forskolin binding sites in non-dopamine-rich brain areas (hippocampus and cerebullum) were modulated in a qualitatively different manner by guanyl nucleotides. In these areas the number of binding sites was significantly reduced by the addition of guanyl nucleotide. These results suggest that forskolin may have a potential role in identifying different functional/structural guanine nucleotide-binding proteins.« less

  14. Drosophila Pumilio Protein Contains Multiple Autonomous Repression Domains That Regulate mRNAs Independently of Nanos and Brain Tumor

    PubMed Central

    Weidmann, Chase A.

    2012-01-01

    Drosophila melanogaster Pumilio is an RNA-binding protein that potently represses specific mRNAs. In developing embryos, Pumilio regulates a key morphogen, Hunchback, in collaboration with the cofactor Nanos. To investigate repression by Pumilio and Nanos, we created cell-based assays and found that Pumilio inhibits translation and enhances mRNA decay independent of Nanos. Nanos robustly stimulates repression through interactions with the Pumilio RNA-binding domain. We programmed Pumilio to recognize a new binding site, which garners repression of new target mRNAs. We show that cofactors Brain Tumor and eIF4E Homologous Protein are not obligatory for Pumilio and Nanos activity. The conserved RNA-binding domain of Pumilio was thought to be sufficient for its function. Instead, we demonstrate that three unique domains in the N terminus of Pumilio possess the major repressive activity and can function autonomously. The N termini of insect and vertebrate Pumilio and Fem-3 binding factors (PUFs) are related, and we show that corresponding regions of human PUM1 and PUM2 have repressive activity. Other PUF proteins lack these repression domains. Our findings suggest that PUF proteins have evolved new regulatory functions through protein sequences appended to their conserved PUF repeat RNA-binding domains. PMID:22064486

  15. Drosophila Pumilio protein contains multiple autonomous repression domains that regulate mRNAs independently of Nanos and brain tumor.

    PubMed

    Weidmann, Chase A; Goldstrohm, Aaron C

    2012-01-01

    Drosophila melanogaster Pumilio is an RNA-binding protein that potently represses specific mRNAs. In developing embryos, Pumilio regulates a key morphogen, Hunchback, in collaboration with the cofactor Nanos. To investigate repression by Pumilio and Nanos, we created cell-based assays and found that Pumilio inhibits translation and enhances mRNA decay independent of Nanos. Nanos robustly stimulates repression through interactions with the Pumilio RNA-binding domain. We programmed Pumilio to recognize a new binding site, which garners repression of new target mRNAs. We show that cofactors Brain Tumor and eIF4E Homologous Protein are not obligatory for Pumilio and Nanos activity. The conserved RNA-binding domain of Pumilio was thought to be sufficient for its function. Instead, we demonstrate that three unique domains in the N terminus of Pumilio possess the major repressive activity and can function autonomously. The N termini of insect and vertebrate Pumilio and Fem-3 binding factors (PUFs) are related, and we show that corresponding regions of human PUM1 and PUM2 have repressive activity. Other PUF proteins lack these repression domains. Our findings suggest that PUF proteins have evolved new regulatory functions through protein sequences appended to their conserved PUF repeat RNA-binding domains.

  16. Solubilization and characterization of haloperidol-sensitive (+)-( sup 3 H)SKF-10,047 binding sites (sigma sites) from rat liver membranes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    McCann, D.J.; Su, T.P.

    1991-05-01

    The zwitterionic detergent 3-((3-cholamidopropyl)dimethylamino)-1-propanesulfonate (CHAPS) produced optimal solubilization of (+)-({sup 3}H)SKF-10,047 binding sites from rat liver membranes at a concentration of 0.2%, well below the critical micellular concentration of the detergent. The pharmacological selectivity of the liver (+)-({sup 3}H)SKF-10,047 binding sites corresponds to that of sigma sites from rat and guinea pig brain. When the affinities of 18 different drugs at (+)-({sup 3}H)SKF-10,047 binding sites in membranes and solubilized preparations were compared, a correlation coefficient of 0.99 and a slope of 1.03 were obtained, indicating that the pharmacological selectivity of rat liver sigma sites is retained after solubilization. In addition,more » the binding of 20 nM ({sup 3}H)progesterone to solubilized rat liver preparations was found to exhibit a pharmacological selectivity appropriate for sigma sites. A stimulatory effect of phenytoin on (+)-({sup 3}H)SKF-10,047 binding to sigma sites persisted after solubilization. When the solubilized preparation was subjected to molecular sizing chromatography, a single peak exhibiting specific (+)-({sup 3}H)SKF-10,047 binding was obtained. The binding activity of this peak was stimulated symmetrically when assays were performed in the presence of 300 microM phenytoin. The molecular weight of the CHAPS-solubilized sigma site complex was estimated to be 450,000 daltons. After solubilization with CHAPS, rat liver sigma sites were enriched to 12 pmol/mg of protein. The present results demonstrate a successful solubilization of sigma sites from rat liver membranes and provide direct evidence that the gonadal steroid progesterone binds to sigma sites. The results also suggest that the anticonvulsant phenytoin binds to an associated allosteric site on the sigma site complex.« less

  17. An APOC3 3′UTR variant associated with plasma triglycerides levels and coronary heart disease by creating a functional miR-4271 binding site

    PubMed Central

    Hu, Sen-Lin; Cui, Guang-Lin; Huang, Jin; Jiang, Jian-Gang; Wang, Dao-Wen

    2016-01-01

    Apolipoprotein C-III (APOC3) is a key regulator of plasma triglycerides levels. Increasing evidence has shown that loss-of-function mutations in APOC3 is associated with reduction in plasma triglycerides levels and will confer a benefit in patients at high risk for cardiovascular disease. However, these favorable mutations were extremely distribution discrepant among different ethnics. In this study, the APOC3 gene was resequenced and we identified a common variant which located in the microRNA-binding site in APOC3 and would affect its expression and the risk of coronary heart disease (CHD). The molecular mechanism was explored. We found that the T allele of rs4225 suppressed APOC3 translation by facilitating miR-4271 binding, but not the G allele. Subjects carrying the GG genotype had higher plasma APOC3 levels (p for trend = 0.03) than those with the TT genotype. Furthermore, the T allele was significantly associated with decreased triglyceride levels [Beta (SE): −0.024 (0.020), P = 0.03]. Finally, the case-control study suggested that the TT genotype resulted in a significant reduction in overall CHD risk [OR, 0.89 (95% confidence interval, 0.77–0.98), P = 0.009]. In conclusion, our results provide evidence that the rs4225 in the 3′-UTR of APOC3 might contribute to the risk of CHD by interfering with miR-4271 binding. PMID:27624799

  18. An APOC3 3'UTR variant associated with plasma triglycerides levels and coronary heart disease by creating a functional miR-4271 binding site.

    PubMed

    Hu, Sen-Lin; Cui, Guang-Lin; Huang, Jin; Jiang, Jian-Gang; Wang, Dao-Wen

    2016-09-14

    Apolipoprotein C-III (APOC3) is a key regulator of plasma triglycerides levels. Increasing evidence has shown that loss-of-function mutations in APOC3 is associated with reduction in plasma triglycerides levels and will confer a benefit in patients at high risk for cardiovascular disease. However, these favorable mutations were extremely distribution discrepant among different ethnics. In this study, the APOC3 gene was resequenced and we identified a common variant which located in the microRNA-binding site in APOC3 and would affect its expression and the risk of coronary heart disease (CHD). The molecular mechanism was explored. We found that the T allele of rs4225 suppressed APOC3 translation by facilitating miR-4271 binding, but not the G allele. Subjects carrying the GG genotype had higher plasma APOC3 levels (p for trend = 0.03) than those with the TT genotype. Furthermore, the T allele was significantly associated with decreased triglyceride levels [Beta (SE): -0.024 (0.020), P = 0.03]. Finally, the case-control study suggested that the TT genotype resulted in a significant reduction in overall CHD risk [OR, 0.89 (95% confidence interval, 0.77-0.98), P = 0.009]. In conclusion, our results provide evidence that the rs4225 in the 3'-UTR of APOC3 might contribute to the risk of CHD by interfering with miR-4271 binding.

  19. Interaction of Human Serum Albumin with Metal Protoporphyrins

    NASA Astrophysics Data System (ADS)

    Hu, Jie; Brancaleon, Lorenzo

    2015-03-01

    Fluorescence spectroscopy is widely used in biotechnology, nanotechnology, and molecular biophysics, since it can provide information on a wide range of molecular processes, e.g. the interactions of solvent molecules with fluorophores, conformational changes, and binding interactions etc. In this study, we present the photophysical properties of the interaction of human serum albumin (HSA) with a series of metal compound of Protoporphyrin IX (PPIX), including ZnPPIX, FePPIX, MgPPIX, MnPPIX and SnPPIX respectively, as well as the free base PPIX. Binding constants were retrieved independently using the Benesi-Hildebrand analysis of the porphyrin emission or absorption spectra and the fluorescence quenching (i.e. Stern-Volmer analysis) and reveal that the two methods yield a difference of approximately one order or magnitude between the two. Fluorescence lifetimes was used to probe whether binding of the porphyrin changes the conformation of the protein or if the interaction places the porphyrin at a location that can prompt resonance energy transfer with the lone Tryptophan residue. In recent years it has been discovered that HSA provides a specific binding site for metal-chelated protoporphyrins in subdomain IA. This has opened a novel field of study over the importance of this site for biomedical applications but it has also created the potential for a series of biotechnological applications of the HSA/protoporphyrin complexes. Our study provides a preliminary investigation of the interaction with metal-chelated protoporphyrins that had not been previously investigated.

  20. Comparison of (/sup 3/H)pirenzepine and (/sup 3/H)quinuclidinylbenzilate binding to muscarinic cholinergic receptors in rat brain

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Luthin, G.R.; Wolfe, B.B.

    The properties of (/sup 3/H)quinuclidinylbenzilate ( (/sup 3/H)QNB) binding and (/sup 3/H)pirenzepine ( (/sup 3/H)PZ) binding to various regions of rat brain were compared. (/sup 3/H)PZ appeared to bind with high affinity to a single site, with a Kd value of approximately 15 nM in the cerebral cortex. The rank order of potencies of muscarinic drugs to inhibit binding of either (/sup 3/H)QNB or (/sup 3/H)PZ was QNB greater than atropine . scopolamine greater than pirenzepine greater than oxotremorine greater than bethanechol. Muscarinic antagonists (except PZ) inhibited both (/sup 3/H)PZ and (/sup 3/H)QNB binding with Hill coefficients of approximately 1.more » PZ inhibited (/sup 3/H)QNB binding in cortex with a Hill coefficient of 0.7, but inhibited (/sup 3/H)PZ binding with a Hill coefficient of 1.0. Hill coefficients for agonists were less than 1. The density of (/sup 3/H)PZ binding sites was approximately half the density of (/sup 3/H)QNB binding sites in cortex, striatum and hippocampus. In pons-medulla and cerebellum, the densities of (/sup 3/H)PZ binding sites were 20 and 0%, respectively, relative to the densities of (/sup 3/H)QNB binding sites. When unlabeled PZ was used to compete for (/sup 3/H)QNB binding, the relative number of high-affinity PZ binding sites in cortex, pons and cerebellum agreed with the relative number of (/sup 3/H)PZ binding sites in those regions. The binding of (/sup 3/H)PZ and (/sup 3/H)QNB was nonadditive in cortex. GTP inhibited high-affinity oxotremorine binding, but not PZ binding. Together, these data suggest that (/sup 3/H)PZ binds to a subset of (/sup 3/H)QNB binding sites. Whether this subset reflects the existence of subtypes of muscarinic receptors or is a consequence of coupling to another membrane protein remains to be seen.« less

  1. Direct association of Csk homologous kinase (CHK) with the diphosphorylated site Tyr568/570 of the activated c-KIT in megakaryocytes.

    PubMed

    Price, D J; Rivnay, B; Fu, Y; Jiang, S; Avraham, S; Avraham, H

    1997-02-28

    The Csk homologous kinase (CHK), formerly MATK, has previously been shown to bind to activated c-KIT. In this report, we characterize the binding of SH2(CHK) to specific phosphotyrosine sites on the c-KIT protein sequence. Phosphopeptide inhibition of the in vitro interaction of SH2(CHK)-glutathione S-transferase fusion protein/c-KIT from SCF/KL-treated Mo7e megakaryocytic cells indicated that two sites on c-KIT were able to bind SH2(CHK). These sites were the Tyr568/570 diphosphorylated sequence and the monophosphorylated Tyr721 sequence. To confirm this, we precipitated native CHK from cellular extracts using phosphorylated peptides linked to Affi-Gel 15. In addition, purified SH2(CHK)-glutathione S-transferase fusion protein was precipitated with the same peptide beads. All of the peptide bead-binding studies were consistent with the direct binding of SH2(CHK) to phosphorylated Tyr568/570 and Tyr721 sites. Binding of FYN and SHC to the diphosphorylated Tyr568/570 site was observed, while binding of Csk to this site was not observed. The SH2(CHK) binding to the two sites is direct and not through phosphorylated intermediates such as FYN or SHC. Site-directed mutagenesis of the full-length c-KIT cDNA followed by transient transfection indicated that only the Tyr568/570, and not the Tyr721, is able to bind SH2(CHK). This indicates that CHK binds to the same site on c-KIT to which FYN binds, possibly bringing the two into proximity on associated c-KIT subunits and leading to the down-regulation of FYN by CHK.

  2. The spacing between adjacent binding sites in the family of repeats affects the functions of Epstein-Barr nuclear antigen 1 in transcription activation and stable plasmid maintenance.

    PubMed

    Hebner, Christy; Lasanen, Julie; Battle, Scott; Aiyar, Ashok

    2003-07-05

    Epstein-Barr virus (EBV) and the closely related Herpesvirus papio (HVP) are stably replicated as episomes in proliferating latently infected cells. Maintenance and partitioning of these viral plasmids requires a viral sequence in cis, termed the family of repeats (FR), that is bound by a viral protein, Epstein-Barr nuclear antigen 1 (EBNA1). Upon binding FR, EBNA1 maintains viral genomes in proliferating cells and activates transcription from viral promoters required for immortalization. FR from either virus encodes multiple binding sites for the viral maintenance protein, EBNA1, with the FR from the prototypic B95-8 strain of EBV containing 20 binding sites, and FR from HVP containing 8 binding sites. In addition to differences in the number of EBNA1-binding sites, adjacent binding sites in the EBV FR are typically separated by 14 base pairs (bp), but are separated by 10 bp in HVP. We tested whether the number of binding sites, as well as the distance between adjacent binding sites, affects the function of EBNA1 in transcription activation or plasmid maintenance. Our results indicate that EBNA1 activates transcription more efficiently when adjacent binding sites are separated by 10 bp, the spacing observed in HVP. In contrast, using two separate assays, we demonstrate that plasmid maintenance is greatly augmented when adjacent EBNA1-binding sites are separated by 14 bp, and therefore, presumably lie on the same face of the DNA double helix. These results provide indication that the functions of EBNA1 in transcription activation and plasmid maintenance are separable.

  3. Existence of three subtypes of bradykinin B2 receptors in guinea pig.

    PubMed

    Seguin, L; Widdowson, P S; Giesen-Crouse, E

    1992-12-01

    We describe the binding of [3H]bradykinin to homogenates of guinea pig brain, lung, and ileum. Analysis of [3H]bradykinin binding kinetics in guinea pig brain, lung, and ileum suggests the existence of two binding sites in each tissue. The finding of two binding sites for [3H]bradykinin in ileum, lung, and brain was further supported by Scatchard analysis of equilibrium binding in each tissue. [3H]Bradykinin binds to a high-affinity site in brain, lung, and ileum (KD = 70-200 pM), which constitutes approximately 20% of the bradykinin binding, and to a second, lower-affinity site (0.63-0.95 nM), which constitutes the remaining 80% of binding. Displacement studies with various bradykinin analogues led us to subdivide the high- and lower-affinity sites in each tissue and to suggest the existence of three subtypes of B2 receptors in the guinea pig, which we classify as B2a, B2b, and B2c. Binding of [3H]bradykinin is largely to a B2b receptor subtype, which constitutes the majority of binding in brain, lung, and ileum and represents the lower-affinity site in our binding studies. Receptor subtype B2c constitutes approximately 20% of binding sites in the brain and lung and is equivalent to the high-affinity site in brain and lung. We suggest that a third subtype of B2 receptor (high-affinity site in ileum), B2a, is found only in the ileum. All three subtypes of B2 receptors display a high affinity for bradykinin, whereas they show different affinities for various bradykinin analogues displaying agonist or antagonist activities.(ABSTRACT TRUNCATED AT 250 WORDS)

  4. Involvement of two classes of binding sites in the interactions of cyclophilin B with peripheral blood T-lymphocytes.

    PubMed

    Denys, A; Allain, F; Carpentier, M; Spik, G

    1998-12-15

    Cyclophilin B (CyPB) is a cyclosporin A (CsA)-binding protein, mainly associated with the secretory pathway, and is released in biological fluids. We recently reported that CyPB specifically binds to T-lymphocytes and promotes enhanced incorporation of CsA. The interactions with cellular binding sites involved, at least in part, the specific N-terminal extension of the protein. In this study, we intended to specify further the nature of the CyPB-binding sites on peripheral blood T-lymphocytes. We first provide evidence that the CyPB binding to heparin-Sepharose is prevented by soluble sulphated glycosaminoglycans (GAG), raising the interesting possibility that such interactions may occur on the T-cell surface. We then characterized CyPB binding to T-cell surface GAG and found that these interactions involved the N-terminal extension of CyPB, but not its conserved CsA-binding domain. In addition, we determined the presence of a second CyPB binding site, which we termed a type I site, in contrast with type II for GAG interactions. The two binding sites exhibit a similar affinity but the expression of the type I site was 3-fold lower. The conclusion that CyPB binding to the type I site is distinct from the interactions with GAG was based on the findings that it was (1) resistant to NaCl wash and GAG-degrading enzyme treatments, (2) reduced in the presence of CsA or cyclophilin C, and (3) unmodified in the presence of either the N-terminal peptide of CyPB or protamine. Finally, we showed that the type I binding sites were involved in an endocytosis process, supporting the hypothesis that they may correspond to a functional receptor for CyPB.

  5. Down-regulation of tryptamine binding sites following chronic molindone administration. A comparison with responses of dopamine and 5-hydroxytryptamine receptors.

    PubMed

    Nguyen, T V; Juorio, A V

    1989-10-01

    The present study assessed changes of tryptamine, dopamine D2, 5-HT1 and 5-HT2 binding sites in rat brain following chronic treatment with low (5 mg/kg/day) and high (40 mg/kg/day) doses of molindone, a clinically effective psychotropic drug. The high-dose molindone treatment produced a decrease in the number of tryptamine binding sites while both high and low doses caused an increase in the number of dopamine D2 binding sites in the striatum. No significant changes were observed in either 5-HT1 or 5-HT2 binding sites in the cerebral cortex. Competition binding experiments showed that molindone was a potent inhibitor at dopamine D2 but less effective at tryptamine, 5-HT1 and 5-HT2 binding sites. The inhibition activity of molindone towards type A monoamine oxidase produced a significant increase in endogenous tryptamine accumulation rate which was much higher than that of dopamine and 5-HT. These findings suggest that the reduction in the number of tryptamine binding sites produced by chronic molindone administration is related to monoamine oxidase inhibition and that the increase in the number of dopamine D2 binding sites is correlated to receptor blocking activity of the drug.

  6. Impact of germline and somatic missense variations on drug binding sites.

    PubMed

    Yan, C; Pattabiraman, N; Goecks, J; Lam, P; Nayak, A; Pan, Y; Torcivia-Rodriguez, J; Voskanian, A; Wan, Q; Mazumder, R

    2017-03-01

    Advancements in next-generation sequencing (NGS) technologies are generating a vast amount of data. This exacerbates the current challenge of translating NGS data into actionable clinical interpretations. We have comprehensively combined germline and somatic nonsynonymous single-nucleotide variations (nsSNVs) that affect drug binding sites in order to investigate their prevalence. The integrated data thus generated in conjunction with exome or whole-genome sequencing can be used to identify patients who may not respond to a specific drug because of alterations in drug binding efficacy due to nsSNVs in the target protein's gene. To identify the nsSNVs that may affect drug binding, protein-drug complex structures were retrieved from Protein Data Bank (PDB) followed by identification of amino acids in the protein-drug binding sites using an occluded surface method. Then, the germline and somatic mutations were mapped to these amino acids to identify which of these alter protein-drug binding sites. Using this method we identified 12 993 amino acid-drug binding sites across 253 unique proteins bound to 235 unique drugs. The integration of amino acid-drug binding sites data with both germline and somatic nsSNVs data sets revealed 3133 nsSNVs affecting amino acid-drug binding sites. In addition, a comprehensive drug target discovery was conducted based on protein structure similarity and conservation of amino acid-drug binding sites. Using this method, 81 paralogs were identified that could serve as alternative drug targets. In addition, non-human mammalian proteins bound to drugs were used to identify 142 homologs in humans that can potentially bind to drugs. In the current protein-drug pairs that contain somatic mutations within their binding site, we identified 85 proteins with significant differential gene expression changes associated with specific cancer types. Information on protein-drug binding predicted drug target proteins and prevalence of both somatic and germline nsSNVs that disrupt these binding sites can provide valuable knowledge for personalized medicine treatment. A web portal is available where nsSNVs from individual patient can be checked by scanning against DrugVar to determine whether any of the SNVs affect the binding of any drug in the database.

  7. Patterns and plasticity in RNA-protein interactions enable recruitment of multiple proteins through a single site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Valley, Cary T.; Porter, Douglas F.; Qiu, Chen

    2012-06-28

    mRNA control hinges on the specificity and affinity of proteins for their RNA binding sites. Regulatory proteins must bind their own sites and reject even closely related noncognate sites. In the PUF [Pumilio and fem-3 binding factor (FBF)] family of RNA binding proteins, individual proteins discriminate differences in the length and sequence of binding sites, allowing each PUF to bind a distinct battery of mRNAs. Here, we show that despite these differences, the pattern of RNA interactions is conserved among PUF proteins: the two ends of the PUF protein make critical contacts with the two ends of the RNA sites.more » Despite this conserved 'two-handed' pattern of recognition, the RNA sequence is flexible. Among the binding sites of yeast Puf4p, RNA sequence dictates the pattern in which RNA bases are flipped away from the binding surface of the protein. Small differences in RNA sequence allow new modes of control, recruiting Puf5p in addition to Puf4p to a single site. This embedded information adds a new layer of biological meaning to the connections between RNA targets and PUF proteins.« less

  8. Thermodynamic compensation upon binding to exosite 1 and the active site of thrombin.

    PubMed

    Treuheit, Nicholas A; Beach, Muneera A; Komives, Elizabeth A

    2011-05-31

    Several lines of experimental evidence including amide exchange and NMR suggest that ligands binding to thrombin cause reduced backbone dynamics. Binding of the covalent inhibitor dPhe-Pro-Arg chloromethyl ketone to the active site serine, as well as noncovalent binding of a fragment of the regulatory protein, thrombomodulin, to exosite 1 on the back side of the thrombin molecule both cause reduced dynamics. However, the reduced dynamics do not appear to be accompanied by significant conformational changes. In addition, binding of ligands to the active site does not change the affinity of thrombomodulin fragments binding to exosite 1; however, the thermodynamic coupling between exosite 1 and the active site has not been fully explored. We present isothermal titration calorimetry experiments that probe changes in enthalpy and entropy upon formation of binary ligand complexes. The approach relies on stringent thrombin preparation methods and on the use of dansyl-l-arginine-(3-methyl-1,5-pantanediyl)amide and a DNA aptamer as ligands with ideal thermodynamic signatures for binding to the active site and to exosite 1. Using this approach, the binding thermodynamic signatures of each ligand alone as well as the binding signatures of each ligand when the other binding site was occupied were measured. Different exosite 1 ligands with widely varied thermodynamic signatures cause a similar reduction in ΔH and a concomitantly lower entropy cost upon DAPA binding at the active site. The results suggest a general phenomenon of enthalpy-entropy compensation consistent with reduction of dynamics/increased folding of thrombin upon ligand binding to either the active site or exosite 1.

  9. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dissanayake, V.U.; Hughes, J.; Hunter, J.C.

    The specific binding of the selective {mu}-, {delta}-, and {kappa}-opioid ligands (3H)(D-Ala2,MePhe4,Gly-ol5)enkephalin ((3H) DAGOL), (3H)(D-Pen2,D-Pen5)enkephalin ((3H)DPDPE), and (3H)U69593, respectively, to crude membranes of the guinea pig and rat whole kidney, kidney cortex, and kidney medulla was investigated. In addition, the distribution of specific 3H-opioid binding sites in the guinea pig and rat kidney was visualized by autoradiography. Homogenate binding and autoradiography demonstrated the absence of {mu}- and {kappa}-opioid binding sites in the guinea pig kidney. No opioid binding sites were demonstrable in the rat kidney. In the guinea pig whole kidney, cortex, and medulla, saturation studies demonstrated that (3H)DPDPE boundmore » with high affinity (KD = 2.6-3.5 nM) to an apparently homogeneous population of binding sites (Bmax = 8.4-30 fmol/mg of protein). Competition studies using several opioid compounds confirmed the nature of the {delta}-opioid binding site. Autoradiography experiments demonstrated that specific (3H)DPDPE binding sites were distributed radially in regions of the inner and outer medulla and at the corticomedullary junction of the guinea pig kidney. Computer-assisted image analysis of saturation data yielded KD values (4.5-5.0 nM) that were in good agreement with those obtained from the homogenate binding studies. Further investigation of the {delta}-opioid binding site in medulla homogenates, using agonist ((3H)DPDPE) and antagonist ((3H)diprenorphine) binding in the presence of Na+, Mg2+, and nucleotides, suggested that the {delta}-opioid site is linked to a second messenger system via a GTP-binding protein. Further studies are required to establish the precise localization of the {delta} binding site in the guinea pig kidney and to determine the nature of the second messenger linked to the GTP-binding protein in the medulla.« less

  10. Evaluation of simultaneous binding of Chromomycin A3 to the multiple sites of DNA by the new restriction enzyme assay.

    PubMed

    Murase, Hirotaka; Noguchi, Tomoharu; Sasaki, Shigeki

    2018-06-01

    Chromomycin A3 (CMA3) is an aureolic acid-type antitumor antibiotic. CMA3 forms dimeric complexes with divalent cations, such as Mg 2+ , which strongly binds to the GC rich sequence of DNA to inhibit DNA replication and transcription. In this study, the binding property of CMA3 to the DNA sequence containing multiple GC-rich binding sites was investigated by measuring the protection from hydrolysis by the restriction enzymes, AccII and Fnu4HI, for the center of the CGCG site and the 5'-GC↓GGC site, respectively. In contrast to the standard DNase I footprinting method, the DNA substrates are fully hydrolyzed by the restriction enzymes, therefore, the full protection of DNA at all the cleavable sites indicates that CMA3 simultaneously binds to all the binding sites. The restriction enzyme assay has suggested that CMA3 has a high tendency to bind the successive CGCG sites and the CGG repeat. Copyright © 2018 Elsevier Ltd. All rights reserved.

  11. Distinct p53 genomic binding patterns in normal and cancer-derived human cells

    PubMed Central

    McCorkle, Sean R; McCombie, WR; Dunn, John J

    2011-01-01

    Here, we report genome-wide analysis of the tumor suppressor p53 binding sites in normal human cells. 743 high-confidence ChIP-seq peaks representing putative genomic binding sites were identified in normal IMR90 fibroblasts using a reference chromatin sample. More than 40% were located within 2 kb of a transcription start site (TSS), a distribution similar to that documented for individually studied, functional p53 binding sites and, to date, not observed by previous p53 genome-wide studies. Nearly half of the high-confidence binding sites in the IMR90 cells reside in CpG islands in marked contrast to sites reported in cancer-derived cells. The distinct genomic features of the IMR90 binding sites do not reflect a distinct preference for specific sequences, since the de novo developed p53 motif based on our study is similar to those reported by genome-wide studies of cancer cells. More likely, the different chromatin landscape in normal, compared with cancer-derived cells, influences p53 binding via modulating availability of the sites. We compared the IMR90 ChIP-seq peaks to the recently published IMR90 methylome1 and demonstrated that they are enriched at hypomethylated DNA. Our study represents the first genome-wide, de novo mapping of p53 binding sites in normal human cells and reveals that p53 binding sites reside in distinct genomic landscapes in normal and cancer-derived human cells. PMID:22127205

  12. Ethylene binding site affinity in ripening apples

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Blankenship, S.M.; Sisler, E.C.

    1993-09-01

    Scatchard plots for ethylene binding in apples (Malus domestica Borkh.), which were harvested weekly for 5 weeks to include the ethylene climacteric rise, showed C[sub 50] values (concentration of ethylene needed to occupy 50% of the ethylene binding sites) of 0.10, 0.11, 0.34, 0.40, and 0.57 [mu]l ethylene/liter[sup [minus]1], respectively, for each of the 5 weeks. Higher ethylene concentrations were required to saturate the binding sites during the climacteric rise than at other times. Diffusion of [sup 14]C-ethylene from the binding sites was curvilinear and did not show any indication of multiple binding sites. Ethylene was not metabolized by applemore » tissue.« less

  13. Physical interaction of the activator protein-1 factors c-Fos and c-Jun with Cbfa1 for collagenase-3 promoter activation

    NASA Technical Reports Server (NTRS)

    D'Alonzo, Richard C.; Selvamurugan, Nagarajan; Karsenty, Gerard; Partridge, Nicola C.

    2002-01-01

    Previously, we determined that the activator protein-1 (AP-1)-binding site and the runt domain (RD)-binding site and their binding proteins, c-Fos.c-Jun and Cbfa, regulate the collagenase-3 promoter in parathyroid hormone-treated and differentiating osteoblasts. Here we show that Cbfa1 and c-Fos.c-Jun appear to cooperatively bind the RD- and AP-1-binding sites and form ternary structures in vitro. Both in vitro and in vivo co-immunoprecipitation and yeast two-hybrid studies further demonstrate interaction between Cbfa1 with c-Fos and c-Jun in the absence of phosphorylation and without binding to DNA. Additionally, only the runt domain of Cbfa1 was required for interaction with c-Jun and c-Fos. In mammalian cells, overexpression of Cbfa1 enhanced c-Jun activation of AP-1-binding site promoter activity, demonstrating functional interaction. Finally, insertion of base pairs that disrupted the helical phasing between the AP-1- and RD-binding sites also inhibited collagenase-3 promoter activation. Thus, we provide direct evidence that Cbfa1 and c-Fos.c-Jun physically interact and cooperatively bind the AP-1- and RD-binding sites in the collagenase-3 promoter. Moreover, the AP-1- and RD-binding sites appear to be organized in a specific required helical arrangement that facilitates transcription factor interaction and enables promoter activation.

  14. Functional identification and characterization of sodium binding sites in Na symporters

    PubMed Central

    Loo, Donald D. F.; Jiang, Xuan; Gorraitz, Edurne; Hirayama, Bruce A.; Wright, Ernest M.

    2013-01-01

    Sodium cotransporters from several different gene families belong to the leucine transporter (LeuT) structural family. Although the identification of Na+ in binding sites is beyond the resolution of the structures, two Na+ binding sites (Na1 and Na2) have been proposed in LeuT. Na2 is conserved in the LeuT family but Na1 is not. A biophysical method has been used to measure sodium dissociation constants (Kd) of wild-type and mutant human sodium glucose cotransport (hSGLT1) proteins to identify the Na+ binding sites in hSGLT1. The Na1 site is formed by residues in the sugar binding pocket, and their mutation influences sodium binding to Na1 but not to Na2. For the canonical Na2 site formed by two –OH side chains, S392 and S393, and three backbone carbonyls, mutation of S392 to cysteine increased the sodium Kd by sixfold. This was accompanied by a dramatic reduction in the apparent sugar and phlorizin affinities. We suggest that mutation of S392 in the Na2 site produces a structural rearrangement of the sugar binding pocket to disrupt both the binding of the second Na+ and the binding of sugar. In contrast, the S393 mutations produce no significant changes in sodium, sugar, and phlorizin affinities. We conclude that the Na2 site is conserved in hSGLT1, the side chain of S392 and the backbone carbonyl of S393 are important in the first Na+ binding, and that Na+ binding to Na2 promotes binding to Na1 and also sugar binding. PMID:24191006

  15. Inactivation by Phenylglyoxal of the Specific Binding of 1-Naphthyl Acetic Acid with Membrane-Bound Auxin Binding Sites from Maize Coleoptiles

    PubMed Central

    Navé, Jean-François; Benveniste, Pierre

    1984-01-01

    The specific binding of 1-[3H]naphthyl acetic acid (NAA) to membrane-bound binding sites from maize (Zea mays cv INRA 258) coleoptiles is inactivated by phenylglyoxal. The inactivation obeys pseudo first-order kinetics. The rate of inactivation is proportional to phenylglyoxal concentration. Under conditions at which significant binding occurs, NAA, R and S-1-naphthyl 2-propionic acids protect the auxin binding site against inactivation by phenylglyoxal. Scatchard analysis shows that the inhibition of binding corresponds to a decrease in the concentration of sites but not in the affinity. The results of the present chemical modification study indicate that at least one arginyl residue is involved in the positively charged recognition site of the carboxylate anion of NAA. PMID:16663499

  16. Clostridium botulinum C2 toxin. Identification of the binding site for chloroquine and related compounds and influence of the binding site on properties of the C2II channel.

    PubMed

    Neumeyer, Tobias; Schiffler, Bettina; Maier, Elke; Lang, Alexander E; Aktories, Klaus; Benz, Roland

    2008-02-15

    Clostridium botulinum C2 toxin belongs to the family of binary AB type toxins that are structurally organized into distinct enzyme (A, C2I) and binding (B, C2II) components. The proteolytically activated 60-kDa C2II binding component is essential for C2I transport into target cells. It oligomerizes into heptamers and forms channels in lipid bilayer membranes. The C2II channel is cation-selective and can be blocked by chloroquine and related compounds. Residues 303-330 of C2II contain a conserved pattern of alternating hydrophobic and hydrophilic residues, which has been implicated in the formation of two amphipathic beta-strands involved in membrane insertion and channel formation. In the present study, C2II mutants created by substitution of different negatively charged amino acids by alanine-scanning mutagenesis were analyzed in artificial lipid bilayer membranes. The results suggested that most of the C2II mutants formed SDS-resistant oligomers (heptamers) similar to wild type. The mutated negatively charged amino acids did not influence channel properties with the exception of Glu(399) and Asp(426), which are probably localized in the vestibule near the channel entrance. These mutants show a dramatic decrease in their affinity for binding of chloroquine and its analogues. Similarly, F428A, which represents the Phi-clamp in anthrax protective antigen, was mutated in C2II in several other amino acids. The C2II mutants F428A, F428D, F428Y, and F428W not only showed altered chloroquine binding but also had drastically changed single channel properties. The results suggest that amino acids Glu(399), Asp(426), and Phe(428) have a major impact on the function of C2II as a binding protein for C2I delivery into target cells.

  17. Molecular blueprint of allosteric binding sites in a homologue of the agonist-binding domain of the α7 nicotinic acetylcholine receptor

    PubMed Central

    Spurny, Radovan; Debaveye, Sarah; Farinha, Ana; Veys, Ken; Vos, Ann M.; Gossas, Thomas; Atack, John; Bertrand, Sonia; Bertrand, Daniel; Danielson, U. Helena; Tresadern, Gary; Ulens, Chris

    2015-01-01

    The α7 nicotinic acetylcholine receptor (nAChR) belongs to the family of pentameric ligand-gated ion channels and is involved in fast synaptic signaling. In this study, we take advantage of a recently identified chimera of the extracellular domain of the native α7 nicotinic acetylcholine receptor and acetylcholine binding protein, termed α7-AChBP. This chimeric receptor was used to conduct an innovative fragment-library screening in combination with X-ray crystallography to identify allosteric binding sites. One allosteric site is surface-exposed and is located near the N-terminal α-helix of the extracellular domain. Ligand binding at this site causes a conformational change of the α-helix as the fragment wedges between the α-helix and a loop homologous to the main immunogenic region of the muscle α1 subunit. A second site is located in the vestibule of the receptor, in a preexisting intrasubunit pocket opposite the agonist binding site and corresponds to a previously identified site involved in positive allosteric modulation of the bacterial homolog ELIC. A third site is located at a pocket right below the agonist binding site. Using electrophysiological recordings on the human α7 nAChR we demonstrate that the identified fragments, which bind at these sites, can modulate receptor activation. This work presents a structural framework for different allosteric binding sites in the α7 nAChR and paves the way for future development of novel allosteric modulators with therapeutic potential. PMID:25918415

  18. Muscarinic binding sites in cultured bovine pulmonary arterial endothelial cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Aronstam, R.S.; Catravas, J.D.; Ryan, U.S.

    The authors have previously reported a) the presence of muscarinic binding sites on cultured bovine pulmonary arterial endothelial cells (BPAE; 2,000 sites/cell) and b) that acetylcholine inhibits the release of thromboxane B/sub 2/ fro BPAE. Since the authors findings could reflect muscarinic receptors (mAChR) on BPAE, they have further investigated the nature of BPAE muscarinic binding sites and contrast them to those of known functional mAChR. Muscarinic binding sites on BPAE resembled mAChR in that a) the binding of 3 nM /sup 3/H QNB was inhibited by muscarinic agonists and antagonists; b) /sup 3/H QNB binding was 30 times moremore » sensitive to R(-)- than to S(+)-QNB; c) carbamylcholine binding was resolved into high and low affinity components (IC50's = 0.04 and 2 ..mu..M; d) 5'-guanylylimidodiphosphate (100 ..mu..M) shifted agonist binding curves to the right by a factor of 3; 4) the atropine-sensitive binding of /sup 3/H oxotremorine-M (/sup 3/H-OXO-M) was depressed by the guanine nucleotide (IC50 + 60 ..mu..M). However, although gallamine allosterically regulates mAChR binding in other tissues, it did not affect the rates of dissociation of /sup 3/H QNB, /sup 3/H methylscopolamine or /sup 3/H OXO-M from BPAE binding sites. Thus, BPAE muscarinic binding sites posses many but not all of the properties associated with functional mAChR.« less

  19. Autoradiographic localization of endothelin-1 binding sites in porcine skin

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhao, Y.D.; Springall, D.R.; Wharton, J.

    Autoradiographic techniques and {sup 125}I-labeled endothelin-1 were used to study the distribution of endothelin-1 binding sites in porcine skin. Specific endothelin-1 binding sites were localized to blood vessels (capillaries, deep cutaneous vascular plexus, arteries, and arterioles), the deep dermal and connective tissue sheath of hair follicles, sebaceous and sweat glands, and arrector pili muscle. Specific binding was inhibited by endothelin-2 and endothelin-3 as well as endothelin-1. Non-specific binding was found in the epidermis and the medulla of hair follicles. No binding was found in connective tissue or fat. These vascular binding sites may represent endothelin receptors, in keeping with themore » known cutaneous vasoconstrictor actions of the peptide. If all binding sites are receptors, the results suggest that endothelin could also regulate the function of sweat glands and may have trophic effects in the skin.« less

  20. Activation of both acfA and acfD transcription by Vibrio cholerae ToxT requires binding to two centrally located DNA sites in an inverted repeat conformation.

    PubMed

    Withey, Jeffrey H; DiRita, Victor J

    2005-05-01

    The Gram-negative bacterium Vibrio cholerae is the infectious agent responsible for the disease Asiatic cholera. The genes required for V. cholerae virulence, such as those encoding the cholera toxin (CT) and toxin-coregulated pilus (TCP), are controlled by a cascade of transcriptional activators. Ultimately, the direct transcriptional activator of the majority of V. cholerae virulence genes is the AraC/XylS family member ToxT protein, the expression of which is activated by the ToxR and TcpP proteins. Previous studies have identified the DNA sites to which ToxT binds upstream of the ctx operon, encoding CT, and the tcpA operon, encoding, among other products, the major subunit of the TCP. These known ToxT binding sites are seemingly dissimilar in sequence other than being A/T rich. Further results suggested that ctx and tcpA each has a pair of ToxT binding sites arranged in a direct repeat orientation upstream of the core promoter elements. In this work, using both transcriptional lacZ fusions and in vitro copper-phenanthroline footprinting experiments, we have identified the ToxT binding sites between the divergently transcribed acfA and acfD genes, which encode components of the accessory colonization factor required for efficient intestinal colonization by V. cholerae. Our results indicate that ToxT binds to a pair of DNA sites between acfA and acfD in an inverted repeat orientation. Moreover, a mutational analysis of the ToxT binding sites indicates that both binding sites are required by ToxT for transcriptional activation of both acfA and acfD. Using copper-phenanthroline footprinting to assess the occupancy of ToxT on DNA having mutations in one of these binding sites, we found that protection by ToxT of the unaltered binding site was not affected, whereas protection by ToxT of the mutant binding site was significantly reduced in the region of the mutations. The results of further footprinting experiments using DNA templates having +5 bp and +10 bp insertions between the two ToxT binding sites indicate that both binding sites are occupied by ToxT regardless of their positions relative to each other. Based on these results, we propose that ToxT binds independently to two DNA sites between acfA and acfD to activate transcription of both genes.

  1. MONKEY: Identifying conserved transcription-factor binding sitesin multiple alignments using a binding site-specific evolutionarymodel

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Moses, Alan M.; Chiang, Derek Y.; Pollard, Daniel A.

    2004-10-28

    We introduce a method (MONKEY) to identify conserved transcription-factor binding sites in multispecies alignments. MONKEY employs probabilistic models of factor specificity and binding site evolution, on which basis we compute the likelihood that putative sites are conserved and assign statistical significance to each hit. Using genomes from the genus Saccharomyces, we illustrate how the significance of real sites increases with evolutionary distance and explore the relationship between conservation and function.

  2. In silico evolution of the Drosophila gap gene regulatory sequence under elevated mutational pressure.

    PubMed

    Chertkova, Aleksandra A; Schiffman, Joshua S; Nuzhdin, Sergey V; Kozlov, Konstantin N; Samsonova, Maria G; Gursky, Vitaly V

    2017-02-07

    Cis-regulatory sequences are often composed of many low-affinity transcription factor binding sites (TFBSs). Determining the evolutionary and functional importance of regulatory sequence composition is impeded without a detailed knowledge of the genotype-phenotype map. We simulate the evolution of regulatory sequences involved in Drosophila melanogaster embryo segmentation during early development. Natural selection evaluates gene expression dynamics produced by a computational model of the developmental network. We observe a dramatic decrease in the total number of transcription factor binding sites through the course of evolution. Despite a decrease in average sequence binding energies through time, the regulatory sequences tend towards organisations containing increased high affinity transcription factor binding sites. Additionally, the binding energies of separate sequence segments demonstrate ubiquitous mutual correlations through time. Fewer than 10% of initial TFBSs are maintained throughout the entire simulation, deemed 'core' sites. These sites have increased functional importance as assessed under wild-type conditions and their binding energy distributions are highly conserved. Furthermore, TFBSs within close proximity of core sites exhibit increased longevity, reflecting functional regulatory interactions with core sites. In response to elevated mutational pressure, evolution tends to sample regulatory sequence organisations with fewer, albeit on average, stronger functional transcription factor binding sites. These organisations are also shaped by the regulatory interactions among core binding sites with sites in their local vicinity.

  3. Selective modification of halloysite lumen with octadecylphosphonic acid: new inorganic tubular micelle.

    PubMed

    Yah, Weng On; Takahara, Atsushi; Lvov, Yuri M

    2012-01-25

    Selective fatty acid hydrophobization of the inner surface of tubule halloysite clay is demonstrated. Aqueous phosphonic acid was found to bind to alumina sites at the tube lumen and did not bind the tube's outer siloxane surface. The bonding was characterized with solid-state nuclear magnetic resonance ((29)Si, (13)C, (31)P NMR), Fourier transform infrared (FTIR), and X-ray photoelectron spectroscopy. NMR and FTIR spectroscopy of selectively modified tubes proved binding of octadecylphosphonic acid within the halloysite lumen through bidentate and tridentate P-O-Al linkage. Selective modification of the halloysite clay lumen creates an inorganic micelle-like architecture with a hydrophobic aliphatic chain core and a hydrophilic silicate shell. An enhanced capacity for adsorption of the modified halloysite toward hydrophobic derivatives of ferrocene was shown. This demonstrates that the different inner and outer surface chemistry of clay nanotubes can be used for selective modification, enabling different applications from water purification to drug immobilization and controlled release. © 2011 American Chemical Society

  4. Prediction of Carbohydrate Binding Sites on Protein Surfaces with 3-Dimensional Probability Density Distributions of Interacting Atoms

    PubMed Central

    Tsai, Keng-Chang; Jian, Jhih-Wei; Yang, Ei-Wen; Hsu, Po-Chiang; Peng, Hung-Pin; Chen, Ching-Tai; Chen, Jun-Bo; Chang, Jeng-Yih; Hsu, Wen-Lian; Yang, An-Suei

    2012-01-01

    Non-covalent protein-carbohydrate interactions mediate molecular targeting in many biological processes. Prediction of non-covalent carbohydrate binding sites on protein surfaces not only provides insights into the functions of the query proteins; information on key carbohydrate-binding residues could suggest site-directed mutagenesis experiments, design therapeutics targeting carbohydrate-binding proteins, and provide guidance in engineering protein-carbohydrate interactions. In this work, we show that non-covalent carbohydrate binding sites on protein surfaces can be predicted with relatively high accuracy when the query protein structures are known. The prediction capabilities were based on a novel encoding scheme of the three-dimensional probability density maps describing the distributions of 36 non-covalent interacting atom types around protein surfaces. One machine learning model was trained for each of the 30 protein atom types. The machine learning algorithms predicted tentative carbohydrate binding sites on query proteins by recognizing the characteristic interacting atom distribution patterns specific for carbohydrate binding sites from known protein structures. The prediction results for all protein atom types were integrated into surface patches as tentative carbohydrate binding sites based on normalized prediction confidence level. The prediction capabilities of the predictors were benchmarked by a 10-fold cross validation on 497 non-redundant proteins with known carbohydrate binding sites. The predictors were further tested on an independent test set with 108 proteins. The residue-based Matthews correlation coefficient (MCC) for the independent test was 0.45, with prediction precision and sensitivity (or recall) of 0.45 and 0.49 respectively. In addition, 111 unbound carbohydrate-binding protein structures for which the structures were determined in the absence of the carbohydrate ligands were predicted with the trained predictors. The overall prediction MCC was 0.49. Independent tests on anti-carbohydrate antibodies showed that the carbohydrate antigen binding sites were predicted with comparable accuracy. These results demonstrate that the predictors are among the best in carbohydrate binding site predictions to date. PMID:22848404

  5. Selective labeling of serotonin uptake sites in rat brain by (/sup 3/H)citalopram contrasted to labeling of multiple sites by (/sup 3/H)imipramine

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    D'Amato, R.J.; Largent, B.L.; Snowman, A.M.

    1987-07-01

    Citalopram is a potent and selective inhibitor of neuronal serotonin uptake. In rat brain membranes (/sup 3/H)citalopram demonstrates saturable and reversible binding with a KD of 0.8 nM and a maximal number of binding sites (Bmax) of 570 fmol/mg of protein. The drug specificity for (/sup 3/H)citalopram binding and synaptosomal serotonin uptake are closely correlated. Inhibition of (/sup 3/H)citalopram binding by both serotonin and imipramine is consistent with a competitive interaction in both equilibrium and kinetic analyses. The autoradiographic pattern of (/sup 3/H)citalopram binding sites closely resembles the distribution of serotonin. By contrast, detailed equilibrium-saturation analysis of (/sup 3/H)imipramine bindingmore » reveals two binding components, i.e., high affinity (KD = 9 nM, Bmax = 420 fmol/mg of protein) and low affinity (KD = 553 nM, Bmax = 8560 fmol/mg of protein) sites. Specific (/sup 3/H)imipramine binding, defined as the binding inhibited by 100 microM desipramine, is displaced only partially by serotonin. Various studies reveal that the serotonin-sensitive portion of binding corresponds to the high affinity sites of (/sup 3/H)imipramine binding whereas the serotonin-insensitive binding corresponds to the low affinity sites. Lesioning of serotonin neurons with p-chloroamphetamine causes a large decrease in (/sup 3/H)citalopram and serotonin-sensitive (/sup 3/H)imipramine binding with only a small effect on serotonin-insensitive (/sup 3/H)imipramine binding. The dissociation rate of (/sup 3/H)imipramine or (/sup 3/H)citalopram is not altered by citalopram, imipramine or serotonin up to concentrations of 10 microM. The regional distribution of serotonin sensitive (/sup 3/H)imipramine high affinity binding sites closely resembles that of (/sup 3/H)citalopram binding.« less

  6. Discovery of Small Molecules that Inhibit the Disordered Protein, p27Kip1

    PubMed Central

    Iconaru, Luigi I.; Ban, David; Bharatham, Kavitha; Ramanathan, Arvind; Zhang, Weixing; Shelat, Anang A.; Zuo, Jian; Kriwacki, Richard W.

    2015-01-01

    Disordered proteins are highly prevalent in biological systems, they control myriad signaling and regulatory processes, and their levels and/or cellular localization are often altered in human disease. In contrast to folded proteins, disordered proteins, due to conformational heterogeneity and dynamics, are not considered viable drug targets. We challenged this paradigm by identifying through NMR-based screening small molecules that bound specifically, albeit weakly, to the disordered cell cycle regulator, p27Kip1 (p27). Two groups of molecules bound to sites created by transient clusters of aromatic residues within p27. Conserved chemical features within these two groups of small molecules exhibited complementarity to their binding sites within p27, establishing structure-activity relationships for small molecule:disordered protein interactions. Finally, one compound counteracted the Cdk2/cyclin A inhibitory function of p27 in vitro, providing proof-of-principle that small molecules can inhibit the function of a disordered protein (p27) through sequestration in a conformation incapable of folding and binding to a natural regulatory target (Cdk2/cyclin A). PMID:26507530

  7. Simulations of CYP51A from Aspergillus fumigatus in a model bilayer provide insights into triazole drug resistance.

    PubMed

    Nash, Anthony; Rhodes, Johanna

    2018-04-01

    Azole antifungal drugs target CYP51A in Aspergillus fumigatus by binding with the active site of the protein, blocking ergosterol biosynthesis. Resistance to azole antifungal drugs is now common, with a leucine to histidine amino acid substitution at position 98 the most frequent, predominantly conferring resistance to itraconazole, although cross-resistance has been reported in conjunction with other mutations. In this study, we create a homology model of CYP51A using a recently published crystal structure of the paralog protein CYP51B. The derived structures, wild type, and L98H mutant are positioned within a lipid membrane bilayer and subjected to molecular dynamics simulations in order improve the accuracy of both models. The structural analysis from our simulations suggests a decrease in active site surface from the formation of hydrogen bonds between the histidine substitution and neighboring polar side chains, potentially preventing the binding of azole drugs. This study yields a biologically relevant structure and set of dynamics of the A. fumigatus Lanosterol 14 alpha-demethylase enzyme and provides further insight into azole antifungal drug resistance.

  8. Discovery of Small Molecules that Inhibit the Disordered Protein, p27 Kip1

    DOE PAGES

    Iconaru, Luigi I.; Ban, David; Bharatham, Kavitha; ...

    2015-10-28

    In disordered proteins we see that they are highly prevalent in biological systems. They control myriad signaling and regulatory processes, and their levels and/or cellular localization are often altered in human disease. In contrast to folded proteins, disordered proteins, due to conformational heterogeneity and dynamics, are not considered viable drug targets. We challenged this paradigm by identifying through NMR-based screening small molecules that bound specifically, albeit weakly, to the disordered cell cycle regulator, p27 Kip1 (p27). Moreover, two groups of molecules bound to sites created by transient clusters of aromatic residues within p27. Conserved chemical features within these two groupsmore » of small molecules exhibited complementarity to their binding sites within p27, establishing structure-activity relationships for small molecule: disordered protein interactions. Finally, one compound counteracted the Cdk2/cyclin A inhibitory function of p27 in vitro, providing proof-of- principle that small molecules can inhibit the function of a disordered protein (p27) through sequestration in a conformation incapable of folding and binding to a natural regulatory target (Cdk2/cyclin A).« less

  9. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Iconaru, Luigi I.; Ban, David; Bharatham, Kavitha

    In disordered proteins we see that they are highly prevalent in biological systems. They control myriad signaling and regulatory processes, and their levels and/or cellular localization are often altered in human disease. In contrast to folded proteins, disordered proteins, due to conformational heterogeneity and dynamics, are not considered viable drug targets. We challenged this paradigm by identifying through NMR-based screening small molecules that bound specifically, albeit weakly, to the disordered cell cycle regulator, p27 Kip1 (p27). Moreover, two groups of molecules bound to sites created by transient clusters of aromatic residues within p27. Conserved chemical features within these two groupsmore » of small molecules exhibited complementarity to their binding sites within p27, establishing structure-activity relationships for small molecule: disordered protein interactions. Finally, one compound counteracted the Cdk2/cyclin A inhibitory function of p27 in vitro, providing proof-of- principle that small molecules can inhibit the function of a disordered protein (p27) through sequestration in a conformation incapable of folding and binding to a natural regulatory target (Cdk2/cyclin A).« less

  10. Computational assessment of the cooperativity between RNA binding proteins and MicroRNAs in Transcript Decay.

    PubMed

    Jiang, Peng; Singh, Mona; Coller, Hilary A

    2013-01-01

    Transcript degradation is a widespread and important mechanism for regulating protein abundance. Two major regulators of transcript degradation are RNA Binding Proteins (RBPs) and microRNAs (miRNAs). We computationally explored whether RBPs and miRNAs cooperate to promote transcript decay. We defined five RBP motifs based on the evolutionary conservation of their recognition sites in 3'UTRs as the binding motifs for Pumilio (PUM), U1A, Fox-1, Nova, and UAUUUAU. Recognition sites for some of these RBPs tended to localize at the end of long 3'UTRs. A specific group of miRNA recognition sites were enriched within 50 nts from the RBP recognition sites for PUM and UAUUUAU. The presence of both a PUM recognition site and a recognition site for preferentially co-occurring miRNAs was associated with faster decay of the associated transcripts. For PUM and its co-occurring miRNAs, binding of the RBP to its recognition sites was predicted to release nearby miRNA recognition sites from RNA secondary structures. The mammalian miRNAs that preferentially co-occur with PUM binding sites have recognition seeds that are reverse complements to the PUM recognition motif. Their binding sites have the potential to form hairpin secondary structures with proximal PUM binding sites that would normally limit RISC accessibility, but would be more accessible to miRNAs in response to the binding of PUM. In sum, our computational analyses suggest that a specific set of RBPs and miRNAs work together to affect transcript decay, with the rescue of miRNA recognition sites via RBP binding as one possible mechanism of cooperativity.

  11. Zn(II) stimulation of Fe(II)-activated repression in the iron-dependent repressor from Mycobacterium tuberculosis.

    PubMed

    Stapleton, Brian; Walker, Lawrence R; Logan, Timothy M

    2013-03-19

    Thermodynamic measurements of Fe(II) binding and activation of repressor function in the iron-dependent repressor from Mycobacterium tuberculosis (IdeR) are reported. IdeR, a member of the diphtheria toxin repressor family of proteins, regulates iron homeostasis and contributes to the virulence response in M. tuberculosis. Although iron is the physiological ligand, this is the first detailed analysis of iron binding and activation in this protein. The results showed that IdeR binds 2 equiv of Fe(II) with dissociation constants that differ by a factor of 25. The high- and low-affinity iron binding sites were assigned to physical binding sites I and II, respectively, using metal binding site mutants. IdeR was also found to contain a high-affinity Zn(II) binding site that was assigned to physical metal binding site II through the use of binding site mutants and metal competition assays. Fe(II) binding was modestly weaker in the presence of Zn(II), but the coupled metal binding-DNA binding affinity was significantly stronger, requiring 30-fold less Fe(II) to activate DNA binding compared to Fe(II) alone. Together, these results suggest that IdeR is a mixed-metal repressor, where Zn(II) acts as a structural metal and Fe(II) acts to trigger the physiologically relevant promoter binding. This new model for IdeR activation provides a better understanding of IdeR and the biology of iron homeostasis in M. tuberculosis.

