Field-Evolved Mode 1 Resistance of the Fall Armyworm to Transgenic Cry1Fa-Expressing Corn Associated with Reduced Cry1Fa Toxin Binding and Midgut Alkaline Phosphatase Expression

PubMed Central

Jakka, Siva R. K.; Gong, Liang; Hasler, James; Banerjee, Rahul; Sheets, Joel J.; Narva, Kenneth; Blanco, Carlos A.

2015-01-01

Insecticidal protein genes from the bacterium Bacillus thuringiensis (Bt) are expressed by transgenic Bt crops (Bt crops) for effective and environmentally safe pest control. The development of resistance to these insecticidal proteins is considered the most serious threat to the sustainability of Bt crops. Resistance in fall armyworm (Spodoptera frugiperda) populations from Puerto Rico to transgenic corn producing the Cry1Fa insecticidal protein resulted, for the first time in the United States, in practical resistance, and Bt corn was withdrawn from the local market. In this study, we used a field-collected Cry1Fa corn-resistant strain (456) of S. frugiperda to identify the mechanism responsible for field-evolved resistance. Binding assays detected reduced Cry1Fa, Cry1Ab, and Cry1Ac but not Cry1Ca toxin binding to midgut brush border membrane vesicles (BBMV) from the larvae of strain 456 compared to that from the larvae of a susceptible (Ben) strain. This binding phenotype is descriptive of the mode 1 type of resistance to Bt toxins. A comparison of the transcript levels for putative Cry1 toxin receptor genes identified a significant downregulation (>90%) of a membrane-bound alkaline phosphatase (ALP), which translated to reduced ALP protein levels and a 75% reduction in ALP activity in BBMV from 456 compared to that of Ben larvae. We cloned and heterologously expressed this ALP from susceptible S. frugiperda larvae and demonstrated that it specifically binds with Cry1Fa toxin. This study provides a thorough mechanistic description of field-evolved resistance to a transgenic Bt crop and supports an association between resistance and reduced Cry1Fa toxin binding and levels of a putative Cry1Fa toxin receptor, ALP, in the midguts of S. frugiperda larvae. PMID:26637593

Screen of Bacillus thuringiensis toxins for transgenic rice to control Sesamia inferens and Chilo suppressalis.

PubMed

Gao, Yulin; Hu, Yang; Fu, Qiang; Zhang, Jie; Oppert, Brenda; Lai, Fengxiang; Peng, Yufa; Zhang, Zhitao

2010-09-01

Transgenic rice to control stem borer damage is under development in China. To assess the potential of Bacillus thuringiensis (Bt) transgenes in stem borer control, the toxicity of five Bt protoxins (Cry1Aa, Cry1Ab, Cry1Ac, Cry1Ba and Cry1Ca) against two rice stem borers, Sesamia inferens (pink stem borer) and Chilo suppressalis (striped stem borer), was evaluated in the laboratory by feeding neonate larvae on artificial diets containing Bt protoxins. The results indicated that Cry1Ca exhibited the highest level of toxicity to both stem borers, with an LC(50) of 0.24 and 0.30 microg/g for C. suppressalis and S. inferens, respectively. However, S. inferens was 4-fold lower in susceptibility to Cry1Aa, and 6- and 47-fold less susceptible to Cry1Ab and Cry1Ba, respectively, compared to C. suppressalis. To evaluate interactions among Bt protoxins in stem borer larvae, toxicity assays were performed with mixtures of Cry1Aa/Cry1Ab, Cry1Aa/Cry1Ca, Cry1Ac/Cry1Ca, Cry1Ac/Cry1Ba, Cry1Ab/Cry1Ac, Cry1Ab/Cry1Ba, and Cry1Ab/Cry1Ca at 1:1 (w/w) ratios. All protoxin mixtures demonstrated significant synergistic toxicity activity against C. suppressalis, with values of 1.6- to 11-fold higher toxicity than the theoretical additive effect. Surprisingly, all but one of the Bt protoxin mixtures were antagonistic in toxicity to S. inferens. In mortality-time response experiments, S. inferens demonstrated increased tolerance to Cry1Ab and Cry1Ac compared to C. suppressalis when treated with low or high protoxin concentrations. The data indicate the utility of Cry1Ca protoxin and a Cry1Ac/Cry1Ca mixture to control both stem borer populations. Copyright 2010 Elsevier Inc. All rights reserved.

Role of Receptors in Bacillus thuringiensis Crystal Toxin Activity

PubMed Central

Pigott, Craig R.; Ellar, David J.

2007-01-01

Bacillus thuringiensis produces crystalline protein inclusions with insecticidal or nematocidal properties. These crystal (Cry) proteins determine a particular strain's toxicity profile. Transgenic crops expressing one or more recombinant Cry toxins have become agriculturally important. Individual Cry toxins are usually toxic to only a few species within an order, and receptors on midgut epithelial cells have been shown to be critical determinants of Cry specificity. The best characterized of these receptors have been identified for lepidopterans, and two major receptor classes have emerged: the aminopeptidase N (APN) receptors and the cadherin-like receptors. Currently, 38 different APNs have been reported for 12 different lepidopterans. Each APN belongs to one of five groups that have unique structural features and Cry-binding properties. While 17 different APNs have been reported to bind to Cry toxins, only 2 have been shown to mediate toxin susceptibly in vivo. In contrast, several cadherin-like proteins bind to Cry toxins and confer toxin susceptibility in vitro, and disruption of the cadherin gene has been associated with toxin resistance. Nonetheless, only a small subset of the lepidopteran-specific Cry toxins has been shown to interact with cadherin-like proteins. This review analyzes the interactions between Cry toxins and their receptors, focusing on the identification and validation of receptors, the molecular basis for receptor recognition, the role of the receptor in resistant insects, and proposed models to explain the sequence of events at the cell surface by which receptor binding leads to cell death. PMID:17554045

A Western Corn Rootworm Cadherin-like Protein is not Involved in the Binding and Toxicity of Cry34/35Ab1 and Cry3Aa Bacillus Thuringiensis Proteins

USDA-ARS?s Scientific Manuscript database

The western corn rootworm (WCR) Diabrotica virgifera virgifera LeConte is an important insect pest of corn. Bacillus thuringiensis (Bt) insecticidal proteins Cry3Aa (as mCry3A) and Cry34Ab1/Cry35Ab1 have been expressed in transgenic corn and are used to control the insect in the U.S. To date, there ...

Cry1Ac and Vip3Aa proteins from Bacillus thuringiensis targeting Cry toxin resistance in Diatraea flavipennella and Elasmopalpus lignosellus from sugarcane

PubMed Central

2017-01-01

The biological potential of Vip and Cry proteins from Bacillus is well known and widely established. Thus, it is important to look for new genes showing different modes of action, selecting those with differentiated entomotoxic activity against Diatraea flavipennella and Elasmopalpus lignosellus, which are secondary pests of sugarcane. Therefore, Cry1 and Vip3 proteins were expressed in Escherichia coli, and their toxicities were evaluated based on bioassays using neonate larvae. Of those, the most toxic were Cry1Ac and Vip3Aa considering the LC50 values. Toxins from E. coli were purified, solubilized, trypsinized, and biotinylated. Brush Border Membrane Vesicles (BBMVs) were prepared from intestines of the two species to perform homologous and heterologous competition assays. The binding assays demonstrated interactions between Cry1Aa, Cry1Ac, and Vip3Aa toxins and proteins from the BBMV of D. flavipennella and E. lignosellus. Homologous competition assays demonstrated that binding to one of the BBMV proteins was specific for each toxin. Heterologous competition assays indicated that Vip3Aa was unable to compete for Cry1Ac toxin binding. Our results suggest that Cry1Ac and Vip3Aa may have potential in future production of transgenic sugarcane for control of D. flavipennella and E. lignosellus, but more research is needed on the potential antagonism or synergism of the toxins in these pests. PMID:28123906

Domain III of Cry1Ac Is Critical to Binding and Toxicity against Soybean Looper (Chrysodeixis includens) but Not to Velvetbean Caterpillar (Anticarsia gemmatalis).

PubMed

Mushtaq, Rubina; Shakoori, Abdul Rauf; Jurat-Fuentes, Juan Luis

2018-02-27

Insecticidal proteins Cry1Ac and Cry2Ac7 from the bacterium Bacillus thuringiensis (Bt) belong to the three-domain family of Bt toxins. Commercial transgenic soybean hybrids produce Cry1Ac to control the larvae of the soybean looper ( Chrysodeixis includens ) and the velvet bean caterpillar ( Anticarsia gemmatalis ). The specificity of Cry1Ac is determined by loops extending from domain II and regions of domain III in the three-dimensional structure of the toxin. In this study, we constructed a hybrid toxin (H1.2Ac) containing domains I and II of Cry1Ac and domain III of Cry2Ac7, in an attempt to obtain a protein with enhanced toxicity compared to parental toxins. Bioassays with H1.2Ac revealed toxicity against the larvae of A. gemmatalis but not against C. includens . Saturation binding assays with radiolabeled toxins and midgut brush border membrane vesicles demonstrated no specific H1.2Ac binding to C. includens , while binding in A. gemmatalis was specific and saturable. Results from competition binding assays supported the finding that Cry1Ac specificity against A. gemmatalis is mainly dictated by domain II. Taken together, these distinct interactions with binding sites may help explain the differential susceptibility to Cry1Ac in C. includens and A. gemmatalis , and guide the design of improved toxins against soybean pests.

The blue light-induced interaction of cryptochrome 1 with COP1 requires SPA proteins during Arabidopsis light signaling.

PubMed

Holtkotte, Xu; Ponnu, Jathish; Ahmad, Margaret; Hoecker, Ute

2017-10-01

Plants constantly adjust their growth, development and metabolism to the ambient light environment. Blue light is sensed by the Arabidopsis photoreceptors CRY1 and CRY2 which subsequently initiate light signal transduction by repressing the COP1/SPA E3 ubiquitin ligase. While the interaction between cryptochromes and SPA is blue light-dependent, it was proposed that CRY1 interacts with COP1 constitutively, i.e. also in darkness. Here, our in vivo co-immunoprecipitation experiments suggest that CRY1 and CRY2 form a complex with COP1 only after seedlings were exposed to blue light. No association between COP1 and CRY1 or CRY2 was observed in dark-grown seedlings. Thus, our results suggest that cryptochromes bind the COP1/SPA complex after photoactivation by blue light. In a spa quadruple mutant that is devoid of all four SPA proteins, CRY1 and COP1 did not interact in vivo, neither in dark-grown nor in blue light-grown seedlings. Hence, SPA proteins are required for the high-affinity interaction between CRY1 and COP1 in blue light. Yeast three-hybrid experiments also show that SPA1 enhances the CRY1-COP1 interaction. The coiled-coil domain of SPA1 which is responsible for COP1-binding was necessary to mediate a CRY1-SPA1 interaction in vivo, implying that-in turn-COP1 may be necessary for a CRY1-SPA1 complex formation. Hence, SPA1 and COP1 may act cooperatively in recognizing and binding photoactivated CRY1. In contrast, the blue light-induced association between CRY2 and COP1 was not dependent on SPA proteins in vivo. Similarly, ΔCC-SPA1 interacted with CRY2, though with a much lower affinity than wild-type SPA1. In total, our results demonstrate that CRY1 and CRY2 strongly differ in their blue light-induced interaction with the COP1/SPA complex.

Identification of Bacillus thuringiensis Cry3Aa toxin domain II loop 1 as the binding site of Tenebrio molitor cadherin repeat CR12.

PubMed

Zúñiga-Navarrete, Fernando; Gómez, Isabel; Peña, Guadalupe; Amaro, Itzel; Ortíz, Ernesto; Becerril, Baltazar; Ibarra, Jorge E; Bravo, Alejandra; Soberón, Mario

2015-04-01

Bacillus thuringiensis Cry toxins exert their toxic effect by specific recognition of larval midgut proteins leading to oligomerization of the toxin, membrane insertion and pore formation. The exposed domain II loop regions of Cry toxins have been shown to be involved in receptor binding. Insect cadherins have shown to be functionally involved in toxin binding facilitating toxin oligomerization. Here, we isolated a VHH (VHHA5) antibody by phage display that binds Cry3Aa loop 1 and competed with the binding of Cry3Aa to Tenebrio molitor brush border membranes. VHHA5 also competed with the binding of Cry3Aa to a cadherin fragment (CR12) that was previously shown to be involved in binding and toxicity of Cry3Aa, indicating that Cry3Aa binds CR12 through domain II loop 1. Moreover, we show that a loop 1 mutant, previously characterized to have increased toxicity to T. molitor, displayed a correlative enhanced binding affinity to T. molitor CR12 and to VHHA5. These results show that Cry3Aa domain II loop 1 is a binding site of CR12 T. molitor cadherin. Copyright © 2015 Elsevier Ltd. All rights reserved.

A specific binding protein from Tenebrio molitor for the insecticidal toxin of Bacillus thuringiensis subsp. tenebrionis.

PubMed

Belfiore, C J; Vadlamudi, R K; Osman, Y A; Bulla, L A

1994-04-15

Biopesticides based on the bacterium Bacillus thuringiensis have attracted wide attention as safe alternatives to chemical insecticides. In this paper, we report, for the first time, the identification of a single binding protein from a coleopteran insect, Tenebrio molitor, that is specific for the cryIII toxin of B. thuringiensis. The protein appeared as a single band of 144 kDa on radioligand and immunoblots of total proteins extracted from brush border membrane vesicles of the midgut of T. molitor. Radiolabelled cryIIIA toxin bound to the protein with a Kd value of 17.5 nM and could be specifically blocked by unlabelled toxin but not by toxins from other subspecies of B. thuringiensis. This study lays the groundwork to clone the cryIIIA toxin binding protein and to determine the molecular mechanism(s) of toxin action.

Binding Site Concentration Explains the Differential Susceptibility of Chilo suppressalis and Sesamia inferens to Cry1A-Producing Rice

PubMed Central

Han, Chao; Liu, Zewen; Chen, Fajun; Hou, Maolin; Peng, Yufa

2014-01-01

Chilo suppressalis and Sesamia inferens are two important lepidopteran rice pests that occur concurrently during outbreaks in paddy fields in the main rice-growing areas of China. Previous and current field tests demonstrate that the transgenic rice line Huahui 1 (HH1) producing a Cry1Ab-Cry1Ac hybrid toxin from the bacterium Bacillus thuringiensis reduces egg and larval densities of C. suppressalis but not of S. inferens. This differential susceptibility to HH1 rice correlates with the reduced susceptibility to Cry1Ab and Cry1Ac toxins in S. inferens larvae compared to C. suppressalis larvae. The goal of this study was to identify the mechanism responsible for this differential susceptibility. In saturation binding assays, both Cry1Ab and Cry1Ac toxins bound with high affinity and in a saturable manner to midgut brush border membrane vesicles (BBMV) from C. suppressalis and S. inferens larvae. While binding affinities were similar, a dramatically lower concentration of Cry1A toxin binding sites was detected for S. inferens BBMV than for C. suppressalis BBMV. In contrast, no significant differences between species were detected for Cry1Ca toxin binding to BBMV. Ligand blotting detected BBMV proteins binding Cry1Ac or Cry1Ca toxins, some of them unique to C. suppressalis or S. inferens. These data support that reduced Cry1A binding site concentration is associated with a lower susceptibility to Cry1A toxins and HH1 rice in S. inferens larvae than in C. suppressalis larvae. Moreover, our data support Cry1Ca as a candidate for pyramiding efforts with Cry1A-producing rice to extend the activity range and durability of this technology against rice stem borers. PMID:24928872

Bacillus thuringiensis Crystal Protein Cry6Aa Triggers Caenorhabditis elegans Necrosis Pathway Mediated by Aspartic Protease (ASP-1)

PubMed Central

Zhang, Fengjuan; Peng, Donghai; Cheng, Chunsheng; Zhou, Wei; Ju, Shouyong; Wan, Danfeng; Yu, Ziquan; Shi, Jianwei; Deng, Yaoyao; Wang, Fenshan; Ye, Xiaobo; Hu, Zhenfei; Lin, Jian; Ruan, Lifang; Sun, Ming

2016-01-01

Cell death plays an important role in host-pathogen interactions. Crystal proteins (toxins) are essential components of Bacillus thuringiensis (Bt) biological pesticides because of their specific toxicity against insects and nematodes. However, the mode of action by which crystal toxins to induce cell death is not completely understood. Here we show that crystal toxin triggers cell death by necrosis signaling pathway using crystal toxin Cry6Aa-Caenorhabditis elegans toxin-host interaction system, which involves an increase in concentrations of cytoplasmic calcium, lysosomal lyses, uptake of propidium iodide, and burst of death fluorescence. We find that a deficiency in the necrosis pathway confers tolerance to Cry6Aa toxin. Intriguingly, the necrosis pathway is specifically triggered by Cry6Aa, not by Cry5Ba, whose amino acid sequence is different from that of Cry6Aa. Furthermore, Cry6Aa-induced necrosis pathway requires aspartic protease (ASP-1). In addition, ASP-1 protects Cry6Aa from over-degradation in C. elegans. This is the first demonstration that deficiency in necrosis pathway confers tolerance to Bt crystal protein, and that Cry6A triggers necrosis represents a newly added necrosis paradigm in the C. elegans. Understanding this model could lead to new strategies for nematode control. PMID:26795495

PxAPN5 serves as a functional receptor of Cry2Ab in Plutella xylostella (L.) and its binding domain analysis.

PubMed

Pan, Zhi-Zhen; Xu, Lian; Liu, Bo; Zhang, Jing; Chen, Zheng; Chen, Qing-Xi; Zhu, Yu-Jing

2017-12-01

Lepidopteran midgut aminopeptidases N (APNs) are widely studied for their potential roles as one of the receptors for Bacillus thuringiensis (Bt) crystal toxins. In the present study, a loss of function analyses by RNAi (RNA interference) silencing of the Plutella xylostella APN5 (PxAPN5), a binding protein of Bt crystal toxin Cry2Ab, were performed. The knocking down of PxAPN5 in P. xylostella larvae greatly reduced their susceptibility to Cry2Ab and led to a decrease of Cry2Ab binding to P. xylostella midgut. Four truncated fragments of PxAPN5 were further constructed and expressed in Escherichia coli (E.coli) to find the binding region of PxAPN5 to Cry2Ab. The ligand blot result indicated that D1 domain (residues 1-262) and D3 domain (residues 510-620) of PxAPN5 could specially bind to Cry2Ab. Copyright © 2017 Elsevier B.V. All rights reserved.

Inheritance of Cry1F resistance, cross-resistance and frequency of resistant alleles in Spodoptera frugiperda (Lepidoptera: Noctuidae).

PubMed

Vélez, A M; Spencer, T A; Alves, A P; Moellenbeck, D; Meagher, R L; Chirakkal, H; Siegfried, B D

2013-12-01

Transgenic maize, Zea maize L., expressing the Cry1F protein from Bacillus thuringiensis has been registered for Spodoptera frugiperda (J. E. Smith) control since 2003. Unexpected damage to Cry1F maize was reported in 2006 in Puerto Rico and Cry1F resistance in S. frugiperda was documented. The inheritance of Cry1F resistance was characterized in a S. frugiperda resistant strain originating from Puerto Rico, which displayed >289-fold resistance to purified Cry1F. Concentration-response bioassays of reciprocal crosses of resistant and susceptible parental populations indicated that resistance is recessive and autosomal. Bioassays of the backcross of the F1 generation crossed with the resistant parental strain suggest that a single locus is responsible for resistance. In addition, cross-resistance to Cry1Aa, Cry1Ab, Cry1Ac, Cry1Ba, Cry2Aa and Vip3Aa was assessed in the Cry1F-resistant strain. There was no significant cross-resistance to Cry1Aa, Cry1Ba and Cry2Aa, although only limited effects were observed in the susceptible strain. Vip3Aa was highly effective against susceptible and resistant insects indicating no cross-resistance with Cry1F. In contrast, low levels of cross-resistance were observed for both Cry1Ab and Cry1Ac. Because the resistance is recessive and conferred by a single locus, an F1 screening assay was used to measure the frequency of Cry1F-resistant alleles from populations of Florida and Texas in 2010 and 2011. A total frequency of resistant alleles of 0.13 and 0.02 was found for Florida and Texas populations, respectively, indicating resistant alleles could be found in US populations, although there have been no reports of reduced efficacy of Cry1F-expressing plants.

A Novel Tenebrio molitor Cadherin Is a Functional Receptor for Bacillus thuringiensis Cry3Aa Toxin*

PubMed Central

Fabrick, Jeff; Oppert, Cris; Lorenzen, Marcé D.; Morris, Kaley; Oppert, Brenda; Jurat-Fuentes, Juan Luis

2009-01-01

Cry toxins produced by the bacterium Bacillus thuringiensis are effective biological insecticides. Cadherin-like proteins have been reported as functional Cry1A toxin receptors in Lepidoptera. Here we present data that demonstrate that a coleopteran cadherin is a functional Cry3Aa toxin receptor. The Cry3Aa receptor cadherin was cloned from Tenebrio molitor larval midgut mRNA, and the predicted protein, TmCad1, has domain structure and a putative toxin binding region similar to those in lepidopteran cadherin B. thuringiensis receptors. A peptide containing the putative toxin binding region from TmCad1 bound specifically to Cry3Aa and promoted the formation of Cry3Aa toxin oligomers, proposed to be mediators of toxicity in lepidopterans. Injection of TmCad1-specific double-stranded RNA into T. molitor larvae resulted in knockdown of the TmCad1 transcript and conferred resistance to Cry3Aa toxicity. These data demonstrate the functional role of TmCad1 as a Cry3Aa receptor in T. molitor and reveal similarities between the mode of action of Cry toxins in Lepidoptera and Coleoptera. PMID:19416969

Expression of hybrid fusion protein (Cry1Ac::ASAL) in transgenic rice plants imparts resistance against multiple insect pests.

PubMed

Boddupally, Dayakar; Tamirisa, Srinath; Gundra, Sivakrishna Rao; Vudem, Dashavantha Reddy; Khareedu, Venkateswara Rao

2018-05-31

To evolve rice varieties resistant to different groups of insect pests a fusion gene, comprising DI and DII domains of Bt Cry1Ac and carbohydrate binding domain of garlic lectin (ASAL), was constructed. Transgenic rice lines were generated and evaluated to assess the efficacy of Cry1Ac::ASAL fusion protein against three major pests, viz., yellow stem borer (YSB), leaf folder (LF) and brown planthopper (BPH). Molecular analyses of transgenic plants revealed stable integration and expression of the fusion gene. In planta insect bioassays on transgenics disclosed enhanced levels of resistance compared to the control plants. High insect mortality of YSB, LF and BPH was observed on transgenics compared to that of control plants. Furthermore, honeydew assays revealed significant decreases in the feeding ability of BPH on transgenic plants as compared to the controls. Ligand blot analysis, using BPH insects fed on cry1Ac::asal transgenic rice plants, revealed a modified receptor protein-binding pattern owing to its ability to bind to additional receptors in insects. The overall results authenticate that Cry1Ac::ASAL protein is endowed with remarkable entomotoxic effects against major lepidopteran and hemipteran insects. As such, the fusion gene appears promising and can be introduced into various other crops to control multiple insect pests.

Binding site concentration explains the differential susceptibility of Chilo suppressalis and Sesamia inferens to Cry1A-producing rice.

PubMed

Han, Lanzhi; Han, Chao; Liu, Zewen; Chen, Fajun; Jurat-Fuentes, Juan Luis; Hou, Maolin; Peng, Yufa

2014-08-01

Chilo suppressalis and Sesamia inferens are two important lepidopteran rice pests that occur concurrently during outbreaks in paddy fields in the main rice-growing areas of China. Previous and current field tests demonstrate that the transgenic rice line Huahui 1 (HH1) producing a Cry1Ab-Cry1Ac hybrid toxin from the bacterium Bacillus thuringiensis reduces egg and larval densities of C. suppressalis but not of S. inferens. This differential susceptibility to HH1 rice correlates with the reduced susceptibility to Cry1Ab and Cry1Ac toxins in S. inferens larvae compared to C. suppressalis larvae. The goal of this study was to identify the mechanism responsible for this differential susceptibility. In saturation binding assays, both Cry1Ab and Cry1Ac toxins bound with high affinity and in a saturable manner to midgut brush border membrane vesicles (BBMV) from C. suppressalis and S. inferens larvae. While binding affinities were similar, a dramatically lower concentration of Cry1A toxin binding sites was detected for S. inferens BBMV than for C. suppressalis BBMV. In contrast, no significant differences between species were detected for Cry1Ca toxin binding to BBMV. Ligand blotting detected BBMV proteins binding Cry1Ac or Cry1Ca toxins, some of them unique to C. suppressalis or S. inferens. These data support that reduced Cry1A binding site concentration is associated with a lower susceptibility to Cry1A toxins and HH1 rice in S. inferens larvae than in C. suppressalis larvae. Moreover, our data support Cry1Ca as a candidate for pyramiding efforts with Cry1A-producing rice to extend the activity range and durability of this technology against rice stem borers. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

Continuous evolution of B. thuringiensis toxins overcomes insect resistance

PubMed Central

Badran, Ahmed H.; Guzov, Victor M.; Huai, Qing; Kemp, Melissa M.; Vishwanath, Prashanth; Kain, Wendy; Nance, Autumn M.; Evdokimov, Artem; Moshiri, Farhad; Turner, Keith H.; Wang, Ping; Malvar, Thomas; Liu, David R.

2016-01-01

The Bacillus thuringiensis δ-endotoxins (Bt toxins) are widely used insecticidal proteins in engineered crops that provide agricultural, economic, and environmental benefits. The development of insect resistance to Bt toxins endangers their long-term effectiveness. We developed a phage-assisted continuous evolution (PACE) selection that rapidly evolves high-affinity protein-protein interactions, and applied this system to evolve variants of the Bt toxin Cry1Ac that bind a cadherin-like receptor from the insect pest Trichoplusia ni (TnCAD) that is not natively targeted by wild-type Cry1Ac. The resulting evolved Cry1Ac variants bind TnCAD with high affinity (Kd = 11–41 nM), kill TnCAD-expressing insect cells that are not susceptible to wild-type Cry1Ac, and kill Cry1Ac-resistant T. ni insects up to 335-fold more potently than wild-type Cry1Ac. Our findings establish that the evolution of Bt toxins with novel insect cell receptor affinity can overcome Bt toxin resistance in insects and confer lethality approaching that of the wild-type Bt toxin against non-resistant insects. PMID:27120167

Identification of a New cry1I-Type Gene as a Candidate for Gene Pyramiding in Corn To Control Ostrinia Species Larvae

PubMed Central

Zhao, Can; Abdelgaffar, Heba M.; Pan, Hongyu; Song, Fuping

2015-01-01

Pyramiding of diverse cry toxin genes from Bacillus thuringiensis with different modes of action is a desirable strategy to delay the evolution of resistance in the European corn borer (Ostrinia nubilalis). Considering the dependency of susceptibility to Cry toxins on toxin binding to receptors in the midgut of target pests, a diverse mode of action is commonly defined as recognition of unique binding sites in the target insect. In this study, we present a novel cry1Ie toxin gene (cry1Ie2) as a candidate for pyramiding with Cry1Ab or Cry1Fa in corn to control Ostrinia species larvae. The new toxin gene encodes an 81-kDa protein that is processed to a protease-resistant core form of approximately 55 kDa by trypsin digestion. The purified protoxin displayed high toxicity to Ostrinia furnacalis and O. nubilalis larvae but low to no activity against Spodoptera or heliothine species or the coleopteran Tenebrio molitor. Results of binding assays with 125I-labeled Cry1Ab toxin and brush border membrane vesicles from O. nubilalis larvae demonstrated that Cry1Ie2 does not recognize the Cry1Ab binding sites in that insect. Reciprocal competition binding assays with biotin-labeled Cry1Ie2 confirmed the lack of shared sites with Cry1Ab or Cry1Fa in O. nubilalis brush border membrane vesicles. These data support Cry1Ie2 as a good candidate for pyramiding with Cry1Ab or Cry1Fa in corn to increase the control of O. nubilalis and reduce the risk of resistance evolution. PMID:25795679

Identification of a New cry1I-Type Gene as a Candidate for Gene Pyramiding in Corn To Control Ostrinia Species Larvae.

PubMed

Zhao, Can; Jurat-Fuentes, Juan Luis; Abdelgaffar, Heba M; Pan, Hongyu; Song, Fuping; Zhang, Jie

2015-06-01

Pyramiding of diverse cry toxin genes from Bacillus thuringiensis with different modes of action is a desirable strategy to delay the evolution of resistance in the European corn borer (Ostrinia nubilalis). Considering the dependency of susceptibility to Cry toxins on toxin binding to receptors in the midgut of target pests, a diverse mode of action is commonly defined as recognition of unique binding sites in the target insect. In this study, we present a novel cry1Ie toxin gene (cry1Ie2) as a candidate for pyramiding with Cry1Ab or Cry1Fa in corn to control Ostrinia species larvae. The new toxin gene encodes an 81-kDa protein that is processed to a protease-resistant core form of approximately 55 kDa by trypsin digestion. The purified protoxin displayed high toxicity to Ostrinia furnacalis and O. nubilalis larvae but low to no activity against Spodoptera or heliothine species or the coleopteran Tenebrio molitor. Results of binding assays with (125)I-labeled Cry1Ab toxin and brush border membrane vesicles from O. nubilalis larvae demonstrated that Cry1Ie2 does not recognize the Cry1Ab binding sites in that insect. Reciprocal competition binding assays with biotin-labeled Cry1Ie2 confirmed the lack of shared sites with Cry1Ab or Cry1Fa in O. nubilalis brush border membrane vesicles. These data support Cry1Ie2 as a good candidate for pyramiding with Cry1Ab or Cry1Fa in corn to increase the control of O. nubilalis and reduce the risk of resistance evolution. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Evaluation of Cytotoxicity, Genotoxicity and Hematotoxicity of the Recombinant Spore-Crystal Complexes Cry1Ia, Cry10Aa and Cry1Ba6 from Bacillus thuringiensis in Swiss Mice

PubMed Central

de Souza Freire, Ingrid; Miranda-Vilela, Ana Luisa; Barbosa, Lilian Carla Pereira; Martins, Erica Soares; Monnerat, Rose Gomes; Grisolia, Cesar Koppe

2014-01-01

The insecticidal properties of Cry-endotoxins from Bacillus thuringiensis (Bt) have long been used as spore-crystals in commercial spray formulations for insect control. Recently, some Bt-endotoxin genes have been cloned in many different plants. Toxicological evaluations of three spore-crystal endotoxins, BtCry1Ia, BtCry10Aa and BtCry1Ba6 from B. thuringiensis, were carried out on mice to understand their adverse effects on hematological systems and on genetic material. These three spore-crystals have shown toxic activity to the boll weevil, which is one of the most aggressive pests of the cotton crop. Cry1Ia, Cry10Aa and Cry1Ba6 did not increase the micronucleus frequency in the peripheral erythrocytes of mice and did not cause changes in the frequency of polychromatic erythrocytes. However, some hematologic disburbances were observed, specifically related to Cry1Ia and Cry1Ba6, respectively, for the erythroid and lymphoid lineage. Thus, although the profile of such adverse side effects can be related to their high level of exposure, which is not commonly found in the environment, results showed that these Bt spore-crystals were not harmless to mice, indicating that each spore-crystal endotoxin presents a characteristic profile of toxicity and might be investigated individually. PMID:25268978

A cryptochrome-like protein is involved in the regulation of photosynthesis genes in Rhodobacter sphaeroides.

PubMed

Hendrischk, Anne-Kathrin; Frühwirth, Sebastian Walter; Moldt, Julia; Pokorny, Richard; Metz, Sebastian; Kaiser, Gebhard; Jäger, Andreas; Batschauer, Alfred; Klug, Gabriele

2009-11-01

Blue light receptors belonging to the cryptochrome/photolyase family are found in all kingdoms of life. The functions of photolyases in repair of UV-damaged DNA as well as of cryptochromes in the light-dependent regulation of photomorphogenetic processes and in the circadian clock in plants and animals are well analysed. In prokaryotes, the only role of members of this protein family that could be demonstrated is DNA repair. Recently, we identified a gene for a cryptochrome-like protein (CryB) in the alpha-proteobacterium Rhodobacter sphaeroides. The protein lacks the typical C-terminal extension of cryptochromes, and is not related to the Cry DASH family. Here we demonstrate that CryB binds flavin adenine dinucleotide that can be photoreduced by blue light. CryB binds single-stranded DNA with very high affinity (K(d) approximately 10(-8) M) but double-stranded DNA and single-stranded RNA with far lower affinity (K(d) approximately 10(-6) M). Despite of that, no in vitro repair activity for pyrimidine dimers in single-stranded DNA could be detected. However, we show that CryB clearly affects the expression of genes for pigment-binding proteins and consequently the amount of photosynthetic complexes in R. sphaeroides. Thus, for the first time a role of a bacterial cryptochrome in gene regulation together with a biological function is demonstrated.

Formation of a repressive complex in the mammalian circadian clock is mediated by the secondary pocket of CRY1

DOE PAGES

Michael, Alicia K.; Fribourgh, Jennifer L.; Chelliah, Yogarany; ...

2017-01-31

The basic helix-loop-helix PAS domain (bHLH-PAS) transcription factor CLOCK:BMAL1 (brain and muscle Arnt-like protein 1) sits at the core of the mammalian circadian transcription/translation feedback loop. Precise control of CLOCK:BMAL1 activity by coactivators and repressors establishes the ~24-h periodicity of gene expression. Formation of a repressive complex, defined by the core clock proteins cryptochrome 1 (CRY1):CLOCK:BMAL1, plays an important role controlling the switch from repression to activation each day. Here in this paper, we show that CRY1 binds directly to the PAS domain core of CLOCK: BMAL1, driven primarily by interaction with the CLOCK PAS-B domain. Integrative modeling and solutionmore » X-ray scattering studies unambiguously position a key loop of the CLOCK PAS-B domain in the secondary pocket of CRY1, analogous to the antenna chromophore-binding pocket of photolyase. CRY1 docks onto the transcription factor alongside the PAS domains, extending above the DNA-binding bHLH domain. Single point mutations at the interface on either CRY1 or CLOCK disrupt formation of the ternary complex, highlighting the importance of this interface for direct regulation of CLOCK:BMAL1 activity by CRY1.« less

Localization of Bacillus thuringiensis Cry1A toxin-binding molecules in gypsy moth larval gut sections using fluorescence microscopy

Treesearch

Algimantas P. Valaitis

2011-01-01

The microbial insecticide Bacillus thuringiensis (Bt) produces Cry toxins, proteins that bind to the brush border membranes of gut epithelial cells of insects that ingest it, disrupting the integrity of the membranes, and leading to cell lysis and insect death. In gypsy moth, Lymantria dispar, two toxin-binding molecules for the...

DOE Office of Scientific and Technical Information (OSTI.GOV)

Michael, Alicia K.; Fribourgh, Jennifer L.; Chelliah, Yogarany

The basic helix-loop-helix PAS domain (bHLH-PAS) transcription factor CLOCK:BMAL1 (brain and muscle Arnt-like protein 1) sits at the core of the mammalian circadian transcription/translation feedback loop. Precise control of CLOCK:BMAL1 activity by coactivators and repressors establishes the ~24-h periodicity of gene expression. Formation of a repressive complex, defined by the core clock proteins cryptochrome 1 (CRY1):CLOCK:BMAL1, plays an important role controlling the switch from repression to activation each day. Here in this paper, we show that CRY1 binds directly to the PAS domain core of CLOCK: BMAL1, driven primarily by interaction with the CLOCK PAS-B domain. Integrative modeling and solutionmore » X-ray scattering studies unambiguously position a key loop of the CLOCK PAS-B domain in the secondary pocket of CRY1, analogous to the antenna chromophore-binding pocket of photolyase. CRY1 docks onto the transcription factor alongside the PAS domains, extending above the DNA-binding bHLH domain. Single point mutations at the interface on either CRY1 or CLOCK disrupt formation of the ternary complex, highlighting the importance of this interface for direct regulation of CLOCK:BMAL1 activity by CRY1.« less

The Macrophage Activation Induced by Bacillus thuringiensis Cry1Ac Protoxin Involves ERK1/2 and p38 Pathways and the Interaction with Cell-Surface-HSP70.

PubMed

Rubio-Infante, Nestor; Ilhuicatzi-Alvarado, Damaris; Torres-Martínez, Marilu; Reyes-Grajeda, Juan Pablo; Nava-Acosta, Raúl; González-González, Edith; Moreno-Fierros, Leticia

2018-01-01

Here, we aimed to further characterize the mechanisms involved in protoxin (p) Cry1Ac-induced macrophage activation. We demonstrated that pCry1Ac induces MAPK ERK1/2, p38, and JNK phosphorylation in RAW264.7 macrophages. Because MAPK activation is mainly triggered via ligand-receptor interactions, we focused on the identification of potential pCry1Ac-receptor proteins. Flow cytometry and confocal analysis showed specific saturable pCry1Ac-binding to the macrophage surface and evidenced its internalization via the clathrin-pathway. We performed immunoprecipitation assays and identified by MALDI-TOF-TOF several possible pCry1Ac-binding proteins, such as heat shock proteins (HSPs), vimentin, α-enolase, and actin; whose interaction and presence was confirmed, respectively, by ligand blot and Western blot assays. We also detected cell-surface (cs) pCry1Ac-HSP70 colocalization, so HSP70 was chosen for further characterization. Co-immunoprecipitation with HSP70 antibodies followed by Western blot confirmed the pCry1Ac-HSP70 interaction. Furthermore, pretreatment of RAW264.7 cells with HSP70 antibodies reduced pCry1Ac-induced ERK1 phosphorylation and MCP-1 production; thus suggest the functional participation of csHSP70 in pCry1Ac-induced macrophage activation. csHSP70 also was evaluated in peritoneal-cavity (PerC) macrophages of untreated BALB/c mice, interestingly it was found that the predominant population namely large-peritoneal-macrophages (LPM) displayed csHSP70 + hi. Furthermore, the dynamics of PerC macrophage subsets, LPM, and small-peritoneal macrophages (SPM) were evaluated in response to in vivo pCry1Ac stimuli in presence or not of phenylethynesulfonamide (PES) a functional HSP70 inhibitor. It was found that pCry1Ac increased the proportion of SPM CD11b + F4/80 + lowMHCII + csHSP70 + low and markedly reduced the amount of LPM CD11b + F4/80 + hiMHCII-csHSP70 + hi; while PES, partially suppressed this pCry1Ac-induced effect, further suggesting the participation of HSP70 in macrophage activation process. J. Cell. Biochem. 119: 580-598, 2018. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

Two conformational states of the membrane-associated Bacillus thuringiensis Cry4Ba {delta}-endotoxin complex revealed by electron crystallography: Implications for toxin-pore formation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ounjai, Puey; Laboratory of Molecular Biophysics and Structural Biochemistry, Institute of Molecular Biology and Genetics, Mahidol University, Salaya Campus, Nakornpathom 73170; Unger, Vinzenz M.

The insecticidal nature of Cry {delta}-endotoxins produced by Bacillus thuringiensis is generally believed to be caused by their ability to form lytic pores in the midgut cell membrane of susceptible insect larvae. Here we have analyzed membrane-associated structures of the 65-kDa dipteran-active Cry4Ba toxin by electron crystallography. The membrane-associated toxin complex was crystallized in the presence of DMPC via detergent dialysis. Depending upon the charge of the adsorbed surface, 2D crystals of the oligomeric toxin complex have been captured in two distinct conformations. The projection maps of those crystals have been generated at 17 A resolution. Both complexes appeared tomore » be trimeric; as in one crystal form, its projection structure revealed a symmetrical pinwheel-like shape with virtually no depression in the middle of the complex. The other form revealed a propeller-like conformation displaying an obvious hole in the center region, presumably representing the toxin-induced pore. These crystallographic data thus demonstrate for the first time that the 65-kDa activated Cry4Ba toxin in association with lipid membranes could exist in at least two different trimeric conformations, conceivably implying the closed and open states of the pore.« less

In Vivo and In Vitro Binding of Vip3Aa to Spodoptera frugiperda Midgut and Characterization of Binding Sites by 125I Radiolabeling

PubMed Central

Chakroun, Maissa

2014-01-01

Bacillus thuringiensis vegetative insecticidal proteins (Vip3A) have been recently introduced in important crops as a strategy to delay the emerging resistance to the existing Cry toxins. The mode of action of Vip3A proteins has been studied in Spodoptera frugiperda with the aim of characterizing their binding to the insect midgut. Immunofluorescence histological localization of Vip3Aa in the midgut of intoxicated larvae showed that Vip3Aa bound to the brush border membrane along the entire apical surface. The presence of fluorescence in the cytoplasm of epithelial cells seems to suggest internalization of Vip3Aa or a fragment of it. Successful radiolabeling and optimization of the binding protocol for the 125I-Vip3Aa to S. frugiperda brush border membrane vesicles (BBMV) allowed the determination of binding parameters of Vip3A proteins for the first time. Heterologous competition using Vip3Ad, Vip3Ae, and Vip3Af as competitor proteins showed that they share the same binding site with Vip3Aa. In contrast, when using Cry1Ab and Cry1Ac as competitors, no competitive binding was observed, which makes them appropriate candidates to be used in combination with Vip3A proteins in transgenic crops. PMID:25002420

Bacillus thuringiensis monogenic strains: screening and interactions with insecticides used against rice pests

PubMed Central

Pinto, Laura M.N.; Dörr, Natália C.; Ribeiro, Ana Paula A.; de Salles, Silvia M.; de Oliveira, Jaime V.; Menezes, Valmir G.; Fiuza, Lidia M.

2012-01-01

The screening of Bacillus thuringiensis (Bt) Cry proteins with high potential to control insect pests has been the goal of numerous research groups. In this study, we evaluated six monogenic Bt strains (Bt dendrolimus HD-37, Bt kurstaki HD-1, Bt kurstaki HD-73, Bt thuringiensis 4412, Bt kurstaki NRD-12 and Bt entomocidus 60.5, which codify the cry1Aa, cry1Ab, cry1Ac, cry1Ba, cry1C, cry2A genes respectively) as potential insecticides for the most important insect pests of irrigated rice: Spodoptera frugiperda, Diatraea saccharalis, Oryzophagus oryzae, Oebalus poecilus and Tibraca limbativentris. We also analyzed their compatibility with chemical insecticides (thiamethoxam, labdacyhalothrin, malathion and fipronil), which are extensively used in rice crops. The bioassay results showed that Bt thuringiensis 4412 and Bt entomocidus 60.5 were the most toxic for the lepidopterans, with a 93% and 82% mortality rate for S. frugiperda and D. saccharalis, respectively. For O. oryzae, the Bt kurstaki NRD-12 (64%) and Bt dendrolimus HD-37 (62%) strains were the most toxic. The Bt dendrolimus HD-37 strain also caused high mortality (82%) to O. poecilus, however the strains assessed to T. limbativentris caused a maximum rate of 5%. The assays for the Bt strains interaction with insecticides revealed the compatibility of the six strains with the four insecticides tested. The results from this study showed the high potential of cry1Aa and cry1Ba genes for genetic engineering of rice plants or the strains to biopesticide formulations. PMID:24031872

FRET Imaging of Diatoms Expressing a Biosilica-Localized Ribose Sensor

PubMed Central

Marshall, Kathryn E.; Robinson, Errol W.; Hengel, Shawna M.; Paša-Tolić, Ljiljana; Roesijadi, Guritno

2012-01-01

Future materials are envisioned to include bio-assembled, hybrid, three-dimensional nanosystems that incorporate functional proteins. Diatoms are amenable to genetic modification for localization of recombinant proteins in the biosilica cell wall. However, the full range of protein functionalities that can be accommodated by the modified porous biosilica has yet to be described. Our objective was to functionalize diatom biosilica with a reagent-less sensor dependent on ligand-binding and conformational change to drive FRET-based signaling capabilities. A fusion protein designed to confer such properties included a bacterial periplasmic ribose binding protein (R) flanked by CyPet (C) and YPet (Y), cyan and yellow fluorescent proteins that act as a FRET pair. The structure and function of the CRY recombinant chimeric protein was confirmed by expression in E. coli prior to transformation of the diatom Thalassiosira pseudonana. Mass spectrometry of the recombinant CRY showed 97% identity with the deduced amino acid sequence. CRY with and without an N-terminal Sil3 tag for biosilica localization exhibited characteristic ribose-dependent changes in FRET, with similar dissociation constants of 123.3 µM and 142.8 µM, respectively. The addition of the Sil3 tag did not alter the affinity of CRY for the ribose substrate. Subsequent transformation of T. pseudonana with a vector encoding Sil3-CRY resulted in fluorescence localization in the biosilica and changes in FRET in both living cells and isolated frustules in response to ribose. This work demonstrated that the nano-architecture of the genetically modified biosilica cell wall was able to support the functionality of the relatively complex Sil3-CyPet-RBP-YPet fusion protein with its requirement for ligand-binding and conformational change for FRET-signal generation. PMID:22470473

FRET imaging of diatoms expressing a biosilica-localized ribose sensor.

PubMed

Marshall, Kathryn E; Robinson, Errol W; Hengel, Shawna M; Paša-Tolić, Ljiljana; Roesijadi, Guritno

2012-01-01

Future materials are envisioned to include bio-assembled, hybrid, three-dimensional nanosystems that incorporate functional proteins. Diatoms are amenable to genetic modification for localization of recombinant proteins in the biosilica cell wall. However, the full range of protein functionalities that can be accommodated by the modified porous biosilica has yet to be described. Our objective was to functionalize diatom biosilica with a reagent-less sensor dependent on ligand-binding and conformational change to drive FRET-based signaling capabilities. A fusion protein designed to confer such properties included a bacterial periplasmic ribose binding protein (R) flanked by CyPet (C) and YPet (Y), cyan and yellow fluorescent proteins that act as a FRET pair. The structure and function of the CRY recombinant chimeric protein was confirmed by expression in E. coli prior to transformation of the diatom Thalassiosira pseudonana. Mass spectrometry of the recombinant CRY showed 97% identity with the deduced amino acid sequence. CRY with and without an N-terminal Sil3 tag for biosilica localization exhibited characteristic ribose-dependent changes in FRET, with similar dissociation constants of 123.3 µM and 142.8 µM, respectively. The addition of the Sil3 tag did not alter the affinity of CRY for the ribose substrate. Subsequent transformation of T. pseudonana with a vector encoding Sil3-CRY resulted in fluorescence localization in the biosilica and changes in FRET in both living cells and isolated frustules in response to ribose. This work demonstrated that the nano-architecture of the genetically modified biosilica cell wall was able to support the functionality of the relatively complex Sil3-CyPet-RBP-YPet fusion protein with its requirement for ligand-binding and conformational change for FRET-signal generation.

Isolation and partial characterization of gypsy moth BTR-270, an anionic brush border membrane glycoconjugate that binds Bacillus thuringiensis Cry1A toxins with high affinity

Treesearch

Algimantas P. Valaitis; Jeremy L. Jenkins; Mi Kyong Lee; Donald H. Dean; Karen J. Garner

2001-01-01

BTR-270, a gypsy moth (Lymantria dispar) brush border membrane molecule that binds Bacillus thuringiensis (Bt) Cry1A toxins with high affinity, was purified by preparative gel electrophoresis. Rabbit antibodies specific for the Bt toxin-binding molecule were raised. Attempts to label BTR-270 by protein-directed techniques were...

Analysis of Homologs of Cry-toxin Receptor-Related Proteins in the Midgut of a Non-Bt Target, Nilaparvata lugens (Stål) (Hemiptera: Delphacidae)

PubMed Central

Shao, Ensi; Lin, Li; Liu, Sijun; Zhang, Jiao; Chen, Xuelin; Sha, Li; Huang, Zhipeng; Huang, Biwang; Guan, Xiong

2018-01-01

Abstract The brown planthopper (BPH) Nilaparvata lugens is one of the most destructive insect pests in the rice fields of Asia. Like other hemipteran insects, BPH is not susceptible to Cry toxins of Bacillus thuringiensis (Bt) or transgenic rice carrying Bt cry genes. Lack of Cry receptors in the midgut is one of the main reasons that BPH is not susceptible to the Cry toxins. The main Cry-binding proteins (CBPs) of the susceptible insects are cadherin, aminopeptidase N (APN), and alkaline phosphatase (ALP). In this study, we analyzed and validated de novo assembled transcripts from transcriptome sequencing data of BPH to identify and characterize homologs of cadherin, APN, and ALP. We then compared the cadherin-, APN-, and ALP-like proteins of BPH to previously reported CBPs to identify their homologs in BPH. The sequence analysis revealed that at least one cadherin, one APN, and two ALPs of BPH contained homologous functional domains identified from the Cry-binding cadherin, APN, and ALP, respectively. Quantitative real-time polymerase chain reaction used to verify the expression level of each putative Cry receptor homolog in the BPH midgut indicated that the CBPs homologous APN and ALP were expressed at high or medium-high levels while the cadherin was expressed at a low level. These results suggest that homologs of CBPs exist in the midgut of BPH. However, differences in key motifs of CBPs, which are functional in interacting with Cry toxins, may be responsible for insusceptibility of BPH to Cry toxins. PMID:29415259

Toxicity and mode of action of insecticidal Cry1A proteins from Bacillus thuringiensis in an insect cell line, CF-1.

PubMed

Portugal, Leivi; Gringorten, J Lawrence; Caputo, Guido F; Soberón, Mario; Muñoz-Garay, Carlos; Bravo, Alejandra

2014-03-01

Bacillus thuringiensis Cry toxins are insecticidal proteins used to control insect pests. The interaction of Cry toxins with the midgut of susceptible insects is a dynamic process involving activation of the toxin, binding to midgut receptors in the apical epithelium and conformational changes in the toxin molecule, leading to pore formation and cell lysis. An understanding of the molecular events underlying toxin mode of action is essential for the continued use of Cry toxins. In this work, we examined the mechanism of action of Cry1A toxins in the lepidopteran cell line CF-1, using native Cry1Ab and mutant forms of this protein that interfer with different steps in the mechanism of action, specifically, receptor binding, oligomerization or pore formation. These mutants lost activity against both Manduca sexta larvae and CF-1 cells. We also analyzed a mutation created in domain I of Cry1Ab, in which helix α-1 and part of helix α-2 were deleted (Cry1AbMod). Cry1AbMod is able to oligomerize in the absence of toxin receptors, and although it shows reduced activity against some susceptible insects, it kills insect pests that have developed resistance to native Cry1Ab. Cry1AbMod showed enhanced toxicity to CF-1, suggesting that oligomerization of native Cry1Ab may be a limiting step in its activity against CF-1 cells. The toxicity of Cry1Ac and Cry1AcMod were also analyzed. Our results suggest that some of the steps in the mode of action of Cry1A toxins are conserved in vivo in insect midgut cells and in vitro in an established cell line, CF-1. Copyright © 2013 Elsevier Inc. All rights reserved.

Expression of Cry1Ac toxin-binding region in Plutella xyllostella cadherin-like receptor and studying their interaction mode by molecular docking and site-directed mutagenesis.

PubMed

Hu, Xiaodan; Zhang, Xiao; Zhong, Jianfeng; Liu, Yuan; Zhang, Cunzheng; Xie, Yajing; Lin, Manman; Xu, Chongxin; Lu, Lina; Zhu, Qing; Liu, Xianjin

2018-05-01

Cadherin-like protein has been identified as the primary Bacillus thuringiensis (Bt) Cry toxin receptor in Lepidoptera pests and plays a key role in Cry toxin insecticidal. In this study, we successfully expressed the putative Cry1Ac toxin-binding region (CR7-CR11) of Plutella xylostella cadherin-like in Escherichia coli BL21 (DE3). The expressed CR7-CR11 fragment showed binding ability to Cry1Ac toxin under denaturing (Ligand blot) and non-denaturing (ELISA) conditions. The three-dimensional structure of CR7-CR11 was constructed by homology modeling. Molecular docking results of CR7-CR11 and Cry1Ac showed that domain II and domain III of Cry1Ac were taking part in binding to CR7-CR11, while CR7-CR8 was the region of CR7-CR11 in interacting with Cry1Ac. The interaction of toxin-receptor complex was found to arise from hydrogen bond and hydrophobic interaction. Through the computer-aided alanine mutation scanning, amino acid residues of Cry1Ac (Met341, Asn442 and Ser486) and CR7-CR11 (Asp32, Arg101 and Arg127) were predicted as the hot spot residues involved in the interaction of the toxin-receptor complex. At last, we verified the importance role of these key amino acid residues by binding assay. These results will lay a foundation for further elucidating the insecticidal mechanism of Cry toxin and enhancing Cry toxin insecticidal activity by molecular modification. Copyright © 2018 Elsevier B.V. All rights reserved.

Interaction of two photoreceptors in the regulation of bacterial photosynthesis genes

PubMed Central

Metz, Sebastian; Haberzettl, Kerstin; Frühwirth, Sebastian; Teich, Kristin; Hasewinkel, Christian; Klug, Gabriele

2012-01-01

The expression of photosynthesis genes in the facultatively photosynthetic bacterium Rhodobacter sphaeroides is controlled by the oxygen tension and by light quantity. Two photoreceptor proteins, AppA and CryB, have been identified in the past, which are involved in this regulation. AppA senses light by its N-terminal BLUF domain, its C-terminal part binds heme and is redox-responsive. Through its interaction to the transcriptional repressor PpsR the AppA photoreceptor controls expression of photosynthesis genes. The cryptochrome-like protein CryB was shown to affect regulation of photosynthesis genes, but the underlying signal chain remained unknown. Here we show that CryB interacts with the C-terminal domain of AppA and modulates the binding of AppA to the transcriptional repressor PpsR in a light-dependent manner. Consequently, binding of the transcription factor PpsR to its DNA target is affected by CryB. In agreement with this, all genes of the PpsR regulon showed altered expression levels in a CryB deletion strain after blue-light illumination. These results elucidate for the first time how a bacterial cryptochrome affects gene expression. PMID:22434878

Interaction of two photoreceptors in the regulation of bacterial photosynthesis genes.

PubMed

Metz, Sebastian; Haberzettl, Kerstin; Frühwirth, Sebastian; Teich, Kristin; Hasewinkel, Christian; Klug, Gabriele

2012-07-01

The expression of photosynthesis genes in the facultatively photosynthetic bacterium Rhodobacter sphaeroides is controlled by the oxygen tension and by light quantity. Two photoreceptor proteins, AppA and CryB, have been identified in the past, which are involved in this regulation. AppA senses light by its N-terminal BLUF domain, its C-terminal part binds heme and is redox-responsive. Through its interaction to the transcriptional repressor PpsR the AppA photoreceptor controls expression of photosynthesis genes. The cryptochrome-like protein CryB was shown to affect regulation of photosynthesis genes, but the underlying signal chain remained unknown. Here we show that CryB interacts with the C-terminal domain of AppA and modulates the binding of AppA to the transcriptional repressor PpsR in a light-dependent manner. Consequently, binding of the transcription factor PpsR to its DNA target is affected by CryB. In agreement with this, all genes of the PpsR regulon showed altered expression levels in a CryB deletion strain after blue-light illumination. These results elucidate for the first time how a bacterial cryptochrome affects gene expression.

Drosophila small heat shock protein CryAB ensures structural integrity of developing muscles, and proper muscle and heart performance.

PubMed

Wójtowicz, Inga; Jabłońska, Jadwiga; Zmojdzian, Monika; Taghli-Lamallem, Ouarda; Renaud, Yoan; Junion, Guillaume; Daczewska, Malgorzata; Huelsmann, Sven; Jagla, Krzysztof; Jagla, Teresa

2015-03-01

Molecular chaperones, such as the small heat shock proteins (sHsps), maintain normal cellular function by controlling protein homeostasis in stress conditions. However, sHsps are not only activated in response to environmental insults, but also exert developmental and tissue-specific functions that are much less known. Here, we show that during normal development the Drosophila sHsp CryAB [L(2)efl] is specifically expressed in larval body wall muscles and accumulates at the level of Z-bands and around myonuclei. CryAB features a conserved actin-binding domain and, when attenuated, leads to clustering of myonuclei and an altered pattern of sarcomeric actin and the Z-band-associated actin crosslinker Cheerio (filamin). Our data suggest that CryAB and Cheerio form a complex essential for muscle integrity: CryAB colocalizes with Cheerio and, as revealed by mass spectrometry and co-immunoprecipitation experiments, binds to Cheerio, and the muscle-specific attenuation of cheerio leads to CryAB-like sarcomeric phenotypes. Furthermore, muscle-targeted expression of CryAB(R120G), which carries a mutation associated with desmin-related myopathy (DRM), results in an altered sarcomeric actin pattern, in affected myofibrillar integrity and in Z-band breaks, leading to reduced muscle performance and to marked cardiac arrhythmia. Taken together, we demonstrate that CryAB ensures myofibrillar integrity in Drosophila muscles during development and propose that it does so by interacting with the actin crosslinker Cheerio. The evidence that a DRM-causing mutation affects CryAB muscle function and leads to DRM-like phenotypes in the fly reveals a conserved stress-independent role of CryAB in maintaining muscle cell cytoarchitecture. © 2015. Published by The Company of Biologists Ltd.

Analysis of cross-resistance to Vip3 proteins in eight insect colonies selected for resistance to Bacillus thuringiensis insecticidal proteins

USDA-ARS?s Scientific Manuscript database

Bacillus thuringiensis Vip3 proteins are synthesized and secreted during the vegetative growth phase. They are activated by gut proteases, recognize and bind to midgut receptors, form pores and lyse cells. We tested the susceptibility to Vip3Aa and Vip3Ca of Cry1A-, Cry2A-, Dipel- and Vip3-resistant...

Binding of Substrate Locks the Electrochemistry of CRY-DASH into DNA Repair.

PubMed

Gindt, Yvonne M; Messyasz, Adriana; Jumbo, Pamela I

2015-05-12

VcCry1, a member of the CRY-DASH family, may serve two diverse roles in vivo, including blue-light signaling and repair of UV-damaged DNA. We have discovered that the electrochemistry of the flavin adenine dinucleotide cofactor of VcCry1 is locked to cycle only between the hydroquinone and neutral semiquinone states when UV-damaged DNA is present. Other potential substrates, including undamaged DNA and ATP, have no discernible effect on the electrochemistry, and the kinetics of the reduction is unaffected by damaged DNA. Binding of the damaged DNA substrate determines the role of the protein and prevents the presumed photochemistry required for blue-light signaling.

Comparative analysis of Bacillus thuringiensis toxin binding to gypsy moth, browntail moth, and douglas-fir tussock moth midgut tissue sections using fluorescence microscopy

Treesearch

Algimantas P. Valaitis; John D. Podgwaite

2011-01-01

Many strains of Bacillus thuringiensis (Bt) produce insecticidal proteins, also referred to as Cry toxins, in crystal inclusions during sporulation. When ingested by insects, the Cry toxins bind to receptors on the brush border midgut epithelial cells and create pores in the epithelial gut membranes resulting in the death of...

FAD Regulates CRYPTOCHROME Protein Stability and Circadian Clock in Mice.

PubMed

Hirano, Arisa; Braas, Daniel; Fu, Ying-Hui; Ptáček, Louis J

2017-04-11

The circadian clock generates biological rhythms of metabolic and physiological processes, including the sleep-wake cycle. We previously identified a missense mutation in the flavin adenine dinucleotide (FAD) binding pocket of CRYPTOCHROME2 (CRY2), a clock protein that causes human advanced sleep phase. This prompted us to examine the role of FAD as a mediator of the clock and metabolism. FAD stabilized CRY proteins, leading to increased protein levels. In contrast, knockdown of Riboflavin kinase (Rfk), an FAD biosynthetic enzyme, enhanced CRY degradation. RFK protein levels and FAD concentrations oscillate in the nucleus, suggesting that they are subject to circadian control. Knockdown of Rfk combined with a riboflavin-deficient diet altered the CRY levels in mouse liver and the expression profiles of clock and clock-controlled genes (especially those related to metabolism including glucose homeostasis). We conclude that light-independent mechanisms of FAD regulate CRY and contribute to proper circadian oscillation of metabolic genes in mammals. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

Bacillus thuringiensis delta-endotoxin binding to brush border membrane vesicles of rice stem borers.

PubMed

Alcantara, Edwin P; Aguda, Remedios M; Curtiss, April; Dean, Donald H; Cohen, Michael B

2004-04-01

The receptor binding step in the molecular mode of action of five delta-endotoxins (Cry1Ab, Cry1Ac, Cry1C, Cry2A, and Cry9C) from Bacillus thuringiensis was examined to find toxins with different receptor sites in the midgut of the striped stem borer (SSB) Chilo suppressalis (Walker) and yellow stem borer (YSB) Scirpophaga incertulas (Walker) (Lepidoptera: Pyralidae). Homologous competition assays were used to estimate binding affinities (K(com)) of (125)I-labelled toxins to brush border membrane vesicles (BBMV). The SSB BBMV affinities in decreasing order was: Cry1Ab = Cry1Ac > Cry9C > Cry2A > Cry1C. In YSB, the order of decreasing affinities was: Cry1Ac > Cry1Ab > Cry9C = Cry2A > Cry1C. The number of binding sites (B(max)) estimated by homologous competition binding among the Cry toxins did not affect toxin binding affinity (K(com)) to both insect midgut BBMVs. Results of the heterologous competition binding assays suggest that Cry1Ab and Cry1Ac compete for the same binding sites in SSB and YSB. Other toxins bind with weak (Cry1C, Cry2A) or no affinity (Cry9C) to Cry1Ab and Cry1Ac binding sites in both species. Cry2A had the lowest toxicity to 10-day-old SSB and Cry1Ab and Cry1Ac were the most toxic. Taken together, the results of this study show that Cry1Ab or Cry1Ac could be combined with either Cry1C, Cry2A, or Cry9C for more durable resistance in transgenic rice. Cry1Ab should not be used together with Cry1Ac because a mutation in one receptor site could diminish binding of both toxins. Copyright 2004 Wiley-Liss, Inc.

Development of monoclonal antibody-based sensitive ELISA for the determination of Cry1Ie protein in transgenic plant.

PubMed

Zhang, Yuwen; Zhang, Wei; Liu, Yan; Wang, Jianhua; Wang, Guoying; Liu, Yunjun

2016-11-01

Cry1Ie is a kind of Bacillus thuringiensis (Bt) toxin protein which has a different action model than the Cry1Ab and Cry1Ac protein. The transgenic maize expressing Cry1Ie might be commercially used in the near future and it is urgent to develop a method to detect Cry1Ie protein in transgenic plants and their products. To develop an ELISA method, Cry1Ie protein was expressed in Escherichia coli strain Transetta DE3, purified with the Ni-NTA spin columns, and then validated by sequencing. Bioassay results showed that the purified Cry1Ie protein was highly toxic to the Asian corn borer. The polyclonal antibody (pAb) and the specific monoclonal antibody (mAb) 1G 4 2D 6 were generated from rabbit and mice which were immunized with Cry1Ie protein, respectively. Western blotting of crude Cry1Ie protein extracts was established by employing mAb 1G 4 2D 6 , whereas the mAb 1G 4 2D 6 negligibly recognized other Bt proteins. Sandwich ELISA against Cry1Ie protein was established by coating with pAb and detecting with mAb 1G 4 2D 6 . The limit of detection (LOD), the limit of quantification (LOQ), and the quantification range of the assay in different matrices of maize plant were determined as 0.27-0.51, 0.29-0.78, and 0.45-15.71 ng/mL, respectively. Recoveries of Cry1Ie protein spiked in different maize tissues ranged from 75.1 to 99.5 %. The established sandwich ELISA was verified using transgenic maize overexpressing Cry1Ie. The results in this study suggested that the established ELISA method is effective for detecting Cry1Ie protein in transgenic plants.

Down-regulation of aminopeptidase N and ABC transporter subfamily G transcripts in Cry1Ab and Cry1Ac resistant Asian corn borer, Ostrina furnacalis (Lepidoptera: Crambidae)

USDA-ARS?s Scientific Manuscript database

Bacillus thuringiensis (Bt) crystalline protein (Cry) toxins cause mortality by a mechanism involving pore formation or signal transduction following toxin binding to receptors along the midgut lumen of susceptible insects, but this mechanism and mutations therein that lead to resistance remain poor...

Analysis of cross-resistance to Vip3 proteins in eight insect colonies, from four insect species, selected for resistance to Bacillus thuringiensis insecticidal proteins.

PubMed

Gomis-Cebolla, Joaquín; Wang, Yuequin; Quan, Yudong; He, Kanglai; Walsh, Tom; James, Bill; Downes, Sharon; Kain, Wendy; Wang, Ping; Leonard, Kathy; Morgan, Tom; Oppert, Brenda; Ferré, Juan

2018-05-16

Bacillus thuringiensis Vip3 proteins are synthesized and secreted during the vegetative growth phase. They are activated by gut proteases, recognize and bind to midgut receptors, form pores and lyse cells. We tested the susceptibility to Vip3Aa and Vip3Ca of Cry1A-, Cry2A-, Dipel- and Vip3-resistant insect colonies from different species to determine whether resistance to other insecticidal proteins confers cross-resistance to Vip3 proteins. As expected, the colonies resistant to Cry1A proteins, Dipel (Helicoverpa armigera, Trichoplusia ni, Ostrinia furnacalis and Plodia interpunctella) or Cry2Ab (H. armigera and T. ni) were not cross-resistant to Vip3 proteins. In contrast, H. armigera colonies resistant to Vip3Aa or Vip3Aa/Cry2Ab showed cross-resistance to the Vip3Ca protein. Moreover, the Vip3Ca protein was highly toxic to O. furnacalis (LC 50 not significantly different from that of Cry1Ab), whereas the Vip3Aa protein only showed moderate growth inhibition at the highest concentration tested (100 µg/g of diet). These results extend the cross-resistance studies between Vip3 and Cry proteins, show for the first time cross-resistance between proteins within the Vip3 subfamily, and points to O. furnacalis as a target for the Vip3Ca protein. Copyright © 2018 Elsevier Inc. All rights reserved.

Photocycle dynamics of the E149A mutant of cryptochrome 3 from Arabidopsis thaliana.

PubMed

Zirak, P; Penzkofer, A; Moldt, J; Pokorny, R; Batschauer, A; Essen, L-O

2009-11-09

The E149A mutant of the cryDASH member cryptochrome 3 (cry3) from Arabidopsis thaliana was characterized in vitro by optical absorption and emission spectroscopic studies. The mutant protein non-covalently binds the chromophore flavin adenine dinucleotide (FAD). In contrast to the wild-type protein it does not bind N5,N10-methenyl-5,6,7,8-tetrahydrofolate (MTHF). Thus, the photo-dynamics caused by FAD is accessible without the intervening coupling with MTHF. In dark adapted cry3-E149A, FAD is present in the oxidized form (FAD(ox)), semiquinone form (FADH(.)), and anionic hydroquinone form (FAD(red)H(-)). Blue-light photo-excitation of previously unexposed cry3-E149A transfers FAD(ox) to the anionic semiquinone form (FAD()(-)) with a quantum efficiency of about 2% and a back recovery time of about 10s (photocycle I). Prolonged photo-excitation leads to an irreversible protein re-conformation with structure modification of the U-shaped FAD and enabling proton transfer. Thus, a change in the photocycle dynamics occurs with photo-conversion of FAD(ox) to FADH(.), FADH(.) to FAD(red)H(-), and thermal back equilibration in the dark (photocycle II). The photocycle dynamics of cry3-E149A is compared with the photocycle behaviour of wild-type cry3 and other photo-sensory cryptochromes.

Bombyx mori ABC transporter C2 structures responsible for the receptor function of Bacillus thuringiensis Cry1Aa toxin.

PubMed

Tanaka, Shiho; Endo, Haruka; Adegawa, Satomi; Iizuka, Ami; Imamura, Kazuhiro; Kikuta, Shingo; Sato, Ryoichi

2017-12-01

Because Bombyx mori ABC transporter C2 (BmABCC2) has 1000-fold higher potential than B. mori cadherin-like protein as a receptor for Bacillus thuringiensis Cry1Aa toxin (Tanaka et al., 2013), the gate-opening ability of the latent pore under six extracellular loops (ECLs) of BmABCC2 was expected to be the reason for its higher potential (Heckel, 2012). In this study, cell swelling assays in Sf9 cells showed that BmABCC2 mutants lacking substrate-excreting activity retained receptor activity, indicating that the gate-opening activity of BmABCC2 is not responsible for Cry1Aa toxicity. The analysis of 29 BmABCC2 mutants demonstrated that 770 DYWL 773 of ECL 4 comprise a putative binding site to Cry1Aa. This suggests that specific toxicity of Cry1Aa toxin to a restricted range of lepidopteran insects is dependent on conservation and variation in the amino acid residues around 770 DYWL 773 of ECL 4 in the ABCC2. Copyright © 2017 Elsevier Ltd. All rights reserved.

Transcriptome profiling of the intoxication response of Tenebrio molitor larvae to Bacillus thuringiensis Cry3Aa protoxin.

PubMed

Oppert, Brenda; Dowd, Scot E; Bouffard, Pascal; Li, Lewyn; Conesa, Ana; Lorenzen, Marcé D; Toutges, Michelle; Marshall, Jeremy; Huestis, Diana L; Fabrick, Jeff; Oppert, Cris; Jurat-Fuentes, Juan Luis

2012-01-01

Bacillus thuringiensis (Bt) crystal (Cry) proteins are effective against a select number of insect pests, but improvements are needed to increase efficacy and decrease time to mortality for coleopteran pests. To gain insight into the Bt intoxication process in Coleoptera, we performed RNA-Seq on cDNA generated from the guts of Tenebrio molitor larvae that consumed either a control diet or a diet containing Cry3Aa protoxin. Approximately 134,090 and 124,287 sequence reads from the control and Cry3Aa-treated groups were assembled into 1,318 and 1,140 contigs, respectively. Enrichment analyses indicated that functions associated with mitochondrial respiration, signalling, maintenance of cell structure, membrane integrity, protein recycling/synthesis, and glycosyl hydrolases were significantly increased in Cry3Aa-treated larvae, whereas functions associated with many metabolic processes were reduced, especially glycolysis, tricarboxylic acid cycle, and fatty acid synthesis. Microarray analysis was used to evaluate temporal changes in gene expression after 6, 12 or 24 h of Cry3Aa exposure. Overall, microarray analysis indicated that transcripts related to allergens, chitin-binding proteins, glycosyl hydrolases, and tubulins were induced, and those related to immunity and metabolism were repressed in Cry3Aa-intoxicated larvae. The 24 h microarray data validated most of the RNA-Seq data. Of the three intoxication intervals, larvae demonstrated more differential expression of transcripts after 12 h exposure to Cry3Aa. Gene expression examined by three different methods in control vs. Cry3Aa-treated larvae at the 24 h time point indicated that transcripts encoding proteins with chitin-binding domain 3 were the most differentially expressed in Cry3Aa-intoxicated larvae. Overall, the data suggest that T. molitor larvae mount a complex response to Cry3Aa during the initial 24 h of intoxication. Data from this study represent the largest genetic sequence dataset for T. molitor to date. Furthermore, the methods in this study are useful for comparative analyses in organisms lacking a sequenced genome.

Transcriptome Profiling of the Intoxication Response of Tenebrio molitor Larvae to Bacillus thuringiensis Cry3Aa Protoxin

PubMed Central

Oppert, Brenda; Dowd, Scot E.; Bouffard, Pascal; Li, Lewyn; Conesa, Ana; Lorenzen, Marcé D.; Toutges, Michelle; Marshall, Jeremy; Huestis, Diana L.; Fabrick, Jeff; Oppert, Cris; Jurat-Fuentes, Juan Luis

2012-01-01

Bacillus thuringiensis (Bt) crystal (Cry) proteins are effective against a select number of insect pests, but improvements are needed to increase efficacy and decrease time to mortality for coleopteran pests. To gain insight into the Bt intoxication process in Coleoptera, we performed RNA-Seq on cDNA generated from the guts of Tenebrio molitor larvae that consumed either a control diet or a diet containing Cry3Aa protoxin. Approximately 134,090 and 124,287 sequence reads from the control and Cry3Aa-treated groups were assembled into 1,318 and 1,140 contigs, respectively. Enrichment analyses indicated that functions associated with mitochondrial respiration, signalling, maintenance of cell structure, membrane integrity, protein recycling/synthesis, and glycosyl hydrolases were significantly increased in Cry3Aa-treated larvae, whereas functions associated with many metabolic processes were reduced, especially glycolysis, tricarboxylic acid cycle, and fatty acid synthesis. Microarray analysis was used to evaluate temporal changes in gene expression after 6, 12 or 24 h of Cry3Aa exposure. Overall, microarray analysis indicated that transcripts related to allergens, chitin-binding proteins, glycosyl hydrolases, and tubulins were induced, and those related to immunity and metabolism were repressed in Cry3Aa-intoxicated larvae. The 24 h microarray data validated most of the RNA-Seq data. Of the three intoxication intervals, larvae demonstrated more differential expression of transcripts after 12 h exposure to Cry3Aa. Gene expression examined by three different methods in control vs. Cry3Aa-treated larvae at the 24 h time point indicated that transcripts encoding proteins with chitin-binding domain 3 were the most differentially expressed in Cry3Aa-intoxicated larvae. Overall, the data suggest that T. molitor larvae mount a complex response to Cry3Aa during the initial 24 h of intoxication. Data from this study represent the largest genetic sequence dataset for T. molitor to date. Furthermore, the methods in this study are useful for comparative analyses in organisms lacking a sequenced genome. PMID:22558093

Evolution of Bacillus thuringiensis Cry toxins insecticidal activity.

PubMed

Bravo, Alejandra; Gómez, Isabel; Porta, Helena; García-Gómez, Blanca Ines; Rodriguez-Almazan, Claudia; Pardo, Liliana; Soberón, Mario

2013-01-01

Insecticidal Cry proteins produced by Bacillus thuringiensis are use worldwide in transgenic crops for efficient pest control. Among the family of Cry toxins, the three domain Cry family is the better characterized regarding their natural evolution leading to a large number of Cry proteins with similar structure, mode of action but different insect specificity. Also, this group is the better characterized regarding the study of their mode of action and the molecular basis of insect specificity. In this review we discuss how Cry toxins have evolved insect specificity in nature and analyse several cases of improvement of Cry toxin action by genetic engineering, some of these examples are currently used in transgenic crops. We believe that the success in the improvement of insecticidal activity by genetic evolution of Cry toxins will depend on the knowledge of the rate-limiting steps of Cry toxicity in different insect pests, the mapping of the specificity binding regions in the Cry toxins, as well as the improvement of mutagenesis strategies and selection procedures. © 2012 The Authors. Microbial Biotechnology © 2012 Society for Applied Microbiology and Blackwell Publishing Ltd.

Residues at a Single Site Differentiate Animal Cryptochromes from Cyclobutane Pyrimidine Dimer Photolyases by Affecting the Proteins' Preferences for Reduced FAD.

PubMed

Xu, Lei; Wen, Bin; Wang, Yuan; Tian, Changqing; Wu, Mingcai; Zhu, Guoping

2017-06-19

Cryptochromes (CRYs) and photolyases belong to the cryptochrome/photolyase family (CPF). Reduced FAD is essential for photolyases to photorepair UV-induced cyclobutane pyrimidine dimers (CPDs) or 6-4 photoproducts in DNA. In Drosophila CRY (dCRY, a type I animal CRY), FAD is converted to the anionic radical but not to the reduced state upon illumination, which might induce a conformational change in the protein to relay the light signal downstream. To explore the foundation of these differences, multiple sequence alignment of 650 CPF protein sequences was performed. We identified a site facing FAD (Ala377 in Escherichia coli CPD photolyase and Val415 in dCRY), hereafter referred to as "site 377", that was distinctly conserved across these sequences: CPD photolyases often had Ala, Ser, or Asn at this site, whereas animal CRYs had Ile, Leu, or Val. The binding affinity for reduced FAD, but not the photorepair activity of E. coli photolyase, was dramatically impaired when replacing Ala377 with any of the three CRY residues. Conversely, in V415S and V415N mutants of dCRY, FAD was photoreduced to its fully reduced state after prolonged illumination, and light-dependent conformational changes of these mutants were severely inhibited. We speculate that the residues at site 377 play a key role in the different preferences of CPF proteins for reduced FAD, which differentiate animal CRYs from CPD photolyases. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Bacillus thuringiensis: A story of a successful bioinsecticide

PubMed Central

Bravo, Alejandra; Likitvivatanavong, Supaporn; Gill, Sarjeet S.; Soberón, Mario

2013-01-01

Bacillus thuringiensis (Bt) bacteria are insect pathogens that rely on insecticidal pore forming proteins known as Cry and Cyt toxins to kill their insect larval hosts. At least four different non-structurally related families of proteins form the Cry toxin group of toxins. The expression of certain Cry toxins in transgenic crops has contributed to an efficient control of insect pests resulting in a significant reduction in chemical insecticide use. The mode of action of the three domain Cry toxin family involves sequential interaction of these toxins with several insect midgut proteins facilitating the formation of a pre-pore oligomer structure and subsequent membrane insertion that leads to the killing of midgut insect cells by osmotic shock. In this manuscript we review recent progress in understanding the mode of action of this family of proteins in lepidopteran, dipteran and coleopteran insects. Interestingly, similar Cry-binding proteins have been identified in the three insect orders, as cadherin, aminopeptidase-N and alkaline phosphatase suggesting a conserved mode of action. Also, recent data on insect responses to Cry toxin attack is discussed. Finally, we review the different Bt based products, including transgenic crops, that are currently used in agriculture. PMID:21376122

Resonance Raman spectroscopic investigation of the light-harvesting chromophore in escherichia coli photolyase and Vibrio cholerae cryptochrome-1.

PubMed

Sokolova, Olga; Cecala, Christine; Gopal, Anand; Cortazar, Frank; McDowell-Buchanan, Carla; Sancar, Aziz; Gindt, Yvonne M; Schelvis, Johannes P M

2007-03-27

Photolyases and cryptochromes are flavoproteins that belong to the class of blue-light photoreceptors. They usually bind two chromophores: flavin adenine dinucleotide (FAD), which forms the active site, and a light-harvesting pigment, which is a 5,10-methenyltetrahydrofolate polyglutamate (MTHF) in most cases. In Escherichia coli photolyase (EcPhr), the MTHF cofactor is present in substoichiometric amounts after purification, while in Vibrio cholerae cryptochrome-1 (VcCry1) the MTHF cofactor is bound more strongly and is present at stoichiometric levels after purification. In this paper, we have used resonance Raman spectroscopy to monitor the effect of loss of MTHF on the protein-FAD interactions in EcPhr and to probe the protein-MTHF interactions in both EcPhr and VcCry1. We find that removal of MTHF does not perturb protein-FAD interactions, suggesting that it may not affect the physicochemical properties of FAD in EcPhr. Our data demonstrate that the pteridine ring of MTHF in EcPhr has different interactions with the protein matrix than that of MTHF in VcCry1. Comparison to solution resonance Raman spectra of MTHF suggests that the carbonyl of its pteridine ring in EcPhr experiences stronger hydrogen bonding and a more polar environment than in VcCry1, but that hydrogen bonding to the pteridine ring amine hydrogens is stronger in VcCry-1. These differences in hydrogen bonding may account for the higher binding affinity of MTHF in VcCry1 compared to EcPhr.

A Spodoptera exigua Cadherin Serves as a Putative Receptor for Bacillus thuringiensis Cry1Ca Toxin and Shows Differential Enhancement of Cry1Ca and Cry1Ac Toxicity

PubMed Central

Ren, Xiang-Liang; Chen, Rui-Rui; Zhang, Ying; Ma, Yan; Cui, Jin-Jie; Han, Zhao-Jun; Mu, Li-Li

2013-01-01

Crystal toxin Cry1Ca from Bacillus thuringiensis has an insecticidal spectrum encompassing lepidopteran insects that are tolerant to current commercially used B. thuringiensis crops (Bt crops) expressing Cry1A toxins and may be useful as a potential bioinsecticide. The mode of action of Cry1A is fairly well understood. However, whether Cry1Ca interacts with the same receptor proteins as Cry1A remains unproven. In the present paper, we first cloned a cadherin-like gene, SeCad1b, from Spodoptera exigua (relatively susceptible to Cry1Ca). SeCad1b was highly expressed in the larval gut but scarcely detected in fat body, Malpighian tubules, and remaining carcass. Second, we bacterially expressed truncated cadherin rSeCad1bp and its interspecific homologue rHaBtRp from Helicoverpa armigera (more sensitive to Cry1Ac) containing the putative toxin-binding regions. Competitive binding assays showed that both Cry1Ca and Cry1Ac could bind to rSeCad1bp and rHaBtRp, and they did not compete with each other. Third, Cry1Ca ingestion killed larvae and decreased the weight of surviving larvae. Dietary introduction of SeCad1b double-stranded RNA (dsRNA) reduced approximately 80% of the target mRNA and partially alleviated the negative effect of Cry1Ca on larval survival and growth. Lastly, rSeCad1bp and rHaBtRp differentially enhanced the negative effects of Cry1Ca and Cry1Ac on the larval mortalities and growth of S. exigua and H. armigera. Thus, we provide the first lines of evidence to suggest that SeCad1b from S. exigua is a functional receptor of Cry1Ca. PMID:23835184

Structure of Full-length Drosophila Cryptochrome

PubMed Central

Zoltowski, Brian D.; Vaidya, Anand T.; Top, Deniz; Widom, Joanne; Young, Michael W.; Crane, Brian R.

2011-01-01

The Cryptochrome/Photolyase (CRY/PL) family of photoreceptors mediates adaptive responses to UV and blue light exposure in all kingdoms of life 1; 2; 3; 4; 5. Whereas PLs function predominantly in DNA repair of cyclobutane pyrimidine dimers (CPDs)and 6-4 photolesions caused by UV radiation, CRYs transduce signals important for growth, development, magnetosensitivity and circadian clocks1; 2; 3; 4; 5. Despite these diverse functions, PLs/CRYs preserve a common structural fold, a dependence on flavin adenine dinucleotide (FAD) and an internal photoactivation mechanism3; 6. However, members of the CRY/PL family differ in the substrates recognized (protein or DNA), photochemical reactions catalyzed and involvement of an antenna cofactor. It is largely unknown how the animal CRYs that regulate circadian rhythms act on their substrates. CRYs contain a variable C-terminal tail that appends the conserved PL homology domain (PHD) and is important for function 7; 8; 9; 10; 11; 12. Herein, we report a 2.3 Å resolution crystal structure of Drosophila CRY with an intact C-terminus. The C-terminal helix docks in the analogous groove that binds DNA substrates in PLs. Conserved Trp536 juts into the CRY catalytic center to mimic PL recognition of DNA photolesions. The FAD anionic semiquinone found in the crystals assumes a conformation to facilitate restructuring of the tail helix. These results help reconcile the diverse functions of the CRY/PL family by demonstrating how conserved protein architecture, and photochemistry can be elaborated into a range of light-driven functions. PMID:22080955

Herbicide and insect resistant Bt cotton pollen assessment finds no detrimental effects on adult honey bees.

PubMed

Niu, Lin; Ma, Weihua; Lei, Chaoliang; Jurat-Fuentes, Juan Luis; Chen, Lizhen

2017-11-01

One important concern regarding the use of transgenic cotton expressing insecticidal toxins from the bacterium Bacillus thuringiensis (Bt) is its potential detrimental effect on non-target organisms. The honey bee (Apis mellifera) is the most important pollinator species worldwide and it is directly exposed to transgenic crops by the consumption of genetically modified (GM) pollen. However, the potential effects of Bt cotton on A. mellifera remain unclear. In the present study, we assessed the effects of two Bt cotton varieties; ZMSJ expressing the Cry1Ac and Cry2Ab insecticidal proteins, and ZMKCKC producing Cry1Ac and EPSPS, on A. mellifera. Feeding on pollen from two Bt cotton varieties led to detection of low levels of Cry toxins (<10 ng/g fresh weight) in the midgut of A. mellifera adults, yet expression of detoxification genes did not change significantly compared to feeding on non-Bt cotton. Binding assays showed no Cry1Ac or Cry2Ab binding to midgut brush border membrane proteins from A. mellifera adults. Taken together, these results support minimal risk for potential negative effects on A. mellifera by exposure to Bt cotton. Copyright © 2017 Elsevier Ltd. All rights reserved.

Lack of Detectable Allergenicity in Genetically Modified Maize Containing “Cry” Proteins as Compared to Native Maize Based on In Silico & In Vitro Analysis

PubMed Central

Mathur, Chandni; Kathuria, Pooran C.; Dahiya, Pushpa; Singh, Anand B.

