Sample records for cryptic binding sites

  1. FOLLITROPIN RECEPTORS CONTAIN CRYPTIC LIGAND BINDING SITES1

    PubMed Central

    Lin, Win; Bernard, Michael P.; Cao, Donghui; Myers, Rebecca V.; Kerrigan, John E.; Moyle, William R.

    2007-01-01

    Human choriogonadotropin (hCG) and follitropin (hFSH) have been shown to contact different regions of the extracellular domains of G-protein coupled lutropin (LHR) and follitropin (FSHR) receptors. We report here that hCG and hFSH analogs interact with an FSHR/LHR chimera having only two unique LHR residues similar to the manners in which they dock with LHR and FSHR, respectively. This shows that although the FSHR does not normally bind hCG, it contains a cryptic lutropin binding site that has the potential to recognize hCG in a manner similar to the LHR. The presence of this cryptic site may explain why equine lutropins bind many mammalian FSHR and why mutations in the transmembrane domain distant from the extracellular domain enable the FSHR to bind hCG. The leucine-rich repeat domain (LRD) of the FSHR also appears to contain a cryptic FSH binding site that is obscured by other parts of the extracellular domain. This will explain why contacts seen in crystals of hFSH complexed with an LRD fragment of the human FSHR are hard to reconcile with the abilities of FSH analogs to interact with membrane G-protein coupled FSHR. We speculate that cryptic lutropin binding sites in the FSHR, which are also likely to be present in thyrotropin receptors (TSHR), permit the physiological regulation of ligand binding specificity. Cryptic FSH binding sites in the LRD may enable alternate spliced forms of the FSHR to interact with FSH. PMID:17059863

  2. Designing small molecules to target cryptic pockets yields both positive and negative allosteric modulators

    PubMed Central

    Moeder, Katelyn E.; Ho, Chris M. W.; Zimmerman, Maxwell I.; Frederick, Thomas E.; Bowman, Gregory R.

    2017-01-01

    Allosteric drugs, which bind to proteins in regions other than their main ligand-binding or active sites, make it possible to target proteins considered “undruggable” and to develop new therapies that circumvent existing resistance. Despite growing interest in allosteric drug discovery, rational design is limited by a lack of sufficient structural information about alternative binding sites in proteins. Previously, we used Markov State Models (MSMs) to identify such “cryptic pockets,” and here we describe a method for identifying compounds that bind in these cryptic pockets and modulate enzyme activity. Experimental tests validate our approach by revealing both an inhibitor and two activators of TEM β-lactamase (TEM). To identify hits, a library of compounds is first virtually screened against either the crystal structure of a known cryptic pocket or an ensemble of structures containing the same cryptic pocket that is extracted from an MSM. Hit compounds are then screened experimentally and characterized kinetically in individual assays. We identify three hits, one inhibitor and two activators, demonstrating that screening for binding to allosteric sites can result in both positive and negative modulation. The hit compounds have modest effects on TEM activity, but all have higher affinities than previously identified inhibitors, which bind the same cryptic pocket but were found, by chance, via a computational screen targeting the active site. Site-directed mutagenesis of key contact residues predicted by the docking models is used to confirm that the compounds bind in the cryptic pocket as intended. Because hit compounds are identified from docking against both the crystal structure and structures from the MSM, this platform should prove suitable for many proteins, particularly targets whose crystal structures lack obvious druggable pockets, and for identifying both inhibitory and activating small-molecule modulators. PMID:28570708

  3. Understanding Cryptic Pocket Formation in Protein Targets by Enhanced Sampling Simulations.

    PubMed

    Oleinikovas, Vladimiras; Saladino, Giorgio; Cossins, Benjamin P; Gervasio, Francesco L

    2016-11-02

    Cryptic pockets, that is, sites on protein targets that only become apparent when drugs bind, provide a promising alternative to classical binding sites for drug development. Here, we investigate the nature and dynamical properties of cryptic sites in four pharmacologically relevant targets, while comparing the efficacy of various simulation-based approaches in discovering them. We find that the studied cryptic sites do not correspond to local minima in the computed conformational free energy landscape of the unliganded proteins. They thus promptly close in all of the molecular dynamics simulations performed, irrespective of the force-field used. Temperature-based enhanced sampling approaches, such as Parallel Tempering, do not improve the situation, as the entropic term does not help in the opening of the sites. The use of fragment probes helps, as in long simulations occasionally it leads to the opening and binding to the cryptic sites. Our observed mechanism of cryptic site formation is suggestive of an interplay between two classical mechanisms: induced-fit and conformational selection. Employing this insight, we developed a novel Hamiltonian Replica Exchange-based method "SWISH" (Sampling Water Interfaces through Scaled Hamiltonians), which combined with probes resulted in a promising general approach for cryptic site discovery. We also addressed the issue of "false-positives" and propose a simple approach to distinguish them from druggable cryptic pockets. Our simulations, whose cumulative sampling time was more than 200 μs, help in clarifying the molecular mechanism of pocket formation, providing a solid basis for the choice of an efficient computational method.

  4. Cryptic binding sites on proteins: definition, detection, and druggability.

    PubMed

    Vajda, Sandor; Beglov, Dmitri; Wakefield, Amanda E; Egbert, Megan; Whitty, Adrian

    2018-05-22

    Many proteins in their unbound structures lack surface pockets appropriately sized for drug binding. Hence, a variety of experimental and computational tools have been developed for the identification of cryptic sites that are not evident in the unbound protein but form upon ligand binding, and can provide tractable drug target sites. The goal of this review is to discuss the definition, detection, and druggability of such sites, and their potential value for drug discovery. Novel methods based on molecular dynamics simulations are particularly promising and yield a large number of transient pockets, but it has been shown that only a minority of such sites are generally capable of binding ligands with substantial affinity. Based on recent studies, current methodology can be improved by combining molecular dynamics with fragment docking and machine learning approaches. Copyright © 2018 Elsevier Ltd. All rights reserved.

  5. Cryptic glucocorticoid receptor-binding sites pervade genomic NF-κB response elements.

    PubMed

    Hudson, William H; Vera, Ian Mitchelle S de; Nwachukwu, Jerome C; Weikum, Emily R; Herbst, Austin G; Yang, Qin; Bain, David L; Nettles, Kendall W; Kojetin, Douglas J; Ortlund, Eric A

    2018-04-06

    Glucocorticoids (GCs) are potent repressors of NF-κB activity, making them a preferred choice for treatment of inflammation-driven conditions. Despite the widespread use of GCs in the clinic, current models are inadequate to explain the role of the glucocorticoid receptor (GR) within this critical signaling pathway. GR binding directly to NF-κB itself-tethering in a DNA binding-independent manner-represents the standing model of how GCs inhibit NF-κB-driven transcription. We demonstrate that direct binding of GR to genomic NF-κB response elements (κBREs) mediates GR-driven repression of inflammatory gene expression. We report five crystal structures and solution NMR data of GR DBD-κBRE complexes, which reveal that GR recognizes a cryptic response element between the binding footprints of NF-κB subunits within κBREs. These cryptic sequences exhibit high sequence and functional conservation, suggesting that GR binding to κBREs is an evolutionarily conserved mechanism of controlling the inflammatory response.

  6. Parkin-phosphoubiquitin complex reveals a cryptic ubiquitin binding site required for RBR ligase activity

    PubMed Central

    Kumar, Atul; Chaugule, Viduth K; Condos, Tara E C; Barber, Kathryn R; Johnson, Clare; Toth, Rachel; Sundaramoorthy, Ramasubramanian; Knebel, Axel; Shaw, Gary S; Walden, Helen

    2017-01-01

    RING-BETWEENRING-RING (RBR) E3 ligases are a class of ubiquitin ligases distinct from RING or HECT E3 ligases. An important RBR is Parkin, mutations in which lead to early onset hereditary Parkinsonism. Parkin and other RBRs share a catalytic RBR module, but are usually autoinhibited and activated via distinct mechanisms. Recent insights into Parkin regulation predict large, unknown conformational changes during activation of Parkin. However, current data on active RBRs are in the absence of regulatory domains. Therefore, how individual RBRs are activated, and whether they share a common mechanism remains unclear. We now report the crystal structure of a human Parkin-phosphoubiquitin complex, which shows that phosphoubiquitin binding induces a movement in the IBR domain to reveal a cryptic ubiquitin binding site. Mutation of this site negatively impacts on Parkin’s activity. Furthermore, ubiquitin binding promotes cooperation between Parkin molecules, suggesting a role for interdomain association in RBR ligase mechanism. PMID:28414322