  12. Sigma opiates and certain antipsychotic drugs mutually inhibit (+)-[3H] SKF 10,047 and [3H]haloperidol binding in guinea pig brain membranes.

    PubMed Central

    Tam, S W; Cook, L

    1984-01-01

    The relationship between binding of antipsychotic drugs and sigma psychotomimetic opiates to binding sites for the sigma agonist (+)-[3H]SKF 10,047 (N-allylnormetazocine) and to dopamine D2 sites was investigated. In guinea pig brain membranes, (+)-[3H]SKF 10,047 bound to a single class of sites with a Kd of 4 X 10(-8) M and a Bmax of 333 fmol/mg of protein. This binding was different from mu, kappa, or delta opiate receptor binding. It was inhibited by opiates that produce psychotomimetic activities but not by opiates that lack such activities. Some antipsychotic drugs inhibited (+)-[3H]SKF 10,047 binding with high to moderate affinities in the following order of potency: haloperidol greater than perphenazine greater than fluphenazine greater than acetophenazine greater than trifluoperazine greater than molindone greater than or equal to pimozide greater than or equal to thioridazine greater than or equal to chlorpromazine greater than or equal to triflupromazine. However, there were other antipsychotic drugs such as spiperone and clozapine that showed low affinity for the (+)-[3H]SKF 10,047 binding sites. Affinities of antipsychotic drugs for (+)-[3H]SKF 10,047 binding sites did not correlate with those for [3H]spiperone (dopamine D2) sites. [3H]-Haloperidol binding in whole brain membranes was also inhibited by the sigma opiates pentazocine, cyclazocine, and (+)-SKF 10,047. In the striatum, about half of the saturable [3H]haloperidol binding was to [3H]spiperone (D2) sites and the other half was to sites similar to (+)-[3H]SKF 10,047 binding sites. PMID:6147851

  13. Uncoupling metallonuclease metal ion binding sites via nudge mutagenesis.

    PubMed

    Papadakos, Grigorios A; Nastri, Horacio; Riggs, Paul; Dupureur, Cynthia M

    2007-05-01

    The hydrolysis of phosphodiester bonds by nucleases is critical to nucleic acid processing. Many nucleases utilize metal ion cofactors, and for a number of these enzymes two active-site metal ions have been detected. Testing proposed mechanistic roles for individual bound metal ions has been hampered by the similarity between the sites and cooperative behavior. In the homodimeric PvuII restriction endonuclease, the metal ion dependence of DNA binding is sigmoidal and consistent with two classes of coupled metal ion binding sites. We reasoned that a conservative active-site mutation would perturb the ligand field sufficiently to observe the titration of individual metal ion binding sites without significantly disturbing enzyme function. Indeed, mutation of a Tyr residue 5.5 A from both metal ions in the enzyme-substrate crystal structure (Y94F) renders the metal ion dependence of DNA binding biphasic: two classes of metal ion binding sites become distinct in the presence of DNA. The perturbation in metal ion coordination is supported by 1H-15N heteronuclear single quantum coherence spectra of enzyme-Ca(II) and enzyme-Ca(II)-DNA complexes. Metal ion binding by free Y94F is basically unperturbed: through multiple experiments with different metal ions, the data are consistent with two alkaline earth metal ion binding sites per subunit of low millimolar affinity, behavior which is very similar to that of the wild type. The results presented here indicate a role for the hydroxyl group of Tyr94 in the coupling of metal ion binding sites in the presence of DNA. Its removal causes the affinities for the two metal ion binding sites to be resolved in the presence of substrate. Such tuning of metal ion affinities will be invaluable to efforts to ascertain the contributions of individual bound metal ions to metallonuclease function.

  14. Identification of the heparin binding site on adeno-associated virus serotype 3B (AAV-3B)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lerch, Thomas F.; Chapman, Michael S., E-mail: chapmami@ohsu.edu

    2012-02-05

    Adeno-associated virus is a promising vector for gene therapy. In the current study, the binding site on AAV serotype 3B for the heparan sulfate proteoglycan (HSPG) receptor has been characterized. X-ray diffraction identified a disaccharide binding site at the most positively charged region on the virus surface. The contributions of basic amino acids at this and other sites were characterized using site-directed mutagenesis. Both heparin and cell binding are correlated to positive charge at the disaccharide binding site, and transduction is significantly decreased in AAV-3B vectors mutated at this site to reduce heparin binding. While the receptor attachment sites ofmore » AAV-3B and AAV-2 are both in the general vicinity of the viral spikes, the exact amino acids that participate in electrostatic interactions are distinct. Diversity in the mechanisms of cell attachment by AAV serotypes will be an important consideration for the rational design of improved gene therapy vectors.« less

  15. Identification of the heparin binding site on adeno-associated virus serotype 3B (AAV-3B)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lerch, Thomas F.; Chapman, Michael S.

    2012-05-24

    Adeno-associated virus is a promising vector for gene therapy. In the current study, the binding site on AAV serotype 3B for the heparan sulfate proteoglycan (HSPG) receptor has been characterized. X-ray diffraction identified a disaccharide binding site at the most positively charged region on the virus surface. The contributions of basic amino acids at this and other sites were characterized using site-directed mutagenesis. Both heparin and cell binding are correlated to positive charge at the disaccharide binding site, and transduction is significantly decreased in AAV-3B vectors mutated at this site to reduce heparin binding. While the receptor attachment sites ofmore » AAV-3B and AAV-2 are both in the general vicinity of the viral spikes, the exact amino acids that participate in electrostatic interactions are distinct. Diversity in the mechanisms of cell attachment by AAV serotypes will be an important consideration for the rational design of improved gene therapy vectors.« less

  16. Location of Bromide Ions in Tetragonal Lysozyme Crystals

    NASA Technical Reports Server (NTRS)

    Lim, Kap; Nadarajah, Arunan; Forsythe, Elizabeth L.; Pusey, Marc L.

    1998-01-01

    Anions have been shown to play a dominant role in the crystallization of chicken egg white lysozyme from salt solutions. Previous studies employing X-ray crystallography had found one chloride ion binding site in the tetragonal crystal form of the protein and four nitrate ion binding sites in the monoclinic form. In this study the anion positions in the tetragonal form were determined from the difference Fourier map obtained from lysozyme crystal grown in bromide and chloride solutions. Five possible anion binding sites were found in this manner. Some of these sites were in pockets containing basic residues while others were near neutral, but polar, residues. The sole chloride ion binding site found in previous studies was confirmed, while four of these sites corresponded to four binding sites found for nitrate ions in monoclinic crystals. The study suggests that most of the anion binding sites in lysozyme remain unchanged, even when different anions and different crystal forms of lysozyme are employed.

  17. Locations of Bromide Ions in Tetragonal Lysozyme Crystals

    NASA Technical Reports Server (NTRS)

    Lim, Kap; Nadarajah, Arunan; Forsythe, Elizabeth L.; Pusey, Marc L.

    1998-01-01

    Anions have been shown to play a dominant role in the crystallization of chicken egg-white lysozyme from salt solutions. Previous studies employing X-ray crystallography have found one chloride ion binding site in the tetragonal crystal form of the protein and four nitrate ion binding sites in the monoclinic form. In this study the anion positions in the tetragonal form were determined from the difference Fourier map obtained from lysozyme crystals grown in bromide and chloride solutions. Five possible anion-binding sites were found in this manner. Some of these sites were in pockets containing basic residues while others were near neutral, but polar, residues. The sole chloride ion binding site found in previous studies was confirmed, while four further sites were found which corresponded to the four binding sites found for nitrate ions in monoclinic crystals. The study suggests that most of the anion-binding sites in lysozyme remain unchanged even when different anions and different crystal forms of lysozyme are employed.

  18. Discovering amino acid patterns on binding sites in protein complexes

    PubMed Central

    Kuo, Huang-Cheng; Ong, Ping-Lin; Lin, Jung-Chang; Huang, Jen-Peng

    2011-01-01

    Discovering amino acid (AA) patterns on protein binding sites has recently become popular. We propose a method to discover the association relationship among AAs on binding sites. Such knowledge of binding sites is very helpful in predicting protein-protein interactions. In this paper, we focus on protein complexes which have protein-protein recognition. The association rule mining technique is used to discover geographically adjacent amino acids on a binding site of a protein complex. When mining, instead of treating all AAs of binding sites as a transaction, we geographically partition AAs of binding sites in a protein complex. AAs in a partition are treated as a transaction. For the partition process, AAs on a binding site are projected from three-dimensional to two-dimensional. And then, assisted with a circular grid, AAs on the binding site are placed into grid cells. A circular grid has ten rings: a central ring, the second ring with 6 sectors, the third ring with 12 sectors, and later rings are added to four sectors in order. As for the radius of each ring, we examined the complexes and found that 10Å is a suitable range, which can be set by the user. After placing these recognition complexes on the circular grid, we obtain mining records (i.e. transactions) from each sector. A sector is regarded as a record. Finally, we use the association rule to mine these records for frequent AA patterns. If the support of an AA pattern is larger than the predetermined minimum support (i.e. threshold), it is called a frequent pattern. With these discovered patterns, we offer the biologists a novel point of view, which will improve the prediction accuracy of protein-protein recognition. In our experiments, we produced the AA patterns by data mining. As a result, we found that arginine (arg) most frequently appears on the binding sites of two proteins in the recognition protein complexes, while cysteine (cys) appears the fewest. In addition, if we discriminate the shape of binding sites between concave and convex further, we discover that patterns {arg, glu, asp} and {arg, ser, asp} on the concave shape of binding sites in a protein more frequently (i.e. higher probability) make contact with {lys} or {arg} on the convex shape of binding sites in another protein. Thus, we can confidently achieve a rate of at least 78%. On the other hand {val, gly, lys} on the convex surface of binding sites in proteins is more frequently in contact with {asp} on the concave site of another protein, and the confidence achieved is over 81%. Applying data mining in biology can reveal more facts that may otherwise be ignored or not easily discovered by the naked eye. Furthermore, we can discover more relationships among AAs on binding sites by appropriately rotating these residues on binding sites from a three-dimension to two-dimension perspective. We designed a circular grid to deposit the data, which total to 463 records consisting of AAs. Then we used the association rules to mine these records for discovering relationships. The proposed method in this paper provides an insight into the characteristics of binding sites for recognition complexes. PMID:21464838

  19. A complex mechanism determines polarity of DNA replication fork arrest by the replication terminator complex of Bacillus subtilis.

    PubMed

    Duggin, Iain G; Matthews, Jacqueline M; Dixon, Nicholas E; Wake, R Gerry; Mackay, Joel P

    2005-04-01

    Two dimers of the replication terminator protein (RTP) of Bacillus subtilis bind to a chromosomal DNA terminator site to effect polar replication fork arrest. Cooperative binding of the dimers to overlapping half-sites within the terminator is essential for arrest. It was suggested previously that polarity of fork arrest is the result of the RTP dimer at the blocking (proximal) side within the complex binding very tightly and the permissive-side RTP dimer binding relatively weakly. In order to investigate this "differential binding affinity" model, we have constructed a series of mutant terminators that contain half-sites of widely different RTP binding affinities in various combinations. Although there appeared to be a correlation between binding affinity at the proximal half-site and fork arrest efficiency in vivo for some terminators, several deviated significantly from this correlation. Some terminators exhibited greatly reduced binding cooperativity (and therefore have reduced affinity at each half-site) but were highly efficient in fork arrest, whereas one terminator had normal affinity over the proximal half-site, yet had low fork arrest efficiency. The results show clearly that there is no direct correlation between the RTP binding affinity (either within the full complex or at the proximal half-site within the full complex) and the efficiency of replication fork arrest in vivo. Thus, the differential binding affinity over the proximal and distal half-sites cannot be solely responsible for functional polarity of fork arrest. Furthermore, efficient fork arrest relies on features in addition to the tight binding of RTP to terminator DNA.

  20. Principal component analysis of chemical shift perturbation data of a multiple-ligand-binding system for elucidation of respective binding mechanism.

    PubMed

    Konuma, Tsuyoshi; Lee, Young-Ho; Goto, Yuji; Sakurai, Kazumasa

    2013-01-01

    Chemical shift perturbations (CSPs) in NMR spectra provide useful information about the interaction of a protein with its ligands. However, in a multiple-ligand-binding system, determining quantitative parameters such as a dissociation constant (K(d) ) is difficult. Here, we used a method we named CS-PCA, a principal component analysis (PCA) of chemical shift (CS) data, to analyze the interaction between bovine β-lactoglobulin (βLG) and 1-anilinonaphthalene-8-sulfonate (ANS), which is a multiple-ligand-binding system. The CSP on the binding of ANS involved contributions from two distinct binding sites. PCA of the titration data successfully separated the CSP pattern into contributions from each site. Docking simulations based on the separated CSP patterns provided the structures of βLG-ANS complexes for each binding site. In addition, we determined the K(d) values as 3.42 × 10⁻⁴ M² and 2.51 × 10⁻³ M for Sites 1 and 2, respectively. In contrast, it was difficult to obtain reliable K(d) values for respective sites from the isothermal titration calorimetry experiments. Two ANS molecules were found to bind at Site 1 simultaneously, suggesting that the binding occurs cooperatively with a partial unfolding of the βLG structure. On the other hand, the binding of ANS to Site 2 was a simple attachment without a significant conformational change. From the present results, CS-PCA was confirmed to provide not only the positions and the K(d) values of binding sites but also information about the binding mechanism. Thus, it is anticipated to be a general method to investigate protein-ligand interactions. Copyright © 2012 Wiley Periodicals, Inc.

  1. Thermodynamic compensation upon binding to exosite 1 and the active site of thrombin

    PubMed Central

    Treuheit, Nicholas A.; Beach, Muneera A.; Komives, Elizabeth A.

    2011-01-01

    Several lines of experimental evidence including amide exchange and NMR suggest that ligands binding to thrombin cause reduced backbone dynamics. Binding of the covalent inhibitor dPhe-Pro-Arg chloromethylketone to the active site serine, as well as non-covalent binding of a fragment of the regulatory protein, thrombomodulin, to exosite 1 on the back side of the thrombin molecule both cause reduced dynamics. However, the reduced dynamics do not appear to be accompanied by significant conformational changes. In addition, binding of ligands to the active site does not change the affinity of thrombomodulin fragments binding to exosite 1, however, the thermodynamic coupling between exosite 1 and the active site has not been fully explored. We present isothermal titration calorimetry experiments that probe changes in enthalpy and entropy upon formation of binary ligand complexes. The approach relies on stringent thrombin preparation methods and on the use of dansyl-L-arginine-(3-methyl-1,5-pantanediyl) amide and a DNA aptamer as ligands with ideal thermodynamic signatures for binding to the active site and to exosite 1. Using this approach, the binding thermodynamic signatures of each ligand alone as well as the binding signatures of each ligand when the other binding site was occupied were measured. Different exosite 1 ligands with widely varied thermodynamic signatures cause the same reduction in ΔH and a concomitantly lower entropy cost upon DAPA binding at the active site. The results suggest a general phenomenon of enthalpy-entropy compensation consistent with reduction of dynamics/increased folding of thrombin upon ligand binding to either the active site or to exosite 1. PMID:21526769

  2. Using Carbohydrate Interaction Assays to Reveal Novel Binding Sites in Carbohydrate Active Enzymes.

    PubMed

    Cockburn, Darrell; Wilkens, Casper; Dilokpimol, Adiphol; Nakai, Hiroyuki; Lewińska, Anna; Abou Hachem, Maher; Svensson, Birte

    2016-01-01

    Carbohydrate active enzymes often contain auxiliary binding sites located either on independent domains termed carbohydrate binding modules (CBMs) or as so-called surface binding sites (SBSs) on the catalytic module at a certain distance from the active site. The SBSs are usually critical for the activity of their cognate enzyme, though they are not readily detected in the sequence of a protein, but normally require a crystal structure of a complex for their identification. A variety of methods, including affinity electrophoresis (AE), insoluble polysaccharide pulldown (IPP) and surface plasmon resonance (SPR) have been used to study auxiliary binding sites. These techniques are complementary as AE allows monitoring of binding to soluble polysaccharides, IPP to insoluble polysaccharides and SPR to oligosaccharides. Here we show that these methods are useful not only for analyzing known binding sites, but also for identifying new ones, even without structural data available. We further verify the chosen assays discriminate between known SBS/CBM containing enzymes and negative controls. Altogether 35 enzymes are screened for the presence of SBSs or CBMs and several novel binding sites are identified, including the first SBS ever reported in a cellulase. This work demonstrates that combinations of these methods can be used as a part of routine enzyme characterization to identify new binding sites and advance the study of SBSs and CBMs, allowing them to be detected in the absence of structural data.

  3. Using Carbohydrate Interaction Assays to Reveal Novel Binding Sites in Carbohydrate Active Enzymes

    PubMed Central

    Wilkens, Casper; Dilokpimol, Adiphol; Nakai, Hiroyuki; Lewińska, Anna; Abou Hachem, Maher; Svensson, Birte

    2016-01-01

    Carbohydrate active enzymes often contain auxiliary binding sites located either on independent domains termed carbohydrate binding modules (CBMs) or as so-called surface binding sites (SBSs) on the catalytic module at a certain distance from the active site. The SBSs are usually critical for the activity of their cognate enzyme, though they are not readily detected in the sequence of a protein, but normally require a crystal structure of a complex for their identification. A variety of methods, including affinity electrophoresis (AE), insoluble polysaccharide pulldown (IPP) and surface plasmon resonance (SPR) have been used to study auxiliary binding sites. These techniques are complementary as AE allows monitoring of binding to soluble polysaccharides, IPP to insoluble polysaccharides and SPR to oligosaccharides. Here we show that these methods are useful not only for analyzing known binding sites, but also for identifying new ones, even without structural data available. We further verify the chosen assays discriminate between known SBS/CBM containing enzymes and negative controls. Altogether 35 enzymes are screened for the presence of SBSs or CBMs and several novel binding sites are identified, including the first SBS ever reported in a cellulase. This work demonstrates that combinations of these methods can be used as a part of routine enzyme characterization to identify new binding sites and advance the study of SBSs and CBMs, allowing them to be detected in the absence of structural data. PMID:27504624

  4. Volatile anesthetics compete for common binding sites on bovine serum albumin: a 19F-NMR study.

    PubMed Central

    Dubois, B W; Cherian, S F; Evers, A S

    1993-01-01

    There is controversy as to the molecular nature of volatile anesthetic target sites. One proposal is that volatile anesthetics bind directly to hydrophobic binding sites on certain sensitive target proteins. Consistent with this hypothesis, we have previously shown that a fluorinated volatile anesthetic, isoflurane, binds saturably [Kd (dissociation constant) = 1.4 +/- 0.2 mM, Bmax = 4.2 +/- 0.3 sites] to fatty acid-displaceable domains on serum albumin. In the current study, we used 19F-NMR T2 relaxation to examine whether other volatile anesthetics bind to the same sites on albumin and, if so, whether they vary in their affinity for these sites. We show that three other fluorinated volatile anesthetics bind with varying affinity to fatty acid-displaceable domains on serum albumin: halothane, Kd = 1.3 +/- 0.2 mM; methoxyflurane, Kd = 2.6 +/- 0.3 mM; and sevoflurane, Kd = 4.5 +/- 0.6 mM. These three anesthetics inhibit isoflurane binding in a competitive manner: halothane, K(i) (inhibition constant) = 1.3 +/- 0.2 mM; methoxyflurane, K(i) = 2.5 +/- 0.4 mM; and sevoflurane, K(i) = 5.4 +/- 0.7 mM--similar to each anesthetic's respective Kd of binding to fatty acid displaceable sites. These results illustrate that a variety of volatile anesthetics can compete for binding to specific sites on a protein. PMID:8341659

  5. Characterization of melatonin binding sites in the Harderian gland and median eminence of the rat

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lopez-Gonzalez, M.A.; Calvo, J.R.; Rubio, A.

    The characterization of specific melatonin binding sites in the Harderian gland (HG) and median eminence (ME) of the rat was studied using ({sup 125}I)melatonin. Binding of melatonin to membrane crude preparations of both tissues was dependent on time and temperature. Thus, maximal binding was obtained at 37{degree}C after 30-60 min incubation. Binding was also dependent on protein concentration. The specific binding of ({sup 125}I)melatonin was saturable, exhibiting only the class of binding sites in both tissues. The dissociation constants (Kd) were 170 and 190 pM for ME and HG, respectively. The concentration of the binding sites in ME was 8more » fmol/mg protein, and in the HG 4 fmol/mg protein. In competition studies, binding of ({sup 125}I)melatonin to ME or HG was inhibited by increasing concentration of native melatonin; 50% inhibition was observed at about 702 and 422 nM for ME and HG, respectively. Additionally, the ({sup 125}I)melatonin binding to the crude membranes was not affected by the addition of different drugs such as norepinephrine, isoproterenol, phenylephrine, propranolol, or prazosin. The results confirm the presence of melatonin binding sites in median eminence and show, for the first time, the existence of melatonin binding sites in the Harderian gland.« less

  6. In vivo binding of PRDM9 reveals interactions with noncanonical genomic sites

    PubMed Central

    Grey, Corinne; Clément, Julie A.J.; Buard, Jérôme; Leblanc, Benjamin; Gut, Ivo; Gut, Marta; Duret, Laurent

    2017-01-01

    In mouse and human meiosis, DNA double-strand breaks (DSBs) initiate homologous recombination and occur at specific sites called hotspots. The localization of these sites is determined by the sequence-specific DNA binding domain of the PRDM9 histone methyl transferase. Here, we performed an extensive analysis of PRDM9 binding in mouse spermatocytes. Unexpectedly, we identified a noncanonical recruitment of PRDM9 to sites that lack recombination activity and the PRDM9 binding consensus motif. These sites include gene promoters, where PRDM9 is recruited in a DSB-dependent manner. Another subset reveals DSB-independent interactions between PRDM9 and genomic sites, such as the binding sites for the insulator protein CTCF. We propose that these DSB-independent sites result from interactions between hotspot-bound PRDM9 and genomic sequences located on the chromosome axis. PMID:28336543

  7. Localization and characterization of (/sup 3/H)desmethylimipramine binding sites in rat brain by quantitative autoradiography

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Biegon, A.; Rainbow, T.C.

    1983-05-01

    The high affinity binding sites for the antidepressant desmethlyimipramine (DMI) have been localized in rat brain by quantitative autoradiography. There are high concentrations of binding sites in the locus ceruleus, the anterior ventral thalamus, the ventral portion of the bed nucleus of the stria terminalis, the paraventricular and the dorsomedial nuclei of the hypothalamus. The distribution of DMI binding sites is in striking accord with the distribution of norepinephrine terminals. Pretreatment of rats with the neurotoxin 6-hydroxydopamine, which causes a selective degeneration of catecholamine terminals, results in 60 to 90% decrease in DMI binding. These data support the idea thatmore » high affinity binding sites for DMI are located on presynaptic noradrenergic terminals.« less

  8. Structural and functional dissection reveals distinct roles of Ca2+-binding sites in the giant adhesin SiiE of Salmonella enterica

    PubMed Central

    Klingl, Stefan; Sandmann, Achim; Taccardi, Nicola; Sticht, Heinrich; Muller, Yves A.; Hensel, Michael

    2017-01-01

    The giant non-fimbrial adhesin SiiE of Salmonella enterica mediates the first contact to the apical site of epithelial cells and enables subsequent invasion. SiiE is a 595 kDa protein composed of 53 repetitive bacterial immunoglobulin (BIg) domains and the only known substrate of the SPI4-encoded type 1 secretion system (T1SS). The crystal structure of BIg50-52 of SiiE revealed two distinct Ca2+-binding sites per BIg domain formed by conserved aspartate or glutamate residues. In a mutational analysis Ca2+-binding sites were disrupted by aspartate to serine exchange at various positions in the BIg domains of SiiE. Amounts of secreted SiiE diminish with a decreasing number of intact Ca2+-binding sites. BIg domains of SiiE contain distinct Ca2+-binding sites, with type I sites being similar to other T1SS-secreted proteins and type II sites newly identified in SiiE. We functionally and structurally dissected the roles of type I and type II Ca2+-binding sites in SiiE, as well as the importance of Ca2+-binding sites in various positions of SiiE. Type I Ca2+-binding sites were critical for efficient secretion of SiiE and a decreasing number of type I sites correlated with reduced secretion. Type II sites were less important for secretion, stability and surface expression of SiiE, however integrity of type II sites in the C-terminal portion was required for the function of SiiE in mediating adhesion and invasion. PMID:28558023

  9. Determination of the molecular basis for a limited dimorphism, N417K, in the Plasmodium vivax Duffy-binding protein.

    PubMed

    McHenry, Amy M; Barnes, Samantha J; Ntumngia, Francis B; King, Christopher L; Adams, John H

    2011-01-01

    Invasion of human red blood cells by Plasmodium merozoites is vital for replication and survival of the parasite and, as such, is an attractive target for therapeutic intervention. Merozoite invasion is mediated by specific interactions between parasite ligands and host erythrocyte receptors. The P. vivax Duffy-binding protein (PvDBP) is heavily dependent on the interaction with the human Duffy blood group antigen/receptor for chemokines (DARC) for invasion. Region II of PvDBP contains many allelic polymorphisms likely to have arisen by host immune selection. Successful vaccine development necessitates a deeper understanding of the role of these polymorphisms in both parasite function and evasion of host immunity. A 3D structure of the homologous P. knowlesi DBP predicts that most variant residues are surface-exposed, including N417K, which is a dimorphic residue change that has previously been shown to be part of a linked haplotype that alters DBP sensitivity to inhibitory antibody. In natural isolates only two residues are found at this site, asparagine (N) and lysine (K). Site-directed mutagenesis of residue 417 was used to create a panel of 20 amino acid variants that were then examined for their binding phenotype and response to immune sera. Our results suggest that the observed dimorphism likely arose due to both structural requirements and immune selection pressure. To our knowledge, this is the first exhaustive examination of this kind of the role of a single amino acid residue in antigenic character and binding ability. Our results demonstrate that a single amino acid substitution can dramatically alter both the ability of the PvDBP to bind to human erythrocytes and its antigenic character.

  10. Assessment of Homology Templates and an Anesthetic Binding Site within the γ-Aminobutyric Acid Receptor

    PubMed Central

    Bertaccini, Edward J.; Yoluk, Ozge; Lindahl, Erik R.; Trudell, James R.

    2013-01-01

    Background Anesthetics mediate portions of their activity via modulation of the γ-aminobutyric acid receptor (GABAaR). While its molecular structure remains unknown, significant progress has been made towards understanding its interactions with anesthetics via molecular modeling. Methods The structure of the torpedo acetylcholine receptor (nAChRα), the structures of the α4 and β2 subunits of the human nAChR, the structures of the eukaryotic glutamate-gated chloride channel (GluCl), and the prokaryotic pH sensing channels, from Gloeobacter violaceus and Erwinia chrysanthemi, were aligned with the SAlign and 3DMA algorithms. A multiple sequence alignment from these structures and those of the GABAaR was performed with ClustalW. The Modeler and Rosetta algorithms independently created three-dimensional constructs of the GABAaR from the GluCl template. The CDocker algorithm docked a congeneric series of propofol derivatives into the binding pocket and scored calculated binding affinities for correlation with known GABAaR potentiation EC50’s. Results Multiple structure alignments of templates revealed a clear consensus of residue locations relevant to anesthetic effects except for torpedo nAChR. Within the GABAaR models generated from GluCl, the residues notable for modulating anesthetic action within transmembrane segments 1, 2, and 3 converged on the intersubunit interface between alpha and beta subunits. Docking scores of a propofol derivative series into this binding site showed strong linear correlation with GABAaR potentiation EC50. Conclusion Consensus structural alignment based on homologous templates revealed an intersubunit anesthetic binding cavity within the transmembrane domain of the GABAaR, which showed correlation of ligand docking scores with experimentally measured GABAaR potentiation. PMID:23770602

  11. Assessment of homology templates and an anesthetic binding site within the γ-aminobutyric acid receptor.

    PubMed

    Bertaccini, Edward J; Yoluk, Ozge; Lindahl, Erik R; Trudell, James R

    2013-11-01

    Anesthetics mediate portions of their activity via modulation of the γ-aminobutyric acid receptor (GABAaR). Although its molecular structure remains unknown, significant progress has been made toward understanding its interactions with anesthetics via molecular modeling. The structure of the torpedo acetylcholine receptor (nAChRα), the structures of the α4 and β2 subunits of the human nAChR, the structures of the eukaryotic glutamate-gated chloride channel (GluCl), and the prokaryotic pH-sensing channels, from Gloeobacter violaceus and Erwinia chrysanthemi, were aligned with the SAlign and 3DMA algorithms. A multiple sequence alignment from these structures and those of the GABAaR was performed with ClustalW. The Modeler and Rosetta algorithms independently created three-dimensional constructs of the GABAaR from the GluCl template. The CDocker algorithm docked a congeneric series of propofol derivatives into the binding pocket and scored calculated binding affinities for correlation with known GABAaR potentiation EC50s. Multiple structure alignments of templates revealed a clear consensus of residue locations relevant to anesthetic effects except for torpedo nAChR. Within the GABAaR models generated from GluCl, the residues notable for modulating anesthetic action within transmembrane segments 1, 2, and 3 converged on the intersubunit interface between α and β subunits. Docking scores of a propofol derivative series into this binding site showed strong linear correlation with GABAaR potentiation EC50. Consensus structural alignment based on homologous templates revealed an intersubunit anesthetic binding cavity within the transmembrane domain of the GABAaR, which showed a correlation of ligand docking scores with experimentally measured GABAaR potentiation.

  12. Closely Related Antibody Receptors Exploit Fundamentally Different Strategies for Steroid Recognition

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Verdino, P.; Aldag, C.; Hilvert, D.

    2009-05-26

    Molecular recognition by the adaptive immune system relies on specific high-affinity antibody receptors that are generated from a restricted set of starting sequences through homologous recombination and somatic mutation. The steroid binding antibody DB3 and the catalytic Diels-Alderase antibody 1E9 derive from the same germ line sequences but exhibit very distinct specificities and functions. However, mutation of only two of the 36 sequence differences in the variable domains, Leu{sup H47}Trp and Arg{sup H100}Trp, converts 1E9 into a high-affinity steroid receptor with a ligand recognition profile similar to DB3. To understand how these changes switch binding specificity and function, we determinedmore » the crystal structures of the 1E9 Leu{sup H47}Trp/Arg{sup H100}Trp double mutant (1E9dm) as an unliganded Fab at 2.05 {angstrom} resolution and in complex with two configurationally distinct steroids at 2.40 and 2.85 {angstrom}. Surprisingly, despite the functional mimicry of DB3, 1E9dm employs a distinct steroid binding mechanism. Extensive structural rearrangements occur in the combining site, where residue H47 acts as a specificity switch and H100 adapts to different ligands. Unlike DB3, 1E9dm does not use alternative binding pockets or different sets of hydrogen-bonding interactions to bind configurationally distinct steroids. Rather, the different steroids are inserted more deeply into the 1E9dm combining site, creating more hydrophobic contacts that energetically compensate for the lack of hydrogen bonds. These findings demonstrate how subtle mutations within an existing molecular scaffold can dramatically modulate the function of immune receptors by inducing unanticipated, but compensating, mechanisms of ligand interaction.« less

  13. Role of four conserved aspartic acid residues of EF-loops in the metal ion binding and in the self-assembly of ciliate Euplotes octocarinatus centrin.

    PubMed

    Liu, Wen; Duan, Lian; Sun, Tijian; Yang, Binsheng

    2016-12-01

    Ciliate Euplotes octocarinatus centrin (EoCen) is an EF-hand calcium-binding protein closely related to the prototypical calcium sensor protein calmodulin. Four mutants (D37K, D73K, D110K and D146K) were created firstly to elucidate the importance of the first aspartic acid residues (Asp37, Asp73, Asp110 and Asp146) in the beginning of the four EF-loops of EoCen. Aromatic-sensitized Tb 3+ fluorescence indicates that the aspartic acid residues are very important for the metal-binding of EoCen, except for Asp73 (in EF-loop II). Resonance light scattering (RLS) measurements for different metal ions (Ca 2+ and Tb 3+ ) binding proteins suggest that the order of four conserved aspartic acid residues for contributing to the self-assembly of EoCen is Asp37 > Asp146 > Asp110 > Asp73. Cross-linking experiment also exhibits that Asp37 and Asp146 play critical role in the self-assembly of EoCen. Asp37, in site I, which is located in the N-terminal domain, plays the most important role in the metal ion-dependent self-assembly of EoCen, and there is cooperativity between N-terminal and C-terminal domain (especially the site IV). In addition, the dependence of Tb 3+ induced self-assembly of EoCen and the mutants on various factors, including ionic strength and pH, were characterized using RLS. Finally, 2-p-toluidinylnaphthalene-6-sulfonate (TNS) binding, ionic strength and pH control experiments indicate that in the process of EoCen self-assembly, molecular interactions are mediated by both electrostatic and hydrophobic forces, and the hydrophobic interaction has the important status.

  14. Binding of N-methylscopolamine to the extracellular domain of muscarinic acetylcholine receptors

    NASA Astrophysics Data System (ADS)

    Jakubík, Jan; Randáková, Alena; Zimčík, Pavel; El-Fakahany, Esam E.; Doležal, Vladimír

    2017-01-01

    Interaction of orthosteric ligands with extracellular domain was described at several aminergic G protein-coupled receptors, including muscarinic acetylcholine receptors. The orthosteric antagonists quinuclidinyl benzilate (QNB) and N-methylscopolamine (NMS) bind to the binding pocket of the muscarinic acetylcholine receptor formed by transmembrane α-helices. We show that high concentrations of either QNB or NMS slow down dissociation of their radiolabeled species from all five subtypes of muscarinic acetylcholine receptors, suggesting allosteric binding. The affinity of NMS at the allosteric site is in the micromolar range for all receptor subtypes. Using molecular modelling of the M2 receptor we found that E172 and E175 in the second extracellular loop and N419 in the third extracellular loop are involved in allosteric binding of NMS. Mutation of these amino acids to alanine decreased affinity of NMS for the allosteric binding site confirming results of molecular modelling. The allosteric binding site of NMS overlaps with the binding site of some allosteric, ectopic and bitopic ligands. Understanding of interactions of NMS at the allosteric binding site is essential for correct analysis of binding and action of these ligands.

  15. Creating an arsenal of Adeno-associated virus (AAV) gene delivery stealth vehicles.

    PubMed

    Smith, J Kennon; Agbandje-McKenna, Mavis

    2018-05-01

    The Adeno-associated virus (AAV) gene delivery system is ushering in a new and exciting era in the United States; following the first approved gene therapy (Glybera) in Europe, the FDA has approved a second therapy, Luxturna [1]. However, challenges to this system remain. In viral gene therapy, the surface of the capsid is an important determinant of tissue tropism, impacts gene transfer efficiency, and is targeted by the human immune system. Preexisting immunity is a significant challenge to this approach, and the ability to visualize areas of antibody binding ("footprints") can inform efforts to improve the efficacy of viral vectors. Atomic resolution, smaller proteins, and asymmetric structures are the goals to attain in cryo-electron microscopy and image reconstruction (cryo-EM) as of late. The versatility of the technique and the ability to vitrify a wide range of heterogeneous molecules in solution allow structural biologists to characterize a variety of protein-DNA and protein-protein interactions at lower resolution. Cryo-EM has served as an important means to study key surface areas of the AAV gene delivery vehicle-specifically, those involved with binding neutralizing antibodies (NAbs) [2-4]. This method offers a unique opportunity for visualizing antibody binding "hotspots" on the surface of these and other viral vectors. When combined with mutagenesis, one can eliminate these hotspots to create viral vectors with the ability to avoid preexisting host immune recognition during gene delivery and genetic defect correction in disease treatment. Here, we discuss the use of structure-guided site-directed mutagenesis and directed evolution to create "stealth" AAV vectors with modified surface amino acid sequences that allow NAb avoidance while maintaining natural capsid functions or gaining desired novel tropisms.

  16. Creating an arsenal of Adeno-associated virus (AAV) gene delivery stealth vehicles

    PubMed Central

    Agbandje-McKenna, Mavis

    2018-01-01

    The Adeno-associated virus (AAV) gene delivery system is ushering in a new and exciting era in the United States; following the first approved gene therapy (Glybera) in Europe, the FDA has approved a second therapy, Luxturna [1]. However, challenges to this system remain. In viral gene therapy, the surface of the capsid is an important determinant of tissue tropism, impacts gene transfer efficiency, and is targeted by the human immune system. Preexisting immunity is a significant challenge to this approach, and the ability to visualize areas of antibody binding (“footprints”) can inform efforts to improve the efficacy of viral vectors. Atomic resolution, smaller proteins, and asymmetric structures are the goals to attain in cryo-electron microscopy and image reconstruction (cryo-EM) as of late. The versatility of the technique and the ability to vitrify a wide range of heterogeneous molecules in solution allow structural biologists to characterize a variety of protein–DNA and protein–protein interactions at lower resolution. Cryo-EM has served as an important means to study key surface areas of the AAV gene delivery vehicle—specifically, those involved with binding neutralizing antibodies (NAbs) [2–4]. This method offers a unique opportunity for visualizing antibody binding “hotspots” on the surface of these and other viral vectors. When combined with mutagenesis, one can eliminate these hotspots to create viral vectors with the ability to avoid preexisting host immune recognition during gene delivery and genetic defect correction in disease treatment. Here, we discuss the use of structure-guided site-directed mutagenesis and directed evolution to create “stealth” AAV vectors with modified surface amino acid sequences that allow NAb avoidance while maintaining natural capsid functions or gaining desired novel tropisms. PMID:29723270

  17. STUDIES OF VERAPAMIL BINDING TO HUMAN SERUM ALBUMIN BY HIGH-PERFORMANCE AFFINITY CHROMATOGRAPHY

    PubMed Central

    Mallik, Rangan; Yoo, Michelle J.; Chen, Sike; Hage, David S.

    2008-01-01

    The binding of verapamil to the protein human serum albumin (HSA) was examined by using high-performance affinity chromatography. Many previous reports have investigated the binding of verapamil with HSA, but the exact strength and nature of this interaction (e.g., the number and location of binding sites) is still unclear. In this study, frontal analysis indicated that at least one major binding site was present for R- and S-verapamil on HSA, with estimated association equilibrium constants on the order of 104 M−1 and a 1.4-fold difference in these values for the verapamil enantiomers at pH 7.4 and 37°C. The presence of a second, weaker group of binding sites on HSA was also suggested by these results. Competitive binding studies using zonal elution were carried out between verapamil and various probe compounds that have known interactions with several major and minor sites on HSA. R/S-Verapamil was found to have direct competition with S-warfarin, indicating that verapamil was binding to Sudlow site I (i.e., the warfarin-azapropazone site of HSA). The average association equilibrium constant for R- and S-verapamil at this site was 1.4 (±0.1) × 104 M−1. Verapamil did not have any notable binding to Sudlow site II of HSA but did appear to have some weak allosteric interactions with L-tryptophan, a probe for this site. An allosteric interaction between verapamil and tamoxifen (a probe for the tamoxifen site) was also noted, which was consistent with the binding of verapamil at Sudlow site I. No interaction was seen between verapamil and digitoxin, a probe for the digitoxin site of HSA. These results gave good agreement with previous observations made in the literature and help provide a more detailed description of how verapamil is transported in blood and of how it may interact with other drugs in the body. PMID:18980867

  18. Crystal structure of the solute-binding protein BxlE from Streptomyces thermoviolaceus OPC-520 complexed with xylobiose.

    PubMed

    Tomoo, Koji; Miki, Yasuhiro; Morioka, Hideaki; Seike, Kiho; Ishida, Toshimasa; Ikenishi, Sadao; Miyamoto, Katsushiro; Hasegawa, Tomokazu; Yamano, Akihito; Hamada, Kensaku; Tsujibo, Hiroshi

    2017-06-01

    BxlE from Streptomyces thermoviolaceus OPC-520 is a xylo-oligosaccharide (mainly xylobiose)-binding protein that serves as the initial receptor for the bacterial ABC-type xylo-oligosaccharide transport system. To determine the ligand-binding mechanism of BxlE, X-ray structures of ligand-free (open form) and ligand (xylobiose)-bound (closed form) BxlE were determined at 1.85 Å resolution. BxlE consists of two globular domains that are linked by two β-strands, with the cleft at the interface of the two domains creating the ligand-binding pocket. In the ligand-free open form, this pocket consists of a U-shaped and negatively charged groove located between the two domains. In the xylobiose-bound closed form of BxlE, both the N and C domains move to fold the ligand without conformational changes in either domain. Xylobiose is buried in the groove and wrapped by the N-domain mainly via hydrogen bond interactions and by the C-domain primarily via non-polar interactions with Trp side chains. In addition to the concave shape matching the binding of xylobiose, an inter-domain salt bridge between Asp-47 and Lys-294 limits the space in the ligand-binding site. This domain-stabilized mechanism of ligand binding to BxlE is a unique feature that is not observed with other solute-binding proteins. © The Authors 2017. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.

  19. Neurotensin receptor binding levels in basal ganglia are not altered in Huntington's chorea or schizophrenia

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Palacios, J.M.; Chinaglia, G.; Rigo, M.

    1991-02-01

    Autoradiographic techniques were used to examine the distribution and levels of neurotensin receptor binding sites in the basal ganglia and related regions of the human brain. Monoiodo ({sup 125}I-Tyr3)neurotensin was used as a ligand. High amounts of neurotensin receptor binding sites were found in the substantia nigra pars compacta. Lower but significant quantities of neurotensin receptor binding sites characterized the caudate, putamen, and nucleus accumbens, while very low quantities were seen in both medial and lateral segments of the globus pallidus. In Huntington's chorea, the levels of neurotensin receptor binding sites were found to be comparable to those of controlmore » cases. Only slight but not statistically significant decreases in amounts of receptor binding sites were detected in the dorsal part of the head and in the body of caudate nucleus. No alterations in the levels of neurotensin receptor binding sites were observed in the substantia nigra pars compacta and reticulata. These results suggest that a large proportion of neurotensin receptor binding sites in the basal ganglia are located on intrinsic neurons and on extrinsic afferent fibers that do not degenerate in Huntington's disease.« less

  20. n-Dodecyl β-D-maltoside specifically competes with general anesthetics for anesthetic binding sites.

    PubMed

    Xu, Longhe; Matsunaga, Felipe; Xi, Jin; Li, Min; Ma, Jingyuan; Liu, Renyu

    2014-01-01

    We recently demonstrated that the anionic detergent sodium dodecyl sulfate (SDS) specifically interacts with the anesthetic binding site in horse spleen apoferritin, a soluble protein which models anesthetic binding sites in receptors. This raises the possibility of other detergents similarly interacting with and occluding such sites from anesthetics, thereby preventing the proper identification of novel anesthetic binding sites. n-Dodecyl β-D-maltoside (DDM) is a non-ionic detergent commonly used during protein-anesthetic studies because of its mild and non-denaturing properties. In this study, we demonstrate that SDS and DDM occupy anesthetic binding sites in the model proteins human serum albumin (HSA) and horse spleen apoferritin and thereby inhibit the binding of the general anesthetics propofol and isoflurane. DDM specifically interacts with HSA (Kd = 40 μM) with a lower affinity than SDS (Kd = 2 μM). DDM exerts all these effects while not perturbing the native structures of either model protein. Computational calculations corroborated the experimental results by demonstrating that the binding sites for DDM and both anesthetics on the model proteins overlapped. Collectively, our results indicate that DDM and SDS specifically interact with anesthetic binding sites and may thus prevent the identification of novel anesthetic sites. Special precaution should be taken when undertaking and interpreting results from protein-anesthetic investigations utilizing detergents like SDS and DDM.

  1. Structural Basis for the ATP-dependent Configuration of Adenylation Active Site in Bacillus subtilis o-Succinylbenzoyl-CoA Synthetase*

    PubMed Central

    Chen, Yaozong; Sun, Yueru; Song, Haigang; Guo, Zhihong

    2015-01-01

    o-Succinylbenzoyl-CoA synthetase, or MenE, is an essential adenylate-forming enzyme targeted for development of novel antibiotics in the menaquinone biosynthesis. Using its crystal structures in a ligand-free form or in complex with nucleotides, a conserved pattern is identified in the interaction between ATP and adenylating enzymes, including acyl/aryl-CoA synthetases, adenylation domains of nonribosomal peptide synthetases, and luciferases. It involves tight gripping interactions of the phosphate-binding loop (P-loop) with the ATP triphosphate moiety and an open-closed conformational change to form a compact adenylation active site. In MenE catalysis, this ATP-enzyme interaction creates a new binding site for the carboxylate substrate, allowing revelation of the determinants of substrate specificities and in-line alignment of the two substrates for backside nucleophilic substitution reaction by molecular modeling. In addition, the ATP-enzyme interaction is suggested to play a crucial catalytic role by mutation of the P-loop residues hydrogen-bonded to ATP. Moreover, the ATP-enzyme interaction has also clarified the positioning and catalytic role of a conserved lysine residue in stabilization of the transition state. These findings provide new insights into the adenylation half-reaction in the domain alteration catalytic mechanism of the adenylate-forming enzymes. PMID:26276389

  2. High-Affinity Quasi-Specific Sites in the Genome: How the DNA-Binding Proteins Cope with Them

    PubMed Central

    Chakrabarti, J.; Chandra, Navin; Raha, Paromita; Roy, Siddhartha

    2011-01-01

    Many prokaryotic transcription factors home in on one or a few target sites in the presence of a huge number of nonspecific sites. Our analysis of λ-repressor in the Escherichia coli genome based on single basepair substitution experiments shows the presence of hundreds of sites having binding energy within 3 Kcal/mole of the OR1 binding energy, and thousands of sites with binding energy above the nonspecific binding energy. The effect of such sites on DNA-based processes has not been fully explored. The presence of such sites dramatically lowers the occupation probability of the specific site far more than if the genome were composed of nonspecific sites only. Our Brownian dynamics studies show that the presence of quasi-specific sites results in very significant kinetic effects as well. In contrast to λ-repressor, the E. coli genome has orders of magnitude lower quasi-specific sites for GalR, an integral transcription factor, thus causing little competition for the specific site. We propose that GalR and perhaps repressors of the same family have evolved binding modes that lead to much smaller numbers of quasi-specific sites to remove the untoward effects of genomic DNA. PMID:21889449

  3. Pharmacological characterization of CCKB receptors in human brain: no evidence for receptor heterogeneity.

    PubMed

    Kinze, S; Schöneberg, T; Meyer, R; Martin, H; Kaufmann, R

    1996-10-11

    In this paper, cholecystokinin (CCK) B-type binding sites were characterized with receptor binding studies in different human brain regions (various parts of cerebral cortex, basal ganglia, hippocampus, thalamus, cerebellar cortex) collected from 22 human postmortem brains. With the exception of the thalamus, where no specific CCK binding sites were found, a pharmacological characterization demonstrated a single class of high affinity CCK sites in all brain areas investigated. Receptor densities ranged from 0.5 fmol/mg protein (hippocampus) to 8.4 fmol/mg protein (nucleus caudatus). These CCK binding sites displayed a typical CCKA binding profile as shown in competition studies by using different CCK-related compounds and non peptide CCK antagonists discriminating between CCKA and CCKB sites. The rank order of agonist or antagonist potency in inhibiting specific sulphated [propionyl-3H]cholecystokinin octapeptide binding was similar and highly correlated for the brain regions investigated as demonstrated by a computer-assisted analysis. Therefore it is concluded that CCKB binding sites in human cerebral cortex, basal ganglia, cerebellar cortex share identical ligand binding characteristics.

  4. Six independent fucose-binding sites in the crystal structure of Aspergillus oryzae lectin

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Makyio, Hisayoshi; Shimabukuro, Junpei; Suzuki, Tatsuya

    The crystal structure of AOL (a fucose-specific lectin of Aspergillus oryzae) has been solved by SAD (single-wavelength anomalous diffraction) and MAD (multi-wavelength anomalous diffraction) phasing of seleno-fucosides. The overall structure is a six-bladed β-propeller similar to that of other fucose-specific lectins. The fucose moieties of the seleno-fucosides are located in six fucose-binding sites. Although the Arg and Glu/Gln residues bound to the fucose moiety are common to all fucose-binding sites, the amino-acid residues involved in fucose binding at each site are not identical. The varying peak heights of the seleniums in the electron density map suggest that each fucose-binding sitemore » has a different carbohydrate binding affinity. - Highlights: • The six-bladed β-propeller structure of AOL was solved by seleno-sugar phasing. • The mode of fucose binding is essentially conserved at all six binding sites. • The seleno-fucosides exhibit slightly different interactions and electron densities. • These findings suggest that the affinity for fucose is not identical at each site.« less

  5. Binding Leverage as a Molecular Basis for Allosteric Regulation

    PubMed Central

    Mitternacht, Simon; Berezovsky, Igor N.

    2011-01-01

    Allosteric regulation involves conformational transitions or fluctuations between a few closely related states, caused by the binding of effector molecules. We introduce a quantity called binding leverage that measures the ability of a binding site to couple to the intrinsic motions of a protein. We use Monte Carlo simulations to generate potential binding sites and either normal modes or pairs of crystal structures to describe relevant motions. We analyze single catalytic domains and multimeric allosteric enzymes with complex regulation. For the majority of the analyzed proteins, we find that both catalytic and allosteric sites have high binding leverage. Furthermore, our analysis of the catabolite activator protein, which is allosteric without conformational change, shows that its regulation involves other types of motion than those modulated at sites with high binding leverage. Our results point to the importance of incorporating dynamic information when predicting functional sites. Because it is possible to calculate binding leverage from a single crystal structure it can be used for characterizing proteins of unknown function and predicting latent allosteric sites in any protein, with implications for drug design. PMID:21935347

  6. Spectroscopic and Thermodynamic Characterization of the Metal-Binding Sites in the LH1-RC Complex from Thermophilic Photosynthetic Bacterium Thermochromatium tepidum.

    PubMed

    Kimura, Yukihiro; Yura, Yuki; Hayashi, Yusuke; Li, Yong; Onoda, Moe; Yu, Long-Jiang; Wang-Otomo, Zheng-Yu; Ohno, Takashi

    2016-12-15

    The light-harvesting 1 reaction center (LH1-RC) complex from thermophilic photosynthetic bacterium Thermochromatium (Tch.) tepidum exhibits enhanced thermostability and an unusual LH1 Q y transition, both induced by Ca 2+ binding. In this study, metal-binding sites and metal-protein interactions in the LH1-RC complexes from wild-type (B915) and biosynthetically Sr 2+ -substituted (B888) Tch. tepidum were investigated by isothermal titration calorimetry (ITC), atomic absorption (AA), and attenuated total reflection (ATR) Fourier transform infrared (FTIR) spectroscopies. The ITC measurements revealed stoichiometric ratios of approximately 1:1 for binding of Ca 2+ , Sr 2+ , or Ba 2+ to the LH1 αβ-subunit, indicating the presence of 16 binding sites in both B915 and B888. The AA analysis provided direct evidence for Ca 2+ and Sr 2+ binding to B915 and B888, respectively, in their purified states. Metal-binding experiments supported that Ca 2+ and Sr 2+ (or Ba 2+ ) competitively associate with the binding sites in both species. The ATR-FTIR difference spectra upon Ca 2+ depletion and Sr 2+ substitution demonstrated that dissociation and binding of Ca 2+ are predominantly responsible for metal-dependent conformational changes of B915 and B888. The present results are largely compatible with the recent structural evidence that another binding site for Sr 2+ (or Ba 2+ ) exists in the vicinity of the Ca 2+ -binding site, a part of which is shared in both metal-binding sites.

  7. Characterizing low affinity epibatidine binding to α4β2 nicotinic acetylcholine receptors with ligand depletion and nonspecific binding

    PubMed Central

    2011-01-01

    Background Along with high affinity binding of epibatidine (Kd1≈10 pM) to α4β2 nicotinic acetylcholine receptor (nAChR), low affinity binding of epibatidine (Kd2≈1-10 nM) to an independent binding site has been reported. Studying this low affinity binding is important because it might contribute understanding about the structure and synthesis of α4β2 nAChR. The binding behavior of epibatidine and α4β2 AChR raises a question about interpreting binding data from two independent sites with ligand depletion and nonspecific binding, both of which can affect equilibrium binding of [3H]epibatidine and α4β2 nAChR. If modeled incorrectly, ligand depletion and nonspecific binding lead to inaccurate estimates of binding constants. Fitting total equilibrium binding as a function of total ligand accurately characterizes a single site with ligand depletion and nonspecific binding. The goal of this study was to determine whether this approach is sufficient with two independent high and low affinity sites. Results Computer simulations of binding revealed complexities beyond fitting total binding for characterizing the second, low affinity site of α4β2 nAChR. First, distinguishing low-affinity specific binding from nonspecific binding was a potential problem with saturation data. Varying the maximum concentration of [3H]epibatidine, simultaneously fitting independently measured nonspecific binding, and varying α4β2 nAChR concentration were effective remedies. Second, ligand depletion helped identify the low affinity site when nonspecific binding was significant in saturation or competition data, contrary to a common belief that ligand depletion always is detrimental. Third, measuring nonspecific binding without α4β2 nAChR distinguished better between nonspecific binding and low-affinity specific binding under some circumstances of competitive binding than did presuming nonspecific binding to be residual [3H]epibatidine binding after adding a large concentration of cold competitor. Fourth, nonspecific binding of a heterologous competitor changed estimates of high and low inhibition constants but did not change the ratio of those estimates. Conclusions Investigating the low affinity site of α4β2 nAChR with equilibrium binding when ligand depletion and nonspecific binding are present likely needs special attention to experimental design and data interpretation beyond fitting total binding data. Manipulation of maximum ligand and receptor concentrations and intentionally increasing ligand depletion are potentially helpful approaches. PMID:22112852

  8. Evaluation of the Significance of Starch Surface Binding Sites on Human Pancreatic α-Amylase.

    PubMed

    Zhang, Xiaohua; Caner, Sami; Kwan, Emily; Li, Chunmin; Brayer, Gary D; Withers, Stephen G

    2016-11-01

    Starch provides the major source of caloric intake in many diets. Cleavage of starch into malto-oligosaccharides in the gut is catalyzed by pancreatic α-amylase. These oligosaccharides are then further cleaved by gut wall α-glucosidases to release glucose, which is absorbed into the bloodstream. Potential surface binding sites for starch on the pancreatic amylase, distinct from the active site of the amylase, have been identified through X-ray crystallographic analyses. The role of these sites in the degradation of both starch granules and soluble starch was probed by the generation of a series of surface variants modified at each site to disrupt binding. Kinetic analysis of the binding and/or cleavage of substrates ranging from simple maltotriosides to soluble starch and insoluble starch granules has allowed evaluation of the potential role of each such surface site. In this way, two key surface binding sites, on the same face as the active site, are identified. One site, containing a pair of aromatic residues, is responsible for attachment to starch granules, while a second site featuring a tryptophan residue around which a malto-oligosaccharide wraps is shown to heavily influence soluble starch binding and hydrolysis. These studies provide insights into the mechanisms by which enzymes tackle the degradation of largely insoluble polymers and also present some new approaches to the interrogation of the binding sites involved.

  9. Cooperative DNA binding and sequence discrimination by the Opaque2 bZIP factor.

    PubMed Central

    Yunes, J A; Vettore, A L; da Silva, M J; Leite, A; Arruda, P

    1998-01-01

    The maize Opaque2 (O2) protein is a basic leucine zipper transcription factor that controls the expression of distinct classes of endosperm genes through the recognition of different cis-acting elements in their promoters. The O2 target region in the promoter of the alpha-coixin gene was analyzed in detail and shown to comprise two closely adjacent binding sites, named O2u and O2d, which are related in sequence to the GCN4 binding site. Quantitative DNase footprint analysis indicated that O2 binding to alpha-coixin target sites is best described by a cooperative model. Transient expression assays showed that the two adjacent sites act synergistically. This synergy is mediated in part by cooperative DNA binding. In tobacco protoplasts, O2 binding at the O2u site is more important for enhancer activity than is binding at the O2d site, suggesting that the architecture of the O2-DNA complex is important for interaction with the transcriptional machinery. PMID:9811800

  10. Cooperative DNA binding and sequence discrimination by the Opaque2 bZIP factor.

    PubMed

    Yunes, J A; Vettore, A L; da Silva, M J; Leite, A; Arruda, P

    1998-11-01

    The maize Opaque2 (O2) protein is a basic leucine zipper transcription factor that controls the expression of distinct classes of endosperm genes through the recognition of different cis-acting elements in their promoters. The O2 target region in the promoter of the alpha-coixin gene was analyzed in detail and shown to comprise two closely adjacent binding sites, named O2u and O2d, which are related in sequence to the GCN4 binding site. Quantitative DNase footprint analysis indicated that O2 binding to alpha-coixin target sites is best described by a cooperative model. Transient expression assays showed that the two adjacent sites act synergistically. This synergy is mediated in part by cooperative DNA binding. In tobacco protoplasts, O2 binding at the O2u site is more important for enhancer activity than is binding at the O2d site, suggesting that the architecture of the O2-DNA complex is important for interaction with the transcriptional machinery.

