Science.gov

Sample records for cronbach alpha coefficient

  1. The Impact of Outliers on Cronbach's Coefficient Alpha Estimate of Reliability: Visual Analogue Scales

    ERIC Educational Resources Information Center

    Liu, Yan; Zumbo, Bruno D.

    2007-01-01

    The impact of outliers on Cronbach's coefficient [alpha] has not been documented in the psychometric or statistical literature. This is an important gap because coefficient [alpha] is the most widely used measurement statistic in all of the social, educational, and health sciences. The impact of outliers on coefficient [alpha] is investigated for…

  2. Bayesian Meta-Analysis of Cronbach's Coefficient Alpha to Evaluate Informative Hypotheses

    ERIC Educational Resources Information Center

    Okada, Kensuke

    2015-01-01

    This paper proposes a new method to evaluate informative hypotheses for meta-analysis of Cronbach's coefficient alpha using a Bayesian approach. The coefficient alpha is one of the most widely used reliability indices. In meta-analyses of reliability, researchers typically form specific informative hypotheses beforehand, such as "alpha of…

  3. Creating comparability among reliability coefficients: the case of Cronbach alpha and Cohen kappa.

    PubMed

    Becker, G

    2000-12-01

    Cronbach alpha and Cohen kappa were compared and found to differ along two major facets. A fourfold classification system based on these facets clarifies the double contrast and produces a common metric allowing direct comparability. A new estimator, coefficient beta, is introduced in the process and is presented as a complement to coefficient alpha in estimating the psychometric properties of test scores and ratings.

  4. A U-statistics-based approach for modeling Cronbach coefficient alpha within a longitudinal data setting.

    PubMed

    Yan, Ma; Alejandro, Gonzalez Della Valle; Hui, Zhang; Tu, X M

    2010-03-15

    Cronbach coefficient alpha (CCA) is a classic measure of item internal consistency of an instrument and is used in a wide range of behavioral, biomedical, psychosocial, and health-care-related research. Methods are available for making inference about one CCA or multiple CCAs from correlated outcomes. However, none of the existing approaches effectively address missing data. As longitudinal study designs become increasingly popular and complex in modern-day clinical studies, missing data have become a serious issue, and the lack of methods to systematically address this problem has hampered the progress of research in the aforementioned fields. In this paper, we develop a novel approach to tackle the complexities involved in addressing missing data (at the instrument level due to subject dropout) within a longitudinal data setting. The approach is illustrated with both clinical and simulated data.

  5. The Impact of Outliers on Cronbach's Coefficient Alpha Estimate of Reliability: Ordinal/Rating Scale Item Responses

    ERIC Educational Resources Information Center

    Liu, Yan; Wu, Amery D.; Zumbo, Bruno D.

    2010-01-01

    In a recent Monte Carlo simulation study, Liu and Zumbo showed that outliers can severely inflate the estimates of Cronbach's coefficient alpha for continuous item response data--visual analogue response format. Little, however, is known about the effect of outliers for ordinal item response data--also commonly referred to as Likert, Likert-type,…

  6. Minimum Sample Size for Cronbach's Coefficient Alpha: A Monte-Carlo Study

    ERIC Educational Resources Information Center

    Yurdugul, Halil

    2008-01-01

    The coefficient alpha is the most widely used measure of internal consistency for composite scores in the educational and psychological studies. However, due to the difficulties of data gathering in psychometric studies, the minimum sample size for the sample coefficient alpha has been frequently debated. There are various suggested minimum sample…

  7. Understanding a Widely Misunderstood Statistic: Cronbach's "Alpha"

    ERIC Educational Resources Information Center

    Ritter, Nicola L.

    2010-01-01

    It is important to explore score reliability in virtually all studies, because tests are not reliable. The present paper explains the most frequently used reliability estimate, coefficient alpha, so that the coefficient's conceptual underpinnings will be understood. Researchers need to understand score reliability because of the possible impact…

  8. Best Alternatives to Cronbach's Alpha Reliability in Realistic Conditions: Congeneric and Asymmetrical Measurements

    PubMed Central

    Trizano-Hermosilla, Italo; Alvarado, Jesús M.

    2016-01-01

    The Cronbach's alpha is the most widely used method for estimating internal consistency reliability. This procedure has proved very resistant to the passage of time, even if its limitations are well documented and although there are better options as omega coefficient or the different versions of glb, with obvious advantages especially for applied research in which the ítems differ in quality or have skewed distributions. In this paper, using Monte Carlo simulation, the performance of these reliability coefficients under a one-dimensional model is evaluated in terms of skewness and no tau-equivalence. The results show that omega coefficient is always better choice than alpha and in the presence of skew items is preferable to use omega and glb coefficients even in small samples. PMID:27303333

  9. Note on Two Generalizations of Coefficient Alpha.

    ERIC Educational Resources Information Center

    Raju, Nambury S.

    1979-01-01

    An important relationship is given for two generalizations of coefficient alpha: (1) Rajaratnam, Cronbach, and Gleser's generalizability formula for stratified-parallel tests, and (2) Raju's coefficient beta. (Author/CTM)

  10. On the Use, the Misuse, and the Very Limited Usefulness of Cronbach's Alpha

    ERIC Educational Resources Information Center

    Sijtsma, Klaas

    2009-01-01

    This discussion paper argues that both the use of Cronbach's alpha as a reliability estimate and as a measure of internal consistency suffer from major problems. First, alpha always has a value, which cannot be equal to the test score's reliability given the inter-item covariance matrix and the usual assumptions about measurement error. Second, in…

  11. Cronbach's [Alpha], Revelle's [Beta], and McDonald's [Omega][sub H]: Their Relations with Each Other and Two Alternative Conceptualizations of Reliability

    ERIC Educational Resources Information Center

    Zinbarg, Richard E.; Revelle, William; Yovel, Iftah; Li, Wen

    2005-01-01

    We make theoretical comparisons among five coefficients--Cronbach's [alpha], Revelle's [beta], McDonald's [omega][sub h], and two alternative conceptualizations of reliability. Though many end users and psychometricians alike may not distinguish among these five coefficients, we demonstrate formally their nonequivalence. Specifically, whereas…

  12. Treating Cronbach's Alpha Reliability Coefficients as Data in Counseling Research

    ERIC Educational Resources Information Center

    Helms, Janet E.; Henze, Kevin T.; Sass, Terry L.; Mifsud, Venus A.

    2006-01-01

    Scientific associations and measurement experts in psychology and education have voiced various standards and best-practice recommendations concerning reliability data over the years. Yet in the counseling psychology literature, there is virtually no single-source compilation and articulation of good practices for reporting, analyzing, and…

  13. Factors Affecting Coefficient Alpha: A Mini Monte Carlo Study.

    ERIC Educational Resources Information Center

    Reinhardt, Brian M.

    Factors affecting a lower-bound estimate of internal consistency reliability, Cronbach's coefficient alpha, are explored. Theoretically, coefficient alpha is an estimate of the correlation between two tests drawn at random from a pool of items like the items in the test under consideration. As a practical matter, coefficient alpha can be an index…

  14. Coefficient alpha and interculture test selection.

    PubMed

    Thurber, Steven; Kishi, Yasuhiro

    2014-04-01

    The internal consistency reliability of a measure can be a focal point in an evaluation of the potential adequacy of an instrument for adaptation to another cultural setting. Cronbach's alpha (α) coefficient is often used as the statistical index for such a determination. However, alpha presumes a tau-equivalent test and may constitute an inaccurate population estimate for multidimensional tests. These notions are expanded and examined with a Japanese version of a questionnaire on nursing attitudes toward suicidal patients, originally constructed in Sweden using the English language. The English measure was reported to have acceptable internal consistency (α) albeit the dimensionality of the questionnaire was not addressed. The Japanese scale was found to lack tau-equivalence. An alternative to alpha, "composite reliability," was computed and found to be below acceptable standards in magnitude and precision. Implications for research application of the Japanese instrument are discussed. PMID:22523134

  15. Coefficient Alpha: A Reliability Coefficient for the 21st Century?

    ERIC Educational Resources Information Center

    Yang, Yanyun; Green, Samuel B.

    2011-01-01

    Coefficient alpha is almost universally applied to assess reliability of scales in psychology. We argue that researchers should consider alternatives to coefficient alpha. Our preference is for structural equation modeling (SEM) estimates of reliability because they are informative and allow for an empirical evaluation of the assumptions…

  16. A Direct Latent Variable Modeling Based Method for Point and Interval Estimation of Coefficient Alpha

    ERIC Educational Resources Information Center

    Raykov, Tenko; Marcoulides, George A.

    2015-01-01

    A direct approach to point and interval estimation of Cronbach's coefficient alpha for multiple component measuring instruments is outlined. The procedure is based on a latent variable modeling application with widely circulated software. As a by-product, using sample data the method permits ascertaining whether the population discrepancy…

  17. Commentary on Coefficient Alpha: A Cautionary Tale

    ERIC Educational Resources Information Center

    Green, Samuel B.; Yang, Yanyun

    2009-01-01

    The general use of coefficient alpha to assess reliability should be discouraged on a number of grounds. The assumptions underlying coefficient alpha are unlikely to hold in practice, and violation of these assumptions can result in nontrivial negative or positive bias. Structural equation modeling was discussed as an informative process both to…

  18. Coefficient Alpha Bootstrap Confidence Interval under Nonnormality

    ERIC Educational Resources Information Center

    Padilla, Miguel A.; Divers, Jasmin; Newton, Matthew

    2012-01-01

    Three different bootstrap methods for estimating confidence intervals (CIs) for coefficient alpha were investigated. In addition, the bootstrap methods were compared with the most promising coefficient alpha CI estimation methods reported in the literature. The CI methods were assessed through a Monte Carlo simulation utilizing conditions…

  19. Robust Coefficients Alpha and Omega and Confidence Intervals with Outlying Observations and Missing Data: Methods and Software

    ERIC Educational Resources Information Center

    Zhang, Zhiyong; Yuan, Ke-Hai

    2016-01-01

    Cronbach's coefficient alpha is a widely used reliability measure in social, behavioral, and education sciences. It is reported in nearly every study that involves measuring a construct through multiple items. With non-tau-equivalent items, McDonald's omega has been used as a popular alternative to alpha in the literature. Traditional estimation…

  20. Coefficient Alpha and Reliability of Scale Scores

    ERIC Educational Resources Information Center

    Almehrizi, Rashid S.

    2013-01-01

    The majority of large-scale assessments develop various score scales that are either linear or nonlinear transformations of raw scores for better interpretations and uses of assessment results. The current formula for coefficient alpha (a; the commonly used reliability coefficient) only provides internal consistency reliability estimates of raw…

  1. A Clarification of the Effects of Rapid Guessing on Coefficient [Alpha]: A Note on Attali's "Reliability of Speeded Number-Right Multiple-Choice Tests"

    ERIC Educational Resources Information Center

    Wise, Steven L.; DeMars, Christine E.

    2009-01-01

    Attali (2005) recently demonstrated that Cronbach's coefficient [alpha] estimate of reliability for number-right multiple-choice tests will tend to be deflated by speededness, rather than inflated as is commonly believed and taught. Although the methods, findings, and conclusions of Attali (2005) are correct, his article may inadvertently invite a…

  2. Evaluation of Dimensionality in the Assessment of Internal Consistency Reliability: Coefficient Alpha and Omega Coefficients

    ERIC Educational Resources Information Center

    Green, Samuel B.; Yang, Yanyun

    2015-01-01

    In the lead article, Davenport, Davison, Liou, & Love demonstrate the relationship among homogeneity, internal consistency, and coefficient alpha, and also distinguish among them. These distinctions are important because too often coefficient alpha--a reliability coefficient--is interpreted as an index of homogeneity or internal consistency.…

  3. Correcting Coefficient Alpha for Correlated Errors: Is [alpha][K]a Lower Bound to Reliability?

    ERIC Educational Resources Information Center

    Rae, Gordon

    2006-01-01

    When errors of measurement are positively correlated, coefficient alpha may overestimate the "true" reliability of a composite. To reduce this inflation bias, Komaroff (1997) has proposed an adjusted alpha coefficient, ak. This article shows that ak is only guaranteed to be a lower bound to reliability if the latter does not include correlated…

  4. Reliability, Dimensionality, and Internal Consistency as Defined by Cronbach: Distinct Albeit Related Concepts

    ERIC Educational Resources Information Center

    Davenport, Ernest C.; Davison, Mark L.; Liou, Pey-Yan; Love, Quintin U.

    2015-01-01

    This article uses definitions provided by Cronbach in his seminal paper for coefficient a to show the concepts of reliability, dimensionality, and internal consistency are distinct but interrelated. The article begins with a critique of the definition of reliability and then explores mathematical properties of Cronbach's a. Internal consistency…

  5. SIMREL: Software for Coefficient Alpha and Its Confidence Intervals with Monte Carlo Studies

    ERIC Educational Resources Information Center

    Yurdugul, Halil

    2009-01-01

    This article describes SIMREL, a software program designed for the simulation of alpha coefficients and the estimation of its confidence intervals. SIMREL runs on two alternatives. In the first one, if SIMREL is run for a single data file, it performs descriptive statistics, principal components analysis, and variance analysis of the item scores…

  6. Evaluating the Impact of Guessing and Its Interactions with Other Test Characteristics on Confidence Interval Procedures for Coefficient Alpha

    ERIC Educational Resources Information Center

    Paek, Insu

    2016-01-01

    The effect of guessing on the point estimate of coefficient alpha has been studied in the literature, but the impact of guessing and its interactions with other test characteristics on the interval estimators for coefficient alpha has not been fully investigated. This study examined the impact of guessing and its interactions with other test…

  7. A Study of the Distribution of Sample Coefficient Alpha with the Hopkins Symptom Checklist: Bootstrap versus Asymptotics.

    ERIC Educational Resources Information Center

    Yuan, Ke-Hai; Guarnaccia, Charles A.; Hayslip, Bert, Jr.

    2003-01-01

    Studied the sample coefficient alpha for each of the five subscales of the Hopkins Symptom Checklist (HSL; L. Derogaitis and others, 1974) in a sample of 419 adults. Findings show that the normal-theory-based distribution has a systematic bias in describing the behavior of the sample coefficient alpha. (SLD)

  8. Confidence Intervals For Maximized Alpha Coefficients: An Evaluation of Joe and Woodward's Procedures and an Alternative Method.

    ERIC Educational Resources Information Center

    Hakstian, A. Ralph; And Others

    1980-01-01

    The procedures yielding confidence intervals for maximized alpha coefficients of Joe and Woodward are reviewed. Confidence interval procedures of Whalen and Masson are next reviewed. Results are then presented of a Monte Carlo investigation of the procedures. (Author/CTM)

  9. ScoreRel CI: An Excel Program for Computing Confidence Intervals for Commonly Used Score Reliability Coefficients

    ERIC Educational Resources Information Center

    Barnette, J. Jackson

    2005-01-01

    An Excel program developed to assist researchers in the determination and presentation of confidence intervals around commonly used score reliability coefficients is described. The software includes programs to determine confidence intervals for Cronbachs alpha, Pearson r-based coefficients such as those used in test-retest and alternate forms…

  10. The local skin dose conversion coefficients of electrons, protons and alpha particles calculated using the Geant4 code.

    PubMed

    Zhang, Bintuan; Dang, Bingrong; Wang, Zhuanzi; Wei, Wei; Li, Wenjian

    2013-10-01

    The skin tissue-equivalent slab reported in the International Commission on Radiological Protection (ICRP) Publication 116 to calculate the localised skin dose conversion coefficients (LSDCCs) was adopted into the Monte Carlo transport code Geant4. The Geant4 code was then utilised for computation of LSDCCs due to a circular parallel beam of monoenergetic electrons, protons and alpha particles <10 MeV. The computed LSDCCs for both electrons and alpha particles are found to be in good agreement with the results using the MCNPX code of ICRP 116 data. The present work thus validates the LSDCC values for both electrons and alpha particles using the Geant4 code.

  11. Study of the absorption coefficient of alpha particles to lower hybrid waves in tokamak

    SciTech Connect

    Wang, Jianbing Zhang, Xianmei Yu, Limin Zhao, Xiang

    2014-02-12

    Part of the energy of the Lower Hybrid (LH) waves may be absorbed by the α particles via the so-called perpendicular landau damping mechanism, which depends on various parameters of fusion reactors and the LH waves. In this article, we calculate the absorption coefficient γ{sub α} of LH waves due to α particles. Results show that, the γ{sub α} increases with the parallel refraction index n{sub ∥} while deceases with increasing the frequency of LH waves ω{sub LH} over a wide range. Higher background plasma temperature and toroidal magnetic field will increase the absorption, and there is a peak value of γ{sub α} when n{sub e}≈8×10{sup 19}m{sup −3} for ITER-like scenario. The thermal corrections to the cold plasma dispersion relation will change the damping rate to a certain extent under some specific conditions. We have also evaluated the fraction of LH power absorbed by the alpha particles, η ≈ 0.47% and 4.1% for an LH frequency of 5 GHz and 3.7 GHz respectively for ITER-like scenario. This work gives the effective reference for the choice of parameters of future fusion reactors.

  12. Field estimates of polyurethane foam - air partition coefficients for hexachlorobenzene, alpha-hexachlorocyclohexane and bromoanisoles.

    PubMed

    Bidleman, Terry F; Nygren, Olle; Tysklind, Mats

    2016-09-01

    Partition coefficients of gaseous semivolatile organic compounds (SVOCs) between polyurethane foam (PUF) and air (KPA) are needed in the estimation of sampling rates for PUF disk passive air samplers. We determined KPA in field experiments by conducting long-term (24-48 h) air sampling to saturate PUF traps and shorter runs (2-4 h) to measure air concentrations. Sampling events were done at daily mean temperatures ranging from 1.9 to 17.5 °C. Target compounds were hexachlorobenzene (HCB), alpha-hexachlorocyclohexane (α-HCH), 2,4-dibromoanisole (2,4-DiBA) and 2,4,6-tribromoanisole (2,4,6-TriBA). KPA (mL g(-1)) was calculated from quantities on the PUF traps at saturation (ng g(-1)) divided by air concentrations (ng mL(-1)). Enthalpies of PUF-to-air transfer (ΔHPA, kJ mol(-1)) were determined from the slopes of log KPA/mL g(-1) versus 1/T(K) for HCB and the bromoanisoles, KPA of α-HCH was measured only at 14.3 to 17.5 °C and ΔHPA was not determined. Experimental log KPA/mL g(-1) at 15 °C were HCB = 7.37; α-HCH = 8.08; 2,4-DiBA = 7.26 and 2,4,6-TriBA = 7.26. Experimental log KPA/mL g(-1) were compared with predictions based on an octanol-air partition coefficient (log KOA) model (Shoeib and Harner, 2002a) and a polyparameter linear free relationship (pp-LFER) model (Kamprad and Goss, 2007) using different sets of solute parameters. Predicted KP values varied by factors of 3 to over 30, depending on the compound and the model. Such discrepancies provide incentive for experimental measurements of KPA for other SVOCs. PMID:27285381

  13. Comparing Fit and Reliability Estimates of a Psychological Instrument Using Second-Order CFA, Bifactor, and Essentially Tau-Equivalent (Coefficient Alpha) Models via AMOS 22

    ERIC Educational Resources Information Center

    Black, Ryan A.; Yang, Yanyun; Beitra, Danette; McCaffrey, Stacey

    2015-01-01

    Estimation of composite reliability within a hierarchical modeling framework has recently become of particular interest given the growing recognition that the underlying assumptions of coefficient alpha are often untenable. Unfortunately, coefficient alpha remains the prominent estimate of reliability when estimating total scores from a scale with…

  14. Starting at the beginning: an introduction to coefficient alpha and internal consistency.

    PubMed

    Streiner, David L

    2003-02-01

    Cronbach's a is the most widely used index of the reliability of a scale. However, its use and interpretation can be subject to a number of errors. This article discusses the historical development of a from other indexes of internal consistency (split-half reliability and Kuder-Richardson 20) and discusses four myths associated with a: (a) that it is a fixed property of the scale, (b) that it measures only the internal consistency of the scale, (c) that higher values are always preferred over lower ones, and (d) that it is restricted to the range of 0 to 1. It provides some recommendations for acceptable values of a in different situations. PMID:12584072

  15. Improving construct validity: Cronbach, Meehl, and Neurath's ship.

    PubMed

    Westen, Drew; Rosenthal, Robert

    2005-12-01

    Smith's article "On Construct Validity: Issues of Method and Measurement" is a fine tribute to L. J. Cronbach and P. E. Meehl (1955) that clarifies the current state and future directions in the understanding of construct validity. Construct validity is a dynamic process, and fit indices need to be used at the service of understanding, not in place of it. The failure of a study or set of studies to support a construct, a measure, or the theory underlying it admits of many explanations, and the ways scientists interpret such failures are prone to cognitive biases and motivated reasoning. This suggests why metrics designed to index the extent to which observations match expectations can be useful prostheses to scientific judgments. As P. E. Meehl (1954) showed decades ago, quantitative, statistical formulas and indices tend to outperform informal, qualitative judgments, and this applies as much to the way researchers evaluate constructs and measures as to judgments in the consulting room.

  16. A Monte Carlo Study of Eight Confidence Interval Methods for Coefficient Alpha

    ERIC Educational Resources Information Center

    Romano, Jeanine L.; Kromrey, Jeffrey D.; Hibbard, Susan T.

    2010-01-01

    The purpose of this research is to examine eight of the different methods for computing confidence intervals around alpha that have been proposed to determine which of these, if any, is the most accurate and precise. Monte Carlo methods were used to simulate samples under known and controlled population conditions. In general, the differences in…

  17. Alpha radiation risk coefficients for liver cancer, bone sarcomas, and leukemia

    SciTech Connect

    Hunacek, M.M.; Kathren, R.L.

    1995-01-01

    This study compares published risk coefficients with those determined from dose rates established by postmortem radiochemical analysis of tissues from two whole body donors to the U.S. Transuranium and Uranium Registries, both of whom had been injected with Thorotrast approximately four decades prior to death. The dose data from these cases were used in combination with published latent periods and epidemiologic study results to calculate the following risk coefficients: 0.020 liver cancers Gy{sup -1}, 0.002 bone sarcomas Gy{sup -1}, and 0.032 leukemias Gy{sup -1}. These compare with the ranges of 0.60 to 0.074 liver cancers Gy{sup -1}, 0.0016 to 0.0120 bone sarcomas Gy{sup -1}, and 0.005 to 0.060 leukemias Gy{sup -1} reported in the literature. The results of this study are generally consistent with previously reported values with two exceptions: the values for bone sarcomas fall below the range given by BEIR IV and the values for leukemia are a factor of 6 greater than those reported by BEIR IV. This suggests that the BEIR IV risk coefficient for bone sarcomas may be too high, and that for leukemia may be too low. 46 refs., 5 tabs.

  18. Influence of plasma parameters on the absorption coefficient of alpha particles to lower hybrid waves in tokamaks

    SciTech Connect

    Wang, J.; Zhang, X. Yu, L.; Zhao, X.

    2014-12-15

    In tokamaks, fusion generated α particles may absorb lower hybrid (LH) wave energy, thus reducing the LH current drive efficiency. The absorption coefficient γ{sub α} of LH waves due to α particles changing with some typical parameters is calculated in this paper. Results show that γ{sub α} increases with the parallel refraction index n{sub ‖}, while decreases with the frequency of LH waves ω over a wide range. Higher background plasma temperature and toroidal magnetic field will increase the absorption. The absorption coefficient γ{sub α} increases with n{sub e} when n{sub e} ≤ 8 × 10{sup 19} m{sup −3}, while decreases with n{sub e} when n{sub e} becomes larger, and there is a peak value of γ{sub α} when n{sub e} ≈ 8 × 10{sup 19} m{sup −1} for the ITER-like scenario. The influence of spectral broadening in parametric decay instabilities on the absorption coefficient is evaluated. The value of γ{sub α} with n{sub ‖} being 2.5 is almost two times larger than that with n{sub ‖} being 2.0 and is even lager in the case of 2.9, which will obviously increase the absorption of the LH power by alpha particles.

  19. Computation of conversion coefficients relating air Kerma to Hp(0.07,alpha), Hp(10,alpha), and H*(10) for x-ray narrow spectrum from 40 to 140 kV.

    PubMed

    Kharrati, Hedi; Zarrad, Boubaker

    2004-02-01

    A computation method was implemented to predict the conversion coefficients and the angular dependence factors relating air Kerma to Hp(0.07,alpha), Hp(10,alpha), and H*(10) in an ICRU slab phantom for tungsten anode x-ray spectra for tube potentials from 40 to 140 kV. The simulation of the unfiltered x-ray spectra is based on the Boone and Seibert model. The calculation of conversion coefficients were performed for an x-ray narrow spectrum at any filtration material and tube potentials in the diagnostic radiology range. This computation method has been checked for five narrow x-ray spectra using a comparison of the results with published data given by the International Organization for Standardization (ISO), and American National Standards Institute (ANSI). In all cases, the mean deviation of the calculated mean conversion coefficients values do not exceed 1% for Hp (0.07,alpha) and 1.5% for Hp (10,alpha), except at 60 degrees where a mean deviation from the ISO values of 1.72% and of 2.27% was, respectively, found. But it is still lower than the mean deviation of 2.31% for Hp(0.07,alpha), and of 3.08% for Hp(10,alpha) observed at this angle between ISO and ANSI values. Otherwise, the computed values of conversion coefficients of H*(10) differ by only 0.41% from the ISO values. The results of this computation method can be considered satisfactory considering the accuracy required in radioprotection fields, and can allow an appreciable estimation of conversion coefficients for the narrow x-ray spectra indispensable to calibrate the personnel dosimeters in terms of the personal dose equivalent.

  20. Comparison of aerodynamic coefficients obtained from theoretical calculations wind tunnel tests and flight tests data reduction for the alpha jet aircraft

    NASA Technical Reports Server (NTRS)

    Guiot, R.; Wunnenberg, H.

    1980-01-01

    The methods by which aerodynamic coefficients are determined and discussed. These include: calculations, wind tunnel experiments and experiments in flight for various prototypes of the Alpha Jet. A comparison of obtained results shows good correlation between expectations and in-flight test results.

  1. Temperature dependence of the rate coefficient for the alpha-pinene reaction with ozone in the range between 243 K and 303 K.

    PubMed

    Tillmann, Ralf; Saathoff, Harald; Brauers, Theo; Kiendler-Scharr, Astrid; Mentel, Thomas F

    2009-04-01

    The absolute rate coefficient for the reaction of alpha-pinene with ozone was determined in the temperature range between 243 K and 303 K at atmospheric pressure. In total, 30 experiments were performed in the large (85 m3) temperature-controlled simulation chamber AIDA, where the concentrations of the reactants ozone and alpha-pinene were measured directly. An Arrhenius expression for the alpha-pinene + ozone reaction was derived with a pre-exponential factor of (1.4 +/- 0.4) x 10(-15) cm3 s(-1) and a temperature coefficient of (833 +/- 86) K. This rate coefficient is in good agreement (-5%) with the current IUPAC (IUPAC 2007) recommendation at 298 K. The IUPAC recommendation is significantly larger (+27%), around 243 K where the recommended values were extrapolated from higher temperatures. This finding is relevant for tropical regions where strong updrafts can rapidly transport reactive hydrocarbons like alpha-pinene from the boundary layer into the cold regions of the free troposphere.

  2. The relationship between unstandardized and standardized alpha, true reliability, and the underlying measurement model.

    PubMed

    Falk, Carl F; Savalei, Victoria

    2011-01-01

    Popular computer programs print 2 versions of Cronbach's alpha: unstandardized alpha, α(Σ), based on the covariance matrix, and standardized alpha, α(R), based on the correlation matrix. Sources that accurately describe the theoretical distinction between the 2 coefficients are lacking, which can lead to the misconception that the differences between α(R) and α(Σ) are unimportant and to the temptation to report the larger coefficient. We explore the relationship between α(R) and α(Σ) and the reliability of the standardized and unstandardized composite under 3 popular measurement models; we clarify the theoretical meaning of each coefficient and conclude that researchers should choose an appropriate reliability coefficient based on theoretical considerations. We also illustrate that α(R) and α(Σ) estimate the reliability of different composite scores, and in most cases cannot be substituted for one another. PMID:21859284

  3. Delimiting Coefficient a from Internal Consistency and Unidimensionality

    ERIC Educational Resources Information Center

    Sijtsma, Klaas

    2015-01-01

    I discuss the contribution by Davenport, Davison, Liou, & Love (2015) in which they relate reliability represented by coefficient a to formal definitions of internal consistency and unidimensionality, both proposed by Cronbach (1951). I argue that coefficient a is a lower bound to reliability and that concepts of internal consistency and…

  4. Lorentz violation and {alpha} decay

    SciTech Connect

    Altschul, Brett

    2009-01-01

    Relating the effective Lorentz violation coefficients for composite particles to the coefficients for their constituent fields is a challenging problem. We calculate the Lorentz violation coefficients relevant to the dynamics of an {alpha} particle in terms of proton and neutron coefficients. The {alpha}-particle coefficients would lead to anisotropies in the {alpha} decays of nuclei, and because the decay process involves quantum tunneling, the effects of any Lorentz violations could be exponentially enhanced.

  5. Confidence Interval Methods for Coefficient Alpha on the Basis of Discrete, Ordinal Response Items: Which One, If Any, Is the Best?

    ERIC Educational Resources Information Center

    Romano, Jeanine L.; Kromrey, Jeffrey D.; Owens, Corina M.; Scott, Heather M.

    2011-01-01

    In this study, the authors aimed to examine 8 of the different methods for computing confidence intervals around alpha that have been proposed to determine which of these, if any, is the most accurate and precise. Monte Carlo methods were used to simulate samples under known and controlled population conditions wherein the underlying item…

  6. A Comparison of Composite Reliability Estimators: Coefficient Omega Confidence Intervals in the Current Literature

    ERIC Educational Resources Information Center

    Padilla, Miguel A.; Divers, Jasmin

    2016-01-01

    Coefficient omega and alpha are both measures of the composite reliability for a set of items. Unlike coefficient alpha, coefficient omega remains unbiased with congeneric items with uncorrelated errors. Despite this ability, coefficient omega is not as widely used and cited in the literature as coefficient alpha. Reasons for coefficient omega's…

  7. Transport coefficients of gluonic fluid

    SciTech Connect

    Das, Santosh K.; Alam, Jan-e

    2011-06-01

    The shear ({eta}) and bulk ({zeta}) viscous coefficients have been evaluated for a gluonic fluid. The elastic, gg{yields}gg and the inelastic, number nonconserving, gg{yields}ggg processes have been considered as the dominant perturbative processes in evaluating the viscous coefficients to entropy density (s) ratios. Recently the processes: gg{yields}ggg has been revisited and a correction to the widely used Gunion-Bertsch (GB) formula has been obtained. The {eta} and {zeta} have been evaluated for gluonic fluid with the formula recently derived. At large {alpha}{sub s} the value of {eta}/s approaches its lower bound, {approx}1/4{pi}.

  8. A parametric study of planform and aeroelastic effects on aerodynamic center, alpha- and q- stability derivatives. Appendix C: Method for computing the aerodynamic influence coefficient matrix of nonplanar wing-body-tail configurations

    NASA Technical Reports Server (NTRS)

    Roskam, J.

    1972-01-01

    Expressions are derived for computing the aerodynamic influence coefficient matrix for nonplanar wing-body-tail configurations. An aerodynamic influence coefficient is defined as the load in lbs. induced on a panel as a result of a unit angle of attack on another panel. Fuselage, wing and tail thickness are assumed to be small with the result that the thickness effect on the flow-field is negligible. The method for determining the aerodynamic influence coefficient matrix is based on the lifting solution to the small perturbation, steady potential flow equation.

  9. A parametric study of planform and aeroelastic effects on aerodynamic center, alpha- and q- stability derivatures. Appendix B: Method for computing the strucutral influence coefficient matrix of nonplanar wing body tail configurations

    NASA Technical Reports Server (NTRS)

    Roskam, J.; Smith, H.; Gibson, G.

    1972-01-01

    The method used in computing the structural influence coefficient matrix of the computer program of Reference 1 (appendix A of the Summary Report) is reported. This matrix is computed for complete wing-body-tail configurations by assuming that all major airplane components can be structurally represented by a slender beam called the elastic axis. A structural influence coefficient is defined as the rotation about the Y-stability axis at panel j induced by a unit load on panel k. A description of how a structural breakdown is performed in detail is included.

  10. Factor Scores, Structure Coefficients, and Communality Coefficients

    ERIC Educational Resources Information Center

    Goodwyn, Fara

    2012-01-01

    This paper presents heuristic explanations of factor scores, structure coefficients, and communality coefficients. Common misconceptions regarding these topics are clarified. In addition, (a) the regression (b) Bartlett, (c) Anderson-Rubin, and (d) Thompson methods for calculating factor scores are reviewed. Syntax necessary to execute all four…

  11. Prediction of coefficients of thermal expansion for unidirectional composites

    NASA Technical Reports Server (NTRS)

    Bowles, David E.; Tompkins, Stephen S.

    1989-01-01

    Several analyses for predicting the longitudinal, alpha(1), and transverse, alpha(2), coefficients of thermal expansion of unidirectional composites were compared with each other, and with experimental data on different graphite fiber reinforced resin, metal, and ceramic matrix composites. Analytical and numerical analyses that accurately accounted for Poisson restraining effects in the transverse direction were in consistently better agreement with experimental data for alpha(2), than the less rigorous analyses. All of the analyses predicted similar values of alpha(1), and were in good agreement with the experimental data. A sensitivity analysis was conducted to determine the relative influence of constituent properties on the predicted values of alpha(1), and alpha(2). As would be expected, the prediction of alpha(1) was most sensitive to longitudinal fiber properties and the prediction of alpha(2) was most sensitive to matrix properties.

  12. Alpha Thalassemia

    MedlinePlus

    ... an apparently normal individual has a child with hemoglobin H disease or alpha thalassemia minor. It can ... gene on one chromosome 25% 25% 25% 25% hemoglobin H disease there is a 25% chance with ...

  13. Alpha-1 Antitrypsin Deficiency

    MedlinePlus

    ... Liver Disease Information > Alpha-1 Antitrypsin Deficiency Alpha-1 Antitrypsin Deficiency Explore this section to learn more about alpha-1 antitrypsin deficiency, including a description of the disorder ...

  14. Self-consistent alpha-particle transport in ignition scenarios

    SciTech Connect

    Kamelander, G.; Woloch, F.; Sdouz, G. )

    1994-05-01

    Recently, fast alpha-particle-driven kinetic Alfven waves were investigated by means of a nonlinear turbulent theory, and an analytic expression for the corresponding diffusion coefficient was derived. This diffusion coefficient is introduced in a kinetic alpha-particle transport code based on the solution of a special Fokker-Planck equation by means of a multigroup formalism. The structure of D[sub [alpha

  15. Coefficients Alpha, Beta, Omega, and the glb: Comments on Sijtsma

    ERIC Educational Resources Information Center

    Revelle, William; Zinbarg, Richard E.

    2009-01-01

    There are three fundamental problems in Sijtsma ("Psychometrika," 2008): (1) contrary to the name, the glb is not the greatest lower bound of reliability but rather is systematically less than omega[subscript t] (McDonald, "Test theory: A unified treatment," Erlbaum, Hillsdale, 1999), (2) we agree with Sijtsma that when considering how well a test…

  16. Sample Size Requirements for Comparing Two Alpha Coefficients.

    ERIC Educational Resources Information Center

    Bonnett, Douglas G.

    2003-01-01

    Derived general formulas to determine the sample size requirements for hypothesis testing with desired power and interval estimation with desired precision. Illustrated the approach with the example of a screening test for adolescent attention deficit disorder. (SLD)

  17. Alpha-1 Antitrypsin Deficiency

    MedlinePlus

    ... from the NHLBI on Twitter. What Is Alpha-1 Antitrypsin Deficiency? Alpha-1 antitrypsin (an-tee-TRIP-sin) deficiency, or AAT ... as it relates to lung disease. Overview Alpha-1 antitrypsin, also called AAT, is a protein made ...

  18. Measuring Seebeck Coefficient

    NASA Technical Reports Server (NTRS)

    Snyder, G. Jeffrey (Inventor)

    2015-01-01

    A high temperature Seebeck coefficient measurement apparatus and method with various features to minimize typical sources of errors is described. Common sources of temperature and voltage measurement errors which may impact accurate measurement are identified and reduced. Applying the identified principles, a high temperature Seebeck measurement apparatus and method employing a uniaxial, four-point geometry is described to operate from room temperature up to 1300K. These techniques for non-destructive Seebeck coefficient measurements are simple to operate, and are suitable for bulk samples with a broad range of physical types and shapes.

  19. Prediction of Aerodynamic Coefficients using Neural Networks for Sparse Data

    NASA Technical Reports Server (NTRS)

    Rajkumar, T.; Bardina, Jorge; Clancy, Daniel (Technical Monitor)

    2002-01-01

    Basic aerodynamic coefficients are modeled as functions of angles of attack and sideslip with vehicle lateral symmetry and compressibility effects. Most of the aerodynamic parameters can be well-fitted using polynomial functions. In this paper a fast, reliable way of predicting aerodynamic coefficients is produced using a neural network. The training data for the neural network is derived from wind tunnel test and numerical simulations. The coefficients of lift, drag, pitching moment are expressed as a function of alpha (angle of attack) and Mach number. The results produced from preliminary neural network analysis are very good.

  20. Turbulent MHD transport coefficients - An attempt at self-consistency

    NASA Technical Reports Server (NTRS)

    Chen, H.; Montgomery, D.

    1987-01-01

    In this paper, some multiple scale perturbation calculations of turbulent MHD transport coefficients begun in earlier papers are first completed. These generalize 'alpha effect' calculations by treating the velocity field and magnetic field on the same footing. Then the problem of rendering such calculations self-consistent is addressed, generalizing an eddy-viscosity hypothesis similar to that of Heisenberg for the Navier-Stokes case. The method also borrows from Kraichnan's direct interaction approximation. The output is a set of integral equations relating the spectra and the turbulent transport coefficients. Previous 'alpha effect' and 'beta effect' coefficients emerge as limiting cases. A treatment of the inertial range can also be given, consistent with a -5/3 energy spectrum power law. In the Navier-Stokes limit, a value of 1.72 is extracted for the Kolmogorov constant. Further applications to MHD are possible.

  1. Ab initio alpha-alpha scattering.

    PubMed

    Elhatisari, Serdar; Lee, Dean; Rupak, Gautam; Epelbaum, Evgeny; Krebs, Hermann; Lähde, Timo A; Luu, Thomas; Meißner, Ulf-G

    2015-12-01

    Processes such as the scattering of alpha particles ((4)He), the triple-alpha reaction, and alpha capture play a major role in stellar nucleosynthesis. In particular, alpha capture on carbon determines the ratio of carbon to oxygen during helium burning, and affects subsequent carbon, neon, oxygen, and silicon burning stages. It also substantially affects models of thermonuclear type Ia supernovae, owing to carbon detonation in accreting carbon-oxygen white-dwarf stars. In these reactions, the accurate calculation of the elastic scattering of alpha particles and alpha-like nuclei--nuclei with even and equal numbers of protons and neutrons--is important for understanding background and resonant scattering contributions. First-principles calculations of processes involving alpha particles and alpha-like nuclei have so far been impractical, owing to the exponential growth of the number of computational operations with the number of particles. Here we describe an ab initio calculation of alpha-alpha scattering that uses lattice Monte Carlo simulations. We use lattice effective field theory to describe the low-energy interactions of protons and neutrons, and apply a technique called the 'adiabatic projection method' to reduce the eight-body system to a two-cluster system. We take advantage of the computational efficiency and the more favourable scaling with system size of auxiliary-field Monte Carlo simulations to compute an ab initio effective Hamiltonian for the two clusters. We find promising agreement between lattice results and experimental phase shifts for s-wave and d-wave scattering. The approximately quadratic scaling of computational operations with particle number suggests that it should be possible to compute alpha scattering and capture on carbon and oxygen in the near future. The methods described here can be applied to ultracold atomic few-body systems as well as to hadronic systems using lattice quantum chromodynamics to describe the interactions of

  2. Ab initio alpha-alpha scattering.

    PubMed

    Elhatisari, Serdar; Lee, Dean; Rupak, Gautam; Epelbaum, Evgeny; Krebs, Hermann; Lähde, Timo A; Luu, Thomas; Meißner, Ulf-G

    2015-12-01

    Processes such as the scattering of alpha particles ((4)He), the triple-alpha reaction, and alpha capture play a major role in stellar nucleosynthesis. In particular, alpha capture on carbon determines the ratio of carbon to oxygen during helium burning, and affects subsequent carbon, neon, oxygen, and silicon burning stages. It also substantially affects models of thermonuclear type Ia supernovae, owing to carbon detonation in accreting carbon-oxygen white-dwarf stars. In these reactions, the accurate calculation of the elastic scattering of alpha particles and alpha-like nuclei--nuclei with even and equal numbers of protons and neutrons--is important for understanding background and resonant scattering contributions. First-principles calculations of processes involving alpha particles and alpha-like nuclei have so far been impractical, owing to the exponential growth of the number of computational operations with the number of particles. Here we describe an ab initio calculation of alpha-alpha scattering that uses lattice Monte Carlo simulations. We use lattice effective field theory to describe the low-energy interactions of protons and neutrons, and apply a technique called the 'adiabatic projection method' to reduce the eight-body system to a two-cluster system. We take advantage of the computational efficiency and the more favourable scaling with system size of auxiliary-field Monte Carlo simulations to compute an ab initio effective Hamiltonian for the two clusters. We find promising agreement between lattice results and experimental phase shifts for s-wave and d-wave scattering. The approximately quadratic scaling of computational operations with particle number suggests that it should be possible to compute alpha scattering and capture on carbon and oxygen in the near future. The methods described here can be applied to ultracold atomic few-body systems as well as to hadronic systems using lattice quantum chromodynamics to describe the interactions of

  3. Statistical Considerations in Choosing a Test Reliability Coefficient. ACT Research Report Series, 2012 (10)

    ERIC Educational Resources Information Center

    Woodruff, David; Wu, Yi-Fang

    2012-01-01

    The purpose of this paper is to illustrate alpha's robustness and usefulness, using actual and simulated educational test data. The sampling properties of alpha are compared with the sampling properties of several other reliability coefficients: Guttman's lambda[subscript 2], lambda[subscript 4], and lambda[subscript 6]; test-retest reliability;…

  4. alpha-Hexachlorocyclohexane (alpha-HCH)

    Integrated Risk Information System (IRIS)

    alpha - Hexachlorocyclohexane ( alpha - HCH ) ; CASRN 319 - 84 - 6 Human health assessment information on a chemical substance is included in the IRIS database only after a comprehensive review of toxicity data , as outlined in the IRIS assessment development process . Sections I ( Health Hazard Ass

  5. Alpha-1 Antitrypsin Test

    MedlinePlus

    ... measures the level of the protein AAT in blood. Alpha-1 antitrypsin phenotype testing evaluates the amount and type of AAT being produced and compares it to normal patterns. Alpha-1 antitrypsin genotype testing ( DNA testing) can ...

  6. Alpha-1 antitrypsin test

    MedlinePlus

    ... page: //medlineplus.gov/ency/article/003715.htm Alpha-1 antitrypsin test To use the sharing features on this page, please enable JavaScript. Alpha-1 antitrypsin is a laboratory test to measure the ...

  7. The Alpha Centauri System.

    ERIC Educational Resources Information Center

    Soderblom, David R.

    1987-01-01

    Describes the Alpha Centauri star system, which is the closest star system to the sun. Discusses the difficulties associated with measurements involving Alpha Centauri, along with some of the recent advances in stellar seismology. Raises questions about the possibilities of planets around Alpha Centauri. (TW)

  8. Averaging Internal Consistency Reliability Coefficients

    ERIC Educational Resources Information Center

    Feldt, Leonard S.; Charter, Richard A.

    2006-01-01

    Seven approaches to averaging reliability coefficients are presented. Each approach starts with a unique definition of the concept of "average," and no approach is more correct than the others. Six of the approaches are applicable to internal consistency coefficients. The seventh approach is specific to alternate-forms coefficients. Although the…

  9. Reference Material for Seebeck Coefficients

    NASA Astrophysics Data System (ADS)

    Edler, F.; Lenz, E.; Haupt, S.

    2015-03-01

    This paper describes a measurement method and a measuring system to determine absolute Seebeck coefficients of thermoelectric bulk materials with the aim of establishing reference materials for Seebeck coefficients. Reference materials with known thermoelectric properties are essential to allow a reliable benchmarking of different thermoelectric materials for application in thermoelectric generators to convert thermal into electrical energy or vice versa. A temperature gradient (1 to 8) K is induced across the sample, and the resulting voltage is measured by using two differential Au/Pt thermocouples. On the basis of the known absolute Seebeck coefficients of Au and Pt, the unknown Seebeck coefficient of the sample is calculated. The measurements are performed in inert atmospheres and at low pressure (30 to 60) mbar in the temperature range between 300 K and 860 K. The measurement results of the Seebeck coefficients of metallic and semiconducting samples are presented. Achievable relative measurement uncertainties of the Seebeck coefficient are on the order of a few percent.

  10. Graph characterization via Ihara coefficients.

    PubMed

    Ren, Peng; Wilson, Richard C; Hancock, Edwin R

    2011-02-01

    The novel contributions of this paper are twofold. First, we demonstrate how to characterize unweighted graphs in a permutation-invariant manner using the polynomial coefficients from the Ihara zeta function, i.e., the Ihara coefficients. Second, we generalize the definition of the Ihara coefficients to edge-weighted graphs. For an unweighted graph, the Ihara zeta function is the reciprocal of a quasi characteristic polynomial of the adjacency matrix of the associated oriented line graph. Since the Ihara zeta function has poles that give rise to infinities, the most convenient numerically stable representation is to work with the coefficients of the quasi characteristic polynomial. Moreover, the polynomial coefficients are invariant to vertex order permutations and also convey information concerning the cycle structure of the graph. To generalize the representation to edge-weighted graphs, we make use of the reduced Bartholdi zeta function. We prove that the computation of the Ihara coefficients for unweighted graphs is a special case of our proposed method for unit edge weights. We also present a spectral analysis of the Ihara coefficients and indicate their advantages over other graph spectral methods. We apply the proposed graph characterization method to capturing graph-class structure and clustering graphs. Experimental results reveal that the Ihara coefficients are more effective than methods based on Laplacian spectra.

  11. Approximate formulation of redistribution in the Ly-alpha, Ly-beta, H-alpha system

    NASA Technical Reports Server (NTRS)

    Cooper, J.; Ballagh, R. J.; Hubeny, I.

    1989-01-01

    Simple approximate formulas are given for the coupled redistribution of Ly-alpha, Ly-beta, and H-alpha, by using well-defined approximations to an essentially exact formulation. These formulas incorporate all the essential physics including Raman scattering, lower state radiative decay, and correlated terms representing emission during a collision which must be retained in order that the emission coefficients are properly behaved in the line wings. Approximate expressions for the appropriate line broadening parameters are collected. Finally, practical expressions for the source functions are given. These are formulated through newly introduced nonimpact redistribution functions, which are shown to be reasonably approximated by existing (ordinary and generalized) redistribution functions.

  12. Determination of Alpha

    NASA Astrophysics Data System (ADS)

    Chmeissani, Mokhtar Abdallah

    The determination of the strong coupling constant alpha_ s, using Energy-Energy Correlation Asymmetry and jet mass difference with Mark II data at SLC (91 GeV) is presented. In Energy-Energy Correlation Asymmetry (EECA), we used the same systematic procedure used to determine alpha_ s with MARK II data at PEP (29 GeV). The chi^2 fit suggests that alpha_ s = 0.119 +/- 0.007(stat.) +/- 0.007(syst.). In addition, we used the EECA method to determine the QCD scale parameter Lambda_{LLA}. The chi^2 fit suggests that Lambda _{LLA} = 420 +/- 90(stat.) MeV. In the jet mass difference method, the determination of alpha_ s is based on QCD calculations up to 2nd order. We showed that in this method we are able to reproduce the value of alpha _ s from a Monte Carlo sample to a very high accuracy. The result with this method is alpha _ s = 0.134 +/- 0.085(stat.) +/- 0.004(syst.). The two values of alpha_ s presented in this work are in agreement within the error bars and in a good agreement with recent results of alpha_ s published from other e^+e^- experiments.

  13. Event counting alpha detector

    DOEpatents

    Bolton, R.D.; MacArthur, D.W.

    1996-08-27

    An electrostatic detector is disclosed for atmospheric radon or other weak sources of alpha radiation. In one embodiment, nested enclosures are insulated from one another, open at the top, and have a high voltage pin inside and insulated from the inside enclosure. An electric field is produced between the pin and the inside enclosure. Air ions produced by collision with alpha particles inside the decay volume defined by the inside enclosure are attracted to the pin and the inner enclosure. With low alpha concentrations, individual alpha events can be measured to indicate the presence of radon or other alpha radiation. In another embodiment, an electrical field is produced between parallel plates which are insulated from a single decay cavity enclosure. 6 figs.

  14. Event counting alpha detector

    DOEpatents

    Bolton, Richard D.; MacArthur, Duncan W.

    1996-01-01

    An electrostatic detector for atmospheric radon or other weak sources of alpha radiation. In one embodiment, nested enclosures are insulated from one another, open at the top, and have a high voltage pin inside and insulated from the inside enclosure. An electric field is produced between the pin and the inside enclosure. Air ions produced by collision with alpha particles inside the decay volume defined by the inside enclosure are attracted to the pin and the inner enclosure. With low alpha concentrations, individual alpha events can be measured to indicate the presence of radon or other alpha radiation. In another embodiment, an electrical field is produced between parallel plates which are insulated from a single decay cavity enclosure.

  15. Imaging alpha particle detector

    DOEpatents

    Anderson, D.F.

    1980-10-29

    A method and apparatus for detecting and imaging alpha particles sources is described. A dielectric coated high voltage electrode and a tungsten wire grid constitute a diode configuration discharge generator for electrons dislodged from atoms or molecules located in between these electrodes when struck by alpha particles from a source to be quantitatively or qualitatively analyzed. A thin polyester film window allows the alpha particles to pass into the gas enclosure and the combination of the glass electrode, grid and window is light transparent such that the details of the source which is imaged with high resolution and sensitivity by the sparks produced can be observed visually as well. The source can be viewed directly, electronically counted or integrated over time using photographic methods. A significant increase in sensitivity over other alpha particle detectors is observed, and the device has very low sensitivity to gamma or beta emissions which might otherwise appear as noise on the alpha particle signal.

  16. Imaging alpha particle detector

    DOEpatents

    Anderson, David F.

    1985-01-01

    A method and apparatus for detecting and imaging alpha particles sources is described. A conducting coated high voltage electrode (1) and a tungsten wire grid (2) constitute a diode configuration discharge generator for electrons dislodged from atoms or molecules located in between these electrodes when struck by alpha particles from a source (3) to be quantitatively or qualitatively analyzed. A thin polyester film window (4) allows the alpha particles to pass into the gas enclosure and the combination of the glass electrode, grid and window is light transparent such that the details of the source which is imaged with high resolution and sensitivity by the sparks produced can be observed visually as well. The source can be viewed directly, electronically counted or integrated over time using photographic methods. A significant increase in sensitivity over other alpha particle detectors is observed, and the device has very low sensitivity to gamma or beta emissions which might otherwise appear as noise on the alpha particle signal.

  17. Cytoplasmic hydrogen ion diffusion coefficient.

    PubMed Central

    al-Baldawi, N F; Abercrombie, R F

    1992-01-01

    The apparent cytoplasmic proton diffusion coefficient was measured using pH electrodes and samples of cytoplasm extracted from the giant neuron of a marine invertebrate. By suddenly changing the pH at one surface of the sample and recording the relaxation of pH within the sample, an apparent diffusion coefficient of 1.4 +/- 0.5 x 10(-6) cm2/s (N = 7) was measured in the acidic or neutral range of pH (6.0-7.2). This value is approximately 5x lower than the diffusion coefficient of the mobile pH buffers (approximately 8 x 10(-6) cm2/s) and approximately 68x lower than the diffusion coefficient of the hydronium ion (93 x 10(-6) cm2/s). A mobile pH buffer (approximately 15% of the buffering power) and an immobile buffer (approximately 85% of the buffering power) could quantitatively account for the results at acidic or neutral pH. At alkaline pH (8.2-8.6), the apparent proton diffusion coefficient increased to 4.1 +/- 0.8 x 10(-6) cm2/s (N = 7). This larger diffusion coefficient at alkaline pH could be explained quantitatively by the enhanced buffering power of the mobile amino acids. Under the conditions of these experiments, it is unlikely that hydroxide movement influences the apparent hydrogen ion diffusion coefficient. PMID:1617134

  18. The alpha channeling effect

    SciTech Connect

    Fisch, N. J.

    2015-12-10

    Alpha particles born through fusion reactions in a tokamak reactor tend to slow down on electrons, but that could take up to hundreds of milliseconds. Before that happens, the energy in these alpha particles can destabilize on collisionless timescales toroidal Alfven modes and other waves, in a way deleterious to energy confinement. However, it has been speculated that this energy might be instead be channeled into useful energy, so as to heat fuel ions or to drive current. Such a channeling needs to be catalyzed by waves Waves can produce diffusion in energy of the alpha particles in a way that is strictly coupled to diffusion in space. If these diffusion paths in energy-position space point from high energy in the center to low energy on the periphery, then alpha particles will be cooled while forced to the periphery. The energy from the alpha particles is absorbed by the wave. The amplified wave can then heat ions or drive current. This process or paradigm for extracting alpha particle energy collisionlessly has been called alpha channeling. While the effect is speculative, the upside potential for economical fusion is immense. The paradigm also operates more generally in other contexts of magnetically confined plasma.