  7. Parkin-phosphoubiquitin complex reveals cryptic ubiquitin-binding site required for RBR ligase activity.

    PubMed

    Kumar, Atul; Chaugule, Viduth K; Condos, Tara E C; Barber, Kathryn R; Johnson, Clare; Toth, Rachel; Sundaramoorthy, Ramasubramanian; Knebel, Axel; Shaw, Gary S; Walden, Helen

    2017-05-01

    RING-between-RING (RBR) E3 ligases are a class of ubiquitin ligases distinct from RING or HECT E3 ligases. An important RBR ligase is Parkin, mutations in which lead to early-onset hereditary Parkinsonism. Parkin and other RBR ligases share a catalytic RBR module but are usually autoinhibited and activated via distinct mechanisms. Recent insights into Parkin regulation predict large, unknown conformational changes during Parkin activation. However, current data on active RBR ligases reflect the absence of regulatory domains. Therefore, it remains unclear how individual RBR ligases are activated, and whether they share a common mechanism. We now report the crystal structure of a human Parkin-phosphoubiquitin complex, which shows that phosphoubiquitin binding induces movement in the 'in-between RING' (IBR) domain to reveal a cryptic ubiquitin-binding site. Mutation of this site negatively affects Parkin's activity. Furthermore, ubiquitin binding promotes cooperation between Parkin molecules, which suggests a role for interdomain association in the RBR ligase mechanism.

  8. Deciphering Cryptic Binding Sites on Proteins by Mixed-Solvent Molecular Dynamics.

    PubMed

    Kimura, S Roy; Hu, Hai Peng; Ruvinsky, Anatoly M; Sherman, Woody; Favia, Angelo D

    2017-06-26

    In recent years, molecular dynamics simulations of proteins in explicit mixed solvents have been applied to various problems in protein biophysics and drug discovery, including protein folding, protein surface characterization, fragment screening, allostery, and druggability assessment. In this study, we perform a systematic study on how mixtures of organic solvent probes in water can reveal cryptic ligand binding pockets that are not evident in crystal structures of apo proteins. We examine a diverse set of eight PDB proteins that show pocket opening induced by ligand binding and investigate whether solvent MD simulations on the apo structures can induce the binding site observed in the holo structures. The cosolvent simulations were found to induce conformational changes on the protein surface, which were characterized and compared with the holo structures. Analyses of the biological systems, choice of probes and concentrations, druggability of the resulting induced pockets, and application to drug discovery are discussed here.

  9. Succession of splicing regulatory elements determines cryptic 5΄ss functionality

    PubMed Central

    Brillen, Anna-Lena; Schöneweis, Katrin; Walotka, Lara; Hartmann, Linda; Müller, Lisa; Ptok, Johannes; Kaisers, Wolfgang; Poschmann, Gereon; Stühler, Kai; Buratti, Emanuele

    2017-01-01

    Abstract A critical step in exon definition is the recognition of a proper splice donor (5΄ss) by the 5’ end of U1 snRNA. In the selection of appropriate 5΄ss, cis-acting splicing regulatory elements (SREs) are indispensable. As a model for 5΄ss recognition, we investigated cryptic 5΄ss selection within the human fibrinogen Bβ-chain gene (FGB) exon 7, where we identified several exonic SREs that simultaneously acted on up- and downstream cryptic 5΄ss. In the FGB exon 7 model system, 5΄ss selection iteratively proceeded along an alternating sequence of U1 snRNA binding sites and interleaved SREs which in principle supported different 3’ exon ends. Like in a relay race, SREs either suppressed a potential 5΄ss and passed the splicing baton on or splicing actually occurred. From RNA-Seq data, we systematically selected 19 genes containing exons with silent U1 snRNA binding sites competing with nearby highly used 5΄ss. Extensive SRE analysis by different algorithms found authentic 5΄ss significantly more supported by SREs than silent U1 snRNA binding sites, indicating that our concept may permit generalization to a model for 5΄ss selection and 3’ exon end definition. PMID:28039323

  10. Cryptic MCAT enhancer regulation in fibroblasts and smooth muscle cells. Suppression of TEF-1 mediated activation by the single-stranded DNA-binding proteins, Pur alpha, Pur beta, and MSY1.

    PubMed

    Carlini, Leslie E; Getz, Michael J; Strauch, Arthur R; Kelm, Robert J

    2002-03-08

    An asymmetric polypurine-polypyrimidine cis-element located in the 5' region of the mouse vascular smooth muscle alpha-actin gene serves as a binding site for multiple proteins with specific affinity for either single- or double-stranded DNA. Here, we test the hypothesis that single-stranded DNA-binding proteins are responsible for preventing a cryptic MCAT enhancer centered within this element from cooperating with a nearby serum response factor-interacting CArG motif to trans-activate the minimal promoter in fibroblasts and smooth muscle cells. DNA binding studies revealed that the core MCAT sequence mediates binding of transcription enhancer factor-1 to the double-stranded polypurine-polypyrimidine element while flanking nucleotides account for interaction of Pur alpha and Pur beta with the purine-rich strand and MSY1 with the complementary pyrimidine-rich strand. Mutations that selectively impaired high affinity single-stranded DNA binding by fibroblast or smooth muscle cell-derived Pur alpha, Pur beta, and MSY1 in vitro, released the cryptic MCAT enhancer from repression in transfected cells. Additional experiments indicated that Pur alpha, Pur beta, and MSY1 also interact specifically, albeit weakly, with double-stranded DNA and with transcription enhancer factor-1. These results are consistent with two plausible models of cryptic MCAT enhancer regulation by Pur alpha, Pur beta, and MSY1 involving either competitive single-stranded DNA binding or masking of MCAT-bound transcription enhancer factor-1.

  11. Follicle-stimulating hormone (FSH) unmasks specific high affinity FSH-binding sites in cell-free membrane preparations of porcine granulosa cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ford, K.A.; LaBarbera, A.R.

    1988-11-01

    The purpose of these studies was to determine whether changes in FSH receptors correlated with FSH-induced attenuation of FSH-responsive adenylyl cyclase in immature porcine granulosa cells. Cells were incubated with FSH (1-1000 ng/ml) for up to 24 h, treated with acidified medium (pH 3.5) to remove FSH bound to cells, and incubated with (125I)iodo-porcine FSH to quantify FSH-binding sites. FSH increased binding of FSH in a time-, temperature-, and FSH concentration-dependent manner. FSH (200 ng/ml) increased binding approximately 4-fold within 16 h. Analysis of equilibrium saturation binding data indicated that the increase in binding sites reflected a 2.3-fold increase inmore » receptor number and a 5.4-fold increase in apparent affinity. The increase in binding did not appear to be due to 1) a decrease in receptor turnover, since the basal rate of turnover appeared to be very slow; 2) an increase in receptor synthesis, since agents that inhibit protein synthesis and glycosylation did not block the increase in binding; or 3) an increase in intracellular receptors, since agents that inhibit cytoskeletal components had no effect. Agents that increase intracellular cAMP did not affect FSH binding. The increase in binding appeared to result from unmasking of cryptic FSH-binding sites, since FSH increased binding in cell-free membrane preparations to the same extent as in cells. Unmasking of cryptic sites was hormone specific, and the sites bound FSH specifically. Unmasking of sites was reversible in a time- and temperature-dependent manner after removal of bound FSH. The similarity between the FSH dose-response relationships for unmasking of FSH-binding sites and attenuation of FSH-responsive cAMP production suggests that the two processes are functionally linked.« less

  12. Left-right axis asymmetry determining human Cryptic gene is transcriptionally repressed by Snail.

    PubMed

    Gupta, Kartik; Pilli, Vijaya Satish Sekhar; Aradhyam, Gopala Krishna

    2016-10-28

    Establishment of the left-right axis is important for positioning organs asymmetrically in the developing vertebrate-embryo. A number of factors like maternally deposited molecules have emerged essential in initiating the specification of the axis; the downstream events, however, are regulated by signal-transduction and gene-expression changes identifying which remains a crucial challenge. The EGF-CFC family member Cryptic, that functions as a co-receptor for some TGF-beta ligands, is developmentally expressed in higher mammals and mutations in the gene cause loss or change in left-right axis asymmetry. Despite the strong phenotype, no transcriptional-regulator of this gene is known till date. Using promoter-analyses tools, we found strong evidence that the developmentally essential transcription factor Snail binds to the human Cryptic-promoter. We cloned the promoter-region of human Cryptic in a reporter gene and observed decreased Cryptic-promoter activation upon increasing Snail expression. Further, the expression of Cryptic is down-regulated upon exogenous Snail expression, validating the reporter assays and the previously identified role of Snail as a transcriptional repressor. Finally, we demonstrate using gel-shift assay that Snail in nuclear extract of PANC1 cells interacts with the promoter-construct bearing putative Snail binding sites and confirm this finding using chromatin immunoprecipitation assay. Snail represses the expression of human Cryptic and therefore, might affect the signaling via Nodal that has previously been demonstrated to specify the left-right axis using the EGF-CFC co-receptors.