2015-01-01

Background Genetically modified, (GM) crops with potential allergens must be evaluated for safety and endogenous IgE binding pattern compared to native variety, prior to market release. Objective To compare endogenous IgE binding proteins of three GM maize seeds containing Cry 1Ab,1Ac,1C transgenic proteins with non GM maize. Methods An integrated approach of in silico & in vitro methods was employed. Cry proteins were tested for presence of allergen sequence by FASTA in allergen databases. Biochemical assays for maize extracts were performed. Specific IgE (sIgE) and Immunoblot using food sensitized patients sera (n = 39) to non GM and GM maize antigens was performed. Results In silico approaches, confirmed for non sequence similarity of stated transgenic proteins in allergen databases. An insignificant (p> 0.05) variation in protein content between GM and non GM maize was observed. Simulated Gastric Fluid (SGF) revealed reduced number of stable protein fractions in GM then non GM maize which might be due to shift of constituent protein expression. Specific IgE values from patients showed insignificant difference in non GM and GM maize extracts. Five maize sensitized cases, recognized same 7 protein fractions of 88-28 kD as IgE bindng in both GM and non-GM maize, signifying absence of variation. Four of the reported IgE binding proteins were also found to be stable by SGF. Conclusion Cry proteins did not indicate any significant similarity of >35% in allergen databases. Immunoassays also did not identify appreciable differences in endogenous IgE binding in GM and non GM maize. PMID:25706412

Compatibility of garlic (Allium sativum L.) leaf agglutinin and Cry1Ac δ-endotoxin for gene pyramiding.

PubMed

Upadhyay, Santosh Kumar; Singh, Seema; Chandrashekar, Krishnappa; Tuli, Rakesh; Singh, Pradhyumna Kumar

2012-03-01

δ-Endotoxins produced by Bacillus thuringiensis (Bt) have been used as bio-pesticides for the control of lepidopteran insect pests. Garlic (Allium sativum L.) leaf agglutinin (ASAL), being toxic to several sap-sucking pests and some lepidopteran pests, may be a good candidate for pyramiding with δ-endotoxins in transgenic plants for enhancing the range of resistance to insect pests. Since ASAL shares the midgut receptors with Cry1Ac in Helicoverpa armigera, there is possibility of antagonism in their toxicity. Our study demonstrated that ASAL increased the toxicity of Cry1Ac against H. armigera while Cry1Ac did not alter the toxicity of ASAL against cotton aphids. The two toxins interacted and increased binding of each other to brush border membrane vesicle (BBMV) proteins and to the two important receptors, alkaline phosphatase (ALP) and aminopeptidase N (APN). The results indicated that the toxins had different binding sites on the ALP and APN but influenced mutual binding. We conclude that ASAL can be safely employed with Cry1Ac for developing transgenic crops for wider insect resistance.

Production and Characterization of Bacillus thuringiensis Cry1Ac-Resistant Cotton Bollworm Helicoverpa zea (Boddie)▿

PubMed Central

Anilkumar, Konasale J.; Rodrigo-Simón, Ana; Ferré, Juan; Pusztai-Carey, Marianne; Sivasupramaniam, Sakuntala; Moar, William J.

2008-01-01

Laboratory-selected Bacillus thuringiensis-resistant colonies are important tools for elucidating B. thuringiensis resistance mechanisms. However, cotton bollworm, Helicoverpa zea, a target pest of transgenic corn and cotton expressing B. thuringiensis Cry1Ac (Bt corn and cotton), has proven difficult to select for stable resistance. Two populations of H. zea (AR and MR), resistant to the B. thuringiensis protein found in all commercial Bt cotton varieties (Cry1Ac), were established by selection with Cry1Ac activated toxin (AR) or MVP II (MR). Cry1Ac toxin reflects the form ingested by H. zea when feeding on Bt cotton, whereas MVP II is a Cry1Ac formulation used for resistance selection and monitoring. The resistance ratio (RR) for AR exceeded 100-fold after 11 generations and has been maintained at this level for nine generations. This is the first report of stable Cry1Ac resistance in H. zea. MR crashed after 11 generations, reaching only an RR of 12. AR was only partially cross-resistant to MVP II, suggesting that MVP II does not have the same Cry1Ac selection pressure as Cry1Ac toxin against H. zea and that proteases may be involved with resistance. AR was highly cross-resistant to Cry1Ab toxin but only slightly cross-resistant to Cry1Ab expressing corn leaf powder. AR was not cross-resistant to Cry2Aa2, Cry2Ab2-expressing corn leaf powder, Vip3A, and cypermethrin. Toxin-binding assays showed no significant differences, indicating that resistance was not linked to a reduction in binding. These results aid in understanding why this pest has not evolved B. thuringiensis resistance, and highlight the need to choose carefully the form of B. thuringiensis protein used in experiments. PMID:18024681

Effects of lymphatic drainage and cryotherapy on indirect markers of muscle damage.

PubMed

Behringer, Michael; Jedlicka, Diana; Mester, Joachim

2018-06-01

Muscle enzymes are cleared from the extracellular space by the lymphatic system, while smaller proteins enter the bloodstream directly. We investigated if manual lymphatic drainage (MLD), local cryotherapy (CRY), and rest (RST) differently affect the time course of creatine kinase (CK, 84 kDa) and heart-type fatty acid binding protein (h-FABP, 15 kDa) in the blood. Randomized controlled trial. After 4x20 unilateral, eccentric accentuated knee extensions (with one-third of the maximal isometric force) 30 sports students randomly received either a 30 min MLD, CRY or they rested (RST) for the same amount of time. CK, h-FABP, neutrophil granulocytes, and the perceived muscle soreness were assessed before, immediately after, and 1 hour, 4 hours, and 24 hours after the exercise. All measures increased significantly (P<0.001) after the protocol indicating that muscle damage was induced. However, the responses did not differ between the treatments. Large and small damage markers were not affected differently by MLD, CRY, or RST, when applied for 30 min and no beneficial effects on inflammation or muscle soreness could be found for MLD and CRY when compared to RST. This information is particularly important for those sports physicians and conditioning specialists who use biochemical muscle damage markers to adjust the training load and volume of athletes.

Screen of Bacillus thuringiensis toxins for transgenic rice to control Sesamia inferens and Chilo suppressalis

USDA-ARS?s Scientific Manuscript database

Transgenic rice to control stem borer damage is under development in China. To assess the potential of Bacillus thuringiensis (Bt) transgenes in stem borer control, the toxicity of five Bt protoxins (Cry1Aa, Cry1Ab, Cry1Ac, Cry1Ba and Cry1Ca) against two rice stem borers, Sesamia inferens (pink stem...

The localization of a vitamin K-induced modification in an N-terminal fragment of human prothrombin

PubMed Central

Skotland, Tore; Holm, Turid; Østerud, Bjarne; Flengsrud, Ragnar; Prydz, Hans

1974-01-01

1. The N-terminal fragment (PF-I) split off from prothrombin during coagulation was purified to homogeneity from human serum. 2. The apparent molecular weight is 27000±2000 in sodium dodecyl sulphate–polyacrylamide-gel electrophoresis, whereas a value of about 19600 is obtained by calculation based on amino acid and carbohydrate analyses. The N-terminal sequence is an Ala-Asx bond. The fragment contains about 16% carbohydrate, binds phospholipids in the presence of Ca2+ and is adsorbed to BaSO4. The pKa of its BaSO4-binding group(s) is 3.1–3.5. 3. By CNBr cleavage of fragment PF-I two peptides (C-1 and C-2) were obtained with molecular weights of about 5900 (C-2) and 12400 (C-1) on the basis of amino acid and carbohydrate analyses. Only the smaller (N-terminal) peptide is adsorbed to BaSO4 and, since the ability of the whole protein to bind to BaSO4 is known to be absent in samples obtained from patients treated with vitamin K antagonists, this peptide probably contains the site of a modification to the structure of the protein which occurs during biosynthesis and depends on vitamin K. This peptide does not contain hexosamine or sialic acid. ImagesFig. 2. PMID:4219283

Mode of action of Bacillus thuringiensis Cry and Cyt toxins and their potential for insect control

PubMed Central

Bravo, Alejandra; Gill, Sarjeet S.; Soberón, Mario

2007-01-01

Bacillus thuringiensis Cry and Cyt protein families are a diverse group of proteins with activity against insects of different orders - Lepidoptera, Coleoptera, Diptera and also against other invertebrates such as nematodes. Their primary action is to lyse midgut epithelial cells by inserting into the target membrane and forming pores. Among this group of proteins, members of the 3-Domain Cry family are used worldwide for insect control, and their mode of action has been characterized in some detail. Phylogenetic analyses established that the diversity of the 3-Domain Cry family evolved by the independent evolution of the three domains and by swapping of domain III among toxins. Like other pore-forming toxins (PFT) that affect mammals, Cry toxins interact with specific receptors located on the host cell surface and are activated by host proteases following receptor binding resulting in the formation of a pre-pore oligomeric structure that is insertion competent. In contrast, Cyt toxins directly interact with membrane lipids and insert into the membrane. Recent evidence suggests that Cyt synergize or overcome resistance to mosquitocidal-Cry proteins by functioning as a Cry-membrane bound receptor. In this review we summarize recent findings on the mode of action of Cry and Cyt toxins, and compare them to the mode of action of other bacterial PFT. Also, we discuss their use in the control of agricultural insect pests and insect vectors of human diseases. PMID:17198720

Cross-resistance to purified Bt proteins, Bt corn and Bt cotton in a Cry2Ab2-corn resistant strain of Spodoptera frugiperda.

PubMed

Yang, Fei; Kerns, David L; Head, Graham P; Price, Paula; Huang, Fangneng

2017-12-01

Gene-pyramiding by combining two or more dissimilar Bacillus thuringiensis (Bt) proteins into a crop has been used to delay insect resistance. The durability of gene-pyramiding can be reduced by cross-resistance. Fall armyworm, Spodoptera frugiperda, is a major target pest of the Cry2Ab2 protein used in pyramided Bt corn and cotton. Here, we provide the first experimental evaluation of cross-resistance in S. frugiperda selected with Cry2Ab2 corn to multiple Bt sources including purified Bt proteins, Bt corn and Bt cotton. Concentration - response bioassays showed that resistance ratios for Cry2Ab2-resistant (RR) relative to Cry2Ab2-susceptible (SS) S. frugiperda were -1.4 for Cry1F, 1.2 for Cry1A.105, >26.7 for Cry2Ab2, >10.0 for Cry2Ae and -1.1 for Vip3A. Larvae of Cry2Ab2-heterozygous (RS), SS and RR S. frugiperda were all susceptible to Bt corn and Bt cotton containing Cry1 (Cry1F or Cry1A.105) and/or Vip3A proteins. Pyramided Bt cotton containing Cry1Ac + Cry2Ab2 or Cry1Ab + Cry2Ae were also effective against SS and RS, but not RR. These findings suggest that Cry2Ab2-corn-selected S. frugiperda is not cross-resistant to Cry1F, Cry1A.105 or Vip3A protein, or corn and cotton plants containing these Bt proteins, but it can cause strong cross-resistance to Cry2Ae and Bt crops expressing similar Bt proteins. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

Essential Role of an Unusually Long-lived Tyrosyl Radical in the Response to Red Light of the Animal-like Cryptochrome aCRY*

PubMed Central

Oldemeyer, Sabine; Franz, Sophie; Wenzel, Sandra; Essen, Lars-Oliver; Mittag, Maria

2016-01-01

Cryptochromes constitute a group of flavin-binding blue light receptors in bacteria, fungi, plants, and insects. Recently, the response of cryptochromes to light was extended to nearly the entire visible spectral region on the basis of the activity of the animal-like cryptochrome aCRY in the green alga Chlamydomonas reinhardtii. This finding was explained by the absorption of red light by the flavin neutral radical as the dark state of the receptor, which then forms the anionic fully reduced state. In this study, time-resolved UV-visible spectroscopy on the full-length aCRY revealed an unusually long-lived tyrosyl radical with a lifetime of 2.6 s, which is present already 1 μs after red light illumination of the flavin radical. Mutational studies disclosed the tyrosine 373 close to the surface to form the long-lived radical and to be essential for photoreduction. This residue is conserved exclusively in the sequences of other putative aCRY proteins distinguishing them from conventional (6–4) photolyases. Size exclusion chromatography showed the full-length aCRY to be a dimer in the dark at 0.5 mm injected concentration with the C-terminal extension as the dimerization site. Upon illumination, partial oligomerization was observed via disulfide bridge formation at cysteine 482 in close proximity to tyrosine 373. The lack of any light response in the C-terminal extension as evidenced by FTIR spectroscopy differentiates aCRY from plant and Drosophila cryptochromes. These findings imply that aCRY might have evolved a different signaling mechanism via a light-triggered redox cascade culminating in photooxidation of a yet unknown substrate or binding partner. PMID:27189948

PRKCDBP (CAVIN3) and CRY2 associate with major depressive disorder.

PubMed

Kovanen, Leena; Donner, Kati; Kaunisto, Mari; Partonen, Timo

2017-01-01

Dysfunctions in the intrinsic clocks are suggested in patients with depressive disorders. The cryptochrome circadian clocks 1 and 2 (CRY1 and CRY2) proteins modulate circadian rhythms in a cell and influence emotional reactions and mood in an individual. The protein kinase C delta binding protein (PRKCDBP, or CAVIN3), similar to the serum deprivation response protein (SDPR, or CAVIN2), reduces metabolic stability of the PER2-CRY2 transcription factor complex that plays a role in the circadian rhythm synchronization. Our aim was to study SDPR, PRKCDBP, CRY1 and CRY2 genetic variants in depressive disorders. The sample included 5910 Finnish individuals assessed with the Munich-Composite International Diagnostic Interview (M-CIDI) in year 2000. In year 2011, 3424 individuals were assessed again. After genotype quality control, there were 383 subjects with major depressive disorder, 166 with dysthymia, and 479 with depressive disorders (major depressive disorder, dysthymia or both), and 4154 healthy controls. A total of 48 single-nucleotide polymorphisms from SDPR, PRKCDBP, CRY1 and CRY2 genes were analyzed using logistic regression models controlling for age and gender. The earlier reported association of CRY2 variants with dysthymia was confirmed and extended to major depressive disorder (q<0.05). In addition, novel associations of PRKCDBP rs1488864 with depressive disorders (q=0.02) and with major depressive disorder in specific (q=0.007) were found. The number of cases was moderate and coverage of PRKCDB was limited. CRY2 and PRKCDBP variants may be risk factors of major depressive disorder and provide information for diagnosis. Copyright © 2016 Elsevier B.V. All rights reserved.

Binding specificity of Bacillus thuringiensis Cry1Aa for purified, native Bombyx mori aminopeptidase N and cadherin-like receptors

PubMed Central

Jenkins, Jeremy L; Dean, Donald H

2001-01-01

Background To better understand the molecular interactions of Bt toxins with non-target insects, we have examined the real-time binding specificity and affinity of Cry1 toxins to native silkworm (Bombyx mori) midgut receptors. Previous studies on B. mori receptors utilized brush border membrane vesicles or purifed receptors in blot-type assays. Results The Bombyx mori (silkworm) aminopeptidase N (APN) and cadherin-like receptors for Bacillus thuringiensis insecticidal Cry1Aa toxin were purified and their real-time binding affinities for Cry toxins were examined by surface plasmon resonance. Cry1Ab and Cry1Ac toxins did not bind to the immobilized native receptors, correlating with their low toxicities. Cry1Aa displayed moderate affinity for B. mori APN (75 nM), and unusually tight binding to the cadherin-like receptor (2.6 nM), which results from slow dissociation rates. The binding of a hybrid toxin (Aa/Aa/Ac) was identical to Cry1Aa. Conclusions These results indicate domain II of Cry1Aa is essential for binding to native B. mori receptors and for toxicity. Moreover, the high-affinity binding of Cry1Aa to native cadherin-like receptor emphasizes the importance of this receptor class for Bt toxin research. PMID:11722800

Improvement and efficient display of Bacillus thuringiensis toxins on M13 phages and ribosomes.

PubMed

Pacheco, Sabino; Cantón, Emiliano; Zuñiga-Navarrete, Fernando; Pecorari, Frédéric; Bravo, Alejandra; Soberón, Mario

2015-12-01

Bacillus thuringiensis (Bt) produces insecticidal proteins that have been used worldwide in the control of insect-pests in crops and vectors of human diseases. However, different insect species are poorly controlled by the available Bt toxins or have evolved resistance to these toxins. Evolution of Bt toxicity could provide novel toxins to control insect pests. To this aim, efficient display systems to select toxins with increased binding to insect membranes or midgut proteins involved in toxicity are likely to be helpful. Here we describe two display systems, phage display and ribosome display, that allow the efficient display of two non-structurally related Bt toxins, Cry1Ac and Cyt1Aa. Improved display of Cry1Ac and Cyt1Aa on M13 phages was achieved by changing the commonly used peptide leader sequence of the coat pIII-fusion protein, that relies on the Sec translocation pathway, for a peptide leader sequence that relies on the signal recognition particle pathway (SRP) and by using a modified M13 helper phage (Phaberge) that has an amber mutation in its pIII genomic sequence and preferentially assembles using the pIII-fusion protein. Also, both Cry1Ac and Cyt1Aa were efficiently displayed on ribosomes, which could allow the construction of large libraries of variants. Furthermore, Cry1Ac or Cyt1Aa displayed on M13 phages or ribosomes were specifically selected from a mixture of both toxins depending on which antigen was immobilized for binding selection. These improved systems may allow the selection of Cry toxin variants with improved insecticidal activities that could counter insect resistances.

Changes in Muscarinic M2 Receptor Levels in the Cortex of Subjects with Bipolar Disorder and Major Depressive Disorder and in Rats after Treatment with Mood Stabilisers and Antidepressants.

PubMed

Gibbons, Andrew Stuart; Jeon, Won Je; Scarr, Elizabeth; Dean, Brian

2016-04-01

Increasingly, data are implicating muscarinic receptors in the aetiology and treatment of mood disorders. This led us to measure levels of different muscarinic receptor-related parameters in the cortex from people with mood disorders and the CNS of rats treated with mood stabilisers and antidepressant drugs. We measured [(3)H]AF-DX 384 binding in BA 46 and BA 24 from subjects with bipolar disorders (n = 14), major depressive disorders (n = 19), as well as age- and sex-matched controls (n = 19) and the CNS of rats treated with fluoxetine or imipramine. In addition, we used Western blots to measure levels of CHRM2 protein and oxotremorine-M stimulated [(35)S]GTPγS binding as a measure of CHRM 2 / 4 signaling. Compared with controls, [(3)H]AF-DX 384 binding was lower in BA 24 and BA 46 in bipolar disorders and major depressive disorders, while CHRM2 protein and oxotremorine-M stimulated [(35)S]GTPγS binding was only lower in BA 24. Compared with vehicle, treatment with mood stabilisers, antidepressant drugs for 10 days, or imipramine for 28 days resulted in higher levels of in [(3)H]AF-DX 384 binding select regions of rat CNS. Our data suggest that levels of CHRM2 are lower in BA 24 from subjects with mood disorders, and it is possible that signalling by that receptor is also less in this cortical region. Our data also suggest increasing levels of CHRM2 may be involved in the mechanisms of action of mood stabilisers and tricyclic antidepressants. © The Author 2015. Published by Oxford University Press on behalf of CINP.

Changes in Muscarinic M2 Receptor Levels in the Cortex of Subjects with Bipolar Disorder and Major Depressive Disorder and in Rats after Treatment with Mood Stabilisers and Antidepressants

PubMed Central

Gibbons, Andrew Stuart; Jeon, Won Je; Scarr, Elizabeth; Dean, Brian

2016-01-01

Background: Increasingly, data are implicating muscarinic receptors in the aetiology and treatment of mood disorders. This led us to measure levels of different muscarinic receptor-related parameters in the cortex from people with mood disorders and the CNS of rats treated with mood stabilisers and antidepressant drugs. Methods: We measured [3H]AF-DX 384 binding in BA 46 and BA 24 from subjects with bipolar disorders (n = 14), major depressive disorders (n = 19), as well as age- and sex-matched controls (n = 19) and the CNS of rats treated with fluoxetine or imipramine. In addition, we used Western blots to measure levels of CHRM2 protein and oxotremorine-M stimulated [35S]GTPγS binding as a measure of CHRM 2 / 4 signaling. Results: Compared with controls, [3H]AF-DX 384 binding was lower in BA 24 and BA 46 in bipolar disorders and major depressive disorders, while CHRM2 protein and oxotremorine-M stimulated [35S]GTPγS binding was only lower in BA 24. Compared with vehicle, treatment with mood stabilisers, antidepressant drugs for 10 days, or imipramine for 28 days resulted in higher levels of in [3H]AF-DX 384 binding select regions of rat CNS. Conclusions: Our data suggest that levels of CHRM2 are lower in BA 24 from subjects with mood disorders, and it is possible that signalling by that receptor is also less in this cortical region. Our data also suggest increasing levels of CHRM2 may be involved in the mechanisms of action of mood stabilisers and tricyclic antidepressants. PMID:26475745

Aberrant rhythmic expression of cryptochrome2 regulates the radiosensitivity of rat gliomas.

PubMed

Fan, Wang; Caiyan, Li; Ling, Zhu; Jiayun, Zhao

2017-09-29

In this study, we investigated the role of the clock regulatory protein cryptochrome 2 (Cry2) in determining the radiosensitivity of C6 glioma cells in a rat model. We observed that Cry2 mRNA and protein levels showed aberrant rhythmic periodicity of 8 h in glioma tissues, compared to 24 h in normal brain tissue. Cry2 mRNA and protein levels did not respond to irradiation in normal tissues, but both were increased at the ZT4 (low Cry2) and ZT8 (high Cry2) time points in gliomas. Immunohistochemical staining of PCNA and TUNEL assays demonstrated that high Cry2 expression in glioma tissues was associated with increased cell proliferation and decreased apoptosis. Western blot analysis showed that glioma cell fate was independent of p53, but was probably dependent on p73, which was more highly expressed at ZT4 (low Cry2) than at ZT8 (high Cry2). Levels of both p53 and p73 were unaffected by irradiation in normal brain tissues. These findings suggest aberrant rhythmic expression of Cry2 influence on radiosensitivity in rat gliomas.

Safety assessment of Cry1C protein from genetically modified rice according to the national standards of PR China for a new food resource.

PubMed

Cao, Sishuo; He, Xiaoyun; Xu, Wentao; Ran, Wenjun; Liang, Lixing; Luo, YunBo; Yuan, Yanfang; Zhang, Nan; Zhou, Xin; Huang, Kunlun

2010-12-01

The Cry1C protein produced in Escherichia coli was used for in vitro evaluation and animal studies to support the safety assessment of GM food or feed products containing the Cry1C protein. The Cry1C protein does not have any sequence homology with known allergens or toxins. Although the Cry1C protein was heat stable it was rapidly degraded in vitro with simulated gastric or intestinal fluids. It did not cause adverse effects in mice as administered by gavage at a high level dosage of 5 g (Cry1C protein)/kg body weight. The mutagenicity of this protein was evaluated according to the national standards of People's Republic of China (PR China) for a new food resource. In mutagenic tests, the Cry1C protein caused<4 micronucleated cells per 1000 cells, <16 sperm abnormalities per 1000 cells and was not associated with any increased mutations in the Ames test. Taken together, these data indicate that the Cry1C protein is not a potential allergen or toxin. Copyright © 2010 Elsevier Inc. All rights reserved.

Draft Genome Sequences of Two Bacillus thuringiensis Strains and Characterization of a Putative 41.9-kDa Insecticidal Toxin

PubMed Central

Palma, Leopoldo; Muñoz, Delia; Berry, Colin; Murillo, Jesús; Caballero, Primitivo

2014-01-01

In this work, we report the genome sequencing of two Bacillus thuringiensis strains using Illumina next-generation sequencing technology (NGS). Strain Hu4-2, toxic to many lepidopteran pest species and to some mosquitoes, encoded genes for two insecticidal crystal (Cry) proteins, cry1Ia and cry9Ea, and a vegetative insecticidal protein (Vip) gene, vip3Ca2. Strain Leapi01 contained genes coding for seven Cry proteins (cry1Aa, cry1Ca, cry1Da, cry2Ab, cry9Ea and two cry1Ia gene variants) and a vip3 gene (vip3Aa10). A putative novel insecticidal protein gene 1143 bp long was found in both strains, whose sequences exhibited 100% nucleotide identity. The predicted protein showed 57 and 100% pairwise identity to protein sequence 72 from a patented Bt strain (US8318900) and to a putative 41.9-kDa insecticidal toxin from Bacillus cereus, respectively. The 41.9-kDa protein, containing a C-terminal 6× HisTag fusion, was expressed in Escherichia coli and tested for the first time against four lepidopteran species (Mamestra brassicae, Ostrinia nubilalis, Spodoptera frugiperda and S. littoralis) and the green-peach aphid Myzus persicae at doses as high as 4.8 µg/cm2 and 1.5 mg/mL, respectively. At these protein concentrations, the recombinant 41.9-kDa protein caused no mortality or symptoms of impaired growth against any of the insects tested, suggesting that these species are outside the protein’s target range or that the protein may not, in fact, be toxic. While the use of the polymerase chain reaction has allowed a significant increase in the number of Bt insecticidal genes characterized to date, novel NGS technologies promise a much faster, cheaper and efficient screening of Bt pesticidal proteins. PMID:24784323

Chilo suppressalis and Sesamia inferens display different susceptibility responses to Cry1A insecticidal proteins.

PubMed

Li, Bo; Xu, Yangyang; Han, Cao; Han, Lanzhi; Hou, Maolin; Peng, Yufa

2015-10-01

Chilo suppressalis and Sesamia inferens are important lepidopteran rice pests that occur concurrently in rice-growing areas of China. The development of transgenic rice expressing Cry1A insecticidal proteins has provided a useful strategy for controlling these pests. This study evaluated the baseline susceptibilities of C. suppressalis and S. inferens to Cry1A, as well as their responses to selection with Cry1A. Wide geographic variation in susceptibility was observed across all field populations. Within a given population, the LC50 of both Cry1Ab and Cry1Ac against S. inferens was drastically higher than that of C. suppressalis. Large LC50 differences (74.6-fold) were detected between the two species for Cry1Ab in the Poyang population, while small differences (3.6-fold) were detected for Cry1Ac in the Changsha population. The Cry1Ac LC50 of C. suppressalis and S. inferens increased 8.4- and 4.4-fold after 21 and eight selection generations respectively. Additionally, the estimated realised heritabilities (h(2) ) of Cry1Ac tolerance were 0.11 in C. suppressalis and 0.292 in S. inferens. S. inferens exhibited a significantly lower susceptibility and more rapidly evolved resistance to Cry1A compared with C. suppressalis. Therefore, S. inferens is more likely to evolve increased resistance, which threatens the sustainability of rice expressing Cry1A protein. © 2014 Society of Chemical Industry.

Bacillus thuringiensis Cry1A toxin-binding glycoconjugates present on the brush border membrane and in the peritrophic membrane of the Douglas-fir tussock moth are peritrophins

Treesearch

Algimantas P. Valaitis; John D. Podgwaite

2013-01-01

Bacillus thuringiensis (Bt) Cry1A toxin-binding sites in the Douglas fir tussock moth (DFTM) larval gut were localized using immunofluorescence microscopy. Cry1Aa, Cry1Ab and Cry1Ac all bound strongly to the DFTM peritrophic membrane (PM); weaker binding of the Cry1A toxins was observed along the apical brush border of the midgut epithelium....

Safety of Bacillus thuringiensis Cry1C protein for Daphnia magna based on different functional traits.

PubMed

Chen, Yi; Yang, Yan; Zhu, Haojun; Romeis, Jörg; Li, Yunhe; Peng, Yufa; Chen, Xiuping

2018-01-01

Cry1C is a Bacillus thuringiensis (Bt) insecticidal protein and it can be produced by transgenic rice lines developed in China. Cladocera species are common aquatic arthropods that may be exposed to insecticidal proteins produced in Bt-transgenic plants through ingestion of pollen or crop residues in water. As the cladoceran Daphnia magna plays an important role in the aquatic food chain, it is important to assess the possible effects of Bt crops to this species. To evaluate the safety of the Cry1C protein for D. magna, individuals were exposed to different concentrations of purified Cry1C protein in M4 medium for 21 days. Potassium dichromate (K 2 Cr 2 O 7 ), a known toxicant to D. magna, was added to M4 medium as a positive control treatment, and pure M4 medium was used as a negative control. Our results show that developmental, reproductive, and biochemical parameters of D. magna were not significantly different between Cry1C and negative control treatments but were significantly inhibited by the positive control. We thus conclude that D. magna is insensitive to Cry1C. Copyright © 2017 Elsevier Inc. All rights reserved.

Phosphate binding reduces aortic angiotensin-converting enzyme and enhances nitric oxide bioactivity in experimental renal insufficiency.

PubMed

Eräranta, Arttu; Törmänen, Suvi; Kööbi, Peeter; Vehmas, Tuija I; Lakkisto, Päivi; Tikkanen, Ilkka; Moilanen, Eeva; Niemelä, Onni; Mustonen, Jukka; Pörsti, Ilkka

2014-01-01

Disturbed calcium-phosphorus metabolism is associated with increased kidney angiotensin-converting enzyme (ACE) in experimental chronic renal insufficiency (CRI). However, information about the effects of phosphate binding and loading on vascular ACE is lacking. Fifteen weeks after 5/6 nephrectomy (NX), rats were placed on a phosphate-binding (NX+Ca, 3.0% Ca), phosphate-loading (NX+Pi, 1.5% Pi), or control diet for 12 weeks (NX and sham). Aortic ACE, blood pressure, plasma phosphate, and parathyroid hormone were increased in the NX and NX+Pi groups, but were reduced with phosphate binding. Endothelium-mediated relaxations of isolated mesenteric conduit artery rings to acetylcholine were impaired in the NX and NX+Pi groups, but did not differ from sham in NX+Ca rats. Experiments with nitric oxide (NO) synthase inhibition in vitro suggested that the NO-mediated component of acetylcholine response was lower in the NX and NX+Pi groups, but did not differ from sham in NX+Ca rats. In all NX groups, aortic endothelial NO synthase (eNOS) was reduced, while plasma and urine concentrations of NO metabolites were increased. Aortic nitrated proteins and calcification were increased in the NX and NX+Pi groups when compared with the NX+Ca and sham groups. Hypertension in the NX model of CRI was associated with reduced vasorelaxation, decreased eNOS, and increased ACE and nitrated proteins in the aorta. Phosphate binding with calcium carbonate enhanced vasorelaxation via endogenous NO and suppressed elevation of ACE and nitrated proteins, suggesting reduced vascular oxidative stress. Our findings support the view that correction of the calcium-phosphorus balance prevents CRI-induced vascular pathophysiology.

Enzyme-linked immunosorbent assay detection and bioactivity of Cry1Ab protein fragments.

PubMed

Albright, Vurtice C; Hellmich, Richard L; Coats, Joel R

2016-12-01

The continuing use of transgenic crops has led to an increased interest in the fate of insecticidal crystalline (Cry) proteins in the environment. Enzyme-linked immunosorbent assays (ELISAs) have emerged as the preferred detection method for Cry proteins in environmental matrices. Concerns exist that ELISAs are capable of detecting fragments of Cry proteins, which may lead to an overestimation of the concentration of these proteins in the environment. Five model systems were used to generate fragments of the Cry1Ab protein, which were then analyzed by ELISAs and bioassays. Fragments from 4 of the model systems were not detectable by ELISA and did not retain bioactivity. Fragments from the proteinase K model system were detectable by ELISA and retained bioactivity. In most cases, ELISAs appear to provide an accurate estimation of the amount of Cry proteins in the environment, as detectable fragments retained bioactivity and nondetectable fragments did not retain bioactivity. Environ Toxicol Chem 2016;35:3101-3112. © 2016 SETAC. © 2016 SETAC.

The Blue Light-Dependent Polyubiquitination and Degradation of Arabidopsis Cryptochrome2 Requires Multiple E3 Ubiquitin Ligases.

PubMed

Liu, Qing; Wang, Qin; Liu, Bin; Wang, Wei; Wang, Xu; Park, Joon; Yang, Zhenming; Du, Xinglin; Bian, Mingdi; Lin, Chentao

2016-10-01

Cryptochromes are blue light receptors regulated by light-dependent ubiquitination and degradation in both plant and animal lineages. The Arabidopsis genome encodes two cryptochromes, CRY1 and CRY2, of which CRY2 undergoes blue light-dependent ubiquitination and 26S proteasome-dependent degradation. The molecular mechanism regulating blue light-dependent proteolysis of CRY2 is still not fully understood. We found that the F-box proteins ZEITLUPE (ZTL) and Lov Kelch Protein2 (LKP2), which mediate blue light suppression of degradation of the CRY2 signaling partner CIB1, are not required for the blue light-dependent CRY2 degradation. We further showed that the previously reported function of the COP1-SPA1 protein complex in blue light-dependent CRY2 degradation is more likely to be attributable to its cullin 4 (CUL4)-based E3 ubiquitin ligase activity than its activity as the cryptochrome signaling partner. However, the blue light-dependent CRY2 degradation is only partially impaired in the cul4 mutant, the cop1-5 null mutant and the spa1234 quadruple mutant, suggesting a possible involvement of additional E3 ubiquitin ligases in the regulation of CRY2. Consistent with this hypothesis, we demonstrated that the blue light-dependent CRY2 degradation is significantly impaired in the temperature-sensitive cul1 mutant allele (axr6-3), especially under the non-permissive temperature. Based on these and other results presented, we propose that photoexcited CRY2 undergoes Lys48-linked polyubiquitination catalyzed by the CUL4- and CUL1-based E3 ubiquitin ligases. © The Author 2016. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.

Activity of a Brazilian strain of Bacillus thuringiensis israelensis against the cotton Boll Weevil Anthonomus grandis Boheman (Coleoptera: Tenebrionidae).

PubMed

Monnerat, R; Martins, E; Praça, L; Dumas, V; Berry, C

2012-02-01

A Brazilian Bacillus thuringiensis subspecies israelensis, toxic to Diptera, including mosquitoes, was found also to show toxicity to the coleopteran boll weevil Anthonomus grandis Boheman at an equivalent level to that of the standard coleopteran-active B. thuringiensis subspecies tenebrionis T08017. Recombinant B. thuringiensis strains expressing the individual Cyt1Aa, Cry4Aa, Cry4Ba and Cry11Aa toxins from this strain were assessed to evaluate their potential contribution to the activity against A. grandis, either alone or in combination. Whilst individual toxins produced mortality, none was sufficiently potent to allow calculation of LC50 values. Combinations of toxins were unable to attain the same potency as the parental B. thuringiensis subsp. israelensis, suggesting a major role for other factors produced by this strain.

Flagellin and GroEL mediates in vitro binding of an atypical enteropathogenic Escherichia coli to cellular fibronectin.

PubMed

Moraes, Claudia T P; Polatto, Juliana M; Rossato, Sarita S; Izquierdo, Mariana; Munhoz, Danielle D; Martins, Fernando H; Pimenta, Daniel C; Farfan, Mauricio J; Elias, Waldir P; Barbosa, Ângela S; Piazza, Roxane M F

2015-12-18

Enteropathogenic Escherichia coli (EPEC) is distinguished mainly by the presence of EPEC adherence factor plasmid (pEAF) in typical EPEC (tEPEC) and its absence in atypical EPEC (aEPEC). The initial adherence to the intestinal mucosa is complex and mediated by adhesins other than bundle-forming pilus, which is not produced by aEPEC. Extracellular matrix (ECM) proteins of eukaryotic cells are commonly recognized by bacterial adhesins. Therefore, binding to ECM proteins may facilitate colonization, invasion and/or signaling by intestinal pathogens. Previous studies from our group demonstrated that aEPEC O26:H11 (strain BA2103) showed high binding activity to fibronectin, not shared by its counterpart, aEPEC O26:HNM. In the present study, using mass spectrometry after fibronectin-associated immunoprecipitation, two proteins, flagellin (50 kDa) and GroEL (52 kDa), were identified and BA2103 binding ability to fibronectin was inhibited in the presence of anti-H11 and anti-GroEL sera, but not by either naïve rabbit or other unrelated sera. It was also observed that the presence of purified flagellin inhibits adhesion of BA2103 to cellular fibronectin in a dose-dependent manner. Additionally, BA2103 GroEL is similar to the same protein of uropathogenic E. coli. Our results suggest that flagellin may play a role in the in vitro interaction of BA2103 with cellular fibronectin, and GroEL can be an accessory protein in this process.

The βγ-crystallin domain of Lysinibacillus sphaericus phosphatidylinositol phospholipase C plays a central role in protein stability.

PubMed

Cerminati, Sebastián; Paoletti, Luciana; Peirú, Salvador; Menzella, Hugo G; Castelli, María Eugenia

2018-06-16

βγ-crystallin has emerged as a superfamily of structurally homologous proteins with representatives across all domains of life. A major portion of this superfamily is constituted by microbial members. This superfamily has also been recognized as a novel group of Ca 2+ -binding proteins with a large diversity and variable properties in Ca 2+ binding and stability. We have recently described a new phosphatidylinositol phospholipase C from Lysinibacillus sphaericus (LS-PIPLC) which was shown to efficiently remove phosphatidylinositol from crude vegetable oil. Here, the role of the C-terminal βγ-crystallin domain of LS-PIPLC was analyzed in the context of the whole protein. A truncated protein in which the C-terminal βγ-crystallin domain was deleted (LS-PIPLC ΔCRY ) is catalytically as efficient as the full-length protein (LS-PIPLC). However, the thermal and chemical stability of LS-PIPLC ΔCRY are highly affected, demonstrating a stabilizing role for this domain. It is also shown that the presence of Ca 2+ increases the thermal and chemical stability of the protein both in aqueous media and in oil, making LS-PIPLC an excellent candidate for use in industrial soybean oil degumming.

Noise levels in neonatal intensive care unit and use of sound absorbing panel in the isolette.

PubMed

Altuncu, E; Akman, I; Kulekci, S; Akdas, F; Bilgen, H; Ozek, E

2009-07-01

The purposes of this study were to measure the noise level of a busy neonatal intensive care unit (NICU) and to determine the effect of sound absorbing panel (SAP) on the level of noise inside the isolette. The sound pressure levels (SPL) of background noise, baby crying, alarms and closing of isolette's door/portholes were measured by a 2235-Brüel&Kjaer Sound Level Meter. Readings were repeated after applying SAP (3D pyramidal shaped open cell polyurethane foam) to the three lateral walls and ceiling of the isolette. The median SPL of background noise inside the NICU was 56dBA and it decreased to 47dBA inside the isolette. The median SPL of monitor alarms and baby crying inside the isolette were not different than SPL measured under radiant warmer (p>0.05). With SAP, the median SPL of temperature alarm inside the isolette decreased significantly from 82 to 72dBA, monitor alarm from 64 to 56dBA, porthole closing from 81 to 74dBA, and isolette door closing from 80 to 68dBA (p<0.01). There was a significant reduction in the noise produced by baby crying when SAP was used in the isolette (79dBA vs 69dBA, respectively) (p<0.0001). There was also significant attenuation effect of panel on the environmental noise. The noise level in our NICU is significantly above the universally recommended levels. Being inside the isolette protects infants from noise sources produced outside the isolette. However, very high noises are produced inside the isolette as well. Sound absorbing panel can be a simple solution and it attenuated the noise levels inside the isolette.

Iron regulatory protein 1 is not required for the modulation of ferritin and transferrin receptor expression by iron in a murine pro-B lymphocyte cell line

PubMed Central

Schalinske, Kevin L.; Blemings, Kenneth P.; Steffen, Daniel W.; Chen, Opal S.; Eisenstein, Richard S.

1997-01-01

Iron regulatory proteins (IRPs) are cytoplasmic RNA binding proteins that are central components of a sensory and regulatory network that modulates vertebrate iron homeostasis. IRPs regulate iron metabolism by binding to iron responsive element(s) (IREs) in the 5′ or 3′ untranslated region of ferritin or transferrin receptor (TfR) mRNAs. Two IRPs, IRP1 and IRP2, have been identified previously. IRP1 exhibits two mutually exclusive functions as an RNA binding protein or as the cytosolic isoform of aconitase. We demonstrate that the Ba/F3 family of murine pro-B lymphocytes represents the first example of a mammalian cell line that fails to express IRP1 protein or mRNA. First, all of the IRE binding activity in Ba/F3-gp55 cells is attributable to IRP2. Second, synthesis of IRP2, but not of IRP1, is detectable in Ba/F3-gp55 cells. Third, the Ba/F3 family of cells express IRP2 mRNA at a level similar to other murine cell lines, but IRP1 mRNA is not detectable. In the Ba/F3 family of cells, alterations in iron status modulated ferritin biosynthesis and TfR mRNA level over as much as a 20- and 14-fold range, respectively. We conclude that IRP1 is not essential for regulation of ferritin or TfR expression by iron and that IRP2 can act as the sole IRE-dependent mediator of cellular iron homeostasis. PMID:9380695

Bacillus thuringiensis toxins trigger receptor shedding from gypsy moth midgut cells

Treesearch

Algimantas P. Valaitis

2007-01-01

The mechanism of action of the Cry1 insecticidal proteins produced by Bacillus thuringiensis (Bt) begins with the processing of these proteins in the larval gut. After proteolytic activation, the Bt toxins bind to specific midgut receptors and insert into the membrane of the gut epithelial cells, causing insect death.

Induction of Macrophage Chemotaxis by Aortic Extracts from Patients with Marfan Syndrome Is Related to Elastin Binding Protein

PubMed Central

Guo, Gao; Gehle, Petra; Doelken, Sandra; Martin-Ventura, José Luis; von Kodolitsch, Yskert; Hetzer, Roland; Robinson, Peter N.

2011-01-01

Marfan syndrome is an autosomal dominantly inherited disorder of connective tissue with prominent skeletal, ocular, and cardiovascular manifestations. Aortic aneurysm and dissection are the major determinants of premature death in untreated patients. In previous work, we showed that extracts of aortic tissues from the mgR mouse model of Marfan syndrome showed increased chemotactic stimulatory activity related to the elastin-binding protein. Aortic samples were collected from 6 patients with Marfan syndrome and 8 with isolated aneurysms of the ascending aorta. Control samples were obtained from 11 organ donors without known vascular or connective tissue diseases. Soluble proteins extracted from the aortic samples of the two patient groups were compared against buffer controls and against the aortic samples from controls with respect to the ability to induce macrophage chemotaxis as measured using a modified Boyden chamber, as well as the reactivity to a monoclonal antibody BA4 against bioactive elastin peptides using ELISA. Samples from Marfan patients displayed a statistically significant increase in chemotactic inductive activity compared to control samples. Additionally, reactivity to BA4 was significantly increased. Similar statistically significant increases were identified for the samples from patients with idiopathic thoracic aortic aneurysm. There was a significant correlation between the chemotactic index and BA4 reactivity, and the increases in chemotactic activity of extracts from Marfan patients could be inhibited by pretreatment with lactose, VGVAPG peptides, or BA4, which indicates the involvement of EBP in mediating the effects. Our results demonstrate that aortic extracts of patients with Marfan syndrome can elicit macrophage chemotaxis, similar to our previous study on aortic extracts of the mgR mouse model of Marfan syndrome (Guo et al., Circulation 2006; 114:1855-62). PMID:21647416

Sequence and expression of two cry8 genes from Bacillus thuringiensis INTA Fr7-4, a native strain from Argentina.

PubMed

Navas, Laura E; Berretta, Marcelo F; Pérez, Melisa P; Amadio, Ariel F; Ortiz, Elio M; Sauka, Diego H; Benintende, Graciela B; Zandomeni, Rubén O

2014-01-01

We found and characterized two cry8 genes from the Bacillus thuringiensis strain INTA Fr7-4 isolated in Argentina. These genes, cry8Kb3 and cry8Pa3, are located in a tandem array within a 13,200-bp DNA segment sequenced from a preparation of total DNA. They encode 1,169- and 1,176-amino-acid proteins, respectively. Both genes were cloned with their promoter sequences and the proteins were expressed separately in an acrystalliferous strain of B. thuringiensis leading to the formation of ovoid crystals in the recombinant strains. The toxicity against larvae of Anthonomus grandis Bh. (Coleoptera: Curculionidae) of a spore-crystal suspension from the recombinant strain containing cry8Pa3 was similar to that of the parent strain INTA Fr7-4. © 2014 S. Karger AG, Basel.

A Comprehensive Assessment of the Effects of Transgenic Cry1Ac/Cry1Ab Rice Huahui 1 on Adult Micraspis discolor (Fabricius) (Coleoptera: Coccinellidae)

PubMed Central

Zhou, Xia; Guo, Yunling; Kong, Hua; Zuo, Jiao; Huang, Qixing; Jia, Ruizong; Guo, Anping; Xu, Lin

2016-01-01

Micraspis discolor (Fabricius) (Coleoptera: Coccinellidae) is a widely distributed coleoptera predator in southern Asia in rice ecosystem, and adult M. discolor feed on both rice pollen and soft-bodied arthropods. Bitrophic bioassay and tritrophic bioassay were conducted to evaluate the potential impact of Cry1Ac/Cry1Ab-expressing rice Huahui 1 and its non-transgenic counterpart Minghui 63 on fitness parameters of adult M. discolor. The results showed that the survival, and fecundity of this beetle’ adults were not different when they fed on Bt rice or non-Bt rice pollen or Nilaparvata lugens (Stål) reared on Bt rice or non-Bt rice. Toxicity assessment to ensure M. discolor adults were not sensitive to Cry1Ab or Cry1Ac protein independent from the pollen background, M. discolor adults were fed with an artificial diet containing Cry1Ac, Cry1Ab or both protein approximately 10 times higher concentration than in Huahui 1 rice pollen. No difference was detected for any of the life-table parameters tested between Cry protein-containing and pure diet. Artificial diet containing E-64 (N-(trans-Epoxysuccinyl)-L-leucine 4-guanidinobutylamide) was included as a positive control. In contrast, the pre-oviposition and fecundity of M. discolor were significantly adversely affected by feeding on E-64-containing diet. In both bioassays, the uptakes of Cry protein by adult M. discolor were tested by ELISA measurements. These results indicated that adults of M. discolor are not affected by Cry1Ab- or Cry1Ac-expressing rice pollen and are not sensitive to Cry protein at concentrations exceeding the levels in rice pollen in Huahui1. This suggests that M. discolor adults would not be harmed by Cry1Ac/Cry1Ab rice if Bt rice Huahui 1 were commercialized. PMID:26914608

Blue Light–Dependent Interaction between Cryptochrome2 and CIB1 Regulates Transcription and Leaf Senescence in Soybean[W

PubMed Central

Meng, Yingying; Li, Hongyu; Wang, Qin; Liu, Bin; Lin, Chentao

2013-01-01

Cryptochromes are blue light receptors that regulate light responses in plants, including various crops. The molecular mechanism of plant cryptochromes has been extensively investigated in Arabidopsis thaliana, but it has not been reported in any crop species. Here, we report a study of the mechanism of soybean (Glycine max) cryptochrome2 (CRY2a). We found that CRY2a regulates leaf senescence, which is a life history trait regulated by light and photoperiods via previously unknown mechanisms. We show that CRY2a undergoes blue light–dependent interaction with the soybean basic helix-loop-helix transcription activator CIB1 (for cryptochrome-interacting bHLH1) that specifically interacts with the E-box (CANNTG) DNA sequences. Analyses of transgenic soybean plants expressing an elevated or reduced level of the CRY2a or CIB1 demonstrate that CIB1 promotes leaf senescence, whereas CRY2a suppresses leaf senescence. Results of the gene expression and molecular interaction analyses support the hypothesis that CIB1 activates transcription of senescence-associated genes, such as WRKY DNA BINDING PROTEIN53b (WRKY53b), and leaf senescence. CIB1 interacts with the E-box–containing promoter sequences of the WRKY53b chromatin, whereas photoexcited CRY2a interacts with CIB1 to inhibit its DNA binding activity. These findings argue that CIB-dependent transcriptional regulation is an evolutionarily conserved CRY-signaling mechanism in plants, and this mechanism is opted in evolution to mediate light regulation of different aspects of plant development in different plant species. PMID:24272488

Bacillus thuringiensis Cry1Ia10 and Vip3Aa protein interactions and their toxicity in Spodoptera spp. (Lepidoptera).

PubMed

Bergamasco, V B; Mendes, D R P; Fernandes, O A; Desidério, J A; Lemos, M V F

2013-02-01

The polyphagous pests belonging to the genus Spodoptera are considered to be among the most important causes of damage and are widely distributed throughout the Americas'. Due to the extensive use of genetically modified plants containing Bacillus thuringiensis genes that code for insecticidal proteins, resistant insects may arise. To prevent the development of resistance, pyramided plants, which express multiple insecticidal proteins that act through distinct mode of actions, can be used. This study analyzed the mechanisms of action for the proteins Cry1Ia10 and Vip3Aa on neonatal Spodoptera frugiperda, Spodoptera albula, Spodoptera eridania and Spodoptera cosmioides larvae. The interactions of these toxins with receptors on the intestinal epithelial membrane were also analyzed by binding biotinylated toxins to brush border membrane vesicles (BBMVs) from the intestines of these insects. A putative receptor of approximately 65 kDa was found by ligand blotting in all of these species. In vitro competition assays using biotinylated proteins have indicated that Vip3Aa and Cry1Ia10 do not compete for the same receptor for S. frugiperda, S. albula and S. cosmioides and that Vip3Aa was more efficient than Cry1Ia10 when tested individually, by bioassays. A synergistic effect of the toxins in S. frugiperda, S. albula and S. cosmioides was observed when they were combined. However, in S. eridania, Cry1Ia10 and Vip3Aa might compete for the same receptor and through bioassays Cry1Ia10 was more efficient than Vip3Aa and showed an antagonistic effect when the proteins were combined. These results suggest that using these genes to develop pyramided plants may not prove effective in preventing the development of resistance in S. eridiana. Copyright © 2012 Elsevier Inc. All rights reserved.

A Flavin Binding Cryptochrome Photoreceptor Responds to Both Blue and Red Light in Chlamydomonas reinhardtii[W

PubMed Central

Beel, Benedikt; Prager, Katja; Spexard, Meike; Sasso, Severin; Weiss, Daniel; Müller, Nico; Heinnickel, Mark; Dewez, David; Ikoma, Danielle; Grossman, Arthur R.; Kottke, Tilman; Mittag, Maria

2012-01-01

Cryptochromes are flavoproteins that act as sensory blue light receptors in insects, plants, fungi, and bacteria. We have investigated a cryptochrome from the green alga Chlamydomonas reinhardtii with sequence homology to animal cryptochromes and (6-4) photolyases. In response to blue and red light exposure, this animal-like cryptochrome (aCRY) alters the light-dependent expression of various genes encoding proteins involved in chlorophyll and carotenoid biosynthesis, light-harvesting complexes, nitrogen metabolism, cell cycle control, and the circadian clock. Additionally, exposure to yellow but not far-red light leads to comparable increases in the expression of specific genes; this expression is significantly reduced in an acry insertional mutant. These in vivo effects are congruent with in vitro data showing that blue, yellow, and red light, but not far-red light, are absorbed by the neutral radical state of flavin in aCRY. The aCRY neutral radical is formed following blue light absorption of the oxidized flavin. Red illumination leads to conversion to the fully reduced state. Our data suggest that aCRY is a functionally important blue and red light–activated flavoprotein. The broad spectral response implies that the neutral radical state functions as a dark form in aCRY and expands the paradigm of flavoproteins and cryptochromes as blue light sensors to include other light qualities. PMID:22773746

Cross-Resistance between Cry1 Proteins in Fall Armyworm (Spodoptera frugiperda) May Affect the Durability of Current Pyramided Bt Maize Hybrids in Brazil

PubMed Central

Bernardi, Daniel; Salmeron, Eloisa; Horikoshi, Renato Jun; Bernardi, Oderlei; Dourado, Patrick Marques; Carvalho, Renato Assis; Martinelli, Samuel; Head, Graham P.; Omoto, Celso

2015-01-01

Genetically modified plants expressing insecticidal proteins from Bacillus thuringiensis (Bt) offer valuable options for managing insect pests with considerable environmental and economic benefits. Despite the benefits provided by Bt crops, the continuous expression of these insecticidal proteins imposes strong selection for resistance in target pest populations. Bt maize (Zea mays) hybrids have been successful in controlling fall armyworm (Spodoptera frugiperda), the main maize pest in Brazil since 2008; however, field-evolved resistance to the protein Cry1F has recently been reported. Therefore it is important to assess the possibility of cross-resistance between Cry1F and other Cry proteins expressed in Bt maize hybrids. In this study, an F2 screen followed by subsequent selection on MON 89034 maize was used to select an S. frugiperda strain (RR) able to survive on the Bt maize event MON 89034, which expresses the Cry1A.105 and Cry2Ab2 proteins. Field-collected insects from maize expressing the Cry1F protein (event TC1507) represented most of the positive (resistance allele-containing) (iso)families found. The RR strain showed high levels of resistance to Cry1F, which apparently also conferred high levels of cross resistance to Cry1A.105 and Cry1Ab, but had only low-level (10-fold) resistance to Cry2Ab2. Life history studies to investigate fitness costs associated with the resistance in RR strain revealed only small reductions in reproductive rate when compared to susceptible and heterozygous strains, but the RR strain produced 32.2% and 28.4% fewer females from each female relative to the SS and RS (pooled) strains, respectively. Consistent with the lack of significant resistance to Cry2Ab2, MON 89034 maize in combination with appropriate management practices continues to provide effective control of S. frugiperda in Brazil. Nevertheless, the occurrence of Cry1F resistance in S. frugiperda across Brazil, and the cross-resistance to Cry1Ab and Cry1A.105, indicates that current Cry1-based maize hybrids face a challenge in managing S. frugiperda in Brazil and highlights the importance of effective insect resistance management for these technologies. PMID:26473961

Cross-Resistance between Cry1 Proteins in Fall Armyworm (Spodoptera frugiperda) May Affect the Durability of Current Pyramided Bt Maize Hybrids in Brazil.

PubMed

Bernardi, Daniel; Salmeron, Eloisa; Horikoshi, Renato Jun; Bernardi, Oderlei; Dourado, Patrick Marques; Carvalho, Renato Assis; Martinelli, Samuel; Head, Graham P; Omoto, Celso

2015-01-01

Genetically modified plants expressing insecticidal proteins from Bacillus thuringiensis (Bt) offer valuable options for managing insect pests with considerable environmental and economic benefits. Despite the benefits provided by Bt crops, the continuous expression of these insecticidal proteins imposes strong selection for resistance in target pest populations. Bt maize (Zea mays) hybrids have been successful in controlling fall armyworm (Spodoptera frugiperda), the main maize pest in Brazil since 2008; however, field-evolved resistance to the protein Cry1F has recently been reported. Therefore it is important to assess the possibility of cross-resistance between Cry1F and other Cry proteins expressed in Bt maize hybrids. In this study, an F2 screen followed by subsequent selection on MON 89034 maize was used to select an S. frugiperda strain (RR) able to survive on the Bt maize event MON 89034, which expresses the Cry1A.105 and Cry2Ab2 proteins. Field-collected insects from maize expressing the Cry1F protein (event TC1507) represented most of the positive (resistance allele-containing) (iso)families found. The RR strain showed high levels of resistance to Cry1F, which apparently also conferred high levels of cross resistance to Cry1A.105 and Cry1Ab, but had only low-level (10-fold) resistance to Cry2Ab2. Life history studies to investigate fitness costs associated with the resistance in RR strain revealed only small reductions in reproductive rate when compared to susceptible and heterozygous strains, but the RR strain produced 32.2% and 28.4% fewer females from each female relative to the SS and RS (pooled) strains, respectively. Consistent with the lack of significant resistance to Cry2Ab2, MON 89034 maize in combination with appropriate management practices continues to provide effective control of S. frugiperda in Brazil. Nevertheless, the occurrence of Cry1F resistance in S. frugiperda across Brazil, and the cross-resistance to Cry1Ab and Cry1A.105, indicates that current Cry1-based maize hybrids face a challenge in managing S. frugiperda in Brazil and highlights the importance of effective insect resistance management for these technologies.

A Plant Cryptochrome Controls Key Features of the Chlamydomonas Circadian Clock and Its Life Cycle.

PubMed

Müller, Nico; Wenzel, Sandra; Zou, Yong; Künzel, Sandra; Sasso, Severin; Weiß, Daniel; Prager, Katja; Grossman, Arthur; Kottke, Tilman; Mittag, Maria

2017-05-01

Cryptochromes are flavin-binding proteins that act as blue light receptors in bacteria, fungi, plants, and insects and are components of the circadian oscillator in mammals. Animal and plant cryptochromes are evolutionarily divergent, although the unicellular alga Chlamydomonas reinhardtii ( Chlamydomonas throughout) has both an animal-like cryptochrome and a plant cryptochrome (pCRY; formerly designated CPH1). Here, we show that the pCRY protein accumulates at night as part of a complex. Functional characterization of pCRY was performed based on an insertional mutant that expresses only 11% of the wild-type pCRY level. The pcry mutant is defective for central properties of the circadian clock. In the mutant, the period is lengthened significantly, ultimately resulting in arrhythmicity, while blue light-based phase shifts show large deviations from what is observed in wild-type cells. We also show that pCRY is involved in gametogenesis in Chlamydomonas pCRY is down-regulated in pregametes and gametes, and in the pcry mutant, there is altered transcript accumulation under blue light of the strictly light-dependent, gamete-specific gene GAS28 pCRY acts as a negative regulator for the induction of mating ability in the light and for the loss of mating ability in the dark. Moreover, pCRY is necessary for light-dependent germination, during which the zygote undergoes meiosis that gives rise to four vegetative cells. In sum, our data demonstrate that pCRY is a key blue light receptor in Chlamydomonas that is involved in both circadian timing and life cycle progression. © 2017 American Society of Plant Biologists. All Rights Reserved.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Yang; National Institute of Biological Sciences, Beijing 102206; Xiong, Wei

Although a deficiency in CRY1 or CRY2 correlates with a shorter or longer circadian period, the regulation of CRY proteins in the circadian period has not been well studied. In this study, we found that both CRY1 and CRY2 were able to rescue oscillation in CRY null cells and that they displayed different periods. Furthermore, we demonstrated that protein nuclear import rates, not protein stability, regulate the period-length at the cellular level. Co-transfection of CRY1 and CRY2 in various ratios in the same cells gives rise to the predicted period length in a dose-dependent manner. Given the distinct characteristics ofmore » the C-terminal tails of the CRY1 and CRY2 proteins, our study addresses a long-standing hypothesis that the ratio of these two CRY molecules affects the clock period. - Highlights: • Rhythmic CRY2, like CRY1, in the correct CRY1 phase is sufficient to rescue clock oscillation in CRY null cells. • The short-period mammalian CRY2 protein is more stable than the CRY1 protein. • The N-terminal polypeptide of CRY2 contributes to its stability and Per2 repression, but it does not affect the period. • The C-terminal tails of CRYs regulate their protein stability and nuclear import, but the import rate governs the period. • The ratio, rather than the absolute amounts of CRY1 and CRY2 proteins, determines the period in mammalian cells.« less

Assessing the potential for interaction between the insecticidal activity of two genetically engineered cotton events combined by conventional breeding: An example with COT102 × MON 15985.

PubMed

Levine, Steven L; Mueller, Geoffrey M; Uffman, Joshua P

2016-08-01

Bollgard(®) III was developed by combining cotton events COT102 and MON 15985 through conventional breeding to improve efficacy against lepidopteran feeding damage. COT102 produces the Vip3Aa19 protein and MON 15985 produces the Cry1Ac and Cry2Ab2 proteins. COT102 × MON 15985 has also been bred with Roundup Ready Flex(®) cotton (MON 88913) that confers glyphosate tolerance. This study evaluated the activity of COT102 and MON 15985 and the combined activity of COT102 and MON 15985 against the cotton bollworm (CBW, Helicoverpa zea). COT102, MON 15985, COT102 × MON 15985 and COT102 × MON 15985 × MON 88913 have comparable Vip3Aa19 and/or Cry1Ac, Cry2Ab2 protein expression levels as determined by enzyme-linked immunosorbent assay. CBW demonstrated concentration-dependent growth inhibition after 7-days of feeding on lyophilized leaf tissue derived from COT102, MON 15985, COT102 × MON 15985 and COT102 × MON 15985 × MON 88913 incorporated into an artificial diet. Observed EC50 values for COT102 × MON 15985 and COT102 × MON 15985 × MON 88913 were comparable (≤4% deviation) with the predicted EC50 value under the assumption of additivity using the combined activity of COT102 and MON 15985. No interaction in biological activity between COT102 and MON 15985 is consistent with results from competition and ligand blotting assays that demonstrated that Vip3Aa does not inhibit the binding of either Cry1Ac or Cry2Ab2 and vice versa. The results from this study demonstrate that the activity of COT102 × MON 15985 against CBW is consistent with predictions of additivity. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Molecular characterization of Cry1D-133 toxin from Bacillus thuringiensis strain HD133 and its toxicity against Spodoptera littoralis.

PubMed

BenFarhat-Touzri, Dalel; Driss, Fatma; Jemli, Sonia; Tounsi, Slim

2018-06-01

Bacillus thuringiensis subsp. aizawai strain HD133, known by its effectiveness against Spodoptera species, produces bipyramidal crystals encompassing the insecticidal proteins Cry1Ab, Cry1Ca and Cry1D-133 in the proportions 60:37:3, respectively. In this study, we dealt with the relevance of the low rate of Cry1D-133. The cry1D-133 gene from HD133 was cloned and sequenced. Both nucleotide and amino acid sequence similarity analyses with the cry1D genes available in the GenBank database revealed that cry1D-133 is a new variant of cry1Da-type genes with 99% identity with cry1Da1. Molecular modeling of the Cry1D-133 toxin showed that its higher toxicity is correlated to a higher number of toxin-receptor interactions. Optimal culture conditions of 4 h post-induction time, 160 rpm agitation and 37 °C post-induction temperature were determined and adopted to overproduce Cry1D-133 toxin at adequate amounts to carryout bioassays. A gradual increase of the proportion of Cry1D-133 to the HD133 insecticidal proteins forming the crystal (Cry1D-133, Cry1Ca and Cry1Ab) showed an improvement of the toxicity against Spodoptera littoralis larvae. Therefore, the potential of Cry1D-133 to enhance HD133 toxicity could promote its combination with other B. thuringiensis insecticidal proteins toxins in order to increase target range or to delay the emergence of resistance. Copyright © 2018 Elsevier B.V. All rights reserved.

TIR-only protein RBA1 recognizes a pathogen effector to regulate cell death in Arabidopsis

PubMed Central

Anderson, Ryan G.; Cherkis, Karen A.; Law, Terry F.; Liu, Qingli L.; Machius, Mischa; Nimchuk, Zachary L.; Yang, Li; Chung, Eui-Hwan; El Kasmi, Farid; Hyunh, Michael; Sondek, John E.; Dangl, Jeffery L.

2017-01-01

Detection of pathogens by plants is mediated by intracellular nucleotide-binding site leucine-rich repeat (NLR) receptor proteins. NLR proteins are defined by their stereotypical multidomain structure: an N-terminal Toll–interleukin receptor (TIR) or coiled-coil (CC) domain, a central nucleotide-binding (NB) domain, and a C-terminal leucine-rich repeat (LRR). The plant innate immune system contains a limited NLR repertoire that functions to recognize all potential pathogens. We isolated Response to the bacterial type III effector protein HopBA1 (RBA1), a gene that encodes a TIR-only protein lacking all other canonical NLR domains. RBA1 is sufficient to trigger cell death in response to HopBA1. We generated a crystal structure for HopBA1 and found that it has similarity to a class of proteins that includes esterases, the heme-binding protein ChaN, and an uncharacterized domain of Pasteurella multocida toxin. Self-association, coimmunoprecipitation with HopBA1, and function of RBA1 require two previously identified TIR–TIR dimerization interfaces. Although previously described as distinct in other TIR proteins, in RBA1 neither of these interfaces is sufficient when the other is disrupted. These data suggest that oligomerization of RBA1 is required for function. Our identification of RBA1 demonstrates that “truncated” NLRs can function as pathogen sensors, expanding our understanding of both receptor architecture and the mechanism of activation in the plant immune system. PMID:28137883

MAPK Signaling Pathway Alters Expression of Midgut ALP and ABCC Genes and Causes Resistance to Bacillus thuringiensis Cry1Ac Toxin in Diamondback Moth

PubMed Central

Wu, Qingjun; Wang, Shaoli; Xie, Wen; Zhu, Xun; Baxter, Simon W.; Zhou, Xuguo; Jurat-Fuentes, Juan Luis; Zhang, Youjun

2015-01-01

Insecticidal crystal toxins derived from the soil bacterium Bacillus thuringiensis (Bt) are widely used as biopesticide sprays or expressed in transgenic crops to control insect pests. However, large-scale use of Bt has led to field-evolved resistance in several lepidopteran pests. Resistance to Bt Cry1Ac toxin in the diamondback moth, Plutella xylostella (L.), was previously mapped to a multigenic resistance locus (BtR-1). Here, we assembled the 3.15 Mb BtR-1 locus and found high-level resistance to Cry1Ac and Bt biopesticide in four independent P. xylostella strains were all associated with differential expression of a midgut membrane-bound alkaline phosphatase (ALP) outside this locus and a suite of ATP-binding cassette transporter subfamily C (ABCC) genes inside this locus. The interplay between these resistance genes is controlled by a previously uncharacterized trans-regulatory mechanism via the mitogen-activated protein kinase (MAPK) signaling pathway. Molecular, biochemical, and functional analyses have established ALP as a functional Cry1Ac receptor. Phenotypic association experiments revealed that the recessive Cry1Ac resistance was tightly linked to down-regulation of ALP, ABCC2 and ABCC3, whereas it was not linked to up-regulation of ABCC1. Silencing of ABCC2 and ABCC3 in susceptible larvae reduced their susceptibility to Cry1Ac but did not affect the expression of ALP, whereas suppression of MAP4K4, a constitutively transcriptionally-activated MAPK upstream gene within the BtR-1 locus, led to a transient recovery of gene expression thereby restoring the susceptibility in resistant larvae. These results highlight a crucial role for ALP and ABCC genes in field-evolved resistance to Cry1Ac and reveal a novel trans-regulatory signaling mechanism responsible for modulating the expression of these pivotal genes in P. xylostella. PMID:25875245

Bacillus anthracis Prolyl 4-Hydroxylase Interacts with and Modifies Elongation Factor Tu

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schnicker, Nicholas J.; Razzaghi, Mortezaali; Guha Thakurta, Sanjukta

Prolyl hydroxylation is a very common post-translational modification and plays many roles in eukaryotes such as collagen stabilization, hypoxia sensing, and controlling protein transcription and translation. There is a growing body of evidence that suggests that prokaryotes contain prolyl 4-hydroxylases (P4Hs) homologous to the hypoxia-inducible factor (HIF) prolyl hydroxylase domain (PHD) enzymes that act on elongation factor Tu (EFTu) and are likely involved in the regulation of bacterial translation. Recent biochemical and structural studies with a PHD from Pseudomonas putida (PPHD) determined that it forms a complex with EFTu and hydroxylates a prolyl residue of EFTu. Moreover, while animal, plant,more » and viral P4Hs act on peptidyl proline, most prokaryotic P4Hs have been known to target free l-proline; the exceptions include PPHD and a P4H from Bacillus anthracis (BaP4H) that modifies collagen-like proline-rich peptides. Here we use biophysical and mass spectrometric methods to demonstrate that BaP4H recognizes full-length BaEFTu and a BaEFTu 9-mer peptide for site-specific proline hydroxylation. Using size-exclusion chromatography coupled small-angle X-ray scattering (SEC–SAXS) and binding studies, we determined that BaP4H forms a 1:1 heterodimeric complex with BaEFTu. The SEC–SAXS studies reveal dissociation of BaP4H dimeric subunits upon interaction with BaEFTu. While BaP4H is unusual within bacteria in that it is structurally and functionally similar to the animal PHDs and collagen P4Hs, respectively, this work provides further evidence of its promiscuous substrate recognition. It is possible that the enzyme might have evolved to hydroxylate a universally conserved protein in prokaryotes, similar to the PHDs, and implies a functional role in B. anthracis.« less

Molecular cloning and functional analysis of a blue light receptor gene MdCRY2 from apple (Malus domestica).

PubMed

Li, Yuan-Yuan; Mao, Ke; Zhao, Cheng; Zhao, Xian-Yan; Zhang, Rui-Fen; Zhang, Hua-Lei; Shu, Huai-Rui; Hao, Yu-Jin

2013-04-01

MdCRY2 was isolated from apple fruit skin, and its function was analyzed in MdCRY2 transgenic Arabidopsis. The interaction between MdCRY2 and AtCOP1 was found by yeast two-hybrid and BiFC assays. Cryptochromes are blue/ultraviolet-A (UV-A) light receptors involved in regulating various aspects of plant growth and development. Investigations of the structure and functions of cryptochromes in plants have largely focused on Arabidopsis (Arabidopsis thaliana), tomato (Solanum lycopersicum), pea (Pisum sativum), and rice (Oryza sativa). However, no data on the function of CRY2 are available in woody plants. In this study, we isolated a cryptochrome gene, MdCRY2, from apple (Malus domestica). The deduced amino acid sequences of MdCRY2 contain the conserved N-terminal photolyase-related domain and the flavin adenine dinucleotide (FAD) binding domain, as well as the C-terminal DQXVP-acidic-STAES (DAS) domain. Relationship analysis indicates that MdCRY2 shows the highest similarity to the strawberry FvCRY protein. The expression of MdCRY2 is induced by blue/UV-A light, which represents a 48-h circadian rhythm. To investigate the function of MdCRY2, we overexpressed the MdCRY2 gene in a cry2 mutant and wild type (WT) Arabidopsis, assessed the phenotypes of the resulting transgenic plants, and found that MdCRY2 functions to regulate hypocotyl elongation, root growth, flower initiation, and anthocyanin accumulation. Furthermore, we examined the interaction between MdCRY2 and AtCOP1 using a yeast two-hybrid assay and a bimolecular fluorescence complementation assay. These data provide functional evidence for a role of blue/UV-A light-induced MdCRY2 in controlling photomorphogenesis in apple.

Food safety assessment of Cry8Ka5 mutant protein using Cry1Ac as a control Bt protein.

PubMed

Farias, Davi Felipe; Viana, Martônio Ponte; Oliveira, Gustavo Ramos; Santos, Vanessa Olinto; Pinto, Clidia Eduarda Moreira; Viana, Daniel Araújo; Vasconcelos, Ilka Maria; Grossi-de-Sa, Maria Fátima; Carvalho, Ana Fontenele Urano

2015-07-01

Cry8Ka5 is a mutant protein from Bacillus thuringiensis (Bt) that has been proposed for developing transgenic plants due to promising activity against coleopterans, like Anthonomus grandis (the major pest of Brazilian cotton culture). Thus, an early food safety assessment of Cry8Ka5 protein could provide valuable information to support its use as a harmless biotechnological tool. This study aimed to evaluate the food safety of Cry8Ka5 protein following the two-tiered approach, based on weights of evidence, proposed by ILSI. Cry1Ac protein was used as a control Bt protein. The history of safe use revealed no convincing hazard reports for Bt pesticides and three-domain Cry proteins. The bioinformatics analysis with the primary amino acids sequence of Cry8Ka5 showed no similarity to any known toxic, antinutritional or allergenic proteins. The mode of action of Cry proteins is well understood and their fine specificity is restricted to insects. Cry8Ka5 and Cry1Ac proteins were rapidly degraded in simulated gastric fluid, but were resistant to simulated intestinal fluid and heat treatment. The LD50 for Cry8Ka5 and Cry1Ac was >5000 mg/kg body weight when administered by gavage in mice. Thus, no expected relevant risks are associated with the consumption of Cry8Ka5 protein. Copyright © 2015 Elsevier Ltd. All rights reserved.

Exploring the Midgut Transcriptome and Brush Border Membrane Vesicle Proteome of the Rice Stem Borer, Chilo suppressalis (Walker)

PubMed Central

Peng, Chuanhua; Wang, Xiaoping; Li, Fei; Lin, Yongjun

2012-01-01

The rice stem borer, Chilo suppressalis (Walker) (Lepidoptera: Pyralidae), is one of the most detrimental pests affecting rice crops. The use of Bacillus thuringiensis (Bt) toxins has been explored as a means to control this pest, but the potential for C. suppressalis to develop resistance to Bt toxins makes this approach problematic. Few C. suppressalis gene sequences are known, which makes in-depth study of gene function difficult. Herein, we sequenced the midgut transcriptome of the rice stem borer. In total, 37,040 contigs were obtained, with a mean size of 497 bp. As expected, the transcripts of C. suppressalis shared high similarity with arthropod genes. Gene ontology and KEGG analysis were used to classify the gene functions in C. suppressalis. Using the midgut transcriptome data, we conducted a proteome analysis to identify proteins expressed abundantly in the brush border membrane vesicles (BBMV). Of the 100 top abundant proteins that were excised and subjected to mass spectrometry analysis, 74 share high similarity with known proteins. Among these proteins, Western blot analysis showed that Aminopeptidase N and EH domain-containing protein have the binding activities with Bt-toxin Cry1Ac. These data provide invaluable information about the gene sequences of C. suppressalis and the proteins that bind with Cry1Ac. PMID:22666467

A Genomic and Proteomic Approach to Identify and Quantify the Expressed Bacillus thuringiensis Proteins in the Supernatant and Parasporal Crystal.

PubMed

Gomis-Cebolla, Joaquín; Scaramal Ricietto, Ana Paula; Ferré, Juan

2018-05-10

The combined analysis of genomic and proteomic data allowed us to determine which cry and vip genes are present in a Bacillus thuringiensis ( Bt ) isolate and which ones are being expressed. Nine Bt isolates were selected from Spanish collections of Bt based on their vip1 and vip2 gene content. As a first step, nine isolates were analyzed by PCR to select those Bt isolates that contained genes with the lowest similarity to already described vip1 and vip2 genes (isolates E-SE10.2 and O-V84.2). Two selected isolates were subjected to a combined genomic and proteomic analysis. The results showed that the Bt isolate E-SE10.2 codifies for two new vegetative proteins, Vip2Ac-like_1 and Sip1Aa-like_1, that do not show expression differences at 24 h vs. 48 h and are expressed in a low amount. The Bt isolate O-V84.2 codifies for three new vegetative proteins, Vip4Aa-like_1, Vip4Aa-like_2, and Vip2Ac-like_2, that are marginally expressed. The Vip4Aa-like_1 protein was two-fold more abundant at 24 h vs. 48 h, while the Vip4Aa-like_2 was detected only at 24 h. For Vip2Ac-like_2, no differences in expression were found at 24 h vs. 48 h. Moreover, the parasporal crystal of the E-SE10.2 isolate contains a single type of crystal protein, Cry23Aa-like, while the parasporal crystal from O-V84.2 contains three kinds of crystal proteins: 7.0⁻9.8% weight of Cry45Aa-like proteins, 35⁻37% weight of Cry32-like proteins and 2.8⁻4.3% weight of Cry73-like protein.

40 CFR 174.505 - Bacillus thuringiensis modified Cry3A protein (mCry3A) in corn; exemption from the requirement of...

Code of Federal Regulations, 2010 CFR

2010-07-01

... protein (mCry3A) in corn; exemption from the requirement of a tolerance. 174.505 Section 174.505... thuringiensis modified Cry3A protein (mCry3A) in corn; exemption from the requirement of a tolerance. Residues of Bacillus thuringiensis modified Cry3A protein (mCry3A) in corn are exempt from the requirement of...

40 CFR 174.505 - Bacillus thuringiensis modified Cry3A protein (mCry3A) in corn; exemption from the requirement of...

Code of Federal Regulations, 2011 CFR

2011-07-01

... protein (mCry3A) in corn; exemption from the requirement of a tolerance. 174.505 Section 174.505... thuringiensis modified Cry3A protein (mCry3A) in corn; exemption from the requirement of a tolerance. Residues of Bacillus thuringiensis modified Cry3A protein (mCry3A) in corn are exempt from the requirement of...

40 CFR 174.505 - Bacillus thuringiensis modified Cry3A protein (mCry3A) in corn; exemption from the requirement of...

Code of Federal Regulations, 2013 CFR

2013-07-01

... protein (mCry3A) in corn; exemption from the requirement of a tolerance. 174.505 Section 174.505... thuringiensis modified Cry3A protein (mCry3A) in corn; exemption from the requirement of a tolerance. Residues of Bacillus thuringiensis modified Cry3A protein (mCry3A) in corn are exempt from the requirement of...

40 CFR 174.505 - Bacillus thuringiensis modified Cry3A protein (mCry3A) in corn; exemption from the requirement of...

Code of Federal Regulations, 2012 CFR

2012-07-01

... protein (mCry3A) in corn; exemption from the requirement of a tolerance. 174.505 Section 174.505... thuringiensis modified Cry3A protein (mCry3A) in corn; exemption from the requirement of a tolerance. Residues of Bacillus thuringiensis modified Cry3A protein (mCry3A) in corn are exempt from the requirement of...

40 CFR 174.505 - Bacillus thuringiensis modified Cry3A protein (mCry3A) in corn; exemption from the requirement of...

Code of Federal Regulations, 2014 CFR

2014-07-01

... protein (mCry3A) in corn; exemption from the requirement of a tolerance. 174.505 Section 174.505... thuringiensis modified Cry3A protein (mCry3A) in corn; exemption from the requirement of a tolerance. Residues of Bacillus thuringiensis modified Cry3A protein (mCry3A) in corn are exempt from the requirement of...

40 CFR 174.506 - Bacillus thuringiensis Cry34Ab1 and Cry35Ab1 proteins in corn; exemption from the requirement of...

Code of Federal Regulations, 2010 CFR

2010-07-01

... Cry35Ab1 proteins in corn; exemption from the requirement of a tolerance. 174.506 Section 174.506... thuringiensis Cry34Ab1 and Cry35Ab1 proteins in corn; exemption from the requirement of a tolerance. Residues of Bacillus thuringiensis Cry34Ab1 and Cry35Ab1 proteins in corn are exempted from the requirement of a...

40 CFR 174.506 - Bacillus thuringiensis Cry34Ab1 and Cry35Ab1 proteins in corn; exemption from the requirement of...

Code of Federal Regulations, 2011 CFR

2011-07-01

... Cry35Ab1 proteins in corn; exemption from the requirement of a tolerance. 174.506 Section 174.506... thuringiensis Cry34Ab1 and Cry35Ab1 proteins in corn; exemption from the requirement of a tolerance. Residues of Bacillus thuringiensis Cry34Ab1 and Cry35Ab1 proteins in corn are exempted from the requirement of a...

40 CFR 174.506 - Bacillus thuringiensis Cry34Ab1 and Cry35Ab1 proteins in corn; exemption from the requirement of...

Code of Federal Regulations, 2013 CFR

2013-07-01

... Cry35Ab1 proteins in corn; exemption from the requirement of a tolerance. 174.506 Section 174.506... thuringiensis Cry34Ab1 and Cry35Ab1 proteins in corn; exemption from the requirement of a tolerance. Residues of Bacillus thuringiensis Cry34Ab1 and Cry35Ab1 proteins in corn are exempted from the requirement of a...

40 CFR 174.506 - Bacillus thuringiensis Cry34Ab1 and Cry35Ab1 proteins in corn; exemption from the requirement of...

Code of Federal Regulations, 2014 CFR

2014-07-01

... Cry35Ab1 proteins in corn; exemption from the requirement of a tolerance. 174.506 Section 174.506... thuringiensis Cry34Ab1 and Cry35Ab1 proteins in corn; exemption from the requirement of a tolerance. Residues of Bacillus thuringiensis Cry34Ab1 and Cry35Ab1 proteins in corn are exempted from the requirement of a...

40 CFR 174.506 - Bacillus thuringiensis Cry34Ab1 and Cry35Ab1 proteins in corn; exemption from the requirement of...

Code of Federal Regulations, 2012 CFR

2012-07-01

... Cry35Ab1 proteins in corn; exemption from the requirement of a tolerance. 174.506 Section 174.506... thuringiensis Cry34Ab1 and Cry35Ab1 proteins in corn; exemption from the requirement of a tolerance. Residues of Bacillus thuringiensis Cry34Ab1 and Cry35Ab1 proteins in corn are exempted from the requirement of a...

DDB1-Mediated CRY1 Degradation Promotes FOXO1-Driven Gluconeogenesis in Liver.

PubMed

Tong, Xin; Zhang, Deqiang; Charney, Nicholas; Jin, Ethan; VanDommelen, Kyle; Stamper, Kenneth; Gupta, Neil; Saldate, Johnny; Yin, Lei

2017-10-01

Targeted protein degradation through ubiquitination is an important step in the regulation of glucose metabolism. Here, we present evidence that the DDB1-CUL4A ubiquitin E3 ligase functions as a novel metabolic regulator that promotes FOXO1-driven hepatic gluconeogenesis. In vivo, hepatocyte-specific Ddb1 deletion leads to impaired hepatic gluconeogenesis in the mouse liver but protects mice from high-fat diet-induced hyperglycemia. Lack of Ddb1 downregulates FOXO1 protein expression and impairs FOXO1-driven gluconeogenic response. Mechanistically, we discovered that DDB1 enhances FOXO1 protein stability via degrading the circadian protein cryptochrome 1 (CRY1), a known target of DDB1 E3 ligase. In the Cry1 depletion condition, insulin fails to reduce the nuclear FOXO1 abundance and suppress gluconeogenic gene expression. Chronic depletion of Cry1 in the mouse liver not only increases FOXO1 protein but also enhances hepatic gluconeogenesis. Thus, we have identified the DDB1-mediated CRY1 degradation as an important target of insulin action on glucose homeostasis. © 2017 by the American Diabetes Association.

Nrf2-Dependent Induction of NQO1 in Mouse Aortic Endothelial Cells Overexpressing Catalase

PubMed Central

Lin, Xinghua; Yang, Hong; Zhou, LiChun; Guo, ZhongMao

2011-01-01

Overexpression of catalase has been shown to accelerate benzo(a)pyrene (BaP) detoxification in mouse aortic endothelial cells (MAECs ). NAD(P)H:quinone oxidoreductase1 (NQO1) is an enzyme that catalyzes BaP-quinone detoxification. Aryl hydrocarbon receptor (AhR) and nuclear factor erythroid 2-related factor-2 (Nrf2) are transcription factors that control NQO1 expression. Here, we investigated the effect of catalase overexpression on NQO1, Nrf2 and AhR expressions. The levels of NQO1 mRNA and protein were comparable in MAECs isolated from wild-type and transgenic mice that overexpress human catalase (hCatTg). BaP treatment increased NQO1 mRNA and protein levels in both groups, with a significantly greater induction in hCatTg MAECs than in wild-type cells. BaP-induced NQO1 promoter activity was dramatically higher in hCatTg MAECs than in wild-type cells. Our data also showed that the basal level of AhR and the BaP-induced level of Nrf2 were significantly higher in hCatTg MAECs than in wild-type cells. Inhibition of specificity protein-1 (Sp1) binding to the AhR promoter region by mithramycin A reversed the enhanced effect of catalase overexpression on AhR expression. Knockdown of AhR by RNA interference diminished BaP-induced expression of Nrf2 and NQO1. Knockdown of Nrf2 significantly decreased NQO1 mRNA and protein levels in cells with or without BaP treatment. NQO1 promoter activity was abrogated by mutation of the Nrf2-binding site in this promoter. In contrast, mutation of the AhR-binding site in NQO1 promoter did not affect the promoter activity. These results suggest that catalase overexpression upregulates BaP-induced NQO1 expression via enhancing the Sp1-AhR-Nrf2 signaling cascade. PMID:21569840

Bt Proteins Have No Detrimental Effects on Larvae of the Green Lacewing, Chrysopa pallens (Rambur) (Neuroptera: Chrysopidae).

PubMed

Ali, I; Zhang, S; Muhammad, M S; Iqbal, M; Cui, J-J J-J

2018-06-01

Biosafety of a genetically modified crop is required to be assessed prior to its commercialization. For this, a suitable artificial diet was developed and used to establish a dietary exposure test for assessing the toxicity of midgut-active Bt insecticidal proteins on Chrysopa pallens (Rambur). Subsequently, this dietary exposure test was used to evaluate the toxicity of the proteins Cry1Ab, Cry1Ac, Cry1Ah, Cry1Ca, Cry1F, Cry2Aa, Cry2Ab, and Vip3Aa on C. pallens larvae. Temporal stability, bioactivity, and the intake of the insecticidal proteins were confirmed by enzyme-linked immunosorbent assay and a sensitive-insect bioassay. The life history characteristics, such as survival, pupation, adult emergence, 7-day larval weight, larval developmental time, and emerged male and female fresh weights remained unaffected, when C. pallens were fed the pure artificial diet (negative control) and the artificial diets containing 200 μg/g of each purified protein: Cry1Ab, Cry1Ac, Cry1Ah, Cry1Ca, Cry1F, Cry2Aa, Cry2Ab, or Vip3Aa. On the contrary, all of the life history characteristics of C. pallens larvae were adversely affected when fed artificial diet containing boric acid (positive control). The results demonstrate that diets containing the tested concentrations of Cry1Ab, Cry1Ac, Cry1Ah, Cry1Ca, Cry1F, Cry2Aa, Cry2Ab, and Vip3Aa have null effects on C. pallens larvae. The outcome indicates that genetically modified crops expressing the tested Bt proteins are safe for the lacewing, C. pallens.

Interfacial metal and antibody recognition.