  19. Fuel Temperature Coefficient of Reactivity

    SciTech Connect

    Loewe, W.E.

    2001-07-31

    A method for measuring the fuel temperature coefficient of reactivity in a heterogeneous nuclear reactor is presented. The method, which is used during normal operation, requires that calibrated control rods be oscillated in a special way at a high reactor power level. The value of the fuel temperature coefficient of reactivity is found from the measured flux responses to these oscillations. Application of the method in a Savannah River reactor charged with natural uranium is discussed.

  20. Wrong Signs in Regression Coefficients

    NASA Technical Reports Server (NTRS)

    McGee, Holly

    1999-01-01

    When using parametric cost estimation, it is important to note the possibility of the regression coefficients having the wrong sign. A wrong sign is defined as a sign on the regression coefficient opposite to the researcher's intuition and experience. Some possible causes for the wrong sign discussed in this paper are a small range of x's, leverage points, missing variables, multicollinearity, and computational error. Additionally, techniques for determining the cause of the wrong sign are given.

  1. Diffusion Coefficients in White Dwarfs

    NASA Astrophysics Data System (ADS)

    Saumon, D.; Starrett, C. E.; Daligault, J.

    2015-06-01

    Models of diffusion in white dwarfs universally rely on the coefficients calculated by Paquette et al. (1986). We present new calculations of diffusion coefficients based on an advanced microscopic theory of dense plasmas and a numerical simulation approach that intrinsically accounts for multiple collisions. Our method is validated against a state-of-the-art method and we present results for the diffusion of carbon ions in a helium plasma.

  2. Converting Sabine absorption coefficients to random incidence absorption coefficients.

    PubMed

    Jeong, Cheol-Ho

    2013-06-01

    Absorption coefficients measured by the chamber method are referred to as Sabine absorption coefficients, which sometimes exceed unity due to the finite size of a sample and non-uniform intensity in the reverberation chambers under test. In this study, conversion methods from Sabine absorption coefficients to random incidence absorption coefficients are proposed. The overestimations of the Sabine absorption coefficient are investigated theoretically based on Miki's model for porous absorbers backed by a rigid wall or an air cavity, resulting in conversion factors. Additionally, three optimizations are suggested: An optimization method for the surface impedances for locally reacting absorbers, the flow resistivity for extendedly reacting absorbers, and the flow resistance for fabrics. With four porous type absorbers, the conversion methods are validated. For absorbers backed by a rigid wall, the surface impedance optimization produces the best results, while the flow resistivity optimization also yields reasonable results. The flow resistivity and flow resistance optimization for extendedly reacting absorbers are also found to be successful. However, the theoretical conversion factors based on Miki's model do not guarantee reliable estimations, particularly at frequencies below 250 Hz and beyond 2500 Hz.

  3. Alpha One Foundation

    MedlinePlus

    ... related programs More News Our Number One Goal: Find a cure for Alpha-1. Website Sponsors Helpful Links 3300 Ponce de Leon Blvd. Coral Gables, FL 33134 Phone: (877) 228-7321 Email: info@alphaone.org Copyright ...

  4. Alpha Particle Diagnostic

    SciTech Connect

    Fisher, Ray, K.

    2009-05-13

    The study of burning plasmas is the next frontier in fusion energy research, and will be a major objective of the U.S. fusion program through U.S. collaboration with our international partners on the ITER Project. For DT magnetic fusion to be useful for energy production, it is essential that the energetic alpha particles produced by the fusion reactions be confined long enough to deposit a significant fraction of their initial ~3.5 MeV energy in the plasma before they are lost. Development of diagnostics to study the behavior of energetic confined alpha particles is a very important if not essential part of burning plasma research. Despite the clear need for these measurements, development of diagnostics to study confined the fast confined alphas to date has proven extremely difficult, and the available techniques remain for the most part unproven and with significant uncertainties. Research under this grant had the goal of developing diagnostics of fast confined alphas, primarily based on measurements of the neutron and ion tails resulting from alpha particle knock-on collisions with the plasma deuterium and tritium fuel ions. One of the strengths of this approach is the ability to measure the alphas in the hot plasma core where the interesting ignition physics will occur.

  5. Transport coefficients of heavy baryons

    NASA Astrophysics Data System (ADS)

    Tolos, Laura; Torres-Rincon, Juan M.; Das, Santosh K.

    2016-08-01

    We compute the transport coefficients (drag and momentum diffusion) of the low-lying heavy baryons Λc and Λb in a medium of light mesons formed at the later stages of high-energy heavy-ion collisions. We employ the Fokker-Planck approach to obtain the transport coefficients from unitarized baryon-meson interactions based on effective field theories that respect chiral and heavy-quark symmetries. We provide the transport coefficients as a function of temperature and heavy-baryon momentum, and analyze the applicability of certain nonrelativistic estimates. Moreover we compare our outcome for the spatial diffusion coefficient to the one coming from the solution of the Boltzmann-Uehling-Uhlenbeck transport equation, and we find a very good agreement between both calculations. The transport coefficients for Λc and Λb in a thermal bath will be used in a subsequent publication as input in a Langevin evolution code for the generation and propagation of heavy particles in heavy-ion collisions at LHC and RHIC energies.

  6. Estimation of effective recombination coefficient and its variation with height for D-region

    NASA Astrophysics Data System (ADS)

    Goyal, R. K.; Mitra, S. N.

    1982-10-01

    The methods of calculating the effective recombination coefficient (alpha) of lower D-region, namely, (1) post-sunset decay and (2) post-flare decay of integrated field strength on 27 kHz atmospherics have been described. Both the methods give nearly the same values of alpha. Data on alpha at different heights have been collected and plotted against height on log log scale. The relationship is found to be linear. A simple formula has been developed to indicate this linear relationship.

  7. Dynamic model with scale-dependent coefficients in the viscous range

    NASA Technical Reports Server (NTRS)

    Meneveau, C.; Lund, T. S.

    1996-01-01

    The standard dynamic procedure is based on the scale-invariance assumption that the model coefficient C is the same at the grid and test-filter levels. In many applications this condition is not met, e.g. when the filter-length, delta, approaches the Kolmogorov scale, and C(delta approaches eta) approaches O. Using a priori tests, we show that the standard dynamic model yields the coefficient corresponding to the test-filter scale (alpha delta) instead of the grid-scale (delta). Several approaches to account for scale dependence are examined and/or tested in large eddy simulation of isotropic turbulence: (a) take the limit alpha approaches 1; (b) solve for two unknown coefficients C(Delta) and C(alpha delta) in the least-square-error formulation; (c) the 'bi-dynamic model', in which two test-filters (e.g. at scales 2(delta) and 4(delta) are employed to gain additional information on possible scale-dependence of the coefficient, and an improved estimate for the grid-level coefficient is obtained by extrapolation, (d) use theoretical predictions for the ratio C(alpha delta)/C(delta) and dynamically solve for C(delta). None of these options is found to be entirely satisfactory, although the last approach appears applicable to the viscous range.

  8. Analysis of internal conversion coefficients

    PubMed

    Coursol; Gorozhankin; Yakushev; Briancon; Vylov

    2000-03-01

    An extensive database has been assembled that contains the three most widely used sets of calculated internal conversion coefficients (ICC): [Hager R.S., Seltzer E.C., 1968. Internal conversion tables. K-, L-, M-shell Conversion coefficients for Z = 30 to Z = 103, Nucl. Data Tables A4, 1-237; Band I.M., Trzhaskovskaya M.B., 1978. Tables of gamma-ray internal conversion coefficients for the K-, L- and M-shells, 10 < or = Z < or = 104, Special Report of Leningrad Nuclear Physics Institute; Rosel F., Fries H.M., Alder K., Pauli H.C., 1978. Internal conversion coefficients for all atomic shells, At. Data Nucl. Data Tables 21, 91-289] and also includes new Dirac Fock calculations [Band I.M. and Trzhaskovskaya M.B., 1993. Internal conversion coefficients for low-energy nuclear transitions, At. Data Nucl. Data Tables 55, 43-61]. This database is linked to a computer program to plot ICCs and their combinations (sums and ratios) as a function of Z and energy, as well as relative deviations of ICC or their combinations for any pair of tabulated data. Examples of these analyses are presented for the K-shell and total ICCs of the gamma-ray standards [Hansen H.H., 1985. Evaluation of K-shell and total internal conversion coefficients for some selected nuclear transitions, Eur. Appl. Res. Rept. Nucl. Sci. Tech. 11.6 (4) 777-816] and for the K-shell and total ICCs of high multipolarity transitions (total, K-, L-, M-shells of E3 and M3 and K-shell of M4). Experimental data sets are also compared with the theoretical values of these specific calculations. PMID:10724406

  9. Dependence of the elastic strain coefficient of copper on the pre-treatment

    NASA Technical Reports Server (NTRS)

    Kuntze, Wilhelm

    1950-01-01

    The effect of various pre-treatments on the elastic strain coefficient (alpha) (defined as the reciprocal of the modulus of elasticity E) (Epsilon) and on the mechanical hysteresis of copper has been investigated. Variables comprising the pre-treatments were pre-straining by stretching in a tensile testing machine and by drawing through a die, aging at room and elevated temperatures and annealing. The variation of the elastic strain coefficient with test stress was also investigated.

  10. Effective Viscosity Coefficient of Nanosuspensions

    NASA Astrophysics Data System (ADS)

    Rudyak, V. Ya.; Belkin, A. A.; Egorov, V. V.

    2008-12-01

    Systematic calculations of the effective viscosity coefficient of nanosuspensions have been performed using the molecular dynamics method. It is established that the viscosity of a nanosuspension depends not only on the volume concentration of the nanoparticles but also on their mass and diameter. Differences from Einstein's relation are found even for nanosuspensions with a low particle concentration.

  11. Aerodynamic coefficients and transformation tables

    NASA Technical Reports Server (NTRS)

    Ames, Joseph S

    1918-01-01

    The problem of the transformation of numerical values expressed in one system of units into another set or system of units frequently arises in connection with aerodynamic problems. Report contains aerodynamic coefficients and conversion tables needed to facilitate such transformation. (author)

  12. Estimating the Polyserial Correlation Coefficient.

    ERIC Educational Resources Information Center

    Bedrick, Edward J.; Breslin, Frederick C.

    1996-01-01

    Simple noniterative estimators of the polyserial correlation coefficient are developed by exploiting a general relationship between the polyserial correlation and the point polyserial correlation to give extensions of the biserial estimators of K. Pearson (1909), H. E. Brogden (1949), and F. M. Lord (1963) to the multicategory setting. (SLD)

  13. Integer Solutions of Binomial Coefficients

    ERIC Educational Resources Information Center

    Gilbertson, Nicholas J.

    2016-01-01

    A good formula is like a good story, rich in description, powerful in communication, and eye-opening to readers. The formula presented in this article for determining the coefficients of the binomial expansion of (x + y)n is one such "good read." The beauty of this formula is in its simplicity--both describing a quantitative situation…

  14. Tables of the coefficients A

    NASA Technical Reports Server (NTRS)

    Chandra, N.

    1974-01-01

    Numerical coefficients required to express the angular distribution for the rotationally elastic or inelastic scattering of electrons from a diatomic molecule were tabulated for the case of nitrogen and in the energy range from 0.20 eV to 10.0 eV. Five different rotational states are considered.

  15. Identities for generalized hypergeometric coefficients

    SciTech Connect

    Biedenharn, L.C.; Louck, J.D.

    1991-01-01

    Generalizations of hypergeometric functions to arbitrarily many symmetric variables are discussed, along with their associated hypergeometric coefficients, and the setting within which these generalizations arose. Identities generalizing the Euler identity for {sub 2}F{sub 1}, the Saalschuetz identity, and two generalizations of the {sub 4}F{sub 3} Bailey identity, among others, are given. 16 refs.

  16. Prediction of stream volatilization coefficients

    USGS Publications Warehouse

    Rathbun, Ronald E.

    1990-01-01

    Equations are developed for predicting the liquid-film and gas-film reference-substance parameters for quantifying volatilization of organic solutes from streams. Molecular weight and molecular-diffusion coefficients of the solute are used as correlating parameters. Equations for predicting molecular-diffusion coefficients of organic solutes in water and air are developed, with molecular weight and molal volume as parameters. Mean absolute errors of prediction for diffusion coefficients in water are 9.97% for the molecular-weight equation, 6.45% for the molal-volume equation. The mean absolute error for the diffusion coefficient in air is 5.79% for the molal-volume equation. Molecular weight is not a satisfactory correlating parameter for diffusion in air because two equations are necessary to describe the values in the data set. The best predictive equation for the liquid-film reference-substance parameter has a mean absolute error of 5.74%, with molal volume as the correlating parameter. The best equation for the gas-film parameter has a mean absolute error of 7.80%, with molecular weight as the correlating parameter.

  17. Measurement of Impact Ionization Coefficients in Gallium Nitride

    NASA Astrophysics Data System (ADS)

    Ozbek, Ayse Merve

    2011-12-01

    GaN has been recognized as a potential semiconductor for high temperature, high frequency and high power applications. Due to its wide bandgap, GaN exhibits high critical electric fields, which are suitable to sustain high breakdown voltages in power electronic devices. In order to obtain a good understanding of the breakdown characteristics of a power device, it is important to know the impact ionization coefficients of electrons and holes as a function of the electric field in the semiconductor. In this work, electron and hole impact ionization coefficients have been accurately measured in both GaN epitaxial layers grown on bulk GaN substrates and GaN epitaxial layers grown on Sapphire substrates using the pulsed electron beam induced current technique. Using Chynoweth's equation (alpha = a e-b/E), measurements for GaN epitaxial layer grown on bulk GaN substrates gave an aN value of 1.5x105 cm-1 and a bN value of 1.413x107 V/cm for the impact ionization coefficient of electrons in GaN at room temperature. For the impact ionization coefficients of holes in GaN, the values of aP and bP were found to be 6.4x105 cm-1 and 1.454x107 V/cm, respectively. An analytical solution of the form alpha = mEn for the variation of the impact ionization coefficients as a function of the electric field was derived, which is useful for analytical calculation of the breakdown voltages in GaN. For Chynoweth's equation (alpha = a e-b/E), measurements for GaN epitaxial layers grown on Sapphire substrates gave an aN value of 9.17x105 cm-1 and a bN value of 1.722x107 V/cm for the impact ionization coefficient for electrons at room temperature. For the impact ionization coefficients for holes at room temperature, the values of aP and bP were found to be 8.7x105 cm-1 and 1.464x107 V/cm, respectively. The values for both coefficients are larger than those measured for GaN grown on GaN substrates. The temperature dependence of the electron and hole impact ionization coefficients as a function

  18. ALPHA MIS: Reference manual

    SciTech Connect

    Lovin, J.K.; Haese, R.L.; Heatherly, R.D.; Hughes, S.E.; Ishee, J.S.; Pratt, S.M.; Smith, D.W.

    1992-02-01

    ALPHA is a powerful and versatile management information system (MIS) initiated and sponsored and by the Finance and Business Management Division of Oak Ridge National Laboratory, who maintain and develop it in concert with the Business Systems Division for its Information Center. A general-purpose MIS, ALPHA allows users to access System 1022 and System 1032 databases to obtain and manage information. From a personal computer or a data terminal, Energy Systems employees can use ALPHA to control their own report reprocessing. Using four general commands (Database, Select, Sort, and Report) they can (1) choose a mainframe database, (2) define subsets within it, (3) sequentially order a subset by one or more variables, and (4) generate a report with their own or a canned format.

  19. Portable alpha spectrometer.

    PubMed

    Martín Sánchez, A; de la Torre Pérez, J

    2012-09-01

    Many portable devices have been designed to detect γ-rays or alpha and beta particles. Most of the α-particle detectors give the total count as a result, without identifying the radionuclides existing in the sample. The development of a device allowing rapid and straightforward α-particle spectrometry would be very useful for detecting the radioactive contents of unknown samples. This work describes the construction of a portable device using silicon semiconductor detectors designed to rapidly detect and possibly identify alpha-emitting radionuclides.

  20. The Apollo Alpha Spectrometer.

    NASA Technical Reports Server (NTRS)

    Jagoda, N.; Kubierschky, K.; Frank, R.; Carroll, J.

    1973-01-01

    Located in the Science Instrument Module of Apollo 15 and 16, the Alpha Particle Spectrometer was designed to detect and measure the energy of alpha particles emitted by the radon isotopes and their daughter products. The spectrometer sensor consisted of an array of totally depleted silicon surface barrier detectors. Biased amplifier and linear gate techniques were utilized to reduce resolution degradation, thereby permitting the use of a single 512 channel PHA. Sensor identification and in-flight radioactive calibration were incorporated to enhance data reduction.

  1. Neural Network Prediction of New Aircraft Design Coefficients

    NASA Technical Reports Server (NTRS)

    Norgaard, Magnus; Jorgensen, Charles C.; Ross, James C.

    1997-01-01

    This paper discusses a neural network tool for more effective aircraft design evaluations during wind tunnel tests. Using a hybrid neural network optimization method, we have produced fast and reliable predictions of aerodynamical coefficients, found optimal flap settings, and flap schedules. For validation, the tool was tested on a 55% scale model of the USAF/NASA Subsonic High Alpha Research Concept aircraft (SHARC). Four different networks were trained to predict coefficients of lift, drag, moment of inertia, and lift drag ratio (C(sub L), C(sub D), C(sub M), and L/D) from angle of attack and flap settings. The latter network was then used to determine an overall optimal flap setting and for finding optimal flap schedules.

  2. Study of Dispersion Coefficient Channel

    NASA Astrophysics Data System (ADS)

    Akiyama, K. R.; Bressan, C. K.; Pires, M. S. G.; Canno, L. M.; Ribeiro, L. C. L. J.

    2016-08-01

    The issue of water pollution has worsened in recent times due to releases, intentional or not, of pollutants in natural water bodies. This causes several studies about the distribution of pollutants are carried out. The water quality models have been developed and widely used today as a preventative tool, ie to try to predict what will be the concentration distribution of constituent along a body of water in spatial and temporal scale. To understand and use such models, it is necessary to know some concepts of hydraulic high on their application, including the longitudinal dispersion coefficient. This study aims to conduct a theoretical and experimental study of the channel dispersion coefficient, yielding more information about their direct determination in the literature.

  3. Consistent transport coefficients in astrophysics

    NASA Technical Reports Server (NTRS)

    Fontenla, Juan M.; Rovira, M.; Ferrofontan, C.

    1986-01-01

    A consistent theory for dealing with transport phenomena in stellar atmospheres starting with the kinetic equations and introducing three cases (LTE, partial LTE, and non-LTE) was developed. The consistent hydrodynamical equations were presented for partial-LTE, the transport coefficients defined, and a method shown to calculate them. The method is based on the numerical solution of kinetic equations considering Landau, Boltzmann, and Focker-Planck collision terms. Finally a set of results for the transport coefficients derived for a partially ionized hydrogen gas with radiation was shown, considering ionization and recombination as well as elastic collisions. The results obtained imply major changes is some types of theoretical model calculations and can resolve some important current problems concerning energy and mass balance in the solar atmosphere. It is shown that energy balance in the lower solar transition region can be fully explained by means of radiation losses and conductive flux.

  4. High temperature Seebeck coefficient metrology

    SciTech Connect

    Martin, J.; Tritt, T.; Uher, C.

    2010-12-15

    We present an overview of the challenges and practices of thermoelectric metrology on bulk materials at high temperature (300 to 1300 K). The Seebeck coefficient, when combined with thermal and electrical conductivity, is an essential property measurement for evaluating the potential performance of novel thermoelectric materials. However, there is some question as to which measurement technique(s) provides the most accurate determination of the Seebeck coefficient at high temperature. This has led to the implementation of nonideal practices that have further complicated the confirmation of reported high ZT materials. To ensure meaningful interlaboratory comparison of data, thermoelectric measurements must be reliable, accurate, and consistent. This article will summarize and compare the relevant measurement techniques and apparatus designs required to effectively manage uncertainty, while also providing a reference resource of previous advances in high temperature thermoelectric metrology.

  5. Portable vapor diffusion coefficient meter

    DOEpatents

    Ho, Clifford K.

    2007-06-12

    An apparatus for measuring the effective vapor diffusion coefficient of a test vapor diffusing through a sample of porous media contained within a test chamber. A chemical sensor measures the time-varying concentration of vapor that has diffused a known distance through the porous media. A data processor contained within the apparatus compares the measured sensor data with analytical predictions of the response curve based on the transient diffusion equation using Fick's Law, iterating on the choice of an effective vapor diffusion coefficient until the difference between the predicted and measured curves is minimized. Optionally, a purge fluid can forced through the porous media, permitting the apparatus to also measure a gas-phase permeability. The apparatus can be made lightweight, self-powered, and portable for use in the field.

  6. Ionization coefficients in gas mixtures

    NASA Astrophysics Data System (ADS)

    Marić, D.; Šašić, O.; Jovanović, J.; Radmilović-Rađenović, M.; Petrović, Z. Lj.

    2007-03-01

    We have tested the application of the common E/N ( E—electric field, N—gas number density) or Wieland approximation [Van Brunt, R.J., 1987. Common parametrizations of electron transport, collision cross section, and dielectric strength data for binary gas mixtures. J. Appl. Phys. 61 (5), 1773-1787.] and the common mean energy (CME) combination of the data for pure gases to obtain ionization coefficients for mixtures. Test calculations were made for Ar-CH4, Ar-N2, He-Xe and CH4-N2 mixtures. Standard combination procedure gives poor results in general, due to the fact that the electron energy distribution is considerably different in mixtures and in individual gases at the same values of E/N. The CME method may be used for mixtures of gases with ionization coefficients that do not differ by more than two orders of magnitude which is better than any other technique that was proposed [Marić, D., Radmilović-Rađenović, M., Petrović, Z.Lj., 2005. On parametrization and mixture laws for electron ionization coefficients. Eur. Phys. J. D 35, 313-321.].

  7. The interpretation of selection coefficients.

    PubMed

    Barton, N H; Servedio, M R

    2015-05-01

    Evolutionary biologists have an array of powerful theoretical techniques that can accurately predict changes in the genetic composition of populations. Changes in gene frequencies and genetic associations between loci can be tracked as they respond to a wide variety of evolutionary forces. However, it is often less clear how to decompose these various forces into components that accurately reflect the underlying biology. Here, we present several issues that arise in the definition and interpretation of selection and selection coefficients, focusing on insights gained through the examination of selection coefficients in multilocus notation. Using this notation, we discuss how its flexibility-which allows different biological units to be identified as targets of selection-is reflected in the interpretation of the coefficients that the notation generates. In many situations, it can be difficult to agree on whether loci can be considered to be under "direct" versus "indirect" selection, or to quantify this selection. We present arguments for what the terms direct and indirect selection might best encompass, considering a range of issues, from viability and sexual selection to kin selection. We show how multilocus notation can discriminate between direct and indirect selection, and describe when it can do so. PMID:25790030

  8. [alpha]-Oxocarboxylic Acids

    ERIC Educational Resources Information Center

    Kerber, Robert C.; Fernando, Marian S.

    2010-01-01

    Several [alpha]-oxocarboxylic acids play key roles in metabolism in plants and animals. However, there are inconsistencies between the structures as commonly portrayed and the reported acid ionization constants, which result because the acids are predominantly hydrated in aqueous solution; that is, the predominant form is RC(OH)[subscript 2]COOH…

  9. From Alpha to Omega

    ERIC Educational Resources Information Center

    Czaja, Paul Clement

    2006-01-01

    The Alpha point of the authors' life as a Montessori educator began in 1959, when he was a graduate student studying philosophy at Fordham University in the Bronx, New York. While studying the works of the great American philosopher William James, the author came across the writings of Maria Montessori and immediately became captivated by her…

  10. Summary of Alpha Particle Transport

    SciTech Connect

    Medley, S.S.; White, R.B.; Zweben, S.J.

    1998-08-19

    This paper summarizes the talks on alpha particle transport which were presented at the 5th International Atomic Energy Agency's Technical Committee Meeting on "Alpha Particles in Fusion Research" held at the Joint European Torus, England in September 1997.

  11. {alpha}-Decay half-lives, {alpha}-capture, and {alpha}-nucleus potential

    SciTech Connect

    Denisov, V. Yu. Khudenko, A.A.

    2009-11-15

    {alpha}-Decay half-lives and {alpha}-capture cross sections are evaluated in the framework of a unified model for {alpha}-decay and {alpha}-capture. In this model {alpha}-decay and {alpha}-capture are considered as penetration of the {alpha}-particle through the potential barrier formed by the nuclear, Coulomb, and centrifugal interactions between the {alpha}-particle and nucleus. The spins and parities of the parent and daughter nuclei as well as the quadrupole and hexadecapole deformations of the daughter nuclei are taken into account for evaluation of the {alpha}-decay half-lives. The {alpha}-decay half-lives for 344 nuclei and the {alpha}-capture cross sections of {sup 40}Ca, {sup 44}Ca, {sup 59}Co, {sup 208}Pb, and {sup 209}Bi agree well with the experimental data. The evaluated {alpha}-decay half-lives within the range of 10{sup -9}{<=}T{sub 1/2}{<=}10{sup 38} s for 1246 {alpha}-emitters are tabulated.

  12. Simultaneous quantification of GABAergic 3alpha,5alpha/3alpha,5beta neuroactive steroids in human and rat serum.

    PubMed

    Porcu, Patrizia; O'Buckley, Todd K; Alward, Sarah E; Marx, Christine E; Shampine, Lawrence J; Girdler, Susan S; Morrow, A Leslie

    2009-01-01

    The 3alpha,5alpha- and 3alpha,5beta-reduced derivatives of progesterone, deoxycorticosterone, dehydroepiandrosterone and testosterone enhance GABAergic neurotransmission and produce inhibitory neurobehavioral and anti-inflammatory effects. Despite substantial information on the progesterone derivative (3alpha,5alpha)-3-hydroxypregnan-20-one (3alpha,5alpha-THP, allopregnanolone), the physiological significance of the other endogenous GABAergic neuroactive steroids has remained elusive. Here, we describe the validation of a method using gas chromatography-mass spectrometry to simultaneously identify serum levels of the eight 3alpha,5alpha- and 3alpha,5beta-reduced derivatives of progesterone, deoxycorticosterone, dehydroepiandrosterone and testosterone. The method shows specificity, sensitivity and enhanced throughput compared to other methods already available for neuroactive steroid quantification. Administration of pregnenolone to rats and progesterone to women produced selective effects on the 3alpha,5alpha- and 3alpha,5beta-reduced neuroactive steroids, indicating differential regulation of their biosynthetic pathways. Pregnenolone administration increased serum levels of 3alpha,5alpha-THP (+1488%, p<0.001), (3alpha,5alpha)-3,21-dihydroxypregnan-20-one (3alpha,5alpha-THDOC, +205%, p<0.01), (3alpha,5alpha)-3-hydroxyandrostan-17-one (3alpha,5alpha-A, +216%, p<0.001), (3alpha,5alpha,17beta)-androstane-3,17-diol (3alpha,5alpha-A-diol, +190%, p<0.01). (3alpha,5beta)-3-hydroxypregnan-20-one (3alpha,5beta-THP) and (3alpha,5beta)-3-hydroxyandrostan-17-one (3alpha,5beta-A) were not altered, while (3alpha,5beta)-3,21-dihydroxypregnan-20-one (3alpha,5beta-THDOC) and (3alpha,5beta,17beta)-androstane-3,17-diol (3alpha,5beta-A-diol) were increased from undetectable levels to 271+/-100 and 2.4+/-0.9 pg+/-SEM, respectively (5/8 rats). Progesterone administration increased serum levels of 3alpha,5alpha-THP (+1806%, p<0.0001), 3alpha,5beta-THP (+575%, p<0.001), 3alpha,5alpha

  13. Measurements of thermal accommodation coefficients.

    SciTech Connect

    Rader, Daniel John; Castaneda, Jaime N.; Torczynski, John Robert; Grasser, Thomas W.; Trott, Wayne Merle

    2005-10-01

    A previously-developed experimental facility has been used to determine gas-surface thermal accommodation coefficients from the pressure dependence of the heat flux between parallel plates of similar material but different surface finish. Heat flux between the plates is inferred from measurements of temperature drop between the plate surface and an adjacent temperature-controlled water bath. Thermal accommodation measurements were determined from the pressure dependence of the heat flux for a fixed plate separation. Measurements of argon and nitrogen in contact with standard machined (lathed) or polished 304 stainless steel plates are indistinguishable within experimental uncertainty. Thus, the accommodation coefficient of 304 stainless steel with nitrogen and argon is estimated to be 0.80 {+-} 0.02 and 0.87 {+-} 0.02, respectively, independent of the surface roughness within the range likely to be encountered in engineering practice. Measurements of the accommodation of helium showed a slight variation with 304 stainless steel surface roughness: 0.36 {+-} 0.02 for a standard machine finish and 0.40 {+-} 0.02 for a polished finish. Planned tests with carbon-nanotube-coated plates will be performed when 304 stainless-steel blanks have been successfully coated.

  14. Thermal expansion coefficients of a 30% glass fiber filled PEEK pyrotechnic charge holder

    SciTech Connect

    Donnelly, M.W.; Walters, R.R.; Miller, G.D.

    1985-01-01

    Pyrotechnic actuators use hollow cylindrical ceramic or plastic charge holders to electrically isolate the pyrotechnic charge from the actuator case. In a newly developed actuator, 30% glass fiber filled polyetheretherketone (PEEK) was selected as the charge holder material both for its strength and its forming properties. Because the actuators are exposed to significant temperature variations during storage and flight, a determination of the coefficient of thermal expansion, ..cap alpha.., of the charge holders was required to assure success in this, the first electroexplosive device application of PEEK. Of special interest in this project were the questions of whether ..cap alpha.. depends on the direction (with respect to flow in the mold) or on injection pressure. From the test results, the conclusions are: (1) ..cap alpha.. does depend on direction. Its value in the thickness direction is approximately twice that in either the height or circumferential direction. This is probably because the wall thickness, 0.015'', is less than the average fiber length, 0.100'', and the PEEK is, therefore, not acting as a composite in the t direction. (2) Varying the injection pressure over the range of this study has no detectable effect on ..cap alpha... This charge holder is molded into an Inconel actuator case with ..cap alpha.. = 11.4 ..mu..m/m.C. This relatively close match of ..cap alpha..'s between adjacent materials has resulted in no dimensional problems during manufacturing and environmental testing. 1 fig., 1 tab.

  15. All-rac-alpha-tocopherol acetate is a better vitamin E source than all-rac-alpha-tocopherol succinate for broilers.

    PubMed

    Jensen, S K; Engberg, R M; Hedemann, M S

    1999-07-01

    The difference in bioavailabilities of the acetate and succinate esters of all-rac-alpha-tocopherol was investigated in a feeding experiment with broilers. The experiment was initiated with 96 12-d-old male Cobb broilers and lasted for 4 wk. The two sources of vitamin E were fed to eight groups of broilers at four different dietary levels (50, 100, 150 and 200 mg/kg feed, including the naturally occurring alpha-tocopherol). A total collection of droppings for determination of apparent tocopherol absorption were performed at two separate time periods (d 28-34 and d 35-41). There were no differences among the eight experimental groups with respect to animal performance or feed intake. At all dietary levels, the apparent absorption coefficient for all-rac-alpha-tocopherol succinate was significantly lower than that of the acetate ester. The mean (+/- SD) apparent absorption coefficient for all-rac-alpha-tocopherol succinate was 58.0 +/- 5.4 compared with 70. 8 +/- 5.6 for all-rac-alpha-tocopherol acetate. Furthermore, the apparent absorption coefficients for both esters was significantly lower in the first collection period (d 28-34) than in the second collection period (d 35-41). This difference in the apparent absorption coefficient between the succinate and the acetate ester was accompanied by significant differences in alpha-tocopherol concentrations in plasma, breast muscle, liver and adipose tissue of the broilers, which were lower in those fed the succinate ester. Based on a comparison of plasma and tissue responses, the succinate ester was utilized only 69-76% as efficiently as the acetate ester. In vitro studies showed a significantly higher capacity of pancreatic carboxyl ester hydrolase to hydrolyze alpha-tocopherol acetate compared to alpha-tocopherol succinate. This difference in intestinal hydrolysis of the two vitamin E sources may explain the observed differences in biopotency.

  16. Ratios of internal conversion coefficients

    SciTech Connect

    Raman, S.; Ertugrul, M.; Nestor, C.W. . E-mail: CNestorjr@aol.com; Trzhaskovskaya, M.B.

    2006-03-15

    We present here a database of available experimental ratios of internal conversion coefficients for different atomic subshells measured with an accuracy of 10% or better for a number of elements in the range 26 {<=} Z {<=} 100. The experimental set involves 414 ratios for pure and 1096 ratios for mixed-multipolarity nuclear transitions in the transition energy range from 2 to 2300 keV. We give relevant theoretical ratios calculated in the framework of the Dirac-Fock method with and without regard for the hole in the atomic subshell after conversion. For comparison, the ratios obtained within the relativistic Hartree-Fock-Slater approximation are also presented. In cases where several ratios were measured for the same transition in a given isotope in which two multipolarities were involved, we present the mixing ratio {delta} {sup 2} obtained by a least squares fit.

  17. A model for the disc Lyman alpha emission of Uranus

    SciTech Connect

    Jaffel, L.B.; Vidal-Madjar, A. ); Prange, R.; Emerich, C. ); McConnell, J.C. )

    1991-06-01

    A new efficient radiative transfer algorithm for inhomogeneous atmospheres has been used to simulate the limb to limb Lyman {alpha} reflectivities observed with the Voyager ultraviolet spectrometer during the flyby of Uranus. It was shown that complete frequency redistribution should be adequate to describe the disc emissions. The model atmosphere used was derived using a combination of Voyager measurements and modeling. Atomic H densities calculated had sources derivable directly from solar FUV and EUV fluxes. To fit the observations, four contributions are evaluated: (1) the resonance scattering of solar Lyman {alpha} radiation, (2) Rayleigh-Raman scattering of solar Lyman {alpha} radiation, (3) the resonance scattering of interplanetary Lyman {alpha} radiation, and (4) a possible internal source of unknown origin. From comparison with the observations, and provided that the published Voyager calibrations are correct, it is shown that only atmospheres with low eddy diffusion coefficients (K{sub H}{le}100 cm{sup 2} s{sup {minus}1}) and an internal source could simulate both the shape and the strength of the measured disc emission. The main results are then that the direct solar Lyman {alpha} scattering contribution (type 1 plus type 2) is of the order of 760 R, the scattering of interplanetary Lyman {alpha} contributes about 320 R, and a small additional internal source providing about 100-500 R is needed to match the measurements. Further, the analysis of the disc intensities suggests that there is no strong variation of K with latitude.

  18. A Note on Using Stratified Alpha to Estimate the Composite Reliability of a Test Composed of Interrelated Nonhomogeneous Items

    ERIC Educational Resources Information Center

    Rae, Gordon

    2007-01-01

    The relationship between stratified alpha (alpha-sub(s)) and the reliability of a test composed of interrelated nonhomogeneous items is examined. It is mathematically demonstrated that when there is congeneric equivalence within the strata or subtests, the difference between the coefficients is a function of the variances of the loadings within…

  19. Soccer Ball Lift Coefficients via Trajectory Analysis

    ERIC Educational Resources Information Center

    Goff, John Eric; Carre, Matt J.

    2010-01-01

    We performed experiments in which a soccer ball was launched from a machine while two high-speed cameras recorded portions of the trajectory. Using the trajectory data and published drag coefficients, we extracted lift coefficients for a soccer ball. We determined lift coefficients for a wide range of spin parameters, including several spin…

  20. M-Bonomial Coefficients and Their Identities

    ERIC Educational Resources Information Center

    Asiru, Muniru A.

    2010-01-01

    In this note, we introduce M-bonomial coefficients or (M-bonacci binomial coefficients). These are similar to the binomial and the Fibonomial (or Fibonacci-binomial) coefficients and can be displayed in a triangle similar to Pascal's triangle from which some identities become obvious.

  1. Note on Methodology: The Coefficient of Variation.

    ERIC Educational Resources Information Center

    Sheret, Michael

    1984-01-01

    Addresses applications of the coefficient of variation as a measure of educational inequality or as a means of measuring changes of inequality status. Suggests the Gini coefficient has many advantages over the coefficient of variation since it can be used with the Lorenz curve (Lorenz provides detail Gini omits). (BRR)

  2. Is the G Index a Correlation Coefficient?

    ERIC Educational Resources Information Center

    Vegelius, Jan

    1980-01-01

    One argument against the G index is that, unlike phi, it is not a correlation coefficient; yet, G conforms to the Kendall and E-coefficient definitions. The G index is also equal to the Pearson product moment correlation coefficient obtained from double scoring. (Author/CP)

  3. Standards for Standardized Logistic Regression Coefficients

    ERIC Educational Resources Information Center

    Menard, Scott

    2011-01-01

    Standardized coefficients in logistic regression analysis have the same utility as standardized coefficients in linear regression analysis. Although there has been no consensus on the best way to construct standardized logistic regression coefficients, there is now sufficient evidence to suggest a single best approach to the construction of a…

  4. Inference of the aerosol Angstrom coefficient from SAGE short-wavelength data. [Stratospheric Aerosol and Gas Experiment

    NASA Technical Reports Server (NTRS)

    Lenoble, J.; Pruvost, P.

    1983-01-01

    SAGE four-channel transmission profiles are inverted to retrieve the extinction profiles from which the aerosol Angstrom coefficient alpha is obtained. The procedure allows one to check the influence of the NO2 absorption profile, which is small below 25 km. The results compare well with those obtained by a completely different procedure at NASA Langley Research Center, and the main features of the alpha profiles seem to be significant, even considering the rather large error bars. The relation between the retrieved Angstrom coefficient, the particle effective radius and the asymmetry factor is considered.

  5. Proteinaceous alpha-amylase inhibitors.

    PubMed

    Svensson, Birte; Fukuda, Kenji; Nielsen, Peter K; Bønsager, Birgit C

    2004-02-12

    Proteins that inhibit alpha-amylases have been isolated from plants and microorganisms. These inhibitors can have natural roles in the control of endogenous alpha-amylase activity or in defence against pathogens and pests; certain inhibitors are reported to be antinutritional factors. The alpha-amylase inhibitors belong to seven different protein structural families, most of which also contain evolutionary related proteins without inhibitory activity. Two families include bifunctional inhibitors acting both on alpha-amylases and proteases. High-resolution structures are available of target alpha-amylases in complex with inhibitors from five families. These structures indicate major diversity but also some similarity in the structural basis of alpha-amylase inhibition. Mutational analysis of the mechanism of inhibition was performed in a few cases and various protein engineering and biotechnological approaches have been outlined for exploitation of the inhibitory function. PMID:14871655

  6. Background canceling surface alpha detector

    DOEpatents

    MacArthur, Duncan W.; Allander, Krag S.; Bounds, John A.

    1996-01-01

    A background canceling long range alpha detector which is capable of providing output proportional to both the alpha radiation emitted from a surface and to radioactive gas emanating from the surface. The detector operates by using an electrical field between first and second signal planes, an enclosure and the surface or substance to be monitored for alpha radiation. The first and second signal planes are maintained at the same voltage with respect to the electrically conductive enclosure, reducing leakage currents. In the presence of alpha radiation and radioactive gas decay, the signal from the first signal plane is proportional to both the surface alpha radiation and to the airborne radioactive gas, while the signal from the second signal plane is proportional only to the airborne radioactive gas. The difference between these two signals is proportional to the surface alpha radiation alone.

  7. Background canceling surface alpha detector

    DOEpatents

    MacArthur, D.W.; Allander, K.S.; Bounds, J.A.

    1996-06-11

    A background canceling long range alpha detector which is capable of providing output proportional to both the alpha radiation emitted from a surface and to radioactive gas emanating from the surface. The detector operates by using an electrical field between first and second signal planes, an enclosure and the surface or substance to be monitored for alpha radiation. The first and second signal planes are maintained at the same voltage with respect to the electrically conductive enclosure, reducing leakage currents. In the presence of alpha radiation and radioactive gas decay, the signal from the first signal plane is proportional to both the surface alpha radiation and to the airborne radioactive gas, while the signal from the second signal plane is proportional only to the airborne radioactive gas. The difference between these two signals is proportional to the surface alpha radiation alone. 5 figs.

  8. Substitutional and Interstitial Diffusion in alpha2-Ti3Al(O)

    NASA Technical Reports Server (NTRS)

    Copland, Evan; Young, David J.; Gleeson, Brian; Jacobson, Nathan

    2007-01-01

    The reaction between Al2O3 and alpha2-Ti3Al was studied with a series of Al2O3/alpha2-Ti3Al multiphase diffusion couples annealed at 900, 1000 and 1100 C. The diffusion-paths were found to strongly depend on alpha2- Ti3Al(O) composition. For alloys with low oxygen concentrations the reaction involved the reduction of Al2O3, the formation of a gamma-TiAl reaction-layer and diffusion of Al and O into the alpha2-Ti3Al substrate. Measured concentration profiles across the interaction-zone showed "up-hill" diffusion of O in alpha2-Ti3Al(O) indicating a significant thermodynamic interaction between O and Al, Ti or both. Diffusion coefficients for the interstitial O in alpha2-Ti3Al(O) were determined independently from the interdiffusion of Ti and Al on the substitutional lattice. Diffusion coefficients are reported for alpha2-Ti3Al(O) as well as gamma-TiAl. Interpretation of the results were aided with the subsequent measurement of the activities of Al, Ti and O in alpha 2-Ti3Al(O) by Knudsen effusion-cell mass spectrometry.

  9. Long range alpha particle detector

    DOEpatents

    MacArthur, D.W.; Wolf, M.A.; McAtee, J.L.; Unruh, W.P.; Cucchiara, A.L.; Huchton, R.L.

    1993-02-02

    An alpha particle detector capable of detecting alpha radiation from distant sources. In one embodiment, a high voltage is generated in a first electrically conductive mesh while a fan draws air containing air molecules ionized by alpha particles through an air passage and across a second electrically conductive mesh. The current in the second electrically conductive mesh can be detected and used for measurement or alarm. The detector can be used for area, personnel and equipment monitoring.

  10. Long range alpha particle detector

    DOEpatents

    MacArthur, Duncan W.; Wolf, Michael A.; McAtee, James L.; Unruh, Wesley P.; Cucchiara, Alfred L.; Huchton, Roger L.

    1993-01-01

    An alpha particle detector capable of detecting alpha radiation from distant sources. In one embodiment, a high voltage is generated in a first electrically conductive mesh while a fan draws air containing air molecules ionized by alpha particles through an air passage and across a second electrically conductive mesh. The current in the second electrically conductive mesh can be detected and used for measurement or alarm. The detector can be used for area, personnel and equipment monitoring.

  11. Water transport by the bacterial channel alpha-hemolysin

    NASA Technical Reports Server (NTRS)

    Paula, S.; Akeson, M.; Deamer, D.

    1999-01-01

    This study is an investigation of the ability of the bacterial channel alpha-hemolysin to facilitate water permeation across biological membranes. alpha-Hemolysin channels were incorporated into rabbit erythrocyte ghosts at varying concentrations, and water permeation was induced by mixing the ghosts with hypertonic sucrose solutions. The resulting volume decrease of the ghosts was followed by time-resolved optical absorption at pH 5, 6, and 7. The average single-channel permeability coefficient of alpha-hemolysin for water ranged between 1.3x10-12 cm/s and 1.5x10-12 cm/s, depending on pH. The slightly increased single-channel permeability coefficient at lower pH-values was attributed to an increase in the effective pore size. The activation energy of water transport through the channel was low (Ea=5.4 kcal/mol), suggesting that the properties of water inside the alpha-hemolysin channel resemble those of bulk water. This conclusion was supported by calculations based on macroscopic hydrodynamic laws of laminar water flow. Using the known three-dimensional structure of the channel, the calculations accurately predicted the rate of water flow through the channel. The latter finding also indicated that water permeation data can provide a good estimate of the pore size for large channels.

  12. Modeling Solar Lyman Alpha Irradiance

    NASA Technical Reports Server (NTRS)

    Pap, J.; Hudson, H. S.; Rottman, G. J.; Willson, R. C.; Donnelly, R. F.; London, J.

    1990-01-01

    Solar Lyman alpha irradiance is estimated from various solar indices using linear regression analyses. Models developed with multiple linear regression analysis, including daily values and 81-day running means of solar indices, predict reasonably well both the short- and long-term variations observed in Lyman alpha. It is shown that the full disk equivalent width of the He line at 1083 nm offers the best proxy for Lyman alpha, and that the total irradiance corrected for sunspot effect also has a high correlation with Lyman alpha.

  13. ISS Update: Alpha Magnetic Spectrometer

    NASA Video Gallery

    NASA Public Affairs Officer Kelly Humphries interviews Trent Martin, Johnson Space Center project manager for the Alpha Magnetic Spectrometer (AMS) aboard the International Space Station. Questions...

  14. Inbreeding coefficients and coalescence times.

    PubMed

    Slatkin, M

    1991-10-01

    This paper describes the relationship between probabilities of identity by descent and the distribution of coalescence times. By using the relationship between coalescence times and identity probabilities, it is possible to extend existing results for inbreeding coefficients in regular systems of mating to find the distribution of coalescence times and the mean coalescence times. It is also possible to express Sewall Wright's FST as the ratio of average coalescence times of different pairs of genes. That simplifies the analysis of models of subdivided populations because the average coalescence time can be found by computing separately the time it takes for two genes to enter a single subpopulation and time it takes for two genes in the same subpopulation to coalesce. The first time depends only on the migration matrix and the second time depends only on the total number of individuals in the population. This approach is used to find FST in the finite island model and in one- and two-dimensional stepping-stone models. It is also used to find the rate of approach of FST to its equilibrium value. These results are discussed in terms of different measures of genetic distance. It is proposed that, for the purposes of describing the amount of gene flow among local populations, the effective migration rate between pairs of local populations, M, which is the migration rate that would be estimated for those two populations if they were actually in an island model, provides a simple and useful measure of genetic similarity that can be defined for either allozyme or DNA sequence data.

  15. Statistical Estimation of the Atmospheric Aerosol Absorption Coefficient Based on the Data of Optical Measurements

    SciTech Connect

    Uzhegov, V.N.; Kozlov, V.S.; Panchenko, M.V.; Pkhalagov, Yu.A.; Pol'kin, V.V.; Terpugova, S.A.; Shmargunov, V.P.; Yausheva, E.P.

    2005-03-18

    The problem of the choice of the aerosol optical constants and, in particular, imaginary part of the refractive index of particles in visible and infrared (IR) wavelength ranges is very important for calculation of the global albedo of the atmosphere in climatic models. The available models of the aerosol optical constants obtained for the prescribed chemical composition of particles (see, for example, Ivlev et al. 1973; Ivlev 1982; Volz 1972), often are far from real aerosol. It is shown in (Krekov et al. 1982) that model estimates of the optical characteristics of the atmosphere depending on the correctness of real and imaginary parts of the aerosol complex refractive index can differ by some hundreds percent. It is known that the aerosol extinction coefficient {alpha}({lambda}) obtained from measurements on a long horizontal path can be represented as {alpha}({lambda})={sigma}({lambda})+{beta}({lambda}), where {sigma} is the directed light scattering coefficient, and {beta} is the aerosol absorption coefficient. The coefficient {sigma}({lambda}) is measured by means of a nephelometer. Seemingly, if measure the values {alpha}({lambda}) and {sigma}({lambda}), it is easy to determine the value {beta}({lambda}). However, in practice it is almost impossible for a number of reasons. Firstly, the real values {alpha}({lambda}) and {sigma}({lambda}) are very close to each other, and the estimate of the parameter {beta}({lambda}) is concealed by the errors of measurements. Secondly, the aerosol optical characteristics on the long path and in the local volume of nephelometer can be different, that also leads to the errors in estimating {beta}({lambda}). Besides, there are serious difficulties in performing spectral measurements of {sigma}({lambda}) in infrared wavelength range. Taking into account these circumstances, in this paper we consider the statistical technique, which makes it possible to estimate the absorption coefficient of real aerosol on the basis of analysis

  16. My Current Thoughts on Coefficient Alpha and Successor Procedures. CSE Report 643

    ERIC Educational Resources Information Center

    Cronbach, Lee J.

    2004-01-01

    Where the accuracy of a measurement is important, whether for scientific or practical purposes, the investigator should evaluate how much random error affects the measurement. New research may not be necessary when a procedure has been studied enough to establish how much error it involves. But, with new measures, or measures being transferred…

  17. A Reliability Generalization Meta-Analysis of Coefficient Alpha for the Maslach Burnout Inventory

    ERIC Educational Resources Information Center

    Wheeler, Denna L.; Vassar, Matt; Worley, Jody A.; Barnes, Laura L. B.

    2011-01-01

    The purpose of this study was to synthesize internal consistency reliability for the subscale scores on the Maslach Burnout Inventory (MBI). The authors addressed three research questions: (a) What is the mean subscale score reliability for the MBI across studies? (b) What factors are associated with observed variance in MBI subscale score…

  18. Reliability of Summed Item Scores Using Structural Equation Modeling: An Alternative to Coefficient Alpha

    ERIC Educational Resources Information Center

    Green, Samuel B.; Yang, Yanyun

    2009-01-01

    A method is presented for estimating reliability using structural equation modeling (SEM) that allows for nonlinearity between factors and item scores. Assuming the focus is on consistency of summed item scores, this method for estimating reliability is preferred to those based on linear SEM models and to the most commonly reported estimate of…

  19. Resting alpha activity predicts learning ability in alpha neurofeedback

    PubMed Central

    Wan, Feng; Nan, Wenya; Vai, Mang I.; Rosa, Agostinho

    2014-01-01

    Individuals differ in their ability to learn how to regulate the brain activity by neurofeedback. This study aimed to investigate whether the resting alpha activity can predict the learning ability in alpha neurofeedback. A total of 25 subjects performed 20 sessions of individualized alpha neurofeedback and the learning ability was assessed by three indices respectively: the training parameter changes between two periods, within a short period and across the whole training time. It was found that the resting alpha amplitude measured before training had significant positive correlations with all learning indices and could be used as a predictor for the learning ability prediction. This finding would help the researchers in not only predicting the training efficacy in individuals but also gaining further insight into the mechanisms of alpha neurofeedback. PMID:25071528

  20. Alpha Magnetic Spectrometer

    NASA Astrophysics Data System (ADS)

    Ting, Samuel

    2012-07-01

    The Alpha Magnetic Spectrometer (AMS) is a precision particle physics magnetic spectrometer designed to measure electrons, positrons, gamma rays and various nuclei and anti-nuclei from the cosmos up to TeV energy ranges. AMS weighs 7.5 tons and measures 5 meters by 4 meters by 3 meters. It contains 300,000 channels of electronics and 650 onboard microprocessors. It was delivered to the International Space Station onboard space shuttle Endeavour and installed on May 19, 2011. Since that time, more than 14 billion cosmic ray events have been collected. All the detectors function properly. At this moment, we are actively engaged in data analysis. AMS is an international collaboration involving 16 countries and 60 institutes. It took 16 years to construct and test. AMS is the only major physical science experiment on the International Space Station and will continue to collect data over the entire lifetime of the Space Station (10-20 years).

  1. Microscopic cluster model of {alpha}+n, {alpha}+p, {alpha}+ {sup 3}He, and {alpha}+{alpha} elastic scattering from a realistic effective nuclear interaction

    SciTech Connect

    Dohet-Eraly, J.; Baye, D.

    2011-07-15

    An effective nucleon-nucleon interaction adapted to cluster-model calculations of collisions is derived from the realistic Argonne potential AV18 with the unitary correlation operator method. The unitary correlation is determined from the {alpha}+{alpha} elastic phase shifts calculated in a cluster approach by the generator coordinate method coupled with the microscopic R-matrix method. With this interaction, the elastic phase shifts for the {alpha}+n, {alpha}+p, and {alpha}+{sup 3}He collisions are calculated within the same model. Without further adjustment, a good agreement with experimental data is obtained with a small model space.

  2. Gas-film coefficients for streams

    USGS Publications Warehouse

    Rathbun, R.E.; Tai, D.Y.

    1983-01-01

    Equations for predicting the gas-film coefficient for the volatilization of organic solutes from streams are developed. The film coefficient is a function of windspeed and water temperature. The dependence of the coefficient on windspeed is determined from published information on the evaporation of water from a canal. The dependence of the coefficient on temperature is determined from laboratory studies on the evaporation of water. Procedures for adjusting the coefficients for different organic solutes are based on the molecular diffusion coefficient and the molecular weight. The molecular weight procedure is easiest to use because of the availability of molecular weights. However, the theoretical basis of the procedure is questionable. The diffusion coefficient procedure is supported by considerable data. Questions, however, remain regarding the exact dependence of the film coefficint on the diffusion coefficient. It is suggested that the diffusion coefficient procedure with a 0.68-power dependence be used when precise estimate of the gas-film coefficient are needed and that the molecular weight procedure be used when only approximate estimates are needed.

  3. Alpha particle emitters in medicine

    SciTech Connect

    Fisher, D.R.