  13. Regulatory role of XynR (YagI) in catabolism of xylonate in Escherichia coli K-12.

    PubMed

    Shimada, Tomohiro; Momiyama, Eri; Yamanaka, Yuki; Watanabe, Hiroki; Yamamoto, Kaneyoshi; Ishihama, Akira

    2017-12-01

    The genome of Escherichia coli K-12 contains ten cryptic phages, altogether constituting about 3.6% of the genome in sequence. Among more than 200 predicted genes in these cryptic phages, 14 putative transcription factor (TF) genes exist, but their regulatory functions remain unidentified. As an initial attempt to make a breakthrough for understanding the regulatory roles of cryptic phage-encoded TFs, we tried to identify the regulatory function of CP4-6 cryptic prophage-encoded YagI with unknown function. After SELEX screening, YagI was found to bind mainly at a single site within the spacer of bidirectional transcription units, yagA (encoding another uncharacterized TF) and yagEF (encoding 2-keto-3-deoxy gluconate aldolase, and dehydratase, respectively) within this prophage region. YagEF enzymes are involved in the catabolism of xylose downstream from xylonate. We then designated YagI as XynR (regulator of xylonate catabolism), one of the rare single-target TFs. In agreement with this predicted regulatory function, the activity of XynR was suggested to be controlled by xylonate. Even though low-affinity binding sites of XynR were identified in the E. coli K-12 genome, they all were inside open reading frames, implying that the regulation network of XynR is still fixed within the CR4-6 prophage without significant influence over the host E. coli K-12. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  14. Competitive regulation of alternative splicing and alternative polyadenylation by hnRNP H and CstF64 determines acetylcholinesterase isoforms

    PubMed Central

    Nazim, Mohammad; Masuda, Akio; Rahman, Mohammad Alinoor; Nasrin, Farhana; Takeda, Jun-ichi; Ohe, Kenji; Ohkawara, Bisei; Ito, Mikako

    2017-01-01

    Abstract Acetylcholinesterase (AChE), encoded by the ACHE gene, hydrolyzes the neurotransmitter acetylcholine to terminate synaptic transmission. Alternative splicing close to the 3΄ end generates three distinct isoforms of AChET, AChEH and AChER. We found that hnRNP H binds to two specific G-runs in exon 5a of human ACHE and activates the distal alternative 3΄ splice site (ss) between exons 5a and 5b to generate AChET. Specific effect of hnRNP H was corroborated by siRNA-mediated knockdown and artificial tethering of hnRNP H. Furthermore, hnRNP H competes for binding of CstF64 to the overlapping binding sites in exon 5a, and suppresses the selection of a cryptic polyadenylation site (PAS), which additionally ensures transcription of the distal 3΄ ss required for the generation of AChET. Expression levels of hnRNP H were positively correlated with the proportions of the AChET isoform in three different cell lines. HnRNP H thus critically generates AChET by enhancing the distal 3΄ ss and by suppressing the cryptic PAS. Global analysis of CLIP-seq and RNA-seq also revealed that hnRNP H competitively regulates alternative 3΄ ss and alternative PAS in other genes. We propose that hnRNP H is an essential factor that competitively regulates alternative splicing and alternative polyadenylation. PMID:28180311

  15. Competitive regulation of alternative splicing and alternative polyadenylation by hnRNP H and CstF64 determines acetylcholinesterase isoforms.

    PubMed

    Nazim, Mohammad; Masuda, Akio; Rahman, Mohammad Alinoor; Nasrin, Farhana; Takeda, Jun-Ichi; Ohe, Kenji; Ohkawara, Bisei; Ito, Mikako; Ohno, Kinji

    2017-02-17

    Acetylcholinesterase (AChE), encoded by the ACHE gene, hydrolyzes the neurotransmitter acetylcholine to terminate synaptic transmission. Alternative splicing close to the 3΄ end generates three distinct isoforms of AChET, AChEH and AChER. We found that hnRNP H binds to two specific G-runs in exon 5a of human ACHE and activates the distal alternative 3΄ splice site (ss) between exons 5a and 5b to generate AChET. Specific effect of hnRNP H was corroborated by siRNA-mediated knockdown and artificial tethering of hnRNP H. Furthermore, hnRNP H competes for binding of CstF64 to the overlapping binding sites in exon 5a, and suppresses the selection of a cryptic polyadenylation site (PAS), which additionally ensures transcription of the distal 3΄ ss required for the generation of AChET. Expression levels of hnRNP H were positively correlated with the proportions of the AChET isoform in three different cell lines. HnRNP H thus critically generates AChET by enhancing the distal 3΄ ss and by suppressing the cryptic PAS. Global analysis of CLIP-seq and RNA-seq also revealed that hnRNP H competitively regulates alternative 3΄ ss and alternative PAS in other genes. We propose that hnRNP H is an essential factor that competitively regulates alternative splicing and alternative polyadenylation.

  16. Fibronectin forms the most extensible biological fibers displaying switchable force-exposed cryptic binding sites.

    PubMed

    Klotzsch, Enrico; Smith, Michael L; Kubow, Kristopher E; Muntwyler, Simon; Little, William C; Beyeler, Felix; Gourdon, Delphine; Nelson, Bradley J; Vogel, Viola

    2009-10-27

    Rather than maximizing toughness, as needed for silk and muscle titin fibers to withstand external impact, the much softer extracellular matrix fibers made from fibronectin (Fn) can be stretched by cell generated forces and display extraordinary extensibility. We show that Fn fibers can be extended more than 8-fold (>700% strain) before 50% of the fibers break. The Young's modulus of single fibers, given by the highly nonlinear slope of the stress-strain curve, changes orders of magnitude, up to MPa. Although many other materials plastically deform before they rupture, evidence is provided that the reversible breakage of force-bearing backbone hydrogen bonds enables the large strain. When tension is released, the nano-sized Fn domains first contract in the crowded environment of fibers within seconds into random coil conformations (molten globule states), before the force-bearing hydrogen bond networks that stabilize the domain's secondary structures are reestablished within minutes (double exponential). The exposure of cryptic binding sites on Fn type III modules increases steeply upon stretching. Thus fiber extension steadily up-regulates fiber rigidity and cryptic epitope exposure, both of which are known to differentially alter cell behavior. Finally, since stress-strain relationships cannot directly be measured in native extracellular matrix (ECM), the stress-strain curves were correlated with stretch-induced alterations of intramolecular fluorescence resonance energy transfer (FRET) obtained from trace amounts of Fn probes (mechanical strain sensors) that can be incorporated into native ECM. Physiological implications of the extraordinary extensibility of Fn fibers and contraction kinetics are discussed.

  17. Characterization of the Campylobacter jejuni cryptic plasmid pTIW94 recovered from wild birds in the southeastern United States.

    PubMed

    Hiett, Kelli L; Rothrock, Michael J; Seal, Bruce S

    2013-09-01

    The complete nucleotide sequence was determined for a cryptic plasmid, pTIW94, recovered from several Campylobacter jejuni isolates from wild birds in the southeastern United States. pTIW94 is a circular molecule of 3860 nucleotides, with a G+C content (31.0%) similar to that of many Campylobacter spp. genomes. A typical origin of replication, with iteron sequences, was identified upstream of DNA sequences that demonstrated similarity to replication initiation proteins. A total of five open reading frames (ORFs) were identified; two of the five ORFs demonstrated significant similarity to plasmid pCC2228-2 found within Campylobacter coli. These two ORFs were similar to essential replication proteins RepA (100%; 26/26 aa identity) and RepB (95%; 327/346 aa identity). A third identified ORF demonstrated significant similarity (99%; 421/424 aa identity) to the MOB protein from C. coli 67-8, originally recovered from swine. The other two identified ORFs were either similar to hypothetical proteins from other Campylobacter spp., or exhibited no significant similarity to any DNA or protein sequence in the GenBank database. Promoter regions (-35 and -10 signal sites), ribosomal binding sites upstream of ORFs, and stem-loop structures were also identified within the plasmid. These results demonstrate that pTIW94 represents a previously un-reported small cryptic plasmid with unique sequences as well as highly similar sequences to other small plasmids found within Campylobacter spp., and that this cryptic plasmid is present among Campylobacter spp. recovered from different genera of wild birds. Copyright © 2013. Published by Elsevier Inc.