PubMed

Zhou, Tongqing; Hamer, Dean H; Hendrickson, Wayne A; Sattentau, Quentin J; Kwong, Peter D

2005-10-11

The unique ligation properties of metal ions are widely exploited by proteins, with approximately one-third of all proteins estimated to be metalloproteins. Although antibodies use various mechanisms for recognition, to our knowledge, none has ever been characterized that uses an interfacial metal. We previously described a family of CD4-reactive antibodies, the archetype being Q425. CD4:Q425 engagement does not interfere with CD4:HIV-1 gp120 envelope glycoprotein binding, but it blocks subsequent steps required for viral entry. Here, we use surface-plasmon resonance to show that Q425 requires calcium for recognition of CD4. Specifically, Q425 binding of calcium resulted in a 55,000-fold enhancement in affinity for CD4. X-ray crystallographic analyses of Q425 in the presence of Ca(2+), Ba(2+), or EDTA revealed an exposed metal-binding site, partially coordinated by five atoms contributed from four antibody complementarity-determining regions. The results suggest that Q425 recognition of CD4 involves direct ligation of antigen by the Q425-held calcium, with calcium binding each ligating atom of CD4 with approximately 1.5 kcal/mol of binding energy. This energetic contribution, which is greater than that from a typical protein atom, demonstrates how interfacial metal ligation can play a unique role in antigen recognition.

Interfacial metal and antibody recognition

PubMed Central

Zhou, Tongqing; Hamer, Dean H.; Hendrickson, Wayne A.; Sattentau, Quentin J.; Kwong, Peter D.

2005-01-01

The unique ligation properties of metal ions are widely exploited by proteins, with approximately one-third of all proteins estimated to be metalloproteins. Although antibodies use various mechanisms for recognition, to our knowledge, none has ever been characterized that uses an interfacial metal. We previously described a family of CD4-reactive antibodies, the archetype being Q425. CD4:Q425 engagement does not interfere with CD4:HIV-1 gp120 envelope glycoprotein binding, but it blocks subsequent steps required for viral entry. Here, we use surface-plasmon resonance to show that Q425 requires calcium for recognition of CD4. Specifically, Q425 binding of calcium resulted in a 55,000-fold enhancement in affinity for CD4. X-ray crystallographic analyses of Q425 in the presence of Ca2+, Ba2+, or EDTA revealed an exposed metal-binding site, partially coordinated by five atoms contributed from four antibody complementarity-determining regions. The results suggest that Q425 recognition of CD4 involves direct ligation of antigen by the Q425-held calcium, with calcium binding each ligating atom of CD4 with ≈1.5 kcal/mol of binding energy. This energetic contribution, which is greater than that from a typical protein atom, demonstrates how interfacial metal ligation can play a unique role in antigen recognition. PMID:16195378

Field-evolved resistance to Cry1Ab maize by Spodoptera frugiperda in Brazil.

PubMed

Omoto, Celso; Bernardi, Oderlei; Salmeron, Eloisa; Sorgatto, Rodrigo J; Dourado, Patrick M; Crivellari, Augusto; Carvalho, Renato A; Willse, Alan; Martinelli, Samuel; Head, Graham P

2016-09-01

The first Bt maize in Brazil was launched in 2008 and contained the MON 810 event, which expresses Cry1Ab protein. Although the Cry1Ab dose in MON 810 is not high against fall armyworm (FAW), Spodoptera frugiperda (J.E. Smith), MON 810 provided commercial levels of control. To support insect resistance management in Brazil, the baseline and ongoing susceptibility of FAW was examined using protein bioassays, and the level of control and life history parameters of FAW were evaluated on MON 810 maize. Baseline diet overlay assays with Cry1Ab (16 µg cm(-2) ) caused 76.3% mortality to field FAW populations sampled in 2009. Moderate mortality (48.8%) and significant growth inhibition (88.4%) were verified in leaf-disc bioassays. In greenhouse trials, MON 810 had significantly less damage than non-Bt maize. The surviving FAW larvae on MON 810 (22.4%) had a 5.5 day increase in life cycle time and a 24% reduction in population growth rate. Resistance monitoring (2010-2015) showed a significant reduction in Cry1Ab susceptibility of FAW over time. Additionally, a significant reduction in the field efficacy of MON 810 maize against FAW was observed in different regions from crop season 2009 to 2013. The decrease in susceptibility to Cry1Ab was expected, but the specific contributions to this resistance by MON 810 maize cannot be distinguished from cross-resistance to Cry1Ab caused by exposure to Cry1F maize. Technologies combining multiple novel insecticidal traits with no cross-resistance to the current Cry1 proteins and high activity against the same target pests should be pursued in Brazil and similar environments. © 2015 Society of Chemical Industry. © 2015 Society of Chemical Industry.

Stable integration and expression of a cry1Ia gene conferring resistance to fall armyworm and boll weevil in cotton plants.

PubMed

Silva, Carliane Rc; Monnerat, Rose; Lima, Liziane M; Martins, Érica S; Melo Filho, Péricles A; Pinheiro, Morganna Pn; Santos, Roseane C

2016-08-01

Boll weevil is a serious pest of cotton crop. Effective control involves applications of chemical insecticides, increasing the cost of production and environmental pollution. The current genetically modified Bt crops have allowed great benefits to farmers but show activity limited to lepidopteran pests. This work reports on procedures adopted for integration and expression of a cry transgene conferring resistance to boll weevil and fall armyworm by using molecular tools. Four Brazilian cotton cultivars were microinjected with a minimal linear cassette generating 1248 putative lines. Complete gene integration was found in only one line (T0-34) containing one copy of cry1Ia detected by Southern blot. Protein was expressed in high concentration at 45 days after emergence (dae), decreasing by approximately 50% at 90 dae. Toxicity of the cry protein was demonstrated in feeding bioassays revealing 56.7% mortality to boll weevil fed buds and 88.1% mortality to fall armyworm fed leaves. A binding of cry1Ia antibody was found in the midgut of boll weevils fed on T0-34 buds in an immunodetection assay. The gene introduced into plants confers resistance to boll weevil and fall armyworm. Transmission of the transgene occurred normally to T1 progeny. All plants showed phenotypically normal growth, with fertile flowers and abundant seeds. © 2015 Society of Chemical Industry. © 2015 Society of Chemical Industry.

CryJ-LAMP DNA Vaccines for Japanese Red Cedar Allergy Induce Robust Th1-Type Immune Responses in Murine Model

PubMed Central

Connolly, Michael; Marketon, Anthony

2016-01-01

Allergies caused by Japanese Red Cedar (JRC) pollen affect up to a third of Japanese people, necessitating development of an effective therapeutic. We utilized the lysosomal targeting property of lysosomal-associated membrane protein-1 (LAMP-1) to make DNA vaccines that encode LAMP-1 and the sequences of immunodominant allergen CryJ1 or CryJ2 from the JRC pollen. This novel strategy is designed to skew the CD4 T cell responses to the target allergens towards a nonallergenic Th1 response. CryJ1-LAMP and CryJ2-LAMP were administrated to BALB/c mice and antigen-specific Th1-type IgG2a and Th2-type IgG1 antibodies, as well as IgE antibodies, were assayed longitudinally. We also isolated different T cell populations from immunized mice and adoptively transferred them into naïve mice followed by CryJ1/CryJ2 protein boosts. We demonstrated that CryJ-LAMP immunized mice produce high levels of IFN-γ and anti-CryJ1 or anti-CryJ2 IgG2a antibodies and low levels of IgE antibodies, suggesting that a Th1 response was induced. In addition, we found that CD4+ T cells are the immunological effectors of DNA vaccination in this allergy model. Together, our results suggest the CryJ-LAMP Vaccine has a potential as an effective therapeutic for JRC induced allergy by skewing Th1/Th2 responses. PMID:27239481

Comparison and validation of methods to quantify Cry1Ab toxin from Bacillus thuringiensis for standardization of insect bioassays.

PubMed

Crespo, André L B; Spencer, Terence A; Nekl, Emily; Pusztai-Carey, Marianne; Moar, William J; Siegfried, Blair D

2008-01-01

Standardization of toxin preparations derived from Bacillus thuringiensis (Berliner) used in laboratory bioassays is critical for accurately assessing possible changes in the susceptibility of field populations of target pests. Different methods were evaluated to quantify Cry1Ab, the toxin expressed by 80% of the commercially available transgenic maize that targets the European corn borer, Ostrinia nubilalis (Hübner). We compared three methods of quantification on three different toxin preparations from independent sources: enzyme-linked immunosorbent assay (ELISA), sodium dodecyl sulfate-polyacrylamide gel electrophoresis and densitometry (SDS-PAGE/densitometry), and the Bradford assay for total protein. The results were compared to those obtained by immunoblot analysis and with the results of toxin bioassays against susceptible laboratory colonies of O. nubilalis. The Bradford method resulted in statistically higher estimates than either ELISA or SDS-PAGE/densitometry but also provided the lowest coefficients of variation (CVs) for estimates of the Cry1Ab concentration (from 2.4 to 5.4%). The CV of estimates obtained by ELISA ranged from 12.8 to 26.5%, whereas the CV of estimates obtained by SDS-PAGE/densitometry ranged from 0.2 to 15.4%. We standardized toxin concentration by using SDS-PAGE/densitometry, which is the only method specific for the 65-kDa Cry1Ab protein and is not confounded by impurities detected by ELISA and Bradford assay for total protein. Bioassays with standardized Cry1Ab preparations based on SDS-PAGE/densitometry showed no significant differences in LC(50) values, although there were significant differences in growth inhibition for two of the three Cry1Ab preparations. However, the variation in larval weight caused by toxin source was only 4% of the total variation, and we conclude that standardization of Cry1Ab production and quantification by SDS-PAGE/densitometry may improve data consistency in monitoring efforts to identify changes in insect susceptibility to Cry1Ab.

Bt proteins Cry1Ah and Cry2Ab do not affect cotton aphid Aphis gossypii and ladybeetle Propylea japonica

PubMed Central

Zhao, Yao; Zhang, Shuai; Luo, Jun-Yu; Wang, Chun-Yi; Lv, Li-Min; Wang, Xiao-Ping; Cui, Jin-Jie; Lei, Chao-Liang

2016-01-01

Plant varieties expressing the Bt (Bacillus thuringiensis) insecticidal proteins Cry1Ah and Cry2Ab have potential commercialization prospects in China. However, their potential effects on non-target arthropods (NTAs) remain uncharacterized. The cotton aphid Aphis gossypii is a worldwide pest that damages various important crops. The ladybeetle Propylea japonica is a common and abundant natural enemy in many cropping systems in East Asia. In the present study, the effects of Cry1Ah and Cry2Ab proteins on A. gossypii and P. japonica were assessed from three aspects. First, neither of the Cry proteins affected the growth or developmental characteristics of the two test insects. Second, the expression levels of the detoxification-related genes of the two test insects did not change significantly in either Cry protein treatment. Third, neither of the Cry proteins had a favourable effect on the expression of genes associated with the amino acid metabolism of A. gossypii and the nutrition utilization of P. japonica. In conclusion, the Cry1Ah and Cry2Ab proteins do not appear to affect the cotton aphid A. gossypii or the ladybeetle P. japonica. PMID:26829252

Multitrophic Cry-protein flow in Bt-cotton

USDA-ARS?s Scientific Manuscript database

Although most genetically engineered cotton plants grown today produce the insecticidal Cry-proteins Cry1Ac and Cry2Ab, studies are lacking on multitrophic Cry-protein acquisition in dual-gene cotton fields. Such field data are important for the design and interpretation of laboratory risk assessmen...

A Transport and Diffusion Model for Smoke Munitions.

DTIC Science & Technology

1979-08-01

oo cri r^ <a- CM «1- »*■ l-H CO in en oo in cri vo Tt 4- CO CO i-) CM tD Z LU —I ts Z O LU Z2 O _l Q (_> =3 O LU _l S» O I-H I...DX * ^ Pox -xceMTPOO/^*^11-) + DY*CP(»y - ycr»JTP(^J)/<SVdti- s = -BA t- apis- zstA/Jj/JiCr))1’ ct = C--^*cJ //=• ^cc - ue. -zr) GO TD s5?? P...50 FORMAT(1101 PRINT m.NRPV 14 FORMAT! IHQ , •NUMBER Of ROUNDS PER VOLLEY ’.It/ ? IHO.-IDEAL IMPACT POINTS •/ ’ •O".’ NO. •,6X

Evaluation of cytotoxic and antimicrobial effects of two Bt Cry proteins on a GMO safety perspective.

PubMed

Farias, Davi Felipe; Viana, Martônio Ponte; de Oliveira, Gustavo Ramos; Beneventi, Magda Aparecida; Soares, Bruno Marques; Pessoa, Claudia; Pessoa, Igor Parra; Silva, Luciano Paulino; Vasconcelos, Ilka Maria; de Sá, Maria Fátima Grossi; Carvalho, Ana Fontenele Urano

2014-01-01

Studies have contested the innocuousness of Bacillus thuringiensis (Bt) Cry proteins to mammalian cells as well as to mammals microbiota. Thus, this study aimed to evaluate the cytotoxic and antimicrobial effects of two Cry proteins, Cry8Ka5 (a novel mutant protein) and Cry1Ac (a widely distributed protein in GM crops). Evaluation of cyto- and genotoxicity in human lymphocytes was performed as well as hemolytic activity coupled with cellular membrane topography analysis in mammal erythrocytes. Effects of Cry8Ka5 and Cry1Ac upon Artemia sp. nauplii and upon bacteria and yeast growth were assessed. The toxins caused no significant effects on the viability (IC50 > 1,000 µg/mL) or to the cellular DNA integrity of lymphocytes (no effects at 1,000 µg/mL). The Cry8Ka5 and Cry1Ac proteins did not cause severe damage to erythrocytes, neither with hemolysis (IC50 > 1,000 µg/mL) nor with alterations in the membrane. Likewise, the Cry8Ka5 and Cry1Ac proteins presented high LC50 (755.11 and >1,000 µg/mL, resp.) on the brine shrimp lethality assay and showed no growth inhibition of the microorganisms tested (MIC > 1,000 µg/mL). This study contributed with valuable information on the effects of Cry8Ka5 and Cry1Ac proteins on nontarget organisms, which reinforce their potential for safe biotechnological applications.

Down-regulation of aminopeptidase N and ABC transporter subfamily G transcripts in Cry1Ab and Cry1Ac resistant Asian corn borer, Ostrinia furnacalis (Lepidoptera: Crambidae)

PubMed Central

Zhang, Tiantao; Coates, Brad S.; Wang, Yueqin; Wang, Yidong; Bai, Shuxiong; Wang, Zhenying; He, Kanglai

2017-01-01

The Asian corn borer (ACB), Ostrinia furnacalis (Lepidoptera: Crambidae), is a highly destructive pest of cultivated maize throughout East Asia. Bacillus thuringiensis (Bt) crystalline protein (Cry) toxins cause mortality by a mechanism involving pore formation or signal transduction following toxin binding to receptors along the midgut lumen of susceptible insects, but this mechanism and mutations therein that lead to resistance are not fully understood. In the current study, quantitative comparisons were made among midgut expressed transcripts from O. furnacalis susceptible (ACB-BtS) and laboratory selected strains resistant to Cry1Ab (ACB-AbR) and Cry1Ac toxins (ACB-AcR) when feeding on non-Bt diet. From a combined de novo transcriptome assembly of 83,370 transcripts, ORFs of ≥ 100 amino acids were predicted and annotated for 28,940 unique isoforms derived from 12,288 transcripts. Transcriptome-wide expression estimated from RNA-seq read depths predicted significant down-regulation of transcripts for previously known Bt resistance genes, aminopeptidase N1 (apn1) and apn3, as well as a putative ATP binding cassette transporter group G (abcg) gene in both ACB-AbR and -AcR (log2[fold-change] ≥ 1.36; P < 0.0001). The transcripts that were most highly differentially regulated in both ACB-AbR and -AcR compared to ACB-BtS (log2[fold-change] ≥ 2.0; P < 0.0001) included up- and down-regulation of serine proteases, storage proteins and cytochrome P450 monooxygenases, as well as up-regulation of genes with predicted transport function. This study predicted the significant down-regulation of transcripts for previously known Bt resistance genes, aminopeptidase N1 (apn1) and apn3, as well as abccg gene in both ACB-AbR and -AcR. These data are important for the understanding of systemic differences between Bt resistant and susceptible genotypes. PMID:28808417

The distinct properties of natural and GM cry insecticidal proteins.

PubMed

Latham, Jonathan R; Love, Madeleine; Hilbeck, Angelika

2017-04-01

The Cry toxins are a family of crystal-forming proteins produced by the bacterium Bacillus thuringiensis. Their mode of action is thought to be to create pores that disrupt the gut epithelial membranes of juvenile insects. These pores allow pathogen entry into the hemocoel, thereby killing the insect. Genes encoding a spectrum of Cry toxins, including Cry mutants, Cry chimaeras and other Cry derivatives, are used commercially to enhance insect resistance in genetically modified (GM) crops. In most countries of the world, such GM crops are regulated and must be assessed for human and environmental safety. However, such risk assessments often do not test the GM crop or its tissues directly. Instead, assessments rely primarily on historical information from naturally occurring Cry proteins and on data collected on Cry proteins (called 'surrogates') purified from laboratory strains of bacteria engineered to express Cry protein. However, neither surrogates nor naturally occurring Cry proteins are identical to the proteins to which humans or other nontarget organisms are exposed by the production and consumption of GM plants. To-date there has been no systematic survey of these differences. This review fills this knowledge gap with respect to the most commonly grown GM Cry-containing crops approved for international use. Having described the specific differences between natural, surrogate and GM Cry proteins this review assesses these differences for their potential to undermine the reliability of risk assessments. Lastly, we make specific recommendations for improving risk assessments.

A novel cry2Ab gene from the indigenous isolate Bacillus thuringiensis subsp. kurstaki.

PubMed

Sevim, Ali; Eryüzlü, Emine; Demirbağ, Zihni; Demir, Ismail

2012-01-01

A novel cry2Ab gene was cloned and sequenced from the indigenous isolate of Bacillus thuringiensis subsp. kurstaki. This gene was designated as cry2Ab25 and its sequence revealed an open reading frame of 1,902 bp encoding a 633 aa protein with calculated molecular mass of 70 kDa and pI value of 8.98. The amino acid sequence of the Cry2Ab25 protein was compared with previously known Cry2Ab toxins, and the phylogenetic relationships among them were determined. The deduced amino acid sequence of the Cry2Ab25 protein showed 99% homology to the known Cry2Ab proteins, except for Cry2Ab10 and Cry2Ab12 with 97% homology, and a variation in one amino acid residue in comparison with all known Cry2Ab proteins. The cry2Ab25 gene was expressed in Escherichia coli BL21(DE3) cells. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) revealed that the Cry2Ab25 protein is about 70 kDa. The toxin expressed in BL21(DE3) exhibited high toxicity against Malacosoma neustria and Rhagoletis cerasi with 73% and 75% mortality after 5 days of treatment, respectively.

Structural and Biophysical Characterization of Bacillus thuringiensis Insecticidal Proteins Cry34Ab1 and Cry35Ab1

PubMed Central

Kelker, Matthew S.; Berry, Colin; Evans, Steven L.; Pai, Reetal; McCaskill, David G.; Wang, Nick X.; Russell, Joshua C.; Baker, Matthew D.; Yang, Cheng; Pflugrath, J. W.; Wade, Matthew; Wess, Tim J.; Narva, Kenneth E.

2014-01-01

Bacillus thuringiensis strains are well known for the production of insecticidal proteins upon sporulation and these proteins are deposited in parasporal crystalline inclusions. The majority of these insect-specific toxins exhibit three domains in the mature toxin sequence. However, other Cry toxins are structurally and evolutionarily unrelated to this three-domain family and little is known of their three dimensional structures, limiting our understanding of their mechanisms of action and our ability to engineer the proteins to enhance their function. Among the non-three domain Cry toxins, the Cry34Ab1 and Cry35Ab1 proteins from B. thuringiensis strain PS149B1 are required to act together to produce toxicity to the western corn rootworm (WCR) Diabrotica virgifera virgifera Le Conte via a pore forming mechanism of action. Cry34Ab1 is a protein of ∼14 kDa with features of the aegerolysin family (Pfam06355) of proteins that have known membrane disrupting activity, while Cry35Ab1 is a ∼44 kDa member of the toxin_10 family (Pfam05431) that includes other insecticidal proteins such as the binary toxin BinA/BinB. The Cry34Ab1/Cry35Ab1 proteins represent an important seed trait technology having been developed as insect resistance traits in commercialized corn hybrids for control of WCR. The structures of Cry34Ab1 and Cry35Ab1 have been elucidated to 2.15 Å and 1.80 Å resolution, respectively. The solution structures of the toxins were further studied by small angle X-ray scattering and native electrospray ion mobility mass spectrometry. We present here the first published structure from the aegerolysin protein domain family and the structural comparisons of Cry34Ab1 and Cry35Ab1 with other pore forming toxins. PMID:25390338

Insecticide susceptibility of Aedes albopictus and Ae. aegypti from Brazil and the Swiss-Italian border region.

PubMed

Suter, Tobias; Crespo, Mônica Maria; de Oliveira, Mariana Francelino; de Oliveira, Thaynan Sama Alves; de Melo-Santos, Maria Alice Varjal; de Oliveira, Cláudia Maria Fontes; Ayres, Constância Flávia Junqueira; Barbosa, Rosângela Maria Rodrigues; Araújo, Ana Paula; Regis, Lêda Narcisa; Flacio, Eleonora; Engeler, Lukas; Müller, Pie; Silva-Filha, Maria Helena Neves Lobo

2017-09-19

Aedes aegypti and Ae. albopictus are two highly invasive mosquito species, both vectors of several viruses, including dengue, chikungunya and Zika. While Ae. aegypti is the primary vector in the tropics and sub-tropics, Ae. albopictus is increasingly under the public health watch as it has been implicated in arbovirus-transmission in more temperate regions, including continental Europe. Vector control using insecticides is the pillar of most control programmes; hence development of insecticide resistance is of great concern. As part of a Brazilian-Swiss Joint Research Programme we set out to assess whether there are any signs of existing or incipient insecticide resistance primarily against the larvicide Bacillus thuringiensis svar. israelensis (Bti), but also against currently applied and potentially alternative insecticides in our areas, Recife (Brazil) and the Swiss-Italian border region. Following World Health Organization guidelines, dose-response curves for a range of insecticides were established for both colonized and field caught Ae. aegypti and Ae. albopictus. The larvicides included Bti, two of its toxins, Cry11Aa and Cry4Ba, Lysinibacillus sphaericus, Vectomax CG®, a formulated combination of Bti and L. sphaericus, and diflubenzuron. In addition to the larvicides, the Swiss-Italian Ae. albopictus populations were also tested against five adulticides (bendiocarb, dichlorodiphenyltrichloroethane, malathion, permethrin and λ-cyhalothrin). Showing a similar dose-response, all mosquito populations were fully susceptible to the larvicides tested and, in particular, to Bti which is currently used both in Brazil and Switzerland. In addition, there were no signs of incipient resistance against Bti as larvae were equally susceptible to the individual toxins, Cry11Aa and Cry4Ba. The field-caught Swiss-Italian populations were susceptible to the adulticides tested but DDT mortality rates showed signs of reduced susceptibility. The insecticides currently used for mosquito control in Switzerland and Brazil are still effective against the target populations. The present study provides an important reference as relatively few insecticide susceptibility surveys have been carried out with Ae. albopictus.

75 FR 3234 - Issuance of an Experimental Use Permit

Federal Register 2010, 2011, 2012, 2013, 2014

2010-01-20

... The quantity authorized equates to 68,066 pounds of corn seed [containing 62 grams (0.137 pounds) of Cry1F protein, 787 grams (1.74 pounds) of Cry34Ab1 and Cry35Ab1 proteins, 27 grams (0.060 pounds) of Cry1Ab protein, 347 grams (0.765 pounds) of Vip3Aa20 protein, and 11 grams (0.024 pounds) of mCry3A...

Recombinant Cry1Ia protein is highly toxic to cotton boll weevil (Anthonomus grandis Boheman) and fall armyworm (Spodoptera frugiperda).

PubMed

Martins, E S; Aguiar, R W D S; Martins, N F; Melatti, V M; Falcão, R; Gomes, A C M M; Ribeiro, B M; Monnerat, R G

2008-05-01

To evaluate the activity of cry1Ia gene against cotton pests, Spodoptera frugiperda and Anthonomus grandis. Had isolated and characterized a toxin gene from the Bacillus thuringiensis S1451 strain which have been previously shown to be toxic to S. frugiperda and A. grandis. The toxin gene (cry1Ia) was amplified by PCR, sequenced, and cloned into the genome of a baculovirus. The Cry1Ia protein was expressed in baculovirus infected insect cells, producing protein inclusions in infected cells. The Cry1Ia protein has used in bioassays against to S. frugiperda and A. grandis. Bioassays using the purified recombinant protein showed high toxicity to S. frugiperda and A. grandis larvae. Molecular modelling of the Cry1Ia protein translated from the DNA sequence obtained in this work, showed that this protein possibly posses a similar structure to the Cry3A protein. Ultrastructural analysis of midgut cells from A. grandis incubated with the Cry1Ia toxin, showed loss of microvilli integrity. The results indicate that the cry1Ia is a good candidate for the construction of transgenic plants resistant to these important cotton pests.

A role for cryptochromes in sleep regulation.

PubMed

Wisor, Jonathan P; O'Hara, Bruce F; Terao, Akira; Selby, Chris P; Kilduff, Thomas S; Sancar, Aziz; Edgar, Dale M; Franken, Paul

2002-12-20

The cryptochrome 1 and 2 genes (cry1 and cry2) are necessary for the generation of circadian rhythms, as mice lacking both of these genes (cry1,2-/-) lack circadian rhythms. We studied sleep in cry1,2-/- mice under baseline conditions as well as under conditions of constant darkness and enforced wakefulness to determine whether cryptochromes influence sleep regulatory processes. Under all three conditions, cry1,2-/- mice exhibit the hallmarks of high non-REM sleep (NREMS) drive (i.e., increases in NREMS time, NREMS consolidation, and EEG delta power during NREMS). This unexpected phenotype was associated with elevated brain mRNA levels of period 1 and 2 (per1,2), and albumin d-binding protein (dbp), which are known to be transcriptionally inhibited by CRY1,2. To further examine the relationship between circadian genes and sleep homeostasis, we examined wild type mice and rats following sleep deprivation and found increased levels of per1,2 mRNA and decreased levels of dbp mRNA specifically in the cerebral cortex; these changes subsided with recovery sleep. The expression of per3, cry1,2, clock, npas2, bmal1, and casein-kinase-1epsilon did not change with sleep deprivation. These results indicate that mice lacking cryptochromes are not simply a genetic model of circadian arrhythmicity in rodents and functionally implicate cryptochromes in the homeostatic regulation of sleep.

Analysis of flour and food samples for cry9C from bioengineered corn.

PubMed

Orlandi, Palmer A; Lampel, Keith A; South, Paul K; Assar, Samir K; Carter, Laurenda; Levy, Dan D

2002-02-01

StarLink corn is a variety of yellow corn that has been genetically modified by the insertion of an altered cry9C gene into the plant genome. resulting in expression of the insecticidal Cry9C protein. The U.S. Environmental Protection Agency has approved StarLink corn for use in animal feed but not in food intended for human consumption. Therefore, under the U.S. Food, Drug, and Cosmetic Act, any food intended for human consumption in which the presence of StarLink corn is indicated by the presence of either the Cry9C protein or the cry9C gene would be considered adulterated. Extraction and PCR-based methods were used to detect the presence of the cry9C DNA initially in corn flour and corn meal, and then these methods were extended to the analysis of processed corn products, including taco shells, cereals, baby foods, party snacks, and chips, for the presence of this modified genetic material. In a survey of 63 products, the cry9C transgene was detected in 4 taco shells.

Molecular and Insecticidal Characterization of a Novel Cry-Related Protein from Bacillus Thuringiensis Toxic against Myzus persicae

PubMed Central

Palma, Leopoldo; Muñoz, Delia; Berry, Colin; Murillo, Jesús; Ruiz de Escudero, Iñigo; Caballero, Primitivo

2014-01-01

This study describes the insecticidal activity of a novel Bacillus thuringiensis Cry-related protein with a deduced 799 amino acid sequence (~89 kDa) and ~19% pairwise identity to the 95-kDa-aphidicidal protein (sequence number 204) from patent US 8318900 and ~40% pairwise identity to the cancer cell killing Cry proteins (parasporins Cry41Ab1 and Cry41Aa1), respectively. This novel Cry-related protein contained the five conserved amino acid blocks and the three conserved domains commonly found in 3-domain Cry proteins. The protein exhibited toxic activity against the green peach aphid, Myzus persicae (Sulzer) (Homoptera: Aphididae) with the lowest mean lethal concentration (LC50 = 32.7 μg/mL) reported to date for a given Cry protein and this insect species, whereas it had no lethal toxicity against the Lepidoptera of the family Noctuidae Helicoverpa armigera (Hübner), Mamestra brassicae (L.), Spodoptera exigua (Hübner), S. frugiperda (J.E. Smith) and S. littoralis (Boisduval), at concentrations as high as ~3.5 μg/cm2. This novel Cry-related protein may become a promising environmentally friendly tool for the biological control of M. persicae and possibly also for other sap sucking insect pests. PMID:25384108

Synergism and Antagonism between Bacillus thuringiensis Vip3A and Cry1 Proteins in Heliothis virescens, Diatraea saccharalis and Spodoptera frugiperda

PubMed Central

Lemes, Ana Rita Nunes; Davolos, Camila Chiaradia; Legori, Paula Cristina Brunini Crialesi; Fernandes, Odair Aparecido; Ferré, Juan; Lemos, Manoel Victor Franco; Desiderio, Janete Apparecida

2014-01-01

Second generation Bt crops (insect resistant crops carrying Bacillus thuringiensis genes) combine more than one gene that codes for insecticidal proteins in the same plant to provide better control of agricultural pests. Some of the new combinations involve co-expression of cry and vip genes. Because Cry and Vip proteins have different midgut targets and possibly different mechanisms of toxicity, it is important to evaluate possible synergistic or antagonistic interactions between these two classes of toxins. Three members of the Cry1 class of proteins and three from the Vip3A class were tested against Heliothis virescens for possible interactions. At the level of LC50, Cry1Ac was the most active protein, whereas the rest of proteins tested were similarly active. However, at the level of LC90, Cry1Aa and Cry1Ca were the least active proteins, and Cry1Ac and Vip3A proteins were not significantly different. Under the experimental conditions used in this study, we found an antagonistic effect of Cry1Ca with the three Vip3A proteins. The interaction between Cry1Ca and Vip3Aa was also tested on two other species of Lepidoptera. Whereas antagonism was observed in Spodoptera frugiperda, synergism was found in Diatraea saccharalis. In all cases, the interaction between Vip3A and Cry1 proteins was more evident at the LC90 level than at the LC50 level. The fact that the same combination of proteins may result in a synergistic or an antagonistic interaction may be an indication that there are different types of interactions within the host, depending on the insect species tested. PMID:25275646

Safety Assessment of Bacillus thuringiensis Insecticidal Proteins Cry1C and Cry2A with a Zebrafish Embryotoxicity Test.

PubMed

Gao, Yan-Jie; Zhu, Hao-Jun; Chen, Yi; Li, Yun-He; Peng, Yu-Fa; Chen, Xiu-Ping

2018-05-02

As a result of the large-scale planting of transgenic Bacillus thuringiensis (Bt) crops, fish would be exposed to freely soluble Bt insecticidal protein(s) that are released from Bt crop tissues into adjacent bodies of water or by way of direct feeding on deposited plant material. To assess the safety of two Bt proteins Cry1C and Cry2A to fish, we used zebrafish as a representative species and exposed their embryos to 0.1, 1, and 10 mg/L of the two Cry proteins until 132 h post-fertilization and then several developmental, biochemical, and molecular parameters were evaluated. Chlorpyrifos (CPF), a known toxicant to aquatic organisms, was used as a positive control. Although CPF exposure resulted in significant developmental, biochemical, and molecular changes in the zebrafish embryos, there were almost no significant differences after Cry1C or Cry2A exposure. Thus, we conclude that zebrafish embryos are not sensitive to Cry1C and Cry2A insecticidal proteins at test concentrations.

40 CFR 174.509 - Bacillus thuringiensis Cry3A protein; exemption from the requirement of a tolerance.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Bacillus thuringiensis Cry3A protein...-INCORPORATED PROTECTANTS Tolerances and Tolerance Exemptions § 174.509 Bacillus thuringiensis Cry3A protein; exemption from the requirement of a tolerance. Residues of Bacillus thuringiensis Cry3A protein are exempted...

40 CFR 174.509 - Bacillus thuringiensis Cry3A protein; exemption from the requirement of a tolerance.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 40 Protection of Environment 24 2011-07-01 2011-07-01 false Bacillus thuringiensis Cry3A protein...-INCORPORATED PROTECTANTS Tolerances and Tolerance Exemptions § 174.509 Bacillus thuringiensis Cry3A protein; exemption from the requirement of a tolerance. Residues of Bacillus thuringiensis Cry3A protein are exempted...

40 CFR 174.509 - Bacillus thuringiensis Cry3A protein; exemption from the requirement of a tolerance.

Code of Federal Regulations, 2013 CFR

2013-07-01

... 40 Protection of Environment 25 2013-07-01 2013-07-01 false Bacillus thuringiensis Cry3A protein...-INCORPORATED PROTECTANTS Tolerances and Tolerance Exemptions § 174.509 Bacillus thuringiensis Cry3A protein; exemption from the requirement of a tolerance. Residues of Bacillus thuringiensis Cry3A protein are exempted...

40 CFR 174.509 - Bacillus thuringiensis Cry3A protein; exemption from the requirement of a tolerance.

Code of Federal Regulations, 2014 CFR

2014-07-01

... 40 Protection of Environment 24 2014-07-01 2014-07-01 false Bacillus thuringiensis Cry3A protein...-INCORPORATED PROTECTANTS Tolerances and Tolerance Exemptions § 174.509 Bacillus thuringiensis Cry3A protein; exemption from the requirement of a tolerance. Residues of Bacillus thuringiensis Cry3A protein are exempted...

40 CFR 174.509 - Bacillus thuringiensis Cry3A protein; exemption from the requirement of a tolerance.

Code of Federal Regulations, 2012 CFR

2012-07-01

... 40 Protection of Environment 25 2012-07-01 2012-07-01 false Bacillus thuringiensis Cry3A protein...-INCORPORATED PROTECTANTS Tolerances and Tolerance Exemptions § 174.509 Bacillus thuringiensis Cry3A protein; exemption from the requirement of a tolerance. Residues of Bacillus thuringiensis Cry3A protein are exempted...

[Exposure degree of important non-target arthropods to Cry2Aa in Bt rice fields].

PubMed

Zhang, Qing-Ling; Li, Yun-He; Hua, Hong-Xia; Yang, Chang-Ju; Wu, Hong-Jin; Peng, Yu-Fa

2013-06-01

Based on the principle of "risk = hazard x exposure", the selected representative nontarget organisms in the assessment of the potential effects of insect-resistant genetically modified (GM) crops on non-target arthropods in laboratory are generally the arthropod species highly exposed to the insecticidal proteins expressed by the GM crops in farmland ecosystem. In order to understand the exposure degree of the important arthropod species to Cry proteins in Bt rice fields, and to select the appropriate non-target arthropods in the risk assessment of insect-resistant GM crops, the enzyme-linked immunosorbent assay (ELISA) was conducted to measure the Cry2Aa protein concentration in the arthropods collected from the cry2Aa rice fields at different rice growth stages. The results showed that there was a significant difference in the Cry2Aa content protein concentration in different arthropod species. Some species did not contain Cry2Aa protein, while some species contained larger amounts of Cry2Aa protein. Relative to the arthropods colleted after rice anthesis, the arthropods colleted in rice anthesis contained relative higher concentrations of Cry2Aa protein, especially for the predacious arthropods. No Cry proteins were detected in parasitic arthropods. This study provided references for the laboratory assessment of the effects of GM rice on nontarget arthropods.

Unique Aspects of Cryptochrome in Chronobiology and Metabolism, Pancreatic β-Cell Dysfunction, and Regeneration: Research into Cysteine414-Alanine Mutant CRY1.

PubMed

Okano, Satoshi

2016-01-01

Cryptochrome proteins (CRYs), which can bind noncovalently to cofactor (chromophore) flavin adenine dinucleotide (FAD), occur widely among organisms. CRYs play indispensable roles in the generation of circadian rhythm in mammals. Transgenic mice (Tg mice), ubiquitously expressing mouse CRY1 having a mutation in which cysteine414 (the zinc-binding site of CRY1) being replaced with alanine, display unique phenotypes in their circadian rhythms. Moreover, male Tg mice exhibit symptoms of diabetes characterized by beta-cell dysfunction, resembling human maturity onset diabetes of the young (MODY). The lowered proliferation of β -cells is a primary cause of age-dependent β -cell loss. Furthermore, unusually enlarged duct-like structures developed prominently in the Tg mice pancreases. The duct-like structures contained insulin-positive cells, suggesting neogenesis of β -cells in the Tg mice. This review, based mainly on the author's investigation of the unique features of Tg mice, presents reported results and recent findings related to molecular processes associated with mammalian cryptochromes, especially their involvement in the regulation of metabolism. New information is described with emphasis on the aspects of islet architecture, pancreatic β -cell dysfunction, and regeneration.

The 13-kD FK506 Binding Protein, FKBP13, Interacts with a Novel Homologue of the Erythrocyte Membrane Cytoskeletal Protein 4.1

PubMed Central

Walensky, Loren D.; Gascard, Philippe; Field, Michael E.; Blackshaw, Seth; Conboy, John G.; Mohandas, Narla; Snyder, Solomon H.

1998-01-01

We have identified a novel generally expressed homologue of the erythrocyte membrane cytoskeletal protein 4.1, named 4.1G, based on the interaction of its COOH-terminal domain (CTD) with the immunophilin FKBP13. The 129-amino acid peptide, designated 4.1G–CTD, is the first known physiologic binding target of FKBP13. FKBP13 is a 13-kD protein originally identified by its high affinity binding to the immunosuppressant drugs FK506 and rapamycin (Jin, Y., M.W. Albers, W.S. Lane, B.E. Bierer, and S.J. Burakoff. 1991. Proc. Natl. Acad. Sci. USA. 88:6677– 6681); it is a membrane-associated protein thought to function as an ER chaperone (Bush, K.T., B.A. Henrickson, and S.K. Nigam. 1994. Biochem. J. [Tokyo]. 303:705–708). We report the specific association of FKBP13 with 4.1G–CTD based on yeast two-hybrid, in vitro binding and coimmunoprecipitation experiments. The histidyl-proline moiety of 4.1G–CTD is required for FKBP13 binding, as indicated by yeast experiments with truncated and mutated 4.1G–CTD constructs. In situ hybridization studies reveal cellular colocalizations for FKBP13 and 4.1G–CTD throughout the body during development, supporting a physiologic role for the interaction. Interestingly, FKBP13 cofractionates with the red blood cell homologue of 4.1 (4.1R) in ghosts, inside-out vesicles, and Triton shell preparations. The identification of FKBP13 in erythrocytes, which lack ER, suggests that FKBP13 may additionally function as a component of membrane cytoskeletal scaffolds. PMID:9531554

Susceptibility of northern corn rootworm Diabrotica barberi (Coleoptera: Chrysomelidae) to mCry3A and eCry3.1Ab Bacillus thuringiensis proteins.

PubMed

Oyediran, Isaac O; Matthews, Phillip; Palekar, Narendra; French, Wade; Conville, Jared; Burd, Tony

2016-12-01

The susceptibility of the northern corn rootworm Diabrotica barberi (Smith & Lawrence) to mCry3A and eCry3.1Ab proteins derived from Bacillus thuringiensis (Bt) was determined using a diet bioassay. Northern corn rootworm neonates were exposed to different concentrations of mCry3A and eCry3.1Ab, incorporated into artificial diet. Larval mortality was evaluated after 7 d. The mCry3A and eCry3.1Ab proteins were found to be toxic to the northern corn rootworm larvae. The LC 50 and LC 99 values for mCry3A were 5.13 and 2482.31 μg/mL, respectively. For eCry3.1Ab, the LC 50 and LC 99 values were 0.49 and 213.01 μg/mL. Based on the estimated lethal concentrations, eCry3.1Ab protein was more efficacious to northern corn rootworm larvae than mCry3A. These lethal concentration values will be used as diagnostic doses for routine annual monitoring for change in susceptibility of field collected northern corn rootworm to mCry3A, and eCry3.1Ab toxins. © 2015 Institute of Zoology, Chinese Academy of Sciences.

Arabidopsis Casein Kinase1 Proteins CK1.3 and CK1.4 Phosphorylate Cryptochrome2 to Regulate Blue Light Signaling[C][W

PubMed Central

Tan, Shu-Tang; Dai, Cheng; Liu, Hong-Tao; Xue, Hong-Wei

2013-01-01

Casein kinase1 (CK1) plays crucial roles in regulating growth and development via phosphorylating various substrates throughout the eukaryote kingdom. Blue light is crucial for normal growth of both plants and animals, and blue light receptor cryptochrome2 (CRY2) undergoes blue light–dependent phosphorylation and degradation in planta. To study the function of plant CK1s, systematic genetic analysis showed that deficiency of two paralogous Arabidopsis thaliana CK1s, CK1.3 and CK1.4, caused shortened hypocotyls, especially under blue light, while overexpression of either CK1.3 or CK1.4 resulted in the insensitive response to blue light and delayed flowering under long-day conditions. CK1.3 or CK1.4 act dependently on CRY2, and overexpression of CK1.3 or CK1.4 significantly suppresses the hypersensitive response to blue light by CRY2 overexpression. Biochemical studies showed that CK1.3 and CK1.4 directly phosphorylate CRY2 at Ser-587 and Thr-603 in vitro and negatively regulate CRY2 stability in planta, which are stimulated by blue light, further confirming the crucial roles of CK1.3 and CK1.4 in blue light responses through phosphorylating CRY2. Interestingly, expression of CK1.3 and CK1.4 is stimulated by blue light and feedback regulated by CRY2-mediated signaling. These results provide direct evidence for CRY2 phosphorylation and informative clues on the mechanisms of CRY2-mediated light responses. PMID:23897926

40 CFR 174.504 - Bacillus thuringiensis Cry1F protein; exemption from the requirement of a tolerance.

Code of Federal Regulations, 2014 CFR

2014-07-01

... 40 Protection of Environment 24 2014-07-01 2014-07-01 false Bacillus thuringiensis Cry1F protein...-INCORPORATED PROTECTANTS Tolerances and Tolerance Exemptions § 174.504 Bacillus thuringiensis Cry1F protein; exemption from the requirement of a tolerance. Residues of Bacillus thuringiensis Cry1F protein in the food...

Abnormal expression and functional characteristics of cyclic adenosine monophosphate response element binding protein in postmortem brain of suicide subjects.

PubMed

Dwivedi, Yogesh; Rao, Jagadeesh Sridhara; Rizavi, Hooriyah S; Kotowski, Jacek; Conley, Robert R; Roberts, Rosalinda C; Tamminga, Carol A; Pandey, Ghanshyam N

2003-03-01

Cyclic adenosine monophosphate response element binding protein (CREB) is a transcription factor that, on phosphorylation by protein kinases, is activated, and in response, regulates the transcription of many neuronally expressed genes. In view of the recent observations that catalytic properties and/or expression of many kinases that mediate their physiological responses through the activation of CREB are altered in the postmortem brain of subjects who commit suicide (hereafter referred to as suicide subjects), we examined the status of CREB in suicidal behavior. These studies were performed in Brodmann area (BA) 9 and hippocampus obtained from 26 suicide subjects and 20 nonpsychiatric healthy control subjects. Messenger RNA levels of CREB and neuron-specific enolase were determined in total RNA by means of quantitative reverse transcriptase-polymerase chain reaction. Protein levels and the functional characteristics of CREB were determined in nuclear fractions by means of Western blot and cyclic adenosine monophosphate response element (CRE)-DNA binding activity, respectively. In the same nuclear fraction, we determined the catalytic activity of cyclic adenosine monophosphate-stimulated protein kinase A by means of enzymatic assay. We observed a significant reduction in messenger RNA and protein levels of CREB, CRE-DNA binding activity, and basal and cyclic adenosine monophosphate-stimulated protein kinase A activity in BA 9 and hippocampus of suicide subjects, without any change in messenger RNA levels of neuron-specific enolase in BA 9. Except for protein kinase A activity, changes in CREB expression and CRE-DNA binding activity were present in all suicide subjects, irrespective of diagnosis. These changes were unrelated to postmortem intervals, age, sex, or antidepressant treatment. Given the significance of CREB in mediating various physiological functions through gene transcription, our results of decreased expression and functional characteristics of CREB in postmortem brain of suicide subjects suggest that CREB may play an important role in suicidal behavior.

Activation of the EIF2α/ATF4 and ATF6 Pathways in DU-145 Cells by Boric Acid at the Concentration Reported in Men at the US Mean Boron Intake.

PubMed

Kobylewski, Sarah E; Henderson, Kimberly A; Yamada, Kristin E; Eckhert, Curtis D

2017-04-01

Fruits, nuts, legumes, and vegetables are rich sources of boron (B), an essential plant nutrient with chemopreventive properties. Blood boric acid (BA) levels reflect recent B intake, and men at the US mean intake have a reported non-fasting level of 10 μM. Treatment of DU-145 prostate cancer cells with physiological concentrations of BA inhibits cell proliferation without causing apoptosis and activates eukaryotic initiation factor 2 (eIF2α). EIF2α induces cell differentiation and protects cells by redirecting gene expression to manage endoplasmic reticulum stress. Our objective was to determine the temporal expression of endoplasmic reticulum (ER) stress-activated genes in DU-145 prostate cells treated with 10 μM BA. Immunoblots showed post-treatment increases in eIF2α protein at 30 min and ATF4 and ATF6 proteins at 1 h and 30 min, respectively. The increase in ATF4 was accompanied by an increase in the expression of its downstream genes growth arrest and DNA damage-induced protein 34 (GADD34) and homocysteine-induced ER protein (Herp), but a decrease in GADD153/CCAAT/enhancer-binding protein homologous protein (CHOP), a pro-apoptotic gene. The increase in ATF6 was accompanied by an increase in expression of its downstream genes GRP78/BiP, calreticulin, Grp94, and EDEM. BA did not activate IRE1 or induce cleavage of XBP1 mRNA, a target of IRE1. Low boron status has been associated with increased cancer risk, low bone mineralization, and retinal degeneration. ATF4 and BiP/GRP78 function in osteogenesis and bone remodeling, calreticulin is required for tumor suppressor p53 function and mineralization of teeth, and BiP/GRP78 and EDEM prevent the aggregation of misfolded opsins which leads to retinal degeneration. The identification of BA-activated genes that regulate its phenotypic effects provides a molecular underpinning for boron nutrition and biology.

Bacillus thuringiensis pore-forming toxins trigger massive shedding of GPI-anchored aminopeptidase N from gypsy moth midgut epithelial cells

Treesearch

Algimantas P. Valaitis

2008-01-01

The insecticidal Cry proteins produced by Bacillus thuringiensis strains are pore-forming toxins (PFTs) that bind to the midgut brush border membrane and cause extensive damage to the midgut epithelial cells of susceptible insect larvae. Force-feeding B. thuringiensis PFTs to Lymantria dispar larvae elicited...

Transgenic pigeonpea events expressing Cry1Ac and Cry2Aa exhibit resistance to Helicoverpa armigera.

PubMed

Ghosh, Gourab; Ganguly, Shreeparna; Purohit, Arnab; Chaudhuri, Rituparna Kundu; Das, Sampa; Chakraborti, Dipankar

2017-07-01

Independent transgenic pigeonpea events were developed using two cry genes. Transgenic Cry2Aa-pigeonpea was established for the first time. Selected transgenic events demonstrated 100% mortality of Helicoverpa armigera in successive generations. Lepidopteran insect Helicoverpa armigera is the major yield constraint of food legume pigeonpea. The present study was aimed to develop H. armigera-resistant transgenic pigeonpea, selected on the basis of transgene expression and phenotyping. Agrobacterium tumefaciens-mediated transformation of embryonic axis explants of pigeonpea cv UPAS 120 was performed using two separate binary vectors carrying synthetic Bacillus thuringiensis insecticidal crystal protein genes, cry1Ac and cry2Aa. T 0 transformants were selected on the basis of PCR and protein expression profile. T 1 events were exclusively selected on the basis of expression and monogenic character for cry, validated through Western and Southern blot analyses, respectively. Independently transformed 12 Cry1Ac and 11 Cry2Aa single-copy events were developed. The level of Cry-protein expression in T 1 transgenic events was 0.140-0.175% of total soluble protein. Expressed Cry1Ac and Cry2Aa proteins in transgenic pigeonpea exhibited significant weight loss of second-fourth instar larvae of H. armigera and ultimately 80-100% mortality in detached leaf bioassay. Selected Cry-transgenic pigeonpea events, established at T 2 generation, inherited insect-resistant phenotype. Immunohistofluorescence localization in T 3 plants demonstrated constitutive accumulation of Cry1Ac and Cry2Aa in leaf tissues of respective transgenic events. This study is the first report of transgenic pigeonpea development, where stable integration, effective expression and biological activity of two Cry proteins were demonstrated in subsequent three generations (T 0 , T 1, and T 2 ). These studies will contribute to biotechnological breeding programmes of pigeonpea for its genetic improvement.

40 CFR 174.520 - Bacillus thuringiensis Cry1F protein in corn; exemption from the requirement of a tolerance.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Bacillus thuringiensis Cry1F protein... Cry1F protein in corn; exemption from the requirement of a tolerance. Residues of Bacillus thuringiensis Cry1F protein in corn are exempt from the requirement of a tolerance when used as plant-incorporated...

40 CFR 174.510 - Bacillus thuringiensis Cry1Ac protein in all plants; exemption from the requirement of a tolerance.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Bacillus thuringiensis Cry1Ac protein... Cry1Ac protein in all plants; exemption from the requirement of a tolerance. Residues of Bacillus thuringiensis Cry1Ac protein in all plants are exempt from the requirement of a tolerance when used as plant...

40 CFR 174.517 - Bacillus thuringiensis Cry9C protein in corn; exemption from the requirement of a tolerance.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Bacillus thuringiensis Cry9C protein... Cry9C protein in corn; exemption from the requirement of a tolerance. The plant-incorporated protectant Bacillus thuringiensis Cry9C protein in corn is exempted from the requirement of a tolerance for residues...

40 CFR 174.511 - Bacillus thuringiensis Cry1Ab protein in all plants; exemption from the requirement of a tolerance.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Bacillus thuringiensis Cry1Ab protein... Cry1Ab protein in all plants; exemption from the requirement of a tolerance. Residues of Bacillus thuringiensis Cry1Ab protein in all plants are exempt from the requirement of a tolerance when used as plant...

40 CFR 174.510 - Bacillus thuringiensis Cry1Ac protein in all plants; exemption from the requirement of a tolerance.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 40 Protection of Environment 24 2011-07-01 2011-07-01 false Bacillus thuringiensis Cry1Ac protein... Cry1Ac protein in all plants; exemption from the requirement of a tolerance. Residues of Bacillus thuringiensis Cry1Ac protein in all plants are exempt from the requirement of a tolerance when used as plant...

40 CFR 174.517 - Bacillus thuringiensis Cry9C protein in corn; exemption from the requirement of a tolerance.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 40 Protection of Environment 24 2011-07-01 2011-07-01 false Bacillus thuringiensis Cry9C protein... Cry9C protein in corn; exemption from the requirement of a tolerance. The plant-incorporated protectant Bacillus thuringiensis Cry9C protein in corn is exempted from the requirement of a tolerance for residues...

40 CFR 174.520 - Bacillus thuringiensis Cry1F protein in corn; exemption from the requirement of a tolerance.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 40 Protection of Environment 24 2011-07-01 2011-07-01 false Bacillus thuringiensis Cry1F protein... Cry1F protein in corn; exemption from the requirement of a tolerance. Residues of Bacillus thuringiensis Cry1F protein in corn are exempt from the requirement of a tolerance when used as plant-incorporated...

40 CFR 174.511 - Bacillus thuringiensis Cry1Ab protein in all plants; exemption from the requirement of a tolerance.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 40 Protection of Environment 24 2011-07-01 2011-07-01 false Bacillus thuringiensis Cry1Ab protein... Cry1Ab protein in all plants; exemption from the requirement of a tolerance. Residues of Bacillus thuringiensis Cry1Ab protein in all plants are exempt from the requirement of a tolerance when used as plant...

40 CFR 174.520 - Bacillus thuringiensis Cry1F protein in corn; exemption from the requirement of a tolerance.

Code of Federal Regulations, 2012 CFR

2012-07-01

... 40 Protection of Environment 25 2012-07-01 2012-07-01 false Bacillus thuringiensis Cry1F protein... Cry1F protein in corn; exemption from the requirement of a tolerance. Residues of Bacillus thuringiensis Cry1F protein in corn are exempt from the requirement of a tolerance when used as plant-incorporated...

40 CFR 174.520 - Bacillus thuringiensis Cry1F protein in corn; exemption from the requirement of a tolerance.

Code of Federal Regulations, 2013 CFR

2013-07-01

... 40 Protection of Environment 25 2013-07-01 2013-07-01 false Bacillus thuringiensis Cry1F protein... Cry1F protein in corn; exemption from the requirement of a tolerance. Residues of Bacillus thuringiensis Cry1F protein in corn are exempt from the requirement of a tolerance when used as plant-incorporated...

40 CFR 174.517 - Bacillus thuringiensis Cry9C protein in corn; exemption from the requirement of a tolerance.

Code of Federal Regulations, 2013 CFR

2013-07-01

... 40 Protection of Environment 25 2013-07-01 2013-07-01 false Bacillus thuringiensis Cry9C protein... Cry9C protein in corn; exemption from the requirement of a tolerance. The plant-incorporated protectant Bacillus thuringiensis Cry9C protein in corn is exempted from the requirement of a tolerance for residues...

40 CFR 174.511 - Bacillus thuringiensis Cry1Ab protein in all plants; exemption from the requirement of a tolerance.

Code of Federal Regulations, 2012 CFR

2012-07-01

... 40 Protection of Environment 25 2012-07-01 2012-07-01 false Bacillus thuringiensis Cry1Ab protein... Cry1Ab protein in all plants; exemption from the requirement of a tolerance. Residues of Bacillus thuringiensis Cry1Ab protein in all plants are exempt from the requirement of a tolerance when used as plant...

40 CFR 174.511 - Bacillus thuringiensis Cry1Ab protein in all plants; exemption from the requirement of a tolerance.

Code of Federal Regulations, 2013 CFR

2013-07-01

... 40 Protection of Environment 25 2013-07-01 2013-07-01 false Bacillus thuringiensis Cry1Ab protein... Cry1Ab protein in all plants; exemption from the requirement of a tolerance. Residues of Bacillus thuringiensis Cry1Ab protein in all plants are exempt from the requirement of a tolerance when used as plant...

40 CFR 174.510 - Bacillus thuringiensis Cry1Ac protein in all plants; exemption from the requirement of a tolerance.

Code of Federal Regulations, 2012 CFR

2012-07-01

... 40 Protection of Environment 25 2012-07-01 2012-07-01 false Bacillus thuringiensis Cry1Ac protein... Cry1Ac protein in all plants; exemption from the requirement of a tolerance. Residues of Bacillus thuringiensis Cry1Ac protein in all plants are exempt from the requirement of a tolerance when used as plant...

40 CFR 174.510 - Bacillus thuringiensis Cry1Ac protein in all plants; exemption from the requirement of a tolerance.

Code of Federal Regulations, 2014 CFR

2014-07-01

... 40 Protection of Environment 24 2014-07-01 2014-07-01 false Bacillus thuringiensis Cry1Ac protein... Cry1Ac protein in all plants; exemption from the requirement of a tolerance. Residues of Bacillus thuringiensis Cry1Ac protein in all plants are exempt from the requirement of a tolerance when used as plant...

40 CFR 174.517 - Bacillus thuringiensis Cry9C protein in corn; exemption from the requirement of a tolerance.

Code of Federal Regulations, 2014 CFR

2014-07-01

... 40 Protection of Environment 24 2014-07-01 2014-07-01 false Bacillus thuringiensis Cry9C protein... Cry9C protein in corn; exemption from the requirement of a tolerance. The plant-incorporated protectant Bacillus thuringiensis Cry9C protein in corn is exempted from the requirement of a tolerance for residues...

40 CFR 174.517 - Bacillus thuringiensis Cry9C protein in corn; exemption from the requirement of a tolerance.

Code of Federal Regulations, 2012 CFR

2012-07-01

... 40 Protection of Environment 25 2012-07-01 2012-07-01 false Bacillus thuringiensis Cry9C protein... Cry9C protein in corn; exemption from the requirement of a tolerance. The plant-incorporated protectant Bacillus thuringiensis Cry9C protein in corn is exempted from the requirement of a tolerance for residues...

40 CFR 174.511 - Bacillus thuringiensis Cry1Ab protein in all plants; exemption from the requirement of a tolerance.

Code of Federal Regulations, 2014 CFR

2014-07-01

... 40 Protection of Environment 24 2014-07-01 2014-07-01 false Bacillus thuringiensis Cry1Ab protein... Cry1Ab protein in all plants; exemption from the requirement of a tolerance. Residues of Bacillus thuringiensis Cry1Ab protein in all plants are exempt from the requirement of a tolerance when used as plant...

Butyric acid stimulates bone sialoprotein gene transcription.

PubMed

Yang, Li; Li, Zhengyang; Li, Xinyue; Wang, Zhitao; Wang, Shuang; Sasaki, Yoko; Takai, Hideki; Ogata, Yorimasa

2010-06-01

Butyric acid (sodium butyrate; BA) is an extracellular metabolite secreted from periodontopathic bacteria present in subgingival plaque. BA induces apoptosis of T and B cells, and acts as a potent inhibitor of histone deacetylases. Bone sialoprotein (BSP) is thought to function in the initial mineralization of bone, and may be crucial for osteoblast differentiation, bone matrix mineralization and tumor metastasis. In the present study we investigated the regulation of BSP transcription by BA in rat osteoblast-like ROS17/2.8 cells. At 12 h, BA (10(-4) M) increased the level of BSP mRNA, and enhanced the luciferase activity of the construct pLUC3, which includes the promoter sequence between nucleotides -116 and +60. Transcriptional stimulation by BA was abrogated in the pLUC3 construct which containing a 2-bp mutation in the fibroblast growth factor 2 response element (FRE). Gel shift analyses showed that BA increased the binding of nuclear protein to FRE. These data suggest that BA increases the transcription of the BSP gene mediated through FRE in the rat BSP gene promoter, and induces osteoblast activity in the early stage of bone formation.

Food safety knowledge on the Bt mutant protein Cry8Ka5 employed in the development of coleopteran-resistant transgenic cotton plants.

PubMed

Farias, Davi F; Peijnenburg, Ad A C M; Grossi-de-Sá, Maria F; Carvalho, Ana F U

2015-01-01

Insecticidal Cry proteins from Bacillus thuringiensis (Bt) have been exploited in the development of genetically modified (GM) crops for pest control. However, several pests are still difficult to control such as the coleopteran boll weevil Anthonomus grandis. By applying in vitro molecular evolution to the cry8Ka1 gene sequence, variants were generated with improved activity against A. grandis. Among them, Cry8Ka5 mutant protein showed coleoptericidal activity 3-fold higher (LC50 2.83 μg/mL) than that of the original protein (Cry8Ka1). Cry8Ka5 has been used in breeding programs in order to obtain coleopteran-resistant cotton plants. Nevertheless, there is some concern in relation to the food safety of transgenic crops, especially to the heterologously expressed proteins. In this context, our research group has performed risk assessment studies on Cry8Ka5, using the tests recommended by Codex as well as tests that we proposed as alternative and/or complementary approaches. Our results on the risk analysis of Cry8Ka5 taken together with those of other Cry proteins, point out that there is a high degree of certainty on their food safety. It is reasonable to emphasize that most safety studies on Cry proteins have essentially used the Codex approach. However, other methodologies would potentially provide additional information such as studies on the effects of Cry proteins and derived peptides on the indigenous gastrointestinal microbiota and on intestinal epithelial cells of humans. Additionally, emerging technologies such as toxicogenomics potentially will offer sensitive alternatives for some current approaches or methods.

Food safety knowledge on the Bt mutant protein Cry8Ka5 employed in the development of coleopteran-resistant transgenic cotton plants

PubMed Central

Farias, Davi F; Peijnenburg, Ad A C M; Grossi-de-Sá, Maria F; Carvalho, Ana F U

2015-01-01

Insecticidal Cry proteins from Bacillus thuringiensis (Bt) have been exploited in the development of genetically modified (GM) crops for pest control. However, several pests are still difficult to control such as the coleopteran boll weevil Anthonomus grandis. By applying in vitro molecular evolution to the cry8Ka1 gene sequence, variants were generated with improved activity against A. grandis. Among them, Cry8Ka5 mutant protein showed coleoptericidal activity 3-fold higher (LC50 2.83 μg/mL) than that of the original protein (Cry8Ka1). Cry8Ka5 has been used in breeding programs in order to obtain coleopteran-resistant cotton plants. Nevertheless, there is some concern in relation to the food safety of transgenic crops, especially to the heterologously expressed proteins. In this context, our research group has performed risk assessment studies on Cry8Ka5, using the tests recommended by Codex as well as tests that we proposed as alternative and/or complementary approaches. Our results on the risk analysis of Cry8Ka5 taken together with those of other Cry proteins, point out that there is a high degree of certainty on their food safety. It is reasonable to emphasize that most safety studies on Cry proteins have essentially used the Codex approach. However, other methodologies would potentially provide additional information such as studies on the effects of Cry proteins and derived peptides on the indigenous gastrointestinal microbiota and on intestinal epithelial cells of humans. Additionally, emerging technologies such as toxicogenomics potentially will offer sensitive alternatives for some current approaches or methods. PMID:26513483

Toxin stability improvement and toxicity increase against dipteran and lepidopteran larvae of Bacillus thuringiensis crystal protein Cry2Aa.

PubMed

Elleuch, Jihen; Jaoua, Samir; Ginibre, Carole; Chandre, Fabrice; Tounsi, Slim; Zghal, Raida Z

2016-12-01

Bacillus thuringiensis δ-endotoxins are the most widely used biopesticides for controlling economically important crop pests and disease vectors. Improving their efficacy is of great benefit. Here, an improvement in Cry2Aa δ-endotoxin toxicity was attempted via a cry gene over expression system using P20 from B. thuringiensis israelensis. The coexpression of Cry2Aa with P20 resulted in a seven fold increase in its production yield in B. thuringiensis. Generated crystals proved to be significantly more toxic (505.207 µg g -1 , 1.99 mg L -1 and 1.49 mg L -1 ) than the P20-lacking control (720.78 µg g -1 , 705.69 mg L -1 and 508.51 mg L -1 ) against Ephestia kuehniella, Aedes aegypti and Culex pipiens larvae respectively. In vitro, processing experiments revealed a P20-mediated protection of Cry2Aa against degradation under larval gut conditions. Thus, P20 could promote the maintenance of a tightly packaged conformation of Cry2Aa toxins in the larval midgut upon correct activation and binding to its membrane receptors. Based on their resistance against excessive proteolysis, Cry2Aa δ-endotoxins, produced in the presence of P20, could be considered as a successful control agent for E. kuehniella and an effective alternative for mosquito control, implying its possible exploitation in pest management programmes. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

Established a new double antibodies sandwich enzyme-linked immunosorbent assay for detecting Bacillus thuringiensis (Bt) Cry1Ab toxin based single-chain variable fragments from a naïve mouse phage displayed library.

PubMed

Zhang, Xiao; Xu, Chongxin; Zhang, Cunzheng; Liu, Yuan; Xie, Yajing; Liu, Xianjin

2014-04-01

ScFvs are composed of the variable regions of the heavy and light chains via a short linker that maintain the specific antigen binding abilities of antibodies. In this study, we constructed a naïve mouse phage displayed library to generate scFvs against Cry1Ab toxin. After affinity panning, positive phage-scFvs were isolated, sequenced and characterized by ELISA. The best binding ability scFv-G9 was expressed and purified. SDS-PAGE indicated that the relative molecular mass of scFv was estimated at 28 kDa. The purified scFv-G9 was used to develop a new DAS-ELISA for detecting Cry1Ab toxin, within minimum detection limit of 0.008 μg mL(-1), a working range 0.018-6.23 μg mL(-1), and the linear curve displayed an acceptable correlation coefficient of 0.98. The cross-reactivity showed that scFv-G9 had strongly binding ability to Cry1Ac toxin, but not to Cry1B, Cry1C and Cry1F toxin. The average recoveries of Cry1Ab toxin from spiked leaf and rice samples were in the range 92.1-94.8%, and 91.6-98.6%, respectively, with a coefficient of variation (C.V) less than 5.0%. These results showed promising applications of scfv-G9 for detecting Cry1Ab toxin with new DAS-ELISA. Copyright © 2014 Elsevier Ltd. All rights reserved.

Bitrophic and tritrophic effects of Bt Cry3A transgenic potato on beneficial, non-target, beetles.

PubMed

Ferry, Natalie; Mulligan, Evan A; Majerus, Michael E N; Gatehouse, Angharad M R

2007-12-01

Insect-resistant transgenic plants have been suggested to have unpredictable effects on the biodiversity of the agro-ecosystem, including potential effects on insect natural enemies, beneficial in control of crop pests. Whilst carnivorous as adults, many of these predators may also consume plant tissues, in particular plant pollen and nectar. Coleoptera are important in terms of agro-ecological research not only because of the large number of species in this order, but also because of their role as biological control agents. Thus any detrimental impact on this group of insects would be highly undesirable. The effects of potato expressing the coleopteran-specific Bacillus thuringiensis delta-endotoxin Cry3A (Bt Cry3A) on the ladybird beetle Harmonia axyridis and the carabid beetle Nebria brevicollis were investigated via the bitrophic interaction of the adult ladybird with potato flowers and the tritrophic interaction of the carabid consuming a non-target potato pest. Immunoassays confirmed accumulation of the transgene product in potato leaves and floral tissues (at levels of up to 0.01% (pollen) and 0.0285% (anthers) of total soluble protein). Despite H. axyridis and N. brevicollis belonging to the targeted insect order, no significant effects upon survival or overall body mass change of either beetle were observed. Furthermore, Bt Cry3A had no detrimental effects on reproductive fitness of either beetle species, either in terms of fecundity or subsequent egg viability. Behavioural analysis revealed no significant impact of Bt Cry3A on beetle activity or locomoter behaviour. Ligand blots indicate that this is due to either the absence of Bt-binding sites in brush border membrane vesicles (BBMV) isolated from Nebria brevicollis, or in the case of Harmonia axyridis, the binding did not functionally lead to behavioural or physical effects.

40 CFR 174.518 - Bacillus thuringiensis Cry3Bb1 protein in corn; exemption from the requirement of a tolerance.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Bacillus thuringiensis Cry3Bb1 protein... Cry3Bb1 protein in corn; exemption from the requirement of a tolerance. Residues of Bacillus thuringiensis Cry3Bb1 protein in corn are exempt from the requirement of a tolerance when used as plant-incorporated...

40 CFR 174.518 - Bacillus thuringiensis Cry3Bb1 protein in corn; exemption from the requirement of a tolerance.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 40 Protection of Environment 24 2011-07-01 2011-07-01 false Bacillus thuringiensis Cry3Bb1 protein... Cry3Bb1 protein in corn; exemption from the requirement of a tolerance. Residues of Bacillus thuringiensis Cry3Bb1 protein in corn are exempt from the requirement of a tolerance when used as plant-incorporated...

40 CFR 174.518 - Bacillus thuringiensis Cry3Bb1 protein in corn; exemption from the requirement of a tolerance.

Code of Federal Regulations, 2014 CFR

2014-07-01

... 40 Protection of Environment 24 2014-07-01 2014-07-01 false Bacillus thuringiensis Cry3Bb1 protein... Cry3Bb1 protein in corn; exemption from the requirement of a tolerance. Residues of Bacillus thuringiensis Cry3Bb1 protein in corn are exempt from the requirement of a tolerance when used as plant-incorporated...

40 CFR 174.518 - Bacillus thuringiensis Cry3Bb1 protein in corn; exemption from the requirement of a tolerance.

Code of Federal Regulations, 2013 CFR

2013-07-01

... 40 Protection of Environment 25 2013-07-01 2013-07-01 false Bacillus thuringiensis Cry3Bb1 protein... Cry3Bb1 protein in corn; exemption from the requirement of a tolerance. Residues of Bacillus thuringiensis Cry3Bb1 protein in corn are exempt from the requirement of a tolerance when used as plant-incorporated...

40 CFR 174.518 - Bacillus thuringiensis Cry3Bb1 protein in corn; exemption from the requirement of a tolerance.

Code of Federal Regulations, 2012 CFR

2012-07-01

... 40 Protection of Environment 25 2012-07-01 2012-07-01 false Bacillus thuringiensis Cry3Bb1 protein... Cry3Bb1 protein in corn; exemption from the requirement of a tolerance. Residues of Bacillus thuringiensis Cry3Bb1 protein in corn are exempt from the requirement of a tolerance when used as plant-incorporated...

Assessment of potential adjuvanticity of Cry proteins.

PubMed

Joshi, Saurabh S; Barnett, Brian; Doerrer, Nancy G; Glenn, Kevin; Herman, Rod A; Herouet-Guicheney, Corinne; Hunst, Penny; Kough, John; Ladics, Gregory S; McClain, Scott; Papineni, Sabitha; Poulsen, Lars K; Rascle, Jean-Baptiste; Tao, Ai-Lin; van Ree, Ronald; Ward, Jason; Bowman, Christal C

2016-08-01

Genetically modified (GM) crops have achieved success in the marketplace and their benefits extend beyond the overall increase in harvest yields to include lowered use of insecticides and decreased carbon dioxide emissions. The most widely grown GM crops contain gene/s for targeted insect protection, herbicide tolerance, or both. Plant expression of Bacillus thuringiensis (Bt) crystal (Cry) insecticidal proteins have been the primary way to impart insect resistance in GM crops. Although deemed safe by regulatory agencies globally, previous studies have been the basis for discussions around the potential immuno-adjuvant effects of Cry proteins. These studies had limitations in study design. The studies used animal models with extremely high doses of Cry proteins, which when given using the ig route were co-administered with an adjuvant. Although the presumption exists that Cry proteins may have immunostimulatory activity and therefore an adjuvanticity risk, the evidence shows that Cry proteins are expressed at very low levels in GM crops and are unlikely to function as adjuvants. This conclusion is based on critical review of the published literature on the effects of immunomodulation by Cry proteins, the history of safe use of Cry proteins in foods, safety of the Bt donor organisms, and pre-market weight-of-evidence-based safety assessments for GM crops. Copyright © 2016 Elsevier Inc. All rights reserved.

The fate and transport of the Cry1Ab protein in an agricultural field and laboratory aquatic microcosms.

PubMed

Strain, Katherine E; Lydy, Michael J

2015-08-01

Genetically engineered crops expressing insecticidal crystalline proteins derived from Bacillus thuringiensis (Bt), were commercialized almost two decades ago as a means to manage agricultural pests. The Bt proteins are highly specific and only lethal upon ingestion, limiting the scope of toxicity to target insects. However, concern of exposure to non-target organisms and negative public perceptions regarding Bt crops has caused controversy surrounding their use. The objective of this research was to monitor the fate and transport of a Bt protein, Cry1Ab, in a large-scale agricultural field containing maize expressing the Cry1Ab protein and a non-Bt near isoline, and in aquatic microcosms. The highest environmental concentrations of the Cry1Ab protein were found in runoff water and sediment, up to 130ngL(-1) and 143ngg(-1) dry weight, respectively, with the Cry1Ab protein detected in both Bt and non-Bt maize fields. As surface runoff and residual crop debris can transport Bt proteins to waterways adjacent to agricultural fields, a series of laboratory experiments were conducted to determine the potential fate of the Cry1Ab protein under different conditions. The results showed that sediment type and temperature can influence the degradation of the Cry1Ab protein in an aquatic system and that the Cry1Ab protein can persist for up to two months. Although Cry1Ab protein concentrations measured in the field soil indicate little exposure to terrestrial organisms, the consistent input of Bt-contaminated runoff and crop debris into agricultural waterways is relevant to understanding potential consequences to aquatic species. Copyright © 2015 Elsevier Ltd. All rights reserved.

in silico identification of cross affinity towards Cry1Ac pesticidal protein with receptor enzyme in Bos taurus and sequence, structure analysis of crystal proteins for stability.

PubMed

Ebenezer, King Solomon; Nachimuthu, Ramesh; Thiagarajan, Prabha; Velu, Rajesh Kannan

2013-01-01

Any novel protein introduced into the GM crops need to be evaluated for cross affinity on living organisms. Many researchers are currently focusing on the impact of Bacillus thuringiensis cotton on soil and microbial diversity by field experiments. In spite of this, in silico approach might be helpful to elucidate the impact of cry genes. The crystal a protein which was produced by Bt at the time of sporulation has been used as a biological pesticide to target the insectivorous pests like Cry1Ac for Helicoverpa armigera and Cry2Ab for Spodoptera sp. and Heliothis sp. Here, we present the comprehensive in silico analysis of Cry1Ac and Cry2Ab proteins with available in silico tools, databases and docking servers. Molecular docking of Cry1Ac with procarboxypeptidase from Helicoverpa armigera and Cry1Ac with Leucine aminopeptidase from Bos taurus has showed the 125(th) amino acid position to be the preference site of Cry1Ac protein. The structures were compared with each other and it showed 5% of similarity. The cross affinity of this toxin that have confirmed the earlier reports of ill effects of Bt cotton consumed by cattle.

Persistence of Bt Bacillus thuringiensis Cry1Aa toxin in various soils determined by physicochemical reactions

NASA Astrophysics Data System (ADS)

Helassa, N.; Noinville, S.; Déjardin, P.; Janot, J. M.; Quiquampoix, H.; Staunton, S.

2009-04-01

Insecticidal Cry proteins from the soil bacterium, Bacillus thuringiensis (Bt) are produced by a class of genetically modified (GM) crops, and released into soils through root exudates and upon decomposition of residues. In contrast to the protoxin produced by the Bacillus, the protein produced in GM crops does not require activation in insect midguts and thereby potentially looses some of its species specificity. Although gene transfer and resistance emergence phenomena are well documented, the fate of these toxins in soil has not yet been clearly elucidated. Cry proteins, in common with other proteins, are adsorbed on soils and soil components. Adsorption on soil, and the reversibility of this adsorption is an important aspect of the environmental behaviour of these toxins. The orientation of the molecule and conformational changes on surfaces may modify the toxicity and confer some protection against microbial degradation. Adsorption will have important consequences for both the risk of exposition of non target species and the acquisition of resistance by target species. We have adopted different approaches to investigate the fate of Cry1Aa in soils and model minerals. In each series of experiments we endeavoured to maintain the protein in a monomeric form (pH above 6.5 and a high ionic strength imposed with 150 mM NaCl). The adsorption and the desorbability of the Cry1Aa Bt insecticidal protein were measured on two different homoionic clays: montmorillonite and kaolinite. Adsorption isotherms obtained followed a low affinity interaction for both clays and could be fitted using the Langmuir equation. Binding of the toxin decreased as the pH increased from 6.5 (close to the isoelectric point) to 9. Maximum adsorption was about 40 times greater on montmorillonite (1.71 g g-1) than on kaolinite (0.04 g g-1) in line with the contrasting respective specific surface areas of the minerals. Finally, some of the adsorbed toxin was desorbed by water and more, about 36 %, by high pH buffers, indicating that it was not extremely tightly bound. Moreover, the toxin was easily and quasi-completely desorbed using zwiterrionic and non-ionic detergents. We have compared the persistence of Cry1Aa on various soils over several weeks varying microbial activity (inhibition or activation). Neither physical nor chemical inhibition of microbial activity led to enhanced persistence of the protein in soil. Stimulation of microbial activity did not accelerate loss of detectable protein. These findings suggest that loss of protein in soil is not determined by microbial breakdown. Chemical fixation and conformational changes may contribute to the observed trends. Hydrophobic interactions with soil organo-mineral surfaces may play an important role in both the adsorption and subsequent changes in conformation of the protein.

Phage-Mediated Competitive Chemiluminescent Immunoassay for Detecting Cry1Ab Toxin by Using an Anti-Idiotypic Camel Nanobody.

PubMed

Qiu, Yulou; Li, Pan; Dong, Sa; Zhang, Xiaoshuai; Yang, Qianru; Wang, Yulong; Ge, Jing; Hammock, Bruce D; Zhang, Cunzheng; Liu, Xianjin

2018-01-31

Cry toxins have been widely used in genetically modified organisms for pest control, raising public concern regarding their effects on the natural environment and food safety. In this work, a phage-mediated competitive chemiluminescent immunoassay (c-CLIA) was developed for determination of Cry1Ab toxin using anti-idiotypic camel nanobodies. By extracting RNA from camels' peripheral blood lymphocytes, a naive phage-displayed nanobody library was established. Using anti-Cry1Ab toxin monoclonal antibodies (mAbs) against the library for anti-idiotypic antibody screening, four anti-idiotypic nanobodies were selected and confirmed to be specific for anti-Cry1Ab mAb binding. Thereafter, a c-CLIA was developed for detection of Cry1Ab toxin based on anti-idiotypic camel nanobodies and employed for sample testing. The results revealed a half-inhibition concentration of developed assay to be 42.68 ± 2.54 ng/mL, in the linear range of 10.49-307.1 ng/mL. The established method is highly specific for Cry1Ab recognition, with negligible cross-reactivity for other Cry toxins. For spiked cereal samples, the recoveries of Cry1Ab toxin ranged from 77.4% to 127%, with coefficient of variation of less than 9%. This study demonstrated that the competitive format based on phage-displayed anti-idiotypic nanobodies can provide an alternative strategy for Cry toxin detection.

Development of an innovative immunoassay for CP4EPSPS and Cry1AB genetically modified protein detection and quantification.

PubMed

Ermolli, M; Prospero, A; Balla, B; Querci, M; Mazzeo, A; Van Den Eede, G

2006-09-01

An innovative immunoassay, called enzyme-linked immunoabsorbant assay (ELISA) Reverse, based on a new conformation of the solid phase, was developed. The solid support was expressly designed to be immersed directly in liquid samples to detect the presence of protein targets. Its application is proposed in those cases where a large number of samples have to be screened simultaneously or when the simultaneous detection of different proteins is required. As a first application, a quantitative immunoassay for Cry1AB protein in genetically modified maize was optimized. The method was tested using genetically modified organism concentrations from 0.1 to 2.0%. The limit of detection and limit of quantitation of the method were determined as 0.0056 and 0.0168 (expressed as the percentage of genetically modified organisms content), respectively. A qualitative multiplex assay to assess the presence of two genetically modified proteins simultaneously was also established for the case of the Cry1AB and the CP4EPSPS (5-enolpyruvylshikimate-3-phosphate synthase) present in genetically modified maize and soy, respectively.

Adsorption of transgenic insecticidal Cry1Ab protein to SiO2. 2. Patch-controlled electrostatic attraction.

PubMed

Madliger, Michael; Sander, Michael; Schwarzenbach, René P

2010-12-01

Adsorption governs the fate of Cry proteins from genetically modified Bt crops in soils. The effect of ionic strength (I) on the adsorption of Cry1Ab (isoelectric point IEP(Cry1Ab) ≈ 6) to negatively charged quartz (SiO(2)) and positively charged poly-L-lysine (PLL) was investigated at pH 5 to 8, using quartz crystal microbalance with dissipation monitoring and optical waveguide lightmode spectroscopy. Cry1Ab adsorbed via positively and negatively charged surface patches to SiO(2) and PLL, respectively. This patch controlled electrostatic attraction (PCEA) explains the observed increase in Cry1Ab adsorption to sorbents that carried the same net charge as the protein (SiO(2) at pH > IEP(Cry1Ab) and PLL at pH < IEP(Cry1Ab)) with decreasing I. In contrast, the adsorption of two reference proteins, BSA and HEWL, with different adsorption mechanism, were little affected by similar changes of I. Consistent with PCEA, Cry1Ab desorption from SiO(2) at pH > IEP(Cry1Ab) increased with increasing I and pH. Weak Cry1Ab-SiO(2) PCEA above pH 7 resulted in reversible, concentration dependent adsorption. Solution depletion experiments showed that PCEA also governed Cry1Ab adsorption to SiO(2) particles at environmentally relevant concentrations (a few ng mL(-1)). These results imply that models describing Cry1Ab adsorption to charged surfaces in soils need to account for the nonuniform surface charge distribution of the protein.

The conserved potassium channel filter can have distinct ion binding profiles: Structural analysis of rubidium, cesium, and barium binding in NaK2K

PubMed Central

Lam, Yee Ling; Zeng, Weizhong; Sauer, David Bryant

2014-01-01

Potassium channels are highly selective for K+ over the smaller Na+. Intriguingly, they are permeable to larger monovalent cations such as Rb+ and Cs+ but are specifically blocked by the similarly sized Ba2+. In this study, we used structural analysis to determine the binding profiles for these permeant and blocking ions in the selectivity filter of the potassium-selective NaK channel mutant NaK2K and also performed permeation experiments using single-channel recordings. Our data revealed that some ion binding properties of NaK2K are distinct from those of the canonical K+ channels KcsA and MthK. Rb+ bound at sites 1, 3, and 4 in NaK2K, as it does in KcsA. Cs+, however, bound predominantly at sites 1 and 3 in NaK2K, whereas it binds at sites 1, 3, and 4 in KcsA. Moreover, Ba2+ binding in NaK2K was distinct from that which has been observed in KcsA and MthK, even though all of these channels show similar Ba2+ block. In the presence of K+, Ba2+ bound to the NaK2K channel at site 3 in conjunction with a K+ at site 1; this led to a prolonged block of the channel (the external K+-dependent Ba2+ lock-in state). In the absence of K+, however, Ba2+ acts as a permeating blocker. We found that, under these conditions, Ba2+ bound at sites 1 or 0 as well as site 3, allowing it to enter the filter from the intracellular side and exit from the extracellular side. The difference in the Ba2+ binding profile in the presence and absence of K+ thus provides a structural explanation for the short and prolonged Ba2+ block observed in NaK2K. PMID:25024267

The conserved potassium channel filter can have distinct ion binding profiles: structural analysis of rubidium, cesium, and barium binding in NaK2K.

PubMed

Lam, Yee Ling; Zeng, Weizhong; Sauer, David Bryant; Jiang, Youxing

2014-08-01

Potassium channels are highly selective for K(+) over the smaller Na(+). Intriguingly, they are permeable to larger monovalent cations such as Rb(+) and Cs(+) but are specifically blocked by the similarly sized Ba(2+). In this study, we used structural analysis to determine the binding profiles for these permeant and blocking ions in the selectivity filter of the potassium-selective NaK channel mutant NaK2K and also performed permeation experiments using single-channel recordings. Our data revealed that some ion binding properties of NaK2K are distinct from those of the canonical K(+) channels KcsA and MthK. Rb(+) bound at sites 1, 3, and 4 in NaK2K, as it does in KcsA. Cs(+), however, bound predominantly at sites 1 and 3 in NaK2K, whereas it binds at sites 1, 3, and 4 in KcsA. Moreover, Ba(2+) binding in NaK2K was distinct from that which has been observed in KcsA and MthK, even though all of these channels show similar Ba(2+) block. In the presence of K(+), Ba(2+) bound to the NaK2K channel at site 3 in conjunction with a K(+) at site 1; this led to a prolonged block of the channel (the external K(+)-dependent Ba(2+) lock-in state). In the absence of K(+), however, Ba(2+) acts as a permeating blocker. We found that, under these conditions, Ba(2+) bound at sites 1 or 0 as well as site 3, allowing it to enter the filter from the intracellular side and exit from the extracellular side. The difference in the Ba(2+) binding profile in the presence and absence of K(+) thus provides a structural explanation for the short and prolonged Ba(2+) block observed in NaK2K. © 2014 Lam et al.