    1989-09-01

    Radiation-induced cancer of bone, liver and lung has been a prominent harmful side-effect of medical applications of alpha emitters. In recent years, however, the potential use of antibodies labeled with alpha emitting radionuclides against cancer has seemed promising because alpha particles are highly effective in cell killing. High dose rates at high LET, effectiveness under hypoxic conditions, and minimal expectancy of repair are additional advantages of alpha emitters over antibodies labeled with beta emitting radionuclides for cancer therapy. Cyclotron-produced astatine-211 ({sup 211}At) and natural bismuth-212 ({sup 212}Bi) have been proposed and are under extensive study in the United States and Europe. Radium-223 ({sup 223}Ra) also has favorable properties as a potential alpha emitting label, including a short-lived daughter chain with four alpha emissions. The radiation dosimetry of internal alpha emitters is complex due to nonuniformly distributed sources, short particle tracks, and high relative specific ionization. The variations in dose at the cellular level may be extreme. Alpha-particle radiation dosimetry, therefore, must involve analysis of statistical energy deposition probabilities for cellular level targets. It must also account fully for nonuniform distributions of sources in tissues, source-target geometries, and particle-track physics. 18 refs., 4 figs.

  4. Gas phase hydrogen permeation in alpha titanium and carbon steels

    NASA Technical Reports Server (NTRS)

    Johnson, D. L.; Shah, K. K.; Reeves, B. H.; Gadgeel, V. L.

    1980-01-01

    Commercially pure titanium and heats of Armco ingot iron and steels containing from 0.008-1.23 w/oC were annealed or normalized and machined into hollow cylinders. Coefficients of diffusion for alpha-Ti and alpha-Fe were determined by the lag-time technique. Steady state permeation experiments yield first power pressure dependence for alpha-Ti and Sievert's law square root dependence for Armco iron and carbon steels. As in the case of diffusion, permeation data confirm that alpha-titanium is subject to at least partial phase boundary reaction control while the steels are purely diffusion controlled. The permeation rate in steels also decreases as the carbon content increases. As a consequence of Sievert's law, the computed hydrogen solubility decreases as the carbon content increases. This decreases in explained in terms of hydrogen trapping at carbide interfaces. Oxidizing and nitriding the surfaces of alpha-titanium membranes result in a decrease in the permeation rate for such treatment on the gas inlet surfaces but resulted in a slight increase in the rate for such treatment on the gas outlet surfaces. This is explained in terms of a discontinuous TiH2 layer.

  5. Gross alpha analytical modifications that improve wastewater treatment compliance

    SciTech Connect

    Tucker, B.J.; Arndt, S.

    2007-07-01

    This paper will propose an improvement to the gross alpha measurement that will provide more accurate gross alpha determinations and thus allow for more efficient and cost-effective treatment of site wastewaters. To evaluate the influence of salts that may be present in wastewater samples from a potentially broad range of environmental conditions, two types of efficiency curves were developed, each using a thorium-230 (Th-230) standard spike. Two different aqueous salt solutions were evaluated, one using sodium chloride, and one using salts from tap water drawn from the Bergen County, New Jersey Publicly Owned Treatment Works (POTW). For each curve, 13 to 17 solutions were prepared, each with the same concentration of Th-230 spike, but differing in the total amount of salt in the range of 0 to 100 mg. The attenuation coefficients were evaluated for the two salt types by plotting the natural log of the counted efficiencies vs. the weight of the sample's dried residue retained on the planchet. The results show that the range of the slopes for each of the attenuation curves varied by approximately a factor of 2.5. In order to better ensure the accuracy of results, and thus verify compliance with the gross alpha wastewater effluent criterion, projects depending on gross alpha measurements of environmental waters and wastewaters should employ gross alpha efficiency curves prepared with salts that mimic, as closely as possible, the salt content of the aqueous environmental matrix. (authors)

  6. Prevalence of -alpha(3.7) and alpha alpha alpha(anti3.7) alleles in sickle cell trait and beta-thalassemia patients in Mexico.

    PubMed

    Nava, María Paulina; Ibarra, Bertha; Magaña, María Teresa; de la Luz Chávez, María; Perea, F Javier

    2006-01-01

    The aim of this study was to determine the frequency of alpha-globin gene mutations in three groups of Mexican unrelated individuals. The first two groups were normal and sickle cell trait individuals from the Costa Chica region, a place with a 12.8% frequency of HbS carriers, and the third group comprised of Mexican mestizo patients with beta-thalassemia. We searched for -alpha(3.7) and -alpha(4.2) alpha(+)-thalassemia deletion alleles, as well as the alpha alpha alpha(anti3.7) triplication through long-gap PCR. The alleles -alpha(3.7) and alpha alpha alpha(anti3.7) were found in the heterozygote state only; 19% of the normal subjects had the -alpha(3.7) allele, and 2% showed the alpha alpha alpha(anti3.7) allele. In individuals with the sickle cell trait, 17% had the -alpha(3.7) deletion, and the alpha alpha alpha(anti3.7) triplication was observed in 3% of these individuals. We revealed that 16% of the subjects with beta-thalassemia showed the -alpha(3.7) deletion and 28% the alpha alpha alpha(anti3.7) triplication. The -alpha(4.2) deletion was not detected in any individual. The frequency of the -alpha(3.7) allele was roughly the same in the three groups studied; this can be explained by the fact that the three groups have common genes from Africa and the Mediterranean, where a high prevalence of alpha(+)-thalassemia has been observed. To our knowledge, the frequency of alpha alpha alpha(anti3.7) triplication observed in the Mexican beta-thalassemia patients is the highest reported. As the -alpha(3.7) and alpha alpha alpha(anti3.7) alleles are very common in our selected populations, we believe that there is a need to investigate systematically the alpha-globin gene mutations in all hemoglobinopathies in the Mexican population.

  7. Genetics Home Reference: alpha-mannosidosis

    MedlinePlus

    ... Me Understand Genetics Home Health Conditions alpha-mannosidosis alpha-mannosidosis Enable Javascript to view the expand/collapse boxes. Download PDF Open All Close All Description Alpha-mannosidosis is a rare inherited disorder that causes ...

  8. The effect of core configuration on temperature coefficient of reactivity in IRR-1

    SciTech Connect

    Bettan, M.; Silverman, I.; Shapira, M.; Nagler, A.

    1997-08-01

    Experiments designed to measure the effect of coolant moderator temperature on core reactivity in an HEU swimming pool type reactor were performed. The moderator temperature coefficient of reactivity ({alpha}{sub {omega}}) was obtained and found to be different in two core loadings. The measured {alpha}{sub {omega}} of one core loading was {minus}13 pcm/{degrees}C at the temperature range of 23-30{degrees}C. This value of {alpha}{sub {omega}} is comparable to the data published by the IAEA. The {alpha}{sub {omega}} measured in the second core loading was found to be {minus}8 pcm/{degrees}C at the same temperature range. Another phenomenon considered in this study is core behavior during reactivity insertion transient. The results were compared to a core simulation using the Dynamic Simulator for Nuclear Power Plants. It was found that in the second core loading factors other than the moderator temperature influence the core reactivity more than expected. These effects proved to be extremely dependent on core configuration and may in certain core loadings render the reactor`s reactivity coefficient undesirable.

  9. [Regulation of lipid metabolism in blood of weaving shop workers (noise level of about 90 dB A) by alpha-tocopherol acetate].

    PubMed

    Melkonian, M M

    1993-01-01

    alpha-Tocopherol acetate, used for repeated treatment within a year of weavers working under highly uncomfortable conditions (the level of noise up to 90 dB), was shown to exhibit the regulating effect on the rate of lipid peroxidation and on content of alpha-tocopherol and cholesterol in blood plasma and erythrocyte membranes as well as on the ratios alpha-tocopherol acetate/total lipids, alpha-tocopherol acetate/cholesterol in blood plasma and cholesterol/alpha-tocopherol acetate in erythrocyte membranes. The vitamin decreased distinctly the atherogenicity coefficient; these data suggest that treatment with tocopherol is essential for prophylaxis of noise-produced impairments.

  10. Alpha-particle spectrometer experiment

    NASA Technical Reports Server (NTRS)

    Gorenstein, P.; Bjorkholm, P.

    1972-01-01

    Mapping the radon emanation of the moon was studied to find potential areas of high activity by detection of radon isotopes and their daughter products. It was felt that based on observation of regions overflown by Apollo spacecraft and within the field of view of the alpha-particle spectrometer, a radon map could be constructed, identifying and locating lunar areas of outgassing. The basic theory of radon migration from natural concentrations of uranium and thorium is discussed in terms of radon decay and the production of alpha particles. The preliminary analysis of the results indicates no significant alpha emission.

  11. Electron and hole impact ionization coefficients in GaAs-Al(x)Ga(1-x)As superlattices

    NASA Technical Reports Server (NTRS)

    Juang, F.-Y.; Das, U.; Nashimoto, Y.; Bhattacharya, P. K.

    1985-01-01

    Electron and hole multiplication and impact ionization coefficients have been measured with pure carrier injection in p(+)-n(-)-n(+) diodes grown by molecular beam epitaxy. Values of the electron and hole ionization coefficient ratio alpha/beta = 2-5 are measured for superlattices with well width Lz greater than or equal to 100 A and alpha/beta greater than 10 is measured in a graded band-gap superlattice with a total well and barrier width LB + LZ = 120 A. The ratio decreases and becomes less than unity for smaller well sizes. This is caused by an increase in beta (E) while alpha (E) remains fairly constant. The results have been interpreted by considering varying hole confinement and scattering in the coupled quantum wells.

  12. Trace element partition coefficient in ionic crystals.

    PubMed

    Nagasawa, H

    1966-05-01

    Partition coefficient monovalent trace ions between liquids and either solid NaNO(2) or KCl were determined. The isotropic elastic model of ionic crystals was used for calculating the energy change caused by the ionic substitutions. The observed values of partition coefficients in KCl good agreement with calculate values.

  13. Implications of NGA for NEHRP site coefficients

    USGS Publications Warehouse

    Borcherdt, Roger D.

    2012-01-01

    Three proposals are provided to update tables 11.4-1 and 11.4-2 of Minimum Design Loads for Buildings and Other Structures (7-10), by the American Society of Civil Engineers (2010) (ASCE/SEI 7-10), with site coefficients implied directly by NGA (Next Generation Attenuation) ground motion prediction equations (GMPEs). Proposals include a recommendation to use straight-line interpolation to infer site coefficients at intermediate values of ̅vs (average shear velocity). Site coefficients are recommended to ensure consistency with ASCE/SEI 7-10 MCER (Maximum Considered Earthquake) seismic-design maps and simplified site-specific design spectra procedures requiring site classes with associated tabulated site coefficients and a reference site class with unity site coefficients. Recommended site coefficients are confirmed by independent observations of average site amplification coefficients inferred with respect to an average ground condition consistent with that used for the MCER maps. The NGA coefficients recommended for consideration are implied directly by the NGA GMPEs and do not require introduction of additional models.

  14. A gain-coefficient switched Alexandrite laser

    NASA Astrophysics Data System (ADS)

    Lee, Chris J.; van der Slot, Peter J. M.; Boller, Klaus-J.

    2013-01-01

    We report on a gain-coefficient switched Alexandrite laser. An electro-optic modulator is used to switch between high and low gain states by making use of the polarization dependent gain of Alexandrite. In gain-coefficient switched mode, the laser produces 85 ns pulses with a pulse energy of 240 mJ at a repetition rate of 5 Hz.

  15. Code System to Calculate Correlation & Regression Coefficients.

    1999-11-23

    Version 00 PCC/SRC is designed for use in conjunction with sensitivity analyses of complex computer models. PCC/SRC calculates the partial correlation coefficients (PCC) and the standardized regression coefficients (SRC) from the multivariate input to, and output from, a computer model.

  16. Docosahexaenoic acid synthesis from alpha-linolenic acid by rat brain is unaffected by dietary n-3 PUFA deprivation.

    PubMed

    Igarashi, Miki; DeMar, James C; Ma, Kaizong; Chang, Lisa; Bell, Jane M; Rapoport, Stanley I

    2007-05-01

    Rates of conversion of alpha-linolenic acid (alpha-LNA, 18:3n-3) to docosahexaenoic acid (DHA, 22:6n-3) by the mammalian brain and the brain's ability to upregulate these rates during dietary deprivation of n-3 polyunsaturated fatty acids (PUFAs) are unknown. To answer these questions, we measured conversion coefficients and rates in post-weaning rats fed an n-3 PUFA deficient (0.2% alpha-LNA of total fatty acids, no DHA) or adequate (4.6% alpha-LNA, no DHA) diet for 15 weeks. Unanesthetized rats in each group were infused intravenously with [1-(14)C]alpha-LNA, and their arterial plasma and microwaved brains collected at 5 minutes were analyzed. The deficient compared with adequate diet reduced brain DHA by 37% and increased brain arachidonic (20:4n-6) and docosapentaenoic (22:5n-6) acids. Only 1% of plasma [1-(14)C]alpha-LNA entering brain was converted to DHA with the adequate diet, and conversion coefficients of alpha-LNA to DHA were unchanged by the deficient diet. In summary, the brain's ability to synthesize DHA from alpha-LNA is very low and is not altered by n-3 PUFA deprivation. Because the liver's reported ability is much higher, and can be upregulated by the deficient diet, DHA converted by the liver from circulating alphaLNA is the source of the brain's DHA when DHA is not in the diet.

  17. An agreement coefficient for image comparison

    USGS Publications Warehouse

    Ji, L.; Gallo, K.

    2006-01-01

    Combination of datasets acquired from different sensor systems is necessary to construct a long time-series dataset for remotely sensed land-surface variables. Assessment of the agreement of the data derived from various sources is an important issue in understanding the data continuity through the time-series. Some traditional measures, including correlation coefficient, coefficient of determination, mean absolute error, and root mean square error, are not always optimal for evaluating the data agreement. For this reason, we developed a new agreement coefficient for comparing two different images. The agreement coefficient has the following properties: non-dimensional, bounded, symmetric, and distinguishable between systematic and unsystematic differences. The paper provides examples of agreement analyses for hypothetical data and actual remotely sensed data. The results demonstrate that the agreement coefficient does include the above properties, and therefore is a useful tool for image comparison. ?? 2006 American Society for Photogrammetry and Remote Sensing.

  18. Estimating Tortuosity Coefficients Based on Hydraulic Conductivity.

    PubMed

    Carey, Grant R; McBean, Edward A; Feenstra, Stan

    2016-07-01

    While the tortuosity coefficient is commonly estimated using an expression based on total porosity, this relationship is demonstrated to not be applicable (and thus is often misapplied) over a broad range of soil textures. The fundamental basis for a correlation between the apparent diffusion tortuosity coefficient and hydraulic conductivity is demonstrated, although such a relationship is not typically considered. An empirical regression for estimating the tortuosity coefficient based on hydraulic conductivity for saturated, unconsolidated soil is derived based on results from 14 previously reported diffusion experiments performed with a broad range of soil textures. Analyses of these experimental results confirm that total porosity is a poor predictor for the tortuosity coefficient over a large range of soil textures. The apparent diffusion tortuosity coefficient is more reliably estimated based on hydraulic conductivity. PMID:27315019

  19. Alpha--College for Exploring

    ERIC Educational Resources Information Center

    Leppert, William; Koenig, Joan

    1976-01-01

    Describes Alpha, the experimental college of individualized instruction at the College of DuPage (Illinois). At this college, students design their own curricula and work in an open classroom situation, and teachers start with students instead of subjects. (DC)

  20. Genetics Home Reference: alpha thalassemia

    MedlinePlus

    ... in each cell. Each copy is called an allele. For each gene, one allele is inherited from a person's father, and the ... person's mother. As a result, there are four alleles that produce alpha-globin. The different types of ...

  1. Detecting Alpha-1 Antitrypsin Deficiency.

    PubMed

    Stoller, James K

    2016-08-01

    Alpha-1 antitrypsin deficiency is a widely underrecognized condition, with evidence of persisting long diagnostic delays and patients' frequent need to see multiple physicians before initial diagnosis. Reasons for underrecognition include inadequate understanding of alpha-1 antitrypsin deficiency by physicians and allied health care providers; failure to implement available, guideline-based practice recommendations; and the belief that effective therapy is unavailable. Multiple studies have described both the results of screening and targeted detection of individuals with alpha-1 antitrypsin deficiency, with both varying strategies employed to identify at-risk individuals and varying results of testing. Also, various strategies to enhance detection of affected individuals have been examined, including use of the electronic medical record to prompt testing and empowerment of allied health providers, especially respiratory therapists, to promote testing for alpha-1 antitrypsin deficiency. Such efforts are likely to enhance detection with the expected result that the harmful effects of delayed diagnosis can be mitigated. PMID:27564667

  2. Alpha Magnetic Spectrometer (AMS) Overview

    NASA Video Gallery

    The Alpha Magnetic Spectrometer (AMS) is flying to the station on STS-134. The AMS experiment is a state-of-the-art particle physics detector being operated by an international team composed of 60 ...

  3. Synthesis and herbicidal activity of novel alpha,alpha,alpha-trifluoro-m-tolyl pyridazinone derivatives.

    PubMed

    Xu, Han; Zou, Xiao-Mao; Zhu, You-Quan; Liu, Bin; Tao, Han-Lin; Hu, Xu-Hong; Song, Hai-Bin; Hu, Fang-Zhong; Wang, Yong; Yang, Hua-Zheng

    2006-06-01

    A series of novel alpha,alpha,alpha-trifluoro-m-tolyl pyridazinone derivatives was synthesised. Herbicidal activities of the two intermediate compounds and 15 pyridazinone derivatives were evaluated through barnyardgrass and rape cup tests and Spirodela polyrrhiza (L.) Schleiden tests. Selected compounds were also evaluated under greenhouse conditions. Bleaching activities were observed at 10 microg ml(-1) and some compounds exhibited herbicidal activities at a rate of 300 g ha(-1). The relationship between crystal structures and herbicidal activities is discussed through a comparison of two compounds (5a and 5f). PMID:16602079

  4. Alpha decay in electron surrounding

    SciTech Connect

    Igashov, S. Yu.; Tchuvil’sky, Yu. M.

    2013-12-15

    The influence of atomic electron shells on the constant of alpha decay of heavy and mediummass nuclei was considered in detail. A method for simultaneously taking into account the change in the potential-barrier shape and the effect of reflection of a diverging Coulomb wave in the classically allowed region was developed. The ratios of decay probabilities per unit time for a bare nucleus and the respective neutral atom were found for some alpha-decaying isotopes.

  5. Spreading coefficients of aliphatic hydrocarbons on water

    SciTech Connect

    Takii, Taichi; Mori, Y.H. . Dept. of Mechanical Engineering)

    1993-11-01

    Experiments have been performed to determine the equilibrium spreading coefficients of some aliphatic hydrocarbons (C[sub 6]C[sub 10]) on water. The thickness of a discrete lens of each hydrocarbon sample floating on a stagnant water pool was measured interferometrically and used to calculate the spreading coefficient of the hydrocarbon with the aid of Langmuir's capillarity theory. The dependences of the spreading coefficient, thus observed, on temperature (0--50 C) and on the number of carbon atoms in the hydrocarbon molecule are in qualitative agreement with the predictions based on the Lifshitz theory of van der Waals forces.

  6. Statistical Methods with Varying Coefficient Models

    PubMed Central

    Fan, Jianqing; Zhang, Wenyang

    2008-01-01

    The varying coefficient models are very important tool to explore the dynamic pattern in many scientific areas, such as economics, finance, politics, epidemiology, medical science, ecology and so on. They are natural extensions of classical parametric models with good interpretability and are becoming more and more popular in data analysis. Thanks to their flexibility and interpretability, in the past ten years, the varying coefficient models have experienced deep and exciting developments on methodological, theoretical and applied sides. This paper gives a selective overview on the major methodological and theoretical developments on the varying coefficient models. PMID:18978950

  7. Inferences on the common coefficient of variation.

    PubMed

    Tian, Lili

    2005-07-30

    The coefficient of variation is often used as a measure of precision and reproducibility of data in medical and biological science. This paper considers the problem of making inference about the common population coefficient of variation when it is a priori suspected that several independent samples are from populations with a common coefficient of variation. The procedures for confidence interval estimation and hypothesis testing are developed based on the concepts of generalized variables. The coverage properties of the proposed confidence intervals and type-I errors of the proposed tests are evaluated by simulation. The proposed methods are illustrated by a real life example.

  8. Measuring optical temperature coefficients of Intralipid.

    PubMed

    McGlone, V Andrew; Martinsen, Paul; Künnemeyer, Rainer; Jordan, Bob; Cletus, Biju

    2007-05-01

    The temperature sensitivities of absorption and reduced scattering coefficients in the range 700-1000 nm are determined for the liquid phantom Intralipid using spatially resolved continuous wave measurements. The measurements were conducted on a 10 L heated volume of 1% Intralipid subjected to a 40-30 degrees C cooling regime. The temperature sensitivities of the absorbance coefficients are similar to that expected for pure water. However, the reduced scattering coefficients are more sensitive than can be explained by temperature related density changes, and show an unexpected relationship with wavelength. We have also found that temperature perturbations provide a useful means to evaluate instrument model performance. PMID:17440240

  9. On the emission coefficient of uranium plasmas.

    NASA Technical Reports Server (NTRS)

    Schneider, R. T.; Campbell, H. D.; Mack, J. M.

    1973-01-01

    The emission coefficient for uranium plasmas (temperature: 8000 K) was measured for the wavelength range from 1200 to 6000 A. The results were compared to theoretical calculations and other measurements. Reasonable agreement between theoretical predictions and our measurements was found in the region from 1200 to 2000 A. Although it was difficult to make absolute comparisons among the different reported measurements, considerable disagreement was found for the higher wavelength region. A short discussion regarding the overall comparisons is given, and final suggestions are made as to the most appropriate emission coefficient values to be used in future design calculations. The absorption coefficient for the same wavelength interval is also reported.

  10. 21 CFR 882.1610 - Alpha monitor.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Alpha monitor. 882.1610 Section 882.1610 Food and... NEUROLOGICAL DEVICES Neurological Diagnostic Devices § 882.1610 Alpha monitor. (a) Identification. An alpha... electroencephalogram which is referred to as the alpha wave. (b) Classification. Class II (performance standards)....

  11. 21 CFR 882.1610 - Alpha monitor.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Alpha monitor. 882.1610 Section 882.1610 Food and... NEUROLOGICAL DEVICES Neurological Diagnostic Devices § 882.1610 Alpha monitor. (a) Identification. An alpha... electroencephalogram which is referred to as the alpha wave. (b) Classification. Class II (performance standards)....

  12. 21 CFR 882.1610 - Alpha monitor.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Alpha monitor. 882.1610 Section 882.1610 Food and... NEUROLOGICAL DEVICES Neurological Diagnostic Devices § 882.1610 Alpha monitor. (a) Identification. An alpha... electroencephalogram which is referred to as the alpha wave. (b) Classification. Class II (performance standards)....

  13. Binding of actin to lens alpha crystallins

    NASA Technical Reports Server (NTRS)

    Gopalakrishnan, S.; Takemoto, L.; Spooner, B. S. (Principal Investigator)

    1992-01-01

    Actin has been coupled to a cyanogen bromide-activated Sepharose 4B column, then tested for binding to alpha, beta, and gamma crystallin preparations from the bovine lens. Alpha, but not beta or gamma, crystallins bound to the actin affinity column in a time dependent and saturable manner. Subfractionation of the alpha crystallin preparation into the alpha-A and alpha-B species, followed by incubation with the affinity column, demonstrated that both species bound approximately the same. Together, these studies demonstrate a specific and saturable binding of lens alpha-A and alpha-B with actin.

  14. Heat transfer coefficient of cryotop during freezing.

    PubMed

    Li, W J; Zhou, X L; Wang, H S; Liu, B L; Dai, J J

    2013-01-01

    Cryotop is an efficient vitrification method for cryopreservation of oocytes. It has been widely used owing to its simple operation and high freezing rate. Recently, the heat transfer performance of cryotop was studied by numerical simulation in several studies. However, the range of heat transfer coefficient in the simulation is uncertain. In this study, the heat transfer coefficient for cryotop during freezing process was analyzed. The cooling rates of 40 percent ethylene glycol (EG) droplet in cryotop during freezing were measured by ultra-fast measurement system and calculated by numerical simulation at different value of heat transfer coefficient. Compared with the results obtained by two methods, the range of the heat transfer coefficient necessary for the numerical simulation of cryotop was determined, which is between 9000 W/(m(2)·K) and 10000 W/(m (2)·K).

  15. Friction coefficient dependence on electrostatic tribocharging

    PubMed Central

    Burgo, Thiago A. L.; Silva, Cristiane A.; Balestrin, Lia B. S.; Galembeck, Fernando

    2013-01-01

    Friction between dielectric surfaces produces patterns of fixed, stable electric charges that in turn contribute electrostatic components to surface interactions between the contacting solids. The literature presents a wealth of information on the electronic contributions to friction in metals and semiconductors but the effect of triboelectricity on friction coefficients of dielectrics is as yet poorly defined and understood. In this work, friction coefficients were measured on tribocharged polytetrafluoroethylene (PTFE), using three different techniques. As a result, friction coefficients at the macro- and nanoscales increase many-fold when PTFE surfaces are tribocharged, but this effect is eliminated by silanization of glass spheres rolling on PTFE. In conclusion, tribocharging may supersede all other contributions to macro- and nanoscale friction coefficients in PTFE and probably in other insulating polymers. PMID:23934227

  16. Second coefficient of viscosity in air

    NASA Technical Reports Server (NTRS)

    Ash, Robert L.; Zuckerwar, Allan J.; Zheng, Zhonquan

    1991-01-01

    Acoustic attenuation measurements in air were analyzed in order to estimate the second coefficient of viscosity. Data over a temperature range of 11 C to 50 C and at relative humidities between 6 percent and 91 percent were used. This analysis showed that the second coefficient of viscosity varied between 1900 and 20,000 times larger than the dynamic or first coefficient of viscosity over the temperature and humidity range of the data. In addition, the data showed that the molecular relaxation effects, which are responsible for the magnitude of the second coefficient of viscosity, place severe limits on the use of time-independent, thermodynamic equations of state. Compressible flows containing large streamwise velocity gradients, like shock waves, which cause significant changes in particle properties to occur during time intervals shorter than hundredths of seconds, must be modeled using dynamic equations of state. The dynamic model approach is described briefly.

  17. Friction coefficient dependence on electrostatic tribocharging.

    PubMed

    Burgo, Thiago A L; Silva, Cristiane A; Balestrin, Lia B S; Galembeck, Fernando

    2013-01-01

    Friction between dielectric surfaces produces patterns of fixed, stable electric charges that in turn contribute electrostatic components to surface interactions between the contacting solids. The literature presents a wealth of information on the electronic contributions to friction in metals and semiconductors but the effect of triboelectricity on friction coefficients of dielectrics is as yet poorly defined and understood. In this work, friction coefficients were measured on tribocharged polytetrafluoroethylene (PTFE), using three different techniques. As a result, friction coefficients at the macro- and nanoscales increase many-fold when PTFE surfaces are tribocharged, but this effect is eliminated by silanization of glass spheres rolling on PTFE. In conclusion, tribocharging may supersede all other contributions to macro- and nanoscale friction coefficients in PTFE and probably in other insulating polymers.

  18. Universal relations of transport coefficients from holography

    SciTech Connect

    Cherman, Aleksey; Nellore, Abhinav

    2009-09-15

    We show that there are universal high-temperature relations for transport coefficients of plasmas described by a wide class of field theories with gravity duals. These theories can be viewed as strongly coupled large-N{sub c} conformal field theories deformed by one or more relevant operators. The transport coefficients we study are the speed of sound and bulk viscosity, as well as the conductivity, diffusion coefficient, and charge susceptibility of probe U(1) charges. We show that the sound bound v{sub s}{sup 2}{<=}1/3 is satisfied at high temperatures in these theories and also discuss bounds on the diffusion coefficient, the conductivity, and the bulk viscosity.

  19. String & Sticky Tape Experiments: Coefficient of Restitution.

    ERIC Educational Resources Information Center

    Edge, R. D., Ed.

    1988-01-01

    Described is an experiment for measuring the coefficient of restitution with a meter stick, balls of different types, and scraps of material for the plates. Provides the experimental procedure and an apparatus diagram. (YP)

  20. [Alpha-Synuclein in blood and cerebrospinal fluid of patients with alpha-synucleinopathy].

    PubMed

    Ono, Kenjiro; Yamada, Masahito

    2014-03-01

    Alpha-Synuclein protein(alphaS) aggregates from a monomer to assemblies such as oligomers, protofibrils, and mature fibrils. The early intermediate aggregate, that is, the oligomer, has been reported to be the most toxic species. We recently reported that melatonin inhibits alphaS aggregation, including protofibril and oligomer formations. While the alphaS concentration in cerebrospinal fluid was reported to significantly decrease in patients with Parkinson's disease (PD) and dementia with Lewy bodies, there have been reports that the alphaS oligomer concentration was elevated in the cerebrospinal fluid of PD patients. Moreover, it was reported that the alphaS oligomer concentration was also elevated in the blood of PD patients. Further studies may establish alphaS in cerebrospinal fluid and blood as a biomarker of alpha-synucleinopathies, including PD.

  1. On computing Laplace's coefficients and their derivatives.

    NASA Astrophysics Data System (ADS)

    Gerasimov, I. A.; Vinnikov, E. L.

    The algorithm of computing Laplace's coefficients and their derivatives is proposed with application of recurrent relations. The A.G.M.-method is used for the calculation of values L0(0), L0(1). The FORTRAN-program corresponding to the algorithm is given. The precision control was provided with numerical integrating by Simpsons method. The behavior of Laplace's coefficients and their third derivatives whith varying indices K, n for fixed values of the α-parameter is presented graphically.

  2. Mechanism of alpha-tocopheryl-phosphate (alpha-TP) transport across the cell membrane

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We have reported that alpha-TP is synthesized and hydrolyzed in animal cells and tissues; it modulates also several cell functions (FRBM 39:970, and UBMB Life, 57:23, 2005). While it is similar to alpha-tocopherol (alpha-T), alpha-TP appears to be more potent than alpha-T in inhibiting cell prolifer...

  3. Workshop on Precision Measurements of $\\alpha_s$

    SciTech Connect

    Bethke, Siegfried; Hoang, Andre H.; Kluth, Stefan; Schieck, Jochen; Stewart, Iain W.; Aoki, S.; Beneke, M.; Bethke, S.; Blumlein, J.; Brambilla, N.; Brodsky, S.; /MIT, LNS

    2011-10-01

    These are the proceedings of the Workshop on Precision Measurements of {alpha}{sub s} held at the Max-Planck-Institute for Physics, Munich, February 9-11, 2011. The workshop explored in depth the determination of {alpha}{sub s}(m{sub Z}) in the {ovr MS} scheme from the key categories where high precision measurements are currently being made, including DIS and global PDF fits, {tau}-decays, electro-weak precision observables and Z-decays, event-shapes, and lattice QCD. These proceedings contain a short summary contribution from the speakers, as well as the lists of authors, conveners, participants, and talks.

  4. Estimating Ordinal Reliability for Likert-Type and Ordinal Item Response Data: A Conceptual, Empirical, and Practical Guide

    ERIC Educational Resources Information Center

    Gadermann, Anne M.; Guhn, Martin; Zumbo, Bruno D.

    2012-01-01

    This paper provides a conceptual, empirical, and practical guide for estimating ordinal reliability coefficients for ordinal item response data (also referred to as Likert, Likert-type, ordered categorical, or rating scale item responses). Conventionally, reliability coefficients, such as Cronbach's alpha, are calculated using a Pearson…

  5. Effect of Items Direction (Positive or Negative) on the Reliability in Likert Scale. Paper-11

    ERIC Educational Resources Information Center

    Gul, Showkeen Bilal Ahmad; Qasem, Mamun Ali Naji; Bhat, Mehraj Ahmad

    2015-01-01

    In this paper an attempt was made to analyze the effect of items direction (positive or negative) on the Alpha Cronbach reliability coefficient and the Split Half reliability coefficient in Likert scale. The descriptive survey research method was used for the study and sample of 510 undergraduate students were selected by used random sampling…

  6. A study of multiplicative watermark detection in the contourlet domain using alpha-stable distributions.

    PubMed

    Sadreazami, Hamidreza; Ahmad, M Omair; Swamy, M N S

    2014-10-01

    In the past decade, several schemes for digital image watermarking have been proposed to protect the copyright of an image document or to provide proof of ownership in some identifiable fashion. This paper proposes a novel multiplicative watermarking scheme in the contourlet domain. The effectiveness of a watermark detector depends highly on the modeling of the transform-domain coefficients. In view of this, we first investigate the modeling of the contourlet coefficients by the alpha-stable distributions. It is shown that the univariate alpha-stable distribution fits the empirical data more accurately than the formerly used distributions, such as the generalized Gaussian and Laplacian, do. We also show that the bivariate alpha-stable distribution can capture the across scale dependencies of the contourlet coefficients. Motivated by the modeling results, a blind watermark detector in the contourlet domain is designed by using the univariate and bivariate alpha-stable distributions. It is shown that the detectors based on both of these distributions provide higher detection rates than that based on the generalized Gaussian distribution does. However, a watermark detector designed based on the alpha-stable distribution with a value of its parameter α other than 1 or 2 is computationally expensive because of the lack of a closed-form expression for the distribution in this case. Therefore, a watermark detector is designed based on the bivariate Cauchy member of the alpha-stable family for which α = 1 . The resulting design yields a significantly reduced-complexity detector and provides a performance that is much superior to that of the GG detector and very close to that of the detector corresponding to the best-fit alpha-stable distribution. The robustness of the proposed bivariate Cauchy detector against various kinds of attacks, such as noise, filtering, and compression, is studied and shown to be superior to that of the generalized Gaussian detector. PMID

  7. Quantitative Ultrasound Imaging Using Acoustic Backscatter Coefficients.

    NASA Astrophysics Data System (ADS)

    Boote, Evan Jeffery

    Current clinical ultrasound scanners render images which have brightness levels related to the degree of backscattered energy from the tissue being imaged. These images offer the interpreter a qualitative impression of the scattering characteristics of the tissue being examined, but due to the complex factors which affect the amplitude and character of the echoed acoustic energy, it is difficult to make quantitative assessments of scattering nature of the tissue, and thus, difficult to make precise diagnosis when subtle disease effects are present. In this dissertation, a method of data reduction for determining acoustic backscatter coefficients is adapted for use in forming quantitative ultrasound images of this parameter. In these images, the brightness level of an individual pixel corresponds to the backscatter coefficient determined for the spatial position represented by that pixel. The data reduction method utilized rigorously accounts for extraneous factors which affect the scattered echo waveform and has been demonstrated to accurately determine backscatter coefficients under a wide range of conditions. The algorithms and procedures used to form backscatter coefficient images are described. These were tested using tissue-mimicking phantoms which have regions of varying scattering levels. Another phantom has a fat-mimicking layer for testing these techniques under more clinically relevant conditions. Backscatter coefficient images were also formed of in vitro human liver tissue. A clinical ultrasound scanner has been adapted for use as a backscatter coefficient imaging platform. The digital interface between the scanner and the computer used for data reduction are described. Initial tests, using phantoms are presented. A study of backscatter coefficient imaging of in vivo liver was performed using several normal, healthy human subjects.

  8. alpha-Thalassemia caused by an unstable alpha-globin mutant.

    PubMed Central

    Liebhaber, S A; Kan, Y W

    1983-01-01

    In a previous study, molecular cloning of the alpha-globin genes from a patient with nondeletion Hb-H disease (genotype--/alpha alpha) showed that a single nucleotide mutation (CTG to CCG) in one of the genes resulted in a leucine to proline substitution. This paper describes the approach we used to detect the abnormal alpha-globin chain. The chain was identified using a cell-free translation system. It turned over rapidly both in vitro and in vivo in the patient's reticulocytes. The unusual feature of this unstable alpha-globin is that the alpha-globin deficiency causes alpha-thalassemia. Simple heterozygotes for this lesion (alpha Pro alpha/alpha alpha) resemble alpha-thalassemia carriers and do not exhibit the hemolytic anemia usually associated with unstable hemoglobins. Images PMID:6826718

  9. Theoretical basis for an anomalous temperature coefficient in swelling pressure of rabbit corneal stroma.

    PubMed Central

    Kwok, L S; Klyce, S D

    1990-01-01

    In the rabbit corneal stroma, the swelling pressure, P, has been reported to have an anomalous (negative) temperature coefficient, alpha P, contradicting traditional Donnan swelling theory. A parallel-plate, diffuse double layer Gouy-Chapman model was used to resolve this discrepancy. The present model incorporates the possibility that surface charge, sigma, is temperature dependent. It is shown that negative, zero, or positive coefficients of swelling pressure change with temperature are not mutually exclusive conditions, but can be attributed to the same underlying mechanism. For likely values of alpha P(range -7 x 10(-3) K-1 to +3.2 x 10(-3)K-1), the effective stromal charge has a negative temperature dependency, or dln sigma/dT less than 0. The present formalism is robust against variation in assumed alpha P, and is able to simultaneously satisfy the known values of swelling pressure, its thermal dependency, and stromal charge. These results implicate significant coulombic forces behind P. Predicted stromal surface charge is approximately 0.01 Cm-2. The predictions were confirmed with macrocontinuum Donnan swelling theory, suggesting that Donnan osmotic swelling is the principal macroscopic component of P. PMID:2306510

  10. Characterization of alpha-cordierite glass-ceramics from fly ash.

    PubMed

    He, Yong; Cheng, Weimin; Cai, Hesheng

    2005-04-11

    Batches of alpha-cordierite glass-ceramics, designated as GC-I and GC-II, containing 68 and 64 wt.% fly ash, respectively, were crystallized in the temperature range of 1125-1320 degrees C. The XRD (X-ray powder diffractometer) of the glass-ceramics show that alpha-cordierite became the dominant phase in GC-I and GC-II at 1200 degrees C. GC-I and GC-II, whose solid parts contain 74 and 78 vol.% alpha-cordierite and whose compressive strengths are 35 and 50 MPa, respectively, have the respective linear thermal expansion coefficients of 1.51x10(-6) and 1.43x10(-6)/ degrees C. The fly ash alpha-cordierite glass-ceramics can be employed as kiln furniture, honeycomb substrates for catalysts, and heat exchangers. PMID:15811690

  11. Bremsstrahlung in {alpha} Decay Reexamined

    SciTech Connect

    Boie, H.; Scheit, H.; Jentschura, U. D.; Koeck, F.; Lauer, M.; Schwalm, D.; Milstein, A. I.; Terekhov, I. S.

    2007-07-13

    A high-statistics measurement of bremsstrahlung emitted in the {alpha} decay of {sup 210}Po has been performed, which allows us to follow the photon spectra up to energies of {approx}500 keV. The measured differential emission probability is in good agreement with our theoretical results obtained within the quasiclassical approximation as well as with the exact quantum mechanical calculation. It is shown that, due to the small effective electric dipole charge of the radiating system, a significant interference between the electric dipole and quadrupole contributions occurs, which is altering substantially the angular correlation between the {alpha} particle and the emitted photon.

  12. NACA Physicist Studying Alpha Rays

    NASA Technical Reports Server (NTRS)

    1957-01-01

    NACA Physicits studying Alpha Rays in a continuous cloud chamber. A cloud chamber is used by Lewis scientists to obtain information aimed at minimizing undesirable effects of radiation on nuclear-powered aircraft components. Here, alpha particles from a polonium source emit in a flower-like pattern at the cloud chamber's center. The particles are made visible by means of alcohol vapor diffusing from an area at room temperature to an area at minus -78 deg. Centigrade. Nuclear-powered aircraft were never developed and aircraft nuclear propulsion systems were canceled in the early 1960s.

  13. Bremsstrahlung in alpha decay reexamined.

    PubMed

    Boie, H; Scheit, H; Jentschura, U D; Köck, F; Lauer, M; Milstein, A I; Terekhov, I S; Schwalm, D

    2007-07-13

    A high-statistics measurement of bremsstrahlung emitted in the alpha decay of (210)Po has been performed, which allows us to follow the photon spectra up to energies of approximately 500 keV. The measured differential emission probability is in good agreement with our theoretical results obtained within the quasiclassical approximation as well as with the exact quantum mechanical calculation. It is shown that, due to the small effective electric dipole charge of the radiating system, a significant interference between the electric dipole and quadrupole contributions occurs, which is altering substantially the angular correlation between the alpha particle and the emitted photon.

  14. Test chamber for alpha spectrometry

    DOEpatents

    Larsen, Robert P.

    1977-01-01

    Alpha emitters for low-level radiochemical analysis by measurement of alpha spectra are positioned precisely with respect to the location of a surface-barrier detector by means of a chamber having a removable threaded planchet holder. A pedestal on the planchet holder holds a specimen in fixed engagement close to the detector. Insertion of the planchet holder establishes an O-ring seal that permits the chamber to be pumped to a desired vacuum. The detector is protected against accidental contact and resulting damage.

  15. Temporal correlation coefficient for directed networks.

    PubMed

    Büttner, Kathrin; Salau, Jennifer; Krieter, Joachim

    2016-01-01

    Previous studies dealing with network theory focused mainly on the static aggregation of edges over specific time window lengths. Thus, most of the dynamic information gets lost. To assess the quality of such a static aggregation the temporal correlation coefficient can be calculated. It measures the overall possibility for an edge to persist between two consecutive snapshots. Up to now, this measure is only defined for undirected networks. Therefore, we introduce the adaption of the temporal correlation coefficient to directed networks. This new methodology enables the distinction between ingoing and outgoing edges. Besides a small example network presenting the single calculation steps, we also calculated the proposed measurements for a real pig trade network to emphasize the importance of considering the edge direction. The farm types at the beginning of the pork supply chain showed clearly higher values for the outgoing temporal correlation coefficient compared to the farm types at the end of the pork supply chain. These farm types showed higher values for the ingoing temporal correlation coefficient. The temporal correlation coefficient is a valuable tool to understand the structural dynamics of these systems, as it assesses the consistency of the edge configuration. The adaption of this measure for directed networks may help to preserve meaningful additional information about the investigated network that might get lost if the edge directions are ignored. PMID:27516936

  16. Extinction coefficient determination using target reflectance measurements.

    PubMed

    Smith, R B; Carswell, A L; Ulitsky, A; Houston, J D

    1989-10-01

    Laboratory measurements are reported for optical extinction at a wavelength of 1.06 microm in water droplet clouds. The extinction coefficient, sigma(T), is determined using the two-way attenuation of a target reflected signal and comparing it to the extinction coefficient sigma determined by a single-pass transmission measurement. As well as solid targets, layers of the clouds have been used as a reflector by employing a selective chopping method to provide range-resolved backscattering information and replicate in the laboratory a lidar configu-ration. It is found that multiple scattering can lead to substantial differences between sigma(T) and sigma and that these differences depend upon the properties of the scattering medium and the target as well as on the field of view of the backscatter receiver used for the reflectance measurements. By keeping the field of view very small, the two methods of measuring the extinction coefficient give the same values.

  17. The effect of thermal cycling to 1100 C on the alpha /Mo/ phase in directionally solidified gamma/gamma-prime-alpha alloys

    NASA Technical Reports Server (NTRS)

    Harf, F. H.

    1981-01-01

    Specimens of gamma/gamma-prime-alpha (Mo) eutectic alloy were thermally cycled or isothermally exposed at temperatures of 1075 to 1100 C. Transmission electron microscopy examination of cycled specimens indicated that even an exposure of 10 minutes effected noticeable changes in the shape of the alpha phase, and that the changes were cumulative as more cycles were added. The cross sections of fine, smooth fibers changed from rectangles to octagons, while lamellae and irregular shapes spheroidized. These effects are attributed to the differences in thermal expansion coefficients between the alpha phase and the gamma/gamma-prime matrix, and to the higher diffusion rates prevailing at elevated temperatures. Where the configuration of the alpha phase is a simple shape, such as a fiber, increasing the temperature eventually brings about a stress free interface between the alpha phase and the matrix by differential thermal expansion. Where the shape of the alpha phase is more complex, a stressed interface persists to higher temperatures where diffusion produces the more drastic morphological changes.

  18. Virial expansion coefficients in the harmonic approximation.

    PubMed

    Armstrong, J R; Zinner, N T; Fedorov, D V; Jensen, A S

    2012-08-01

    The virial expansion method is applied within a harmonic approximation to an interacting N-body system of identical fermions. We compute the canonical partition functions for two and three particles to get the two lowest orders in the expansion. The energy spectrum is carefully interpolated to reproduce ground-state properties at low temperature and the noninteracting high-temperature limit of constant virial coefficients. This resembles the smearing of shell effects in finite systems with increasing temperature. Numerical results are discussed for the second and third virial coefficients as functions of dimension, temperature, interaction, and transition temperature between low- and high-energy limits. PMID:23005730

  19. Absorption coefficient instrument for turbid natural waters

    NASA Technical Reports Server (NTRS)

    Friedman, E.; Cherdak, A.; Poole, L.; Houghton, W.

    1980-01-01

    The paper presents an instrument that directly measures multispectral absorption coefficient of turbid natural water. Attention is given to the design, which is shown to incorporate methods for the compensation of variation in the internal light source intensity, correction of the spectrally dependent nature of the optical elements, and correction for variation in the background light level. In addition, when used in conjunction with a spectrally matched total attenuation instrument, the spectrally dependent scattering coefficient can also be derived. Finally, it is reported that systematic errors associated with multiple scattering have been estimated using Monte Carlo techniques.

  20. Shear viscosity coefficient of liquid lanthanides

    SciTech Connect

    Patel, H. P. Thakor, P. B. Prajapati, A. V.; Sonvane, Y. A.

    2015-05-15

    Present paper deals with the computation of shear viscosity coefficient (η) of liquid lanthanides. The effective pair potential v(r) is calculated through our newly constructed model potential. The Pair distribution function g(r) is calculated from PYHS reference system. To see the influence of local field correction function, Hartree (H), Tailor (T) and Sarkar et al (S) local field correction function are used. Present results are compared with available experimental as well as theoretical data. Lastly, we found that our newly constructed model potential successfully explains the shear viscosity coefficient (η) of liquid lanthanides.

  1. Diffusion and transport coefficients in synthetic opals

    SciTech Connect

    Sofo, J. O.; Mahan, G. D.

    2000-07-15

    Opals are structures composed of close-packed spheres in the size range of nano to micrometers. They are sintered to create small necks at the points of contact. We have solved the diffusion problem in such structures. The relation between the diffusion coefficient and the thermal and electrical conductivity is used to estimate the transport coefficients of opal structures as a function of the neck size and the mean free path of the carriers. The theory presented is also applicable to the diffusion problem in other periodic structures. (c) 2000 The American Physical Society.

  2. Brownian friction coefficient of Kr/graphite.

    NASA Astrophysics Data System (ADS)

    Boutchko, R.

    1998-03-01

    Calculations of the Brownian friction coefficient of fluid Kr/graphite are described. The phonon frequencies and polarization vectors are calculated for a thick graphite slab using the Benedek-Onida bond charge model(G. Benedek and G. Onida, Phys. Rev. B 47), 16471 (1993). The fluctuating forces on the adatom from the substrate are expressed in terms of the graphite fluctuation spectrum. The friction coefficient is expressed in terms of a spectral density to be derived from the slab calculations. The relation of the results to diffusive processes in monolayer fluids(F. Y. Hansen, L. W. Bruch, and H. Taub, Phys. Rev. B 54), 14077 (1996). is discussed.

  3. Alcoholism, Alpha Production, and Biofeedback

    ERIC Educational Resources Information Center

    Jones, Frances W.; Holmes, David S.

    1976-01-01

    Electroencephalograms of 20 alcoholics and 20 nonalcoholics were obtained. Data indicated that alcoholics produced less alpha than nonalcoholics. In one training condition subjects were given accurate biofeedback, whereas in the other condition subjects were given random (noncontingent) feedback. Accurate biofeedback did not result in greater…

  4. Targeted therapy using alpha emitters.

    PubMed

    Vaidyanathan, G; Zalutsky, M R

    1996-10-01

    Radionuclides such as 211At and 212Bi which decay by the emission of alpha-particles are attractive for certain applications of targeted radiotherapy. The tissue penetration of 212Bi and 211At alpha-particles is equivalent to only a few cell diameters, offering the possibility of combining cell-specific targeting with radiation of similar range. Unlike the beta-particles emitted by radionuclides such as 131I and 90Y, alpha-particles are radiation of high linear energy transfer and thus greater biological effectiveness. Several approaches have been explored for targeted radiotherapy with 212Bi- and 211At-labelled substances including colloids, monoclonal antibodies, metabolic precursors, receptor-avid ligands and other lower molecular weight molecules. An additional agent which exemplifies the promise of alpha-emitting radiopharmaceuticals is meta-[211At]astatobenzylguanidine. The toxicity of this compound under single-cell conditions, determined both by [3H]thymidine incorporation and by limiting dilution clonogenic assays, for human neuroblastoma cells is of the order of 1000 times higher than that of meta-[131I] iodobenzylguanidine. For meta-[211At] astatobenzylguanidine, the Do value was equivalent to only 6-7 211At atoms bound per cell. These results suggest that meta-[211At] astatobenzylguanidine might be valuable for the targeted radiotherapy of micrometastatic neuroblastomas.

  5. Meet the Alpha-Pets.

    ERIC Educational Resources Information Center

    Zitlaw, Jo Ann Bruce; Frank, Cheryl Standish

    1985-01-01

    "Alpha-Pets" are the focal point of an integrated, multidisciplinary curriculum. Each pet is featured for a week in a vocabulary-rich story and introduces related activities beginning with the featured letter, such as the four food groups during Freddie Fish's week or universe during Ulysses Unicorn's week. (MT)

  6. Alpha proton x ray spectrometer

    NASA Technical Reports Server (NTRS)

    Rieder, Rudi; Waeke, H.; Economou, T.

    1994-01-01

    Mars Pathfinder will carry an alpha-proton x ray spectrometer (APX) for the determination of the elemental chemical composition of Martian rocks and soils. The instrument will measure the concentration of all major and some minor elements, including C, N, and O at levels above typically 1 percent.

  7. Postnatal changes of nicotinic acetylcholine receptor alpha 2, alpha 3, alpha 4, alpha 7 and beta 2 subunits genes expression in rat brain.

    PubMed

    Zhang, X; Liu, C; Miao, H; Gong, Z H; Nordberg, A

    1998-10-01

    Postnatal changes of nicotinic acetylcholine receptor (nAChR) alpha 2, alpha 3, alpha 4, alpha 7 and beta 2 subunits mRNAs were investigated in rat brain using ribonuclease protection assay. Multiple developmental patterns were observed: (1) transient expression during the first few postnatal weeks; alpha 2 in the hippocampus and brain stem, alpha 3 in the striatum, cerebellum and cortex, alpha 4 in the hippocampus, striatum and cerebellum, alpha 7 in the cerebellum and beta 2 in the striatum. (2) Constant expression across development; alpha 2 and alpha 3 in the thalamus, alpha 4 in the cortex, thalamus and brain stem, alpha 7 in the thalamus and brain stem and beta 2 in all brain regions except striatum. (3) Non-detection across development; alpha 2 in the cortex, striatum and cerebellum. (4) Increase with age; alpha 7 in the cortex and hippocampus. (5) Bell-shaped development; alpha 7 in the striatum. Postnatal changes of nAChR isoforms in different brain regions of rat were investigated by receptor binding assays. The developmental patterns of [3H]epibatidine and (-)-[3H]nicotine binding sites were similar to each other in each brain region, but different from that of [3H] alpha-bungarotoxin binding sites. No obvious correlation was observed between the developmental patterns of [3H] alpha-bungarotoxin, [3H]epibatidine and (-)-[3H]nicotine binding sites and corresponding subunits mRNAs. These results indicate that multiple mechanisms are involved in changes of gene expression of nAChRs subunits in the brain of developing rats.

  8. Energetic particle diffusion coefficients upstream of quasi-parallel interplanetary shocks

    NASA Technical Reports Server (NTRS)

    Tan, L. C.; Mason, G. M.; Gloeckler, G.; Ipavich, F. M.

    1989-01-01

    The properties of about 30 to 130-keV/e protons and alpha particles upstream of six quasi-parallel interplanetary shocks that passed by the ISEE 3 spacecraft during 1978-1979 were analyzed, and the values for the upstream energegic particle diffusion coefficient, kappa, in these six events were deduced for a number of energies and upstream positions. These observations were compared with predictions of Lee's (1983) theory of shock acceleration. It was found that the observations verified the prediction of the A/Q dependence (where A and Q are the particle atomic mass and ionization state, respectively) of kappa for alpha and proton particles upstream of the quasi-parallel shocks.

  9. Coexistence of {alpha}+{alpha}+n+n and {alpha}+t+t cluster structures in {sup 10}Be

    SciTech Connect

    Itagaki, N.; Ito, M.; Milin, M.; Hashimoto, T.; Ishiyama, H.; Miyatake, H.

    2008-06-15

    The coexistence of the {alpha}+{alpha}+n+n and {alpha}+t+t cluster structures in the excited states of {sup 10}Be has been discussed. In the previous analysis, all the low-lying states of {sup 10}Be were found to be well described by the motion of the two valence neutrons around two {alpha} clusters. However, the {alpha}+t+t cluster structure was found to coexist with the {alpha}+{alpha}+n+n structure around E{sub x}=15 MeV, close to the corresponding threshold. We have introduced a microscopic model to solve the coupling effect between these two configurations. The K=0 and K=1 states are generated from the {alpha}+t+t configurations due to the spin coupling of two triton clusters. The present case of {sup 10}Be is one of the few examples in which completely different configurations of triton-type ({alpha}+t+t three-center) and {alpha}-type ({alpha}+{alpha}+n+n two-center) clusters coexist in a single nucleus in the same energy region.

  10. A synopsis of collective alpha effects and implications for ITER

    SciTech Connect

    Sigmar, D.J.

    1990-10-01

    This paper discusses the following: Alpha Interaction with Toroidal Alfven Eigenmodes; Alpha Interaction with Ballooning Modes; Alpha Interaction with Fishbone Oscillations; and Implications for ITER.