  18. Application of oxime-diversification to optimize ligand interactions within a cryptic pocket of the polo-like kinase 1 polo-box domain.

    PubMed

    Zhao, Xue Zhi; Hymel, David; Burke, Terrence R

    2016-10-15

    By a process involving initial screening of a set of 87 aldehydes using an oxime ligation-based strategy, we were able to achieve a several-fold affinity enhancement over one of the most potent previously known polo-like kinase 1 (Plk1) polo-box domain (PBD) binding inhibitors. This improved binding may result by accessing a newly identified auxiliary region proximal to a key hydrophobic cryptic pocket on the surface of the protein. Our findings could have general applicability to the design of PBD-binding antagonists. Published by Elsevier Ltd.

  19. Gating by tryptophan 73 exposes a cryptic pocket at the protein-binding interface of the oncogenic eIF4E protein.

    PubMed

    Lama, Dilraj; Brown, Christopher J; Lane, David P; Verma, Chandra S

    2015-10-27

    Targeting protein-protein interacting sites for potential therapeutic applications is a challenge in the development of inhibitors, and this becomes more difficult when these interfaces are relatively planar, as in the eukaryotic translation initiation factor 4E (eIF4E) protein. eIF4E is an oncogene that is overexpressed in numerous forms of cancer, making it a prime target as a therapeutic molecule. We report here the presence of a cryptic pocket at the protein-binding interface of eIF4E, which opens transiently during molecular dynamics simulations of the protein in solvent water and is observed to be stable when solvent water is mixed with benzene molecules. This pocket can also be seen in the ensemble of structures available from the solution-state conformations of eIF4E. The accessibility of the pocket is gated by the side-chain transitions of an evolutionarily conserved tryptophan residue. It is found to be feasible for accommodating clusters of benzene molecules, which signify the plasticity and ligandability of the pocket. We also observe that the newly formed cavity provides a favorable binding environment for interaction of a well-recognized small molecule inhibitor of eIF4E. The occurrence of this transiently accessible cavity highlights the existence of a more pronounced binding groove in a region that has traditionally been considered to be planar. Together, the data suggest that an alternate binding cavity exists on eIF4E and could be exploited for the rational design and development of a new class of lead compounds against the protein.

  20. An anti-hapten camelid antibody reveals a cryptic binding site with significant energetic contributions from a nonhypervariable loop

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fanning, Sean W.; Horn, James R.

    2014-03-05

    Conventional anti-hapten antibodies typically bind low-molecular weight compounds (haptens) in the crevice between the variable heavy and light chains. Conversely, heavy chain-only camelid antibodies, which lack a light chain, must rely entirely on a single variable domain to recognize haptens. While several anti-hapten VHHs have been generated, little is known regarding the underlying structural and thermodynamic basis for hapten recognition. Here, an anti-methotrexate VHH (anti-MTX VHH) was generated using grafting methods whereby the three complementarity determining regions (CDRs) were inserted onto an existing VHH framework. Thermodynamic analysis of the anti-MTX VHH CDR1-3 Graft revealed a micromolar binding affinity, while themore » crystal structure of the complex revealed a somewhat surprising noncanonical binding site which involved MTX tunneling under the CDR1 loop. Due to the close proximity of MTX to CDR4, a nonhypervariable loop, the CDR4 loop sequence was subsequently introduced into the CDR1-3 graft, which resulted in a dramatic 1000-fold increase in the binding affinity. Crystal structure analysis of both the free and complex anti-MTX CDR1-4 graft revealed CDR4 plays a significant role in both intermolecular contacts and binding site conformation that appear to contribute toward high affinity binding. Additionally, the anti-MTX VHH possessed relatively high specificity for MTX over closely related compounds aminopterin and folate, demonstrating that VHH domains are capable of binding low-molecular weight ligands with high affinity and specificity, despite their reduced interface.« less

  1. The Application of Ligand-Mapping Molecular Dynamics Simulations to the Rational Design of Peptidic Modulators of Protein-Protein Interactions.

    PubMed

    Tan, Yaw Sing; Spring, David R; Abell, Chris; Verma, Chandra S

    2015-07-14

    A computational ligand-mapping approach to detect protein surface pockets that interact with hydrophobic moieties is presented. In this method, we incorporated benzene molecules into explicit solvent molecular dynamics simulations of various protein targets. The benzene molecules successfully identified the binding locations of hydrophobic hot-spot residues and all-hydrocarbon cross-links from known peptidic ligands. They also unveiled cryptic binding sites that are occluded by side chains and the protein backbone. Our results demonstrate that ligand-mapping molecular dynamics simulations hold immense promise to guide the rational design of peptidic modulators of protein-protein interactions, including that of stapled peptides, which show promise as an exciting new class of cell-penetrating therapeutic molecules.

  2. Structure-Based Druggability Assessment of the Mammalian Structural Proteome with Inclusion of Light Protein Flexibility

    PubMed Central

    Loving, Kathryn A.; Lin, Andy; Cheng, Alan C.

    2014-01-01

    Advances reported over the last few years and the increasing availability of protein crystal structure data have greatly improved structure-based druggability approaches. However, in practice, nearly all druggability estimation methods are applied to protein crystal structures as rigid proteins, with protein flexibility often not directly addressed. The inclusion of protein flexibility is important in correctly identifying the druggability of pockets that would be missed by methods based solely on the rigid crystal structure. These include cryptic pockets and flexible pockets often found at protein-protein interaction interfaces. Here, we apply an approach that uses protein modeling in concert with druggability estimation to account for light protein backbone movement and protein side-chain flexibility in protein binding sites. We assess the advantages and limitations of this approach on widely-used protein druggability sets. Applying the approach to all mammalian protein crystal structures in the PDB results in identification of 69 proteins with potential druggable cryptic pockets. PMID:25079060

  3. An adventitious interaction of filamin A with RhoGDI2(Tyr153Glu)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Song, Mia; He, Qianjing; Berk, Benjamin-Andreas

    2016-01-15

    Filamin A (FLNA) is an actin filament crosslinking protein with multiple intracellular binding partners. Mechanical force exposes cryptic FLNA binding sites for some of these ligands. To identify new force-dependent binding interactions, we used a fusion construct composed of two FLNA domains, one of which was previously identified as containing a force-dependent binding site as a bait in a yeast two-hybrid system and identified the Rho dissociation inhibitor 2 (RhoGDI2) as a potential interacting partner. A RhoGDI2 truncate with 81 N-terminal amino acid residues and a phosphomimetic mutant, RhoGDI(Tyr153Glu) interacted with the FLNA construct. However, neither wild-type or full-length RhoGDI2 phosphorylatedmore » at Y153 interacted with FLNA. Our interpretation of these contradictions is that truncation and/or mutation of RhoGDI2 perturbs its conformation to expose a site that adventitiously binds FLNA and is not a bona–fide interaction. Therefore, previous studies reporting that a RhoGDI(Y153E) mutant suppresses the metastasis of human bladder cancer cells must be reinvestigated in light of artificial interaction of this point mutant with FLNA. - Highlights: • RhoGDI2 is identified as a potential filamin A (FLNA)-binding partner. • Phosphomimetic mutant, RhoGDI2(Tyr153Glu) interacts with FLNA. • RhoGDI2 phosphorylated (Tyr153) by src kinase does not interact with FLNA. • Mutation of Tyr-153 to Glu of RhoGDI2 does not mimic phosphorylation. • RhoGDI2(Tyr153Glu) provokes an adventitious interaction with FLNA.« less

  4. Human HDAC7 Harbors a Class IIa Histone Deacetylase-specific Zinc Binding Motif and Cryptic Deacetylase Activity*S⃞

    PubMed Central

    Schuetz, Anja; Min, Jinrong; Allali-Hassani, Abdellah; Schapira, Matthieu; Shuen, Michael; Loppnau, Peter; Mazitschek, Ralph; Kwiatkowski, Nick P.; Lewis, Timothy A.; Maglathin, Rebecca L.; McLean, Thomas H.; Bochkarev, Alexey; Plotnikov, Alexander N.; Vedadi, Masoud; Arrowsmith, Cheryl H.