Evidence of Field-Evolved Resistance of Spodoptera frugiperda to Bt Corn Expressing Cry1F in Brazil That Is Still Sensitive to Modified Bt Toxins

PubMed Central

Monnerat, Rose; Martins, Erica; Macedo, Cristina; Queiroz, Paulo; Praça, Lilian; Soares, Carlos Marcelo; Moreira, Helio; Grisi, Isabella; Silva, Joseane; Soberon, Mario; Bravo, Alejandra

2015-01-01

Brazil ranked second only to the United States in hectares planted to genetically modified crops in 2013. Recently corn producers in the Cerrado region reported that the control of Spodoptera frugiperda with Bt corn expressing Cry1Fa has decreased, forcing them to use chemicals to reduce the damage caused by this insect pest. A colony of S. frugiperda was established from individuals collected in 2013 from Cry1Fa corn plants (SfBt) in Brazil and shown to have at least more than ten-fold higher resistance levels compared with a susceptible colony (Sflab). Laboratory assays on corn leaves showed that in contrast to SfLab population, the SfBt larvae were able to survive by feeding on Cry1Fa corn leaves. The SfBt population was maintained without selection for eight generations and shown to maintain high levels of resistance to Cry1Fa toxin. SfBt showed higher cross-resistance to Cry1Aa than to Cry1Ab or Cry1Ac toxins. As previously reported, Cry1A toxins competed the binding of Cry1Fa to brush border membrane vesicles (BBMV) from SfLab insects, explaining cross-resistance to Cry1A toxins. In contrast Cry2A toxins did not compete Cry1Fa binding to SfLab-BBMV and no cross-resistance to Cry2A was observed, although Cry2A toxins show low toxicity to S. frugiperda. Bioassays with Cry1AbMod and Cry1AcMod show that they are highly active against both the SfLab and the SfBt populations. The bioassay data reported here show that insects collected from Cry1Fa corn in the Cerrado region were resistant to Cry1Fa suggesting that resistance contributed to field failures of Cry1Fa corn to control S. frugiperda. PMID:25830928

Evidence of field-evolved resistance of Spodoptera frugiperda to Bt corn expressing Cry1F in Brazil that is still sensitive to modified Bt toxins.

PubMed

Monnerat, Rose; Martins, Erica; Macedo, Cristina; Queiroz, Paulo; Praça, Lilian; Soares, Carlos Marcelo; Moreira, Helio; Grisi, Isabella; Silva, Joseane; Soberon, Mario; Bravo, Alejandra

2015-01-01

Brazil ranked second only to the United States in hectares planted to genetically modified crops in 2013. Recently corn producers in the Cerrado region reported that the control of Spodoptera frugiperda with Bt corn expressing Cry1Fa has decreased, forcing them to use chemicals to reduce the damage caused by this insect pest. A colony of S. frugiperda was established from individuals collected in 2013 from Cry1Fa corn plants (SfBt) in Brazil and shown to have at least more than ten-fold higher resistance levels compared with a susceptible colony (Sflab). Laboratory assays on corn leaves showed that in contrast to SfLab population, the SfBt larvae were able to survive by feeding on Cry1Fa corn leaves. The SfBt population was maintained without selection for eight generations and shown to maintain high levels of resistance to Cry1Fa toxin. SfBt showed higher cross-resistance to Cry1Aa than to Cry1Ab or Cry1Ac toxins. As previously reported, Cry1A toxins competed the binding of Cry1Fa to brush border membrane vesicles (BBMV) from SfLab insects, explaining cross-resistance to Cry1A toxins. In contrast Cry2A toxins did not compete Cry1Fa binding to SfLab-BBMV and no cross-resistance to Cry2A was observed, although Cry2A toxins show low toxicity to S. frugiperda. Bioassays with Cry1AbMod and Cry1AcMod show that they are highly active against both the SfLab and the SfBt populations. The bioassay data reported here show that insects collected from Cry1Fa corn in the Cerrado region were resistant to Cry1Fa suggesting that resistance contributed to field failures of Cry1Fa corn to control S. frugiperda.

Selective estrogen receptor modulators and betulinic acid act synergistically to target ERα and SP1 transcription factor dependent Pygopus expression in breast cancer.

PubMed

Tzenov, Youlian R; Andrews, Phillip; Voisey, Kim; Gai, Luis; Carter, Beverley; Whelan, Kathryn; Popadiuk, Catherine; Kao, Kenneth R

2016-06-01

Estrogen and progesterone hormone receptor (ER and PR) expression in invasive breast cancer predicts response to hormone disruptive therapy. Pygopus2 (hPYGO2) encodes a chromatin remodelling protein important for breast cancer growth and cell cycle progression. The aims of this study were to determine the mechanism of expression of hPYGO2 in breast cancer and to examine how this expression is affected therapeutically. hPYGO2 and ER protein expression was examined in a breast tumour microarray by immunohistochemistry. hPYGO2 RNA and protein expression was examined in ER+ and ER- breast cancer cell lines in the presence of selective estrogen hormone receptor modulator drugs and the specificity protein-1 (SP1) inhibitor, betulinic acid (BA). The effects of these drugs on the ability for ER and SP1 to bind the hPYGO2 promoter and affect cell cycle progression were studied using chromatin immunoprecipitation assays. hPYGO2 was expressed in seven of eight lines and in nuclei of 98% of 65 breast tumours, including 3 Ductal carcinoma in situ and 62 invasive specimens representing ER-negative (22%) and ER-positive (78%) cases. Treatment with either 4-Hydroxytamoxifen (OHT) or fulvestrant reduced hPYGO2 mRNA 10-fold and protein 5-10-fold within 4 h. Promoter analysis indicated an ER/SP1 binding site at nt -225 to -531 of hPYGO2. SP1 RNA interference and BA reduced hPYGO2 protein and RNA expression by fivefold in both ER- and ER+ cells. Further attenuation was achieved by combining BA and 4-OHT resulting in eightfold reduction in cell growth. Our findings reveal a mechanistic link between hormone signalling and the growth transcriptional programme. The activation of its expression by ERα and/or SP1 suggests hPYGO2 as a theranostic target for hormone therapy responsive and refractory breast cancer. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fu, Zidong Donna; Klaassen, Curtis D., E-mail: cklaasse@kumc.edu

Previous studies showed glucose and insulin signaling can regulate bile acid (BA) metabolism during fasting or feeding. However, limited knowledge is available on the effect of calorie restriction (CR), a well-known anti-aging intervention, on BA homeostasis. To address this, the present study utilized a “dose–response” model of CR, where male C57BL/6 mice were fed 0, 15, 30, or 40% CR diets for one month, followed by BA profiling in various compartments of the enterohepatic circulation by UPLC-MS/MS technique. This study showed that 40% CR increased the BA pool size (162%) as well as total BAs in serum, gallbladder, and smallmore » intestinal contents. In addition, CR “dose-dependently” increased the concentrations of tauro-cholic acid (TCA) and many secondary BAs (produced by intestinal bacteria) in serum, such as tauro-deoxycholic acid (TDCA), DCA, lithocholic acid, ω-muricholic acid (ωMCA), and hyodeoxycholic acid. Notably, 40% CR increased TDCA by over 1000% (serum, liver, and gallbladder). Interestingly, 40% CR increased the proportion of 12α-hydroxylated BAs (CA and DCA), which correlated with improved glucose tolerance and lipid parameters. The CR-induced increase in BAs correlated with increased expression of BA-synthetic (Cyp7a1) and conjugating enzymes (BAL), and the ileal BA-binding protein (Ibabp). These results suggest that CR increases BAs in male mice possibly through orchestrated increases in BA synthesis and conjugation in liver as well as intracellular transport in ileum. - Highlights: • Dose response effects of short-term CR on BA homeostasis in male mice. • CR increased the BA pool size and many individual BAs. • CR altered BA composition (increased proportion of 12α-hydroxylated BAs). • Increased mRNAs of BA enzymes in liver (Cyp7a1 and BAL) and ileal BA binding protein.« less

The effects of Bacillus thuringiensis Cry6A on the survival, growth, reproduction, locomotion, and behavioral response of Caenorhabditis elegans.

PubMed

Luo, Hui; Xiong, Jing; Zhou, Qiaoni; Xia, Liqiu; Yu, Ziquan

2013-12-01

Several families of crystal proteins from Bacillus thuringiensis exhibit nematicidal activity. Cry5B protein, a pore-forming toxin, has been intensively studied yielding many insights into the mode of action of crystal protein at molecular level and pathogenesis of pore-forming toxins. However, little attention was paid to Cry6A, another representative nematicidal crystal protein. Cry6A shares very low homology with Cry5B at amino acid sequence and probably acts in a distinct pathway from Cry5B and even the other main commercial crystal proteins. In the current study, we comprehensively investigated the nematicidal properties of Cry6Aa2 against the free-living soil nematode Caenorhabditis elegans and examined the physical response of C. elegans to Cry6Aa2 attack. Our results indicate that Cry6Aa2 exhibits high lethal activity to C. elegans and could cause detrimental effects on C. elegans, including obviously suppressed growth, decreased brood size, and even abnormal motility. Meanwhile, our study additionally shows that C. elegans could defend against the Cry6Aa2 toxin harmful threat through behavioral defense responses, such as reduced oral uptake and physical avoidance. In general, this study suggests that Cry6Aa2 possesses diverse nematicidal properties, which strongly indicates that Cry6Aa2 is a promising potential candidate of nematicidal agent. Moreover, this study highlights the importance of behavioral responses in defense of C. elegans for survival and demonstrates the key role of crystal protein in the interaction of B. thuringiensis-C. elegans. These findings could shed light on understanding the interaction of C. elegans with B. thuringiensis and provide a perfect model to study the role of pathogenic factor in the interaction of pathogen-host.

Adsorption of transgenic insecticidal Cry1Ab protein to silica particles. Effects on transport and bioactivity.

PubMed

Madliger, Michael; Gasser, Christoph A; Schwarzenbach, René P; Sander, Michael

2011-05-15

Bt crops are genetically modified to be resistant against insect pests by expressing insecticidal Cry proteins. The processes governing the fate and bioavailability of the expressed transgenic Cry proteins in soils are poorly understood. We studied adsorption of Cry1Ab to negatively charged silica (SiO(2)) particles, a major soil constituent and a model for negatively charged mineral surfaces, at pH 5 to 10 and ionic strengths I = 10 mM to 250 mM, both in solution depletion and saturated column transport experiments. Cry1Ab-SiO(2) interactions were dominated by patch-controlled electrostatic attraction (PCEA), as evident from increasing Cry1Ab attraction to SiO(2) with decreasing I at pH at which both Cry1Ab and SiO(2) were net negatively charged. Experimental and modeling evidence is provided that the surface heterogeneity of SiO(2) particles modulated PCEA, leading to a fraction of adsorption sites with slow Cry1Ab desorption kinetics. Desorption rates from these sites increased upon increasing the solution pH. In toxicity bioassays, we demonstrated that Cry1Ab retained insecticidal activity when adsorbed to SiO(2), suggesting high protein conformational stability during adsorption-desorption cycles. Models predicting Cry1A protein adsorption in soils therefore need to account for combined effects of the nonuniform protein surface charge distribution and of sorbent surface heterogeneity.

Occurrence, leaching, and degradation of Cry1Ab protein from transgenic maize detritus in agricultural streams

DOE PAGES

Griffiths, Natalie A.; Tank, Jennifer L.; Royer, Todd V.; ...

2017-03-15

The insecticidal Cry1Ab protein expressed by transgenic (Bt) maize can enter adjacent water bodies via multiple pathways, but its fate in stream ecosystems is not as well studied as in terrestrial systems. In this study, we used a combination of field sampling and laboratory experiments to examine the occurrence, leaching, and degradation of soluble Cry1Ab protein derived from Bt maize in agricultural streams. We surveyed 11 agricultural streams in northwestern Indiana, USA, on 6 dates that encompassed the growing season, crop harvest, and snowmelt/spring flooding, and detected Cry1Ab protein in the water column and in flowing subsurface tile drains atmore » concentrations of 3–60 ng/L. In a series of laboratory experiments, submerged Bt maize leaves leached Cry1Ab into stream water with 1% of the protein remaining in leaves after 70 d. Laboratory experiments suggested that dissolved Cry1Ab protein degraded rapidly in microcosms containing water-column microorganisms, and light did not enhance breakdown by stimulating assimilatory uptake of the protein by autotrophs. Here, the common detection of Cry1Ab protein in streams sampled across an agricultural landscape, combined with laboratory studies showing rapid leaching and degradation, suggests that Cry1Ab may be pseudo-persistent at the watershed scale due to the multiple input pathways from the surrounding terrestrial environment.« less

Occurrence, leaching, and degradation of Cry1Ab protein from transgenic maize detritus in agricultural streams

DOE Office of Scientific and Technical Information (OSTI.GOV)

Griffiths, Natalie A.; Tank, Jennifer L.; Royer, Todd V.

The insecticidal Cry1Ab protein expressed by transgenic (Bt) maize can enter adjacent water bodies via multiple pathways, but its fate in stream ecosystems is not as well studied as in terrestrial systems. In this study, we used a combination of field sampling and laboratory experiments to examine the occurrence, leaching, and degradation of soluble Cry1Ab protein derived from Bt maize in agricultural streams. We surveyed 11 agricultural streams in northwestern Indiana, USA, on 6 dates that encompassed the growing season, crop harvest, and snowmelt/spring flooding, and detected Cry1Ab protein in the water column and in flowing subsurface tile drains atmore » concentrations of 3–60 ng/L. In a series of laboratory experiments, submerged Bt maize leaves leached Cry1Ab into stream water with 1% of the protein remaining in leaves after 70 d. Laboratory experiments suggested that dissolved Cry1Ab protein degraded rapidly in microcosms containing water-column microorganisms, and light did not enhance breakdown by stimulating assimilatory uptake of the protein by autotrophs. Here, the common detection of Cry1Ab protein in streams sampled across an agricultural landscape, combined with laboratory studies showing rapid leaching and degradation, suggests that Cry1Ab may be pseudo-persistent at the watershed scale due to the multiple input pathways from the surrounding terrestrial environment.« less

Enzyme-linked immunosorbent assay detection and bioactivity of Cry1Ab protein fragments

USDA-ARS?s Scientific Manuscript database

Enzyme-linked immunosorbent assay (ELISA) has emerged as the preferred detection method for Cry proteins in environmental matrices. Concerns exist that ELISAs are capable of detecting fragments of Cry proteins, which may lead to an over-estimation of the concentration of these proteins in the enviro...

Use of a pollen-based diet to expose the ladybird beetle Propylea japonica to insecticidal proteins.

PubMed

Zhang, Xiaojie; Li, Yunhe; Romeis, Jörg; Yin, Xinming; Wu, Kongming; Peng, Yufa

2014-01-01

A rape seed pollen-based diet was developed and found to be suitable for use in a dietary exposure assay for Propylea japonica. Using the diet, we established and validated a dietary exposure assay by using the protease inhibitor E-64 as positive control. Dose-dependent responses were documented for all observed life-table parameters of P. japonica including survival, pupation and eclosion rates, development time and adult weight. Results suggested that the dietary assay can detect the effects of insecticidal compounds on the survival and development of P. japonica. Using the established dietary assay, we subsequently tested the toxicity of Cry1Ab, Cry1Ac and Cry1F proteins that are expressed by transgenic maize, cotton or rice plants to P. japonica larvae. The diet containing E-64 was included as a positive control. Survival and development of P. japonica larvae were not adversely affected when the diet contained purified Cry1Ab, Cry1Ac, or Cry1F at 500 µg/g diet representing a worst-case exposure scenario. In contrast, P. japonica larvae were adversely affected when the diet contained E-64. The bioactivity and stability of the Cry proteins in the diet and Cry protein uptake by the ladybird larvae were confirmed by bioassay with a Cry-sensitive insect species and by ELISA. The current study describes a suitable experimental system for assessing the potential effects of gut-active insecticidal compounds on ladybird beetle larvae. The experiments with the Cry proteins demonstrate that P. japonica larvae are not sensitive to Cry1Ab, Cry1Ac and Cry1F.

Bioinformatic analysis for allergenicity assessment of Bacillus thuringiensis Cry proteins expressed in insect-resistant food crops.

PubMed

Randhawa, Gurinder Jit; Singh, Monika; Grover, Monendra

2011-02-01

The novel proteins introduced into the genetically modified (GM) crops need to be evaluated for the potential allergenicity before their introduction into the food chain to address the safety concerns of consumers. At present, there is no single definitive test that can be relied upon to predict allergic response in humans to a new protein; hence a composite approach to allergic response prediction is described in this study. The present study reports on the evaluation of the Cry proteins, encoded by cry1Ac, cry1Ab, cry2Ab, cry1Ca, cry1Fa/cry1Ca hybrid, being expressed in Bt food crops that are under field trials in India, for potential allergenic cross-reactivity using bioinformatics search tools. The sequence identity of amino acids was analyzed using FASTA3 of AllergenOnline version 10.0 and BLASTX of NCBI Entrez to identify any potential sequence matches to allergen proteins. As a step further in the detection of allergens, an independent database of domains in the allergens available in the AllergenOnline database was also developed. The results indicated no significant alignment and similarity of Cry proteins at domain level with any of the known allergens revealing that there is no potential risk of allergenic cross-reactivity. Copyright © 2010 Elsevier Ltd. All rights reserved.

Construction of an Immunized Rabbit Phage Display Library for Selecting High Activity against Bacillus thuringiensis Cry1F Toxin Single-Chain Antibodies.

PubMed

Xu, Chongxin; Zhang, Cunzheng; Zhong, Jianfeng; Hu, Hui; Luo, Shimin; Liu, Xiaoqin; Zhang, Xiao; Liu, Yuan; Liu, Xianjin

2017-07-26

In the present study, a Cry1F-immunized rabbit phage display library (6.96 × 10 8 cfu/mL) was constructed for selecting high activity of anti-Cry1F toxin single-chain antibody (a single-chain variable fragment, scFv) by biopanning. A total of 16 positive monoclonal phage scFv's were obtained after 4 rounds of panning, which were identified by enzyme-linked immunosorbent assay (ELISA), polymerized chain reaction, and DNA sequencing. The most positive phage scFv (named RF4) was expressed in Escherichia coli HB2151, and a soluble protein of approximately 30 kDa was purified with sodium dodecyl sulfate-polyacrylamide gel electrophoresis. An indirect competitive ELISA (IC-ELISA) was established on the basis of purified soluble RF4-scFv for Cry1F toxin. It indicated the 50% inhibition of the control (IC 50 ) was 11.56 ng/mL and the detection limit (IC 10 ) was 0.18 ng/mL and showed weak cross-reactivities for Cry1Ab (2.8%), Cry1Ac (1.3%), and Cry1B, Cry1C, Cry1Ie, and Cry2A (less than 0.1%). It was found that IC-ELISA detected Cry1F toxin spiked in rice, wheat, corn, and soil samples with good accuracy, stability, and repeatability. The recoveries were in the range of 80.2-99.6%, and the coefficients of variation were in the range of 2.5-10.0%. These results showed that IC-ELISA based on scFv from the immunized rabbit phage display library was promising for specific detection of Cry1F toxin in agroproducts and environmental samples.

No Interactions of Stacked Bt Maize with the Non-target Aphid Rhopalosiphum padi and the Spider Mite Tetranychus urticae.

PubMed

Shu, Yinghua; Romeis, Jörg; Meissle, Michael

2018-01-01

In the agroecosystem, genetically engineered plants producing insecticidal Cry proteins from Bacillus thuringiensis (Bt) interact with non-target herbivores and other elements of the food web. Stacked Bt crops expose herbivores to multiple Cry proteins simultaneously. In this study, the direct interactions between SmartStax ® Bt maize producing six different Cry proteins and two herbivores with different feeding modes were investigated. Feeding on leaves of Bt maize had no effects on development time, fecundity, or longevity of the aphid Rhopalosiphum padi (Hemiptera: Aphididae), and no effects on the egg hatching time, development time, sex ratio, fecundity, and survival of the spider mite Tetranychus urticae (Acari: Tetranychidae). The results thus confirm the lack of effects on those species reported previously for some of the individual Cry proteins. In the Bt maize leaves, herbivore infestation did not result in a consistent change of Cry protein concentrations. However, occasional statistical differences between infested and non-infested leaves were observed for some Cry proteins and experimental repetitions. Overall, the study provides evidence that the Cry proteins in stacked Bt maize do not interact with two common non-target herbivores.

Investigations of immunogenic, allergenic and adjuvant properties of Cry1Ab protein after intragastric exposure in a food allergy model in mice.

PubMed

Andreassen, Monica; Bøhn, Thomas; Wikmark, Odd-Gunnar; Bodin, Johanna; Traavik, Terje; Løvik, Martinus; Nygaard, Unni Cecilie

2016-05-04

In genetically modified (GM) crops there is a risk that the inserted genes may introduce new allergens and/or adjuvants into the food and feed chain. The MON810 maize, expressing the insecticidal Cry1Ab toxin, is grown in many countries worldwide. In animal models, intranasal and intraperitoneal immunisations with the purified Cry1Ab proteins have induced immune responses, and feeding trials with Cry1Ab-containing feed have revealed some altered immune responses. Previous investigations have primarily measured antibody responses to the protein, while investigations of clinical food allergy symptoms, or allergy promotion (adjuvant effect) associated with the Cry1Ab protein are largely missing. We aimed to investigate immunogenic, allergenic and adjuvant properties of purified Cry1Ab toxin (trypCry1Ab, i.e., trypsin activated Cry1Ab) in a mouse model of food allergy. Female C3H/HeJ mice were immunized by intragastric gavage of 10 μg purified, trypsin activated Cry1Ab toxin (trypCry1Ab) alone or together with the food allergen lupin. Cholera toxin was added as a positive control for adjuvant effect to break oral tolerance. Clinical symptoms (anaphylaxis) as well as humoral and cellular responses were assessed. In contrast to results from previous airway investigations, we observed no indication of immunogenic properties of trypCry1Ab protein after repeated intragastric exposures to one dose, with or without CT as adjuvant. Moreover, the results indicated that trypCry1Ab given by the intragastric route was not able to promote allergic responses or anaphylactic reactions against the co-administered allergen lupin at the given dose. The study suggests no immunogenic, allergenic or adjuvant capacity of the given dose of trypCry1Ab protein after intragastric exposure of prime aged mice.

Intra-vitreal αB crystallin fused to elastin-like polypeptide provides neuroprotection in a mouse model of age-related macular degeneration.

PubMed

Sreekumar, Parameswaran G; Li, Zhe; Wang, Wan; Spee, Christine; Hinton, David R; Kannan, Ram; MacKay, J Andrew

2018-05-18

Age-related macular degeneration (AMD) is the leading cause of severe and irreversible central vision loss, and the primary site of AMD pathology is the retinal pigment epithelium (RPE). Geographic atrophy (GA) is an advanced form of AMD characterized by extensive RPE cell loss, subsequent degeneration of photoreceptors, and thinning of retina. This report describes the protective potential of a peptide derived from the αB crystallin protein using a sodium iodate (NaIO 3 ) induced mouse model of GA. Systemic NaIO 3 challenge causes degeneration of the RPE and neighboring photoreceptors, which have similarities to retinas of GA patients. αB crystallin is an abundant ocular protein that maintains ocular clarity and retinal homeostasis, and a small peptide from this protein (mini cry) displays neuroprotective properties. To retain this peptide for longer in the vitreous, mini cry was fused to an elastin-like polypeptide (ELP). A single intra-vitreal treatment by this crySI fusion significantly inhibits retinal degeneration in comparison to free mini cry. While mini cry is cleared from the eye with a mean residence time of 0.4 days, crySI is retained with a mean residence time of 3.0 days; furthermore, fundus photography reveals evidence of retention at two weeks. Unlike the free mini cry, crySI protects the RPE against NaIO 3 challenge for at least two weeks after administration. CrySI also inhibits RPE apoptosis and caspase-3 activation and protects the retina from cell death up to 1-month post NaIO 3 challenge. These results show that intra-ocular ELP-linked peptides such as crySI hold promise as protective agents to prevent RPE atrophy and progressive retinal degeneration in AMD. Copyright © 2018 Elsevier B.V. All rights reserved.

High Expression of Cry1Ac Protein in Cotton (Gossypium hirsutum) by Combining Independent Transgenic Events that Target the Protein to Cytoplasm and Plastids.

PubMed

Singh, Amarjeet Kumar; Paritosh, Kumar; Kant, Uma; Burma, Pradeep Kumar; Pental, Deepak

2016-01-01

Transgenic cotton was developed using two constructs containing a truncated and codon-modified cry1Ac gene (1,848 bp), which was originally characterized from Bacillus thuringiensis subspecies kurstaki strain HD73 that encodes a toxin highly effective against many lepidopteran pests. In Construct I, the cry1Ac gene was cloned under FMVde, a strong constitutively expressing promoter, to express the encoded protein in the cytoplasm. In Construct II, the encoded protein was directed to the plastids using a transit peptide taken from the cotton rbcSIb gene. Genetic transformation experiments with Construct I resulted in a single copy insertion event in which the Cry1Ac protein expression level was 2-2.5 times greater than in the Bacillus thuringiensis cotton event Mon 531, which is currently used in varieties and hybrids grown extensively in India and elsewhere. Another high expression event was selected from transgenics developed with Construct II. The Cry protein expression resulting from this event was observed only in the green plant parts. No transgenic protein expression was observed in the non-green parts, including roots, seeds and non-green floral tissues. Thus, leucoplasts may lack the mechanism to allow entry of a protein tagged with the transit peptide from a protein that is only synthesized in tissues containing mature plastids. Combining the two events through sexual crossing led to near additive levels of the toxin at 4-5 times the level currently used in the field. The two high expression events and their combination will allow for effective resistance management against lepidopteran insect pests, particularly Helicoverpa armigera, using a high dosage strategy.

Diversity of Bacillus thuringiensis strains in the maize and bean phylloplane and their respective soils in Colombia.

PubMed

Jara, S; Maduell, P; Orduz, S

2006-07-01

To evaluate the distribution of Bacillus thuringiensis strains from maize and bean phylloplane and their respective soils. B. thuringiensis was isolated from the phylloplane and soil of maize and bean from three municipalities in Antioquia, Colombia. Ninety six samples of phylloplane and 24 of soil were analyzed. A total of 214 isolates were obtained from 96 phylloplane samples while 59 isolates were recovered from 24 soil samples. Sixty five per cent and 12% of the phylloplane and soil isolates, respectively, showed activity against Spodoptera frugiperda. These isolates contained delta-endotoxin proteins of 57 and 130 kDa. The most toxic isolates against S. frugiperda had the genotype cry1Aa, cry1Ac, cry1B, and cry1D. In contrast, 27% of the phylloplane isolates and 88% of the soil isolates were active against Culex quinquefasciatus and had protein profiles similar to B. thuringiensis serovar. medellin and B. thuringiensis serovar. israelensis. The most active isolates contain cry4 and cry11 genes. The predominant population of B. thuringiensis on the phylloplane harbored the cry1 gene and was active against S. frugiperda, whereas in soil, isolates harboring cry11 gene and active against C. quinquefasciatus were the majority. The predominance of specific B. thuringiensis populations, both on the leaves and in the soil, suggests the presence of selection in B. thuringiensis populations on the studied environment.

Boronic acid-modified lipid nanocapsules: a novel platform for the highly efficient inhibition of hepatitis C viral entry

NASA Astrophysics Data System (ADS)

Khanal, Manakamana; Barras, Alexandre; Vausselin, Thibaut; Fénéant, Lucie; Boukherroub, Rabah; Siriwardena, Aloysius; Dubuisson, Jean; Szunerits, Sabine

2015-01-01

The search for viral entry inhibitors that selectively target viral envelope glycoproteins has attracted increasing interest in recent years. Amongst the handful of molecules reported to show activity as hepatitis C virus (HCV) entry inhibitors are a variety of glycan-binding proteins including the lectins, cyanovirin-N (CV-N) and griffithsin. We recently demonstrated that boronic acid-modified nanoparticles are able to reduce HCV entry through a similar mechanism to that of lectins. A major obstacle to any further development of these nanostructures as viral entry inhibitors is their only moderate maximal inhibition potential. In the present study, we report that lipid nanocapsules (LNCs), surface-functionalized with amphiphilic boronic acid (BA) through their post-insertion into the semi-rigid shell of the LNCs, are indeed far superior as HCV entry inhibitors when compared with previously reported nanostructures. These 2nd generation particles (BA-LNCs) are shown to prevent HCV infection in the micromolar range (IC50 = 5.4 μM of BA moieties), whereas the corresponding BA monomers show no significant effects even at the highest analyzed concentration (20 μM). The new BA-LNCs are the most promising boronolectin-based HCV entry inhibitors reported to date and are thus observed to show great promise in the development of a pseudolectin-based therapeutic agent.The search for viral entry inhibitors that selectively target viral envelope glycoproteins has attracted increasing interest in recent years. Amongst the handful of molecules reported to show activity as hepatitis C virus (HCV) entry inhibitors are a variety of glycan-binding proteins including the lectins, cyanovirin-N (CV-N) and griffithsin. We recently demonstrated that boronic acid-modified nanoparticles are able to reduce HCV entry through a similar mechanism to that of lectins. A major obstacle to any further development of these nanostructures as viral entry inhibitors is their only moderate maximal inhibition potential. In the present study, we report that lipid nanocapsules (LNCs), surface-functionalized with amphiphilic boronic acid (BA) through their post-insertion into the semi-rigid shell of the LNCs, are indeed far superior as HCV entry inhibitors when compared with previously reported nanostructures. These 2nd generation particles (BA-LNCs) are shown to prevent HCV infection in the micromolar range (IC50 = 5.4 μM of BA moieties), whereas the corresponding BA monomers show no significant effects even at the highest analyzed concentration (20 μM). The new BA-LNCs are the most promising boronolectin-based HCV entry inhibitors reported to date and are thus observed to show great promise in the development of a pseudolectin-based therapeutic agent. Electronic supplementary information (ESI) available. See DOI: 10.1039/c4nr03875d

Detrimental effect of expression of Bt endotoxin Cry1Ac on in vitro regeneration, in vivo growth and development of tobacco and cotton transgenics.

PubMed

Rawat, Preeti; Singh, Amarjeet Kumar; Ray, Krishna; Chaudhary, Bhupendra; Kumar, Sanjeev; Gautam, Taru; Kanoria, Shaveta; Kaur, Gurpreet; Kumar, Paritosh; Pental, Deepak; Burma, Pradeep Kumar

2011-06-01

High levels of expression of the cry1Ac gene from Bacillus thuringiensis cannot be routinely achieved in transgenic plants despite modifications made in the gene to improve its expression. This has been attributed to the instability of the transcript in a few reports. In the present study, based on the genetic transformation of cotton and tobacco, we show that the expression of the Cry1Ac endotoxin has detrimental effects on both the in vitro and in vivo growth and development of transgenic plants. A number of experiments on developing transgenics in cotton with different versions of cry1Ac gene showed that the majority of the plants did not express any Cry1Ac protein. Based on Southern blot analysis, it was also observed that a substantial number of lines did not contain the cry1Ac gene cassette although they contained the marker gene nptII. More significantly, all the lines that showed appreciable levels of expression were found to be phenotypically abnormal. Experiments on transformation of tobacco with different constructs expressing the cry1Ac gene showed that in vitro regeneration was inhibited by the encoded protein. Further, out of a total of 145 independent events generated with the different cry1Ac gene constructs in tobacco, only 21 showed expression of the Cry1Ac protein, confirming observations made in cotton that regenerants that express high levels of the Cry1Ac protein are selected against during regeneration of transformed events. This problem was circumvented by targeting the Cry1Ac protein to the chloroplast, which also significantly improved the expression of the protein.

Adsorption of Insecticidal Crystal Protein Cry11Aa onto Nano-Mg(OH)2: Effects on Bioactivity and Anti-Ultraviolet Ability.

PubMed

Pan, Xiaohong; Xu, Zhangyan; Li, Lan; Shao, Enshi; Chen, Saili; Huang, Tengzhou; Chen, Zhi; Rao, Wenhua; Huang, Tianpei; Zhang, Lingling; Wu, Songqing; Guan, Xiong

2017-11-01

The traditional Bacillus thuringiensis (Bt) formulations for field applications are not resistant to harsh environmental conditions. Hence, the active ingredients of the Bt bioinsecticides could degrade quickly and has low anti-ultraviolet ability in the field, which significantly limits its practical application. In the present study, we developed an efficient and stable delivery system for Bt Cry11Aa toxins. We coated Cry11Aa proteins with Mg(OH) 2 nanoparticles (MHNPs), and then assessed the effects of MHNPs on bioactivity and anti-ultraviolet ability of the Cry11Aa proteins. Our results indicated that MHNPs, like "coating clothes", could effectively protect the Cry protein and enhance the insecticidal bioactivity after UV radiation (the degradation rate was decreased from 64.29% to 16.67%). In addtion, MHNPs could improve the proteolysis of Cry11Aa in the midgut and aggravate the damage of the Cry protein to the gut epithelial cells, leading to increased insecticidal activity against Culex quinquefasciatus. Our results revealed that MHNPs, as an excellent nanocarrier, could substantially improve the insecticidal bioactivity and anti-ultraviolet ability of Cry11Aa.

Baseline sensitivity of maize borers in India to the Bacillus thuringiensis insecticidal proteins Cry1A.105 and Cry2Ab2.

PubMed

Jalali, Sushil K; Yadavalli, Lalitha; Ojha, Rakshit; Kumar, Pradyumn; Sulaikhabeevi, Suby B; Sharma, Reema; Nair, Rupa; Kadanur, Ravi C; Kamath, Subray P; Komarlingam, Mohan S

2015-08-01

Among the major pests of maize in India are two stem borers, Chilo partellus (Swinhoe) and Sesamia inferens (Walker), and an earworm, Helicoverpa armigera (Hübner). As a pest control strategy, transgenic Bacillus thuringiensis (Bt) maize hybrids are undergoing regulatory trials in India. We have determined the sensitivity of the target lepidopterans to the insecticidal Bt proteins expressed in Bt maize, as this determines product efficacy and the resistance management strategy to be adopted. Maize hybrids with event MON89034 express two insecticidal Bt proteins, Cry1A.105 and Cry2Ab2. Sensitivity profiles of 53 populations of C. partellus, 21 populations of S. inferens and 21 populations of H. armigera, collected between 2008 and 2013 from maize-growing areas in India, to Cry1A.105 and Cry2Ab2 proteins were generated through dose-response assays. Cry1A.105 protein was the most effective to neonates of C. partellus (mean MIC90 range 0.30-1.0 µg mL(-1) ) and H. armigera (mean MIC90 range 0.71-8.22 µg mL(-1) ), whereas Cry2Ab2 (mean MIC90 range 0.65-1.70 µg mL(-1) ) was the most effective to S. inferens. Populations of C. partellus, S. inferens and H. armigera were susceptible to the Bt proteins Cry1A.105 and Cry2Ab2. The Bt sensitivity data will serve as precommercialisation benchmarks for resistance monitoring purposes. © 2014 Society of Chemical Industry.

The interaction of two-spotted spider mites, Tetranychus urticae Koch, with Cry protein production and predation by Amblyseius andersoni (Chant) in Cry1Ac/Cry2Ab cotton and Cry1F maize.

USDA-ARS?s Scientific Manuscript database

Crops producing insecticidal crystal (Cry) proteins from the bacterium, Bacillus thuringiensis (Bt), are an important tool for managing lepidopteran pests on cotton and maize. However, the effects of these Bt crops on non-target organisms, especially natural enemies that provide biological control s...

Resistance to Bacillus thuringiensis Mediated by an ABC Transporter Mutation Increases Susceptibility to Toxins from Other Bacteria in an Invasive Insect

PubMed Central

Zhang, Dandan; Gong, Lingling; He, Fei; Soberón, Mario; Bravo, Alejandra; Tabashnik, Bruce E.; Wu, Kongming

2016-01-01

Evolution of pest resistance reduces the efficacy of insecticidal proteins from the gram-positive bacterium Bacillus thuringiensis (Bt) used widely in sprays and transgenic crops. Recent efforts to delay pest adaptation to Bt crops focus primarily on combinations of two or more Bt toxins that kill the same pest, but this approach is often compromised because resistance to one Bt toxin causes cross-resistance to others. Thus, integration of Bt toxins with alternative controls that do not exhibit such cross-resistance is urgently needed. The ideal scenario of negative cross-resistance, where selection for resistance to a Bt toxin increases susceptibility to alternative controls, has been elusive. Here we discovered that selection of the global crop pest, Helicoverpa armigera, for >1000-fold resistance to Bt toxin Cry1Ac increased susceptibility to abamectin and spineotram, insecticides derived from the soil bacteria Streptomyces avermitilis and Saccharopolyspora spinosa, respectively. Resistance to Cry1Ac did not affect susceptibility to the cyclodiene, organophospate, or pyrethroid insecticides tested. Whereas previous work demonstrated that the resistance to Cry1Ac in the strain analyzed here is conferred by a mutation disrupting an ATP-binding cassette protein named ABCC2, the new results show that increased susceptibility to abamectin is genetically linked with the same mutation. Moreover, RNAi silencing of HaABCC2 not only decreased susceptibility to Cry1Ac, it also increased susceptibility to abamectin. The mutation disrupting ABCC2 reduced removal of abamectin in live larvae and in transfected Hi5 cells. The results imply that negative cross-resistance occurs because the wild type ABCC2 protein plays a key role in conferring susceptibility to Cry1Ac and in decreasing susceptibility to abamectin. The negative cross-resistance between a Bt toxin and other bacterial insecticides reported here may facilitate more sustainable pest control. PMID:26872031

Structural Analysis of a Putative Aminoglycoside N-Acetyltransferase from Bacillus anthracis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Klimecka, Maria M.; Chruszcz, Maksymilian; Font, Jose

2012-02-15

For the last decade, worldwide efforts for the treatment of anthrax infection have focused on developing effective vaccines. Patients that are already infected are still treated traditionally using different types of standard antimicrobial agents. The most popular are antibiotics such as tetracyclines and fluoroquinolones. While aminoglycosides appear to be less effective antimicrobial agents than other antibiotics, synthetic aminoglycosides have been shown to act as potent inhibitors of anthrax lethal factor and may have potential application as antitoxins. Here, we present a structural analysis of the BA2930 protein, a putative aminoglycoside acetyltransferase, which may be a component of the bacterium's aminoglycosidemore » resistance mechanism. The determined structures revealed details of a fold characteristic only for one other protein structure in the Protein Data Bank, namely, YokD from Bacillus subtilis. Both BA2930 and YokD are members of the Antibiotic-NAT superfamily (PF02522). Sequential and structural analyses showed that residues conserved throughout the Antibiotic-NAT superfamily are responsible for the binding of the cofactor acetyl coenzyme A. The interaction of BA2930 with cofactors was characterized by both crystallographic and binding studies.« less

Comparative performance of modified full-length and truncated Bacillus thuringiensis-cry1Ac genes in transgenic tomato.

PubMed

Koul, Bhupendra; Yadav, Reena; Sanyal, Indraneel; Amla, Devindra Vijay

2015-01-01

Bt-cry1Ac gene has been reputedly effective against Helicoverpa armigera a notorious lepidopteran pest. Reports on the expression of full-length and truncated cry1Ac genes in plants for effective resistance against Helicoverpa sp. have been documented however, their performance is still ambiguous. Moreover, the question remains to be addressed that truncation of 3' end of the native gene was documented and suggested for active insecticidal toxin production while the most successful transgenic event(s) of commercialized-cotton are based on full-length of the cry gene. Therefore, we performed a comparative study on the efficacy of the two versions of cry1Ac genes (full-length: 3,510 bp and truncated: 1,845 bp) in T0 and T1 transgenic tomato plants and analyzed the extent of protection against H. armigera and also compared the results with our previous findings related to a successful transgenic tomato line Ab25E, expressing cry1Ab gene. The integration of cry1Ac gene(s) in T0 transgenic plants and its inheritance in T1 progeny was observed by PCR, RT-PCR and Southern blot hybridization analysis while, the toxin integrity, expression and toxicity was monitored by Western immunoassay, DAS-ELISA and insect bioassay respectively. An average transformation frequency and Bt-Cry protein content of 16.93 ± 2.10 and 0.0020-0.0128% of total soluble protein (TSP) was obtained with pRD400 vector (Trcry1Ac) while, a much lower value of 9.30 ± 2.041 and 0.0001 - 0.0026% of TSP was observed with pNBRI-1 vector (Flcry1Ac), respectively. The promising Trcry1Ac T0 transgenic plants and their T1 progeny gave full protection from H. armigera. Although Flcry1Ac gene showed lower transformation frequency and lower expression, it showed higher toxicity to H. armigera when compared with truncated Trcry1Ac gene. The full-length cry1Ac gene can be redesigned for higher expression and performance in dicots or a hybrid gene could be designed having a blend of strong receptor binding and stable expression characteristics for enhanced efficacy and toxicity to the susceptible insects.

The fate of fusion Cry1Ab/1Ac proteins from Bt-transgenic rice in soil and water.

PubMed

Liu, Yongbo; Li, Junsheng; Luo, Zunlan; Wang, Huaru; Liu, Fang

2016-02-01

Toxin proteins form transgenic crops entering into the environment are likely affect non-target organisms. To investigate the entry route and fate of fusion Cry1Ab/1Ac proteins from transgenic rice expressing insecticide toxins from Bacillus thuringiensis (Bt) in soil and water, we conducted greenhouse and field experiments in 2013 and 2014. Cry1Ab/1Ac proteins from Bt-transgenic rice in soil was found within a horizontal range of 25cm, where most of plant roots distributed. Concentration of Cry1Ab/1Ac proteins was lower in water than in soil in the greenhouse experiment, and no Cry1Ab/1Ac protein was detected in field water. Cry1Ab/1Ac concentration from rice straws was higher in ditch water than in distilled water due to the existence of aquatic organisms in ditch water. Bt proteins from transgenic crops enter into soil ecosystems mainly through root exudates and into aquatic ecosystems through plant residues, which determines Bt fate in the environment. Copyright © 2015 Elsevier Inc. All rights reserved.

Consumption of Bt Maize Pollen Containing Cry1Ie Does Not Negatively Affect Propylea japonica (Thunberg) (Coleoptera: Coccinellidae).

PubMed

Li, Yonghui; Liu, Yanmin; Yin, Xinming; Romeis, Jörg; Song, Xinyuan; Chen, Xiuping; Geng, Lili; Peng, Yufa; Li, Yunhe

2017-03-16

Propylea japonica (Thunberg) (Coleoptera: Coccinellidae) are prevalent predators and pollen feeders in East Asian maize fields. They are therefore indirectly (via prey) and directly (via pollen) exposed to Cry proteins within Bt -transgenic maize fields. The effects of Cry1Ie-producing transgenic maize pollen on the fitness of P. japonica was assessed using two dietary-exposure experiments in the laboratory. In the first experiment, survival, larval developmental time, adult fresh weight, and fecundity did not differ between ladybirds consuming Bt or non- Bt maize pollen. In the second experiment, none of the tested lethal and sublethal parameters of P. japonica were negatively affected when fed a rapeseed pollen-based diet containing Cry1Ie protein at 200 μg/g dry weight of diet. In contrast, the larval developmental time, adult fresh weight, and fecundity of P. japonica were significantly adversely affected when fed diet containing the positive control compound E-64. In both experiments, the bioactivity of the Cry1Ie protein in the food sources was confirmed by bioassays with a Cry1Ie-sensitive lepidopteran species. These results indicated that P. japonica are not affected by the consumption of Cry1Ie-expressing maize pollen and are not sensitive to the Cry1Ie protein, suggesting that the growing of Bt maize expressing Cry1Ie protein will pose a negligible risk to P. japonica .

Modulation of DNA methylation machineries in japanese rice fish (Oryzias latipes) embryogenesis by ethanol and 5-azacytidine

USDA-ARS?s Scientific Manuscript database

As a sequel of our investigations on the impact of epigenome in inducing fetal alcohol spectrum disorder (FASD) phenotypes in Japanese rice fish, we investigated on several DNA methylation machinery genes including DNA methyl transferase 3ba (dnmt3ba) and methyl binding proteins (MBPs), namely, mbdl...

Evaluation of sampling plans to detect Cry9C protein in corn flour and meal.

PubMed

Whitaker, Thomas B; Trucksess, Mary W; Giesbrecht, Francis G; Slate, Andrew B; Thomas, Francis S

2004-01-01

StarLink is a genetically modified corn that produces an insecticidal protein, Cry9C. Studies were conducted to determine the variability and Cry9C distribution among sample test results when Cry9C protein was estimated in a bulk lot of corn flour and meal. Emphasis was placed on measuring sampling and analytical variances associated with each step of the test procedure used to measure Cry9C in corn flour and meal. Two commercially available enzyme-linked immunosorbent assay kits were used: one for the determination of Cry9C protein concentration and the other for % StarLink seed. The sampling and analytical variances associated with each step of the Cry9C test procedures were determined for flour and meal. Variances were found to be functions of Cry9C concentration, and regression equations were developed to describe the relationships. Because of the larger particle size, sampling variability associated with cornmeal was about double that for corn flour. For cornmeal, the sampling variance accounted for 92.6% of the total testing variability. The observed sampling and analytical distributions were compared with the Normal distribution. In almost all comparisons, the null hypothesis that the Cry9C protein values were sampled from a Normal distribution could not be rejected at 95% confidence limits. The Normal distribution and the variance estimates were used to evaluate the performance of several Cry9C protein sampling plans for corn flour and meal. Operating characteristic curves were developed and used to demonstrate the effect of increasing sample size on reducing false positives (seller's risk) and false negatives (buyer's risk).

Identification of Cha o 3 homolog Cry j 4 from Cryptomeria japonica (Japanese cedar) pollen: Limitation of the present Japanese cedar-specific ASIT.

PubMed

Osada, Toshihiro; Tanaka, Yuki; Yamada, Akira; Sasaki, Eiji; Utsugi, Teruhiro

2018-03-07

About one-third of the Japanese population suffers from Japanese cedar pollinosis, which is frequently accompanied by Japanese cypress pollinosis. Recently, a novel major Japanese cypress pollen allergen, Cha o 3, was discovered. However, whether a Cha o 3 homolog is present in Japanese cedar pollen remains to be determined. Western blot analysis was performed using Cha o 3-specific antiserum. In addition, cloning of the gene encoding Cry j 4 was conducted using total cDNA from the male flower of Japanese cedar trees. Allergen potency and cross-reactivity were investigated using a T-cell proliferation assay, basophil activation test, and ImmunoCAP inhibition assay. A low amount of Cha o 3 homolog protein was detected in Japanese cedar pollen extract. The deduced amino acid sequence of Cry j 4 showed 84% identity to that of Cha o 3. Cross-reactivity between Cry j 4 and Cha o 3 was observed at the T cell and IgE levels. Cry j 4 was discovered as a counterpart allergen of Cha o 3 in Japanese cedar pollen, with a relationship similar to that between Cry j 1-Cha o 1 and Cry j 2-Cha o 2. Our findings also suggest that allergen-specific immunotherapy (ASIT) using Japanese cedar pollen extract does not induce adequate immune tolerance to Cha o 3 due to the low amount of Cry j 4 in Japanese cedar pollen. Therefore, ASIT using Cha o 3 or cypress pollen extract coupled with Japanese cedar pollen extract is required in order to optimally control allergy symptoms during Japanese cypress pollen season. Copyright © 2018 Japanese Society of Allergology. Production and hosting by Elsevier B.V. All rights reserved.

Localisation of the Putative Magnetoreceptive Protein Cryptochrome 1b in the Retinae of Migratory Birds and Homing Pigeons.

PubMed

Bolte, Petra; Bleibaum, Florian; Einwich, Angelika; Günther, Anja; Liedvogel, Miriam; Heyers, Dominik; Depping, Anne; Wöhlbrand, Lars; Rabus, Ralf; Janssen-Bienhold, Ulrike; Mouritsen, Henrik

2016-01-01

Cryptochromes are ubiquitously expressed in various animal tissues including the retina. Some cryptochromes are involved in regulating circadian activity. Cryptochrome proteins have also been suggested to mediate the primary mechanism in light-dependent magnetic compass orientation in birds. Cryptochrome 1b (Cry1b) exhibits a unique carboxy terminus exclusively found in birds so far, which might be indicative for a specialised function. Cryptochrome 1a (Cry1a) is so far the only cryptochrome protein that has been localised to specific cell types within the retina of migratory birds. Here we show that Cry1b, an alternative splice variant of Cry1a, is also expressed in the retina of migratory birds, but it is primarily located in other cell types than Cry1a. This could suggest different functions for the two splice products. Using diagnostic bird-specific antibodies (that allow for a precise discrimination between both proteins), we show that Cry1b protein is found in the retinae of migratory European robins (Erithacus rubecula), migratory Northern Wheatears (Oenanthe oenanthe) and pigeons (Columba livia). In all three species, retinal Cry1b is localised in cell types which have been discussed as potentially well suited locations for magnetoreception: Cry1b is observed in the cytosol of ganglion cells, displaced ganglion cells, and in photoreceptor inner segments. The cytosolic rather than nucleic location of Cry1b in the retina reported here speaks against a circadian clock regulatory function of Cry1b and it allows for the possible involvement of Cry1b in a radical-pair-based magnetoreception mechanism.

Mining new crystal protein genes from Bacillus thuringiensis on the basis of mixed plasmid-enriched genome sequencing and a computational pipeline.

PubMed

Ye, Weixing; Zhu, Lei; Liu, Yingying; Crickmore, Neil; Peng, Donghai; Ruan, Lifang; Sun, Ming

2012-07-01

We have designed a high-throughput system for the identification of novel crystal protein genes (cry) from Bacillus thuringiensis strains. The system was developed with two goals: (i) to acquire the mixed plasmid-enriched genomic sequence of B. thuringiensis using next-generation sequencing biotechnology, and (ii) to identify cry genes with a computational pipeline (using BtToxin_scanner). In our pipeline method, we employed three different kinds of well-developed prediction methods, BLAST, hidden Markov model (HMM), and support vector machine (SVM), to predict the presence of Cry toxin genes. The pipeline proved to be fast (average speed, 1.02 Mb/min for proteins and open reading frames [ORFs] and 1.80 Mb/min for nucleotide sequences), sensitive (it detected 40% more protein toxin genes than a keyword extraction method using genomic sequences downloaded from GenBank), and highly specific. Twenty-one strains from our laboratory's collection were selected based on their plasmid pattern and/or crystal morphology. The plasmid-enriched genomic DNA was extracted from these strains and mixed for Illumina sequencing. The sequencing data were de novo assembled, and a total of 113 candidate cry sequences were identified using the computational pipeline. Twenty-seven candidate sequences were selected on the basis of their low level of sequence identity to known cry genes, and eight full-length genes were obtained with PCR. Finally, three new cry-type genes (primary ranks) and five cry holotypes, which were designated cry8Ac1, cry7Ha1, cry21Ca1, cry32Fa1, and cry21Da1 by the B. thuringiensis Toxin Nomenclature Committee, were identified. The system described here is both efficient and cost-effective and can greatly accelerate the discovery of novel cry genes.

Ingestion of Bt corn pollen containing Cry1Ab/2Aj or Cry1Ac does not harm Propylea japonica larvae

PubMed Central

Liu, Yanmin; Liu, Qingsong; Wang, Yanan; Chen, Xiuping; Song, Xinyuan; Romeis, Jörg; Li, Yunhe; Peng, Yufa

2016-01-01

Propylea japonica (Thunberg) (Coleoptera: Coccinellidae) is a prevalent pollen consumer in corn fields and is therefore exposed to insecticidal proteins contained in the pollen of insect-resistant transgenic corn cultivars expressing Cry proteins derived from Bacillus thuringiensis (Bt). In the present study, the potential effect of Cry1Ab/2Aj- or Cry1Ac-containing transgenic Bt corn pollen on the fitness of P. japonica larvae was evaluated. The results show that the larval developmental time was significantly shorter when P. japonica larvae were fed pollen from Bt corn cultivars rather than control pollen but that pupation rate, eclosion rate, and adult fresh weight were not significantly affected. In the feeding experiments, the stability of the Cry proteins in the food sources was confirmed. When Bt corn pollen passed through the gut of P. japonica, 23% of Cry1Ab/2Aj was digested. The results demonstrate that consumption of Bt corn pollen containing Cry1Ab/2Aj or Cry1Ac has no detrimental effect on P. japonica larvae; the shortened developmental time of larvae that consumed these proteins was likely attributable to unknown differences in the nutritional composition between the Bt-transgenic and control corn pollen. PMID:27005950

Computational investigations of physicochemical, pharmacokinetic, toxicological properties and molecular docking of betulinic acid, a constituent of Corypha taliera (Roxb.) with Phospholipase A2 (PLA2).

PubMed

Khan, Mohammad Firoz; Nahar, Nusrat; Rashid, Ridwan Bin; Chowdhury, Akhtaruzzaman; Rashid, Mohammad A

2018-02-02

Betulinic acid (BA) is a natural triterpenoid compound and exhibits a wide range of biological and medicinal properties including anti-inflammatory activity. Therefore, this theoretical investigation is performed to evaluate (a) physicochemical properties such as acid dissociation constant (pKa), distribution coefficient (logD), partition coefficient (logP), aqueous solubility (logS), solvation free energy, dipole moment, polarizability, hyperpolarizability and different reactivity descriptors, (b) pharmacokinetic properties like human intestinal absorption (HIA), cellular permeability, skin permeability (P Skin ), plasma protein binding (PPB), penetration of the blood brain barrier (BBB), (c) toxicological properties including mutagenicity, carcinogenicity, risk of inhibition of hERG gene and (d) molecular mechanism of anti-inflammatory action which will aid the development of analytical method and the synthesis of BA derivatives. The physicochemical properties were calculated using MarvinSketch 15.6.29 and Gaussian 09 software package. The pharmacokinetic and toxicological properties were calculated on online server PreADMET. Further, the molecular docking study was conducted on AutoDock vina in PyRx 0.8. The aqueous solubility increased with increasing pH due to the ionization of BA leading to decrease in distribution coefficient. The solvation energies in water, dimethyl sulfoxide (DMSO), acetonitrile, n-octanol, chloroform and carbon tetrachloride were - 41.74 kJ/mol, - 53.80 kJ/mol, - 66.27 kJ/mol, - 69.64 kJ/mol, - 65.96 kJ/mol and - 60.13 kJ/mol, respectively. From the results of polarizability and softness, it was clear that BA is less stable and hence, kinetically more reactive in water. BA demonstrated good human intestinal absorption (HIA) and moderate cellular permeability. Further, BA also exhibited positive CNS activity due to high permeability through BBB. The toxicological study revealed that BA was a mutagenic compound but noncarcinogenic in mice model. Moreover, molecular docking study of BA with PLA2 revealed that BA interacts with GLY22 & GLY29 through hydrogen bond formation and LEU2, PHE5, HIS6, ALA17, ALA18, HIS47 and TYR51 through different types of hydrophobic interactions. The binding affinity of BA was - 41.00 kJ/mol which is comparable to the binding affinity of potent inhibitor 6-Phenyl-4(R)-(7-Phenyl-heptanoylamino)-hexanoic acid (BR4) (- 33.89 kJ/mol). Our computed properties may assist the development of analytical method to assay BA or to develop BA derivatives with better pharmacokinetic and toxicological profile.

The First Cry2Ac-Type Protein Toxic to Helicoverpa armigera: Cloning and Overexpression of Cry2ac7 Gene from SBS-BT1 Strain of Bacillus thuringiensis

PubMed Central

Saleem, Faiza; Shakoori, Abdul Rauf

2017-01-01

The Cry (crystal) proteins from Bacillus thuringiensis are known to have toxicity against a variety of insects and have been exploited to control insect pests through transgenic plants and biopesticides. B. thuringiensis SBS BT-1 carrying the cry2 genes was isolated from soil samples in Pakistan. The 2-kb full length cry2Ac gene was cloned, sequenced, and submitted to the EMBL DNA database (Accession No. AM292031). For expression analysis, Escherichia coli DH5α was transformed with the fragment sub-cloned in pET22b expression vector using NdeI and HindIII restriction sites, and later confirmed by restriction endonuclease analysis. To assess the toxicity of Cry2Ac7 protein against lepidopteran and dipteran insects, BL21 (codon plus) strain of E. coli was further transformed with the recombinant plasmid. The 65-kDa protein was expressed in the form of inclusion bodies up to 180 OD units per liter of the medium. Inclusions were washed with a buffer containing 1.5% Triton-X 100 and >90% pure Cry2Ac7 was obtained. The inclusion bodies were dissolved in 50 mM K2CO3 (pH 11.5), dialyzed, and freeze-dried. This freeze-dried protein as well as inclusion bodies were used in bioassays against larvae of Helicoverpa armigera and Musca domestica. The freeze-dried protein was toxic to H. armigera larvae with an LC50 value of 131 ng/mL. However, Cry2Ac7 produced in E. coli did not show any mortality to M. domestica larvae. This is the first report of Cry2Ac protein toxic to H. armigera. PMID:29099767

Army Sustainment. Volume 43, Issue 4, July-August 2011

DTIC Science & Technology

2011-08-01

ManageMent coMMand. he holdS a B.a. degree in criMinal juStice froM con- cordia college in Michigan and iS level ii certified in PrograM ManageMent and...got there. Think about the entire process, from raw-materials extraction to transformation at a plant or mill, movement of these materials to a manu...facturing plant , assembly of the product’s various components, packaging and further movement to a warehouse or distribution center, delivery to the

Activity of Bacillus thuringiensis Cry1Ie2, Cry2Ac7, and Cry7Ab3 proteins against Anticarsia gemmatalis, Chrysodeixis includens and Ceratoma trifurcata

USDA-ARS?s Scientific Manuscript database

Transgenic soybeans producing the Cry1Ac insecticidal protein from the bacterium Bacillus thuringiensis (or “Bt”) are currently used to control larvae of the velvetbean caterpillar (Anticarsia gemmatalis Hübner) and the soybean looper [Chrysodeixis includens (Walker)]. The main threat to the sustain...

Development of Monoclonal Antibodies Recognizing Linear Epitope: Illustration by Three Bacillus thuringiensis Crystal Proteins of Genetically Modified Cotton, Maize, and Tobacco.

PubMed

Cao, Zhen; Zhang, Wei; Ning, Xiangxue; Wang, Baomin; Liu, Yunjun; Li, Qing X

2017-11-22

Bacillus thuringiensis Cry1Ac, Cry1Ia1, and Cry1Ie are δ-endotoxin insecticidal proteins widely implemented in genetically modified organisms (GMO), such as cotton, maize, and potato. Western blot assay integrates electrophoresis separation power and antibody high specificity for monitoring specific exogenous proteins expressed in GMO. Procedures for evoking monoclonal antibody (mAb) for Western blot were poorly documented. In the present study, Cry1Ac partially denatured at 100 °C for 5 min was used as an immunogen to develop mAbs selectively recognizing a linear epitope of Cry1Ac for Western blot. mAb 5E9C6 and 3E6E2 selected with sandwich ELISA strongly recognized the heat semidenatured Cry1Ac. Particularly, 3E6E2 recognized both E. coli and cotton seed expressed Cry1Ac in Western blot. Such strategy of using partially denatured proteins as immunogens and using sandwich ELISA for mAb screening was also successfully demonstrated with production of mAbs against Cry1Ie for Western blot assay in maize.

Characterization of Bacillus thuringiensis Berl. indigenous from soil and its potency as biological agents of Spodoptera litura (Lepidoptera: Noctuidae)

NASA Astrophysics Data System (ADS)

Pujiastuti, Y.; Astuti, D. T.; Afriyani, S. R.; Suparman, S.; Irsan, C.; Sembiring, E. R.; Nugraha, S.; Mulawarman; Damiri, N.

2018-01-01

The objective of the study was to characterize the molecular weight of protein in order to be utilized as biological agent of S. litura and their cell or spores production. To investigate the molecular weight of protein was done by SDS-Page electrophoresis. Growth media used for producing B. thuringiensis were T3, LB broth and agricultural waste. The results showed that the molecular weight of protein ranged from 37 to 140 kDa. In DLM and DLKK23 isolates were found ranging from 37 to 40 kDa and from 110 to 130 kDa, respectively. KJ3R5 and KJ3P1 isolates were obtained having three protein bands ranging from 43 to 45, 73 to 80 and 110 to 130 kDa and 45-50, 75-80 and 130-140 kDa, respectively. It was predicted that isolates B. thuringiensis were belonging to Cry IA, Cry IIA, Cry IVC and Cry15c. These crystal proteins were toxic to S. litura. There was no protein bands found in the two last isolates (KJ3R3 and KJ3J4). Production of spore after sporulation in agricultural waste media ranged from 0.5 to 106 - 2.67 x 107 spores/ml showing medium level of toxicity to S. litura.

Susceptibility of field populations of the fall armyworm (Lepidoptera: Noctuidae) from Florida and Puerto Rico to purified Cry1F protein and corn leaf tissue containing single and pyramided Bt genes

USDA-ARS?s Scientific Manuscript database

Larval survival of Cry1F-susceptible (FL), -resistant (PR and Cry1F-RR), and -heterozygous (FL x PR and Cry1F-RS) populations of the fall armyworm, Spodoptera frugiperda (J.E. Smith) to purified Cry1F protein and corn leaf tissue of seven Bacillus thuringiensis (Bt) corn hybrids and five non-Bt corn...

No differences in calcium-binding protein immunoreactivity in the posterior cingulate and visual cortex: schizophrenia and controls.

PubMed

Wheeler, David G; Dixon, Gavin; Harper, Clive G

2006-06-01

Schizophrenia-specific alterations in the densities of interneurons immunoreactive (ir) to the calcium binding proteins are reported for several cortical regions. However, no reported studies have searched for such differences within the posterior cingulate cortex using antibodies to a specific calcium binding protein, calbindin (Cb). Compare the (a) relative density of Cb-ir neurons (ratio of labeled neurons to total neurons), (b) relative width of cortical layers II/III and (c) somal areas of Cb-ir neurons in people with schizophrenia and non-psychiatric age-, gender- and postmortem index-matched controls (9 per group). Tissue from Brodmann's area (BA) 30 and 23 and an internal control region, the visual cortex (BA 18) were labeled with polyclonal Cb antibodies then Nissl counter-stained. Cb-ir neurons as well as counter-stained neurons with clearly visible nucleoli were plotted and counted within their area 1 and laminar boundaries. No qualitative or statistical differences in the relative density of Cb-ir neurons were observed. A trend towards a significant effect was detected in BA 30, the relative density of Cb-ir neurons for controls was greater than for schizophrenics (P=0.0518). There were no significant differences in the relative cortical widths or somal areas. The data from this study suggest that the posterior cingulate cortex may not be involved in schizophrenia, at least not as far as Cb-ir neurons are concerned.

Analysis of oxygen binding-energy variations for BaO on W

NASA Astrophysics Data System (ADS)

Haas, G. A.; Shih, A.; Mueller, D.; Thomas, R. E.

Interatomic Auger analyses have been made of different forms of BaO layers on W substrates. Variations in Auger spectroscopy energies of the Ba4dBa5pO2p interatomic Auger transition were found to be largely governed by the O2p binding energy of the BaO adsorbate. This was illustrated by comparing results of the Auger data values with values derived from O2p binding energies using ultraviolet photoelectron spectroscopy. Very good agreement was observed not only for the W<100> substrate but also for the W<110> substrate which showed two oxygen-induced electronics state. Variations in binding energy were noted for different states of BaO lattice formation and for different amounts of oxidation, ranging from the transition of Ba to BaO and continuing to the BaO 2 stoichiometry and beyond. Effects were also reported for adsorbate alignment and thermal activation (i.e., reduction) of the oxidized state. An empirical relationship was found suggesting that the more tightly bound the O2p states of the BaO adsorbate were, the lower its work function would be. This link between binding energy and work function was observed to be valid not only for cases of poisoning by oxidation, but held as well during reactivation by the subsequent reduction of the oxide. In addition, this relationship also appeared to predict the low work function obtained through the introduction of substances such as Sc to the BaO-W system. Possible qualitative reasons which might contribute to this are discussed in terms of enhanced dipole effects and shifts in band structure.

Laboratory toxicity studies demonstrate no adverse effects of Cry1Ab and Cry3Bb1 to larvae of Adalia bipunctata (Coleoptera: Coccinellidae): the importance of study design.

PubMed

Alvarez-Alfageme, Fernando; Bigler, Franz; Romeis, Jörg

2011-06-01

Scientific studies are frequently used to support policy decisions related to transgenic crops. Schmidt et al., Arch Environ Contam Toxicol 56:221-228 (2009) recently reported that Cry1Ab and Cry3Bb were toxic to larvae of Adalia bipunctata in direct feeding studies. This study was quoted, among others, to justify the ban of Bt maize (MON 810) in Germany. The study has subsequently been criticized because of methodological shortcomings that make it questionable whether the observed effects were due to direct toxicity of the two Cry proteins. We therefore conducted tritrophic studies assessing whether an effect of the two proteins on A. bipunctata could be detected under more realistic routes of exposure. Spider mites that had fed on Bt maize (events MON810 and MON88017) were used as carriers to expose young A. bipunctata larvae to high doses of biologically active Cry1Ab and Cry3Bb1. Ingestion of the two Cry proteins by A. bipunctata did not affect larval mortality, weight, or development time. These results were confirmed in a subsequent experiment in which A. bipunctata were directly fed with a sucrose solution containing dissolved purified proteins at concentrations approximately 10 times higher than measured in Bt maize-fed spider mites. Hence, our study does not provide any evidence that larvae of A. bipunctata are sensitive to Cry1Ab and Cry3Bb1 or that Bt maize expressing these proteins would adversely affect this predator. The results suggest that the apparent harmful effects of Cry1Ab and Cry3Bb1 reported by Schmidt et al., Arch Environ Contam Toxicol 56:221-228 (2009) were artifacts of poor study design and procedures. It is thus important that decision-makers evaluate the quality of individual scientific studies and do not view all as equally rigorous and relevant.

Enhanced nematicidal potential of the chitinase pachi from Pseudomonas aeruginosa in association with Cry21Aa

PubMed Central

Chen, Lin; Jiang, Huang; Cheng, Qipeng; Chen, Junpeng; Wu, Gaobing; Kumar, Ashok; Sun, Ming; Liu, Ziduo

2015-01-01

Nematodes are known to be harmful to various crops, vegetables, plants and insects. The present study reports that, chitin upregulates the activity of chitinase (20%) and nematicidal potential (15%) of Pseudomonas aeruginosa. The chitinase gene (pachi) from P. aeruginosa was cloned, and its nematicidal activity of pachi protein against Caenorhabditis elegans was studied. The mortality rate induced by pachi increased by 6.3-fold when in association with Cry21Aa from Bacillus thuringiensis. Pachi efficiently killed C. elegans in its native state (LC50 = 387.3 ± 31.7 μg/ml), as well as in association with Cry21Aa (LC50 = 30.9 ± 4.1 μg/ml), by degrading the cuticle, egg shell and intestine in a relatively short time period of 24 h. To explore the nematidal potential of chitinase, six fusion proteins were constructed using gene engineering techniques. The CHACry showed higher activity against C. elegans than others owing to its high solubility. Notably, the CHACry showed a synergistic factor of 4.1 versus 3.5 a mixture [1:1] of pachi and Cry21Aa. The present study has identified eco-friendly biological routes (e.g., mixed proteins, fusion proteins) with potent nematicidal activity, which not only can help to prevent major crop losses but also strengthen the agro-economy and increase gross crop yield. PMID:26400097

40 CFR 174.532 - Bacillus thuringiensis eCry3.1Ab protein in corn; temporary exemption from the requirement of a...

Code of Federal Regulations, 2010 CFR

2010-07-01

... protein in corn; temporary exemption from the requirement of a tolerance. 174.532 Section 174.532... thuringiensis eCry3.1Ab protein in corn; temporary exemption from the requirement of a tolerance. Residues of Bacillus thuringiensis eCry3.1Ab protein in corn, in or on the food and feed commodities of corn; corn...

40 CFR 174.532 - Bacillus thuringiensis eCry3.1Ab protein in corn; temporary exemption from the requirement of a...

Code of Federal Regulations, 2011 CFR

2011-07-01

... protein in corn; temporary exemption from the requirement of a tolerance. 174.532 Section 174.532... thuringiensis eCry3.1Ab protein in corn; temporary exemption from the requirement of a tolerance. Residues of Bacillus thuringiensis eCry3.1Ab protein in corn, in or on the food and feed commodities of corn; corn...

40 CFR 174.532 - Bacillus thuringiensis eCry3.1Ab protein in corn; temporary exemption from the requirement of a...

Code of Federal Regulations, 2012 CFR

2012-07-01

... protein in corn; temporary exemption from the requirement of a tolerance. 174.532 Section 174.532... thuringiensis eCry3.1Ab protein in corn; temporary exemption from the requirement of a tolerance. Residues of Bacillus thuringiensis eCry3.1Ab protein in corn, in or on the food and feed commodities of corn; corn...

40 CFR 174.532 - Bacillus thuringiensis eCry3.1Ab protein in corn; exemption from the requirement of a tolerance.

Code of Federal Regulations, 2014 CFR

2014-07-01

... protein in corn; exemption from the requirement of a tolerance. 174.532 Section 174.532 Protection of...Cry3.1Ab protein in corn; exemption from the requirement of a tolerance. Residues of Bacillus thuringiensis eCry3.1Ab protein in corn, in or on the food and feed commodities of corn; corn, field; corn...

40 CFR 174.532 - Bacillus thuringiensis eCry3.1Ab protein in corn; exemption from the requirement of a tolerance.

Code of Federal Regulations, 2013 CFR

2013-07-01

... protein in corn; exemption from the requirement of a tolerance. 174.532 Section 174.532 Protection of...Cry3.1Ab protein in corn; exemption from the requirement of a tolerance. Residues of Bacillus thuringiensis eCry3.1Ab protein in corn, in or on the food and feed commodities of corn; corn, field; corn...

Cyt1Aa protein of Bacillus thuringiensis is toxic to the Cottonwood Leaf Beetle, Chrysomela scripta, and suppresses high levels of resistance to Cry3Aa

Treesearch

Brian A. Federici; Leah S. Bauer

1998-01-01

The insecticidal activity of Bacillus thuringiensis is due primarily to Cry and Cyt proteins. Cry proteins are typically toxic to lepidopterous, coleopterous, or dipterous insects, whereas the known toxicity of Cyt proteins is limited to dipterans. We report here that a Cyt protein, Cyt1Aa, is also highly toxic to the cottonwood leaf beetle, Chrysomela scripta, with a...

CIR, a corepressor of CBF1, binds to PAP-1 and effects alternative splicing

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maita, Hiroshi; CREST, Japan Science and Technology Corporation, Saitama 332-0012; Kitaura, Hirotake

2005-02-15

We have reported that PAP-1, a product of a causative gene for autosomal retinitis pigmentosa, plays a role in splicing. In this study, CIR, a protein originally identified as a CBF1-interacting protein and reported to act as a transcriptional corepressor, was identified as a PAP-1 binding protein and its function as a splicing factor was investigated. In addition to a basic lysine and acidic serine-rich (BA) domain and a zinc knuckle-like motif, CIR has an arginine/serine dipeptide repeat (RS) domain in its C terminal region. The RS domain has been reported to be present in the superfamily of SR proteins,more » which are involved in splicing reactions. We generated CIR mutants with deletions of each BA and RS domain and studied their subcellular localizations and interactions with PAP-1 and other SR proteins, including SC35, SF2/ASF, and U2AF{sup 35}. CIR was found to interact with U2AF{sup 35} through the BA domain, with SC35 and SF2/ASF through the RS domain, and with PAP-1 outside the BA domain in vivo and in vitro. CIR was found to be colocalized with SC35 and PAP-1 in nuclear speckles. Then the effect of CIR on splicing was investigated using the E1a minigene as a reporter in HeLa cells. Ectopic expression of CIR with the E1a minigene changed the ratio of spliced isoforms of E1a that were produced by alternative selection of 5'-splice sites. These results indicate that CIR is a member of the family of SR-related proteins and that CIR plays a role in splicing regulation.« less

Dominant resistance to Bt cotton and minor cross-resistance to Bt toxin Cry2Ab in cotton bollworm from China

PubMed Central

Jin, Lin; Wei, Yiyun; Zhang, Lei; Yang, Yihua; Tabashnik, Bruce E; Wu, Yidong

2013-01-01

Evolution of resistance by insect pests threatens the long-term benefits of transgenic crops that produce insecticidal proteins from Bacillus thuringiensis (Bt). Previous work has detected increases in the frequency of resistance to Bt toxin Cry1Ac in populations of cotton bollworm, Helicoverpa armigera, from northern China where Bt cotton producing Cry1Ac has been grown extensively for more than a decade. Confirming that trend, we report evidence from 2011 showing that the percentage of individuals resistant to a diagnostic concentration of Cry1Ac was significantly higher in two populations from different provinces of northern China (1.4% and 2.3%) compared with previously tested susceptible field populations (0%). We isolated two resistant strains: one from each of the two field-selected populations. Relative to a susceptible strain, the two strains had 460- and 1200-fold resistance to Cry1Ac, respectively. Both strains had dominant resistance to a diagnostic concentration of Cry1Ac in diet and to Bt cotton leaves containing Cry1Ac. Both strains had low, but significant cross-resistance to Cry2Ab (4.2- and 5.9-fold), which is used widely as the second toxin in two-toxin Bt cotton. Compared with resistance in other strains of H. armigera, the resistance in the two strains characterized here may be especially difficult to suppress. PMID:24478804

40 CFR 174.530 - Bacillus thuringiensis Cry2Ae protein in cotton; exemption from the requirement of a tolerance.

Code of Federal Regulations, 2014 CFR

2014-07-01

... in cotton; exemption from the requirement of a tolerance. 174.530 Section 174.530 Protection of... Cry2Ae protein in cotton; exemption from the requirement of a tolerance. Residues of Bacillus thuringiensis Cry2Ae protein in or on the food and feed commodities of cotton; cotton, undelinted seed; cotton...

40 CFR 174.530 - Bacillus thuringiensis Cry2Ae protein in cotton; exemption from the requirement of a tolerance.

Code of Federal Regulations, 2013 CFR

2013-07-01

... in cotton; exemption from the requirement of a tolerance. 174.530 Section 174.530 Protection of... Cry2Ae protein in cotton; exemption from the requirement of a tolerance. Residues of Bacillus thuringiensis Cry2Ae protein in or on the food and feed commodities of cotton; cotton, undelinted seed; cotton...

40 CFR 174.504 - Bacillus thuringiensis Cry1F protein in cotton; exemption from the requirement of a tolerance.

Code of Federal Regulations, 2013 CFR

2013-07-01

... in cotton; exemption from the requirement of a tolerance. 174.504 Section 174.504 Protection of... Cry1F protein in cotton; exemption from the requirement of a tolerance. Residues of Bacillus thuringiensis Cry1F protein in cotton are exempt from the requirement of a tolerance when used as a plant...

40 CFR 174.504 - Bacillus thuringiensis Cry1F protein in cotton; exemption from the requirement of a tolerance.

Code of Federal Regulations, 2011 CFR

2011-07-01

... in cotton; exemption from the requirement of a tolerance. 174.504 Section 174.504 Protection of... Cry1F protein in cotton; exemption from the requirement of a tolerance. Residues of Bacillus thuringiensis Cry1F protein in cotton are exempt from the requirement of a tolerance when used as a plant...

40 CFR 174.504 - Bacillus thuringiensis Cry1F protein in cotton; exemption from the requirement of a tolerance.

Code of Federal Regulations, 2010 CFR

2010-07-01

... in cotton; exemption from the requirement of a tolerance. 174.504 Section 174.504 Protection of... Cry1F protein in cotton; exemption from the requirement of a tolerance. Residues of Bacillus thuringiensis Cry1F protein in cotton are exempt from the requirement of a tolerance when used as a plant...

40 CFR 174.530 - Bacillus thuringiensis Cry2Ae protein in cotton; temporary exemption from the requirement of a...

Code of Federal Regulations, 2011 CFR

2011-07-01

... in cotton; temporary exemption from the requirement of a tolerance. 174.530 Section 174.530... thuringiensis Cry2Ae protein in cotton; temporary exemption from the requirement of a tolerance. Residues of Bacillus thuringiensis Cry2Ae protein in or on the food commodities of cotton, cotton; cotton, undelinted...

40 CFR 174.504 - Bacillus thuringiensis Cry1F protein in cotton; exemption from the requirement of a tolerance.

Code of Federal Regulations, 2012 CFR

2012-07-01

... in cotton; exemption from the requirement of a tolerance. 174.504 Section 174.504 Protection of... Cry1F protein in cotton; exemption from the requirement of a tolerance. Residues of Bacillus thuringiensis Cry1F protein in cotton are exempt from the requirement of a tolerance when used as a plant...

40 CFR 174.530 - Bacillus thuringiensis Cry2Ae protein in cotton; temporary exemption from the requirement of a...

Code of Federal Regulations, 2010 CFR

2010-07-01

... in cotton; temporary exemption from the requirement of a tolerance. 174.530 Section 174.530... thuringiensis Cry2Ae protein in cotton; temporary exemption from the requirement of a tolerance. Residues of Bacillus thuringiensis Cry2Ae protein in or on the food commodities of cotton, cotton; cotton, undelinted...

40 CFR 174.530 - Bacillus thuringiensis Cry2Ae protein in cotton; exemption from the requirement of a tolerance.

Code of Federal Regulations, 2012 CFR

2012-07-01

... in cotton; exemption from the requirement of a tolerance. 174.530 Section 174.530 Protection of... Cry2Ae protein in cotton; exemption from the requirement of a tolerance. Residues of Bacillus thuringiensis Cry2Ae protein in or on the food and feed commodities of cotton; cotton, undelinted seed; cotton...

Changes in protease activity and Cry3Aa toxin binding in the Colorado potato beetle: implications for insect resistance to Bacillus thuringiensis toxins

Treesearch

Olga Loseva; Mohamed Ibrahim; Mehmet Candas; C. Noah Koller; Leah S. Bauer; Lee A. Jr. Bulla

2002-01-01

Widespread commercial use of Bacillus thuringiensis Cry toxins to control pest insects has increased the likelihood for development of insect resistance to this entomopathogen. In this study, we investigated protease activity profiles and toxin-binding capacities in the midgut of a strain of Colorado potato beetle (CPB) that has developed resistance...

Cry1A(b)16 toxin from Bacillus thuringiensis: Theoretical refinement of three-dimensional structure and prediction of peptides as molecular markers for detection of genetically modified organisms.

PubMed

Plácido, Alexandra; Coelho, Andreia; Abreu Nascimento, Lucas; Gomes Vasconcelos, Andreanne; Fátima Barroso, Maria; Ramos-Jesus, Joilson; Costa, Vladimir; das Chagas Alves Lima, Francisco; Delerue-Matos, Cristina; Martins Ramos, Ricardo; Marani, Mariela M; Roberto de Souza de Almeida Leite, José

2017-07-01

Transgenic maize produced by the insertion of the Cry transgene into its genome became the second most cultivated crop worldwide. Cry gene from Bacillus thuringiensis kurstaki expresses protein derivatives of crystalline endotoxins which confer insect resistance onto the maize crop. Mandatory labeling of processed food containing or made by genetically modified organisms is in force in many countries, so, it is very urgent to develop fast and practical methods for GMO identification, for example, biosensors. In the absence of an available empirical structure of Cry1A(b)16 protein, a theoretical model was effectively generated, in this work, by homology modeling and molecular dynamics simulations based on two available homologous protein structures. Molecular dynamics simulations were carried out to refine the selected model, and an analysis of its global structure was performed. The refined models of Cry1A(b)16 showed a standard fold and structural characteristics similar to those seen in Bacillus thuringiensis Cry1A(a) insecticidal toxin and Bacillus thuringiensis serovar kurstaki Cry1A(c) toxin. After in silico analysis of Cry1A(b)16, two immunoreactive candidate peptides were selected and specific polyclonal antibodies were produced resulting in antibody-peptide interaction. Biosensing devices are expected to be developed for detection of the Cry1A(b) protein as a marker of transgenic maize in food. Proteins 2017; 85:1248-1257. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

Effect of Stacked Insecticidal Cry Proteins from Maize Pollen on Nurse Bees (Apis mellifera carnica) and Their Gut Bacteria

PubMed Central

Härtel, Stephan; Näther, Astrid; Dohrmann, Anja B.; Steffan-Dewenter, Ingolf; Tebbe, Christoph C.

2013-01-01

Honey bee pollination is a key ecosystem service to nature and agriculture. However, biosafety research on genetically modified crops rarely considers effects on nurse bees from intact colonies, even though they receive and primarily process the largest amount of pollen. The objective of this study was to analyze the response of nurse bees and their gut bacteria to pollen from Bt maize expressing three different insecticidal Cry proteins (Cry1A.105, Cry2Ab2, and Cry3Bb1). Naturally Cry proteins are produced by bacteria (Bacillus thuringiensis). Colonies of Apis mellifera carnica were kept during anthesis in flight cages on field plots with the Bt maize, two different conventionally bred maize varieties, and without cages, 1-km outside of the experimental maize field to allow ad libitum foraging to mixed pollen sources. During their 10-days life span, the consumption of Bt maize pollen had no effect on their survival rate, body weight and rates of pollen digestion compared to the conventional maize varieties. As indicated by ELISA-quantification of Cry1A.105 and Cry3Bb1, more than 98% of the recombinant proteins were degraded. Bacterial population sizes in the gut were not affected by the genetic modification. Bt-maize, conventional varieties and mixed pollen sources selected for significantly different bacterial communities which were, however, composed of the same dominant members, including Proteobacteria in the midgut and Lactobacillus sp. and Bifidobacterium sp. in the hindgut. Surprisingly, Cry proteins from natural sources, most likely B. thuringiensis, were detected in bees with no exposure to Bt maize. The natural occurrence of Cry proteins and the lack of detectable effects on nurse bees and their gut bacteria give no indication for harmful effects of this Bt maize on nurse honey bees. PMID:23533634

Effect of stacked insecticidal Cry proteins from maize pollen on nurse bees (Apis mellifera carnica) and their gut bacteria.

PubMed

Hendriksma, Harmen P; Küting, Meike; Härtel, Stephan; Näther, Astrid; Dohrmann, Anja B; Steffan-Dewenter, Ingolf; Tebbe, Christoph C

2013-01-01

Honey bee pollination is a key ecosystem service to nature and agriculture. However, biosafety research on genetically modified crops rarely considers effects on nurse bees from intact colonies, even though they receive and primarily process the largest amount of pollen. The objective of this study was to analyze the response of nurse bees and their gut bacteria to pollen from Bt maize expressing three different insecticidal Cry proteins (Cry1A.105, Cry2Ab2, and Cry3Bb1). Naturally Cry proteins are produced by bacteria (Bacillus thuringiensis). Colonies of Apis mellifera carnica were kept during anthesis in flight cages on field plots with the Bt maize, two different conventionally bred maize varieties, and without cages, 1-km outside of the experimental maize field to allow ad libitum foraging to mixed pollen sources. During their 10-days life span, the consumption of Bt maize pollen had no effect on their survival rate, body weight and rates of pollen digestion compared to the conventional maize varieties. As indicated by ELISA-quantification of Cry1A.105 and Cry3Bb1, more than 98% of the recombinant proteins were degraded. Bacterial population sizes in the gut were not affected by the genetic modification. Bt-maize, conventional varieties and mixed pollen sources selected for significantly different bacterial communities which were, however, composed of the same dominant members, including Proteobacteria in the midgut and Lactobacillus sp. and Bifidobacterium sp. in the hindgut. Surprisingly, Cry proteins from natural sources, most likely B. thuringiensis, were detected in bees with no exposure to Bt maize. The natural occurrence of Cry proteins and the lack of detectable effects on nurse bees and their gut bacteria give no indication for harmful effects of this Bt maize on nurse honey bees.

Field Trial Performance of Herculex XTRA (Cry34Ab1/Cry35Ab1) and SmartStax (Cry34Ab1/Cry35Ab1 + Cry3Bb1) Hybrids and Soil Insecticides Against Western and Northern Corn Rootworms (Coleoptera: Chrysomelidae).

PubMed

Johnson, K D; Campbell, L A; Lepping, M D; Rule, D M

2017-06-01

Western corn rootworm, Diabrotica virgifera virgifera LeConte (Coleoptera: Chrysomelidae), and northern corn rootworm, Diabrotica barberi Smith and Lawrence (Coleoptera: Chrysomelidae), are important insect pests in corn, Zea mays L. For more than a decade, growers have been using transgenic plants expressing proteins from the bacterium Bacillus thuringiensis (Bt) to protect corn roots from feeding. In 2011, western corn rootworm populations were reported to have developed resistance to Bt hybrids expressing Cry3Bb1 and later found to be cross-resistant to hybrids expressing mCry3A and eCry3.1Ab. The identification of resistance to Cry3 (Cry3Bb1, mCry3A, and eCry3.1Ab) hybrids led to concerns about durability and efficacy of products with single traits and of products containing a pyramid of a Cry3 protein and the binary Bt proteins Cry34Ab1 and Cry35Ab1. From 2012 to 2014, 43 field trials were conducted across the central United States to estimate root protection provided by plants expressing Cry34Ab1/Cry35Ab1 alone (Herculex RW) or pyramided with Cry3Bb1 (SmartStax). These technologies were evaluated with and without soil-applied insecticides to determine if additional management measures provided benefit where Cry3 performance was reduced. Trials were categorized for analysis based on rootworm damage levels on Cry3-expressing hybrids and rootworm feeding pressure within each trial. Across scenarios, Cry34Ab1/Cry35Ab1 hybrids provided excellent root protection. Pyramided traits provided greater root and yield protection than non-Bt plus a soil-applied insecticide, and only in trials where larval feeding pressure exceeded two nodes of damage did Cry34Ab1/Cry35Ab1 single-trait hybrids and pyramided hybrids show greater root protection from the addition of soil-applied insecticides. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Mapping Interaction Sites on Human Chemokine Receptors by Deep Mutational Scanning.