  11. Extending the Constant Coefficient Solution Technique to Variable Coefficient Ordinary Differential Equations

    ERIC Educational Resources Information Center

    Mohammed, Ahmed; Zeleke, Aklilu

    2015-01-01

    We introduce a class of second-order ordinary differential equations (ODEs) with variable coefficients whose closed-form solutions can be obtained by the same method used to solve ODEs with constant coefficients. General solutions for the homogeneous case are discussed.

  12. Molecular Diffusion Coefficients: Experimental Determination and Demonstration.

    ERIC Educational Resources Information Center

    Fate, Gwendolyn; Lynn, David G.

    1990-01-01

    Presented are laboratory methods which allow the demonstration and determination of the diffusion coefficients of compounds ranging in size from water to small proteins. Included are the procedures involving the use of a spectrometer, UV cell, triterated agar, and oxygen diffusion. Results including quantification are described. (CW)

  13. Measurement of Coefficient of Restitution Made Easy

    ERIC Educational Resources Information Center

    Farkas, N.; Ramsier, R. D.

    2006-01-01

    We present a simple activity that permits students to determine the coefficient of restitution of bouncing balls using only a stopwatch, a metre stick and graphical analysis. The experiment emphasizes that simple models, in combination with careful attention to how students make measurements, can lead to good results in a straightforward way.

  14. Pressure viscosity coefficient of vegetable oils

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The elastohydrodynamic (EHD) pressure viscosity coefficient (PVC) of ten vegetable oils from commodity and new crops, and two petroleum-based oils, polyalphaolefin (PAO) and hexadecane, were investigated. PVC was measured using three different methods: the So and Klaus (S-K) procedure from oil visco...

  15. Problems on Divisibility of Binomial Coefficients

    ERIC Educational Resources Information Center

    Osler, Thomas J.; Smoak, James

    2004-01-01

    Twelve unusual problems involving divisibility of the binomial coefficients are represented in this article. The problems are listed in "The Problems" section. All twelve problems have short solutions which are listed in "The Solutions" section. These problems could be assigned to students in any course in which the binomial theorem and Pascal's…

  16. Bitplane Image Coding With Parallel Coefficient Processing.

    PubMed

    Auli-Llinas, Francesc; Enfedaque, Pablo; Moure, Juan C; Sanchez, Victor

    2016-01-01

    Image coding systems have been traditionally tailored for multiple instruction, multiple data (MIMD) computing. In general, they partition the (transformed) image in codeblocks that can be coded in the cores of MIMD-based processors. Each core executes a sequential flow of instructions to process the coefficients in the codeblock, independently and asynchronously from the others cores. Bitplane coding is a common strategy to code such data. Most of its mechanisms require sequential processing of the coefficients. The last years have seen the upraising of processing accelerators with enhanced computational performance and power efficiency whose architecture is mainly based on the single instruction, multiple data (SIMD) principle. SIMD computing refers to the execution of the same instruction to multiple data in a lockstep synchronous way. Unfortunately, current bitplane coding strategies cannot fully profit from such processors due to inherently sequential coding task. This paper presents bitplane image coding with parallel coefficient (BPC-PaCo) processing, a coding method that can process many coefficients within a codeblock in parallel and synchronously. To this end, the scanning order, the context formation, the probability model, and the arithmetic coder of the coding engine have been re-formulated. The experimental results suggest that the penalization in coding performance of BPC-PaCo with respect to the traditional strategies is almost negligible.

  17. Coefficient of variation of underwater irradiance fluctuations

    NASA Astrophysics Data System (ADS)

    Weber, V. L.

    2010-06-01

    We consider underwater sunlight fluctuations in the case of a one-dimensional irregular sea surface. Several rigorous and approximate models are proposed, which make it possible to analytically treat and physically explain the dependence of the coefficient of variation of the underwater irradiance on the depth, the wind velocity, and optical parameters of the sea water.

  18. Determination of sedimentation coefficients for small peptides.

    PubMed Central

    Schuck, P; MacPhee, C E; Howlett, G J

    1998-01-01

    Direct fitting of sedimentation velocity data with numerical solutions of the Lamm equations has been exploited to obtain sedimentation coefficients for single solutes under conditions where solvent and solution plateaus are either not available or are transient. The calculated evolution was initialized with the first experimental scan and nonlinear regression was employed to obtain best-fit values for the sedimentation and diffusion coefficients. General properties of the Lamm equations as data analysis tools were examined. This method was applied to study a set of small peptides containing amphipathic heptad repeats with the general structure Ac-YS-(AKEAAKE)nGAR-NH2, n = 2, 3, or 4. Sedimentation velocity analysis indicated single sedimenting species with sedimentation coefficients (s(20,w) values) of 0.37, 0.45, and 0.52 S, respectively, in good agreement with sedimentation coefficients predicted by hydrodynamic theory. The described approach can be applied to synthetic boundary and conventional loading experiments, and can be extended to analyze sedimentation data for both large and small macromolecules in order to define shape, heterogeneity, and state of association. PMID:9449347

  19. Rate coefficient for the reaction N + NO

    NASA Technical Reports Server (NTRS)

    Fox, J. L.

    1994-01-01

    Evidence has been advanced that the rate coefficient for the reaction N + NO right arrow N2 + O has a small positive temperature dependence at the high temperatures (900 to 1500 K) that prevail in the terrestrial middle and upper thermosphere by Siskind and Rusch (1992), and at the low temperatures (100 to 200 K) of the Martian lower thermosphere by Fox (1993). Assuming that the rate coefficient recommended by the Jet Propulsion Laboratory evaluation (DeMore et al., 1992) is accurate at 300 K, we derive here the low temperature value of the activation energy for this reaction and thus the rate coefficient that best fits the Viking 1 measured NO densities. We find that the fit is acceptable for a rate coefficient of about 1.3 x 10(exp -10)(T/300)(exp 0.5)exp(-400/T) and better for a value of about 2.5 x 10(exp -10)(T/300)(exp 0.5)exp(-600/T)cu cm/s.

  20. A Graphical Interpretation of Probit Coefficients.

    ERIC Educational Resources Information Center

    Becker, William E.; Waldman, Donald M.

    1989-01-01

    Contends that, when discrete choice models are taught, particularly the probit model, it is the method rather than the interpretation of the results that is emphasized. This article provides a graphical technique for interpretation of an estimated probit coefficient that will be useful in statistics and econometrics courses. (GG)

  1. Experimental Influence Coefficients and Vibration Modes

    NASA Technical Reports Server (NTRS)

    Weidman, Deene J.; Kordes, Eldon E.

    1959-01-01

    Test results are presented for both symmetrical and antisymmetrical static loading of a wing model mounted on a three-point support system. The first six free-free vibration modes were determined experimentally. A comparison is made of the symmetrical nodal patterns and frequencies with the symmetrical nodal patterns and frequencies calculated from the experimental influence coefficients.

  2. Microcomputer Listens to the Coefficient of Restitution.

    ERIC Educational Resources Information Center

    Smith, P. A.; And Others

    1981-01-01

    Describes a procedure for determining the coefficient of restitution using a microcomputer which collects and sends data to a large computer where analysis is done and graphical output is generated. The data collection hardware and software are described, and results are illustrated. (Author/SK)

  3. The Seebeck coefficient of superionic conductors

    SciTech Connect

    Mahan, G. D.

    2015-01-28

    We present a theory of the anomalous Seebeck coefficient found in the superionic conductor Cu{sub 2}Se. It has a phase transition at T = 400 K where the cations disorder but the anions do not. This disorder gives a temperature-dependent width to the electronic states in the conduction band. This width provides the anomalous Seebeck contribution.

  4. Pressure-viscosity coefficient of biobased lubricants

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Film thickness is an important tribological property that is dependent on the combined effect of lubricant properties, material property of friction surfaces, and the operating conditions of the tribological process. Pressure-viscosity coefficient (PVC) is one of the lubricant properties that influe...

  5. The Lorenz Curve and the Gini Coefficient.

    ERIC Educational Resources Information Center

    Rycroft, Robert

    2003-01-01

    States that the Lorenz Curve and the Gini Coefficient is a Web-based interactive tutorial developed for students in an upper level, undergraduate, elective economics course about income and wealth distribution, poverty, and discrimination. States that students achieve mastery because they cannot complete the tutorial without adequate understanding…

  6. Computer programs for the concordance correlation coefficient.

    PubMed

    Crawford, Sara B; Kosinski, Andrzej S; Lin, Hung-Mo; Williamson, John M; Barnhart, Huiman X

    2007-10-01

    The CCC macro is presented for computation of the concordance correlation coefficient (CCC), a common measure of reproducibility. The macro has been produced in both SAS and R, and a detailed presentation of the macro input and output for the SAS program is included. The macro provides estimation of three versions of the CCC, as presented by Lin [L.I.-K. Lin, A concordance correlation coefficient to evaluate reproducibility, Biometrics 45 (1989) 255-268], Barnhart et al. [H.X. Barnhart, J.L. Haber, J.L. Song, Overall concordance correlation coefficient for evaluating agreement among multiple observers, Biometrics 58 (2002) 1020-1027], and Williamson et al. [J.M. Williamson, S.B. Crawford, H.M. Lin, Resampling dependent concordance correlation coefficients, J. Biopharm. Stat. 17 (2007) 685-696]. It also provides bootstrap confidence intervals for the CCC, as well as for the difference in CCCs for both independent and dependent samples. The macro is designed for balanced data only. Detailed explanation of the involved computations and macro variable definitions are provided in the text. Two biomedical examples are included to illustrate that the macro can be easily implemented.

  7. Phosphorus Availability Coefficients from Various Organic Sources

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The objectives of this study were to determine Phosphorus Availability Coefficients (PACs) for a variety of organic phosphorus (P) sources, and to examine the relationship between PACs measured in simulated rainfall runoff and alternative soil incubations. PAC is an important parameter in the P-Ind...

  8. Coefficient Omega Bootstrap Confidence Intervals: Nonnormal Distributions

    ERIC Educational Resources Information Center

    Padilla, Miguel A.; Divers, Jasmin

    2013-01-01

    The performance of the normal theory bootstrap (NTB), the percentile bootstrap (PB), and the bias-corrected and accelerated (BCa) bootstrap confidence intervals (CIs) for coefficient omega was assessed through a Monte Carlo simulation under conditions not previously investigated. Of particular interests were nonnormal Likert-type and binary items.…

  9. Recursive Construction of Operator Product Expansion Coefficients

    NASA Astrophysics Data System (ADS)

    Holland, Jan; Hollands, Stefan

    2015-06-01

    We derive a novel formula for the derivative of operator product expansion (OPE) coefficients with respect to a coupling constant. The formula involves just the OPE coefficients themselves but no further input, and is in this sense self-consistent. Furthermore, unlike other formal identities of this general nature in quantum field theory (such as the formal expression for the Lagrangian perturbation of a correlation function), our formula requires no further UV-renormalization, i.e., it is completely well-defined from the start. This feature is a result of a cancelation of UV- and IR-divergences between various terms in our identity. Our proof, and an analysis of the features of the identity, is given for the example of massive, Euclidean theory in 4 dimensional Euclidean space. It relies on the renormalization group flow equation method and is valid to arbitrary, but finite orders in perturbation theory. The final formula, however, makes neither explicit reference to the renormalization group flow, nor to perturbation theory, and we conjecture that it also holds non-perturbatively. Our identity can be applied constructively because it gives a novel recursive algorithm for the computation of OPE coefficients to arbitrary (finite) perturbation order in terms of the zeroth order coefficients corresponding to the underlying free field theory, which in turn are trivial to obtain. We briefly illustrate the relation of this method to more standard methods for computing the OPE in some simple examples.

  10. Genetics Home Reference: 5-alpha reductase deficiency

    MedlinePlus

    ... gene provides instructions for making an enzyme called steroid 5-alpha reductase 2. This enzyme is involved ... external genitalia. Mutations in the SRD5A2 gene prevent steroid 5-alpha reductase 2 from effectively converting testosterone ...

  11. What Causes Alpha-1 Antitrypsin Deficiency?

    MedlinePlus

    ... from the NHLBI on Twitter. What Causes Alpha-1 Antitrypsin Deficiency? Alpha-1 antitrypsin (AAT) deficiency is an inherited disease. "Inherited" ... have AAT deficiency inherit two faulty AAT genes, one from each parent. These genes tell cells in ...

  12. How Is Alpha-1 Antitrypsin Deficiency Treated?

    MedlinePlus

    ... from the NHLBI on Twitter. How Is Alpha-1 Antitrypsin Deficiency Treated? Alpha-1 antitrypsin (AAT) deficiency has no cure, but its ... of these treatments are the same as the ones used for a lung disease called COPD (chronic ...

  13. Q (Alpha) Function and Squeezing Effect

    NASA Technical Reports Server (NTRS)

    Yunjie, Xia; Xianghe, Kong; Kezhu, Yan; Wanping, Chen

    1996-01-01

    The relation of squeezing and Q(alpha) function is discussed in this paper. By means of Q function, the squeezing of field with gaussian Q(alpha) function or negative P(a)function is also discussed in detail.

  14. Association of actin with alpha crystallins

    NASA Technical Reports Server (NTRS)

    Gopalakrishnan, S.; Boyle, D.; Takemoto, L.; Spooner, B. S. (Principal Investigator)

    1993-01-01

    The alpha crystallins are cytosolic proteins that co-localize and co-purify with actin-containing microfilaments. Affinity column chromatography employing both covalently-coupled actin or alpha crystallin was used to demonstrate specific and saturable binding of actin with alpha crystallin. This conclusion was confirmed by direct visualization of alpha aggregates bound to actin polymerized in vitro. The significance of this interaction in relation to the functional properties of these two polypeptides will be discussed.

  15. The ultraviolet spectra of Alpha Aquilae and Alpha Canis Minoris

    NASA Technical Reports Server (NTRS)

    Morton, D. C.; Bruzual A., G.; Kurucz, R. L.; Spinrad, H.

    1977-01-01

    Scans of Alpha Aql (A7 IV, V) and Alpha CMi (F5 IV-V) obtained with the Copernicus satellite spectrometer over the wavelength range from 2100 to 3200 A are presented along with a spectrum of the integrated solar disk over the same range procured during a calibrated rocket flight. About 1500 fairly strong absorption lines in the Alpha CMi spectrum between 2400 and 2961 A are identified by comparison with a solar atlas and by using a theoretical spectrum synthesized from a blanketed LTE model with an effective temperature of 6500 K and a surface gravity of 10,000 cm/sec per sec. The Mg II resonance doublet at 2795.528 and 2802.704 A is found to be present in all three stars together with a discontinuity at 2635 A due to Fe II, Fe I, Cr I, and Mn II. It is concluded that the Mg II resonance lines and the 2635-A continuum break would be the best spectral features for estimating the redshift of a galaxy observed at low resolution provided the redshift is not less than about 0.75.

  16. Effectiveness of Alpha Biofeedback Therapy: Negative Results.

    ERIC Educational Resources Information Center

    Watson, Charles G.; Herder, Joseph

    1980-01-01

    Assessed the utility of alpha biofeedback training in the treatment of patients (N=66). Biofeedback and placebo biofeedback groups were given alpha or mock-alpha training sessions. Improvement on 54 variables was compared to that of no-treatment controls. Only a chance number of significant changes appeared among the groups. (Author)

  17. Recent Results on the CKM Angle Alpha

    SciTech Connect

    Mihalyi, A.; /Wisconsin U., Madison

    2005-10-18

    The method to measure the CKM angle {alpha} and the modes sensitive to it are discussed. It is shown that the B {yields} {rho}{rho} decays provide the most stringent constraint on {alpha}, which is found to be {alpha} = 96{sup o} {+-} 10{sup o}(stat) {+-} 4{sup o}(syst){+-} 13{sup o}(penguin).

  18. 21 CFR 882.1610 - Alpha monitor.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Alpha monitor. 882.1610 Section 882.1610 Food and... NEUROLOGICAL DEVICES Neurological Diagnostic Devices § 882.1610 Alpha monitor. (a) Identification. An alpha monitor is a device with electrodes that are placed on a patient's scalp to monitor that portion of...

  19. 21 CFR 882.1610 - Alpha monitor.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Alpha monitor. 882.1610 Section 882.1610 Food and... NEUROLOGICAL DEVICES Neurological Diagnostic Devices § 882.1610 Alpha monitor. (a) Identification. An alpha monitor is a device with electrodes that are placed on a patient's scalp to monitor that portion of...

  20. 6 alpha-Fluoro- and 6 alpha,9 alpha-difluoro-11 beta,21-dihydroxy-16 alpha,17 alpha-propylmethylenedioxypregn-4-ene-3,20-dione: synthesis and evaluation of activity and kinetics of their C-22 epimers.

    PubMed

    Thalén, B A; Axelsson, B I; Andersson, P H; Brattsand, R L; Nylander, B; Wickström, L I

    1998-01-01

    It is generally accepted that the anti-inflammatory effect of glucocorticosteroids cannot be separated from their adverse effects at the receptor level. However, modification of the pharmacokinetics through structural alterations could provide steroids with a better therapeutic index than those currently used. Thus, new 16 alpha,17 alpha-acetals between butyraldehyde and 6 alpha-fluoro- or 6 alpha,9 alpha-difluoro-16 alpha-hydroxycortisol were synthesized and studied. Acetalization of the corresponding 16 alpha,17 alpha-diols or transacetalization of their 16 alpha,17 alpha-acetonides in dioxane produced mixtures of C-22 epimers, which were resolved by preparative chromatography. Alternatively, an efficient method was used to produce the 22R-epimer stereoselectively through performing the acetalization and transacetalization in a hydrocarbon with an inert material present. The C-22 configuration of (22R)-6 alpha,9 alpha-difluoro-11 beta,21-dihydroxy-16 alpha,17 alpha-propylmethylenedioxypregn-4-ene-3,20-dione was unambiguously established by single crystal X-ray diffraction. The present compounds, especially the 22R-epimer just mentioned, bind to the rat thymus glucocorticoid receptor with high potency. The C-22 epimers of the 6 alpha,9 alpha-difluoro derivatives showed a 10-fold higher biotransformation rate than the budesonide 22R-epimer when incubated with human liver S9 subcellular fraction. The high receptor affinity in combination with the high biotransformation rate indicates that (22R)-6 alpha,9 alpha-difluoro-11 beta,21-dihydroxy-16 alpha,17 alpha-propylmethylenedioxypregn-4-ene-3,20-dione may be an improved 16 alpha,17 alpha-acetal glucocorticosteroid for therapy of inflammatory diseases, in which the mucous membranes are involved, such as those in the intestinal tract as well in the respiratory tract. PMID:9437793

  1. Series extension: predicting approximate series coefficients from a finite number of exact coefficients

    NASA Astrophysics Data System (ADS)

    Guttmann, Anthony J.

    2016-10-01

    Given the first 20-100 coefficients of a typical generating function of the type that arises in many problems of statistical mechanics or enumerative combinatorics, we show that the method of differential approximants performs surprisingly well in predicting (approximately) subsequent coefficients. These can then be used by the ratio method to obtain improved estimates of critical parameters. In favourable cases, given only the first 20 coefficients, the next 100 coefficients are predicted with useful accuracy. More surprisingly, this is also the case when the method of differential approximants does not do a useful job in estimating the critical parameters, such as those cases in which one has stretched exponential asymptotic behaviour. Nevertheless, the coefficients are predicted with surprising accuracy. As one consequence, significant computer time can be saved in enumeration problems where several runs would normally be made, modulo different primes, and the coefficients constructed from their values modulo different primes. Another is in the checking of newly calculated coefficients. We believe that this concept of approximate series extension opens up a whole new chapter in the method of series analysis.

  2. An assessment of coefficient accuracy in linear regression models with spatially varying coefficients

    NASA Astrophysics Data System (ADS)

    Wheeler, David C.; Calder, Catherine A.

    2007-06-01

    The realization in the statistical and geographical sciences that a relationship between an explanatory variable and a response variable in a linear regression model is not always constant across a study area has led to the development of regression models that allow for spatially varying coefficients. Two competing models of this type are geographically weighted regression (GWR) and Bayesian regression models with spatially varying coefficient processes (SVCP). In the application of these spatially varying coefficient models, marginal inference on the regression coefficient spatial processes is typically of primary interest. In light of this fact, there is a need to assess the validity of such marginal inferences, since these inferences may be misleading in the presence of explanatory variable collinearity. In this paper, we present the results of a simulation study designed to evaluate the sensitivity of the spatially varying coefficients in the competing models to various levels of collinearity. The simulation study results show that the Bayesian regression model produces more accurate inferences on the regression coefficients than does GWR. In addition, the Bayesian regression model is overall fairly robust in terms of marginal coefficient inference to moderate levels of collinearity, and degrades less substantially than GWR with strong collinearity.

  3. Electron-Ion Recombination Rate Coefficient Measurements in a Flowing Afterglow Plasma

    NASA Technical Reports Server (NTRS)

    Gougousi, Theodosia; Golde, Michael F.; Johnsen, Rainer

    1996-01-01

    The flowing-afterglow technique in conjunction with computer modeling of the flowing plasma has been used to determine accurate dissociative-recombination rate coefficients alpha for the ions O2(+), HCO(+), CH5(+), C2H5(+), H3O(+), CO2(+), HCO2(+), HN2O(+), and N2O(+) at 295 K. We find that the simple form of data analysis that was employed in earlier experiments was adequate and we largely confirm earlier results. In the case of HCO(+) ions, published coefficients range from 1.1 X 10(exp -7) to 2.8 x 10(exp -7) cu cm/S, while our measurements give a value of 1.9 x 10(exp -7) cu cm/S.

  4. Alpha voltaic batteries and methods thereof

    NASA Technical Reports Server (NTRS)

    Raffaelle, Ryne P. (Inventor); Jenkins, Phillip (Inventor); Wilt, David (Inventor); Scheiman, David (Inventor); Chubb, Donald (Inventor); Castro, Stephanie (Inventor)

    2011-01-01

    An alpha voltaic battery includes at least one layer of a semiconductor material comprising at least one p/n junction, at least one absorption and conversion layer on the at least one layer of semiconductor layer, and at least one alpha particle emitter. The absorption and conversion layer prevents at least a portion of alpha particles from the alpha particle emitter from damaging the p/n junction in the layer of semiconductor material. The absorption and conversion layer also converts at least a portion of energy from the alpha particles into electron-hole pairs for collection by the one p/n junction in the layer of semiconductor material.

  5. Yield Coefficient for Surface Penning Ionization

    NASA Astrophysics Data System (ADS)

    Rutherford, G. H.; Asbury, M. J.; Davis, R. A.; Ingram, L. A.; Shepard, G. G.; Zich, R.

    2000-06-01

    Surface Penning Ionization (SPI) occurs when a metastable atom strikes a surface. The yield coefficient γ is defined as the probability of electron ejection per collision with the surface. Knowledge of γ is important in modeling rare gas discharges, in which Penning ionization is an important source of charged particles, especially at the confining surfaces, which may be some distance from the active discharge. We present experimental data and Monte Carlo calculations to extract the yield coefficient for helium metastable atoms on chemically-cleaned copper. The experiment involves measuring the ejected electron current from a pair of fine copper meshes placed in the flowtube of a flowing afterglow apparatus. The downstream mesh is closely spaced and destroys all metastable atoms that reach it. The fraction of metastables surviving the upstream mesh is used in conjunction with Monte Carlo simulations, which give the average number of metastable/mesh collision, to yield a robust value of γ.

  6. Minior Actinide Doppler Coefficient Measurement Assessment

    SciTech Connect

    Nolan E. Hertel; Dwayne Blaylock

    2008-04-10

    The "Minor Actinide Doppler Coefficient Measurement Assessment" was a Department of Energy (DOE) U-NERI funded project intended to assess the viability of using either the FLATTOP or the COMET critical assembly to measure high temperature Doppler coefficients. The goal of the project was to calculate using the MCNP5 code the gram amounts of Np-237, Pu-238, Pu-239, Pu-241, AM-241, AM-242m, Am-243, and CM-244 needed to produce a 1E-5 in reactivity for a change in operating temperature 800C to 1000C. After determining the viability of using the assemblies and calculating the amounts of each actinide an experiment will be designed to verify the calculated results. The calculations and any doncuted experiments are designed to support the Advanced Fuel Cycle Initiative in conducting safety analysis of advanced fast reactor or acceoerator-driven transmutation systems with fuel containing high minor actinide content.

  7. Activity coefficient of aqueous sodium bicarbonate

    SciTech Connect

    Pitzer, Kenneth S.; Peiper, J. Christopher

    1980-09-01

    The determination of the activity coefficient and related properties of sodium bicarbonate presents special problems because of the appreciable vapor pressure of CO2 above such solutions. With the development of reliable equations for the thermodynamic properties of mixed electrolytes, it is possible to determine the parameters for NaHCO3 from cell measurements or NaCl-NaHCO3 mixtures. Literature data are analyzed to illustrate the method and provide interim values, hoever it is noted that further measurements over a wider range of concentrations would yield more definitive results. Lastly, an estimate is also given for the activity coefficient of KHCO3.

  8. THE LYMAN ALPHA REFERENCE SAMPLE: EXTENDED LYMAN ALPHA HALOS PRODUCED AT LOW DUST CONTENT

    SciTech Connect

    Hayes, Matthew; Oestlin, Goeran; Duval, Florent; Guaita, Lucia; Melinder, Jens; Sandberg, Andreas; Schaerer, Daniel; Verhamme, Anne; Orlitova, Ivana; Mas-Hesse, J. Miguel; Oti-Floranes, Hector; Adamo, Angela; Atek, Hakim; Cannon, John M.; Herenz, E. Christian; Kunth, Daniel; Laursen, Peter

    2013-03-10

    We report on new imaging observations of the Lyman alpha emission line (Ly{alpha}), performed with the Hubble Space Telescope, that comprise the backbone of the Lyman alpha Reference Sample. We present images of 14 starburst galaxies at redshifts 0.028 < z < 0.18 in continuum-subtracted Ly{alpha}, H{alpha}, and the far ultraviolet continuum. We show that Ly{alpha} is emitted on scales that systematically exceed those of the massive stellar population and recombination nebulae: as measured by the Petrosian 20% radius, R{sub P20}, Ly{alpha} radii are larger than those of H{alpha} by factors ranging from 1 to 3.6, with an average of 2.4. The average ratio of Ly{alpha}-to-FUV radii is 2.9. This suggests that much of the Ly{alpha} light is pushed to large radii by resonance scattering. Defining the Relative Petrosian Extension of Ly{alpha} compared to H{alpha}, {xi}{sub Ly{alpha}} = R {sup Ly{alpha}}{sub P20}/R {sup H{alpha}}{sub P20}, we find {xi}{sub Ly{alpha}} to be uncorrelated with total Ly{alpha} luminosity. However, {xi}{sub Ly{alpha}} is strongly correlated with quantities that scale with dust content, in the sense that a low dust abundance is a necessary requirement (although not the only one) in order to spread Ly{alpha} photons throughout the interstellar medium and drive a large extended Ly{alpha} halo.

  9. Correlation and prediction of gaseous diffusion coefficients.

    NASA Technical Reports Server (NTRS)

    Marrero, T. R.; Mason, E. A.

    1973-01-01

    A new correlation method for binary gaseous diffusion coefficients from very low temperatures to 10,000 K is proposed based on an extended principle of corresponding states, and having greater range and accuracy than previous correlations. There are two correlation parameters that are related to other physical quantities and that are predictable in the absence of diffusion measurements. Quantum effects and composition dependence are included, but high-pressure effects are not. The results are directly applicable to multicomponent mixtures.

  10. THE DIFFUSION COEFFICIENT OF CRYSTALLINE TRYPSIN

    PubMed Central

    Scherp, Henry W.

    1933-01-01

    The diffusion coefficient of crystalline trypsin in 0.5 saturated magnesium sulfate at 5°C. is 0.020 ±0.001 cm.2 per day, corresponding to a molecular radius of 2.6 x 10–7 cm. The rate of diffusion of the proteolytic activity is the same as that of the protein nitrogen, indicating that these two properties are held together in chemical combination and not in the form of an adsorption complex. PMID:19872740

  11. Understanding correlation coefficients in treaty verification. Revised

    SciTech Connect

    DeVolpi, A.

    1993-02-01

    When a pair of images is compared on a point-by-point basis, the linear-correlation coefficient is usually used as a measure of similarity or dissimilarity. This report evaluates the theoretical underpinnings and limitations of the linear-correlation coefficient, as well as other related statistics, particularly for cases where inherent white noise is present. As a result of the limitations in linear-correlation, an additional step has been derived -- local-sum clustering -- in order to improve recognition of small dissimilarities in a pair of otherwise identical images. Results show an optimal three-stage procedure: first, establish congruence of the two images; second, use the linear-correlation coefficient as a test of true negatives; and, third, qualify a true positive by using the cluster (local-sum) method. These three algorithmic stages would be especially useful in application to arms control treaty verification, particularly for comparison of unique identifiers (tags or seals). This is illustrated by comparing scanning-electron microscope topographical images for an intrinsic-surface tag.

  12. Stratospheric eddy diffusion coefficients from tracer data

    NASA Technical Reports Server (NTRS)

    Massie, S. T.; Hunten, D. M.

    1981-01-01

    Global distributions of nitrous oxide, methane, ozone, and carbon 14 are used to estimate four sets of stratospheric eddy diffusion coefficients. A photochemical equilibrium model calculates O(3P), O(1D), H, HO2, OH, H2O2, NO, and NO2 densities, as a function of altitude, latitude, and time. The calculated O(1D), OH, and observed Cl densities are used to obtain the eddy profiles associated with the methane and nitrous oxide distributions, for altitudes between 10 and 40 km. Application of a constant flux condition to the seasonally averaged ozone data yields eddy values below 20 km. Time-dependent carbon 14 calculations produce eddy coefficients between 13 and 27 km. A composite profile is obtained by comparing the four sets of coefficients. Further, carbon 14 computations are used to test these profiles as well as those recommended in reports issued by the National Academy of Sciences in 1976 and 1979. The composite eddy profile produces the best agreement.

  13. The electron diffusion coefficient in Jupiter's magnetosphere

    NASA Technical Reports Server (NTRS)

    Birmingham, T.; Northrop, T.; Baxter, R.; Hess, W.; Lojko, M.

    1974-01-01

    A steady-state model of Jupiter's electron radiation belt is developed. The model includes injection from the solar wind, radial diffusion, energy degradation by synchrotron radiation, and absorption at Jupiter's surface. A diffusion coefficient of the form D sub RR/R sub J squared = k times R to the m-th power is assumed, and then observed data on synchrotron radiation are used to fit the model. The free parameters determined from this fit are m = 1.95 plus or minus 0.5, k = 1.7 plus or minus 0.5 x 10 to the 9th power per sec, and the magnetic moment of injected particles equals 770 plus or minus 300 MeV/G. The value of m shows quite clearly that the diffusion is not caused by magnetic pumping by a variable solar wind or by a fluctuating convection electric field. The process might be field line exchange driven by atmospheric-ionospheric winds; our diffusion coefficient has roughly the same radial dependence but is considerably smaller in magnitude than the upper bound diffusion coefficients recently suggested for this process by Brice and McDonough (1973) and Jacques and Davis (1972).

  14. Roughness coefficients for stream channels in Arizona

    USGS Publications Warehouse

    Aldridge, B.N.; Garrett, J.M.

    1973-01-01

           n in which V = mean cross-sectional velocity of flow, in feet per second; R = hydraulic radius at a cross section, which is the cross-sectional area divided by the wetter perimeter, in feet; Se = energy slope; and n = coefficient of roughness. Many research studies have been made to determine "n" values for open-channel flow (Carter and others, 1963). Guidelines for selecting coefficient of roughness for stream channels are given in most of the literature of stream-channel hydraulics, but few of the data relate directly to streams of Arizona, The U.S> Geological Survey, at the request of the Arizona Highway Department, assembled the color photographs and tables of the Manning "n" values in this report to aid highway engineers in the selection of roughness coefficients for Arizona streams. Most of the photographs show channel reaches for which values of "n" have been assigned by experienced Survey personnel; a few photographs are included for reaches where "n" values have been verified. Verified "n" values are computed from a known discharge and measured channel geometry. Selected photographs of stream channels for which "n" values have been verified are included in U.S. Geological Survey Water-Supply Paper 1849 (Barnes, 1967); stereoscopic slides of Barnes' (1967) photographs and additional photographs can be inspected at U.S> Geological Survey offices in: 2555 E. First Street, Tucson; and 5017 Federal Building, 230 N. First Avenue, Phoenix.

  15. Subjective pain perception mediated by alpha rhythms.

    PubMed

    Peng, Weiwei; Babiloni, Claudio; Mao, Yanhui; Hu, Yong

    2015-07-01

    Suppression of spontaneous alpha oscillatory activities, interpreted as cortical excitability, was observed in response to both transient and tonic painful stimuli. The changes of alpha rhythms induced by pain could be modulated by painful sensory inputs, experimental tasks, and top-down cognitive regulations such as attention. The temporal and spatial characteristics, as well as neural functions of pain induced alpha responses, depend much on how these factors contribute to the observed alpha event-related desynchronization/synchronization (ERD/ERS). How sensory-, task-, and cognitive-related changes of alpha oscillatory activities interact in pain perception process is reviewed in the current study, and the following conclusions are made: (1) the functional inhibition hypothesis that has been proposed in auditory and visual modalities could be applied also in pain modality; (2) the neural functions of pain induced alpha ERD/ERS were highly dependent on the cortical regions where it is observed, e.g., somatosensory cortex alpha ERD/ERS in pain perception for painful stimulus processing; (3) the attention modulation of pain perception, i.e., influences on the sensory and affective dimensions of pain experience, could be mediated by changes of alpha rhythms. Finally, we propose a model regarding the determinants of pain related alpha oscillatory activity, i.e., sensory-discriminative, affective-motivational, and cognitive-modulative aspects of pain experience, would affect and determine pain related alpha oscillatory activities in an integrated way within the distributed alpha system. PMID:26026894

  16. Dependence of the osmotic coefficients and average ionic activity coefficients on hydrophobic hydration in solutions

    NASA Astrophysics Data System (ADS)

    Sergievskii, V. V.; Rudakov, A. M.

    2016-08-01

    The model that considers the nonideality of aqueous solutions of electrolytes with allowance for independent contributions of hydration of ions of various types and electrostatic interactions was substantiated using the cluster ion model. The empirical parameters in the model equations were found to be the hydrophilic and hydrophobic hydration numbers of ions in the standard state and the dispersion of their distribution over the stoichiometric coefficients. A mathematically adequate description of the concentration dependences of the osmotic coefficients and average ion activity coefficients of electrolytes was given for several systems. The difference in the rate of the decrease in the hydrophilic and hydrophobic hydration numbers of ions leads to extremum concentration dependences of the osmotic coefficients, which were determined by other authors from isopiestic data for many electrolytes and did not find explanation.

  17. Copernicus measurement of the Jovian Lyman-alpha emission and its aeronomical significance

    NASA Technical Reports Server (NTRS)

    Atreya, S. K.; Kerr, R. B.; Upson, W. L., II; Festou, M. C.; Donahue, T. M.; Barker, E. S.; Cochran, W. D.; Bertaux, J. L.

    1982-01-01

    It is pointed out that the intensity of the Lyman-alpha emission is a good indicator of the principal aeronomical processes on the major planets. The high-resolution ultraviolet spectrometer aboard the Orbiting Astronomical Observatory Copernicus was used in 1980 April and May to detect the Jovian Lyman-alpha emission by spectroscopically discriminating it from other Doppler shifted Lyman-alpha emissions such as those of the geocorona, and the interplanetary medium. Taking into consideration the reported emission data, it appears that an unusually large energy input due to the particle precipitation in the auroral region must have been responsible for the large observed Lyman-alpha intensity during the Voyager encounter. At most other times, the observed Jovian Lyman-alpha intensity can be explained, within the range of statistical uncertainty, by a model that takes into consideration the solar EUV flux, the solar Lyman-alpha flux, the high exospheric temperature, and the eddy diffusion coefficient without energy input from the auroral sources.

  18. Modeling of MeV alpha particle energy transfer to lower hybrid waves

    SciTech Connect

    Schivell, J.; Monticello, D.A.; Fisch, N.; Rax, J.M.

    1993-10-01

    The interaction between a lower hybrid wave and a fusion alpha particle displaces the alpha particle simultaneously in space and energy. This results in coupled diffusion. Diffusion of alphas down the density gradient could lead to their transferring energy to the wave. This could, in turn, put energy into current drive. An initial analytic study was done by Fisch and Rax. Here the authors calculate numerical solutions for the alpha energy transfer and study a range of conditions that are favorable for wave amplification from alpha energy. They find that it is possible for fusion alpha particles to transfer a large fraction of their energy to the lower hybrid wave. The numerical calculation shows that the net energy transfer is not sensitive to the value of the diffusion coefficient over a wide range of practical values. An extension of this idea, the use of a lossy boundary to enhance the energy transfer, is investigated. This technique is shown to offer a large potential benefit.

  19. High-Resolution {alpha} and Electron Spectroscopy of {sup 249}{sub 98}Cf

    SciTech Connect

    Ahmad, I.; Greene, J. P.; Kondev, F. G.; Zhu, S.

    2015-04-13

    alpha-particle spectra of Cf-249 have been measured with a double-focusing magnetic spectrometer and with passivated implanted planar silicon (PIPS) detectors. The conversion-electron spectra of Cf-249 have been measured with a cooled Si(Li) detector and with a room-temperature PIPS detector. Precise energies of a groups in the decay of Cf-249 have been measured with respect to the known energy of Cf-250. In addition, alpha-electron, alpha-gamma, and gamma-gamma coincidence measurements were also performed to determine the spin-parity of the previously known 643.64-keV level. From electron intensities, conversion coefficients of transitions in the daughter Cm-245 have been determined. The measured L-3 conversion coefficients of the 333.4- and 388.2-keV transitions are found to be in agreement with the theoretical conversion coefficients for pure E1 multipolarity. On the other hand, the K, L-1 + L-2, M, and N conversion coefficients are approximately twice the theoretical values for pure E1 transitions. These measurements indicate anomalous E1 conversion coefficients for the 333.4- and 388.2-keV transitions, as has been pointed out in earlier measurements. The measured conversion coefficient of the 255.5-keV transition gives an M1 multipolarity for this transition which establishes a spin-parity of 7/2(-) and the 7/2(-)[743] single-particle assignment to the 643.64-keV level.

  20. Synthesis of 16 alpha-3H androgen and estrogen substrates for 16 alpha-hydroxylase.

    PubMed

    Cantineau, R; Kremers, P; De Graeve, J; Cornelis, A; Laszlo, P; Gielen, J E; Lambotte, R

    1981-02-01

    The synthesis of 16 alpha-3H androgens and estrogens is described. 1-(3H)-Acetic acid in the presence of zinc dust reacts with 16 alpha-bromo-17-ketosteroids to produce 16 alpha-3H-17-ketosteroids. This chemical reaction was used to prepare 16 alpha-3H-dehydroepiandrosterone (I) and 16 alpha-3H-estrone acetate (XI) from 16 alpha-bromo-dehydroepiandrosterone (X) and from 16 alpha-bromo-estrone acetate (XII), respectively. Using appropriate microbiological techniques, it was possible to convert these radiolabelled substrates into 16 alpha-3H-androstenedione (II) and 16 alpha-3H-estradiol-17 beta (VII). 16 alpha-3H-Estrone (VI) was obtained by the chemical hydrolysis of 16 alpha-3H-estrone acetate. The label distribution as determined by microbiological 16 alpha-hydroxylations indicated a specific labelling of 77% for androgens and 65% for estrogens in the 16 alpha position. These substrates can be used for measuring the 16 alpha hydroxylase activity, an important step in the biosynthesis of estriol (VIII) and estetrol (IX). PMID:7013160

  1. Reference Phantom Method for Acoustic Backscatter Coefficient and Attenuation Coefficient Measurements.

    NASA Astrophysics Data System (ADS)

    Yao, Linxin

    1990-08-01

    In previous work in our laboratory accurate backscatter coefficient measurements were obtained with a data reduction method that explicitly accounts for experimental factors involved in recording echo data. An alternative, relative processing method for determining the backscatter coefficient and the attenuation coefficient is presented here. This method involves comparison of echo data from a sample with data recorded from a reference phantom whose backscatter and attenuation coefficients are known. The ratio of the signals cancels depth-dependent instrumentation factors. This saves the efforts of beam profile computation and various calibrations. The attenuation coefficient and backscatter coefficient of the sample are found from these ratios and the known acoustic properties of the reference phantom. This method is tested using tissue-mimicking phantoms with known scattering and attenuation properties. Various experiments have been done using clinical scanners with different transducers to compute attenuation coefficients and backscatter coefficients, and to make quantitative images. This method has been found to be accurate for media containing Rayleigh scatterers, as well as samples containing intermediate-size scatterers. Accuracy was maintained over different frequency bands and for a wide range of transducer-to-ROI distances. Measurements were done in vivo for human livers, kidneys and dog myocardium. The results have shown that the reference phantom method simplifies the measurement procedure as well as keeps the accuracy, and therefore is practical clinically. Statistical uncertainties propagated in the data reduction have been analyzed in detail. Formulae are deduced to predict statistical errors in the attenuation and backscatter coefficients measured with the reference phantom method. Spatial correlations of the echo signals are also considered. A 2-dimensional lateral correlation matrix is introduced to compute the number of effective independent

  2. A study of presynaptic alpha2-autoreceptors in alpha2A/D-, alpha2B- and alpha2C-adrenoceptor-deficient mice.

    PubMed

    Trendelenburg, A U; Klebroff, W; Hein, L; Starke, K

    2001-08-01

    The function of presynaptic alpha2-autoreceptors was studied in the hippocampus, occipito-parietal cortex, atria and vas deferens of NMRI mice, mice in which the alpha2A/D-, the alpha2B- or alpha2c-adrenoceptor gene had been disrupted (alpha2A/DKO, alpha2BKO and alpha2CKO, respectively), and the wildtype mice from which the knockout animals had been generated. Tissue pieces were preincubated with 3H-noradrenaline and then superfused and stimulated electrically. The alpha2-adrenoceptor agonist medetomidine reduced the electrically evoked overflow of tritium in all tissues from all mouse strains (stimulation with single pulses or single high-frequency pulse trains, called POPs, i.e. pulse patterns leading to minimal autoinhibition). The effects of medetomidine did not differ in NMRI, wildtype, alpha2BKO and alpha2CKO mice but were greatly reduced in alpha2A/DKO brain preparations and to a lesser extent in alpha2A/DKO atria and vasa deferentia. Six drugs were tested as antagonists against medetomidine. Their pKd values indicated that the hippocampal and occipito-parietal alpha2-autoreceptors in NMRI and wildtype mice were alpha2D (the rodent variant of the alpha2A/D-adrenoceptor) whereas the atrial and vas deferens alpha2-autoreceptors in NMRI and wildtype mice could not be identified with a single alpha2 subtype. Deletion of the alpha2A/D gene changed the pKd values in all tissues so that they now reflected alpha2C properties, whereas deletion of the alpha2C gene changed the pKd values in atria and vasa deferentia so that they now had alpha2D properties (as they had in NMRI and wildtype brain preparations). Autoinhibition by released noradrenaline was created using trains of up to 64 pulses or up to 4 POPs, and the overflow-enhancing effect of the alpha2 antagonist rauwolscine was determined. Results did not differ, irrespective of whether preparations were obtained from NMRI, wildtype, alpha2BKO or alpha2CKO mice: the overflow of tritium elicited by p pulses or POPs

  3. The Assessment of Reliability Under Range Restriction: A Comparison of [Alpha], [Omega], and Test-Retest Reliability for Dichotomous Data

    ERIC Educational Resources Information Center

    Fife, Dustin A.; Mendoza, Jorge L.; Terry, Robert

    2012-01-01

    Though much research and attention has been directed at assessing the correlation coefficient under range restriction, the assessment of reliability under range restriction has been largely ignored. This article uses item response theory to simulate dichotomous item-level data to assess the robustness of KR-20 ([alpha]), [omega], and test-retest…

  4. Computing confidence intervals for standardized regression coefficients.

    PubMed

    Jones, Jeff A; Waller, Niels G

    2013-12-01

    With fixed predictors, the standard method (Cohen, Cohen, West, & Aiken, 2003, p. 86; Harris, 2001, p. 80; Hays, 1994, p. 709) for computing confidence intervals (CIs) for standardized regression coefficients fails to account for the sampling variability of the criterion standard deviation. With random predictors, this method also fails to account for the sampling variability of the predictor standard deviations. Nevertheless, under some conditions the standard method will produce CIs with accurate coverage rates. To delineate these conditions, we used a Monte Carlo simulation to compute empirical CI coverage rates in samples drawn from 36 populations with a wide range of data characteristics. We also computed the empirical CI coverage rates for 4 alternative methods that have been discussed in the literature: noncentrality interval estimation, the delta method, the percentile bootstrap, and the bias-corrected and accelerated bootstrap. Our results showed that for many data-parameter configurations--for example, sample size, predictor correlations, coefficient of determination (R²), orientation of β with respect to the eigenvectors of the predictor correlation matrix, RX--the standard method produced coverage rates that were close to their expected values. However, when population R² was large and when β approached the last eigenvector of RX, then the standard method coverage rates were frequently below the nominal rate (sometimes by a considerable amount). In these conditions, the delta method and the 2 bootstrap procedures were consistently accurate. Results using noncentrality interval estimation were inconsistent. In light of these findings, we recommend that researchers use the delta method to evaluate the sampling variability of standardized regression coefficients.

  5. Transport coefficients of He(+) ions in helium.

    PubMed

    Viehland, Larry A; Johnsen, Rainer; Gray, Benjamin R; Wright, Timothy G

    2016-02-21

    This paper demonstrates that the transport coefficients of (4)He(+) in (4)He can be calculated over wide ranges of E/N, the ratio of the electrostatic field strength to the gas number density, with the same level of precision as can be obtained experimentally if sufficiently accurate potential energy curves are available for the X(2)Σu (+) and A(2)Σg (+) states and one takes into account resonant charge transfer. We start by computing new potential energy curves for these states and testing their accuracy by calculating spectroscopic values for the separate states. It is established that the potentials obtained by extrapolation of results from d-aug-cc-pVXZ (X = 6, 7) basis sets using the CASSCF+MRCISD approach are each in exceptionally close agreement with the best potentials available and with experiment. The potentials are then used in a new computer program to determine the semi-classical phase shifts and the transport cross sections, and from these the gaseous ion transport coefficients are determined. In addition, new experimental values are reported for the mobilities of (4)He(+) in (4)He at 298.7 K, as a function of E/N, where careful consideration is given to minimizing various sources of uncertainty. Comparison with previously measured values establishes that only one set of previous data is reliable. Finally, the experimental and theoretical ion transport coefficients are shown to be in very good to excellent agreement, once corrections are applied to account for quantum-mechanical effects. PMID:26896985

  6. Transport coefficients of He+ ions in helium

    NASA Astrophysics Data System (ADS)

    Viehland, Larry A.; Johnsen, Rainer; Gray, Benjamin R.; Wright, Timothy G.

    2016-02-01

    This paper demonstrates that the transport coefficients of 4He+ in 4He can be calculated over wide ranges of E/N, the ratio of the electrostatic field strength to the gas number density, with the same level of precision as can be obtained experimentally if sufficiently accurate potential energy curves are available for the X2Σu+ and A2Σg+ states and one takes into account resonant charge transfer. We start by computing new potential energy curves for these states and testing their accuracy by calculating spectroscopic values for the separate states. It is established that the potentials obtained by extrapolation of results from d-aug-cc-pVXZ (X = 6, 7) basis sets using the CASSCF+MRCISD approach are each in exceptionally close agreement with the best potentials available and with experiment. The potentials are then used in a new computer program to determine the semi-classical phase shifts and the transport cross sections, and from these the gaseous ion transport coefficients are determined. In addition, new experimental values are reported for the mobilities of 4He+ in 4He at 298.7 K, as a function of E/N, where careful consideration is given to minimizing various sources of uncertainty. Comparison with previously measured values establishes that only one set of previous data is reliable. Finally, the experimental and theoretical ion transport coefficients are shown to be in very good to excellent agreement, once corrections are applied to account for quantum-mechanical effects.

  7. Relative biological effectiveness for induction of cancer by protracted alpha versus beta internal irradiation

    SciTech Connect

    Raabe, O.G.

    1996-06-01

    Three-dimensional dose-rate/time/ response mathematical surfaces describe radiation effects in lifetime studies of beagles after Intake by injection or inhalation of selected radionuclides (including {alpha}-emitters {sup 226}Ra, {sup 239}Pu, {sup 238}Pu, and {sup 241}Am and {Beta}-emitters {sup 90}Sr, {sup 91}Y, and {sup 144}Ce) and in people after intake of {sup 226}Ra. For each effect t{sub m}=K{sub m}d{sup -s}, where t{sub m} is the median elapsed time to death with the specified effect after intake, d is the time-weighted average absorbed radiation dose-rate to the target organ, K{sub m} is the median distribution coefficient, and s is the negative slope parameter. Using maximum likelihood survival regression methods, for fatal cancer induction s was found to be one-third for {alpha} radiation and two-thirds for {beta} radiation. Because the slopes of the response curves for high LET {alpha} emitters differ from those for the low LET {Beta} emitters, the observed relative biological effectiveness, RBE({alpha}/{beta}), varies as a function of time-weighted average dose rate. At high dose rates, this radiation-induced cancer RBE({alpha}/{beta}) is small, but as dose rate goes down, the radiation-induced cancer RBE({alpha}/{beta}) rises without limit; actually the RBE({beta}/{alpha}) for producing radiation-induced cancer approaches zero. For example, for {sup 239}Pu dioxide in lung at 0.1 Gy d{sup -1} vs. {sup 90}Sr, the RBE({alpha}/{beta})=5, while at 1 mGy d{sup -1}, RBE({alpha}/{Beta})=50. The bone cancer RBE({alpha}/{beta})=l at 0.16 Gy d{sup -1} but RBE({alpha}/{beta})=30 at 1 mGy d{sup -1} for {sup 226}Ra/{sup 90}Sr in bone. Since {sup 238}Pu and {sup 239}Pu are about 10 times more effective than {sup 226}Ra in producing bone cancer, the apparent RBE({alpha}/{beta})=300 for plutonium in bone at 1 mG d{sup -1}.

  8. Experimental rotordynamic coefficient results for honeycomb seals

    NASA Technical Reports Server (NTRS)

    Elrod, David A.; Childs, Dara W.

    1988-01-01

    Test results (leakage and rotordynamic coefficients) are presented for seven honeycomb-stator smooth-rotor seals. Tests were carried out with air at rotor speeds up to 16,000 cpm and supply pressures up to 8.2 bars. Test results for the seven seals are compared, and the most stable configuration is identified based on the whirl frequency ratio. Results from tests of a smooth-rotor/smooth-stator seal, a teeth-on-stator labyrinth seal, and the most stable honeycomb seal are compared.

  9. Micro-Fluidic Diffusion Coefficient Measurement

    SciTech Connect

    Forster, F.K.; Galambos, P.

    1998-10-06

    A new method for diffusion coefficient measurement applicable to micro-fluidics is pre- sented. The method Iltilizes an analytical model describing laminar dispersion in rect- anglllar ~llicro_channe]s. The Illethod ~vas verified throllgh measllremen~ of fllloresceill diffusivity in water and aqueolls polymer solutions of differing concentration. The diffll- sivity of flllorescein was measlmed as 0.64 x 10-gm2/s in water, 0.49 x 10-gm2/s in the 4 gm/dl dextran solution and 0.38 x 10-9n12/s in the 8 gnl/dl dextran solution.

  10. Studies of Gaseous Multiplication Coefficient in Isobutane

    SciTech Connect

    Lima, Iara B.; Vivaldini, Tulio C.; Goncalves, Josemary A. C.; Botelho, Suzana; Bueno Tobias, Carmen C.; Ridenti, Marco A.; Pascholati, Paulo R.; Fonte, Paulo; Mangiarotti, Alessio

    2010-05-21

    This work presents the studies of gaseous multiplication coefficient behavior for isobutane, as function of the reduced electric field, by means of signal amplitude analysis. The experimental method used is based on the Pulsed Townsend technique, which follows from Townsend equation solution for a uniform electric field. In our configuration, the anode is made of a high resistivity (2.10{sup 12} OMEGA.cm) glass, while the cathode is of aluminium. In order to validate the technique and to analyze effects of non-uniformity, results for nitrogen, which has well-established data available in literature, are also presented.

  11. Surface area coefficients for airship envelopes

    NASA Technical Reports Server (NTRS)

    Diehl, W S

    1922-01-01

    In naval architecture, it is customary to determine the wetted surface of a ship by means of some formula which involves the principal dimensions of the design and suitable constants. These formulas of naval architecture may be extended and applied to the calculation of the surface area of airship envelopes by the use of new values of the constants determined for this purpose. Surface area coefficients were calculated from the actual dimensions, surfaces, and volumes of 52 streamline bodies, which form a series covering the entire range of shapes used in the present aeronautical practice.

  12. Gauge Invariance of Thermal Transport Coefficients

    NASA Astrophysics Data System (ADS)

    Ercole, Loris; Marcolongo, Aris; Umari, Paolo; Baroni, Stefano

    2016-10-01

    Thermal transport coefficients are independent of the specific microscopic expression for the energy density and current from which they can be derived through the Green-Kubo formula. We discuss this independence in terms of a kind of gauge invariance resulting from energy conservation and extensivity, and demonstrate it numerically for a Lennard-Jones fluid, where different forms of the microscopic energy density lead to different time correlation functions for the heat flux, all of them, however, resulting in the same value for the thermal conductivity.