  11. Position specific variation in the rate of evolution in transcription factor binding sites

    PubMed Central

    Moses, Alan M; Chiang, Derek Y; Kellis, Manolis; Lander, Eric S; Eisen, Michael B

    2003-01-01

    Background The binding sites of sequence specific transcription factors are an important and relatively well-understood class of functional non-coding DNAs. Although a wide variety of experimental and computational methods have been developed to characterize transcription factor binding sites, they remain difficult to identify. Comparison of non-coding DNA from related species has shown considerable promise in identifying these functional non-coding sequences, even though relatively little is known about their evolution. Results Here we analyse the genome sequences of the budding yeasts Saccharomyces cerevisiae, S. bayanus, S. paradoxus and S. mikatae to study the evolution of transcription factor binding sites. As expected, we find that both experimentally characterized and computationally predicted binding sites evolve slower than surrounding sequence, consistent with the hypothesis that they are under purifying selection. We also observe position-specific variation in the rate of evolution within binding sites. We find that the position-specific rate of evolution is positively correlated with degeneracy among binding sites within S. cerevisiae. We test theoretical predictions for the rate of evolution at positions where the base frequencies deviate from background due to purifying selection and find reasonable agreement with the observed rates of evolution. Finally, we show how the evolutionary characteristics of real binding motifs can be used to distinguish them from artefacts of computational motif finding algorithms. Conclusion As has been observed for protein sequences, the rate of evolution in transcription factor binding sites varies with position, suggesting that some regions are under stronger functional constraint than others. This variation likely reflects the varying importance of different positions in the formation of the protein-DNA complex. The characterization of the pattern of evolution in known binding sites will likely contribute to the effective use of comparative sequence data in the identification of transcription factor binding sites and is an important step toward understanding the evolution of functional non-coding DNA. PMID:12946282

  12. Hydrolysis at One of the Two Nucleotide-binding Sites Drives the Dissociation of ATP-binding Cassette Nucleotide-binding Domain Dimers

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zoghbi, M. E.; Altenberg, G. A.

    The functional unit of ATP-binding cassette (ABC) transporters consists of two transmembrane domains and two nucleotide-binding domains (NBDs). ATP binding elicits association of the two NBDs, forming a dimer in a head-to-tail arrangement, with two nucleotides “sandwiched” at the dimer interface. Each of the two nucleotide-binding sites is formed by residues from the two NBDs. We recently found that the prototypical NBD MJ0796 from Methanocaldococcus jannaschii dimerizes in response to ATP binding and dissociates completely following ATP hydrolysis. However, it is still unknown whether dissociation of NBD dimers follows ATP hydrolysis at one or both nucleotide-binding sites. Here, we usedmore » luminescence resonance energy transfer to study heterodimers formed by one active (donor-labeled) and one catalytically defective (acceptor-labeled) NBD. Rapid mixing experiments in a stop-flow chamber showed that NBD heterodimers with one functional and one inactive site dissociated at a rate indistinguishable from that of dimers with two hydrolysis-competent sites. Comparison of the rates of NBD dimer dissociation and ATP hydrolysis indicated that dissociation followed hydrolysis of one ATP. We conclude that ATP hydrolysis at one nucleotide-binding site drives NBD dimer dissociation.« less

  13. Functional asymmetry in the lysyl-tRNA synthetase explored by molecular dynamics, free energy calculations and experiment

    PubMed Central

    Hughes, Samantha J; Tanner, Julian A; Hindley, Alison D; Miller, Andrew D; Gould, Ian R

    2003-01-01

    Background Charging of transfer-RNA with cognate amino acid is accomplished by the aminoacyl-tRNA synthetases, and proceeds through an aminoacyl adenylate intermediate. The lysyl-tRNA synthetase has evolved an active site that specifically binds lysine and ATP. Previous molecular dynamics simulations of the heat-inducible Escherichia coli lysyl-tRNA synthetase, LysU, have revealed differences in the binding of ATP and aspects of asymmetry between the nominally equivalent active sites of this dimeric enzyme. The possibility that this asymmetry results in different binding affinities for the ligands is addressed here by a parallel computational and biochemical study. Results Biochemical experiments employing isothermal calorimetry, steady-state fluorescence and circular dichroism are used to determine the order and stoichiometries of the lysine and nucleotide binding events, and the associated thermodynamic parameters. An ordered mechanism of substrate addition is found, with lysine having to bind prior to the nucleotide in a magnesium dependent process. Two lysines are found to bind per dimer, and trigger a large conformational change. Subsequent nucleotide binding causes little structural rearrangement and crucially only occurs at a single catalytic site, in accord with the simulations. Molecular dynamics based free energy calculations of the ATP binding process are used to determine the binding affinities of each site. Significant differences in ATP binding affinities are observed, with only one active site capable of realizing the experimental binding free energy. Half-of-the-sites models in which the nucleotide is only present at one active site achieve their full binding potential irrespective of the subunit choice. This strongly suggests the involvement of an anti-cooperative mechanism. Pathways for relaying information between the two active sites are proposed. Conclusions The asymmetry uncovered here appears to be a common feature of oligomeric aminoacyl-tRNA synthetases, and may play an important functional role. We suggest a manner in which catalytic efficiency could be improved by LysU operating in an alternating sites mechanism. PMID:12787471

  14. Carbohydrate binding properties of the stinging nettle (Urtica dioica) rhizome lectin.

    PubMed

    Shibuya, N; Goldstein, I J; Shafer, J A; Peumans, W J; Broekaert, W F

    1986-08-15

    The interaction of the stinging nettle rhizome lectin (UDA) with carbohydrates was studied by using the techniques of quantitative precipitation, hapten inhibition, equilibrium dialysis, and uv difference spectroscopy. The Carbohydrate binding site of UDA was determined to be complementary to an N,N',N"-triacetylchitotriose unit and proposed to consist of three subsites, each of which has a slightly different binding specificity. UDA also has a hydrophobic interacting region adjacent to the carbohydrate binding site. Equilibrium dialysis and uv difference spectroscopy revealed that UDA has two carbohydrate binding sites per molecule consisting of a single polypeptide chain. These binding sites either have intrinsically different affinities for ligand molecules, or they may display negative cooperativity toward ligand binding.

  15. Statistical Profiling of One Promiscuous Protein Binding Site: Illustrated by Urokinase Catalytic Domain.

    PubMed

    Cerisier, Natacha; Regad, Leslie; Triki, Dhoha; Petitjean, Michel; Flatters, Delphine; Camproux, Anne-Claude

    2017-10-01

    While recent literature focuses on drug promiscuity, the characterization of promiscuous binding sites (ability to bind several ligands) remains to be explored. Here, we present a proteochemometric modeling approach to analyze diverse ligands and corresponding multiple binding sub-pockets associated with one promiscuous binding site to characterize protein-ligand recognition. We analyze both geometrical and physicochemical profile correspondences. This approach was applied to examine the well-studied druggable urokinase catalytic domain inhibitor binding site, which results in a large number of complex structures bound to various ligands. This approach emphasizes the importance of jointly characterizing pocket and ligand spaces to explore the impact of ligand diversity on sub-pocket properties and to establish their main profile correspondences. This work supports an interest in mining available 3D holo structures associated with a promiscuous binding site to explore its main protein-ligand recognition tendency. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. RBind: computational network method to predict RNA binding sites.

    PubMed

    Wang, Kaili; Jian, Yiren; Wang, Huiwen; Zeng, Chen; Zhao, Yunjie

    2018-04-26

    Non-coding RNA molecules play essential roles by interacting with other molecules to perform various biological functions. However, it is difficult to determine RNA structures due to their flexibility. At present, the number of experimentally solved RNA-ligand and RNA-protein structures is still insufficient. Therefore, binding sites prediction of non-coding RNA is required to understand their functions. Current RNA binding site prediction algorithms produce many false positive nucleotides that are distance away from the binding sites. Here, we present a network approach, RBind, to predict the RNA binding sites. We benchmarked RBind in RNA-ligand and RNA-protein datasets. The average accuracy of 0.82 in RNA-ligand and 0.63 in RNA-protein testing showed that this network strategy has a reliable accuracy for binding sites prediction. The codes and datasets are available at https://zhaolab.com.cn/RBind. yjzhaowh@mail.ccnu.edu.cn. Supplementary data are available at Bioinformatics online.

  17. Insulation and wiring specificity of BceR-like response regulators and their target promoters in Bacillus subtilis.

    PubMed

    Fang, Chong; Nagy-Staroń, Anna; Grafe, Martin; Heermann, Ralf; Jung, Kirsten; Gebhard, Susanne; Mascher, Thorsten

    2017-04-01

    BceRS and PsdRS are paralogous two-component systems in Bacillus subtilis controlling the response to antimicrobial peptides. In the presence of extracellular bacitracin and nisin, respectively, the two response regulators (RRs) bind their target promoters, P bceA or P psdA , resulting in a strong up-regulation of target gene expression and ultimately antibiotic resistance. Despite high sequence similarity between the RRs BceR and PsdR and their known binding sites, no cross-regulation has been observed between them. We therefore investigated the specificity determinants of P bceA and P psdA that ensure the insulation of these two paralogous pathways at the RR-promoter interface. In vivo and in vitro analyses demonstrate that the regulatory regions within these two promoters contain three important elements: in addition to the known (main) binding site, we identified a linker region and a secondary binding site that are crucial for functionality. Initial binding to the high-affinity, low-specificity main binding site is a prerequisite for the subsequent highly specific binding of a second RR dimer to the low-affinity secondary binding site. In addition to this hierarchical cooperative binding, discrimination requires a competition of the two RRs for their respective binding site mediated by only slight differences in binding affinities. © 2016 John Wiley & Sons Ltd.

  18. A novel substance P binding site in bovine adrenal medulla.

    PubMed

    Geraghty, D P; Livett, B G; Rogerson, F M; Burcher, E

    1990-05-04

    Radioligand binding techniques were used to characterize the substance P (SP) binding site on membranes prepared from bovine adrenal medullae. 125I-labelled Bolton-Hunter substance P (BHSP), which recognises the C-terminally directed, SP-preferring NK1 receptor, showed no specific binding. In contrast, binding of [3H]SP was saturable (at 6 nM) and reversible, with an equilibrium dissociation constant (Kd) 1.46 +/- 0.73 nM, Bmax 0.73 +/- 0.06 pmol/g wet weight and Hill coefficient 0.98 +/- 0.01. Specific binding of [3H]SP was displaced by SP greater than neurokinin A (NKA) greater than SP(3-11) approximately SP(1-9) greater than SP(1-7) approximately SP(1-4) approximately SP(1-6), with neurokinin B (NKB) and SP(1-3) very weak competitors and SP(5-11), SP(7-11) and SP(9-11) causing negligible inhibition (up to 10 microM). This potency order is quite distinct from that seen with binding to an NK1 site, a conclusion confirmed by the lack of BHSP binding. It appears that Lys3 and/or Pro4 are critical for binding, suggesting an anionic binding site. These data suggest the existence of an unusual binding site which may represent a novel SP receptor. This site appears to require the entire sequence of the SP molecule for full recognition.

  19. sigma opiates and certain antipsychotic drugs mutually inhibit (+)-(/sup 3/H)SKF 10,047 and (/sup 3/H)haloperidol binding in guinea pig brain membranes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tam, S.W.; Cook, L.

    1984-09-01

    The relationship between binding of antipsychotic drugs and sigma psychotomimetic opiates to binding sites for the sigma agonist (+)-(/sup 3/H)SKF 10,047 (N-allylnormetazocine) and to dopamine D/sub 2/ sites was investigated. In guinea pig brain membranes, (+)-(/sup 3/H)SKF 10,047 bound to single class of sites with a K/sub d/ of 4 x 10/sup -8/ M and a B/sub max/ of 333 fmol/mg of protein. This binding was different from ..mu.., kappa, or delta opiate receptor binding. It was inhibited by opiates that produce psychotomimetic activities but not by opiates that lack such activities. Some antipsychotic drugs inhibited (+)-(/sup 3/H)SKF 10,047 bindingmore » with high to moderate affinities in the following order of potency: haloperidol > perphenazine > fluphenazine > acetophenazine > trifluoperazine > molindone greater than or equal to pimozide greater than or equal to thioridazine greater than or equal to chlorpromazine greater than or equal to triflupromazine. However, there were other antipsychotic drugs such as spiperone and clozapine that showed low affinity for the (+)-(/sup 3/H)SKF 10,047 binding sites. Affinities of antipsychotic drugs for (+)-(/sup 3/H)SKF 10,047 binding sites did not correlate with those for (/sup 3/H)spiperone (dopamine D/sub 2/) sites. (/sup 3/H)-Haloperidol binding in whole brain membranes was also inhibited by the sigma opiates pentazocine, cyclazocine, and (+)-(/sup 3/H)SKF 10,047. In the striatum, about half of the saturable (/sup 3/H)haloperidol binding was to (/sup 3/H)spiperone (D/sub 2/) sites and the other half was to sites similar to (+)-(/sup 3/H)SKF 10,047 binding sites. 15 references, 4 figures, 1 table.« less

  20. Clotrimazole and efaroxan inhibit red cell Gardos channel independently of imidazoline I1 and I2 binding sites.

    PubMed

    Coupry, I; Armsby, C C; Alper, S L; Brugnara, C; Parini, A

    1996-01-04

    In the present report, we investigated the potential involvement of imidazoline I1 and I2 binding sites in the inhibition of the Ca(2+)-activated K+ channel (Gardos channel) by clotrimazole in human red cells. Ca(2+)-activated 86Rb influx was inhibited by clotrimazole and efaroxan but not by the imidazoline binding site ligands clonidine, moxonidine, cirazoline and idazoxan (100 microM). Binding studies with [3H]idazoxan and [3H]p-aminoclonidine did not reveal the expression of I1 and I2 binding sites in erythrocytes. These data indicate that the effects of clotrimazole and efaroxan on the erythrocyte Ca(2+)-activated K+ channel may be mediated by a 'non-I1/non-I2' binding site.

  1. Accurate and sensitive quantification of protein-DNA binding affinity.

    PubMed

    Rastogi, Chaitanya; Rube, H Tomas; Kribelbauer, Judith F; Crocker, Justin; Loker, Ryan E; Martini, Gabriella D; Laptenko, Oleg; Freed-Pastor, William A; Prives, Carol; Stern, David L; Mann, Richard S; Bussemaker, Harmen J

    2018-04-17

    Transcription factors (TFs) control gene expression by binding to genomic DNA in a sequence-specific manner. Mutations in TF binding sites are increasingly found to be associated with human disease, yet we currently lack robust methods to predict these sites. Here, we developed a versatile maximum likelihood framework named No Read Left Behind (NRLB) that infers a biophysical model of protein-DNA recognition across the full affinity range from a library of in vitro selected DNA binding sites. NRLB predicts human Max homodimer binding in near-perfect agreement with existing low-throughput measurements. It can capture the specificity of the p53 tetramer and distinguish multiple binding modes within a single sample. Additionally, we confirm that newly identified low-affinity enhancer binding sites are functional in vivo, and that their contribution to gene expression matches their predicted affinity. Our results establish a powerful paradigm for identifying protein binding sites and interpreting gene regulatory sequences in eukaryotic genomes. Copyright © 2018 the Author(s). Published by PNAS.

  2. Accurate and sensitive quantification of protein-DNA binding affinity

    PubMed Central

    Rastogi, Chaitanya; Rube, H. Tomas; Kribelbauer, Judith F.; Crocker, Justin; Loker, Ryan E.; Martini, Gabriella D.; Laptenko, Oleg; Freed-Pastor, William A.; Prives, Carol; Stern, David L.; Mann, Richard S.; Bussemaker, Harmen J.

    2018-01-01

    Transcription factors (TFs) control gene expression by binding to genomic DNA in a sequence-specific manner. Mutations in TF binding sites are increasingly found to be associated with human disease, yet we currently lack robust methods to predict these sites. Here, we developed a versatile maximum likelihood framework named No Read Left Behind (NRLB) that infers a biophysical model of protein-DNA recognition across the full affinity range from a library of in vitro selected DNA binding sites. NRLB predicts human Max homodimer binding in near-perfect agreement with existing low-throughput measurements. It can capture the specificity of the p53 tetramer and distinguish multiple binding modes within a single sample. Additionally, we confirm that newly identified low-affinity enhancer binding sites are functional in vivo, and that their contribution to gene expression matches their predicted affinity. Our results establish a powerful paradigm for identifying protein binding sites and interpreting gene regulatory sequences in eukaryotic genomes. PMID:29610332

  3. Rolling Circle Amplification For Spatially Directed Synthesis Of A Solid Phase Anchored Single-Stranded DNA Molecule

    NASA Astrophysics Data System (ADS)

    Reiß, Edda; Hölzel, Ralph; von Nickisch-Rosenegk, Markus; Bier, Frank F.

    2006-09-01

    In this article the usefulness of the enzyme phi29 DNA polymerase and the principle of rolling circle amplification (RCA) for creating single-stranded DNA (ssDNA) nanostructures is described. Currently we are working on the spatial orientation of a growing ssDNA molecule during its RCA-based synthesis by the application of a hydrodynamic force. Starting at an immobilized primer at single molecule level, the aim is to construct a nanostructure of known location and orientation, providing multiple repeating binding sites that can be addressed via complementary base-pairing. Proof-of-principle experiments demonstrate the potential of the enzymatic reaction. ssDNA molecules of more than 20 μm length were created at an immobilized primer and detected by means of fluorescence microscopy.

  4. DISTINCT ROLES OF β1 MIDAS, ADMIDAS AND LIMBS CATION-BINDING SITES IN LIGAND RECOGNITION BY INTEGRIN α2β1*

    PubMed Central

    Valdramidou, Dimitra; Humphries, Martin J.; Mould, A. Paul

    2012-01-01

    Integrin-ligand interactions are regulated in a complex manner by divalent cations, and previous studies have identified ligand-competent, stimulatory, and inhibitory cation-binding sites. In collagen-binding integrins, such as α2β1, ligand recognition takes place exclusively at the α subunit I domain. However, activation of the αI domain depends on its interaction with a structurally similar domain in the β subunit known as the I-like or βI domain. The top face of the βI domain contains three cation-binding sites: the metal-ion dependent adhesion site (MIDAS), the ADMIDAS (adjacent to MIDAS) and LIMBS (ligand-associated metal binding site). The role of these sites in controlling ligand binding to the αI domain has yet to be elucidated. Mutation of the MIDAS or LIMBS completely blocked collagen binding to α2β1; in contrast mutation of the ADMIDAS reduced ligand recognition but this effect could be overcome by the activating mAb TS2/16. Hence, the MIDAS and LIMBS appear to be essential for the interaction between αI and βI whereas occupancy of the ADMIDAS has an allosteric effect on the conformation of βI. An activating mutation in the α2 I domain partially restored ligand binding to the MIDAS and LIMBS mutants. Analysis of the effects of Ca2+, Mg2+ and Mn2+ on ligand binding to these mutants showed that the MIDAS is a ligand-competent site through which Mn2+ stimulates ligand binding, whereas the LIMBS is a stimulatory Ca2+-binding site, occupancy of which increases the affinity of Mg2+ for the MIDAS. PMID:18820259

  5. Insight into the binding mechanism of imipenem to human serum albumin by spectroscopic and computational approaches.

    PubMed

    Rehman, Md Tabish; Shamsi, Hira; Khan, Asad U

    2014-06-02

    The mechanism of interaction between imipenem and HSA was investigated by various techniques like fluorescence, UV.vis absorbance, FRET, circular dichroism, urea denaturation, enzyme kinetics, ITC, and molecular docking. We found that imipenem binds to HSA at a high affinity site located in subdomain IIIA (Sudlow's site I) and a low affinity site located in subdomain IIA.IIB. Electrostatic interactions played a vital role along with hydrogen bonding and hydrophobic interactions in stabilizing the imipenem.HSA complex at subdomain IIIA, while only electrostatic and hydrophobic interactions were present at subdomain IIA.IIB. The binding and thermodynamic parameters obtained by ITC showed that the binding of imipenem to HSA was a spontaneous process (ΔGD⁰(D)= -32.31 kJ mol(-1) for high affinity site and ΔGD⁰(D) = -23.02 kJ mol(-1) for low affinity site) with binding constants in the range of 10(4)-10(5) M(-1). Spectroscopic investigation revealed only one binding site of imipenem on HSA (Ka∼10(4) M(-1)). FRET analysis showed that the binding distance between imipenem and HSA (Trp-214) was optimal (r = 4.32 nm) for quenching to occur. Decrease in esterase-like activity of HSA in the presence of imipenem showed that Arg-410 and Tyr-411 of subdomain IIIA (Sudlow's site II) were directly involved in the binding process. CD spectral analysis showed altered conformation of HSA upon imipenem binding. Moreover, the binding of imipenem to subdomain IIIA (Sudlow's site II) of HSA also affected its folding pathway as clear from urea-induced denaturation studies.

  6. Direct optical mapping of transcription factor binding sites on field-stretched λ-DNA in nanofluidic devices

    PubMed Central

    Sriram, K. K.; Yeh, Jia-Wei; Lin, Yii-Lih; Chang, Yi-Ren; Chou, Chia-Fu

    2014-01-01

    Mapping transcription factor (TF) binding sites along a DNA backbone is crucial in understanding the regulatory circuits that control cellular processes. Here, we deployed a method adopting bioconjugation, nanofluidic confinement and fluorescence single molecule imaging for direct mapping of TF (RNA polymerase) binding sites on field-stretched single DNA molecules. Using this method, we have mapped out five of the TF binding sites of E. coli RNA polymerase to bacteriophage λ-DNA, where two promoter sites and three pseudo-promoter sites are identified with the corresponding binding frequency of 45% and 30%, respectively. Our method is quick, robust and capable of resolving protein-binding locations with high accuracy (∼ 300 bp), making our system a complementary platform to the methods currently practiced. It is advantageous in parallel analysis and less prone to false positive results over other single molecule mapping techniques such as optical tweezers, atomic force microscopy and molecular combing, and could potentially be extended to general mapping of protein–DNA interaction sites. PMID:24753422

  7. Follicle-stimulating hormone (FSH) unmasks specific high affinity FSH-binding sites in cell-free membrane preparations of porcine granulosa cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ford, K.A.; LaBarbera, A.R.

    1988-11-01

    The purpose of these studies was to determine whether changes in FSH receptors correlated with FSH-induced attenuation of FSH-responsive adenylyl cyclase in immature porcine granulosa cells. Cells were incubated with FSH (1-1000 ng/ml) for up to 24 h, treated with acidified medium (pH 3.5) to remove FSH bound to cells, and incubated with (125I)iodo-porcine FSH to quantify FSH-binding sites. FSH increased binding of FSH in a time-, temperature-, and FSH concentration-dependent manner. FSH (200 ng/ml) increased binding approximately 4-fold within 16 h. Analysis of equilibrium saturation binding data indicated that the increase in binding sites reflected a 2.3-fold increase inmore » receptor number and a 5.4-fold increase in apparent affinity. The increase in binding did not appear to be due to 1) a decrease in receptor turnover, since the basal rate of turnover appeared to be very slow; 2) an increase in receptor synthesis, since agents that inhibit protein synthesis and glycosylation did not block the increase in binding; or 3) an increase in intracellular receptors, since agents that inhibit cytoskeletal components had no effect. Agents that increase intracellular cAMP did not affect FSH binding. The increase in binding appeared to result from unmasking of cryptic FSH-binding sites, since FSH increased binding in cell-free membrane preparations to the same extent as in cells. Unmasking of cryptic sites was hormone specific, and the sites bound FSH specifically. Unmasking of sites was reversible in a time- and temperature-dependent manner after removal of bound FSH. The similarity between the FSH dose-response relationships for unmasking of FSH-binding sites and attenuation of FSH-responsive cAMP production suggests that the two processes are functionally linked.« less

  8. Molecular simulations and Markov state modeling reveal the structural diversity and dynamics of a theophylline-binding RNA aptamer in its unbound state

    PubMed Central

    Warfield, Becka M.

    2017-01-01

    RNA aptamers are oligonucleotides that bind with high specificity and affinity to target ligands. In the absence of bound ligand, secondary structures of RNA aptamers are generally stable, but single-stranded and loop regions, including ligand binding sites, lack defined structures and exist as ensembles of conformations. For example, the well-characterized theophylline-binding aptamer forms a highly stable binding site when bound to theophylline, but the binding site is unstable and disordered when theophylline is absent. Experimental methods have not revealed at atomic resolution the conformations that the theophylline aptamer explores in its unbound state. Consequently, in the present study we applied 21 microseconds of molecular dynamics simulations to structurally characterize the ensemble of conformations that the aptamer adopts in the absence of theophylline. Moreover, we apply Markov state modeling to predict the kinetics of transitions between unbound conformational states. Our simulation results agree with experimental observations that the theophylline binding site is found in many distinct binding-incompetent states and show that these states lack a binding pocket that can accommodate theophylline. The binding-incompetent states interconvert with binding-competent states through structural rearrangement of the binding site on the nanosecond to microsecond timescale. Moreover, we have simulated the complete theophylline binding pathway. Our binding simulations supplement prior experimental observations of slow theophylline binding kinetics by showing that the binding site must undergo a large conformational rearrangement after the aptamer and theophylline form an initial complex, most notably, a major rearrangement of the C27 base from a buried to solvent-exposed orientation. Theophylline appears to bind by a combination of conformational selection and induced fit mechanisms. Finally, our modeling indicates that when Mg2+ ions are present the population of binding-competent aptamer states increases more than twofold. This population change, rather than direct interactions between Mg2+ and theophylline, accounts for altered theophylline binding kinetics. PMID:28437473

  9. The gammaPE complex contains both SATB1 and HOXB2 and has positive and negative roles in human gamma-globin gene regulation.

    PubMed

    Case, S S; Huber, P; Lloyd, J A

    1999-11-01

    A large nuclear protein complex, termed gammaPE (for gamma-globin promoter and enhancer binding factor), binds to five sites located 5' and 3' of the human y-globin gene. Two proteins, SATB1 (special A-T-rich binding protein 1) and HOXB2, can bind to yPE binding sites. SATB1 binds to nuclear matrix-attachment sites, and HOXB2 is a homeodomain protein important in neural development that is also expressed during erythropoiesis. The present work showed that antisera directed against either SATB1 or HOXB2 reacted specifically with the entire gammaPE complex in electrophoretic mobility shift assays (EMSAs), suggesting that the two proteins can bind to the gammaPE binding site simultaneously. When SATB1 or HOXB2 was expressed in vitro, they could bind independently to gammaPE binding sites in EMSA. Interestingly, the proteins expressed in vitro competed effectively with each other for the gammaPE binding site, suggesting that this may occur under certain conditions in vivo. Transient cotransfections of a HOXB2 cDNA and a y-globin-luciferase reporter gene construct into cells expressing SATB1 suggested that SATB1 has a positive and HOXB2 a negative regulatory effect on transcription. Taking into account their potentially opposing effects and binding activities, SATB1 and HOXB2 may modulate the amount of gamma-globin mRNA expressed during development and differentiation.

  10. Antagonism of human CC-chemokine receptor 4 can be achieved through three distinct binding sites on the receptor

    PubMed Central

    Slack, Robert J; Russell, Linda J; Barton, Nick P; Weston, Cathryn; Nalesso, Giovanna; Thompson, Sally-Anne; Allen, Morven; Chen, Yu Hua; Barnes, Ashley; Hodgson, Simon T; Hall, David A

    2013-01-01

    Chemokine receptor antagonists appear to access two distinct binding sites on different members of this receptor family. One class of CCR4 antagonists has been suggested to bind to a site accessible from the cytoplasm while a second class did not bind to this site. In this report, we demonstrate that antagonists representing a variety of structural classes bind to two distinct allosteric sites on CCR4. The effects of pairs of low-molecular weight and/or chemokine CCR4 antagonists were evaluated on CCL17- and CCL22-induced responses of human CCR4+ T cells. This provided an initial grouping of the antagonists into sets which appeared to bind to distinct binding sites. Binding studies were then performed with radioligands from each set to confirm these groupings. Some novel receptor theory was developed to allow the interpretation of the effects of the antagonist combinations. The theory indicates that, generally, the concentration-ratio of a pair of competing allosteric modulators is maximally the sum of their individual effects while that of two modulators acting at different sites is likely to be greater than their sum. The low-molecular weight antagonists could be grouped into two sets on the basis of the functional and binding experiments. The antagonistic chemokines formed a third set whose behaviour was consistent with that of simple competitive antagonists. These studies indicate that there are two allosteric regulatory sites on CCR4. PMID:25505571

  11. BindML/BindML+: Detecting Protein-Protein Interaction Interface Propensity from Amino Acid Substitution Patterns.

    PubMed

    Wei, Qing; La, David; Kihara, Daisuke

    2017-01-01

    Prediction of protein-protein interaction sites in a protein structure provides important information for elucidating the mechanism of protein function and can also be useful in guiding a modeling or design procedures of protein complex structures. Since prediction methods essentially assess the propensity of amino acids that are likely to be part of a protein docking interface, they can help in designing protein-protein interactions. Here, we introduce BindML and BindML+ protein-protein interaction sites prediction methods. BindML predicts protein-protein interaction sites by identifying mutation patterns found in known protein-protein complexes using phylogenetic substitution models. BindML+ is an extension of BindML for distinguishing permanent and transient types of protein-protein interaction sites. We developed an interactive web-server that provides a convenient interface to assist in structural visualization of protein-protein interactions site predictions. The input data for the web-server are a tertiary structure of interest. BindML and BindML+ are available at http://kiharalab.org/bindml/ and http://kiharalab.org/bindml/plus/ .

  12. Hydration in drug design. 3. Conserved water molecules at the ligand-binding sites of homologous proteins

    NASA Astrophysics Data System (ADS)

    Poornima, C. S.; Dean, P. M.

    1995-12-01

    Water molecules are known to play an important rôle in mediating protein-ligand interactions. If water molecules are conserved at the ligand-binding sites of homologous proteins, such a finding may suggest the structural importance of water molecules in ligand binding. Structurally conserved water molecules change the conventional definition of `binding sites' by changing the shape and complementarity of these sites. Such conserved water molecules can be important for site-directed ligand/drug design. Therefore, five different sets of homologous protein/protein-ligand complexes have been examined to identify the conserved water molecules at the ligand-binding sites. Our analysis reveals that there are as many as 16 conserved water molecules at the FAD binding site of glutathione reductase between the crystal structures obtained from human and E. coli. In the remaining four sets of high-resolution crystal structures, 2-4 water molecules have been found to be conserved at the ligand-binding sites. The majority of these conserved water molecules are either bound in deep grooves at the protein-ligand interface or completely buried in cavities between the protein and the ligand. All these water molecules, conserved between the protein/protein-ligand complexes from different species, have identical or similar apolar and polar interactions in a given set. The site residues interacting with the conserved water molecules at the ligand-binding sites have been found to be highly conserved among proteins from different species; they are more conserved compared to the other site residues interacting with the ligand. These water molecules, in general, make multiple polar contacts with protein-site residues.

  13. Altered binding of thioflavin t to the peripheral anionic site of acetylcholinesterase after phosphorylation of the active site by chlorpyrifos oxon or dichlorvos

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sultatos, L.G.; Kaushik, R.

    2008-08-01

    The peripheral anionic site of acetylcholinesterase, when occupied by a ligand, is known to modulate reaction rates at the active site of this important enzyme. The current report utilized the peripheral anionic site specific fluorogenic probe thioflavin t to determine if the organophosphates chlorpyrifos oxon and dichlorvos bind to the peripheral anionic site of human recombinant acetylcholinesterase, since certain organophosphates display concentration-dependent kinetics when inhibiting this enzyme. Incubation of 3 nM acetylcholinesterase active sites with 50 nM or 2000 nM inhibitor altered both the B{sub max} and K{sub d} for thioflavin t binding to the peripheral anionic site. However, thesemore » changes resulted from phosphorylation of Ser203 since increasing either inhibitor from 50 nM to 2000 nM did not alter further thioflavin t binding kinetics. Moreover, the organophosphate-induced decrease in B{sub max} did not represent an actual reduction in binding sites, but instead likely resulted from conformational interactions between the acylation and peripheral anionic sites that led to a decrease in the rigidity of bound thioflavin t. A drop in fluorescence quantum yield, leading to an apparent decrease in B{sub max}, would accompany the decreased rigidity of bound thioflavin t molecules. The organophosphate-induced alterations in K{sub d} represented changes in binding affinity of thioflavin t, with diethylphosphorylation of Ser203 increasing K{sub d}, and dimethylphosphorylation of Ser203 decreasing K{sub d}. These results indicate that chlorpyrifos oxon and dichlorvos do not bind directly to the peripheral anionic site of acetylcholinesterase, but can affect binding to that site through phosphorylation of Ser203.« less

  14. Directed assembly of binary monolayers with a high protein affinity: infrared reflection absorption spectroscopy (IRRAS) and surface plasmon resonance (SPR).

    PubMed

    Du, Xuezhong; Wang, Yuchun

    2007-03-08

    Infrared reflection absorption spectroscopy (IRRAS) and surface plasmon resonance (SPR) techniques have been employed to investigate human serum albumin (HSA) binding to binary monolayers of zwitterionic dipalmitoylphosphatidylcholine (DPPC) and cationic dioctadecyldimethylammonium bromide (DOMA). At the air-water interface, the favorable electrostatic interaction between DPPC and DOMA leads to a dense chain packing. The tilt angle of the hydrocarbon chains decreases with increasing mole fraction of DOMA (X(DOMA)) in the monolayers at the surface pressure 30 mN/m: DPPC ( approximately 30 degrees ), X(DOMA) = 0.1 ( approximately 15 degrees ), and X(DOMA) = 0.3 ( approximately 0 degrees ). Negligible protein binding to the DPPC monolayer is observed in contrast to a significant binding to the binary monolayers. After HSA binding, the hydrocarbon chains at X(DOMA) = 0.1 undergo an increase in tilt angle from 15 degrees to 25 approximately 30 degrees , and the chains at X(DOMA) = 0.3 remain almost unchanged. The two components in the monolayers deliver through lateral reorganization, induced by the protein in the subphase, to form multiple interaction sites favorable for protein binding. The surfaces with a high protein affinity are created through the directed assembly of binary monolayers for use in biosensing.

  15. The Binding of Silibinin, the Main Constituent of Silymarin, to Site I on Human Serum Albumin.

    PubMed

    Yamasaki, Keishi; Sato, Hiroki; Minagoshi, Saori; Kyubun, Karin; Anraku, Makoto; Miyamura, Shigeyuki; Watanabe, Hiroshi; Taguchi, Kazuaki; Seo, Hakaru; Maruyama, Toru; Otagiri, Masaki

    2017-01-01

    Silibinin is the main constituent of silymarin, an extract from the seeds of milk thistle (Silybum marianum). Because silibinin has many pharmacological activities, extending its clinical use in the treatment of a wider variety of diseases would be desirable. In this study, we report on the binding of silibinin to plasma proteins, an issue that has not previously been extensively studied. The findings indicated that silibinin mainly binds to human serum albumin (HSA). Mutual displacement experiments using ligands that primarily bind to sites I and II clearly revealed that silibinin binds tightly and selectively to site I (subsites Ia and/or Ic) of HSA, which is located in subdomain IIA. Thermodynamic analyses suggested that hydrogen bonding and van der Waals interactions are major contributors to silibinin-HSA interactions. Furthermore, the binding of silibinin to HSA was found to be decreased with increasing ionic strength and detergent concentration of the media, suggesting that electrostatic and hydrophobic interactions are involved in the binding. Trp214 and Arg218 were identified as being involved in the binding of silibinin to site I, based on binding experiments using chemically modified- and mutant-HSAs. In conclusion, the available evidence indicates that silibinin binds to the region close to Trp214 and Arg218 in site I of HSA with assistance by multiple forces and can displace site I drugs (e.g., warfarin or iodipamide), but not site II drugs (e.g., ibuprofen).

  16. Characterization and localization of arginine vasotocin receptors in the brain and kidney of an amphibian

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Boyd, S.K.

    1987-01-01

    Because arginine vasotocin (AVT) activates male sexual behaviors in the rough-skinned newt (Taricha granulosa), quantitative autoradiography with radiolabeled arginine vasopressin (/sup 3/H-AVP) was used to localize and characterize putative AVT receptors in the brain of this amphibian. Binding of /sup 3/H-AVP to sites within the medial pallium was saturable, specific, reversible, of high affinity and low capacity. These binding sites appear to represent authentic central nervous system receptors for AVT. Furthermore, ligand specificity for the binding sites in this amphibian differs from that reported for AVP binding sites in rat brains. Dense concentrations of specific binding sites were located inmore » the olfactory nerve as it entered the olfactory bulb within the medial pallium, dorsal pallium, and amygdala pars lateralis of the telencephalon, and in the tegmental region of the medulla. Concentrations of binding sites differed significantly among various brain regions. A comparison of male and female newts collected during the breeding season revealed no sexual dimorphism. These areas may represent site(s) of action where AVT elicits sexual behaviors in male T. granulosa.« less

  17. sc-PDB: a database for identifying variations and multiplicity of 'druggable' binding sites in proteins.

    PubMed

    Meslamani, Jamel; Rognan, Didier; Kellenberger, Esther

    2011-05-01

    The sc-PDB database is an annotated archive of druggable binding sites extracted from the Protein Data Bank. It contains all-atoms coordinates for 8166 protein-ligand complexes, chosen for their geometrical and physico-chemical properties. The sc-PDB provides a functional annotation for proteins, a chemical description for ligands and the detailed intermolecular interactions for complexes. The sc-PDB now includes a hierarchical classification of all the binding sites within a functional class. The sc-PDB entries were first clustered according to the protein name indifferent of the species. For each cluster, we identified dissimilar sites (e.g. catalytic and allosteric sites of an enzyme). SCOPE AND APPLICATIONS: The classification of sc-PDB targets by binding site diversity was intended to facilitate chemogenomics approaches to drug design. In ligand-based approaches, it avoids comparing ligands that do not share the same binding site. In structure-based approaches, it permits to quantitatively evaluate the diversity of the binding site definition (variations in size, sequence and/or structure). The sc-PDB database is freely available at: http://bioinfo-pharma.u-strasbg.fr/scPDB.

  18. Screening Mixtures of Small Molecules for Binding to Multiple Sites on the Surface Tetanus Toxin C Fragment by Bioaffinity NMR

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cosman, M; Zeller, L; Lightstone, F C

    2002-01-01

    The clostridial neurotoxins include the closely related tetanus (TeNT) and botulinum (BoNT) toxins. Botulinum toxin is used to treat severe muscle disorders and as a cosmetic wrinkle reducer. Large quantities of botulinum toxin have also been produced by terrorists for use as a biological weapon. Because there are no known antidotes for these toxins, they thus pose a potential threat to human health whether by an accidental overdose or by a hostile deployment. Thus, the discovery of high specificity and affinity compounds that can inhibit their binding to neural cells can be used as antidotes or in the design ofmore » chemical detectors. Using the crystal structure of the C fragment of the tetanus toxin (TetC), which is the cell recognition and cell surface binding domain, and the computational program DOCK, sets of small molecules have been predicted to bind to two different sites located on the surface of this protein. While Site-1 is common to the TeNT and BoNTs, Site-2 is unique to TeNT. Pairs of these molecules from each site can then be linked together synthetically to thereby increase the specificity and affinity for this toxin. Electrospray ionization mass spectroscopy was used to experimentally screen each compound for binding. Mixtures containing binders were further screened for activity under biologically relevant conditions using nuclear magnetic resonance (NMR) methods. The screening of mixtures of compounds offers increased efficiency and throughput as compared to testing single compounds and can also evaluate how possible structural changes induced by the binding of one ligand can influence the binding of the second ligand. In addition, competitive binding experiments with mixtures containing ligands predicted to bind the same site could identify the best binder for that site. NMR transfer nuclear Overhauser effect (trNOE) confirm that TetC binds doxorubicin but that this molecule is displaced by N-acetylneuraminic acid (sialic acid) in a mixture that also contains 3-sialyllactose (another predicted site 1 binder) and bisbenzimide 33342 (non-binder). A series of five predicted Site-2 binders were then screened sequentially in the presence of the Site-1 binder doxorubicin. These experiments showed that the compounds lavendustin A and naphthofluorescein-di-({beta}-D-galactopyranoside) binds along with doxorubicin to TetC. Further experiments indicate that doxorubicin and lavendustin are potential candidates to use in preparing a bidendate inhibitor specific for TetC. The simultaneous binding of two different predicted Site-2 ligands to TetC suggests that they may bind multiple sites. Another possibility is that the conformations of the binding sites are dynamic and can bind multiple diverse ligands at a single site depending on the pre-existing conformation of the protein, especially when doxorubicin is already bound.« less

  19. Ap4A and ADP-beta-S binding to P2 purinoceptors present on rat brain synaptic terminals.

    PubMed Central

    Pintor, J.; Díaz-Rey, M. A.; Miras-Portugal, M. T.

    1993-01-01

    1. Diadenosine tetraphosphate (Ap4A) a dinucleotide stored and released from rat brain synaptic terminals presents two types of affinity binding sites in synaptosomes. When [3H]-Ap4A was used for binding studies a Kd value of 0.10 +/- 0.014 nM and a Bmax value of 16.6 +/- 1.2 fmol mg-1 protein were obtained for the high affinity binding site from the Scatchard analysis. The second binding site, obtained by displacement studies, showed a Ki value of 0.57 +/- 0.09 microM. 2. Displacement of [3H]-Ap4A by non-labelled Ap4A and P2-purinoceptor ligands showed a displacement order of Ap4A > adenosine 5'-O-(2-thiodiphosphate) (ADP-beta-S) > 5'-adenylyl-imidodiphosphate (AMP-PNP) > alpha,beta-methylene adenosine 5'-triphosphate (alpha,beta-MeATP) in both sites revealed by the Ki values of 0.017 nM, 0.030 nM, 0.058 nM and 0.147 nM respectively for the high affinity binding site and values of 0.57 microM, 0.87 microM, 2.20 microM and 4.28 microM respectively for the second binding site. 3. Studies of the P2-purinoceptors present in synaptosomes were also performed with [35S]-ADP-beta-S. This radioligand showed two binding sites the first with Kd and Bmax values of 0.11 +/- 0.022 nM and 3.9 +/- 2.1 fmol mg-1 of protein respectively for the high affinity binding site obtained from the Scatchard plot. The second binding site showed a Ki of 0.018 +/- 0.0035 microM obtained from displacement curves. 4. Competition studies with diadenosine polyphosphates of [35S]-ADP-beta-S binding showed a displacement order of Ap4A > Ap5A > Ap6A in the high affinity binding site and Ki values of 0.023 nM, 0.081 nM and 5.72 nM respectively.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:8485620

  20. Influence of sulfhydryl sites on metal binding by bacteria

    NASA Astrophysics Data System (ADS)

    Nell, Ryan M.; Fein, Jeremy B.

    2017-02-01

    The role of sulfhydryl sites within bacterial cell envelopes is still unknown, but the sites may control the fate and bioavailability of metals. Organic sulfhydryl compounds are important complexing ligands in aqueous systems and they can influence metal speciation in natural waters. Though representing only approximately 5-10% of the total available binding sites on bacterial surfaces, sulfhydryl sites exhibit high binding affinities for some metals. Due to the potential importance of bacterial sulfhydryl sites in natural systems, metal-bacterial sulfhydryl site binding constants must be determined in order to construct accurate models of the fate and distribution of metals in these systems. To date, only Cd-sulfhydryl binding has been quantified. In this study, the thermodynamic stabilities of Mn-, Co-, Ni-, Zn-, Sr- and Pb-sulfhydryl bacterial cell envelope complexes were determined for the bacterial species Shewanella oneidensis MR-1. Metal adsorption experiments were conducted as a function of both pH, ranging from 5.0 to 7.0, and metal loading, from 0.5 to 40.0 μmol/g (wet weight) bacteria, in batch experiments in order to determine if metal-sulfhydryl binding occurs. Initially, the data were used to calculate the value of the stability constants for the important metal-sulfhydryl bacterial complexes for each metal-loading condition studied, assuming a single binding reaction for the dominant metal-binding site type under the pH conditions of the experiments. For most of the metals that we studied, these calculated stability constant values increased significantly with decreasing metal loading, strongly suggesting that our initial assumption was not valid and that more than one type of binding occurs at the assumed binding site. We then modeled each dataset with two distinct site types with identical acidity constants: one site with a high metal-site stability constant value, which we take to represent metal-sulfhydryl binding and which dominates under low metal loading conditions, and another more abundant site that we term non-sulfhydryl sites that becomes important at high metal loadings. The resulting calculated stability constants do not vary significantly as a function of metal loading and yield reasonable fits to the observed adsorption behaviors as a function of both pH and metal loading. We use the results to calculate the speciation of metals bound by the bacterial envelope in realistic bacteria-bearing, heavy metal contaminated systems in order to demonstrate the potential importance of metal-sulfhydryl binding in the budget of bacterially-adsorbed metals under low metal-loading conditions.

  1. Discovery of the ammonium substrate site on glutamine synthetase, a third cation binding site.

    PubMed Central

    Liaw, S. H.; Kuo, I.; Eisenberg, D.

    1995-01-01

    Glutamine synthetase (GS) catalyzes the ATP-dependent condensation of ammonia and glutamate to yield glutamine, ADP, and inorganic phosphate in the presence of divalent cations. Bacterial GS is an enzyme of 12 identical subunits, arranged in two rings of 6, with the active site between each pair of subunits in a ring. In earlier work, we have reported the locations within the funnel-shaped active site of the substrates glutamate and ATP and of the two divalent cations, but the site for ammonia (or ammonium) has remained elusive. Here we report the discovery by X-ray crystallography of a binding site on GS for monovalent cations, Tl+ and Cs+, which is probably the binding site for the substrate ammonium ion. Fourier difference maps show the following. (1) Tl+ and Cs+ bind at essentially the same site, with ligands being Glu 212, Tyr 179, Asp 50', Ser 53' of the adjacent subunit, and the substrate glutamate. From its position adjacent to the substrate glutamate and the cofactor ADP, we propose that this monovalent cation site is the substrate ammonium ion binding site. This proposal is supported by enzyme kinetics. Our kinetic measurements show that Tl+, Cs+, and NH4+ are competitive inhibitors to NH2OH in the gamma-glutamyl transfer reaction. (2) GS is a trimetallic enzyme containing two divalent cation sites (n1, n2) and one monovalent cation site per subunit. These three closely spaced ions are all at the active site: the distance between n1 and n2 is 6 A, between n1 and Tl+ is 4 A, and between n2 and Tl+ is 7 A. Glu 212 and the substrate glutamate are bridging ligands for the n1 ion and Tl+. (3) The presence of a monovalent cation in this site may enhance the structural stability of GS, because of its effect of balancing the negative charges of the substrate glutamate and its ligands and because of strengthening the "side-to-side" intersubunit interaction through the cation-protein bonding. (4) The presence of the cofactor ADP increases the Tl+ binding to GS because ADP binding induces movement of Asp 50' toward this monovalent cation site, essentially forming the site. This observation supports a two-step mechanism with ordered substrate binding: ATP first binds to GS, then Glu binds and attacks ATP to form gamma-glutamyl phosphate and ADP, which complete the ammonium binding site. The third substrate, an ammonium ion, then binds to GS, and then loses a proton to form the more active species ammonia, which attacks the gamma-glutamyl phosphate to yield Gln. (5) Because the products (Glu or Gln) of the reactions catalyzed by GS are determined by the molecule (water or ammonium) attacking the intermediate gamma-glutamyl phosphate, this negatively charged ammonium binding pocket has been designed naturally for high affinity of ammonium to GS, permitting glutamine synthesis to proceed in aqueous solution. PMID:8563633

  2. RNA binding protein and binding site useful for expression of recombinant molecules

    DOEpatents

    Mayfield, Stephen P.

    2006-10-17

    The present invention relates to a gene expression system in eukaryotic and prokaryotic cells, preferably plant cells and intact plants. In particular, the invention relates to an expression system having a RB47 binding site upstream of a translation initiation site for regulation of translation mediated by binding of RB47 protein, a member of the poly(A) binding protein family. Regulation is further effected by RB60, a protein disulfide isomerase. The expression system is capable of functioning in the nuclear/cytoplasm of cells and in the chloroplast of plants. Translation regulation of a desired molecule is enhanced approximately 100 fold over that obtained without RB47 binding site activation.

  3. RNA binding protein and binding site useful for expression of recombinant molecules

    DOEpatents

    Mayfield, Stephen

    2000-01-01

    The present invention relates to a gene expression system in eukaryotic and prokaryotic cells, preferably plant cells and intact plants. In particular, the invention relates to an expression system having a RB47 binding site upstream of a translation initiation site for regulation of translation mediated by binding of RB47 protein, a member of the poly(A) binding protein family. Regulation is further effected by RB60, a protein disulfide isomerase. The expression system is capable of functioning in the nuclear/cytoplasm of cells and in the chloroplast of plants. Translation regulation of a desired molecule is enhanced approximately 100 fold over that obtained without RB47 binding site activation.

  4. Web-accessible molecular modeling with Rosetta: The Rosetta Online Server that Includes Everyone (ROSIE).

    PubMed

    Moretti, Rocco; Lyskov, Sergey; Das, Rhiju; Meiler, Jens; Gray, Jeffrey J

    2018-01-01

    The Rosetta molecular modeling software package provides a large number of experimentally validated tools for modeling and designing proteins, nucleic acids, and other biopolymers, with new protocols being added continually. While freely available to academic users, external usage is limited by the need for expertise in the Unix command line environment. To make Rosetta protocols available to a wider audience, we previously created a web server called Rosetta Online Server that Includes Everyone (ROSIE), which provides a common environment for hosting web-accessible Rosetta protocols. Here we describe a simplification of the ROSIE protocol specification format, one that permits easier implementation of Rosetta protocols. Whereas the previous format required creating multiple separate files in different locations, the new format allows specification of the protocol in a single file. This new, simplified protocol specification has more than doubled the number of Rosetta protocols available under ROSIE. These new applications include pK a determination, lipid accessibility calculation, ribonucleic acid redesign, protein-protein docking, protein-small molecule docking, symmetric docking, antibody docking, cyclic toxin docking, critical binding peptide determination, and mapping small molecule binding sites. ROSIE is freely available to academic users at http://rosie.rosettacommons.org. © 2017 The Protein Society.

  5. Acceleration of Binding Site Comparisons by Graph Partitioning.

    PubMed

    Krotzky, Timo; Klebe, Gerhard

    2015-08-01

    The comparison of protein binding sites is a prominent task in computational chemistry and has been studied in many different ways. For the automatic detection and comparison of putative binding cavities the Cavbase system has been developed which uses a coarse-grained set of pseudocenters to represent the physicochemical properties of a binding site and employs a graph-based procedure to calculate similarities between two binding sites. However, the comparison of two graphs is computationally quite demanding which makes large-scale studies such as the rapid screening of entire databases hardly feasible. In a recent work, we proposed the method Local Cliques (LC) for the efficient comparison of Cavbase binding sites. It employs a clique heuristic to detect the maximum common subgraph of two binding sites and an extended graph model to additionally compare the shape of individual surface patches. In this study, we present an alternative to further accelerate the LC method by partitioning the binding-site graphs into disjoint components prior to their comparisons. The pseudocenter sets are split with regard to their assigned phyiscochemical type, which leads to seven much smaller graphs than the original one. Applying this approach on the same test scenarios as in the former comprehensive way results in a significant speed-up without sacrificing accuracy. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. GenProBiS: web server for mapping of sequence variants to protein binding sites.

    PubMed

    Konc, Janez; Skrlj, Blaz; Erzen, Nika; Kunej, Tanja; Janezic, Dusanka

    2017-07-03

    Discovery of potentially deleterious sequence variants is important and has wide implications for research and generation of new hypotheses in human and veterinary medicine, and drug discovery. The GenProBiS web server maps sequence variants to protein structures from the Protein Data Bank (PDB), and further to protein-protein, protein-nucleic acid, protein-compound, and protein-metal ion binding sites. The concept of a protein-compound binding site is understood in the broadest sense, which includes glycosylation and other post-translational modification sites. Binding sites were defined by local structural comparisons of whole protein structures using the Protein Binding Sites (ProBiS) algorithm and transposition of ligands from the similar binding sites found to the query protein using the ProBiS-ligands approach with new improvements introduced in GenProBiS. Binding site surfaces were generated as three-dimensional grids encompassing the space occupied by predicted ligands. The server allows intuitive visual exploration of comprehensively mapped variants, such as human somatic mis-sense mutations related to cancer and non-synonymous single nucleotide polymorphisms from 21 species, within the predicted binding sites regions for about 80 000 PDB protein structures using fast WebGL graphics. The GenProBiS web server is open and free to all users at http://genprobis.insilab.org. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  7. Artificial genetic selection for an efficient translation initiation site for expression of human RACK1 gene in Escherichia coli

    PubMed Central

    Zhelyabovskaya, Olga B.; Berlin, Yuri A.; Birikh, Klara R.

    2004-01-01

    In bacterial expression systems, translation initiation is usually the rate limiting and the least predictable stage of protein synthesis. Efficiency of a translation initiation site can vary dramatically depending on the sequence context. This is why many standard expression vectors provide very poor expression levels of some genes. This notion persuaded us to develop an artificial genetic selection protocol, which allows one to find for a given target gene an individual efficient ribosome binding site from a random pool. In order to create Darwinian pressure necessary for the genetic selection, we designed a system based on translational coupling, in which microorganism survival in the presence of antibiotic depends on expression of the target gene, while putting no special requirements on this gene. Using this system we obtained superproducing constructs for the human protein RACK1 (receptor for activated C kinase). PMID:15034151

  8. Evolution of a designed retro-aldolase leads to complete active site remodeling

    PubMed Central

    Giger, Lars; Caner, Sami; Obexer, Richard; Kast, Peter; Baker, David; Ban, Nenad; Hilvert, Donald

    2013-01-01

    Evolutionary advances are often fueled by unanticipated innovation. Directed evolution of a computationally designed enzyme suggests that dramatic molecular changes can also drive the optimization of primitive protein active sites. The specific activity of an artificial retro-aldolase was boosted >4,400 fold by random mutagenesis and screening, affording catalytic efficiencies approaching those of natural enzymes. However, structural and mechanistic studies reveal that the engineered catalytic apparatus, consisting of a reactive lysine and an ordered water molecule, was unexpectedly abandoned in favor of a new lysine residue in a substrate binding pocket created during the optimization process. Structures of the initial in silico design, a mechanistically promiscuous intermediate, and one of the most evolved variants highlight the importance of loop mobility and supporting functional groups in the emergence of the new catalytic center. Such internal competition between alternative reactive sites may have characterized the early evolution of many natural enzymes. PMID:23748672

  9. Monodisperse measurement of the biotin-streptavidin interaction strength in a well-defined pulling geometry

    PubMed Central

    Sedlak, Steffen M.; Bauer, Magnus S.; Kluger, Carleen; Schendel, Leonard C.; Milles, Lukas F.; Pippig, Diana A.