    2008-01-01

    Histone deacetylases (HDACs) are protein deacetylases that play a role in repression of gene transcription and are emerging targets in cancer therapy. Here, we characterize the structure and enzymatic activity of the catalytic domain of human HDAC7 (cdHDAC7). Although HDAC7 normally exists as part of a multiprotein complex, we show that cdHDAC7 has a low level of deacetylase activity which can be inhibited by known HDAC inhibitors. The crystal structures of human cdHDAC7 and its complexes with two hydroxamate inhibitors are the first structures of the catalytic domain of class IIa HDACs and demonstrate significant differences with previously reported class I and class IIb-like HDAC structures. We show that cdHDAC7 has an additional class IIa HDAC-specific zinc binding motif adjacent to the active site which is likely to participate in substrate recognition and protein-protein interaction and may provide a site for modulation of activity. Furthermore, a different active site topology results in modified catalytic properties and in an enlarged active site pocket. Our studies provide mechanistic insights into class IIa HDACs and facilitate the design of specific modulators. PMID:18285338

  5. Human HDAC7 harbors a class IIa histone deacetylase-specific zinc binding motif and cryptic deacetylase activity.

    PubMed

    Schuetz, Anja; Min, Jinrong; Allali-Hassani, Abdellah; Schapira, Matthieu; Shuen, Michael; Loppnau, Peter; Mazitschek, Ralph; Kwiatkowski, Nick P; Lewis, Timothy A; Maglathin, Rebecca L; McLean, Thomas H; Bochkarev, Alexey; Plotnikov, Alexander N; Vedadi, Masoud; Arrowsmith, Cheryl H

    2008-04-25

    Histone deacetylases (HDACs) are protein deacetylases that play a role in repression of gene transcription and are emerging targets in cancer therapy. Here, we characterize the structure and enzymatic activity of the catalytic domain of human HDAC7 (cdHDAC7). Although HDAC7 normally exists as part of a multiprotein complex, we show that cdHDAC7 has a low level of deacetylase activity which can be inhibited by known HDAC inhibitors. The crystal structures of human cdHDAC7 and its complexes with two hydroxamate inhibitors are the first structures of the catalytic domain of class IIa HDACs and demonstrate significant differences with previously reported class I and class IIb-like HDAC structures. We show that cdHDAC7 has an additional class IIa HDAC-specific zinc binding motif adjacent to the active site which is likely to participate in substrate recognition and protein-protein interaction and may provide a site for modulation of activity. Furthermore, a different active site topology results in modified catalytic properties and in an enlarged active site pocket. Our studies provide mechanistic insights into class IIa HDACs and facilitate the design of specific modulators.

  6. Homologous SV40 RNA trans-splicing

    PubMed Central

    Eul, Joachim; Patzel, Volker

    2013-01-01

    Simian Virus 40 (SV40) is a polyomavirus found in both monkeys and humans, which causes cancer in some animal models. In humans, SV40 has been reported to be associated with cancers but causality has not been proven yet. The transforming activity of SV40 is mainly due to its 94-kD large T antigen, which binds to the retinoblastoma (pRb) and p53 tumor suppressor proteins, and thereby perturbs their functions. Here we describe a 100 kD super T antigen harboring a duplication of the pRB binding domain that was associated with unusual high cell transformation activity and that was generated by a novel mechanism involving homologous RNA trans-splicing of SV40 early transcripts in transformed rodent cells. Enhanced trans-splice activity was observed in clones carrying a single point mutation in the large T antigen 5′ donor splice site (ss). This mutation impaired cis-splicing in favor of an alternative trans-splice reaction via a cryptic 5′ss within a second cis-spliced SV40 pre-mRNA molecule and enabled detectable gene expression. Next to the cryptic 5′ss we identified additional trans-splice helper functions, including putative dimerization domains and a splice enhancer sequence. Our findings suggest RNA trans-splicing as a SV40-intrinsic mechanism that supports the diversification of viral RNA and phenotypes. PMID:24178438

  7. In silico modeling of the cryptic E2∼ubiquitin-binding site of E6-associated protein (E6AP)/UBE3A reveals the mechanism of polyubiquitin chain assembly.

    PubMed

    Ronchi, Virginia P; Kim, Elizabeth D; Summa, Christopher M; Klein, Jennifer M; Haas, Arthur L

    2017-11-03

    To understand the mechanism for assembly of Lys 48 -linked polyubiquitin degradation signals, we previously demonstrated that the E6AP/UBE3A ligase harbors two functionally distinct E2∼ubiquitin-binding sites: a high-affinity Site 1 required for E6AP Cys 820 ∼ubiquitin thioester formation and a canonical Site 2 responsible for subsequent chain elongation. Ordered binding to Sites 1 and 2 is here revealed by observation of UbcH7∼ubiquitin-dependent substrate inhibition of chain formation at micromolar concentrations. To understand substrate inhibition, we exploited the PatchDock algorithm to model in silico UbcH7∼ubiquitin bound to Site 1, validated by chain assembly kinetics of selected point mutants. The predicted structure buries an extensive solvent-excluded surface bringing the UbcH7∼ubiquitin thioester bond within 6 Å of the Cys 820 nucleophile. Modeling onto the active E6AP trimer suggests that substrate inhibition arises from steric hindrance between Sites 1 and 2 of adjacent subunits. Confirmation that Sites 1 and 2 function in trans was demonstrated by examining the effect of E6APC820A on wild-type activity and single-turnover pulse-chase kinetics. A cyclic proximal indexation model proposes that Sites 1 and 2 function in tandem to assemble thioester-linked polyubiquitin chains from the proximal end attached to Cys 820 before stochastic en bloc transfer to the target protein. Non-reducing SDS-PAGE confirms assembly of the predicted Cys 820 -linked 125 I-polyubiquitin thioester intermediate. Other studies suggest that Glu 550 serves as a general base to generate the Cys 820 thiolate within the low dielectric binding interface and Arg 506 functions to orient Glu 550 and to stabilize the incipient anionic transition state during thioester exchange. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  8. Base pairing between the 3' exon and an internal guide sequence increases 3' splice site specificity in the Tetrahymena self-splicing rRNA intron.

    PubMed Central

    Suh, E R; Waring, R B

    1990-01-01

    It has been proposed that recognition of the 3' splice site in many group I introns involves base pairing between the start of the 3' exon and a region of the intron known as the internal guide sequence (R. W. Davies, R. B. Waring, J. Ray, T. A. Brown, and C. Scazzocchio, Nature [London] 300:719-724, 1982). We have examined this hypothesis, using the self-splicing rRNA intron from Tetrahymena thermophila. Mutations in the 3' exon that weaken this proposed pairing increased use of a downstream cryptic 3' splice site. Compensatory mutations in the guide sequence that restore this pairing resulted in even stronger selection of the normal 3' splice site. These changes in 3' splice site usage were more pronounced in the background of a mutation (414A) which resulted in an adenine instead of a guanine being the last base of the intron. These results show that the proposed pairing (P10) plays an important role in ensuring that cryptic 3' splice sites are selected against. Surprisingly, the 414A mutation alone did not result in activation of the cryptic 3' splice site. Images PMID:2342465

  9. Location of Sites Within 'Cryptic Terrain'

    NASA Technical Reports Server (NTRS)

    2007-01-01

    A regional landscape near Mars' south pole is called 'cryptic terrain' because it once defied explanation, but new observations bolster and refine interpretations of how springtime outbursts of carbon-dioxide gas there sculpt intricate patterns and paint seasonal splotches. This map indicates locations of three sites that have been examined within the area of cryptic terrain, informally designated 'Manhattan,' 'Giza' and 'Ithaca.'

    The underlying map offers context of brightness measurements from the Thermal Emission Spectrometer instrument draped over a shaded relief map based on data from the Mars Orbiter Laser Altimeter instrument. Cool colors are areas with a low albedo (dark) and warm colors are areas which have high albedo (bright). Both of those instruments flew on NASA's Mars Global Surveyor orbiter.

  10. Structure of the novel monomeric glyoxalase I from Zea mays

    PubMed Central

    Turra, Gino L.; Agostini, Romina B.; Fauguel, Carolina M.; Presello, Daniel A.; Andreo, Carlos S.; González, Javier M.; Campos-Bermudez, Valeria A.