  13. Modeling canopy reflectance and microwave backscattering coefficient

    NASA Technical Reports Server (NTRS)

    Goel, N. S.

    1985-01-01

    Various approaches to model canopy reflectance (CR) in the visible/infrared region and backscattering coefficient (BSC) in the microwave region are compared and contrasted. It is noted that BSC can be related to CR in the source direction (the 'hot spot' direction). By assuming a frequency dependent leaf reflectance and transmittance it is shown that the observed dependence of BSC on leaf area index, leaf angle distribution, angle of incidence, soil moisture content, and frequency can be simulated by a CR model. Thus both BSC and CR can, in principle, be calculated using a single model which has essentially the same parameters as many CR models do.

  14. Elastic-Stiffness Coefficients of Titanium Diboride

    PubMed Central

    Ledbetter, Hassel; Tanaka, Takaho

    2009-01-01

    Using resonance ultrasound spectroscopy, we measured the monocrystal elastic-stiffness coefficients, the Voigt Cij, of TiB2. With hexagonal symmetry, TiB2 exhibits five independent Cij: C11, C33, C44, C12, C13. Using Voigt-Reuss-Hill averaging, we converted these monocrystal values to quasiisotropic (polycrystal) elastic stiffnesses. Briefly, we comment on effects of voids. From the Cij, we calculated the Debye characteristic temperature, the Grüneisen parameter, and various sound velocities. Our study resolves the enormous differences between two previous reports of TiB2’s Cij. PMID:27504232

  15. Estimating Vertical Diffusion Coefficients By Lidar

    NASA Technical Reports Server (NTRS)

    Culkowski, Walter M.; Swisher, Searle D.

    1973-01-01

    The Atmospheric Turbulence and Diffusion Laboratory at Oak Ridge, Tennessee has been conducting routine probing of the lower troposphere and comparing the results with those obtained with turbidity photometers and a distant suspended particulate station. The change in scale height, K (sub z) divided by v (sub s), with time permits the vertical turbulence coefficient K (sub z) to be estimated if v (sub s) is known or assumed. Extremely high monthly correlations of turbidity versus the log of backscatter at 100 meters have been obtained. In addition, high correlations of suspended particulate matter at Chattanooga and Oak Ridge suggest that the bulk of particulate matter is of natural, rather than industrial, origin.

  16. Surfaces with adaptive radar reflection coefficients

    NASA Astrophysics Data System (ADS)

    Chambers, Barry

    1997-10-01

    Conventional (passive) radar-absorbing materials (RAM) have been in use now for over half a century, but it is only with recent advances in conducting polymer composite materials that large-area surfaces having controllable reflection coefficients at radar frequencies have become practicable. Techniques for utilizing these new materials in re-configurable electromagnetic, or `smart', surfaces are reviewed, with due emphasis given to the problem of system integration. The discussion is complemented by modelled and measured performance data on several smart surface configurations.

  17. Fresnel coefficients in materials with magnetic monopoles.

    PubMed

    Costa-Quintana, J; López-Aguilar, F

    2011-02-14

    Recent experiments have found entities in crystals whose behavior is equivalent to magnetic monopoles. In this paper, we explain some optical properties based on the reformulated "Maxwell" equations in material media in which there are equivalent magnetic charges. We calculate the coefficients of reflection and transmission of an electromagnetic wave in a plane interface between the vacuum and a medium with magnetic charges. These results can give a more extended vision of the properties of the materials with magnetic monopoles, since the phase and the amplitudes of the reflected and transmitted waves, differ with and without these magnetic entities.

  18. High gas flow alpha detector

    DOEpatents

    Bolton, Richard D.; Bounds, John A.; Rawool-Sullivan, Mohini W.

    1996-01-01

    An alpha detector for application in areas of high velocity gas flows, such as smokestacks and air vents. A plurality of spaced apart signal collectors are placed inside an enclosure, which would include smokestacks and air vents, in sufficient numbers to substantially span said enclosure so that gas ions generated within the gas flow are electrostatically captured by the signal collector means. Electrometer means and a voltage source are connected to the signal collectors to generate an electrical field between adjacent signal collectors, and to indicate a current produced through collection of the gas ions by the signal collectors.

  19. High gas flow alpha detector

    DOEpatents

    Bolton, R.D.; Bounds, J.A.; Rawool-Sullivan, M.W.

    1996-05-07

    An alpha detector for application in areas of high velocity gas flows, such as smokestacks and air vents. A plurality of spaced apart signal collectors are placed inside an enclosure, which would include smokestacks and air vents, in sufficient numbers to substantially span said enclosure so that gas ions generated within the gas flow are electrostatically captured by the signal collector means. Electrometer means and a voltage source are connected to the signal collectors to generate an electrical field between adjacent signal collectors, and to indicate a current produced through collection of the gas ions by the signal collectors. 4 figs.

  20. SDSS-II: Determination of shape and color parameter coefficients for SALT-II fit model

    SciTech Connect

    Dojcsak, L.; Marriner, J.; /Fermilab

    2010-08-01

    In this study we look at the SALT-II model of Type IA supernova analysis, which determines the distance moduli based on the known absolute standard candle magnitude of the Type IA supernovae. We take a look at the determination of the shape and color parameter coefficients, {alpha} and {beta} respectively, in the SALT-II model with the intrinsic error that is determined from the data. Using the SNANA software package provided for the analysis of Type IA supernovae, we use a standard Monte Carlo simulation to generate data with known parameters to use as a tool for analyzing the trends in the model based on certain assumptions about the intrinsic error. In order to find the best standard candle model, we try to minimize the residuals on the Hubble diagram by calculating the correct shape and color parameter coefficients. We can estimate the magnitude of the intrinsic errors required to obtain results with {chi}{sup 2}/degree of freedom = 1. We can use the simulation to estimate the amount of color smearing as indicated by the data for our model. We find that the color smearing model works as a general estimate of the color smearing, and that we are able to use the RMS distribution in the variables as one method of estimating the correct intrinsic errors needed by the data to obtain the correct results for {alpha} and {beta}. We then apply the resultant intrinsic error matrix to the real data and show our results.

  1. Transport coefficients for the shear dynamo problem at small Reynolds numbers

    SciTech Connect

    Singh, Nishant K.; Sridhar, S.

    2011-05-15

    We build on the formulation developed in S. Sridhar and N. K. Singh [J. Fluid Mech. 664, 265 (2010)] and present a theory of the shear dynamo problem for small magnetic and fluid Reynolds numbers, but for arbitrary values of the shear parameter. Specializing to the case of a mean magnetic field that is slowly varying in time, explicit expressions for the transport coefficients {alpha}{sub il} and {eta}{sub iml} are derived. We prove that when the velocity field is nonhelical, the transport coefficient {alpha}{sub il} vanishes. We then consider forced, stochastic dynamics for the incompressible velocity field at low Reynolds number. An exact, explicit solution for the velocity field is derived, and the velocity spectrum tensor is calculated in terms of the Galilean-invariant forcing statistics. We consider forcing statistics that are nonhelical, isotropic, and delta correlated in time, and specialize to the case when the mean field is a function only of the spatial coordinate X{sub 3} and time {tau}; this reduction is necessary for comparison with the numerical experiments of A. Brandenburg, K. H. Raedler, M. Rheinhardt, and P. J. Kaepylae [Astrophys. J. 676, 740 (2008)]. Explicit expressions are derived for all four components of the magnetic diffusivity tensor {eta}{sub ij}({tau}). These are used to prove that the shear-current effect cannot be responsible for dynamo action at small Re and Rm, but for all values of the shear parameter.

  2. Electron distribution function and recombination coefficient in ultracold plasma in a magnetic field

    SciTech Connect

    Bobrov, A. A.; Bronin, S. Ya.; Zelener, B. B.; Zelener, B. V.; Manykin, E. A.; Khikhlukha, D. R.

    2013-07-15

    The electron distribution function and diffusion coefficient in energy space have been calculated for the first time for a weakly coupled ultracold plasma in a magnetic field in the range of magnetic fields B = 100-50000 G for various temperatures. The dependence of these characteristics on the magnetic field is analyzed and the distribution function is shown to depend on the electron energy shift in a magnetic field. The position of the 'bottleneck' of the distribution function has been found to be shifted toward negative energies with increasing magnetic field. The electron velocity autocorrelators as a function of the magnetic field have been calculated; their behavior suggests that the frequency of collisions between charged particles decreases significantly with increasing magnetic field. The collisional recombination coefficient {alpha}{sub B} has been calculated in the diffusion approximation for a weakly coupled ultracold plasma in a magnetic field. An increase in magnetic field is shown to lead to a decrease in {alpha}{sub B} and this decrease can be several orders of magnitude.

  3. Separation of Cf, Es, and Fm by eluative chromatography using ammonium. cap alpha. -hydroxyisobutyrate

    SciTech Connect

    Mikheev, N.B.; Kamenskaya, A.N.; Auerman, L.N.; Kulyukhin, S.A.; Rumer, I.A.; Novichenko, V.L.

    1987-11-01

    The method of separation of californium, einsteinium, fermium, and certain lanthanides, based on the use of ammonium ..cap alpha..-hydroxyisobutyrate as the eluent, has been improved. The use of a 0.10-0.14 M solution of this reagent and columns (9 x 0.5 cm) filled with the resin Aminex SB with particle size 20-25 ..mu.., permitted the production of about 0.5 ..mu..g of einsteinium-253 from irradiated californium-252 with coefficient of purification of einsteinium from californium in two cycles of adsorption and elution of approx. 10/sup 10/. The coefficient of separation of californium and einsteinium is equal to 1.6 and that of einsteinium and fermium 1.9. The behavior of certain lanthanides in the separation of californium, einsteinium, and fermium using a 0.010 M solution of ammonium ..cap alpha..-hydroxyisobutyrate is discussed.

  4. Reliability of {alpha}{sub 1} and {alpha}{sub 2} from lattice codes

    SciTech Connect

    Ng, K.Y.

    1996-10-01

    Whether the higher-order terms in the momentum-compaction factor, {alpha}{sub 1} and {alpha}{sub 2}, can be obtained reliably from lattice codes is an important issue for some quasi-isochronous rings. A FODO lattice consisting of thin quadrupoles, dipoles filling all spaces, and two families of thin sextupoles is solved and {alpha}{sub 1} and {alpha}{sub 2} are derived analytically. We find accurate agreement with SYNCH is examined. Some methods of measurement of {alpha}{sub 1} and {alpha}{sub 2} are discussed.

  5. alpha-DNA. VII. Solid phase synthesis of alpha-anomeric oligodeoxyribonucleotides.

    PubMed Central

    Morvan, F; Rayner, B; Leonetti, J P; Imbach, J L

    1988-01-01

    An efficient procedure for the synthesis of unnatural alpha-anomeric oligodeoxyribonucleotides is described. This solid-phase procedure is based on the use of alpha-nucleoside phosphoramidites and alpha-nucleoside derivatized solid supports corresponding to the four natural bases and allow rapid synthesis of oligonucleotides up to 20 alpha-deoxynucleotide units in length. After HPLC purification, a 15-mer: alpha-d(CCTCTCGTTCTTTAC) and a 20-mer: alpha-d(ATACTTGAGGAAGAGGTGTT) were obtained respectively in 27 and 29% overall yields. Their purity, nucleoside composition and primary structure were ascertained by HPLC and Maxam-Gilbert sequence analyses. Images PMID:3344220

  6. Use of a laser beam with an oblique angle of incidence to measure the reduced scattering coefficient of a turbid medium

    NASA Astrophysics Data System (ADS)

    Wang, Lihong; Jacques, Steven L.

    1995-05-01

    A simple and quick approach is used to measure the reduced scattering coefficient ( mu s `) of a semi-infinite turbid medium having a much smaller absorption coefficient than mu s`. A laser beam with an oblique angle of incidence to the medium causes the center of the diffuse reflectance that is several transport mean-free paths away from the incident point to shift away from the point of incidence by an amount Delta x. This amount is used to compute mu s` by mu s` = sin( alpha i)/(n Delta x), where n is the refractive index of the turbid medium divided by that of the incident medium and alpha i is the angle of incidence measured from the surface normal. For a turbid medium having an absorption coefficient comparable with mu s `, a revision to the above formula is made. This method is tested theoretically by Monte Carlo simulations and experimentally by a video reflectometer.

  7. X-ray analysis of alpha mercuric iodide crystal structure and processing effects

    SciTech Connect

    Keller, L.; Wang, E.X.; Cheng, A.Y.

    1993-07-01

    X-ray topography and rocking curve experiments were performed on {alpha}-mercuric iodide samples. As-grown crystals were examined for Intrinsic defects and crystallinity. Orientation of certain defects depends on the direction of crystal growth. The propagation of as-grown crystalline features was documented. The extent of crystal damage Introduced during various steps of device fabrication such as sawing, polishing, etching and contact deposition was explored. Coefficients of linear thermal expansion of {alpha}{sub 33} = 54 {plus_minus} 5{center_dot}10{sup {minus}6}/{degrees}C along the tetragonal c-axis, [001] direction and {alpha}{sub 11} = 11 {plus_minus} 4{center_dot}10{sup {minus}6}/{degrees}C in the [100] direction were measured.

  8. Estimating biokinetic coefficients in the PACT™ system.

    PubMed

    Shen, Zhiyao; Arbuckle, Wm Brian

    2016-02-01

    When powdered activated carbon (PAC) is continuously added to the aeration tank of an activated sludge reactor, the modification is called a PACT™ process (for powdered activated carbon treatment). The PAC provides many benefits, but complicates the determination of biological phenomena. Determination of bio-oxidation kinetics in a PACT system is a key to fully understanding enhanced biological mechanisms resulting from PAC addition. A model is developed to account for the main mechanisms involved in the PACT system -- adsorption, air stripping and bio-oxidation. The model enables the investigation of biokinetic information, including possible synergistic effects. Six parallel reactors were used to treat a synthetic waste; three activated sludge and three PACT. The PACT reactors provided significantly reduced effluent TOC (total organic carbon). Biokinetic coefficients were obtained from steady-state data using averaged reactor data and by using all data (22 points for each reactor). As expected, the PACT reactors resulted in a substantial reduction in the effluent concentration of non-biodegradable total organic carbon. The Monod equation's half-saturation coefficient (Ks) was reduced significantly in the PACT reactors, resulting in higher growth rates at lower concentrations. The maximum specific substrate utilization (qm) rate was also reduced about 25% using the averaged data and remained unchanged using all the data. The substrate utilization values are affected by errors in biomass determination and more research is needed to accurately determine biomass.

  9. Virial coefficients of Lennard-Jones mixtures

    NASA Astrophysics Data System (ADS)

    Schultz, Andrew J.; Kofke, David A.

    2009-06-01

    We report results of calculations of the second through sixth virial coefficients for four prototype Lennard-Jones (LJ) mixtures that have been the subject of previous studies in the literature. Values are reported for temperatures ranging from T =0.6 to T =10.0, where here the temperature is given units of the LJ energy parameter of one of the components. Thermodynamic stability of the mixtures is studied using the virial equation of state (VEOS) with the calculated coefficients, with particular focus on characterizing the vapor-liquid critical behavior of the mixtures. For three of the mixtures, vapor-liquid coexistence and critical data are available for comparison at only one temperature, while for the fourth we can compare to a critical line. We find that the VEOS provides a useful indication of the presence and location of critical behavior, although in some situations we find need to consider "near-miss" critical behavior, where the classical conditions of criticality are nearly but not exactly satisfied.

  10. Angular Fock coefficients: Refinement and further development

    NASA Astrophysics Data System (ADS)

    Liverts, Evgeny Z.; Barnea, Nir

    2015-10-01

    The angular coefficients ψk ,p(α ,θ ) of the Fock expansion characterizing the S -state wave function of the two-electron atomic system are calculated in hyperspherical angular coordinates α and θ . To solve the problem the Fock recurrence relations separated into the independent individual equations associated with definite power j of the nucleus charge Z are applied. The "pure" j components of the angular Fock coefficients, orthogonal to the hyperspherical harmonics Yk l, are found for even values of k . To this end, the specific coupling equation is proposed and applied. Effective techniques for solving the individual equations with the simplest nonseparable and separable right-hand sides are proposed. Some mistakes or misprints made earlier in representations of ψ2 ,0, are noted and corrected. All j components of ψ4 ,1 and the majority of components and subcomponents of ψ3 ,0 are calculated and presented. All calculations are carried out with the help of Wolfram Mathematica.

  11. The Convergence Coefficient across Political Systems

    PubMed Central

    Schofield, Norman

    2013-01-01

    Formal work on the electoral model often suggests that parties or candidates should locate themselves at the electoral mean. Recent research has found no evidence of such convergence. In order to explain nonconvergence, the stochastic electoral model is extended by including estimates of electoral valence. We introduce the notion of a convergence coefficient, c. It has been shown that high values of c imply that there is a significant centrifugal tendency acting on parties. We used electoral surveys to construct a stochastic valence model of the the elections in various countries. We find that the convergence coefficient varies across elections in a country, across countries with similar regimes, and across political regimes. In some countries, the centripetal tendency leads parties to converge to the electoral mean. In others the centrifugal tendency dominates and some parties locate far from the electoral mean. In particular, for countries with proportional electoral systems, namely, Israel, Turkey, and Poland, the centrifugal tendency is very high. In the majoritarian polities of the United States and Great Britain, the centrifugal tendency is very low. In anocracies, the autocrat imposes limitations on how far from the origin the opposition parties can move. PMID:24385886

  12. Estimating biokinetic coefficients in the PACT™ system.

    PubMed

    Shen, Zhiyao; Arbuckle, Wm Brian

    2016-02-01

    When powdered activated carbon (PAC) is continuously added to the aeration tank of an activated sludge reactor, the modification is called a PACT™ process (for powdered activated carbon treatment). The PAC provides many benefits, but complicates the determination of biological phenomena. Determination of bio-oxidation kinetics in a PACT system is a key to fully understanding enhanced biological mechanisms resulting from PAC addition. A model is developed to account for the main mechanisms involved in the PACT system -- adsorption, air stripping and bio-oxidation. The model enables the investigation of biokinetic information, including possible synergistic effects. Six parallel reactors were used to treat a synthetic waste; three activated sludge and three PACT. The PACT reactors provided significantly reduced effluent TOC (total organic carbon). Biokinetic coefficients were obtained from steady-state data using averaged reactor data and by using all data (22 points for each reactor). As expected, the PACT reactors resulted in a substantial reduction in the effluent concentration of non-biodegradable total organic carbon. The Monod equation's half-saturation coefficient (Ks) was reduced significantly in the PACT reactors, resulting in higher growth rates at lower concentrations. The maximum specific substrate utilization (qm) rate was also reduced about 25% using the averaged data and remained unchanged using all the data. The substrate utilization values are affected by errors in biomass determination and more research is needed to accurately determine biomass. PMID:26613352

  13. Rotordynamic coefficients for stepped labyrinth gas seals

    NASA Technical Reports Server (NTRS)

    Scharrer, Joseph K.

    1989-01-01

    The basic equations are derived for compressible flow in a stepped labyrinth gas seal. The flow is assumed to be completely turbulent in the circumferential direction where the friction factor is determined by the Blasius relation. Linearized zeroth and first-order perturbation equations are developed for small motion about a centered position by an expansion in the eccentricity ratio. The zeroth-order pressure distribution is found by satisfying the leakage equation while the circumferential velocity distribution is determined by satisfying the momentum equations. The first order equations are solved by a separation of variables solution. Integration of the resultant pressure distribution along and around the seal defines the reaction force developed by the seal and the corresponding dynamic coefficients. The results of this analysis are presented in the form of a parametric study, since there are no known experimental data for the rotordynamic coefficients of stepped labyrinth gas seals. The parametric study investigates the relative rotordynamic stability of convergent, straight and divergent stepped labyrinth gas seals. The results show that, generally, the divergent seal is more stable, rotordynamically, than the straight or convergent seals. The results also show that the teeth-on-stator seals are not always more stable, rotordynamically, then the teeth-on-rotor seals as was shown by experiment by Childs and Scharrer (1986b) for a 15 tooth seal.

  14. Link prediction with node clustering coefficient

    NASA Astrophysics Data System (ADS)

    Wu, Zhihao; Lin, Youfang; Wang, Jing; Gregory, Steve

    2016-06-01

    Predicting missing links in incomplete complex networks efficiently and accurately is still a challenging problem. The recently proposed Cannistrai-Alanis-Ravai (CAR) index shows the power of local link/triangle information in improving link-prediction accuracy. Inspired by the idea of employing local link/triangle information, we propose a new similarity index with more local structure information. In our method, local link/triangle structure information can be conveyed by clustering coefficient of common-neighbors directly. The reason why clustering coefficient has good effectiveness in estimating the contribution of a common-neighbor is that it employs links existing between neighbors of a common-neighbor and these links have the same structural position with the candidate link to this common-neighbor. In our experiments, three estimators: precision, AUP and AUC are used to evaluate the accuracy of link prediction algorithms. Experimental results on ten tested networks drawn from various fields show that our new index is more effective in predicting missing links than CAR index, especially for networks with low correlation between number of common-neighbors and number of links between common-neighbors.

  15. Coefficient adaptive triangulation for strongly anisotropic problems

    SciTech Connect

    D`Azevedo, E.F.; Romine, C.H.; Donato, J.M.

    1996-01-01

    Second order elliptic partial differential equations arise in many important applications, including flow through porous media, heat conduction, the distribution of electrical or magnetic potential. The prototype is the Laplace problem, which in discrete form produces a coefficient matrix that is relatively easy to solve in a regular domain. However, the presence of anisotropy produces a matrix whose condition number is increased, making the resulting linear system more difficult to solve. In this work, we take the anisotropy into account in the discretization by mapping each anisotropic region into a ``stretched`` coordinate space in which the anisotropy is removed. The region is then uniformly triangulated, and the resulting triangulation mapped back to the original space. The effect is to generate long slender triangles that are oriented in the direction of ``preferred flow.`` Slender triangles are generally regarded as numerically undesirable since they tend to cause poor conditioning; however, our triangulation has the effect of producing effective isotropy, thus improving the condition number of the resulting coefficient matrix.

  16. Trace-Element Diffusion Coefficients in Olivine

    NASA Astrophysics Data System (ADS)

    Spandler, C.; O'Neill, H. S.

    2006-12-01

    We have undertaken chemical diffusion experiments at 1300°C to determine both crystal/melt partition coefficients and diffusion coefficients for a wide range of trace elements in forsteritic olivine. Experiments were conducted at 1 atm under controlled fO2 for up to 25 days using synthetic melts made to a composition in equilibrium with olivine for major elements, and doped with selected trace elements. The melt was put into a 5 mm diameter cylindrical hole in gem quality San Carlos olivine crystals drilled paralell to the a axis. Diffusion profiles were obtained both for trace elements that were added to the starting material and diffuse into the olivine, and also for several trace elements present at natural abundances in the olivine that diffuse out. The profiles were measured across sections perpendicular to crystal/melt boundary at a variety of crystallographic orientations (confirmed by EBSD) by laser-ablation ICP-MS. A thin laser slit oriented parallel to the crystal/melt interface was traversed from the melt through the crystal. Element concentrations were fitted to the diffusion equation to obtain both diffusion coefficients and concentrations at the crystal/melt interface, and hence partition coefficients. Calculated diffusivities for many trace elements (Ca, REE, Y, Sc, V, Cr, Ni, Co, Mn, Na, Li, Be, Ti) are relatively fast (D = 10-16 to 10^{-13 m2/s at 1300°C). The diffusion of Li in olivine (approx. D = 10^{-15} m2/s) is only slightly slower than REEs and similar to divalent cations, in good agreement with inferences from zoning profiles in natural olivine [1]. This rate is considerably slower than for plagioclase and clinopyroxene [2], a result which has important implications for interpreting Li isotopic data from mantle-derived rocks. The fastest diffusing trace element we observe is Be. Applying our diffusion and partition coefficients to the model of Qin et al. [3], we calculate that the REEs of olivine-hosted melt inclusions in the mantle will

  17. Effects of interferon-alpha (IFN-alpha) administration on leucocytes in healthy humans.

    PubMed

    Corssmit, E P; Heijligenberg, R; Hack, C E; Endert, E; Sauerwein, H P; Romijn, J A

    1997-02-01

    Plasma concentrations of IFN-alpha are increased in several inflammatory conditions. Several lines of evidence indicate that IFN-alpha has anti-inflammatory properties. To study the effects of IFN-alpha on leucocyte subsets and activation and on cytokines, we administered IFN-alpha (rhIFN-alpha2b; 5 x 10(6) U/m2) to eight healthy human subjects in a randomized controlled cross-over study and analysed changes in circulating leucocytes and parameters for neutrophil and monocyte activation. After administration of IFN-alpha, neutrophil counts increased, monocyte counts decreased transiently, whereas the number of lymphocytes, basophils and eosinophils showed a sustained decrease. IFN-alpha administration was also associated with neutrophil activation, reflected in an increase in the plasma concentrations of elastase-alpha1-antitrypsin complexes and lactoferrin. Serum neopterin, a marker for monocyte activation, was significantly increased 10 h after administration of IFN-alpha. IFN-alpha significantly increased plasma concentrations of IL-6, IL-8 and IL-10. Although IL-1 and tumour necrosis factor (TNF) remained undetectable, plasma concentrations of soluble TNF receptors p55 and p75 increased after IFN-alpha administration. We conclude that IFN-alpha induces multiple alterations in the distribution and functional properties of leucocytes. IFN-alpha exerts pro- as well as anti-inflammatory effects within the cytokine network.

  18. Beta/alpha continuous air monitor

    DOEpatents

    Becker, G.K.; Martz, D.E.

    1988-06-27

    A single deep layer silicon detector in combination with a microcomputer, recording both alpha and beta activity and the energy of each pulse, distinquishing energy peaks using a novel curve fitting technique to reduce the natural alpha counts in the energy region where plutonium and other transuranic alpha emitters are present, and using a novel algorithm to strip out radon daughter contribution to actual beta counts. 7 figs.

  19. Beta/alpha continuous air monitor

    DOEpatents

    Becker, Gregory K.; Martz, Dowell E.

    1989-01-01

    A single deep layer silicon detector in combination with a microcomputer, recording both alpha and beta activity and the energy of each pulse, distinguishing energy peaks using a novel curve fitting technique to reduce the natural alpha counts in the energy region where plutonium and other transuranic alpha emitters are present, and using a novel algorithm to strip out radon daughter contribution to actual beta counts.

  20. The origin and age of the Alpha-Mendeleev and Lomonosov ridges in the Amerasia Basin

    NASA Astrophysics Data System (ADS)

    Verzhbitskii, E. V.; Lobkovskii, L. I.; Byakov, A. F.; Kononov, M. V.

    2013-02-01

    The results of the bathymetry simulation indicate the emplacement of the Mesozoic Arctic plume into the lithosphere of the Alpha-Mendeleev and Lomonosov ridges. The study also presents a model of the thermal subsidence to the asthenosphere. The calculated coefficients are compared with those obtained for the Greenland-Iceland and Iceland-Faeroe ridges, which were formed in response to hotspot activity. It was shown that the coefficients of the thermal subsidence in the central part of the Alpha-Mendeleev and Lomonosov Ridges are similar to those calculated for the Greenland-Iceland and Iceland-Faeroe ridges. This indicates the thermal regime of the subsidence of the Alpha-Mendeleev and Lomonosov ridges since the Early Miocene and the increased influence of the Arctic plume on the ridge genesis. The ridges are interpreted to have formed over a broad geological timeframe, from the late Cretaceous to the Cenozoic. A geothermal method, which is highly informative in terms of the age of the lithosphere, provides better constraints on the timing of ridge formation. The age estimates for the Alpha-Mendeleev (97-79 Ma) and Lomonosov ridges (69-57 Ma) derived from the geothermal data allowed us to draw a convincing conclusion about the genesis of these ridges.

  1. Genesis of the Alpha-Mendeleev and Lomonosov ridges (Amerasian Basin)

    NASA Astrophysics Data System (ADS)

    Verzhbitskii, E. V.; Lobkovskii, L. I.; Byakov, A. F.; Kononov, M. V.

    2012-06-01

    In order to specify the origin and evolution of the Alpha-Mendeleev and Lomonosov ridges, profiles of the bottom relief and crustal basement were made. Additionally, the coefficients characterizing the rate of subsidence of the crustal basement in different parts of the ridges for the last 25 Ma were calculated and the depth of the crustal basement prior to the beginning of subsidence in the Early Miocene was estimated. The calculation results were compared with the model of thermal subsidence of the Greenland-Iceland and Iceland-Faroe thresholds, which were also formed by plume-tectonic processes. A large dome rise of the basement was found in the central parts of the Alpha-Mendeleev and Lomonosov ridges. It was also found that the coefficients of thermal subsidence of the crustal basement in the central parts of the Alpha-Mendeleev and Lomonosov ridges are close to those for the Greenland-Iceland and Iceland-Faroe thresholds. It was shown that the depth of the crustal basement prior to the beginning of subsidence in the Early Miocene grew going outwards from the central parts of the ridges, analogous to the present-day pattern. All the information given above indicates the thermal origin of subsidence for the Alpha-Mendeleev and Lomonosov ridges starting from the Early Miocene and the substantial influence of the Arctic Plume on the genesis and evolution of these ridges.

  2. Hemoglobin Evanston (alpha 14 Trp----Arg). An unstable alpha-chain variant expressed as alpha-thalassemia.

    PubMed Central

    Honig, G R; Shamsuddin, M; Vida, L N; Mompoint, M; Valcourt, E; Bowie, L J; Jones, E C; Powers, P A; Spritz, R A; Guis, M

    1984-01-01

    A new hematologic syndrome with phenotypic features of mild Hb H disease was identified in three children from two unrelated black American families. Erythrocytes from each of these children contained Hb H (beta 4) and Hb Barts (gamma 4), as well as a slowly migrating hemoglobin fraction that made up 7-10% of the total hemoglobin. The parents of the affected children all showed mild thalassemia-like changes, with one of the parents in each family also expressing the variant hemoglobin; in the latter individuals the mutant alpha-chains made up less than 2% of the total, and were present mainly or exclusively in combination with delta-chains in the form of a slowly migrating Hb A2. Purified Hb Evanston showed an increased oxygen affinity, but its Bohr effect, cooperativity, and 2,3-diphosphoglycerate effect were normal. The mutant hemoglobin appeared to have normal stability to heat and to isopropanol, and the stability of its alpha-chain in an extended time course synthesis study also appeared to be similar to that of alpha A. However, the results from short-term globin synthesis studies, and from mRNA translation in vitro, suggest that the two types of alpha-chains were synthesized at relatively equal rates, with a major fraction of the newly synthesized variant alpha-chains undergoing rapid catabolism. The hematologic data taken in combination with DNA hybridization and globin synthesis findings indicate that the proposita in each of these families has the genotype--, alpha A/--, alpha Ev. These observations suggest that two separate mechanisms are contributing to the alpha-thalassemia-like expression of Hb Evanston : the newly synthesized alpha EV-chains are unstable and are subject to early proteolytic destruction; and the mutant alpha-allele is linked to an alpha-globin gene deletion. Images PMID:6725558

  3. Teaching calculus with Wolfram|Alpha

    NASA Astrophysics Data System (ADS)

    Dimiceli, Vincent E.; Lang, Andrew S. I. D.; Locke, LeighAnne

    2010-12-01

    This article describes the benefits and drawbacks of using Wolfram|Alpha as the platform for teaching calculus concepts in the lab setting. It is a result of our experiences designing and creating an entirely new set of labs using Wolfram|Alpha. We present the reasoning behind our transition from using a standard computer algebra system (CAS) to Wolfram|Alpha in our differential and integral calculus labs, together with the positive results from our experience. We also discuss the current limitations of Wolfram|Alpha, including a discussion on why we still use a CAS for our multivariate calculus labs.

  4. Gene transfer mediated by alpha2-macroglobulin.

    PubMed Central

    Schneider, H; Huse, K; Birkenmeier, G; Otto, A; Scholz, G H

    1996-01-01

    alpha2-Macroglobulin covalently linked to poly(L)-lysine can be used as a vehicle for receptor-mediated gene transfer. This modified alpha2-macroglobulin maintains its ability to bind to the alpha2-macroglobulin receptor, and was shown to introduce a luciferase reporter gene plasmid into HepG2 human hepatoma cells in vitro. The alpha2-macroglobulin receptor is a very large and multifunctional cell surface receptor, whose rapid and efficient internalization rate makes it attractive for gene therapy, e.g. for hepatic gene targeting via injection into the portal vein. PMID:8871570

  5. Prospects for alpha particle studies on TFTR

    SciTech Connect

    Zweben, S.J.

    1987-05-01

    TFTR is expected to produce approximately 5 MW of alpha heating during the D/T Q approx. = 1 phase of operation in 1990. At that point the collective confinement properties and the heating effects of alpha particles become accessible for study for the first time. This paper outlines the potential performance of TFTR with respect to alpha particle production, the diagnostics which will be available for alpha particle measurements, and the physics issues which can be studied both before and during D/T operation.

  6. 5 alpha-reductase deficiency without hypospadias.

    PubMed Central

    Ng, W K; Taylor, N F; Hughes, I A; Taylor, J; Ransley, P G; Grant, D B

    1990-01-01

    A boy aged 4 with penoscrotal hypospadias and his brother aged 12 with micropenis had typical changes of homozygous 5 alpha-reductase deficiency. After three injections of chorionic gonadotrophin there was a trivial rise in plasma dihydrotestosterone with a normal increase in plasma testosterone. Urine steroid chromatography showed abnormally high 5 beta: 5 alpha ratios and 5 alpha-reductase activity was appreciably reduced in genital skin fibroblasts. The results indicate that 5 alpha-reductase deficiency is not invariably associated with genital ambiguity. PMID:2248513

  7. Radon diffusion coefficients in soils of varying moisture content

    NASA Astrophysics Data System (ADS)

    Papachristodoulou, C.; Ioannides, K.; Pavlides, S.

    2009-04-01

    in D was initiated and became particularly pronounced approaching complete saturation; at m =0.9, D was as low as 2×10-9 m2s-1. A series of field experiments has also been conducted using alpha-track CR-39 detectors to follow the moisture-dependence of radon diffusion through soil under natural conditions. Diffusion coefficients were determined as a function of surface soil moisture assuming a one-dimensional diffusive radon transport model. Comparison between results obtained by the two methods showed that laboratory studies may provide a good indication of radon diffusion coefficients to be expected in the field. However, values determined in the field were systematically lower than those assessed in the laboratory. This finding could be attributed to soil-dependent parameters, such as differences in pore space geometry between the soil used in laboratory experiments and the undisturbed soil. In the latter case, the higher degree of compaction imposes a more tortuous pathway to soil gas, while at the same time the diffusive gas flux is hindered by local-scale zones of higher bulk density or water content.

  8. The large coefficient problem; can we make sense out of QCD perturbation theory

    SciTech Connect

    West, G.B.

    1989-01-01

    There is the possibility of an impending crisis looming on the horizon for QCD. The problem is that in many processes, large coefficients arise in the perturbation series expansion leading to serious uncertainties concerning its predictive power. Until recently most of the examples of such a phenomenon occurred in the calculation of decay rates. These were, by and large, either ignored or dismissed using possible scheme-dependence arguments as a way out. However, more recently a calculation of the 3-loop contribution to the total e{sup +}e{sup -} annihilation cross-section was performed which gave an enormous coefficient of the order of 50 times that of the 2-loop term. If correct, this would imply that the 3-loop contribution actually exceeds that of the 2-loop Thus, from a conservative viewpoint, the validity of the perturbation series expansion as an estimate for the total e{sup +}e{sup -} cross-section is called into question. Since this process has played a key role in the development and understanding of QCD and since, in many ways, it is one of the cleanest methods for extracting {alpha}{sub s} the problem can no longer be avoided. Furthermore, there is no reason to doubt that this problem should occur in all physical processes. Coming to grips with it is, of course, not only important for testing QCD but also for extracting fundamental quantities such as {alpha}{sub s}. Clearly one needs to understand the nature and origin of such large coefficients before one can confidently continue to use perturbative estimates. The purpose of this talk is to focus on these problems. I shall first review the experimental situation with some examples illustrating the problem. I shall then discuss various general components and properties of perturbation theory before attempting to give a possible resolution of the problem. 18 refs., 5 figs.

  9. Condensation heat transfer coefficient versus wettability

    NASA Astrophysics Data System (ADS)

    Roudgar, M.; De Coninck, J.

    2015-05-01

    In this paper we show how condensation on substrates can induce wetting behavior that is quite different from that of deposited or impinging drops. We describe surfaces with the same wettability in ambient conditions presenting different wetting behavior and growth of droplets in condensation. The experimental results show a rapid spread of droplets and formation of the film on the copper surface, while droplets on SU-8 surface remains on the regular shape while they grow within the time, without coalescence, as observed for Cu. Although the heat conductivity of SU-8 is much lower, due to a difference in wetting behavior, the heat transfer coefficient (h) is higher for dropwise condensation on Cu with a thin layer of SU-8 than filmwise on the bare copper.

  10. Optical absorption coefficients of pure water

    NASA Astrophysics Data System (ADS)

    Lu, Zheng; Zhao, Xianzhen; Fry, Edward S.

    2002-10-01

    The integrating cavity absorption meter(ICAM), which is independent of scattering effect, is used to measure the absolute values of small optical absorption coefficients of liquid. A modified ICAM is being used to measure the absorption of water in the wavelength range 300 to 700 nm. The ultrapure water produced by a two-stages water purification system reaches Type I quality. This is equal to or better than ASTM,CAP and NCCLS water quality standards. To avoid the fact that dissolved oxygen absorbs ultraviolet light due to the photochemical effect, the water sample is delivered through a nitrogen sealed system which will prevent the sample from contacting with oxygen. A compassion of our absorption spectrum with other existing data is given.

  11. Clustering stocks using partial correlation coefficients

    NASA Astrophysics Data System (ADS)

    Jung, Sean S.; Chang, Woojin

    2016-11-01

    A partial correlation analysis is performed on the Korean stock market (KOSPI). The difference between Pearson correlation and the partial correlation is analyzed and it is found that when conditioned on the market return, Pearson correlation coefficients are generally greater than those of the partial correlation, which implies that the market return tends to drive up the correlation between stock returns. A clustering analysis is then performed to study the market structure given by the partial correlation analysis and the members of the clusters are compared with the Global Industry Classification Standard (GICS). The initial hypothesis is that the firms in the same GICS sector are clustered together since they are in a similar business and environment. However, the result is inconsistent with the hypothesis and most clusters are a mix of multiple sectors suggesting that the traditional approach of using sectors to determine the proximity between stocks may not be sufficient enough to diversify a portfolio.

  12. Effective Electrocardiogram Steganography Based on Coefficient Alignment.

    PubMed

    Yang, Ching-Yu; Wang, Wen-Fong

    2016-03-01

    This study presents two types of data hiding methods based on coefficient alignment for electrocardiogram (ECG) signals, namely, lossy and reversible ECG steganographys. The lossy method is divided into high-quality and high-capacity ECG steganography, both of which are capable of hiding confidential patient data in ECG signals. The reversible data hiding method can not only hide secret messages but also completely restore the original ECG signal after bit extraction. Simulations confirmed that the perceived quality generated by the lossy ECG steganography methods was good, while hiding capacity was acceptable. In addition, these methods have a certain degree of robustness, which is rare in conventional ECG stegangraphy schemes. Moreover, the proposed reversible ECG steganography method can not only successfully extract hidden messages but also completely recover the original ECG data.

  13. Interplanetary diffusion coefficients for cosmic rays

    NASA Technical Reports Server (NTRS)

    Cummings, A. C.; Stone, E. C.; Vogt, R. E.

    1974-01-01

    Information on the cosmic-ray diffusion coefficient, kappa, derived from near-earth observations of the solar modulation of galactic electron fluxes and from the near-earth power spectra of the interplanetary magnetic field, has been used to study the heliocentric radial dependence of kappa, and to derive limits on the spatial extent of the solar modulation region. Representing kappa, as a separable function of radius r and rigidity, and assumming kappa(r) proportional to r to the n-th power, we can place a limit on the power law exponent, n not greater than 1.2. The distance of the modulation boundary is a function of n, and, e.g., for n = 0, falls into the range of 6-25 AU.

  14. Manning's roughness coefficient for Illinois streams

    USGS Publications Warehouse

    Soong, David T.; Prater, Crystal D.; Halfar, Teresa M.; Wobig, Loren A.

    2012-01-01

    Manning's roughness coefficients for 43 natural and constructed streams in Illinois are reported and displayed on a U.S. Geological Survey Web site. At a majority of the sites, discharge and stage were measured, and corresponding Manning's coefficients—the n-values—were determined at more than one river discharge. The n-values discussed in this report are computed from data representing the stream reach studied and, therefore, are reachwise values. Presentation of the resulting n-values takes a visual-comparison approach similar to the previously published Barnes report (1967), in which photographs of channel conditions, description of the site, and the resulting n-values are organized for each site. The Web site where the data can be accessed and are displayed is at URL http://il.water.usgs.gov/proj/nvalues/.

  15. Comment on "Generalized exclusion processes: Transport coefficients"

    NASA Astrophysics Data System (ADS)

    Becker, T.; Nelissen, K.; Cleuren, B.; Partoens, B.; Van den Broeck, C.

    2016-04-01

    In a recent paper, Arita et al. [Phys. Rev. E 90, 052108 (2014), 10.1103/PhysRevE.90.052108] consider the transport properties of a class of generalized exclusion processes. Analytical expressions for the transport-diffusion coefficient are derived by ignoring correlations. It is claimed that these expressions become exact in the hydrodynamic limit. In this Comment, we point out that (i) the influence of correlations upon the diffusion does not vanish in the hydrodynamic limit, and (ii) the expressions for the self- and transport diffusion derived by Arita et al. are special cases of results derived in Becker et al. [Phys. Rev. Lett. 111, 110601 (2013), 10.1103/PhysRevLett.111.110601].

  16. Secondary Ionization Coefficient of Dielectric Electrode

    NASA Astrophysics Data System (ADS)

    Kashiwagi, Yasuhide; Suzuki, Susumu; Itoh, Haruo

    Experiments for observations and stabilization of discharge paths in several electrode systems are carried out aiming at precise measurement of the secondary ionization coefficient γ of MgO film electrode. The discharge chamber is filled with Ar gas. The waveforms of the applied voltage between the electrodes and the discharge current are measured with visual observation of the discharge light. Two MgO coated electrodes are placed so that they are facing each other. For these MgO electrodes, the discharge paths take a detour, not the shortest distance. Smaller prebreakdown current pulses are observed before the breakdown. After breakdown, discontinuous discharge current is observed. Therefore, it is prepared a glass tube surrounding the discharge area. As the result, the discharge paths take a straight perpendicular for the electrode surface, and the discharge is stabilized.

  17. Molar extinction coefficients of some fatty acids

    NASA Astrophysics Data System (ADS)

    Sandhu, G. K.; Singh, Kulwant; Lark, B. S.; Gerward, L.

    2002-10-01

    The attenuation of gamma rays in some fatty acids, viz. formic acid (CH 2O 2), acetic acid (C 2H 4O 2), propionic acid (C 3H 6O 2), butyric acid (C 4H 8O 2), n-hexanoic acid (C 6H 12O 2), n-caprylic acid (C 8H 16O 2), lauric acid (C 12H 24O 2), myristic acid (C 14H 28O 2), palmitic acid (C 16H 32O 2), oleic acid (C 18H 34O 2) and stearic acid (C 18H 36O 2), has been measured at the photon energies 81, 356, 511, 662, 1173 and 1332 keV. Experimental values for the molar extinction coefficient, the effective atomic number and the electron density have been derived and compared with theoretical calculations. There is good agreement between experiment and theory.

  18. Analysis of the coefficient of variation in shear and tensile bond strength tests.

    PubMed

    Romano, Fábio Lourenço; Ambrosano, Gláucia Maria Bovi; Magnani, Maria Beatriz Borges de Araújo; Nouer, Darcy Flávio

    2005-09-01

    The coefficient of variation is a dispersion measurement that does not depend on the unit scales, thus allowing the comparison of experimental results involving different variables. Its calculation is crucial for the adhesive experiments performed in laboratories because both precision and reliability can be verified. The aim of this study was to evaluate and to suggest a classification of the coefficient variation (CV) for in vitro experiments on shear and tensile strengths. The experiments were performed in laboratory by fifty international and national studies on adhesion materials. Statistical data allowing the estimation of the coefficient of variation was gathered from each scientific article since none of them had such a measurement previously calculated. Excel worksheet was used for organizing the data while the sample normality was tested by using Shapiro Wilk tests (alpha = 0.05) and the Statistical Analysis System software (SAS). A mean value of 6.11 (SD = 1.83) for the coefficient of variation was found by the data analysis and the data had a normal distribution (p>0.05). A range classification was proposed for the coefficient of variation from such data, that is, it should be considered low for a value lesser than 2.44; intermediate for a value between 2.44 and 7.94, high for a value between 7.94 and 9.78, and finally, very high for a value greater than 9.78. Such classification can be used as a guide for experiments on adhesion materials, thus making the planning easier as well as revealing precision and validity concerning the data.

  19. Mass-transport limitation to in-cloud reaction rates: Implications of new accommodation coefficient measurements

    SciTech Connect

    Schwartz, S.E.

    1988-10-01

    Although it has been recognized for some time that the rate of reactive uptake of gases in cloudwater can depend on the value of the mass-accommodation coefficient (..cap alpha..) describing interfacial mass transport (MT), definitive evaluation of such rates is only now becoming possible with the availability of measurements of ..cap alpha.. for gases of atmospheric interest at air-water interfaces. Examination of MT limitation to the rate of in-cloud aqueous-phase oxidation of SO/sub 2/ by O/sub 3/ and H/sub 2/O/sub 2/ shows that despite the low value of ..cap alpha../sub O3/ (5 /times/ 10/sup /minus/4/), interfacial MT of this species is not limiting under essentially all conditions of interest; the high values of ..cap alpha.. for SO/sub 2/ (greater than or equal to 0.2) and H/sub 2/O/sub 2/ (greater than or equal to 0.08) indicate no interfacial MT limitation for these species also. Although gas- and aqueous-phase MT can be limiting under certain extremes of conditions, treating the system as under chemical kinetic control is generally an excellent approximation. Interfacial MT limitation also is found not to hinder the rate of H/sub 2/O/sub 2/ formation by aqueous-phase disproportionation of HO/sub 2/. Finally, the rapid uptake of N/sub 2/O/sub 5/ by cloud droplets implies that the yield of aqueous HNO/sub 3/ from in-cloud gas-phase oxidation of NO/sub 2/by O/sub 3/ can be substantial even under daytime conditions. This report consists of copies of viewgraphs prepared for this presentation.

  20. Synthesis of anticholinergic agents: N-methyl-4-piperidinyl alpha-benzoyloxy-alpha-cyclopentylphenylacetate salts.

    PubMed

    Oroshnik, W; Soldati, G

    1978-05-01

    The synthesis of a new anticholinergic agent, N-methyl-4-piperidinyl alpha-benzoyloxy-alpha-cyclopentylphenylacetate, obtained by reacting N-methyl-4-piperidinyl alpha-cyclopentylmandelate with benzoyl chloride in the presence of methyllithium, is reported. This material may be useful as an antiperspirant.

  1. 40 CFR 721.10300 - Benzeneacetic acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ...-.alpha.-phenyl-, ethyl ester. 721.10300 Section 721.10300 Protection of Environment ENVIRONMENTAL....-phenyl-, ethyl ester. (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified as benzeneacetic acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester (PMN...

  2. 40 CFR 721.10300 - Benzeneacetic acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ...-.alpha.-phenyl-, ethyl ester. 721.10300 Section 721.10300 Protection of Environment ENVIRONMENTAL....-phenyl-, ethyl ester. (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified as benzeneacetic acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester (PMN...

  3. 40 CFR 721.10300 - Benzeneacetic acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ...-.alpha.-phenyl-, ethyl ester. 721.10300 Section 721.10300 Protection of Environment ENVIRONMENTAL....-phenyl-, ethyl ester. (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified as benzeneacetic acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester (PMN...

  4. Resting-State Alpha in Autism Spectrum Disorder and Alpha Associations with Thalamic Volume

    ERIC Educational Resources Information Center

    Edgar, J. Christopher; Heiken, Kory; Chen, Yu-Han; Herrington, John D.; Chow, Vivian; Liu, Song; Bloy, Luke; Huang, Mingxiong; Pandey, Juhi; Cannon, Katelyn M.; Qasmieh, Saba; Levy, Susan E.; Schultz, Robert T.; Roberts, Timothy P. L.

    2015-01-01

    Alpha circuits (8-12 Hz), necessary for basic and complex brain processes, are abnormal in autism spectrum disorder (ASD). The present study obtained estimates of resting-state (RS) alpha activity in children with ASD and examined associations between alpha activity, age, and clinical symptoms. Given that the thalamus modulates cortical RS alpha…

  5. Mathematical model of an air-filled alpha stirling refrigerator

    NASA Astrophysics Data System (ADS)

    McFarlane, Patrick; Semperlotti, Fabio; Sen, Mihir

    2013-10-01

    This work develops a mathematical model for an alpha Stirling refrigerator with air as the working fluid and will be useful in optimizing the mechanical design of these machines. Two pistons cyclically compress and expand air while moving sinusoidally in separate chambers connected by a regenerator, thus creating a temperature difference across the system. A complete non-linear mathematical model of the machine, including air thermodynamics, and heat transfer from the walls, as well as heat transfer and fluid resistance in the regenerator, is developed. Non-dimensional groups are derived, and the mathematical model is numerically solved. The heat transfer and work are found for both chambers, and the coefficient of performance of each chamber is calculated. Important design parameters are varied and their effect on refrigerator performance determined. This sensitivity analysis, which shows what the significant parameters are, is a useful tool for the design of practical Stirling refrigeration systems.

  6. A model for the disc Lyman alpha emission of Uranus

    NASA Technical Reports Server (NTRS)

    Ben Jaffel, L.; Prange, R.; Emerich, C.; Vidal-Madjar, A.; Mcconnell, J. C.

    1991-01-01

    A new efficient radiative transfer algorithm for nonhomogeneous model atmospheres has been applied to the Uranian atmosphere. The contribution of the scatter solar Lyman-alpha to the Uranain emission is of the order of 300 R, and the Rayleigh contribution may reach 450 R for small values of the eddy diffusion coefficient (EDC). The total solar contribution may then reach about 750 R for a solar flux of 2.5 x 10 to the 11th photons/sq cm/s/A. A level of up to 400 R is confirmed in some directions for the interstellar wind contribution. The values of the atmospheric EDC necessary to mimic the observations are 50-100 sq cm/s. A small additional source located on the dayside Uranian atmosphere seems necessary correctly to fit the shape of the limb to limb intensity variation, especially near the limbs. Its contribution to the emergent intensity would range from 100 to 500 R.

  7. High-alpha space trucks

    SciTech Connect

    Cook, L.M.; Ball, J.

    1997-01-01

    Vertically-landing Reusable Launch Vehicles (RLVs) are the best hope of building a true {open_quotes}Space Truck{close_quotes} with current technology. Because they do not require a low angle-of-attack (AOA, or alpha) horizontal landing, they can be designed to operate exclusively at very high angles-of-attack. This offers savings in vehicle dry weight and complexity, which can be traded for significantly heavier payload, more ascent velocity, or extra design margin. The price for abandoning low angle-of-attack flight is reduced crossrange. To quantify the potential weight reduction, a trade study was performed to determine the relationship between a vehicle{close_quote}s maximum crossrange (angle-of-attack) and it{close_quote}s dry weight (payload margin). At the study conclusion, three vertically-landing (VL) vehicles provided multiple points on a payload weight vs. maximum crossrange curve, showing significant payload increases as crossrange is sacrificed. This is primarily the result of being able to simplify the structure, fly a cooler entry trajectory, and be aerodynamically stable through the entire flight. This reduces subsystem requirements and complexity, enhancing reliability. Further benefits are realized in reduced landing propellant requirements and simplifying or eliminating the {open_quotes}rotation{close_quotes} maneuver. This paper also suggests unique operability solutions that adapt high-alpha vehicles to traditional high-crossrange missions such as the polar {open_quotes}once-around{close_quotes} flight, and proposes a small scale drop-test program to prove the subsonic and landing portion of the flight envelope. {copyright} {ital 1997 American Institute of Physics.}

  8. Sedimentation Coefficient, Frictional Coefficient, and Molecular Weight: A Preparative Ultracentrifuge Experiment for the Advanced Undergraduate Laboratory.

    ERIC Educational Resources Information Center

    Halsall, H. B.; Wermeling, J. R.