    2017-01-01

    The widely used interaction of the homotetramer streptavidin with the small molecule biotin has been intensively studied by force spectroscopy and has become a model system for receptor ligand interaction. However, streptavidin’s tetravalency results in diverse force propagation pathways through the different binding interfaces. This multiplicity gives rise to polydisperse force spectroscopy data. Here, we present an engineered monovalent streptavidin tetramer with a single cysteine in its functional subunit that allows for site-specific immobilization of the molecule, orthogonal to biotin binding. Functionality of streptavidin and its binding properties for biotin remain unaffected. We thus created a stable and reliable molecular anchor with a unique high-affinity binding site for biotinylated molecules or nanoparticles, which we expect to be useful for many single-molecule applications. To characterize the mechanical properties of the bond between biotin and our monovalent streptavidin, we performed force spectroscopy experiments using an atomic force microscope. We were able to conduct measurements at the single-molecule level with 1:1-stoichiometry and a well-defined geometry, in which force exclusively propagates through a single subunit of the streptavidin tetramer. For different force loading rates, we obtained narrow force distributions of the bond rupture forces ranging from 200 pN at 1,500 pN/s to 230 pN at 110,000 pN/s. The data are in very good agreement with the standard Bell-Evans model with a single potential barrier at Δx0 = 0.38 nm and a zero-force off-rate koff,0 in the 10−6 s-1 range. PMID:29206886

  10. Monodisperse measurement of the biotin-streptavidin interaction strength in a well-defined pulling geometry.

    PubMed

    Sedlak, Steffen M; Bauer, Magnus S; Kluger, Carleen; Schendel, Leonard C; Milles, Lukas F; Pippig, Diana A; Gaub, Hermann E

    2017-01-01

    The widely used interaction of the homotetramer streptavidin with the small molecule biotin has been intensively studied by force spectroscopy and has become a model system for receptor ligand interaction. However, streptavidin's tetravalency results in diverse force propagation pathways through the different binding interfaces. This multiplicity gives rise to polydisperse force spectroscopy data. Here, we present an engineered monovalent streptavidin tetramer with a single cysteine in its functional subunit that allows for site-specific immobilization of the molecule, orthogonal to biotin binding. Functionality of streptavidin and its binding properties for biotin remain unaffected. We thus created a stable and reliable molecular anchor with a unique high-affinity binding site for biotinylated molecules or nanoparticles, which we expect to be useful for many single-molecule applications. To characterize the mechanical properties of the bond between biotin and our monovalent streptavidin, we performed force spectroscopy experiments using an atomic force microscope. We were able to conduct measurements at the single-molecule level with 1:1-stoichiometry and a well-defined geometry, in which force exclusively propagates through a single subunit of the streptavidin tetramer. For different force loading rates, we obtained narrow force distributions of the bond rupture forces ranging from 200 pN at 1,500 pN/s to 230 pN at 110,000 pN/s. The data are in very good agreement with the standard Bell-Evans model with a single potential barrier at Δx0 = 0.38 nm and a zero-force off-rate koff,0 in the 10-6 s-1 range.

  11. Direct evidence for interaction between nano-anatase and superoxide dismutase from rat erythrocytes

    NASA Astrophysics Data System (ADS)

    Ma, Linglan; Ze, Yuguang; Liu, Jie; Liu, Huiting; Liu, Chao; Li, Zhongrui; Zhao, Jinfang; Yan, Jinying; Duan, Yanmei; Xie, Yaning; Hong, Fashui

    2009-07-01

    Nano-TiO2 and superoxide dismutase (SOD, EC 1.15.1.1) have been added to cosmetics and used to prevent injury of skin from UV-radiation, which might be related to the decrease of oxidative damage of skin. In previous studies we had proven that nano-anatase could increase the activity of SOD and decrease the oxidative damage in vivo. The mechanisms by which nano-anatase promoted SOD activity, however, are still not clearly understood. In the present work, nano-anatase in various concentrations was added to SOD from rat erythrocytes in vitro to gain insight into the mechanism of molecular interactions between nano-anatase and SOD by various spectral methods, suggesting that the reaction between SOD and nano-anatase was two-order, which meant that the SOD activity was greatly increased by low concentration of nano-anatase and inhibited by high concentration of nano-anatase. The spectroscopic assays suggested that the nano-anatase was determined to directly bind to SOD; the binding site of nano-anatase to SOD was 0.256 and the binding constants were 6.54 × 105 and 3.6 × 105 L mol-1; Ti was bound with three oxygen or nitrogen atoms and a sulfur atoms of amino acid residues at the Ti-O(N) and Ti-S bond lengths of 1.86 and 2.37 Å, respectively, the binding nano-anatase entirely altered the secondary structure of SOD. It implied that the nano-anatase coordination created a new metal ion-active site form in SOD, thus leading to an enhancement in SOD activity.

  12. Molecular modeling of fibronectin adsorption on topographically nanostructured rutile (110) surfaces

    NASA Astrophysics Data System (ADS)

    Guo, Chuangqiang; Wu, Chunya; Chen, Mingjun; Zheng, Ting; Chen, Ni; Cummings, Peter T.

    2016-10-01

    To investigate the topographical dependency of protein adsorption, molecular dynamics simulations were employed to describe the adsorption behavior of the tenth type-III module of fibronectin (FN-III10) on nanostructured rutile (110) surfaces. The results indicated that the residence time of adsorbed FN-III10 largely relied on its binding mode (direct or indirect) with the substrate and the region for protein migration on the periphery (protrusion) or in the interior (cavity or groove) of nanostructures. In the direct binding mode, FN-III10 molecules were found to be 'trapped' at the anchoring sites of rutile surface, or even penetrate deep into the interior of nanostructures, regardless of the presented geometrical features. In the indirect binding mode, FN-III10 molecules were indirectly connected to the substrate via a hydrogen-bond network (linking FN-III10 and interfacial hydrations). The facets created by nanostructures, which exerted restraints on protein migration, were suggested to play an important role in the stability of indirect FN-III10-rutile binding. However, a doubly unfavorable situation - indirect FN-III10-rutile connections bridged by a handful of mediating waters and few constraints on movement of protein provided by nanostructures - would result in an early desorption of protein.

  13. Two Distantly Spaced Basic Patches in the Flexible Domain of Huntingtin-Interacting Protein 1 (HIP1) Are Essential for the Binding of Clathrin Light Chain.

    PubMed

    Ybe, Joel A; Clegg, Mary E; Illingworth, Melissa; Gonzalez, Claire; Niu, Qian

    2009-01-01

    The interaction between HIP family proteins (HIP1 and HIP12/1R) and clathrin is fundamental to endocytosis. We used circular dichroism (CD) to study the stability of an HIP1 subfragment (aa468-530) that is splayed open. CD thermal melts show HIP1 468-530 is only stable at low temperatures, but this HIP1 fragment contains a structural unit that does not melt out even at 83°C. We then created HIP1 mutants to probe our hypothesis that a short hydrophobic path in the opened region is the binding site for clathrin light chain. We found that the binding of hub/LCb was sensitive to mutating two distantly separated basic residues (K474 and K494). The basic patches marked by K474 and K494 are conserved in HIP12/1R. The lack of conservation in sla2p (S. cerevisiae), HIP1 from D. melanogaster, and HIP1 homolog ZK370.3 from C. elegans implies the binding of HIP1 and HIP1 homologs to clathrin light chain may be different in these organisms.

  14. Two Distantly Spaced Basic Patches in the Flexible Domain of Huntingtin-Interacting Protein 1 (HIP1) Are Essential for the Binding of Clathrin Light Chain

    PubMed Central

    Ybe, Joel A.; Clegg, Mary E.; Illingworth, Melissa; Gonzalez, Claire; Niu, Qian

    2009-01-01

    The interaction between HIP family proteins (HIP1 and HIP12/1R) and clathrin is fundamental to endocytosis. We used circular dichroism (CD) to study the stability of an HIP1 subfragment (aa468-530) that is splayed open. CD thermal melts show HIP1 468-530 is only stable at low temperatures, but this HIP1 fragment contains a structural unit that does not melt out even at 83°C. We then created HIP1 mutants to probe our hypothesis that a short hydrophobic path in the opened region is the binding site for clathrin light chain. We found that the binding of hub/LCb was sensitive to mutating two distantly separated basic residues (K474 and K494). The basic patches marked by K474 and K494 are conserved in HIP12/1R. The lack of conservation in sla2p (S. cerevisiae), HIP1 from D. melanogaster, and HIP1 homolog ZK370.3 from C. elegans implies the binding of HIP1 and HIP1 homologs to clathrin light chain may be different in these organisms. PMID:22820750

  15. Determination of structure of the MinD-ATP complex reveals the orientation of MinD on the membrane and the relative location of the binding sites for MinE and MinC

    PubMed Central

    Wu, Wei; Park, Kyung-Tae; Holyoak, Todd; Lutkenhaus, Joe

    2011-01-01

    Summary The three Min proteins spatially regulate Z ring positioning in E. coli and are dynamically associated with the membrane. MinD binds to vesicles in the presence of ATP and can recruit MinC or MinE. Biochemical and genetic evidence indicate the binding sites for these two proteins on MinD overlap. Here we solved the structure of a hydrolytic-deficient mutant of MinD truncated for the C-terminal amphipathic helix involved in binding to the membrane. The structure solved in the presence of ATP is a dimer and reveals the face of MinD abutting the membrane. Using a combination of random and extensive site-directed mutagenesis additional residues important for MinE and MinC binding were identified. The location of these residues on the MinD structure confirms that the binding sites overlap and reveals that the binding sites are at the dimer interface and exposed to the cytosol. The location of the binding sites at the dimer interface offers a simple explanation for the ATP-dependency of MinC and MinE binding to MinD. PMID:21231967

  16. Interaction between phloretin and the red blood cell membrane

    PubMed Central

    1976-01-01

    Phloretin binding to red blood cell components has been characterized at pH6, where binding and inhibitory potency are maximal. Binding to intact red cells and to purified hemoglobin are nonsaturated processes approximately equal in magnitude, which strongly suggests that most of the red cell binding may be ascribed to hemoglobin. This conclusion is supported by the fact that homoglobin-free red cell ghosts can bind only 10% as much phloretin as an equivalent number of red cells. The permeability of the red cell membrane to phloretin has been determined by a direct measurement at the time-course of the phloretin uptake. At a 2% hematocrit, the half time for phloretin uptake is 8.7s, corresponding to a permeability coefficient of 2 x 10(-4) cm/s. The concentration dependence of the binding to ghosts reveals two saturable components. Phloretin binds with high affinity (K diss = 1.5 muM) to about 2.5 x 10(6) sites per cell; it also binds with lower affinity (Kdiss = 54 muM) to a second (5.5 x 10(7) per cell) set of sites. In sonicated total lipid extracts of red cell ghosts, phloretin binding consists of a single, saturable component. Its affinity and total number of sites are not significantly different from those of the low affinity binding process in ghosts. No high affinity binding of phloretin is exhibited by the red cell lipid extracts. Therefore, the high affinity phloretin binding sites are related to membrane proteins, and the low affinity sites result from phloretin binding to lipid. The identification of these two types of binding sites allows phloretin effects on protein-mediated transport processes to be distinguished from effects on the lipid region of the membrane. PMID:5575

  17. A peek into tropomyosin binding and unfolding on the actin filament.

    PubMed

    Singh, Abhishek; Hitchcock-Degregori, Sarah E

    2009-07-24

    Tropomyosin is a prototypical coiled coil along its length with subtle variations in structure that allow interactions with actin and other proteins. Actin binding globally stabilizes tropomyosin. Tropomyosin-actin interaction occurs periodically along the length of tropomyosin. However, it is not well understood how tropomyosin binds actin. Tropomyosin's periodic binding sites make differential contributions to two components of actin binding, cooperativity and affinity, and can be classified as primary or secondary sites. We show through mutagenesis and analysis of recombinant striated muscle alpha-tropomyosins that primary actin binding sites have a destabilizing coiled-coil interface, typically alanine-rich, embedded within a non-interface recognition sequence. Introduction of an Ala cluster in place of the native, more stable interface in period 2 and/or period 3 sites (of seven) increased the affinity or cooperativity of actin binding, analysed by cosedimentation and differential scanning calorimetry. Replacement of period 3 with period 5 sequence, an unstable region of known importance for cooperative actin binding, increased the cooperativity of binding. Introduction of the fluorescent probe, pyrene, near the mutation sites in periods 2 and 3 reported local instability, stabilization by actin binding, and local unfolding before or coincident with dissociation from actin (measured using light scattering), and chain dissociation (analyzed using circular dichroism). This, and previous work, suggests that regions of tropomyosin involved in binding actin have non-interface residues specific for interaction with actin and an unstable interface that is locally stabilized upon binding. The destabilized interface allows residues on the coiled-coil surface to obtain an optimal conformation for interaction with actin by increasing the number of local substates that the side chains can sample. We suggest that local disorder is a property typical of coiled coil binding sites and proteins that have multiple binding partners, of which tropomyosin is one type.

  18. Proteome-wide Identification of Novel Ceramide-binding Proteins by Yeast Surface cDNA Display and Deep Sequencing.

    PubMed

    Bidlingmaier, Scott; Ha, Kevin; Lee, Nam-Kyung; Su, Yang; Liu, Bin

    2016-04-01

    Although the bioactive sphingolipid ceramide is an important cell signaling molecule, relatively few direct ceramide-interacting proteins are known. We used an approach combining yeast surface cDNA display and deep sequencing technology to identify novel proteins binding directly to ceramide. We identified 234 candidate ceramide-binding protein fragments and validated binding for 20. Most (17) bound selectively to ceramide, although a few (3) bound to other lipids as well. Several novel ceramide-binding domains were discovered, including the EF-hand calcium-binding motif, the heat shock chaperonin-binding motif STI1, the SCP2 sterol-binding domain, and the tetratricopeptide repeat region motif. Interestingly, four of the verified ceramide-binding proteins (HPCA, HPCAL1, NCS1, and VSNL1) and an additional three candidate ceramide-binding proteins (NCALD, HPCAL4, and KCNIP3) belong to the neuronal calcium sensor family of EF hand-containing proteins. We used mutagenesis to map the ceramide-binding site in HPCA and to create a mutant HPCA that does not bind to ceramide. We demonstrated selective binding to ceramide by mammalian cell-produced wild type but not mutant HPCA. Intriguingly, we also identified a fragment from prostaglandin D2synthase that binds preferentially to ceramide 1-phosphate. The wide variety of proteins and domains capable of binding to ceramide suggests that many of the signaling functions of ceramide may be regulated by direct binding to these proteins. Based on the deep sequencing data, we estimate that our yeast surface cDNA display library covers ∼60% of the human proteome and our selection/deep sequencing protocol can identify target-interacting protein fragments that are present at extremely low frequency in the starting library. Thus, the yeast surface cDNA display/deep sequencing approach is a rapid, comprehensive, and flexible method for the analysis of protein-ligand interactions, particularly for the study of non-protein ligands. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  19. sc-PDB: a 3D-database of ligandable binding sites--10 years on.

    PubMed

    Desaphy, Jérémy; Bret, Guillaume; Rognan, Didier; Kellenberger, Esther

    2015-01-01

    The sc-PDB database (available at http://bioinfo-pharma.u-strasbg.fr/scPDB/) is a comprehensive and up-to-date selection of ligandable binding sites of the Protein Data Bank. Sites are defined from complexes between a protein and a pharmacological ligand. The database provides the all-atom description of the protein, its ligand, their binding site and their binding mode. Currently, the sc-PDB archive registers 9283 binding sites from 3678 unique proteins and 5608 unique ligands. The sc-PDB database was publicly launched in 2004 with the aim of providing structure files suitable for computational approaches to drug design, such as docking. During the last 10 years we have improved and standardized the processes for (i) identifying binding sites, (ii) correcting structures, (iii) annotating protein function and ligand properties and (iv) characterizing their binding mode. This paper presents the latest enhancements in the database, specifically pertaining to the representation of molecular interaction and to the similarity between ligand/protein binding patterns. The new website puts emphasis in pictorial analysis of data. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  20. Piracetam defines a new binding site for allosteric modulators of alpha-amino-3-hydroxy-5-methyl-4-isoxazole-propionic acid (AMPA) receptors.

    PubMed

    Ahmed, Ahmed H; Oswald, Robert E

    2010-03-11

    Glutamate receptors are the most prevalent excitatory neurotransmitter receptors in the vertebrate central nervous system and are important potential drug targets for cognitive enhancement and the treatment of schizophrenia. Allosteric modulators of AMPA receptors promote dimerization by binding to a dimer interface and reducing desensitization and deactivation. The pyrrolidine allosteric modulators, piracetam and aniracetam, were among the first of this class of drugs to be discovered. We have determined the structure of the ligand binding domain of the AMPA receptor subtypes GluA2 and GluA3 with piracetam and a corresponding structure of GluA3 with aniracetam. Both drugs bind to GluA2 and GluA3 in a very similar manner, suggesting little subunit specificity. However, the binding sites for piracetam and aniracetam differ considerably. Aniracetam binds to a symmetrical site at the center of the dimer interface. Piracetam binds to multiple sites along the dimer interface with low occupation, one of which is a unique binding site for potential allosteric modulators. This new site may be of importance in the design of new allosteric regulators.

  1. Piracetam Defines a New Binding Site for Allosteric Modulators of α-amino-3-hydroxy-5-methyl-4-isoxazole-propionic acid (AMPA) receptors§

    PubMed Central

    Ahmed, Ahmed H.; Oswald, Robert E.

    2010-01-01

    Glutamate receptors are the most prevalent excitatory neurotransmitter receptors in the vertebrate central nervous system and are important potential drug targets for cognitive enhancement and the treatment of schizophrenia. Allosteric modulators of AMPA receptors promote dimerization by binding to a dimer interface and reducing desensitization and deactivation. The pyrrolidine allosteric modulators, piracetam and aniracetam, were among the first of this class of drugs to be discovered. We have determined the structure of the ligand binding domain of the AMPA receptor subtypes GluA2 and GluA3 with piracetam and a corresponding structure of GluA3 with aniracetam. Both drugs bind to both GluA2 and GluA3 in a very similar manner, suggesting little subunit specificity. However, the binding sites for piracetam and aniracetam differ considerably. Aniracetam binds to a symmetrical site at the center of the dimer interface. Piracetam binds to multiple sites along the dimer interface with low occupation, one of which is a unique binding site for potential allosteric modulators. This new site may be of importance in the design of new allosteric regulators. PMID:20163115

  2. Amyloid tracers detect multiple binding sites in Alzheimer's disease brain tissue.

    PubMed

    Ni, Ruiqing; Gillberg, Per-Göran; Bergfors, Assar; Marutle, Amelia; Nordberg, Agneta

    2013-07-01

    Imaging fibrillar amyloid-β deposition in the human brain in vivo by positron emission tomography has improved our understanding of the time course of amyloid-β pathology in Alzheimer's disease. The most widely used amyloid-β imaging tracer so far is (11)C-Pittsburgh compound B, a thioflavin derivative but other (11)C- and (18)F-labelled amyloid-β tracers have been studied in patients with Alzheimer's disease and cognitively normal control subjects. However, it has not yet been established whether different amyloid tracers bind to identical sites on amyloid-β fibrils, offering the same ability to detect the regional amyloid-β burden in the brains. In this study, we characterized (3)H-Pittsburgh compound B binding in autopsied brain regions from 23 patients with Alzheimer's disease and 20 control subjects (aged 50 to 88 years). The binding properties of the amyloid tracers FDDNP, AV-45, AV-1 and BF-227 were also compared with those of (3)H-Pittsburgh compound B in the frontal cortices of patients with Alzheimer's disease. Saturation binding studies revealed the presence of high- and low-affinity (3)H-Pittsburgh compound B binding sites in the frontal cortex (K(d1): 3.5 ± 1.6 nM; K(d2): 133 ± 30 nM) and hippocampus (K(d1):5.6 ± 2.2 nM; K(d2): 181 ± 132 nM) of Alzheimer's disease brains. The relative proportion of high-affinity to low-affinity sites was 6:1 in the frontal cortex and 3:1 in the hippocampus. One control showed both high- and low-affinity (3)H-Pittsburgh compound B binding sites (K(d1): 1.6 nM; K(d2): 330 nM) in the cortex while the others only had a low-affinity site (K(d2): 191 ± 70 nM). (3)H-Pittsburgh compound B binding in Alzheimer's disease brains was higher in the frontal and parietal cortices than in the caudate nucleus and hippocampus, and negligible in the cerebellum. Competitive binding studies with (3)H-Pittsburgh compound B in the frontal cortices of Alzheimer's disease brains revealed high- and low-affinity binding sites for BTA-1 (Ki: 0.2 nM, 70 nM), florbetapir (1.8 nM, 53 nM) and florbetaben (1.0 nM, 65 nM). BF-227 displaced 83% of (3)H-Pittsburgh compound B binding, mainly at a low-affinity site (311 nM), whereas FDDNP only partly displaced (40%). We propose a multiple binding site model for the amyloid tracers (binding sites 1, 2 and 3), where AV-45 (florbetapir), AV-1 (florbetaben), and Pittsburgh compound B, all show nanomolar affinity for the high-affinity site (binding site 1), as visualized by positron emission tomography. BF-227 shows mainly binding to site 3 and FDDNP shows only some binding to site 2. Different amyloid tracers may provide new insight into the pathophysiological mechanisms in the progression of Alzheimer's disease.

  3. Role of Electrostatics in Protein-RNA Binding: The Global vs the Local Energy Landscape.

    PubMed

    Ghaemi, Zhaleh; Guzman, Irisbel; Gnutt, David; Luthey-Schulten, Zaida; Gruebele, Martin

    2017-09-14

    U1A protein-stem loop 2 RNA association is a basic step in the assembly of the spliceosomal U1 small nuclear ribonucleoprotein. Long-range electrostatic interactions due to the positive charge of U1A are thought to provide high binding affinity for the negatively charged RNA. Short range interactions, such as hydrogen bonds and contacts between RNA bases and protein side chains, favor a specific binding site. Here, we propose that electrostatic interactions are as important as local contacts in biasing the protein-RNA energy landscape toward a specific binding site. We show by using molecular dynamics simulations that deletion of two long-range electrostatic interactions (K22Q and K50Q) leads to mutant-specific alternative RNA bound states. One of these states preserves short-range interactions with aromatic residues in the original binding site, while the other one does not. We test the computational prediction with experimental temperature-jump kinetics using a tryptophan probe in the U1A-RNA binding site. The two mutants show the distinct predicted kinetic behaviors. Thus, the stem loop 2 RNA has multiple binding sites on a rough RNA-protein binding landscape. We speculate that the rough protein-RNA binding landscape, when biased to different local minima by electrostatics, could be one way that protein-RNA interactions evolve toward new binding sites and novel function.

  4. CavityPlus: a web server for protein cavity detection with pharmacophore modelling, allosteric site identification and covalent ligand binding ability prediction.

    PubMed

    Xu, Youjun; Wang, Shiwei; Hu, Qiwan; Gao, Shuaishi; Ma, Xiaomin; Zhang, Weilin; Shen, Yihang; Chen, Fangjin; Lai, Luhua; Pei, Jianfeng

    2018-05-10

    CavityPlus is a web server that offers protein cavity detection and various functional analyses. Using protein three-dimensional structural information as the input, CavityPlus applies CAVITY to detect potential binding sites on the surface of a given protein structure and rank them based on ligandability and druggability scores. These potential binding sites can be further analysed using three submodules, CavPharmer, CorrSite, and CovCys. CavPharmer uses a receptor-based pharmacophore modelling program, Pocket, to automatically extract pharmacophore features within cavities. CorrSite identifies potential allosteric ligand-binding sites based on motion correlation analyses between cavities. CovCys automatically detects druggable cysteine residues, which is especially useful to identify novel binding sites for designing covalent allosteric ligands. Overall, CavityPlus provides an integrated platform for analysing comprehensive properties of protein binding cavities. Such analyses are useful for many aspects of drug design and discovery, including target selection and identification, virtual screening, de novo drug design, and allosteric and covalent-binding drug design. The CavityPlus web server is freely available at http://repharma.pku.edu.cn/cavityplus or http://www.pkumdl.cn/cavityplus.

  5. THE STRUCTURAL BIOLOGY OF THE FGF19 SUBFAMILY

    PubMed Central

    Beenken, Andrew; Mohammadi, Moosa

    2013-01-01

    The ability of the Fibroblast Growth Factor (FGF) 19 subfamily to signal in an endocrine fashion sets this subfamily apart from the remaining five FGF subfamilies known for their paracrine functions during embryonic development. Compared to the members of paracrine FGF subfamiles, the three members of the FGF 19 subfamily, namely FGF19, FGF21 and FGF23, have poor affinity for heparan sulfate (HS) and therefore can diffuse freely in the HS-rich extracellular matrix to enter into the bloodstream. In further contrast to paracrine FGFs, FGF 19 subfamily members have unusually poor affinity for their cognate FGF receptors (FGFRs) and therefore cannot bind and activate them in a solely HS-dependent fashion. As a result, the FGF 19 subfamily requires α/βklotho coreceptor proteins in order to bind, dimerize and activate their cognate FGFRs. This klotho-dependency also determines the tissue specificity of endocrine FGFs. Recent structural and biochemical studies have begun to shed light onto the molecular basis for the klotho-dependent endocrine mode of action of the FGF 19 subfamily. Crystal structures of FGF 19 and FGF23 show that the topology of the HS binding site (HBS) of FGF19 subfamily members deviates drastically from the common topology adopted by the paracrine FGFs. The distinct topologies of the HBS of FGF 19 and FGF23 prevent HS from direct hydrogen bonding with the backbone atoms of the HBS of these ligands and accordingly decrease the HS binding affinity of this subfamily. Recent biochemical data reveal that the αklotho ectodomain binds avidly to the ectodomain of FGFR1c, the main cognate FGFR of FGF23, creating a de novo high affinity binding site for the C-terminal tail of FGF23. The isolated FGF23 C-terminus can be used to effectively inhibit the formation of the FGF23-FGFR1c-αklotho complex and alleviate hypophosphatemia in renal phosphate disorders due to elevated levels of FGF23. PMID:22396159

  6. TmiRUSite and TmiROSite scripts: searching for mRNA fragments with miRNA binding sites with encoded amino acid residues.

    PubMed

    Berillo, Olga; Régnier, Mireille; Ivashchenko, Anatoly

    2014-01-01

    microRNAs are small RNA molecules that inhibit the translation of target genes. microRNA binding sites are located in the untranslated regions as well as in the coding domains. We describe TmiRUSite and TmiROSite scripts developed using python as tools for the extraction of nucleotide sequences for miRNA binding sites with their encoded amino acid residue sequences. The scripts allow for retrieving a set of additional sequences at left and at right from the binding site. The scripts presents all received data in table formats that are easy to analyse further. The predicted data finds utility in molecular and evolutionary biology studies. They find use in studying miRNA binding sites in animals and plants. TmiRUSite and TmiROSite scripts are available for free from authors upon request and at https: //sites.google.com/site/malaheenee/downloads for download.

  7. LHRH-pituitary plasma membrane binding: the presence of specific binding sites in other tissues.

    PubMed

    Marshall, J C; Shakespear, R A; Odell, W D

    1976-11-01

    Two specific binding sites for LHRH are present on plasma membranes prepared from rat and bovine anterior pituitary glands. One site is of high affinity (K = 2X108 1/MOL) and the second is of lower affinity (8-5X105 1/mol) and much greater capacity. Studies on membrane fractions prepared from other tissues showed the presence of a single specific site for LHRH. The kinetics and specificity of this site were similar to those of the lower affinity pituitary receptor. These results indicate that only pituitary membranes possess the higher affinity binding site and suggest that the low affinity site is not of physiological importance in the regulation of gonadotrophin secretion. After dissociation from membranes of non-pituitary tissues 125I-LHRH rebound to pituitary membrane preparations. Thus receptor binding per se does not result in degradation of LHRH and the function of these peripheral receptors remains obscure.

  8. Computational design of trimeric influenza-neutralizing proteins targeting the hemagglutinin receptor binding site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Strauch, Eva-Maria; Bernard, Steffen M.; La, David

    Many viral surface glycoproteins and cell surface receptors are homo-oligomers1, 2, 3, 4, and thus can potentially be targeted by geometrically matched homo-oligomers that engage all subunits simultaneously to attain high avidity and/or lock subunits together. The adaptive immune system cannot generally employ this strategy since the individual antibody binding sites are not arranged with appropriate geometry to simultaneously engage multiple sites in a single target homo-oligomer. We describe a general strategy for the computational design of homo-oligomeric protein assemblies with binding functionality precisely matched to homo-oligomeric target sites5, 6, 7, 8. In the first step, a small protein ismore » designed that binds a single site on the target. In the second step, the designed protein is assembled into a homo-oligomer such that the designed binding sites are aligned with the target sites. We use this approach to design high-avidity trimeric proteins that bind influenza A hemagglutinin (HA) at its conserved receptor binding site. The designed trimers can both capture and detect HA in a paper-based diagnostic format, neutralizes influenza in cell culture, and completely protects mice when given as a single dose 24 h before or after challenge with influenza.« less

  9. An alternate binding site for PPARγ ligands

    PubMed Central

    Hughes, Travis S.; Giri, Pankaj Kumar; de Vera, Ian Mitchelle S.; Marciano, David P.; Kuruvilla, Dana S.; Shin, Youseung; Blayo, Anne-Laure; Kamenecka, Theodore M.; Burris, Thomas P.; Griffin, Patrick R.; Kojetin, Douglas J.

    2014-01-01

    PPARγ is a target for insulin sensitizing drugs such as glitazones, which improve plasma glucose maintenance in patients with diabetes. Synthetic ligands have been designed to mimic endogenous ligand binding to a canonical ligand-binding pocket to hyperactivate PPARγ. Here we reveal that synthetic PPARγ ligands also bind to an alternate site, leading to unique receptor conformational changes that impact coregulator binding, transactivation and target gene expression. Using structure-function studies we show that alternate site binding occurs at pharmacologically relevant ligand concentrations, and is neither blocked by covalently bound synthetic antagonists nor by endogenous ligands indicating non-overlapping binding with the canonical pocket. Alternate site binding likely contributes to PPARγ hyperactivation in vivo, perhaps explaining why PPARγ full and partial or weak agonists display similar adverse effects. These findings expand our understanding of PPARγ activation by ligands and suggest that allosteric modulators could be designed to fine tune PPARγ activity without competing with endogenous ligands. PMID:24705063

  10. Concerted formation of macromolecular Suppressor–mutator transposition complexes

    PubMed Central

    Raina, Ramesh; Schläppi, Michael; Karunanandaa, Balasulojini; Elhofy, Adam; Fedoroff, Nina

    1998-01-01

    Transposition of the maize Suppressor–mutator (Spm) transposon requires two element-encoded proteins, TnpA and TnpD. Although there are multiple TnpA binding sites near each element end, binding of TnpA to DNA is not cooperative, and the binding affinity is not markedly affected by the number of binding sites per DNA fragment. However, intermolecular complexes form cooperatively between DNA fragments with three or more TnpA binding sites. TnpD, itself not a sequence-specific DNA-binding protein, binds to TnpA and stabilizes the TnpA–DNA complex. The high redundancy of TnpA binding sites at both element ends and the protein–protein interactions between DNA-bound TnpA complexes and between these and TnpD imply a concerted transition of the element from a linear to a protein crosslinked transposition complex within a very narrow protein concentration range. PMID:9671711

  11. Accelerated molecular dynamics simulations of ligand binding to a muscarinic G-protein-coupled receptor.

    PubMed

    Kappel, Kalli; Miao, Yinglong; McCammon, J Andrew

    2015-11-01

    Elucidating the detailed process of ligand binding to a receptor is pharmaceutically important for identifying druggable binding sites. With the ability to provide atomistic detail, computational methods are well poised to study these processes. Here, accelerated molecular dynamics (aMD) is proposed to simulate processes of ligand binding to a G-protein-coupled receptor (GPCR), in this case the M3 muscarinic receptor, which is a target for treating many human diseases, including cancer, diabetes and obesity. Long-timescale aMD simulations were performed to observe the binding of three chemically diverse ligand molecules: antagonist tiotropium (TTP), partial agonist arecoline (ARc) and full agonist acetylcholine (ACh). In comparison with earlier microsecond-timescale conventional MD simulations, aMD greatly accelerated the binding of ACh to the receptor orthosteric ligand-binding site and the binding of TTP to an extracellular vestibule. Further aMD simulations also captured binding of ARc to the receptor orthosteric site. Additionally, all three ligands were observed to bind in the extracellular vestibule during their binding pathways, suggesting that it is a metastable binding site. This study demonstrates the applicability of aMD to protein-ligand binding, especially the drug recognition of GPCRs.

  12. Oligomycin frames a common drug-binding site in the ATP synthase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Symersky, Jindrich; Osowski, Daniel; Walters, D. Eric

    We report the high-resolution (1.9 {angstrom}) crystal structure of oligomycin bound to the subunit c10 ring of the yeast mitochondrial ATP synthase. Oligomycin binds to the surface of the c10 ring making contact with two neighboring molecules at a position that explains the inhibitory effect on ATP synthesis. The carboxyl side chain of Glu59, which is essential for proton translocation, forms an H-bond with oligomycin via a bridging water molecule but is otherwise shielded from the aqueous environment. The remaining contacts between oligomycin and subunit c are primarily hydrophobic. The amino acid residues that form the oligomycin-binding site are 100%more » conserved between human and yeast but are widely different from those in bacterial homologs, thus explaining the differential sensitivity to oligomycin. Prior genetics studies suggest that the oligomycin-binding site overlaps with the binding site of other antibiotics, including those effective against Mycobacterium tuberculosis, and thereby frames a common 'drug-binding site.' We anticipate that this drug-binding site will serve as an effective target for new antibiotics developed by rational design.« less

  13. Alignment-independent comparison of binding sites based on DrugScore potential fields encoded by 3D Zernike descriptors.

    PubMed

    Nisius, Britta; Gohlke, Holger

    2012-09-24

    Analyzing protein binding sites provides detailed insights into the biological processes proteins are involved in, e.g., into drug-target interactions, and so is of crucial importance in drug discovery. Herein, we present novel alignment-independent binding site descriptors based on DrugScore potential fields. The potential fields are transformed to a set of information-rich descriptors using a series expansion in 3D Zernike polynomials. The resulting Zernike descriptors show a promising performance in detecting similarities among proteins with low pairwise sequence identities that bind identical ligands, as well as within subfamilies of one target class. Furthermore, the Zernike descriptors are robust against structural variations among protein binding sites. Finally, the Zernike descriptors show a high data compression power, and computing similarities between binding sites based on these descriptors is highly efficient. Consequently, the Zernike descriptors are a useful tool for computational binding site analysis, e.g., to predict the function of novel proteins, off-targets for drug candidates, or novel targets for known drugs.

  14. Analysis of the reaction of carbachol with acetylcholinesterase using thioflavin T as a coupled fluorescence reporter.

    PubMed

    Rosenberry, Terrone L; Sonoda, Leilani K; Dekat, Sarah E; Cusack, Bernadette; Johnson, Joseph L

    2008-12-09

    Acetylcholinesterase (AChE) contains a narrow and deep active site gorge with two sites of ligand binding, an acylation site (or A-site) at the base of the gorge and a peripheral site (or P-site) near the gorge entrance. The P-site contributes to catalytic efficiency by transiently binding substrates on their way to the acylation site, where a short-lived acylated enzyme intermediate is produced. Carbamates are very poor substrates that, like other AChE substrates, form an initial enzyme-substrate complex with free AChE (E) and proceed to an acylated enzyme intermediate (EC), which is then hydrolyzed. However, the hydrolysis of EC is slow enough to resolve the acylation and deacylation steps on the catalytic pathway. Here, we focus on the reaction of carbachol (carbamoylcholine) with AChE. The kinetics and thermodynamics of this reaction are of special interest because carbachol is an isosteric analogue of the physiological substrate acetylcholine. We show that the reaction can be monitored with thioflavin T as a fluorescent reporter group. The fluorescence of thioflavin T is strongly enhanced when it binds to the P-site of AChE, and this fluorescence is partially quenched when a second ligand binds to the A-site to form a ternary complex. Analysis of the fluorescence reaction profiles was challenging because four thermodynamic parameters and two fluorescence coefficients were fitted from the combined data both for E and for EC. Respective equilibrium dissociation constants of 6 and 26 mM were obtained for carbachol binding to the A- and P-sites in E and of 2 and 32 mM for carbachol binding to the A- and P-sites in EC. These constants for the binding of carbachol to the P-site are about an order of magnitude larger (i.e., indicating lower affinity) than previous estimates for the binding of acetylthiocholine to the P-site.

  15. Analysis of the reaction of carbachol with acetylcholinesterase with thioflavin T as a coupled fluorescence reporter†

    PubMed Central

    Rosenberry, Terrone L.; Sonoda, Leilani K.; Dekat, Sarah E.; Cusack, Bernadette; Johnson, Joseph L.

    2009-01-01

    Acetylcholinesterase (AChE) contains a narrow and deep active site gorge with two sites of ligand binding, an acylation site (or A-site) at the base of the gorge and a peripheral site (or P-site) near the gorge entrance. The P-site contributes to catalytic efficiency by transiently binding substrates on their way to the acylation site, where a short-lived acylated enzyme intermediate is produced. Carbamates are very poor substrates that, like other AChE substrates, form an initial enzyme-substrate complex with free AChE (E) and proceed to an acylated enzyme intermediate (EC) which is then hydrolyzed. However, the hydrolysis of EC is slow enough to resolve the acylation and deacylation steps on the catalytic pathway. Here we focus on the reaction of carbachol (carbamoylcholine) with AChE. The kinetics and thermodynamics of this reaction are of special interest because carbachol is an isosteric analog of the physiological substrate acetylcholine. We show that the reaction can be monitored with thioflavin T as a fluorescent reporter group. The fluorescence of thioflavin T is strongly enhanced when it binds to the P-site of AChE, and this fluorescence is partially quenched when a second ligand binds to the A-site to form a ternary complex. Analysis of the fluorescence reaction profiles was challenging, because four thermodynamic parameters and two fluorescence coefficients were fitted from the combined data both for E and for EC. Respective equilibrium dissociation constants of 6 and 26 mM were obtained for carbachol binding to the A- and P-sites in E and of 2 and 32 mM for carbachol binding to the A- and P-sites in EC. These constants for the binding of carbachol to the P-site are about an order of magnitude larger (i.e., indicating lower affinity) than previous estimates for the binding of acetylthiocholine to the P-site. PMID:19006330

  16. Drug Promiscuity in PDB: Protein Binding Site Similarity Is Key.

    PubMed

    Haupt, V Joachim; Daminelli, Simone; Schroeder, Michael

    2013-01-01

    Drug repositioning applies established drugs to new disease indications with increasing success. A pre-requisite for drug repurposing is drug promiscuity (polypharmacology) - a drug's ability to bind to several targets. There is a long standing debate on the reasons for drug promiscuity. Based on large compound screens, hydrophobicity and molecular weight have been suggested as key reasons. However, the results are sometimes contradictory and leave space for further analysis. Protein structures offer a structural dimension to explain promiscuity: Can a drug bind multiple targets because the drug is flexible or because the targets are structurally similar or even share similar binding sites? We present a systematic study of drug promiscuity based on structural data of PDB target proteins with a set of 164 promiscuous drugs. We show that there is no correlation between the degree of promiscuity and ligand properties such as hydrophobicity or molecular weight but a weak correlation to conformational flexibility. However, we do find a correlation between promiscuity and structural similarity as well as binding site similarity of protein targets. In particular, 71% of the drugs have at least two targets with similar binding sites. In order to overcome issues in detection of remotely similar binding sites, we employed a score for binding site similarity: LigandRMSD measures the similarity of the aligned ligands and uncovers remote local similarities in proteins. It can be applied to arbitrary structural binding site alignments. Three representative examples, namely the anti-cancer drug methotrexate, the natural product quercetin and the anti-diabetic drug acarbose are discussed in detail. Our findings suggest that global structural and binding site similarity play a more important role to explain the observed drug promiscuity in the PDB than physicochemical drug properties like hydrophobicity or molecular weight. Additionally, we find ligand flexibility to have a minor influence.

  17. Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome.

    PubMed

    Dresch, Jacqueline M; Zellers, Rowan G; Bork, Daniel K; Drewell, Robert A

    2016-01-01

    A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development.

  18. Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome

    PubMed Central

    Dresch, Jacqueline M.; Zellers, Rowan G.; Bork, Daniel K.; Drewell, Robert A.

    2016-01-01

    A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development. PMID:27330274

  19. [3H]MK-801 binding sites in post-mortem human frontal cortex.

    PubMed

    Kornhuber, J; Mack-Burkhardt, F; Kornhuber, M E; Riederer, P

    1989-03-29

    The binding of [3H]MK-801 ((+)-5-methyl-10,11-dihydro-5H-dibenzo[a,d]cyclohepten-5,10-imine maleate) was investigated in extensively washed homogenates of post-mortem human frontal cortex. The association of [3H]MK-801 proceeded slowly (t1/2 = 553 min) and reached equilibrium only after a prolonged incubation (greater than 24 h). The dissociation of [3H]MK-801 from the binding site was also slow (t1/2 = 244 min). Glutamate, glycine and magnesium markedly increased the rate of association (t1/2 = 14.8 min) and dissociation (t1/2 = 36.5 min). At equilibrium, the binding was not altered by these substances. Specific binding was linear with protein concentration, was saturable, reversible, stereoselective, heat-labile and was nearly absent in the white matter. Scatchard analysis of the saturation curves obtained at equilibrium indicated that there was a high-affinity (Kd1 1.39 +/- 0.21 nM, Bmax1 0.483 +/- 0.084 pmol/mg protein) and a low-affinity (Kd2 116.25 +/- 50.79 nM, Bmax2 3.251 +/- 0.991 pmol/mg protein) binding site. All competition curves obtained with (+)-MK-801, (-)-MK-801, phencyclidine and ketamine had Hill coefficients of less than unity and were best explained by a two-site model. Thus, our results demonstrate the presence of binding sites for MK-801 in post-mortem human brains and provide evidence for binding site heterogeneity. Furthermore, glutamate, glycine and magnesium accelerate the association and dissociation of [3H]MK-801 to and from its binding sites. The results add support to the hypothesis that MK-801, glutamate, glycine and magnesium all bind to different sites on the NMDA receptor-ion channel complex.

  20. The binding sites of inhibitory monoclonal antibodies on acetylcholinesterase. Identification of a novel regulatory site at the putative "back door".

    PubMed

    Simon, S; Le Goff, A; Frobert, Y; Grassi, J; Massoulié, J

    1999-09-24

    We investigated the target sites of three inhibitory monoclonal antibodies on Electrophorus acetylcholinesterase (AChE). Previous studies showed that Elec-403 and Elec-410 are directed to overlapping but distinct epitopes in the peripheral site, at the entrance of the catalytic gorge, whereas Elec-408 binds to a different region. Using Electrophorus/rat AChE chimeras, we identified surface residues that differed between sensitive and insensitive AChEs: the replacement of a single Electrophorus residue by its rat homolog was able to abolish binding and inhibition, for each antibody. Reciprocally, binding and inhibition by Elec-403 and by Elec-410 could be conferred to rat AChE by the reverse mutation. Elec-410 appears to bind to one side of the active gorge, whereas Elec-403 covers its opening, explaining why the AChE-Elec-410 complex reacts faster than the AChE-Elec-403 or AChE-fasciculin complexes with two active site inhibitors, m-(N,N, N-trimethyltammonio)trifluoro-acetophenone and echothiophate. Elec-408 binds to the region of the putative "back door," distant from the peripheral site, and does not interfere with the access of inhibitors to the active site. The binding of an antibody to this novel regulatory site may inhibit the enzyme by blocking the back door or by inducing a conformational distortion within the active site.

  1. Searching for putative binding sites of the bispyridinium compound MB327 in the nicotinic acetylcholine receptor.

    PubMed

    Wein, Thomas; Höfner, Georg; Rappenglück, Sebastian; Sichler, Sonja; Niessen, Karin V; Seeger, Thomas; Worek, Franz; Thiermann, Horst; Wanner, Klaus T

    2018-09-01

    Irreversible inhibition of the acetylcholine esterase upon intoxication with organophosphorus compounds leads to an accumulation of acetylcholine in the synaptic cleft and a subsequent desensitization of nicotinic acetylcholine receptors which may ultimately result in respiratory failure. The bispyridinium compound MB327 has been found to restore functional activity of nAChR thus representing a promising starting point for the development of new drugs for the treatment of organophosphate poisoning. In order to optimize the resensitizing effect of MB327 on nAChR, it would be very helpful to know the MB327 specific binding site to apply structure based molecular modeling. The binding site for MB327 at the nAChR is not known and so far goal of speculations, but it has been shown that MB327 does not bind to the orthosteric acetylcholine binding site. We have used docking calculations to screen the surface of nAChR for possible binding sites of MB327. The results indicate that at least two potential binding sites for MB327 at nAChR are present inside the channel pore. In these binding sites, MB327 intercalates between the γ-α and β-δ subunits of nAChR, respectively. Both putative MB327 binding sites show an unsymmetrical distribution of surrounding hydrophilic and lipophilic amino acids. This suggests that substitution of MB327-related bispyridinium compounds on one of the two pyridinium rings with polar substituents should have a favorable effect on the pharmacological function. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Comparison of the fibrin-binding activities in the N- and C-termini of fibronectin.

    PubMed

    Rostagno, A A; Schwarzbauer, J E; Gold, L I

    1999-03-01

    Fibronectin (Fn) binds to fibrin in clots by covalent and non-covalent interactions. The N- and C-termini of Fn each contain one non-covalent fibrin-binding site, which are composed of type 1 (F1) structural repeats. We have previously localized the N-terminal site to the fourth and fifth F1 repeats (4F1.5F1). In the current studies, using proteolytic and recombinant proteins representing both the N- and C-terminal fibrin-binding regions, we localized and characterized the C-terminal fibrin-binding site, compared the relative fibrin-binding activities of both sites and determined the contribution of each site to the fibrin-binding activity of intact Fn. By fibrin-affinity chromatography, a protein composed of the 10F1 repeat through to the C-terminus of Fn (10F1-COOH), expressed in COS-1 cells, and 10F1-12F1, produced in Saccharomyces cerevisiae, displayed fibrin-binding activity. However, since 10F1 and 10F1.11F1 were not active, the presence of 12F1 is required for fibrin binding. A proteolytic fragment of 14.4 kDa, beginning 14 residues N-terminal to 10F1, was isolated from the fibrin-affinity matrix. Radio-iodinated 14.4 kDa fibrin-binding peptide/protein (FBP) demonstrated a dose-dependent and saturable binding to fibrin-coated wells that was both competitively inhibited and reversed by unlabelled 14.4 kDa FBP. Comparison of the fibrin-binding affinities of proteolytic FBPs from the N-terminus (25.9 kDa FBP), the C-terminus (14.4 kDa) and intact Fn by ELISA yielded estimated Kd values of 216, 18 and 2.1 nM, respectively. The higher fibrin-binding affinity of the N-terminus was substantiated by the ability of both a recombinant 4F1.5F1 and a monoclonal antibody (mAb) to this site to maximally inhibit biotinylated Fn binding to fibrin by 80%, and by blocking the 90% inhibitory activity of a polyclonal anti-Fn, by absorption with the 25.9 kDa FBP. We propose that whereas the N-terminal site appears to contribute to most of the binding activity of native Fn to fibrin, the specific binding of the C-terminal site may strengthen this interaction.

  3. Comparison of the fibrin-binding activities in the N- and C-termini of fibronectin.

    PubMed Central

    Rostagno, A A; Schwarzbauer, J E; Gold, L I

    1999-01-01

    Fibronectin (Fn) binds to fibrin in clots by covalent and non-covalent interactions. The N- and C-termini of Fn each contain one non-covalent fibrin-binding site, which are composed of type 1 (F1) structural repeats. We have previously localized the N-terminal site to the fourth and fifth F1 repeats (4F1.5F1). In the current studies, using proteolytic and recombinant proteins representing both the N- and C-terminal fibrin-binding regions, we localized and characterized the C-terminal fibrin-binding site, compared the relative fibrin-binding activities of both sites and determined the contribution of each site to the fibrin-binding activity of intact Fn. By fibrin-affinity chromatography, a protein composed of the 10F1 repeat through to the C-terminus of Fn (10F1-COOH), expressed in COS-1 cells, and 10F1-12F1, produced in Saccharomyces cerevisiae, displayed fibrin-binding activity. However, since 10F1 and 10F1.11F1 were not active, the presence of 12F1 is required for fibrin binding. A proteolytic fragment of 14.4 kDa, beginning 14 residues N-terminal to 10F1, was isolated from the fibrin-affinity matrix. Radio-iodinated 14.4 kDa fibrin-binding peptide/protein (FBP) demonstrated a dose-dependent and saturable binding to fibrin-coated wells that was both competitively inhibited and reversed by unlabelled 14.4 kDa FBP. Comparison of the fibrin-binding affinities of proteolytic FBPs from the N-terminus (25.9 kDa FBP), the C-terminus (14.4 kDa) and intact Fn by ELISA yielded estimated Kd values of 216, 18 and 2.1 nM, respectively. The higher fibrin-binding affinity of the N-terminus was substantiated by the ability of both a recombinant 4F1.5F1 and a monoclonal antibody (mAb) to this site to maximally inhibit biotinylated Fn binding to fibrin by 80%, and by blocking the 90% inhibitory activity of a polyclonal anti-Fn, by absorption with the 25.9 kDa FBP. We propose that whereas the N-terminal site appears to contribute to most of the binding activity of native Fn to fibrin, the specific binding of the C-terminal site may strengthen this interaction. PMID:10024513

  4. sc-PDB: a 3D-database of ligandable binding sites—10 years on

    PubMed Central

    Desaphy, Jérémy; Bret, Guillaume; Rognan, Didier; Kellenberger, Esther

    2015-01-01

    The sc-PDB database (available at http://bioinfo-pharma.u-strasbg.fr/scPDB/) is a comprehensive and up-to-date selection of ligandable binding sites of the Protein Data Bank. Sites are defined from complexes between a protein and a pharmacological ligand. The database provides the all-atom description of the protein, its ligand, their binding site and their binding mode. Currently, the sc-PDB archive registers 9283 binding sites from 3678 unique proteins and 5608 unique ligands. The sc-PDB database was publicly launched in 2004 with the aim of providing structure files suitable for computational approaches to drug design, such as docking. During the last 10 years we have improved and standardized the processes for (i) identifying binding sites, (ii) correcting structures, (iii) annotating protein function and ligand properties and (iv) characterizing their binding mode. This paper presents the latest enhancements in the database, specifically pertaining to the representation of molecular interaction and to the similarity between ligand/protein binding patterns. The new website puts emphasis in pictorial analysis of data. PMID:25300483

  5. Allosteric Coupling of CARMIL and V-1 Binding to Capping Protein Revealed by Hydrogen-Deuterium Exchange.

    PubMed

    Johnson, Britney; McConnell, Patrick; Kozlov, Alex G; Mekel, Marlene; Lohman, Timothy M; Gross, Michael L; Amarasinghe, Gaya K; Cooper, John A

    2018-05-29

    Actin assembly is important for cell motility. The ability of actin subunits to join or leave filaments via the barbed end is critical to actin dynamics. Capping protein (CP) binds to barbed ends to prevent subunit gain and loss and is regulated by proteins that include V-1 and CARMIL. V-1 inhibits CP by sterically blocking one binding site for actin. CARMILs bind at a distal site and decrease the affinity of CP for actin, suggested to be caused by conformational changes. We used hydrogen-deuterium exchange with mass spectrometry (HDX-MS) to probe changes in structural dynamics induced by V-1 and CARMIL binding to CP. V-1 and CARMIL induce changes in both proteins' binding sites on the surface of CP, along with a set of internal residues. Both also affect the conformation of CP's ββ subunit "tentacle," a second distal actin-binding site. Concerted regulation of actin assembly by CP occurs through allosteric couplings between CP modulator and actin binding sites. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

  6. Elucidation of the Human Serum Albumin (HSA) Binding Site for the Cu-PTSM and Cu-ATSM Radiopharmaceuticals

    PubMed Central

    Basken, Nathan E.; Mathias, Carla J.; Green, Mark A.

    2008-01-01

    The Cu-PTSM (pyruvaldehyde bis(N4-methylthiosemicarbazonato)copper(II)) and Cu-ATSM (diacetyl bis(N4-methylthiosemicarbazonato)copper(II)) radiopharmaceuticals exhibit strong, species-dependent binding to human serum albumin (HSA), while Cu-ETS (ethylglyoxal bis(thiosemicarbazonato)copper(II)) appears to only exhibit non-specific binding to human and animal serum albumins. This study examines the structural basis for HSA binding of Cu-PTSM and Cu-ATSM via competition with drugs having known albumin binding sites. Warfarin, furosemide, ibuprofen, phenylbutazone, benzylpenicillin, and cephmandole were added to HSA solutions at drug:HSA mole ratios from 0 to 8:1, followed by quantification of radiopharmaceutical binding to HSA by ultrafiltration. Warfarin, a site IIA drug, progressively displaced both [64Cu]Cu-PTSM and [64Cu]Cu-ATSM from HSA. At 8:1 warfarin:HSA mole ratios, free [64Cu]Cu-PTSM and [64Cu]Cu-ATSM levels increased 300–500%. This was in contrast to solutions containing ibuprofen, a site IIIA drug; no increase in free [64Cu]Cu-PTSM or [64Cu]Cu-ATSM was observed except at high ibuprofen:HSA ratios, where secondary ibuprofen binding to the IIA site may cause modest radiopharmaceutical displacement. By contrast, and consistent with earlier findings suggesting Cu-ETS exhibits only non-specific associations, [64Cu]Cu-ETS binding to HSA was unaffected by the addition of drugs that bind in either site. We conclude that the species-dependence of Cu-PTSM and Cu-ATSM albumin binding arises from interaction(s) with the IIA site of HSA. PMID:18937368

  7. Binding and Translocation of Termination Factor Rho Studied at the Single-Molecule Level

    PubMed Central

    Koslover, Daniel J.; Fazal, Furqan M.; Mooney, Rachel A.; Landick, Robert; Block, Steven M.

    2012-01-01

    Rho termination factor is an essential hexameric helicase responsible for terminating 20–50% of all mRNA synthesis in E. coli. We used single- molecule force spectroscopy to investigate Rho-RNA binding interactions at the Rho- utilization (rut) site of the ? tR1 terminator. Our results are consistent with Rho complexes adopting two states, one that binds 57 ±2 nucleotides of RNA across all six of the Rho primary binding sites, and another that binds 85 ±2 nucleotides at the six primary sites plus a single secondary site situated at the center of the hexamer. The single-molecule data serve to establish that Rho translocates 5′-to-3′ towards RNA polymerase (RNAP) by a tethered-tracking mechanism, looping out the intervening RNA between the rut site and RNAP. These findings lead to a general model for Rho binding and translocation, and establish a novel experimental approach that should facilitate additional single- molecule studies of RNA-binding proteins. PMID:22885804

  8. OnTheFly: a database of Drosophila melanogaster transcription factors and their binding sites.

    PubMed

    Shazman, Shula; Lee, Hunjoong; Socol, Yakov; Mann, Richard S; Honig, Barry

    2014-01-01

    We present OnTheFly (http://bhapp.c2b2.columbia.edu/OnTheFly/index.php), a database comprising a systematic collection of transcription factors (TFs) of Drosophila melanogaster and their DNA-binding sites. TFs predicted in the Drosophila melanogaster genome are annotated and classified and their structures, obtained via experiment or homology models, are provided. All known preferred TF DNA-binding sites obtained from the B1H, DNase I and SELEX methodologies are presented. DNA shape parameters predicted for these sites are obtained from a high throughput server or from crystal structures of protein-DNA complexes where available. An important feature of the database is that all DNA-binding domains and their binding sites are fully annotated in a eukaryote using structural criteria and evolutionary homology. OnTheFly thus provides a comprehensive view of TFs and their binding sites that will be a valuable resource for deciphering non-coding regulatory DNA.