    2015-01-01

    The glyoxalase system is ubiquitous among all forms of life owing to its central role in relieving the cell from the accumulation of methylglyoxal, a toxic metabolic byproduct. In higher plants, this system is upregulated under diverse metabolic stress conditions, such as in the defence response to infection by pathogenic microorganisms. Despite their proven fundamental role in metabolic stresses, plant glyoxalases have been poorly studied. In this work, glyoxalase I from Zea mays has been characterized both biochemically and structurally, thus reporting the first atomic model of a glyoxalase I available from plants. The results indicate that this enzyme comprises a single polypeptide with two structurally similar domains, giving rise to two lateral concavities, one of which harbours a functional nickel(II)-binding active site. The putative function of the remaining cryptic active site remains to be determined. PMID:26457425

  11. Structure of the novel monomeric glyoxalase I from Zea mays.

    PubMed

    Turra, Gino L; Agostini, Romina B; Fauguel, Carolina M; Presello, Daniel A; Andreo, Carlos S; González, Javier M; Campos-Bermudez, Valeria A

    2015-10-01

    The glyoxalase system is ubiquitous among all forms of life owing to its central role in relieving the cell from the accumulation of methylglyoxal, a toxic metabolic byproduct. In higher plants, this system is upregulated under diverse metabolic stress conditions, such as in the defence response to infection by pathogenic microorganisms. Despite their proven fundamental role in metabolic stresses, plant glyoxalases have been poorly studied. In this work, glyoxalase I from Zea mays has been characterized both biochemically and structurally, thus reporting the first atomic model of a glyoxalase I available from plants. The results indicate that this enzyme comprises a single polypeptide with two structurally similar domains, giving rise to two lateral concavities, one of which harbours a functional nickel(II)-binding active site. The putative function of the remaining cryptic active site remains to be determined.

  12. Zinc is required for the catalytic activity of the human deubiquitinating isopeptidase T.

    PubMed

    Gabriel, Jean-Marc; Lacombe, Thierry; Carobbio, Stefania; Paquet, Nicole; Bisig, Ruth; Cox, Jos A; Jaton, Jean-Claude

    2002-11-19

    Two recombinant human isopeptidase T isoforms, ISOT-S and ISOT-L, differing by an insertion of 23 amino acids in ISOT-L, were previously classified as thiol proteases. Both contain one Zn2+-binding site of high-affinity, which is part of a cryptic nitrilo-triacetate-resistant pocket (site 1). A second Zn2+ site (site 2) was disclosed when both isoforms of the holoenzyme were incubated with an excess of Zn2+. The firmly bound Zn2+ of site 1 could be removed either slowly by dialysis against 1,10-phenanthroline at pH 5.5 or rapidly by treatment at pH 3.0 in the presence of 6 M urea followed by gel filtration at neutral pH. Zn2+ in site 1, but not in site 2, is essential for proteolytic activity because apoproteins were inactive. Inhibition of the catalytic activity was not due to a loss of ubiquitin binding capacity. CD spectra of both isoforms disclosed no major structural differences between the apo- and holoenzymes. The reconstitution of apoenzyme with Zn2+ under nondenaturing conditions at pH 5.5 completely restored enzymatic activity, which was indistinguishable from the reconstitution carried out in urea at pH 3.0. Thus, both human ISOTs are either thiol proteases with a local structural Zn2+ or monozinc metalloproteases that might use in catalysis a Zn2+-activated hydroxide ion polarized by Cys335.

  13. Structure of C3b reveals conformational changes that underlie complement activity.

    PubMed

    Janssen, Bert J C; Christodoulidou, Agni; McCarthy, Andrew; Lambris, John D; Gros, Piet

    2006-11-09

    Resistance to infection and clearance of cell debris in mammals depend on the activation of the complement system, which is an important component of innate and adaptive immunity. Central to the complement system is the activated form of C3, called C3b, which attaches covalently to target surfaces to amplify complement response, label cells for phagocytosis and stimulate the adaptive immune response. C3b consists of 1,560 amino-acid residues and has 12 domains. It binds various proteins and receptors to effect its functions. However, it is not known how C3 changes its conformation into C3b and thereby exposes its many binding sites. Here we present the crystal structure at 4-A resolution of the activated complement protein C3b and describe the conformational rearrangements of the 12 domains that take place upon proteolytic activation. In the activated form the thioester is fully exposed for covalent attachment to target surfaces and is more than 85 A away from the buried site in native C3 (ref. 5). Marked domain rearrangements in the alpha-chain present an altered molecular surface, exposing hidden and cryptic sites that are consistent with known putative binding sites of factor B and several complement regulators. The structural data indicate that the large conformational changes in the proteolytic activation and regulation of C3 take place mainly in the first conversion step, from C3 to C3b. These insights are important for the development of strategies to treat immune disorders that involve complement-mediated inflammation.

  14. Role of Architecture in the Function and Specificity of Two Notch-Regulated Transcriptional Enhancer Modules

    PubMed Central

    Liu, Feng; Posakony, James W.

    2012-01-01

    In Drosophila melanogaster, cis-regulatory modules that are activated by the Notch cell–cell signaling pathway all contain two types of transcription factor binding sites: those for the pathway's transducing factor Suppressor of Hairless [Su(H)] and those for one or more tissue- or cell type–specific factors called “local activators.” The use of different “Su(H) plus local activator” motif combinations, or codes, is critical to ensure that only the correct subset of the broadly utilized Notch pathway's target genes are activated in each developmental context. However, much less is known about the role of enhancer “architecture”—the number, order, spacing, and orientation of its component transcription factor binding motifs—in determining the module's specificity. Here we investigate the relationship between architecture and function for two Notch-regulated enhancers with spatially distinct activities, each of which includes five high-affinity Su(H) sites. We find that the first, which is active specifically in the socket cells of external sensory organs, is largely resistant to perturbations of its architecture. By contrast, the second enhancer, active in the “non-SOP” cells of the proneural clusters from which neural precursors arise, is sensitive to even simple rearrangements of its transcription factor binding sites, responding with both loss of normal specificity and striking ectopic activity. Thus, diverse cryptic specificities can be inherent in an enhancer's particular combination of transcription factor binding motifs. We propose that for certain types of enhancer, architecture plays an essential role in determining specificity, not only by permitting factor–factor synergies necessary to generate the desired activity, but also by preventing other activator synergies that would otherwise lead to unwanted specificities. PMID:22792075

  15. Cryptic splice site in the complementary DNA of glucocerebrosidase causes inefficient expression.

    PubMed

    Bukovac, Scott W; Bagshaw, Richard D; Rigat, Brigitte A; Callahan, John W; Clarke, Joe T R; Mahuran, Don J

    2008-10-15

    The low levels of human lysosomal glucocerebrosidase activity expressed in transiently transfected Chinese hamster ovary (CHO) cells were investigated. Reverse transcription PCR (RT-PCR) demonstrated that a significant portion of the transcribed RNA was misspliced owing to the presence of a cryptic splice site in the complementary DNA (cDNA). Missplicing results in the deletion of 179 bp of coding sequence and a premature stop codon. A repaired cDNA was constructed abolishing the splice site without changing the amino acid sequence. The level of glucocerebrosidase expression was increased sixfold. These data demonstrate that for maximum expression of any cDNA construct, the transcription products should be examined.

  16. Information theory-based analysis of CYP2C19, CYP2D6 and CYP3A5 splicing mutations.

    PubMed

    Rogan, Peter K; Svojanovsky, Stan; Leeder, J Steven

    2003-04-01

    Several mutations are known or suspected to affect mRNA splicing of CYP2C19, CYP2D6 and CYP3A5 genes; however, little experimental evidence exists to support these conclusions. The present study applies mathematical models that measure changes in information content of splice sites in these genes to demonstrate the relationship between the predicted phenotypes of these variants to the corresponding genotypes. Based on information analysis, the CYP2C19*2 variant activates a new cryptic site 40 nucleotides downstream of the natural splice site. CYP2C19*7 abolishes splicing at the exon 5 donor site. The CYP2D6*4 allele similarly inactivates splicing at the acceptor site of exon 4 and activates a new cryptic site one nucleotide downstream of the natural acceptor. CYP2D6*11 inactivates the acceptor site of exon 2. The CYP3A5*3 allele activates a new cryptic site 236 nucleotides upstream of the exon 4 natural acceptor site. CYP3A5*5 inactivates the exon 5 donor site and CYP3A5*6 strengthens a site upstream of the natural donor site, resulting in skipping of exon 7. Other previously described missense and nonsense mutations at terminal codons of exons in these genes affected splicing. CYP2D6*8 and CYP2D6*14 both decrease the strength of the exon 3 donor site, producing transcripts lacking this exon. The results of information analysis are consistent with the poor metabolizer phenotypes observed in patients with these mutations, and illustrate the potential value of these mathematical models to quantitatively evaluate the functional consequences of new mutations suspected of altering mRNA splicing.