PubMed

Heredia, Jeremiah D; Park, Jihye; Brubaker, Riley J; Szymanski, Steven K; Gill, Kevin S; Procko, Erik

2018-06-01

Chemokine receptors CXCR4 and CCR5 regulate WBC trafficking and are engaged by the HIV-1 envelope glycoprotein gp120 during infection. We combine a selection of human CXCR4 and CCR5 libraries comprising nearly all of ∼7000 single amino acid substitutions with deep sequencing to define sequence-activity landscapes for surface expression and ligand interactions. After consideration of sequence constraints for surface expression, known interaction sites with HIV-1-blocking Abs were appropriately identified as conserved residues following library sorting for Ab binding, validating the use of deep mutational scanning to map functional interaction sites in G protein-coupled receptors. Chemokine CXCL12 was found to interact with residues extending asymmetrically into the CXCR4 ligand-binding cavity, similar to the binding surface of CXCR4 recognized by an antagonistic viral chemokine previously observed crystallographically. CXCR4 mutations distal from the chemokine binding site were identified that enhance chemokine recognition. This included disruptive mutations in the G protein-coupling site that diminished calcium mobilization, as well as conservative mutations to a membrane-exposed site (CXCR4 residues H79 2.45 and W161 4.50 ) that increased ligand binding without loss of signaling. Compared with CXCR4-CXCL12 interactions, CCR5 residues conserved for gp120 (HIV-1 BaL strain) interactions map to a more expansive surface, mimicking how the cognate chemokine CCL5 makes contacts across the entire CCR5 binding cavity. Acidic substitutions in the CCR5 N terminus and extracellular loops enhanced gp120 binding. This study demonstrates how comprehensive mutational scanning can define functional interaction sites on receptors, and novel mutations that enhance receptor activities can be found simultaneously. Copyright © 2018 by The American Association of Immunologists, Inc.

In situ surface transfer process of Cry1Ac protein on SiO2： The effect of biosurfactants for desorption.

PubMed

Miao, Shuzhou; Yuan, Xingzhong; Liang, Yunshan; Wang, Hou; Leng, Lijian; Wu, Zhibin; Jiang, Longbo; Li, Yifu; Mo, Dan; Zeng, Guangming

2018-01-05

Genetically modified Bacillus thuringiensis (Bt) crops, which have been widely used in agricultural transgenic plants, express insecticidal Cry proteins and release the toxin into soils. Taking into consideration the environmental risk of Cry proteins, biosurfactant-rhamnolipids were applied to desorb Cry proteins from soil environment, which has not been elucidated before. Quartz crystal microbalance with dissipation (QCM-D) was used in this article to investigate the adsorption and desorption behaviors of Cry1Ac on SiO 2 surface (model soil). Results showed that patch-controlled electrostatic attraction (PCEA) governed Cry1Ac adsorption to SiO 2, and the solution pH or ionic strength can affect PCEA. The adsorption kinetics could be fitted by the pseudo-second-order model, and the adsorption isotherm was fitted to Langmuir model with correlation coefficients higher than 0.999. The desorption characteristics of Cry1Ac from SiO 2 were assessed in the presence of mono-rhamnolipid, di-rhamnolipid or complex-rhamnolipid. Mono-rhamnolipid exhibited the most significant positive effect on desorption performance. With a complete removal of Cry1Ac reached when mono-rhamnolipid concentration was up to 50mgL -1 . Additionally, the desorption was enhanced at alkaline pH range, and Cry1Ac can be completely and rapidly desorbed by rhamnolipids from SiO 2 at ionic strength of 5×10 -2 M. Copyright © 2017 Elsevier B.V. All rights reserved.

Effects of water management practices on residue decomposition and degradation of Cry1Ac protein from crop-wild Bt rice hybrids and parental lines during winter fallow season.

PubMed

Xiao, Manqiu; Dong, Shanshan; Li, Zhaolei; Tang, Xu; Chen, Yi; Yang, Shengmao; Wu, Chunyan; Ouyang, Dongxin; Fang, Changming; Song, Zhiping

2015-12-01

Rice is the staple diet of over half of the world's population and Bacillus thuringiensis (Bt) rice expressing insecticidal Cry proteins is ready for deployment. An assessment of the potential impact of Bt rice on the soil ecosystem under varied field management practices is urgently required. We used litter bags to assess the residue (leaves, stems and roots) decomposition dynamics of two transgenic rice lines (Kefeng6 and Kefeng8) containing stacked genes from Bt and sck (a modified CpTI gene encoding a cowpea trypsin inhibitor) (Bt/CpTI), a non-transgenic rice near-isoline (Minghui86), wild rice (Oryza rufipogon) and crop-wild Bt rice hybrid under contrasting conditions (drainage or continuous flooding) in the field. No significant difference was detected in the remaining mass, total C and total N among cultivars under aerobic conditions, whereas significant differences in the remaining mass and total C were detected between Kefeng6 and Kefeng8 and Minghui86 under the flooded condition. A higher decomposition rate constant (km) was measured under the flooded condition compared with the aerobic condition for leaf residues, whereas the reverse was observed for root residues. The enzyme-linked immunosorbent assay (ELISA), which was used to monitor the changes in the Cry1Ac protein in Bt rice residues, indicated that (1) the degradation of the Cry1Ac protein under both conditions best fit first-order kinetics, and the predicted DT50 (50% degradation time) of the Cry1Ac protein ranged from 3.6 to 32.5 days; (2) the Cry1Ac protein in the residue degraded relatively faster under aerobic conditions; and (3) by the end of the study (~154 days), the protein was present at a low concentration in the remaining residues under both conditions. The degradation rate constant was negatively correlated with the initial carbon content and positively correlated with the initial Cry1Ac protein concentration, but it was only correlated with the mass decomposition rate constants under the flooded condition. No Cry1Ac protein was detected in the soils surrounding the buried residue. Our results did not reveal any evidence that the stacked genes (Bt/CpTI) or the presence of the Cry1Ac protein influenced the decomposition dynamics of the rice residues. Furthermore, our results suggested that field drainage after residue incorporation would promote Cry1Ac protein degradation. Copyright © 2015 Elsevier Inc. All rights reserved.

Cloning, expression, and characterization of recombinant nitric oxide synthase-like protein from Bacillus anthracis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Midha, Shuchi; Mishra, Rajeev; Aziz, M.A.

2005-10-14

Nitric oxide synthase (NOS) is amongst a family of evolutionarily conserved enzymes, involved in a multi-turnover process that results in NO as a product. The significant role of NO in various pathological and physiological processes has created an interest in this enzyme from several perspectives. This study describes for the first time, cloning and expression of a NOS-like protein, baNOS, from Bacillus anthracis, a pathogenic bacterium responsible for causing anthrax. baNOS was expressed in Escherichia coli as a soluble and catalytically active enzyme. Homology models generated for baNOS indicated that the key structural features that are involved in the substratemore » and active site interaction have been highly conserved. Further, the behavior of baNOS in terms of heme-substrate interactions and heme-transitions was studied in detail. The optical perturbation spectra of the heme domain demonstrated that the ligands perturb the heme site in a ligand specific manner. baNOS forms a five-coordinate, high-spin complex with L-arginine analogs and a six-coordinate low-spin complex with inhibitor imidazole. Studies indicated that the binding of L-arginine, N {sup {omega}}-hydroxy-L-arginine, and imidazole produces various spectroscopic species that closely correspond to the equivalent complexes of mammalian NOS. The values of spectral binding constants further corroborated these results. The overall conservation of the key structural features and the correlation of heme-substrate interactions in baNOS and mammalian NOS, thus, point towards an interesting phenomenon of convergent evolution. Importantly, the NO generated by NOS of mammalian macrophages plays a potent role in antimicrobicidal activity. Because of the existence of high structural and behavioral similarity between mammalian NOS and baNOS, we propose that NO produced by B. anthracis may also have a pivotal pathophysiological role in anthrax infection. Therefore, this first report of characterization of a NOS-like protein from a pathogenic bacterium opens up avenues for further studies in understanding the importance of this protein in pathogenicity.« less

Chemical-Induced Inhibition of Blue Light-Mediated Seedling Development Caused by Disruption of Upstream Signal Transduction Involving Cryptochromes in Arabidopsis thaliana.

PubMed

Ong, Wen-Dee; Okubo-Kurihara, Emiko; Kurihara, Yukio; Shimada, Setsuko; Makita, Yuko; Kawashima, Mika; Honda, Kaori; Kondoh, Yasumitsu; Watanabe, Nobumoto; Osada, Hiroyuki; Cutler, Sean R; Sudesh, Kumar; Matsui, Minami

2017-01-01

Plants have a remarkable ability to perceive and respond to various wavelengths of light and initiate regulation of different cascades of light signaling and molecular components. While the perception of red light and the mechanisms of its signaling involving phytochromes are largely known, knowledge of the mechanisms of blue light signaling is still limited. Chemical genetics involves the use of diverse small active or synthetic molecules to evaluate biological processes. By combining chemicals and analyzing the effects they have on plant morphology, we identified a chemical, 3-bromo-7-nitroindazole (3B7N), that promotes hypocotyl elongation of wild-type Arabidopsis only under continuous blue light. Further evaluation with loss-of-function mutants confirmed that 3B7N inhibits photomorphogenesis through cryptochrome-mediated light signaling. Microarray analysis demonstrated that the effect of 3B7N treatment on gene expression in cry1cry2 is considerably smaller than that in the wild type, indicating that 3B7N specifically interrupts cryptochrome function in the control of seedling development in a light-dependent manner. We demonstrated that 3B7N directly binds to CRY1 protein using an in vitro binding assay. These results suggest that 3B7N is a novel chemical that directly inhibits plant cryptochrome function by physical binding. The application of 3B7N can be used on other plants to study further the blue light mechanism and the genetic control of cryptochromes in the growth and development of plant species. © The Author 2016. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.

Multiple assays indicate varying levels of cross resistance of Cry3Bb1-selected field populations of the western corn rootworm to mCry3A, eCry3.1Ab, and Cry34/35Ab1

USDA-ARS?s Scientific Manuscript database

Minnesota populations of the western corn rootworm (WCR) surviving Cry3Bb1-expressing corn in the field and WCR populations assumed to be susceptible to all Bt proteins were evaluated for susceptibility to Cry3Bb1, mCry3A, eCry3.1Ab, and Cry34/35Ab1 in diet assays and three different plant-based ass...

40 CFR 174.519 - Bacillus thuringiensis Cry2Ab2 protein in corn and cotton; exemption from the requirement of a...

Code of Federal Regulations, 2014 CFR

2014-07-01

... in corn and cotton; exemption from the requirement of a tolerance. 174.519 Section 174.519 Protection... thuringiensis Cry2Ab2 protein in corn and cotton; exemption from the requirement of a tolerance. Residues of Bacillus thuringiensis Cry2Ab2 protein in or on corn or cotton are exempt from the requirement of a...

40 CFR 174.519 - Bacillus thuringiensis Cry2Ab2 protein in corn and cotton; exemption from the requirement of a...

Code of Federal Regulations, 2012 CFR

2012-07-01

... in corn and cotton; exemption from the requirement of a tolerance. 174.519 Section 174.519 Protection... thuringiensis Cry2Ab2 protein in corn and cotton; exemption from the requirement of a tolerance. Residues of Bacillus thuringiensis Cry2Ab2 protein in or on corn or cotton are exempt from the requirement of a...

40 CFR 174.519 - Bacillus thuringiensis Cry2Ab2 protein in corn and cotton; exemption from the requirement of a...

Code of Federal Regulations, 2011 CFR

2011-07-01

... in corn and cotton; exemption from the requirement of a tolerance. 174.519 Section 174.519 Protection... thuringiensis Cry2Ab2 protein in corn and cotton; exemption from the requirement of a tolerance. Residues of Bacillus thuringiensis Cry2Ab2 protein in or on corn or cotton are exempt from the requirement of a...

40 CFR 174.519 - Bacillus thuringiensis Cry2Ab2 protein in corn and cotton; exemption from the requirement of a...

Code of Federal Regulations, 2013 CFR

2013-07-01

... in corn and cotton; exemption from the requirement of a tolerance. 174.519 Section 174.519 Protection... thuringiensis Cry2Ab2 protein in corn and cotton; exemption from the requirement of a tolerance. Residues of Bacillus thuringiensis Cry2Ab2 protein in or on corn or cotton are exempt from the requirement of a...

40 CFR 174.519 - Bacillus thuringiensis Cry2Ab2 protein in corn and cotton; exemption from the requirement of a...

Code of Federal Regulations, 2010 CFR

2010-07-01

... in corn and cotton; exemption from the requirement of a tolerance. 174.519 Section 174.519 Protection... thuringiensis Cry2Ab2 protein in corn and cotton; exemption from the requirement of a tolerance. Residues of Bacillus thuringiensis Cry2Ab2 protein in or on corn or cotton are exempt from the requirement of a...

More Than a Repair Enzyme: Aspergillus nidulans Photolyase-like CryA Is a Regulator of Sexual Development

PubMed Central

Bayram, Özgür; Biesemann, Christoph; Krappmann, Sven; Galland, Paul

2008-01-01

Cryptochromes are blue-light receptors that have presumably evolved from the DNA photolyase protein family, and the genomes of many organisms contain genes for both types of molecules. Both protein structures resemble each other, which suggests that light control and light protection share a common ancient origin. In the genome of the filamentous fungus Aspergillus nidulans, however, only one cryptochrome/photolyase-encoding gene, termed cryA, was identified. Deletion of the cryA gene triggers sexual differentiation under inappropriate culture conditions and results in up-regulation of transcripts encoding regulators of fruiting body formation. CryA is a protein whose N- and C-terminal synthetic green fluorescent protein fusions localize to the nucleus. CryA represses sexual development under UVA350-370 nm light both on plates and in submerged culture. Strikingly, CryA exhibits photorepair activity as demonstrated by heterologous complementation of a DNA repair-deficient Escherichia coli strain as well as overexpression in an A. nidulans uvsBΔ genetic background. This is in contrast to the single deletion cryAΔ strain, which does not show increased sensitivity toward UV-induced damage. In A. nidulans, cryA encodes a novel type of cryptochrome/photolyase that exhibits a regulatory function during light-dependent development and DNA repair activity. This represents a paradigm for the evolutionary transition between photolyases and cryptochromes. PMID:18495868

Bt Crops Producing Cry1Ac, Cry2Ab and Cry1F Do Not Harm the Green Lacewing, Chrysoperla rufilabris

PubMed Central

Tian, Jun-Ce; Wang, Xiang-Ping; Long, Li-Ping; Romeis, Jörg; Naranjo, Steven E.; Hellmich, Richard L.; Wang, Ping; Earle, Elizabeth D.; Shelton, Anthony M.

2013-01-01

The biological control function provided by natural enemies is regarded as a protection goal that should not be harmed by the application of any new pest management tool. Plants producing Cry proteins from the bacterium, Bacillus thuringiensis (Bt), have become a major tactic for controlling pest Lepidoptera on cotton and maize and risk assessment studies are needed to ensure they do not harm important natural enemies. However, using Cry protein susceptible hosts as prey often compromises such studies. To avoid this problem we utilized pest Lepidoptera, cabbage looper (Trichoplusia ni) and fall armyworm (Spodoptera frugiperda), that were resistant to Cry1Ac produced in Bt broccoli (T. ni), Cry1Ac/Cry2Ab produced in Bt cotton (T. ni), and Cry1F produced in Bt maize (S. frugiperda). Larvae of these species were fed Bt plants or non-Bt plants and then exposed to predaceous larvae of the green lacewing Chrysoperla rufilabris. Fitness parameters (larval survival, development time, fecundity and egg hatch) of C. rufilabris were assessed over two generations. There were no differences in any of the fitness parameters regardless if C. rufilabris consumed prey (T. ni or S. frugiperda) that had consumed Bt or non-Bt plants. Additional studies confirmed that the prey contained bioactive Cry proteins when they were consumed by the predator. These studies confirm that Cry1Ac, Cry2Ab and Cry1F do not pose a hazard to the important predator C. rufilabris. This study also demonstrates the power of using resistant hosts when assessing the risk of genetically modified plants on non-target organisms. PMID:23544126

Peptide selection and antibody generation for the prospective immunorecognition of Cry1Ab16 protein of transgenic maize.

PubMed

Costa, Joana; Marani, Mariela M; Grazina, Liliana; Villa, Caterina; Meira, Liliana; Oliveira, M Beatriz P P; Leite, José R S A; Mafra, Isabel

2017-09-15

The introduction of genes isolated from different Bacillus thuringiensis strains to express Cry-type toxins in transgenic crops is a common strategy to confer insect resistance traits. This work intended to extensively in silico analyse Cry1A(b)16 protein for the identification of peptide markers for the biorecognition of transgenic crops. By combining two different strategies based on several bioinformatic tools for linear epitope prediction, a set of seven peptides was successfully selected as potential Cry1A(b)16 immunogens. For the prediction of conformational epitopes, Cry1A(b)16 models were built on the basis of three independent templates of homologue proteins of Cry1A(a) and Cry1A(c) using an integrated approach. PcH_736-746 and PcH_876-886 peptides were selected as the best candidates, being synthesised and used for the production of polyclonal antibodies. To the best of our knowledge, this is the first attempt of selecting and defining linear peptides as immunogenic markers of Cry1A(b)-type toxins in transgenic maize. Copyright © 2017 Elsevier Ltd. All rights reserved.

Transgenic rice plants expressing a fused protein of Cry1Ab/Vip3H has resistance to rice stem borers under laboratory and field conditions.

PubMed

Chen, Yang; Tian, Jun-Ce; Shen, Zhi-Chen; Peng, Yu-Fa; Hu, Cui; Guo, Yu-Yuan; Ye, Gong-Yin

2010-08-01

Six transgenic rice, Oryza sativa L., lines (G6H1, G6H2, G6H3, G6H4, G6H5, and G6H6) expressing a fused Cry1Ab/Vip3H protein, were evaluated for resistance against the Asiatic rice borer, Chilo suppressalis (Walker) (Lepidoptera: Crambidae), and the stem borer Sesamia inferens (Walker) (Lepidoptera: Noctuidae) in the laboratory and field. The bioassay results indicated that the mortality of Asiatic rice borer and S. inferens neonate larvae on six transgenic lines from seedling to filling stage was up to 100% at 168 h after infestation. The cumulative feeding area by Asiatic rice borer neonate larvae on all transgenic lines was significantly reduced compared with the untransformed parental 'Xiushui 110' rice. A 2-yr field evaluation showed that damage during the vegetative stage (deadheart) or during the reproductive stage (whitehead) caused by Asiatic rice borer and S. inferens for transgenic lines was much lower than the control. For three lines (G6H1, G6H2, and G6H6), no damage was found during the entire growing period. Estimation of fused Cry1Ab/Vip3H protein concentrations using PathoScreen kit for Bt-Cry1Ab/1Ac protein indicated that the expression levels of Cry1Ab protein both in main stems (within the average range of 0.006-0.073% of total soluble protein) and their flag leaves (within the average range of 0.001-0.038% of total soluble protein) were significantly different among six transgenic lines at different developmental stages. Both laboratory and field researches suggested that the transgenic rice lines have considerable potential for protecting rice from attack by both stem borers.

Cry1F Resistance in Fall Armyworm Spodoptera frugiperda: Single Gene versus Pyramided Bt Maize

PubMed Central

Huang, Fangneng; Qureshi, Jawwad A.; Meagher, Robert L.; Reisig, Dominic D.; Head, Graham P.; Andow, David A.; Ni, Xinzi; Kerns, David; Buntin, G. David; Niu, Ying; Yang, Fei; Dangal, Vikash

2014-01-01

Evolution of insect resistance to transgenic crops containing Bacillus thuringiensis (Bt) genes is a serious threat to the sustainability of this technology. However, field resistance related to the reduced efficacy of Bt maize has not been documented in any lepidopteran pest in the mainland U.S. after 18 years of intensive Bt maize planting. Here we report compelling evidence of field resistance in the fall armyworm, Spodoptera frugiperda (J.E. Smith), to Cry1F maize (TC 3507) in the southeastern region of the U.S. An F2 screen showed a surprisingly high (0.293) Cry1F resistance allele frequency in a population collected in 2011 from non-Bt maize in south Florida. Field populations from non-Bt maize in 2012–2013 exhibited 18.8-fold to >85.4-fold resistance to purified Cry1F protein and those collected from unexpectedly damaged Bt maize plants at several locations in Florida and North Carolina had >85.4-fold resistance. In addition, reduced efficacy and control failure of Cry1F maize against natural populations of S. frugiperda were documented in field trials using Cry1F-based and pyramided Bt maize products in south Florida. The Cry1F-resistant S. frugiperda also showed a low level of cross-resistance to Cry1A.105 and related maize products, but not to Cry2Ab2 or Vip3A. The occurrence of Cry1F resistance in the U.S. mainland populations of S. frugiperda likely represents migration of insects from Puerto Rico, indicating the great challenges faced in achieving effective resistance management for long-distance migratory pests like S. frugiperda. PMID:25401494

Cry1F resistance in fall armyworm Spodoptera frugiperda: single gene versus pyramided Bt maize.

PubMed

Huang, Fangneng; Qureshi, Jawwad A; Meagher, Robert L; Reisig, Dominic D; Head, Graham P; Andow, David A; Ni, Xinzi; Kerns, David; Buntin, G David; Niu, Ying; Yang, Fei; Dangal, Vikash

2014-01-01

Evolution of insect resistance to transgenic crops containing Bacillus thuringiensis (Bt) genes is a serious threat to the sustainability of this technology. However, field resistance related to the reduced efficacy of Bt maize has not been documented in any lepidopteran pest in the mainland U.S. after 18 years of intensive Bt maize planting. Here we report compelling evidence of field resistance in the fall armyworm, Spodoptera frugiperda (J.E. Smith), to Cry1F maize (TC 3507) in the southeastern region of the U.S. An F2 screen showed a surprisingly high (0.293) Cry1F resistance allele frequency in a population collected in 2011 from non-Bt maize in south Florida. Field populations from non-Bt maize in 2012-2013 exhibited 18.8-fold to >85.4-fold resistance to purified Cry1F protein and those collected from unexpectedly damaged Bt maize plants at several locations in Florida and North Carolina had >85.4-fold resistance. In addition, reduced efficacy and control failure of Cry1F maize against natural populations of S. frugiperda were documented in field trials using Cry1F-based and pyramided Bt maize products in south Florida. The Cry1F-resistant S. frugiperda also showed a low level of cross-resistance to Cry1A.105 and related maize products, but not to Cry2Ab2 or Vip3A. The occurrence of Cry1F resistance in the U.S. mainland populations of S. frugiperda likely represents migration of insects from Puerto Rico, indicating the great challenges faced in achieving effective resistance management for long-distance migratory pests like S. frugiperda.

Consumption of Bt Rice Pollen Containing Cry1C or Cry2A Protein Poses a Low to Negligible Risk to the Silkworm Bombyx mori (Lepidoptera: Bombyxidae)

PubMed Central

Yang, Yan; Liu, Yue; Cao, Fengqin; Chen, Xiuping; Cheng, Lisheng; Romeis, Jörg; Li, Yunhe; Peng, Yufa

2014-01-01

By consuming mulberry leaves covered with pollen from nearby genetically engineered, insect-resistant rice lines producing Cry proteins derived from Bacillus thuringiensis (Bt), larvae of the domestic silkworm, Bombyx mori (Linnaeus) (Lepidoptera: Bombyxidae), could be exposed to insecticidal proteins. Laboratory experiments were conducted to assess the potential effects of Cry1C- or Cry2A-producing transgenic rice (T1C-19, T2A-1) pollen on B. mori fitness. In a short-term assay, B. mori larvae were fed mulberry leaves covered with different densities of pollen from Bt rice lines or their corresponding near isoline (control) for the first 3 d and then were fed mulberry leaves without pollen. No effect was detected on any life table parameter, even at 1800 pollen grains/cm2 leaf, which is much higher than the mean natural density of rice pollen on leaves of mulberry trees near paddy fields. In a long-term assay, the larvae were fed Bt and control pollen in the same way but for their entire larval stage (approximately 27 d). Bt pollen densities ≥150 grains/cm2 leaf reduced 14-d larval weight, increased larval development time, and reduced adult eclosion rate. ELISA analyses showed that 72.6% of the Cry protein was still detected in the pollen grains excreted with the feces. The low exposure of silkworm larvae to Cry proteins when feeding Bt rice pollen may be the explanation for the relatively low toxicity detected in the current study. Although the results demonstrate that B. mori larvae are sensitive to Cry1C and Cry2A proteins, the exposure levels that harmed the larvae in the current study are far greater than natural exposure levels. We therefore conclude that consumption of Bt rice pollen will pose a low to negligible risk to B. mori. PMID:25014054

Expression of the genes for insecticidal crystal proteins in Bacillus thuringiensis: cryIVA, not cryIVB, is transcribed by RNA polymerase containing sigma H and that containing sigma E.

PubMed

Yoshisue, H; Ihara, K; Nishimoto, T; Sakai, H; Komano, T

1995-03-15

To investigate the mechanism of transcriptional regulation of cryIVA and cryIVB, encoding 130-kDa dipteran-active crystal proteins, in Bacillus thuringiensis subsp. israelensis, we introduced each gene into several sporulation mutants of Bacillus subtilis. A spoIIG mutation, the wild-type gene of which encodes sigma E precursor, completely blocked the cryIVB transcription. In contrast, low but detectable transcription of cryIVA was observed in the spoIIG mutant. In the wild-type B. subtilis, no transcription of cryIVB was detected before T2 (2 h after the onset of stationary phase), while the cryIVA transcription started at the late exponential phase at low levels. Furthermore, in a wild-type strain of B. thuringiensis subsp. israelensis, transcription of cryIVA began earlier than that of genes encoding other crystal components, cryIVB and cytA. A consensus sequence recognized by an RNA polymerase containing sigma H of B. subtilis was found upstream of the transcription start point of cryIVA, which overlapped with that recognized by sigma E.

Does Cry1Ab protein affect learning performances of the honey bee Apis mellifera L. (Hymenoptera, Apidae)?

PubMed

Ramirez-Romero, R; Desneux, N; Decourtye, A; Chaffiol, A; Pham-Delègue, M H

2008-06-01

Genetically modified Bt crops are increasingly used worldwide but side effects and especially sublethal effects on beneficial insects remain poorly studied. Honey bees are beneficial insects for natural and cultivated ecosystems through pollination. The goal of the present study was to assess potential effects of two concentrations of Cry1Ab protein (3 and 5000 ppb) on young adult honey bees. Following a complementary bioassay, our experiments evaluated effects of the Cry1Ab on three major life traits of young adult honey bees: (a) survival of honey bees during sub-chronic exposure to Cry1Ab, (b) feeding behaviour, and (c) learning performance at the time that honey bees become foragers. The latter effect was tested using the proboscis extension reflex (PER) procedure. The same effects were also tested using a chemical pesticide, imidacloprid, as positive reference. The tested concentrations of Cry1Ab protein did not cause lethal effects on honey bees. However, honey bee feeding behaviour was affected when exposed to the highest concentration of Cry1Ab protein, with honey bees taking longer to imbibe the contaminated syrup. Moreover, honey bees exposed to 5000 ppb of Cry1Ab had disturbed learning performances. Honey bees continued to respond to a conditioned odour even in the absence of a food reward. Our results show that transgenic crops expressing Cry1Ab protein at 5000 ppb may affect food consumption or learning processes and thereby may impact honey bee foraging efficiency. The implications of these results are discussed in terms of risks of transgenic Bt crops for honey bees.

Spectroscopic and Thermodynamic Characterization of the Metal-Binding Sites in the LH1-RC Complex from Thermophilic Photosynthetic Bacterium Thermochromatium tepidum.

PubMed

Kimura, Yukihiro; Yura, Yuki; Hayashi, Yusuke; Li, Yong; Onoda, Moe; Yu, Long-Jiang; Wang-Otomo, Zheng-Yu; Ohno, Takashi

2016-12-15

The light-harvesting 1 reaction center (LH1-RC) complex from thermophilic photosynthetic bacterium Thermochromatium (Tch.) tepidum exhibits enhanced thermostability and an unusual LH1 Q y transition, both induced by Ca 2+ binding. In this study, metal-binding sites and metal-protein interactions in the LH1-RC complexes from wild-type (B915) and biosynthetically Sr 2+ -substituted (B888) Tch. tepidum were investigated by isothermal titration calorimetry (ITC), atomic absorption (AA), and attenuated total reflection (ATR) Fourier transform infrared (FTIR) spectroscopies. The ITC measurements revealed stoichiometric ratios of approximately 1:1 for binding of Ca 2+ , Sr 2+ , or Ba 2+ to the LH1 αβ-subunit, indicating the presence of 16 binding sites in both B915 and B888. The AA analysis provided direct evidence for Ca 2+ and Sr 2+ binding to B915 and B888, respectively, in their purified states. Metal-binding experiments supported that Ca 2+ and Sr 2+ (or Ba 2+ ) competitively associate with the binding sites in both species. The ATR-FTIR difference spectra upon Ca 2+ depletion and Sr 2+ substitution demonstrated that dissociation and binding of Ca 2+ are predominantly responsible for metal-dependent conformational changes of B915 and B888. The present results are largely compatible with the recent structural evidence that another binding site for Sr 2+ (or Ba 2+ ) exists in the vicinity of the Ca 2+ -binding site, a part of which is shared in both metal-binding sites.

Performance and cross-crop resistance of Cry1F-maize selected Spodoptera frugiperda on transgenic Bt cotton: implications for resistance management

PubMed Central

Yang, Fei; Kerns, David L.; Brown, Sebe; Kurtz, Ryan; Dennehy, Tim; Braxton, Bo; Head, Graham; Huang, Fangneng

2016-01-01

Transgenic crops producing Bacillus thuringiensis (Bt) proteins have become a primary tool in pest management. Due to the intensive use of Bt crops, resistance of the fall armyworm, Spodoptera frugiperda, to Cry1F maize has occurred in Puerto Rico, Brazil, and some areas of the southeastern U.S. The sustainability of Bt crops faces a great challenge because the Cry1F-maize resistant S. frugiperda may also infest other Bt crops in multiple cropping ecosystems. Here we examined the survival and plant injury of a S. frugiperda population selected with Cry1F maize on three single-gene and five pyramided Bt cotton products. Larvae of Cry1F-susceptible (SS), -heterozygous (RS), and -resistant (RR) genotypes of S. frugiperda were all susceptible to the pyramided cotton containing Cry1Ac/Cry2Ab, Cry1Ac/Cry1F/Vip3A, Cry1Ab/Cry2Ae, or Cry1Ab/Cry2Ae/Vip3A, and the single-gene Cry2Ae cotton. Pyramided cotton containing Cry1Ac/Cry1F was effective against SS and RS, but not for RR. These findings show that the Cry1F-maize selected S. frugiperda can cause cross-crop resistance to other Bt crops expressing similar insecticidal proteins. Resistance management and pest management programs that utilize diversify mortality factors must be implemented to ensure the sustainability of Bt crops. This is especially important in areas where resistance to single-gene Bt crops is already widespread. PMID:27301612

Performance and cross-crop resistance of Cry1F-maize selected Spodoptera frugiperda on transgenic Bt cotton: implications for resistance management.

PubMed

Yang, Fei; Kerns, David L; Brown, Sebe; Kurtz, Ryan; Dennehy, Tim; Braxton, Bo; Head, Graham; Huang, Fangneng

2016-06-15

Transgenic crops producing Bacillus thuringiensis (Bt) proteins have become a primary tool in pest management. Due to the intensive use of Bt crops, resistance of the fall armyworm, Spodoptera frugiperda, to Cry1F maize has occurred in Puerto Rico, Brazil, and some areas of the southeastern U.S. The sustainability of Bt crops faces a great challenge because the Cry1F-maize resistant S. frugiperda may also infest other Bt crops in multiple cropping ecosystems. Here we examined the survival and plant injury of a S. frugiperda population selected with Cry1F maize on three single-gene and five pyramided Bt cotton products. Larvae of Cry1F-susceptible (SS), -heterozygous (RS), and -resistant (RR) genotypes of S. frugiperda were all susceptible to the pyramided cotton containing Cry1Ac/Cry2Ab, Cry1Ac/Cry1F/Vip3A, Cry1Ab/Cry2Ae, or Cry1Ab/Cry2Ae/Vip3A, and the single-gene Cry2Ae cotton. Pyramided cotton containing Cry1Ac/Cry1F was effective against SS and RS, but not for RR. These findings show that the Cry1F-maize selected S. frugiperda can cause cross-crop resistance to other Bt crops expressing similar insecticidal proteins. Resistance management and pest management programs that utilize diversify mortality factors must be implemented to ensure the sustainability of Bt crops. This is especially important in areas where resistance to single-gene Bt crops is already widespread.

Susceptibility of Anthonomus grandis (cotton boll weevil) and Spodoptera frugiperda (fall armyworm) to a cry1ia-type toxin from a Brazilian Bacillus thuringiensis strain.

PubMed

Grossi-de-Sa, Maria Fatima; Quezado de Magalhaes, Mariana; Silva, Marilia Santos; Silva, Shirley Margareth Buffon; Dias, Simoni Campos; Nakasu, Erich Yukio Tempel; Brunetta, Patricia Sanglard Felipe; Oliveira, Gustavo Ramos; Neto, Osmundo Brilhante de Oliveira; Sampaio de Oliveira, Raquel; Soares, Luis Henrique Barros; Ayub, Marco Antonio Zachia; Siqueira, Herbert Alvaro Abreu; Figueira, Edson L Z

2007-09-30

Different isolates of the soil bacterium Bacillus thuringiensis produce multiple crystal (Cry) proteins toxic to a variety of insects, nematodes and protozoans. These insecticidal Cry toxins are known to be active against specific insect orders, being harmless to mammals, birds, amphibians, and reptiles. Due to these characteristics, genes encoding several Cry toxins have been engineered in order to be expressed by a variety of crop plants to control insectpests. The cotton boll weevil, Anthonomus grandis, and the fall armyworm, Spodoptera frugiperda, are the major economically devastating pests of cotton crop in Brazil, causing severe losses, mainly due to their endophytic habit, which results in damages to the cotton boll and floral bud structures. A cry1Ia-type gene, designated cry1Ia12, was isolated and cloned from the Bt S811 strain. Nucleotide sequencing of the cry1Ia12 gene revealed an open reading frame of 2160 bp, encoding a protein of 719 amino acid residues in length, with a predicted molecular mass of 81 kDa. The amino acid sequence of Cry1Ia12 is 99% identical to the known Cry1Ia proteins and differs from them only in one or two amino acid residues positioned along the three domains involved in the insecticidal activity of the toxin. The recombinant Cry1Ia12 protein, corresponding to the cry1Ia12 gene expressed in Escherichia coli cells, showed moderate toxicity towards first instar larvae of both cotton boll weevil and fall armyworm. The highest concentration of the recombinant Cry1Ia12 tested to achieve the maximum toxicities against cotton boll weevil larvae and fall armyworm larvae were 230 microg/mL and 5 microg/mL, respectively. The herein demonstrated insecticidal activity of the recombinant Cry1Ia12 toxin against cotton boll weevil and fall armyworm larvae opens promising perspectives for the genetic engineering of cotton crop resistant to both these devastating pests in Brazil.

Use of JH4 joining segment gene by an anti-arsonate antibody that bears the major A-strain cross-reactive idiotype but displays diminished antigen binding.

PubMed

Slaughter, C A; Jeske, D J; Kuziel, W A; Milner, E C; Capra, J D

1984-06-01

One of the antibody families utilized by the A/J mouse in its response to p-azophenylarsonate (Ars) is characterized by the expression of the major anti-arsonate cross-reactive idiotype (CRI) of the A strain. This family has been termed the Ars-A family. A hybridoma antibody (HP 101F11 ) obtained after immunization of an A/J mouse with Ars was identified initially as displaying the CRI, but was subsequently found to bind antigen at a level much lower than most members of the Ars-A family. The results of binding studies suggested that HP 101F11 possesses reduced avidity for antigen. When isolated light and heavy chains were allowed to recombine with the heavy and light chains of a strongly antigen-binding, strongly CRI-positive antibody of the Ars-A family (HP 93G7 ), the low level of antigen binding by HP 101F11 was found to be due to a structurally variant heavy chain. Whereas antibodies of the Ars-A family with normal avidity for antigen had been shown to use the JH2 joining segment gene, amino acid sequence analysis of HP 101F11 revealed that this antibody has a JH segment with a sequence identical to that encoded by a portion of a different JH gene, JH4 . The implication that 101F11 uses the JH4 gene instead of JH2 was supported by the observation that the productively rearranged gene is associated with an Eco R1 restriction fragment 0.95 Kb smaller than the corresponding fragments of Ars-A hybridomas with normal avidity for antigen. The size difference of 0.95 Kb corresponds exactly to the known distance between the JH2 and JH4 genes in BALB/c germline DNA. In addition to the structural differences immediately attributable to the use of JH4 , HP 101F11 has shown an amino acid interchange in the DH segment, and a single amino acid deletion at the DH-JH boundary. These results show that variation among members of the Ars-A family in the DH and/or JH segments provides alternative structural forms of Ars-A antibodies upon which selective processes can operate during the course of an immune response.

Topical ocular treatment with monoclonal antibody Fab fragments targeting Japanese cedar pollen Cry j 1 inhibits Japanese cedar pollen-induced allergic conjunctivitis in mice.

PubMed

Mizutani, Nobuaki; Nabe, Takeshi; Yoshino, Shin

2017-03-05

Fab fragments (Fabs) of antibodies having the ability only to bind to specific allergens lack effector functions due to the absence of the Fc portion. In the present study, we examined whether IgG1 monoclonal antibody (mAb) Fabs targeting Japanese cedar pollen (JCP) Cry j 1 were able to regulate JCP-induced allergic conjunctivitis in mice. BALB/c mice actively sensitized with JCP were repeatedly challenged by topical administration of JCP eye drops. Fabs prepared by the digestion of anti-JCP IgG1 mAbs (P1-3 and P1-8) with papain were applied to the eye 15min before the JCP challenges followed by measurement of the clinical conjunctivitis score. In the in vitro experiments, P1-3 and P1-8 showed specific binding to JCP Cry j 1. Furthermore, intact P1-3 binding to Cry j 1 was inhibited by P1-3 Fabs, but not P1-8 Fabs; additionally, P1-8 Fabs, but not P1-3 Fabs, suppressed the intact P1-8 binding, suggesting that the epitopes of Cry j 1 recognized by P1-3 and P1-8 were different. Topical ocular treatment with P1-3 Fabs or P1-8 Fabs was followed by marked suppression of JCP-induced conjunctivitis (P<0.01). In histological evaluation, P1-8 Fabs showed a reduction in eosinophil infiltration in the conjunctiva (P<0.01). These results demonstrated that topical ocular treatment with IgG1 mAb Fabs to Cry j 1 was effective in suppressing JCP-induced allergic conjunctivitis in mice. Furthermore, it suggests the possibility that some epitopes recognized by Fabs could be used as a tool to regulate allergic conjunctivitis. Copyright © 2017 Elsevier B.V. All rights reserved.

Mutational disruption of the ABCC2 gene in fall armyworm, Spodoptera frugiperda, confers resistance to the Cry1Fa and Cry1A.105 insecticidal proteins.

PubMed

Flagel, Lex; Lee, Young Wha; Wanjugi, Humphrey; Swarup, Shilpa; Brown, Alana; Wang, Jinling; Kraft, Edward; Greenplate, John; Simmons, Jeni; Adams, Nancy; Wang, Yanfei; Martinelli, Samuel; Haas, Jeffrey A; Gowda, Anilkumar; Head, Graham

2018-05-08

The use of Bt proteins in crops has revolutionized insect pest management by offering effective season-long control. However, field-evolved resistance to Bt proteins threatens their utility and durability. A recent example is field-evolved resistance to Cry1Fa and Cry1A.105 in fall armyworm (Spodoptera frugiperda). This resistance has been detected in Puerto Rico, mainland USA, and Brazil. A S. frugiperda population with suspected resistance to Cry1Fa was sampled from a maize field in Puerto Rico and used to develop a resistant lab colony. The colony demonstrated resistance to Cry1Fa and partial cross-resistance to Cry1A.105 in diet bioassays. Using genetic crosses and proteomics, we show that this resistance is due to loss-of-function mutations in the ABCC2 gene. We characterize two novel mutant alleles from Puerto Rico. We also find that these alleles are absent in a broad screen of partially resistant Brazilian populations. These findings confirm that ABCC2 is a receptor for Cry1Fa and Cry1A.105 in S. frugiperda, and lay the groundwork for genetically enabled resistance management in this species, with the caution that there may be several distinct ABCC2 resistances alleles in nature.

Specificity determinants for Cry insecticidal proteins: Insights from their mode of action.

PubMed

Jurat-Fuentes, Juan Luis; Crickmore, Neil

2017-01-01

Insecticidal proteins from the bacterium Bacillus thuringiensis (Bt) are used as active components of biopesticides and as plant incorporated protectants in transgenic crops. One of the most relevant attributes of these Bt protein-based insecticidal technologies is their high specificity, which assures lack of detrimental effects on non-target insects, vertebrates and the environment. The identification of specificity determinants in Bt insecticidal proteins could guide risk assessment for novel insecticidal proteins currently considered for commercialization. In this work we review the available data on specificity determinants of crystal (Cry) insecticidal proteins as the Bt toxins most well characterized and used in transgenic crops. The multi-step mode of action of the Cry insecticidal proteins allows various factors to potentially affect specificity determination and here we define seven levels that could influence specificity. The relative relevance of each of these determinants on efficacy of transgenic crops producing Cry insecticidal proteins is also discussed. Copyright © 2016 Elsevier Inc. All rights reserved.

Multi-state trials of Bt sweet corn varieties for control of the corn earworm (Lepidoptera: Noctuidae).

PubMed

Shelton, A M; Olmstead, D L; Burkness, E C; Hutchison, W D; Dively, G; Welty, C; Sparks, A N

2013-10-01

Field tests in 2010-2011 were performed in New York, Minnesota, Maryland, Ohio, and Georgia to compare Bt sweet corn lines expressing Cry1A.105 + Cry2Ab2 and Cry1Ab with their non-Bt isolines, with and without the use of foliar insecticides. The primary insect pest in all locations during the trial years was Heliocoverpa zea (Boddie), which is becoming the most serious insect pest of sweet corn in the United States. At harvest, the ears were measured for marketability according to fresh market and processing standards. For fresh market and processing, least squares regression showed significant effects of protein expression, state, and insecticide frequency. There was a significant effect of year for fresh market but not for processing. The model also showed significant effects of H. zea per ear by protein expression. Sweet corn containing two genes (Cry1A.105 + Cry2Ab2) and a single gene (Cry1Ab) provided high marketability, and both Bt varieties significantly outperformed the traditional non-Bt isolines in nearly all cases regardless of insecticide application frequency. For pest suppression of H. zea, plants expressing Bt proteins consistently performed better than non-Bt isoline plants, even those sprayed at conventional insecticide frequencies. Where comparisons in the same state were made between Cry1A.105 + Cry2Ab2 and Cry1Ab plants for fresh market, the product expressing Cry1A.105 + Cry2Ab2 provided better protection and resulted in less variability in control. Overall, these results indicate Cry1A.105 + Cry2Ab2 and Cry1Ab plants are suitable for fresh market and processing corn production across a diversity of growing regions and years. Our results demonstrate that Bt sweet corn has the potential to significantly reduce the use of conventional insecticides against lepidopteran pests and, in turn, reduce occupational and environmental risks that arise from intensive insecticide use.

Occurrence of maize detritus and a transgenic insecticidal protein (Cry1Ab) within the stream network of an agricultural landscape

PubMed Central

Tank, Jennifer L.; Rosi-Marshall, Emma J.; Royer, Todd V.; Whiles, Matt R.; Griffiths, Natalie A.; Frauendorf, Therese C.; Treering, David J.

2010-01-01

Widespread planting of maize throughout the agricultural Midwest may result in detritus entering adjacent stream ecosystems, and 63% of the 2009 US maize crop was genetically modified to express insecticidal Cry proteins derived from Bacillus thuringiensis. Six months after harvest, we conducted a synoptic survey of 217 stream sites in Indiana to determine the extent of maize detritus and presence of Cry1Ab protein in the stream network. We found that 86% of stream sites contained maize leaves, cobs, husks, and/or stalks in the active stream channel. We also detected Cry1Ab protein in stream-channel maize at 13% of sites and in the water column at 23% of sites. We found that 82% of stream sites were adjacent to maize fields, and Geographical Information Systems analyses indicated that 100% of sites containing Cry1Ab-positive detritus in the active stream channel had maize planted within 500 m during the previous crop year. Maize detritus likely enters streams throughout the Corn Belt; using US Department of Agriculture land cover data, we estimate that 91% of the 256,446 km of streams/rivers in Iowa, Illinois, and Indiana are located within 500 m of a maize field. Maize detritus is common in low-gradient stream channels in northwestern Indiana, and Cry1Ab proteins persist in maize leaves and can be measured in the water column even 6 mo after harvest. Hence, maize detritus, and associated Cry1Ab proteins, are widely distributed and persistent in the headwater streams of a Corn Belt landscape. PMID:20876106

Occurrence of maize detritus and a transgenic insecticidal protein (Cry1Ab) within the stream network of an agricultural landscape.

PubMed

Tank, Jennifer L; Rosi-Marshall, Emma J; Royer, Todd V; Whiles, Matt R; Griffiths, Natalie A; Frauendorf, Therese C; Treering, David J

2010-10-12

Widespread planting of maize throughout the agricultural Midwest may result in detritus entering adjacent stream ecosystems, and 63% of the 2009 US maize crop was genetically modified to express insecticidal Cry proteins derived from Bacillus thuringiensis. Six months after harvest, we conducted a synoptic survey of 217 stream sites in Indiana to determine the extent of maize detritus and presence of Cry1Ab protein in the stream network. We found that 86% of stream sites contained maize leaves, cobs, husks, and/or stalks in the active stream channel. We also detected Cry1Ab protein in stream-channel maize at 13% of sites and in the water column at 23% of sites. We found that 82% of stream sites were adjacent to maize fields, and Geographical Information Systems analyses indicated that 100% of sites containing Cry1Ab-positive detritus in the active stream channel had maize planted within 500 m during the previous crop year. Maize detritus likely enters streams throughout the Corn Belt; using US Department of Agriculture land cover data, we estimate that 91% of the 256,446 km of streams/rivers in Iowa, Illinois, and Indiana are located within 500 m of a maize field. Maize detritus is common in low-gradient stream channels in northwestern Indiana, and Cry1Ab proteins persist in maize leaves and can be measured in the water column even 6 mo after harvest. Hence, maize detritus, and associated Cry1Ab proteins, are widely distributed and persistent in the headwater streams of a Corn Belt landscape.

Transgenic cotton expressing Cry10Aa toxin confers high resistance to the cotton boll weevil.

PubMed

Ribeiro, Thuanne Pires; Arraes, Fabricio Barbosa Monteiro; Lourenço-Tessutti, Isabela Tristan; Silva, Marilia Santos; Lisei-de-Sá, Maria Eugênia; Lucena, Wagner Alexandre; Macedo, Leonardo Lima Pepino; Lima, Janaina Nascimento; Santos Amorim, Regina Maria; Artico, Sinara; Alves-Ferreira, Márcio; Mattar Silva, Maria Cristina; Grossi-de-Sa, Maria Fatima

2017-08-01

Genetically modified (GM) cotton plants that effectively control cotton boll weevil (CBW), which is the most destructive cotton insect pest in South America, are reported here for the first time. This work presents the successful development of a new GM cotton with high resistance to CBW conferred by Cry10Aa toxin, a protein encoded by entomopathogenic Bacillus thuringiensis (Bt) gene. The plant transformation vector harbouring cry10Aa gene driven by the cotton ubiquitination-related promoter uceA1.7 was introduced into a Brazilian cotton cultivar by biolistic transformation. Quantitative PCR (qPCR) assays revealed high transcription levels of cry10Aa in both T 0 GM cotton leaf and flower bud tissues. Southern blot and qPCR-based 2 -ΔΔCt analyses revealed that T 0 GM plants had either one or two transgene copies. Quantitative and qualitative analyses of Cry10Aa protein expression showed variable protein expression levels in both flower buds and leaves tissues of T 0 GM cotton plants, ranging from approximately 3.0 to 14.0 μg g -1 fresh tissue. CBW susceptibility bioassays, performed by feeding adults and larvae with T 0 GM cotton leaves and flower buds, respectively, demonstrated a significant entomotoxic effect and a high level of CBW mortality (up to 100%). Molecular analysis revealed that transgene stability and entomotoxic effect to CBW were maintained in T 1 generation as the Cry10Aa toxin expression levels remained high in both tissues, ranging from 4.05 to 19.57 μg g -1 fresh tissue, and the CBW mortality rate remained around 100%. In conclusion, these Cry10Aa GM cotton plants represent a great advance in the control of the devastating CBW insect pest and can substantially impact cotton agribusiness. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Baseline sensitivity of lepidopteran corn pests in India to Cry1Ab insecticidal protein of Bacillus thuringiensis.

PubMed

Jalali, Sushil K; Lalitha, Yadavalli; Kamath, Subray P; Mohan, Komarlingam S; Head, Graham P

2010-08-01

Genetically engineered corn (Bt corn) expressing Bacillus thuringiensis Berliner insecticidal protein Cry1Ab is a biotechnological option being considered for management of lepidopteran corn pests in India. As a resistance management practice it was essential to determine the sensitivity of multiple populations of the stalk borer Chilo partellus (Swinhoe), pink borer Sesamia inferens (Walker) and the cob borer Helicoverpa armigera (Hübner) to Cry1Ab protein through bioassays. The insect populations were collected during growing seasons of Rabi 2005 (October 2005 to February 2006) and Kharif 2006 (May to September 2006). Multiple populations of the three lepidopteran corn pests were found to be susceptible to Cry1Ab. Median lethal concentrations (LC(50)) ranged between 0.008 and 0.068 microg Cry1Ab mL(-1) diet for 18 populations of C. partellus (across two seasons), between 0.12 and 1.99 microg mL(-1) for seven populations of H. armigera and between 0.46 and 0.56 microg mL(-1) for two populations of S. inferens. Dose-response concentrations for lethality and growth inhibition have been determined to mark baseline sensitivity of multiple populations of key lepidopteran corn pests in India to Cry1Ab protein. These benchmark values will be referenced while monitoring resistance to Cry1Ab should Bt corn hybrids expressing Cry1Ab be approved for commercial cultivation in India. Copyright (c) 2010 Society of Chemical Industry.

Efficacy of genetically modified Bt toxins alone and in combinations against pink bollworm resistant to Cry1Ac and Cry2Ab

USDA-ARS?s Scientific Manuscript database

Evolution of resistance in pests threatens the long-term success of transgenic crops that produce insecticidal proteins from Bacillus thuringiensis (Bt). Previous work showed that genetically modified Bt toxins Cry1AbMod and Cry1AcMod effectively countered resistance to native Bt toxins Cry1Ab and ...

Application of Box-Behnken experimental design to optimize the extraction of insecticidal Cry1Ac from soil.

PubMed

Li, Yan-Liang; Fang, Zhi-Xiang; You, Jing

2013-02-20

A validated method for analyzing Cry proteins is a premise to study the fate and ecological effects of contaminants associated with genetically engineered Bacillus thuringiensis crops. The current study has optimized the extraction method to analyze Cry1Ac protein in soil using a response surface methodology with a three-level-three-factor Box-Behnken experimental design (BBD). The optimum extraction conditions were at 21 °C and 630 rpm for 2 h. Regression analysis showed a good fit of the experimental data to the second-order polynomial model with a coefficient of determination of 0.96. The method was sensitive and precise with a method detection limit of 0.8 ng/g dry weight and relative standard deviations at 7.3%. Finally, the established method was applied for analyzing Cry1Ac protein residues in field-collected soil samples. Trace amounts of Cry1Ac protein were detected in the soils where transgenic crops have been planted for 8 and 12 years.

Degradation and detection of transgenic Bacillus thuringiensis DNA and proteins in flour of three genetically modified rice events submitted to a set of thermal processes.

PubMed

Wang, Xiaofu; Chen, Xiaoyun; Xu, Junfeng; Dai, Chen; Shen, Wenbiao

2015-10-01

This study aimed to investigate the degradation of three transgenic Bacillus thuringiensis (Bt) genes (Cry1Ab, Cry1Ac, and Cry1Ab/Ac) and the corresponding encoded Bt proteins in KMD1, KF6, and TT51-1 rice powder, respectively, following autoclaving, cooking, baking, or microwaving. Exogenous Bt genes were more stable than the endogenous sucrose phosphate synthase (SPS) gene, and short DNA fragments were detected more frequently than long DNA fragments in both the Bt and SPS genes. Autoclaving, cooking (boiling in water, 30 min), and baking (200 °C, 30 min) induced the most severe Bt protein degradation effects, and Cry1Ab protein was more stable than Cry1Ac and Cry1Ab/Ac protein, which was further confirmed by baking samples at 180 °C for different periods of time. Microwaving induced mild degradation of the Bt and SPS genes, and Bt proteins, whereas baking (180 °C, 15 min), cooking and autoclaving led to further degradation, and baking (200 °C, 30 min) induced the most severe degradation. The findings of the study indicated that degradation of the Bt genes and proteins somewhat correlated with the treatment intensity. Polymerase chain reaction, enzyme-linked immunosorbent assay, and lateral flow tests were used to detect the corresponding transgenic components. Strategies for detecting transgenic ingredients in highly processed foods are discussed. Copyright © 2015 Elsevier Ltd. All rights reserved.

Transgenic cotton coexpressing Vip3A and Cry1Ac has a broad insecticidal spectrum against lepidopteran pests.

PubMed

Chen, Wen-Bo; Lu, Guo-Qing; Cheng, Hong-Mei; Liu, Chen-Xi; Xiao, Yu-Tao; Xu, Chao; Shen, Zhi-Cheng; Wu, Kong-Ming

2017-10-01

Although farmers in China have grown transgenic Bt-Cry1Ac cotton to resist the major pest Helicoverpa armigera since 1997 with great success, many secondary lepidopteran pests that are tolerant to Cry1Ac are now reported to cause considerable economic damage. Vip3AcAa, a chimeric protein with the N-terminal part of Vip3Ac and the C-terminal part of Vip3Aa, has a broad insecticidal spectrum against lepidopteran pests and has no cross resistance to Cry1Ac. In the present study, we tested insecticidal activities of Vip3AcAa against Spodoptera litura, Spodoptera exigua, and Agrotis ipsilon, which are relatively tolerant to Cry1Ac proteins. The bioassay results showed that insecticidal activities of Vip3AcAa against these three pests are superior to Cry1Ac, and after an activation pretreatment, Vip3AcAa retained insecticidal activity against S. litura, S. exigua and A. ipsilon that was similar to the unprocessed protein. The putative receptor for this chimeric protein in the brush border membrane vesicle (BBMV) in the three pests was also identified using biotinylated Vip3AcAa toxin. To broaden Bt cotton activity against a wider spectrum of pests, we introduced the vip3AcAa and cry1Ac genes into cotton. Larval mortality rates for S. litura, A. ipsilon and S. exigua that had fed on this new cotton increased significantly compared with larvae fed on non-Bt cotton and Bt-Cry1Ac cotton in a laboratory experiment. These results suggested that the Vip3AcAa protein is an excellent option for a "pyramid" strategy for integrated pest management in China. Copyright © 2017 Elsevier Inc. All rights reserved.

Management of Field-Evolved Resistance to Bt Maize in Argentina: A Multi-Institutional Approach.

PubMed

Signorini, Ana M; Abratti, Gustavo; Grimi, Damián; Machado, Marcos; Bunge, Florencia F; Parody, Betiana; Ramos, Laura; Cortese, Pablo; Vesprini, Facundo; Whelan, Agustina; Araujo, Mónica P; Podworny, Mariano; Cadile, Alejandro; Malacarne, María F

2018-01-01

Evolution of resistance to control measures in insect populations is a natural process, and management practices are intended to delay or mitigate resistance when it occurs. During the 2012/13 season the first reports of unexpected damage by Diatraea saccharalis on some Bt maize hybrids occurred in the northeast of San Luis province, Argentina. The affected Bt technologies were Herculex I® (HX-TC1507) and VT3PRO® (MON 89034 × MON 88017 * ). Event TC1507 expresses Cry1F and event MON 89034 expresses Cry1A.105 and Cry2Ab2, whichr are all Bt proteins with activity against the lepidopterans D. saccharalis and Spodoptera frugiperda (MON 88017 expresses the protein Cry3Bb1 for control of coleopteran insects and the enzyme CP4EPSPS for glyphosate tolerance). The affected area is an isolated region surrounded by sierra systems to the northeast and west, with a hot semi-arid climate, long frost-free period, warm winters, hot dry summers, and woody shrubs as native flora. To manage and mitigate the development of resistance, joint actions were taken by the industry, growers and Governmental Agencies. Hybrids expressing Vip3A protein (event MIR162) and/or Cry1Ab protein (events MON 810 and Bt11) as single or stacked events are used in early plantings to control the first generations of D. saccharalis , and in later plantings date's technologies with good control of S. frugiperda . A commitment was made to plant the refuge, and pest damage is monitored. As a result, maize production in the area is sustainable and profitable with yields above the average.

Management of Field-Evolved Resistance to Bt Maize in Argentina: A Multi-Institutional Approach

PubMed Central

Signorini, Ana M.; Abratti, Gustavo; Grimi, Damián; Machado, Marcos; Bunge, Florencia F.; Parody, Betiana; Ramos, Laura; Cortese, Pablo; Vesprini, Facundo; Whelan, Agustina; Araujo, Mónica P.; Podworny, Mariano; Cadile, Alejandro; Malacarne, María F.

2018-01-01

Evolution of resistance to control measures in insect populations is a natural process, and management practices are intended to delay or mitigate resistance when it occurs. During the 2012/13 season the first reports of unexpected damage by Diatraea saccharalis on some Bt maize hybrids occurred in the northeast of San Luis province, Argentina. The affected Bt technologies were Herculex I® (HX-TC1507) and VT3PRO® (MON 89034 × MON 88017*). Event TC1507 expresses Cry1F and event MON 89034 expresses Cry1A.105 and Cry2Ab2, whichr are all Bt proteins with activity against the lepidopterans D. saccharalis and Spodoptera frugiperda (MON 88017 expresses the protein Cry3Bb1 for control of coleopteran insects and the enzyme CP4EPSPS for glyphosate tolerance). The affected area is an isolated region surrounded by sierra systems to the northeast and west, with a hot semi-arid climate, long frost-free period, warm winters, hot dry summers, and woody shrubs as native flora. To manage and mitigate the development of resistance, joint actions were taken by the industry, growers and Governmental Agencies. Hybrids expressing Vip3A protein (event MIR162) and/or Cry1Ab protein (events MON 810 and Bt11) as single or stacked events are used in early plantings to control the first generations of D. saccharalis, and in later plantings date's technologies with good control of S. frugiperda. A commitment was made to plant the refuge, and pest damage is monitored. As a result, maize production in the area is sustainable and profitable with yields above the average. PMID:29888224

Development and validation of a sensitive and fast chemiluminescent enzyme immunoassay for the detection of genetically modified maize.

PubMed

Roda, A; Mirasoli, M; Guardigli, M; Michelini, E; Simoni, P; Magliulo, M

2006-03-01

Proteins from the Cry 1 family, in particular Cry 1Ab, are commonly expressed in genetically modified Bt maize in order to control chewing insect pests. A sensitive chemiluminescent sandwich enzyme immunoassay for the detection of Cry1Ab protein from genetically modified Bt maize has been developed and validated. A Cry1Ab protein-specific antibody was immobilized on 96- or 384-well microtiter plates in order to capture the Cry1Ab toxin in the sample; the bound toxin was then detected by employing a second anti-Cry1Ab antibody and a horseradish peroxidase-labeled anti-antibody, followed by measurement of the enzyme activity with an enhanced chemiluminescent system. The chemiluminescent assay fulfilled all the requirements of accuracy and precision and exhibited limits of detection of a few pg mL(-1) Cry1Ab (3 or 5 pg mL(-1), depending on the assay format), which are significantly lower than that achievable using conventional colorimetric detection of peroxidase activity and also represent an improvement compared to previously developed Cry1Ab immunoassays. High-throughput analysis can be performed using the 384-well microtiter plate format immunoassay, which also allows one to reduce the consumption of samples and reagents. Validation of the assay, performed by analyzing certified reference materials, proved that the immunoassay is able to detect the presence of the Cry1Ab protein in certified reference samples containing as low as 0.1% of MON 810 genetically modified Bt maize. This value is below the threshold requiring mandatory labeling of foods containing genetically modified material according to the actual EU regulation.

Transgenic Bt cotton driven by the green tissue-specific promoter shows strong toxicity to lepidopteran pests and lower Bt toxin accumulation in seeds.

PubMed

Wang, Qing; Zhu, Yi; Sun, Lin; Li, Lebin; Jin, Shuangxia; Zhang, Xianlong

2016-02-01

A promoter of the PNZIP (Pharbitis nil leucine zipper) gene (1.459 kb) was cloned from Pharbitis nil and fused to the GUS (β-glucuronidase) and Bacillus thuringiensis endotoxin (Cry9C) genes. Several transgenic PNZIP::GUS and PNZIP::Cry9C cotton lines were developed by Agrobacterium-mediated transformation. Strong GUS staining was detected in the green tissues of the transgenic PNZIP::GUS cotton plants. In contrast, GUS staining in the reproductive structures such as petals, anther, and immature seeds of PNZIP::GUS cotton was very faint. Two transgenic PNZIP::Cry9C lines and one transgenic cauliflower mosaic virus (CaMV) 35S::Cry9C line were selected for enzyme-linked immunosorbent assay (ELISA) and insect bioassays. Expression of the Cry9C protein in the 35S::Cry9C line maintained a high level in most tissues ranging from 24.6 to 45.5 μg g(-1) fresh weight. In green tissues such as the leaves, boll rinds, and bracts of the PNZIP::Cry9C line, the Cry9C protein accumulated up to 50.2, 39.7, and 48.3 μg g(-1) fresh weight respectively. In contrast, seeds of the PNZIP::Cry9C line (PZ1.3) accumulated only 0.26 μg g(-1) fresh weight of the Cry9C protein, which was 100 times lower than that recorded for the seeds of the CaMV 35S::Cry9C line. The insect bioassay showed that the transgenic PNZIP::Cry9C cotton plant exhibited strong resistance to both the cotton bollworm and the pink bollworm. The PNZIP promoter could effectively drive Bt toxin expression in green tissues of cotton and lower accumulated levels of the Bt protein in seeds. These features should allay public concerns about the safety of transgenic foods. We propose the future utility of PNZIP as an economical, environmentally friendly promoter in cotton biotechnology.

Transgenic elite indica rice plants expressing CryIAc delta-endotoxin of Bacillus thuringiensis are resistant against yellow stem borer (Scirpophaga incertulas).

PubMed

Nayak, P; Basu, D; Das, S; Basu, A; Ghosh, D; Ramakrishnan, N A; Ghosh, M; Sen, S K

1997-03-18

Generation of insect-resistant, transgenic crop plants by expression of the insecticidal crystal protein (ICP) gene of Bacillus thuringiensis (Bt) is a standard crop improvement approach. In such cases, adequate expression of the most appropriate ICP against the target insect pest of the crop species is desirable. It is also considered advantageous to generate Bt-transgenics with multiple toxin systems to control rapid development of pest resistance to the ICP. Larvae of yellow stem borer (YSB), Scirpophaga incertulas, a major lepidopteran insect pest of rice, cause massive losses of rice yield. Studies on insect feeding and on the binding properties of ICP to brush border membrane receptors in the midgut of YSB larvae revealed that cryIAb and cryIAc are two individually suitable candidate genes for developing YSB-resistant rice. Programs were undertaken to develop Bt-transgenic rice with these ICP genes independently in a single cultivar. A cryIAc gene was reconstructed and placed under control of the maize ubiquitin 1 promoter, along with the first intron of the maize ubiquitin 1 gene, and the nos terminator. The gene construct was delivered to embryogenic calli of IR64, an elite indica rice cultivar, using the particle bombardment method. Six highly expressive independent transgenic ICP lines were identified. Molecular analyses and insect-feeding assays of two such lines revealed that the transferred synthetic cryIAc gene was expressed stably in the T2 generation of these lines and that the transgenic rice plants were highly toxic to YSB larvae and lessened the damage caused by their feeding.

Comprehensive in silico allergenicity assessment of novel protein engineered chimeric Cry proteins for safe deployment in crops.

PubMed

Rathinam, Maniraj; Singh, Shweta; Pattanayak, Debasis; Sreevathsa, Rohini

2017-08-02

Development of chimeric Cry toxins by protein engineering of known and validated proteins is imperative for enhancing the efficacy and broadening the insecticidal spectrum of these genes. Expression of novel Cry proteins in food crops has however created apprehensions with respect to the safety aspects. To clarify this, premarket evaluation consisting of an array of analyses to evaluate the unintended effects is a prerequisite to provide safety assurance to the consumers. Additionally, series of bioinformatic tools as in silico aids are being used to evaluate the likely allergenic reaction of the proteins based on sequence and epitope similarity with known allergens. In the present study, chimeric Cry toxins developed through protein engineering were evaluated for allergenic potential using various in silico algorithms. Major emphasis was on the validation of allergenic potential on three aspects of paramount significance viz., sequence-based homology between allergenic proteins, validation of conformational epitopes towards identification of food allergens and physico-chemical properties of amino acids. Additionally, in vitro analysis pertaining to heat stability of two of the eight chimeric proteins and pepsin digestibility further demonstrated the non-allergenic potential of these chimeric toxins. The study revealed for the first time an all-encompassing evaluation that the recombinant Cry proteins did not show any potential similarity with any known allergens with respect to the parameters generally considered for a protein to be designated as an allergen. These novel chimeric proteins hence can be considered safe to be introgressed into plants.

Is the Cry1Ab protein from Bacillus thuringiensis (Bt) taken up by plants from soils previously planted with Bt corn and by carrot from hydroponic culture?

PubMed

Icoz, I; Andow, D; Zwahlen, C; Stotzky, G

2009-07-01

The uptake of the insecticidal Cry1Ab protein from Bacillus thuringiensis (Bt) by various crops from soils on which Bt corn had previously grown was determined. In 2005, the Cry1Ab protein was detected by Western blot in tissues (leaves plus stems) of basil, carrot, kale, lettuce, okra, parsnip, radish, snap bean, and soybean but not in tissues of beet and spinach and was estimated by enzyme-linked immunosorbent assay (ELISA) to be 0.05 +/- 0.003 ng g(-1) of fresh plant tissue in basil, 0.02 +/- 0.014 ng g(-1) in okra, and 0.34 +/- 0.176 ng g(-1) in snap bean. However, the protein was not detected by ELISA in carrot, kale, lettuce, parsnip, radish, and soybean or in the soils by Western blot. In 2006, the Cry1Ab protein was detected by Western blot in tissues of basil, carrot, kale, radish, snap bean, and soybean from soils on which Bt corn had been grown the previous year and was estimated by ELISA to be 0.02 +/- 0.014 ng g(-1) of fresh plant tissue in basil, 0.19 +/- 0.060 ng g(-1) in carrot, 0.05 +/- 0.018 ng g(-1) in kale, 0.04 +/- 0.022 ng g(-1) in radish, 0.53 +/- 0.170 ng g(-1) in snap bean, and 0.15 +/- 0.071 ng g(-1) in soybean. The Cry1Ab protein was also detected by Western blot in tissues of basil, carrot, kale, radish, and snap bean but not of soybean grown in soil on which Bt corn had not been grown since 2002; the concentration was estimated by ELISA to be 0.03 +/- 0.021 ng g(-1) in basil, 0.02 +/- 0.008 ng g(-1) in carrot, 0.04 +/- 0.017 ng g(-1) in kale, 0.02 +/- 0.012 ng g(-1) in radish, 0.05 +/- 0.004 ng g(-1) in snap bean, and 0.09 +/- 0.015 ng g(-1) in soybean. The protein was detected by Western blot in 2006 in most soils on which Bt corn had or had not been grown since 2002. The Cry1Ab protein was detected by Western blot in leaves plus stems and in roots of carrot after 56 days of growth in sterile hydroponic culture to which purified Cry1Ab protein had been added and was estimated by ELISA to be 0.08 +/- 0.021 and 0.60 +/- 0.148 ng g(-1) of fresh leaves plus stems and roots, respectively. No Cry1Ab protein was detected in the tissues of carrot grown in hydroponic culture to which no Cry1Ab protein had been added. Because of the different results obtained with different commercial Western blot (i.e., from Envirologix and Agdia) and ELISA kits (i.e., from Envirologix, Agdia, and Abraxis), it is not clear whether the presence of the Cry1Ab protein in the tissues of some plants under field condition and in carrot in sterile hydroponic culture was the result of the uptake of the protein by the plants or of the accuracy and sensitivity of the different commercial kits used. More detailed studies with additional techniques are obviously needed to confirm the uptake of Cry proteins from soil by plants subsequently planted after a Bt crop.

Establishment of a dietary exposure assay for evaluating the toxicity of insecticidal compounds to Apolygus lucorum (Hemiptera: Miridae).

PubMed

Zhao, Man; Li, Yunhe; Yuan, Xiangdong; Liang, Gemei; Wang, Bingjie; Liu, Chen; Khaing, Myint Myint

2018-06-01

With the commercialization of transgenic cotton that expresses Bt (Bacillus thuringiensis) insecticidal proteins, mirid bugs have become key pests in cotton and maize fields in China. Genetically engineered (GE) crops for controlling mirids are unavailable owing to a lack of suitable insecticidal genes. In this study, we developed and validated a dietary exposure assay for screening insecticidal compounds and for assessing the potential effects of insecticidal proteins produced by GE plants on Apolygus lucorum, one of the main mirid pests of Bt cotton and Bt maize. Diets containing potassium arsenate (PA) or the cysteine protease inhibitor E-64 were used as positive controls for validating the efficacy of the dietary exposure assay. The results showed that with increasing concentrations of PA or E-64, A. lucorum larval development time was prolonged and adult weight and fecundity were decreased, suggesting that the dietary exposure assay was useful for detecting the toxicity of insecticidal compounds to A. lucorum. This assay was then used to assess the toxicity of Cry1Ab, Cry1Ac, Cry1F, Cry2Aa, and Cry2Ab proteins, which have been transformed into several crops, against A. lucorum. The results showed that A. lucorum did not show a negative effect by feeding on an artificial diet containing any of the purified Cry proteins. No significant changes in the activities of digestive, detoxifying, or antioxidant enzymes were detected in A. lucorum that fed on a diet containing Cry proteins, but A. lucorum fitness was reduced when the insect fed on a diet containing E-64 or PA. These results demonstrate that A. lucorum is not sensitive to the tested Cry proteins and that the dietary exposure assay is useful for evaluating the toxicity of insecticidal compounds to this species. Copyright © 2018 Elsevier Ltd. All rights reserved.

The tiered-evaluation of the effects of transgenic cry1c rice on Cyrtorhinus lividipennis, a main predator of Nilaparvata lugens

PubMed Central

Han, Yu; Ma, Fugang; Nawaz, Muhammad; Wang, Yu; Cai, Wanlun; Zhao, Jing; He, Yueping; Hua, Hongxia; Zou, Yulan

2017-01-01

T1C-19, a newly developed transgenic cry1C rice line, expresses cry1C under the control of the maize ubiquitin promoter, and is highly resistant to lepidopteran pests of rice. Cyrtorhinus lividipennis is the major predator of the eggs and young nymphs of Nilaparvata lugens, which is the main non-target sap-sucking insect pest of Bt rice. C. lividipennis may be exposed to Cry1C protein, thus biosafety evaluations of transgenic cry1C rice on C. lividipennis should be conducted before the commercialization of T1C-19. In the current study, we tested the direct toxicity of elevated doses of Cry1C to C. lividipennis, effects of T1C-19 on the life-table parameters of C. lividipennis via preying planthoppers, and effects of T1C-19 on the population density and dynamics in rice fields. No detrimental effects on development, survival, female ratio and body weight of C. lividipennis were caused by direct exposure to elevated doses of the Cry1C protein or prey-mediated exposure to realistic doses of the protein. The population density and dynamics did not significantly differ between C. lividipennis in T1C-19 and non-transgenic rice fields. Thus, transgenic cry1C rice had no negative effects on C. lividipennis. This is the first report of the effects of transgenic cry1C rice on C. lividipennis. PMID:28205641

The tiered-evaluation of the effects of transgenic cry1c rice on Cyrtorhinus lividipennis, a main predator of Nilaparvata lugens

NASA Astrophysics Data System (ADS)

Han, Yu; Ma, Fugang; Nawaz, Muhammad; Wang, Yu; Cai, Wanlun; Zhao, Jing; He, Yueping; Hua, Hongxia; Zou, Yulan

2017-02-01

T1C-19, a newly developed transgenic cry1C rice line, expresses cry1C under the control of the maize ubiquitin promoter, and is highly resistant to lepidopteran pests of rice. Cyrtorhinus lividipennis is the major predator of the eggs and young nymphs of Nilaparvata lugens, which is the main non-target sap-sucking insect pest of Bt rice. C. lividipennis may be exposed to Cry1C protein, thus biosafety evaluations of transgenic cry1C rice on C. lividipennis should be conducted before the commercialization of T1C-19. In the current study, we tested the direct toxicity of elevated doses of Cry1C to C. lividipennis, effects of T1C-19 on the life-table parameters of C. lividipennis via preying planthoppers, and effects of T1C-19 on the population density and dynamics in rice fields. No detrimental effects on development, survival, female ratio and body weight of C. lividipennis were caused by direct exposure to elevated doses of the Cry1C protein or prey-mediated exposure to realistic doses of the protein. The population density and dynamics did not significantly differ between C. lividipennis in T1C-19 and non-transgenic rice fields. Thus, transgenic cry1C rice had no negative effects on C. lividipennis. This is the first report of the effects of transgenic cry1C rice on C. lividipennis.

75 FR 57778 - Issuance of an Experimental Use Permit

Federal Register 2010, 2011, 2012, 2013, 2014

2010-09-22

...) necessary for its production in Event TC1507 corn. There are 10.213 kilograms (kg) of eCry3.1Ab, 11.14 grams of Cry1Ab, 8,145 grams of Cry34Ab1, 112.1 grams of Cry35Ab1, 280.6 grams of Vip3Aa20, 217.9 grams of mCry3A, and 177.5 grams of Cry1F proteins in 69,473 kg seeds on 7,311 acres (3,830 PIP and 3,481 non...

Comparative Proteomic and Nutritional Composition Analysis of Independent Transgenic Pigeon Pea Seeds Harboring cry1AcF and cry2Aa Genes and Their Nontransgenic Counterparts.

PubMed

Mishra, Pragya; Singh, Shweta; Rathinam, Maniraj; Nandiganti, Muralimohan; Ram Kumar, Nikhil; Thangaraj, Arulprakash; Thimmegowda, Vinutha; Krishnan, Veda; Mishra, Vagish; Jain, Neha; Rai, Vandna; Pattanayak, Debasis; Sreevathsa, Rohini

2017-02-22

Safety assessment of genetically modified plants is an important aspect prior to deregulation. Demonstration of substantial equivalence of the transgenics compared to their nontransgenic counterparts can be performed using different techniques at various molecular levels. The present study is a first-ever comprehensive evaluation of pigeon pea transgenics harboring two independent cry genes, cry2Aa and cry1AcF. The absence of unintended effects in the transgenic seed components was demonstrated by proteome and nutritional composition profiling. Analysis revealed that no significant differences were found in the various nutritional compositional analyses performed. Additionally, 2-DGE-based proteome analysis of the transgenic and nontransgenic seed protein revealed that there were no major changes in the protein profile, although a minor fold change in the expression of a few proteins was observed. Furthermore, the study also demonstrated that neither the integration of T-DNA nor the expression of the cry genes resulted in the production of unintended effects in the form of new toxins or allergens.

Edible Safety Assessment of Genetically Modified Rice T1C-1 for Sprague Dawley Rats through Horizontal Gene Transfer, Allergenicity and Intestinal Microbiota.

PubMed

Zhao, Kai; Ren, Fangfang; Han, Fangting; Liu, Qiwen; Wu, Guogan; Xu, Yan; Zhang, Jian; Wu, Xiao; Wang, Jinbin; Li, Peng; Shi, Wei; Zhu, Hong; Lv, Jianjun; Zhao, Xiao; Tang, Xueming

2016-01-01

In this study, assessment of the safety of transgenic rice T1C-1 expressing Cry1C was carried out by: (1) studying horizontal gene transfer (HGT) in Sprague Dawley rats fed transgenic rice for 90 d; (2) examining the effect of Cry1C protein in vitro on digestibility and allergenicity; and (3) studying the changes of intestinal microbiota in rats fed with transgenic rice T1C-1 in acute and subchronic toxicity tests. Sprague Dawley rats were fed a diet containing either 60% GM Bacillus thuringiensis (Bt) rice T1C-1 expressing Cry1C protein, the parental rice Minghui 63, or a basic diet for 90 d. The GM Bt rice T1C-1 showed no evidence of HGT between rats and transgenic rice. Sequence searching of the Cry1C protein showed no homology with known allergens or toxins. Cry1C protein was rapidly degraded in vitro with simulated gastric and intestinal fluids. The expressed Cry1C protein did not induce high levels of specific IgG and IgE antibodies in rats. The intestinal microbiota of rats fed T1C-1 was also analyzed in acute and subchronic toxicity tests by DGGE. Cluster analysis of DGGE profiles revealed significant individual differences in the rats' intestinal microbiota.

Bacillus thuringiensis plants expressing Cry1Ac, Cry2Ab and Cry1F are not toxic to the assassin bug, Zelus renardii

USDA-ARS?s Scientific Manuscript database

Cotton and maize delivering insecticidal crystal (Cry) proteins from the bacterium, Bacillus thuringiensis (Bt), have been commercialized since 1996. Bt plants are subjected to environmental risk assessments for non-target organisms, especially natural enemies that suppress pest populations. In th...

Arylphorin is a mitogen in the Heliothis virescens midgut cell secretome upon Cry1Ac intoxication

USDA-ARS?s Scientific Manuscript database

Insecticidal crystal (Cry) proteins produced by the bacterium Bacillus thuringiensis (Bt) target cells in the midgut epithelium of susceptible larvae. While the mode of action of Cry toxins has been extensively investigated, the midgut response to Cry intoxication and its regulation are not well ch...

No impact of transgenic cry1C rice on the rove beetle Paederus fuscipes, a generalist predator of brown planthopper Nilaparvata lugens

NASA Astrophysics Data System (ADS)

Meng, Jiarong; Mabubu, Juma Ibrahim; Han, Yu; He, Yueping; Zhao, Jing; Hua, Hongxia; Feng, Yanni; Wu, Gang

2016-07-01

T1C-19 is newly developed transgenic rice active against lepidopteran pests, and expresses a synthesized cry1C gene driven by the maize ubiquitin promoter. The brown planthopper, Nilaparvata lugens, is a major non-target pest of rice, and the rove beetle (Paederus fuscipes) is a generalist predator of N. lugens nymphs. As P. fuscipes may be exposed to the Cry1C protein through preying on N. lugens, it is essential to assess the potential effects of transgenic cry1C rice on this predator. In this study, two experiments (a direct feeding experiment and a tritrophic experiment) were conducted to evaluate the ecological risk of cry1C rice to P. fuscipes. No significant negative effects were observed in the development, survival, female ratio and body weight of P. fuscipes in both treatments of direct exposure to elevated doses of Cry1C protein and prey-mediated exposure to realistic doses of the protein. This indicated that cry1C rice had no detrimental effects on P. fuscipes. This work represents the first study of an assessment continuum for the effects of transgenic cry1C rice on P. fuscipes. Use of the rove beetle as an indicator species to assess potential effects of genetically modified crops on non-target arthropods is feasible.

No impact of transgenic cry1C rice on the rove beetle Paederus fuscipes, a generalist predator of brown planthopper Nilaparvata lugens

PubMed Central

Meng, Jiarong; Mabubu, Juma Ibrahim; Han, Yu; He, Yueping; Zhao, Jing; Hua, Hongxia; Feng, Yanni; Wu, Gang

2016-01-01

T1C-19 is newly developed transgenic rice active against lepidopteran pests, and expresses a synthesized cry1C gene driven by the maize ubiquitin promoter. The brown planthopper, Nilaparvata lugens, is a major non-target pest of rice, and the rove beetle (Paederus fuscipes) is a generalist predator of N. lugens nymphs. As P. fuscipes may be exposed to the Cry1C protein through preying on N. lugens, it is essential to assess the potential effects of transgenic cry1C rice on this predator. In this study, two experiments (a direct feeding experiment and a tritrophic experiment) were conducted to evaluate the ecological risk of cry1C rice to P. fuscipes. No significant negative effects were observed in the development, survival, female ratio and body weight of P. fuscipes in both treatments of direct exposure to elevated doses of Cry1C protein and prey-mediated exposure to realistic doses of the protein. This indicated that cry1C rice had no detrimental effects on P. fuscipes. This work represents the first study of an assessment continuum for the effects of transgenic cry1C rice on P. fuscipes. Use of the rove beetle as an indicator species to assess potential effects of genetically modified crops on non-target arthropods is feasible. PMID:27444416

PCR analysis of the cryI insecticidal crystal family genes from Bacillus thuringiensis.

PubMed Central

Ceron, J; Covarrubias, L; Quintero, R; Ortiz, A; Ortiz, M; Aranda, E; Lina, L; Bravo, A

1994-01-01

A method allowing rapid and accurate identification of different subgroups within the insecticidal crystal CryI protein-producing family of Bacillus thuringiensis strains was established by using PCR technology. Thirteen highly homologous primers specific to regions within genes encoding seven different subgroups of B. thuringiensis CryI proteins were described. Differentiation among these strains was determined on the basis of the electrophoretic patterns of PCR products. B. thuringiensis strains, isolated from soil samples, were analyzed by PCR technology. Small amounts of bacterial lysates were assayed in two reaction mixtures containing six to eight primers. This method can be applied to rapidly detect the subgroups of CryI proteins that correspond with toxicity to various lepidopteran insects. Images PMID:8117089

Cytochrome P450 system expression and DNA adduct formation in the liver of Zacco platypus following waterborne benzo(a)pyrene exposure: implications for biomarker determination.

PubMed

Lee, Jin Wuk; Kim, Yong Hwa; Yoon, Seokjoo; Lee, Sung Kyu

2014-09-01

Benzo(a)pyrene (BaP) is a polycyclic aromatic hydrocarbon that causes mutations and tumor formation. Zacco platypus is a sentinel species that is suitable for monitoring aquatic environments. We studied cytochrome P450 system (CYP system) expression and DNA adduct formation in the liver of Z. platypus following waterborne exposure to BaP. The results showed both dose and time dependency. The significant induction levels of CYP system mRNA and protein reached maximums at 2 days and 14 days, respectively, and hepatosomatic index was maximally induced at 4 days during 14 days BaP exposure. DNA adduct formation was significantly induced compared to corresponding controls (t-test, p < 0.01) after 4 days of exposure in 100 μg/L BaP. These results indicate that the only use of mRNA expression level of CYP system as a biomarker make us underestimate prolonged toxicity (4-14 days) of BaP and the only use of protein expression level of CYP system make us underestimate acute toxicity (1-2 days) of BaP. Therefore, we suggests that a combinational use of the mRNA expression level and protein expression level of CYP system, hepatosomatic index is a useful biomarker in risk assessment of waterborne BaP exposure. In addition, DNA adduct formation was a useful biomarker in risk assessment of waterborne BaP exposure at 4 days. CYP1A was a more sensitive biomarker than CYP reductase for BaP exposure when considering both the mRNA and protein level. Furthermore, our results show that Z. platypus is a useful species for assessing the risk of waterborne BaP exposure. Copyright © 2012 Wiley Periodicals, Inc., a Wiley company.

Crystallin-αB Regulates Skeletal Muscle Homeostasis via Modulation of Argonaute2 Activity*

PubMed Central

Neppl, Ronald L.; Kataoka, Masaharu; Wang, Da-Zhi

2014-01-01

The core functional machinery of the RNAi pathway is the RNA-induced silencing complex (RISC), wherein Argonaute2 (Ago2) is essential for siRNA-directed endonuclease activity and RNAi/microRNA-mediated gene silencing. Crystallin-αB (CryAB) is a small heat shock protein involved in preventing protein aggregation. We demonstrate that CryAB interacts with the N and C termini of Ago2, not the catalytic site defined by the convergence of the PAZ, MID, and PIWI domains. We further demonstrate significantly reduced Ago2 activity in the absence of CryAB, highlighting a novel role of CryAB in the mammalian RNAi/microRNA pathway. In skeletal muscle of CryAB null mice, we observe a shift in the hypertrophy-atrophy signaling axis toward atrophy under basal conditions. Moreover, loss of CryAB altered the capability of satellite cells to regenerate skeletal muscle. These studies establish that CryAB is necessary for normal Ago2/RISC activity and cellular homeostasis in skeletal muscle. PMID:24782307

KPNB1 mediates PER/CRY nuclear translocation and circadian clock function.