    1982-01-01

    Describes an experiment using a high-speed preparative centrifuge and calculator to demonstrate effects of the frictional coefficient of a macromolecule on its rate of transport in a force field and to estimate molecular weight of the macromolecule using an empirical relationship. Background information, procedures, and discussion of results are…

  9. Incoming Engineering Students' Self-Assessment of Their Mathematical Background

    ERIC Educational Resources Information Center

    Guner, Necdet

    2013-01-01

    The aim of this study was to develop a tool to measure levels of mathematical knowledge gained in high school, as perceived by incoming engineering students. The study included 657 engineering students in the 2011-2012 academic year. Factor analysis was used to obtain a scale consisting of 47 items (Cronbach Alpha coefficient, 0.975). The…

  10. Psychometric Analysis of Role Conflict and Ambiguity Scales in Academia

    ERIC Educational Resources Information Center

    Khan, Anwar; Yusoff, Rosman Bin Md.; Khan, Muhammad Muddassar; Yasir, Muhammad; Khan, Faisal

    2014-01-01

    A comprehensive Psychometric Analysis of Rizzo et al.'s (1970) Role Conflict & Ambiguity (RCA) scales were performed after its distribution among 600 academic staff working in six universities of Pakistan. The reliability analysis includes calculation of Cronbach Alpha Coefficients and Inter-Items statistics, whereas validity was determined by…

  11. Confirmatory Factor Analysis of Persian Adaptation of Multidimensional Students' Life Satisfaction Scale (MSLSS)

    ERIC Educational Resources Information Center

    Hatami, Gissou; Motamed, Niloofar; Ashrafzadeh, Mahshid

    2010-01-01

    Validity and reliability of Persian adaptation of MSLSS in the 12-18 years, middle and high school students (430 students in grades 6-12 in Bushehr port, Iran) using confirmatory factor analysis by means of LISREL statistical package were checked. Internal consistency reliability estimates (Cronbach's coefficient [alpha]) were all above the…

  12. Measuring Cultural Awareness in Nursing Students.

    ERIC Educational Resources Information Center

    Rew, Lynn; Becker, Heather; Cookston, Jeff; Khosropour, Shirin; Martinez, Stephanie

    2003-01-01

    A multicultural awareness scale completed by 72 nursing students obtained a Cronbach's alpha reliability coefficient of .91. An expert panel analyzed content validity and the revised scale was completed by 118 students. Factor analysis supported the measure's construct validity. (Contains 30 references.) (SK)

  13. Age Band 1 of the Movement Assessment Battery for Children-Second Edition: Exploring Its Usefulness in Mainland China

    ERIC Educational Resources Information Center

    Hua, Jing; Gu, Guixiong; Meng, Wei; Wu, Zhuochun

    2013-01-01

    The aim of this paper was to examine the validity and reliability of age band 1 of the Movement Assessment Battery for Children-Second Edition (MABC-2) in preparation for its standardization in mainland China. Interrater and test-retest reliability of the MABC-2 was estimated using Intraclass Correlation Coefficient (ICC). Cronbach's alpha for…

  14. The Score Reliability of Draw-a-Person Intellectual Ability Test (DAP: IQ) for Rural Malawi Students

    ERIC Educational Resources Information Center

    Khasu, Denis S.; Williams, Thomas O., Jr.

    2016-01-01

    In this brief article, the reliability of scores for the Draw-A-Person Intellectual Ability Test for Children, Adolescents, and Adults (DAP: IQ; Reynolds & Hickman, 2004) was examined through several analyses with a sample of 147 children from rural Malawi, Africa using a Chichewa translation of instructions. Cronbach alpha coefficients for…

  15. (De)Motivation in Preparatory EFL Classrooms

    ERIC Educational Resources Information Center

    Vefali, Gülsen Musayeva; Ayan, Hatice Ç.

    2015-01-01

    This survey study aimed to explore EFL learners' (de)motivation in the preparatory classes at a tertiary institution in Northern Cyprus. It administered questionnaires to 105 preparatory learners and 30 language teachers. The statistical analysis revealed the Cronbach's alpha reliability coefficient of 0.88 for the Learners' version, and 0.89 for…

  16. Farmers' Attitudes and Skills of Farm Business Management in Jordan

    ERIC Educational Resources Information Center

    Al-Rimawi, Ahmad Sh.; Karablieh, Emad K.; Al-Qadi, Abdulfatah S.; Al-Qudah, Hussein F.

    2006-01-01

    This study aimed to investigate farmers' attitudes and skills of farm management. Two scales were constructed as an instrument for data collection, based on a sample of 100 farm units. Cronbach's alpha coefficients were 0.84 or higher, which indicated that the instrument scales were internally consistent. Non-parametric tests were used to analyze…

  17. Development of Social Media Addiction Test (SMAT17)

    ERIC Educational Resources Information Center

    Esgi, Necmi

    2016-01-01

    The aim of this study was to develop a test for assessing individuals' social media addiction; and conducting a reliability and validity study of this scale. Sample for this study was composed of 285 college students between the ages of 18 and 25. Reliability coefficients Cronbach's alpha value was 0.94 and Spearman Brown value was 0.91 for our…

  18. The Effect of Music on the Test Scores of the Students in Limits and Derivatives Subject in the Mathematics Exams Done with Music

    ERIC Educational Resources Information Center

    Kesan, Cenk; Ozkalkan, Zuhal; Iric, Hamdullah; Kaya, Deniz

    2012-01-01

    In the exams based on limits and derivatives, in this study, it was tried to determine that if there was any difference in students' test scores according to the type of music listened to and environment without music. For this purpose, the achievement test including limits and derivatives and whose reliability coefficient of Cronbach Alpha is…

  19. Arrangements of alpha-globin gene cluster in Taiwan.

    PubMed

    Peng, H W; Choo, K B; Ho, C H; Yen, M S; Liung, W Y; Lin, C K; Yang, Z L; Ng, H T; Ching, K N; Han, S H

    1989-01-01

    In a gene mapping study on 217 newborn babies in Taiwan with alpha- and zeta-globin probes, we have observed 4 cases (1.84%) of alpha-thalassemia-2 heterozygotes (zeta zeta-alpha/zeta zeta alpha alpha) without increased levels of hemoglobin (Hb) Bart's in the cord blood. Eleven subjects (5.07%) were found to have the South East Asian alpha-thalassemia-1 haplotype (zeta zeta--SEA/zeta zeta alpha alpha) with increased Hb Bart's levels ranging from 2.2 to 9%. One case, with Hb Bart's level of 14% in the cord blood, was found to have the genotype of zeta zeta--SEA/zeta zeta alpha alpha T (0.46%). Four heterozygotes (1.84%) were found with the triple alpha gene anti-rightward arrangement (zeta zeta alpha alpha alpha 3.7/zeta zeta alpha alpha). Twenty-one heterozygotes (9.68%) were found to have the triple zeta-globin gene arrangement (zeta zeta zeta alpha alpha/zeta zeta alpha alpha). A new triple zeta-globin gene variant with a BamHI polymorphism was also observed in this study.

  20. Cluster automorphism groups of cluster algebras with coefficients

    NASA Astrophysics Data System (ADS)

    Chang, Wen; Zhu, Bin

    2016-10-01

    We study the cluster automorphism group of a skew-symmetric cluster algebra with geometric coefficients. For this, we introduce the notion of gluing free cluster algebra, and show that under a weak condition the cluster automorphism group of a gluing free cluster algebra is a subgroup of the cluster automorphism group of its principal part cluster algebra (i.e. the corresponding cluster algebra without coefficients). We show that several classes of cluster algebras with coefficients are gluing free, for example, cluster algebras with principal coefficients, cluster algebras with universal geometric coefficients, and cluster algebras from surfaces (except a 4-gon) with coefficients from boundaries. Moreover, except four kinds of surfaces, the cluster automorphism group of a cluster algebra from a surface with coefficients from boundaries is isomorphic to the cluster automorphism group of its principal part cluster algebra; for a cluster algebra with principal coefficients, its cluster automorphism group is isomorphic to the automorphism group of its initial quiver.

  1. The Attenuation of Correlation Coefficients: A Statistical Literacy Issue

    ERIC Educational Resources Information Center

    Trafimow, David

    2016-01-01

    Much of the science reported in the media depends on correlation coefficients. But the size of correlation coefficients depends, in part, on the reliability with which the correlated variables are measured. Understanding this is a statistical literacy issue.

  2. Alpha Biofeedback Conditioning and Retarded Subjects.

    ERIC Educational Resources Information Center

    Martin, Walter; And Others

    1981-01-01

    An experimental group of three institutionalized severely retarded adult males received binary tone feedback for alpha production while a control group (3) followed identical procedures without feedback. Analysis revealed significant difference between groups in alpha percentage increase over baseline, encouraging research on applications for…

  3. Elementary Processes Underlying Alpha Channeling in Tokamaks

    SciTech Connect

    NM.J. Fisch

    2012-06-15

    Alpha channeling in tokamaks is speculative, but also extraordinarily attractive. Waves that can accomplish this effect have been identified. Key aspects of the theory now enjoy experimental confirmation. This paper will review the elementary processes of wave-particle interactions in plasma that underlie the alpha channeling effect

  4. Alpha-1 Antitrypsin Deficiency (Inherited Emphysema)

    MedlinePlus

    ... 1 protein in the blood with normal alpha-1 antitrypsin from healthy plasma donors. It is given in a vein (IV). The dose is adjusted based on body weight. This treatment is often given once a week. There are three ... the management of Alpha-1 related emphysema includes: • Exercise and a healthy lifestyle ...

  5. Psychiatric Symptoms in Alpha-Mannosidosis

    ERIC Educational Resources Information Center

    Malm, D.; Pantel, J.; Linaker, O. M.

    2005-01-01

    Alpha-mannosidosis is characterized by mild to moderate intellectual disability (ID), moderate to severe neurosensory hearing loss, frequent infections, psychomotor disturbances and skeletal dysmorphism. For the first time, a panel of nine alpha-mannosidosis patients with psychiatric symptoms is presented. The clinical picture has several…

  6. 27 CFR 21.95 - Alpha terpineol.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2014-04-01 2014-04-01 false Alpha terpineol. 21.95 Section 21.95 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY ALCOHOL FORMULAS FOR DENATURED ALCOHOL AND RUM Specifications for Denaturants § 21.95 Alpha terpineol. (a) Boiling point at...

  7. 27 CFR 21.95 - Alpha terpineol.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2012-04-01 2012-04-01 false Alpha terpineol. 21.95 Section 21.95 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY LIQUORS FORMULAS FOR DENATURED ALCOHOL AND RUM Specifications for Denaturants § 21.95 Alpha terpineol. (a) Boiling point at...

  8. Remote Associates Test and Alpha Brain Waves

    ERIC Educational Resources Information Center

    Haarmann, Henk J.; George, Timothy; Smaliy, Alexei; Dien, Joseph

    2012-01-01

    Previous studies found that performance on the remote associates test (RAT) improves after a period of incubation and that increased alpha brain waves over the right posterior brain predict the emergence of RAT insight solutions. We report an experiment that tested whether increased alpha brain waves during incubation improve RAT performance.…

  9. Atypical Alpha Asymmetry in Adults with ADHD

    ERIC Educational Resources Information Center

    Hale, T. Sigi; Smalley, Susan L.; Hanada, Grant; Macion, James; McCracken, James T.; McGough, James J.; Loo, Sandra K.

    2009-01-01

    Introduction: A growing body of literature suggests atypical cerebral asymmetry and interhemispheric interaction in ADHD. A common means of assessing lateralized brain function in clinical populations has been to examine the relative proportion of EEG alpha activity (8-12 Hz) in each hemisphere (i.e., alpha asymmetry). Increased rightward alpha…

  10. Teaching Calculus with Wolfram|Alpha

    ERIC Educational Resources Information Center

    Dimiceli, Vincent E.; Lang, Andrew S. I. D.; Locke, LeighAnne

    2010-01-01

    This article describes the benefits and drawbacks of using Wolfram|Alpha as the platform for teaching calculus concepts in the lab setting. It is a result of our experiences designing and creating an entirely new set of labs using Wolfram|Alpha. We present the reasoning behind our transition from using a standard computer algebra system (CAS) to…

  11. 27 CFR 21.95 - Alpha terpineol.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2013-04-01 2013-04-01 false Alpha terpineol. 21.95 Section 21.95 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY ALCOHOL FORMULAS FOR DENATURED ALCOHOL AND RUM Specifications for Denaturants § 21.95 Alpha terpineol. (a) Boiling point at...

  12. 27 CFR 21.95 - Alpha terpineol.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Alpha terpineol. 21.95 Section 21.95 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY LIQUORS FORMULAS FOR DENATURED ALCOHOL AND RUM Specifications for Denaturants § 21.95 Alpha terpineol. (a) Boiling point at...

  13. 27 CFR 21.95 - Alpha terpineol.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2011-04-01 2011-04-01 false Alpha terpineol. 21.95 Section 21.95 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY LIQUORS FORMULAS FOR DENATURED ALCOHOL AND RUM Specifications for Denaturants § 21.95 Alpha terpineol. (a) Boiling point at...

  14. Inhibitory spectrum of alpha 2-plasmin inhibitor.

    PubMed

    Saito, H; Goldsmith, G H; Moroi, M; Aoki, N

    1979-04-01

    alpha 2-Plasmin inhibitor (alpha 2PI) has been recently characterized as a fast-reacting inhibitor of plasmin in human plasma and appears to play an important role in the regulation of fibrinolysis in vivo. We have studied the effect of purified alpha 2PI upon various proteases participating in human blood coagulation and kinin generation. At physiological concentration (50 microgram/ml), alpha 2PI inhibited the clot-promoting and prekallikrein-activating activity of Hageman factor fragments, the amidolytic, kininogenase, and clot-promoting activities of plasma kallikrein, and the clot-promoting properties of activated plasma thromboplastin antecedent (PTA, Factor XIa) and thrombin. alpha 2PI had minimal inhibitory effect on surface-bound activated PTA and activated Stuart factor (Factor Xa). alpha 2PI did not inhibit the activity of activated Christmas factor (Factor IXa) or urinary kallikrein. Heparin (1.5-2.0 units/ml) did not enhance the inhibitory function of alpha 2PI. These results suggest that, like other plasma protease inhibitors, alpha 2PI possesses a broad in vitro spectrum of inhibitory properties.

  15. Selective solid-phase extraction of alpha-tocopherol by functionalized ionic liquid-modified mesoporous SBA-15 adsorbent.

    PubMed

    Li, Min; Pham, Patrisha J; Pittman, Charles U; Li, Tingyu

    2008-10-01

    Ordered mesoporous adsorbents were prepared by physically grafting functionalized ionic liquids onto SBA-15 (a mesoporous siliceous substrate) using incipient wetness immersion method. These adsorbents were successfully applied to the selective extraction and separation of alpha-tocopherol (an isomer of vitamin E) from a model mixture of soybean oil deodorizer distillate. Various parameters affecting adsorption process such as adsorption time, the structures and loadings of ionic liquids, the adsorption isotherm, and the reusability of adsorbent were investigated using liquid-solid extraction. As high as 211 mg/g adsorbent of the adsorption capacity for alpha-tocopherol was obtained through the adsorption isotherm tests using [emim][Gly]/SBA-15 (functionalized ionic liquid 1-ethyl-3-methylimidazolium glycine which was physically coated on SBA-15) as the adsorbent, in which the functionalized ionic liquids contained the amino acid glycine as the anion. The adsorbent [emim][Gly]/SBA-15 also exhibited a very high adsorption selectivity for alpha-tocopherol. The extraction selectivity or the ratio of distribution coefficients between alpha-tocopherol and the major interference component glyceryl triundecanoate (K(d(alpha-tocopherol))/K(d(triglyceride))) was 10.5. The concentration of alpha-tocopherol was significantly increased from 15.6% in original feedstock solution that contained fatty acid methyl ester, triglyceride and alpha-tocopherol to 73.0% after stripping by diethyl ether. Five adsorbent recycle tests showed good reusability of the functionalized ionic liquid-modified mesoporous adsorbent. PMID:18845881

  16. Suppression of hepatic prostaglandin F2 alpha in rats by dietary alpha-tocopherol acetate is independent of total hepatic alpha-tocopherol.

    PubMed

    Duitsman, P K; Chen, H W; Cook, L R; Hendrich, S

    1992-09-01

    Groups of eight weanling female F344/N rats were fed semipurified diets that supplied 0, 50, 500, 5000, or 15,000 mg alpha-tocopherol acetate/kg diet, with and without 0.05% phenobarbital (PB) for 9 weeks. Both plasma and hepatic alpha-tocopherol levels, measured by HPLC, strongly correlated with alpha-tocopherol intake (r greater than 0.73, p less than 0.0001). Phenobarbital both depleted hepatic alpha-tocopherol and increased plasma alpha-tocopherol significantly. Although treatment with PB for 9 weeks significantly increased GST activity, PB did not affect hepatic prostaglandin (PG)F2 alpha status, as determined by radioimmunoassay. PGF2 alpha was significantly greater (by 52%) in rats fed no alpha-tocopherol than in rats fed 15,000 mg alpha-tocopherol acetate/kg diet. Hepatic PGF2 alpha status was correlated inversely but weakly with dietary alpha-tocopherol (r = -0.24, p less than 0.05). Hepatic PGF2 alpha status was not correlated with hepatic or plasma alpha-tocopherol status. This finding suggests either that there is a small depletion-resistant subcellular alpha-tocopherol pool which regulates PGF2 alpha production or that alpha-tocopherol alters PGF2 alpha production in vivo by an indirect mechanism.

  17. Local Structure and Vibrational Properties of alpha-Pu, alpha-U, and the alpha-U Charge Density Wave

    SciTech Connect

    Nelson, E J; Allen, P G; Blobaum, K M; Wall, M A; Booth, C H

    2004-08-10

    The local atomic environment and vibrational properties of atoms in monoclinic pure {alpha}-plutonium as well as orthorhombic pure {alpha}-uranium and its low-temperature charge-density-wave (CDW) modulation are examined by extended x-ray absorption fine structure spectroscopy (EXAFS). Pu L{sub III}-edge and U L{sub III}-edge EXAFS data measured at low temperatures verify the crystal structures of {alpha}-U and {alpha}-Pu samples previously determined by x-ray diffraction and neutron scattering. Debye-Waller factors from temperature-dependent EXAFS measurements are fit with a correlated Debye model. The observed Pu-Pu bond correlated Debye temperature of {theta}{sub cD}({alpha}-Pu) = 162 {+-} 5 K for the pure {alpha}-Pu phase agrees with our previous measurement of the correlated Debye temperature of the gallium-containing {alpha}'-Pu phase in a mixed phase 1.9 at% Ga-doped {alpha}'-Pu/{delta}-Pu alloy. The temperature dependence of the U-U nearest neighbor Debye-Waller factor exhibits a sharp discontinuity in slope near T{sub CDW} = 43 K, the transition temperature at which the charge-density wave (CDW) in {alpha}-U condenses from a soft phonon mode along the (100) direction. Our measurement of the CDW using EXAFS is the first observation of the structure of the CDW in polycrystalline {alpha}-U. The different temperature dependence of the Debye-Waller factor for T < T{sub CDW} can be modeled by the change in bond length distributions resulting from condensation of the charge density wave. For T > T{sub CDW}, the observed correlated Debye temperature of {theta}{sub cD}({alpha}-U) = 199 {+-} 3 K is in good agreement with other measurements of the Debye temperature for polycrystalline {alpha}-U. CDW structural models fit to the {alpha}-U EXAFS data support a squared CDW at the lowest temperatures, with a displacement amplitude of {var_epsilon} = 0.05 {+-} 0.02 {angstrom}.

  18. Improved peak shape fitting in alpha spectra.

    PubMed

    Pommé, S; Caro Marroyo, B

    2015-02-01

    Peak overlap is a recurrent issue in alpha-particle spectrometry, not only in routine analyses but also in the high-resolution spectra from which reference values for alpha emission probabilities are derived. In this work, improved peak shape formulae are presented for the deconvolution of alpha-particle spectra. They have been implemented as fit functions in a spreadsheet application and optimum fit parameters were searched with built-in optimisation routines. Deconvolution results are shown for a few challenging spectra with high statistical precision. The algorithm outperforms the best available routines for high-resolution spectrometry, which may facilitate a more reliable determination of alpha emission probabilities in the future. It is also applicable to alpha spectra with inferior energy resolution. PMID:25497323

  19. Homomers of alpha 8 and alpha 7 subunits of nicotinic receptors exhibit similar channel but contrasting binding site properties.

    PubMed

    Gerzanich, V; Anand, R; Lindstrom, J

    1994-02-01

    alpha 8 subunits of alpha-bungarotoxin-sensitive chick neuronal nicotinic acetylcholine receptors expressed in Xenopus oocytes from cRNA are shown to form homomeric, acetylcholine-gated, rapidly desensitizing, inwardly rectifying, Ca(2+)-permeable cation channels similar to those of alpha 7 homomers. alpha 8 forms oligomers of several sizes, of which < 14% are expressed on the oocyte surface, which is less efficient than for alpha 7 homomers. alpha 8 homomers are more sensitive to agonists but less sensitive to antagonists than are alpha 7 homomers, and some agonists for alpha 8 homomers are partial agonists or antagonists for alpha 7 homomers. The pharmacological properties of homomers of alpha 8 and alpha 7 subunits generally reflect those of native alpha 8 and alpha 7 receptors.

  20. Permeation study of five formulations of alpha-tocopherol acetate through human cadaver skin.

    PubMed

    Mahamongkol, Hansa; Bellantone, Robert A; Stagni, Grazia; Plakogiannis, Fotios M

    2005-01-01

    Alpha-tocopherol (AT) is the vitamin E homologue with the highest in vivo biological activity. AT protects against the carcinogenic and mutagenic activity of ionizing radiation and chemical agents, and possibly against UV-induced cutaneous damage. For stability consideration, alpha-tocopherol is usually used as its prodrug ester, alpha-tocopherol acetate (ATA), which once absorbed into the skin is hydrolyzed to alpha-tocopherol, the active form. The objective of this research was to characterize in vitro the permeation properties of ATA from various solutions and gel formulations. Permeation studies were conducted using modified Franz diffusion cells and human cadaver skin as the membrane. Specifically, 5% (w/w) alpha-tocopherol acetate was formulated in the following vehicles: ethanol, isopropyl myristate, light mineral oil, 1% Klucel gel in ethanol, and 3% Klucel gel in ethanol (w/w). The receiver temperature was 37 degrees C. Samples from the receiver were collected at 2, 4, 6, 8, 12, 24, 30, 36, and 48 hours and analyzed by HPLC for concentrations of alpha-tocopherol acetate and alpha-tocopherol. The permeabilities of ATA through human cadaver skin were 1.0x10(-4), 1.1x10(-2), 1.4x10(-4), 2.1x10(-4), and 4.7x10(-4) cm/h for the ethanol solution, isopropyl myristate solution, light mineral oil solution, 1% Klucel gel, and 3% Klucel gel, respectively. The results show that the formulation had relatively minor effects on the permeability coefficients of ATA through cadaver skin in all cases except for the isopropyl myristate solution.

  1. Loss coefficient measurements for flat oval elbows and transitions

    SciTech Connect

    Townsend, B.; Khodabakhsh, F.; Idem, S.

    1996-12-31

    Zero-length loss coefficients were measured for several flat oval elbow and transition fittings over a range of Reynolds numbers from 20,000 to 600,000. Least-squares curve fitting was employed to fit a linear function to the loss coefficient data, with the intercept forced to zero. Local loss coefficient values for each fitting are presented.

  2. Coefficients of Association Analogous to Pearson's r for Nonparametric Statistics.

    ERIC Educational Resources Information Center

    Stavig, Gordon; Acock, Alan C.

    1980-01-01

    Two r coefficients of association are discussed. One of the coefficients can be applied to any nonparametric test statistic (NTS) in which a normal approximation equation is appropriate. The other coefficient is applicable to any NTS in which exact probabilities are known. (Author/RL)

  3. On the Occurrence of Standardized Regression Coefficients Greater than One.

    ERIC Educational Resources Information Center

    Deegan, John, Jr.

    1978-01-01

    It is demonstrated here that standardized regression coefficients greater than one can legitimately occur. Furthermore, the relationship between the occurrence of such coefficients and the extent of multicollinearity present among the set of predictor variables in an equation is examined. Comments on the interpretation of these coefficients are…

  4. Interpretation of Standardized Regression Coefficients in Multiple Regression.

    ERIC Educational Resources Information Center

    Thayer, Jerome D.

    The extent to which standardized regression coefficients (beta values) can be used to determine the importance of a variable in an equation was explored. The beta value and the part correlation coefficient--also called the semi-partial correlation coefficient and reported in squared form as the incremental "r squared"--were compared for variables…

  5. Catalytic Mechanism of Human Alpha-galactosidase

    SciTech Connect

    Guce, A.; Clark, N; Salgado, E; Ivanen, D; Kulinskaya, A; Brumer, H; Garman, S

    2010-01-01

    The enzyme {alpha}-galactosidase ({alpha}-GAL, also known as {alpha}-GAL A; E.C. 3.2.1.22) is responsible for the breakdown of {alpha}-galactosides in the lysosome. Defects in human {alpha}-GAL lead to the development of Fabry disease, a lysosomal storage disorder characterized by the buildup of {alpha}-galactosylated substrates in the tissues. {alpha}-GAL is an active target of clinical research: there are currently two treatment options for Fabry disease, recombinant enzyme replacement therapy (approved in the United States in 2003) and pharmacological chaperone therapy (currently in clinical trials). Previously, we have reported the structure of human {alpha}-GAL, which revealed the overall structure of the enzyme and established the locations of hundreds of mutations that lead to the development of Fabry disease. Here, we describe the catalytic mechanism of the enzyme derived from x-ray crystal structures of each of the four stages of the double displacement reaction mechanism. Use of a difluoro-{alpha}-galactopyranoside allowed trapping of a covalent intermediate. The ensemble of structures reveals distortion of the ligand into a {sup 1}S{sub 3} skew (or twist) boat conformation in the middle of the reaction cycle. The high resolution structures of each step in the catalytic cycle will allow for improved drug design efforts on {alpha}-GAL and other glycoside hydrolase family 27 enzymes by developing ligands that specifically target different states of the catalytic cycle. Additionally, the structures revealed a second ligand-binding site suitable for targeting by novel pharmacological chaperones.

  6. Sumoylation and the function of CCAAT enhancer binding protein alpha (C/EBP alpha).

    PubMed

    Khanna-Gupta, Arati

    2008-01-01

    CCAAT enhancer binding protein alpha (C/EBP alpha) is the founding member of a family of basic region/leucine zipper (bZIP) transcription factors and is a master regulator of granulopoiesis. It is expressed at high levels throughout myeloid differentiation and binds to the promoters of multiple myeloid-specific genes at different stages of myeloid maturation. Profound hematopoietic abnormalities occur in mice nullizygous for C/EBP alpha including a selective early block in the differentiation of granulocytes. Mutations in C/EBP alpha are present in a subset of patients with AML presenting with a normal karyotype. These mutations can result in the expression of a 30 kDa dominant negative C/EBP alpha isoform, which contributes to loss of C/EBP alpha function. The molecular basis for this observation remains unknown. In addition to phosphorylation, C/EBP alpha is modified, post-translationally by a small ubiquitin-related modifier (SUMO) at a lysine residue (K159), which lies within the growth inhibitory region of the C/EBP alpha protein. Sumoylation at K159 in the C/EBP alpha protein prevents association of the SWI/SNF chromatin remodeling complex with C/EBP alpha, thereby hampering transactivation. In this review, the functional implications of post-translational modification, particularly sumoylation, of C/EBP alpha in normal granulopoiesis and leukemia are considered. PMID:18406180

  7. Folate receptor {alpha} regulates cell proliferation in mouse gonadotroph {alpha}T3-1 cells

    SciTech Connect

    Yao, Congjun; Evans, Chheng-Orn; Stevens, Victoria L.; Owens, Timothy R.; Oyesiku, Nelson M.

    2009-11-01

    We have previously found that the mRNA and protein levels of the folate receptor alpha (FR{alpha}) are uniquely over-expressed in clinically human nonfunctional (NF) pituitary adenomas, but the mechanistic role of FR{alpha} has not fully been determined. We investigated the effect of FR{alpha} over-expression in the mouse gonadotroph {alpha}T3-1 cell line as a model for NF pituitary adenomas. We found that the expression and function of FR{alpha} were strongly up-regulated, by Western blotting and folic acid binding assay. Furthermore, we found a higher cell growth rate, an enhanced percentage of cells in S-phase by BrdU assay, and a higher PCNA staining. These observations indicate that over-expression of FR{alpha} promotes cell proliferation. These effects were abrogated in the same {alpha}T3-1 cells when transfected with a mutant FR{alpha} cDNA that confers a dominant-negative phenotype by inhibiting folic acid binding. Finally, by real-time quantitative PCR, we found that mRNA expression of NOTCH3 was up-regulated in FR{alpha} over-expressing cells. In summary, our data suggests that FR{alpha} regulates pituitary tumor cell proliferation and mechanistically may involve the NOTCH pathway. Potentially, this finding could be exploited to develop new, innovative molecular targeted treatment for human NF pituitary adenomas.

  8. Alpha1 and Alpha2 Integrins Mediate Invasive Activity of Mouse Mammary Carcinoma Cells through Regulation of Stromelysin-1 Expression

    SciTech Connect

    Lochter, Andre; Navre, Marc; Werb, Zena; Bissell, Mina J

    1998-06-29

    Tumor cell invasion relies on cell migration and extracellular matrix proteolysis. We investigated the contribution of different integrins to the invasive activity of mouse mammary carcinoma cells. Antibodies against integrin subunits {alpha}6 and {beta}1, but not against {alpha}1 and {alpha}2, inhibited cell locomotion on a reconstituted basement membrane in two-dimensional cell migration assays, whereas antibodies against {beta}1, but not against a6 or {alpha}2, interfered with cell adhesion to basement membrane constituents. Blocking antibodies against {alpha}1 integrins impaired only cell adhesion to type IV collagen. Antibodies against {alpha}1, {alpha}2, {alpha}6, and {beta}1, but not {alpha}5, integrin subunits reduced invasion of a reconstituted basement membrane. Integrins {alpha}1 and {alpha}2, which contributed only marginally to motility and adhesion, regulated proteinase production. Antibodies against {alpha}1 and {alpha}2, but not {alpha}6 and {beta}1, integrin subunits inhibited both transcription and protein expression of the matrix metalloproteinase stromelysin-1. Inhibition of tumor cell invasion by antibodies against {alpha}1 and {alpha}2 was reversed by addition of recombinant stromelysin-1. In contrast, stromelysin-1 could not rescue invasion inhibited by anti-{alpha}6 antibodies. Our data indicate that {alpha}1 and {alpha}2 integrins confer invasive behavior by regulating stromelysin-1 expression, whereas {alpha}6 integrins regulate cell motility. These results provide new insights into the specific functions of integrins during tumor cell invasion.

  9. A procedure for the calculation of alpha function coefficients for the attraction parameter of Van der Waals equations of state

    SciTech Connect

    Stamateris, B.; Olivera-Fuentes, C.

    1996-12-31

    A new procedure is proposed for the calculation and correlation of cohesion parameters in cubic equations of state of the Van der Waals type. In this method, the derivative (rather than the function itself) is computed subject to the Maxwell (equal area) and Clapeyron equations. Strong experimental evidence indicates that properly formulated a functions must generate negative values at high temperatures. A theoretical analysis demonstrates the correct, hard-body limiting behavior of the cohesion function at infinite temperatures. From this, the simplest possible form of the cohesion function follows as a two-constant expression that can be considered an extension of a functional form previously proposed by Martin. The proposed function`s performance is comparable to more complex expressions previously presented in the literature, predicting vapor pressures of polar and nonpolar fluids with relative deviations (i) of {+-} 1%. 14 refs., 2 figs., 1 tab.

  10. G alpha 12 and G alpha 13 subunits define a fourth class of G protein alpha subunits.

    PubMed Central

    Strathmann, M P; Simon, M I

    1991-01-01

    Heterotrimeric guanine nucleotide-binding regulatory proteins (G proteins) are central to the signaling processes of multicellular organisms. We have explored the diversity of the G protein subunits in mammals and found evidence for a large family of genes that encode the alpha subunits. Amino acid sequence comparisons show that the different alpha subunits fall into at least three classes. These classes have been conserved in animals separated by considerable evolutionary distances; they are present in mammals, Drosophila, and nematodes. We have now obtained cDNA clones encoding two murine alpha subunits, G alpha 12 and G alpha 13, that define a fourth class. The translation products are predicted to have molecular masses of 44 kDa and to be insensitive to ADP-ribosylation by pertussis toxin. They share 67% amino acid sequence identity with each other and less than 45% identity with other alpha subunits. Their transcripts can be detected in every tissue examined, although the relative levels of the G alpha 13 message appear somewhat variable. Images PMID:1905812

  11. Sensitivity to alpha-amylcinnamic aldehyde and alpha-amylcinnamic alcohol.

    PubMed

    Guin, J D; Haffley, P

    1983-01-01

    Sensitivity to alpha-amylcinnamic aldehyde (alpha-AcAld) is apparently uncommon, but, like allergy to alpha-amylcinnamic alcohol (alpha-AcAlc), it often accompanies allergy to the perfume in Mycolog cream. Although alpha-AcAlc is a known ingredient, alpha-AcAld is not. However, gas-liquid chromatographic analysis shows alpha-AcAld to be present. Of fourteen persons sensitive to either chemical, ten reacted to both. Of these, one man and three women were markedly sensitive, and all three women had chronic recalcitrant vulvar eczema. That condition might have been the cause as well as the result of sensitization, but reexposure to a suspected product reproduced the eruption in both persons tested. Its use with other potent sensitizers, e.g., ethylenediamine, to treat irritations and chronic eczemas in an area of high absorption may partly explain development of allergy to a relatively weak sensitizer.

  12. Effect of UVB on hydrolysis of alpha-tocopherol acetate to alpha-tocopherol in mouse skin.

    PubMed

    Kramer-Stickland, K; Liebler, D C

    1998-08-01

    We have assessed the hydrolysis of alpha-tocopherol acetate (alpha-TAc) to the active antioxidant alpha-tocopherol (alpha-TH) in mouse epidermis and in supernatant from epidermal homogenates. Topically administered alpha-TH prevents UVB photocarcinogenesis in C3H mice, whereas alpha-TAc does not. Hydrolysis in skin was monitored in mice treated topically with deuterium labeled alpha-TAc (d3-alpha-TAc). Epidermal samples were isolated from mice and analyzed for endogenous (d0-alpha-TAc) and d3-alpha-TH by gas chromatography-mass spectrometry. Within 24 h, the levels of d3-alpha-TH increased up to 10-fold over endogenous d0-alpha-TH levels; however, in mice irradiated with UVB prior to the application of d3-alpha-TAc, levels of d3-alpha-TH increased up to 30-40-fold over endogenous d0-alpha-TH. This enhancement of alpha-TAc hydrolysis increased with increasing UVB dose. Prior UVB exposure may increase hydrolysis of alpha-TAc by increasing epidermal esterase activity. Nonspecific esterase activity was measured in the 2000 x g supernatant from epidermis of unirradiated and irradiated mice. Alpha-napthyl acetate, a nonspecific esterase substrate, was converted to alpha-napthol in supernatants from unirradiated mice. Hydrolysis to alpha-napthol increased approximately 3-fold in supernatants from irradiated mice. Hydrolysis of alpha-TAc to alpha-TH also occurred in supernatant from unirradiated mice, and this hydrolysis increased approximately 3-fold in supernatant from irradiated animals. These data indicate that nonspecific esterase activity was increased by UVB in the skin, that alpha-TAc is converted to alpha-TH in the homogenate fraction containing nonspecific esterase, and that UVB exposure modulates the metabolism of alpha-TAc to alpha-TH in vivo.

  13. Impact of inhomogeneous optical scattering coefficient distribution on recovery of optical absorption coefficient maps using tomographic photoacoustic data.

    PubMed

    Li, Xiaoqi; Jiang, Huabei

    2013-02-21

    We present a study through extensive simulation that considers the impact of inhomogeneous optical scattering coefficient distribution on recovery of optical absorption coefficient maps using tomographic photoacoustic data collected from media mimicking breast tissue. We found that while the impact of scattering heterogeneities/targets is modest on photoacoustic recovery of optical absorption coefficients, the impact of scattering contrast caused by adipose tissue, a layer of normal tissue along the boundary of the breast, is dramatic on reconstruction of optical absorption coefficients using photoacoustic data-up to 25.8% relative error in recovering the absorption coefficient is estimated in such cases. To overcome this problem, we propose a new method to enhance photoacoustic recovery of the optical absorption coefficient in heterogeneous media by considering inhomogeneous scattering coefficient distribution provided by diffuse optical tomography (DOT). Results from extensive simulations show that photoacoustic recovery of absorption coefficient maps can be improved considerably with a priori scattering information from DOT.

  14. Pulmonary interstitial compliance and microvascular filtration coefficient.

    PubMed

    Goldberg, H S

    1980-08-01

    Static and dynamic properties governing the fluid movement into the pulmonary interstitium were examined in isolated canine lobes. The system was driven by altering intravascular presure (Piv) when the lobe was isogravimetric (change in weight (W) = 0) and allowing the lobe to become isogravimetric again. By making use of an analogy to charging a capacitor across a resistor, calculation of the filtration coefficient for transvascular fluid movement (KF) and determination of the pressure-volume relationship of the pulmonary interstitial space (Pis-Vis), with a minimum of untested assumptions, was possible. KF was found to be the same for fluid moving out of or into the intravascular space, and when the relationship between Piv and alveolar pressure (PAlv) was constant, KF was independent of transpulmonary pressure (PL). When PAlv exceeded Piv, changes in Piv did not influence KF, suggesting no significant change in either surface area available for fluid transudation or vascular permeability. The Pis-Vis curve for increasing values of Vis and Pis is best described by an exponential relationhip and is independent of PL. However, the Pis-Vis curve with decreasing values of Vis and Pis is dependent on PL.

  15. Backscatter coefficient estimation using tapers with gaps.

    PubMed

    Luchies, Adam C; Oelze, Michael L

    2015-04-01

    When using the backscatter coefficient (BSC) to estimate quantitative ultrasound parameters such as the effective scatterer diameter (ESD) and the effective acoustic concentration (EAC), it is necessary to assume that the interrogated medium contains diffuse scatterers. Structures that invalidate this assumption can affect the estimated BSC parameters in terms of increased bias and variance and decrease performance when classifying disease. In this work, a method was developed to mitigate the effects of echoes from structures that invalidate the assumption of diffuse scattering, while preserving as much signal as possible for obtaining diffuse scatterer property estimates. Backscattered signal sections that contained nondiffuse signals were identified and a windowing technique was used to provide BSC estimates for diffuse echoes only. Experiments from physical phantoms were used to evaluate the effectiveness of the proposed BSC estimation methods. Tradeoffs associated with effective mitigation of specular scatterers and bias and variance introduced into the estimates were quantified. Analysis of the results suggested that discrete prolate spheroidal (PR) tapers with gaps provided the best performance for minimizing BSC error. Specifically, the mean square error for BSC between measured and theoretical had an average value of approximately 1.0 and 0.2 when using a Hanning taper and PR taper respectively, with six gaps. The BSC error due to amplitude bias was smallest for PR (Nω = 1) tapers. The BSC error due to shape bias was smallest for PR (Nω = 4) tapers. These results suggest using different taper types for estimating ESD versus EAC.

  16. Transport coefficients of a relativistic plasma

    NASA Astrophysics Data System (ADS)

    Pike, O. J.; Rose, S. J.

    2016-05-01

    In this work, a self-consistent transport theory for a relativistic plasma is developed. Using the notation of Braginskii [S. I. Braginskii, in Reviews of Plasma Physics, edited by M. A. Leontovich (Consultants Bureau, New York, 1965), Vol. 1, p. 174], we provide semianalytical forms of the electrical resistivity, thermoelectric, and thermal conductivity tensors for a Lorentzian plasma in a magnetic field. This treatment is then generalized to plasmas with arbitrary atomic number by numerically solving the linearized Boltzmann equation. The corresponding transport coefficients are fitted by rational functions in order to make them suitable for use in radiation-hydrodynamic simulations and transport calculations. Within the confines of linear transport theory and on the assumption that the plasma is optically thin, our results are valid for temperatures up to a few MeV. By contrast, classical transport theory begins to incur significant errors above kBT ˜10 keV, e.g., the parallel thermal conductivity is suppressed by 15% at kBT =20 keV due to relativistic effects.

  17. Altitude Dependent Auroral Ion Diffusion Coefficients

    NASA Astrophysics Data System (ADS)

    Ludlow, G. R.

    2011-12-01

    Simultaneous upgoing auroral H+ and O+ ion beams generate ion acoustic waves which have both parallel and oblique wave vectors with respect to the ambient magnetic field. A parallel mode is investigated with phase velocity UO + CO in the direction of beam propagation, where UO is the oxygen beam velocity and CO is the oxygen ion sound speed. Due to the mass difference, this mode preferentially resonates with the oxygen beam through the n = 1 cyclotron resonance, causing O+ ions to diffuse in a direction that is primarily perpendicular to the background magnetic field. The Landau resonance (n = 0) is very narrow in parallel velocity and does not interact with either ion beam. In one case study the parallel acoustic mode begins to resonate with O+ ions within the auroral acceleration region and this resonant region in velocity space sweeps through the entire O+ beam as it moves into weaker magnetic field regions. The O+ quasilinear diffusion coefficients are examined during this process. Perpendicular diffusion becomes significant when the parallel resonant velocity is close to the parallel group velocity of the waves. This selects regions of velocity space where perpendicular diffusion is maximum which occurs at the leading edge of the resonant region as it sweeps through the O+ beam. In k - space these resonant velocities correspond to the regions of peak growth rate. The relevance of this work to the selective energization of heavy auroral ion beams will be discussed.

  18. Operation Greenhouse. Scientific Director's report of atomic-weapon tests at Eniwetok, 1951. Annex 1. 9. Air-drop instrumentation. Part 2. Teller-alpha

    SciTech Connect

    Grier, H.E.

    1985-09-01

    It was the purpose of the Teller-Alpha experiment to measure the coefficient alpha by means of detectors placed a long distance from the bomb. The detectors are photoelectric devices that respond to visible light produced in the air surrounding the bomb by the absorbed gamma rays. A measurement of this sort was proposed by Edward Teller prior to the Sandstone Operation. The main components of the Teller-Alpha equipment were the photohead, the 200-Mc timing oscillator, and the high-speed-sensitivity recoding oscilloscope. A complete discussion of the experiment is provided.

  19. Mapping High-Velocity H-alpha and Lyman-alpha Emission from Supernova 1987A

    NASA Technical Reports Server (NTRS)

    France, Kevin; McCray, Richard; Fransson, Claes; Larsson, Josefin; Frank, Kari A.; Burrows, David N.; Challis, Peter; Kirshner, Robert P.; Chevalier, Roger A.; Garnavich, Peter; Heng, Kevin; Lawrence, Stephen S.; Lundqvist, Peter; Smith, Nathan; Sonneborn, George

    2015-01-01

    We present new Hubble Space Telescope images of high-velocity H-alpha and Lyman-alpha emission in the outer debris of SN 1987A. The H-alpha images are dominated by emission from hydrogen atoms crossing the reverse shock. For the first time we observe emission from the reverse shock surface well above and below the equatorial ring, suggesting a bipolar or conical structure perpendicular to the ring plane. Using the H-alpha imaging, we measure the mass flux of hydrogen atoms crossing the reverse shock front, in the velocity intervals (-7,500 < V(sub obs) < -2,800 km/s) and (1,000 < V(sub obs) < 7,500 km/s), ?M(sub H) = 1.2 × 10(exp -3) M/ y. We also present the first Lyman-alpha imaging of the whole remnant and new Chandra X-ray observations. Comparing the spatial distribution of the Lyman-alpha and X-ray emission, we observe that the majority of the high-velocity Lyman-alpha emission originates interior to the equatorial ring. The observed Lyman-alpha/H-alpha photon ratio, R(L-alpha/H-alpha) approx. = 17, is significantly higher than the theoretically predicted ratio of approx. = 5 for neutral atoms crossing the reverse shock front. We attribute this excess to Lyman-alpha emission produced by X-ray heating of the outer debris. The spatial orientation of the Lyman-alpha and X-ray emission suggests that X-ray heating of the outer debris is the dominant Lyman-alpha production mechanism in SN 1987A at this phase in its evolution.

  20. [Contents and its change during storage of alpha-solanine and alpha-chaconine in potatoes].

    PubMed

    Shindo, Tetsuya; Ushiyama, Hirofumi; Kan, Kimiko; Yasuda, Kazuo; Saito, Kazuo

    2004-10-01

    Contents of alpha-solanine and alpha-chaconine in native species of potato (May Queen, Danshaku and Waseshiro), and in species (Jagakids Red '90 (Red) and Jagakids Purple '90 (Purple)) on the market, and their change during storage at room temparature were investigated. alpha-Solanine and alpha-chaconine were extracted from potatoes with methanol, cleaned up by using a Sep-Pak Plus C18 cartridge, and then subjected to HPLC. The recoveries of alpha-solanine and alpha-chaconine from potatoes were both more than 96%, and the quantitation limits were both 2 microg/g. alpha-Solanine and alpha-chaconine were detected in periderm in all samples at the levels of 260-320 microg/g in May Queen,190-240 microg/g in Danshaku, 43-63 microg/g in Waseshiro, 140-200 microg/g in Red and 84-130 microg/g in Purple, respectively. alpha-Solanine and alpha-chaconine were detected in the cortex in all samples of May Queen and Danshaku at the levels of 2.7-12 microg/g and 5.8-31 microg/g, respectively. Contents of alpha-solanine and alpha-chaconine in the cortex of May Queen and Danshaku were less than 10% of those in the periderm. When potatoes were stored for 90 days at room temparature in a dark place, no marked change in the contents of alpha-solanine and alpha-chaconine was observed in any of the potato samples.

  1. [Contents and its change during storage of alpha-solanine and alpha-chaconine in potatoes].

    PubMed

    Shindo, Tetsuya; Ushiyama, Hirofumi; Kan, Kimiko; Yasuda, Kazuo; Saito, Kazuo

    2004-10-01

    Contents of alpha-solanine and alpha-chaconine in native species of potato (May Queen, Danshaku and Waseshiro), and in species (Jagakids Red '90 (Red) and Jagakids Purple '90 (Purple)) on the market, and their change during storage at room temparature were investigated. alpha-Solanine and alpha-chaconine were extracted from potatoes with methanol, cleaned up by using a Sep-Pak Plus C18 cartridge, and then subjected to HPLC. The recoveries of alpha-solanine and alpha-chaconine from potatoes were both more than 96%, and the quantitation limits were both 2 microg/g. alpha-Solanine and alpha-chaconine were detected in periderm in all samples at the levels of 260-320 microg/g in May Queen,190-240 microg/g in Danshaku, 43-63 microg/g in Waseshiro, 140-200 microg/g in Red and 84-130 microg/g in Purple, respectively. alpha-Solanine and alpha-chaconine were detected in the cortex in all samples of May Queen and Danshaku at the levels of 2.7-12 microg/g and 5.8-31 microg/g, respectively. Contents of alpha-solanine and alpha-chaconine in the cortex of May Queen and Danshaku were less than 10% of those in the periderm. When potatoes were stored for 90 days at room temparature in a dark place, no marked change in the contents of alpha-solanine and alpha-chaconine was observed in any of the potato samples. PMID:15678944

  2. A new alpha chain hemoglobin variant: Hb Al-Hammadi Riyadh [alpha75(EF4)Asp-->Val (alpha2)].

    PubMed

    Burnichon, Nelly; Lacan, Philippe; Becchi, Michel; Zanella-Cleon, Isabelle; Aubry, Martine; Mowafy, Mohammed; Couprie, Nicole; Francina, Alain

    2006-01-01

    A new hemoglobin (Hb) variant in the heterozygous state, Hb Al-Hammadi Riyadh [codon 75 (GAC-->GTC); alpha75(EF4)Asp-->Val (alpha2)] corresponding to an A-->T transversion on the second exon of the alpha2-globin gene, is described. The variant was characterized by DNA sequencing and mass spectrometry (MS). The variant was found during a routine Hb analysis for anemia in a 16-month-old boy who lived in Riyadh, Kingdom of Saudi Arabia.

  3. Genetics Home Reference: mucolipidosis III alpha/beta

    MedlinePlus

    ... Health Conditions mucolipidosis III alpha/beta mucolipidosis III alpha/beta Enable Javascript to view the expand/collapse ... PDF Open All Close All Description Mucolipidosis III alpha/beta is a slowly progressive disorder that affects ...

  4. Genetics Home Reference: mucolipidosis II alpha/beta

    MedlinePlus

    ... Health Conditions mucolipidosis II alpha/beta mucolipidosis II alpha/beta Enable Javascript to view the expand/collapse ... PDF Open All Close All Description Mucolipidosis II alpha/beta (also known as I-cell disease) is ...

  5. 24xi-Methyl 5 alpha-cholestane-3 alpha,6 beta,9 alpha,25-tetrol 24-monoacetate, a novel polyhydroxylated steroid from the soft coral Sarcophyton tortuosum.

    PubMed

    Su, J Y; Peng, T S; Long, K H; Zeng, L M

    1986-01-01

    A novel polyhydroxylated steroid, named sartortuosterol A, with rare 3 alpha- and 6-hydroxyl groups, was isolated from the South China Sea soft coral Sarcophyton tortuosum Tixier-Durivault, and its structure was established as 24xi-methyl 5 alpha-cholestane-3 alpha, 6 beta, 9 alpha,25-tetrol 25-monoacetate from spectroscopic data and chemical conversions.

  6. Generalized skew coefficients for flood-frequency analysis in Minnesota

    USGS Publications Warehouse

    Lorenz, D.L.

    1997-01-01

    This report presents an evaluation of generalized skew coefficients used in flood-frequency analysis. Station skew coefficients were computed for 267 long-term stream-gaging stations in Minnesota and the surrounding states of Iowa, North and South Dakota, Wisconsin, and the provinces of Manitoba and Ontario, Canada. Generalized skew coefficients were computed from station skew coefficients using a locally weighted regression technique. The resulting regression trend surface was the generalized skew coefficient map, except for the North Shore area, and has a mean square error of 0.182.

  7. The intraclass correlation coefficient: distribution-free definition and test.

    PubMed

    Commenges, D; Jacqmin, H

    1994-06-01

    A definition of the intraclass correlation coefficient is given on the basis of a general class of random effect model. The conventional intraclass correlation coefficient and the intracluster correlation coefficient for binary data are both particular cases of the generalized coefficient. We derive the score test for the hypothesis of null intraclass correlation in the exponential family. The statistic does not depend on the particular distribution in this family and is related to the pairwise correlation coefficient. The test can be adjusted for explanatory variables.

  8. A simple application of the Bailey-Orowan creep model to Fe-39.8 at. pct Al and gamma/gamma prime - alpha

    NASA Technical Reports Server (NTRS)

    Whittenberger, J. D.; Krishnan, R. V.

    1984-01-01

    The results of a study to determine the recovery rates and work-hardening coefficients for creep from constant cross-head speed compressive tests are presented. Stressing and straining rates are computed from measured time-load curves obtained from compression testing between 1200 and 1400 K of several B2 crystal structure Fe-39.8 Al intermetallic materials and the directionally solidified eutectic alloy gamma/gamma prime alpha. These quantities are then fitted to the universal form of the Bailey-Orowan equation for creep. The recovery rates were found to be functions of nominal strain rate, stress, and temperature, while the hardening coefficients were dependent only on temperature. While the work-hardening coefficient for gamma/gamma prime - alpha was about 0.05 of the elastic modulus, the work-hardening coefficients for Fe-39.8 at. pct Al were less than 0.002 of the modulus.

  9. Lucid dreaming and alpha activity: a preliminary report.

    PubMed

    Ogilvie, R D; Hunt, H T; Tyson, P D; Lucescu, M L; Jeakins, D B

    1982-12-01

    10 good dream recallers spent 2 nights in the sleep lab during which they were awakened 4 times per night from REM sleep, twice during their highest alpha activity in REM, and twice during low REM alpha. 5 were given alpha feedback training prior to sleep onset. Arousals from high alpha REM sleep yielded significantly higher lucidity ratings. Alpha feedback had no effect upon lucidity or REM alpha levels. Similarities between lucid dreams and meditative phenomena are discussed. PMID:7162915

  10. Lucid dreaming and alpha activity: a preliminary report.

    PubMed

    Ogilvie, R D; Hunt, H T; Tyson, P D; Lucescu, M L; Jeakins, D B

    1982-12-01

    10 good dream recallers spent 2 nights in the sleep lab during which they were awakened 4 times per night from REM sleep, twice during their highest alpha activity in REM, and twice during low REM alpha. 5 were given alpha feedback training prior to sleep onset. Arousals from high alpha REM sleep yielded significantly higher lucidity ratings. Alpha feedback had no effect upon lucidity or REM alpha levels. Similarities between lucid dreams and meditative phenomena are discussed.

  11. Applying alpha-channeling to mirror machines

    SciTech Connect

    Zhmoginov, A. I.; Fisch, N. J.

    2012-05-15

    The {alpha}-channeling effect entails the use of radio-frequency waves to expel and cool high-energetic {alpha} particles born in a fusion reactor; the device reactivity can then be increased even further by redirecting the extracted energy to fuel ions. Originally proposed for tokamaks, this technique has also been shown to benefit open-ended fusion devices. Here, the fundamental theory and practical aspects of {alpha} channeling in mirror machines are reviewed, including the influence of magnetic field inhomogeneity and the effect of a finite wave region on the {alpha}-channeling mechanism. For practical implementation of the {alpha}-channeling effect in mirror geometry, suitable contained weakly damped modes are identified. In addition, the parameter space of candidate waves for implementing the {alpha}-channeling effect can be significantly extended through the introduction of a suitable minority ion species that has the catalytic effect of moderating the transfer of power from the {alpha}-channeling wave to the fuel ions.

  12. Lyman alpha radiation in external galaxies

    NASA Technical Reports Server (NTRS)

    Neufeld, David A.; Mckee, Christopher F.