  17. U1snRNP-mediated suppression of polyadenylation in conjunction with the RNA structure controls poly (A) site selection in foamy viruses

    PubMed Central

    2013-01-01

    Background During reverse transcription, retroviruses duplicate the long terminal repeats (LTRs). These identical LTRs carry both promoter regions and functional polyadenylation sites. To express full-length transcripts, retroviruses have to suppress polyadenylation in the 5′LTR and activate polyadenylation in the 3′LTR. Foamy viruses have a unique LTR structure with respect to the location of the major splice donor (MSD), which is located upstream of the polyadenylation signal. Results Here, we describe the mechanisms of foamy viruses regulating polyadenylation. We show that binding of the U1 small nuclear ribonucleoprotein (U1snRNP) to the MSD suppresses polyadenylation at the 5′LTR. In contrast, polyadenylation at the 3′LTR is achieved by adoption of a different RNA structure at the MSD region, which blocks U1snRNP binding and furthers RNA cleavage and subsequent polyadenylation. Conclusion Recently, it was shown that U1snRNP is able to suppress the usage of intronic cryptic polyadenylation sites in the cellular genome. Foamy viruses take advantage of this surveillance mechanism to suppress premature polyadenylation at the 5’end of their RNA. At the 3’end, Foamy viruses use a secondary structure to presumably block access of U1snRNP and thereby activate polyadenylation at the end of the genome. Our data reveal a contribution of U1snRNP to cellular polyadenylation site selection and to the regulation of gene expression. PMID:23718736

  18. Drosophila Suppressor of Sable Protein [Su(s)] Promotes Degradation of Aberrant and Transposon-Derived RNAs▿

    PubMed Central

    Kuan, Yung-Shu; Brewer-Jensen, Paul; Bai, Wen-Li; Hunter, Cedric; Wilson, Carrie B.; Bass, Sarah; Abernethy, John; Wing, James S.; Searles, Lillie L.

    2009-01-01

    RNA-binding proteins act at various stages of gene expression to regulate and fine-tune patterns of mRNA accumulation. One protein in this class is Drosophila Su(s), a nuclear protein that has been previously shown to inhibit the accumulation of mutant transcripts by an unknown mechanism. Here, we have identified several additional RNAs that are downregulated by Su(s). These Su(s) targets include cryptic wild-type transcripts from the developmentally regulated Sgs4 and ng1 genes, noncoding RNAs derived from tandemly repeated αβ/αγ elements within an Hsp70 locus, and aberrant transcripts induced by Hsp70 promoter transgenes inserted at ectopic sites. We used the αβ RNAs to investigate the mechanism of Su(s) function and obtained evidence that these transcripts are degraded by the nuclear exosome and that Su(s) promotes this process. Furthermore, we showed that the RNA binding domains of Su(s) are important for this effect and mapped the sequences involved to a 267-nucleotide region of an αβ element. Taken together, these results suggest that Su(s) binds to certain nascent transcripts and stimulates their degradation by the nuclear exosome. PMID:19687295

  19. Is the Kapuskasing structure the site of a cryptic suture

    NASA Technical Reports Server (NTRS)

    Burke, K.

    1983-01-01

    The demonstration that the Kapuskasing structure involves substantial thrusting of deep continental crustal rocks over shallower continental rocks calls into question an earlier suggestion (by Wilson) that the Circum-Ungaua suture zone continued through the Kapuskasing to join the Penokean fold belt (implying that the Kapuskasing marked the site of what has since come to be called a cryptic suture). Problems are discussed which arose in attempting to reconcile Wilson's idea with data from more recent studies: whether the Kapuskasing and the Thompson belt both mark sutures of about 1700 Ma age; why there is no age difference across the Kapuskasing if it does mark the site of continental collision, and why there is no offset of Superior subprovinces across the Kapuskasing.

  20. The Emerging Importance of Non-HLA Autoantibodies in Kidney Transplant Complications.

    PubMed

    Cardinal, Héloise; Dieudé, Mélanie; Hébert, Marie-Josée

    2017-02-01

    Antibodies that are specific to organ donor HLA have been involved in the majority of cases of antibody-mediated rejection in solid organ transplant recipients. However, recent data show that production of non-HLA autoantibodies can occur before transplant in the form of natural autoantibodies. In contrast to HLAs, which are constitutively expressed on the cell surface of the allograft endothelium, autoantigens are usually cryptic. Tissue damage associated with ischemia-reperfusion, vascular injury, and/or rejection creates permissive conditions for the expression of cryptic autoantigens, allowing these autoantibodies to bind antigenic targets and further enhance vascular inflammation and renal dysfunction. Antiperlecan/LG3 antibodies and antiangiotensin II type 1 receptor antibodies have been found before transplant in patients with de novo transplants and portend negative long-term outcome in patients with renal transplants. Here, we review mounting evidence suggesting an important role for autoantibodies to cryptic antigens as novel accelerators of kidney dysfunction and acute or chronic allograft rejection. Copyright © 2017 by the American Society of Nephrology.

  1. The distribution of lectin receptor sites in human breast lesions.

    PubMed

    Skutelsky, E; Hoenig, S; Griffel, B; Alroy, J

    1988-08-01

    Conflicting data regarding the status of A, B, H and T antigens in epithelium of normal, mastopathies, fibroadenomas and carcinomas of the breast stimulated us to re-examine the carbohydrate residues in these condition. Currently, we extended the number of carbohydrate residues studied by using ten different biotinylated lectins as probes and avidin-biotin-peroxidase complex (ABC) as a visualant. In addition, the pattern of lectin staining of cancerous cells in primary and metastatic sites was compared. In primary and metastatic breast carcinomas, lectin receptor sites were stained more intensely with Concanavalia ensiformi agglutinin (*Con A), Ricinus communis agglutinin-I (RCA-I) and wheat germ agglutinin (WGA), than in normal breast, in mastopathies or in fibroadenomas. Cryptic receptor sites for peanut agglutinin (PNA) were stained in all cases of breast carcinomas, while free PNA sites stained only in a few cases of well-differentiated carcinomas. Receptors sites for Ulex europaeus agglutinin-I (UEA-I) stained non-malignant epithelium of patients with blood group H but did not stain malignant cells. The results show significant differences in lectin-binding patterns and staining intensities between normal and non-malignant, and malignant epithelial breast cells. Furthermore, these results indicate that in malignant cells, there is an increased content of sialic acid-rich carbohydrates but not of asialylated glycoconjugates.

  2. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lolicato, Marco; Arrigoni, Cristina; Mori, Takahiro

    Polymodal thermo- and mechanosensitive two-pore domain potassium (K2P) channels of the TREK1 subfamily generate ‘leak’ currents that regulate neuronal excitability, respond to lipids, temperature and mechanical stretch, and influence pain, temperature perception and anaesthetic responses1, 2, 3. These dimeric voltage-gated ion channel (VGIC) superfamily members have a unique topology comprising two pore-forming regions per subunit4, 5, 6. In contrast to other potassium channels, K2P channels use a selectivity filter ‘C-type’ gate7, 8, 9, 10 as the principal gating site. Despite recent advances3, 11, 12, poor pharmacological profiles of K2P channels limit mechanistic and biological studies. Here we describe a classmore » of small-molecule TREK activators that directly stimulate the C-type gate by acting as molecular wedges that restrict interdomain interface movement behind the selectivity filter. Structures of K2P2.1 (also known as TREK-1) alone and with two selective K2P2.1 (TREK-1) and K2P10.1 (TREK-2) activators—an N-aryl-sulfonamide, ML335, and a thiophene-carboxamide, ML402—define a cryptic binding pocket unlike other ion channel small-molecule binding sites and, together with functional studies, identify a cation–π interaction that controls selectivity. Together, our data reveal a druggable K2P site that stabilizes the C-type gate ‘leak mode’ and provide direct evidence for K2P selectivity filter gating.« less

  3. Utilizing nanobody technology to target non-immunodominant domains of VAR2CSA.

    PubMed

    Ditlev, Sisse B; Florea, Raluca; Nielsen, Morten A; Theander, Thor G; Magez, Stefan; Boeuf, Philippe; Salanti, Ali