PubMed

Lee, Yool; Jang, A Reum; Francey, Lauren J; Sehgal, Amita; Hogenesch, John B

2015-08-29

Regulated nuclear translocation of the PER/CRY repressor complex is critical for negative feedback regulation of the circadian clock of mammals. However, the precise molecular mechanism is not fully understood. Here, we report that KPNB1, an importin β component of the ncRNA repressor of nuclear factor of activated T cells (NRON) ribonucleoprotein complex, mediates nuclear translocation and repressor function of the PER/CRY complex. RNAi depletion of KPNB1 traps the PER/CRY complex in the cytoplasm by blocking nuclear entry of PER proteins in human cells. KPNB1 interacts mainly with PER proteins and directs PER/CRY nuclear transport in a circadian fashion. Interestingly, KPNB1 regulates the PER/CRY nuclear entry and repressor function, independently of importin α, its classical partner. Moreover, inducible inhibition of the conserved Drosophila importin β in lateral neurons abolishes behavioral rhythms in flies. Collectively, these data show that KPNB1 is required for timely nuclear import of PER/CRY in the negative feedback regulation of the circadian clock.

Betulinic acid ameliorates experimental diabetic-induced renal inflammation and fibrosis via inhibiting the activation of NF-κB signaling pathway.

PubMed

Wang, Shaogui; Yang, Zhiying; Xiong, Fengxiao; Chen, Cheng; Chao, Xiaojuan; Huang, Junying; Huang, Heqing

2016-10-15

Diabetic nephropathy (DN) is the leading cause of end-stage renal failure and is characterized by excessive deposition of extracellular matrix (ECM) proteins such as fibronectin (FN), in the glomerular mesangium and tubulointerstitium. Betulinic acid (BA), a pentacyclic triterpene derived from the bark of the white birch tree, has been demonstrated to have many pharmacological activities. However, the effect of BA on DN has not been fully elucidated. To explore the possible anti-inflammatory effects of BA and their underlying mechanisms, we used streptozotocin-induced diabetic rat kidneys and high glucose-treated glomerular mesangial cells. Our study showed BA could inhibit the degradation of IκBα and the activity of NF-κB in diabetic rat kidneys and high glucose-induced mesangial cells, resulting in reduction of FN expression. In addition, BA suppressed the DNA binding activity and transcriptional activity of NF-κB in high glucose-induced glomerular mesangial cells (GMCs). Furthermore, BA enhanced the interaction between IκBα and β-arrestin2 in mesangial cells. Taken together, our data suggest BA inhibits NF-κB activation through stabilizing NF-κB inhibitory protein IκBα, thereby preventing diabetic renal fibrosis. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Influence of calcareous soil on Cry3Bb1 expression and efficacy in the field.

PubMed

Wangila, David S; Valencia J, Arnubio; Wang, Haichuan; Siegfried, Blair D; Meinke, Lance J

2017-06-01

Greater than expected injury by western corn rootworm (WCR) (Diabrotica virgifera virgifera LeConte) to Cry3Bb1 expressing maize hybrids (Zea mays L.) has been reported in southwestern Nebraska. Affected areas of some fields are often associated with high pH calcareous soils where maize growth is poor and iron chlorosis is common. As part of a comprehensive study to understand potential causes of unexpected injury, experiments were conducted during 2013 and 2014 to ascertain whether the calcareous soil conditions and associated poor maize growth negatively affect the expression of Cry3Bb1. Quantitative determination of Cry3Bb1 protein expression levels in root tissues was carried out on plants at V5-V6 growth stage using the enzyme-linked immunosorbent assay. Cry3Bb1 and non-Bt near isoline maize hybrids were artificially infested with Cry3Bb1-susceptible WCR eggs to measure survival and efficacy of Cry3Bb1 maize in calcareous and non-calcareous soils. Results showed that there was not a significant difference in expression of Cry3Bb1 protein between plants from calcareous and non-calcareous soils (18.9-21.2 µg/g fresh weight). Western corn rootworm survival was about sevenfold greater from the non-Bt isoline than Cry3Bb1 maize indicating that Cry3Bb1 performed as expected when infested with a Cry3Bb1 susceptible rootworm population. When survival from calcareous and non-calcareous soils was compared, no significant differences were observed in each soil. A significant positive correlation between soil pH and expression of Cry3Bb1 protein in roots was detected from samples collected in 2014 but not in 2013. No such correlation was found between soil pH and survival of WCR. Results suggest that Cry3Bb1 expression levels were sufficient to provide adequate root protection against WCR regardless of soil environment, indicating that lowered Cry3Bb1 expression is not a contributing factor to the greater than expected WCR injury observed in some southwestern Nebraska maize fields.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Halavaty, Andrei S.; Northwestern University, Chicago, IL 60611; Kim, Youngchang

The structural characterization of acyl-carrier-protein synthase (AcpS) from three different pathogenic microorganisms is reported. One interesting finding of the present work is a crystal artifact related to the activity of the enzyme, which fortuitously represents an opportunity for a strategy to design a potential inhibitor of a pathogenic AcpS. Some bacterial type II fatty-acid synthesis (FAS II) enzymes have been shown to be important candidates for drug discovery. The scientific and medical quest for new FAS II protein targets continues to stimulate research in this field. One of the possible additional candidates is the acyl-carrier-protein synthase (AcpS) enzyme. Its holomore » form post-translationally modifies the apo form of an acyl carrier protein (ACP), which assures the constant delivery of thioester intermediates to the discrete enzymes of FAS II. At the Center for Structural Genomics of Infectious Diseases (CSGID), AcpSs from Staphylococcus aureus (AcpS{sub SA}), Vibrio cholerae (AcpS{sub VC}) and Bacillus anthracis (AcpS{sub BA}) have been structurally characterized in their apo, holo and product-bound forms, respectively. The structure of AcpS{sub BA} is emphasized because of the two 3′, 5′-adenosine diphosphate (3′, 5′-ADP) product molecules that are found in each of the three coenzyme A (CoA) binding sites of the trimeric protein. One 3′, 5′-ADP is bound as the 3′, 5′-ADP part of CoA in the known structures of the CoA–AcpS and 3′, 5′-ADP–AcpS binary complexes. The position of the second 3′, 5′-ADP has never been described before. It is in close proximity to the first 3′, 5′-ADP and the ACP-binding site. The coordination of two ADPs in AcpS{sub BA} may possibly be exploited for the design of AcpS inhibitors that can block binding of both CoA and ACP.« less

Aquatic degradation of Cry1Ab protein and decomposition dynamics of transgenic corn leaves under controlled conditions.

PubMed

Böttger, Rita; Schaller, Jörg; Lintow, Sven; Gert Dudel, E

2015-03-01

The increasing cultivation of genetically modified corn plants (Zea mays) during the last decades is suggested as a potential risk to the environment. One of these genetically modified variety expressed the insecticidal Cry1Ab protein originating from Bacillus thuringiensis (Bt), resulting in resistance against Ostrinia nubilalis, the European corn borer. Transgenic litter material is extensively studied regarding the decomposition in soils. However, only a few field studies analyzed the fate of the Cry1Ab protein and the impact of green and senescent leaf litter from corn on the decomposition rate and related ecosystem functions in aquatic environments. Consequently, a microbial litter decomposition experiment was conducted under controlled semi-natural conditions in batch culture using two maize varieties: one variety with Cry1Ab and another one with the appertaining Iso-line as control treatment. The results showed no significant differences between the treatment with Cry1Ab and the Iso-line regarding loss of total mass in dry weight of 43% for Iso-line and 45% for Bt-corn litter, lignin content increased to 137.5% (Iso-line) and 115.7% (Bt-corn), and phenol loss decreased by 53.6% (Iso-line), 62.2% (Bt-corn) during three weeks of the experiment. At the end of the experiment Cry1Ab protein was still detected with 6% of the initial concentration. A slightly but significant lower cellulose content was found for the Cry1Ab treatment compared to the Iso-line litter at the end of the experiment. The significant higher total protein (25%) and nitrogen (25%) content in Bt corn, most likely due to the additionally expression of the transgenic protein, may increase the microbial cellulose degradation and decrease microbial lignin degradation. In conclusion a relevant year by year input of protein and therefore nitrogen rich Bt corn litter into aquatic environments may affect the balanced nutrient turnover in aquatic ecosystems. Copyright © 2014 Elsevier Inc. All rights reserved.

75 FR 34040 - Bacillus thuringiensis

Federal Register 2010, 2011, 2012, 2013, 2014

2010-06-16

... protein in corn under the FFDCA. The temporary tolerance exemption expires on June 1, 2012. DATES: This..., and III (Refs. 3, 5, 6 and 7). The toxin portions of Cry proteins are characterized by having five... rates. 3. Prevalence in food. Preliminary expression level analysis shows that the eCry.1Ab protein is...

pH-Controlled Bacillus thuringiensis Cry1Ac Protoxin Loading and Release from Polyelectrolyte Microcapsules

PubMed Central

Yang, Wenhui; He, Kanglai; Zhang, Jie; Guo, Shuyuan

2012-01-01

Crystal proteins synthesized by Bacillus thuringiensis (Bt) have been used as biopesticides because of their toxicity to the insect larval hosts. To protect the proteins from environmental stress to extend their activity, we have developed a new microcapsule formulation. Poly (acrylic acid) (PAH) and poly (styrene sulfonate) (PSS) were fabricated through layer-by-layer self-assembly based on a CaCO3 core. Cry1Ac protoxins were loaded into microcapsules through layer-by-layer self-assembly at low pH, and the encapsulated product was stored in water at 4°C. Scanning electron microscopy (SEM) was used to observe the morphology of the capsules. To confirm the successful encapsulation, the loading results were observed with a confocal laser scattering microscope (CLSM), using fluorescein-labeled Cry1Ac protoxin (FITC-Cry1Ac). The protoxins were released from the capsule under the alkaline condition corresponding to the midgut of certain insects, a condition which seldom exists elsewhere in the environment. The following bioassay experiment demonstrated that the microcapsules with Cry1Ac protoxins displayed approximately equivalent insecticidal activity to the Asian corn borer compared with free Cry1Ac protoxins, and empty capsules proved to have no effect on insects. Further result also indicated that the formulation could keep stable under the condition of heat and desiccation. These results suggest that this formulation provides a promising methodology that protects protoxins from the environment and releases them specifically in the target insects’ midgut, which has shown potential as biopesticide in the field. PMID:23024810

Transgenic rice expressing the cry2AX1 gene confers resistance to multiple lepidopteran pests.

PubMed

Chakraborty, M; Reddy, P Sairam; Mustafa, G; Rajesh, G; Narasu, V M Laxmi; Udayasuriyan, V; Rana, Debashis

2016-10-01

A chimeric Bacillus thuringiensis toxin (Bt) gene, cry2AX1was cloned in a bi-selectable marker free binary vector construct. The cry2AX1 gene, driven by the Chrysanthemum rbcS1 promoter, was introduced into JK1044R, the restorer line (Oryza sativa L. ssp. Indica) of a notified commercially grown rice hybrid in India, by Agrobacterium-mediated transformation. Its effect against two major lepidopteran insect pests viz., yellow stem borer (YSB) Scirpophaga incertulas, rice leaf folder (RLF) Cnaphalocrocis medinalis and one minor insect pest, oriental army worm (OAW) Mythimna separata was demonstrated through bioassays of transgenic rice plants under laboratory and greenhouse conditions. The rbcS1 promoter with chloroplast signal peptide was used to avoid Cry2AX1 protein expression in rice seed endosperm tissue. A total of 37 independent transformants were generated, of which after preliminary molecular characterization and YSB bioassay screening, five events were selected for their protein expression and bioefficacy against all three rice insect. One elite transgenic rice line, BtE15, was identified with Cry2AX1 expression ranging from 0.68 to 1.34 µg g(-1) leaf fresh weight and with 80-92 % levels of resistance against rice pests at the vegetative and reproductive stages. Increase in Cry2AX1 protein concentration was also observed with crop maturity. The Cry2AX1protein concentration in the de-husked seeds was negligible (as low as 2.7-3.6 ng g(-1)). These results indicate the potential application of cry2AX1 gene in rice for protection against YSB, RLF and OAW.

Vaccinia-related kinase 3 (VRK3) sets the circadian period and amplitude by affecting the subcellular localization of clock proteins in mammalian cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Park, Nayoung; Department of Brain Science, Ajou University School of Medicine, 164 Worldcup-ro, Yeongtong-gu, Suwon, Kyunggi-do, 16499; Song, Jieun

In the eukaryotic circadian clock machinery, negative feedback repression of CLOCK (CLK) and BMAL1 transcriptional activity by PERIOD (PER) and CRYPTOCHROME (CRY) underlies the basis for 24 h rhythmic gene expression. Thus, precise regulation of the time-dependent nuclear entry of circadian repressors is crucial to generating normal circadian rhythms. Here, we sought to identify novel kinase(s) that regulate nuclear entry of mammalian CRY1 (mCRY1) with an unbiased screening using red fluorescent protein (RFP)-tagged human kinome expression plasmids in mammalian cells. Transient expression of human vaccinia-related kinase 3 (hVRK3) reduced the nuclear presence of mCRY1. hVRK3 expression also induced alterations in themore » subcellular localization of other core clock proteins, including mCRY2, mPER2, and BMAL1. In contrast, the subcellular localization of mCLK was not changed. Given that singly expressed mCLK mostly resides in the cytoplasm and that nuclear localization sequence (NLS) mutation of hVRK3 attenuated the effect of hVRK3 co-expression on subcellular localization, ectopically expressed hVRK3 presumably reduces the retention of proteins in the nucleus. Finally, downregulation of hvrk3 using siRNA reduced the amplitude and lengthened the period of the cellular bioluminescence rhythm. Taken together, these data suggest that VRK3 plays a role in setting the amplitude and period length of circadian rhythms in mammalian cells. - Highlights: • Screening was performed to identify kinases that regulate CRY1 subcellular localization. • VRK3 alters the subcellular localization of CRY1, CRY2, PER2, and BMAL1. • VRK3 knock-down alters the circadian bioluminescence rhythm in mammalian cells.« less

Extracellular glycosylphosphatidylinositol-anchored mannoproteins and proteases of Cryptococcus neoformans.

PubMed

Eigenheer, Richard A; Jin Lee, Young; Blumwald, Eduardo; Phinney, Brett S; Gelli, Angie

2007-06-01

Extracellular proteins of Cryptococcus neoformans are involved in the pathogenesis of cryptococcosis, and some are immunoreactive antigens that may potentially serve as candidates for vaccine development. To further study the extracellular proteome of the human fungal pathogen Cry. neoformans, we conducted a proteomic analysis of secreted and cell wall-bound proteins with an acapsular strain of Cry. neoformans. Proteins were identified from both intact cells and cell walls. In both cases, extracellular proteins were removed with trypsin or beta-glucanase, and then all proteins/peptides were purified by solid-phase extraction, spin dialysis, and HPLC, and identified by liquid chromatography-mass spectrometry. This study identified 29 extracellular proteins with a predicted N-terminal signal sequence and also a predicted glycosylphosphatidylinositol anchor motif in more than half. Among the novel proteins identified were five glycosylphosphatidylinositol-anchored proteins with extensive Ser/Thr-rich regions but no apparent functional domains, a glycosylphosphatidylinositol-anchored aspartic protease, and a metalloprotease with structural similarity to an elastinolytic metalloprotease of Aspergillus fumigatus. This study suggests that Cry. neoformans has the machinery required to target glycosylphosphatidylinositol-anchored proteins to the cell wall, and it confirms the extracellular proteolytic ability of Cry. neoformans.

Molecular characterization of Bacillus thuringiensis isolated from diverse habitats of India.

PubMed

Patel, Ketan D; Chudasama, Chaitanyasinh J; Ingle, Sanjay S

2012-08-01

Bacillus thuringiensis (Bt) strains were isolated from 94 samples from different geographical regions. Novel types of crystalline inclusion bodies were observed from some of the isolates. Crystalline inclusions of bipyramidal, spherical and cuboidal morphology were found produced by most of the isolates. Isolate GS12 showed crystal on one side of spore while isolate GM108 formed crystals on both termini of spore. Isolate GN31 produced large sized bipyramidal crystals. SDS-PAGE analysis of the spore crystal suspension showed major protein bands in the range of 29 and 140 kDa. Two new serovars of Bt viz. GS4 and GN24 having H3abce and H3ab serotype respectively were isolated. Toxicity comparable to the reference strain Bacillus thuringiensis subs. kurstaki (Btk) HD-1 was observed for the isolates GM20, GM17 and MP3 against larvae of Helicoverpa armigera. Some of the isolates harboring cry genes like cry1Ac and cry2 did not show any toxicity towards H. armigera while most of the isolates were harboring cry1, cry1Ac and cry2 gene. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Overexpression of the Bacillus thuringiensis (Bt) Cry2Aa2 protein in chloroplasts confers resistance to plants against susceptible and Bt-resistant insects

PubMed Central

Kota, Madhuri; Daniell, Henry; Varma, Sam; Garczynski, Stephen F.; Gould, Fred; Moar, William J.

1999-01-01

Evolving levels of resistance in insects to the bioinsecticide Bacillus thuringiensis (Bt) can be dramatically reduced through the genetic engineering of chloroplasts in plants. When transgenic tobacco leaves expressing Cry2Aa2 protoxin in chloroplasts were fed to susceptible, Cry1A-resistant (20,000- to 40,000-fold) and Cry2Aa2-resistant (330- to 393-fold) tobacco budworm Heliothis virescens, cotton bollworm Helicoverpa zea, and the beet armyworm Spodoptera exigua, 100% mortality was observed against all insect species and strains. Cry2Aa2 was chosen for this study because of its toxicity to many economically important insect pests, relatively low levels of cross-resistance against Cry1A-resistant insects, and its expression as a protoxin instead of a toxin because of its relatively small size (65 kDa). Southern blot analysis confirmed stable integration of cry2Aa2 into all of the chloroplast genomes (5,000–10,000 copies per cell) of transgenic plants. Transformed tobacco leaves expressed Cry2Aa2 protoxin at levels between 2% and 3% of total soluble protein, 20- to 30-fold higher levels than current commercial nuclear transgenic plants. These results suggest that plants expressing high levels of a nonhomologous Bt protein should be able to overcome or at the very least, significantly delay, broad spectrum Bt-resistance development in the field. PMID:10051556

Cryptochrome 2 expression level is critical for adrenocorticotropin stimulation of cortisol production in the capuchin monkey adrenal.

PubMed

Torres-Farfan, C; Abarzua-Catalan, L; Valenzuela, F J; Mendez, N; Richter, H G; Valenzuela, G J; Serón-Ferré, M

2009-06-01

Timely production of glucocorticoid hormones in response to ACTH is essential for survival by coordinating energy intake and expenditure and acting as homeostatic regulators against stress. Adrenal cortisol response to ACTH is clock time dependent, suggesting that an intrinsic circadian oscillator in the adrenal cortex contributes to modulate the response to ACTH. Circadian clock gene expression has been reported in the adrenal cortex of several species. However, there are no reports accounting for potential involvement of adrenal clock proteins on cortisol response to ACTH. Here we explored whether the clock protein cryptochrome 2 (CRY2) knockdown modifies the adrenal response to ACTH in a primate. Adrenal gland explants from adult capuchin monkey (n = 5) were preincubated for 6 h with transfection vehicle (control) or with two different Cry2 antisense and sense probes followed by 48 h incubation in medium alone (no ACTH) or with 100 nm ACTH. Under control and sense conditions, ACTH increased cortisol production, whereas CRY2 suppression inhibited ACTH-stimulated cortisol production. Expression of the steroidogenic enzymes steroidogenic acute regulatory protein and 3beta-hydroxysteroid dehydrogenase at 48 h of incubation was increased by ACTH in control explants and suppressed by Cry2 knockdown. Additionally, we found that Cry2 knockdown decreased the expression of the clock gene brain and muscle aryl hydrocarbon receptor nuclear translocator-like protein (Bmal1) at the mRNA and protein levels. Altogether these results strongly support that the clock protein CRY2 is involved in the mechanism by which ACTH increases the expression of steroidogenic acute regulatory protein and 3beta-hydroxysteroid dehydrogenase. Thus, adequate expression levels of components of the adrenal circadian clock are required for an appropriate cortisol response to ACTH.

The diverse nematicidal properties and biocontrol efficacy of Bacillus thuringiensis Cry6A against the root-knot nematode Meloidogyne hapla.

PubMed

Yu, Ziquan; Xiong, Jing; Zhou, Qiaoni; Luo, Haiyan; Hu, Shengbiao; Xia, Liqiu; Sun, Ming; Li, Lin; Yu, Ziniu

2015-02-01

Cry6A toxin from Bacillus thuringiensis is a representative nematicidal crystal protein with a variety of nematicidal properties to free-living nematode Caenorhabditis elegans. Cry6A shares very low homology and different structure with Cry5B, another representative nematicidal crystal protein, and probably acts in a distinct pathway. All these strongly indicate that Cry6A toxin is likely a potent candidate for nematicide. The present study dealt with global investigation to determine the detrimental impacts of Cry6Aa2 toxin on Meloidogyne hapla, a root-knot nematode, and evaluated its biocontrol efficacy in pot experiment. Obtained results indicated that Cry6Aa2 toxin exhibits obvious toxicity to second-stage juvenile of M. hapla, and significantly inhibits egg hatch, motility, and penetration to host plant. Pot experiment suggested that soil drenching with spore-crystal mixture of Cry6Aa2 can clearly lighten the disease of root-knot nematode, including reduction of galling index and egg masses on host plant root, decreasing final population of nematode in soil. Moreover, application of Cry6Aa2 can obviously promote plant growth. These results demonstrated that Cry6Aa2 toxin is a promising nematicidal agent, and possesses great potential in plant-parasitic nematode management and construction of transgenic crop with constant resistance to nematode. Copyright © 2015 Elsevier Inc. All rights reserved.

Transgenic elite indica rice plants expressing CryIAc ∂-endotoxin of Bacillus thuringiensis are resistant against yellow stem borer (Scirpophaga incertulas)

PubMed Central

Nayak, Pritilata; Basu, Debabrata; Das, Sampa; Basu, Asitava; Ghosh, Dipankar; Ramakrishnan, Neeliyath A.; Ghosh, Maloy; Sen, Soumitra K.

1997-01-01

Generation of insect-resistant, transgenic crop plants by expression of the insecticidal crystal protein (ICP) gene of Bacillus thuringiensis (Bt) is a standard crop improvement approach. In such cases, adequate expression of the most appropriate ICP against the target insect pest of the crop species is desirable. It is also considered advantageous to generate Bt-transgenics with multiple toxin systems to control rapid development of pest resistance to the ICP. Larvae of yellow stem borer (YSB), Scirpophaga incertulas, a major lepidopteran insect pest of rice, cause massive losses of rice yield. Studies on insect feeding and on the binding properties of ICP to brush border membrane receptors in the midgut of YSB larvae revealed that cryIAb and cryIAc are two individually suitable candidate genes for developing YSB-resistant rice. Programs were undertaken to develop Bt-transgenic rice with these ICP genes independently in a single cultivar. A cryIAc gene was reconstructed and placed under control of the maize ubiquitin 1 promoter, along with the first intron of the maize ubiquitin 1 gene, and the nos terminator. The gene construct was delivered to embryogenic calli of IR64, an elite indica rice cultivar, using the particle bombardment method. Six highly expressive independent transgenic ICP lines were identified. Molecular analyses and insect-feeding assays of two such lines revealed that the transferred synthetic cryIAc gene was expressed stably in the T2 generation of these lines and that the transgenic rice plants were highly toxic to YSB larvae and lessened the damage caused by their feeding. PMID:9122157

Bt crops producing Cry1Ac, Cry2Ab and Cry1F do not harm the green lacewing, chrysoperla rufilabris

USDA-ARS?s Scientific Manuscript database

The biological control function provided by natural enemies is regarded as a protection goal that should not be harmed by the application of any new pest management tool. Plants producing Cry proteins from the bacterium, Bacillus thuringiensis (Bt), have become a major tactic for controlling pest Le...

Cry8Ca2-containing layer-by-layer microcapsules for the pH-controlled release of crystal protein.

PubMed

Li, Feng; Yan, Yue; Wang, Dandan; Zhang, Jie; Guo, Shuyuan

2014-01-01

To extend the activity of crystal proteins by protection from environmental stress, we developed a new type of microcapsule containing Cry8Ca2 protoxins. Layer-by-layer (LbL) microcapsules containing Cry8Ca2 were successfully prepared for the first time by the alternate deposition of poly(acrylic acid) (PAH) and Cry8Ca2 at pH 6 on the surface of poly(styrene sulphonate) (PSS)-doped CaCO3 microbeads. Scanning electron microscopy (SEM) photos showed that microparticles were spherical in shape, approximately 2 μm in diameter. After removing the templates, the loading results were observed with a confocal laser scattering microscope (CLSM) by using fluorescein-labelled Cry8Ca2. The Cry8Ca2 protoxins were released from the microcapsules when they were exposed to a pH higher than 6 due to the loss of the electrostatic attraction. The microcapsules displayed resistance to proteinase K. Bioassay result demonstrated that the microcapsules with Cry8Ca2 displayed approximately equivalent insecticidal activity to the larvae of Anomala corpulenta compared to the free Cry8Ca2.

Mucosal and systemic adjuvant effects of cholera toxin and Cry1Ac protoxin on the specific antibody response to HIV-1 C4/V3 peptides are different and depend on the antigen co-administered.

PubMed

Esquivel-Pérez, Rita; Moreno-Fierros, Leticia

2005-01-01

Evidence from several sources support the assertion that cholera toxin (CT) is a potent immunogen and mucosal adjuvant; however there are also reports showing its lack of adjuvanticity against some antigens. Cry1Ac protoxin also exerts adjuvant effects in the antibody responses to proteins and polysaccharides but its adjuvanticity with regard to peptide vaccines had not been tested. To probe whether the adjuvant effects of these proteins varied depending on the antigen co-administered, we evaluated antipeptide antibody responses in serum and mucosal samples (vaginal, intestinal, and pulmonary) of mice that were immunized by intranasal or intraperitoneal routes with one of two distinct hybrid C4/V3 HIV peptides, either alone or with CT or Cry1Ac. The tested HIV 1 peptides differed in two aminoacids, T1SP10MN(A) was modified at the SP10 region by the substitution of the isoleucines 12 and 14 for cysteines and was called modified (m)T1SP10MN(A). Our data indicate that the adjuvant effects of CT and Cry1Ac are different. In addition they vary depending on the antigen co-administered and the number of antigen doses, because after three doses moderate adjuvant effects of CT and Cry1Ac on anti-peptide serum and mucosal antibody responses were observed only against the mT1SP10MN(A). In contrast, to attain significant adjuvant effects against the T1SP10MN, four doses were required. Interestingly we found that modification of the HIV peptide increases its immunogenicity without altering the principal neutralizing determinant (SP10).

Molecular basis for blue light-dependent phosphorylation of Arabidopsis cryptochrome 2

PubMed Central

Liu, Qing; Wang, Qin; Deng, Weixian; Wang, Xu; Piao, Mingxin; Cai, Dawei; Li, Yaxing; Barshop, William D.; Yu, Xiaolan; Zhou, Tingting; Liu, Bin; Oka, Yoshito; Wohlschlegel, James; Zuo, Zecheng; Lin, Chentao

2017-01-01

Plant cryptochromes undergo blue light-dependent phosphorylation to regulate their activity and abundance, but the protein kinases that phosphorylate plant cryptochromes have remained unclear. Here we show that photoexcited Arabidopsis cryptochrome 2 (CRY2) is phosphorylated in vivo on as many as 24 different residues, including 7 major phosphoserines. We demonstrate that four closely related Photoregulatory Protein Kinases (previously referred to as MUT9-like kinases) interact with and phosphorylate photoexcited CRY2. Analyses of the ppk123 and ppk124 triple mutants and amiR4k artificial microRNA-expressing lines demonstrate that PPKs catalyse blue light-dependent CRY2 phosphorylation to both activate and destabilize the photoreceptor. Phenotypic analyses of these mutant lines indicate that PPKs may have additional substrates, including those involved in the phytochrome signal transduction pathway. These results reveal a mechanism underlying the co-action of cryptochromes and phytochromes to coordinate plant growth and development in response to different wavelengths of solar radiation in nature. PMID:28492234

Bt crops benefit natural enemies to control non-target pests

PubMed Central

Tian, Jun-Ce; Yao, Ju; Long, Li-Ping; Romeis, Jörg; Shelton, Anthony M.

2015-01-01

Crops producing insecticidal crystal (Cry) proteins from Bacillus thuringiensis (Bt) control important lepidopteran pests. However, pests such as aphids not susceptible to Cry proteins may require other integrated pest management (IPM) tactics, including biological control. We fed aphids on Bt and non-Bt plants and analyzed the Bt protein residue in aphids and compared the effects of Bt plants and a pyrethroid, lambda-cyhalothrin, on the performance of three natural enemies (predators: Coleomegilla maculata and Eupeodes americanus; parasitoid Aphidius colemani) of the green peach aphid, Myzus persicae. No Bt protein residues in aphids were detected and no significant differences were recorded in the performance of pyrethroid-resistant aphids that fed on Bt broccoli expressing Cry1Ab or Cry1C, or on non-Bt broccoli plants treated or not treated with the pyrethroid. This indicated the aphids were not affected by the Cry proteins or the pyrethroid, thus removing any effect of prey quality. Tri-trophic experiments demonstrated that no C. maculata and E. americanus survived consumption of pyrethroid-treated aphids and that ovipositional behavior of A. colemani was impaired when provided with pyrethroid-treated aphids. In contrast, natural enemies were not affected when fed aphids reared on Bt broccoli, thus demonstrating the safety of these Bt plants for IPM. PMID:26559133

Bt crops benefit natural enemies to control non-target pests.

PubMed

Tian, Jun-Ce; Yao, Ju; Long, Li-Ping; Romeis, Jörg; Shelton, Anthony M

2015-11-12

Crops producing insecticidal crystal (Cry) proteins from Bacillus thuringiensis (Bt) control important lepidopteran pests. However, pests such as aphids not susceptible to Cry proteins may require other integrated pest management (IPM) tactics, including biological control. We fed aphids on Bt and non-Bt plants and analyzed the Bt protein residue in aphids and compared the effects of Bt plants and a pyrethroid, lambda-cyhalothrin, on the performance of three natural enemies (predators: Coleomegilla maculata and Eupeodes americanus; parasitoid Aphidius colemani) of the green peach aphid, Myzus persicae. No Bt protein residues in aphids were detected and no significant differences were recorded in the performance of pyrethroid-resistant aphids that fed on Bt broccoli expressing Cry1Ab or Cry1C, or on non-Bt broccoli plants treated or not treated with the pyrethroid. This indicated the aphids were not affected by the Cry proteins or the pyrethroid, thus removing any effect of prey quality. Tri-trophic experiments demonstrated that no C. maculata and E. americanus survived consumption of pyrethroid-treated aphids and that ovipositional behavior of A. colemani was impaired when provided with pyrethroid-treated aphids. In contrast, natural enemies were not affected when fed aphids reared on Bt broccoli, thus demonstrating the safety of these Bt plants for IPM.

Butyric acid regulates progesterone and estradiol secretion via cAMP signaling pathway in porcine granulosa cells.

PubMed

Lu, Naisheng; Li, Mengjiao; Lei, Hulong; Jiang, Xueyuan; Tu, Weilong; Lu, Yang; Xia, Dong

2017-09-01

Butyric acid (BA), one of the short chain fatty acids (SCFAs), has positive actions on the metabolism, inflammation, etc. However, whether it influences the reproductive physiology and if so the detail mechanism involved has not yet been determined. In this study, the porcine granulosa cells (PGCs) were treated with gradient concentrations of BA. After 24h culture, 0.05mM BA significantly stimulated the progesterone (P 4 ) secretion (P<0.05), 5mM and 10mM BA significantly inhibited the P 4 secretion (P<0.05). Simultaneously, BA up-regulated the estradiol (E 2 ) secretion in a dose dependent manner, 5mM and 10mM BA significantly promoted the E 2 level (P<0.05). In addition, 10mM BA significantly promoted the G-protein-coupled receptor 41/43 mRNA (P<0.05). Interestingly, 5mM BA treatment significantly down-regulated cyclic adenosine monophosphate (cAMP) content (P<0.05), steroidogenic acute regulatory (StAR), steroidogenic factor 1 (SF1), P450scc in the mRNA and/or protein level (P<0.05), and these actions were reversed by cAMP activator forskolin (FK). Moreover, the co-treatment of 5mM BA and bupivacaine (BPC, the cAMP inhibitor) significantly accumulated the inhibition action of BPC on cAMP, the secretion of P 4 , and the abundance of StAR mRNA (P<0.05), inhibited the up-regulation of 5mM BA on the E 2 secretion (P<0.05). Further, the Global Proteome and KEGG pathway analysis found that 5mM BA significantly up-regulated the I3LM80 proteins (P<0.05), which is involved in the steroid biosynthesis signaling pathway. 5mM BA significantly decreased the F2Z5G3 protein level (P<0.05), and the cAMP signaling pathway. In conclusion, present findings for the first time demonstrated that BA could regulate the P 4 and E 2 hormone synthesis in PGCs via the cAMP signaling pathway. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

Protein quality control in protection against systolic overload cardiomyopathy: the long term role of small heat shock proteins

PubMed Central

Kumarapeli, Asangi R K; Horak, Kathleen; Wang, Xuejun

2010-01-01

Molecular chaperones represent the first line of defense of intracellular protein quality control. As a major constituent of molecular chaperones, heat shock proteins (HSP) are known to confer cardiomyocyte short-term protection against various insults and injuries. Previously, we reported that the small HSP αB-crystallin (CryAB) attenuates cardiac hypertrophic response in mice subjected to 2 weeks of severe pressure overload. However, the long-term role of small HSPs in cardiac hypertrophy and failure has rarely been studied. The present study investigates the cardiac responses to chronic severe pressure overload in CryAB/HSPB2 germ line ablated (KO) and cardiac-specific CryAB overexpressingtransgenic (TG) mice. Pressure overload was induced by transverse aortic constriction in KO, TG, and non-transgenic wild type (NTG) control mice and 10 weeks later molecular, cellular, and whole organ level hypertrophic responses were analyzed. As we previously described, CryAB/HSPB2 KO mice showed abnormal baseline cardiac physiology that worsened into a restrictive cardiomyopathic phenotype with aging. Severe pressure overload in these mice led to rapid deterioration of heart function and development of congestive cardiac failure. Contrary to their short term protective phenotype, CryAB TG mice showed no significant effects on cardiac hypertrophic responses and very modest improvement of hemodynamics during chronic systolic overload. These findings indicate that small HSPs CryAB and/or HSPB2 are essential to maintain cardiac structure and function but overex-pression of CryAB is not sufficient to confer a sustained protection against chronic systolic overload. PMID:20733949

Protein quality control in protection against systolic overload cardiomyopathy: the long term role of small heat shock proteins.

PubMed

Kumarapeli, Asangi R K; Horak, Kathleen; Wang, Xuejun

2010-07-21

Molecular chaperones represent the first line of defense of intracellular protein quality control. As a major constituent of molecular chaperones, heat shock proteins (HSP) are known to confer cardiomyocyte short-term protection against various insults and injuries. Previously, we reported that the small HSP alphaB-crystallin (CryAB) attenuates cardiac hypertrophic response in mice subjected to 2 weeks of severe pressure overload. However, the long-term role of small HSPs in cardiac hypertrophy and failure has rarely been studied. The present study investigates the cardiac responses to chronic severe pressure overload in CryAB/HSPB2 germ line ablated (KO) and cardiac-specific CryAB overexpressingtransgenic (TG) mice. Pressure overload was induced by transverse aortic constriction in KO, TG, and non-transgenic wild type (NTG) control mice and 10 weeks later molecular, cellular, and whole organ level hypertrophic responses were analyzed. As we previously described, CryAB/HSPB2 KO mice showed abnormal baseline cardiac physiology that worsened into a restrictive cardiomyopathic phenotype with aging. Severe pressure overload in these mice led to rapid deterioration of heart function and development of congestive cardiac failure. Contrary to their short term protective phenotype, CryAB TG mice showed no significant effects on cardiac hypertrophic responses and very modest improvement of hemodynamics during chronic systolic overload. These findings indicate that small HSPs CryAB and/or HSPB2 are essential to maintain cardiac structure and function but overex-pression of CryAB is not sufficient to confer a sustained protection against chronic systolic overload.

Bitrophic and Tritrophic Effects of Transgenic cry1Ab/cry2Aj Maize on the Beneficial, Nontarget Harmonia axyridis (Coleoptera: Coccinellidae).

PubMed

Chang, Xue; Lu, Zengbin; Shen, Zhicheng; Peng, Yufa; Ye, Gongyin

2017-10-01

Harmonia axyridis (Pallas) is a common and abundant predator in China and may be exposed to Cry toxins that are produced in Bt crops either by feeding on plant parts or by feeding on target or nontarget herbivorous insects. A new Bt maize line, expressing the Cry1Ab/Cry2Aj fused protein, has been developed and should be rigorously assessed for the ecological risks on the natural enemy. Laboratory experiments were carried out to study the effects of this Bt maize on nontarget predator H. axyridis via bitrophic interaction of adult H. axyridis feeding on Bt maize pollen and tritrophic interaction of H. axyridis consuming the lepidopteran prey. Spodoptera exigua (Hübner) neonate larvae were used to transfer Bt protein because they could survive after ingesting transgenic cry1Ab/cry2Aj maize kernels in the previous study. ELISA bioassays confirmed that the Bt protein could be transferred, but diluted through Bt maize-prey-predator. Life history parameters such as survival, development, weight, fecundity, and egg hatching rate were not significantly different when H. axyridis consumed prey that had been reared on Bt maize compared with prey reared on a nontransformed parental control. Furthermore, feeding directly on Bt maize pollen also had no detrimental effects on fitness, survival, and weight of female and male adults. In conclusion, our results indicate that transgenic cry1Ab/cry2Aj maize poses no ecological risks on the nontarget predator H. axyridis. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

A 52-week safety study in cynomolgus macaques for genetically modified rice expressing Cry1Ab/1Ac protein.

PubMed

Mao, Jie; Sun, Xing; Cheng, Jian-Hua; Shi, Yong-Jie; Wang, Xin-Zheng; Qin, Jun-Jie; Sang, Zhi-Hong; He, Kun; Xia, Qing

2016-09-01

A 52-week feeding study in cynomolgus macaques was carried out to evaluate the safety of Bt rice Huahui 1 (HH1), a transgenic rice line expressing Cry1Ab/1Ac protein. Monkeys were fed a diet with 20% or 60% HH1 rice, 20% or 60% parental rice (Minghui 63, MH63), normal diet, normal diet spiked with purified recombinant Cry1Ab/1Ac fusion protein or bovine serum albumin (BSA) respectively. During the feeding trail, clinical observations were conducted daily, and multiple parameters, including body weight, body temperature, electrocardiogram, hematology, blood biochemistry, serum metabolome and gut microbiome were examined at regular intervals. Upon sacrifice, the organs were weighted, and the macroscopic, microscopic and electron microscopic examinations were performed. The results show no adverse or toxic effects of Bt rice HH1 or Cry1Ab/1Ac fusion protein on monkeys. Therefore, the present 52-week primate feeding study suggests that the transgenic rice containing Cry 1Ab/1Ac is equivalent to its parental rice line MH63. Copyright © 2016 Elsevier Ltd. All rights reserved.

Molecular Characterization and Regulation of the aguBA Operon, Responsible for Agmatine Utilization in Pseudomonas aeruginosa PAO1

PubMed Central

Nakada, Yuji; Jiang, Ying; Nishijyo, Takayuki; Itoh, Yoshifumi; Lu, Chung-Dar

2001-01-01

Pseudomonas aeruginosa PAO1 utilizes agmatine as the sole carbon and nitrogen source via two reactions catalyzed successively by agmatine deiminase (encoded by aguA; also called agmatine iminohydrolase) and N-carbamoylputrescine amidohydrolase (encoded by aguB). The aguBA and adjacent aguR genes were cloned and characterized. The predicted AguB protein (Mr 32,759; 292 amino acids) displayed sequence similarity (≤60% identity) to enzymes of the β-alanine synthase/nitrilase family. While the deduced AguA protein (Mr 41,190; 368 amino acids) showed no significant similarity to any protein of known function, assignment of agmatine deiminase to AguA in this report discovered a new family of carbon-nitrogen hydrolases widely distributed in organisms ranging from bacteria to Arabidopsis. The aguR gene encoded a putative regulatory protein (Mr 24,424; 221 amino acids) of the TetR protein family. Measurements of agmatine deiminase and N-carbamoylputrescine amidohydrolase activities indicated the induction effect of agmatine and N-carbamoylputrescine on expression of the aguBA operon. The presence of an inducible promoter for the aguBA operon in the aguR-aguB intergenic region was demonstrated by lacZ fusion experiments, and the transcription start of this promoter was localized 99 bp upstream from the initiation codon of aguB by S1 nuclease mapping. Experiments with knockout mutants of aguR established that expression of the aguBA operon became constitutive in the aguR background. Interaction of AguR overproduced in Escherichia coli with the aguBA regulatory region was demonstrated by gel retardation assays, supporting the hypothesis that AguR serves as the negative regulator of the aguBA operon, and binding of agmatine and N-carbamoylputrescine to AguR would antagonize its repressor function. PMID:11673419

Genetic and biochemical characterization of field-evolved resistance to Bacillus thuringiensis toxin Cry1Ac in the diamondback moth, Plutella xylostella.

PubMed

Sayyed, Ali H; Raymond, Ben; Ibiza-Palacios, M Sales; Escriche, Baltasar; Wright, Denis J

2004-12-01

The long-term usefulness of Bacillus thuringiensis Cry toxins, either in sprays or in transgenic crops, may be compromised by the evolution of resistance in target insects. Managing the evolution of resistance to B. thuringiensis toxins requires extensive knowledge about the mechanisms, genetics, and ecology of resistance genes. To date, laboratory-selected populations have provided information on the diverse genetics and mechanisms of resistance to B. thuringiensis, highly resistant field populations being rare. However, the selection pressures on field and laboratory populations are very different and may produce resistance genes with distinct characteristics. In order to better understand the genetics, biochemical mechanisms, and ecology of field-evolved resistance, a diamondback moth (Plutella xylostella) field population (Karak) which had been exposed to intensive spraying with B. thuringiensis subsp. kurstaki was collected from Malaysia. We detected a very high level of resistance to Cry1Ac; high levels of resistance to B. thuringiensis subsp. kurstaki Cry1Aa, Cry1Ab, and Cry1Fa; and a moderate level of resistance to Cry1Ca. The toxicity of Cry1Ja to the Karak population was not significantly different from that to a standard laboratory population (LAB-UK). Notable features of the Karak population were that field-selected resistance to B. thuringiensis subsp. kurstaki did not decline at all in unselected populations over 11 generations in laboratory microcosm experiments and that resistance to Cry1Ac declined only threefold over the same period. This finding may be due to a lack of fitness costs expressed by resistance strains, since such costs can be environmentally dependent and may not occur under ordinary laboratory culture conditions. Alternatively, resistance in the Karak population may have been near fixation, leading to a very slow increase in heterozygosity. Reciprocal genetic crosses between Karak and LAB-UK populations indicated that resistance was autosomal and recessive. At the highest dose of Cry1Ac tested, resistance was completely recessive, while at the lowest dose, it was incompletely dominant. A direct test of monogenic inheritance based on a backcross of F1 progeny with the Karak population suggested that resistance to Cry1Ac was controlled by a single locus. Binding studies with 125I-labeled Cry1Ab and Cry1Ac revealed greatly reduced binding to brush border membrane vesicles prepared from this field population.

Spodoptera frugiperda (J.E. Smith) with field-evolved resistance to Bt maize are susceptible to Bt pesticides.

PubMed

Jakka, S R K; Knight, V R; Jurat-Fuentes, J L

2014-10-01

Field-evolved resistance to maize event TC1507 expressing the Cry1Fa toxin from Bacillus thuringiensis (Bt) was detected in populations of Spodoptera frugiperda from Puerto Rico. We tested for cross-resistance to purified Cry1A toxins and commercial Bt pesticides in susceptible (Benzon) and TC1507-resistant (456) strains of S. frugiperda. Larvae from the 456 strain exhibited cross-resistance to Cry1Ab and Cry1Ac toxins, while no differences in susceptibility to XenTari WG and DiPel ES pesticides were detected. These data support cross-resistance to toxins that share binding sites with Cry1Fa and no cross-resistance to Bt pesticides in S. frugiperda with field-evolved resistance to Bt maize. Copyright © 2014 Elsevier Inc. All rights reserved.

The food and environmental safety of Bt crops.

PubMed

Koch, Michael S; Ward, Jason M; Levine, Steven L; Baum, James A; Vicini, John L; Hammond, Bruce G

2015-01-01

Bacillus thuringiensis (Bt) microbial pesticides have a 50-year history of safety in agriculture. Cry proteins are among the active insecticidal ingredients in these pesticides, and genes coding for Cry proteins have been introduced into agricultural crops using modern biotechnology. The Cry gene sequences are often modified to enable effective expression in planta and several Cry proteins have been modified to increase biological activity against the target pest(s). Additionally, the domains of different but structurally conserved Cry proteins can be combined to produce chimeric proteins with enhanced insecticidal properties. Environmental studies are performed and include invertebrates, mammals, and avian species. Mammalian studies used to support the food and feed safety assessment are also used to support the wild mammal assessment. In addition to the NTO assessment, the environmental assessment includes a comparative assessment between the Bt crop and the appropriate conventional control that is genetically similar but lacks the introduced trait to address unintended effects. Specific phenotypic, agronomic, and ecological characteristics are measured in the Bt crop and the conventional control to evaluate whether the introduction of the insect resistance has resulted in any changes that might cause ecological harm in terms of altered weed characteristics, susceptibility to pests, or adverse environmental impact. Additionally, environmental interaction data are collected in field experiments for Bt crop to evaluate potential adverse effects. Further to the agronomic and phenotypic evaluation, potential movement of transgenes from a genetically modified crop plants into wild relatives is assessed for a new pest resistance gene in a new crop. This review summarizes the evidence for safety of crops containing Cry proteins for humans, livestock, and other non-target organisms.

The food and environmental safety of Bt crops

PubMed Central

Koch, Michael S.; Ward, Jason M.; Levine, Steven L.; Baum, James A.; Vicini, John L.; Hammond, Bruce G.

2015-01-01

Bacillus thuringiensis (Bt) microbial pesticides have a 50-year history of safety in agriculture. Cry proteins are among the active insecticidal ingredients in these pesticides, and genes coding for Cry proteins have been introduced into agricultural crops using modern biotechnology. The Cry gene sequences are often modified to enable effective expression in planta and several Cry proteins have been modified to increase biological activity against the target pest(s). Additionally, the domains of different but structurally conserved Cry proteins can be combined to produce chimeric proteins with enhanced insecticidal properties. Environmental studies are performed and include invertebrates, mammals, and avian species. Mammalian studies used to support the food and feed safety assessment are also used to support the wild mammal assessment. In addition to the NTO assessment, the environmental assessment includes a comparative assessment between the Bt crop and the appropriate conventional control that is genetically similar but lacks the introduced trait to address unintended effects. Specific phenotypic, agronomic, and ecological characteristics are measured in the Bt crop and the conventional control to evaluate whether the introduction of the insect resistance has resulted in any changes that might cause ecological harm in terms of altered weed characteristics, susceptibility to pests, or adverse environmental impact. Additionally, environmental interaction data are collected in field experiments for Bt crop to evaluate potential adverse effects. Further to the agronomic and phenotypic evaluation, potential movement of transgenes from a genetically modified crop plants into wild relatives is assessed for a new pest resistance gene in a new crop. This review summarizes the evidence for safety of crops containing Cry proteins for humans, livestock, and other non-target organisms. PMID:25972882

Establishment of Cry9C susceptibility baselines for European corn borer and southwestern corn borer (Lepidoptera: Crambidae).

PubMed

Reed, J P; Halliday, W R

2001-04-01

In 1997 and 1998, Cry9C susceptibility baselines were established for field-collected populations of European corn borer, Osrinia nubilalis (Hubner), and southwestern corn borer, Diatraea grandiosella Dyar. Bioassay of neonate European corn borer larvae of 16 colonies collected from the midwestern United States indicated LC50 values ranging from 13.2 to 65.1 ng of Cry9C protein per square centimeter. Neonate European corn borer LC50 values ranged from 46.5 to 214 ng/cm2. Neonate larvae of three colonies of southwestern corn borer collected from the southern and southwestern United States exhibited LC50 values from 16.9 to 39.9 ng of Cry9C protein per square centimeter. Southwestern corn borer neonate LC90 confidence limit values ranged from 40.3 to 157 ng of Cry9C protein per centimeter. The most sensitive southwestern corn borer colony was collected from the Mississippi delta exhibiting an LC50 value of 22.6 ng of Cry9C per cm2 and also displayed the widest LC0 confidence limits of 40.3-94.8 ng of Cry9C per cm2. Geographic baseline susceptibility data establishes the natural genetic variation and provides the foundation for future testing of insect populations exposed to increased use of Bacillus thuringiensis-based crops. Insect resistance management and stewardship of Cry9C will rely upon baseline data for the validation of discriminating dose assays for European corn borer and southwestern corn borer.

Bt rice harbouring cry genes controlled by a constitutive or wound-inducible promoter: protection and transgene expression under Mediterranean field conditions.

PubMed

Breitler, Jean Christophe; Vassal, Jean Michel; del Mar Catala, Maria; Meynard, Donaldo; Marfà, Victoria; Melé, Enric; Royer, Monique; Murillo, Isabel; San Segundo, Blanca; Guiderdoni, Emmanuel; Messeguer, Joaquima

2004-09-01

Seven homozygous transgenic lines of two European commercial cultivars of rice (Ariete (A) and Senia (S)), harbouring the cry1B or cry1Aa Bacillus thuringiensis (Bt) delta-endotoxin genes, were field evaluated for protection from striped stem borer (SSB) (Chilo suppressalis) damage during the 2001 and 2002 summer crop seasons in the Delta de l'Ebre region, Spain. The plant codon-optimized toxin gene was placed under the control of the promoter of either the constitutive ubi1 gene or the wound-inducible mpi gene from maize. Stable, high-level, insecticidal protein accumulation was observed throughout root, leaf and seed tissues of field-grown plants harbouring the cry1B (lines A64.1, A33.1, A3.4 and S98.9) or cry1Aa (lines S05.1 and A19.14) genes under the control of the ubi1 promoter. Conversely, no toxin was detected in unwounded vegetative tissues of the A9.1 line harbouring the cry1B gene controlled by the mpi promoter, indicating that natural environmental stresses did not trigger the activity of the wound-inducible promoter. However, the toxin accumulated at 0.2% total soluble proteins in A9.1 sheath tissue exhibiting brown lesions resulting from SSB damage. The agronomical traits and performance of the transgenic lines were generally comparable with parental controls, except in the two lines accumulating Cry1Aa, which exhibited a high frequency of plants non-true to type. Natural infestation was assisted with manual infestations of L2/L3 SSB larvae in border control plants surrounding the experimental plots, which served as a reservoir for the second-cycle SSB population. The observation of damage (brown lesions and dead hearts) during the crop season and dissection of plants at harvest stage revealed a range of protection amongst the transgenic lines, which was highly consistent with the level of toxin accumulation and with previous experience in greenhouse assays. Lines A3.4 and S05.1 were found to exhibit stable and full protection against SSB attacks, mediated by the accumulation of Cry1B and Cry1Aa toxin, respectively, which was comparable with that afforded by the spraying of chemical insecticides on control plants. The wound-induced A9.1 line exhibited a satisfactory level of protection, with a notably low level of penetration of SSB larvae in the stems, but higher external symptoms than constitutive lines, probably due to the time lag to benefit from the protective effect of Cry1B.

Multi-Toxin Resistance Enables Pink Bollworm Survival on Pyramided Bt Cotton

PubMed Central

Fabrick, Jeffrey A.; Unnithan, Gopalan C.; Yelich, Alex J.; DeGain, Ben; Masson, Luke; Zhang, Jie; Carrière, Yves; Tabashnik, Bruce E.

2015-01-01

Transgenic crops producing Bacillus thuringiensis (Bt) proteins kill key insect pests, providing economic and environmental benefits. However, the evolution of pest resistance threatens the continued success of such Bt crops. To delay or counter resistance, transgenic plant “pyramids” producing two or more Bt proteins that kill the same pest have been adopted extensively. Field populations of the pink bollworm (Pectinophora gossypiella) in the United States have remained susceptible to Bt toxins Cry1Ac and Cry2Ab, but field-evolved practical resistance to Bt cotton producing Cry1Ac has occurred widely in India. Here we used two rounds of laboratory selection to achieve 18,000- to 150,000-fold resistance to Cry2Ab in pink bollworm. Inheritance of resistance to Cry2Ab was recessive, autosomal, conferred primarily by one locus, and independent of Cry1Ac resistance. We created a strain with high resistance to both toxins by crossing the Cry2Ab-resistant strain with a Cry1Ac-resistant strain, followed by one selection with Cry2Ab. This multi-toxin resistant strain survived on field-collected Bt cotton bolls producing both toxins. The results here demonstrate the risk of evolution of resistance to pyramided Bt plants, particularly when toxins are deployed sequentially and refuges are scarce, as seen with Bt cotton and pink bollworm in India. PMID:26559899

Enhanced toxicity of Bacillus thuringiensis Cry3A 8-endotoxin in coleopterans by mutagenesis in recetor binding loop

Treesearch

Sheng-Jiun Wu; Noah C. Koller; Deborah L. Miller; Leah S. Bauer; Donald H. Dean

2000-01-01

We used site-directed mutagenesis to modify the Bacillus cry3A gene in amino acid residues 350-354. Two mutant toxins, A1 (R345A, Y350F, Y351F) and A2 (R345A,DeltaY350, DeltaY351, showed significantly improved...

Effect of seed blends and soil-insecticide on western and northern corn rootworm emergence from mCry3A + eCry3.1Ab Bt maize

USDA-ARS?s Scientific Manuscript database

Blended seed mixtures containing various ratios of transgenic Bt maize expressing the mCry3A + eCry3.1Ab proteins and non-Bt maize (near-isoline maize) were deployed alone and in combination with a soil applied insecticide (Force CS) to evaluate the survivorship of the western corn rootworm, Diabrot...

Short-Term Evaluation in Growing Rats of Diet Containing Bacillus thuringiensis Cry1Ia12 Entomotoxin: Nutritional Responses and Some Safety Aspects

PubMed Central

Guimarães, Luciane Mourão; Farias, Davi Felipe; Muchagata, Relinda Campos Carvalho; de Magalhães, Mariana Quezado; Campello, Cláudio Cabral; Rocha, Thales Lima; Vasconcelos, Ilka Maria; Carvalho, Ana Fontenele Urano; Mulinari, Fernanda; Grossi-de-Sa, Maria Fátima

2010-01-01

The Cry1Ia12 entomotoxin from a Brazilian Bacillus thuringiensis strain is currently being expressed in cotton cultivars to confer resistance to insect-pests. The present study aimed to assess the effects of a diet containing Cry1Ia12 protein on growing rats. A test diet containing egg white and Cry1Ia12 (0.1% of total protein) as a protein source was offered to rats for ten days. In addition, an acute toxicity bioassay was performed in rats with a single oral dose of the entomotoxin (12 mg/animal). No adverse effects were observed in the animals receiving the test diet when compared to those receiving a control diet (egg white). The analysed parameters included relative dry weight of internal organs, duodenum histology, blood biochemistry, and nutritional parameters. The results of the acute toxicity test showed no mortality or behaviour alteration. Thus, Cry1Ia12 toxin at the tested concentration does not cause deleterious effects on growing rats when incorporated in the diet for 10 days. PMID:20862341

Characterization of the Activity Spectrum of MON 88702 and the Plant-Incorporated Protectant Cry51Aa2.834_16

PubMed Central

Ahmad, Aqeel; Ahrens, Jeffrey E.; Akbar, Waseem; Baum, James A.; Brown, Scott; Clark, Thomas L.; Fridley, Jennifer M.; Gowda, Anilkumar; Greenplate, John T.; Jensen, Peter D.; Mueller, Geoffrey M.; Odegaard, Matthew L.; Tan, Jianguo; Uffman, Joshua P.; Levine, Steven L.

2017-01-01

The spectrum of insecticidal activity of Cry51Aa2.834_16 protein targeting hemipteran and thysanopteran insect pests in cotton was characterized by selecting and screening multiple pest and non-pest species, based on representation of ecological functional groups, taxonomic relatedness (e.g. relationship to species where activity was observed), and availability for effective testing. Seven invertebrate orders, comprising 12 families and 17 representative species were screened for susceptibility to Cry51Aa2.834_16 protein and/or the ability of the protein to protect against feeding damage in laboratory, controlled environments (e.g. greenhouse/growth chamber), and/or field studies when present in cotton plants. The screening results presented for Cry51Aa2.834_16 demonstrate selective and limited activity within three insect orders. Other than Orius insidiosus, no activity was observed for Cry51Aa2.834_16 against several groups of arthropods that perform key ecological roles in some agricultural ecosystems (e.g. pollinators, decomposers, and natural enemies). PMID:28072875

A Point Mutation in the Rhesus Rotavirus VP4 Protein Generated through a Rotavirus Reverse Genetics System Attenuates Biliary Atresia in the Murine Model.

PubMed

Mohanty, Sujit K; Donnelly, Bryan; Dupree, Phylicia; Lobeck, Inna; Mowery, Sarah; Meller, Jaroslaw; McNeal, Monica; Tiao, Greg

2017-08-01

Rotavirus infection is one of the most common causes of diarrheal illness in humans. In neonatal mice, rhesus rotavirus (RRV) can induce biliary atresia (BA), a disease resulting in inflammatory obstruction of the extrahepatic biliary tract and intrahepatic bile ducts. We previously showed that the amino acid arginine (R) within the sequence SRL (amino acids 445 to 447) in the RRV VP4 protein is required for viral binding and entry into biliary epithelial cells. To determine if this single amino acid (R) influences the pathogenicity of the virus, we generated a recombinant virus with a single amino acid mutation at this site through a reverse genetics system. We demonstrated that the RRV mutant (RRV VP4-R446G ) produced less symptomatology and replicated to lower titers both in vivo and in vitro than those seen with wild-type RRV, with reduced binding in cholangiocytes. Our results demonstrate that a single amino acid change in the RRV VP4 gene influences cholangiocyte tropism and reduces pathogenicity in mice. IMPORTANCE Rotavirus is the leading cause of diarrhea in humans. Rhesus rotavirus (RRV) can also lead to biliary atresia (a neonatal human disease) in mice. We developed a reverse genetics system to create a mutant of RRV (RRV VP4-R446G ) with a single amino acid change in the VP4 protein compared to that of wild-type RRV. In vitro , the mutant virus had reduced binding and infectivity in cholangiocytes. In vivo , it produced fewer symptoms and lower mortality in neonatal mice, resulting in an attenuated form of biliary atresia. Copyright © 2017 American Society for Microbiology.

Safety and long-term immunological effects of CryJ2-LAMP plasmid vaccine in Japanese red cedar atopic subjects: A phase I study.

PubMed

Su, Yan; Romeu-Bonilla, Eliezer; Anagnostou, Athanasia; Fitz-Patrick, David; Hearl, William; Heiland, Teri

2017-12-02

Japanese Red Cedar (JRC) pollen induced allergy affects one third of Japanese and the development of effective therapies remains an unachieved challenge. We designed a DNA vaccine encoding CryJ2 allergen from the JRC pollen and Lysosomal Associated Membrane Protein 1 (LAMP-1) to treat JRC allergy. These Phase IA and IB trials assessed safety and immunological effects of the investigational CryJ2-LAMP DNA vaccine in both non-sensitive and sensitive Japanese expatriates living in Honolulu, Hawaii. In the Phase IA trial, 6 JRC non-sensitive subjects and 9 JRC and/or Mountain Cedar (MC) sensitive subjects were given 4 vaccine doses (each 4mg/1ml) intramuscularly (IM) at 14-day intervals. Nine JRC and/or MC sensitive subjects were given 4 doses (2 mg/0.5 ml) IM at 14-day intervals. The safety and functional biomarkers were followed for 132 d. Following this, 17 of 24 subjects were recruited into the IB trial and received one booster dose (2 mg/0.5 ml) IM approximately 300 d after the first vaccination dose to which they were randomized in the first phase of the trial. All safety endpoints were met and all subjects tolerated CryJ2-LAMP vaccinations well. At the end of the IA trial, 10 out of 12 JRC sensitive and 6 out of 11 MC sensitive subjects experienced skin test negative conversion, possibly related to the CryJ2-LAMP vaccinations. Collectively, these data suggested that the CryJ2-LAMP DNA vaccine is safe and may be immunologically effective in treating JRC induced allergy.

Concentrated Protein Body Product Derived from Rice Endosperm as an Oral Tolerogen for Allergen-Specific Immunotherapy—A New Mucosal Vaccine Formulation against Japanese Cedar Pollen Allergy

PubMed Central

Wakasa, Yuhya; Takagi, Hidenori; Watanabe, Nobumasa; Kitamura, Noriko; Fujiwara, Yoshihiro; Ogo, Yuko; Hayashi, Shimpei; Yang, Lijun; Ohta, Masaru; Thet Tin, Wai Wai; Sekikawa, Kenji; Takano, Makoto; Ozawa, Kenjirou; Hiroi, Takachika; Takaiwa, Fumio

2015-01-01

The endoplasmic reticulum-derived type-I protein body (PB-I) from rice endosperm cells is an ideal candidate formulation for the oral delivery of bioencapsulated peptides as tolerogens for allergen-specific immunotherapy. In the present study, PBs containing the deconstructed Japanese cedar pollen allergens Cryptomeria japonica 1 (Cry j 1) and Cry j 2 were concentrated by treatment with thermostable α-amylase at 90°C to remove the starch from milled rice powder, which resulted in a 12.5-fold reduction of dry weight compared to the starting material. The modified Cry j 1 and Cry j 2 antigens in this concentrated PB product were more resistant to enzymatic digestion than those in the milled seed powder despite the absence of intact cell wall and starch, and remained stable for at least 10 months at room temperature without detectable loss or degradation. The high resistance of these allergens could be attributed to changes in protein physicochemical properties induced by the high temperature concentration process, as suggested by the decreased solubility of the antigens and seed proteins in PBs in step-wise-extraction experiments. Confocal microscopy showed that the morphology of antigen-containing PB-Is was preserved in the concentrated PB product. The concentrated PB product induced specific immune tolerance against Cry j 1 and Cry j 2 in mice when orally administered, supporting its potential use as a novel oral tolerogen formulation. PMID:25774686

Serum Mac-2 binding protein glycosylation isomer predicts grade F4 liver fibrosis in patients with biliary atresia.

PubMed

Yamada, Naoya; Sanada, Yukihiro; Tashiro, Masahisa; Hirata, Yuta; Okada, Noriki; Ihara, Yoshiyuki; Urahashi, Taizen; Mizuta, Koichi

2017-02-01

Mac-2 Binding Protein Glycosylation Isomer (M2BPGi) is a novel fibrosis marker. We examined the ability of M2BPGi to predict liver fibrosis in patients with biliary atresia. Sixty-four patients who underwent living donor liver transplantation (LDLT) were included [median age, 1.1 years (range 0.4-16.0), male 16 patients (25.0 %)]. We examined M2BPGi levels in serum obtained the day before LDLT, and we compared the value of the preoperative M2BPGi levels with the histological evaluation of fibrosis using the METAVIR fibrosis score. Subsequently, we assessed the ability of M2BPGi levels to predict fibrosis. The median M2BPGi level in patients with BA was 6.02 (range, 0.36-20.0), and 0, 1, 1, 11, and 51 patients had METAVIR fibrosis scores of F0, F1, F2, F3, and F4, respectively. In patients with F4 fibrosis, the median M2BPGi level was 6.88 (quartile; 5.235, 12.10), significantly higher than that in patients with F3 fibrosis who had a median level of 2.42 (quartile; 1.93, 2.895, p < 0.01). Area under the curve analysis for the ability of M2BPGi level to predict grade fibrosis was 0.917, with a specificity and sensitivity of 0.923 and 0.941, respectively. In comparison with other fibrosis markers such as hyaluronic acid, procollagen-III-peptide, type IV collagen 7 s, and aspartate aminotransferase platelet ratio index, M2BPGi showed the strongest ability to predict grade F4 fibrosis. M2BPGi is a novel fibrosis marker for evaluating the status of the liver in patients with BA, especially when predicting grade F4 fibrosis.

Isolation of a peptide from Ph.D.-C7C phage display library for detection of Cry1Ab.

PubMed

Wang, Yun; Wang, Qian; Wu, Ai-Hua; Hao, Zhen-Ping; Liu, Xian-Jin

2017-12-15

Traditional ELISA methods of using animal immunity yield antibodies for detection Cry toxin. Not only is this incredibly harmful to the animals, but is also time-intensive. Here we developed a simple method to yield the recognition element. Using a critical selection strategy and immunoassay we confirmed a clone from the Ph.D-C7C phage library, which has displayed the most interesting Cry1Ab-binding characteristics examined in this study (Fig. 1). The current study indicates that isolating peptide is an alternative method for the preparation of a recognition element, and that the developed assay is a potentially useful tool for detecting Cry1Ab. Copyright © 2017. Published by Elsevier Inc.

Characterization of a hybridoma-derived T cell factor that promotes the production of antibodies bearing a dominant cross-reactive idiotype(s).

PubMed

Wardzala, A M; Bowen, M B; Jendrisak, G S; Bellone, C J

1986-01-01

The participation of postulated subsets of T helper cells in antigen-specific antibody responses has generated both interest and controversy among immunologists. Specifically the import as well as the very existence of multiple populations of T helper cells has led to an intense search in recent years for cloned lines of such subsets that permit unambiguous classification and study. Furthermore, the means by which some of these T cells induce antibody responses may be via the elaboration of soluble factors mandating their characterization both biochemically and mechanistically. We have recently reported the existence of a T helper factor present in a 24-h Con A supernatant that specifically enhances an idiotype-bearing (Id+) response to trinitrophenol (TNP). The unique biochemical properties of this substance, namely, its capacity to bind both antigen and cross-reactive idiotype (CRI), has led to the generation of a cloned T cell hybridoma that constitutively "secretes" a factor which appears identical to the helper activity in Con A Sn. The cloned T cell hybridoma, herein designated LOP 1.4, elaborates a factor which selectively enhances the CRI+ anti-TNP antibody response in vitro. The specificity of the assay employed as well as its sensitivity for detecting significant enhancement of the percent CRI+ anti-TNP PFC response lent itself well as a useful vehicle for subsequent characterization of the factor. The LOP 1.4 factor, which can act at the later stages of the B cell response in a dose-dependent fashion, was characterized by affinity chromatography in order to probe the mechanism of its selective Id enhancement. The factor binds both the idiotype and the ligand for which one of the idiotype-bearing monoclonal antibodies is specific. That the factor binds idiotype and can be eluted selectively with ligand but not with noncross-reacting ligand suggests that the factor possesses separate but not independent binding sites, or alternatively, a single binding site that preferentially binds to a unique composite of antigen-idiotype. In addition, the factor bears I-J determinants, consistent with what we have previously detected on the surface of TH2-like cells. These results, collectively, suggest that the T cell hybridoma LOP 1.4 is a TH2-like cell (supporting the concept of multiple TH subsets) in light of its ability to enhance an idiotypic response to specific antigen through the production of a soluble factor that demonstrates affinity for both antigen and idiotype. In addition, like the I-J+ TH2 cell, the LOP 1.4 factor also bears I-J region determinants.(ABSTRACT TRUNCATED AT 400 WORDS)

Soil incubation studies with Cry1Ac protein indicate no adverse effect of Bt crops on soil microbial communities.

PubMed

Zhaolei, Li; Naishun, Bu; Xueping, Chen; Jun, Cui; Manqiu, Xiao; Zhiping, Song; Ming, Nie; Changming, Fang

2018-05-15

Bt crops that are transgenic crops engineered to produce Bt toxins which occur naturally with Bacillus thuringiensis (Bt) have been widely planted and its environmental risk assessment has been heavily debated. The effects of Bt crops on soil microbial communities are possible through changing the quantity and quality of C inputs and potential toxic activity of Bt protein on soil organisms. To date, the direct effects of Bt protein on soil microorganisms is unclear. Here we added Cry1Ac, one of the most commonly used Bt protein in Bt crops, to the soil and monitored changes in soil bacterial, fungal and archaeal diversities and community structures using ribosomal DNA-fingerprinting method, as well as their population sizes by real-time PCR over a 100-day period. Despite the fact that variations were observed in the indices of evenness, diversity and population sizes of bacteria, fungi and archaea with different Cry1Ac addition rates up to 100ngg -1 soil, the indices of soil microbial diversities and evennesses did not significantly shift with Cry1Ac protein addition, nor did population sizes change over time. The diversities of the dominant bacteria, fungi and archaea were not significantly changed, given Cry1Ac protein addition rates over a period of 100 days. These results suggested that Bt protein derived by cultivations of transgenic Bt crops is unlikely to cause transient or even persisting significant changes in soil microorganisms in field. Copyright © 2017 Elsevier Inc. All rights reserved.

A review of Cry protein detection with enzyme-linked immunosorbent assays

USDA-ARS?s Scientific Manuscript database

Several detection methods are available to monitor the fate of Cry proteins in the environment, enzyme-linked immunosorbent assays (ELISAs) have emerged as the preferred detection method, due to their cost-effectiveness, ease of use, and rapid results. Validation of ELISAs is necessary to ensure acc...

Efficacy of Genetically Modified Bt Toxins Alone and in Combinations Against Pink Bollworm Resistant to Cry1Ac and Cry2Ab

PubMed Central

Tabashnik, Bruce E.; Fabrick, Jeffrey A.; Unnithan, Gopalan C.; Yelich, Alex J.; Masson, Luke; Zhang, Jie; Bravo, Alejandra; Soberón, Mario

2013-01-01

Evolution of resistance in pests threatens the long-term efficacy of insecticidal proteins from Bacillus thuringiensis (Bt) used in sprays and transgenic crops. Previous work showed that genetically modified Bt toxins Cry1AbMod and Cry1AcMod effectively countered resistance to native Bt toxins Cry1Ab and Cry1Ac in some pests, including pink bollworm (Pectinophora gossypiella). Here we report that Cry1AbMod and Cry1AcMod were also effective against a laboratory-selected strain of pink bollworm resistant to Cry2Ab as well as to Cry1Ab and Cry1Ac. Resistance ratios based on the concentration of toxin killing 50% of larvae for the resistant strain relative to a susceptible strain were 210 for Cry2Ab, 270 for Cry1Ab, and 310 for Cry1Ac, but only 1.6 for Cry1AbMod and 2.1 for Cry1AcMod. To evaluate the interactions among toxins, we tested combinations of Cry1AbMod, Cry1Ac, and Cry2Ab. For both the resistant and susceptible strains, the net results across all concentrations tested showed slight but significant synergism between Cry1AbMod and Cry2Ab, whereas the other combinations of toxins did not show consistent synergism or antagonism. The results suggest that the modified toxins might be useful for controlling populations of pink bollworm resistant to Cry1Ac, Cry2Ab, or both. PMID:24244692

An ultrasensitive label-free electrochemiluminescent immunosensor for measuring Cry1Ab level and genetically modified crops content.

PubMed

Gao, Hongfei; Wen, Luke; Wu, Yuhua; Fu, Zhifeng; Wu, Gang

2017-11-15

The development of genetically modified (GM) insect-resistant crops has aroused great public concern about the risks on the eco-environment resulting from a release of toxic Cry proteins (such as Cry1Ab) to the soil. Therefore, it is of crucial importance to measure the Cry proteins level and the GM crops content. Here, we have tested for the first time a method that uses novel carbon nanospheres (CNPs) label-free electrochemiluminescent (ECL) immunosensor for the ultrasensitive quantification of Cry1Ab and GM crops. In this work, novel CNPs were prepared from printer toner with a very facile approach, and linked with anti-Cry1Ab antibodies to modify a golden working electrode. The immunoreaction between Cry1Ab and its antibody formed an immunocomplex on the bioreceptor region of the sensor, which inhibited electron transfer between the electrode surface and the ECL substance, leading to a decrease of ECL response. Under the optimal conditions, the fabricated label-free ECL immunosensor determined Cry1Ab down to 3.0pgmL -1 within a linear range of 0.010-1.0ngmL -1 , showing significant improvement of sensitivity than that of most previous reports. Meanwhile, the proposed method was successfully applied for GM rice BT63 and GM maize MON810 detections down to 0.010% and 0.020%, respectively. Due to its outstanding advantages such as high sensitivity, ideal selectivity, simple fabrication, rapid detection, and low cost, the developed method can be considered as a powerful and pioneering tool for GM crops detection. Its use can also be extended to other toxin protein sensing in foods. Copyright © 2017. Published by Elsevier B.V.

Biochemical and redox characterization of the mediator complex and its associated transcription factor GeBPL, a GLABROUS1 enhancer binding protein.

PubMed

Shaikhali, Jehad; Davoine, Céline; Brännström, Kristoffer; Rouhier, Nicolas; Bygdell, Joakim; Björklund, Stefan; Wingsle, Gunnar

2015-06-15

The eukaryotic mediator integrates regulatory signals from promoter-bound transcription factors (TFs) and transmits them to RNA polymerase II (Pol II) machinery. Although redox signalling is important in adjusting plant metabolism and development, nothing is known about a possible redox regulation of mediator. In the present study, using pull-down and yeast two-hybrid assays, we demonstrate the association of mediator (MED) subunits MED10a, MED28 and MED32 with the GLABROUS1 (GL1) enhancer-binding protein-like (GeBPL), a plant-specific TF that binds a promoter containing cryptochrome 1 response element 2 (CryR2) element. All the corresponding recombinant proteins form various types of covalent oligomers linked by intermolecular disulfide bonds that are reduced in vitro by the thioredoxin (TRX) and/or glutathione/glutaredoxin (GRX) systems. The presence of recombinant MED10a, MED28 and MED32 subunits or changes of its redox state affect the DNA-binding capacity of GeBPL suggesting that redox-driven conformational changes might modulate its activity. Overall, these results advance our understanding of how redox signalling affects transcription and identify mediator as a novel actor in redox signalling pathways, relaying or integrating redox changes in combination with specific TFs as GeBPL. © The Authors Journal compilation © 2015 Biochemical Society.

F2 screen for resistance to Bacillus thuringiensis Cry2Ab2-maize in field populations of Spodoptera frugiperda (Lepidoptera: Noctuidae) from the southern United States.

PubMed

Niu, Ying; Qureshi, Jawwad A; Ni, Xinzhi; Head, Graham P; Price, Paula A; Meagher, Robert L; Kerns, David; Levy, Ronnie; Yang, Xiangbing; Huang, Fangneng

2016-07-01

The fall armyworm, Spodoptera frugiperda (J. E. Smith) (Lepidoptera: Noctuidae), is a target pest of transgenic maize and cotton expressing Bacillus thuringiensis (Bt) proteins in both North and South America. In 2013 and 2014, a total of 215 F2 two-parent families of S. frugiperda were established using single-pair mating of field individuals collected from seven locations in four states of the southern U.S.: Texas, Louisiana, Georgia, and Florida. The objective of the investigation was to detect resistance alleles in field populations to Cry2Ab2, a common Bt protein produced in transgenic maize and cotton. For each F2 family, 128 F2 neonates were screened on leaf tissue of Cry2Ab2 maize plants in the laboratory. A conservative estimate of the frequency of major Cry2Ab2 resistance alleles in S. frugiperda from the four states was 0.0023 with a 95% credibility interval of 0.0003-0.0064. In addition, six families were considered to likely possess minor resistance alleles at a frequency of 0.0082 with a 95% credibility interval of 0.0033-0.0152. One F2 family from Georgia (GA-15) was confirmed to possess a major resistance allele to the Cry2Ab2 protein. Larvae from this family survived well on whole maize plants expressing Cry2Ab2 protein and demonstrated a significant level (>15-fold) of resistance when fed with the same protein incorporated in a meridic diet. The detection of the major resistance allele along with the relatively abundant minor resistance alleles revealed in this study may have important implications for resistance management. Copyright © 2016 Elsevier Inc. All rights reserved.

Non Target Effect of Cry1 Ab and Cry Ab x Cry3 Bb1 Bt Transgenic Maize on Orius Insidiosus (Hemiptera: Anthocoridae) Abundance

USDA-ARS?s Scientific Manuscript database

Non-target effects of Cry1Ab x CP4 EPSPS and Cry1Ab + Cry3Bb1 x CP4 EPSPS Bt transgenic new maize hybrids on insidious flower bugs [Orius insidiosus (Say)] was studied in Nebraska (Mead, C lay Center, and Concord) during 2007 and 2008. The Bt effect was compared to CP4 EPSPS maize (isoline), convent...

Cry3Bb1-Resistant Western Corn Rootworm, Diabrotica virgifera virgifera (LeConte) Does Not Exhibit Cross-Resistance to DvSnf7 dsRNA.

PubMed

Moar, William; Khajuria, Chitvan; Pleau, Michael; Ilagan, Oliver; Chen, Mao; Jiang, Changjian; Price, Paula; McNulty, Brian; Clark, Thomas; Head, Graham

2017-01-01

There is a continuing need to express new insect control compounds in transgenic maize against western corn rootworm, Diabrotica virgifera virgifera (LeConte) (WCR). In this study three experiments were conducted to determine cross-resistance between the new insecticidal DvSnf7 dsRNA, and Bacillus thuringiensis (Bt) Cry3Bb1; used to control WCR since 2003, with field-evolved resistance being reported. Laboratory susceptible and Cry3Bb1-resistant WCR were evaluated against DvSnf7 dsRNA in larval diet-incorporation bioassays. Additionally, the susceptibility of seven field and one field-derived WCR populations to DvSnf7 (and Cry3Bb1) was assessed in larval diet-overlay bioassays. Finally, beetle emergence of laboratory susceptible and Cry3Bb1-resistant WCR was evaluated with maize plants in the greenhouse expressing Cry3Bb1, Cry34Ab1/Cry35Ab1, or DvSnf7 dsRNA singly, or in combination. The Cry3Bb1-resistant colony had slight but significantly (2.7-fold; P<0.05) decreased susceptibility to DvSnf7 compared to the susceptible colony, but when repeated using a field-derived WCR population selected for reduced Cry3Bb1 susceptibility, there was no significant difference (P<0.05) in DvSnf7 susceptibility compared to that same susceptible population. Additionally, this 2.7-fold difference in susceptibility falls within the range of DvSnf7 susceptibility among the seven field populations tested. Additionally, there was no correlation between susceptibility to DvSnf7 and Cry3Bb1 for all populations evaluated. In greenhouse studies, there were no significant differences (P<0.05) between beetle emergence of susceptible and Cry3Bb1-resistant colonies on DvSnf7 and Cry34Ab1/Cry35Ab1, and between DvSnf7 and MON 87411 (DvSnf7 + Cry3Bb1) for the Cry3Bb1-resistant colony. These results demonstrate no cross-resistance between DvSnf7 and Cry3Bb1 against WCR. Therefore, pyramiding DvSnf7 with Bt proteins such as Cry3Bb1 and Cry34Ab1/Cry35Ab1 will provide a valuable IRM tool against WCR that will increase the durability of these Bt proteins. These results also illustrate the importance of using appropriate bioassay methods when characterizing field-evolved resistant WCR populations.

Cry3Bb1-Resistant Western Corn Rootworm, Diabrotica virgifera virgifera (LeConte) Does Not Exhibit Cross-Resistance to DvSnf7 dsRNA

PubMed Central

Khajuria, Chitvan; Pleau, Michael; Ilagan, Oliver; Chen, Mao; Jiang, Changjian; Price, Paula; McNulty, Brian; Clark, Thomas; Head, Graham

2017-01-01

Background and Methodology There is a continuing need to express new insect control compounds in transgenic maize against western corn rootworm, Diabrotica virgifera virgifera (LeConte) (WCR). In this study three experiments were conducted to determine cross-resistance between the new insecticidal DvSnf7 dsRNA, and Bacillus thuringiensis (Bt) Cry3Bb1; used to control WCR since 2003, with field-evolved resistance being reported. Laboratory susceptible and Cry3Bb1-resistant WCR were evaluated against DvSnf7 dsRNA in larval diet-incorporation bioassays. Additionally, the susceptibility of seven field and one field-derived WCR populations to DvSnf7 (and Cry3Bb1) was assessed in larval diet-overlay bioassays. Finally, beetle emergence of laboratory susceptible and Cry3Bb1-resistant WCR was evaluated with maize plants in the greenhouse expressing Cry3Bb1, Cry34Ab1/Cry35Ab1, or DvSnf7 dsRNA singly, or in combination. Principal Findings and Conclusions The Cry3Bb1-resistant colony had slight but significantly (2.7-fold; P<0.05) decreased susceptibility to DvSnf7 compared to the susceptible colony, but when repeated using a field-derived WCR population selected for reduced Cry3Bb1 susceptibility, there was no significant difference (P<0.05) in DvSnf7 susceptibility compared to that same susceptible population. Additionally, this 2.7-fold difference in susceptibility falls within the range of DvSnf7 susceptibility among the seven field populations tested. Additionally, there was no correlation between susceptibility to DvSnf7 and Cry3Bb1 for all populations evaluated. In greenhouse studies, there were no significant differences (P<0.05) between beetle emergence of susceptible and Cry3Bb1-resistant colonies on DvSnf7 and Cry34Ab1/Cry35Ab1, and between DvSnf7 and MON 87411 (DvSnf7 + Cry3Bb1) for the Cry3Bb1-resistant colony. These results demonstrate no cross-resistance between DvSnf7 and Cry3Bb1 against WCR. Therefore, pyramiding DvSnf7 with Bt proteins such as Cry3Bb1 and Cry34Ab1/Cry35Ab1 will provide a valuable IRM tool against WCR that will increase the durability of these Bt proteins. These results also illustrate the importance of using appropriate bioassay methods when characterizing field-evolved resistant WCR populations. PMID:28060922

The Two Cryptochrome/Photolyase Family Proteins Fulfill Distinct Roles in DNA Photorepair and Regulation of Conidiation in the Gray Mold Fungus Botrytis cinerea

PubMed Central

Cohrs, Kim C.

2017-01-01

ABSTRACT The plant-pathogenic leotiomycete Botrytis cinerea is known for the strict regulation of its asexual differentiation programs by environmental light conditions. Sclerotia are formed in constant darkness; black/near-UV (NUV) light induces conidiation; and blue light represses both differentiation programs. Sensing of black/NUV light is attributed to proteins of the cryptochrome/photolyase family (CPF). To elucidate the molecular basis of the photoinduction of conidiation, we functionally characterized the two CPF proteins encoded in the genome of B. cinerea as putative positive-acting components. B. cinerea CRY1 (BcCRY1), a cyclobutane pyrimidine dimer (CPD) photolyase, acts as the major enzyme of light-driven DNA repair (photoreactivation) and has no obvious role in signaling. In contrast, BcCRY2, belonging to the cry-DASH proteins, is dispensable for photorepair but performs regulatory functions by repressing conidiation in white and especially black/NUV light. The transcription of bccry1 and bccry2 is induced by light in a White Collar complex (WCC)-dependent manner, but neither light nor the WCC is essential for the repression of conidiation through BcCRY2 when bccry2 is constitutively expressed. Further, BcCRY2 affects the transcript levels of both WCC-induced and WCC-repressed genes, suggesting a signaling function downstream of the WCC. Since both CPF proteins are dispensable for photoinduction by black/NUV light, the origin of this effect remains elusive and may be connected to a yet unknown UV-light-responsive system. IMPORTANCE Botrytis cinerea is an economically important plant pathogen that causes gray mold diseases in a wide variety of plant species, including high-value crops and ornamental flowers. The spread of disease in the field relies on the formation of conidia, a process that is regulated by different light qualities. While this feature has been known for a long time, we are just starting to understand the underlying molecular mechanisms. Conidiation in B. cinerea is induced by black/near-UV light, whose sensing is attributed to the action of cryptochrome/photolyase family (CPF) proteins. Here we report on the distinct functions of two CPF proteins in the photoresponse of B. cinerea. While BcCRY1 acts as the major photolyase in photoprotection, BcCRY2 acts as a cryptochrome with a signaling function in regulating photomorphogenesis (repression of conidiation). PMID:28667107

Improving Cry8Ka toxin activity towards the cotton boll weevil (Anthonomus grandis).