    1990-01-01

    The Ly alpha line of atomic hydrogen is often a luminous component of the radiation emitted by distant galaxies. Except for those galaxies which have a substantial central source of non-stellar ionizing radiation, most of the Ly alpha radiation emitted by galaxies is generated within regions of the interstellar medium which are photoionized by starlight. Conversely, much of the energy radiated by photoionized regions is carried by the Ly alpha line. Only hot, massive stars are capable of ionizing hydrogen in the interstellar medium which surrounds them, and because such stars are necessarily short-lived, Ly alpha emission traces regions of active star formation. Researchers argue that the strength of the Ly alpha emission observed from external galaxies may be used to estimate quantitatively the dust content of the emitting region, while the Ly alpha line profile is sensitive to the presence of shock waves. Interstellar dust particles and shock waves are intimately associated with the process of star formation in two senses. First, both dust particles and shock waves owe their existence to stellar activity; second, they may both serve as agents which facilitate the formation of stars, shocks by triggering gravitational instabilities in the interstellar gas that they compress, and dust by shielding star-forming molecular clouds from the ionizing and dissociative effects of external UV radiation. By using Ly alpha observations as a probe of the dust content in diffuse gas at high redshift, we might hope to learn about the earliest epochs of star formation.

  13. Diagnostics for PLX-alpha

    NASA Astrophysics Data System (ADS)

    Gilmore, Mark; Hsu, Scott

    2015-11-01

    The goal of the Plasma Liner eXperiment PLX-alpha at Los Alamos National Laboratory is to establish the viability of creating a spherically imploding plasma liner for MIF and HED applications, using a spherical array of supersonic plasma jets launched by innovative contoured-gap coaxial plasma guns. PLX- α experiments will focus in particular on establishing the ram pressure and uniformity scalings of partial and fully spherical plasma liners. In order to characterize these parameters experimentally, a suite of diagnostics is planned, including multi-camera fast imaging, a 16-channel visible interferometer (upgraded from 8 channels) with reconfigurable, fiber-coupled front end, and visible and VUV high-resolution and survey spectroscopy. Tomographic reconstruction and data fusion techniques will be used in conjunction with interferometry, imaging, and synthetic diagnostics from modeling to characterize liner uniformity in 3D. Diagnostic and data analysis design, implementation, and status will be presented. Supported by the Advanced Research Projects Agency - Energy - U.S. Department of Energy.

  14. Lyman Alpha Spicule Observatory (LASO)

    NASA Technical Reports Server (NTRS)

    Chamberlin, Phillip C.

    2011-01-01

    The Lyman Alpha Spicule Observatory (LASO) sounding rocket will observe smallscale eruptive events called "Rapid Blue-shifted Events" (RBEs) [Rouppe van der Voort et al., 2009], the on-disk equivalent of Type-II spicules, and extend observations that explore their role in the solar coronal heating problem [De Pontieu et al., 2011]. LASO utilizes a new and novel optical design to simultaneously observe two spatial dimensions at 4.2" spatial resolution (2.1" pixels) over a 2'x2' field of view with high spectral resolution of 66mAngstroms (33mAngstroms pixels) across a broad 20Angstrom spectral window. This spectral window contains three strong chromospheric and transition region emissions and is centered on the strong Hydrogen Lyman-a emission at 1216Angstroms. This instrument makes it possible to obtain new data crucial to the physical understanding of these phenomena and their role in the overall energy and momentum balance from the upper chromosphere to lower corona. LASO was submitted March 2011 in response to the ROSES SHP-LCAS call.

  15. Diabetes and Alpha Lipoic Acid

    PubMed Central

    Golbidi, Saeid; Badran, Mohammad; Laher, Ismail

    2011-01-01

    Diabetes mellitus is a multi-faceted metabolic disorder where there is increased oxidative stress that contributes to the pathogenesis of this debilitating disease. This has prompted several investigations into the use of antioxidants as a complementary therapeutic approach. Alpha lipoic acid, a naturally occurring dithiol compound which plays an essential role in mitochondrial bioenergetic reactions, has gained considerable attention as an antioxidant for use in managing diabetic complications. Lipoic acid quenches reactive oxygen species, chelates metal ions, and reduces the oxidized forms of other antioxidants such as vitamin C, vitamin E, and glutathione. It also boosts antioxidant defense system through Nrf-2-mediated antioxidant gene expression and by modulation of peroxisome proliferator activated receptors-regulated genes. ALA inhibits nuclear factor kappa B and activates AMPK in skeletal muscles, which in turn have a plethora of metabolic consequences. These diverse actions suggest that lipoic acid acts by multiple mechanisms, many of which have only been uncovered recently. In this review we briefly summarize the known biochemical properties of lipoic acid and then discussed the oxidative mechanisms implicated in diabetic complications and the mechanisms by which lipoic acid may ameliorate these reactions. The findings of some of the clinical trials in which lipoic acid administration has been tested in diabetic patients during the last 10 years are summarized. It appears that the clearest benefit of lipoic acid supplementation is in patients with diabetic neuropathy. PMID:22125537

  16. Lyman Alpha Spicule Observatory (LASO)

    NASA Astrophysics Data System (ADS)

    Chamberlin, Phillip C.; Allred, J.; Airapetian, V.; Gong, Q.; Fontenla, J.; McIntosh, S.; de Pontieu, B.

    2011-05-01

    The Lyman Alpha Spicule Observatory (LASO) sounding rocket will observe small-scale eruptive events called "Rapid Blue-shifted Events” (RBEs), the on-disk equivalent of Type-II spicules, and extend observations that explore their role in the solar coronal heating problem. LASO utilizes a new and novel optical design to simultaneously observe two spatial dimensions at 4.2" spatial resolution (2.1” pixels) over a 2'x2' field of view with high spectral resolution of 66mÅ (33mÅ pixels) across a broad 20Å spectral window. This spectral window contains three strong chromospheric and transition region emissions and is centered on the strong Hydrogen Lyman-α emission at 1216Å. This instrument makes it possible to obtain new data crucial to the physical understanding of these phenomena and their role in the overall energy and momentum balance from the upper chromosphere to lower corona. LASO was submitted March 2011 in response to the ROSES SHP-LCAS call.

  17. Lyman Alpha Spicule Observatory (LASO)

    NASA Astrophysics Data System (ADS)

    Chamberlin, P. C.; Allred, J. C.; Airapetian, V.; Gong, Q.; Mcintosh, S. W.; De Pontieu, B.; Fontenla, J. M.

    2011-12-01

    The Lyman Alpha Spicule Observatory (LASO) sounding rocket will observe small-scale eruptive events called "Rapid Blue-shifted Events" (RBEs) [Rouppe van der Voort et al., 2009], the on-disk equivalent of Type-II spicules, and extend observations that explore their role in the solar coronal heating problem [De Pontieu et al., 2011]. LASO utilizes a new and novel optical design to simultaneously observe two spatial dimensions at 4.2" spatial resolution (2.1" pixels) over a 2'x2' field of view with high spectral resolution of 66mÅ (33mÅ pixels) across a broad 20Å spectral window. This spectral window contains three strong chromospheric and transition region emissions and is centered on the strong Hydrogen Lyman-α emission at 1216Å. This instrument makes it possible to obtain new data crucial to the physical understanding of these phenomena and their role in the overall energy and momentum balance from the upper chromosphere to lower corona. LASO was submitted March 2011 in response to the ROSES SHP-LCAS call.

  18. Distribution Coefficients of Impurities in Metals

    NASA Astrophysics Data System (ADS)

    Pearce, J. V.

    2014-04-01

    Impurities dissolved in very pure metals at the level of parts per million often cause an elevation or depression of the freezing temperature of the order of millikelvins. This represents a significant contribution to the uncertainty of standard platinum resistance thermometer calibrations. An important parameter for characterizing the behavior of impurities is the distribution coefficient , which is the ratio of the solid solubility to liquid solubility. A knowledge of for a given binary system is essential for contemporary methods of evaluating or correcting for the effect of impurities, and it is therefore of universal interest to have the most complete set of values possible. A survey of equilibrium values of (in the low concentration limit) reported in the literature for the International Temperature Scale of 1990 fixed points of Hg, Ga, In, Sn, Zn, Al, Au, Ag, and Cu is presented. In addition, thermodynamic calculations of using MTDATA are presented for 170 binary systems. In total, the combined values of from all available sources for 430 binary systems are presented. In addition, by considering all available values of for impurities in 25 different metal solvents (1300 binary systems) enough data are available to characterize patterns in the value of for a given impurity as a function of its position in the periodic table. This enables prediction of for a significant number of binary systems for which data and calculations are unavailable. By combining data from many sources, values of for solutes (atomic number from 1 to 94) in ITS-90 fixed points from Hg to Cu are suggested, together with some tentative predicted values where literature data and calculations are unavailable.

  19. Divergence of human [alpha]-chain constant region gene sequences: A novel recombinant [alpha]2 gene

    SciTech Connect

    Chintalacharuvu, K. R.; Morrison, S.L. ); Raines, M. )

    1994-06-01

    IgA is the major Ig synthesized in humans and provides the first line of defense at the mucosal surfaces. The constant region of IgA heavy chain is encoded by the [alpha] gene on chromosome 14. Previous studies have indicated the presence of two [alpha] genes, [alpha]1 and [alpha]2 existing in two allotypic forms, [alpha]2 m(1) and [alpha]2 m(2). Here the authors report the cloning and complete nucleotide sequence determination of a novel human [alpha] gene. Nucleotide sequence comparison with the published [alpha] sequences suggests that the gene arose as a consequence of recombination or gene conversion between the two [alpha]2 alleles. The authors have expressed the gene as a chimeric protein in myeloma cells indicating that it encodes a functional protein. The novel IgA resembles IgA2 m(2) in that disulfide bonds link H and L chains. This novel recombinant gene provides insights into the mechanisms of generation of different constant regions and suggests that within human populations, multiple alleles of [alpha] may be present providing IgAs of different structures.

  20. Fibrinogen {alpha} genes: Conservation of bipartite transcripts and carboxy-terminal-extended {alpha} subunits in vertebrates

    SciTech Connect

    Fu, Y.; Cao, Y.; Hertzberg, K.M.; Grieninger, G.

    1995-11-01

    All three well-studied subunits of the clotting protein fibrinogen ({alpha}, {beta}, {gamma}) share N-terminal structural homologies, but until recently only the {beta} and {gamma} chains were recognized as having similar globular C-termini. With the discovery of an extra exon in the human fibrinogen {alpha} gene (exon VI), a minor form of the {alpha} subunit ({alpha}{sub E}) with an extended {beta}- and {gamma}-like C-terminus has been identified. In the present study, the polymerase chain reaction has been used to identify sequences that encode counterparts to {alpha}{sub E} in chicken, rabbit, rat, and baboon. The basic six-exon structure of the fibrinogen {alpha} genes is shown to be conserved among mammals and birds, as are the intron positions. Bipartite transcripts - still bearing an intron prior to the last exon - are found among the products of the various vertebrate fibrinogen {alpha} genes. The last exon represents the largest conserved segment of the gene and, in each species examined, encodes exactly 236 amino acids. The C-termini of these {alpha}{sub E} chains align without a single gap and are between 76 and 99% identical. Since the exon VI-encoded domain of {alpha}{sub E} is as well conserved as the corresponding regions of the {beta} and {gamma} chains, it follows that it is equally important and that {alpha}{sub E}-fibrinogen plays a vital, if as-yet unrecognized physiological role. 21 refs., 7 figs., 1 tab.

  1. Variable displacement alpha-type Stirling engine

    NASA Astrophysics Data System (ADS)

    Homutescu, V. M.; Bălănescu, D. T.; Panaite, C. E.; Atanasiu, M. V.

    2016-08-01

    The basic design and construction of an alpha-type Stirling engine with on load variable displacement is presented. The variable displacement is obtained through a planar quadrilateral linkage with one on load movable ground link. The physico-mathematical model used for analyzing the variable displacement alpha-type Stirling engine behavior is an isothermal model that takes into account the real movement of the pistons. Performances and power adjustment capabilities of such alpha-type Stirling engine are calculated and analyzed. An exemplification through the use of the numerical simulation was performed in this regard.

  2. Alpha spectral analysis via artificial neural networks

    SciTech Connect

    Kangas, L.J.; Hashem, S.; Keller, P.E.; Kouzes, R.T.; Troyer, G.L.

    1994-10-01

    An artificial neural network system that assigns quality factors to alpha particle energy spectra is discussed. The alpha energy spectra are used to detect plutonium contamination in the work environment. The quality factors represent the levels of spectral degradation caused by miscalibration and foreign matter affecting the instruments. A set of spectra was labeled with a quality factor by an expert and used in training the artificial neural network expert system. The investigation shows that the expert knowledge of alpha spectra quality factors can be transferred to an ANN system.

  3. Determining cellular role of G alpha 12.

    PubMed

    Dermott, Jonathan M; Dhanasekaran, N

    2002-01-01

    Using the expression strategies described here, we have demonstrated a model system whereby the sequential signaling events involved in cell proliferation and subsequent transformation regulated by G alpha 12 can be investigated. The model system presented here can also be used to study the temporal interrelationships between small GTPases, kinases, and other signaling proteins involved in G alpha 12-signaling pathways. Further analyses using this model system and the strategies presented here should provide valuable clues in defining the signaling network regulated by G alpha 12 in stimulating cell proliferation and oncogenic transformation. PMID:11771390

  4. Quantitative digital image analysis of chromogenic assays for high throughput screening of alpha-amylase mutant libraries.

    PubMed

    Shankar, Manoharan; Priyadharshini, Ramachandran; Gunasekaran, Paramasamy

    2009-08-01

    An image analysis-based method for high throughput screening of an alpha-amylase mutant library using chromogenic assays was developed. Assays were performed in microplates and high resolution images of the assay plates were read using the Virtual Microplate Reader (VMR) script to quantify the concentration of the chromogen. This method is fast and sensitive in quantifying 0.025-0.3 mg starch/ml as well as 0.05-0.75 mg glucose/ml. It was also an effective screening method for improved alpha-amylase activity with a coefficient of variance of 18%.

  5. Structural dynamics of the alpha-neurotoxin-acetylcholine-binding protein complex: hydrodynamic and fluorescence anisotropy decay analyses.

    PubMed

    Hibbs, Ryan E; Johnson, David A; Shi, Jianxin; Hansen, Scott B; Taylor, Palmer

    2005-12-20

    The three-fingered alpha-neurotoxins have played a pivotal role in elucidating the structure and function of the muscle-type and neuronal alpha7 nicotinic acetylcholine receptors (nAChRs). To advance our understanding of the alpha-neurotoxin-nAChR interaction, we examined the flexibility of alpha-neurotoxin bound to the acetylcholine-binding protein (AChBP), which shares structural similarity and sequence identities with the extracellular domain of nAChRs. Because the crystal structure of five alpha-cobratoxin molecules bound to AChBP shows the toxins projecting radially like propeller "blades" from the perimeter of the donut-shaped AChBP, the toxin molecules should increase the frictional resistance and thereby alter the hydrodynamic properties of the complex. alpha-Bungarotoxin binding had little effect on the frictional coefficients of AChBP measured by analytical ultracentrifugation, suggesting that the bound toxins are flexible. To support this conclusion, we measured the anisotropy decay of four site-specifically labeled alpha-cobratoxins (conjugated at positions Lys(23), Lys(35), Lys(49), and Lys(69)) bound to AChBP and free in solution and compared their anisotropy decay properties with fluorescently labeled cysteine mutants of AChBP. The results indicated that the core of the toxin molecule is relatively flexible when bound to AChBP. When hydrodynamic and anisotropy decay analyses are taken together, they establish that only one face of the second loop of the alpha-neurotoxin is immobilized significantly by its binding. The results indicate that bound alpha-neurotoxin is not rigidly oriented on the surface of AChBP but rather exhibits segmental motion by virtue of flexibility in its fingerlike structure.

  6. Crystallization of hepatocyte nuclear factor 4 alpha (HNF4 alpha) in complex with the HNF1 alpha promoter element.

    PubMed

    Lu, Peng; Liu, Jianguo; Melikishvili, Manana; Fried, Michael G; Chi, Young-In

    2008-04-01

    Hepatocyte nuclear factor 4alpha (HNF4alpha) is a member of the nuclear receptor superfamily that plays a central role in organ development and metabolic functions. Mutations on HNF4alpha cause maturity-onset diabetes of the young (MODY), a dominant monogenic cause of diabetes. In order to understand the molecular mechanism of promoter recognition and the molecular basis of disease-causing mutations, the recombinant HNF4alpha DNA-binding domain was prepared and used in a study of its binding properties and in crystallization with a 21-mer DNA fragment that contains the promoter element of another MODY gene, HNF1alpha. The HNF4alpha protein displays a cooperative and specific DNA-binding activity towards its target gene-recognition elements. Crystals of the complex diffract to 2.0 A using a synchrotron-radiation source under cryogenic (100 K) conditions and belong to space group C2, with unit-cell parameters a = 121.63, b = 35.43, c = 70.99 A, beta = 119.36 degrees . A molecular-replacement solution has been obtained and structure refinement is in progress. This structure and the binding studies will provide the groundwork for detailed functional and biochemical studies of the MODY mutants. PMID:18391435

  7. Oxygen binding by alpha(Fe2+)2beta(Ni2+)2 hemoglobin crystals.

    PubMed Central

    Bruno, S.; Bettati, S.; Manfredini, M.; Mozzarelli, A.; Bolognesi, M.; Deriu, D.; Rosano, C.; Tsuneshige, A.; Yonetani, T.; Henry, E. R.

    2000-01-01

    Oxygen binding by hemoglobin fixed in the T state either by crystallization or by encapsulation in silica gels is apparently noncooperative. However, cooperativity might be masked by different oxygen affinities of alpha and beta subunits. Metal hybrid hemoglobins, where the noniron metal does not bind oxygen, provide the opportunity to determine the oxygen affinities of alpha and beta hemes separately. Previous studies have characterized the oxygen binding by alpha(Ni2+)2beta(Fe2+)2 crystals. Here, we have determined the three-dimensional (3D) structure and oxygen binding of alpha(Fe2+)2beta(Ni2+)2 crystals grown from polyethylene glycol solutions. Polarized absorption spectra were recorded at different oxygen pressures with light polarized parallel either to the b or c crystal axis by single crystal microspectrophotometry. The oxygen pressures at 50% saturation (p50s) are 95 +/- 3 and 87 +/- 4 Torr along the b and c crystal axes, respectively, and the corresponding Hill coefficients are 0.96 +/- 0.06 and 0.90 +/- 0.03. Analysis of the binding curves, taking into account the different projections of the alpha hemes along the optical directions, indicates that the oxygen affinity of alpha1 hemes is 1.3-fold lower than alpha2 hemes. Inspection of the 3D structure suggests that this inequivalence may arise from packing interactions of the Hb tetramer within the monoclinic crystal lattice. A similar inequivalence was found for the beta subunits of alpha(Ni2+)2beta(Fe2+)2 crystals. The average oxygen affinity of the alpha subunits (p50 = 91 Torr) is about 1.2-fold higher than the beta subunits (p50 = 110 Torr). In the absence of cooperativity, this heterogeneity yields an oxygen binding curve of Hb A with a Hill coefficient of 0.999. Since the binding curves of Hb A crystals exhibit a Hill coefficient very close to unity, these findings indicate that oxygen binding by T-state hemoglobin is noncooperative, in keeping with the Monod, Wyman, and Changeux model. PMID

  8. Oxygen binding by alpha(Fe2+)2beta(Ni2+)2 hemoglobin crystals.

    PubMed

    Bruno, S; Bettati, S; Manfredini, M; Mozzarelli, A; Bolognesi, M; Deriu, D; Rosano, C; Tsuneshige, A; Yonetani, T; Henry, E R

    2000-04-01

    Oxygen binding by hemoglobin fixed in the T state either by crystallization or by encapsulation in silica gels is apparently noncooperative. However, cooperativity might be masked by different oxygen affinities of alpha and beta subunits. Metal hybrid hemoglobins, where the noniron metal does not bind oxygen, provide the opportunity to determine the oxygen affinities of alpha and beta hemes separately. Previous studies have characterized the oxygen binding by alpha(Ni2+)2beta(Fe2+)2 crystals. Here, we have determined the three-dimensional (3D) structure and oxygen binding of alpha(Fe2+)2beta(Ni2+)2 crystals grown from polyethylene glycol solutions. Polarized absorption spectra were recorded at different oxygen pressures with light polarized parallel either to the b or c crystal axis by single crystal microspectrophotometry. The oxygen pressures at 50% saturation (p50s) are 95 +/- 3 and 87 +/- 4 Torr along the b and c crystal axes, respectively, and the corresponding Hill coefficients are 0.96 +/- 0.06 and 0.90 +/- 0.03. Analysis of the binding curves, taking into account the different projections of the alpha hemes along the optical directions, indicates that the oxygen affinity of alpha1 hemes is 1.3-fold lower than alpha2 hemes. Inspection of the 3D structure suggests that this inequivalence may arise from packing interactions of the Hb tetramer within the monoclinic crystal lattice. A similar inequivalence was found for the beta subunits of alpha(Ni2+)2beta(Fe2+)2 crystals. The average oxygen affinity of the alpha subunits (p50 = 91 Torr) is about 1.2-fold higher than the beta subunits (p50 = 110 Torr). In the absence of cooperativity, this heterogeneity yields an oxygen binding curve of Hb A with a Hill coefficient of 0.999. Since the binding curves of Hb A crystals exhibit a Hill coefficient very close to unity, these findings indicate that oxygen binding by T-state hemoglobin is noncooperative, in keeping with the Monod, Wyman, and Changeux model.

  9. Production of tumor necrosis factor alpha, interleukin-1 alpha, and interleukin-6 during murine coccidioidomycosis.

    PubMed Central

    Cox, R A; Magee, D M

    1995-01-01

    The proinflammatory cytokines tumor necrosis factor alpha (TNF-alpha), interleukin-1 alpha (IL-1 alpha), and interleukin-6 (IL-6) were induced in mice infected with Coccidioides immitis. Analyses of the cytokine profiles of two inbred mouse strains which differ in their susceptibility to pulmonary challenge with C. immitis revealed higher levels of IL-6 in lungs from DBA/2 mice (resistant strain) than in those from BALB/c mice (susceptible strain) beginning at day 6 and continuing through day 15 postinfection. Spleen cells from both mouse strains secreted TNF-alpha, IL-1 alpha, and IL-6 in vitro in response to stimulation with killed spherules but differed in that spleen cells from the resistant strain produced increased levels of these cytokines earlier after pulmonary challenge and at increased levels throughout the course of the disease. PMID:7558338

  10. Influence of fast alpha diffusion and thermal alpha buildup on tokamak reactor performance

    SciTech Connect

    Uckan, N.A.; Tolliver, J.S.; Houlberg, W.A.; Attenberger, S.E.

    1987-11-01

    The effect of fast alpha diffusion and thermal alpha accumulation on the confinement capability of a candidate Engineering Test Reactor (ETR) plasma (Tokamak Ignition/Burn Experimental Reactor (TIBER-II)) in achieving ignition and steady-state driven operation has been assessed using both global and 1-1/2-D transport models. Estimates are made of the threshold for radial diffusion of fast alphas and thermal alpha buildup. It is shown that a relatively low level of radial transport, when combined with large gradients in the fast alpha density, leads to a significant radial flow with a deleterious effect on plasma performance. Similarly, modest levels of thermal alpha concentration significantly influence the ignition and steady-state burn capability. 23 refs., 9 figs., 4 tabs.

  11. Radioimmunotherapy with alpha-particle emitting radionuclides.

    PubMed

    Zalutsky, M R; Pozzi, O R

    2004-12-01

    An important consideration in the development of effective strategies for radioimmunotherapy is the nature of the radiation emitted by the radionuclide. Radionuclides decaying by the emission of alpha-particles offer the possibility of matching the cell specific reactivity of monoclonal antibodies with radiation with a range of only a few cell diameters. Furthermore, alpha-particles have important biological advantages compared with external beam radiation and beta-particles including a higher biological effectiveness, which is nearly independent of oxygen concentration, dose rate and cell cycle position. In this review, the clinical settings most likely to benefit from alpha-particle radioimmunotherapy will be discussed. The current status of preclinical and clinical research with antibodies labeled with 3 promising alpha-particle emitting radionuclides - (213)Bi, (225)Ac, and (211)At - also will be summarized.

  12. Radioimmunotherapy with alpha-particle emitting radionuclides.

    PubMed

    Zalutsky, M R; Pozzi, O R

    2004-12-01

    An important consideration in the development of effective strategies for radioimmunotherapy is the nature of the radiation emitted by the radionuclide. Radionuclides decaying by the emission of alpha-particles offer the possibility of matching the cell specific reactivity of monoclonal antibodies with radiation with a range of only a few cell diameters. Furthermore, alpha-particles have important biological advantages compared with external beam radiation and beta-particles including a higher biological effectiveness, which is nearly independent of oxygen concentration, dose rate and cell cycle position. In this review, the clinical settings most likely to benefit from alpha-particle radioimmunotherapy will be discussed. The current status of preclinical and clinical research with antibodies labeled with 3 promising alpha-particle emitting radionuclides - (213)Bi, (225)Ac, and (211)At - also will be summarized. PMID:15640792

  13. Alpha Coincidence Spectroscopy studied with GEANT4

    SciTech Connect

    Dion, Michael P.; Miller, Brian W.; Tatishvili, Gocha; Warren, Glen A.

    2013-11-02

    Abstract The high-energy side of peaks in alpha spectra, e.g. 241Am, as measured with a silicon detector has structure caused mainly by alpha-conversion electron and to some extent alphagamma coincidences. We compare GEANT4 simulation results to 241Am alpha spectroscopy measurements with a passivated implanted planar silicon detector. A large discrepancy between the measurements and simulations suggest that the GEANT4 photon evaporation database for 237Np (daughter of 241Am decay) does not accurately describe the conversion electron spectrum and therefore was found to have large discrepancies with experimental measurements. We describe how to improve the agreement between GEANT4 and alpha spectroscopy for actinides of interest by including experimental measurements of conversion electron spectroscopy into the photon evaporation database.

  14. Radioimmunotherapy with alpha-emitting nuclides.

    PubMed

    McDevitt, M R; Sgouros, G; Finn, R D; Humm, J L; Jurcic, J G; Larson, S M; Scheinberg, D A

    1998-09-01

    This review discusses the application of alpha particle-emitting radionuclides in targeted radioimmunotherapy. It will outline the production and chemistry of astatine-211, bismuth-212, lead-212, actinium-225, bismuth-213, fermium-255, radium-223 and terbium-149, which at present are the most promising alpha-emitting isotopes available for human clinical use. The selective cytotoxicity offered by alpha particle-emitting radioimmunoconstructs is due to the high linear energy transfer and short particle path length of these radionuclides. Based upon the pharmacokinetics of alpha particle-emitting radioimmunoconstructs, both stochastic and conventional dosimetric methodology is discussed, as is the preclinical and initial clinical use of these radionuclides conjugated to monoclonal antibodies for the treatment of human neoplasia. PMID:9724387

  15. Genetics Home Reference: alpha-1 antitrypsin deficiency

    MedlinePlus

    ... and genetic modifiers of emphysema risk. Thorax. 2004 Mar;59(3):259-64. Review. Citation on PubMed ... alpha}1-antitrypsin deficiency. Arch Intern Med. 2009 Mar 23;169(6):546-50. doi: 10.1001/ ...

  16. Nuclear diagnostic for fast alpha particles

    DOEpatents

    Grisham, L.R.; Post, D.E. Jr.; Dawson, J.M.

    1983-11-23

    This invention relates generally to high energy confined plasmas and more particularly is directed to measuring the velocity distribution of confined energetic alpha particles resulting from deuterium-tritium fusion reactions in a confined energetic plasma.

  17. [Multiplex PCR for detecting genotypes of deletional alpha-thalassemia].

    PubMed

    Wu, Jie-Ying; Liao, Can; Li, Jian; Huang, Yi-Ning

    2004-08-01

    To investigate the clinical application of multiplex PCR in detecting genotypes of deletional alpha-thalassemia in South China and observe the distribution frequency of alpha-globin gene deletion, 145 patients with silent carrier, alpha thalassemia trait or HbH were identified by M-PCR and 1.2% agarose gel electrophoresis. There are 1.3, 1.6, 1.8 and 2.0 kb bands which indicate --(SEA), -alpha(4.2), alphaalpha and -alpha(3.7), respectively. The results showed that among 145 patients, 100 patients with --(SEA)/alphaalpha (68.9%), 15 with -alpha(3.7)/alphaalpha (10.3%), 8 with -alpha(4.2)/alphaalpha (5.52%), 2 with -alpha(3.7)/-alpha(4.2) (1.38%), 1 with -alpha(3.7)/-alpha(3.7) (0.69%), 1 with -alpha(4.2)/-alpha(4.2) (0.69%), 14 with --(SEA)/-alpha(3.7) (9.65%), 2 with --(SEA)/-alpha(4.2) (1.38%) were found. Two patients prenatal diagnosed were confirmed with Bart's hydrops fetuses. In conclusion, M-PCR analysis is a simple, rapid and accurate method for detection of alpha-thalassemia gene deletion. This technique is helpful in screening, carrier identification and prenatal diagnosis of deletional alpha-thalassemia.

  18. Analytical aerodynamic model of a high alpha research vehicle wind-tunnel model

    NASA Technical Reports Server (NTRS)

    Cao, Jichang; Garrett, Frederick, Jr.; Hoffman, Eric; Stalford, Harold

    1990-01-01

    A 6 DOF analytical aerodynamic model of a high alpha research vehicle is derived. The derivation is based on wind-tunnel model data valid in the altitude-Mach flight envelope centered at 15,000 ft altitude and 0.6 Mach number with Mach range between 0.3 and 0.9. The analytical models of the aerodynamics coefficients are nonlinear functions of alpha with all control variable and other states fixed. Interpolation is required between the parameterized nonlinear functions. The lift and pitching moment coefficients have unsteady flow parts due to the time range of change of angle-of-attack (alpha dot). The analytical models are plotted and compared with their corresponding wind-tunnel data. Piloted simulated maneuvers of the wind-tunnel model are used to evaluate the analytical model. The maneuvers considered are pitch-ups, 360 degree loaded and unloaded rolls, turn reversals, split S's, and level turns. The evaluation finds that (1) the analytical model is a good representation at Mach 0.6, (2) the longitudinal part is good for the Mach range 0.3 to 0.9, and (3) the lateral part is good for Mach numbers between 0.6 and 0.9. The computer simulations show that the storage requirement of the analytical model is about one tenth that of the wind-tunnel model and it runs twice as fast.

  19. Photoluminescence detection of alpha particle using DAM-ADC nuclear detector

    NASA Astrophysics Data System (ADS)

    Abdalla, Ayman M.; Harraz, Farid A.; Ali, Atif M.; Al-Sayari, S. A.; Al-Hajry, A.

    2016-09-01

    The photoluminescence (PL) and UV-vis spectral analysis of DAM-ADC (diallyl maleate: DAM, polyallyl diglycol carbonate: ADC) nuclear detector are demonstrated for the first time. The DAM-ADC surfaces were exposed to thin 241Am disk source that emits alpha particles with activity 333 kBq. It is found that the track density of the irradiated samples remarkably influences the PL characteristics of the DAM-ADC detector. The spectral peak heights and the integrated intensities under the peaks exhibit linear correlations with correlation coefficient R2=0.9636 and 0.9806, respectively for different alpha particle fluences ranging from 8.16-40.82×107 particles/cm2. Additionally, a correlation coefficient R2=0.9734 was achieved for the UV-vis spectral analysis. The linear fitting functions, along with the corresponding fitting parameters were evaluated in each case. Both the PL and the UV-vis data of the irradiated DAM-ADC samples showed considerable spectral differences, and hence they would be used to offer sensitive approaches for alpha particle detection.

  20. The ALPHA Experiment: A Cold Antihydrogen Trap

    SciTech Connect

    Bertsche, W.; Chapman, S.; Deutsch, A.; Fajans, J.; Gomberoff, K.; Wurtele, J.; Boston, A.; Chartier, M.; Nolan, P.; Page, R.D.; Bowe, P.D.; Hangst, J.S.; Madsen, N.; Cesar, C.L.; Miranda, D.; Charlton, M.; Jenkins, M.; Joergensen, L.V.; Telle, H.H.; Werf, D.P. van der

    2005-10-26

    The ALPHA experiment aims to trap antihydrogen as the next crucial step towards a precise CPT test, by a spectroscopic comparison of antihydrogen with hydrogen. The experiment will retain the salient techniques developed by the ATHENA collaboration during the previous phase of antihydrogen experiments at the antiproton decelerator (AD) at CERN. The collaboration has identified the key problems in adding a neutral antiatom trap to the previously developed experimental configuration. The solutions identified by ALPHA are described in this paper.

  1. Transport of Radioactive Material by Alpha Recoil

    SciTech Connect

    Icenhour, A.S.

    2005-05-19

    The movement of high-specific-activity radioactive particles (i.e., alpha recoil) has been observed and studied since the early 1900s. These studies have been motivated by concerns about containment of radioactivity and the protection of human health. Additionally, studies have investigated the potential advantage of alpha recoil to effect separations of various isotopes. This report provides a review of the observations and results of a number of the studies.

  2. Measurement of the angle alpha at BABAR

    SciTech Connect

    Perez, A.; /Orsay, LAL

    2009-06-25

    The authors present recent measurements of the CKM angle {alpha} using data collected by the BABAR detector at the PEP-II asymmetric-energy e{sup +}e{sup -} collider at the SLAC National Accelerator Laboratory, operating at the {Upsilon}(4S) resonance. They present constraints on {alpha} from B {yields} {pi}{pi}, B {yields} {rho}{rho} and B {yields} {rho}{pi} decays.

  3. Alpha-emitters for medical therapy workshop

    SciTech Connect

    Feinendegen, L.E.; McClure, J.J.

    1996-12-31

    A workshop on ``Alpha-Emitters for Medical Therapy`` was held May 30-31, 1996 in Denver Colorado to identify research goals and potential clinical needs for applying alpha-particle emitters and to provide DOE with sufficient information for future planning. The workshop was attended by 36 participants representing radiooncology, nuclear medicine, immunotherapy, radiobiology, molecular biology, biochemistry, radiopharmaceutical chemistry, dosimetry, and physics. This report provides a summary of the key points and recommendations arrived at during the conference.

  4. Different polyphenolic components of soft fruits inhibit alpha-amylase and alpha-glucosidase.

    PubMed

    McDougall, Gordon J; Shpiro, Faina; Dobson, Patricia; Smith, Pauline; Blake, Alison; Stewart, Derek

    2005-04-01

    Polyphenol-rich extracts from soft fruits were tested for their ability to inhibit alpha-amylase and alpha-glucosidase. All extracts tested caused some inhibition of alpha-amylase, but there was a 10-fold difference between the least and most effective extracts. Strawberry and raspberry extracts were more effective alpha-amylase inhibitors than blueberry, blackcurrant, or red cabbage. Conversely, alpha-glucosidase was more readily inhibited by blueberry and blackcurrant extracts. The extent of inhibition of alpha-glucosidase was related to their anthocyanin content. For example, blueberry and blackcurrant extracts, which have the highest anthocyanin content, were the most effective inhibitors of alpha-glucosidase. The extracts most effective in inhibiting alpha-amylase (strawberry and raspberry) contain appreciable amounts of soluble tannins. Other tannin-rich extracts (red grape, red wine, and green tea) were also effective inhibitors of alpha-amylase. Indeed, removing tannins from strawberry extracts with gelatin also removed inhibition. Fractionation of raspberry extracts on Sephadex LH-20 produced an unbound fraction enriched in anthocyanins and a bound fraction enriched in tannin-like polyphenols. The unbound anthocyanin-enriched fraction was more effective against alpha-glucosidase than the original extract, whereas the alpha-amylase inhibitors were concentrated in the bound fraction. The LH-20 bound sample was separated by preparative HPLC, and fractions were assayed for inhibition of alpha-amylase. The inhibitory components were identified as ellagitannins using LC-MS-MS. This study suggests that different polyphenolic components of fruits may influence different steps in starch digestion in a synergistic manner. PMID:15796622

  5. HETDEX: Evolution of Lyman Alpha Emitters

    NASA Astrophysics Data System (ADS)

    Blanc, Guillermo A.; Gebhardt, K.; Hill, G. J.; Gronwall, C.; Ciardullo, R.; Finkelstein, S.; Gawiser, E.; HETDEX Collaboration

    2012-01-01

    The Hobby Eberly Telescope Dark Energy Experiment (HETDEX) will produce a sample of 800,000 Lyman Alpha Emitters (LAEs) over the 1.9Alpha photon escape fraction. Our results show a strong evolution in the Lyman Alpha escape fraction with redshift, most likely associated with the buildup of dust in the ISM. Dust is shown to be the main parameter setting the escape of Lyman Alpha photons. The observed relation between E(B-V) and the escape fraction indicates that radiative transfer effects in LAEs promote the escape of Lyman Alpha photons, but only up to the point of them suffering similar amounts of extinction as continuum photons. Enhancement of the Lyman Alpha EW (e.g. due to the presence of a clumpy medium) seems not to be a common process in these objects. We also discuss the potential of the full HETDEX sample to study the evolution of LAE properties.

  6. Alpha-dispersion in human tissue

    NASA Astrophysics Data System (ADS)

    Grimnes, Sverre; Martinsen, Ørjan G.

    2010-04-01

    Beta dispersion is found in living tissue in the kilohertz - megahertz range and is caused by the cellular structure of biological materials with low frequency properties caused by cell membranes. Alpha dispersion is found in the hertz range and the causes are not so well known. Alpha dispersions are the first to disappear when tissue dies. Tissue data have often been based upon excised specimen from animals and are therefore not necessarily representative for human tissue alpha dispersions. Here we present data obtained with non-invasive skin surface electrodes for different segments of the living human body. We found alpha dispersions in all cases; the ankle-wrist results had the smallest. Large alpha dispersions were found where the distance between the electrodes and muscle masses was small, e.g. on the calf. Further studies on electrode technique and reciprocity, electrode positioning, statistical variations, gender, age and bodily constitutions are necessary in order to reveal more about the alpha dispersion, its appearance and disappearance.

  7. [Alpha-1 antitrypsin deficiency: diagnosis and treatment].

    PubMed

    Camelier, Aquiles A; Winter, Daniel Hugo; Jardim, José Roberto; Barboza, Carlos Eduardo Galvão; Cukier, Alberto; Miravitlles, Marc

    2008-07-01

    Alpha-1 antitrypsin deficiency is a recently identified genetic disease that occurs almost as frequently as cystic fibrosis. It is caused by various mutations in the SERPINA1 gene, and has numerous clinical implications. Alpha-1 antitrypsin is mainly produced in the liver and acts as an antiprotease. Its principal function is to inactivate neutrophil elastase, preventing tissue damage. The mutation most commonly associated with the clinical disease is the Z allele, which causes polymerization and accumulation within hepatocytes. The accumulation of and the consequent reduction in the serum levels of alpha-1 antitrypsin cause, respectively, liver and lung disease, the latter occurring mainly as early emphysema, predominantly in the lung bases. Diagnosis involves detection of low serum levels of alpha-1 antitrypsin as well as phenotypic confirmation. In addition to the standard treatment of chronic obstructive pulmonary disease, specific therapy consisting of infusion of purified alpha-1 antitrypsin is currently available. The clinical efficacy of this therapy, which appears to be safe, has yet to be definitively established, and its cost-effectiveness is also a controversial issue that is rarely addressed. Despite its importance, in Brazil, there are no epidemiological data on the prevalence of the disease or the frequency of occurrence of deficiency alleles. Underdiagnosis has also been a significant limitation to the study of the disease as well as to appropriate treatment of patients. It is hoped that the creation of the Alpha One International Registry will resolve these and other important issues. PMID:18695797

  8. Alpha particle analysis using PEARLS spectrometry

    SciTech Connect

    McKlveen, J.W.; Klingler, G.W.; McDowell, W.J.; Case, G.N.

    1984-01-01

    Alpha particle assay by conventional plate-counting methods is difficult because chemical separation, tracer techniques, and/or self-absorption losses in the final sample may cause either non-reproducible results or create unacceptable errors. PEARLS (Photon-Electron Rejecting Alpha Liquid Scintillation) Spectrometry is an attractive alternative since radionuclides may be extracted into a scintillator in which there would be no self-absorption or geometry problems and in which up to 100% chemical recovery and counting efficiency is possible. Sample preparation may include extraction of the alpha emitter of interest by a specific organic-phase-soluble compound directly into the liquid scintillator. Detection electronics use energy and pulse-shape discrimination to provide discrete alpha spectra and virtual absence of beta and gamma backgrounds. Backgrounds on the order of 0.01 cpm are readily achievable. Accuracy and reproducibility are typically in the 100 +-1% range. Specific procedures have been developed for gross alpha, uranium, plutonium, thorium, and polonium assay. This paper will review liquid scintillation alpha counting methods and reference some of the specific applications. 8 refs., 1 fig.

  9. ANALYTIC FORMS OF THE PERPENDICULAR DIFFUSION COEFFICIENT IN NRMHD TURBULENCE

    SciTech Connect

    Shalchi, A.

    2015-02-01

    In the past different analytic limits for the perpendicular diffusion coefficient of energetic particles interacting with magnetic turbulence were discussed. These different limits or cases correspond to different transport modes describing how the particles are diffusing across the large-scale magnetic field. In the current paper we describe a new transport regime by considering the model of noisy reduced magnetohydrodynamic turbulence. We derive different analytic forms of the perpendicular diffusion coefficient, and while we do this, we focus on the aforementioned new transport mode. We show that for this turbulence model a small perpendicular diffusion coefficient can be obtained so that the latter diffusion coefficient is more than hundred times smaller than the parallel diffusion coefficient. This result is relevant to explain observations in the solar system where such small perpendicular diffusion coefficients have been reported.

  10. Personal dose-equivalent conversion coefficients for 1252 radionuclides.

    PubMed

    Otto, Thomas

    2016-01-01

    Dose conversion coefficients for radionuclides are useful for routine calculations in radiation protection in industry, medicine and research. They give a simple and often sufficient estimate of dose rates during production, handling and storage of radionuclide sources, based solely on the source's activity. The latest compilation of such conversion coefficients dates from 20 y ago, based on nuclear decay data published 30 y ago. The present publication provides radionuclide-specific conversion coefficients to personal dose based on the most recent evaluations of nuclear decay data for 1252 radionuclides and fluence-to-dose-equivalent conversion coefficients for monoenergetic radiations. It contains previously unknown conversion coefficients for >400 nuclides and corrects those conversion coefficients that were based on erroneous decay schemes. For the first time, estimates for the protection quantity Hp(3) are included.

  11. Enzymic conversion of alpha-oxyprotohaem IX into biliverdin IX alpha by haem oxygenase.

    PubMed Central

    Yoshinaga, T; Sudo, Y; Sano, S

    1990-01-01

    Conversion of four isomers of meso-oxyprotohaem IX into the corresponding biliverdin IX was attempted with a reconstituted haem oxygenase system in the presence of NADPH-cytochrome c reductase and NADPH. Only the alpha-isomer of meso-oxyprotohaem IX was converted effectively into biliverdin IX alpha, which was further reduced to bilirubin IX alpha by biliverdin reductase. Only trace amounts of biliverdins IX beta, IX gamma and IX delta were respectively formed from the incubation mixture of the corresponding oxyprotohaemin IX isomers with the complete haem oxygenase system under the same conditions. In a kinetic study, the Km for alpha-meso-oxyprotohaem IX was 3.6 microM, which was 2-fold higher than that for protohaem IX. The maximum velocity (Vmax.) of the conversion of alpha-meso-oxyprotohaem IX into biliverdin IX alpha was twice as fast as that of protohaem IX. These results demonstrate that alpha-meso-oxyprotohaem IX is an intermediate of haem degradation and it was converted stereospecifically into biliverdin IX alpha via verdohaem IX alpha. PMID:2122884

  12. Assembly of an alpha-gamma coincidence measuring device for checking alpha decay schemes.

    PubMed

    Martín Sánchez, A; Caro Marroyo, B

    2012-09-01

    Two new chambers for measuring alpha-particle emissions have been made: a low-geometry chamber with a powerful magnet to eliminate conversion electrons, and an alpha-gamma coincidence chamber. Both devices incorporate a high-resolution Si detector, and the second chamber, a low-energy Ge detector as well. A dual parameter multichannel analyzer was used to register coincidences in the second device. Alpha-particle and gamma-ray detectors work simultaneously in both individual and dual modes, providing single and coincidence spectra. Some preliminary alpha-gamma coincidence spectra have been obtained.

  13. Methods for the synthesis and polymerization of .alpha.,.alpha.'-dihalo-p-xylenes

    DOEpatents

    Ferraris, John P.; Neef, Charles J.

    2002-07-30

    The present invention describes an improved method for the polymerization of .alpha.,.alpha.-dihalo-p-xylene's such as the .alpha.,.alpha.'-dihalo-2-methoxy-5-(2-ethylhexyloxy)-xylene's. The procedure for synthesis is based on the specific order of addition of reagents and the use of an anionic initiator that allows control of the molecular weight of the polymer. The molecular weight control allows processability of the polymer which is important for its utility in applications including in light-emitting-diodes, field effect transistors and photovoltaic devices.

  14. Two renal. cap alpha. /sub 2/-adrenergic receptor sites revealed by of-aminoclonidine binding

    SciTech Connect

    Sripanidkulchai, B.; Dawson, R.; Oparil, S.; Wyss, J.M.

    1987-02-01

    (/sup 3/H)p-aminoclonidine (/sup 3/H)PAC, a specific ..cap alpha../sub 2/-adrenergic agonist, was used to characterize ..cap alpha../sub 2/-adrenoceptor binding in rat renal membranes. Rosenthal plots demonstrated two binding sites with K/sub dS/ of approx. 1.7 and 14.2 nM and B/sub max/S (maximum binding) of 47.3 and 218.8 fmol/mg protein for the high- and low-affinity sites, respectively. These characteristics were confirmed by estimate of K/sub d/ parameters based on association and dissociation experiments. Pseudo-Hill coefficients generated from drug inhibition experiments were all less than unity, suggesting differential binding at two ..cap alpha../sub 2/-adrenoceptor binding sites. Specific ..cap alpha../sub 2/-adrenergic agonists exhibited greater binding affinity to both sites than did nonspecific drugs, and all drugs displayed greater affinity for the high- than the low-affinity binding site. Both guanyl nucleotides and sodium chloride inhibited (/sup 3/H)PAC binding more at the high-affinity than at the low-affinity site. Renal denervation resulted in significant upregulation of receptor density only at the high-affinity sites with no change in receptor affinity at either site, suggesting that a majority of the ..cap alpha../sub 2/-adrenoceptors in the kidney are postsynaptic. Thus all lines of evidence in this study indicate that two ..cap alpha../sub 2/-adrenoceptor binding sites exist in the rat kidney.

  15. Formation Mechanism of alpha-Fe2O3 Nanotubes via Electrospinning and Their Adsorption Characteristics of BSA and DNA.

    PubMed

    Liu, Ruijiang; Wang, Peng; Tao, Yuting; Liu, Yifan; Shen, Xiangqian

    2016-02-01

    The alpha-Fe2O3 nanotubes with diameters of 400-700 nm have been prepared via the sol-gel assisted electrospinning and subsequent one-step heat treatment with ferric nitrate, ethanol and poly(vinyl pyrrolidone) as starting regents. The resultant alpha-Fe2O3 nanotubes were characterized by XRD, SEM, TEM, and VSM techniques. The hollow structure is mainly influenced by the water content in the gel precursor and the heating rate, and the hollow formation mechanism of alpha-Fe2O9 nanotubes is discussed. Adsorption of BSA onto the as-prepared alpha-Fe2O3 nanotubes exhibits a good capacity of 56.5 mg/g with the initial BSA concentration of 1.0 mg/mL, which demonstrates their feasibility in delivery of biomacromolecules. Subsequently, the adsorption characteristics of DNA onto the alpha-Fe2O3 nanotubes were investigated, and the adsorbance of DNA can achieve a maximum value of 4.19 microg/g when the initial DNA concentration is 50 microg/mL. The adsorption process of DNA onto alpha-Fe2O3 nanotubes can be described well by the pseudo-first-order kinetic model at room temperature according to the correlation coefficient R2 = 0.9978. PMID:27433591

  16. Formation Mechanism of alpha-Fe2O3 Nanotubes via Electrospinning and Their Adsorption Characteristics of BSA and DNA.

    PubMed

    Liu, Ruijiang; Wang, Peng; Tao, Yuting; Liu, Yifan; Shen, Xiangqian

    2016-02-01

    The alpha-Fe2O3 nanotubes with diameters of 400-700 nm have been prepared via the sol-gel assisted electrospinning and subsequent one-step heat treatment with ferric nitrate, ethanol and poly(vinyl pyrrolidone) as starting regents. The resultant alpha-Fe2O3 nanotubes were characterized by XRD, SEM, TEM, and VSM techniques. The hollow structure is mainly influenced by the water content in the gel precursor and the heating rate, and the hollow formation mechanism of alpha-Fe2O9 nanotubes is discussed. Adsorption of BSA onto the as-prepared alpha-Fe2O3 nanotubes exhibits a good capacity of 56.5 mg/g with the initial BSA concentration of 1.0 mg/mL, which demonstrates their feasibility in delivery of biomacromolecules. Subsequently, the adsorption characteristics of DNA onto the alpha-Fe2O3 nanotubes were investigated, and the adsorbance of DNA can achieve a maximum value of 4.19 microg/g when the initial DNA concentration is 50 microg/mL. The adsorption process of DNA onto alpha-Fe2O3 nanotubes can be described well by the pseudo-first-order kinetic model at room temperature according to the correlation coefficient R2 = 0.9978.

  17. PAC91 - PROPERTIES AND COEFFICIENTS 1991

    NASA Technical Reports Server (NTRS)

    Mcbride, B. J.

    1994-01-01

    The two principal functions of PAC91 are to provide a means of generating theoretical thermodynamic functions from molecular constant data and to supply a means of fitting these functions to empirical equations by using a least-squares fit. The coefficients obtained from the fit may then be used to generate a library of thermodynamic data in a uniform and easy-to-use format for use in other computer codes. Several large compilations of selected or calculated thermodynamic data currently exist. Nevertheless, there is a continuing need for additional calculations due to the discovery of new species, the revision of existing molecular constant data and structural parameters, the need for data at temperatures other than those already published, the availability of new or revised heats of formation, dissociation or transition, and the revision of fundamental constants or atomic weights. Calculations may also be needed to compare the results of assuming various possible forms of the partition function. In addition, there is often a preference for thermodynamic data in functional rather than tabular form. In order to satisfy these needs, the PAC91 program can perform any combination of the following: (1) calculate thermodynamic functions (heat capacity, enthalpy, entropy, and Gibbs energy) for any set of 1 to 202 temperatures, (2) obtain a least-squares fit of the first three of these functions (either individually, two at a time, or all three simultaneously) for up to eight temperature intervals, and (3) calculate, as a function of temperature, heats of formation and equilibrium constants from assigned reference elements. The thermodynamic functions for ideal gases may be calculated from molecular constant data using one of several partition function variations provided by the program. For monatomic gases, one of three partition function cutoff techniques may be selected by the user, and unobserved but predicted electronic energy levels may be included by the program

  18. Aerosol Angstrom Absorption Coefficient Comparisons during MILAGRO.

    NASA Astrophysics Data System (ADS)

    Marley, N. A.; Marchany-Rivera, A.; Kelley, K. L.; Mangu, A.; Gaffney, J. S.

    2007-12-01

    aerosol Angstrom absorption exponents by linear regression over the entire UV-visible spectral range. These results are compared to results obtained from the absorbance measurements obtained in the field. The differences in calculated Angstrom absorption exponents between the field and laboratory measurements are attributed partly to the differences in time resolution of the sample collection resulting in heavier particle pileup on the filter surface of the 12-hour samples. Some differences in calculated results can also be attributed to the presence of narrow band absorbers below 400 nm that do not fall in the wavelengths covered by the 7 wavelengths of the aethalometer. 1. Marley, N.A., J.S. Gaffney, J.C. Baird, C.A. Blazer, P.J. Drayton, and J.E. Frederick, "The determination of scattering and absorption coefficients of size-fractionated aerosols for radiative transfer calculations." Aerosol Sci. Technol., 34, 535-549, (2001). This work was conducted as part of the Department of Energy's Atmospheric Science Program as part of the Megacity Aerosol Experiment - Mexico City during MILAGRO. This research was supported by the Office of Science (BER), U.S. Department of Energy Grant No. DE-FG02-07ER64329. We also wish to thank Mexican Scientists and students for their assistance from the Instituto Mexicano de Petroleo (IMP) and CENICA.

  19. Scanning measurement of Seebeck coefficient of a heated sample

    DOEpatents

    Snyder, G. Jeffrey; Iwanaga, Shiho

    2016-04-19

    A novel scanning Seebeck coefficient measurement technique is disclosed utilizing a cold scanning thermocouple probe tip on heated bulk and thin film samples. The system measures variations in the Seebeck coefficient within the samples. The apparatus may be used for two dimensional mapping of the Seebeck coefficient on the bulk and thin film samples. This technique can be utilized for detection of defective regions, as well as phase separations in the sub-mm range of various thermoelectric materials.

  20. Measuring Furnace/Sample Heat-Transfer Coefficients

    NASA Technical Reports Server (NTRS)

    Rosch, William R.; Fripp, Archibald L., Jr.; Debnam, William J., Jr.; Woodell, Glenn A.

    1993-01-01

    Complicated, inexact calculations now unnecessary. Device called HTX used to simulate and measure transfer of heat between directional-solidification crystal-growth furnace and ampoule containing sample of crystalline to be grown. Yields measurement data used to calculate heat-transfer coefficients directly, without need for assumptions or prior knowledge of physical properties of furnace, furnace gas, or specimen. Determines not only total heat-transfer coefficients but also coefficients of transfer of heat in different modes.