  9. Zampanolide Binding to Tubulin Indicates Cross-Talk of Taxane Site with Colchicine and Nucleotide Sites.

    PubMed

    Field, Jessica J; Pera, Benet; Gallego, Juan Estévez; Calvo, Enrique; Rodríguez-Salarichs, Javier; Sáez-Calvo, Gonzalo; Zuwerra, Didier; Jordi, Michel; Andreu, José M; Prota, Andrea E; Ménchon, Grégory; Miller, John H; Altmann, Karl-Heinz; Díaz, J Fernando

    2018-03-23

    The marine natural product zampanolide and analogues thereof constitute a new chemotype of taxoid site microtubule-stabilizing agents with a covalent mechanism of action. Zampanolide-ligated tubulin has the switch-activation loop (M-loop) in the assembly prone form and, thus, represents an assembly activated state of the protein. In this study, we have characterized the biochemical properties of the covalently modified, activated tubulin dimer, and we have determined the effect of zampanolide on tubulin association and the binding of tubulin ligands at other binding sites. Tubulin activation by zampanolide does not affect its longitudinal oligomerization but does alter its lateral association properties. The covalent binding of zampanolide to β-tubulin affects both the colchicine site, causing a change of the quantum yield of the bound ligand, and the exchangeable nucleotide binding site, reducing the affinity for the nucleotide. While these global effects do not change the binding affinity of 2-methoxy-5-(2,3,4-trimethoxyphenyl)-2,4,6-cycloheptatrien-1-one (MTC) (a reversible binder of the colchicine site), the binding affinity of a fluorescent analogue of GTP (Mant-GTP) at the nucleotide E-site is reduced from 12 ± 2 × 10 5 M -1 in the case of unmodified tubulin to 1.4 ± 0.3 × 10 5 M -1 in the case of the zampanolide tubulin adduct, indicating signal transmission between the taxane site and the colchicine and nucleotide sites of β-tubulin.

  10. Binding Pathway of Opiates to μ-Opioid Receptors Revealed by Machine Learning

    NASA Astrophysics Data System (ADS)

    Barati Farimani, Amir; Feinberg, Evan; Pande, Vijay

    2018-02-01

    Many important analgesics relieve pain by binding to the $\\mu$-Opioid Receptor ($\\mu$OR), which makes the $\\mu$OR among the most clinically relevant proteins of the G Protein Coupled Receptor (GPCR) family. Despite previous studies on the activation pathways of the GPCRs, the mechanism of opiate binding and the selectivity of $\\mu$OR are largely unknown. We performed extensive molecular dynamics (MD) simulation and analysis to find the selective allosteric binding sites of the $\\mu$OR and the path opiates take to bind to the orthosteric site. In this study, we predicted that the allosteric site is responsible for the attraction and selection of opiates. Using Markov state models and machine learning, we traced the pathway of opiates in binding to the orthosteric site, the main binding pocket. Our results have important implications in designing novel analgesics.

  11. Identification of new 2,5-diketopiperazine derivatives as simultaneous effective inhibitors of αβ-tubulin and BCRP proteins: Molecular docking, Structure-Activity Relationships and virtual consensus docking studies

    NASA Astrophysics Data System (ADS)

    Fani, Najmeh; Sattarinezhad, Elham; Bordbar, Abdol-Khalegh

    2017-06-01

    In the first part of this paper, docking method was employed in order to study the binding mechanism of breast cancer resistance protein (BCRP) with a group of previously synthesized TPS-A derivatives which known as potent inhibitors of this protein to get insight into drug binding site of BCRP and to explore structure-activity relationship of these compounds. Molecular docking results showed that most of these compounds bind in the binding site of BCRP at the interface between the membrane and outer environment. In the second part, a group of designed TPS-A derivatives which showed good binding energies in the binding site of αβ-tubulin in the previous study were chosen to study their binding energies in the binding site of BCRP to investigate their simultaneous inhibitory effect on both αβ-tubulin and BCRP. The results showed that all of these compounds bind to the binding site of BCRP with relatively suitable binding energies and therefore could be potential inhibitors of both αβ-tubulin and BCRP proteins. Finally, virtual consensus docking method was utilized with the aim of design of new 2,5-diketopiperazine derivatives with significant inhibitory effect on both αβ-tubulin and BCRP proteins. For this purpose binding energies of a library of 2,5-diketopiperazine derivatives in the binding sites of αβ-tubulin and BCRP was investigated by using AutoDock and AutoDock vina tools. Molecular docking results revealed that a group of 36 compounds among them exhibit strong anti-tubulin and anti-BCRP activity.

  12. A deep learning framework for modeling structural features of RNA-binding protein targets

    PubMed Central

    Zhang, Sai; Zhou, Jingtian; Hu, Hailin; Gong, Haipeng; Chen, Ligong; Cheng, Chao; Zeng, Jianyang

    2016-01-01

    RNA-binding proteins (RBPs) play important roles in the post-transcriptional control of RNAs. Identifying RBP binding sites and characterizing RBP binding preferences are key steps toward understanding the basic mechanisms of the post-transcriptional gene regulation. Though numerous computational methods have been developed for modeling RBP binding preferences, discovering a complete structural representation of the RBP targets by integrating their available structural features in all three dimensions is still a challenging task. In this paper, we develop a general and flexible deep learning framework for modeling structural binding preferences and predicting binding sites of RBPs, which takes (predicted) RNA tertiary structural information into account for the first time. Our framework constructs a unified representation that characterizes the structural specificities of RBP targets in all three dimensions, which can be further used to predict novel candidate binding sites and discover potential binding motifs. Through testing on the real CLIP-seq datasets, we have demonstrated that our deep learning framework can automatically extract effective hidden structural features from the encoded raw sequence and structural profiles, and predict accurate RBP binding sites. In addition, we have conducted the first study to show that integrating the additional RNA tertiary structural features can improve the model performance in predicting RBP binding sites, especially for the polypyrimidine tract-binding protein (PTB), which also provides a new evidence to support the view that RBPs may own specific tertiary structural binding preferences. In particular, the tests on the internal ribosome entry site (IRES) segments yield satisfiable results with experimental support from the literature and further demonstrate the necessity of incorporating RNA tertiary structural information into the prediction model. The source code of our approach can be found in https://github.com/thucombio/deepnet-rbp. PMID:26467480

  13. Functional Characterization of the Mannitol Promoter of Pseudomonas fluorescens DSM 50106 and Its Application for a Mannitol-Inducible Expression System for Pseudomonas putida KT2440

    PubMed Central

    Hoffmann, Jana; Altenbuchner, Josef

    2015-01-01

    A new pBBR1MCS-2-derived vector containing the Pseudomonas fluorescens DSM10506 mannitol promoter PmtlE and mtlR encoding its AraC/XylS type transcriptional activator was constructed and optimized for low basal expression. Mannitol, arabitol, and glucitol-inducible gene expression was demonstrated with Pseudomonas putida and eGFP as reporter gene. The new vector was applied for functional characterization of PmtlE. Identification of the DNA binding site of MtlR was achieved by in vivo eGFP measurement with PmtlE wild type and mutants thereof. Moreover, purified MtlR was applied for detailed in vitro investigations using electrophoretic mobility shift assays and DNaseI footprinting experiments. The obtained data suggest that MtlR binds to PmtlE as a dimer. The proposed DNA binding site of MtlR is AGTGC-N5-AGTAT-N7-AGTGC-N5-AGGAT. The transcription activation mechanism includes two binding sites with different binding affinities, a strong upstream binding site and a weaker downstream binding site. The presence of the weak downstream binding site was shown to be necessary to sustain mannitol-inducibility of PmtlE. Two possible functions of mannitol are discussed; the effector might stabilize binding of the second monomer to the downstream half site or promote transcription activation by inducing a conformational change of the regulator that influences the contact to the RNA polymerase. PMID:26207762

  14. The structure of binding curves and practical identifiability of equilibrium ligand-binding parameters

    PubMed Central

    Middendorf, Thomas R.

    2017-01-01

    A critical but often overlooked question in the study of ligands binding to proteins is whether the parameters obtained from analyzing binding data are practically identifiable (PI), i.e., whether the estimates obtained from fitting models to noisy data are accurate and unique. Here we report a general approach to assess and understand binding parameter identifiability, which provides a toolkit to assist experimentalists in the design of binding studies and in the analysis of binding data. The partial fraction (PF) expansion technique is used to decompose binding curves for proteins with n ligand-binding sites exactly and uniquely into n components, each of which has the form of a one-site binding curve. The association constants of the PF component curves, being the roots of an n-th order polynomial, may be real or complex. We demonstrate a fundamental connection between binding parameter identifiability and the nature of these one-site association constants: all binding parameters are identifiable if the constants are all real and distinct; otherwise, at least some of the parameters are not identifiable. The theory is used to construct identifiability maps from which the practical identifiability of binding parameters for any two-, three-, or four-site binding curve can be assessed. Instructions for extending the method to generate identifiability maps for proteins with more than four binding sites are also given. Further analysis of the identifiability maps leads to the simple rule that the maximum number of structurally identifiable binding parameters (shown in the previous paper to be equal to n) will also be PI only if the binding curve line shape contains n resolved components. PMID:27993951

  15. Super-high-affinity binding site for [3H]diazepam in the presence of Co2+, Ni2+, Cu2+, or Zn2+.

    PubMed

    Mizuno, S; Ogawa, N; Mori, A

    1982-12-01

    Chloride salts of Li+, Na+, K+, Mg2+, Ca2+, Cr3+, Mn2+, Fe2+, and Fe3+ had no effect on [3H]diazepam binding. Chloride salts of Co2+, Ni2+, Cu2+, and Zn2+ increased [3H]diazepam binding by 34 to 68% in a concentration-dependent fashion. Since these divalent cations potentiated the GABA-enhanced [3H]diazepam binding and the effect of each divalent cation was nearly additive with GABA, these cations probably act at a site different from the GABA recognition site in the benzodiazepine-receptor complex. Scatchard plots of [3H]diazepam binding without an effective divalent cation showed a single class of binding, with a Kd value of 5.3 nM. In the presence of 1 mM Co2+, Ni2+, Cu2+, or Zn2+, two distinct binding sites were evident with apparent Kd values of 1.0 nM and 5.7 nM. The higher-affinity binding was not detected in the absence of an effective divalent cation and is probably a novel, super-high-affinity binding site.

  16. Point mutations abolishing the mannose-binding capability of boar spermadhesin AQN-1.

    PubMed

    Ekhlasi-Hundrieser, Mahnaz; Calvete, Juan J; Von Rad, Bettina; Hettel, Christiane; Nimtz, Manfred; Töpfer-Petersen, Edda

    2008-05-01

    The mannose-binding capability of recombinant wild-type boar spermadhesin AQN-1 and of its site-directed mutants in the highly-conserved region around of the single glycosylation site (asparagine 50) of some spermadhesins, where the carbohydrate binding site has been proposed to be located, was checked using a solid-phase assay and a biotinylated mannose ligand. Substitution of glycine 54 by amino acids bearing an unipolar side chain did not cause significant decrease in the mannose-binding activity. However, amino acids with uncharged polar side chains or having a charged polar side chain abolished the binding of biotinylated mannose to the corresponding AQN-1 mutants. The results suggest that the higher surface accessibility of amino acids possessing polar side chains compared to those bearing nonpolar groups may sterically interfere with monosaccharide binding. The location of the mannose-binding site in AQN-1 appears to be topologically conserved in other heparin-binding boar spermadhesins, i.e., AQN-3 and AWN, but departs from the location of the mannose-6-phosphate-recognition site of PSP-II. This indicates that different spermadhesin molecules have evolved non-equivalent carbohydrate-binding capabilities, which may underlie their distinct patterns of biological activities.

  17. Virtual screening of potential inhibitors from TCM for the CPSF30 binding site on the NS1A protein of influenza A virus.

    PubMed

    Ai, Haixin; Zhang, Li; Chang, Alan K; Wei, Hongyun; Che, Yuchen; Liu, Hongsheng

    2014-03-01

    Inhibition of CPSF30 function by the effector domain of influenza A virus of non-structural protein 1 (NS1A) protein plays a critical role in the suppression of host key antiviral response. The CPSF30-binding site of NS1A appears to be a very attractive target for the development of new drugs against influenza A virus. In this study, structure-based molecular docking was utilized to screen more than 30,000 compounds from a Traditional Chinese Medicine (TCM) database. Four drug-like compounds were selected as potential inhibitors for the CPSF30-binding site of NS1A. Docking conformation analysis results showed that these potential inhibitors could bind to the CPSF30-binding site with strong hydrophobic interactions and weak hydrogen bonds. Molecular dynamics simulations and MM-PBSA calculations suggested that two of the inhibitors, compounds 32056 and 31674, could stably bind to the CPSF30-binding site with high binding free energy. These two compounds could be modified to achieve higher binding affinity, so that they may be used as potential leads in the development of new anti-influenza drugs.

  18. Expression and GTP sensitivity of peptide histidine isoleucine high-affinity-binding sites in rat.

    PubMed

    Debaigt, Colin; Meunier, Annie-Claire; Goursaud, Stephanie; Montoni, Alicia; Pineau, Nicolas; Couvineau, Alain; Laburthe, Marc; Muller, Jean-Marc; Janet, Thierry

    2006-07-01

    High-affinity-binding sites for the vasoactive intestinal peptide (VIP) analogs peptide histidine/isoleucine-amide (PHI)/carboxyterminal methionine instead of isoleucine (PHM) are expressed in numerous tissues in the body but the nature of their receptors remains to be elucidated. The data presented indicate that PHI discriminated a high-affinity guanosine 5'-triphosphate (GTP)-insensitive-binding subtype that represented the totality of the PHI-binding sites in newborn rat tissues but was differentially expressed in adult animals. The GTP-insensitive PHI/PHM-binding sites were also observed in CHO cells over expressing the VPAC2 but not the VPAC1 VIP receptor.

  19. Selectivity of externally facing ion-binding sites in the Na/K pump to alkali metals and organic cations

    PubMed Central

    Ratheal, Ian M.; Virgin, Gail K.; Yu, Haibo; Roux, Benoît; Gatto, Craig; Artigas, Pablo

    2010-01-01

    The Na/K pump is a P-type ATPase that exchanges three intracellular Na+ ions for two extracellular K+ ions through the plasmalemma of nearly all animal cells. The mechanisms involved in cation selection by the pump's ion-binding sites (site I and site II bind either Na+ or K+; site III binds only Na+) are poorly understood. We studied cation selectivity by outward-facing sites (high K+ affinity) of Na/K pumps expressed in Xenopus oocytes, under voltage clamp. Guanidinium+, methylguanidinium+, and aminoguanidinium+ produced two phenomena possibly reflecting actions at site III: (i) voltage-dependent inhibition (VDI) of outwardly directed pump current at saturating K+, and (ii) induction of pump-mediated, guanidinium-derivative–carried inward current at negative potentials without Na+ and K+. In contrast, formamidinium+ and acetamidinium+ induced K+-like outward currents. Measurement of ouabain-sensitive ATPase activity and radiolabeled cation uptake confirmed that these cations are external K+ congeners. Molecular dynamics simulations indicate that bound organic cations induce minor distortion of the binding sites. Among tested metals, only Li+ induced Na+-like VDI, whereas all metals tested except Na+ induced K+-like outward currents. Pump-mediated K+-like organic cation transport challenges the concept of rigid structural models in which ion specificity at site I and site II arises from a precise and unique arrangement of coordinating ligands. Furthermore, actions by guanidinium+ derivatives suggest that Na+ binds to site III in a hydrated form and that the inward current observed without external Na+ and K+ represents cation transport when normal occlusion at sites I and II is impaired. These results provide insights on external ion selectivity at the three binding sites. PMID:20937860

  20. Mechanistic Insight from Calorimetric Measurements of the Assembly of the Binuclear Metal Active Site of Glycerophosphodiesterase (GpdQ) from Enterobacter aerogenes.

    PubMed

    Pedroso, Marcelo M; Ely, Fernanda; Carpenter, Margaret C; Mitić, Nataša; Gahan, Lawrence R; Ollis, David L; Wilcox, Dean E; Schenk, Gerhard

    2017-07-05

    Glycerophosphodiesterase (GpdQ) from Enterobacter aerogenes is a binuclear metallohydrolase with a high affinity for metal ions at its α site but a lower affinity at its β site in the absence of a substrate. Isothermal titration calorimetry (ITC) has been used to quantify the Co(II) and Mn(II) binding affinities and thermodynamics of the two sites in wild-type GpdQ and two mutants, both in the absence and in the presence of phosphate. Metal ions bind to the six-coordinate α site in an entropically driven process with loss of a proton, while binding at the β site is not detected by ITC. Phosphate enhances the metal affinity of the α site by increasing the binding entropy and the metal affinity of the β site by enthalpic (Co) or entropic (Mn) contributions, but no additional loss of protons. Mutations of first- and second-coordination sphere residues at the β site increase the metal affinity of both sites by enhancing the binding enthalpy. In particular, loss of the hydrogen bond from second-sphere Ser127 to the metal-coordinating Asn80 has a significant effect on the metal binding thermodynamics that result in a resting binuclear active site with high catalytic activity. While structural and spectroscopic data with excess metal ions have indicated a bridging hydroxide in the binuclear GpdQ site, analysis of ITC data here reveals the loss of a single proton in the assembly of this site, indicating that the metal-bound hydroxide nucleophile is formed in the resting inactive mononuclear form, which becomes catalytically competent upon binding the second metal ion.

  1. Volatile anesthetic binding to proteins is influenced by solvent and aliphatic residues.

    PubMed

    Streiff, John H; Jones, Keith A

    2008-10-01

    The main objective of this work was to characterize VA binding sites in multiple anesthetic target proteins. A computational algorithm was used to quantify the solvent exclusion and aliphatic character of amphiphilic pockets in the structures of VA binding proteins. VA binding sites in the protein structures were defined as the pockets with solvent exclusion and aliphatic character that exceeded minimum values observed in the VA binding sites of serum albumin, firefly luciferase, and apoferritin. We found that the structures of VA binding proteins are enriched in these pockets and that the predicted binding sites were consistent with experimental determined binding locations in several proteins. Autodock3 was used to dock the simulated molecules of 1,1,1,2,2-pentafluoroethane, difluoromethyl 1,1,1,2-tetrafluoroethyl ether, and sevoflurane and the isomers of halothane and isoflurane into these potential binding sites. We found that the binding of the various VA molecules to the amphiphilic pockets is driven primarily by VDW interactions and to a lesser extent by weak hydrogen bonding and electrostatic interactions. In addition, the trend in Delta G binding values follows the Meyer-Overton rule. These results suggest that VA potencies are related to the VDW interactions between the VA ligand and protein target. It is likely that VA bind to sites with a high degree of solvent exclusion and aliphatic character because aliphatic residues provide favorable VDW contacts and weak hydrogen bond donors. Water molecules occupying these sites maintain pocket integrity, associate with the VA ligand, and diminish the unfavorable solvation enthalpy of the VA. Water molecules displaced into the bulk by the VA ligand may provide an additional favorable enthalpic contribution to VA binding. Anesthesia is a component of many health related procedures, the outcomes of which could be improved with a better understanding of the molecular targets and mechanisms of anesthetic action.

  2. Fold independent structural comparisons of protein-ligand binding sites for exploring functional relationships.

    PubMed

    Gold, Nicola D; Jackson, Richard M

    2006-02-03

    The rapid growth in protein structural data and the emergence of structural genomics projects have increased the need for automatic structure analysis and tools for function prediction. Small molecule recognition is critical to the function of many proteins; therefore, determination of ligand binding site similarity is important for understanding ligand interactions and may allow their functional classification. Here, we present a binding sites database (SitesBase) that given a known protein-ligand binding site allows rapid retrieval of other binding sites with similar structure independent of overall sequence or fold similarity. However, each match is also annotated with sequence similarity and fold information to aid interpretation of structure and functional similarity. Similarity in ligand binding sites can indicate common binding modes and recognition of similar molecules, allowing potential inference of function for an uncharacterised protein or providing additional evidence of common function where sequence or fold similarity is already known. Alternatively, the resource can provide valuable information for detailed studies of molecular recognition including structure-based ligand design and in understanding ligand cross-reactivity. Here, we show examples of atomic similarity between superfamily or more distant fold relatives as well as between seemingly unrelated proteins. Assignment of unclassified proteins to structural superfamiles is also undertaken and in most cases substantiates assignments made using sequence similarity. Correct assignment is also possible where sequence similarity fails to find significant matches, illustrating the potential use of binding site comparisons for newly determined proteins.

  3. Analysis of functional importance of binding sites in the Drosophila gap gene network model.

    PubMed

    Kozlov, Konstantin; Gursky, Vitaly V; Kulakovskiy, Ivan V; Dymova, Arina; Samsonova, Maria

    2015-01-01

    The statistical thermodynamics based approach provides a promising framework for construction of the genotype-phenotype map in many biological systems. Among important aspects of a good model connecting the DNA sequence information with that of a molecular phenotype (gene expression) is the selection of regulatory interactions and relevant transcription factor bindings sites. As the model may predict different levels of the functional importance of specific binding sites in different genomic and regulatory contexts, it is essential to formulate and study such models under different modeling assumptions. We elaborate a two-layer model for the Drosophila gap gene network and include in the model a combined set of transcription factor binding sites and concentration dependent regulatory interaction between gap genes hunchback and Kruppel. We show that the new variants of the model are more consistent in terms of gene expression predictions for various genetic constructs in comparison to previous work. We quantify the functional importance of binding sites by calculating their impact on gene expression in the model and calculate how these impacts correlate across all sites under different modeling assumptions. The assumption about the dual interaction between hb and Kr leads to the most consistent modeling results, but, on the other hand, may obscure existence of indirect interactions between binding sites in regulatory regions of distinct genes. The analysis confirms the previously formulated regulation concept of many weak binding sites working in concert. The model predicts a more or less uniform distribution of functionally important binding sites over the sets of experimentally characterized regulatory modules and other open chromatin domains.

  4. Factors governing the substitution of La3+ for Ca2+ and Mg2+ in metalloproteins: a DFT/CDM study.

    PubMed

    Dudev, Todor; Chang, Li-Ying; Lim, Carmay

    2005-03-23

    Trivalent lanthanide cations are extensively being used in biochemical experiments to probe various dication-binding sites in proteins; however, the factors governing the binding specificity of lanthanide cations for these binding sites remain unclear. Hence, we have performed systematic studies to evaluate the interactions between La3+ and model Ca2+ - and Mg2+ -binding sites using density functional theory combined with continuum dielectric methods. The calculations reveal the key factors and corresponding physical bases favoring the substitution of trivalent lanthanides for divalent Ca2+ and Mg2+ in holoproteins. Replacing Ca2+ or Mg2+ with La3+ is facilitated by (1) minimizing the solvent exposure and the flexibility of the metal-binding cavity, (2) freeing both carboxylate oxygen atoms of Asp/Glu side chains in the metal-binding site so that they could bind bidentately to La3+, (3) maximizing the number of metal-bound carboxylate groups in buried sites, but minimizing the number of metal-bound carboxylate groups in solvent-exposed sites, and (4) including an Asn/Gln side chain for sites lined with four Asp/Glu side chains. In proteins bound to both Mg2+ and Ca2+, La3+ would prefer to replace Ca2+, as compared to Mg2+. A second Mg2+-binding site with a net positive charge would hamper the Mg2+ --> La3+ exchange, as compared to the respective mononuclear site, although the La3+ substitution of the first native metal is more favorable than the second one. The findings of this work are in accord with available experimental data.

  5. Sequence of ligand binding and structure change in the diphtheria toxin repressor upon activation by divalent transition metals.

    PubMed

    Rangachari, Vijayaraghavan; Marin, Vedrana; Bienkiewicz, Ewa A; Semavina, Maria; Guerrero, Luis; Love, John F; Murphy, John R; Logan, Timothy M

    2005-04-19

    The diphtheria toxin repressor (DtxR) is an Fe(II)-activated transcriptional regulator of iron homeostatic and virulence genes in Corynebacterium diphtheriae. DtxR is a two-domain protein that contains two structurally and functionally distinct metal binding sites. Here, we investigate the molecular steps associated with activation by Ni(II)Cl(2) and Cd(II)Cl(2). Equilibrium binding energetics for Ni(II) were obtained from isothermal titration calorimetry, indicating apparent metal dissociation constants of 0.2 and 1.7 microM for two independent sites. The binding isotherms for Ni(II) and Cd(II) exhibited a characteristic exothermic-endothermic pattern that was used to infer the metal binding sequence by comparing the wild-type isotherm with those of several binding site mutants. These data were complemented by measuring the distance between specific backbone amide nitrogens and the first equivalent of metal through heteronuclear NMR relaxation measurements. Previous studies indicated that metal binding affects a disordered to ordered transition in the metal binding domain. The coupling between metal binding and structure change was investigated using near-UV circular dichroism spectroscopy. Together, the data show that the first equivalent of metal is bound by the primary metal binding site. This binding orients the DNA binding helices and begins to fold the N-terminal domain. Subsequent binding at the ancillary site completes the folding of this domain and formation of the dimer interface. This model is used to explain the behavior of several mutants.

  6. Functional analysis of the EspR binding sites upstream of espR in Mycobacterium tuberculosis.

    PubMed

    Cao, Guangxiang; Howard, Susan T; Zhang, Peipei; Hou, Guihua; Pang, Xiuhua

    2013-11-01

    The ESX-1 secretion system exports substrate proteins into host cells and is crucial for the pathogenesis of Mycobacterium tuberculosis. EspR is one of the characterized transcriptional regulators that modulates the ESX-1 system by binding the conserved EspR binding sites in the promoter of espA, the encoding gene of EspA, which is also a substrate protein of the ESX-1 system and is required for the ESX-1 activity. EspR is autoregulatory and conserved EspR binding sites are present upstream of espR. In this study, we showed that these EspR sites had varying affinities for EspR, with site B being the strongest one. Point mutations of the DNA sequence at site B abolished binding of EspR to oligonucleotides containing site B alone or with other sites, further suggesting that site B is a major binding site for EspR. Complementation studies showed that constructs containing espR, and the upstream intergenic region fully restored espR expression in a ΔespR mutant strain. Although recombinant strains with mutations at more than one EspR site showed minimal differences in espR expression, reduced expression of other EspR target genes was observed, suggesting that slight changes in EspR levels can have downstream regulatory effects. These findings contribute to our understanding of the regulation of the ESX-1 system.

  7. DNA breathing dynamics distinguish binding from nonbinding consensus sites for transcription factor YY1 in cells.

    PubMed

    Alexandrov, Boian S; Fukuyo, Yayoi; Lange, Martin; Horikoshi, Nobuo; Gelev, Vladimir; Rasmussen, Kim Ø; Bishop, Alan R; Usheva, Anny

    2012-11-01

    The genome-wide mapping of the major gene expression regulators, the transcription factors (TFs) and their DNA binding sites, is of great importance for describing cellular behavior and phenotypic diversity. Presently, the methods for prediction of genomic TF binding produce a large number of false positives, most likely due to insufficient description of the physiochemical mechanisms of protein-DNA binding. Growing evidence suggests that, in the cell, the double-stranded DNA (dsDNA) is subject to local transient strands separations (breathing) that contribute to genomic functions. By using site-specific chromatin immunopecipitations, gel shifts, BIOBASE data, and our model that accurately describes the melting behavior and breathing dynamics of dsDNA we report a specific DNA breathing profile found at YY1 binding sites in cells. We find that the genomic flanking sequence variations and SNPs, may exert long-range effects on DNA dynamics and predetermine YY1 binding. The ubiquitous TF YY1 has a fundamental role in essential biological processes by activating, initiating or repressing transcription depending upon the sequence context it binds. We anticipate that consensus binding sequences together with the related DNA dynamics profile may significantly improve the accuracy of genomic TF binding sites and TF binding-related functional SNPs.

  8. Prostaglandin E and F2 alpha receptors in human myometrium during the menstrual cycle and in pregnancy and labor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Giannopoulos, G.; Jackson, K.; Kredentser, J.

    The binding of prostaglandins E1 and F2 alpha has been studied in the human myometrium and cervix during the menstrual cycle and in the myometrium of pregnant patients at term before and during labor. Tritium-labeled prostaglandin E1 and F2 alpha binding was saturable and reversible. Scatchard analysis of tritium-labeled prostaglandin E1 binding was linear, which suggests a single class of high-affinity binding sites with an estimated apparent equilibrium dissociation constant of 2.5 to 5.4 nmol/L and inhibitor affinities of 0.9, 273, 273, and 217 nmol/L for prostaglandins E2, A1, B1, and F2 alpha, respectively. Scatchard analysis of tritium-labeled prostaglandin F2more » alpha, binding was also linear, but the affinity of these binding sites was much lower, with an average dissociation constant of 50 nmol/L and inhibitor affinities of 1.6, 2.2, and 11.2 nmol/L for prostaglandins E1, E2, and A1, respectively. In nonpregnant patients, the concentrations and affinities of tritium-labeled prostaglandin E1 binding sites were similar in the myometrium during the proliferative and secretory phases of the menstrual cycle, but the concentration of these sites was much lower in the cervix. The concentration of the tritium-labeled prostaglandin E1 binding sites was significantly lower in the myometrium of pregnant patients at term than in the myometrium of nonpregnant patients. The concentrations and affinities of tritium-labeled prostaglandin E1 binding sites were not significantly different in the upper and lower myometrium of pregnant patients at term or in the myometrium of such patients before and during labor. The concentrations of the tritium-labeled prostaglandin F2 alpha binding sites during the menstrual cycle and in pregnancy at term were similar to those of tritium-labeled prostaglandin E1 binding sites.« less

  9. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Eilert, Andre; Cavalca, Filippo; Roberts, F. Sloan

    Copper electrocatalysts derived from an oxide have shown extraordinary electrochemical properties for the carbon dioxide reduction reaction (CO 2RR). Using in situ ambient pressure X-ray photoelectron spectroscopy and quasi in situ electron energy-loss spectroscopy in a transmission electron microscope, we show that there is a substantial amount of residual oxygen in nanostructured, oxide-derived copper electrocatalysts but no residual copper oxide. On the basis of these findings in combination with density functional theory simulations, we propose that residual subsurface oxygen changes the electronic structure of the catalyst and creates sites with higher carbon monoxide binding energy. If such sites are stablemore » under the strongly reducing conditions found in CO 2RR, these findings would explain the high efficiencies of oxide-derived copper in reducing carbon dioxide to multicarbon compounds such as ethylene.« less

  10. Two classes of cholesterol binding sites for the β2AR revealed by thermostability and NMR.

    PubMed

    Gater, Deborah L; Saurel, Olivier; Iordanov, Iordan; Liu, Wei; Cherezov, Vadim; Milon, Alain

    2014-11-18

    Cholesterol binding to G protein-coupled receptors (GPCRs) and modulation of their activities in membranes is a fundamental issue for understanding their function. Despite the identification of cholesterol binding sites in high-resolution x-ray structures of the ?2 adrenergic receptor (β2AR) and other GPCRs, the binding affinity of cholesterol for this receptor and exchange rates between the free and bound cholesterol remain unknown. In this study we report the existence of two classes of cholesterol binding sites in β2AR. By analyzing the β2AR unfolding temperature in lipidic cubic phase (LCP) as a function of cholesterol concentration we observed high-affinity cooperative binding of cholesterol with sub-nM affinity constant. In contrast, saturation transfer difference (STD) NMR experiments revealed the existence of a second class of cholesterol binding sites, in fast exchange on the STD NMR timescale. Titration of the STD signal as a function of cholesterol concentration provided a lower limit of 100 mM for their dissociation constant. However, these binding sites are specific for both cholesterol and β2AR, as shown with control experiments using ergosterol and a control membrane protein (KpOmpA). We postulate that this specificity is mediated by the high-affinity bound cholesterol molecules and propose the formation of transient cholesterol clusters around the high-affinity binding sites.

  11. Prediction of the binding sites of huperzine A in acetylcholinesterase by docking studies

    NASA Astrophysics Data System (ADS)

    Pang, Yuan-Ping; Kozikowski, Alan P.

    1994-12-01

    We have performed docking studies with the SYSDOC program on acetylcholinesterase (AChE) to predict the binding sites in AChE of huperzine A (HA), which is a potent and selective, reversible inhibitor of AChE. The unique aspects of our docking studies include the following: (i) Molecular flexibility of the guest and the host is taken into account, which permits both to change their conformations upon binding. (ii) The binding energy is evaluated by a sum of energies of steric, electrostatic and hydrogen bonding interactions. In the energy calculation no grid approximation is used, and all hydrogen atoms of the system are treated explicitly. (iii) The energy of cation-π interactions between the guest and the host, which is important in the binding of AChE, is included in the calculated binding energy. (iv) Docking is performed in all regions of the host's binding cavity. Based on our docking studies and the pharmacological results reported for HA and its analogs, we predict that HA binds to the bottom of the binding cavity of AChE (the gorge) with its ammonium group interacting with Trp84, Phe330, Glu199 and Asp72 (catalytic site). At the the opening of the gorge with its ammonium group partially interacting with Trp279 (peripheral site). At the catalytic site, three partially overlapping subsites of HA were identified which might provide a dynamic view of binding of HA to the catalytic site.

  12. Stereoselective L-(3H)quinuclidinyl benzilate-binding sites in nervous tissue of Aplysia californica: evidence for muscarinic receptors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Murray, T.F.; Mpitsos, G.J.; Siebenaller, J.F.

    The muscarinic antagonist L-(/sup 3/H)quinuclidinyl benzilate (L-(/sup 3/H)QNB) binds with a high affinity (Kd = 0.77 nM) to a single population of specific sites (Bmax = 47 fmol/mg of protein) in nervous tissue of the gastropod mollusc, Aplysia. The specific L-(/sup 3/H)QNB binding is displaced stereoselectively by the enantiomers of benzetimide, dexetimide, and levetimide. The pharmacologically active enantiomer, dexetimide, is more potent than levetimide as an inhibitor of L-(/sup 3/H)QNB binding. Moreover, the muscarinic cholinergic ligands, scopolamine, atropine, oxotremorine, and pilocarpine are effective inhibitors of the specific L-(/sup 3/H)QNB binding, whereas nicotinic receptor antagonists, decamethonium and d-tubocurarine, are considerably lessmore » effective. These pharmacological characteristics of the L-(/sup 3/H)QNB-binding site provide evidence for classical muscarinic receptors in Aplysia nervous tissue. The physiological relevance of the dexetimide-displaceable L-(/sup 3/H)QNB-binding site was supported by the demonstration of the sensitivity of the specific binding to thermal denaturation. Specific binding of L-(/sup 3/H)QNB was also detected in nervous tissue of another marine gastropod, Pleurobranchaea californica. The characteristics of the Aplysia L-(/sup 3/H)QNB-binding site are in accordance with studies of numerous vertebrate and invertebrate tissues indicating that the muscarinic cholinergic receptor site has been highly conserved through evolution.« less

  13. Tyrosine411 and Arginine410 of Human Serum Albumin Play an Important Role in the Binding of Sodium 4-Phenylbutyrate to Site II.

    PubMed

    Enokida, Taisuke; Yamasaki, Keishi; Okamoto, Yuko; Taguchi, Kazuaki; Ishiguro, Takako; Maruyama, Toru; Seo, Hakaru; Otagiri, Masaki

    2016-06-01

    Sodium 4-phenylbutyrate (PB) has many pharmacological activities; therefore extending its clinical use to the treatment of a wider variety of diseases would be desirable. However, our knowledge of the binding of PB to plasma proteins is not extensive. To address this issue in more detail, we characterized the protein binding of PB. Binding experiments showed that PB mainly binds to human serum albumin (HSA) in plasma. PB was also found to bind to a single site on HSA, which was identified as site II by fluorescent probe displacement experiment. Furthermore, an appropriate alkyl chain length and a carboxylic group in the PB structure were required for PB binding to HSA, suggesting that hydrophobic (and van der Waals) and electrostatic interactions are involved as binding modes. The contributions of hydrogen bonding and/or van der Waals interactions were also indicated by thermodynamic analyses. Tyrosine411 and arginine410 were identified as being involved in the binding of PB to site II, based on binding experiments using chemically modified- and mutant-HSA preparations. In conclusion, the available evidence indicates that PB binds to site II of HSA with assistance by multiple forces and that tyrosine411 and arginine410 both play important roles in this phenomenon. Copyright © 2016 American Pharmacists Association®. Published by Elsevier Inc. All rights reserved.

  14. In silico fragment-based drug discovery: setup and validation of a fragment-to-lead computational protocol using S4MPLE.

    PubMed

    Hoffer, Laurent; Renaud, Jean-Paul; Horvath, Dragos

    2013-04-22

    This paper describes the use and validation of S4MPLE in Fragment-Based Drug Design (FBDD)--a strategy to build drug-like ligands starting from small compounds called fragments. S4MPLE is a conformational sampling tool based on a hybrid genetic algorithm that is able to simulate one (conformer enumeration) or more molecules (docking). The goal of the current paper is to show that due to the judicious design of genetic operators, S4MPLE may be used without any specific adaptation as an in silico FBDD tool. Such fragment-to-lead evolution involves either growing of one or linking of several fragment-like binder(s). The native ability to specifically "dock" a substructure that is covalently anchored to its target (here, some prepositioned fragment formally part of the binding site) enables it to act like dedicated de novo builders and differentiates it from most classical docking tools, which may only cope with non-covalent interactions. Besides, S4MPLE may address growing/linking scenarios involving protein site flexibility, and it might also suggest "growth" moves by bridging the ligand to the site via water-mediated interactions if H2O molecules are simply appended to the input files. Therefore, the only development overhead required to build a virtual fragment→ligand growing/linking strategy based on S4MPLE were two chemoinformatics programs meant to provide a minimalistic management of the linker library. The first creates a duplicate-free library by fragmenting a compound database, whereas the second builds new compounds, attaching chemically compatible linkers to the starting fragments. S4MPLE is subsequently used to probe the optimal placement of the linkers within the binding site, with initial restraints on atoms from initial fragments, followed by an optimization of all kept poses after restraint removal. Ranking is mainly based on two criteria: force-field potential energy and RMSD shifts of the original fragment moieties. This strategy was applied to several examples from the FBDD literature with good results over several monitored criteria: ability to generate the optimized ligand (or close analogs), good ranking of analogs among decoy compounds, and accurate predictions of expected binding modes of reference ligands. Simulations included "classical" covalent growing/linking, more challenging ones involving binding site conformational changes, and growth with optional recognition of putatively favorable water-mediated interactions.

  15. VIH from the mud crab is specifically expressed in the eyestalk and potentially regulated by transactivator of Sox9/Oct4/Oct1.

    PubMed

    Liu, Chunyun; Jia, Xiwei; Zou, Zhihua; Wang, Xiaowei; Wang, Yilei; Zhang, Ziping

    2018-01-01

    Vitellogenesis-inhibiting hormone (VIH) is known to regulate ovarian maturation by suppressing the synthesis of vitellogenin (Vtg) in crustaceans, which belongs to a member of crustacean hyperglycemic hormone (CHH) family synthesized and secreted from the X-organ/sinus gland complex of eyestalks. In this study, the cDNA, genomic DNA (gDNA) and the 5'-upstream regulatory (promoter region) sequences of VIH gene were obtained by conventional PCR, genome walker and tail-PCR techniques according to our transcriptomic database of Scylla paramamosain. The full-length cDNA of SpVIH is 634bp including 105bp 5'UTR, 151bp 3'UTR and 378bp ORF that encodes a peptide of 125 amino acids. The full length gDNA of SpVIH is 790bp containing two exons and one intron. The 5'-flanking promoter regions of SpVIH we isolated are 3070bp from the translation initiation (ATG) and 2398bp from the predicted transcription initiation (A), which consists of putative core promoter region and multiple potential transcription factor binding sites. SpVIH was only expressed in eyestalk. The expression level of SpVIH in eyestalk of female crab decreased gradually along with the development of ovary. As there is not cell line of crabs available, we chose the mature transfection system HEK293FT cell lines to explore the mechanism of transcription regulation of SpVIH in crabs. Sequential deletion assays using luciferase reporter gene in HEK293FT cells revealed that the possible promoter activity regions (including positive and negative transcription factors binding sites simultaneously) presented between pSpVIH-4 and pSpVIH-6. In order to further identify the crucial transcription factors binding site in this region, the site-directed mutagenesis of Sox9/Oct4/Oct1 binding site of pSpVIH-4 was created. The results demonstrated that the transcriptional activity of pSpVIH-4△ decreased significantly (p<0.05). Thus, it is reasonable to deduce that the Sox9/Oct4/Oct1 may be the essential positive transcription factors which regulate the expression of SpVIH. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. Energetics and kinetics of cooperative cofilin-actin filament interactions.

    PubMed

    Cao, Wenxiang; Goodarzi, Jim P; De La Cruz, Enrique M

    2006-08-11

    We have evaluated the thermodynamic parameters associated with cooperative cofilin binding to actin filaments, accounting for contributions of ion-linked equilibria, and determined the kinetic basis of cooperative cofilin binding. Ions weaken non-contiguous (isolated, non-cooperative) cofilin binding to an actin filament without affecting cooperative filament interactions. Non-contiguous cofilin binding is coupled to the dissociation of approximately 1.7 thermodynamically bound counterions. Counterion dissociation contributes approximately 40% of the total cofilin binding free energy (in the presence of 50 mM KCl). The non-contiguous and cooperative binding free energies are driven entirely by large, positive entropy changes, consistent with a cofilin-mediated increase in actin filament structural dynamics. The rate constant for cofilin binding to an isolated site on an actin filament is slow and likely to be limited by filament breathing. Cooperative cofilin binding arises from an approximately tenfold more rapid association rate constant and an approximately twofold slower dissociation rate constant. The more rapid association rate constant is presumably a consequence of cofilin-dependent changes in the average orientation of subdomain 2, subunit angular disorder and filament twist, which increase the accessibility of a neighboring cofilin-binding site on an actin filament. Cooperative association is more rapid than binding to an isolated site, but still slow for a second-order reaction, suggesting that cooperative binding is limited also by binding site accessibility. We suggest that the dissociation of actin-associated ions weakens intersubunit interactions in the actin filament lattice that enhance cofilin-binding site accessibility, favor cooperative binding and promote filament severing.

  17. Structure, Function, and Evolution of Biogenic Amine-binding Proteins in Soft Ticks

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mans, Ben J.; Ribeiro, Jose M.C.; Andersen, John F.

    2008-08-19

    Two highly abundant lipocalins, monomine and monotonin, have been isolated from the salivary gland of the soft tick Argas monolakensis and shown to bind histamine and 5-hydroxytryptamine (5-HT), respectively. The crystal structures of monomine and a paralog of monotonin were determined in the presence of ligands to compare the determinants of ligand binding. Both the structures and binding measurements indicate that the proteins have a single binding site rather than the two sites previously described for the female-specific histamine-binding protein (FS-HBP), the histamine-binding lipocalin of the tick Rhipicephalus appendiculatus. The binding sites of monomine and monotonin are similar to themore » lower, low affinity site of FS-HBP. The interaction of the protein with the aliphatic amine group of the ligand is very similar for the all of the proteins, whereas specificity is determined by interactions with the aromatic portion of the ligand. Interestingly, protein interaction with the imidazole ring of histamine differs significantly between the low affinity binding site of FS-HBP and monomine, suggesting that histamine binding has evolved independently in the two lineages. From the conserved features of these proteins, a tick lipocalin biogenic amine-binding motif could be derived that was used to predict biogenic amine-binding function in other tick lipocalins. Heterologous expression of genes from salivary gland libraries led to the discovery of biogenic amine-binding proteins in soft (Ornithodoros) and hard (Ixodes) tick genera. The data generated were used to reconstruct the most probable evolutionary pathway for the evolution of biogenic amine-binding in tick lipocalins.« less

  18. Anesthetic Binding in a Pentameric Ligand-Gated Ion Channel: GLIC

    PubMed Central

    Chen, Qiang; Cheng, Mary Hongying; Xu, Yan; Tang, Pei

    2010-01-01

    Cys-loop receptors are molecular targets of general anesthetics, but the knowledge of anesthetic binding to these proteins remains limited. Here we investigate anesthetic binding to the bacterial Gloeobacter violaceus pentameric ligand-gated ion channel (GLIC), a structural homolog of cys-loop receptors, using an experimental and computational hybrid approach. Tryptophan fluorescence quenching experiments showed halothane and thiopental binding at three tryptophan-associated sites in the extracellular (EC) domain, transmembrane (TM) domain, and EC-TM interface of GLIC. An additional binding site at the EC-TM interface was predicted by docking analysis and validated by quenching experiments on the N200W GLIC mutant. The binding affinities (KD) of 2.3 ± 0.1 mM and 0.10 ± 0.01 mM were derived from the fluorescence quenching data of halothane and thiopental, respectively. Docking these anesthetics to the original GLIC crystal structure and the structures relaxed by molecular dynamics simulations revealed intrasubunit sites for most halothane binding and intersubunit sites for thiopental binding. Tryptophans were within reach of both intra- and intersubunit binding sites. Multiple molecular dynamics simulations on GLIC in the presence of halothane at different sites suggested that anesthetic binding at the EC-TM interface disrupted the critical interactions for channel gating, altered motion of the TM23 linker, and destabilized the open-channel conformation that can lead to inhibition of GLIC channel current. The study has not only provided insights into anesthetic binding in GLIC, but also demonstrated a successful fusion of experiments and computations for understanding anesthetic actions in complex proteins. PMID:20858424

  19. ProBiS-ligands: a web server for prediction of ligands by examination of protein binding sites.

    PubMed

    Konc, Janez; Janežič, Dušanka

    2014-07-01

    The ProBiS-ligands web server predicts binding of ligands to a protein structure. Starting with a protein structure or binding site, ProBiS-ligands first identifies template proteins in the Protein Data Bank that share similar binding sites. Based on the superimpositions of the query protein and the similar binding sites found, the server then transposes the ligand structures from those sites to the query protein. Such ligand prediction supports many activities, e.g. drug repurposing. The ProBiS-ligands web server, an extension of the ProBiS web server, is open and free to all users at http://probis.cmm.ki.si/ligands. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  20. 1-3-A Resolution Structure of Human Glutathione S-Transferase With S-Hexyl Glutathione Bound Reveals Possible Extended Ligandin Binding Site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Trong, I.Le; Stenkamp, R.E.; Ibarra, C.

    2005-08-22

    Cytosolic glutathione S-transferases (GSTs) play a critical role in xenobiotic binding and metabolism, as well as in modulation of oxidative stress. Here, the high-resolution X-ray crystal structures of homodimeric human GSTA1-1 in the apo form and in complex with S-hexyl glutathione (two data sets) are reported at 1.8, 1.5, and 1.3A respectively. At this level of resolution, distinct conformations of the alkyl chain of S-hexyl glutathione are observed, reflecting the nonspecific nature of the hydrophobic substrate binding site (H-site). Also, an extensive network of ordered water, including 75 discrete solvent molecules, traverses the open subunit-subunit interface and connects the glutathionemore » binding sites in each subunit. In the highest-resolution structure, three glycerol moieties lie within this network and directly connect the amino termini of the glutathione molecules. A search for ligand binding sites with the docking program Molecular Operating Environment identified the ordered water network binding site, lined mainly with hydrophobic residues, suggesting an extended ligand binding surface for nonsubstrate ligands, the so-called ligandin site. Finally, detailed comparison of the structures reported here with previously published X-ray structures reveal a possible reaction coordinate for ligand-dependent conformational changes in the active site and the C-terminus.« less

  1. Characterizing multiple metal ion binding sites within a ribozyme by cadmium-induced EPR silencing

    PubMed Central

    Kisseleva, Natalia; Kraut, Stefanie; Jäschke, Andres; Schiemann, Olav

    2007-01-01

    In ribozyme catalysis, metal ions are generally known to make structural and∕or mechanistic contributions. The catalytic activity of a previously described Diels-Alderase ribozyme was found to depend on the concentration of divalent metal ions, and crystallographic data revealed multiple binding sites. Here, we elucidate the interactions of this ribozyme with divalent metal ions in solution using electron paramagnetic resonance (EPR) spectroscopy. Manganese ion titrations revealed five high-affinity Mn2+ binding sites with an upper Kd of 0.6±0.2 μM. In order to characterize each binding site individually, EPR-silent Cd2+ ions were used to saturate the other binding sites. This cadmium-induced EPR silencing showed that the Mn2+ binding sites possess different affinities. In addition, these binding sites could be assigned to three different types, including innersphere, outersphere, and a Mn2+ dimer. Based on simulations, the Mn2+-Mn2+ distance within the dimer was found to be ∼6 Å, which is in good agreement with crystallographic data. The EPR-spectroscopic characterization reveals no structural changes upon addition of a Diels-Alder product, supporting the concept of a preorganized catalytic pocket in the Diels-Alder ribozyme and the structural role of these ions. PMID:19404418

  2. Pharmacological characterization of the cloned kappa opioid receptor as a kappa 1b subtype.

    PubMed

    Lai, J; Ma, S W; Zhu, R H; Rothman, R B; Lentes, K U; Porreca, F

    1994-10-27

    Substantial pharmacological evidence in vitro and in vivo has suggested the existence of subtypes of the kappa opioid receptor. Quantitative radioligand binding techniques resolved the presence of two high affinity binding sites for the kappa 1 ligand [3H]U69,593 in mouse brain membranes, termed kappa 1a and kappa 1b, respectively. Whereas the kappa 1a site has high affinity for fedotozine and oxymorphindole and low affinity for bremazocine and alpha-neoendorphin, site kappa 1b has high affinity for bremazocine and alpha-neoendorphin and low affinity for fedotozine and oxymorphindole. CI-977 and U69,593 bind equally well at both sites. To determine the relationship between these kappa 1 receptor subtypes and the recently cloned mouse kappa 1 receptor (KOR), we examined [3H]U69,593 binding to the KOR in stably transfected cells (KORCHN-8). Competition of [3H]U69,593 binding to the KOR by bremazocine, alpha-neoendorphin, fedotozine and oxymorphindole resolved a single class of binding sites at which these agents had binding affinities similar to that of the kappa 1b site present in mouse brain. These results suggest that the cloned KOR corresponds to the kappa 1 site in mouse brain defined as kappa 1b.

  3. Anisotropic energy flow and allosteric ligand binding in albumin

    NASA Astrophysics Data System (ADS)

    Li, Guifeng; Magana, Donny; Dyer, R. Brian

    2014-01-01

    Allosteric interactions in proteins generally involve propagation of local structural changes through the protein to a remote site. Anisotropic energy transport is thought to couple the remote sites, but the nature of this process is poorly understood. Here, we report the relationship between energy flow through the structure of bovine serum albumin and allosteric interactions between remote ligand binding sites of the protein. Ultrafast infrared spectroscopy is used to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic and anisotropic energy flow through the protein structure following input of thermal energy into the flexible ligand binding sites, without local heating of the rigid helix bundles that connect these sites. This efficient energy transport mechanism enables the allosteric propagation of binding energy through the connecting helix structures.

  4. Anisotropic energy flow and allosteric ligand binding in albumin.

    PubMed

    Li, Guifeng; Magana, Donny; Dyer, R Brian

    2014-01-01

    Allosteric interactions in proteins generally involve propagation of local structural changes through the protein to a remote site. Anisotropic energy transport is thought to couple the remote sites, but the nature of this process is poorly understood. Here, we report the relationship between energy flow through the structure of bovine serum albumin and allosteric interactions between remote ligand binding sites of the protein. Ultrafast infrared spectroscopy is used to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic and anisotropic energy flow through the protein structure following input of thermal energy into the flexible ligand binding sites, without local heating of the rigid helix bundles that connect these sites. This efficient energy transport mechanism enables the allosteric propagation of binding energy through the connecting helix structures.

  5. Anisotropic energy flow and allosteric ligand binding in albumin

    PubMed Central

    Li, Guifeng; Magana, Donny; Dyer, R. Brian

    2014-01-01

    Allosteric interactions in proteins generally involve propagation of local structural changes through the protein to a remote site. Anisotropic energy transport is thought to couple the remote sites, but the nature of this process is poorly understood. Here, we report the relationship between energy flow through the structure of bovine serum albumin and allosteric interactions between remote ligand binding sites of the protein. Ultrafast infrared spectroscopy is used to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic and anisotropic energy flow through the protein structure following input of thermal energy into the flexible ligand binding sites, without local heating of the rigid helix bundles that connect these sites. This efficient energy transport mechanism enables the allosteric propagation of binding energy through the connecting helix structures. PMID:24445265

  6. An Experimental and Theoretical Evaluation of Multi-site Cadmium(II) Exchange in Designed Three-Stranded Coiled Coil Peptides

    PubMed Central

    Chakraborty, Saumen; Iranzo, Olga; Zuiderweg, Erik R.P.; Pecoraro, Vincent L.

    2012-01-01

    An important factor that defines the toxicity of elements such as cadmium(II), mercury(II), and lead(II) with biological macromolecules is metal ion exchange dynamics. Intriguingly, little is known about the fundamental rates and mechanisms of metal ion exchange into proteins, especially helical bundles. Herein, we investigate the exchange kinetics of cadmium(II) using de novo designed three-stranded coiled coil peptides that contain metal complexing cysteine thiolates as a model for the incorporation of this ion into trimeric, parallel helical bundles. Peptides were designed containing both single cadmium(II) binding site, GrandL12AL16C [Grand=AcG-(LKALEEK)5-GNH2], GrandL26AL30C, and GrandL26AE28QL30C, as well as GrandL12AL16CL26AL30C with two cadmium(II) binding sites. The binding of cadmium(II) to any of these sites is of high affinity (KA > 3×107 M−1). Using 113Cd NMR spectroscopy, cadmium(II) binding to these designed peptides was monitored. While the cadmium(II) binding is in extreme slow exchange without showing any chemical shift changes, incremental line broadening for the bound 113cadmium(II) signal is observed when excess 113cadmium(II) is titrated into the peptides. Most dramatically, for one site, L26AL30C, all 113cadmium(II) NMR signals disappear once a 1.7:1 ratio of cadmium(II)/(peptide)3 is reached. The observed processes are not compatible with simple “free-bound” two-site exchange kinetics at any time regime. The experimental results can, however, be simulated in detail with a multi-site binding model, which features additional cadmium(II) binding site(s) which, once occupied, perturb the primary binding site. This model is expanded into differential equations for five-site NMR chemical exchange. The numerical integration of these equations exhibits progressive loss of the primary site NMR signal without a chemical shift change and with limited line broadening, in good agreement with the observed experimental data. The mathematical model is interpreted in molecular terms as representing binding of excess cadmium(II) to surface Glu residues located at the helical interfaces. In the absence of cadmium(II), the Glu residues stabilize the three-helical structure though salt bridge interactions with surface Lys residues. We hypothesize that cadmium(II) interferes with these surface ion pairs, destabilizing the helical structure, and perturbing the primary cadmium(II) binding site. This hypothesis is supported by the observation that the cadmium(II)-excess line broadening is attenuated in GrandL26AE28QL30C where a surface Glu(28), close to the metal binding site, was changed to Gln. The external binding site may function as an entry pathway for cadmium(II) to find its internal binding site following a molecular rearrangement which may serve as a basis for our understanding of metal complexation, transport and exchange in complex native systems containing α-helical bundles. PMID:22394049

  7. The crystal structure of the AgamOBP1•Icaridin complex reveals alternative binding modes and stereo-selective repellent recognition.

    PubMed

    Drakou, Christina E; Tsitsanou, Katerina E; Potamitis, Constantinos; Fessas, Dimitrios; Zervou, Maria; Zographos, Spyros E

    2017-01-01

    Anopheles gambiae Odorant Binding Protein 1 in complex with the most widely used insect repellent DEET, was the first reported crystal structure of an olfactory macromolecule with a repellent, and paved the way for OBP1-structure-based approaches for discovery of new host-seeking disruptors. In this work, we performed STD-NMR experiments to directly monitor and verify the formation of a complex between AgamOBP1 and Icaridin, an efficient DEET alternative. Furthermore, Isothermal Titration Calorimetry experiments provided evidence for two Icaridin-binding sites with different affinities (Kd = 0.034 and 0.714 mM) and thermodynamic profiles of ligand binding. To elucidate the binding mode of Icaridin, the crystal structure of AgamOBP1•Icaridin complex was determined at 1.75 Å resolution. We found that Icaridin binds to the DEET-binding site in two distinct orientations and also to a novel binding site located at the C-terminal region. Importantly, only the most active 1R,2S-isomer of Icaridin's equimolar diastereoisomeric mixture binds to the AgamOBP1 crystal, providing structural evidence for the possible contribution of OBP1 to the stereoselectivity of Icaridin perception in mosquitoes. Structural analysis revealed two ensembles of conformations differing mainly in spatial arrangement of their sec-butyl moieties. Moreover, structural comparison with DEET indicates a common recognition mechanism for these structurally related repellents. Ligand interactions with both sites and binding modes were further confirmed by 2D 1 H- 15 N HSQC NMR spectroscopy. The identification of a novel repellent-binding site in AgamOBP1 and the observed structural conservation and stereoselectivity of its DEET/Icaridin-binding sites open new perspectives for the OBP1-structure-based discovery of next-generation insect repellents.

  8. AF64A depletes hippocampal high-affinity choline uptake but does not alter the density of alpha-bungarotoxin binding sites or modify the effect of exogenous choline.