PubMed

Oliveira, Gustavo R; Silva, Maria C M; Lucena, Wagner A; Nakasu, Erich Y T; Firmino, Alexandre A P; Beneventi, Magda A; Souza, Djair S L; Gomes, José E; de Souza, José D A; Rigden, Daniel J; Ramos, Hudson B; Soccol, Carlos R; Grossi-de-Sa, Maria F

2011-09-09

The cotton boll weevil (Anthonomus grandis) is a serious insect-pest in the Americas, particularly in Brazil. The use of chemical or biological insect control is not effective against the cotton boll weevil because of its endophytic life style. Therefore, the use of biotechnological tools to produce insect-resistant transgenic plants represents an important strategy to reduce the damage to cotton plants caused by the boll weevil. The present study focuses on the identification of novel molecules that show improved toxicity against the cotton boll weevil. In vitro directed molecular evolution through DNA shuffling and phage display screening was applied to enhance the insecticidal activity of variants of the Cry8Ka1 protein of Bacillus thuringiensis. Bioassays carried out with A. grandis larvae revealed that the LC50 of the screened mutant Cry8Ka5 toxin was 3.15-fold higher than the wild-type Cry8Ka1 toxin. Homology modelling of Cry8Ka1 and the Cry8Ka5 mutant suggested that both proteins retained the typical three-domain Cry family structure. The mutated residues were located mostly in loops and appeared unlikely to interfere with molecular stability. The improved toxicity of the Cry8Ka5 mutant obtained in this study will allow the generation of a transgenic cotton event with improved potential to control A. grandis.

Improving Cry8Ka toxin activity towards the cotton boll weevil (Anthonomus grandis)

PubMed Central

2011-01-01

Background The cotton boll weevil (Anthonomus grandis) is a serious insect-pest in the Americas, particularly in Brazil. The use of chemical or biological insect control is not effective against the cotton boll weevil because of its endophytic life style. Therefore, the use of biotechnological tools to produce insect-resistant transgenic plants represents an important strategy to reduce the damage to cotton plants caused by the boll weevil. The present study focuses on the identification of novel molecules that show improved toxicity against the cotton boll weevil. In vitro directed molecular evolution through DNA shuffling and phage display screening was applied to enhance the insecticidal activity of variants of the Cry8Ka1 protein of Bacillus thuringiensis. Results Bioassays carried out with A. grandis larvae revealed that the LC50 of the screened mutant Cry8Ka5 toxin was 3.15-fold higher than the wild-type Cry8Ka1 toxin. Homology modelling of Cry8Ka1 and the Cry8Ka5 mutant suggested that both proteins retained the typical three-domain Cry family structure. The mutated residues were located mostly in loops and appeared unlikely to interfere with molecular stability. Conclusions The improved toxicity of the Cry8Ka5 mutant obtained in this study will allow the generation of a transgenic cotton event with improved potential to control A. grandis. PMID:21906288

Betulinic acid inhibits colon cancer cell and tumor growth and induces proteasome-dependent and -independent downregulation of specificity proteins (Sp) transcription factors

PubMed Central

2011-01-01

Background Betulinic acid (BA) inhibits growth of several cancer cell lines and tumors and the effects of BA have been attributed to its mitochondriotoxicity and inhibition of multiple pro-oncogenic factors. Previous studies show that BA induces proteasome-dependent degradation of specificity protein (Sp) transcription factors Sp1, Sp3 and Sp4 in prostate cancer cells and this study focused on the mechanism of action of BA in colon cancer cells. Methods The effects of BA on colon cancer cell proliferation and apoptosis and tumor growth in vivo were determined using standardized assays. The effects of BA on Sp proteins and Sp-regulated gene products were analyzed by western blots, and real time PCR was used to determine microRNA-27a (miR-27a) and ZBTB10 mRNA expression. Results BA inhibited growth and induced apoptosis in RKO and SW480 colon cancer cells and inhibited tumor growth in athymic nude mice bearing RKO cells as xenograft. BA also decreased expression of Sp1, Sp3 and Sp4 transcription factors which are overexpressed in colon cancer cells and decreased levels of several Sp-regulated genes including survivin, vascular endothelial growth factor, p65 sub-unit of NFκB, epidermal growth factor receptor, cyclin D1, and pituitary tumor transforming gene-1. The mechanism of action of BA was dependent on cell context, since BA induced proteasome-dependent and proteasome-independent downregulation of Sp1, Sp3 and Sp4 in SW480 and RKO cells, respectively. In RKO cells, the mechanism of BA-induced repression of Sp1, Sp3 and Sp4 was due to induction of reactive oxygen species (ROS), ROS-mediated repression of microRNA-27a, and induction of the Sp repressor gene ZBTB10. Conclusions These results suggest that the anticancer activity of BA in colon cancer cells is due, in part, to downregulation of Sp1, Sp3 and Sp4 transcription factors; however, the mechanism of this response is cell context-dependent. PMID:21864401

Pollen contamination in seed mixture increases the dominance of resistance to Bt maize in Spodoptera frugiperda (Lepidoptera: Noctuidae).

PubMed

Yang, Fei; Kerns, David L; Brown, Sebe; Head, Graham P; Huang, Fangneng

2017-11-01

Seed mixture, also called 'RIB', has been used to provide refuge populations for delaying insect resistance. Pollen contamination in RIB could result in refuge kernels of non-Bt maize expressing variable Bt proteins. Data are lacking regarding the impact of pollen contamination on evolution of resistance for ear-feeding insects. Here, we used Spodoptera frugiperda and Cry1F-maize as a model to examine if pollen contamination in RIB increases the dominance of insect resistance. Pollen contamination caused >66% refuge kernels in 5:95% (non-Bt:Bt) and 20:80% RIBs to express Cry1F protein. Survival at adult stage on pure non-Bt ears was similar (54.4-63.3%) among Cry1F-susceptible (SS), Cry1F-resistant (RR) and Cry1F-heterozygous (RS) S. frugiperda. On Bt ears, survival was similar between SS and RS (0.0-1.7%), but it was significantly less than that of RR (59.2%). On the two RIB refuge ears, survival at adult stage for RS (42.3% in 5:95% RIB; 50.0% in 20:80% RIB) was significantly higher than for SS (8.7% in 5:95% RIB; 10.0% in 20:80% RIB). The results suggest that pollen contamination in RIB could increase the dominance of resistance for ear-feeding insects by significantly reducing susceptible refuge populations and supporting higher survival of heterozygotes relative to homozygous susceptible insects. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

Bacillus anthracis TIR Domain-Containing Protein Localises to Cellular Microtubule Structures and Induces Autophagy.

PubMed

Carlsson, Emil; Thwaite, Joanne E; Jenner, Dominic C; Spear, Abigail M; Flick-Smith, Helen; Atkins, Helen S; Byrne, Bernadette; Ding, Jeak Ling

2016-01-01

Toll-like receptors (TLRs) recognise invading pathogens and mediate downstream immune signalling via Toll/IL-1 receptor (TIR) domains. TIR domain proteins (Tdps) have been identified in multiple pathogenic bacteria and have recently been implicated as negative regulators of host innate immune activation. A Tdp has been identified in Bacillus anthracis, the causative agent of anthrax. Here we present the first study of this protein, designated BaTdp. Recombinantly expressed and purified BaTdp TIR domain interacted with several human TIR domains, including that of the key TLR adaptor MyD88, although BaTdp expression in cultured HEK293 cells had no effect on TLR4- or TLR2- mediated immune activation. During expression in mammalian cells, BaTdp localised to microtubular networks and caused an increase in lipidated cytosolic microtubule-associated protein 1A/1B-light chain 3 (LC3), indicative of autophagosome formation. In vivo intra-nasal infection experiments in mice showed that a BaTdp knockout strain colonised host tissue faster with higher bacterial load within 4 days post-infection compared to the wild type B. anthracis. Taken together, these findings indicate that BaTdp does not play an immune suppressive role, but rather, its absence increases virulence. BaTdp present in wild type B. anthracis plausibly interact with the infected host cell, which undergoes autophagy in self-defence.

Soluble Prokaryotic Expression and Purification of Bioactive Tumor Necrosis Factor-Related Apoptosis-Inducing Ligand.

PubMed

Do, Bich Hang; Nguyen, Minh Tan; Song, Jung-A; Park, Sangsu; Yoo, Jiwon; Jang, Jaepyeong; Lee, Sunju; So, Seoungjun; Yoon, Yejin; Kim, Inki; Lee, Kyungjin; Jang, Yeon Jin; Choe, Han

2017-12-28

Tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) is considered as an antitumor agent owing to its ability to induce apoptosis of cancer cells without imparting toxicity toward most normal cells. TRAIL is produced in poor yield because of its insoluble expression in the cytoplasm of E. coli . In this study, we achieved soluble expression of TRAIL by fusing maltose-binding protein (MBP), b'a' domain of protein disulfide isomerase (PDIb'a'), or protein disulfide isomerase at the N-terminus of TRAIL. The TRAIL was purified using subsequent immobilized metal affinity chromatography and amylose-binding chromatography, with the tag removal using tobacco etch virus protease. Approximately 4.5 mg of pure TRAIL was produced from 125 ml flask culture with a purification yield of 71.6%. The endotoxin level of the final product was 0.4 EU/μg, as measured by the Limulus amebocyte lysate endotoxin assay. The purified TRAIL was validated and shown to cause apoptosis of HeLa cells with an EC₅₀ and Hill coefficient of 0.6 ± 0.03 nM and 2.41 ± 0.15, respectively. The high level of apoptosis in HeLa cells following administration of purified TRAIL indicates the significance and novelty of this method for producing high-grade and high-yield TRAIL.

Fate of Transgenic DNA from Orally Administered Bt MON810 Maize and Effects on Immune Response and Growth in Pigs

PubMed Central

Walsh, Maria C.; Buzoianu, Stefan G.; Gardiner, Gillian E.; Rea, Mary C.; Gelencsér, Eva; Jánosi, Anna; Epstein, Michelle M.; Ross, R. Paul; Lawlor, Peadar G.

2011-01-01

We assessed the effect of short-term feeding of genetically modified (GM: Bt MON810) maize on immune responses and growth in weanling pigs and determined the fate of the transgenic DNA and protein in-vivo. Pigs were fed a diet containing 38.9% GM or non-GM isogenic parent line maize for 31 days. We observed that IL-12 and IFNγ production from mitogenic stimulated peripheral blood mononuclear cells decreased (P<0.10) following 31 days of GM maize exposure. While Cry1Ab-specific IgG and IgA were not detected in the plasma of GM maize-fed pigs, the detection of the cry1Ab gene and protein was limited to the gastrointestinal digesta and was not found in the kidneys, liver, spleen, muscle, heart or blood. Feeding GM maize to weanling pigs had no effect on growth performance or body weight. IL-6 and IL-4 production from isolated splenocytes were increased (P<0.05) in response to feeding GM maize while the proportion of CD4+ T cells in the spleen decreased. In the ileum, the proportion of B cells and macrophages decreased while the proportion of CD4+ T cells increased in GM maize-fed pigs. IL-8 and IL-4 production from isolated intraepithelial and lamina propria lymphocytes were also increased (P<0.05) in response to feeding GM maize. In conclusion, there was no evidence of cry1Ab gene or protein translocation to the organs and blood of weaning pigs. The growth of pigs was not affected by feeding GM maize. Alterations in immune responses were detected; however, their biologic relevance is questionable. PMID:22132091

Cellular origin of the Bufo arenarum sperm receptor gp75, a ZP2 family member: its proteolysis after fertilization.

PubMed

Scarpeci, Sonia L; Sanchez, Mercedes L; Cabada, Marcelo O

2008-04-01

The egg envelope is an extracellular matrix that surrounds oocytes. In frogs and mammals, a prominent feature of envelope modification following fertilization is the N-terminal proteolysis of the envelope glycoproteins, ZPA [ZP (zona pellucida) A]. It was proposed that ZPA N-terminal proteolysis leads to a conformational change in egg envelope glycoproteins, resulting in the prevention of polyspermy. Bufo arenarum VE (vitelline envelope) is made up of at least four glycoproteins: gp120 (glycoprotein 120), gp75, gp41 and gp38. The aim of the present study was to identify and characterize the baZPA (B. arenarum ZPA homologue). Also, our aim was to evaluate its integrity and functional significance during fertilization. VE components were labelled with FITC in order to study their sperm-binding capacity. The assay showed that gp75, gp41 and gp38 possess sperm-binding activity. We obtained a full-length cDNA of 2062 bp containing one ORF (open reading frame) with a sequence for 687 amino acids. The predicted amino acid sequence had close similarity to that of mammalian ZPA. This result indicates that gp75 is the baZPA. Antibodies raised against an N-terminal sequence recognized baZPA and inhibited sperm-baZPA extracted from VE binding. This protein does not induce the acrosome reaction in homologue sperm. Northern-blot studies indicated that the transcript is exclusively expressed in the ovary. In situ hybridization studies confirmed this and pointed to previtellogenic oocytes and follicle cells surrounding the oocyte as the source of the transcript. baZPA was cleaved during fertilization and the N-terminal peptide fragment remained disulfide bonded to the glycoprotein moiety following proteolysis. From the sequence analysis, it was possible to consider that gp75 is the baZPA. It is expressed by previtellogenic oocytes and follicle cells. Also, it can be considered as a sperm receptor that undergoes N-terminal proteolysis during fertilization. The N-terminal peptide could be necessary for sperm binding.

Transcriptome profiling of the intoxication response of Tenebrio molitor larvae to Bacillus thuringiensis Cry3Aa protoxin

USDA-ARS?s Scientific Manuscript database

Bacillus thuringiensis (Bt) crystal (Cry) proteins are effective against some coleopteran pests, but improvements are needed in both efficacy and “time to kill” for Cry toxins to become valuable tools for use in integrated pest management. To gain insight into Bt intoxication of Coleoptera, we perfo...

Cryptochrome 1 interacts with PIF4 to regulate high temperature-mediated hypocotyl elongation in response to blue light.

PubMed

Ma, Dingbang; Li, Xu; Guo, Yongxia; Chu, Jingfang; Fang, Shuang; Yan, Cunyu; Noel, Joseph P; Liu, Hongtao

2016-01-05

Cryptochrome 1 (CRY1) is a blue light receptor that mediates primarily blue-light inhibition of hypocotyl elongation. Very little is known of the mechanisms by which CRY1 affects growth. Blue light and temperature are two key environmental signals that profoundly affect plant growth and development, but how these two abiotic factors integrate remains largely unknown. Here, we show that blue light represses high temperature-mediated hypocotyl elongation via CRY1. Furthermore, CRY1 interacts directly with PHYTOCHROME-INTERACTING FACTOR 4 (PIF4) in a blue light-dependent manner to repress the transcription activity of PIF4. CRY1 represses auxin biosynthesis in response to elevated temperature through PIF4. Our results indicate that CRY1 signal by modulating PIF4 activity, and that multiple plant photoreceptors [CRY1 and PHYTOCHROME B (PHYB)] and ambient temperature can mediate morphological responses through the same signaling component-PIF4.

SHP-1 Binds and Negatively Modulates the c-Kit Receptor by Interaction with Tyrosine 569 in the c-Kit Juxtamembrane Domain

PubMed Central

Kozlowski, Maya; Larose, Louise; Lee, Fai; Le, Duc Mingh; Rottapel, Robert; Siminovitch, Katherine A.

1998-01-01

The SH2 domain-containing SHP-1 tyrosine phosphatase has been shown to negatively regulate a broad spectrum of growth factor- and cytokine-driven mitogenic signaling pathways. Included among these is the cascade of intracellular events evoked by stem cell factor binding to c-Kit, a tyrosine kinase receptor which associates with and is dephosphorylated by SHP-1. Using a series of glutathione S-transferase (GST) fusion proteins containing either tyrosine-phosphorylated segments of the c-Kit cytosolic region or the SH2 domains of SHP-1, we have shown that SHP-1 interacts with c-Kit by binding selectively to the phosphorylated c-Kit juxtamembrane region and that the association of c-Kit with the larger of the two SHP-1 isoforms may be mediated through either the N-terminal or C-terminal SHP-1 SH2 domain. The results of binding assays with mutagenized GST-Kit juxtamembrane fusion proteins and competitive inhibition assays with phosphopeptides encompassing each c-Kit juxtamembrane region identified the tyrosine residue at position 569 as the major site for binding of SHP-1 to c-Kit and suggested that tyrosine 567 contributes to, but is not required for, this interaction. By analysis of Ba/F3 cells retrovirally transduced to express c-Kit receptors, phenylalanine substitution of c-Kit tyrosine residue 569 was shown to be associated with disruption of c-Kit–SHP-1 binding and induction of hyperproliferative responses to stem cell factor. Although phenylalanine substitution of c-Kit tyrosine residue 567 in the Ba/F3–c-Kit cells did not alter SHP-1 binding to c-Kit, the capacity of a second c-Kit-binding tyrosine phosphatase, SHP-2, to associate with c-Kit was markedly reduced, and the cells again showed hyperproliferative responses to stem cell factor. These data therefore identify SHP-1 binding to tyrosine 569 on c-Kit as an interaction pivotal to SHP-1 inhibitory effects on c-Kit signaling, but they indicate as well that cytosolic protein tyrosine phosphatases other than SHP-1 may also negatively regulate the coupling of c-Kit engagement to proliferation. PMID:9528781

Protein aggregation studied by forward light scattering and light transmission analysis

NASA Astrophysics Data System (ADS)

Penzkofer, A.; Shirdel, J.; Zirak, P.; Breitkreuz, H.; Wolf, E.

2007-12-01

The aggregation of the circadian blue-light photo-receptor cryptochrome from Drosophila melanogaster (dCry) is studied by transmission and forward light scattering measurement in the protein transparent wavelength region. The light scattering in forward direction is caused by Rayleigh scattering which is proportional to the degree of aggregation. The light transmission through the samples in the transparent region is reduced by Mie light scattering in all directions. It depends on the degree of aggregation and the monomer volume fill factor of the aggregates (less total scattering with decreasing monomer volume fill factor of protein globule) allowing a distinction between tightly packed protein aggregation (monomer volume fill factor 1) and loosely packed protein aggregation (monomer volume fill factor less than 1). An increase in aggregation with temperature, concentration, and blue-light exposure is observed. At a temperature of 4 °C and a protein concentration of less than 0.135 mM no dCry aggregation was observed, while at 24 °C and 0.327 mM gelation occurred (loosely packed aggregates occupying the whole solution volume).

Insecticidal properties of a crystal protein gene product isolated from Bacillus thuringiensis subsp. kenyae.

PubMed

Masson, L; Moar, W J; van Frankenhuyzen, K; Bossé, M; Brousseau, R

1992-02-01

A protoxin gene, localized to a high-molecular-weight plasmid from Bacillus thuringiensis subsp. kenyae, was cloned on a 19-kb BamHI DNA fragment into Escherichia coli. Characterization of the gene revealed it to be a member of the CryIE toxin subclass which has been reported to be as toxic as the CryIC subclass to larvae from Spodoptera exigua in assays with crude E. coli extracts. To directly test the purified recombinant gene product, the gene was subcloned as a 4.8-kb fragment into an expression vector resulting in the overexpression of a 134-kDa protein in the form of phase-bright inclusions in E. coli. Treatment of solubilized inclusion bodies with either trypsin or gut juice from the silkworm Bombyx mori resulted in the appearance of a protease-resistant 65-kDa protein. In force-feeding bioassays, the purified activated protein was highly toxic to larvae of B. mori but not to larvae of Choristoneura fumiferana. In diet bioassays with larvae from S. exigua, the purified protoxin was nontoxic. However, prior activation of the protoxin by tryptic digestion resulted in the appearance of some toxic activity. These results demonstrate that this new subclass of protein toxin may not be useful for the control of Spodoptera species as previously reported. Hierarchical clustering of the nine known lepidopteran-specific CryI toxin subclasses through multiple sequence alignment suggests that the toxins fall into four possible subgroups or clusters.

Influences of Cry1Ac broccoli on larval survival and oviposition of diamondback moth.

PubMed

Yi, Dengxia; Cui, Shusong; Yang, Limei; Fang, Zhiyuan; Liu, Yumei; Zhuang, Mu; Zhang, Yangyong

2015-01-01

Larval survival and oviposition behavior of three genotypes of diamondback moth, Plutella xylostella L. (Lepidoptera: Plutellidae), (homozygous Cry1Ac-susceptibile, Cry1Ac-resistant, and their F1 hybrids), on transgenic Bacillus thuringiensis (Bt) broccoli expressing different levels of Cry1Ac protein were evaluated in laboratory. These Bt broccoli lines were designated as relative low, medium, and high, respectively, according to the Cry1Ac content. Untransformed brocccoli plants were used as control. Larval survival of diamondback moth on non-Bt leaves was not significantly different among the three genotypes. The Cry1Ac-resistant larvae could survive on the low level of Bt broccoli plants, while Cry1Ac-susceptible and F1 larvae could not survive on them. The three genotypes of P. xylostella larvae could not survive on medium and high levels of Bt broccoli. In oviposition choice tests, there was no significant difference in the number of eggs laid by the three P. xylostella genotypes among different Bt broccoli plants. The development of Cry1Ac-susceptible and Cry1Ac-resistant P. xylostella on intact Bt plants was also tested in greenhouse. All susceptible P. xylostella larvae died on all Bt plants, while resistant larvae could survive on broccoli, which expresses low Cry1Ac protein under greenhouse conditions. The results of the greenhouse trials were similar to that of laboratory tests. This study indicated that high dose of Bt toxins in broccoli cultivars or germplasm lines is required for effective resistance management. © The Author 2015. Published by Oxford University Press on behalf of the Entomological Society of America.

Dual mode of action of Bt proteins: protoxin efficacy against resistant insects

PubMed Central

Tabashnik, Bruce E.; Zhang, Min; Fabrick, Jeffrey A.; Wu, Yidong; Gao, Meijing; Huang, Fangneng; Wei, Jizhen; Zhang, Jie; Yelich, Alexander; Unnithan, Gopalan C.; Bravo, Alejandra; Soberón, Mario; Carrière, Yves; Li, Xianchun

2015-01-01

Transgenic crops that produce Bacillus thuringiensis (Bt) proteins for pest control are grown extensively, but insect adaptation can reduce their effectiveness. Established mode of action models assert that Bt proteins Cry1Ab and Cry1Ac are produced as inactive protoxins that require conversion to a smaller activated form to exert toxicity. However, contrary to this widely accepted paradigm, we report evidence from seven resistant strains of three major crop pests showing that Cry1Ab and Cry1Ac protoxins were generally more potent than the corresponding activated toxins. Moreover, resistance was higher to activated toxins than protoxins in eight of nine cases evaluated in this study. These data and previously reported results support a new model in which protoxins and activated toxins kill insects via different pathways. Recognizing that protoxins can be more potent than activated toxins against resistant insects may help to enhance and sustain the efficacy of transgenic Bt crops. PMID:26455902

Screening for single-chain variable fragment antibodies against multiple Cry1 toxins from an immunized mouse phage display antibody library.

PubMed

Dong, Sa; Bo, Zongyi; Zhang, Cunzheng; Feng, Jianguo; Liu, Xianjin

2018-04-01

Single-chain variable fragment (scFv) is a kind of antibody that possess only one chain of the complete antibody while maintaining the antigen-specific binding abilities and can be expressed in prokaryotic system. In this study, scFvs against Cry1 toxins were screened out from an immunized mouse phage displayed antibody library, which was successfully constructed with capacity of 6.25 × 10 7  CFU/mL. Using the mixed and alternative antigen coating strategy and after four rounds of affinity screening, seven positive phage-scFvs against Cry1 toxins were selected and characterized. Among them, clone scFv-3H9 (MG214869) showing relative stable and high binding abilities to six Cry1 toxins was selected for expression and purification. SDS-PAGE indicated that the scFv-3H9 fragments approximately 27 kDa were successfully expressed in Escherichia coli HB2151 strain. The purified scFv-3H9 was used to establish the double antibody sandwich enzyme-linked immunosorbent assay method (DAS-ELISA) for detecting six Cry1 toxins, of which the lowest detectable limits (LOD) and the lowest quantitative limits (LOQ) were 3.14-11.07 and 8.22-39.44 ng mL -1 , respectively, with the correlation coefficient higher than 0.997. The average recoveries of Cry1 toxins from spiked rice leaf samples were ranged from 84 to 95%, with coefficient of variation (CV) less than 8.2%, showing good accuracy for the multi-residue determination of six Cry1 toxins in agricultural samples. This research suggested that the constructed phage display antibody library based on the animal which was immunized with the mixture of several antigens under the same category can be used for the quick and effective screening of generic antibodies.

Field-Evolved Resistance in Corn Earworm to Cry Proteins Expressed by Transgenic Sweet Corn.

PubMed

Dively, Galen P; Venugopal, P Dilip; Finkenbinder, Chad

2016-01-01

Transgenic corn engineered with genes expressing insecticidal toxins from the bacterium Bacillus thuringiensis (Berliner) (Bt) are now a major tool in insect pest management. With its widespread use, insect resistance is a major threat to the sustainability of the Bt transgenic technology. For all Bt corn expressing Cry toxins, the high dose requirement for resistance management is not achieved for corn earworm, Helicoverpa zea (Boddie), which is more tolerant to the Bt toxins. We present field monitoring data using Cry1Ab (1996-2016) and Cry1A.105+Cry2Ab2 (2010-2016) expressing sweet corn hybrids as in-field screens to measure changes in field efficacy and Cry toxin susceptibility to H. zea. Larvae successfully damaged an increasing proportion of ears, consumed more kernel area, and reached later developmental stages (4th - 6th instars) in both types of Bt hybrids (Cry1Ab-event Bt11, and Cry1A.105+Cry2Ab2-event MON89034) since their commercial introduction. Yearly patterns of H. zea population abundance were unrelated to reductions in control efficacy. There was no evidence of field efficacy or tissue toxicity differences among different Cry1Ab hybrids that could contribute to the decline in control efficacy. Supportive data from laboratory bioassays demonstrate significant differences in weight gain and fitness characteristics between the Maryland H. zea strain and a susceptible strain. In bioassays with Cry1Ab expressing green leaf tissue, Maryland H. zea strain gained more weight than the susceptible strain at all concentrations tested. Fitness of the Maryland H. zea strain was significantly lower than that of the susceptible strain as indicated by lower hatch rate, longer time to adult eclosion, lower pupal weight, and reduced survival to adulthood. After ruling out possible contributing factors, the rapid change in field efficacy in recent years and decreased susceptibility of H. zea to Bt sweet corn provide strong evidence of field-evolved resistance in H. zea populations to multiple Cry toxins. The high adoption rate of Bt field corn and cotton, along with the moderate dose expression of Cry1Ab and related Cry toxins in these crops, and decreasing refuge compliance probably contributed to the evolution of resistance. Our results have important implications for resistance monitoring, refuge requirements and other regulatory policies, cross-resistance issues, and the sustainability of the pyramided Bt technology.

Comparative analysis of genomics and proteomics in Bacillus thuringiensis 4.0718.

PubMed

Rang, Jie; He, Hao; Wang, Ting; Ding, Xuezhi; Zuo, Mingxing; Quan, Meifang; Sun, Yunjun; Yu, Ziquan; Hu, Shengbiao; Xia, Liqiu

2015-01-01

Bacillus thuringiensis is a widely used biopesticide that produced various insecticidal active substances during its life cycle. Separation and purification of numerous insecticide active substances have been difficult because of the relatively short half-life of such substances. On the other hand, substances can be synthetized at different times during development, so samples at different stages have to be studied, further complicating the analysis. A dual genomic and proteomic approach would enhance our ability to identify such substances, and particularily using mass spectrometry-based proteomic methods. The comparative analysis for genomic and proteomic data have showed that not all of the products deduced from the annotated genome could be identified among the proteomic data. For instance, genome annotation results showed that 39 coding sequences in the whole genome were related to insect pathogenicity, including five cry genes. However, Cry2Ab, Cry1Ia, Cytotoxin K, Bacteriocin, Exoenzyme C3 and Alveolysin could not be detected in the proteomic data obtained. The sporulation-related proteins were also compared analysis, results showed that the great majority sporulation-related proteins can be detected by mass spectrometry. This analysis revealed Spo0A~P, SigF, SigE(+), SigK(+) and SigG(+), all known to play an important role in the process of spore formation regulatory network, also were displayed in the proteomic data. Through the comparison of the two data sets, it was possible to infer that some genes were silenced or were expressed at very low levels. For instance, found that cry2Ab seems to lack a functional promoter while cry1Ia may not be expressed due to the presence of transposons. With this comparative study a relatively complete database can be constructed and used to transform hereditary material, thereby prompting the high expression of toxic proteins. A theoretical basis is provided for constructing highly virulent engineered bacteria and for promoting the application of proteogenomics in the life sciences.

Cry-Bt identifier: a biological database for PCR detection of Cry genes present in transgenic plants.

PubMed

Singh, Vinay Kumar; Ambwani, Sonu; Marla, Soma; Kumar, Anil

2009-10-23

We describe the development of a user friendly tool that would assist in the retrieval of information relating to Cry genes in transgenic crops. The tool also helps in detection of transformed Cry genes from Bacillus thuringiensis present in transgenic plants by providing suitable designed primers for PCR identification of these genes. The tool designed based on relational database model enables easy retrieval of information from the database with simple user queries. The tool also enables users to access related information about Cry genes present in various databases by interacting with different sources (nucleotide sequences, protein sequence, sequence comparison tools, published literature, conserved domains, evolutionary and structural data). http://insilicogenomics.in/Cry-btIdentifier/welcome.html.

40 CFR 174.510 - Bacillus thuringiensis Cry1Ac protein in all plants; exemption from the requirement of a tolerance.

Code of Federal Regulations, 2013 CFR

2013-07-01

... 40 Protection of Environment 25 2013-07-01 2013-07-01 false Bacillus thuringiensis Cry1Ac protein in all plants; exemption from the requirement of a tolerance. 174.510 Section 174.510 Protection of... PLANT-INCORPORATED PROTECTANTS Tolerances and Tolerance Exemptions § 174.510 Bacillus thuringiensis...

X-ray structure of the ternary MTX·NADPH complex of the anthrax dihydrofolate reductase: A pharmacophore for dual-site inhibitor design

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bennett, Brad C.; Wan, Qun; Ahmad, Md Faiz

2009-11-18

For reasons of bioterrorism and drug resistance, it is imperative to identify and develop new molecular points of intervention against anthrax. Dihydrofolate reductase (DHFR) is a highly conserved enzyme and an established target in a number of species for a variety of chemotherapeutic programs. Recently, the crystal structure of B. anthracis DHFR (baDHFR) in complex with methotrexate (MTX) was determined and, based on the structure, proposals were made for drug design strategies directed against the substrate binding site. However, little is gleaned about the binding site for NADPH, the cofactor responsible for hydride transfer in the catalytic mechanism. In themore » present study, X-ray crystallography at 100 K was used to determine the structure of baDHFR in complex with MTX and NADPH. Although the NADPH binding mode is nearly identical to that seen in other DHFR ternary complex structures, the adenine moiety adopts an off-plane tilt of nearly 90 deg. and this orientation is stabilized by hydrogen bonds to functionally conserved Arg residues. A comparison of the binding site, focusing on this region, between baDHFR and the human enzyme is discussed, with an aim at designing species-selective therapeutics. Indeed, the ternary model, refined to 2.3{angstrom} resolution, provides an accurate template for testing the feasibility of identifying dual-site inhibitors, compounds that target both the substrate and cofactor binding site. With the ternary model in hand, using in silico methods, several compounds were identified which could potentially form key bonding contacts in the substrate and cofactor binding sites. Ultimately, two structurally distinct compounds were verified that inhibit baDHFR at low {mu}M concentrations. The apparent K{sub d} for one of these, (2-(3-(2-(hydroxyimino)-2-(pyridine-4-yl)-6,7-dimethylquinoxalin-2-yl)-1-(pyridine-4-yl)ethanone oxime), was measured by fluorescence spectroscopy to be 5.3 {mu}M.« less

Intermittent bolus injection versus continuous infusion of furosemide in normal adult greyhound dogs.

PubMed

Adin, Darcy B; Taylor, Aaron W; Hill, Richard C; Scott, Karen C; Martin, Frank G

2003-01-01

Several studies in human subjects have demonstrated greater diuresis with constant rate infusion (CRI) furosemide than intermittent bolus (IB) furosemide. This study was conducted to compare the diuretic efficacy of the same total dose of IB furosemide and CRI furosemide in 6 healthy, adult Greyhound dogs in a randomized crossover design with a 2-week washout period between treatments. For IB administration, dogs received 3 mg/kg at 0 and 4 hours. For CRI administration, dogs received a 0.66 mg/kg loading dose followed by 0.66 mg/kg/h over 8 hours. The same volume of fluid was administered for both methods. Urine output was quantified hourly. Urine electrolyte concentrations, urine specific gravity (USG), packed cell volume (PCV), total protein (TP), serum electrolyte concentrations, total carbon dioxide (TCO2), serum creatinine (sCr), and blood urea nitrogen (BUN) were determined every 2 hours. Urine production and water intake were greater (P < or = 0.05) for CRI than IB. Urine sodium and calcium losses were greater (P < 0.05) and urine potassium loss was less (P = 0.03) for CRI than IB, but there was no evidence of a difference between methods for urine magnesium and chloride losses. Serum chloride concentration was less (P < 0.001), sCr concentration greater (P = 0.04). TP greater (P = 0.01), and PCV greater (P = 0.003) for CRI than IB. No differences in USG, TCO2, BUN, or serum potassium, sodium, and magnesium concentrations were detected between methods. The same total dose of CRI furosemide resulted in more diuresis, natriuresis, and calciuresis and less kaliuresis than IB furosemide in these normal Greyhound dogs over 8 hours, suggesting that furosemide is a more effective diuretic when administered by CRI than by IB.

Minnesota field population of western corn rootworm (Coleoptera: Chrysomelidae) shows incomplete resistance to Cry34Ab1/Cry35Ab1 and Cry3Bb1

USDA-ARS?s Scientific Manuscript database

The western corn rootworm, Diabrotica virgifera virgifera LeConte, is commonly managed with corn (Zea mays L.) expressing insecticidal proteins from the bacteria Bacillus thuringiensis (Bt). Under laboratory conditions, populations of western corn rootworm have been selected for resistance to each c...

Development and characterization of MIR604 resistance in a western corn rootworm population (Coleoptera: Chrysomelidae)

USDA-ARS?s Scientific Manuscript database

mCry3A is one of only four proteins licensed for commercial use in Diabrotica control. Utilizing a colony of western corn rootworm, Diabrotica virgifera virgifera LeConte, selected for resistance to mCry3A, we evaluated how mCry3A resistance was inherited and whether fitness costs were associated wi...

Key genes and pathways in measles and their interaction with environmental chemicals.

PubMed

Zhang, Rongqiang; Jiang, Hualin; Li, Fengying; Su, Ning; Ding, Yi; Mao, Xiang; Ren, Dan; Wang, Jing

2018-06-01

The aim of the present study was to explore key genes that may have a role in the pathology of measles virus infection and to clarify the interaction networks between environmental factors and differentially expressed genes (DEGs). After screening the database of the Gene Expression Omnibus of the National Center for Biotechnology Information, the dataset GSE5808 was downloaded and analyzed. A global normalization method was performed to minimize data inconsistencies and heterogeneity. DEGs during different stages of measles virus infection were explored using R software (v3.4.0). Gene Ontology and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis of the DEGs were performed using Cytoscape 3.4.0 software. A protein-protein interaction (PPI) network of the DEGs was obtained from the STRING database v9.05. A total of 43 DEGs were obtained from four analyzed sample groups, including 10 highly expressed genes and 33 genes with decreased expression. The most enriched pathways based on KEGG analysis were fatty acid elongation, cytokine-cytokine receptor interaction and RNA degradation. The genes mentioned in the PPI network were mainly associated with protein binding and chemokine activity. A total of 219 chemicals were identified that may, jointly or on their own, interact with the 6 DEGs between the control group and patients with measles (at hospital entry), including benzo(a)pyrene (BaP) and tetrachlorodibenzodioxin (TCDD). In conclusion, the present study revealed that chemokines and environmental chemicals, e.g. BaP and TCDD, may affect the development of measles.

A Cryptochrome 2 mutation yields advanced sleep phase in humans.

PubMed

Hirano, Arisa; Shi, Guangsen; Jones, Christopher R; Lipzen, Anna; Pennacchio, Len A; Xu, Ying; Hallows, William C; McMahon, Thomas; Yamazaki, Maya; Ptáček, Louis J; Fu, Ying-Hui

2016-08-16

Familial Advanced Sleep Phase (FASP) is a heritable human sleep phenotype characterized by very early sleep and wake times. We identified a missense mutation in the human Cryptochrome 2 (CRY2) gene that co-segregates with FASP in one family. The mutation leads to replacement of an alanine residue at position 260 with a threonine (A260T). In mice, the CRY2 mutation causes a shortened circadian period and reduced phase-shift to early-night light pulse associated with phase-advanced behavioral rhythms in the light-dark cycle. The A260T mutation is located in the phosphate loop of the flavin adenine dinucleotide (FAD) binding domain of CRY2. The mutation alters the conformation of CRY2, increasing its accessibility and affinity for FBXL3 (an E3 ubiquitin ligase), thus promoting its degradation. These results demonstrate that CRY2 stability controlled by FBXL3 plays a key role in the regulation of human sleep wake behavior.

Cryptochrome 1 interacts with PIF4 to regulate high temperature-mediated hypocotyl elongation in response to blue light

PubMed Central

Ma, Dingbang; Li, Xu; Guo, Yongxia; Chu, Jingfang; Fang, Shuang; Yan, Cunyu; Noel, Joseph P.; Liu, Hongtao

2016-01-01

Cryptochrome 1 (CRY1) is a blue light receptor that mediates primarily blue-light inhibition of hypocotyl elongation. Very little is known of the mechanisms by which CRY1 affects growth. Blue light and temperature are two key environmental signals that profoundly affect plant growth and development, but how these two abiotic factors integrate remains largely unknown. Here, we show that blue light represses high temperature-mediated hypocotyl elongation via CRY1. Furthermore, CRY1 interacts directly with PHYTOCHROME-INTERACTING FACTOR 4 (PIF4) in a blue light-dependent manner to repress the transcription activity of PIF4. CRY1 represses auxin biosynthesis in response to elevated temperature through PIF4. Our results indicate that CRY1 signal by modulating PIF4 activity, and that multiple plant photoreceptors [CRY1 and PHYTOCHROME B (PHYB)] and ambient temperature can mediate morphological responses through the same signaling component—PIF4. PMID:26699514

Assessment of the Antimicrobial Activity and the Entomocidal Potential of Bacillus thuringiensis Isolates from Algeria

PubMed Central

Djenane, Zahia; Nateche, Farida; Amziane, Meriam; Gomis-Cebolla, Joaquín; El-Aichar, Fairouz; Khorf, Hassiba; Ferré, Juan

2017-01-01

This work represents the first initiative to analyze the distribution of B. thuringiensis in Algeria and to evaluate the biological potential of the isolates. A total of 157 isolates were recovered, with at least one isolate in 94.4% of the samples. The highest Bt index was found in samples from rhizospheric soil (0.48) and from the Mediterranean area (0.44). Most isolates showed antifungal activity (98.5%), in contrast to the few that had antibacterial activity (29.9%). A high genetic diversity was made evident by the finding of many different crystal shapes and various combinations of shapes within a single isolate (in 58.4% of the isolates). Also, over 50% of the isolates harbored cry1, cry2, or cry9 genes, and 69.3% contained a vip3 gene. A good correlation between the presence of chitinase genes and antifungal activity was observed. More than half of the isolates with a broad spectrum of antifungal activity harbored both endochitinase and exochitinase genes. Interestingly, 15 isolates contained the two chitinase genes and all of the above cry family genes, with some of them harboring a vip3 gene as well. The combination of this large number of genes coding for entomopathogenic proteins suggests a putative wide range of entomotoxic activity. PMID:28406460

Bacterial community structure in the rhizosphere of a Cry1Ac Bt-brinjal crop and comparison to its non-transgenic counterpart in the tropical soil.

PubMed

Singh, Amit Kishore; Rai, Govind Kumar; Singh, Major; Dubey, Suresh Kumar

2013-11-01

To elucidate whether the transgenic crop alters the rhizospheric bacterial community structure, a 2-year study was performed with Cry1Ac gene-inserted brinjal crop (Bt) and their near isogenic non-transformed trait (non-Bt). The event of Bt crop (VRBT-8) was screened using an insect bioassay and enzyme-linked immunosorbent assay. Soil moisture, NH4 (+)-N, NO3 (-)-N, and PO4 (-)-P level had non-significant variation. Quantitative polymerase chain reaction revealed that abundance of bacterial 16S rRNA gene copies were lower in soils associated with Bt brinjal. Microbial biomass carbon (MBC) showed slight reduction in Bt brinjal soils. Higher MBC values in the non-Bt crop soil may be attributed to increased root activity and availability of readily metabolizable carbon compounds. The restriction fragment length polymorphism of PCR-amplified rRNA gene fragments detected 13 different bacterial groups with the exclusive presence of β-Proteobacteria, Chloroflexus, Planctomycetes, and Fusobacteria in non-Bt, and Cyanobacteria and Bacteroidetes in Bt soils, respectively, reflecting minor changes in the community structure. Despite the detection of Cry1Ac protein in the rhizospheric soil, the overall impact of Cry1Ac expressing Bt brinjal was less compared to that due to seasonal changes.

Differential protection of Cry1Fa toxin against Spodoptera frugiperda larval gut proteases by cadherin orthologs correlates with increased synergism.

PubMed

Rahman, Khalidur; Abdullah, Mohd Amir F; Ambati, Suresh; Taylor, Milton D; Adang, Michael J

2012-01-01

The Cry proteins produced by Bacillus thuringiensis (Bt) are the most widely used biopesticides effective against a range of crop pests and disease vectors. Like chemical pesticides, development of resistance is the primary threat to the long-term efficacy of Bt toxins. Recently discovered cadherin-based Bt Cry synergists showed the potential to augment resistance management by improving efficacy of Cry toxins. However, the mode of action of Bt Cry synergists is thus far unclear. Here we elucidate the mechanism of cadherin-based Cry toxin synergism utilizing two cadherin peptides, Spodoptera frugiperda Cad (SfCad) and Manduca sexta Cad (MsCad), which differentially enhance Cry1Fa toxicity to Spodoptera frugiperda neonates. We show that differential SfCad- and MsCad-mediated protection of Cry1Fa toxin in the Spodoptera frugiperda midgut correlates with differential Cry1Fa toxicity enhancement. Both peptides exhibited high affinity for Cry1Fa toxin and an increased rate of Cry1Fa-induced pore formation in S. frugiperda. However, only SfCad bound the S. frugiperda brush border membrane vesicle and more effectively prolonged the stability of Cry1Fa toxin in the gut, explaining higher Cry1Fa enhancement by this peptide. This study shows that cadherin fragments may enhance B. thuringiensis toxicity by at least two different mechanisms or a combination thereof: (i) protection of Cry toxin from protease degradation in the insect midgut and (ii) enhancement of pore-forming ability of Cry toxin.

Effect of transgenic Bacillus thuringiensis rice lines on mortality and feeding behavior of rice stem borers (Lepidoptera: Crambidae).

PubMed

Chen, Hao; Zhang, Guoan; Zhang, Qifa; Lin, Yongjun

2008-02-01

Ten transgenic Bacillus thuringiensis Bt rice, Oryza sativa L., lines with different Bt genes (two Cry1Ac lines, three Cry2A lines, and five Cry9C lines) derived from the same variety Minghui 63 were evaluated in both the laboratory and the field. Bioassays were conducted by using the first instars of two main rice lepidopteran insect species: yellow stem borer, Scirpophaga incertulas (Walker) and Asiatic rice borer, Chilo suppressalis (Walker). All transgenic lines exhibited high toxicity to these two rice borers. Field evaluation results also showed that all transgenic lines were highly insect resistant with both natural infestation and manual infestation of the neonate larvae of S. incertulas compared with the nontransformed Minghui63. Bt protein concentrations in leaves of 10 transgenic rice lines were estimated by the sandwich enzyme-linked immunosorbent assay. The cry9C gene had the highest expression level, next was cry2A gene, and the cry1Ac gene expressed at the lowest level. The feeding behavior of 7-d-old Asiatic rice borer to three classes of Bt transgenic rice lines also was detected by using rice culm cuttings. The results showed that 7-d-old larvae of Asiatic rice borer have the capacity to distinguish Bt and non-Bt culm cuttings and preferentially fed on non-Bt cuttings. When only Bt culm cuttings with three classes of different Bt proteins (CrylAc, Cry2A, and Cry9C) were fed, significant distribution difference of 7-d-old Asiatic rice borer in culm cuttings of different Bt proteins also was found. In the current study, we evaluate different Bt genes in the same rice variety in both the laboratory and the field, and also tested feeding behavior of rice insect to these Bt rice. These data are valuable for the further development of two-toxin Bt rice and establishment of appropriate insect resistance management in the future.

Nrf2: A Novel Biomarker of Disease Severity and Target for Therapeutic Intervention in Multiple Sclerosis

DTIC Science & Technology

2013-10-01

transcription factor that controls expression of genes encoding important antioxidant and stress response proteins through binding to the antioxidant response...abundant in many species from the Cucurbita family such as cucumber, watermelon , melon root, culture from radicle. To facilitate further studies of the...via Griess assay in LPS- activated cells treated with BA for 24 h. (B) viability was measured by the MTT assay. (C) iNOS protein levels were

Activation of Bt Protoxin Cry1Ac in Resistant and Susceptible Cotton Bollworm.

PubMed

Wei, Jizhen; Liang, Gemei; Wang, Bingjie; Zhong, Feng; Chen, Lin; Khaing, Myint Myint; Zhang, Jie; Guo, Yuyuan; Wu, Kongming; Tabashnik, Bruce E

2016-01-01

Crystalline (Cry) proteins from Bacillus thuringiensis (Bt) are used extensively for insect control in sprays and transgenic plants, but their efficacy is reduced by evolution of resistance in pests. Here we evaluated reduced activation of Cry1Ac protoxin as a potential mechanism of resistance in the invasive pest Helicoverpa armigera. Based on the concentration killing 50% of larvae (LC50) for a laboratory-selected resistant strain (LF120) divided by the LC50 for its susceptible parent strain (LF), the resistance ratio was 1600 for Cry1Ac protoxin and 1200 for trypsin-activated Cry1Ac toxin. The high level of resistance to activated toxin as well as to protoxin indicates reduced activation of protoxin is not a major mechanism of resistance to Cry1Ac in LF120. For both insect strains, treatment with either the trypsin inhibitor N-a-tosyl-L-lysine chloromethyl ketone (TLCK) or the chymotrypsin inhibitor N-a-tosyl-L-phenylalanine chloromethyl ketone (TPCK) did not significantly affect the LC50 of Cry1Ac protoxin. Enzyme activity was higher for LF than LF120 for trypsin-like proteases, but did not differ between strains for chymotrypsin-like proteases. The results here are consistent with previous reports indicating that reduced activation of protoxin is generally not a major mechanism of resistance to Bt proteins.

Activation of Bt Protoxin Cry1Ac in Resistant and Susceptible Cotton Bollworm

PubMed Central

Liang, Gemei; Wang, Bingjie; Zhong, Feng; Chen, Lin; Khaing, Myint Myint; Zhang, Jie; Guo, Yuyuan; Wu, Kongming; Tabashnik, Bruce E.

2016-01-01

Crystalline (Cry) proteins from Bacillus thuringiensis (Bt) are used extensively for insect control in sprays and transgenic plants, but their efficacy is reduced by evolution of resistance in pests. Here we evaluated reduced activation of Cry1Ac protoxin as a potential mechanism of resistance in the invasive pest Helicoverpa armigera. Based on the concentration killing 50% of larvae (LC50) for a laboratory-selected resistant strain (LF120) divided by the LC50 for its susceptible parent strain (LF), the resistance ratio was 1600 for Cry1Ac protoxin and 1200 for trypsin-activated Cry1Ac toxin. The high level of resistance to activated toxin as well as to protoxin indicates reduced activation of protoxin is not a major mechanism of resistance to Cry1Ac in LF120. For both insect strains, treatment with either the trypsin inhibitor N-a-tosyl-L-lysine chloromethyl ketone (TLCK) or the chymotrypsin inhibitor N-a-tosyl-L-phenylalanine chloromethyl ketone (TPCK) did not significantly affect the LC50 of Cry1Ac protoxin. Enzyme activity was higher for LF than LF120 for trypsin-like proteases, but did not differ between strains for chymotrypsin-like proteases. The results here are consistent with previous reports indicating that reduced activation of protoxin is generally not a major mechanism of resistance to Bt proteins. PMID:27257885

Agronomic performance of insect-protected and herbicide-tolerant MON 89034 × TC1507 × NK603 × DAS-40278-9 corn is equivalent to that of conventional corn.

PubMed

de Cerqueira, Denise T Rezende; Schafer, Ariane C; Fast, Brandon J; Herman, Rod A

2017-07-03

Agronomic characteristics of genetically modified (GM) MON 89034 × TC1507 × NK603 × DAS-40278-9 (PowerCore™ Enlist™), MON 89034 × TC1507 × NK603 (PowerCore™), and DAS-40278-9 (Enlist™) corn, a non-GM near-isogenic hybrid, and 2 commercial non-GM hybrids were assessed in a field study to determine if the agronomic performance of the GM corn hybrids is equivalent to that of non-transgenic hybrid corn. The MON 89034 × TC1507 × NK603 × DAS-40278-9 hybrid corn was developed through stacking of 4 individual transgenic events, MON 89034, TC1507, NK603, and DAS-40278-9 by traditional breeding and contains the cry1A.105 and cry2Ab2 (MON 89034), cry1F and pat (TC1507), cp4 epsps (NK603) and aad-1 (DAS-40278-9) transgenes. These transgenes encode the proteins Cry1A.105, Cry2Ab2, and Cry1F, which confer insect resistance, PAT, CP4 EPSPS, and AAD-1, which confer herbicide tolerance. The following agronomic characteristics were assessed in the study: initial and final stand count, seedling vigor, time to silk, time to pollen shed, pollen viability, plant height, ear height, stalk lodging, root lodging, days to maturity, stay green, disease incidence, insect damage, herbicide injury, and yield. The agronomic assessment was conducted in 2 regions of Brazil (Indianopolis-MG; Cravinhos-SP). The agronomic attributes for all GM entries were statistically indistinguishable from the non-GM near-isogenic hybrid. In addition, most of the agronomic assessments fell within the range of the commercial varieties included in the study. Taken together, MON 89034 × TC1507 × NK603 × DAS-40278, MON 89034 × TC1507 × NK603, and DAS-40278-9 were found to be agronomically equivalent to non-GM corn.

Novel Palm Fatty Acid Functionalized Magnetite Nanoparticles for Magnetic Solid-Phase Extraction of Trace Polycyclic Aromatic Hydrocarbons from Environmental Samples.

PubMed

Rozi, Siti Khalijah Mahmad; Nodeh, Hamid Rashidi; Kamboh, Muhammad Afzal; Manan, Ninie Suhana Abdul; Mohamad, Sharifah

2017-07-01

A novel adsorbent, palm fatty acid coated magnetic Fe 3 O 4 nanoparticles (MNP-FA) was successfully synthesized with immobilization of the palm fatty acid onto the surface of MNPs. The successful synthesis of MNP-FA was further confirmed by X-Ray diffraction (XRD), transmission electron microscopy (TEM), Fourier transform infrared spectroscopy (FT-IR) and Energy dispersive X-Ray spectroscopy (EDX) analyses and water contact angle (WCA) measurement. This newly synthesized MNP-FA was applied as magnetic solid phase extraction (MSPE) adsorbent for the enrichment of polycyclic aromatic hydrocarbons (PAHs), namely fluoranthene (FLT), pyrene (Pyr), chrysene (Cry) and benzo(a)pyrene (BaP) from environmental samples prior to High Performance Liquid Chromatography- Diode Array Detector (HPLC-DAD) analysis. The MSPE method was optimized by several parameters such as amount of sorbent, desorption solvent, volume of desorption solvent, extraction time, desorption time, pH and sample volume. Under the optimized conditions, MSPE method provided a low detection limit (LOD) for FLT, Pyr, Cry and BaP in the range of 0.01-0.05 ng mL -1 . The PAHs recoveries of the spiked leachate samples ranged from 98.5% to 113.8% with the RSDs (n = 5) ranging from 3.5% to 12.2%, while for the spiked sludge samples, the recoveries ranged from 81.1% to 119.3% with the RSDs (n = 5) ranging from 3.1% to 13.6%. The recyclability study revealed that MNP-FA has excellent reusability up to five times. Chromatrographic analysis demonstrated the suitability of MNP-FA as MSPE adsorbent for the efficient extraction of PAHs from environmental samples.

Efficacy of Soybean’s Event DAS-81419-2 Expressing Cry1F and Cry1Ac to Manage Key Tropical Lepidopteran Pests Under Field Conditions in Brazil

PubMed Central

Marques, L H; Castro, B A; Rossetto, J; Silva, O A B N; Moscardini, V F; Zobiole, L H S; Santos, A C; Valverde-Garcia, P; Babcock, J M; Rule, D M; Fernandes, O A

2016-01-01

Abstract Bacillus thuringiensis (Bt) event DAS-81419-2 (Conkesta technology) in soybean, Glycine max (L.) Merrill, expresses Cry1F and Cry1Ac proteins to provide protection from feeding by several lepidopteran pests. A total of 27 field experiments across nine locations were conducted from 2011 to 2015 in southern and central Brazil to characterize the efficacy of DAS-81419-2 soybean infested with Anticarsia gemmatalis Hübner (Lepidoptera: Erebidae), Chrysodeixis includens (Walker) (Lepidoptera: Noctuidae), Heliothis virescens (F.) (Lepidoptera: Noctuidae), and Spodoptera cosmioides (Walker) (Lepidoptera: Noctuidae) during vegetative (V4) and reproductive (R2 and R4) crop developmental stages. The efficacy of DAS-81419-2 was compared to that of a non-Bt isogenic variety managed with or without applications of commercial foliar insecticides for lepidopteran control. DAS-81419-2 soybean consistently experienced defoliation levels of 0.5% or less (compared with 20.05–56.74% in the non-Bt, nonsprayed treatment) and larval survival of < 0.1% in all four species across the vegetative and reproductive plant stages evaluated. The efficacy of DAS-81419-2 was significantly higher than commercial foliar insecticides applied to the non-Bt variety. DAS-81419-2 soybeans containing two highly effective Bt proteins are expected to be a more robust IRM tool compared to single-trait Bt technologies. The consistent efficacy of DAS-81419-2 soybeans across years, locations, and crop stages suggests that it will be a valuable product for management of hard-to-control key lepidopteran pests in South American soybean production. PMID:27401112

Altered M(1) muscarinic acetylcholine receptor (CHRM1)-Galpha(q/11) coupling in a schizophrenia endophenotype.

PubMed

Salah-Uddin, Hasib; Scarr, Elizabeth; Pavey, Geoffrey; Harris, Kriss; Hagan, Jim J; Dean, Brian; Challiss, R A John; Watson, Jeannette M

2009-08-01

Alterations in muscarinic acetylcholine receptor (CHRM) populations have been implicated in the pathology of schizophrenia. Here we have assessed whether the receptor function of the M(1) subtype (CHRM1) is altered in a sub-population of patients with schizophrenia, defined by marked (60-80%) reductions in cortical [3H]-pirenzepine (PZP) binding, and termed 'muscarinic receptor-deficit schizophrenia' (MRDS). Using a [35S]-GTPgammaS-Galpha(q/11) immunocapture method we have assessed whether CHRM1 signalling in human cortex (Brodmann area 9 (BA9)) is altered in post mortem tissue from a MRDS group compared with a subgroup of patients with schizophrenia displaying normal PZP binding, and controls with no known history of psychiatric or neurological disorders. The CHRM agonist (oxotremorine-M) and a CHRM1-selective agonist (AC-42) increased Galpha(q/11)-[35S]-GTPgammaS binding, with AC-42 producing responses that were approximately 50% of those maximally evoked by the full agonist, oxotremorine-M, in control and subgroups of patients with schizophrenia. However, the potency of oxotremorine-M to stimulate Galpha(q/11)-[35S]-GTPgammaS binding was significantly decreased in the MRDS group (pEC(50) (M)=5.69+/-0.16) compared with the control group (6.17+/-0.10) and the non-MRDS group (6.05+/-0.07). The levels of Galpha(q/11) protein present in BA9 did not vary with diagnosis. Maximal oxotremorine-M-stimulated Galpha(q/11)-[35S]-GTPgammaS binding in BA9 membranes was significantly increased in the MRDS group compared with the control group. Similar, though non-statistically significant, trends were observed for AC-42. These data provide evidence that both orthosterically and allosterically acting CHRM agonists can stimulate a receptor-driven functional response ([35S]-GTPgammaS binding to Galpha(q/11)) in membranes prepared from post mortem human dorsolateral prefrontal cortex of patients with schizophrenia and controls . Furthermore, in a subgroup of patients with schizophrenia displaying markedly decreased PZP binding (MRDS) we have shown that although agonist potency may decrease, the efficacy of CHRM1-Galpha(q/11) coupling increases, suggesting an adaptative change in receptor-G protein coupling efficiency in this endophenotype of patients with schizophrenia.

Two different Bacillus thuringiensis toxin genes confer resistance to beet armyworm (Spodoptera exigua Hübner) in transgenic Bt-shallots (Allium cepa L.).

PubMed

Zheng, Si-Jun; Henken, Betty; de Maagd, Ruud A; Purwito, Agus; Krens, Frans A; Kik, Chris

2005-06-01

Agrobacterium-mediated genetic transformation was applied to produce beet armyworm (Spodoptera exigua Hübner) resistant tropical shallots (Allium cepa L. group Aggregatum). A cry1Ca or a H04 hybrid gene from Bacillus thuringiensis, driven by the chrysanthemum ribulose-1,5-bisphosphate carboxylase/oxygenase small subunit (Rubisco SSU) promoter, along with the hygromycin phosphotransferase gene (hpt) driven by the CaMV 35S promoter, was employed for genetic transformation. An average transformation frequency of 3.68% was obtained from two shallot cultivars, Tropix and Kuning. After transfer of the in vitro plants to the greenhouse 69% of the cry1Ca and 39% of the H04 transgenic shallots survived the first half year. After one year of cultivation in the greenhouse the remaining cry1Ca and H04 transgenic plants grew vigorously and had a normal bulb formation, although the cry1Ca transgenic plants (and controls) had darker green leaves compared to their H04 counterparts. Standard PCR, adaptor ligation PCR and Southern analyses confirmed the integration of T-DNA into the shallot genome. Northern blot and ELISA analyses revealed expression of the cry1Ca or H04 gene in the transgenic plants. The amount of Cry1Ca expressed in transgenic plants was higher than the expression levels of H04 (0.39 vs. 0.16% of the total soluble leaf proteins, respectively). There was a good correlation between protein expression and beet armyworm resistance. Cry1Ca or H04 gene expression of at least 0.22 or 0.08% of the total soluble protein in shallot leaves was sufficient to give a complete resistance against beet armyworm. This confirms earlier observations that the H04 toxin is more toxic to S. exigua than the Cry1Ca toxin. The results from this study suggest that the cry1Ca and H04 transgenic shallots developed could be used for introducing resistance to beet armyworm in (sub) tropical shallot.

Energy shifts in photoemission lines during the tetragonal- to cubic-phase transition in BaTiO3 single crystals and systems with CoFe2O4 and NiFe2O4 overlayers

NASA Astrophysics Data System (ADS)

Welke, M.; Huth, P.; Dabelow, K.; Gorgoi, M.; Schindler, K.-M.; Chassé, A.; Denecke, R.

2018-05-01

In BaTiO3 the phase transition from tetragonal to cubic is connected with the disappearance of the ferroelectric polarization. In photoelectron spectroscopy huge transient shifts in the binding energies of all core-level photoemission lines have been observed while heating and cooling through the Curie temperature. Excitation energies from 2 keV to 6 keV have been used to show this to be a bulk effect and not a surface effect alone. These observations are discussed in terms of charging, which results from the disappearance of the ferroelectric polarization. This mechanism has previously been proposed as the origin of electron emission in ferroelectric materials. Besides the jump-like shifts, additional permanent shifts in binding energies have been observed for the tetragonal and the cubic phase. These experimental shifts have been related to theoretical ones from ab initio calculations. In addition to BaTiO3 single crystals, systems with CoFe2O4 and NiFe2O4 overlayers on BaTiO3 have been investigated. The low conductivity of these layers sets them apart from metallic overlayers like Fe or Co, where the shifts are suppressed. This difference adds further support for charging as the origin of the effect.

Construction of a biodynamic model for Cry protein production studies.

PubMed

Navarro-Mtz, Ana Karin; Pérez-Guevara, Fermín

2014-12-01

Mathematical models have been used from growth kinetic simulation to gen regulatory networks prediction for B. thuringiensis culture. However, this culture is a time dependent dynamic process where cells physiology suffers several changes depending on the changes in the cell environment. Therefore, through its culture, B. thuringiensis presents three phases related with the predominance of three major metabolic pathways: vegetative growth (Embded-Meyerhof-Parnas pathway), transition (γ-aminobutiric cycle) and sporulation (tricarboxylic acid cycle). There is not available a mathematical model that relates the different stages of cultivation with the metabolic pathway active on each one of them. Therefore, in the present study, and based on published data, a biodynamic model was generated to describe the dynamic of the three different phases based on their major metabolic pathways. The biodynamic model is used to study the interrelation between the different culture phases and their relationship with the Cry protein production. The model consists of three interconnected modules where each module represents one culture phase and its principal metabolic pathway. For model validation four new fermentations were done showing that the model constructed describes reasonably well the dynamic of the three phases. The main results of this model imply that poly-β-hydroxybutyrate is crucial for endospore and Cry protein production. According to the yields of dipicolinic acid and Cry from poly-β-hydroxybutyrate, calculated with the model, the endospore and Cry protein production are not just simultaneous and parallel processes they are also competitive processes.

Proteomic Analysis of Bacillus thuringiensis Strain 4.0718 at Different Growth Phases

PubMed Central

Li, Xiaohui; Ding, Xuezhi; Xia, Liqiu; Sun, Yunjun; Yuan, Can; Yin, Jia

2012-01-01

The growth process of Bacillus thuringiensis Bt4.0718 strain was studied using proteomic technologies. The proteins of Bt whole cells at three phases—middle vegetative, early sporulation, and late sporulation—were extracted with lysis buffer, followed with separation by 2-DE and identified by MALDI-TOF/TOF MS. Bioactive factors such as insecticidal crystal proteins (ICPs) including Cry1Ac(3), Cry2Aa, and BTRX28, immune inhibitor (InhA), and InhA precursor were identified. InhA started to express at the middle vegetative phase, suggesting its contribution to the survival of Bt in the host body. At the early sporulation phase, ICPs started their expression. CotJC, OppA, ORF1, and SpoIVA related to the formation of crystals and spores were identified, the expression characteristics of which ensured the stable formation of crystals and spores. This study provides an important foundation for further exploration of the stable expression of ICPs, the smooth formation of crystals, and the construction of recombinant strains. PMID:22649324

A new regulatory mechanism for bacterial lipoic acid synthesis

PubMed Central

Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

2015-01-01

Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID:25611823

A new regulatory mechanism for bacterial lipoic acid synthesis.

PubMed

Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

2015-01-22

Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. © 2015 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.

Differential Protection of Cry1Fa Toxin against Spodoptera frugiperda Larval Gut Proteases by Cadherin Orthologs Correlates with Increased Synergism

PubMed Central

Rahman, Khalidur; Abdullah, Mohd Amir F.; Ambati, Suresh; Taylor, Milton D.

2012-01-01

The Cry proteins produced by Bacillus thuringiensis (Bt) are the most widely used biopesticides effective against a range of crop pests and disease vectors. Like chemical pesticides, development of resistance is the primary threat to the long-term efficacy of Bt toxins. Recently discovered cadherin-based Bt Cry synergists showed the potential to augment resistance management by improving efficacy of Cry toxins. However, the mode of action of Bt Cry synergists is thus far unclear. Here we elucidate the mechanism of cadherin-based Cry toxin synergism utilizing two cadherin peptides, Spodoptera frugiperda Cad (SfCad) and Manduca sexta Cad (MsCad), which differentially enhance Cry1Fa toxicity to Spodoptera frugiperda neonates. We show that differential SfCad- and MsCad-mediated protection of Cry1Fa toxin in the Spodoptera frugiperda midgut correlates with differential Cry1Fa toxicity enhancement. Both peptides exhibited high affinity for Cry1Fa toxin and an increased rate of Cry1Fa-induced pore formation in S. frugiperda. However, only SfCad bound the S. frugiperda brush border membrane vesicle and more effectively prolonged the stability of Cry1Fa toxin in the gut, explaining higher Cry1Fa enhancement by this peptide. This study shows that cadherin fragments may enhance B. thuringiensis toxicity by at least two different mechanisms or a combination thereof: (i) protection of Cry toxin from protease degradation in the insect midgut and (ii) enhancement of pore-forming ability of Cry toxin. PMID:22081566

75 FR 51043 - Pesticide Experimental Use Permit; Receipt of Application; Comment Request

Federal Register 2010, 2011, 2012, 2013, 2014

2010-08-18

... (vector pCOT1) in event COT102 cotton, Bt Cry1Ac protein and the genetic material necessary for its production (vector PV-GHBK04) in event MON 15985 cotton, and Bt Cry2Ab2 protein and the genetic material necessary for its production (vector PV-GHBK11) in event MON 15985 cotton. The Agency has determined that...

75 FR 52329 - Corn Event MON 863 and MON 863 x MON 810; Product Cancellation Order for Certain Pesticide...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-08-25

... MON 863 and MON 863 x MON 810 seed through July 1, 2011, for planting by July 1, 2011. 3. Existing... certain products containing the pesticides, Bacillus thuringiensis Cry3Bb1 protein and the genetic... thuringiensis Cry1Ab protein and the genetic material necessary for its production (vector PV-ZMCT01) in MON 810...

Alleviative effects from boswellic acid on acetaminophen-induced hepatic injury - Corrected and republished from: Biomedicine (Taipei). 2016 Jun; 6 (2): 9. doi: 10.7603/s40681-016-0009-1PMCID: PMC4864770.

PubMed

Chen, Lung-Che; Hu, Li-Hong; Yin, Mei-Chin

2017-06-01

Protective effects of boswellic acid (BA) against acetaminophen (APAP)-induced hepatotoxicity in Balb/ cA mice were examined. BA, at 0.05 or 0.1%, was supplied for 4 weeks. Acute liver injury was induced by APAP treatment. Results showed that BA intake increased hepatic BA bioavailability. APAP treatment decreased glutathione (GSH) level, increased reactive oxygen species (ROS) and oxidized glutathione (GSSG) production; and lowered activity and protein expression of glutathione reductase (GR) and heme oxygenase (HO)-1 in liver. BA intake at both doses alleviated subsequent APAP-induced oxidative stress by retaining GSH content, decreasing ROS and GSSG formations, reserving activity and expression of GR and HO-1 in liver, and lowering hepatic cytochrome P450 2E1 activity and expression. APAP treatment enhanced hepatic levels of interleukin-6, tumor necrosis factor-alpha and monocyte chemoattractant protein-1. BA pre-intake diminished APAP-induced release of those inflammatory cytokines and chemokines. APAP up-regulated hepatic protein expression of toll-like receptor (TLR)-3, TLR-4, MyD88, nuclear factor kappa B (NF-κB) p50, NF-κB p65 and JNK. BA pre-intake at both doses suppressed the expression of NF-κB p65 and p-JNK, and only at 0.1% down-regulated hepatic TLR-3, TLR-4 and MyD88 expression. APAP led to obvious foci of inflammatory cell infiltration in liver, determined by H&E stain. BA intake at both doses attenuated hepatic inflammatory infiltration. These findings support that boswellic acid is a potent hepato-protective agent. © Author(s) 2017. This article is published with open access by China Medical University.

Identification of Small Molecule Activators of Cryptochrome

PubMed Central

Hirota, Tsuyoshi; Lee, Jae Wook; St. John, Peter C.; Sawa, Mariko; Iwaisako, Keiko; Noguchi, Takako; Pongsawakul, Pagkapol Y.; Sonntag, Tim; Welsh, David K.; Brenner, David A.; Doyle, Francis J.; Schultz, Peter G.; Kay, Steve A.

2013-01-01

Impairment of the circadian clock has been associated with numerous disorders, including metabolic disease. Although small molecules that modulate clock function might offer therapeutic approaches to such diseases, only a few compound have been identified that selectively target core clock proteins. From an unbiased cell-based circadian screen, we identified KL001, a small molecule that specifically interacts with cryptochrome (CRY). KL001 prevented ubiquitin-dependent degradation of CRY, resulting in lengthening of the circadian period. In combination with mathematical modeling, KL001 revealed that CRY1 and CRY2 share a similar functional role in the period regulation. Furthermore, KL001- mediated CRY stabilization inhibited glucagon-induced gluconeogenesis in primary hepatocytes. KL001 thus provides a tool to study the regulation of CRY-dependent physiology and aid development of clock-based therapeutics of diabetes. PMID:22798407

Field-Evolved Resistance in Corn Earworm to Cry Proteins Expressed by Transgenic Sweet Corn

PubMed Central

Dively, Galen P.; Finkenbinder, Chad

2016-01-01

Background Transgenic corn engineered with genes expressing insecticidal toxins from the bacterium Bacillus thuringiensis (Berliner) (Bt) are now a major tool in insect pest management. With its widespread use, insect resistance is a major threat to the sustainability of the Bt transgenic technology. For all Bt corn expressing Cry toxins, the high dose requirement for resistance management is not achieved for corn earworm, Helicoverpa zea (Boddie), which is more tolerant to the Bt toxins. Methodology/Major Findings We present field monitoring data using Cry1Ab (1996–2016) and Cry1A.105+Cry2Ab2 (2010–2016) expressing sweet corn hybrids as in-field screens to measure changes in field efficacy and Cry toxin susceptibility to H. zea. Larvae successfully damaged an increasing proportion of ears, consumed more kernel area, and reached later developmental stages (4th - 6th instars) in both types of Bt hybrids (Cry1Ab—event Bt11, and Cry1A.105+Cry2Ab2—event MON89034) since their commercial introduction. Yearly patterns of H. zea population abundance were unrelated to reductions in control efficacy. There was no evidence of field efficacy or tissue toxicity differences among different Cry1Ab hybrids that could contribute to the decline in control efficacy. Supportive data from laboratory bioassays demonstrate significant differences in weight gain and fitness characteristics between the Maryland H. zea strain and a susceptible strain. In bioassays with Cry1Ab expressing green leaf tissue, Maryland H. zea strain gained more weight than the susceptible strain at all concentrations tested. Fitness of the Maryland H. zea strain was significantly lower than that of the susceptible strain as indicated by lower hatch rate, longer time to adult eclosion, lower pupal weight, and reduced survival to adulthood. Conclusions/Significance After ruling out possible contributing factors, the rapid change in field efficacy in recent years and decreased susceptibility of H. zea to Bt sweet corn provide strong evidence of field-evolved resistance in H. zea populations to multiple Cry toxins. The high adoption rate of Bt field corn and cotton, along with the moderate dose expression of Cry1Ab and related Cry toxins in these crops, and decreasing refuge compliance probably contributed to the evolution of resistance. Our results have important implications for resistance monitoring, refuge requirements and other regulatory policies, cross-resistance issues, and the sustainability of the pyramided Bt technology. PMID:28036388

Agrobacterium-transformed rice plants expressing synthetic cryIA(b) and cryIA(c) genes are highly toxic to striped stem borer and yellow stem borer.

PubMed

Cheng, X; Sardana, R; Kaplan, H; Altosaar, I

1998-03-17

Over 2,600 transgenic rice plants in nine strains were regenerated from >500 independently selected hygromycin-resistant calli after Agrobacterium-mediated transformation. The plants were transformed with fully modified (plant codon optimized) versions of two synthetic cryIA(b) and cryIA(c) coding sequences from Bacillus thuringiensis as well as the hph and gus genes, coding for hygromycin phosphotransferase and beta-glucuronidase, respectively. These sequences were placed under control of the maize ubiquitin promoter, the CaMV35S promoter, and the Brassica Bp10 gene promoter to achieve high and tissue-specific expression of the lepidopteran-specific delta-endotoxins. The integration, expression, and inheritance of these genes were demonstrated in R0 and R1 generations by Southern, Northern, and Western analyses and by other techniques. Accumulation of high levels (up to 3% of soluble proteins) of CryIA(b) and CryIA(c) proteins was detected in R0 plants. Bioassays with R1 transgenic plants indicated that the transgenic plants were highly toxic to two major rice insect pests, striped stem borer (Chilo suppressalis) and yellow stem borer (Scirpophaga incertulas), with mortalities of 97-100% within 5 days after infestation, thus offering a potential for effective insect resistance in transgenic rice plants.

A challenge for the seed mixture refuge strategy in Bt maize: impact of cross-pollination on an ear-feeding pest, corn earworm.

PubMed

Yang, Fei; Kerns, David L; Head, Graham P; Leonard, B Rogers; Levy, Ronnie; Niu, Ying; Huang, Fangneng

2014-01-01

To counter the threat of insect resistance, Bacillus thuringiensis (Bt) maize growers in the U.S. are required to plant structured non-Bt maize refuges. Concerns with refuge compliance led to the introduction of seed mixtures, also called RIB (refuge-in-the-bag), as an alternative approach for implementing refuge for Bt maize products in the U.S. Maize Belt. A major concern in RIB is cross-pollination of maize hybrids that can cause Bt proteins to be present in refuge maize kernels and negatively affect refuge insects. Here we show that a mixed planting of 5% nonBt and 95% Bt maize containing the SmartStax traits expressing Cry1A.105, Cry2Ab2 and Cry1F did not provide an effective refuge for an important above-ground ear-feeding pest, the corn earworm, Helicoverpa zea (Boddie). Cross-pollination in RIB caused a majority (>90%) of refuge kernels to express ≥ one Bt protein. The contamination of Bt proteins in the refuge ears reduced neonate-to-adult survivorship of H. zea to only 4.6%, a reduction of 88.1% relative to larvae feeding on ears of pure non-Bt maize plantings. In addition, the limited survivors on refuge ears had lower pupal mass and took longer to develop to adults.

BA321, a novel carborane analog that binds to androgen and estrogen receptors, acts as a new selective androgen receptor modulator of bone in male mice

DOE Office of Scientific and Technical Information (OSTI.GOV)

Watanabe, Kenta; Cooperative Major in Advanced Health Science, Tokyo University of Agriculture and Technology, 2-24-16 Nakamachi, Koganei, Tokyo 184-8588; Hirata, Michiko

Carboranes are a class of carbon-containing polyhedral boron cluster compounds with globular geometry and hydrophobic surface that interact with hormone receptors such as estrogen receptor (ER) and androgen receptor (AR). We have synthesized BA321, a novel carborane compound, which binds to AR. We found here that it also binds to ERs, ERα and ERβ. In orchidectomized (ORX) mice, femoral bone mass was markedly reduced due to androgen deficiency and BA321 restored bone loss in the male, whilst the decreased weight of seminal vesicle in ORX mice was not recovered by administration of BA321. In female mice, BA321 acts as amore » pure estrogen agonist, and restored both the loss of bone mass and uterine atrophy due to estrogen deficiency in ovariectomized (OVX) mice. In bone tissues, the trabecular bone loss occurred in both ORX and OVX mice, and BA321 completely restored the trabecular bone loss in both sexes. Cortical bone loss occurred in ORX mice but not in OVX mice, and BA321 clearly restored cortical bone loss due to androgen deficiency in ORX mice. Therefore, BA321 is a novel selective androgen receptor modulator (SARM) that may offer a new therapy option for osteoporosis in the male. - Highlights: • A novel carborane compound BA321 binds to both AR and ERs, ERα and ERβ. • BA321 restores bone loss in orchidectomized mice without effects on sex organ. • BA321 acts as an estrogen agonist in bone and uterus in ovariectomized mice. • BA321 may be a new SARM to prevent the loss of musculoskeletal mass in elder men.« less

Impaired bile acid handling and aggravated liver injury in mice expressing a hepatocyte-specific RXRα variant lacking the DNA-binding domain.

PubMed

Kosters, Astrid; Felix, Julio C; Desai, Moreshwar S; Karpen, Saul J

2014-02-01

Retinoid X Receptor α (RXRα) is the principal heterodimerization partner of class II Nuclear Receptors (NRs), and a major regulator of gene expression of numerous hepatic processes, including bile acid (BA) homeostasis through multiple partners. Specific contributions of hepatic RXRα domains in heterodimer function in response to either BA load or ductular cholestasis are not fully characterized. Wild-type (WT) mice and mice expressing a hepatocyte-specific RXRα lacking the DNA-Binding-Domain (hs-RxrαΔex4(-/-)), which retains partial ability to heterodimerize with its partners, were fed a 1% cholic acid (CA) diet for 5 days, a 3,5-diethoxycarbonyl-1,4-dihydrocollidine (DDC) diet for 3 weeks, or control diet. Serum ALT (6.5-fold; p<0.05), AST (9.3-fold; p=0.06) and BA (2.8-fold; p<0.05) were increased in CA-fed hs-RxαΔex4(-/-) mice compared to CA-fed WT mice, but were equally induced between genotypes by DDC-feeding. CA-feeding elevated total (4.4-fold; p=0.06) and unconjugated (2.2-fold; p<0.02) bilirubin levels in hs-RxrαΔex4(-/-) mice compared to WT mice, but not in DDC-fed hs-RxrαΔex4(-/-) mice. Increased necrosis and inflammation was observed in CA-fed, but not in DDC-fed hs-RxrαΔex4(-/-) mice. Apoptotic markers DR5, CK8, CK18 RNA were increased in CA- and DDC-fed hs-RxrαΔex4(-/-) mice. Cleaved caspase 3, CK18 and p-JNK protein were elevated in CA-fed but not in DDC-fed hs-RxrαΔex4(-/-) mice. Induction of Ostβ and Cyp2b10 RNA was impaired in CA-fed and DDC-fed hs-RxrαΔex4(-/-) mice. Surprisingly, DDC-fed hs-RxrαΔex4(-/-) mice showed attenuated fibrosis compared to DDC-fed WT mice. These two models of cholestasis identify common and injury-specific roles for RXRα heterodimers and the functional relevance of an intact RXRα-DBD in the hepatocytic adaptive cholestatic response. Copyright © 2013 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved.

Characterization of parasporin gene harboring Indian isolates of Bacillus thuringiensis.

PubMed

Lenina, N K; Naveenkumar, A; Sozhavendan, A E; Balakrishnan, N; Balasubramani, V; Udayasuriyan, V

2014-10-01

Bacillus thuringiensis (Bt) is popularly known as insecticidal bacterium. However, non-insecticidal Bt strains are more extensively available in natural environment than the insecticidal ones. Parasporin (PS) is a collection of genealogically heterogeneous Cry proteins synthesized in non-insecticidal isolates of Bt. An important character generally related with PS proteins is their strong cytocidal activity preferentially on human cancer cells of various origins. Identification and characterization of novel parasporin protein which are non-hemolytic and non-insecticidal but having selective anticancer activity raise the possibility of a novel application of Bt in medical field. In the present study, seven new indigenous isolates (T6, T37, T68, T98, T165, T186, and T461) of Bt showed variation in colony morphology, crystal characters and protein profiles with each other. Out of the seven new isolates screened for parasporin (ps) and cry genes, two of the new indigenous isolates (T98 and T186) of Bt showed the presence of ps4 gene. Partial ps4 gene was cloned from the two new isolates and the sequence of partial ps4 gene showed high homology with its holotype ps4Aa1. These two isolates were characterized based on the proteolytic processing of the inclusion proteins and the proteolytic products were found to be comparable to the PS4 reference strain A1470. The two isolates of Bt did not show toxicity toward Spodoptera litura and Helicoverpa armigera. Based on the results of this study, it can be concluded that the isolates T98 and T186 are parasporin producers.

Platelet-derived growth factor receptor mediates activation of ras through different signaling pathways in different cell types.

PubMed Central

Satoh, T; Fantl, W J; Escobedo, J A; Williams, L T; Kaziro, Y

1993-01-01

A series of pieces of evidence have shown that Ras protein acts as a transducer of the platelet-derived growth factor (PDGF) receptor-mediated signaling pathway: (i) formation of Ras.GTP is detected immediately on PDGF stimulation, and (ii) a dominant inhibitory mutant Ras, as well as a neutralizing anti-Ras antibody, can interfere with PDGF-induced responses. On the other hand, several signal transducing molecules including phosphatidylinositol 3-kinase (PI3-K), GTPase-activating protein (GAP), and phospholipase C gamma (PLC gamma) bind directly to the PDGF receptor and become tyrosine phosphorylated. Recently, it was shown that specific phosphorylated tyrosines of the PDGF receptor are responsible for interaction between the receptor and each signaling molecule. However, the roles of these signaling molecules have not been elucidated, and it remains unclear which molecules are implicated in the Ras pathway. In this study, we measured Ras activation in cell lines expressing mutant PDGF receptors that are deficient in coupling with specific molecules. In fibroblast CHO cells, a mutant receptor (Y708F/Y719F [PI3-K-binding sites]) was unable to stimulate Ras, whereas another mutant (Y739F [the GAP-binding site]) could do so, suggesting an indispensable role of PI3-K or a protein that binds to the same sites as PI3-K for PDGF-stimulated Ras activation. By contrast, both of the above mutants were capable of stimulating Ras protein in a pro-B-cell line, BaF3. Furthermore, a mutant receptor (Y977F/Y989F [PLC gamma-binding sites]) could fully activate Ras, and the direct activation of protein kinase C and calcium mobilization had almost no effect on the GDP/GTP state of Ras in this cell line. These results suggest that, in the pro-B-cell transfectants, each of the above pathways (PI3-K, GAP, and PLC gamma) can be eliminated without a loss of Ras activation. It remains unclear whether another unknown essential pathway which regulates Ras protein exists within BaF3 cells. Therefore, it is likely that several different PDGF receptor-mediated signaling pathways function upstream of Ras, and the extent of the contribution of each pathway for the regulation of Ras may differ among different cell types. Images PMID:8388543

Deactivation of the E. coli pH stress sensor CadC by cadaverine.

PubMed

Haneburger, Ina; Fritz, Georg; Jurkschat, Nicole; Tetsch, Larissa; Eichinger, Andreas; Skerra, Arne; Gerland, Ulrich; Jung, Kirsten

2012-11-23

At acidic pH and in the presence of lysine, the pH sensor CadC activates transcription of the cadBA operon encoding the lysine/cadaverine antiporter CadB and the lysine decarboxylase CadA. In effect, these proteins contribute to acid stress adaptation in Escherichia coli. cadBA expression is feedback inhibited by cadaverine, and a cadaverine binding site is predicted within the central cavity of the periplasmic domain of CadC on the basis of its crystallographic analysis. Our present study demonstrates that this site only partially accounts for the cadaverine response in vivo. Instead, evidence for a second, pivotal binding site was collected, which overlaps with the pH-responsive patch of amino acids located at the dimer interface of the periplasmic domain. The temporal response of the E. coli Cad module upon acid shock was measured and modeled for two CadC variants with mutated cadaverine binding sites. These studies supported a cascade-like binding and deactivation model for the CadC dimer: binding of cadaverine within the pair of central cavities triggers a conformational transition that exposes two further binding sites at the dimer interface, and the occupation of those stabilizes the inactive conformation. Altogether, these data represent a striking example for the deactivation of a pH sensor. Copyright © 2012 Elsevier Ltd. All rights reserved.

Optimizing Urine Processing Protocols for Protein and Metabolite Detection.

PubMed

Siddiqui, Nazema Y; DuBois, Laura G; St John-Williams, Lisa; Will, Thompson J; Grenier, Carole; Burke, Emily; Fraser, Matthew O; Amundsen, Cindy L; Murphy, Susan K

In urine, factors such as timing of voids, and duration at room temperature (RT) may affect the quality of recovered protein and metabolite data. Additives may aid with detection, but can add more complexity in sample collection or analysis. We aimed to identify the optimal urine processing protocol for clinically-obtained urine samples that allows for the highest protein and metabolite yields with minimal degradation. Healthy women provided multiple urine samples during the same day. Women collected their first morning (1 st AM) void and another "random void". Random voids were aliquotted with: 1) no additive; 2) boric acid (BA); 3) protease inhibitor (PI); or 4) both BA + PI. Of these aliquots, some were immediately stored at 4°C, and some were left at RT for 4 hours. Proteins and individual metabolites were quantified, normalized to creatinine concentrations, and compared across processing conditions. Sample pools corresponding to each processing condition were analyzed using mass spectrometry to assess protein degradation. Ten Caucasian women between 35-65 years of age provided paired 1 st morning and random voided urine samples. Normalized protein concentrations were slightly higher in 1 st AM compared to random "spot" voids. The addition of BA did not significantly change proteins, while PI significantly improved normalized protein concentrations, regardless of whether samples were immediately cooled or left at RT for 4 hours. In pooled samples, there were minimal differences in protein degradation under the various conditions we tested. In metabolite analyses, there were significant differences in individual amino acids based on the timing of the void. For comparative translational research using urine, information about void timing should be collected and standardized. For urine samples processed in the same day, BA does not appear to be necessary while the addition of PI enhances protein yields, regardless of 4°C or RT storage temperature.

Construction and characterisation of near-isogenic Plutella xylostella (Lepidoptera: Plutellidae) strains resistant to Cry1Ac toxin.