  1. DCFPAK: Dose coefficient data file package for Sandia National Laboratory

    SciTech Connect

    Eckerman, K.F.; Leggett, R.W.

    1996-07-31

    The FORTRAN-based computer package DCFPAK (Dose Coefficient File Package) has been developed to provide electronic access to the dose coefficient data files summarized in Federal Guidance Reports 11 and 12. DCFPAK also provides access to standard information regarding decay chains and assembles dose coefficients for all dosimetrically significant radioactive progeny of a specified radionuclide. DCFPAK was designed for application on a PC but, with minor modifications, may be implemented on a UNIX workstation.

  2. Discharge coefficients of impingement and film cooling holes

    NASA Astrophysics Data System (ADS)

    Chu, T.; Brown, A.; Garret, S.

    1985-03-01

    In this article measurements of fluid flow through impingement and film cooling holes for typical turbine blade cooling systems are presented. The purpose of the measurements was to determine hole discharge coefficients over a range of Reynolds numbers from 5,000 to 30,000 and to observe in this range the dependence of discharge coefficient on Reynolds number. The effect of hole geometry, that is, sharp edged inlet or corner radius inlet, on discharge coefficients is also measured. Correlations relating discharge coefficients to Reynolds number, corner radius to hole diameter ratio, and blowing parameter are suggested.

  3. Coefficients of convergent multiple Walsh-Paley series

    SciTech Connect

    Plotnikov, Mikhail G

    2012-09-30

    The paper is concerned with the behaviour of the coefficients of multiple Walsh-Paley series that are cube convergent to a finite sum. It is shown that even an everywhere convergent series of this kind may contain coefficients with numbers from a sufficiently large set that grow faster than any preassigned sequence. By Cohen's theorem, this sort of thing cannot happen for multiple trigonometric series that are cube convergent on a set of full measure - their coefficients cannot grow even exponentially. Null subsequences of coefficients are determined for multiple Walsh-Paley series that are cube convergent on a set of definite measure. Bibliography: 18 titles.

  4. Measurement of the extinction coefficients of magnetic fluids

    PubMed Central

    2011-01-01

    A novel spectral transmittance approach for measuring the extinction coefficient of magnetic fluids is proposed. The measuring principle and accuracy of the approach are analysed. Experiments are conducted to measure the extinction coefficient of magnetic fluids with different particle volume fractions. The relative uncertainty of experimental data is less than 1.8%. The experimental results indicate that the extinction coefficient of magnetic fluids increases with increase of the volume fraction of suspended magnetic nanoparticles and the optical properties of the particle material have a significant effect on the extinction coefficient of the magnetic fluids. PMID:21711742

  5. Heat transfer coefficients for drying in pulsating flows

    SciTech Connect

    Fraenkel, S.L.

    1998-05-01

    Pulsating flows generated by a Rijke type combustor are studied for drying of grains and food particles. It is assumed that the velocity fluctuations are the main factor in the enhancement of the drying process. The heat transfer coefficients for drying in vibrating beds are utilized to estimate the heat transfer coefficients of fixed beds in pulsating and permeating flows and are compared to the steady flow heat transfer coefficients obtained for solid porous bodies, after perturbing the main flow. The cases considered are compared to the convective heat transfer coefficients employed in non-pulsating drying.

  6. Diffusion coefficient of three-dimensional Yukawa liquids

    SciTech Connect

    Dzhumagulova, K. N.; Ramazanov, T. S.; Masheeva, R. U.

    2013-11-15

    The purpose of this work is an investigation of the diffusion coefficient of the dust component in complex plasma. The computer simulation of the Yukawa liquids was made on the basis of the Langevin equation, which takes into account the influence of buffer plasma on the dust particles dynamics. The Green–Kubo relation was used to calculate the diffusion coefficient. Calculations of the diffusion coefficient for a wide range of the system parameters were performed. Using obtained numerical data, we constructed the interpolation formula for the diffusion coefficient. We also show that the interpolation formula correctly describes experimental data obtained under microgravity conditions.

  7. Repeatability study of mechanomyography in submaximal isometric contractions using coefficient of variation and intraclass correlation coefficient.

    PubMed

    Akataki, K; Mita, K; Itoh, Y

    1999-01-01

    The within-day and between-day repeatability of the mechanomyogram (MMG) was assessed using the coefficient of variation (CV) and the intraclass correlation coefficient (ICC) and was compared with that of the electromyogram (EMG). The MMG and EMG were recorded simultaneously during isometric elbow flexion trials at different submaximal levels of 10% to 90% MVC. The testing session consisting of 9 submaximal trials was repeated 8 times on the same day for estimation of the within-day variation. In order to examine the between-day variation, the same testing session was also performed 8 times over 3 weeks with a 2-day rest interval between each session. The CVs within-day and between-day in both the MMG and EMG did not demonstrate any significant differences relating to the magnitude of force exerted. The CVs combined over all the force levels were approximately 10% within the same day and 25% between days for both the MMG and EMG. These corresponded to the within-day ICC of approximately 0.95 and the between-day ICC of 0.80. The repeatability of the MMG during submaximal isometric contractions of biceps brachii muscles is considered to be similar to that of the more established EMG.

  8. Improvement of alpha-L: -arabinofuranosidase production by Talaromyces thermophilus and agro-industrial residues saccharification.

    PubMed

    Guerfali, Mohamed; Chaabouni, Moncef; Gargouri, Ali; Belghith, Hafedh

    2010-02-01

    This study is an application of an experimental design methodology for the optimization of the culture conditions of alpha-L: -arabinofuranosidase production by Talaromyces thermophilus. Wheat bran and yeast extract were first selected as the best carbon and nitrogen sources, respectively, for enzyme production. A Plackett-Burman design was then used to evaluate the effects of eight variables. Statistical analyses showed that while pH had a negative effect on alpha-L: -arabinofuranosidase production, wheat bran and MgSO(4) had a significantly positive effect. The values of the latter three parameters were further optimised using a central composite design and a response surface methodology. The experimental results were fitted to a second-order polynomial model that yielded a determination coefficient of R(2) = 0.91. The statistical output showed that the linear and quadric terms of the three variables had significant effects. Using optimal conditions, the experimental value of alpha-L: -arabinofuranosidase activity produced was very close to the model-predicted value. The optimal temperature and pH of enzyme activity were 55 degrees C and 7.0, respectively. This enzyme was very stable over a considerable pH range from 4 to 9. The crude enzyme of T. thermophilus rich in alpha-L: -arabinofuranosidase was also used for saccharification of lignocellulosic materials and arabinose production.

  9. Raw materials influence the alpha-particle emission rate of AlN

    SciTech Connect

    Fawcett, T.G.; Knudsen, A.K.; Guiton, T.A.; Quinn, T.J. III; Mills, L.K.; Dunmead, S.D.; Rigot, W.L.; Wijeyesekera, S.D.

    1996-10-01

    Most electronic devices are packaged in plastic, generally epoxy-based molding compounds. Organic compounds serve as effective barriers for alpha particles. However, sensitive or thermally stressed devices often must be packaged in ceramic packages, including Al{sub 2}O{sub 3}, glass ceramics, BeO and AlN. Therefore, the concentration of alpha-particle-generating elements and the tendency of the material to induce soft errors in the device must be considered when selecting a ceramic package option. AlN is a relatively new packaging material. It offers high thermal conductivity ({ge}170 W/(m{center_dot}K)), dielectric and mechanical properties comparable to Al{sub 2}O{sub 3} and a coefficient of thermal expansion similar to silicon. AlN substrates and packages are produced via pressureless sintering or hot pressing, using high-purity powders and sintering aids, generally alkaline- and/or rare-earth oxides. The concentration of alpha-particle-emitting elements in AlN ceramics depends on the concentration of these elements in the AlN and additive powders. In the present work, the concentration of alpha-particle-generating elements uranium and thorium in AlN powders is shown to be related to the levels of these elements in the raw materials used in AlN powder synthesis.

  10. Overview Of Suborbital Human Transportation Concept Alpha

    NASA Astrophysics Data System (ADS)

    Adirim, H.; Pilz, N.; Marini, M.; Hendrick, P.; Schmid, M.; Behr, R.; Barth, T.; Tarfeld, F.; Wiegand, A.; Charbonnier, D.; Haya Ramos, R.; Steeland, J.; Mack, A.

    2011-05-01

    Within the EC co-funded project FAST20XX (Future high-Altitude high-Speed Transport 20XX), the European suborbital passenger transportation system concept ALPHA (Airplane Launched PHoenix Aircraft), which shall be based to a maximum extent on existing technologies and capabilities, is currently being investigated as collaborative project by a European consortium under coordination of ESA. The ALPHA concept incorporates an air-launch from a carrier aircraft, which shall be used as first stage. The ALPHA vehicle shall be capable of transporting up to four passengers plus one pilot to an altitude of at least 100 km. The ALPHA vehicle is a down-scaled version of the suborbital space transportation concept Hopper, which was already deeply investigated within the European FESTIP System Study and the German ASTRA program including the successfully flown experimental landing demonstrator Phoenix. This approach has allowed the use of existing aerodynamic vehicle data and has led to the adaptation of the external Hopper/Phoenix configuration for ALPHA. In FESTIP and ASTRA, the Hopper configuration showed sufficient stability margins. Due to the geometric similarity of the ALPHA and Hopper vehicles, a trimable and flyable configuration could be derived by means of ALPHA flight trajectory calculations. In its current configuration, the ALPHA vehicle has a length of ca. 9 m and a gross take-off mass of ca. 3.5 Mg. The launch, staging and separation of ALPHA shall be performed either as internal air-launch from the cargo bay of the carrier aircraft, as under-wing air-launch or as towed air-launch. After separation from the carrier aircraft, the ALPHA vehicle ignites its onboard rocket propulsion system. Since conventional liquid and solid propulsion did not seem suitable for ALPHA due to Their high cost, limited safety and toxicity, a low-cost, “green” and non-hazardous hybrid propulsion system based on liquid nitrous oxide in combination with a solid polymer fuel was

  11. Recent advances in the discovery of alpha1-adrenoceptor agonists.

    PubMed

    Bishop, Michael J

    2007-01-01

    The alpha(1) adrenoceptors are three of nine well-characterized receptors that are activated by epinephrine and norepinephrine. Agonists acting at the alpha(1) adrenoceptors produce numerous physiological effects, and are used therapeutically for several indications. Many known alpha(1) adrenoceptor agonists are alpha(1A) selective, but the discovery of highly selective alpha(1B) and alpha(1D) adrenoceptor agonists has proven to be an extremely difficult goal to achieve. This review will focus on recent advances in the discovery, development and clinical utility of subtype-specific alpha(1) agonists as well as contributions to our understanding of agonist-receptor interactions.

  12. Binary-YORP Coefficients for Known Asteroid Shapes

    NASA Astrophysics Data System (ADS)

    McMahon, Jay W.; Scheeres, D. J.

    2012-10-01

    The binary YORP (bYORP) effect has been hypothesized to be a significant factor in the evolution of near-Earth binary asteroid systems (Cuk and Burns, Icarus, v.176, pp.418-431, 2005; McMahon and Scheeres, CMDA, v.106, pp.261-300, 2010). However, understanding of the coefficient values for realistic asteroid shapes is lacking due to the small number of shape models available for the generally smaller secondary asteroids. Until now, we have only calculated the coefficients based on the shape of 1999 KW4 Beta, although various studies by other authors have computed coefficients for artificially generated asteroids based on Gaussian Spheres and some shape models without self-shadowing (Steinberg and Sari, The Astronomical Journal, v.141, pp.55-64, 2011). We also scaled the 1999 KW4 Beta coefficients to other binary systems with no knowledge of the other systems' secondary shapes in order to make evolutionary predictions (McMahon and Scheeres, Icarus Vol. 209, pp 494-509, 2010). In this study, we compute the bYORP coefficient for a range of asteroid shapes, using these as a stand-in for actual secondaries. This allows us to circumvent the lack of information on binary asteroid secondaries and to develop a richer database of realistic coefficients. While this approach may miss some key features of binary secondaries, at the least it provides some statistics on the expected variability of the bYORP coefficient. We analyze all available asteroid shape models on the PDS-SBN, including radar-based shape models and models estimated from past spacecraft missions. The coefficients are computed with an updated algorithm that includes the effects of self-shadowing. We also present the coefficients for perturbed versions of the available shape models, which give effective error bars to the computed coefficients due to inexact shape models. Finally, we discuss the dynamical implications of the derived bYORP coefficients on binary asteroid evolution.

  13. Pharmacologic specificity of alpha-2 adrenergic receptor subtypes

    SciTech Connect

    Petrash, A.; Bylund, D.

    1986-03-01

    The authors have defined alpha-2 adrenergic receptor subtypes in human and rat tissues using prazosin as a subtype selective drug. Prazosin has a lower affinity (250 nM) at alpha-2A receptor and a higher affinity (5 nM) at alpha-2B receptors. In order to determine if other adrenergic drugs are selective for one or the other subtypes, the authors performed (/sup 3/H)yohimbine inhibition experiments with various adrenergic drugs in tissues containing alpha-2A, alpha-2B or both subtypes. Oxymetazoline, WB4101 and yohimbine were found to be 80-, 20- and 10-fold more potent at alpha-2A receptors than at alpha-2B receptors. Phentolamine, adazoxan, (+)- and (-)-mianserin, clonidine, (+)-butaclamol, (-)- and (+)-norepinephrine, epinephrine, dopamine and thioridazine were found to have equal affinities for the two subtypes. These results further validate the subdivision of alpha-2 adrenergic receptors into alpha-2A and alpha-2B subtypes.

  14. Cancer radioimmunotherapy with alpha-emitting nuclides.

    PubMed

    Couturier, Olivier; Supiot, Stéphane; Degraef-Mougin, Marie; Faivre-Chauvet, Alain; Carlier, Thomas; Chatal, Jean-François; Davodeau, François; Cherel, Michel

    2005-05-01

    In lymphoid malignancies and in certain solid cancers such as medullary thyroid carcinoma, somewhat mixed success has been achieved when applying radioimmunotherapy (RIT) with beta-emitters for the treatment of refractory cases. The development of novel RIT with alpha-emitters has created new opportunities and theoretical advantages due to the high linear energy transfer (LET) and the short path length in biological tissue of alpha-particles. These physical properties offer the prospect of achieving selective tumoural cell killing. Thus, RIT with alpha-emitters appears particularly suited for the elimination of circulating single cells or cell clusters or for the treatment of micrometastases at an early stage. However, to avoid non-specific irradiation of healthy tissues, it is necessary to identify accessible tumoural targets easily and rapidly. For this purpose, a small number of alpha-emitters have been investigated, among which only a few have been used for in vivo preclinical studies. Another problem is the availability and cost of these radionuclides; for instance, the low cost and the development of a reliable actinium-225/bismuth-213 generator were probably determining elements in the choice of bismuth-213 in the only human trial of RIT with an alpha-emitter. This article reviews the literature concerning monoclonal antibodies radiolabelled with alpha-emitters that have been developed for possible RIT in cancer patients. The principal radio-immunoconjugates are considered, starting with physical and chemical properties of alpha-emitters, their mode of production, the possibilities and difficulties of labelling, in vitro studies and finally, when available, in vivo preclinical and clinical studies. PMID:15841373

  15. Turbulent transport of MeV range cyclotron heated minorities as compared to alpha particles

    NASA Astrophysics Data System (ADS)

    Pusztai, István; Wilkie, George J.; Kazakov, Yevgen O.; Fülöp, Tünde

    2016-11-01

    We study the turbulent transport of an ion cyclotron resonance heated (ICRH), MeV range minority ion species in tokamak plasmas. Such highly energetic minorities, which can be produced in the three ion minority heating scheme (Kazakov et al (2015) Nucl. Fusion 55 032001), have been proposed to be used to experimentally study the confinement properties of fast ions without the generation of fusion alphas. We compare the turbulent transport properties of ICRH ions with that of fusion born alpha particles. Our theoretical predictions indicate that care must be taken when conclusions are drawn from experimental results: while the effect of turbulence on these particles is similar in terms of transport coefficients, differences in their distribution functions—ultimately their generation processes—make the resulting turbulent fluxes different.

  16. Physically consistent simulation of mesoscale chemical kinetics: The non-negative FIS-{alpha} method

    SciTech Connect

    Dana, Saswati; Raha, Soumyendu

    2011-10-01

    Biochemical pathways involving chemical kinetics in medium concentrations (i.e., at mesoscale) of the reacting molecules can be approximated as chemical Langevin equations (CLE) systems. We address the physically consistent non-negative simulation of the CLE sample paths as well as the issue of non-Lipschitz diffusion coefficients when a species approaches depletion and any stiffness due to faster reactions. The non-negative Fully Implicit Stochastic {alpha} (FIS {alpha}) method in which stopped reaction channels due to depleted reactants are deleted until a reactant concentration rises again, for non-negativity preservation and in which a positive definite Jacobian is maintained to deal with possible stiffness, is proposed and analysed. The method is illustrated with the computation of active Protein Kinase C response in the Protein Kinase C pathway.

  17. Alpha Channeling in Rotating Plasma with Stationary Waves

    SciTech Connect

    A. Fetterman and N.J. Fisch

    2010-02-15

    An extension of the alpha channeling effect to supersonically rotating mirrors shows that the rotation itself can be driven using alpha particle energy. Alpha channeling uses radiofrequency waves to remove alpha particles collisionlessly at low energy. We show that stationary magnetic fields with high nθ can be used for this purpose, and simulations show that a large fraction of the alpha energy can be converted to rotation energy.

  18. Experimental and Theoretical Electron Density Distribution of Alpha,Alpha-Trehalose Dihydrate

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Alpha,alpha-rehalose is of interest because of its cryoprotective and antidessicant properties, and because it possesses various technical anomalies such as 13C NMR spectra that give misleading indications of intramolecular structural symmetry. It is a non-reducing disaccharide, with the glycosidic...

  19. Amyloid formation and disaggregation of {alpha}-synuclein and its tandem repeat ({alpha}-TR)

    SciTech Connect

    Bae, Song Yi; Kim, Seulgi; Hwang, Heejin; Kim, Hyun-Kyung; Yoon, Hyun C.; Kim, Jae Ho; Lee, SangYoon; Kim, T. Doohun

    2010-10-01

    Research highlights: {yields} Formation of the {alpha}-synuclein amyloid fibrils by [BIMbF{sub 3}Im]. {yields} Disaggregation of amyloid fibrils by epigallocatechin gallate (EGCG) and baicalein. {yields} Amyloid formation of {alpha}-synuclein tandem repeat ({alpha}-TR). -- Abstract: The aggregation of {alpha}-synuclein is clearly related to the pathogenesis of Parkinson's disease. Therefore, detailed understanding of the mechanism of fibril formation is highly valuable for the development of clinical treatment and also of the diagnostic tools. Here, we have investigated the interaction of {alpha}-synuclein with ionic liquids by using several biochemical techniques including Thioflavin T assays and transmission electron microscopy (TEM). Our data shows a rapid formation of {alpha}-synuclein amyloid fibrils was stimulated by 1-butyl-3-methylimidazolium bis(trifluoromethylsulfonyl)imide [BIMbF{sub 3}Im], and these fibrils could be disaggregated by polyphenols such as epigallocatechin gallate (EGCG) and baicalein. Furthermore, the effect of [BIMbF{sub 3}Im] on the {alpha}-synuclein tandem repeat ({alpha}-TR) in the aggregation process was studied.

  20. A graphical algorithm for fast computation of identity coefficients and generalized kinship coefficients

    PubMed Central

    Abney, Mark

    2009-01-01

    Summary: Computing the probability of identity by descent sharing among n genes given only the pedigree of those genes is a computationally challenging problem, if n or the pedigree size is large. Here, I present a novel graphical algorithm for efficiently computing all generalized kinship coefficients for n genes. The graphical description transforms the problem from doing many recursion on the pedigree to doing a single traversal of a structure referred to as the kinship graph. Availability: The algorithm is implemented for n = 4 in the software package IdCoefs at http://home.uchicago.edu/abney/Software.html. Contact: abney@bsd.uchicago.edu Supplementary Information:Supplementary data are available at Bioinformatics online. PMID:19359355

  1. Calculation of fusion product angular correlation coefficients for fusion plasmas

    SciTech Connect

    Murphy, T.J.

    1987-08-01

    The angular correlation coefficients for fusion products are calculated in the cases of Maxwellian and beam-target plasmas. Measurement of these coefficients as a localized ion temperature or fast-ion diagnostic is discussed. 8 refs., 7 figs., 1 tab.

  2. Temperature dependence of the diffusion coefficient of nanoparticles

    NASA Astrophysics Data System (ADS)

    Rudyak, V. Ya.; Dubtsov, S. N.; Baklanov, A. M.

    2008-06-01

    The temperature dependence of the diffusion coefficient of nanoparticles in gases has been experimentally studied. It is established that this dependence significantly differs from that predicted by various correlations, in particular, by the Cunningham-Millikan-Davies correlation that is used as an instrumental basis for virtually all methods of measurement of the diffusion coefficient in aerosols.

  3. Amide temperature coefficients in the protein G B1 domain.

    PubMed

    Tomlinson, Jennifer H; Williamson, Mike P

    2012-01-01

    Temperature coefficients have been measured for backbone amide (1)H and (15)N nuclei in the B1 domain of protein G (GB1), using temperatures in the range 283-313 K, and pH values from 2.0 to 9.0. Many nuclei display pH-dependent coefficients, which were fitted to one or two pK(a) values. (1)H coefficients showed the expected behaviour, in that hydrogen-bonded amides have less negative values, but for those amides involved in strong hydrogen bonds in regular secondary structure there is a negative correlation between strength of hydrogen bond and size of temperature coefficient. The best correlation to temperature coefficient is with secondary shift, indicative of a very approximately uniform thermal expansion. The largest pH-dependent changes in coefficient are for amides in loops adjacent to sidechain hydrogen bonds rather than the amides involved directly in hydrogen bonds, indicating that the biggest determinant of the temperature coefficient is temperature-dependent loss of structure, not hydrogen bonding. Amide (15)N coefficients have no clear relationship with structure.

  4. A Simple Geometric Approach to Approximating the Gini Coefficient

    ERIC Educational Resources Information Center

    Kasper, Hirschel; Golden, John

    2008-01-01

    The author shows how a quick approximation of the Lorenz curve's Gini coefficient can be calculated empirically using numerical data presented in cumulative income quintiles. When the technique here was used to estimate 621 income quintile/Gini coefficient observations from the Deninger and Squire/World Bank data set, this approach performed…

  5. Analysis of a heat transfer device for measuring film coefficients

    NASA Technical Reports Server (NTRS)

    Medrow, R. A.; Johnson, R. L.; Loomis, W. R.; Wedeven, L. D.

    1975-01-01

    A heat transfer device consisting of a heated rotating cylinder in a bath was analyzed for its effectiveness to determine heat transfer coefficient of fluids. A time dependent analysis shows that the performance is insensitive to the value of heat transfer coefficient with the given rig configuration.

  6. Micro- and macroscale coefficients of friction of cementitious materials

    SciTech Connect

    Lomboy, Gilson; Sundararajan, Sriram; Wang, Kejin

    2013-12-15

    Millions of metric tons of cementitious materials are produced, transported and used in construction each year. The ease or difficulty of handling cementitious materials is greatly influenced by the material friction properties. In the present study, the coefficients of friction of cementitious materials were measured at the microscale and macroscale. The materials tested were commercially-available Portland cement, Class C fly ash, and ground granulated blast furnace slag. At the microscale, the coefficient of friction was determined from the interaction forces between cementitious particles using an Atomic Force Microscope. At the macroscale, the coefficient of friction was determined from stresses on bulk cementitious materials under direct shear. The study indicated that the microscale coefficient of friction ranged from 0.020 to 0.059, and the macroscale coefficient of friction ranged from 0.56 to 0.75. The fly ash studied had the highest microscale coefficient of friction and the lowest macroscale coefficient of friction. -- Highlights: •Microscale (interparticle) coefficient of friction (COF) was determined with AFM. •Macroscale (bulk) COF was measured under direct shear. •Fly ash had the highest microscale COF and the lowest macroscale COF. •Portland cement against GGBFS had the lowest microscale COF. •Portland cement against Portland cement had the highest macroscale COF.

  7. Testing the Difference of Correlated Agreement Coefficients for Statistical Significance

    ERIC Educational Resources Information Center

    Gwet, Kilem L.

    2016-01-01

    This article addresses the problem of testing the difference between two correlated agreement coefficients for statistical significance. A number of authors have proposed methods for testing the difference between two correlated kappa coefficients, which require either the use of resampling methods or the use of advanced statistical modeling…

  8. A method for obtaining coefficients of compositional inverse generating functions

    NASA Astrophysics Data System (ADS)

    Kruchinin, Dmitry V.; Shablya, Yuriy V.; Kruchinin, Vladimir V.; Shelupanov, Alexander A.

    2016-06-01

    The aim of this paper is to show how to obtain expressions for coefficients of compositional inverse generating functions in explicit way. The method is based on the Lagrange inversion theorem and composita of generating functions. Also we give a method of obtaining expressions for coefficients of reciprocal generating functions and consider some examples.

  9. Visualising the Roots of Quadratic Equations with Complex Coefficients

    ERIC Educational Resources Information Center

    Bardell, Nicholas S.

    2014-01-01

    This paper is a natural extension of the root visualisation techniques first presented by Bardell (2012) for quadratic equations with real coefficients. Consideration is now given to the familiar quadratic equation "y = ax[superscript 2] + bx + c" in which the coefficients "a," "b," "c" are generally…

  10. Connection coefficients between orthogonal polynomials and the canonical sequence

    NASA Astrophysics Data System (ADS)

    Maroni, P.; Da Rocha, Z.

    2008-03-01

    We deal with the problem of obtaining closed formulas for the connection coefficients between orthogonal polynomials and the canonical sequence. We use a recurrence relation fulfilled by these coefficients and symbolic computation with the Mathematica language. We treat the cases of Gegenbauer, Jacobi and a new semi-classical sequence.

  11. On the coefficients of differentiated expansions of ultraspherical polynomials

    NASA Technical Reports Server (NTRS)

    Karageorghis, Andreas; Phillips, Timothy N.

    1989-01-01

    A formula expressing the coefficients of an expression of ultraspherical polynomials which has been differentiated an arbitrary number of times in terms of the coefficients of the original expansion is proved. The particular examples of Chebyshev and Legendre polynomials are considered.

  12. Factor Scores, Structure and Communality Coefficients: A Primer

    ERIC Educational Resources Information Center

    Odum, Mary

    2011-01-01

    (Purpose) The purpose of this paper is to present an easy-to-understand primer on three important concepts of factor analysis: Factor scores, structure coefficients, and communality coefficients. Given that statistical analyses are a part of a global general linear model (GLM), and utilize weights as an integral part of analyses (Thompson, 2006;…

  13. Crop coefficient development and application to an evapotranspiration network

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Crop coefficients derived from properly designed, operated, and maintained lysimeters provide the most accurate values throughout the growing season and are critical in the computation of hourly and daily,regionally based, crop evapotranspiration (ET) values. Multi-stage crop coefficients can be der...

  14. Extracting electron backscattering coefficients from backscattered electron micrographs

    SciTech Connect

    Zupanic, F.

    2010-12-15

    Electron backscattering micrographs possess the so-called Z-contrast, carrying information about the chemical compositions of phases present in microstructures. The intensity at a particular point in the backscattered electron micrograph is proportional to the signal detected at a corresponding point in the scan raster, which is, in turn, proportional to the electron backscattering coefficient of a phase at that point. This article introduces a simple method for extracting the electron backscattering coefficients of phases present in the microstructure, from the backscattered electron micrographs. This method is able to convert the micrograph's greyscale to the backscattering-coefficient-scale. The prerequisite involves the known backscattering coefficients for two phases in the micrograph. In this way, backscattering coefficients of other phases can be determined. The method is unable to determine the chemical compositions of phases or the presence of an element only from analysing the backscattered electron micrograph. Nevertheless, this method was found to be very powerful when combined with energy dispersive spectroscopy, and the calculations of backscattering coefficients. - Research Highlights: {yields}A simple method for extracting the electron backscattering coefficients {yields}The prerequisite is known backscattering coefficients for two phases {yields}The information is complementary to the EDS-results. {yields}This method is especially useful when a phase contains a light element (H, Li, Be, and B)

  15. Crop Coefficients of Some Selected Crops of Andhra Pradesh

    NASA Astrophysics Data System (ADS)

    Reddy, K. Chandrasekhar; Arunajyothy, S.; Mallikarjuna, P.

    2015-06-01

    Precise information on crop coefficients for estimating crop evapotranspiration (ETc) for regional scale irrigation planning is a major impediment in many regions. Crop coefficients suggested based on lysimeter data by earlier investigators have to be locally calibrated to account for the differences in the crop canopy under given climatic conditions. In the present study crop coefficients were derived based on reference crop evapotranspiration (ET0) estimated from Penman-Monteith equation and lysimeter measured ETc for groundnut, paddy, tobacco, sugarcane and castor crops at Tirupati, Nellore, Rajahmundry, Anakapalli and Rajendranagar centers of Andhra Pradesh respectively. Crop coefficients derived were compared with those recommended by FAO-56. The mean crop coefficients at different stages of growth were significantly different from those of FAO-56 curve though a similar trend was observed. A third order polynomial crop coefficient model has therefore been developed as a function of time (days after sowing the crop) for deriving suitable crop coefficients. The crop coefficient models suggested may be adopted to estimate crop evapotranspiration in the study area with reasonable degree of accuracy.

  16. Graphical Solution of the Monic Quadratic Equation with Complex Coefficients

    ERIC Educational Resources Information Center

    Laine, A. D.

    2015-01-01

    There are many geometrical approaches to the solution of the quadratic equation with real coefficients. In this article it is shown that the monic quadratic equation with complex coefficients can also be solved graphically, by the intersection of two hyperbolas; one hyperbola being derived from the real part of the quadratic equation and one from…

  17. REE and Strontium Partition Coefficients for Nakhla Pyroxenes

    NASA Technical Reports Server (NTRS)

    Oe, K.; McKay, G.; Le, L.

    2001-01-01

    We present new partition coefficients for REE and Sr determined using a synthetic melt that crystallizes pyroxenes very similar in composition to Nakhla pyroxene cores. We believe these are the most appropriate partition coefficients to use in studying Nakhla Additional information is contained in the original extended abstract..

  18. The Use of Structure Coefficients in Regression Research.

    ERIC Educational Resources Information Center

    Perry, Lucille N.

    It is recognized that parametric methods (e.g., t-tests, discriminant analysis, and methods based on analysis of variance) are special cases of canonical correlation analysis. In canonical correlation it has been argued that structure coefficients must be computed to correctly interpret results. It follows that structure coefficients may be useful…

  19. The Importance of Structure Coefficients in Parametric Analyses.

    ERIC Educational Resources Information Center

    Friedrich, Katherine R.

    The recognition that all parametric methods are interrelated, coupled with the notion that structure coefficients are often vital in factor and canonical analyses, suggests that structure coefficients may be important in univariate analysis as well. Using a small, heuristic data set, this paper discusses the importance of structure coefficients…

  20. Binding properties of alpha-1 adrenergic receptors in rat cerebral cortex: similarity to smooth muscle

    SciTech Connect

    Minneman, K.P.

    1983-12-01

    The characteristics of alpha-1 adrenergic receptors in rat cerebral cortex were examined using the radioiodinated alpha-1 adrenergic receptor antagonist ((/sup 125/I)BE). (/sup 125/I)BE labeled a single class of high-affinity binding sites in a particulate fraction of rat cerebral cortex with mass action kinetics and a KD of 57 pM. The binding of (/sup 125/I)BE was inhibited by various alpha adrenergic receptor antagonists, partial agonists and full agonists. The potency of these compounds in competing for the (/sup 125/I)BE binding sites suggested that (/sup 125/I)BE was labeling alpha-1 adrenergic receptors in rat cerebral cortex. In the absence of a physiological concentration of NaCl in the assay medium there was a small (20%) decrease in the density of (/sup 125/I)BE binding sites with no effect on the KD value. The absence of NaCl also caused a 4-fold increase in the potency of norepinephrine in competing for (/sup 125/I)BE binding sites. All drugs competed for (/sup 125/I) BE binding sites with Hill coefficients greater than 0.86, except for oxymetazoline which had a Hill coefficient of 0.77. Scatchard analysis of specific (/sup 125/I)BE binding in the presence of various competing drugs showed that the inhibition by both agonists and antagonists was purely competitive, but the inhibition by oxymetazoline was complex. Treatment of the particulate fraction of rat cerebral cortex with 0.2 to 200 nM phenoxybenzamine for 10 min caused a dose-dependent decrease in the density of (/sup 125/I) BE binding sites which could be mostly blocked by the presence of norepinephrine during the phenoxybenzamine exposure.

  1. Prestimulus EEG alpha activity reflects temporal expectancy.

    PubMed

    Min, Byoung-Kyong; Park, Jin Young; Kim, Eun Joo; Kim, Joong Il; Kim, Jae-Jin; Park, Hae-Jeong

    2008-06-27

    Since prestimulus EEG alpha activity has recently been considered to convey prestimulus top-down processing, we investigated whether prestimulus alpha activity reflects temporal expectancy of upcoming stimulation even under the non-classical contingent negative variation (CNV) paradigm. EEG was recorded from 16 subjects performing a color and a shape discrimination task manipulated with constant and variable inter-stimulus interval (ISI) conditions. The power of oscillatory activity was investigated by convolving the EEG signals with Morlet wavelets. The constant ISI condition yielded significantly shorter reaction times than the variable ISI condition, indicating more efficient preparation for upcoming stimuli during the constant ISI. We found significantly higher prestimulus alpha activity in the constant ISI condition than in the variable ISI condition, but no significant CNV even in the constant ISI condition. Such a reflection of temporal expectancy in the prestimulus alpha activity corroborates that the prestimulus top-down mental state for preparing upcoming task-performance is considerably reflected in the prestimulus ongoing alpha activity. PMID:18486342

  2. Role of Frontal Alpha Oscillations in Creativity

    PubMed Central

    Lustenberger, Caroline; Boyle, Michael R.; Foulser, A. Alban; Mellin, Juliann M.; Fröhlich, Flavio

    2015-01-01

    Creativity, the ability to produce innovative ideas, is a key higher-order cognitive function that is poorly understood. At the level of macroscopic cortical network dynamics, recent EEG data suggests that cortical oscillations in the alpha frequency band (8 – 12 Hz) are correlated with creative thinking. However, whether alpha oscillations play a fundamental role in creativity has remained unknown. Here we show that creativity is increased by enhancing alpha power using 10 Hz transcranial alternating current stimulation (10Hz-tACS) of the frontal cortex. In a study of 20 healthy participants with a randomized, balanced cross-over design, we found a significant improvement of 7.4% in the Creativity Index measured by the Torrance Test of Creative Thinking, a comprehensive and most frequently used assay of creative potential and strengths. In a second similar study with 20 subjects, 40Hz-tACS was used in instead of 10Hz-tACS to rule out a general “electrical stimulation” effect. No significant change in the Creativity Index was found for such frontal gamma stimulation. Our results suggest that alpha activity in frontal brain areas is selectively involved in creativity; this enhancement represents the first demonstration of specific neuronal dynamics that drive creativity and can be modulated by non-invasive brain stimulation. Our findings agree with the model that alpha recruitment increases with internal processing demands and is involved in inhibitory top-down control, which is an important requirement for creative ideation. PMID:25913062

  3. Alpha-particle sensitive test SRAMs

    NASA Technical Reports Server (NTRS)

    Buehler, M. G.; Blaes, B. R.

    1990-01-01

    A bench-level test is being developed to evaluate memory-cell upsets in a test SRAM designed with a cell offset voltage. This offset voltage controls the critical charge needed to upset the cell. The effect is demonstrated using a specially designed 2-micron n-well CMOS 4-kb test SRAM and a Po-208 5.1-MeV 0.61-LET alpha-particle source. This test SRAM has been made sensitive to alpha particles through the use of a cell offset voltage, and this has allowed a bench-level characterization in a laboratory setting. The experimental data are linked to a alpha-particle interaction physics and to SPICE circuit simulations through the alpha-particle collection depth. The collection depth is determined by two methods and found to be about 7 micron. In addition, alpha particles that struck outside the bloated drain were able to flip the SRAM cells. This lateral charge collection was observed to be more than 6 micron.

  4. H-alpha Observations of MKW10

    NASA Astrophysics Data System (ADS)

    Johnson, Harold; Coble, Kimberly A.; Koopmann, Rebecca A.; Durbala, Adriana; Undergraduate ALFALFA Team

    2016-01-01

    As part of the Undergraduate ALFALFA Team project looking at clusters and groups of galaxies to investigate the effects of environment on star formation, we analyzed H-alpha and R-band observations of the group MKW10 from the WIYN 0.9-m telescope with MOSAIC camera at Kitt Peak. We continuum-subtract the H-alpha images by scaling and subtracting the broadband R images. This process includes: determining the seeing of each image by calculating the FWHM values of several stars in the image; convolving all images to the worst seeing; stacking images for each filter; subtracting sky background; scaling the R image to H-alpha; and subtracting the scaled R from H-alpha. We then use the H-alpha-continuum-subtracted image to perform surface photometry of individual galaxies in MKW10. The data will be used to determine star formation rates and distributions of galaxies in this group environment and will be compared to results for galaxies in other UAT group and cluster environments. Analysis is ongoing.This work has been supported by NSF grant AST-1211005 and the Illinois Space Grant Consortium.

  5. Venus - False Color Image of Alpha Regio

    NASA Technical Reports Server (NTRS)

    1991-01-01

    This Magellan radar image shows Alpha Regio, a topographic upland approximately 1,300 kilometers (806 miles) across which is centered on 25 degrees south latitude, 4 degrees east longitude. In 1963 Alpha Regio was the first feature on Venus to be identified from Earth based radar. The radar bright area of Alpha Regio is characterized by multiple sets of intersecting trends of structural features such as ridges, troughs and flat floored fault valleys that together form a polygonal outline. Circular to oblong dark patches within the complex terrain are local topographic lows that are filled with smooth volcanic lava. Complex ridged terrains such as Alpha, formerly called 'tessera' in the Soviet Venera 15 and 16 radar missions and the Arecibo radar data, appear to be widespread and common surface expressions of Venusian tectonic processes. Directly south of the complex ridged terrain is a large ovoid shaped feature named Eve. The radar bright spot located centrally within Eve marks the location of the prime meridian of Venus. Magellan radar data reveals that relatively young lava flows emanate from Eve and extends into the southern margin of the ridged terrain at Alpha. The mosaic was produced by Eric de Jong and Myche McAuley in the JPL Multimission Image Processing Laboratory.

  6. ALPHA ATTENUATION DUE TO DUST LOADING

    SciTech Connect

    Dailey, A; Dennis Hadlock, D

    2007-08-09

    Previous studies had been done in order to show the attenuation of alpha particles in filter media. These studies provided an accurate correction for this attenuation, but there had not yet been a study with sufficient results to properly correct for attenuation due to dust loading on the filters. At the Savannah River Site, filter samples are corrected for attenuation due to dust loading at 20%. Depending on the facility the filter comes from and the duration of the sampling period, the proper correction factor may vary. The objective of this study was to determine self-absorption curves for each of three counting instruments. Prior work indicated significant decreases in alpha count rate (as much as 38%) due to dust loading, especially on filters from facilities where sampling takes place over long intervals. The alpha count rate decreased because of a decrease in the energy of the alpha. The study performed resulted in a set of alpha absorption curves for each of three detectors. This study also took into account the affects of the geometry differences in the different counting equipment used.

  7. Benchmarking the External Surrogate Ratio Method using the (alpha,alpha' f) reaction at STARS

    SciTech Connect

    Lesher, S R; Bernstein, L A; Ai, H; Beausang, C W; Bleuel, D; Burke, J T; Clark, R M; Fallon, P; Gibelin, J; Lee, I Y; Lyles, B F; Macchiavelli, A O; McMahan, M A; Moody, K J; Norman, E B; Phair, L; Rodriguez-Vieitez, E; Wiedeking, M

    2008-01-09

    We measured the ratio of the fission probabilities of {sup 234}U* relative to {sup 236}U* formed via an ({alpha},{alpha}{prime}) direct reactions using the STARS array at the 88-inch cyclotron at the Lawrence Berkeley National Laboratory. This ratio has a shape similar to the ratio of neutron capture probabilities from {sup 233}U(n; f) and {sup 235}U(n; f), indicating the alpha reactions likely formed a compound nucleus. This result indicates that the ratios of fission exit channel probabilities for two actinide nuclei populated via ({alpha}, {alpha}{prime}) can be used to determine an unknown fission cross section relative to a known one. The validity of the External Surrogate Ratio Method (ESRM) is tested and the results support the conclusions of Burke et al. [1].

  8. Direct Extraction of One-loop Integral Coefficients

    SciTech Connect

    Forde, Darren

    2007-04-16

    We present a general procedure for obtaining the coefficients of the scalar bubble and triangle integral functions of one-loop amplitudes. Coefficients are extracted by considering two-particle and triple unitarity cuts of the corresponding bubble and triangle integral functions. After choosing a specific parameterization of the cut loop momentum we can uniquely identify the coefficients of the desired integral functions simply by examining the behavior of the cut integrand as the unconstrained parameters of the cut loop momentum approach infinity. In this way we can produce compact forms for scalar integral coefficients. Applications of this method are presented for both QCD and electroweak processes, including an alternative form for the recently computed three-mass triangle coefficient in the six-photon amplitude A{sub 6}(1{sup -}, 2{sup +}, 3{sup -}, 4{sup +}, 5{sup -}, 6{sup +}). The direct nature of this extraction procedure allows for a very straightforward automation of the procedure.

  9. Diffusion and viscosity coefficients for helium. [in astrophysical gas mixtures

    NASA Technical Reports Server (NTRS)

    Roussel-Dupre, R.

    1982-01-01

    The first order Boltzmann-Fokker-Planck equation is solved numerically to obtain diffusion and viscosity coefficients for a ternary gas mixture composed of electron, protons, and helium. The coefficients are tabulated for five He/H abundances ranging from 0.01 to 10 and for both He II and He III. Comparison with Burgers's thermal diffusion coefficients reveals a maximum difference of 9-10% for both He II and He III throughout the range of helium abundances considered. The viscosity coefficients are compared to those of Chapman and Cowling and show a maximum difference of only 5-6% for He II but 15-16% for He III. For the astrophysically important gas mixtures, it is concluded that the results of existing studies which employed Burgers's or Chapman and Cowling's coefficients will remain substantially unaltered.

  10. A new correlation coefficient for bivariate time-series data

    NASA Astrophysics Data System (ADS)

    Erdem, Orhan; Ceyhan, Elvan; Varli, Yusuf

    2014-11-01

    The correlation in time series has received considerable attention in the literature. Its use has attained an important role in the social sciences and finance. For example, pair trading in finance is concerned with the correlation between stock prices, returns, etc. In general, Pearson’s correlation coefficient is employed in these areas although it has many underlying assumptions which restrict its use. Here, we introduce a new correlation coefficient which takes into account the lag difference of data points. We investigate the properties of this new correlation coefficient. We demonstrate that it is more appropriate for showing the direction of the covariation of the two variables over time. We also compare the performance of the new correlation coefficient with Pearson’s correlation coefficient and Detrended Cross-Correlation Analysis (DCCA) via simulated examples.

  11. [Characteristics and Parameterization for Atmospheric Extinction Coefficient in Beijing].

    PubMed

    Chen, Yi-na; Zhao, Pu-sheng; He, Di; Dong, Fan; Zhao, Xiu-juan; Zhang, Xiao-ling

    2015-10-01

    In order to study the characteristics of atmospheric extinction coefficient in Beijing, systematic measurements had been carried out for atmospheric visibility, PM2.5 concentration, scattering coefficient, black carbon, reactive gases, and meteorological parameters from 2013 to 2014. Based on these data, we compared some published fitting schemes of aerosol light scattering enhancement factor [ f(RH)], and discussed the characteristics and the key influence factors for atmospheric extinction coefficient. Then a set of parameterization models of atmospheric extinction coefficient for different seasons and different polluted levels had been established. The results showed that aerosol scattering accounted for more than 94% of total light extinction. In the summer and autumn, the aerosol hygroscopic growth caused by high relative humidity had increased the aerosol scattering coefficient by 70 to 80 percent. The parameterization models could reflect the influencing mechanism of aerosol and relative humidity upon ambient light extinction, and describe the seasonal variations of aerosol light extinction ability. PMID:26841588

  12. Determination of absolute internal conversion coefficients using the SAGE spectrometer

    NASA Astrophysics Data System (ADS)

    Sorri, J.; Greenlees, P. T.; Papadakis, P.; Konki, J.; Cox, D. M.; Auranen, K.; Partanen, J.; Sandzelius, M.; Pakarinen, J.; Rahkila, P.; Uusitalo, J.; Herzberg, R.-D.; Smallcombe, J.; Davies, P. J.; Barton, C. J.; Jenkins, D. G.

    2016-03-01

    A non-reference based method to determine internal conversion coefficients using the SAGE spectrometer is carried out for transitions in the nuclei of 154Sm, 152Sm and 166Yb. The Normalised-Peak-to-Gamma method is in general an efficient tool to extract internal conversion coefficients. However, in many cases the required well-known reference transitions are not available. The data analysis steps required to determine absolute internal conversion coefficients with the SAGE spectrometer are presented. In addition, several background suppression methods are introduced and an example of how ancillary detectors can be used to select specific reaction products is given. The results obtained for ground-state band E2 transitions show that the absolute internal conversion coefficients can be extracted using the methods described with a reasonable accuracy. In some cases of less intense transitions only an upper limit for the internal conversion coefficient could be given.

  13. [Characteristics and Parameterization for Atmospheric Extinction Coefficient in Beijing].

    PubMed

    Chen, Yi-na; Zhao, Pu-sheng; He, Di; Dong, Fan; Zhao, Xiu-juan; Zhang, Xiao-ling

    2015-10-01

    In order to study the characteristics of atmospheric extinction coefficient in Beijing, systematic measurements had been carried out for atmospheric visibility, PM2.5 concentration, scattering coefficient, black carbon, reactive gases, and meteorological parameters from 2013 to 2014. Based on these data, we compared some published fitting schemes of aerosol light scattering enhancement factor [ f(RH)], and discussed the characteristics and the key influence factors for atmospheric extinction coefficient. Then a set of parameterization models of atmospheric extinction coefficient for different seasons and different polluted levels had been established. The results showed that aerosol scattering accounted for more than 94% of total light extinction. In the summer and autumn, the aerosol hygroscopic growth caused by high relative humidity had increased the aerosol scattering coefficient by 70 to 80 percent. The parameterization models could reflect the influencing mechanism of aerosol and relative humidity upon ambient light extinction, and describe the seasonal variations of aerosol light extinction ability.

  14. The alpha 2-adrenoceptors of the human retinoblastoma cell line (Y79) may represent an additional example of the alpha 2C-adrenoceptor.

    PubMed Central

    Gleason, M. M.; Hieble, J. P.

    1992-01-01

    1. In agreement with the literature, correlation of the ability of a series of agonists and antagonists to displace [3H]-rauwolscine binding shows the alpha 2-adrenoceptors of HT29 cells, NG108-15 cells, OK cells and homogenates of rat sublingual gland to represent four distinct subtypes. 2. [3H]-rauwolscine also bound with high affinity (KD = 0.30 +/- 0.10 mM) to a human retinoblastoma cell line (Y79). Specific binding represents 73% of total binding, and a Bmax of 38 +/- 1 fmol mg-1 protein was determined. 3. Correlation of antagonist affinities against [3H]-rauwolscine with corresponding values in the other four tissue sources showed the Y79 cells to resemble most closely the OK cells, the prototype example of an alpha 2C-adrenoceptor, with a correlation coefficient of 0.90 and a regression slope of 1.01 being obtained for 10 antagonists in these two systems. 4. Comparison of KD values for [3H]-rauwolscine also showed a similarity between the OK cells (0.19 +/- 0.07 nM) and Y79 cells. 5. These data suggest that the human retinoblastoma cell line may represent an additional example of the alpha 2C-adrenoceptor subtype. PMID:1358385

  15. Acousto-optic interaction in alpha-BaB(2)O(4)and Li(2)B(4)O(7) crystals.

    PubMed

    Martynyuk-Lototska, Irina; Mys, Oksana; Dudok, Taras; Adamiv, Volodymyr; Smirnov, Yevgen; Vlokh, Rostyslav

    2008-07-01

    Experimental studies and analysis of acousto-optic diffraction in alpha-BaB(2)O(4) and Li(2)B(4)O(7) crystals are given. Ultrasonic wave velocity, elastic compliance and stiffness coefficients, and piezo-optic and photoelastic coefficients of alpha-BaB(2)O(4) and Li(2)B(4)O(7) crystals are determined. The acousto-optic figure of merit has been estimated for different possible geometries of acousto-optic interaction. It is shown that the acousto-optic figures of merit for alpha-BaB(2)O(4) crystals reach the value M(2)=(270 +/- 70) x 10(-15) s(3)/kg for the case of interaction with the slowest ultrasonic wave. The directions of propagation and polarization of those acoustic waves are obtained on the basis of construction of acoustic slowness surfaces. The acousto-optic diffraction is experimentally studied for alpha-BaB(2)O(4) and Li(2)B(4)O(7) crystals.

  16. Alpha-decay of light protactinium isotopes

    SciTech Connect

    Faestermann, T.; Gillitzer, A.; Hartel, K.; Henning, W.; Kienle, P.

    1987-12-10

    Light protactinium isotopes have been produced with /sup 204/Pb (/sup 19/F,xn) reactions. ..cap alpha..-activities with E/sub ..cap alpha../ = 9.90(5) MeV, T/sub 1/2/ = 53(10) ns and E/sub ..cap alpha../ = 9.65(5) MeV, T/sub 1/2/ = 0.78(16) ..mu..s could be attributed to the previously unobserved nuclei /sup 219/Pa and /sup 220/Pa with the help of excitation functions. The peak cross sections for the 4n and 3n evaporation channels are on the order of 10 ..mu..b. The decay energies as well as the halflives fit well into the systematics of these nuclei close to the magic neutron number N = 126. /sup 219/Pa is the shortest lived nuclide known with directly measured halflife.

  17. Radiation risks from inhaled alpha emitters

    NASA Astrophysics Data System (ADS)

    Simmons, Jack A.

    2001-06-01

    The alpha emitter that gives rise to the greatest concern over its link to the induction of lung cancer is radon. As noted by the ICRP, attempts to relate the risk of cancer induction to the dose delivered by the alpha particles result in a value for this risk which is unrealistically high. Instead, an estimate based on the epidemiology of radon in mines is preferred. The logical result, that the weighting factor for these alpha particles should be very much lesser than the recommended value of 20, appears to have been ignored. It will be shown that there are two fundamental reasons for this large discrepancy. The first is that the implied "linear non-threshold" hypothesis is not supported by recent investigations. The second is that the concept of "dose" is meaningless at the levels of exposure considered in this context. Alternative proposals in terms of fluence and the effect cross-section will be presented.

  18. Synthesis of peptide .alpha.-thioesters

    DOEpatents

    Camarero, Julio A.; Mitchell, Alexander R.; De Yoreo, James J.

    2008-08-19

    Disclosed herein is a new method for the solid phase peptide synthesis (SPPS) of C-terminal peptide .alpha. thioesters using Fmoc/t-Bu chemistry. This method is based on the use of an aryl hydrazine linker, which is totally stable to conditions required for Fmoc-SPPS. When the peptide synthesis has been completed, activation of the linker is achieved by mild oxidation. The oxidation step converts the acyl-hydrazine group into a highly reactive acyl-diazene intermediate which reacts with an .alpha.-amino acid alkylthioester (H-AA-SR) to yield the corresponding peptide .alpha.-thioester in good yield. A variety of peptide thioesters, cyclic peptides and a fully functional Src homology 3 (SH3) protein domain have been successfully prepared.

  19. ALPHA MIS: Reference manual. Revision 2

    SciTech Connect

    Lovin, J.K.; Haese, R.L.; Heatherly, R.D.; Hughes, S.E.; Ishee, J.S.; Pratt, S.M.; Smith, D.W.

    1992-02-01

    ALPHA is a powerful and versatile management information system (MIS) initiated and sponsored and by the Finance and Business Management Division of Oak Ridge National Laboratory, who maintain and develop it in concert with the Business Systems Division for its Information Center. A general-purpose MIS, ALPHA allows users to access System 1022 and System 1032 databases to obtain and manage information. From a personal computer or a data terminal, Energy Systems employees can use ALPHA to control their own report reprocessing. Using four general commands (Database, Select, Sort, and Report) they can (1) choose a mainframe database, (2) define subsets within it, (3) sequentially order a subset by one or more variables, and (4) generate a report with their own or a canned format.

  20. Nuclear diagnostic for fast alpha particles

    DOEpatents

    Grisham, Larry R.; Post Jr., Douglass E.; Dawson, John M.

    1986-06-03

    Measurement of the velocity distribution of confined energetic alpha particles resulting from deuterium-tritium fusion reactions in a magnetically contained plasma is provided. The fusion plasma is seeded with energetic boron neutrals for producing, by means of the reaction .sup.10 B (.alpha.,n) .sup.13 N reaction, radioactive nitrogen nuclei which are then collected by a probe. The radioactivity of the probe is then measured by conventional techniques in determining the energy distribution of the alpha particles in the plasma. In a preferred embodiment, diborane gas (B.sub.2 H.sub.6) is the source of the boron neutrals to produce .sup.13 N which decays almost exclusively by positron emission with a convenient half-life of 10 minutes.