    PubMed

    Morley, B J; Garner, L L

    1990-06-11

    Sodium-dependent, high-affinity choline uptake (HACU) and the density of alpha-bungarotoxin (BuTX) receptor-binding sites were measured in the hippocampus following the intraventricular infusion of ethylcholine aziridinium ion (AF64A), a neurotoxin that competes with choline at high-affinity choline transport sites and may result in the degeneration of cholinergic axons. Eight days after the infusion of AF64A into the lateral ventricles (2.5 nmol/side), HACU was depleted by 60% in the hippocampus of experimental animals in comparison with controls, but the density of BuTX-binding sites was not altered. The administration of 15 mg/ml of choline chloride in the drinking water increased the density of BuTX-binding sites, as previously reported by this laboratory. The administration of AF64A did not prevent the effect of exogenous choline on the density of binding sites, nor did choline treatment alter the effect of AF64A on HACU. These data indicate that the density of BuTX-binding sites in the hippocampus is not altered following a substantial decrease in HACU and presumed degeneration of cholinergic axons. Since the effect of exogenous choline was not prevented by AF64A treatment, the data are interpreted to support the hypothesis that the increase in the density of BuTX-binding sites following dietary choline supplementation is attributable to a direct effect of choline on receptor sites.

  9. Circular dichroism study of the interaction between mutagens and bilirubin bound to different binding sites of serum albumins

    NASA Astrophysics Data System (ADS)

    Orlov, Sergey; Goncharova, Iryna; Urbanová, Marie

    Although recent investigations have shown that bilirubin not only has a negative role in the organism but also exhibits significant antimutagenic properties, the mechanisms of interactions between bilirubin and mutagens are not clear. In this study, interaction between bilirubin bound to different binding sites of mammalian serum albumins with structural analogues of the mutagens 2-aminofluorene, 2,7-diaminofluorene and mutagen 2,4,7-trinitrofluorenone were investigated by circular dichroism and absorption spectroscopy. Homological human and bovine serum albumins were used as chiral matrices, which preferentially bind different conformers of bilirubin in the primary binding sites and make it observable by circular dichroism. These molecular systems approximated a real system for the study of mutagens in blood serum. Differences between the interaction of bilirubin bound to primary and to secondary binding sites of serum albumins with mutagens were shown. For bilirubin bound to secondary binding sites with low affinity, partial displacement and the formation of self-associates were observed in all studied mutagens. The associates of bilirubin bound to primary binding sites of serum albumins are formed with 2-aminofluorene and 2,4,7-trinitrofluorenone. It was proposed that 2,7-diaminofluorene does not interact with bilirubin bound to primary sites of human and bovine serum albumins due to the spatial hindrance of the albumins binding domains. The spatial arrangement of the bilirubin bound to serum albumin along with the studied mutagens was modelled using ligand docking, which revealed a possibility of an arrangement of the both bilirubin and 2-aminofluorene and 2,4,7-trinitrofluorenone in the primary binding site of human serum albumin.

  10. Genome-Wide Motif Statistics are Shaped by DNA Binding Proteins over Evolutionary Time Scales

    NASA Astrophysics Data System (ADS)

    Qian, Long; Kussell, Edo

    The composition of genomes with respect to short DNA motifs impacts the ability of DNA binding proteins to locate and bind their target sites. Since nonfunctional DNA binding can be detrimental to cellular functions and ultimately to organismal fitness, organisms could benefit from reducing the number of nonfunctional binding sites genome wide. Using in vitro measurements of binding affinities for a large collection of DNA binding proteins, in multiple species, we detect a significant global avoidance of weak binding sites in genomes. The underlying evolutionary process leaves a distinct genomic hallmark in that similar words have correlated frequencies, which we detect in all species across domains of life. We hypothesize that natural selection against weak binding sites contributes to this process, and using an evolutionary model we show that the strength of selection needed to maintain global word compositions is on the order of point mutation rates. Alternative contributions may come from interference of protein-DNA binding with replication and mutational repair processes, which operates with similar rates. We conclude that genome-wide word compositions have been molded by DNA binding proteins through tiny evolutionary steps over timescales spanning millions of generations.

  11. Multi-Mode Binding of Cellobiohydrolase Cel7A from Trichoderma reesei to Cellulose

    PubMed Central

    Jalak, Jürgen; Väljamäe, Priit

    2014-01-01

    Enzymatic hydrolysis of recalcitrant polysaccharides like cellulose takes place on the solid-liquid interface. Therefore the adsorption of enzymes to the solid surface is a pre-requisite for catalysis. Here we used enzymatic activity measurements with fluorescent model-substrate 4-methyl-umbelliferyl-β-D-lactoside for sensitive monitoring of the binding of cellobiohydrolase TrCel7A from Trichoderma reesei to bacterial cellulose (BC). The binding at low nanomolar free TrCel7A concentrations was exclusively active site mediated and was consistent with Langmuir's one binding site model with K d and A max values of 2.9 nM and 126 nmol/g BC, respectively. This is the strongest binding observed with non-complexed cellulases and apparently represents the productive binding of TrCel7A to cellulose chain ends on the hydrophobic face of BC microfibril. With increasing free TrCel7A concentrations the isotherm gradually deviated from the Langmuir's one binding site model. This was caused by the increasing contribution of lower affinity binding modes that included both active site mediated binding and non-productive binding with active site free from cellulose chain. The binding of TrCel7A to BC was found to be only partially reversible. Furthermore, the isotherm was dependent on the concentration of BC with more efficient binding observed at lower BC concentrations. The phenomenon can be ascribed to the BC concentration dependent aggregation of BC microfibrils with concomitant reduction of specific surface area. PMID:25265511

  12. Concentration-Dependent Multiple Binding Sites on Saliva-Treated Hydroxyapatite for Streptococcus sanguis

    PubMed Central

    Gibbons, R. J.; Moreno, E. C.; Etherden, I.

    1983-01-01

    The influence of bacterial cell concentration on estimates of the number of binding sites and the affinity for the adsorption of a strain of Streptococcus sanguis to saliva-treated hydroxyapatite was determined, and the possible presence of multiple binding sites for this organism was tested. The range of concentrations of available bacteria varied from 4.7 × 106 to 5,960 × 106 cells per ml. The numbers of adsorbed bacteria increased over the entire range tested, but a suggestion of a break in an otherwise smooth adsorption isotherm was evident. Values for the number of binding sites and the affinity varied considerably depending upon the range of available bacterial concentrations used to estimate them; high correlation coefficients were obtained in all cases. The use of low bacterial cell concentrations yielded lower values for the number of sites and much higher values for the affinity constant than did the use of high bacterial cell concentrations. When data covering the entire range of bacterial concentrations were employed, values for the number of sites and the affinity were similar to those obtained by using only high bacterial cell concentrations. The simplest explanation for these results is that there are multiple binding sites for S. sanguis on saliva-treated hydroxyapatite surfaces. When present in low concentration, the streptococci evidently attach to more specific high-affinity sites which become saturated when higher bacterial concentrations are employed. The possibility of multiple binding sites was substantiated by comparing estimates of the adsorption parameters from a computer-simulated isotherm with those derived from the experimentally generated isotherm. A mathematical model describing bacterial adsorption to binary binding sites was further evidence for the existence of at least two classes of binding sites for S. sanguis. Far fewer streptococci adsorbed to experimental pellicles prepared from saliva depleted of bacterial aggregating activity when low numbers of streptococci were used, but the magnitude of this difference was considerably less when high streptococcal concentrations were employed. This suggests an association between salivary components which possess bacterial-aggregating activity and bacterial adsorption to high-affinity specific binding sites on saliva-treated hydroxyapatite surfaces. PMID:6822416

  13. Ropizine concurrently enhances and inhibits ( sup 3 H) dextromethorpan binding to different structures of the guinea pig brain: Autoradiographic evidence for multiple binding sites

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Canoll, P.D.; Smith, P.R.; and Musacchio, J.M.

    1990-01-01

    Ropizine produces a simultaneous enhancement and inhibition of ({sup 3}H) dextromethorphan (DM) high-affinity binding to different areas of the guinea pig brain. These results imply that there are two distinct types of high-affinity ({sup 3}H)DM binding sites, which are present in variable proportions in different brain structures. The ropizine-enhances ({sup 3}H)DM binding type was preferentially inhibited by (+)-pentazocine. This is consistent with the presumption that the (+)-pentazocine-sensitive site is identical with the common site for DM and 3-(-3-Hydroxphenyl)-N-(1-propyl)piperidine ((+)-3-PPP). The second binding type, which is inhibited by ropizine and is not so sensitive to (+){minus} pentazocine, has not been fullymore » characterized. This study demonstrates that the biphasic effects to ropizine are due, at least in part, to the effects of ropizine on two different types of ({sup 3}H)DM binding sites. However, this study does not rule out that the common DM/(+)-3-PPP site also might be inhibited by higher concentrations of ropizine.« less

  14. The Structural Basis of ATP as an Allosteric Modulator

    PubMed Central

    Wang, Qi; Shen, Qiancheng; Li, Shuai; Nussinov, Ruth; Zhang, Jian

    2014-01-01

    Adenosine-5’-triphosphate (ATP) is generally regarded as a substrate for energy currency and protein modification. Recent findings uncovered the allosteric function of ATP in cellular signal transduction but little is understood about this critical behavior of ATP. Through extensive analysis of ATP in solution and proteins, we found that the free ATP can exist in the compact and extended conformations in solution, and the two different conformational characteristics may be responsible for ATP to exert distinct biological functions: ATP molecules adopt both compact and extended conformations in the allosteric binding sites but conserve extended conformations in the substrate binding sites. Nudged elastic band simulations unveiled the distinct dynamic processes of ATP binding to the corresponding allosteric and substrate binding sites of uridine monophosphate kinase, and suggested that in solution ATP preferentially binds to the substrate binding sites of proteins. When the ATP molecules occupy the allosteric binding sites, the allosteric trigger from ATP to fuel allosteric communication between allosteric and functional sites is stemmed mainly from the triphosphate part of ATP, with a small number from the adenine part of ATP. Taken together, our results provide overall understanding of ATP allosteric functions responsible for regulation in biological systems. PMID:25211773

  15. Using 15N-Ammonium to Characterise and Map Potassium Binding Sites in Proteins by NMR Spectroscopy

    PubMed Central

    Werbeck, Nicolas D; Kirkpatrick, John; Reinstein, Jochen; Hansen, D Flemming

    2014-01-01

    A variety of enzymes are activated by the binding of potassium ions. The potassium binding sites of these enzymes are very specific, but ammonium ions can often replace potassium ions in vitro because of their similar ionic radii. In these cases, ammonium can be used as a proxy for potassium to characterise potassium binding sites in enzymes: the 1H,15N spin-pair of enzyme-bound 15NH4+ can be probed by 15N-edited heteronuclear NMR experiments. Here, we demonstrate the use of NMR spectroscopy to characterise binding of ammonium ions to two different enzymes: human histone deacetylase 8 (HDAC8), which is activated allosterically by potassium, and the bacterial Hsp70 homologue DnaK, for which potassium is an integral part of the active site. Ammonium activates both enzymes in a similar way to potassium, thus supporting this non-invasive approach. Furthermore, we present an approach to map the observed binding site onto the structure of HDAC8. Our method for mapping the binding site is general and does not require chemical shift assignment of the enzyme resonances. PMID:24520048

  16. Fighting obesity with a sugar-based library: discovery of novel MCH-1R antagonists by a new computational-VAST approach for exploration of GPCR binding sites.

    PubMed

    Heifetz, Alexander; Barker, Oliver; Verquin, Geraldine; Wimmer, Norbert; Meutermans, Wim; Pal, Sandeep; Law, Richard J; Whittaker, Mark

    2013-05-24

    Obesity is an increasingly common disease. While antagonism of the melanin-concentrating hormone-1 receptor (MCH-1R) has been widely reported as a promising therapeutic avenue for obesity treatment, no MCH-1R antagonists have reached the market. Discovery and optimization of new chemical matter targeting MCH-1R is hindered by reduced HTS success rates and a lack of structural information about the MCH-1R binding site. X-ray crystallography and NMR, the major experimental sources of structural information, are very slow processes for membrane proteins and are not currently feasible for every GPCR or GPCR-ligand complex. This situation significantly limits the ability of these methods to impact the drug discovery process for GPCR targets in "real-time", and hence, there is an urgent need for other practical and cost-efficient alternatives. We present here a conceptually pioneering approach that integrates GPCR modeling with design, synthesis, and screening of a diverse library of sugar-based compounds from the VAST technology (versatile assembly on stable templates) to provide structural insights on the MCH-1R binding site. This approach creates a cost-efficient new avenue for structure-based drug discovery (SBDD) against GPCR targets. In our work, a primary VAST hit was used to construct a high-quality MCH-1R model. Following model validation, a structure-based virtual screen yielded a 14% hit rate and 10 novel chemotypes of potent MCH-1R antagonists, including EOAI3367472 (IC50 = 131 nM) and EOAI3367474 (IC50 = 213 nM).

  17. The use of molecular dynamics simulations to evaluate the DNA sequence-selectivity of G-A cross-linking PBD-duocarmycin dimers.

    PubMed

    Jackson, Paul J M; Rahman, Khondaker M; Thurston, David E

    2017-01-01

    The pyrrolobenzodiazepine (PBD) and duocarmycin families are DNA-interactive agents that covalently bond to guanine (G) and adenine (A) bases, respectively, and that have been joined together to create synthetic dimers capable of cross-linking G-G, A-A, and G-A bases. Three G-A alkylating dimers have been reported in publications to date, with defined DNA-binding sites proposed for two of them. In this study we have used molecular dynamics simulations to elucidate preferred DNA-binding sites for the three published molecular types. For the PBD-CPI dimer UTA-6026 (1), our simulations correctly predicted its favoured binding site (i.e., 5'-C(G)AATTA-3') as identified by DNA cleavage studies. However, for the PBD-CI molecule ('Compound 11', 3), we were unable to reconcile the results of our simulations with the reported preferred cross-linking sequence (5'-ATTTTCC(G)-3'). We found that the molecule is too short to span the five base pairs between the A and G bases as claimed, but should target instead a sequence such as 5'-ATTTC(G)-3' with two less base pairs between the reacting G and A residues. Our simulation results for this hybrid dimer are also in accord with the very low interstrand cross-linking and in vitro cytotoxicity activities reported for it. Although a preferred cross-linking sequence was not reported for the third hybrid dimer ('27eS', 2), our simulations predict that it should span two base pairs between covalently reacting G and A bases (e.g., 5'-GTAT(A)-3'). Copyright © 2016. Published by Elsevier Ltd.

  18. Structural Basis of Glyphosate Resistance Resulting from the Double Mutation Thr97 → Ile and Pro101 → Ser in 5-Enolpyruvylshikimate-3-phosphate Synthase from Escherichia coli*S⃞

    PubMed Central

    Funke, Todd; Yang, Yan; Han, Huijong; Healy-Fried, Martha; Olesen, Sanne; Becker, Andreas; Schönbrunn, Ernst

    2009-01-01

    The shikimate pathway enzyme 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) is the target of the broad spectrum herbicide glyphosate. The genetic engineering of EPSPS led to the introduction of glyphosate-resistant crops worldwide. The genetically engineered corn lines NK603 and GA21 carry distinct EPSPS enzymes. CP4 EPSPS, expressed in NK603 corn and transgenic soybean, cotton, and canola, belongs to class II EPSPS, glyphosate-insensitive variants of this enzyme isolated from certain Gram-positive bacteria. GA21 corn, on the other hand, was created by point mutations of class I EPSPS, such as the enzymes from Zea mays or Escherichia coli, which are sensitive to low glyphosate concentrations. The structural basis of the glyphosate resistance resulting from these point mutations has remained obscure. We studied the kinetic and structural effects of the T97I/P101S double mutation, the molecular basis for GA21 corn, using EPSPS from E. coli. The T97I/P101S enzyme is essentially insensitive to glyphosate (Ki = 2.4 mm) but maintains high affinity for the substrate phosphoenolpyruvate (PEP) (Km = 0.1 mm). The crystal structure at 1.7-Å resolution revealed that the dual mutation causes a shift of residue Gly96 toward the glyphosate binding site, impairing efficient binding of glyphosate, while the side chain of Ile97 points away from the substrate binding site, facilitating PEP utilization. The single site T97I mutation renders the enzyme sensitive to glyphosate and causes a substantial decrease in the affinity for PEP. Thus, only the concomitant mutations of Thr97 and Pro101 induce the conformational changes necessary to produce catalytically efficient, glyphosate-resistant class I EPSPS. PMID:19211556

  19. Structural basis of glyphosate resistance resulting from the double mutation Thr97 -> Ile and Pro101 -> Ser in 5-enolpyruvylshikimate-3-phosphate synthase from Escherichia coli.

    PubMed

    Funke, Todd; Yang, Yan; Han, Huijong; Healy-Fried, Martha; Olesen, Sanne; Becker, Andreas; Schönbrunn, Ernst

    2009-04-10

    The shikimate pathway enzyme 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) is the target of the broad spectrum herbicide glyphosate. The genetic engineering of EPSPS led to the introduction of glyphosate-resistant crops worldwide. The genetically engineered corn lines NK603 and GA21 carry distinct EPSPS enzymes. CP4 EPSPS, expressed in NK603 corn and transgenic soybean, cotton, and canola, belongs to class II EPSPS, glyphosate-insensitive variants of this enzyme isolated from certain Gram-positive bacteria. GA21 corn, on the other hand, was created by point mutations of class I EPSPS, such as the enzymes from Zea mays or Escherichia coli, which are sensitive to low glyphosate concentrations. The structural basis of the glyphosate resistance resulting from these point mutations has remained obscure. We studied the kinetic and structural effects of the T97I/P101S double mutation, the molecular basis for GA21 corn, using EPSPS from E. coli. The T97I/P101S enzyme is essentially insensitive to glyphosate (K(i) = 2.4 mm) but maintains high affinity for the substrate phosphoenolpyruvate (PEP) (K(m) = 0.1 mm). The crystal structure at 1.7-A resolution revealed that the dual mutation causes a shift of residue Gly(96) toward the glyphosate binding site, impairing efficient binding of glyphosate, while the side chain of Ile(97) points away from the substrate binding site, facilitating PEP utilization. The single site T97I mutation renders the enzyme sensitive to glyphosate and causes a substantial decrease in the affinity for PEP. Thus, only the concomitant mutations of Thr(97) and Pro(101) induce the conformational changes necessary to produce catalytically efficient, glyphosate-resistant class I EPSPS.

  20. Organizational requirements of the SaeR binding sites for a functional P1 promoter of the sae operon in Staphylococcus aureus.

    PubMed

    Cho, Hoonsik; Jeong, Do-Won; Li, Chunling; Bae, Taeok

    2012-06-01

    In Staphylococcus aureus, the SaeRS two-component system controls the expression of multiple virulence factors. Of the two promoters in the sae operon, P1 is autoinduced and has two binding sites for the response regulator SaeR. In this study, we examined the organizational requirements of the SaeR binding sites in P1 for transcription activation. Mutational studies showed that both binding sites are essential for binding to phosphorylated SaeR (P-SaeR) and transcription activation. When the 21-bp distance between the centers of the two SaeR binding sites was altered to 26 bp, 31 bp, 36 bp, or 41 bp, only the 31-bp mutant retained approximately 40% of the original promoter activity. When the -1-bp spacing (i.e.,1-bp overlap) between the primary SaeR binding site and the -35 promoter region was altered, all mutant P1 promoters failed to initiate transcription; however, when the first nucleotide of the -35 region was changed from A to T, the mutants with 0-bp or 22-bp spacing showed detectable promoter activity. Although P-SaeR was essential for the binding of RNA polymerase to P1, it was not essential for the binding of the enzyme to the alpha-hemolysin promoter. When the nonoptimal spacing between promoter elements in P1 or the coagulase promoter was altered to the optimal spacing of 17 bp, both promoters failed to initiate transcription. These results suggest that SaeR binding sites are under rather strict organizational restrictions and provide clues for understanding the molecular mechanism of sae-mediated transcription activation.

  1. Human antibody recognition of antigenic site IV on Pneumovirus fusion proteins.

    PubMed

    Mousa, Jarrod J; Binshtein, Elad; Human, Stacey; Fong, Rachel H; Alvarado, Gabriela; Doranz, Benjamin J; Moore, Martin L; Ohi, Melanie D; Crowe, James E

    2018-02-01

    Respiratory syncytial virus (RSV) is a major human pathogen that infects the majority of children by two years of age. The RSV fusion (F) protein is a primary target of human antibodies, and it has several antigenic regions capable of inducing neutralizing antibodies. Antigenic site IV is preserved in both the pre-fusion and post-fusion conformations of RSV F. Antibodies to antigenic site IV have been described that bind and neutralize both RSV and human metapneumovirus (hMPV). To explore the diversity of binding modes at antigenic site IV, we generated a panel of four new human monoclonal antibodies (mAbs) and competition-binding suggested the mAbs bind at antigenic site IV. Mutagenesis experiments revealed that binding and neutralization of two mAbs (3M3 and 6F18) depended on arginine (R) residue R429. We discovered two R429-independent mAbs (17E10 and 2N6) at this site that neutralized an RSV R429A mutant strain, and one of these mAbs (17E10) neutralized both RSV and hMPV. To determine the mechanism of cross-reactivity, we performed competition-binding, recombinant protein mutagenesis, peptide binding, and electron microscopy experiments. It was determined that the human cross-reactive mAb 17E10 binds to RSV F with a binding pose similar to 101F, which may be indicative of cross-reactivity with hMPV F. The data presented provide new concepts in RSV immune recognition and vaccine design, as we describe the novel idea that binding pose may influence mAb cross-reactivity between RSV and hMPV. Characterization of the site IV epitope bound by human antibodies may inform the design of a pan-Pneumovirus vaccine.

  2. Elimination of a ligand gating site generates a supersensitive olfactory receptor.

    PubMed

    Sharma, Kanika; Ahuja, Gaurav; Hussain, Ashiq; Balfanz, Sabine; Baumann, Arnd; Korsching, Sigrun I

    2016-06-21

    Olfaction poses one of the most complex ligand-receptor matching problems in biology due to the unparalleled multitude of odor molecules facing a large number of cognate olfactory receptors. We have recently deorphanized an olfactory receptor, TAAR13c, as a specific receptor for the death-associated odor cadaverine. Here we have modeled the cadaverine/TAAR13c interaction, exchanged predicted binding residues by site-directed mutagenesis, and measured the activity of the mutant receptors. Unexpectedly we observed a binding site for cadaverine at the external surface of the receptor, in addition to an internal binding site, whose mutation resulted in complete loss of activity. In stark contrast, elimination of the external binding site generated supersensitive receptors. Modeling suggests this site to act as a gate, limiting access of the ligand to the internal binding site and thereby downregulating the affinity of the native receptor. This constitutes a novel mechanism to fine-tune physiological sensitivity to socially relevant odors.

  3. Elimination of a ligand gating site generates a supersensitive olfactory receptor

    PubMed Central

    Sharma, Kanika; Ahuja, Gaurav; Hussain, Ashiq; Balfanz, Sabine; Baumann, Arnd; Korsching, Sigrun I.

    2016-01-01

    Olfaction poses one of the most complex ligand-receptor matching problems in biology due to the unparalleled multitude of odor molecules facing a large number of cognate olfactory receptors. We have recently deorphanized an olfactory receptor, TAAR13c, as a specific receptor for the death-associated odor cadaverine. Here we have modeled the cadaverine/TAAR13c interaction, exchanged predicted binding residues by site-directed mutagenesis, and measured the activity of the mutant receptors. Unexpectedly we observed a binding site for cadaverine at the external surface of the receptor, in addition to an internal binding site, whose mutation resulted in complete loss of activity. In stark contrast, elimination of the external binding site generated supersensitive receptors. Modeling suggests this site to act as a gate, limiting access of the ligand to the internal binding site and thereby downregulating the affinity of the native receptor. This constitutes a novel mechanism to fine-tune physiological sensitivity to socially relevant odors. PMID:27323929

  4. An unexpected phosphate binding site in Glyceraldehyde 3-Phosphate Dehydrogenase: Crystal structures of apo, holo and ternary complex of Cryptosporidium parvum enzyme

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cook, William J; Senkovich, Olga; Chattopadhyay, Debasish

    2009-06-08

    The structure, function and reaction mechanism of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) have been extensively studied. Based on these studies, three anion binding sites have been identified, one 'Ps' site (for binding the C-3 phosphate of the substrate) and two sites, 'Pi' and 'new Pi', for inorganic phosphate. According to the original flip-flop model, the substrate phosphate group switches from the 'Pi' to the 'Ps' site during the multistep reaction. In light of the discovery of the 'new Pi' site, a modified flip-flop mechanism, in which the C-3 phosphate of the substrate binds to the 'new Pi' site and flips tomore » the 'Ps' site before the hydride transfer, was proposed. An alternative model based on a number of structures of B. stearothermophilus GAPDH ternary complexes (non-covalent and thioacyl intermediate) proposes that in the ternary Michaelis complex the C-3 phosphate binds to the 'Ps' site and flips from the 'Ps' to the 'new Pi' site during or after the redox step. We determined the crystal structure of Cryptosporidium parvum GAPDH in the apo and holo (enzyme + NAD) state and the structure of the ternary enzyme-cofactor-substrate complex using an active site mutant enzyme. The C. parvum GAPDH complex was prepared by pre-incubating the enzyme with substrate and cofactor, thereby allowing free movement of the protein structure and substrate molecules during their initial encounter. Sulfate and phosphate ions were excluded from purification and crystallization steps. The quality of the electron density map at 2{angstrom} resolution allowed unambiguous positioning of the substrate. In three subunits of the homotetramer the C-3 phosphate group of the non-covalently bound substrate is in the 'new Pi' site. A concomitant movement of the phosphate binding loop is observed in these three subunits. In the fourth subunit the C-3 phosphate occupies an unexpected site not seen before and the phosphate binding loop remains in the substrate-free conformation. Orientation of the substrate with respect to the active site histidine and serine (in the mutant enzyme) also varies in different subunits. The structures of the C. parvum GAPDH ternary complex and other GAPDH complexes demonstrate the plasticity of the substrate binding site. We propose that the active site of GAPDH can accommodate the substrate in multiple conformations at multiple locations during the initial encounter. However, the C-3 phosphate group clearly prefers the 'new Pi' site for initial binding in the active site.« less

  5. The structure of myostatin:follistatin 288: insights into receptor utilization and heparin binding

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cash, Jennifer N.; Rejon, Carlis A.; McPherron, Alexandra C.

    2009-09-29

    Myostatin is a member of the transforming growth factor-{beta} (TGF-{beta}) family and a strong negative regulator of muscle growth. Here, we present the crystal structure of myostatin in complex with the antagonist follistatin 288 (Fst288). We find that the prehelix region of myostatin very closely resembles that of TGF-{beta} class members and that this region alone can be swapped into activin A to confer signalling through the non-canonical type I receptor Alk5. Furthermore, the N-terminal domain of Fst288 undergoes conformational rearrangements to bind myostatin and likely acts as a site of specificity for the antagonist. In addition, a unique continuousmore » electropositive surface is created when myostatin binds Fst288, which significantly increases the affinity for heparin. This translates into stronger interactions with the cell surface and enhanced myostatin degradation in the presence of either Fst288 or Fst315. Overall, we have identified several characteristics unique to myostatin that will be paramount to the rational design of myostatin inhibitors that could be used in the treatment of muscle-wasting disorders.« less

  6. Macrocycle peptides delineate locked-open inhibition mechanism for microorganism phosphoglycerate mutases

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yu, Hao; Dranchak, Patricia; Li, Zhiru

    Glycolytic interconversion of phosphoglycerate isomers is catalysed in numerous pathogenic microorganisms by a cofactor-independent mutase (iPGM) structurally distinct from the mammalian cofactor-dependent (dPGM) isozyme. The iPGM active site dynamically assembles through substrate-triggered movement of phosphatase and transferase domains creating a solvent inaccessible cavity. Here we identify alternate ligand binding regions using nematode iPGM to select and enrich lariat-like ligands from an mRNA-display macrocyclic peptide library containing >1012 members. Functional analysis of the ligands, named ipglycermides, demonstrates sub-nanomolar inhibition of iPGM with complete selectivity over dPGM. The crystal structure of an iPGM macrocyclic peptide complex illuminated an allosteric, locked-open inhibition mechanismmore » placing the cyclic peptide at the bi-domain interface. This binding mode aligns the pendant lariat cysteine thiolate for coordination with the iPGM transition metal ion cluster. The extended charged, hydrophilic binding surface interaction rationalizes the persistent challenges these enzymes have presented to small-molecule screening efforts highlighting the important roles of macrocyclic peptides in expanding chemical diversity for ligand discovery.« less

  7. The evolutionary turnover of recombination hot spots contributes to speciation in mice.

    PubMed

    Smagulova, Fatima; Brick, Kevin; Pu, Yongmei; Camerini-Otero, R Daniel; Petukhova, Galina V

    2016-02-01

    Meiotic recombination is required for the segregation of homologous chromosomes and is essential for fertility. In most mammals, the DNA double-strand breaks (DSBs) that initiate meiotic recombination are directed to a subset of genomic loci (hot spots) by sequence-specific binding of the PRDM9 protein. Rapid evolution of the DNA-binding specificity of PRDM9 and gradual erosion of PRDM9-binding sites by gene conversion will alter the recombination landscape over time. To better understand the evolutionary turnover of recombination hot spots and its consequences, we mapped DSB hot spots in four major subspecies of Mus musculus with different Prdm9 alleles and in their F1 hybrids. We found that hot spot erosion governs the preferential usage of some Prdm9 alleles over others in hybrid mice and increases sequence diversity specifically at hot spots that become active in the hybrids. As crossovers are disfavored at such hot spots, we propose that sequence divergence generated by hot spot turnover may create an impediment for recombination in hybrids, potentially leading to reduced fertility and, eventually, speciation. Published by Cold Spring Harbor Laboratory Press.

  8. Strength of Neisseria meningitidis binding to endothelial cells requires highly-ordered CD147/β2-adrenoceptor clusters assembled by alpha-actinin-4

    PubMed Central

    Maïssa, Nawal; Covarelli, Valentina; Janel, Sébastien; Durel, Beatrice; Simpson, Nandi; Bernard, Sandra C.; Pardo-Lopez, Liliana; Bouzinba-Ségard, Haniaa; Faure, Camille; Scott, Mark G.H.; Coureuil, Mathieu; Morand, Philippe C.; Lafont, Frank; Nassif, Xavier; Marullo, Stefano; Bourdoulous, Sandrine

    2017-01-01

    Neisseria meningitidis (meningococcus) is an invasive bacterial pathogen that colonizes human vessels, causing thrombotic lesions and meningitis. Establishment of tight interactions with endothelial cells is crucial for meningococci to resist haemodynamic forces. Two endothelial receptors, CD147 and the β2-adrenergic receptor (β2AR), are sequentially engaged by meningococci to adhere and promote signalling events leading to vascular colonization, but their spatiotemporal coordination is unknown. Here we report that CD147 and β2AR form constitutive hetero-oligomeric complexes. The scaffolding protein α-actinin-4 directly binds to the cytosolic tail of CD147 and governs the assembly of CD147–β2AR complexes in highly ordered clusters at bacterial adhesion sites. This multimolecular assembly process increases the binding strength of meningococci to endothelial cells under shear stress, and creates molecular platforms for the elongation of membrane protrusions surrounding adherent bacteria. Thus, the specific organization of cellular receptors has major impacts on host–pathogen interaction. PMID:28569760

  9. Protein-mediated loops in supercoiled DNA create large topological domains

    PubMed Central

    Yan, Yan; Ding, Yue; Leng, Fenfei; Dunlap, David; Finzi, Laura

    2018-01-01

    Abstract Supercoiling can alter the form and base pairing of the double helix and directly impact protein binding. More indirectly, changes in protein binding and the stress of supercoiling also influence the thermodynamic stability of regulatory, protein-mediated loops and shift the equilibria of fundamental DNA/chromatin transactions. For example, supercoiling affects the hierarchical organization and function of chromatin in topologically associating domains (TADs) in both eukaryotes and bacteria. On the other hand, a protein-mediated loop in DNA can constrain supercoiling within a plectonemic structure. To characterize the extent of constrained supercoiling, 400 bp, lac repressor-secured loops were formed in extensively over- or under-wound DNA under gentle tension in a magnetic tweezer. The protein-mediated loops constrained variable amounts of supercoiling that often exceeded the maximum writhe expected for a 400 bp plectoneme. Loops with such high levels of supercoiling appear to be entangled with flanking domains. Thus, loop-mediating proteins operating on supercoiled substrates can establish topological domains that may coordinate gene regulation and other DNA transactions across spans in the genome that are larger than the separation between the binding sites. PMID:29538766

  10. Midbody Targeting of the ESCRT Machinery by a Noncanonical Coiled Coil in CEP55

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lee, Hyung Ho; Elia, Natalie; Ghirlando, Rodolfo

    2008-11-14

    The ESCRT (endosomal sorting complex required for transport) machinery is required for the scission of membrane necks in processes including the budding of HIV-1 and cytokinesis. An essential step in cytokinesis is recruitment of the ESCRT-I complex and the ESCRT-associated protein ALIX to the midbody (the structure that tethers two daughter cells) by the protein CEP55. Biochemical experiments show that peptides from ALIX and the ESCRT-I subunit TSG101 compete for binding to the ESCRT and ALIX-binding region (EABR) of CEP55. We solved the crystal structure of EABR bound to an ALIX peptide at a resolution of 2.0 angstroms. The structuremore » shows that EABR forms an aberrant dimeric parallel coiled coil. Bulky and charged residues at the interface of the two central heptad repeats create asymmetry and a single binding site for an ALIX or TSG101 peptide. Both ALIX and ESCRT-I are required for cytokinesis, which suggests that multiple CEP55 dimers are required for function.« less

  11. The evolutionary turnover of recombination hot spots contributes to speciation in mice

    PubMed Central

    Smagulova, Fatima; Brick, Kevin; Pu, Yongmei; Camerini-Otero, R. Daniel; Petukhova, Galina V.

    2016-01-01

    Meiotic recombination is required for the segregation of homologous chromosomes and is essential for fertility. In most mammals, the DNA double-strand breaks (DSBs) that initiate meiotic recombination are directed to a subset of genomic loci (hot spots) by sequence-specific binding of the PRDM9 protein. Rapid evolution of the DNA-binding specificity of PRDM9 and gradual erosion of PRDM9-binding sites by gene conversion will alter the recombination landscape over time. To better understand the evolutionary turnover of recombination hot spots and its consequences, we mapped DSB hot spots in four major subspecies of Mus musculus with different Prdm9 alleles and in their F1 hybrids. We found that hot spot erosion governs the preferential usage of some Prdm9 alleles over others in hybrid mice and increases sequence diversity specifically at hot spots that become active in the hybrids. As crossovers are disfavored at such hot spots, we propose that sequence divergence generated by hot spot turnover may create an impediment for recombination in hybrids, potentially leading to reduced fertility and, eventually, speciation. PMID:26833728

  12. Hexameric supramolecular scaffold orients carbohydrates to sense bacteria.

    PubMed

    Grünstein, Dan; Maglinao, Maha; Kikkeri, Raghavendra; Collot, Mayeul; Barylyuk, Konstantin; Lepenies, Bernd; Kamena, Faustin; Zenobi, Renato; Seeberger, Peter H

    2011-09-07

    Carbohydrates are integral to biological signaling networks and cell-cell interactions, yet the detection of discrete carbohydrate-lectin interactions remains difficult since binding is generally weak. A strategy to overcome this problem is to create multivalent sensors, where the avidity rather than the affinity of the interaction is important. Here we describe the development of a series of multivalent sensors that self-assemble via hydrophobic supramolecular interactions. The multivalent sensors are comprised of a fluorescent ruthenium(II) core surrounded by a heptamannosylated β-cyclodextrin scaffold. Two additional series of complexes were synthesized as proof-of-principle for supramolecular self-assembly, the fluorescent core alone and the core plus β-cyclodextrin. Spectroscopic analyses confirmed that the three mannosylated sensors displayed 14, 28, and 42 sugar units, respectively. Each complex adopted original and unique spatial arrangements. The sensors were used to investigate the influence of carbohydrate spatial arrangement and clustering on the mechanistic and qualitative properties of lectin binding. Simple visualization of binding between a fluorescent, multivalent mannose complex and the Escherichia coli strain ORN178 that possesses mannose-specific receptor sites illustrates the potential for these complexes as biosensors.

  13. Fivefold increase of hydrogen uptake in MOF74 through linker decorations

    NASA Astrophysics Data System (ADS)

    Arter, C. A.; Zuluaga, S.; Harrison, D.; Welchman, E.; Thonhauser, T.

    2016-10-01

    We present ab initio results for linker decorations in Mg-MOF74, i.e., attaching various metals M =Li, Na, K, Sc, Cr, Mn, Fe, Ni, Cu, Zn, Rb, Pd, Ag, and Pt near the ring of the linker, creating new strong adsorption sites and thus maximizing small-molecule uptake. We find that in most cases these decorations influence the overall form and structure of Mg-MOF74 only marginally. After the initial screening, we chose metals that bind favorably to the linker and further investigated adsorption of H2,CO2, and H2O for M =Li , Na, K, and Sc. For the case of H2 we show that up to 24 additional guest molecules can be adsorbed in the metal-organic framework (MOF) unit cell, with binding energies comparable to the original open-metal sites at the six corners of the channel. This leads to a fivefold increase of the molecule uptake in Mg-MOF74, with tremendous impact on many applications in general and hydrogen storage in particular, where the gravimetric hydrogen density increases from 1.63 to 7.28 mass % and the volumetric density increases from 15.10 to 75.50 g H2L-1 .

  14. Defining the bacteroides ribosomal binding site.

    PubMed

    Wegmann, Udo; Horn, Nikki; Carding, Simon R

    2013-03-01

    The human gastrointestinal tract, in particular the colon, hosts a vast number of commensal microorganisms. Representatives of the genus Bacteroides are among the most abundant bacterial species in the human colon. Bacteroidetes diverged from the common line of eubacterial descent before other eubacterial groups. As a result, they employ unique transcription initiation signals and, because of this uniqueness, they require specific genetic tools. Although some tools exist, they are not optimal for studying the roles and functions of these bacteria in the human gastrointestinal tract. Focusing on translation initiation signals in Bacteroides, we created a series of expression vectors allowing for different levels of protein expression in this genus, and we describe the use of pepI from Lactobacillus delbrueckii subsp. lactis as a novel reporter gene for Bacteroides. Furthermore, we report the identification of the 3' end of the 16S rRNA of Bacteroides ovatus and analyze in detail its ribosomal binding site, thus defining a core region necessary for efficient translation, which we have incorporated into the design of our expression vectors. Based on the sequence logo information from the 5' untranslated region of other Bacteroidales ribosomal protein genes, we conclude that our findings are relevant to all members of this order.

  15. Simulations of CYP51A from Aspergillus fumigatus in a model bilayer provide insights into triazole drug resistance

    PubMed Central

    Nash, Anthony; Rhodes, Johanna

    2018-01-01

    Abstract Azole antifungal drugs target CYP51A in Aspergillus fumigatus by binding with the active site of the protein, blocking ergosterol biosynthesis. Resistance to azole antifungal drugs is now common, with a leucine to histidine amino acid substitution at position 98 the most frequent, predominantly conferring resistance to itraconazole, although cross-resistance has been reported in conjunction with other mutations. In this study, we create a homology model of CYP51A using a recently published crystal structure of the paralog protein CYP51B. The derived structures, wild type, and L98H mutant are positioned within a lipid membrane bilayer and subjected to molecular dynamics simulations in order improve the accuracy of both models. The structural analysis from our simulations suggests a decrease in active site surface from the formation of hydrogen bonds between the histidine substitution and neighboring polar side chains, potentially preventing the binding of azole drugs. This study yields a biologically relevant structure and set of dynamics of the A. fumigatus Lanosterol 14 alpha-demethylase enzyme and provides further insight into azole antifungal drug resistance. PMID:28992260

  16. The structure of the yeast NADH dehydrogenase (Ndi1) reveals overlapping binding sites for water- and lipid-soluble substrates.

    PubMed

    Iwata, Momi; Lee, Yang; Yamashita, Tetsuo; Yagi, Takao; Iwata, So; Cameron, Alexander D; Maher, Megan J

    2012-09-18

    Bioenergy is efficiently produced in the mitochondria by the respiratory system consisting of complexes I-V. In various organisms, complex I can be replaced by the alternative NADH-quinone oxidoreductase (NDH-2), which catalyzes the transfer of an electron from NADH via FAD to quinone, without proton pumping. The Ndi1 protein from Saccharomyces cerevisiae is a monotopic membrane protein, directed to the matrix. A number of studies have investigated the potential use of Ndi1 as a therapeutic agent against complex I disorders, and the NDH-2 enzymes have emerged as potential therapeutic targets for treatments against the causative agents of malaria and tuberculosis. Here we present the crystal structures of Ndi1 in its substrate-free, NAD(+)- and ubiquinone- (UQ2) complexed states. The structures reveal that Ndi1 is a peripheral membrane protein forming an intimate dimer, in which packing of the monomeric units within the dimer creates an amphiphilic membrane-anchor domain structure. Crucially, the structures of the Ndi1-NAD(+) and Ndi1-UQ2 complexes show overlapping binding sites for the NAD(+) and quinone substrates.

  17. rVISTA 2.0: Evolutionary Analysis of Transcription Factor Binding Sites

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Loots, G G; Ovcharenko, I

    2004-01-28

    Identifying and characterizing the patterns of DNA cis-regulatory modules represents a challenge that has the potential to reveal the regulatory language the genome uses to dictate transcriptional dynamics. Several studies have demonstrated that regulatory modules are under positive selection and therefore are often conserved between related species. Using this evolutionary principle we have created a comparative tool, rVISTA, for analyzing the regulatory potential of noncoding sequences. The rVISTA tool combines transcription factor binding site (TFBS) predictions, sequence comparisons and cluster analysis to identify noncoding DNA regions that are highly conserved and present in a specific configuration within an alignment. Heremore » we present the newly developed version 2.0 of the rVISTA tool that can process alignments generated by both zPicture and PipMaker alignment programs or use pre-computed pairwise alignments of seven vertebrate genomes available from the ECR Browser. The rVISTA web server is closely interconnected with the TRANSFAC database, allowing users to either search for matrices present in the TRANSFAC library collection or search for user-defined consensus sequences. rVISTA tool is publicly available at http://rvista.dcode.org/.« less

  18. Activation of erythropoietin receptor in the absence of hormone by a peptide that binds to a domain different from the hormone binding site

    PubMed Central

    Naranda, Tatjana; Wong, Kenneth; Kaufman, R. Ilene; Goldstein, Avram; Olsson, Lennart

    1999-01-01

    Applying a homology search method previously described, we identified a sequence in the extracellular dimerization site of the erythropoietin receptor, distant from the hormone binding site. A peptide identical to that sequence was synthesized. Remarkably, it activated receptor signaling in the absence of erythropoietin. Neither the peptide nor the hormone altered the affinity of the other for the receptor; thus, the peptide does not bind to the hormone binding site. The combined activation of signal transduction by hormone and peptide was strongly synergistic. In mice, the peptide acted like the hormone, protecting against the decrease in hematocrit caused by carboplatin. PMID:10377456

  19. Kinetic and Spectroscopic Studies of Bicupin Oxalate Oxidase and Putative Active Site Mutants

    PubMed Central

    Moomaw, Ellen W.; Hoffer, Eric; Moussatche, Patricia; Salerno, John C.; Grant, Morgan; Immelman, Bridget; Uberto, Richard; Ozarowski, Andrew; Angerhofer, Alexander

    2013-01-01

    Ceriporiopsis subvermispora oxalate oxidase (CsOxOx) is the first bicupin enzyme identified that catalyzes manganese-dependent oxidation of oxalate. In previous work, we have shown that the dominant contribution to catalysis comes from the monoprotonated form of oxalate binding to a form of the enzyme in which an active site carboxylic acid residue must be unprotonated. CsOxOx shares greatest sequence homology with bicupin microbial oxalate decarboxylases (OxDC) and the 241-244DASN region of the N-terminal Mn binding domain of CsOxOx is analogous to the lid region of OxDC that has been shown to determine reaction specificity. We have prepared a series of CsOxOx mutants to probe this region and to identify the carboxylate residue implicated in catalysis. The pH profile of the D241A CsOxOx mutant suggests that the protonation state of aspartic acid 241 is mechanistically significant and that catalysis takes place at the N-terminal Mn binding site. The observation that the D241S CsOxOx mutation eliminates Mn binding to both the N- and C- terminal Mn binding sites suggests that both sites must be intact for Mn incorporation into either site. The introduction of a proton donor into the N-terminal Mn binding site (CsOxOx A242E mutant) does not affect reaction specificity. Mutation of conserved arginine residues further support that catalysis takes place at the N-terminal Mn binding site and that both sites must be intact for Mn incorporation into either site. PMID:23469254

  20. Functional Variants at the 11q13 Risk Locus for Breast Cancer Regulate Cyclin D1 Expression through Long-Range Enhancers

    PubMed Central

    French, Juliet D.; Ghoussaini, Maya; Edwards, Stacey L.; Meyer, Kerstin B.; Michailidou, Kyriaki; Ahmed, Shahana; Khan, Sofia; Maranian, Mel J.; O’Reilly, Martin; Hillman, Kristine M.; Betts, Joshua A.; Carroll, Thomas; Bailey, Peter J.; Dicks, Ed; Beesley, Jonathan; Tyrer, Jonathan; Maia, Ana-Teresa; Beck, Andrew; Knoblauch, Nicholas W.; Chen, Constance; Kraft, Peter; Barnes, Daniel; González-Neira, Anna; Alonso, M. Rosario; Herrero, Daniel; Tessier, Daniel C.; Vincent, Daniel; Bacot, Francois; Luccarini, Craig; Baynes, Caroline; Conroy, Don; Dennis, Joe; Bolla, Manjeet K.; Wang, Qin; Hopper, John L.; Southey, Melissa C.; Schmidt, Marjanka K.; Broeks, Annegien; Verhoef, Senno; Cornelissen, Sten; Muir, Kenneth; Lophatananon, Artitaya; Stewart-Brown, Sarah; Siriwanarangsan, Pornthep; Fasching, Peter A.; Loehberg, Christian R.; Ekici, Arif B.; Beckmann, Matthias W.; Peto, Julian; dos Santos Silva, Isabel; Johnson, Nichola; Aitken, Zoe; Sawyer, Elinor J.; Tomlinson, Ian; Kerin, Michael J.; Miller, Nicola; Marme, Frederik; Schneeweiss, Andreas; Sohn, Christof; Burwinkel, Barbara; Guénel, Pascal; Truong, Thérèse; Laurent-Puig, Pierre; Menegaux, Florence; Bojesen, Stig E.; Nordestgaard, Børge G.; Nielsen, Sune F.; Flyger, Henrik; Milne, Roger L.; Zamora, M. Pilar; Arias Perez, Jose Ignacio; Benitez, Javier; Anton-Culver, Hoda; Brenner, Hermann; Müller, Heiko; Arndt, Volker; Stegmaier, Christa; Meindl, Alfons; Lichtner, Peter; Schmutzler, Rita K.; Engel, Christoph; Brauch, Hiltrud; Hamann, Ute; Justenhoven, Christina; Aaltonen, Kirsimari; Heikkilä, Päivi; Aittomäki, Kristiina; Blomqvist, Carl; Matsuo, Keitaro; Ito, Hidemi; Iwata, Hiroji; Sueta, Aiko; Bogdanova, Natalia V.; Antonenkova, Natalia N.; Dörk, Thilo; Lindblom, Annika; Margolin, Sara; Mannermaa, Arto; Kataja, Vesa; Kosma, Veli-Matti; Hartikainen, Jaana M.; Wu, Anna H.; Tseng, Chiu-chen; Van Den Berg, David; Stram, Daniel O.; Lambrechts, Diether; Peeters, Stephanie; Smeets, Ann; Floris, Giuseppe; Chang-Claude, Jenny; Rudolph, Anja; Nickels, Stefan; Flesch-Janys, Dieter; Radice, Paolo; Peterlongo, Paolo; Bonanni, Bernardo; Sardella, Domenico; Couch, Fergus J.; Wang, Xianshu; Pankratz, Vernon S.; Lee, Adam; Giles, Graham G.; Severi, Gianluca; Baglietto, Laura; Haiman, Christopher A.; Henderson, Brian E.; Schumacher, Fredrick; Le Marchand, Loic; Simard, Jacques; Goldberg, Mark S.; Labrèche, France; Dumont, Martine; Teo, Soo Hwang; Yip, Cheng Har; Ng, Char-Hong; Vithana, Eranga Nishanthie; Kristensen, Vessela; Zheng, Wei; Deming-Halverson, Sandra; Shrubsole, Martha; Long, Jirong; Winqvist, Robert; Pylkäs, Katri; Jukkola-Vuorinen, Arja; Grip, Mervi; Andrulis, Irene L.; Knight, Julia A.; Glendon, Gord; Mulligan, Anna Marie; Devilee, Peter; Seynaeve, Caroline; García-Closas, Montserrat; Figueroa, Jonine; Chanock, Stephen J.; Lissowska, Jolanta; Czene, Kamila; Klevebring, Daniel; Schoof, Nils; Hooning, Maartje J.; Martens, John W.M.; Collée, J. Margriet; Tilanus-Linthorst, Madeleine; Hall, Per; Li, Jingmei; Liu, Jianjun; Humphreys, Keith; Shu, Xiao-Ou; Lu, Wei; Gao, Yu-Tang; Cai, Hui; Cox, Angela; Balasubramanian, Sabapathy P.; Blot, William; Signorello, Lisa B.; Cai, Qiuyin; Pharoah, Paul D.P.; Healey, Catherine S.; Shah, Mitul; Pooley, Karen A.; Kang, Daehee; Yoo, Keun-Young; Noh, Dong-Young; Hartman, Mikael; Miao, Hui; Sng, Jen-Hwei; Sim, Xueling; Jakubowska, Anna; Lubinski, Jan; Jaworska-Bieniek, Katarzyna; Durda, Katarzyna; Sangrajrang, Suleeporn; Gaborieau, Valerie; McKay, James; Toland, Amanda E.; Ambrosone, Christine B.; Yannoukakos, Drakoulis; Godwin, Andrew K.; Shen, Chen-Yang; Hsiung, Chia-Ni; Wu, Pei-Ei; Chen, Shou-Tung; Swerdlow, Anthony; Ashworth, Alan; Orr, Nick; Schoemaker, Minouk J.; Ponder, Bruce A.J.; Nevanlinna, Heli; Brown, Melissa A.; Chenevix-Trench, Georgia; Easton, Douglas F.; Dunning, Alison M.

    2013-01-01

    Analysis of 4,405 variants in 89,050 European subjects from 41 case-control studies identified three independent association signals for estrogen-receptor-positive tumors at 11q13. The strongest signal maps to a transcriptional enhancer element in which the G allele of the best candidate causative variant rs554219 increases risk of breast cancer, reduces both binding of ELK4 transcription factor and luciferase activity in reporter assays, and may be associated with low cyclin D1 protein levels in tumors. Another candidate variant, rs78540526, lies in the same enhancer element. Risk association signal 2, rs75915166, creates a GATA3 binding site within a silencer element. Chromatin conformation studies demonstrate that these enhancer and silencer elements interact with each other and with their likely target gene, CCND1. PMID:23540573

  1. Functionalizing Microporous Membranes for Protein Purification and Protein Digestion

    NASA Astrophysics Data System (ADS)

    Dong, Jinlan; Bruening, Merlin L.

    2015-07-01

    This review examines advances in the functionalization of microporous membranes for protein purification and the development of protease-containing membranes for controlled protein digestion prior to mass spectrometry analysis. Recent studies confirm that membranes are superior to bead-based columns for rapid protein capture, presumably because convective mass transport in membrane pores rapidly brings proteins to binding sites. Modification of porous membranes with functional polymeric films or TiO2 nanoparticles yields materials that selectively capture species ranging from phosphopeptides to His-tagged proteins, and protein-binding capacities often exceed those of commercial beads. Thin membranes also provide a convenient framework for creating enzyme-containing reactors that afford control over residence times. With millisecond residence times, reactors with immobilized proteases limit protein digestion to increase sequence coverage in mass spectrometry analysis and facilitate elucidation of protein structures. This review emphasizes the advantages of membrane-based techniques and concludes with some challenges for their practical application.

  2. Functionalizing Microporous Membranes for Protein Purification and Protein Digestion.

    PubMed

    Dong, Jinlan; Bruening, Merlin L

    2015-01-01

    This review examines advances in the functionalization of microporous membranes for protein purification and the development of protease-containing membranes for controlled protein digestion prior to mass spectrometry analysis. Recent studies confirm that membranes are superior to bead-based columns for rapid protein capture, presumably because convective mass transport in membrane pores rapidly brings proteins to binding sites. Modification of porous membranes with functional polymeric films or TiO₂ nanoparticles yields materials that selectively capture species ranging from phosphopeptides to His-tagged proteins, and protein-binding capacities often exceed those of commercial beads. Thin membranes also provide a convenient framework for creating enzyme-containing reactors that afford control over residence times. With millisecond residence times, reactors with immobilized proteases limit protein digestion to increase sequence coverage in mass spectrometry analysis and facilitate elucidation of protein structures. This review emphasizes the advantages of membrane-based techniques and concludes with some challenges for their practical application.

  3. Engineered Antibodies for Monitoring of Polynuclear Aromatic Hydrocarbons

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Alexander E. Karu Ph.D; Victoria A. Roberts Ph.D.; Qing X. Li, Ph.D.

    2002-01-17

    This project was undertaken to fill needs in ODE's human and ecosystem health effects research, site remediation, rapid emergency response, and regulatory compliance monitoring programs. Doe has greatly stimulated development and validation of antibody-based, rapid, field-portable detection systems for small hazardous compounds. These range from simple dipsticks, microplate enzyme-linked immunosorbent assays (ELISAs), and hand-held colorimeters, to ultrasensitive microfluidic reactors, fiber-optic sensors and microarrays that can identify multiple analytes from patterns of cross-reactivity. Unfortunately, the technology to produce antibodies with the most desirable properties did not keep pace. Lack of antibodies remains a limiting factor in production and practical use ofmore » such devices. The goals of our project were to determine the chemical and structural bases for the antibody-analyte binding interactions using advanced computational chemistry, and to use this information to create useful new binding properties through in vitro genetic engineering and combinatorial library methods.« less

  4. 3' Homologous Free Ends are Required for Stable Joint Molecule Formation by the RecA and Single-Stranded Binding Proteins of Escherichia coli

    NASA Astrophysics Data System (ADS)

    Konforti, Boyana B.; Davis, Ronald W.

    1987-02-01

    The RecA protein of Escherichia coli is important for genetic recombination in vivo and can promote synapsis and strand exchange in vitro. The DNA pairing and strand exchange reactions have been well characterized in reactions with circular single strands and linear duplexes, but little is known about these two processes using substrates more characteristic of those likely to exist in the cell. Single-stranded linear DNAs were prepared by separating strands of duplex molecules or by cleaving single-stranded circles at a unique restriction site created by annealing a short defined oligonucleotide to the circle. Analysis by gel electrophoresis and electron microscopy revealed that, in the presence of RecA and single-stranded binding proteins, a free 3' homologous end is essential for stable joint molecule formation between linear single-stranded and circular duplex DNA.

  5. Architecture of a Fur Binding Site: a Comparative Analysis

    PubMed Central

    Lavrrar, Jennifer L.; McIntosh, Mark A.