PubMed

Zhu, Xun; Lei, Yanyuan; Yang, Yanjv; Baxter, Simon W; Li, Jianhong; Wu, Qingjun; Wang, Shaoli; Xie, Wen; Guo, Zhaojiang; Fu, Wei; Zhang, Youjun

2015-02-01

Resistance to insecticidal Bacillus thuringiensis (Bt) toxins has arisen in multiple populations of the worldwide Brassica pest Plutella xylostella (L.). To help elucidate the mechanism of resistance to Bt Cry1Ac toxin in a population from Florida, two pairs of near-isogenic lines (NILs) were developed. NILs were generated using either backcross or recombinant inbred line methodologies and evaluated for near-isogenicity with inter-simple-sequence-repeat (ISSR) markers. Backcross line BC6F4 maintained a similar level of Cry1Ac resistance to parental strain DBM1Ac-R (>5000-fold) yet showed 98.24% genetic similarity to the susceptible parental strain DBM1Ac-S. Single-pair backcrosses between DBM1Ac-S and BC6F4 revealed that Cry1Ac resistance was controlled by one recessive autosomal locus. BC6F4 exhibited high levels of cross-resistance to Cry1Ab and Cry1Ah but not to Cry1Ca or Cry1Ie. Near-isogenic strains were constructed to provide a reliable biological system to investigate the mechanism of Cry1Ac resistance in P. xylostella. These data suggest that resistance to Cry1Ac, Cry1Ab and Cry1Ah is probably caused by the alteration of a common receptor not recognised by Cry1Ca or Cry1Ie. Understanding Bt toxin cross-resistance provides valuable information to consider when developing pest control strategies to delay resistance evolution. © 2014 Society of Chemical Industry. © 2014 Society of Chemical Industry.

Kinetics and Mechanism Study of Competitive Inhibition of Jack-Bean Urease by Baicalin

PubMed Central

Tan, Lirong; Su, Jiyan; Wu, Dianwei; Yu, Xiaodan; Su, Zuqing; Wu, Xiaoli; Kong, Songzhi; Lai, Xiaoping; Lin, Ji; Su, Ziren

2013-01-01

Baicalin (BA) is the principal component of Radix Scutellariae responsible for its pharmacological activity. In this study, kinetics and mechanism of inhibition by BA against jack-bean urease were investigated for its therapeutic potential. It was revealed that the IC50 of BA against jack-bean urease was 2.74 ± 0.51 mM, which was proved to be a competitive and concentration-dependent inhibition with slow-binding progress curves. The rapid formation of initial BA-urease complex with an inhibition constant of K i = 3.89 × 10−3 mM was followed by a slow isomerization into the final complex with an overall inhibition constant of K i* = 1.47 × 10−4 mM. High effectiveness of thiol protectors against BA inhibition indicated that the strategic role of the active-site sulfhydryl group of the urease was involved in the blocking process. Moreover, the inhibition of BA was proved to be reversible due to the fact that urease could be reactivated by dithiothreitol but not reactant dilution. Molecular docking assay suggested that BA made contacts with the important activating sulfhydryl group Cys-592 residues and restricted the mobility of the active-site flap. Taken together, it could be deduced that BA was a competitive inhibitor targeting thiol groups of urease in a slow-binding manner both reversibly and concentration-dependently, serving as a promising urease inhibitor for treatments on urease-related diseases. PMID:24198731

New insights into the application of the valence rules in Zintl phases—Crystal and electronic structures of Ba{sub 7}Ga{sub 4}P{sub 9}, Ba{sub 7}Ga{sub 4}As{sub 9}, Ba{sub 7}Al{sub 4}Sb{sub 9}, Ba{sub 6}CaAl{sub 4}Sb{sub 9}, and Ba{sub 6}CaGa{sub 4}Sb{sub 9}

DOE Office of Scientific and Technical Information (OSTI.GOV)

He, Hua; Stoyko, Stanislav; Bobev, Svilen, E-mail: bobev@udel.edu

Crystals of three new ternary pnictides—Ba{sub 7}Al{sub 4}Sb{sub 9}, Ba{sub 7}Ga{sub 4}P{sub 9}, and Ba{sub 7}Ga{sub 4}As{sub 9} have been prepared by reactions of the respective elements in molten Al or Pb fluxes. Single-crystal X-ray diffraction studies reveal that the three phases are isotypic, crystallizing in the orthorhombic Ba{sub 7}Ga{sub 4}Sb{sub 9}-type structure (space group Pmmn, Pearson symbol oP40, Z=2), for which only the prototype is known. The structure is based on TrPn{sub 4} tetrahedra (Tr=Al, Ga; Pn=P, As, Sb), connected in an intricate scheme into 1D-ribbons. Long interchain Pn–Pn bonds (d{sub P–P}>3.0 Å; d{sub As–As}>3.1 Å; d{sub Sb–Sb}>3.3 Å)more » account for the realization of 2D-layers, separated by Ba{sup 2+} cations. Applying the classic valance rules to rationalize the bonding apparently fails, and Ba{sub 7}Ga{sub 4}Sb{sub 9} has long been known as a metallic Zintl phase. Earlier theoretical calculations, both empirical and ab-initio, suggest that the possible metallic properties originate from filled anti-bonding Pn–Pn states, and the special roles of the “cations” in this crystal structure. To experimentally probe this hypothesis, we sought to synthesize the ordered quaternary phases Ba{sub 6}CaTr{sub 4}Sb{sub 9} (Tr=Al, Ga). Single-crystal X-ray diffraction work confirms Ba{sub 6.145(3)}Ca{sub 0.855}Al{sub 4}Sb{sub 9} and Ba{sub 6.235(3)}Ca{sub 0.765}Ga{sub 4}Sb{sub 9}, with Ca atoms preferably substituting Ba on one of the three available sites. The nuances of the five crystal structures are discussed, and the chemical bonding in Ba{sub 7}Ga{sub 4}As{sub 9} is interrogated by tight-binding linear muffin-tin orbital calculations. - Graphical abstract: The new Zintl phases—Ba{sub 7}Al{sub 4}Sb{sub 9}, Ba{sub 7}Ga{sub 4}P{sub 9}, and Ba{sub 7}Ga{sub 4}As{sub 9}, and their quaternary variants Ba{sub 6}CaTr{sub 4}Sb{sub 9} (Tr=Al, Ga)—crystallize in the Ba{sub 7}Ga{sub 4}Sb{sub 9} structure type. The structures are based on TrPn{sub 4} tetrahedra (a perspective of the crystal structure is shown, as viewed along the c axis). - Highlights: • Ba{sub 7}Al{sub 4}Sb{sub 9}, Ba{sub 7}Ga{sub 4}P{sub 9}, and Ba{sub 7}Ga{sub 4}As{sub 9} are new compounds in the respective phase diagrams. • The quaternary phases Ba{sub 6}CaTr{sub 4}Sb{sub 9} (Tr=Al, Ga) show nearly ordered Ba/Ca distribution. • Very weak Pn–Pn bonds and pairing distortion are observed for Ba{sub 7}Ga{sub 4}Pn{sub 9} (Pn=P, As).« less

Fitness Costs Related To Selection for Resistance to the Cry3Bb1 Protein in a Genetically Diverse Population of Non-diapausing Western Corn Rootworm

USDA-ARS?s Scientific Manuscript database

The western corn rootworm (Diabrotica virgifera virgifera LeConte) is an important pest of maize in North America. Since approved for commercial use in 2003, the acreage planted to maize (Zea mays L.) expressing the Bt derived Cry3Bb1 protein has significantly increased each year in the United State...

Optimization of Cry3A yields in Bacillus thuringiensis by use of sporulation-dependent promoters in combination with the STAB-SD mRNA sequence

Treesearch

Hyun-woo Park; Baoxue Ge; Leah S. Bauer; Brian A. Federici

1998-01-01

The insecticidal activity of Bacillus thuringiensis strains toxic to coleopterous insects is due to Cry3 proteins assembled into small rectangular crystals. Toxin synthesis in these strains is dependent primarily upon a promoter that is active in the stationary phase and a STAB-SD sequence that stabilizes the cry3 transcript-ribosome complex. Here we show that...

Laboratory evaluation of transgenic Populus davidiana×Populus bolleana expressing Cry1Ac + SCK, Cry1Ah3, and Cry9Aa3 genes against gypsy moth and fall webworm.

PubMed

Ding, Liping; Chen, Yajuan; Wei, Xiaoli; Ni, Mi; Zhang, Jiewei; Wang, Hongzhi; Zhu, Zhen; Wei, Jianhua

2017-01-01

Transgenic poplar lines 'Shanxin' (Populus davidiana×Populus bolleana) were generated via Agrobacterium-mediated transformation. The transgenic lines carried the expression cassettes of Cry1Ac + SCK, Cry1Ah3, and Cry9Aa3, respectively. The expression levels of the exogenous insect resistance genes in the transgenic lines were determined by Q-PCR and Western blot. Leaves of the transgenic lines were used for insect feeding bioassays on first instar larvae of the gypsy moth (Lymantria dispar) and fall webworm (Hyphantria cunea). At 5 d of feeding, the mean mortalities of larvae feeding on Cry1Ac + SCK and Cry1Ah3 transgenic poplars leaves were 97% and 91%, while mortality on Cry9Aa3 transgenic lines was about 49%. All gypsy moth and fall webworm larvae were killed in 7-9 days after feeding on leaves from Cry1Ac + SCK or Cry1Ah3 transgenic poplars, while all the fall webworm larvae were killed in 11 days and about 80% of gypsy moth larvae were dead in 14 days after feeding on those from Cry9Aa3 transgenic lines. It was concluded that the transgenic lines of Cry1Ac + SCK and Cry1Ah3 were highly toxic to larvae of both insect species while lines with Cry9Aa3 had lower toxicity,and H. cunea larvae are more sensitive to the insecticidal proteins compared to L. dispar. Transgenic poplar lines toxic to L. dispar and H. cunea could be used to provide Lepidoptera pest resistance to selected strains of poplar trees.

Cryptochrome 1 in Retinal Cone Photoreceptors Suggests a Novel Functional Role in Mammals

PubMed Central

Nießner, Christine; Denzau, Susanne; Malkemper, Erich Pascal; Gross, Julia Christina; Burda, Hynek; Winklhofer, Michael; Peichl, Leo

2016-01-01

Cryptochromes are a ubiquitous group of blue-light absorbing flavoproteins that in the mammalian retina have an important role in the circadian clock. In birds, cryptochrome 1a (Cry1a), localized in the UV/violet-sensitive S1 cone photoreceptors, is proposed to be the retinal receptor molecule of the light-dependent magnetic compass. The retinal localization of mammalian Cry1, homologue to avian Cry1a, is unknown, and it is open whether mammalian Cry1 is also involved in magnetic field sensing. To constrain the possible role of retinal Cry1, we immunohistochemically analysed 90 mammalian species across 48 families in 16 orders, using an antiserum against the Cry1 C-terminus that in birds labels only the photo-activated conformation. In the Carnivora families Canidae, Mustelidae and Ursidae, and in some Primates, Cry1 was consistently labeled in the outer segment of the shortwave-sensitive S1 cones. This finding would be compatible with a magnetoreceptive function of Cry1 in these taxa. In all other taxa, Cry1 was not detected by the antiserum that likely also in mammals labels the photo-activated conformation, although Western blots showed Cry1 in mouse retinal cell nuclei. We speculate that in the mouse and the other negative-tested mammals Cry1 is involved in circadian functions as a non-light-responsive protein. PMID:26898837

Cryptochrome 1 in Retinal Cone Photoreceptors Suggests a Novel Functional Role in Mammals.

PubMed

Nießner, Christine; Denzau, Susanne; Malkemper, Erich Pascal; Gross, Julia Christina; Burda, Hynek; Winklhofer, Michael; Peichl, Leo

2016-02-22

Cryptochromes are a ubiquitous group of blue-light absorbing flavoproteins that in the mammalian retina have an important role in the circadian clock. In birds, cryptochrome 1a (Cry1a), localized in the UV/violet-sensitive S1 cone photoreceptors, is proposed to be the retinal receptor molecule of the light-dependent magnetic compass. The retinal localization of mammalian Cry1, homologue to avian Cry1a, is unknown, and it is open whether mammalian Cry1 is also involved in magnetic field sensing. To constrain the possible role of retinal Cry1, we immunohistochemically analysed 90 mammalian species across 48 families in 16 orders, using an antiserum against the Cry1 C-terminus that in birds labels only the photo-activated conformation. In the Carnivora families Canidae, Mustelidae and Ursidae, and in some Primates, Cry1 was consistently labeled in the outer segment of the shortwave-sensitive S1 cones. This finding would be compatible with a magnetoreceptive function of Cry1 in these taxa. In all other taxa, Cry1 was not detected by the antiserum that likely also in mammals labels the photo-activated conformation, although Western blots showed Cry1 in mouse retinal cell nuclei. We speculate that in the mouse and the other negative-tested mammals Cry1 is involved in circadian functions as a non-light-responsive protein.

Army Sustainment. Volume 44, Issue 2, March-April 2012

DTIC Science & Technology

2012-04-01

b.a. deGree in criMinal justice adMinistration froM con- cordia colleGe in MicHiGan. He is leVel iii certified in loGistics ManaGeMent and leVel ii...book and unit supply), plant maintenance, finance, and Defense Forces and Public Security (DFPS). Together, these modules provide enhanced...maintenance-related information for all assigned assets. The plant maintenance module provides users with equipment readiness and enhanced personnel

Bacillus thuringiensis Cry5B protein as a new pan-hookworm cure.

PubMed

Hu, Yan; Nguyen, Thanh-Thanh; Lee, Alice C Y; Urban, Joseph F; Miller, Melanie M; Zhan, Bin; Koch, David J; Noon, Jason B; Abraham, Ambily; Fujiwara, Ricardo Toshio; Bowman, Dwight D; Ostroff, Gary R; Aroian, Raffi V

2018-05-04

Hookworms are intestinal nematode parasites that infect nearly half a billion people and are globally one of the most important contributors to iron-deficiency anemia. These parasites have significant impacts in developing children, pregnant women and working adults. Of all the soil-transmitted helminths or nematodes (STNs), hookworms are by far the most important, with disease burdens conservatively estimated at four million DALYs (Disability-Adjusted Life Years) and with productivity losses of up to US$139 billion annually. To date, mainly one drug, albendazole is used for hookworm therapy in mass drug administration, which has on average ∼80% cure rate that is lower (<40%) in some places. Given the massive numbers of people needing treatment, the threat of parasite resistance, and the inadequacy of current treatments, new and better cures against hookworms are urgently needed. Cry5B, a pore-forming protein produced by the soil bacterium Bacillus thuringiensis (Bt) has demonstrated good efficacy against Ancylostoma ceylanicum hookworm infections in hamsters. Here we broaden studies of Cry5B to include tests against infections of Ancylostoma caninum hookworms in dogs and against infections of the dominant human hookworm, Necator americanus, in hamsters. We show that Cry5B is highly effective against all hookworm parasites tested in all models. Neutralization of stomach acid improves Cry5B efficacy, which will aid in practical application of Cry5B significantly. Importantly, we also demonstrate that the anti-nematode therapeutic efficacy of Cry5B is independent of the host immune system and is not itself negated by repeated dosing. This study indicates that Bt Cry5B is a pan-hookworm anthelmintic with excellent properties for use in humans and other animals. Copyright © 2018. Published by Elsevier Ltd.

Understanding blue-light photoreceptors

NASA Astrophysics Data System (ADS)

Crane, Brian

Blue-light sensing proteins coordinate many biological processes that include phototropism, photomorphism, stress responses, virulence and the entrainment of circadian clocks. Three major types of blue-light sensors all bind flavin nucleotides as chromophores, but the photochemistry employed and conformational responses invoked differ considerably among the classes. Nevertheless, photoinduced electron transfer reactions play a key role in many mechanisms. How such reactivity leads to conformational signaling will be discussed for both cryptochromes (CRYs) and light- oxygen- voltage (LOV) domains. In CRYs, blue-light mediated flavin reduction promotes proton transfer within the active center that then leads to displacement of a key signaling element. For LOV proteins, blue light causes formation of a covalent cysteinyl-flavin adduct, which rearranges hydrogen bonding and restructures the N-terminal region of the protein. Interestingly, a new class of LOV-like sensor does not undergo adduct formation and instead can operate by flavin photoreduction, like CRY. Conserved aspects of reactivity in these proteins provide lessons for the design of new photosensors, which may find use as tools in optogenetics Supported by NIH GM079679.

Genomic sequences of murine gamma B- and gamma C-crystallin-encoding genes: promoter analysis and complete evolutionary pattern of mouse, rat and human gamma-crystallins.

PubMed

Graw, J; Liebstein, A; Pietrowski, D; Schmitt-John, T; Werner, T

1993-12-22

The murine genes, gamma B-cry and gamma C-cry, encoding the gamma B- and gamma C-crystallins, were isolated from a genomic DNA library. The complete nucleotide (nt) sequences of both genes were determined from 661 and 711 bp, respectively, upstream from the first exon to the corresponding polyadenylation sites, comprising more than 2650 and 2890 bp, respectively. The new sequences were compared to the partial cDNA sequences available for the murine gamma B-cry and gamma C-cry, as well as to the corresponding genomic sequences from rat and man, at both the nt and predicted amino acid (aa) sequence levels. In the gamma B-cry promoter region, a canonical CCAAT-box, a TATA-box, putative NF-I and C/EBP sites were detected. An R-repeat is inserted 366 bp upstream from the transcription start point. In contrast, the gamma C-cry promoter does not contain a CCAAT-box, but some other putative binding sites for transcription factors (AP-2, UBP-1, LBP-1) were located by computer analysis. The promoter regions of all six gamma-cry from mouse, rat and human, except human psi gamma F-cry, were analyzed for common sequence elements. A complex sequence element of about 70-80 bp was found in the proximal promoter, which contains a gamma-cry-specific and almost invariant sequence (crygpel) of 14 nt, and ends with the also invariant TATA-box. Within the complex sequence element, a minimum of three further features specific for the gamma A-, gamma B- and gamma D/E/F-cry genes can be defined, at least two of which were recently shown to be functional. In addition to these four sequence elements, a subtype-specific structure of inverted repeats with different-sized spacers can be deduced from the multiple sequence alignment. A phylogenetic analysis based on the promoter region, as well as the complete exon 3 of all gamma-cry from mouse, rat and man, suggests separation of only five gamma-cry subtypes (gamma A-, gamma B-, gamma C-, gamma D- and gamma E/F-cry) prior to species separation.

Key genes and pathways in measles and their interaction with environmental chemicals

PubMed Central

Zhang, Rongqiang; Jiang, Hualin; Li, Fengying; Su, Ning; Ding, Yi; Mao, Xiang; Ren, Dan; Wang, Jing

2018-01-01

The aim of the present study was to explore key genes that may have a role in the pathology of measles virus infection and to clarify the interaction networks between environmental factors and differentially expressed genes (DEGs). After screening the database of the Gene Expression Omnibus of the National Center for Biotechnology Information, the dataset GSE5808 was downloaded and analyzed. A global normalization method was performed to minimize data inconsistencies and heterogeneity. DEGs during different stages of measles virus infection were explored using R software (v3.4.0). Gene Ontology and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis of the DEGs were performed using Cytoscape 3.4.0 software. A protein-protein interaction (PPI) network of the DEGs was obtained from the STRING database v9.05. A total of 43 DEGs were obtained from four analyzed sample groups, including 10 highly expressed genes and 33 genes with decreased expression. The most enriched pathways based on KEGG analysis were fatty acid elongation, cytokine-cytokine receptor interaction and RNA degradation. The genes mentioned in the PPI network were mainly associated with protein binding and chemokine activity. A total of 219 chemicals were identified that may, jointly or on their own, interact with the 6 DEGs between the control group and patients with measles (at hospital entry), including benzo(a)pyrene (BaP) and tetrachlorodibenzodioxin (TCDD). In conclusion, the present study revealed that chemokines and environmental chemicals, e.g. BaP and TCDD, may affect the development of measles. PMID:29805511

Bile acids-mediated overexpression of MUC4 via FAK-dependent c-Jun activation in pancreatic cancer.

PubMed

Joshi, Suhasini; Cruz, Eric; Rachagani, Satyanarayana; Guha, Sushovan; Brand, Randall E; Ponnusamy, Moorthy P; Kumar, Sushil; Batra, Surinder K

2016-08-01

The majority of pancreatic cancer (PC) patients are clinically presented with obstructive jaundice with elevated levels of circulatory bilirubin and alkaline phosphatases. In the current study, we examined the implications of bile acids (BA), an important component of bile, on the pathophysiology of PC and investigated their mechanistic association in tumor-promoting functions. Integration of results from PC patient samples and autochthonous mouse models showed an elevated levels of BA (p < 0.05) in serum samples compared to healthy controls. Similarly, an elevated BA levels was observed in pancreatic juice derived from PC patients (p < 0.05) than non-pancreatic non-healthy (NPNH) controls, further establishing the clinical association of BA with the pathogenesis of PC. The tumor-promoting functions of BA were established by observed transcriptional upregulation of oncogenic MUC4 expression. Luciferase reporter assay revealed distal MUC4 promoter as the primary responsive site to BA. In silico analysis recognized two c-Jun binding sites at MUC4 distal promoter, which was biochemically established using ChIP assay. Interestingly, BA treatment led to an increased transcription and activation of c-Jun in a FAK-dependent manner. Additionally, BA receptor, namely FXR, which is also upregulated at transcriptional level in PC patient samples, was demonstrated as an upstream molecule in BA-mediated FAK activation, plausibly by regulating Src activation. Altogether, these results demonstrate that elevated levels of BA increase the tumorigenic potential of PC cells by inducing FXR/FAK/c-Jun axis to upregulate MUC4 expression, which is overexpressed in pancreatic tumors and is known to be associated with progression and metastasis of PC. Published by Elsevier B.V.

Molecular identification of Bacillus thuringiensis var. israelensis to trace its fate after application as a biological insecticide in wetland ecosystems.

PubMed

De Respinis, S; Demarta, A; Patocchi, N; Lüthy, P; Peduzzi, R; Tonolla, M

2006-11-01

To determine the fate of viable Bacillus thuringiensis var. israelensis (Bti) spores dispersed in the environment, using a universally applicable molecular detection methodology. Soil samples were spread on growth medium, after a temperature selection of the spores. A PCR amplification of the cry4Aa and cry4Ba insecticidal genes was applied on the colonies. Ribotyping was performed subsequently. This combined molecular method proved to be very specific for Bti, which was easily differentiated from the other B. thuringiensis serovars. A site regularly treated with Vectobac-G was chosen within the 'Bolle di Magadino' natural reserve, and monitored throughout 1 year for the detection of Bti spores. The results showed that the numbers were relatively high after insecticidal applications (1.4 x 10(5) CFU g(-1)), and decreased approx. 10-fold after 220 days. A successive treatment induced a new increase. The results show that yearly repeated use of Vectobac-G does not seem to have a major ecological impact on the 'Bolle di Magadino' natural reserve. Bti spores followed a trend leading to their eventual disappearance from the ecosystem, despite the seasonal application of this biological insecticide for more than a decade. The molecular identification of Bti cells through the PCR analysis of the delta-endotoxins genes coupled to ribotyping, is an innovative method, that has enabled the identification of this organism into wetland environments.

Field Performance of Bt Eggplants (Solanum melongena L.) in the Philippines: Cry1Ac Expression and Control of the Eggplant Fruit and Shoot Borer (Leucinodes orbonalis Guenée)

PubMed Central

Hautea, Desiree M.; Taylo, Lourdes D.; Masanga, Anna Pauleen L.; Sison, Maria Luz J.; Narciso, Josefina O.; Quilloy, Reynaldo B.; Hautea, Randy A.; Shotkoski, Frank A.; Shelton, Anthony M.

2016-01-01

Plants expressing Cry proteins from the bacterium, Bacillus thuringiensis (Bt), have become a major tactic for controlling insect pests in maize and cotton globally. However, there are few Bt vegetable crops. Eggplant (Solanum melongena) is a popular vegetable grown throughout Asia that is heavily treated with insecticides to control the eggplant fruit and shoot borer, Leucinodes orbonalis (EFSB). Herein we provide the first publicly available data on field performance in Asia of eggplant engineered to produce the Cry1Ac protein. Replicated field trials with five Bt eggplant open-pollinated (OP) lines from transformation event EE-1 and their non-Bt comparators were conducted over three cropping seasons in the Philippines from 2010–2012. Field trials documented levels of Cry1Ac protein expressed in plants and evaluated their efficacy against the primary target pest, EFSB. Cry1Ac concentrations ranged from 0.75–24.7 ppm dry weight with the highest in the terminal leaves (or shoots) and the lowest in the roots. Cry1Ac levels significantly increased from the vegetative to the reproductive stage. Bt eggplant lines demonstrated excellent control of EFSB. Pairwise analysis of means detected highly significant differences between Bt eggplant lines and their non-Bt comparators for all field efficacy parameters tested. Bt eggplant lines demonstrated high levels of control of EFSB shoot damage (98.6–100%) and fruit damage (98.1–99.7%) and reduced EFSB larval infestation (95.8–99.3%) under the most severe pest pressure during trial 2. Moths that emerged from larvae collected from Bt plants in the field and reared in their Bt eggplant hosts did not produce viable eggs or offspring. These results demonstrate that Bt eggplant lines containing Cry1Ac event EE-1 provide outstanding control of EFSB and can dramatically reduce the need for conventional insecticides. PMID:27322533

Coulomb and CH-π interactions in (6-4) photolyase-DNA complex dominate DNA binding and repair abilities.

PubMed

Terai, Yuma; Sato, Ryuma; Yumiba, Takahiro; Harada, Ryuhei; Shimizu, Kohei; Toga, Tatsuya; Ishikawa-Fujiwara, Tomoko; Todo, Takeshi; Iwai, Shigenori; Shigeta, Yasuteru; Yamamoto, Junpei

2018-05-14

(6-4) Photolyases ((6-4)PLs) are flavoenzymes that repair the carcinogenic UV-induced DNA damage, pyrimidine(6-4)pyrimidone photoproducts ((6-4)PPs), in a light-dependent manner. Although the reaction mechanism of DNA photorepair by (6-4)PLs has been intensively investigated, the molecular mechanism of the lesion recognition remains obscure. We show that a well-conserved arginine residue in Xenopus laevis (6-4)PL (Xl64) participates in DNA binding, through Coulomb and CH-π interactions. Fragment molecular orbital calculations estimated attractive interaction energies of -80-100 kcal mol-1 for the Coulomb interaction and -6 kcal mol-1 for the CH-π interaction, and the loss of either of them significantly reduced the affinity for (6-4)PP-containing oligonucleotides, as well as the quantum yield of DNA photorepair. From experimental and theoretical observations, we formulated a DNA binding model of (6-4)PLs. Based on the binding model, we mutated this Arg in Xl64 to His, which is well conserved among the animal cryptochromes (CRYs), and found that the CRY-type mutant exhibited reduced affinity for the (6-4)PP-containing oligonucleotides, implying the possible molecular origin of the functional diversity of the photolyase/cryptochrome superfamily.

Down-regulation of a novel ABC transporter gene (Pxwhite) is associated with Cry1Ac resistance in the diamondback moth, Plutella xylostella (L.).

PubMed

Guo, Zhaojiang; Kang, Shi; Zhu, Xun; Xia, Jixing; Wu, Qingjun; Wang, Shaoli; Xie, Wen; Zhang, Youjun

2015-04-01

Biopesticides or transgenic crops based on Cry toxins from the soil bacterium Bacillus thuringiensis (Bt) effectively control agricultural insect pests. The sustainable use of Bt biopesticides and Bt crops is threatened, however, by the development of Cry resistance in the target pests. The diamondback moth, Plutella xylostella (L.), is the first pest that developed resistance to a Bt biopesticide in the field, and a recent study has shown that the resistance of P. xylostella to Cry1Ac is caused by a mutation in an ATP-binding cassette (ABC) transporter gene (ABCC2). In this study, we report that down-regulation of a novel ABC transporter gene from ABCG subfamily (Pxwhite) is associated with Cry1Ac resistance in P. xylostella. The full-length cDNA sequence of Pxwhite was cloned and analyzed. Spatial-temporal expression detection revealed that Pxwhite was expressed in all tissues and developmental stages, and highest expressed in Malpighian tubule tissue and in egg stage. Sequence variation analysis of Pxwhite indicated the absence of constant non-synonymous mutations between susceptible and resistant strains, whereas midgut transcript analysis showed that Pxwhite was remarkably reduced in all resistant strains and further reduced when larvae of the moderately resistant SZ-R strain were subjected to selection with Cry1Ac toxin. Furthermore, RNA interference (RNAi)-mediated suppression of Pxwhite gene expression significantly reduced larval susceptibility to Cry1Ac toxin, and genetic linkage analysis confirmed that down-regulation of Pxwhite gene is tightly linked to Cry1Ac resistance in P. xylostella. To our knowledge, this is the first report indicating that Pxwhite gene is involved in Cry1Ac resistance in P. xylostella. Copyright © 2015 Elsevier Ltd. All rights reserved.

Vertebrate-like CRYPTOCHROME 2 from monarch regulates circadian transcription via independent repression of CLOCK and BMAL1 activity

PubMed Central

Zhang, Ying; Markert, Matthew J.; Groves, Shayna C.; Hardin, Paul E.; Merlin, Christine

2017-01-01

Circadian repression of CLOCK-BMAL1 by PERIOD and CRYPTOCHROME (CRY) in mammals lies at the core of the circadian timekeeping mechanism. CRY repression of CLOCK-BMAL1 and regulation of circadian period are proposed to rely primarily on competition for binding with coactivators on an α-helix located within the transactivation domain (TAD) of the BMAL1 C terminus. This model has, however, not been tested in vivo. Here, we applied CRISPR/Cas9-mediated mutagenesis in the monarch butterfly (Danaus plexippus), which possesses a vertebrate-like CRY (dpCRY2) and an ortholog of BMAL1, to show that insect CRY2 regulates circadian repression through TAD α-helix–dependent and –independent mechanisms. Monarch mutants lacking the BMAL1 C terminus including the TAD exhibited arrhythmic eclosion behavior. In contrast, mutants lacking the TAD α-helix but retaining the most distal C-terminal residues exhibited robust rhythms during the first day of constant darkness (DD1), albeit with a delayed peak of eclosion. Phase delay in this mutant on DD1 was exacerbated in the presence of a single functional allele of dpCry2, and rhythmicity was abolished in the absence of dpCRY2. Reporter assays in Drosophila S2 cells further revealed that dpCRY2 represses through two distinct mechanisms: a TAD-dependent mechanism that involves the dpBMAL1 TAD α-helix and dpCLK W328 and a TAD-independent mechanism involving dpCLK E333. Together, our results provide evidence for independent mechanisms of vertebrate-like CRY circadian regulation on the BMAL1 C terminus and the CLK PAS-B domain and demonstrate the importance of a BMAL1 TAD-independent mechanism for generating circadian rhythms in vivo. PMID:28831003

Vertebrate-like CRYPTOCHROME 2 from monarch regulates circadian transcription via independent repression of CLOCK and BMAL1 activity.

PubMed

Zhang, Ying; Markert, Matthew J; Groves, Shayna C; Hardin, Paul E; Merlin, Christine

2017-09-05

Circadian repression of CLOCK-BMAL1 by PERIOD and CRYPTOCHROME (CRY) in mammals lies at the core of the circadian timekeeping mechanism. CRY repression of CLOCK-BMAL1 and regulation of circadian period are proposed to rely primarily on competition for binding with coactivators on an α-helix located within the transactivation domain (TAD) of the BMAL1 C terminus. This model has, however, not been tested in vivo. Here, we applied CRISPR/Cas9-mediated mutagenesis in the monarch butterfly ( Danaus plexippus ), which possesses a vertebrate-like CRY (dpCRY2) and an ortholog of BMAL1, to show that insect CRY2 regulates circadian repression through TAD α-helix-dependent and -independent mechanisms. Monarch mutants lacking the BMAL1 C terminus including the TAD exhibited arrhythmic eclosion behavior. In contrast, mutants lacking the TAD α-helix but retaining the most distal C-terminal residues exhibited robust rhythms during the first day of constant darkness (DD1), albeit with a delayed peak of eclosion. Phase delay in this mutant on DD1 was exacerbated in the presence of a single functional allele of dpCry2 , and rhythmicity was abolished in the absence of dpCRY2. Reporter assays in Drosophila S2 cells further revealed that dpCRY2 represses through two distinct mechanisms: a TAD-dependent mechanism that involves the dpBMAL1 TAD α-helix and dpCLK W328 and a TAD-independent mechanism involving dpCLK E333. Together, our results provide evidence for independent mechanisms of vertebrate-like CRY circadian regulation on the BMAL1 C terminus and the CLK PAS-B domain and demonstrate the importance of a BMAL1 TAD-independent mechanism for generating circadian rhythms in vivo.

Soya protein stimulates bile acid excretion by the liver and intestine through direct and indirect pathways influenced by the presence of dietary cholesterol.

PubMed

Arellano-Martínez, Gloria Leticia; Granados, Omar; Palacios-González, Berenice; Torres, Nimbe; Medina-Vera, Isabel; Tovar, Armando R

2014-06-28

Several studies using different animal models have demonstrated that the consumption of soya protein (SP) reduces serum cholesterol concentrations by increasing the excretion of bile acids (BA). However, the mechanism by which SP enhances BA excretion is not fully understood. Therefore, the aim of the present study was to determine whether the consumption of SP regulates the expression of key enzymes involved in hepatic BA synthesis and the transporters involved in reverse cholesterol transport (RCT) via fibroblast growth factor 15 (FGF15) and/or small heterodimer protein (SHP) in rats. To achieve this aim, four groups of rats were fed experimental diets containing 20 % casein (C) or SP with or without the addition of 0·2 % cholesterol and the expression of hepatic genes involved in BA synthesis and the ileal and hepatic RCT was measured. Rats fed the SP diet had higher concentrations of ileal FGF15 and hepatic FGF15 receptor (FGFR4) and increased expression of SHP and liver receptor homolog 1 (LRH1) than those fed the C diet; as a result, the excretion of faecal BA was greater. The addition of cholesterol to the diet repressed the protein abundance of FGF15 and FGFR4; however, SP increased the expression of SHP and LRH1 to a lesser extent. Nonetheless, the expression of ABCG5/8 was increased in the intestine of rats fed the SP diet, and the effect was enhanced by the addition of cholesterol to the diet. In conclusion, SP in the presence of cholesterol increases BA synthesis via the repressions of FGF15 and SHP and accelerates BA excretion to prevent cholesterol overload in the enterocytes by increasing RCT.

Three cases of Creutzfeldt-Jakob disease with prion protein gene codon180 mutation presenting with pathological laughing and crying.

PubMed

Iwasaki, Yasushi

2012-08-15

Although there are no reports of pathological laughing and crying being observed in patients with Creutzfeldt-Jakob disease (CJD), the author experienced three patients with CJD with prion protein gene codon180 mutation (V180I CJD) who showed this characteristic clinical finding. This finding was observed from the early disease stage in all 3 patients and continued for several months. Startle reaction was also remarkable in all patients, although myoclonus was generally mild. The dissociation between the startle reaction and myoclonus was suspected to be another feature of V180I CJD. The pathological laughing and crying co-occured with the startle reaction and stopped right before the onset of akinetic mutism, and the degree of both symptoms was almost parallel during this period. On the basis of MRI and autopsy findings, pathological laughing and crying was suspected of being induced by the widespread cerebral cortical involvement that is characteristic of V180I CJD. From the present observations, the author speculated that pathological laughing and crying may be a comparatively frequent observation in V180I CJD patients. Copyright © 2012 Elsevier B.V. All rights reserved.

Bacillus thuringiensis-derived Cry5B Has Potent Anthelmintic Activity against Ascaris suum

PubMed Central

Miller, Melanie M.; Scheib, Ulrike; Yiu, Ying Y.; Aroian, Raffi V.

2013-01-01

Ascaris suum and Ascaris lumbricoides are two closely related geo-helminth parasites that ubiquitously infect pigs and humans, respectively. Ascaris suum infection in pigs is considered a good model for A. lumbricoides infection in humans because of a similar biology and tissue migration to the intestines. Ascaris lumbricoides infections in children are associated with malnutrition, growth and cognitive stunting, immune defects, and, in extreme cases, life-threatening blockage of the digestive tract and aberrant migration into the bile duct and peritoneum. Similar effects can be seen with A. suum infections in pigs related to poor feed efficiency and performance. New strategies to control Ascaris infections are needed largely due to reduced treatment efficacies of current anthelmintics in the field, the threat of resistance development, and the general lack of new drug development for intestinal soil-transmitted helminths for humans and animals. Here we demonstrate for the first time that A. suum expresses the receptors for Bacillus thuringiensis crystal protein and novel anthelmintic Cry5B, which has been previously shown to intoxicate hookworms and which belongs to a class of proteins considered non-toxic to vertebrates. Cry5B is able to intoxicate A. suum larvae and adults and triggers the activation of the p38 mitogen-activated protein kinase pathway similar to that observed with other nematodes. Most importantly, two moderate doses of 20 mg/kg body weight (143 nM/kg) of Cry5B resulted in a near complete cure of intestinal A. suum infections in pigs. Taken together, these results demonstrate the excellent potential of Cry5B to treat Ascaris infections in pigs and in humans and for Cry5B to work effectively in the human gastrointestinal tract. PMID:23818995

Influence of transgenic rice expressing a fused Cry1Ab/1Ac protein on frogs in paddy fields.

PubMed

Wang, Jia-Mei; Chen, Xiu-Ping; Liang, Yu-Yong; Zhu, Hao-Jun; Ding, Jia-Tong; Peng, Yu-Fa

2014-11-01

As genetic engineering in plants is increasingly used to control agricultural pests, it is important to determine whether such transgenic plants adversely affect non-target organisms within and around cultivated fields. The cry1Ab/1Ac fusion gene from Bacillus thuringiensis (Bt) has insecticidal activity and has been introduced into rice line Minghui 63 (MH63). We evaluated the effect of transgenic cry1Ab/1Ac rice (Huahui 1, HH1) on paddy frogs by comparing HH1 and MH63 rice paddies with and without pesticide treatment. The density of tadpoles in rice fields was surveyed at regular intervals, and Cry1Ab/1Ac protein levels were determined in tissues of tadpoles and froglets collected from the paddy fields. In addition, Rana nigromaculata froglets were raised in purse nets placed within these experimental plots. The survival, body weight, feeding habits, and histological characteristics of the digestive tract of these froglets were analyzed. We found that the tadpole density was significantly decreased immediately after pesticide application, and the weight of R. nigromaculata froglets of pesticide groups was significantly reduced compared with no pesticide treatment, but we found no differences between Bt and non-Bt rice groups. Moreover, no Cry1Ab/1Ac protein was detected in tissue samples collected from 192 tadpoles and froglets representing all four experimental groups. In addition, R. nigromaculata froglets raised in purse seines fed primarily on stem borer and non-target insects, and showed no obvious abnormality in the microstructure of their digestive tracts. Based on these results, we conclude that cultivation of transgenic cry1Ab/1Ac rice does not adversely affect paddy frogs.

Quantification of toxins in a Cry1Ac + CpTI cotton cultivar and its potential effects on the honey bee Apis mellifera L.

PubMed

Han, Peng; Niu, Chang-Ying; Lei, Chao-Liang; Cui, Jin-Jie; Desneux, Nicolas

2010-11-01

Transgenic Cry1Ac + CpTI cotton (CCRI41) is increasingly planted throughout China. However, negative effects of this cultivar on the honey bee Apis mellifera L., the most important pollinator for cultivated ecosystem, remained poorly investigated. The objective of our study was to evaluate the potential side effects of transgenic Cry1Ac + CpTI pollen from cotton on young adult honey bees A. mellifera L. Two points emphasized the significance of our study: (1) A higher expression level of insecticidal protein Cry1Ac in pollen tissues was detected (when compared with previous reports). In particular, Cry1Ac protein was detected at 300 ± 4.52 ng g(-1) [part per billion (ppb)] in pollen collected in July, (2) Effects on chronic mortality and feeding behaviour in honey bees were evaluated using a no-choice dietary feeding protocol with treated pollen, which guarantee the highest exposure level to bees potentially occurring in natural conditions (worst case scenario). Tests were also conducted using imidacloprid-treated pollen at a concentration of 48 ppb as positive control for sublethal effect on feeding behaviour. Our results suggested that Cry1Ac + CpTI pollen carried no lethal risk for honey bees. However, during a 7-day oral exposure to the various treatments (transgenic, imidacloprid-treated and control), honey bee feeding behaviour was disturbed and bees consumed significantly less CCRI41 cotton pollen than in the control group in which bees were exposed to conventional cotton pollen. It may indicate an antifeedant effect of CCRI41 pollen on honey bees and thus bees may be at risk because of large areas are planted with transgenic Bt cotton in China. This is the first report suggesting a potential sublethal effect of CCRI41 cotton pollen on honey bees. The implications of the results are discussed in terms of risk assessment for bees as well as for directions of future work involving risk assessment of CCRI41 cotton.

Effective dominance of resistance of Spodoptera frugiperda to Bt maize and cotton varieties: implications for resistance management

PubMed Central

Horikoshi, Renato J.; Bernardi, Daniel; Bernardi, Oderlei; Malaquias, José B.; Okuma, Daniela M.; Miraldo, Leonardo L.; Amaral, Fernando S. de A. e; Omoto, Celso

2016-01-01

The resistance of fall armyworm (FAW), Spodoptera frugiperda, has been characterized to some Cry and Vip3A proteins of Bacillus thuringiensis (Bt) expressed in transgenic maize in Brazil. Here we evaluated the effective dominance of resistance based on the survival of neonates from selected Bt-resistant, heterozygous, and susceptible (Sus) strains of FAW on different Bt maize and cotton varieties. High survival of strains resistant to the Cry1F (HX-R), Cry1A.105/Cry2Ab (VT-R) and Cry1A.105/Cry2Ab/Cry1F (PW-R) proteins was detected on Herculex, YieldGard VT PRO and PowerCore maize. Our Vip3A-resistant strain (Vip-R) exhibited high survival on Herculex, Agrisure Viptera and Agrisure Viptera 3 maize. However, the heterozygous from HX-R × Sus, VT-R × Sus, PW-R × Sus and Vip-R × Sus had complete mortality on YieldGard VT PRO, PowerCore, Agrisure Viptera, and Agrisure Viptera 3, whereas the HX-R × Sus and Vip-R × Sus strains survived on Herculex maize. On Bt cotton, the HX-R, VT-R and PW-R strains exhibited high survival on Bollgard II. All resistant strains survived on WideStrike, but only PW-R and Vip-R × Sus survived on TwinLink. Our study provides useful data to aid in the understanding of the effectiveness of the refuge strategy for Insect Resistance Management of Bt plants. PMID:27721425

Effective dominance of resistance of Spodoptera frugiperda to Bt maize and cotton varieties: implications for resistance management

NASA Astrophysics Data System (ADS)

Horikoshi, Renato J.; Bernardi, Daniel; Bernardi, Oderlei; Malaquias, José B.; Okuma, Daniela M.; Miraldo, Leonardo L.; Amaral, Fernando S. De A. E.; Omoto, Celso

2016-10-01

The resistance of fall armyworm (FAW), Spodoptera frugiperda, has been characterized to some Cry and Vip3A proteins of Bacillus thuringiensis (Bt) expressed in transgenic maize in Brazil. Here we evaluated the effective dominance of resistance based on the survival of neonates from selected Bt-resistant, heterozygous, and susceptible (Sus) strains of FAW on different Bt maize and cotton varieties. High survival of strains resistant to the Cry1F (HX-R), Cry1A.105/Cry2Ab (VT-R) and Cry1A.105/Cry2Ab/Cry1F (PW-R) proteins was detected on Herculex, YieldGard VT PRO and PowerCore maize. Our Vip3A-resistant strain (Vip-R) exhibited high survival on Herculex, Agrisure Viptera and Agrisure Viptera 3 maize. However, the heterozygous from HX-R × Sus, VT-R × Sus, PW-R × Sus and Vip-R × Sus had complete mortality on YieldGard VT PRO, PowerCore, Agrisure Viptera, and Agrisure Viptera 3, whereas the HX-R × Sus and Vip-R × Sus strains survived on Herculex maize. On Bt cotton, the HX-R, VT-R and PW-R strains exhibited high survival on Bollgard II. All resistant strains survived on WideStrike, but only PW-R and Vip-R × Sus survived on TwinLink. Our study provides useful data to aid in the understanding of the effectiveness of the refuge strategy for Insect Resistance Management of Bt plants.

Mu opioid receptor availability in people with psychiatric disorders who died by suicide: a case control study

PubMed Central

2012-01-01

Background Mu opioid receptors have previously been shown to be altered in people with affective disorders who died as a result of suicide. We wished to determine whether these changes were more widespread and independent of psychiatric diagnoses. Methods Mu receptor levels were determined using [3 H]DAMGO binding in BA24 from 51 control subjects; 38 people with schizophrenia (12 suicides); 20 people with major depressive disorder (15 suicides); 13 people with bipolar disorder (5 suicides) and 9 people who had no history of psychiatric disorders but who died as a result of suicide. Mu receptor levels were further determined in BA9 and caudate-putamen from 38 people with schizophrenia and 20 control subjects using [3 H]DAMGO binding and, in all three regions, using Western blots. Data was analysed using one-way ANOVAs with Bonferroni’s Multiple Comparison Test or, where data either didn’t approximate to a binomial distribution or the sample size was too small to determine distribution, a Kruskal-Wallis test with Dunn’s Multiple Comparison Test. Results [3 H]DAMGO binding density was lower in people who had died as a result of suicide (p<0.01). People with schizophrenia who had died as a result of suicide had lower binding than control subjects (p<0.001), whilst people with bipolar disorder (non- suicide) had higher levels of binding (p<0.05). [3 H]DAMGO binding densities, but not mu protein levels, were significantly decreased in BA9 from people with schizophrenia who died as a result of suicide (p<0.01). Conclusions Overall these data suggest that mu opioid receptor availability is decreased in the brains of people with schizophrenia who died as a result of suicide, which would be consistent with increased levels of endogenous ligands occupying these receptors. PMID:22925223

Evaluation of Bt Corn with Pyramided Genes on Efficacy and Insect Resistance Management for the Asian Corn Borer in China.

PubMed

Jiang, Fan; Zhang, Tiantao; Bai, Shuxiong; Wang, Zhenying; He, Kanglai

2016-01-01

A Bt corn hybrid (AcIe) with two Bt genes (cry1Ie and cry1Ac) was derived by breeding stack from line expressing Cry1Ie and a line expressing Cry1Ac. Efficacy of this pyramided Bt corn hybrid against the Asian corn borer (ACB), Ostrinia furnacalis, was evaluated. We conducted laboratory bioassays using susceptible and resistant ACB strains fed on artificial diet or fresh plant tissues. We also conducted field trials with artificial infestations of ACB neonates at the V6 and silk stages. The toxin-diet bioassay data indicated that mixtures of Cry1Ac and Cry1Ie proteins had synergistic insecticidal efficacy. The plant tissue bioassay data indicated that Bt corn hybrids expressing either a single toxin (Cry1Ac or Cry1Ie) or two toxins had high efficacy against susceptible ACB. Damage ratings in the field trials indicated that the Bt corn hybrids could effectively protect against 1st and the 2nd generation ACB in China. The hybrid line with two Bt genes showed a higher efficacy against ACB larvae resistant to Cry1Ac or CryIe than the hybrid containing one Bt gene, and the two gene hybrid would have increased potential for managing or delaying the evolution of ACB resistance to Bt corn plants.

Time-related dynamics of variation in core clock gene expression levels in tissues relevant to the immune system.

PubMed

Mazzoccoli, G; Sothern, R B; Greco, A; Pazienza, V; Vinciguerra, M; Liu, S; Cai, Y

2011-01-01

Immune parameters show rhythmic changes with a 24-h periodicity driven by an internal circadian timing system that relies on clock genes (CGs). CGs form interlocked transcription-translation feedback loops to generate and maintain 24-h mRNA and protein oscillations. In this study we evaluate and compare the profiles and the dynamics of variation of CG expression in peripheral blood, and two lymphoid tissues of mice. Expression levels of seven recognized key CGs (mBmal1, mClock, mPer1, mPer2, mCry1, mCry2, and Rev-erbalpha) were evaluated by quantitative RT- PCR in spleen, thymus and peripheral blood of C57BL/6 male mice housed on a 12-h light (L)-dark (D) cycle and sacrificed every 4 h for 24 h (3-4 mice/time point). We found a statistically significant time-effect in spleen (S), thymus (T) and blood (B) for the original values of expression level of mBmal1 (S), mClock (T, B), mPer1 (S, B), mPer2 (S), mCry1 (S), mCry2 (B) and mRev-Erbalpha (S, T, B) and for the fractional variation calculated between single time-point expression value of mBmal1 (B), mPer2 (T), mCry2 (B) and mRev-Erbalpha (S). A significant 24-h rhythm was validated for five CGs in blood (mClock, mPer1, mPer2, mCry2, mRev-Erbalpha), for four CGs in the spleen (mBmal1, mPer1, mPer2, mRev-Erbalpha), and for three CGs in the thymus (mClock, mPer2, mRev-Erbalpha). The original values of acrophases for mBmal1, mClock, mPer1, mPer2, mCry1 and mCry2 were very similar for spleen and thymus and advanced by several hours for peripheral blood compared to the lymphoid tissues, whereas the phases of mRev-Erbalpha were coincident for all three tissues. In conclusion, central and peripheral lymphoid tissues in the mouse show different sequences of activation of clock gene expression compared to peripheral blood. These differences may underlie the compartmental pattern of web functioning in the immune system.

Gp120/CD4 blocking antibodies are frequently elicited in ART-naïve chronically HIV-1 infected individuals.

PubMed

Carrillo, Jorge; Molinos-Albert, Luis Manuel; Rodríguez de la Concepción, Maria Luisa; Marfil, Silvia; García, Elisabet; Derking, Ronald; Sanders, Rogier W; Clotet, Bonaventura; Blanco, Julià

2015-01-01

Antibodies with the ability to block the interaction of HIV-1 envelope glycoprotein (Env) gp120 with CD4, including those overlapping the CD4 binding site (CD4bs antibodies), can protect from infection by HIV-1, and their elicitation may be an interesting goal for any vaccination strategy. To identify gp120/CD4 blocking antibodies in plasma samples from HIV-1 infected individuals we have developed a competitive flow cytometry-based functional assay. In a cohort of treatment-naïve chronically infected patients, we showed that gp120/CD4 blocking antibodies were frequently elicited (detected in 97% plasma samples) and correlated with binding to trimeric HIV-1 envelope glycoproteins. However, no correlation was observed between functional CD4 binding blockade data and titer of CD4bs antibodies determined by ELISA using resurfaced gp120 proteins. Consistently, plasma samples lacking CD4bs antibodies were able to block the interaction between gp120 and its receptor, indicating that antibodies recognizing other epitopes, such as PGT126 and PG16, can also play the same role. Antibodies blocking CD4 binding increased over time and correlated positively with the capacity of plasma samples to neutralize the laboratory-adapted NL4.3 and BaL virus isolates, suggesting their potential contribution to the neutralizing workforce of plasma in vivo. Determining whether this response can be boosted to achieve broadly neutralizing antibodies may provide valuable information for the design of new strategies aimed to improve the anti-HIV-1 humoral response and to develop a successful HIV-1 vaccine.

Gp120/CD4 Blocking Antibodies Are Frequently Elicited in ART-Naïve Chronically HIV-1 Infected Individuals

PubMed Central

Carrillo, Jorge; Molinos-Albert, Luis Manuel; de la Concepción, Maria Luisa Rodríguez; Marfil, Silvia; García, Elisabet; Derking, Ronald; Sanders, Rogier W.; Clotet, Bonaventura; Blanco, Julià

2015-01-01

Antibodies with the ability to block the interaction of HIV-1 envelope glycoprotein (Env) gp120 with CD4, including those overlapping the CD4 binding site (CD4bs antibodies), can protect from infection by HIV-1, and their elicitation may be an interesting goal for any vaccination strategy. To identify gp120/CD4 blocking antibodies in plasma samples from HIV-1 infected individuals we have developed a competitive flow cytometry-based functional assay. In a cohort of treatment-naïve chronically infected patients, we showed that gp120/CD4 blocking antibodies were frequently elicited (detected in 97% plasma samples) and correlated with binding to trimeric HIV-1 envelope glycoproteins. However, no correlation was observed between functional CD4 binding blockade data and titer of CD4bs antibodies determined by ELISA using resurfaced gp120 proteins. Consistently, plasma samples lacking CD4bs antibodies were able to block the interaction between gp120 and its receptor, indicating that antibodies recognizing other epitopes, such as PGT126 and PG16, can also play the same role. Antibodies blocking CD4 binding increased over time and correlated positively with the capacity of plasma samples to neutralize the laboratory-adapted NL4.3 and BaL virus isolates, suggesting their potential contribution to the neutralizing workforce of plasma in vivo. Determining whether this response can be boosted to achieve broadly neutralizing antibodies may provide valuable information for the design of new strategies aimed to improve the anti-HIV-1 humoral response and to develop a successful HIV-1 vaccine. PMID:25803681

Near-Isogenic Cry1F-Resistant Strain of Spodoptera frugiperda (Lepidoptera: Noctuidae) to Investigate Fitness Cost Associated With Resistance in Brazil.

PubMed

Horikoshi, Renato J; Bernardi, Oderlei; Bernardi, Daniel; Okuma, Daniela M; Farias, Juliano R; Miraldo, Leonardo L; Amaral, Fernando S A; Omoto, Celso

2016-04-01

Field-evolved resistance to Cry1F maize in Spodoptera frugiperda (J.E. Smith) populations in Brazil was reported in 2014. In this study, to investigate fitness costs, we constructed a near-isogenic S. frugiperda-resistant strain (R-Cry1F) using Cry1F-resistant and Cry1F-susceptible strains sharing a close genetic background. A near-isogenic R-Cry1F strain was obtained by eight repeated backcrossings, each followed by sib-mating and selection among resistant and susceptible strains. Fitness cost parameters were evaluated by comparing the biological performance of resistant, susceptible, and heterozygous strains on artificial diet. Fitness parameters monitored included development time and survival rates of egg, larval, pupal, and egg-to-adult periods; sex ratio; adult longevity; timing of preoviposition, oviposition, and postoviposition; fecundity; and fertility. A fertility life table was also calculated. The near-isogenic R-Cry1F strain showed lower survival rate of eggs (32%), when compared with Sus and reciprocal crosses (41 and 55%, respectively). The number of R-Cry1F insects that completed the life cycle was reduced to ∼25%, compared with the Sus strain with ∼32% reaching the adult stage. The mean generation time (T) of R-Cry1F strain was ∼2 d shorter than R-Cry1F♂×Sus♀ and Sus strains. The reproductive parameters of R-Cry1F strain were similar to the Sus strain. However, fewer females were produced by R-Cry1F strain than R-Cry1F♀×Sus♂ and more females than R-Cry1F♂×Sus♀. In summary, no relevant fitness costs are observed in a near-isogenic Cry1F-resistant strain of S. frugiperda, indicating stability of resistance to Cry1F protein in Brazilian populations of this species in the absence of selection pressure.

Bt Cry1Ie Toxin Does Not Impact the Survival and Pollen Consumption of Chinese Honey Bees, Apis cerana cerana (Hymenoptera, Apidae).

PubMed

Dai, Ping-Li; Jia, Hui-Ru; Jack, Cameron J; Geng, Li-Li; Liu, Feng; Hou, Chun-Sheng; Diao, Qing-Yun; Ellis, James D

2016-12-01

The cry1Ie gene may be a good candidate for the development of Bt maize because over-expression of Cry1Ie is highly toxic to Lepidopteran pests such as Heliothis armigera Hübner and Ostrinia furnacalis Guenée. The Bt cry1Ie gene also has no cross resistance with other insecticidal proteins such as Cry1Ab, Cry1Ac, Cry1Ah, or Cry1F. Chinese honey bees (Apis cerana cerana) are potentially exposed to insect-resistant genetically modified (IRGM) crops expressing Cry1Ie toxin via the collection of IRGM crop pollen. In this study, we tested whether Chinese honey bee workers are negatively affected by sugar syrup containing 20, 200, or 20,000 ng/ml Cry1Ie toxin and 48 ng/ml imidacloprid under controlled laboratory conditions. Our results demonstrated that the Cry1Ie toxin does not adversely impact survival and pollen consumption of Chinese honey bees. However, imidacloprid decreases Chinese honey bee survival and the total pollen consumption on the 5th, 6th, and 18th d of exposure. The described bioassay is suitable to assess the effects of GM expressed toxins against honey bee. © The Authors 2016. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Enhanced HIV-1 neutralization by a CD4-VH3-IgG1 fusion protein

DOE Office of Scientific and Technical Information (OSTI.GOV)

Meyuhas, Ronit; Noy, Hava; Fishman, Sigal

2009-08-21

HIV-1 gp120 is an alleged B cell superantigen, binding certain VH3+ human antibodies. We reasoned that a CD4-VH3 fusion protein could possess higher affinity for gp120 and improved HIV-1 inhibitory capacity. To test this we produced several human IgG1 immunoligands harboring VH3. Unlike VH3-IgG1 or VH3-CD4-IgG1, CD4-VH3-IgG1 bound gp120 considerably stronger than CD4-IgG1. CD4-VH3-IgG1 exhibited {approx}1.5-2.5-fold increase in neutralization of two T-cell laboratory-adapted strains when compared to CD4-IgG1. CD4-VH3-IgG1 improved neutralization of 7/10 clade B primary isolates or pseudoviruses, exceeding 20-fold for JR-FL and 13-fold for Ba-L. It enhanced neutralization of 4/8 clade C viruses, and had negligible effect onmore » 1/4 clade A pseudoviruses. We attribute this improvement to possible pairing of VH3 with CD4 D1 and stabilization of an Ig Fv-like structure, rather than to superantigen interactions. These novel findings support the current notion that CD4 fusion proteins can act as better HIV-1 entry inhibitors with potential clinical implications.« less

Magneto-optical properties of BaCryFe12-yO19 (0.0 ≤ y ≤ 1.0) hexaferrites

NASA Astrophysics Data System (ADS)

Asiri, S.; Güner, S.; Korkmaz, A. D.; Amir, Md.; Batoo, K. M.; Almessiere, M. A.; Gungunes, H.; Sözeri, H.; Baykal, A.

2018-04-01

In this study, nanocrystalline BaCryFe12-yO19 (0.0 ≤ y ≤ 1.0) hexaferrite powders were prepared by sol-gel auto combustion method and the effect of Cr3+ ion substitution on morphology, structure, optic and magnetic properties of Barium hexaferrite were investigated. X-ray powder diffraction (XRD) analyses confirmed the purity of all samples. The XRD data shows that the average crystallite size lies between 60.95 nm and 50.10 nm and same was confirmed by Transmission electron microscopy. Transmission electron and scanning electron microscopy analyses presented the hexagonal morphology of all products. The characteristic hysteresis (σ-H) curves proved the ferromagnetic feature of as grown nanoparticle samples. Specific saturation magnetization (σs) drops from 46.59 to 34.89 emu/g with increasing Cr content while the coercive field values lie between 770 and 1652 Oe. The large magnitude of the magnetocrystalline (intrinsic) anisotropy field, (Ha) between 11.0 and 12.6 kOe proves that all products are magnetically hard. The energy band gap values decrease from 2.0 eV to 1.84 eV with increasing Cr content. From 57Fe Mössbauer spectroscopy, the variation in line width, isomer shift, quadrupole splitting and hyperfine magnetic field values were determined and discussed.

[Dynamics of Cry1ab protein content in the rhizosphere soil and straw debris of transgenic Bt corn].

PubMed

Li, Fan; Wang, Min; Sun, Hong-Wei; Yang, Shu-Ke; Lu, Xing-Bo

2013-07-01

By using ELISA test kits, a field investigation was conducted on the degradation dynamics of CrylAb protein in the rhizosphere soil of Bt corn MON810 at its different growth stages and in the MON810 straws returned into field after harvest. Three models (shift-log model, exponential model, and bi-exponential model) were used to fit the degradation dynamics of the Cry1 Ab protein from the straw debris, and the DT50 and DT90, values were estimated. There existed great differences in the CrylAb protein content in the rhizosphere soil of MON810 at its different growth stages, but overall, the CrylAb protein content was decreased remarkably with the growth of MON810. The degradation of Cry1 Ab protein from the straws covered on soil surface and buried in soil showed the same two-stage pattern, i.e., more rapid at early stage and slow-stable in later period. Within the first week after straw return, the degradation rate of the CrylAb protein from the straws covered on soil surface was significantly higher than that from the straws buried in soil. At 10 d, the degradation rate of the CrylAb protein from the straws covered on soil surface and buried in soil was basically the same, being 88.8% and 88.6%, respectively. After 20 days, the degradation of CrylAb protein entered slow-stable stage. Till at 180 d, a small amount of Cry1Ab protein could still be detected in the straw debris. All of the three models used in this study could fit the decay pattern of the CrylAb protein from the straw debris in field. By comparing the correlation coefficient (r) and the consistency between the measured and calculated DT90, bi-exponential model was considered to be the best.

Amino acid residues 196-225 of LcrV represent a plague protective epitope.

PubMed

Quenee, Lauriane E; Berube, Bryan J; Segal, Joshua; Elli, Derek; Ciletti, Nancy A; Anderson, Deborah; Schneewind, Olaf

2010-02-17

LcrV, a protein that resides at the tip of the type III secretion needles of Yersinia pestis, is the single most important plague protective antigen. Earlier work reported monoclonal antibody MAb 7.3, which binds a conformational epitope of LcrV and protects experimental animals against lethal plague challenge. By screening monoclonal antibodies directed against LcrV for their ability to protect immunized mice against bubonic plague challenge, we examined here the possibility of additional protective epitopes. MAb BA5 protected animals against plague, neutralized the Y. pestis type III secretion pathway and promoted opsonophagocytic clearance of bacteria in blood. LcrV residues 196-225 were necessary and sufficient for MAb BA5 binding. Compared to full-length LcrV, a variant lacking its residues 196-225 retained the ability of eliciting plague protection. These results identify LcrV residues 196-225 as a linear epitope that is recognized by the murine immune system to confer plague protection. Copyright (c) 2009 Elsevier Ltd. All rights reserved.

Amino acid residues 196–225 of LcrV represent a plague protective epitope

PubMed Central

Quenee, Lauriane E.; Berube, Bryan J.; Segal, Joshua; Elli, Derek; Ciletti, Nancy A.; Anderson, Deborah; Schneewind, Olaf

2010-01-01

LcrV, a protein that resides at the tip of the type III secretion needles of Yersinia pestis, is the single most important plague protective antigen. Earlier work reported monoclonal antibody MAb 7.3, which binds a conformational epitope of LcrV and protects experimental animals against lethal plague challenge. By screening monoclonal antibodies directed against LcrV for their ability to protect immunized mice against bubonic plague challenge, we examined here the possibility of additional protective epitopes. MAb BA5 protected animals against plague, neutralized the Y. pestis type III secretion pathway and promoted opsonophagocytic clearance of bacteria in blood. LcrV residues 196–225 were necessary and sufficient for MAb-BA5 binding. Compared to full length LcrV, a variant lacking its residues 196–225 retained the ability of eliciting plague protection. These results identify LcrV residues 196–225 as a linear epitope that is recognized by the murine immune system to confer plague protection. PMID:20005318

Effects of recombinant human growth hormone in the treatment of dwarfism and relationship between IGF-1, IGFBP-3 and thyroid hormone

PubMed Central

Ren, Shanxiang; Nie, Yuxiang; Wang, Aihong

2016-01-01

The effects of recombinant human growth hormone (rhGH) in the treatment of dwarfism and the relationship between insulin-like growth factor (IGF)-1, IGF-binding protein (IGFBP)-3 and thyroid hormone were examined in the present study. For this purpose, 66 patients diagnosed with dwarfism were selected retrospectively, with 36 cases of growth hormone deficiency (GHD) and 30 cases of idiopathic short stature (ISS). The therapeutic dose of GHD 0.10 IU/kg·day and ISS 0.15 IU/kg·day were injected subcutaneously every night before sleep until adulthood. The average follow-up was 5 years, and the results were evaluated and measured every 3 months, including height, BA, secondary test of growth hormone (GH peak), IGF-1, IGFBP-3 and thyroid hormone (FT3, FT4 and TSH). After treatment, the height, BA, GH peak, IGF-A and IGFBP-3 of the GHD group were all increased, and the differences were statistically significant (P<0.05), while FT3, FT4 and TSH had no significant change (P<0.05). The height and BA increased and the differences were statistically significant (P<0.05). The indexes of the ISS group were not statistically significant (P>0.05). The results of the Pearson-related analysis suggested that GH peak of the GHD group, IGF-1 and IGFBP-3 were positively associated with height (P<0.05), and had no relationship with BA (P<0.05). None of the above indexes of the ISS group had an obvious correlation with height and BA (P>0.05). rhGH was effective for GHD and ISS, with the GHD effect being positively associated with the GH peak, IGF-1 and IGFBP-3. ISS had no obvious relationship with GH peak, IGF-1 and IGFBP-3 although other influencing factors may be involved. PMID:28105090

Effects of recombinant human growth hormone in the treatment of dwarfism and relationship between IGF-1, IGFBP-3 and thyroid hormone.

PubMed

Ren, Shanxiang; Nie, Yuxiang; Wang, Aihong

2016-12-01

The effects of recombinant human growth hormone (rhGH) in the treatment of dwarfism and the relationship between insulin-like growth factor (IGF)-1, IGF-binding protein (IGFBP)-3 and thyroid hormone were examined in the present study. For this purpose, 66 patients diagnosed with dwarfism were selected retrospectively, with 36 cases of growth hormone deficiency (GHD) and 30 cases of idiopathic short stature (ISS). The therapeutic dose of GHD 0.10 IU/kg·day and ISS 0.15 IU/kg·day were injected subcutaneously every night before sleep until adulthood. The average follow-up was 5 years, and the results were evaluated and measured every 3 months, including height, BA, secondary test of growth hormone (GH peak), IGF-1, IGFBP-3 and thyroid hormone (FT3, FT4 and TSH). After treatment, the height, BA, GH peak, IGF-A and IGFBP-3 of the GHD group were all increased, and the differences were statistically significant (P<0.05), while FT3, FT4 and TSH had no significant change (P<0.05). The height and BA increased and the differences were statistically significant (P<0.05). The indexes of the ISS group were not statistically significant (P>0.05). The results of the Pearson-related analysis suggested that GH peak of the GHD group, IGF-1 and IGFBP-3 were positively associated with height (P<0.05), and had no relationship with BA (P<0.05). None of the above indexes of the ISS group had an obvious correlation with height and BA (P>0.05). rhGH was effective for GHD and ISS, with the GHD effect being positively associated with the GH peak, IGF-1 and IGFBP-3. ISS had no obvious relationship with GH peak, IGF-1 and IGFBP-3 although other influencing factors may be involved.

Induction of rapid and selective cell necrosis in Drosophila using Bacillus thuringiensis Cry toxin and its silkworm receptor.

PubMed

Obata, Fumiaki; Tanaka, Shiho; Kashio, Soshiro; Tsujimura, Hidenobu; Sato, Ryoichi; Miura, Masayuki

2015-07-08

Genetic ablation of target cells is a powerful tool to study the origins and functions of cells, tissue regeneration, or pathophysiology in a human disease model in vivo. Several methods for selective cell ablation by inducing apoptosis have been established, using exogenous toxins or endogenous proapoptotic genes. However, their application is limited to cells with intact apoptotic machinery. Herein, we established a method for inducing rapid and selective cell necrosis by the pore-forming bacterial toxin Cry1Aa, which is specifically active in cells expressing the Cry1Aa receptor (CryR) derived from the silkworm Bombyx mori. We demonstrated that overexpressing CryR in Drosophila melanogaster tissues induced rapid cell death of CryR-expressing cells only, in the presence of Cry1Aa toxin. Cry/CryR system was effective against both proliferating cells in imaginal discs and polyploid postmitotic cells in the fat body. Live imaging analysis of cell ablation revealed swelling and subsequent osmotic lysis of CryR-positive cells after 30 min of incubation with Cry1Aa toxin. Osmotic cell lysis was still triggered when apoptosis, JNK activation, or autophagy was inhibited, suggesting that Cry1Aa-induced necrotic cell death occurred independently of these cellular signaling pathways. Injection of Cry1Aa into the body cavity resulted in specific ablation of CryR-expressing cells, indicating the usefulness of this method for in vivo cell ablation. With Cry toxins from Bacillus thuringiensis, we developed a novel method for genetic induction of cell necrosis. Our system provides a "proteinous drill" for killing target cells through physical injury of the cell membrane, which can potentially be used to ablate any cell type in any organisms, even those that are resistant to apoptosis or JNK-dependent programmed cell death.

Identification of a Novel Virulence Determinant with Serum Opacification Activity in Streptococcus suis

PubMed Central

Baums, Christoph G.; Kaim, Ute; Fulde, Marcus; Ramachandran, Girish; Goethe, Ralph; Valentin-Weigand, Peter

2006-01-01

Streptococcus suis serotype 2 is a porcine and human pathogen with adhesive and invasive properties. In other streptococci, large surface-associated proteins (>100 kDa) of the MSCRAMM family (microbial surface components recognizing adhesive matrix molecules) are key players in interactions with host tissue. In this study, we identified a novel opacity factor of S. suis (OFS) with structural homology to members of the MSCRAMM family. The N-terminal region of OFS is homologous to the respective regions of fibronectin-binding protein A (FnBA) of Streptococcus dysgalactiae and the serum opacity factor (SOF) of Streptococcus pyogenes. Similar to these two proteins, the N-terminal domain of OFS opacified horse serum. Serum opacification activity was detectable in sodium dodecyl sulfate extracts of wild-type S. suis but not in extracts of isogenic ofs knockout mutants. Heterologous expression of OFS in Lactococcus lactis demonstrated that a high level of expression of OFS is sufficient to provide surface-associated serum opacification activity. Furthermore, serum opacification could be inhibited by an antiserum against recombinant OFS. The C-terminal repetitive sequence elements of OFS differed significantly from the respective repeat regions of FnBA and SOF as well as from the consensus sequence of the fibronectin-binding repeats of MSCRAMMs. Accordingly, fibronectin binding was not detectable in recombinant OFS. To investigate the putative function of OFS in the pathogenesis of invasive S. suis diseases, piglets were experimentally infected with an isogenic mutant strain in which the ofs gene had been knocked out by an in-frame deletion. The mutant was severely attenuated in virulence but not in colonization, demonstrating that OFS represents a novel virulence determinant of S. suis. PMID:17057090

A method for in Vivo radiolabeling Bacillus thuringiensis native δ-endotoxin crystals

Treesearch

C. Noah Koller; Leah S. Bauer; Robert M. Hollingworth

1995-01-01

The entomocidal CryIIIA δ-endotoxin protein of Bacillus thuringiensis var. tenebrionis is distinctive in chemistry and host range. In contrast to other δ-endotoxins, the CryIIIA parasporal crystals are toxic within the acidic midgut environment of several coleopteran species, particularly those in the family...

A laboratory assessment of the potential effect of Cry1Ab/Cry2Aj-containing Bt maize pollen on Folsomia candida by toxicological and biochemical analyses.

PubMed

Zhang, Bing; Yang, Yan; Zhou, Xiang; Shen, Ping; Peng, Yufa; Li, Yunhe

2017-03-01

The common soil arthropod Folsomia candida can survive well when fed only maize pollen and thus may be exposed to insecticidal proteins by ingesting insect-resistant genetically engineered maize pollen containing Bacillus thuringiensis (Bt) proteins when being released into the soil. Laboratory experiments were conducted to assess the potential effects of Cry1Ab/Cry2Aj-producing transgenic Bt maize (Shuangkang 12-5) pollen on F. candida fitness. Survival, development, and the reproduction were not significantly reduced when F. candida fed on Bt maize pollen rather than on non-Bt maize pollen, but these parameters were significantly reduced when F. candida fed on non-Bt maize pollen containing the protease inhibitor E-64 at 75 μg/g pollen. The intrinsic rate of increase (r m ) was not significantly reduced when F. candida fed on Bt maize pollen but was significantly reduced when F. candida fed on non-Bt maize pollen containing E-64. The activities of antioxidant-related enzymes in F. candida were not significantly affected when F. candida fed on Bt maize pollen but were significantly increased when F. candida fed on non-Bt pollen containing E-64. The results demonstrate that consumption of Bt maize pollen containing Cry1Ab/Cry2Aj has no lethal or sublethal effects on F. candida. Copyright © 2017 Elsevier Ltd. All rights reserved.

Changes in active site histidine hydrogen bonding trigger cryptochrome activation

PubMed Central

Ganguly, Abir; Manahan, Craig C.; Top, Deniz; Yee, Estella F.; Lin, Changfan; Young, Michael W.; Thiel, Walter; Crane, Brian R.

2016-01-01

Cryptochrome (CRY) is the principal light sensor of the insect circadian clock. Photoreduction of the Drosophila CRY (dCRY) flavin cofactor to the anionic semiquinone (ASQ) restructures a C-terminal tail helix (CTT) that otherwise inhibits interactions with targets that include the clock protein Timeless (TIM). All-atom molecular dynamics (MD) simulations indicate that flavin reduction destabilizes the CTT, which undergoes large-scale conformational changes (the CTT release) on short (25 ns) timescales. The CTT release correlates with the conformation and protonation state of conserved His378, which resides between the CTT and the flavin cofactor. Poisson-Boltzmann calculations indicate that flavin reduction substantially increases the His378 pKa. Consistent with coupling between ASQ formation and His378 protonation, dCRY displays reduced photoreduction rates with increasing pH; however, His378Asn/Arg variants show no such pH dependence. Replica-exchange MD simulations also support CTT release mediated by changes in His378 hydrogen bonding and verify other responsive regions of the protein previously identified by proteolytic sensitivity assays. His378 dCRY variants show varying abilities to light-activate TIM and undergo self-degradation in cellular assays. Surprisingly, His378Arg/Lys variants do not degrade in light despite maintaining reactivity toward TIM, thereby implicating different conformational responses in these two functions. Thus, the dCRY photosensory mechanism involves flavin photoreduction coupled to protonation of His378, whose perturbed hydrogen-bonding pattern alters the CTT and surrounding regions. PMID:27551082

Mechanisms of triglyceride metabolism in patients with bile acid diarrhea

PubMed Central

Sagar, Nidhi Midhu; McFarlane, Michael; Nwokolo, Chuka; Bardhan, Karna Dev; Arasaradnam, Ramesh Pulendran

2016-01-01

Bile acids (BAs) are essential for the absorption of lipids. BA synthesis is inhibited through intestinal farnesoid X receptor (FXR) activity. BA sequestration is known to influence BA metabolism and control serum lipid concentrations. Animal data has demonstrated a regulatory role for the FXR in triglyceride metabolism. FXR inhibits hepatic lipogenesis by inhibiting the expression of sterol regulatory element binding protein 1c via small heterodimer primer activity. Conversely, FXR promotes free fatty acids oxidation by inducing the expression of peroxisome proliferator-activated receptor α. FXR can reduce the expression of microsomal triglyceride transfer protein, which regulates the assembly of very low-density lipoproteins (VLDL). FXR activation in turn promotes the clearance of circulating triglycerides by inducing apolipoprotein C-II, very low-density lipoproteins receptor (VLDL-R) and the expression of Syndecan-1 together with the repression of apolipoprotein C-III, which increases lipoprotein lipase activity. There is currently minimal clinical data on triglyceride metabolism in patients with bile acid diarrhoea (BAD). Emerging data suggests that a third of patients with BAD have hypertriglyceridemia. Further research is required to establish the risk of hypertriglyceridaemia in patients with BAD and elicit the mechanisms behind this, allowing for targeted treatment. PMID:27570415

Reaction of cyanide with cytochrome ba3 from Thermus thermophilus: spectroscopic characterization of the Fe(II)a3-CN.Cu(II)B-CN complex suggests four 14N atoms are coordinated to CuB.

PubMed Central

Surerus, K K; Oertling, W A; Fan, C; Gurbiel, R J; Einarsdóttir, O; Antholine, W E; Dyer, R B; Hoffman, B M; Woodruff, W H; Fee, J A

1992-01-01

Cytochrome ba3 from Thermus thermophilus reacts slowly with excess HCN at pH 7.4 to create a form of the enzyme in which CuA, cytochrome b, and CuB remain oxidized, while cytochrome a3 is reduced by one electron, presumably with the formation of cyanogen. We have examined this form of the enzyme by UV-visible, resonance Raman, EPR, and electron nuclear double resonance spectroscopies in conjunction with permutations of 13C- and 15N-labeled cyanide. The results support a model in which one CN- binds through the carbon atom to ferrous a3, supporting a low-spin (S = 0) configuration on the Fe; bridging by this cyanide to the CuB is weak or absent. Four 14N atoms, presumably donated by histidine residues of the protein, provide a strong equatorial ligand field about CuB; a second CN- is coordinated through the carbon atom to CuB in an axial position. PMID:1314380

Molecular Properties of Guar Gum and Pectin Modify Cecal Bile Acids, Microbiota, and Plasma Lipopolysaccharide-Binding Protein in Rats

PubMed Central

Ghaffarzadegan, Tannaz; Marungruang, Nittaya; Fåk, Frida; Nyman, Margareta

2016-01-01

Bile acids (BAs) act as signaling molecules in various physiological processes, and are related to colonic microbiota composition as well as to different types of dietary fat and fiber. This study investigated whether guar gum and pectin—two fibers with distinct functional characteristics—affect BA profiles, microbiota composition, and gut metabolites in rats. Low- (LM) or high-methoxylated (HM) pectin, and low-, medium-, or high-molecular-weight (MW) guar gum were administered to rats that were fed either low- or high-fat diets. Cecal BAs, short-chain fatty acids (SCFA) and microbiota composition, and plasma lipopolysaccharide-binding protein (LBP) levels were analyzed, by using novel methodologies based on gas chromatography (BAs and SCFAs) and 16S rRNA gene sequencing on the Illumina MiSeq platform. Strong correlations were observed between cecal BA and SCFA levels, microbiota composition, and portal plasma LBP levels in rats on a high-fat diet. Notably, guar gum consumption with medium-MW increased the cecal amounts of cholic-, chenodeoxycholic-, and ursodeoxycholic acids as well as α-, β-, and ω-muricholic acids to a greater extent than other types of guar gum or the fiber-free control diet. In contrast, the amounts of cecal deoxycholic- and hyodeoxycholic acid were reduced with all types of guar gum independent of chain length. Differences in BA composition between pectin groups were less obvious, but cecal levels of α- and ω-muricholic acids were higher in rats fed LM as compared to HM pectin or the control diet. The inflammatory marker LBP was downregulated in rats fed medium-MW guar gum and HM pectin; these two fibers decreased the cecal abundance of Oscillospira and an unclassified genus in Ruminococcaceae, and increased that of an unclassified family in RF32. These results indicate that the molecular properties of guar gum and pectin are important for their ability to modulate cecal BA formation, gut microbiota composition, and high-fat diet induced inflammation. PMID:27315087

The Flavoproteins CryD and VvdA Cooperate with the White Collar Protein WcoA in the Control of Photocarotenogenesis in Fusarium fujikuroi

PubMed Central

Castrillo, Marta; Avalos, Javier

2015-01-01

Light stimulates carotenoid biosynthesis in the ascomycete fungus Fusarium fujikuroi through transcriptional activation of the structural genes of the pathway carRA, carB, and cart, but the molecular basis of this photoresponse is unknown. The F. fujikuroi genome contains genes for different predicted photoreceptors, including the WC protein WcoA, the DASH cryptochrome CryD and the Vivid-like flavoprotein VvdA. We formerly found that null mutants of wcoA, cryD or vvdA exhibit carotenoid photoinduction under continuous illumination. Here we show that the wild type exhibits a biphasic response in light induction kinetics experiments, with a rapid increase in carotenoid content in the first hours, a transient arrest and a subsequent slower increase. The mutants of the three photoreceptors show different kinetic responses: the wcoA mutants are defective in the rapid response, the cryD mutants are affected in the slower response, while the fast and slow responses were respectively enhanced and attenuated in the vvdA mutants. Transcriptional analyses of the car genes revealed a strong reduction of dark and light-induced transcript levels in the wcoA mutants, while minor or no reductions were found in the cryD mutants. Formerly, we found no change on carRA and carB photoinduction in vvdA mutants. Taken together, our data suggest a cooperative participation of WcoA and CryD in early and late stages of photoinduction of carotenoid biosynthesis in F. fujikuroi, and a possible modulation of WcoA activity by VvdA. An unexpected transcriptional induction by red light of vvdA, cryD and carRA genes suggest the participation of an additional red light-absorbing photoreceptor. PMID:25774802

The presence of Bacillus thuringiensis (Bt) protein in earthworms Eisenia fetida has no deleterious effects on their growth and reproduction.

PubMed

Shu, Yinghua; Ma, Honghui; Du, Yan; Li, Zhixian; Feng, Yuanjiao; Wang, Jianwu

2011-11-01

Earthworms Eisenia fetida, bred in substances with stover of two genetically-engineered Bacillus thuringiensis (Bt) corns (5422Bt1 (Event Bt11) and 5422CBCL (MON810)) expressing Cry1Ab and their near-isogenic non-Bt corn (5422), were used to investigate the non-target effects of Bt corn on soil-dwelling organisms. Cry1Ab concentrations in substances, casts and guts of E. fetida were also investigated by Enzyme-linked immunosorbent assay (ELISA). More than 90% individuals of E. fetida survived over a period of 30 d, irrespective of whether they received Bt corn or non-Bt corn. Compared to 5422 treatments, significantly higher relative growth rate and more number of new offspring and cocoons of E. fetida were found in 5422Bt1 and 5422CBCL treatments. These results were unlikely to be directly caused by Cry1Ab released from Bt corns but rather by differences in other factors of plants such as plant components (soluble sugar, total organic carbon, total protein and available phosphorus of Bt corns were more than 5422). ELISA results indicated immunoreactive Cry1Ab was detectable in substances, and the casts, guts of E. fetida from Bt corns treatments, of which the highest levels were detected in substances under the corresponding experimental conditions. With the increase of treated time, a strong decline was observed in Cry1Ab from substances and casts of E. fetida, whereas Cry1Ab in guts of E. fetida from 5422Bt1 treatments gradually increased and that from 5422CBCL treatments increased between 14 and 30 d. Therefore, the presence of Cry1Ab in E. fetida had no deleterious effects on their growth and reproduction. Copyright © 2011 Elsevier Ltd. All rights reserved.

Identification of the Ah-Receptor Structural Determinants for Ligand Preferences

PubMed Central

Xing, Yongna

2012-01-01

The aryl hydrocarbon receptor (AHR) is a transcription factor that responds to diverse ligands and plays a critical role in toxicology, immune function, and cardiovascular physiology. The structural basis of the AHR for ligand promiscuity and preferences is critical for understanding AHR function. Based on the structure of a closely related protein HIF2α, we modeled the AHR ligand binding domain (LBD) bound to 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) and benzo(a)pyrene (BaP) and identified residues that control ligand preferences by shape and H-bond potential. Mutations to these residues, particularly Q377 and G298, resulted in robust and opposite changes in the potency of TCDD and BaP and up to a 20-fold change in the ratio of TCDD/BaP efficacy. The model also revealed a flexible “belt” structure; molecular dynamic (MD) simulation suggested that the “belt” and several other structural elements in the AHR-LBD are more flexible than HIF2α and likely contribute to ligand promiscuity. Molecular docking of TCDD congeners to a model of human AHR-LBD ranks their binding affinity similar to experimental ranking of their toxicity. Our study reveals key structural basis for prediction of toxicity and understanding the AHR signaling through diverse ligands. PMID:22659362

An overview of the safety and biological effects of Bacillus thuringiensis Cry toxins in mammals.

PubMed

Rubio-Infante, Néstor; Moreno-Fierros, Leticia

2016-05-01

Crystal proteins (Cry) produced during the growth and sporulation phases of Bacillus thuringiensis (Bt) bacterium are known as delta endotoxins. These toxins are being used worldwide as bioinsecticides to control pests in agriculture, and some Cry toxins are used against mosquitoes to control vector transmission. This review summarizes the relevant information currently available regarding the biosafety and biological effects that Bt and its insecticidal Cry proteins elicit in mammals. This work was performed because of concerns regarding the possible health impact of Cry toxins on vertebrates, particularly because Bt toxins might be associated with immune-activating or allergic responses. The controversial data published to date are discussed in this review considering earlier toxicological studies of B. thuringiensis, spores, toxins and Bt crops. We discussed the experimental studies performed in humans, mice, rats and sheep as well as in diverse mammalian cell lines. Although the term 'toxic' is not appropriate for defining the effects these toxins have on mammals, they cannot be considered innocuous, as they have some physiological effects that may become pathological; thus, trials that are more comprehensive are necessary to determine their effects on mammals because knowledge in this field remains limited. Copyright © 2015 John Wiley & Sons, Ltd.