    2003-01-01

    Fur is an iron-binding transcriptional repressor that recognizes a 19-bp consensus site of the sequence 5′-GATAATGATAATCATTATC-3′. This site can be defined as three adjacent hexamers of the sequence 5′-GATAAT-3′, with the third being slightly imperfect (an F-F-F configuration), or as two hexamers in the forward orientation separated by one base pair from a third hexamer in the reverse orientation (an F-F-x-R configuration). Although Fur can bind synthetic DNA sequences containing the F-F-F arrangement, most natural binding sites are variations of the F-F-x-R arrangement. The studies presented here compared the ability of Fur to recognize synthetic DNA sequences containing two to four adjacent hexamers with binding to sequences containing variations of the F-F-x-R arrangement (including natural operator sequences from the entS and fepB promoter regions of Escherichia coli). Gel retardation assays showed that the F-F-x-R architecture was necessary for high-affinity Fur-DNA interactions and that contiguous hexamers were not recognized as effectively. In addition, the stoichiometry of Fur at each binding site was determined, showing that Fur interacted with its minimal 19-bp binding site as two overlapping dimers. These data confirm the proposed overlapping-dimer binding model, where the unit of interaction with a single Fur dimer is two inverted hexamers separated by a C:G base pair, with two overlapping units comprising the 19-bp consensus binding site required for the high-affinity interaction with two Fur dimers. PMID:12644489

  6. VASP-E: Specificity Annotation with a Volumetric Analysis of Electrostatic Isopotentials

    PubMed Central

    Chen, Brian Y.

    2014-01-01

    Algorithms for comparing protein structure are frequently used for function annotation. By searching for subtle similarities among very different proteins, these algorithms can identify remote homologs with similar biological functions. In contrast, few comparison algorithms focus on specificity annotation, where the identification of subtle differences among very similar proteins can assist in finding small structural variations that create differences in binding specificity. Few specificity annotation methods consider electrostatic fields, which play a critical role in molecular recognition. To fill this gap, this paper describes VASP-E (Volumetric Analysis of Surface Properties with Electrostatics), a novel volumetric comparison tool based on the electrostatic comparison of protein-ligand and protein-protein binding sites. VASP-E exploits the central observation that three dimensional solids can be used to fully represent and compare both electrostatic isopotentials and molecular surfaces. With this integrated representation, VASP-E is able to dissect the electrostatic environments of protein-ligand and protein-protein binding interfaces, identifying individual amino acids that have an electrostatic influence on binding specificity. VASP-E was used to examine a nonredundant subset of the serine and cysteine proteases as well as the barnase-barstar and Rap1a-raf complexes. Based on amino acids established by various experimental studies to have an electrostatic influence on binding specificity, VASP-E identified electrostatically influential amino acids with 100% precision and 83.3% recall. We also show that VASP-E can accurately classify closely related ligand binding cavities into groups with different binding preferences. These results suggest that VASP-E should prove a useful tool for the characterization of specific binding and the engineering of binding preferences in proteins. PMID:25166865

  7. X-Ray Crystal Structure of the Ancestral 3-Ketosteroid Receptor-Progesterone-Mifepristone Complex Shows Mifepristone Bound at the Coactivator Binding Interface

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Colucci, Jennifer K.; Ortlund, Eric A.

    2013-12-12

    Steroid receptors are a subfamily of nuclear receptors found throughout all metazoans. They are highly important in the regulation of development, inflammation, and reproduction and their misregulation has been implicated in hormone insensitivity syndromes and cancer. Steroid binding to SRs drives a conformational change in the ligand binding domain that promotes nuclear localization and subsequent interaction with coregulator proteins to affect gene regulation. SRs are important pharmaceutical targets, yet most SR-targeting drugs have off-target pharmacology leading to unwanted side effects. A better understanding of the structural mechanisms dictating ligand specificity and the evolution of the forces that created the SR-hormonemore » pairs will enable the design of better pharmaceutical ligands. In order to investigate this relationship, we attempted to crystallize the ancestral 3-ketosteroid receptor (ancSR2) with mifepristone, a SR antagonist. Here, we present the x-ray crystal structure of the ancestral 3-keto steroid receptor (ancSR2)-progesterone complex at a resolution of 2.05 Å. This improves upon our previously reported structure of the ancSR2-progesterone complex, permitting unambiguous assignment of the ligand conformation within the binding pocket. Surprisingly, we find mifepristone, fortuitously docked at the protein surface, poised to interfere with coregulator binding. Recent attention has been given to generating pharmaceuticals that block the coregulator binding site in order to obstruct coregulator binding and achieve tissue-specific SR regulation independent of hormone binding. Mifepristone’s interaction with the coactivator cleft of this SR suggests that it may be a useful molecular scaffold for further coactivator binding inhibitor development.« less

  8. 2-(/sup 125/I)iodomelatonin binding sites in hamster brain membranes: pharmacological characteristics and regional distribution

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Duncan, M.J.; Takahashi, J.S.; Dubocovich, M.L.

    1988-05-01

    Studies in a variety of seasonally breeding mammals have shown that melatonin mediates photoperiodic effects on reproduction. Relatively little is known, however, about the site(s) or mechanisms of action of this hormone for inducing reproductive effects. Although binding sites for (3H)melatonin have been reported previously in bovine, rat, and hamster brain, the pharmacological selectivity of these sites was never demonstrated. In the present study, we have characterized binding sites for a new radioligand, 2-(125I)iodomelatonin, in brains from a photoperiodic species, the Syrian hamster. 2-(125I)Iodomelatonin labels a high affinity binding site in hamster brain membranes. Specific binding of 2-(125I)iodomelatonin is rapid,more » stable, saturable, and reversible. Saturation studies demonstrated that 2-(125I)iodomelatonin binds to a single class of sites with an affinity constant (Kd) of 3.3 +/- 0.5 nM and a total binding capacity (Bmax) of 110.2 +/- 13.4 fmol/mg protein (n = 4). The Kd value determined from kinetic analysis (3.1 +/- 0.9 nM; n = 5) was very similar to that obtained from saturation experiments. Competition experiments showed that the relative order of potency of a variety of indoles for inhibition of 2-(125I)iodomelatonin binding site to hamster brain membranes was as follows: 6-chloromelatonin greater than or equal to 2-iodomelatonin greater than N-acetylserotonin greater than or equal to 6-methoxymelatonin greater than or equal to melatonin greater than 6-hydroxymelatonin greater than or equal to 6,7-dichloro-2-methylmelatonin greater than 5-methoxytryptophol greater than 5-methoxytryptamine greater than or equal to 5-methoxy-N,N-dimethyltryptamine greater than N-acetyltryptamine greater than serotonin greater than 5-methoxyindole (inactive).« less

  9. Purification of L-( sup 3 H) Nicotine eliminates low affinity binding

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Romm, E.; Marks, M.J.; Collins, A.C.

    1990-01-01

    Some studies of L-({sup 3}H) nicotine binding to rodent and human brain tissue have detected two binding sites as evidenced by nonlinear Scatchard plots. Evidence presented here indicated that the low affinity binding site is not stereospecific, is not inhibited by low concentrations of cholinergic agonists and is probably due to breakdown products of nicotine since purification of the L-({sup 3}H)nicotine eliminates the low affinity site.

  10. Binding of (/sup 3/H)Forskolin to rat brain membranes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Seamon, K.B.; Vaillancourt, R.; Edwards, M.

    1984-08-01

    (12-/sup 3/H)Forskolin (27 Ci/mmol) has been used to study binding sites in rat brain tissue by using both centrifugation and filtration assays. The binding isotherm measured in the presence of 5 mM MgCl/sub 2/ by using the centrifugation assay is described best by a two-site model: K/sub d1/ = 15 nM, B/sub max/sub 1// (maximal binding) = 270 fmol/mg of protein; K/sub d2/ = 1.1 ..mu..M; B/sub max/sub 2// = 4.2 pmol/mg of protein. Only the high-affinity binding sites are detected when the binding is determined by using a filtration assay; K/sub d/ = 26 nM, B/sub max/ = 400more » fmol/mg of protein. Analogs of forskolin that do not activate adenylate cyclase (EC 4.6.1.1) do not compete effectively for (/sup 3/H)forskolin binding sites. Analogs of forskolin that are less potent than forskolin in activating adenylate cyclase are also less potent in competing for forskolin binding sites. The presence of 5 mM MgCl/sub 2/ or MnCl/sub 2/ was found to enhance binding. In the presence of 1 mM EDTA the amount of high-affinity binding is reduced to 110 fmol/mg of protein with no change in K/sub d/. There is no effect of CaCl/sub 2/ (20 mM) or NaCl (100 mM) on the binding. No high-affinity binding can be detected in membranes from ram sperm, which contains an adenylate cyclase that is not activated by forskolin. It is proposed that the high-affinity binding sites for forskolin are associated with the activated complex of catalytic subunit and stimulatory guanine nucleotide binding protein. 23 references, 5 figures, 2 tables.« less

  11. Biophysical Fitness Landscapes for Transcription Factor Binding Sites

    PubMed Central

    Haldane, Allan; Manhart, Michael; Morozov, Alexandre V.

    2014-01-01

    Phenotypic states and evolutionary trajectories available to cell populations are ultimately dictated by complex interactions among DNA, RNA, proteins, and other molecular species. Here we study how evolution of gene regulation in a single-cell eukaryote S. cerevisiae is affected by interactions between transcription factors (TFs) and their cognate DNA sites. Our study is informed by a comprehensive collection of genomic binding sites and high-throughput in vitro measurements of TF-DNA binding interactions. Using an evolutionary model for monomorphic populations evolving on a fitness landscape, we infer fitness as a function of TF-DNA binding to show that the shape of the inferred fitness functions is in broad agreement with a simple functional form inspired by a thermodynamic model of two-state TF-DNA binding. However, the effective parameters of the model are not always consistent with physical values, indicating selection pressures beyond the biophysical constraints imposed by TF-DNA interactions. We find little statistical support for the fitness landscape in which each position in the binding site evolves independently, indicating that epistasis is common in the evolution of gene regulation. Finally, by correlating TF-DNA binding energies with biological properties of the sites or the genes they regulate, we are able to rule out several scenarios of site-specific selection, under which binding sites of the same TF would experience different selection pressures depending on their position in the genome. These findings support the existence of universal fitness landscapes which shape evolution of all sites for a given TF, and whose properties are determined in part by the physics of protein-DNA interactions. PMID:25010228

  12. SP transcription factor paralogs and DNA-binding sites coevolve and adaptively converge in mammals and birds.

    PubMed

    Yokoyama, Ken Daigoro; Pollock, David D

    2012-01-01

    Functional modification of regulatory proteins can affect hundreds of genes throughout the genome, and is therefore thought to be almost universally deleterious. This belief, however, has recently been challenged. A potential example comes from transcription factor SP1, for which statistical evidence indicates that motif preferences were altered in eutherian mammals. Here, we set out to discover possible structural and theoretical explanations, evaluate the role of selection in SP1 evolution, and discover effects on coregulatory proteins. We show that SP1 motif preferences were convergently altered in birds as well as mammals, inducing coevolutionary changes in over 800 regulatory regions. Structural and phylogenic evidence implicates a single causative amino acid replacement at the same SP1 position along both lineages. Furthermore, paralogs SP3 and SP4, which coregulate SP1 target genes through competitive binding to the same sites, have accumulated convergent replacements at the homologous position multiple times during eutherian and bird evolution, presumably to preserve competitive binding. To determine plausibility, we developed and implemented a simple model of transcription factor and binding site coevolution. This model predicts that, in contrast to prevailing beliefs, even small selective benefits per locus can drive concurrent fixation of transcription factor and binding site mutants under a broad range of conditions. Novel binding sites tend to arise de novo, rather than by mutation from ancestral sites, a prediction substantiated by SP1-binding site alignments. Thus, multiple lines of evidence indicate that selection has driven convergent evolution of transcription factors along with their binding sites and coregulatory proteins.

  13. SP Transcription Factor Paralogs and DNA-Binding Sites Coevolve and Adaptively Converge in Mammals and Birds

    PubMed Central

    Yokoyama, Ken Daigoro; Pollock, David D.

    2012-01-01

    Functional modification of regulatory proteins can affect hundreds of genes throughout the genome, and is therefore thought to be almost universally deleterious. This belief, however, has recently been challenged. A potential example comes from transcription factor SP1, for which statistical evidence indicates that motif preferences were altered in eutherian mammals. Here, we set out to discover possible structural and theoretical explanations, evaluate the role of selection in SP1 evolution, and discover effects on coregulatory proteins. We show that SP1 motif preferences were convergently altered in birds as well as mammals, inducing coevolutionary changes in over 800 regulatory regions. Structural and phylogenic evidence implicates a single causative amino acid replacement at the same SP1 position along both lineages. Furthermore, paralogs SP3 and SP4, which coregulate SP1 target genes through competitive binding to the same sites, have accumulated convergent replacements at the homologous position multiple times during eutherian and bird evolution, presumably to preserve competitive binding. To determine plausibility, we developed and implemented a simple model of transcription factor and binding site coevolution. This model predicts that, in contrast to prevailing beliefs, even small selective benefits per locus can drive concurrent fixation of transcription factor and binding site mutants under a broad range of conditions. Novel binding sites tend to arise de novo, rather than by mutation from ancestral sites, a prediction substantiated by SP1-binding site alignments. Thus, multiple lines of evidence indicate that selection has driven convergent evolution of transcription factors along with their binding sites and coregulatory proteins. PMID:23019068

  14. New functionalized IRMOF-10 with strong affinity for methanol: A simulation study

    NASA Astrophysics Data System (ADS)

    Liu, Zewei; Zhang, Kai; Wu, Ying; Xi, Hongxia

    2018-05-01

    Grand Canonical Monte Carlo (GCMC) method simulation combined with density functional theory (DFT) calculation were used to investigate the methanol adsorption in IRMOF-10, with nitrogen and metal-doping functionalizations in order to understand the underlying performance of MOFs in methanol adsorption. New doped IRMOF-10s (M-2N-IRMOF-10, M = Be, Mg, Ca, Sr, Ba) were theoretically constructed by binding nitrogen atoms of organic linkers in N-doping IRMOF-10 (2N-IRMOF-10) with various metal atoms. 2N-IRMOF-10 shows only a little higher methanol capacity in the measured pressure range. However, M-2N-IRMOF-10s (especially Be-2N-IRMOF-10) demonstrate much higher methanol capacity due to the stronger interaction between the induced Be atoms and methanol molecules. Furthermore, the obtained results can be attributed to the new adsorption sites created by metal-doping, as revealed by the more exothermic binding energies (BEs) on Be-sites (-160.8 kJ/mol) than Zn-sites (-19.4 kJ/mol). According to the simulation results, it can be concluded that functionalized IRMOF-10 are capable of enhancing the adsorption capacity of methanol at pressure from 0 to 12 kPa at 298 K. This study provides a new functionalized method to effectively enhance methanol adsorption capacity of MOFs, which might extend the application of MOFs on methanol adsorption in the near future.

  15. Nucleotide-dependent bisANS binding to tubulin.

    PubMed

    Chakraborty, S; Sarkar, N; Bhattacharyya, B

    1999-07-13

    Non-covalent hydrophobic probes such as 5, 5'-bis(8-anilino-1-naphthalenesulfonate) (bisANS) have become increasingly popular to gain information about protein structure and conformation. However, there are limitations as bisANS binds non-specifically at multiple sites of many proteins. Successful use of this probe depends upon the development of binding conditions where only specific dye-protein interaction will occur. In this report, we have shown that the binding of bisANS to tubulin occurs instantaneously, specifically at one high affinity site when 1 mM guanosine 5'-triphosphate (GTP) is included in the reaction medium. Substantial portions of protein secondary structure and colchicine binding activity of tubulin are lost upon bisANS binding in absence of GTP. BisANS binding increases with time and occurs at multiple sites in the absence of GTP. Like GTP, other analogs, guanosine 5'-diphosphate, guanosine 5'-monophosphate and adenosine 5'-triphosphate, also displace bisANS from the lower affinity sites of tubulin. We believe that these multiple binding sites are generated due to the bisANS-induced structural changes on tubulin and the presence of GTP and other nucleotides protect those structural changes.

  16. Evaluation of Novel Design Strategies for Developing Zinc Finger Nucleases Tools for Treating Human Diseases

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bach, Christian; Sherman, William; Pallis, Jani

    Zinc finger nucleases (ZFNs) are associated with cell death and apoptosis by binding at countless undesired locations. This cytotoxicity is associated with the binding ability of engineered zinc finger domains to bind dissimilar DNA sequences with high affinity. In general, binding preferences of transcription factors are associated with significant degenerated diversity and complexity which convolutes the design and engineering of precise DNA binding domains. Evolutionary success of natural zinc finger proteins, however, evinces that nature created specific evolutionary traits and strategies, such as modularity and rank-specific recognition to cope with binding complexity that are critical for creating clinical viable toolsmore » to precisely modify the human genome. Our findings indicate preservation of general modularity and significant alteration of the rank-specific binding preferences of the three-finger binding domain of transcription factor SP1 when exchanging amino acids in the 2nd finger.« less

  17. Evaluation of Novel Design Strategies for Developing Zinc Finger Nucleases Tools for Treating Human Diseases

    DOE PAGES

    Bach, Christian; Sherman, William; Pallis, Jani; ...

    2014-01-01

    Zinc finger nucleases (ZFNs) are associated with cell death and apoptosis by binding at countless undesired locations. This cytotoxicity is associated with the binding ability of engineered zinc finger domains to bind dissimilar DNA sequences with high affinity. In general, binding preferences of transcription factors are associated with significant degenerated diversity and complexity which convolutes the design and engineering of precise DNA binding domains. Evolutionary success of natural zinc finger proteins, however, evinces that nature created specific evolutionary traits and strategies, such as modularity and rank-specific recognition to cope with binding complexity that are critical for creating clinical viable toolsmore » to precisely modify the human genome. Our findings indicate preservation of general modularity and significant alteration of the rank-specific binding preferences of the three-finger binding domain of transcription factor SP1 when exchanging amino acids in the 2nd finger.« less

  18. Development of a Fluorescence Assay for the Characterization of Brevenal Binding to Rat Brain Synaptosomes

    PubMed Central

    2015-01-01

    The marine dinoflagellate Karenia brevis produces a family of neurotoxins known as brevetoxins. Brevetoxins elicit their effects by binding to and activating voltage-sensitive sodium channels (VSSCs) in cell membranes. K. brevis also produces brevenal, a brevetoxin antagonist, which is able to inhibit and/or negate many of the detrimental effects of brevetoxins. Brevenal binding to VSSCs has yet to be fully characterized, in part due to the difficulty and expense of current techniques. In this study, we have developed a novel fluorescence binding assay for the brevenal binding site. Several fluorescent compounds were conjugated to brevenal to assess their effects on brevenal binding. The assay was validated against the radioligand assay for the brevenal binding site and yielded comparable equilibrium inhibition constants. The fluorescence-based assay was shown to be quicker and far less expensive and did not generate radioactive waste or need facilities for handling radioactive materials. In-depth studies using the brevenal conjugates showed that, while brevenal conjugates do bind to a binding site in the VSSC protein complex, they are not displaced by known VSSC site specific ligands. As such, brevenal elicits its action through a novel mechanism and/or currently unknown receptor site on VSSCs. PMID:25226846

  19. Characterization of (/sup 3/H)forskolin binding sites in the iris-ciliary body of the albino rabbit

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Goldman, M.E.; Mallorga, P.; Pettibone, D.J.

    1988-01-01

    (/sup 3/H)forskolin binding sites were identified using membranes prepared from the iris-ciliary body of adult, albino rabbits. Scatchard analysis of saturation binding experiments demonstrated that (/sup 3/H)forskolin bound to a single population of high affinity sites. The K/sub d/ and B/sub max/ values were 8.7 +- 0.9 nM and 119.0 +- 30.9 fmolmg prot. using membranes prepared from frozen tissue and 17.0 +- 6.2 nM and 184.4 +- 47.2 fmolmg prot. using fresh tissue. The binding of (/sup 3/H)forskolin was magnesium-dependent. The B/sub max/ was enhanced by sodium fluoride and Gpp(NH)p, a nonhydrolyzable guanine nucleotide analog. Forskolin was the mostmore » potent inhibitor of (/sup 3/H)forskolin binding; two commercially-available analogs were weaker inhibitors. In an adenylate cyclase assay, there was the same rank order of potency to enhance enzyme activity. Based upon binding affinities, magnesium-dependence, sensitivity to sodium fluoride and Gpp(NH)p, rank order of potencies of analogs and correlation of binding with adenylate cyclase activity, these studies suggest that the (/sup 3/H)forskolin binding site in the iris-ciliary body is similar to the binding site in other tissues« less

  20. Impact of disruption of secondary binding site S2 on dopamine transporter function.

    PubMed

    Zhen, Juan; Reith, Maarten E A

    2016-09-01

    The structures of the leucine transporter, drosophila dopamine transporter, and human serotonin transporter show a secondary binding site (designated S2 ) for drugs and substrate in the extracellular vestibule toward the membrane exterior in relation to the primary substrate recognition site (S1 ). The present experiments are aimed at disrupting S2 by mutating Asp476 and Ile159 to Ala. Both mutants displayed a profound decrease in [(3) H]DA uptake compared with wild-type associated with a reduced turnover rate kcat . This was not caused by a conformational bias as the mutants responded to Zn(2+) (10 μM) similarly as WT. The dopamine transporters with either the D476A or I159A mutation both displayed a higher Ki for dopamine for the inhibition of [3H](-)-2-β-carbomethoxy-3-β-(4-fluorophenyl)tropane binding than did the WT transporter, in accordance with an allosteric interaction between the S1 and S2 sites. The results provide evidence in favor of a general applicability of the two-site allosteric model of the Javitch/Weinstein group from LeuT to dopamine transporter and possibly other monoamine transporters. X-ray structures of transporters closely related to the dopamine (DA) transporter show a secondary binding site S2 in the extracellular vestibule proximal to the primary binding site S1 which is closely linked to one of the Na(+) binding sites. This work examines the relationship between S2 and S1 sites. We found that S2 site impairment severely reduced DA transport and allosterically reduced S1 site affinity for the cocaine analog [(3) H]CFT. Our results are the first to lend direct support for the application of the two-site allosteric model, advanced for bacterial LeuT, to the human DA transporter. The model states that, after binding of the first DA molecule (DA1 ) to the primary S1 site (along with Na(+) ), binding of a second DA (DA2 ) to the S2 site triggers, through an allosteric interaction, the release of DA1 and Na(+) into the cytoplasm. © 2016 International Society for Neurochemistry.

  1. Mössbauer properties of the diferric cluster and the differential iron(II)-binding affinity of the iron sites in protein R2 of class Ia Escherichia coli ribonucleotide reductase: a DFT/electrostatics study.

    PubMed

    Han, Wen-Ge; Sandala, Gregory M; Giammona, Debra Ann; Bashford, Donald; Noodleman, Louis

    2011-11-14

    The R2 subunit of class-Ia ribonucleotide reductase (RNR) from Escherichia coli (E. coli) contains a diiron active site. Starting from the apo-protein and Fe(II) in solution at low Fe(II)/apoR2 ratios, mononuclear Fe(II) binding is observed indicating possible different Fe(II) binding affinities for the two alternative sites. Further, based on their Mössbauer spectroscopy and two-iron-isotope reaction experiments, Bollinger et al. (J. Am. Chem. Soc., 1997, 119, 5976-5977) proposed that the site Fe1, which bonds to Asp84, should be associated with the higher observed (57)Fe Mössbauer quadrupole splitting (2.41 mm s(-1)) and lower isomer shift (0.45 mm s(-1)) in the Fe(III)Fe(III) state, site Fe2, which is further from Tyr122, should have a greater affinity for Fe(II) binding than site Fe1, and Fe(IV) in the intermediate X state should reside at site Fe2. In this paper, using density functional theory (DFT) incorporated with the conductor-like screening (COSMO) solvation model and with the finite-difference Poisson-Boltzmann self-consistent reaction field (PB-SCRF) methodologies, we have demonstrated that the observed large quadrupole splitting for the diferric state R2 does come from site Fe1(III) and it is mainly caused by the binding position of the carboxylate group of the Asp84 sidechain. Further, a series of active site clusters with mononuclear Fe(II) binding at either site Fe1 or Fe2 have been studied, which show that with a single dielectric medium outside the active site quantum region, there is no energetic preference for Fe(II) binding at one site over another. However, when including the explicit extended protein environment in the PB-SCRF model, the reaction field favors the Fe(II) binding at site Fe2 rather than at site Fe1 by ~9 kcal mol(-1). Therefore our calculations support the proposal of the previous Mössbauer spectroscopy and two-iron-isotope reaction experiments by Bollinger et al.

  2. Minute Virus of Mice Initiator Protein NS1 and a Host KDWK Family Transcription Factor Must Form a Precise Ternary Complex with Origin DNA for Nicking To Occur

    PubMed Central

    Christensen, Jesper; Cotmore, Susan F.; Tattersall, Peter

    2001-01-01

    Parvoviral rolling hairpin replication generates palindromic genomic concatemers whose junctions are resolved to give unit-length genomes by a process involving DNA replication initiated at origins derived from each viral telomere. The left-end origin of minute virus of mice (MVM), oriL, contains binding sites for the viral initiator nickase, NS1, and parvovirus initiation factor (PIF), a member of the emerging KDWK family of transcription factors. oriL is generated as an active form, oriLTC, and as an inactive form, oriLGAA, which contains a single additional nucleotide inserted between the NS1 and PIF sites. Here we examined the interactions on oriLTC which lead to activation of NS1 by PIF. The two subunits of PIF, p79 and p96, cooperatively bind two ACGT half-sites, which can be flexibly spaced. When coexpressed from recombinant baculoviruses, the PIF subunits preferentially form heterodimers which, in the presence of ATP, show cooperative binding with NS1 on oriL, but this interaction is preferentially enhanced on oriLTC compared to oriLGAA. Without ATP, NS1 is unable to bind stably to its cognate site, but PIF facilitates this interaction, rendering the NS1 binding site, but not the nick site, resistant to DNase I. Varying the spacing of the PIF half-sites shows that the distance between the NS1 binding site and the NS1-proximal half-site is critical for nickase activation, whereas the position of the distal half-site is unimportant. When expressed separately, both PIF subunits form homodimers that bind site specifically to oriL, but only complexes containing p79 activate the NS1 nickase function. PMID:11435581

  3. Improved targeting and enhanced retention of the human, autologous, fibroblast-derived, induced, pluripotent stem cells to the sarcomeres of the infarcted myocardium with the aid of the bioengineered, heterospecific, tetravalent antibodies**

    PubMed Central

    Malecki, Marek

    2013-01-01

    Clinical trials, to regenerate the human heart injured by myocardial infarction, involve the delivery of stem cells to the site of the injury. However, only a small fraction of the introduced stem cells are detected at the site of the injury, merely two weeks after this therapeutic intervention. This significantly hampers the effectiveness of the stem cell therapy. To resolve the aforementioned problem, we genetically and molecularly bioengineered heterospecific, tetravalent antibodies (htAbs), which have both exquisite specificity and high affinity towards human, pluripotent, stem cells through the htAbs’ domains binding SSEA-4, SSEA-3, TRA-1-60, and TRA-1-81, as well as towards the injured cardiac muscle through the htAbs’ domains binding human cardiac myosin, α-actinin, actin, and titin. The cardiac tissue was acquired from the patients, who were receiving heart transplants. The autologous, human, induced, pluripotent stem cells (hiPSCs) were generated from the patients’ fibroblasts by non-viral delivery and transient expression of the DNA constructs for: Oct4, Nanog, Sox2, Lin28, Klf4, c-Myc. In the trials involving the htAbs, the human, induced, pluripotent stem cells anchored to the myocardial sarcomeres with the efficiency, statistically, significantly higher, than in the trials with non-specific or without antibodies (p < 0.0003). Moreover, application of the htAbs resulted in cross-linking of the sarcomeric proteins to create the stable scaffolds for anchoring of the stem cells. Thereafter, these human, induced pluripotent stem cells differentiated into cardiomyocytes at their anchorage sites. By bioengineering of these novel heterospecific, tetravalent antibodies and using them to guide and to anchor the stem cells specifically to the stabilized sarcomeric scaffolds, we demonstrated the proof of concept in vitro for improving effectiveness of regenerative therapy of myocardial infarction and created the foundations for the trials in vivo. PMID:23956947

  4. Structural characterization of O- and C-glycosylating variants of the landomycin glycosyltransferase LanGT2.

    PubMed

    Tam, Heng Keat; Härle, Johannes; Gerhardt, Stefan; Rohr, Jürgen; Wang, Guojun; Thorson, Jon S; Bigot, Aurélien; Lutterbeck, Monika; Seiche, Wolfgang; Breit, Bernhard; Bechthold, Andreas; Einsle, Oliver

    2015-02-23

    The structures of the O-glycosyltransferase LanGT2 and the engineered, C-C bond-forming variant LanGT2S8Ac show how the replacement of a single loop can change the functionality of the enzyme. Crystal structures of the enzymes in complex with a nonhydrolyzable nucleotide-sugar analogue revealed that there is a conformational transition to create the binding sites for the aglycon substrate. This induced-fit transition was explored by molecular docking experiments with various aglycon substrates. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Phyloscan: locating transcription-regulating binding sites in mixed aligned and unaligned sequence data.

    PubMed

    Palumbo, Michael J; Newberg, Lee A

    2010-07-01

    The transcription of a gene from its DNA template into an mRNA molecule is the first, and most heavily regulated, step in gene expression. Especially in bacteria, regulation is typically achieved via the binding of a transcription factor (protein) or small RNA molecule to the chromosomal region upstream of a regulated gene. The protein or RNA molecule recognizes a short, approximately conserved sequence within a gene's promoter region and, by binding to it, either enhances or represses expression of the nearby gene. Since the sought-for motif (pattern) is short and accommodating to variation, computational approaches that scan for binding sites have trouble distinguishing functional sites from look-alikes. Many computational approaches are unable to find the majority of experimentally verified binding sites without also finding many false positives. Phyloscan overcomes this difficulty by exploiting two key features of functional binding sites: (i) these sites are typically more conserved evolutionarily than are non-functional DNA sequences; and (ii) these sites often occur two or more times in the promoter region of a regulated gene. The website is free and open to all users, and there is no login requirement. Address: (http://bayesweb.wadsworth.org/phyloscan/).

  6. Autoradiographic demonstration of oxytocin-binding sites in the macula densa

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Stoeckel, M.E.; Freund-Mercier, M.J.

    1989-08-01

    Specific oxytocin (OT)-binding sites were localized in the rat kidney with use of a selective {sup 125}I-labeled OT antagonist ({sup 125}I-OTA). High concentrations of OT binding sites were detected on the juxtaglomerular apparatus with use of the conventional film autoradiographic technique. No labeling occurred on other renal structures. The cellular localization of the OT binding sites within the juxtaglomerular apparatus was studied in light microscope autoradiography, on semithin sections from paraformaldehyde-fixed kidney slices incubated in the presence of {sup 125}I-OTA. These preparations revealed selective labeling of the macula densa, mainly concentrated at the basal pole of the cells. Control experimentsmore » showed first that {sup 125}I-OTA binding characteristics were not noticeably altered by prior paraformaldehyde fixation of the kidneys and second that autoradiographic detection of the binding sites was not impaired by histological treatments following binding procedures. In view of the role of the macula densa in the tubuloglomerular feedback, the putative OT receptors of this structure might mediate the stimulatory effect of OT on glomerular filtration.« less

  7. High-affinity cannabinoid binding site in brain: A possible marijuana receptor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nye, J.S.

    The mechanism by which delta{sup 9} tetrahydrocannabinol (delta{sup 9}THC), the major psychoactive component of marijuana or hashish, produces its potent psychological and physiological effects is unknown. To find receptor binding sites for THC, we designed a water-soluble analog for use as a radioligand. 5{prime}-Trimethylammonium-delta{sup 8}THC (TMA) is a positively charged analog of delta-{sup 8}THC modified on the 5{prime} carbon, a portion of the molecule not important for its psychoactivity. We have studied the binding of ({sup 3}H)-5{prime}-trimethylammonium-delta-{sup 8}THC (({sup 3}H)TMA) to rat neuronal membranes. ({sup 3}H)TMA binds saturably and reversibly to brain membranes with high affinity to apparently one classmore » of sites. Highest binding site density occurs in brain, but several peripheral organs also display specific binding. Detergent solubilizes the sites without affecting their pharmacologial properties. Molecular sieve chromatography reveals a bimodal peak of ({sup 3}H)TMA binding activity of approximately 60,000 daltons apparent molecular weight.« less

  8. Binding characteristics of levetiracetam to synaptic vesicle protein 2A (SV2A) in human brain and in CHO cells expressing the human recombinant protein.

    PubMed

    Gillard, Michel; Chatelain, Pierre; Fuks, Bruno

    2006-04-24

    A specific binding site for the antiepileptic drug levetiracetam (2S-(oxo-1-pyrrolidinyl)butanamide, Keppra) in rat brain, referred to as the levetiracetam binding site, was discovered several years ago. More recently, this binding site has been identified as the synaptic vesicle protein 2A (SV2A), a protein present in synaptic vesicles [Lynch, B., Lambeng, N., Nocka, K., Kensel-Hammes, P., Bajjalieh, S.M., Matagne, A., Fuks, B., 2004. The synaptic vesicle protein SV2A is the binding site for the antiepileptic drug levetiracetam. Proc. Natl. Acad. Sci. USA, 101, 9861-9866.]. In this study, we characterized the binding properties of levetiracetam in post-mortem human brain and compared them to human SV2A expressed in Chinese hamster ovary (CHO) cells. The results showed that the binding properties of levetiracetam and [3H]ucb 30889, an analogue that was previously characterized as a suitable ligand for levetiracetam binding site/SV2A in rat brain [Gillard, M., Fuks, B., Michel, P., Vertongen, P., Massingham, R. Chatelain, P., 2003. Binding characteristics of [3H]ucb 30889 to levetiracetam binding sites in rat brain. Eur. J. Pharmacol. 478, 1-9.], are almost identical in human brain samples (cerebral cortex, hippocampus and cerebellum) and in CHO cell membranes expressing the human SV2A protein. Moreover, the results are also similar to those previously obtained in rat brain. [3H]ucb 30889 binding in human brain and to SV2A was saturable and reversible. At 4 degrees C, its binding kinetics were best fitted assuming a two-phase model in all tissues. The half-times of association for the fast component ranged between 1 to 2 min and represent 30% to 36% of the sites whereas the half-times for the slow component ranged from 20 to 29 min. In dissociation experiments, the half-times were from 2 to 4 min for the fast component (33% to 49% of the sites) and 20 to 41 min for the slow component. Saturation binding curves led to Kd values for [3H]ucb 30889 of 53+/-7, 55+/-9, 70+/-11 and 75+/-33 nM in human cerebral cortex, hippocampus, cerebellum and CHO cells expressing SV2A respectively. Bmax values around 3-4 pmol/mg protein were calculated in all brain regions. Some of the saturation curves displayed curvilinear Scatchard plots indicating the presence of high and low affinity binding sites. When this was the case, Kd values from 25 to 30 nM for the high affinity sites (24% to 34% of total sites) and from 200 to 275 nM for the low affinity sites were calculated. This was observed in all brain regions and in CHO cell membranes expressing the SV2A protein. It cannot be explained by putative binding of [3H]ucb 30889 to SV2B or C isoforms but may reflect different patterns of SV2A glycosylation or the formation of SV2A oligomers. Competition experiments were performed to determine the affinities for SV2A of a variety of compounds including levetiracetam, some of its analogues and other molecules known to interact with levetiracetam binding sites in rat brain such as bemegride, pentylenetetrazol and chlordiazepoxide. We found an excellent correlation between the affinities of these compounds measured in human brain, rat brain and CHO cells expressing human SV2A. In conclusion, we report for the first time that the binding characteristics of native levetiracetam binding sites/SV2A in human brain and rat brain share very similar properties with human recombinant SV2A expressed in CHO cells.

  9. The Polar and Electrical Nature of Dye Binding Sites on Human Red Blood Cell Membranes.

    DTIC Science & Technology

    positive charges at the binding sites. By increasing the concentration of the anionic BPB (or by the addition of the anionic detergent sodium lauryl ... sulfate ) these positive charges appear to be successively titrated, rendering the membrane binding sites electrically neutral at this pH. The average

  10. Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP

    PubMed Central

    Hafner, Markus; Landthaler, Markus; Burger, Lukas; Khorshid, Mohsen; Hausser, Jean; Berninger, Philipp; Rothballer, Andrea; Ascano, Manuel; Jungkamp, Anna-Carina; Munschauer, Mathias; Ulrich, Alexander; Wardle, Greg S.; Dewell, Scott; Zavolan, Mihaela; Tuschl, Thomas

    2010-01-01

    Summary RNA transcripts are subject to post-transcriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases. PMID:20371350

  11. Pharmacophore screening of the protein data bank for specific binding site chemistry.

    PubMed

    Campagna-Slater, Valérie; Arrowsmith, Andrew G; Zhao, Yong; Schapira, Matthieu

    2010-03-22

    A simple computational approach was developed to screen the Protein Data Bank (PDB) for putative pockets possessing a specific binding site chemistry and geometry. The method employs two commonly used 3D screening technologies, namely identification of cavities in protein structures and pharmacophore screening of chemical libraries. For each protein structure, a pocket finding algorithm is used to extract potential binding sites containing the correct types of residues, which are then stored in a large SDF-formatted virtual library; pharmacophore filters describing the desired binding site chemistry and geometry are then applied to screen this virtual library and identify pockets matching the specified structural chemistry. As an example, this approach was used to screen all human protein structures in the PDB and identify sites having chemistry similar to that of known methyl-lysine binding domains that recognize chromatin methylation marks. The selected genes include known readers of the histone code as well as novel binding pockets that may be involved in epigenetic signaling. Putative allosteric sites were identified on the structures of TP53BP1, L3MBTL3, CHEK1, KDM4A, and CREBBP.

  12. Identification of a p53-response element in the promoter of the proline oxidase gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-05-02

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

  13. The Role and Specificity of the Catalytic and Regulatory Cation-binding Sites of the Na+-pumping NADH:Quinone Oxidoreductase from Vibrio cholerae*

    PubMed Central

    Juárez, Oscar; Shea, Michael E.; Makhatadze, George I.; Barquera, Blanca

    2011-01-01

    The Na+-translocating NADH:quinone oxidoreductase is the entry site for electrons into the respiratory chain and the main sodium pump in Vibrio cholerae and many other pathogenic bacteria. In this work, we have employed steady-state and transient kinetics, together with equilibrium binding measurements to define the number of cation-binding sites and characterize their roles in the enzyme. Our results show that sodium and lithium ions stimulate enzyme activity, and that Na+-NQR enables pumping of Li+, as well as Na+ across the membrane. We also confirm that the enzyme is not able to translocate other monovalent cations, such as potassium or rubidium. Although potassium is not used as a substrate, Na+-NQR contains a regulatory site for this ion, which acts as a nonessential activator, increasing the activity and affinity for sodium. Rubidium can bind to the same site as potassium, but instead of being activated, enzyme turnover is inhibited. Activity measurements in the presence of both sodium and lithium indicate that the enzyme contains at least two functional sodium-binding sites. We also show that the binding sites are not exclusively responsible for ion selectivity, and other steps downstream in the mechanism also play a role. Finally, equilibrium-binding measurements with 22Na+ show that, in both its oxidized and reduced states, Na+-NQR binds three sodium ions, and that the affinity for sodium is the same for both of these states. PMID:21652714

  14. Characterization of [3H] oxymorphone binding sites in mouse brain: Quantitative autoradiography in opioid receptor knockout mice.

    PubMed

    Yoo, Ji Hoon; Borsodi, Anna; Tóth, Géza; Benyhe, Sándor; Gaspar, Robert; Matifas, Audrey; Kieffer, Brigitte L; Metaxas, Athanasios; Kitchen, Ian; Bailey, Alexis

    2017-03-16

    Oxymorphone, one of oxycodone's metabolic products, is a potent opioid receptor agonist which is thought to contribute to the analgesic effect of its parent compound and may have high potential abuse liability. Nonetheless, the in vivo pharmacological binding profile of this drug is still unclear. This study uses mice lacking mu (MOP), kappa (KOP) or delta (DOP) opioid receptors as well as mice lacking all three opioid receptors to provide full characterisation of oxymorphone binding sites in the brain. Saturation binding studies using [ 3 H]oxymorphone revealed high affinity binding sites in mouse brain displaying Kd of 1.7nM and Bmax of 147fmol/mg. Furthermore, we performed quantitative autoradiography binding studies using [ 3 H]oxymorphone in mouse brain. The distribution of [ 3 H]oxymorphone binding sites was found to be similar to the selective MOP agonist [ 3 H]DAMGO in the mouse brain. [ 3 H]Oxymorphone binding was completely abolished across the majority of the brain regions in mice lacking MOP as well as in mice lacking all three opioid receptors. DOP and KOP knockout mice retained [ 3 H]oxymorphone binding sites suggesting oxymorphone may not target DOP or KOP. These results confirm that the MOP, and not the DOP or the KOP is the main high affinity binding target for oxymorphone. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Autoradiographic localization of sigma receptor binding sites in guinea pig and rat central nervous system with (+)3H-3-(3-hydroxyphenyl)-N-(1-propyl)piperidine

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gundlach, A.L.; Largent, B.L.; Snyder, S.H.

    1986-06-01

    (+)3H-3-PPP ((+)3H-3-(3-Hydroxyphenyl)-N-(1-propyl)-piperidine) binds with high affinity to brain membranes with a pharmacological profile consistent with that of sigma receptors. The distribution of (+)3H-3-PPP binding sites in brain and spinal cord of both guinea pig and rat has been determined by in vitro autoradiography with binding densities quantitated by computer-assisted densitometry. (+)3H-3-PPP binding to slide-mounted brain sections is saturable and displays high affinity and a pharmacological specificity very similar to sites labeled in homogenates. (+)3H-3-PPP binding sites are heterogeneously distributed. Highest concentrations of binding sites occur in spinal cord, particularly the ventral horn and dorsal root ganglia; the pons-medulla, associated withmore » the cranial nerve and pontine nuclei and throughout the brain stem reticular formation; the cerebellum, over the Purkinje cell layer; the midbrain, particularly the central gray and red nucleus; and hippocampus, over the pyramidal cell layer. Lowest levels are seen in the basal ganglia and parts of the thalamus, while all other areas, including hypothalamus and cerebral cortex, exhibit moderate grain densities. Quinolinic acid-induced lesions of the hippocampus indicate that (+)3H-3-PPP labels hippocampal pyramidal cells and granule cells in the dentate gyrus. Intrastriatal injection of ibotenic acid dramatically reduces (+)3H-3-PPP binding in this area, while injection of 6-hydroxydopamine produces a relatively slight decrease. The distribution of (+)3H-3-PPP binding sites does not correlate with the receptor distribution of any recognized neurotransmitter or neuropeptide, including dopamine. However, there is a notable similarity between the distribution of (+)3H-3-PPP sites and high-affinity binding sites for psychotomimetic opioids, such as the benzomorphan (+)SKF 10,047.« less

  16. DNA binding site characterization by means of Rényi entropy measures on nucleotide transitions.

    PubMed

    Perera, A; Vallverdu, M; Claria, F; Soria, J M; Caminal, P

    2008-06-01

    In this work, parametric information-theory measures for the characterization of binding sites in DNA are extended with the use of transitional probabilities on the sequence. We propose the use of parametric uncertainty measures such as Rényi entropies obtained from the transition probabilities for the study of the binding sites, in addition to nucleotide frequency-based Rényi measures. Results are reported in this work comparing transition frequencies (i.e., dinucleotides) and base frequencies for Shannon and parametric Rényi entropies for a number of binding sites found in E. Coli, lambda and T7 organisms. We observe that the information provided by both approaches is not redundant. Furthermore, under the presence of noise in the binding site matrix we observe overall improved robustness of nucleotide transition-based algorithms when compared with nucleotide frequency-based method.

  17. Modeling the Embrace of a Mutator: APOBEC Selection of Nucleic Acid Ligands.

    PubMed

    Salter, Jason D; Smith, Harold C

    2018-05-23

    The 11-member APOBEC (apolipoprotein B mRNA editing catalytic polypeptide-like) family of zinc-dependent cytidine deaminases bind to RNA and single-stranded DNA (ssDNA) and, in specific contexts, modify select (deoxy)cytidines to (deoxy)uridines. In this review, we describe advances made through high-resolution co-crystal structures of APOBECs bound to mono- or oligonucleotides that reveal potential substrate-specific binding sites at the active site and non-sequence-specific nucleic acid binding sites distal to the active site. We also discuss the effect of APOBEC oligomerization on functionality. Future structural studies will need to address how ssDNA binding away from the active site may enhance catalysis and the mechanism by which RNA binding may modulate catalytic activity on ssDNA. Copyright © 2018 The Author(s). Published by Elsevier Ltd.. All rights reserved.

  18. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bidlack, J.M.; Frey, D.K.; Seyed-Mozaffari, A.

    The binding properties of 14{beta}-(bromoacetamido)morphine (BAM) and the ability of BAM to irreversibly inhibit opioid binding to rat brain membranes were examined to characterize the affinity and selectivity of BAM as an irreversible affinity ligand for opioid receptors. BAM had the same receptor selectivity as morphine, with a 3-5-fold decrease in affinity for the different types of opioid receptors. When brain membranes were incubated with BAM, followed by extensive washing, opioid binding was restored to control levels. However, when membranes were incubated with dithiothreitol (DTT), followed by BAM, and subsequently washed, 90% of the 0.25 nM ({sup 3}H)(D-Ala{sup 2},(Me)Phe{sup 4},Gly(ol){supmore » 5})enkephalin (DAGO) binding was irreversibly inhibited as a result of the specific alkylation of a sulfhydryl group at the {mu} binding site. This inhibition was dependent on the concentrations of both DTT and BAM. The {mu} receptor specificity of BAM alkylation was demonstrated by the ability of BAM alkylated membranes to still bind the {delta}-selective peptide ({sup 3}H)(D-penicillamine{sup 2},D-penicillamine{sup 5})enkephalin (DPDPE) and (-)-({sup 3}H)bremazocine in the presence of {mu} and {delta} blockers, selective for {kappa} binding sites. Morphine and naloxone partially protected the binding site from alkylation with BAM, while ligands that did not bind to the {mu}s site did not afford protection. These studies have demonstrated that when a disulfide bond at or near {mu} opioid binding sites was reduced, BAM could then alkylate this site, resulting in the specific irreversible labeling of {mu} opioid receptors.« less

  19. ( sup 3 H)RO15-4513 binding to cerebellar diazepam-sensitive and insensitive GABAA receptors is unchanged by one week of ethanol intake

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Martin, M.W.; Chen, J.P.; Wallis, C.

    1992-02-26

    ({sup 3}H)RO15-4513, a partial inverse agonist at GABAA receptors, binds to two sites in cerebellar membranes, one sensitive (DZ-S) and one insensitive (DZ-IS) to inhibition by diazepam. These binding sites may represent different isoforms of the GABAA receptor and may play a role in ethanol (EtOH) dependence. The authors tested the hypothesis that chronic intake of EtOH induces changes in the binding properties of one or both of these putative GABBA receptors. Rats were fed a liquid diet of 4.5% EtOH for 7 d, gavaged with a 3g/kg dose of EtOH, and then sacrificed after 2 h, 12 h, ormore » 4.5 d. Binding of ({sup 3}H)RO15-4513 to cerebellar membranes was performed in the absence or presence of 10{mu}M diazepam (DZ-IS binding); DZ-S binding was calculated as the difference between total and DZ-IS. Nonlinear regression analysis showed that each class of binding site fit a model of mass action binding to a single, noninteractive population of sites. No significant difference was observed between any of the treatment groups in the apparent affinity (Kd) for ({sup 3}H)RO15-4513 at total, DZ-S, or DZ-IS sites following chronic EtOH intake or withdrawal. In addition, no significant difference was observed in the apparent number of DZ-S or DZ-IS binding sites or the ratio of DZ-S to DZ-IS.« less

  20. High Structural Resolution Hydroxyl Radical Protein Footprinting Reveals an Extended Robo1-Heparin Binding Interface*

    PubMed Central

    Li, Zixuan; Moniz, Heather; Wang, Shuo; Ramiah, Annapoorani; Zhang, Fuming; Moremen, Kelley W.; Linhardt, Robert J.; Sharp, Joshua S.

    2015-01-01

    Interaction of transmembrane receptors of the Robo family and the secreted protein Slit provides important signals in the development of the central nervous system and regulation of axonal midline crossing. Heparan sulfate, a sulfated linear polysaccharide modified in a complex variety of ways, serves as an essential co-receptor in Slit-Robo signaling. Previous studies have shown that closely related heparin octasaccharides bind to Drosophila Robo directly, and surface plasmon resonance analysis revealed that Robo1 binds more tightly to full-length unfractionated heparin. For the first time, we utilized electron transfer dissociation-based high spatial resolution hydroxyl radical protein footprinting to identify two separate binding sites for heparin interaction with Robo1: one binding site at the previously identified site for heparin dp8 and a second binding site at the N terminus of Robo1 that is disordered in the x-ray crystal structure. Mutagenesis of the identified N-terminal binding site exhibited a decrease in binding affinity as measured by surface plasmon resonance and heparin affinity chromatography. Footprinting also indicated that heparin binding induces a minor change in the conformation and/or dynamics of the Ig2 domain, but no major conformational changes were detected. These results indicate a second low affinity binding site in the Robo-Slit complex as well as suggesting the role of the Ig2 domain of Robo1 in heparin-mediated signal transduction. This study also marks the first use of electron transfer dissociation-based high spatial resolution hydroxyl radical protein footprinting, which shows great utility for the characterization of protein-carbohydrate complexes. PMID:25752613

  1. Point mutation increases a form of the NK1 receptor with high affinity for neurokinin A and B and septide

    PubMed Central

    Ciucci, Alessandra; Palma, Carla; Manzini, Stefano; Werge, Thomas M

    1998-01-01

    The binding modalities of substance P and neurokinin A on the wild type and Gly166 to-Cys mutant NK1 receptors expressed on CHO cells were investigated in homologous and heterologous binding experiments using both radiolabelled substance P and neurokinin A.On the wild type NK1 receptor NKA displaces radiolabelled substance P with very low apparent affinity, despite its high-affinity binding constant (determined in homologous binding experiments). The Gly166 to-Cys substitution in the NK1 tachykinin receptor greatly enhances the apparent affinity of neurokinin A in competition for radiolabelled substance P, but it does not change the binding constant of neurokinin A. The mutation, thereby, eliminates the discrepancy between the low apparent affinity and the high binding constant of neurokinin A.On the wild type receptor the binding capacity of neurokinin A is significantly smaller than that of substance P. In contrast, the two tachykinins bind to approximately the same number of sites on the mutant receptor.Simultaneous mass action law analysis of binding data in which multiple radioligands were employed in parallel demonstrated that a one-site model was unable to accommodate all the experimental data, whereas a two-site model provided a dramatically better description.These two receptor-sites display equally high affinity for substance P, while neurokinin A strongly discriminates between a high and a low affinity component. The binding affinities of neurokinin A are not affected by the mutation, which instead specifically alters the distribution between receptor sites in favour of a high affinity neurokinin A binding form.The low apparent affinity and binding capacity of neurokinin A on the wild type receptor results from neurokinin A binding with high affinity only to a fraction of the sites labelled by substance P. The mutation increases the proportion of this site, and consequently enhances the apparent affinity and binding capacity of neurokinin A.The binding modalities of septide-like ligands (i.e. neurokinin B, SP(6-11), SP-methyl ester) are affected similarly to neurokinin A and are better resolved into two sites. The mutation leaves the affinity of these ligands for the two receptor forms unchanged, but increases the fraction of high-affinity sites. On the other hand, the binding of non-peptide and peptide antagonists (SR140.333 and FK888) behaved similarly to substance P with a single high affinity site that is unaffected by the mutation.These findings may suggest that the NK1 receptor exists in two different forms with similar affinity for substance P and NK1 antagonists, but with a high and a low affinity for neurokinin A and septide-like ligands. Hence, the Gly166 in the NK1 receptor would seem to control the distribution between a pan-reactive form and a substance P-selective form of the receptor. PMID:9786514

  2. Denervation does not alter the number of neuronal bungarotoxin binding sites on autonomic neurons in the frog cardiac ganglion.

    PubMed

    Sargent, P B; Bryan, G K; Streichert, L C; Garrett, E N

    1991-11-01

    The binding of neuronal bungarotoxin (n-BuTX; also known as bungarotoxin 3.1, kappa-bungarotoxin, and toxin F) was analyzed in normal and denervated parasympathetic cardiac ganglia of the frog Rana pipiens, n-BuTX blocks both EPSPs and ACh potentials at 5-20 nM, as determined by intracellular recording techniques. Scatchard analysis on homogenates indicates that cardiac ganglia have two classes of binding sites for 125I-n-BuTX: a high-affinity site with an apparent dissociation constant (Kd,app) of 1.7 nM and a Bmax (number of binding sites) of 3.8 fmol/ganglion and a low-affinity site with a Kd,app of 12 microM and a Bmax of 14 pmol/ganglion. alpha-Bungarotoxin does not appear to interfere with the binding of 125I-n-BuTX to either site. The high-affinity binding site is likely to be the functional nicotinic ACh receptor (AChR), given the similarity between its affinity for 125I-n-BuTX and the concentration of n-BuTX required to block AChR function. Light microscopic autoradiographic analysis of 125I-n-BuTX binding to the ganglion cell surface reveals that toxin binding is concentrated at synaptic sites, which were identified using a synaptic vesicle-specific antibody. Scatchard analysis of autoradiographic data reveals that 125I-n-BuTX binding to the neuronal surface is saturable and has a Kd,app similar to that of the high-affinity binding site characterized in homogenates. Surface binding of 125I-n-BuTX is blocked by nicotine, carbachol, and d-tubocurarine (IC50 less than 20 microM), but not by atropine (IC50 greater than 10 mM). Denervation of the heart increases the ACh sensitivity of cardiac ganglion cells but has no effect upon the number of high-affinity binding sites for 125I-n-BuTX in tissue homogenates. Moreover, autoradiographic analysis indicates that denervation does not alter the number of 125I-n-BuTX binding sites on the ganglion cell surface. n-BuTX is as effective in reducing ganglion cell responses to ACh in denervated ganglia as it is in normally innervated ganglia. These results suggest that denervation alters neither the total number of nicotinic AChRs in the cardiac ganglion nor the number found on the surface of ganglion cells. These autonomic neurons thus respond differently to denervation than do skeletal myofibers. The increase in ACh sensitivity displayed by cardiac ganglion cells upon denervation cannot be explained by changes in AChR number.

  3. Identification of 50- and 23-/25-kDa HeLa cell membrane glycoproteins involved in poliovirus infection: occurrence of poliovirus specific binding sites on susceptible and nonsusceptible cells.

    PubMed

    Barnert, R H; Zeichhardt, H; Habermehl, K O

    1992-02-01

    Glycoproteins in the range 50 and 23/25 kDa were identified as poliovirus specific binding sites on HeLa cells with the monoclonal antibody mAb 122. mAb 122 is characterized by its partial inhibiting effect on poliovirus reproduction and adsorption when prebound to HeLa cells. The binding sites are endocytosed in native cells and specific for poliovirus as mAb 122 did not interfere with the adsorption of human rhinovirus type 14 (HRV 14). The poliovirus binding sites are present also on nonprimate so called nonsusceptible cells, e.g., mouse L-cells, as could be shown with sensitive ELISA based binding assays and performance of binding studies with fixed cells at 37 degrees.

  4. Cooperative interplay of let-7 mimic and HuR with MYC RNA.

    PubMed

    Gunzburg, Menachem J; Sivakumaran, Andrew; Pendini, Nicole R; Yoon, Je-Hyun; Gorospe, Myriam; Wilce, Matthew C J; Wilce, Jacqueline A

    2015-01-01

    Both RNA-binding proteins (RBP) and miRNA play important roles in the regulation of mRNA expression, often acting together to regulate a target mRNA. In some cases the RBP and miRNA have been reported to act competitively, but in other instances they function cooperatively. Here, we investigated HuR function as an enhancer of let-7-mediated translational repression of c-Myc despite the separation of their binding sites. Using an in vitro system, we determined that a let-7 mimic, consisting of single-stranded (ss)DNA complementary to the let-7 binding site, enhanced the affinity of HuR for a 122-nt MYC RNA encompassing both binding sites. This finding supports the biophysical principle of cooperative binding by an RBP and miRNA purely through interactions at distal mRNA binding sites.

  5. The binding properties of cycloxaprid on insect native nAChRs partially explain the low cross-resistance with imidacloprid in Nilaparvata lugens.

    PubMed

    Zhang, Yixi; Xu, Xiaoyong; Bao, Haibo; Shao, Xusheng; Li, Zhong; Liu, Zewen

    2018-06-06

    Neonicotinoids, such as imidacloprid, are selective agonists of insect nicotinic acetylcholine receptors (nAChRs) to control Nilaparvata lugens, a major rice insect pest. High imidacloprid resistance has been reported in N. lugens in laboratory and in fields. Cycloxaprid, an oxabridged cis-nitromethylene neonicotinoid, showed high insecticidal activity against N. lugens and low cross-resistance in the imidacloprid resistant strains and field populations. Binding studies have demonstrated that imidacloprid had two binding sites with different affinities (Kd = 3.18 ± 0.43 pM and 1.78 ± 0.19 nM) in N. lugens nAChRs. Cycloxaprid was poor at displacing [ 3 H]imidacloprid at its high-affinity binding site (Ki = 159.38±20.43 nM), but quite efficient at the low-affinity binding site (Ki = 1.27±0.35 nM). These data showed that cycloxaprid had overlapping binding sites with imidacloprid only at its low-affinity binding site. Therefore, the low displacement ability of cycloxaprid against imidacloprid binding at its high affinity site could partially explain the low cross-resistance of cycloxaprid in the imidacloprid resistant populations. The high insecticidal activity, low cross-resistance and different binding properties on insect nAChRs of cycloxaprid demonstrating it a potential insecticide to control N. lugens and related insect pests, especially the ones with high resistance to neonicotinoids. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  6. CCL22-specific Antibodies Reveal That Engagement of Two Distinct Binding Domains on CCL22 Is Required for CCR4-mediated Function.

    PubMed

    Santulli-Marotto, Sandra; Wheeler, John; Lacy, Eilyn R; Boakye, Ken; Luongo, Jennifer; Wu, Sheng-Jiun; Ryan, Mary

    2015-12-01

    CCL22 inactivation in vivo occurs by cleavage at the N-terminus; however, it is unclear whether this encompasses the entire site of CCR4 interaction. CCL17 also binds CCR4 and its function requires binding via two discrete binding sites. Using monoclonal antibodies (MAbs), we report that there are two separate sites on CCL22 that are required for CCR4-mediated function. The CCL22-specific antibodies bind with affinities of 632 ± 297 pM (MC2B7) and 308 ± 43 pM (MAB4391) and neither exhibited detectable binding to CCL17. Both antibodies are comparable in their ability to inhibit CCL22-mediated calcium mobilization; however, competition binding studies demonstrate that MC2B7 and MAB4391 bind to distinct epitopes on CCL22. Both antibodies inhibit function through CCR4, which is demonstrated by loss of β-arrestin recruitment in a reporter cell line. In both assays, blocking either site independently abolished CCL22 function, suggesting that concurrent engagement of both sites with CCR4 is necessary for function. This is the first demonstration that CCL22 has two distinct binding sites that are required for CCR4 function. These antibodies are valuable tools for better understanding the interaction and function of CCL22 and CCR4 and will potentially help further understanding of the differential outcomes of CCL17 and CCL22 interaction with CCR4.

  7. FOLLITROPIN RECEPTORS CONTAIN CRYPTIC LIGAND BINDING SITES1

    PubMed Central

    Lin, Win; Bernard, Michael P.; Cao, Donghui; Myers, Rebecca V.; Kerrigan, John E.; Moyle, William R.

    2007-01-01

    Human choriogonadotropin (hCG) and follitropin (hFSH) have been shown to contact different regions of the extracellular domains of G-protein coupled lutropin (LHR) and follitropin (FSHR) receptors. We report here that hCG and hFSH analogs interact with an FSHR/LHR chimera having only two unique LHR residues similar to the manners in which they dock with LHR and FSHR, respectively. This shows that although the FSHR does not normally bind hCG, it contains a cryptic lutropin binding site that has the potential to recognize hCG in a manner similar to the LHR. The presence of this cryptic site may explain why equine lutropins bind many mammalian FSHR and why mutations in the transmembrane domain distant from the extracellular domain enable the FSHR to bind hCG. The leucine-rich repeat domain (LRD) of the FSHR also appears to contain a cryptic FSH binding site that is obscured by other parts of the extracellular domain. This will explain why contacts seen in crystals of hFSH complexed with an LRD fragment of the human FSHR are hard to reconcile with the abilities of FSH analogs to interact with membrane G-protein coupled FSHR. We speculate that cryptic lutropin binding sites in the FSHR, which are also likely to be present in thyrotropin receptors (TSHR), permit the physiological regulation of ligand binding specificity. Cryptic FSH binding sites in the LRD may enable alternate spliced forms of the FSHR to interact with FSH. PMID:17059863

  8. Investigation of glucose binding sites on insulin.

    PubMed

    Zoete, Vincent; Meuwly, Markus; Karplus, Martin

    2004-05-15

    Possible insulin binding sites for D-glucose have been investigated theoretically by docking and molecular dynamics (MD) simulations. Two different docking programs for small molecules were used; Multiple Copy Simultaneous Search (MCSS) and Solvation Energy for Exhaustive Docking (SEED) programs. The configurations resulting from the MCSS search were evaluated with a scoring function developed to estimate the binding free energy. SEED calculations were performed using various values for the dielectric constant of the solute. It is found that scores emphasizing non-polar interactions gave a preferential binding site in agreement with that inferred from recent fluorescence and NMR NOESY experiments. The calculated binding affinity of -1.4 to -3.5 kcal/mol is within the measured range of -2.0 +/- 0.5 kcal/mol. The validity of the binding site is suggested by the dynamical stability of the bound glucose when examined with MD simulations with explicit solvent. Alternative binding sites were found in the simulations and their relative stabilities were estimated. The motions of the bound glucose during molecular dynamics simulations are correlated with the motions of the insulin side chains that are in contact with it and with larger scale insulin motions. These results raise the question of whether glucose binding to insulin could play a role in its activity. The results establish the complementarity of molecular dynamics simulations and normal mode analyses with the search for binding sites proposed with small molecule docking programs. Copyright 2004 Wiley-Liss, Inc.

  9. Evidence that Chemical Chaperone 4-Phenylbutyric Acid Binds to Human Serum Albumin at Fatty Acid Binding Sites

    PubMed Central

    James, Joel; Shihabudeen, Mohamed Sham; Kulshrestha, Shweta; Goel, Varun; Thirumurugan, Kavitha

    2015-01-01

    Endoplasmic reticulum stress elicits unfolded protein response to counteract the accumulating unfolded protein load inside a cell. The chemical chaperone, 4-Phenylbutyric acid (4-PBA) is a FDA approved drug that alleviates endoplasmic reticulum stress by assisting protein folding. It is found efficacious to augment pathological conditions like type 2 diabetes, obesity and neurodegeneration. This study explores the binding nature of 4-PBA with human serum albumin (HSA) through spectroscopic and molecular dynamics approaches, and the results show that 4-PBA has high binding specificity to Sudlow Site II (Fatty acid binding site 3, subdomain IIIA). Ligand displacement studies, RMSD stabilization profiles and MM-PBSA binding free energy calculation confirm the same. The binding constant as calculated from fluorescence spectroscopic studies was found to be kPBA = 2.69 x 105 M-1. Like long chain fatty acids, 4-PBA induces conformational changes on HSA as shown by circular dichroism, and it elicits stable binding at Sudlow Site II (fatty acid binding site 3) by forming strong hydrogen bonding and a salt bridge between domain II and III of HSA. This minimizes the fluctuation of HSA backbone as shown by limited conformational space occupancy in the principal component analysis. The overall hydrophobicity of W214 pocket (located at subdomain IIA), increases upon occupancy of 4-PBA at any FA site. Descriptors of this pocket formed by residues from other subdomains largely play a role in compensating the dynamic movement of W214. PMID:26181488

  10. A Sequence in the loop domain of hepatitis C virus E2 protein identified in silico as crucial for the selective binding to human CD81

    PubMed Central

    Chang, Chun-Chun; Hsu, Hao-Jen; Yen, Jui-Hung; Lo, Shih-Yen

    2017-01-01

    Hepatitis C virus (HCV) is a species-specific pathogenic virus that infects only humans and chimpanzees. Previous studies have indicated that interactions between the HCV E2 protein and CD81 on host cells are required for HCV infection. To determine the crucial factors for species-specific interactions at the molecular level, this study employed in silico molecular docking involving molecular dynamic simulations of the binding of HCV E2 onto human and rat CD81s. In vitro experiments including surface plasmon resonance measurements and cellular binding assays were applied for simple validations of the in silico results. The in silico studies identified two binding regions on the HCV E2 loop domain, namely E2-site1 and E2-site2, as being crucial for the interactions with CD81s, with the E2-site2 as the determinant factor for human-specific binding. Free energy calculations indicated that the E2/CD81 binding process might follow a two-step model involving (i) the electrostatic interaction-driven initial binding of human-specific E2-site2, followed by (ii) changes in the E2 orientation to facilitate the hydrophobic and van der Waals interaction-driven binding of E2-site1. The sequence of the human-specific, stronger-binding E2-site2 could serve as a candidate template for the future development of HCV-inhibiting peptide drugs. PMID:28481946

  11. Desensitization of the nicotinic acetylcholine receptor by diisopropylfluorophosphate.

    PubMed

    Eldefrawi, M E; Schweizer, G; Bakry, N M; Valdes, J J

    1988-01-01

    The interaction of diisopropylfluorophosphate (DFP) with the nicotinic acetylcholine (ACh) receptor of Torpedo electric organ was studied, using [3H]-phencyclidine ([3H]-PCP) as a reporter probe. Phencyclidine binds with different kinetics to resting, activated, and desensitized receptor conformations. Although DFP did not inhibit binding of [3H]-ACh or 125I-alpha-bungarotoxin (BGT) to the receptor recognition sites and potentiated in a time-dependent manner [3H]-PCP binding to the receptor's high-affinity allosteric site, it inhibited the ACh- or carbamylcholine-stimulated [3H]-PCP binding. This suggested that DFP bound to a third kind of site on the receptor and affected receptor conformation. Preincubation of the membranes with DFP increased the receptor's affinity for carbamylcholine by eightfold and raised the pseudo-first-order rate of [3H]-PCP binding to that of an agonist-desensitized receptor. Accordingly, it is suggested that DFP induces receptor desensitization by binding to a site that is distinct from the recognition or high-affinity noncompetitive sites.

  12. Discovery and validation of information theory-based transcription factor and cofactor binding site motifs.

    PubMed

    Lu, Ruipeng; Mucaki, Eliseos J; Rogan, Peter K

    2017-03-17

    Data from ChIP-seq experiments can derive the genome-wide binding specificities of transcription factors (TFs) and other regulatory proteins. We analyzed 765 ENCODE ChIP-seq peak datasets of 207 human TFs with a novel motif discovery pipeline based on recursive, thresholded entropy minimization. This approach, while obviating the need to compensate for skewed nucleotide composition, distinguishes true binding motifs from noise, quantifies the strengths of individual binding sites based on computed affinity and detects adjacent cofactor binding sites that coordinate with the targets of primary, immunoprecipitated TFs. We obtained contiguous and bipartite information theory-based position weight matrices (iPWMs) for 93 sequence-specific TFs, discovered 23 cofactor motifs for 127 TFs and revealed six high-confidence novel motifs. The reliability and accuracy of these iPWMs were determined via four independent validation methods, including the detection of experimentally proven binding sites, explanation of effects of characterized SNPs, comparison with previously published motifs and statistical analyses. We also predict previously unreported TF coregulatory interactions (e.g. TF complexes). These iPWMs constitute a powerful tool for predicting the effects of sequence variants in known binding sites, performing mutation analysis on regulatory SNPs and predicting previously unrecognized binding sites and target genes. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  13. Cone arrestin binding to JNK3 and Mdm2: conformational preference and localization of interaction sites

    PubMed Central

    Song, Xiufeng; Gurevich, Eugenia V.; Gurevich, Vsevolod V.

    2008-01-01

    Arrestins are multi-functional regulators of G protein-coupled receptors. Receptor-bound arrestins interact with >30 remarkably diverse proteins and redirect the signaling to G protein-independent pathways. The functions of free arrestins are poorly understood, and the interaction sites of the non-receptor arrestin partners are largely unknown. In this study, we show that cone arrestin, the least studied member of the family, binds c-Jun N-terminal kinase (JNK3) and Mdm2 and regulates their subcellular distribution. Using arrestin mutants with increased or reduced structural flexibility, we demonstrate that arrestin in all conformations binds JNK3 comparably, whereas Mdm2 preferentially binds cone arrestin ‘frozen’ in the basal state. To localize the interaction sites, we expressed separate N- and C-domains of cone and rod arrestins and found that individual domains bind JNK3 and remove it from the nucleus as efficiently as full-length proteins. Thus, the arrestin binding site for JNK3 includes elements in both domains with the affinity of partial sites on individual domains sufficient for JNK3 relocalization. N-domain of rod arrestin binds Mdm2, which localizes its main interaction site to this region. Comparable binding of JNK3 and Mdm2 to four arrestin subtypes allowed us to identify conserved residues likely involved in these interactions. PMID:17680991

  14. An additional substrate binding site in a bacterial phenylalanine hydroxylase

    PubMed Central

    Ronau, Judith A.; Paul, Lake N.; Fuchs, Julian E.; Corn, Isaac R.; Wagner, Kyle T.; Liedl, Klaus R.; Abu-Omar, Mahdi M.; Das, Chittaranjan

    2014-01-01

    Phenylalanine hydroxylase (PAH) is a non-heme iron enzyme that catalyzes phenylalanine oxidation to tyrosine, a reaction that must be kept under tight regulatory control. Mammalian PAH features a regulatory domain where binding of the substrate leads to allosteric activation of the enzyme. However, existence of PAH regulation in evolutionarily distant organisms, such as certain bacteria in which it occurs, has so far been underappreciated. In an attempt to crystallographically characterize substrate binding by PAH from Chromobacterium violaceum (cPAH), a single-domain monomeric enzyme, electron density for phenylalanine was observed at a distal site, 15.7Å from the active site. Isothermal titration calorimetry (ITC) experiments revealed a dissociation constant of 24 ± 1.1 µM for phenylalanine. Under the same conditions, no detectable binding was observed in ITC for alanine, tyrosine, or isoleucine, indicating the distal site may be selective for phenylalanine. Point mutations of residues in the distal site that contact phenylalanine (F258A, Y155A, T254A) lead to impaired binding, consistent with the presence of distal site binding in solution. Kinetic analysis reveals that the distal site mutants suffer a discernible loss in their catalytic activity. However, x-ray structures of Y155A and F258A, two of the mutants showing more noticeable defect in their activity, show no discernible change in their active site structure, suggesting that the effect of distal binding may transpire through protein dynamics in solution. PMID:23860686

  15. An auto-inhibitory helix in CTP:phosphocholine cytidylyltransferase hijacks the catalytic residue and constrains a pliable, domain-bridging helix pair

    PubMed Central

    Ramezanpour, Mohsen; Lee, Jaeyong; Taneva, Svetla G.; Tieleman, D. Peter; Cornell, Rosemary B.

    2018-01-01

    The activity of CTP:phosphocholine cytidylyltransferase (CCT), a key enzyme in phosphatidylcholine synthesis, is regulated by reversible interactions of a lipid-inducible amphipathic helix (domain M) with membrane phospholipids. When dissociated from membranes, a portion of the M domain functions as an auto-inhibitory (AI) element to suppress catalysis. The AI helix from each subunit binds to a pair of α helices (αE) that extend from the base of the catalytic dimer to create a four-helix bundle. The bound AI helices make intimate contact with loop L2, housing a key catalytic residue, Lys122. The impacts of the AI helix on active-site dynamics and positioning of Lys122 are unknown. Extensive MD simulations with and without the AI helix revealed that backbone carbonyl oxygens at the point of contact between the AI helix and loop L2 can entrap the Lys122 side chain, effectively competing with the substrate, CTP. In silico, removal of the AI helices dramatically increased αE dynamics at a predicted break in the middle of these helices, enabling them to splay apart and forge new contacts with loop L2. In vitro cross-linking confirmed the reorganization of the αE element upon membrane binding of the AI helix. Moreover, when αE bending was prevented by disulfide engineering, CCT activation by membrane binding was thwarted. These findings suggest a novel two-part auto-inhibitory mechanism for CCT involving capture of Lys122 and restraint of the pliable αE helices. We propose that membrane binding enables bending of the αE helices, bringing the active site closer to the membrane surface. PMID:29519816

  16. Replacing antibodies with modified DNA aptamers in vaccine potency assays.

    PubMed

    Trausch, Jeremiah J; Shank-Retzlaff, Mary; Verch, Thorsten

    2017-10-04

    Vaccine in vitro potency assays are vital regulatory tests that are used to confirm the presence and concentration of an antigen of interest in a form that directly or indirectly relates to protective activity in patients. Current assays come in many forms, but they almost exclusively use antibody reagents for selective detection of the target antigen. Antibodies provide specific recognition of vaccine antigens but also exhibit drawbacks such as stability limitations, cost, and lot-to-lot variation, which can make it challenging to maintain the reagent throughout the lifetime of the vaccine. We explored replacing antibodies with aptamers. Aptamers are macromolecules, such as nucleic acids, which can bind to their targets with high specificity and affinity, similar to that of antibodies. Some of the advantages of using aptamers over antibodies is that aptamers can be more stable, smaller, less expensive to produce, synthesized in vitro, and logistically easier to supply throughout the multi-decade lifespan of a commercial vaccine. We created modified DNA aptamers against the common vaccine carrier protein, CRM 197 . Several aptamers were discovered and one was chosen for further characterization. The binding kinetics of the aptamer revealed an off-rate 16-fold slower than anti-CRM 197 antibodies used for comparison. The aptamers were more sensitive than available antibodies in some assay formats and comparable in others. The aptamer epitope was mapped to the receptor-binding domain of CRM 197 , a site adjacent to a known antibody binding site. These data address some key aspects for a path forward in replacing antibodies with aptamers for use as critical reagents in vaccine assays. We further highlight the possibility of using nucleic acid reagents to develop next generation potency assays. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. Epigenetic priors for identifying active transcription factor binding sites.

    PubMed

    Cuellar-Partida, Gabriel; Buske, Fabian A; McLeay, Robert C; Whitington, Tom; Noble, William Stafford; Bailey, Timothy L

    2012-01-01

    Accurate knowledge of the genome-wide binding of transcription factors in a particular cell type or under a particular condition is necessary for understanding transcriptional regulation. Using epigenetic data such as histone modification and DNase I, accessibility data has been shown to improve motif-based in silico methods for predicting such binding, but this approach has not yet been fully explored. We describe a probabilistic method for combining one or more tracks of epigenetic data with a standard DNA sequence motif model to improve our ability to identify active transcription factor binding sites (TFBSs). We convert each data type into a position-specific probabilistic prior and combine these priors with a traditional probabilistic motif model to compute a log-posterior odds score. Our experiments, using histone modifications H3K4me1, H3K4me3, H3K9ac and H3K27ac, as well as DNase I sensitivity, show conclusively that the log-posterior odds score consistently outperforms a simple binary filter based on the same data. We also show that our approach performs competitively with a more complex method, CENTIPEDE, and suggest that the relative simplicity of the log-posterior odds scoring method makes it an appealing and very general method for identifying functional TFBSs on the basis of DNA and epigenetic evidence. FIMO, part of the MEME Suite software toolkit, now supports log-posterior odds scoring using position-specific priors for motif search. A web server and source code are available at http://meme.nbcr.net. Utilities for creating priors are at http://research.imb.uq.edu.au/t.bailey/SD/Cuellar2011. t.bailey@uq.edu.au Supplementary data are available at Bioinformatics online.

  18. Cross-activating c-Met/β1 integrin complex drives metastasis and invasive resistance in cancer

    PubMed Central

    Jahangiri, Arman; Nguyen, Alan; Sidorov, Maxim K.; Yagnik, Garima; Rick, Jonathan; Han, Sung Won; Chen, William; Flanigan, Patrick M.; Schneidman-Duhovny, Dina; Mascharak, Smita; De Lay, Michael; Imber, Brandon; Park, Catherine C.; Matsumoto, Kunio; Lu, Kan; Bergers, Gabriele; Sali, Andrej; Weiss, William A.

    2017-01-01

    The molecular underpinnings of invasion, a hallmark of cancer, have been defined in terms of individual mediators but crucial interactions between these mediators remain undefined. In xenograft models and patient specimens, we identified a c-Met/β1 integrin complex that formed during significant invasive oncologic processes: breast cancer metastases and glioblastoma invasive resistance to antiangiogenic VEGF neutralizing antibody, bevacizumab. Inducing c-Met/β1 complex formation through an engineered inducible heterodimerization system promoted features crucial to overcoming stressors during metastases or antiangiogenic therapy: migration in the primary site, survival under hypoxia, and extravasation out of circulation. c-Met/β1 complex formation was up-regulated by hypoxia, while VEGF binding VEGFR2 sequestered c-Met and β1 integrin, preventing their binding. Complex formation promoted ligand-independent receptor activation, with integrin-linked kinase phosphorylating c-Met and crystallography revealing the c-Met/β1 complex to maintain the high-affinity β1 integrin conformation. Site-directed mutagenesis verified the necessity for c-Met/β1 binding of amino acids predicted by crystallography to mediate their extracellular interaction. Far-Western blotting and sequential immunoprecipitation revealed that c-Met displaced α5 integrin from β1 integrin, creating a complex with much greater affinity for fibronectin (FN) than α5β1. Thus, tumor cells adapt to microenvironmental stressors induced by metastases or bevacizumab by coopting receptors, which normally promote both cell migration modes: chemotaxis, movement toward concentrations of environmental chemoattractants, and haptotaxis, movement controlled by the relative strengths of peripheral adhesions. Tumor cells then redirect these receptors away from their conventional binding partners, forming a powerful structural c-Met/β1 complex whose ligand-independent cross-activation and robust affinity for FN drive invasive oncologic processes. PMID:28973887

  19. Rate constants for proteins binding to substrates with multiple binding sites using a generalized forward flux sampling expression

    NASA Astrophysics Data System (ADS)

    Vijaykumar, Adithya; ten Wolde, Pieter Rein; Bolhuis, Peter G.

    2018-03-01

    To predict the response of a biochemical system, knowledge of the intrinsic and effective rate constants of proteins is crucial. The experimentally accessible effective rate constant for association can be decomposed in a diffusion-limited rate at which proteins come into contact and an intrinsic association rate at which the proteins in contact truly bind. Reversely, when dissociating, bound proteins first separate into a contact pair with an intrinsic dissociation rate, before moving away by diffusion. While microscopic expressions exist that enable the calculation of the intrinsic and effective rate constants by conducting a single rare event simulation of the protein dissociation reaction, these expressions are only valid when the substrate has just one binding site. If the substrate has multiple binding sites, a bound enzyme can, besides dissociating into the bulk, also hop to another binding site. Calculating transition rate constants between multiple states with forward flux sampling requires a generalized rate expression. We present this expression here and use it to derive explicit expressions for all intrinsic and effective rate constants involving binding to multiple states, including rebinding. We illustrate our approach by computing the intrinsic and effective association, dissociation, and hopping rate constants for a system in which a patchy particle model enzyme binds to a substrate with two binding sites. We find that these rate constants increase as a function of the rotational diffusion constant of the particles. The hopping rate constant decreases as a function of the distance between the binding sites. Finally, we find that blocking one of the binding sites enhances both association and dissociation rate constants. Our approach and results are important for understanding and modeling association reactions in enzyme-substrate systems and other patchy particle systems and open the way for large multiscale simulations of such systems.

  20. Symmetry of Fv architecture is conducive to grafting a second antibody binding site in the Fv region.

    PubMed Central

    Keck, P C; Huston, J S

    1996-01-01

    Molecular modeling studies on antibody Fv regions have been pursued to design a second antigen-binding site (chi-site) in a chimeric single-chain Fv (chi sFv) species of about 30 kDa. This analysis has uncovered an architectural basis common to many Fv regions that permits grafting a chi-site onto the Fv surface that diametrically opposes the normal combining site. By using molecular graphics analysis, chimeric complementarity-determining regions (chi CDRs) were defined that comprised most of the CDRs from an antibody binding site of interest. The chain directionality of chi CDRs was consistent with that of specific bottom loops of the sFv, which allowed for grafting of chi CDRs with an overall geometry approximating CDRs in the parent combining site. Analysis of 10 different Fv crystal structures indicates that the positions for inserting chi CDRs are very highly conserved, as are the corresponding chi CDR boundaries in the parent binding site. The results of this investigation suggest that it should be possible to generally apply this approach to the development of chimeric bispecific antibody binding site (chi BABS) proteins. Images FIGURE 2 FIGURE 3 PMID:8889174

  1. Deciphering common recognition principles of nucleoside mono/di and tri-phosphates binding in diverse proteins via structural matching of their binding sites.

    PubMed

    Bhagavat, Raghu; Srinivasan, Narayanaswamy; Chandra, Nagasuma

    2017-09-01

    Nucleoside triphosphate (NTP) ligands are of high biological importance and are essential for all life forms. A pre-requisite for them to participate in diverse biochemical processes is their recognition by diverse proteins. It is thus of great interest to understand the basis for such recognition in different proteins. Towards this, we have used a structural bioinformatics approach and analyze structures of 4677 NTP complexes available in Protein Data Bank (PDB). Binding sites were extracted and compared exhaustively using PocketMatch, a sensitive in-house site comparison algorithm, which resulted in grouping the entire dataset into 27 site-types. Each of these site-types represent a structural motif comprised of two or more residue conservations, derived using another in-house tool for superposing binding sites, PocketAlign. The 27 site-types could be grouped further into 9 super-types by considering partial similarities in the sites, which indicated that the individual site-types comprise different combinations of one or more site features. A scan across PDB using the 27 structural motifs determined the motifs to be specific to NTP binding sites, and a computational alanine mutagenesis indicated that residues identified to be highly conserved in the motifs are also most contributing to binding. Alternate orientations of the ligand in several site-types were observed and rationalized, indicating the possibility of some residues serving as anchors for NTP recognition. The presence of multiple site-types and the grouping of multiple folds into each site-type is strongly suggestive of convergent evolution. Knowledge of determinants obtained from this study will be useful for detecting function in unknown proteins. Proteins 2017; 85:1699-1712. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  2. Catalytic site interactions in yeast OMP synthase.

    PubMed

    Hansen, Michael Riis; Barr, Eric W; Jensen, Kaj Frank; Willemoës, Martin; Grubmeyer, Charles; Winther, Jakob R

    2014-01-15

    The enigmatic kinetics, half-of-the-sites binding, and structural asymmetry of the homodimeric microbial OMP synthases (orotate phosphoribosyltransferase, EC 2.4.2.10) have been proposed to result from an alternating site mechanism in these domain-swapped enzymes [R.W. McClard et al., Biochemistry 45 (2006) 5330-5342]. This behavior was investigated in the yeast enzyme by mutations in the conserved catalytic loop and 5-phosphoribosyl-1-diphosphate (PRPP) binding motif. Although the reaction is mechanistically sequential, the wild-type (WT) enzyme shows parallel lines in double reciprocal initial velocity plots. Replacement of Lys106, the postulated intersubunit communication device, produced intersecting lines in kinetic plots with a 2-fold reduction of kcat. Loop (R105G K109S H111G) and PRPP-binding motif (D131N D132N) mutant proteins, each without detectable enzymatic activity and ablated ability to bind PRPP, complemented to produce a heterodimer with a single fully functional active site showing intersecting initial velocity plots. Equilibrium binding of PRPP and orotidine 5'-monophosphate showed a single class of two binding sites per dimer in WT and K106S enzymes. Evidence here shows that the enzyme does not follow half-of-the-sites cooperativity; that interplay between catalytic sites is not an essential feature of the catalytic mechanism; and that parallel lines in steady-state kinetics probably arise from tight substrate binding. Copyright © 2013. Published by Elsevier Inc.

  3. Characterization of local polarity and hydrophobic binding sites of beta-lactoglobulin by using N-terminal specific fluorescence labeling.

    PubMed

    Dong, Su-Ying; Zhao, Zhen-Wen; Ma, Hui-Min

    2006-01-01

    Because of wide ligand-binding ability and significant industrial interest of beta-lactoglobulin (beta-LG), its binding properties have been extensively studied. However, there still exists a controversy as to where a ligand binds, since at least two potential hydrophobic binding sites in beta-LG have been postulated for ligand binding: an internal one (calyx) and an external one (near the N-terminus). In this work, the local polarity and hydrophobic binding sites of beta-LG have been characterized by using N-terminal specific fluorescence labeling combined with a polarity-sensitive fluorescent probe 3-(4-chloro-6-hydrazino- 1,3,5-triazinylamino)-7-(dimethylamino)-2-methylphenazine (CHTDP). The polarity within the calyx is found to be extremely low, which is explained in terms of superhydrophobicity possibly resulting from its nanostructure, and the polarity is increased with the destruction of the calyx by heat treatment. However, the polarity of the N-terminal domain in native beta-LG is decreased after thermal denaturation. This polarity trend toward decreasing instead of increasing shows that beta-LG may have no definite external hydrophobic binding site. The hydrophobic binding of a ligand such as CHTDP at the surface of the protein is probably achieved via appropriate assembling of corresponding hydrophobic residues rather than via a fixed external hydrophobic binding site. Also, the ligand-binding location in beta-LG is found to be relevant to not only experimental conditions (pH < or = 6.2 or pH > 7.1) but also binding mechanisms (hydrophobic affinity or electrostatic interaction).

  4. Mesophilic and hyperthermophilic adenylate kinases differ in their tolerance to random fragmentation.

    PubMed

    Segall-Shapiro, Thomas H; Nguyen, Peter Q; Dos Santos, Edgardo D; Subedi, Saurav; Judd, Justin; Suh, Junghae; Silberg, Jonathan J

    2011-02-11

    The extent to which thermostability influences the location of protein fragmentation sites that allow retention of function is not known. To evaluate this, we used a novel transposase-based approach to create libraries of vectors that express structurally-related fragments of Bacillus subtilis adenylate kinase (BsAK) and Thermotoga neapolitana adenylate kinase (TnAK) with identical modifications at their termini, and we selected for variants in each library that complement the growth of Escherichia coli with a temperature-sensitive adenylate kinase (AK). Mutants created using the hyperthermophilic TnAK were found to support growth with a higher frequency (44%) than those generated from the mesophilic BsAK (6%), and selected TnAK mutants complemented E. coli growth more strongly than homologous BsAK variants. Sequencing of functional clones from each library also identified a greater dispersion of fragmentation sites within TnAK. Nondisruptive fission sites were observed within the AMP binding and core domains of both AK homologs. However, only TnAK contained sites within the lid domain, which undergoes dynamic fluctuations that are critical for catalysis. These findings implicate the flexible lid domain as having an increased sensitivity to fission events at physiological temperatures. In addition, they provide evidence that comparisons of nondisruptive fission sites in homologous proteins could be useful for finding dynamic regions whose conformational fluctuations are important for function, and they show that the discovery of protein fragments that cooperatively function in mesophiles can be aided by the use of thermophilic enzymes as starting points for protein design. Copyright © 2010 Elsevier Ltd. All rights reserved.

  5. Biochemical study of prolactin binding sites in Xenopus laevis brain and choroid plexus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Muccioli, G.; Guardabassi, A.; Pattono, P.

    1990-03-01

    The occurrence of prolactin binding sites in some brain structures (telencephalon, ventral hypothalamus, myelencephalon, hypophysis, and choroid plexus) from Xenopus laevis (anuran amphibian) was studied by the in vitro biochemical technique. The higher binding values were obtained at the level of the choroid plexus and above all of the hypothalamus. On the bases of hormonal specificity and high affinity, these binding sites are very similar to those of prolactin receptors of classical target tissues as well as of those described by us in other structures from Xenopus. To our knowledge, the present results provide the first demonstration of the occurrencemore » of prolactin specific binding sites in Xenopus laevis choroid plexus cells.« less

  6. Study of DNA binding sites using the Rényi parametric entropy measure.

    PubMed

    Krishnamachari, A; moy Mandal, Vijnan; Karmeshu

    2004-04-07

    Shannon's definition of uncertainty or surprisal has been applied extensively to measure the information content of aligned DNA sequences and characterizing DNA binding sites. In contrast to Shannon's uncertainty, this study investigates the applicability and suitability of a parametric uncertainty measure due to Rényi. It is observed that this measure also provides results in agreement with Shannon's measure, pointing to its utility in analysing DNA binding site region. For facilitating the comparison between these uncertainty measures, a dimensionless quantity called "redundancy" has been employed. It is found that Rényi's measure at low parameter values possess a better delineating feature of binding sites (of binding regions) than Shannon's measure. The critical value of the parameter is chosen with an outlier criterion.

  7. The loss of Cbl-phosphatidylinositol 3-kinase interaction perturbs RANKL-mediated signaling, inhibiting bone resorption and promoting osteoclast survival.

    PubMed

    Adapala, Naga Suresh; Barbe, Mary F; Langdon, Wallace Y; Nakamura, Mary C; Tsygankov, Alexander Y; Sanjay, Archana

    2010-11-19

    Cbl is an adaptor protein and an E3 ligase that plays both positive and negative roles in several signaling pathways that affect various cellular functions. Tyrosine 737 is unique to Cbl and is phosphorylated by Syk and Src family kinases. Phosphorylated Cbl Tyr(737) creates a binding site for the p85 regulatory subunit of PI3K, which also plays an important role in the regulation of bone resorption by osteoclasts. To investigate the role of Cbl-PI3K interaction in bone homeostasis, we examined the knock-in mice (Cbl(YF/YF)) in which the PI3K binding site in Cbl is ablated due to the mutation in the regulatory tyrosine. We report that in Cbl(YF/YF) mice, despite increased numbers of osteoclasts, bone volume is increased due to defective osteoclast function. Additionally, in ex vivo cultures, mature Cbl(YF/YF) osteoclasts showed an increased ability to survive in the presence of RANKL due to delayed onset of apoptosis. RANKL-mediated signaling is perturbed in Cbl(YF/YF) osteoclasts, and most interestingly, AKT phosphorylation is up-regulated, suggesting that the lack of PI3K sequestration by Cbl results in increased survival and decreased bone resorption. Cumulatively, these in vivo and in vitro results show that, on one hand, binding of Cbl to PI3K negatively regulates osteoclast differentiation, survival, and signaling events (e.g. AKT phosphorylation), whereas on the other hand it positively influences osteoclast function.

  8. SITEHOUND-web: a server for ligand binding site identification in protein structures.

    PubMed

    Hernandez, Marylens; Ghersi, Dario; Sanchez, Roberto

    2009-07-01

    SITEHOUND-web (http://sitehound.sanchezlab.org) is a binding-site identification server powered by the SITEHOUND program. Given a protein structure in PDB format SITEHOUND-web will identify regions of the protein characterized by favorable interactions with a probe molecule. These regions correspond to putative ligand binding sites. Depending on the probe used in the calculation, sites with preference for different ligands will be identified. Currently, a carbon probe for identification of binding sites for drug-like molecules, and a phosphate probe for phosphorylated ligands (ATP, phoshopeptides, etc.) have been implemented. SITEHOUND-web will display the results in HTML pages including an interactive 3D representation of the protein structure and the putative sites using the Jmol java applet. Various downloadable data files are also provided for offline data analysis.

  9. Common Anesthetic-binding Site for Inhibition of Pentameric Ligand-gated Ion Channels.

    PubMed

    Kinde, Monica N; Bu, Weiming; Chen, Qiang; Xu, Yan; Eckenhoff, Roderic G; Tang, Pei

    2016-03-01

    Identifying functionally relevant anesthetic-binding sites in pentameric ligand-gated ion channels (pLGICs) is an important step toward understanding the molecular mechanisms underlying anesthetic action. The anesthetic propofol is known to inhibit cation-conducting pLGICs, including a prokaryotic pLGIC from Erwinia chrysanthemi (ELIC), but the sites responsible for functional inhibition remain undetermined. We photolabeled ELIC with a light-activated derivative of propofol (AziPm) and performed fluorine-19 nuclear magnetic resonance experiments to support propofol binding to a transmembrane domain (TMD) intrasubunit pocket. To differentiate sites responsible for propofol inhibition from those that are functionally irrelevant, we made an ELIC-γ-aminobutyric acid receptor (GABAAR) chimera that replaced the ELIC-TMD with the α1β3GABAAR-TMD and compared functional responses of ELIC-GABAAR and ELIC with propofol modulations. Photolabeling showed multiple AziPm-binding sites in the extracellular domain (ECD) but only one site in the TMD with labeled residues M265 and F308 in the resting state of ELIC. Notably, this TMD site is an intrasubunit pocket that overlaps with binding sites for anesthetics, including propofol, found previously in other pLGICs. Fluorine-19 nuclear magnetic resonance experiments supported propofol binding to this TMD intrasubunit pocket only in the absence of agonist. Functional measurements of ELIC-GABAAR showed propofol potentiation of the agonist-elicited current instead of inhibition observed on ELIC. The distinctly different responses of ELIC and ELIC-GABAAR to propofol support the functional relevance of propofol binding to the TMD. Combining the newly identified TMD intrasubunit pocket in ELIC with equivalent TMD anesthetic sites found previously in other cationic pLGICs, we propose this TMD pocket as a common site for anesthetic inhibition of pLGICs.

  10. Multiple binding sites involved in the effect of choline esters on decarbamoylation of monomethylcarbamoyl- or dimethylcarbamoly-acetylcholinesterase.

    PubMed Central

    Sok, D E; Kim, Y B; Choi, S J; Jung, C H; Cha, S H

    1994-01-01

    Multiple binding sites for inhibitory choline esters in spontaneous decarbamoylation of dimethylcarbamoyl-acetylcholinesterase (AChE) were suggested from a wide range of IC50 values, in contrast with a limited range of AC50 values (concentration giving 50% of maximal activation) at a peripheral activatory site. Association of choline esters containing a long acyl chain (C7-C12) with the hydrophobic zone in the active site could be deduced from a linear relationship between the size of the acyl group and the inhibitory potency in either spontaneous decarbamoylation or acetylthiocholine hydrolysis. Direct support for laurylcholine binding to the active site might come from the competitive inhibition (Ki 33 microM) of choline-catalysed decarbamoylation by laurylcholine. Moreover, its inhibitory action was greater for monomethylcarbamoyl-AChE than for dimethylcarbamoyl-AChE, where there is a greater steric hindrance at the active centre. In further support, the inhibition of pentanoylthiocholine-induced decarbamoylation by laurylcholine was suggested to be due to laurylcholine binding to a central site rather than a peripheral site, similar to the inhibition of spontaneous decarbamoylation by laurylcholine. Supportive data for acetylcholine binding to the active site are provided by the results that acetylcholine is a competitive inhibitor (Ki 7.6 mM) of choline-catalysed decarbamoylation, and its inhibitory action was greater for monomethylcarbamoyl-AChE than for dimethylcarbamoyl-AChE. Meanwhile, choline esters with an acyl group of an intermediate size (C4-C6), more subject to steric exclusion at the active centre, and less associable with the hydrophobic zone, appear to bind preferentially to a peripheral activity site. Thus the multiple effects of choline esters may be governed by hydrophobicity and/or a steric effect exerted by the acyl moiety at the binding sites. PMID:8053896

  11. Binding site and affinity prediction of general anesthetics to protein targets using docking.

    PubMed

    Liu, Renyu; Perez-Aguilar, Jose Manuel; Liang, David; Saven, Jeffery G

    2012-05-01

    The protein targets for general anesthetics remain unclear. A tool to predict anesthetic binding for potential binding targets is needed. In this study, we explored whether a computational method, AutoDock, could serve as such a tool. High-resolution crystal data of water-soluble proteins (cytochrome C, apoferritin, and human serum albumin), and a membrane protein (a pentameric ligand-gated ion channel from Gloeobacter violaceus [GLIC]) were used. Isothermal titration calorimetry (ITC) experiments were performed to determine anesthetic affinity in solution conditions for apoferritin. Docking calculations were performed using DockingServer with the Lamarckian genetic algorithm and the Solis and Wets local search method (http://www.dockingserver.com/web). Twenty general anesthetics were docked into apoferritin. The predicted binding constants were compared with those obtained from ITC experiments for potential correlations. In the case of apoferritin, details of the binding site and their interactions were compared with recent cocrystallization data. Docking calculations for 6 general anesthetics currently used in clinical settings (isoflurane, sevoflurane, desflurane, halothane, propofol, and etomidate) with known 50% effective concentration (EC(50)) values were also performed in all tested proteins. The binding constants derived from docking experiments were compared with known EC(50) values and octanol/water partition coefficients for the 6 general anesthetics. All 20 general anesthetics docked unambiguously into the anesthetic binding site identified in the crystal structure of apoferritin. The binding constants for 20 anesthetics obtained from the docking calculations correlate significantly with those obtained from ITC experiments (P = 0.04). In the case of GLIC, the identified anesthetic binding sites in the crystal structure are among the docking predicted binding sites, but not the top ranked site. Docking calculations suggest a most probable binding site located in the extracellular domain of GLIC. The predicted affinities correlated significantly with the known EC(50) values for the 6 frequently used anesthetics in GLIC for the site identified in the experimental crystal data (P = 0.006). However, predicted affinities in apoferritin, human serum albumin, and cytochrome C did not correlate with these 6 anesthetics' known experimental EC(50) values. A weak correlation between the predicted affinities and the octanol/water partition coefficients was observed for the sites in GLIC. We demonstrated that anesthetic binding sites and relative affinities can be predicted using docking calculations in an automatic docking server (AutoDock) for both water-soluble and membrane proteins. Correlation of predicted affinity and EC(50) for 6 frequently used general anesthetics was only observed in GLIC, a member of a protein family relevant to anesthetic mechanism.

  12. Binding Site and Affinity Prediction of General Anesthetics to Protein Targets Using Docking

    PubMed Central

    Liu, Renyu; Perez-Aguilar, Jose Manuel; Liang, David; Saven, Jeffery G.

    2012-01-01

    Background The protein targets for general anesthetics remain unclear. A tool to predict anesthetic binding for potential binding targets is needed. In this study, we explore whether a computational method, AutoDock, could serve as such a tool. Methods High-resolution crystal data of water soluble proteins (cytochrome C, apoferritin and human serum albumin), and a membrane protein (a pentameric ligand-gated ion channel from Gloeobacter violaceus, GLIC) were used. Isothermal titration calorimetry (ITC) experiments were performed to determine anesthetic affinity in solution conditions for apoferritin. Docking calculations were performed using DockingServer with the Lamarckian genetic algorithm and the Solis and Wets local search method (https://www.dockingserver.com/web). Twenty general anesthetics were docked into apoferritin. The predicted binding constants are compared with those obtained from ITC experiments for potential correlations. In the case of apoferritin, details of the binding site and their interactions were compared with recent co-crystallization data. Docking calculations for six general anesthetics currently used in clinical settings (isoflurane, sevoflurane, desflurane, halothane, propofol, and etomidate) with known EC50 were also performed in all tested proteins. The binding constants derived from docking experiments were compared with known EC50s and octanol/water partition coefficients for the six general anesthetics. Results All 20 general anesthetics docked unambiguously into the anesthetic binding site identified in the crystal structure of apoferritin. The binding constants for 20 anesthetics obtained from the docking calculations correlate significantly with those obtained from ITC experiments (p=0.04). In the case of GLIC, the identified anesthetic binding sites in the crystal structure are among the docking predicted binding sites, but not the top ranked site. Docking calculations suggest a most probable binding site located in the extracellular domain of GLIC. The predicted affinities correlated significantly with the known EC50s for the six commonly used anesthetics in GLIC for the site identified in the experimental crystal data (p=0.006). However, predicted affinities in apoferritin, human serum albumin, and cytochrome C did not correlate with these six anesthetics’ known experimental EC50s. A weak correlation between the predicted affinities and the octanol/water partition coefficients was observed for the sites in GLIC. Conclusion We demonstrated that anesthetic binding sites and relative affinities can be predicted using docking calculations in an automatic docking server (Autodock) for both water soluble and membrane proteins. Correlation of predicted affinity and EC50 for six commonly used general anesthetics was only observed in GLIC, a member of a protein family relevant to anesthetic mechanism. PMID:22392968

  13. AutoSite: an automated approach for pseudo-ligands prediction—from ligand-binding sites identification to predicting key ligand atoms

    PubMed Central

    Ravindranath, Pradeep Anand; Sanner, Michel F.

    2016-01-01

    Motivation: The identification of ligand-binding sites from a protein structure facilitates computational drug design and optimization, and protein function assignment. We introduce AutoSite: an efficient software tool for identifying ligand-binding sites and predicting pseudo ligand corresponding to each binding site identified. Binding sites are reported as clusters of 3D points called fills in which every point is labelled as hydrophobic or as hydrogen bond donor or acceptor. From these fills AutoSite derives feature points: a set of putative positions of hydrophobic-, and hydrogen-bond forming ligand atoms. Results: We show that AutoSite identifies ligand-binding sites with higher accuracy than other leading methods, and produces fills that better matches the ligand shape and properties, than the fills obtained with a software program with similar capabilities, AutoLigand. In addition, we demonstrate that for the Astex Diverse Set, the feature points identify 79% of hydrophobic ligand atoms, and 81% and 62% of the hydrogen acceptor and donor hydrogen ligand atoms interacting with the receptor, and predict 81.2% of water molecules mediating interactions between ligand and receptor. Finally, we illustrate potential uses of the predicted feature points in the context of lead optimization in drug discovery projects. Availability and Implementation: http://adfr.scripps.edu/AutoDockFR/autosite.html Contact: sanner@scripps.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:27354702

  14. Characterization of the binding of 8-anilinonaphthalene sulphonate to rat class Mu GST M1-1

    PubMed Central

    Kinsley, Nichole; Sayed, Yasien; Armstrong, Richard N.; Dirr, Heini W.

    2008-01-01

    Molecular docking and ANS-displacement experiments indicated that 8-anilinonaphthalene sulphonate (ANS) binds the hydrophobic site (H-site) in the active site of dimeric class Mu rGST M1-1. The naphthalene moiety provides most of the van der Waals contacts at the ANS-binding interface while the anilino group is able to sample different rotamers. The energetics of ANS binding were studied by isothermal titration calorimetry (ITC) over the temperature range of 5–30 °C. Binding is both enthalpically and entropically driven and displays a stoichiometry of one ANS molecule per subunit (or H-site). ANS binding is linked to the uptake of 0.5 protons at pH 6.5. Enthalpy of binding depends linearly upon temperature yielding a ΔCp of −80 ± 4 cal K−1 mol−1 indicating the burial of solvent-exposed nonpolar surface area upon ANS-protein complex formation. While ion-pair interactions between the sulfonate moiety of ANS and protein cationic groups may be significant for other ANS-binding proteins, the binding of ANS to rGST M1-1 is primarily hydrophobic in origin. The binding properties are compared with those of other GSTs and ANS-binding proteins. PMID:18703268

  15. Convection, diffusion and reaction in a surface-based biosensor: modeling of cooperativity and binding site competition on the surface and in the hydrogel.

    PubMed

    Lebedev, Konstantin; Mafé, Salvador; Stroeve, Pieter

    2006-04-15

    We study theoretically the transport and kinetic processes underlying the operation of a biosensor (particularly the surface plasmon sensor "Biacore") used to study the surface binding kinetics of biomolecules in solution to immobilized receptors. Unlike previous studies, we concentrate mainly on the modeling of system-specific phenomena rather than on the influence of mass transport limitations on the intrinsic kinetic rate constants determined from binding data. In the first problem, the case of two-site binding where each receptor unit on the surface can accommodate two analyte molecules on two different sites is considered. One analyte molecule always binds first to a specific site. Subsequently, the second analyte molecule can bind to the adjacent unoccupied site. In the second problem, two different analytes compete for one binding site on the same surface receptor. Finally, the third problem considers the case of positive cooperativity among bound molecules in the hydrogel using a simple mean-field approach. The transport in both the flow channel and the hydrogel phases of the biosensor is taken into account in this case (with few exceptions, most previous studies assume a simpler model in which the hydrogel is treated as a planar surface with the receptors). We consider simultaneously diffusion and convection through the flow channel together with diffusion and cooperativity binding on the surface and in the hydrogel. In each case, typical results for the concentration contours of the free and bound molecules in the flow channel and hydrogel regions are presented together with the time-dependent association/dissociation curves and reaction rates. For binding site competition, the analysis predicts overshoot phenomena.

  16. A mammary cell-specific enhancer in mouse mammary tumor virus DNA is composed of multiple regulatory elements including binding sites for CTF/NFI and a novel transcription factor, mammary cell-activating factor.

    PubMed Central

    Mink, S; Härtig, E; Jennewein, P; Doppler, W; Cato, A C

    1992-01-01

    Mouse mammary tumor virus (MMTV) is a milk-transmitted retrovirus involved in the neoplastic transformation of mouse mammary gland cells. The expression of this virus is regulated by mammary cell type-specific factors, steroid hormones, and polypeptide growth factors. Sequences for mammary cell-specific expression are located in an enhancer element in the extreme 5' end of the long terminal repeat region of this virus. This enhancer, when cloned in front of the herpes simplex thymidine kinase promoter, endows the promoter with mammary cell-specific response. Using functional and DNA-protein-binding studies with constructs mutated in the MMTV long terminal repeat enhancer, we have identified two main regulatory elements necessary for the mammary cell-specific response. These elements consist of binding sites for a transcription factor in the family of CTF/NFI proteins and the transcription factor mammary cell-activating factor (MAF) that recognizes the sequence G Pu Pu G C/G A A G G/T. Combinations of CTF/NFI- and MAF-binding sites or multiple copies of either one of these binding sites but not solitary binding sites mediate mammary cell-specific expression. The functional activities of these two regulatory elements are enhanced by another factor that binds to the core sequence ACAAAG. Interdigitated binding sites for CTF/NFI, MAF, and/or the ACAAAG factor are also found in the 5' upstream regions of genes encoding whey milk proteins from different species. These findings suggest that mammary cell-specific regulation is achieved by a concerted action of factors binding to multiple regulatory sites. Images PMID:1328867

  17. Caffeine inhibits glucose transport by binding at the GLUT1 nucleotide-binding site

    PubMed Central

    Sage, Jay M.; Cura, Anthony J.; Lloyd, Kenneth P.

    2015-01-01

    Glucose transporter 1 (GLUT1) is the primary glucose transport protein of the cardiovascular system and astroglia. A recent study proposes that caffeine uncompetitive inhibition of GLUT1 results from interactions at an exofacial GLUT1 site. Intracellular ATP is also an uncompetitive GLUT1 inhibitor and shares structural similarities with caffeine, suggesting that caffeine acts at the previously characterized endofacial GLUT1 nucleotide-binding site. We tested this by confirming that caffeine uncompetitively inhibits GLUT1-mediated 3-O-methylglucose uptake in human erythrocytes [Vmax and Km for transport are reduced fourfold; Ki(app) = 3.5 mM caffeine]. ATP and AMP antagonize caffeine inhibition of 3-O-methylglucose uptake in erythrocyte ghosts by increasing Ki(app) for caffeine inhibition of transport from 0.9 ± 0.3 mM in the absence of intracellular nucleotides to 2.6 ± 0.6 and 2.4 ± 0.5 mM in the presence of 5 mM intracellular ATP or AMP, respectively. Extracellular ATP has no effect on sugar uptake or its inhibition by caffeine. Caffeine and ATP displace the fluorescent ATP derivative, trinitrophenyl-ATP, from the GLUT1 nucleotide-binding site, but d-glucose and the transport inhibitor cytochalasin B do not. Caffeine, but not ATP, inhibits cytochalasin B binding to GLUT1. Like ATP, caffeine renders the GLUT1 carboxy-terminus less accessible to peptide-directed antibodies, but cytochalasin B and d-glucose do not. These results suggest that the caffeine-binding site bridges two nonoverlapping GLUT1 endofacial sites—the regulatory, nucleotide-binding site and the cytochalasin B-binding site. Caffeine binding to GLUT1 mimics the action of ATP but not cytochalasin B on sugar transport. Molecular docking studies support this hypothesis. PMID:25715702

  18. Mechanism of human antibody-mediated neutralization of Marburg virus.

    PubMed

    Flyak, Andrew I; Ilinykh, Philipp A; Murin, Charles D; Garron, Tania; Shen, Xiaoli; Fusco, Marnie L; Hashiguchi, Takao; Bornholdt, Zachary A; Slaughter, James C; Sapparapu, Gopal; Klages, Curtis; Ksiazek, Thomas G; Ward, Andrew B; Saphire, Erica Ollmann; Bukreyev, Alexander; Crowe, James E

    2015-02-26

    The mechanisms by which neutralizing antibodies inhibit Marburg virus (MARV) are not known. We isolated a panel of neutralizing antibodies from a human MARV survivor that bind to MARV glycoprotein (GP) and compete for binding to a single major antigenic site. Remarkably, several of the antibodies also bind to Ebola virus (EBOV) GP. Single-particle EM structures of antibody-GP complexes reveal that all of the neutralizing antibodies bind to MARV GP at or near the predicted region of the receptor-binding site. The presence of the glycan cap or mucin-like domain blocks binding of neutralizing antibodies to EBOV GP, but not to MARV GP. The data suggest that MARV-neutralizing antibodies inhibit virus by binding to infectious virions at the exposed MARV receptor-binding site, revealing a mechanism of filovirus inhibition. Copyright © 2015 Elsevier Inc. All rights reserved.

  19. Photoabsorption of acridine yellow and proflavin bound to human serum albumin studied by means of quantum mechanics/molecular dynamics.

    PubMed

    Aidas, Kęstutis; Olsen, Jógvan Magnus H; Kongsted, Jacob; Ågren, Hans

    2013-02-21

    Attempting to unravel mechanisms in optical probing of proteins, we have performed pilot calculations of two cationic chromophores-acridine yellow and proflavin-located at different binding sites within human serum albumin, including the two primary drug binding sites as well as a heme binding site. The computational scheme adopted involves classical molecular dynamics simulations of the ligands bound to the protein and subsequent linear response polarizable embedding density functional theory calculations of the excitation energies. A polarizable embedding potential consisting of point charges fitted to reproduce the electrostatic potential and isotropic atomic polarizabilities computed individually for every residue of the protein was used in the linear response calculations. Comparing the calculated aqueous solution-to-protein shifts of maximum absorption energies to available experimental data, we concluded that the cationic proflavin chromophore is likely not to bind albumin at its drug binding site 1 nor at its heme binding site. Although agreement with experimental data could only be obtained in qualitative terms, our results clearly indicate that the difference in optical response of the two probes is due to deprotonation, and not, as earlier suggested, to different binding sites. The ramifications of this finding for design of molecular probes targeting albumin or other proteins is briefly discussed.

  20. Autoradiographic localization of /sup 3/H-paroxetine-labeled serotonin uptake sites in rat brain

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    De Souza, E.B.; Kuyatt, B.L.

    1987-01-01

    Paroxetine is a potent and selective inhibitor of serotonin uptake into neurons. Serotonin uptake sites have been identified, localized, and quantified in rat brain by autoradiography with 3H-paroxetine; 3H-paroxetine binding in slide-mounted sections of rat forebrain was of high affinity (KD = 10 pM) and the inhibition affinity constant (Ki) values of various drugs in competing 3H-paroxetine binding significantly correlated with their reported potencies in inhibiting synaptosomal serotonin uptake. Serotonin uptake sites labeled by 3H-paroxetine were highly concentrated in the dorsal and median raphe nuclei, central gray, superficial layer of the superior colliculus, lateral septal nucleus, paraventricular nucleus of themore » thalamus, and the islands of Calleja. High concentrations of 3H-paroxetine binding sites were found in brainstem areas containing dopamine (substantia nigra and ventral tegmental area) and norepinephrine (locus coeruleus) cell bodies. Moderate concentrations of 3H-paroxetine binding sites were present in laminae I and IV of the frontal parietal cortex, primary olfactory cortex, olfactory tubercle, regions of the basal ganglia, septum, amygdala, thalamus, hypothalamus, hippocampus, and some brainstem areas including the interpeduncular, trigeminal, and parabrachial nuclei. Lower densities of 3H-paroxetine binding sites were found in other regions of the neocortex and very low to nonsignificant levels of binding were present in white matter tracts and in the cerebellum. Lesioning of serotonin neurons with 3,4-methylenedioxyamphetamine caused large decreases in 3H-paroxetine binding. The autoradiographic distribution of 3H-paroxetine binding sites in rat brain corresponds extremely well to the distribution of serotonin terminals and cell bodies as well as with the pharmacological sites of action of serotonin.« less

Top