    2014-01-01

    Placental malaria is a major health problem for both pregnant women and their fetuses in malaria endemic regions. It is triggered by the accumulation of Plasmodium falciparum-infected erythrocytes (IE) in the intervillous spaces of the placenta and is associated with foetal growth restriction and maternal anemia. IE accumulation is supported by the binding of the parasite-expressed protein VAR2CSA to placental chondroitin sulfate A (CSA). Defining specific CSA-binding epitopes of VAR2CSA, against which to target the immune response, is essential for the development of a vaccine aimed at blocking IE adhesion. However, the development of a VAR2CSA adhesion-blocking vaccine remains challenging due to (i) the large size of VAR2CSA and (ii) the extensive immune selection for polymorphisms and thereby non-neutralizing B-cell epitopes. Camelid heavy-chain-only antibodies (HcAbs) are known to target epitopes that are less immunogenic to classical IgG and, due to their small size and protruding antigen-binding loop, able to reach and recognize cryptic, conformational epitopes which are inaccessible to conventional antibodies. The variable heavy chain (VHH) domain is the antigen-binding site of camelid HcAbs, the so called Nanobody, which represents the smallest known (15 kDa) intact, native antigen-binding fragment. In this study, we have used the Nanobody technology, an approach new to malaria research, to generate small and functional antibody fragments recognizing unique epitopes broadly distributed on VAR2CSA.

  4. Taxonomic richness and abundance of cryptic peracarid crustaceans in the Puerto Morelos Reef National Park, Mexico

    PubMed Central

    Alvarez, Fernando

    2017-01-01

    Background and Aims Cryptic peracarids are an important component of the coral reef fauna in terms of diversity and abundance, yet they have been poorly studied. The aim of this study was to evaluate the taxonomic richness and abundance of cryptic peracarids in coral rubble in the Puerto Morelos Reef National Park, Mexico (PMRNP), and their relationship with depth. Methods Three reef sites were selected: (1) Bonanza, (2) Bocana, and (3) Jardines. At each site six kilograms of coral rubble were collected over four sampling periods at three depths: 3 m (back-reef), 6–8 m (fore-reef), and 10–12 m (fore-reef). Results A total of 8,887 peracarid crustaceans belonging to 200 taxa distributed over five orders and 63 families was obtained; 70% of the taxa were identified to species and 25% to genus level. Fifty species of those collected represent new records for the Mexican Caribbean Sea. Isopoda was the most speciose order while Tanaidacea was the most abundant. Discussion Cryptic peracarid taxonomic richness and abundance were related to depth with higher values of both parameters being found in the shallow (3 m) back-reef, possibly due to a higher reef development and a greater accumulation of coral rubble produced during hurricanes. Peracarid data obtained in the present study can be used as a baseline for future monitoring programs in the PMRNP. PMID:28630800

  5. Application of oxime-diversification to optimize ligand interactions within a cryptic pocket of the polo-like kinase 1 polo-box domain | Center for Cancer Research

    Cancer.gov

    By a process involving initial screening of a set of 87 aldehydes using an oxime ligation-based strategy, we were able to achieve a several-fold affinity enhancement over one of the most potent previously known polo-like kinase 1 (Plk1) polo-box domain (PBD) binding inhibitors. This improved binding may result by accessing a newly identified auxiliary region proximal to a key

  6. A CsrA/RsmA translational regulator gene encoded in the replication region of a Sinorhizobium meliloti cryptic plasmid complements Pseudomonas fluorescens rsmA/E mutants.

    PubMed

    Agaras, Betina; Sobrero, Patricio; Valverde, Claudio

    2013-02-01

    Members of the CsrA/RsmA family are global regulatory proteins that bind to mRNAs, usually at the ribosome-binding site, to control mRNA translation and stability. Their activity is counteracted by small non-coding RNAs (sRNAs), which offer several binding sites to compete with mRNA binding. The csrA/rsmA genes are widespread in prokaryotic chromosomes, although certain phylogenetic groups such as Alphaproteobacteria lack this type of global regulator. Interestingly, a csrA/rsmA-like sequence was identified in the replication region of plasmid pMBA19a from the alphaproteobacterium Sinorhizobium meliloti. This rsmA-like allele (rsmA(Sm)) is 58 % identical to Xanthomonas axonopodis pv. citri chromosomal rsmA and bears an unusual C-terminal extension that may fold into an extra α-helix. Homology-based modelling of RsmA(Sm) suggests that all key mRNA-binding residues are conserved and correctly positioned in the RNA-binding pocket. In fact, a 1.6 kb fragment from pMBA19a encompassing the rsmA(Sm) locus restored rsmA/E-dependent phenotypes of rsmA/E gacS Pseudomonas fluorescens mutants. The functionality of RsmA(Sm) was confirmed by the gain of control over target aprA'-'lacZ and hcnA'-'lacZ translational fusions in the same mutant background. The RsmA(Sm) activity correlated with Western blot detection of the polypeptide. Phenotype and translational fusion data from rsmA/E P. fluorescens mutants expressing RsmX/Y/Z RNAs indicated that RsmA(Sm) is able to bind these antagonistic sRNAs. In agreement with the latter observation, it was also found that the sRNA RsmY was stabilized by RsmA(Sm). Deletion of the C-terminal extra α-helix of RsmA(Sm) affected its cellular concentration, but increased its relative RNA-binding activity. This is believed to be the first report of the presence and characterization of a functional csrA/rsmA homologue in a mobile genetic element.

  7. Evolution of the SOUL Heme-Binding Protein Superfamily Across Eukarya.

    PubMed

    Fortunato, Antonio Emidio; Sordino, Paolo; Andreakis, Nikos

    2016-06-01

    SOUL homologs constitute a heme-binding protein superfamily putatively involved in heme and tetrapyrrole metabolisms associated with a number of physiological processes. Despite their omnipresence across the tree of life and the biochemical characterization of many SOUL members, their functional role and the evolutionary events leading to such remarkable protein repertoire still remain cryptic. To explore SOUL evolution, we apply a computational phylogenetic approach, including a relevant number of SOUL homologs, to identify paralog forms and reconstruct their genealogy across the tree of life and within species. In animal lineages, multiple gene duplication or loss events and paralog functional specializations underlie SOUL evolution from the dawn of ancestral echinoderm and mollusc SOUL forms. In photosynthetic organisms, SOUL evolution is linked to the endosymbiosis events leading to plastid acquisition in eukaryotes. Derivative features, such as the F2L peptide and BH3 domain, evolved in vertebrates and provided innovative functionality to support immune response and apoptosis. The evolution of elements such as the N-terminal protein domain DUF2358, the His42 residue, or the tetrapyrrole heme-binding site is modern, and their functional implications still unresolved. This study represents the first in-depth analysis of SOUL protein evolution and provides novel insights in the understanding of their obscure physiological role.

  8. Collagen fibril surface displays a constellation of sites capable of promoting fibril assembly, stability, and hemostasis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Orgel, J.P.; Antipova, O.; Sagi, I.

    Fibrillar collagens form the structural basis of organs and tissues including the vasculature, bone, and tendon. They are also dynamic, organizational scaffolds that present binding and recognition sites for ligands, cells, and platelets. We interpret recently published X-ray diffraction findings and use atomic force microscopy data to illustrate the significance of new insights into the functional organization of the collagen fibril. These data indicate that collagen's most crucial functional domains localize primarily to the overlap region, comprising a constellation of sites we call the 'master control region.' Moreover, the collagen's most exposed aspect contains its most stable part - themore » C-terminal region that controls collagen assembly, cross-linking, and blood clotting. Hidden beneath the fibril surface exists a constellation of 'cryptic' sequences poised to promote hemostasis and cell - collagen interactions in tissue injury and regeneration. These findings begin to address several important, and previously unresolved, questions: How functional domains are organized in the fibril, which domains are accessible, and which require proteolysis or structural trauma to become exposed? Here we speculate as to how collagen fibrillar organization impacts molecular processes relating to tissue growth, development, and repair.« less

  9. Activation of a cryptic splice site in the mitochondrial elongation factor GFM1 causes combined OXPHOS deficiency☆

    PubMed Central

    Simon, Mariella T.; Ng, Bobby G.; Friederich, Marisa W.; Wang, Raymond Y.; Boyer, Monica; Kircher, Martin; Collard, Renata; Buckingham, Kati J.; Chang, Richard; Shendure, Jay; Nickerson, Deborah A.; Bamshad, Michael J.; Van Hove, Johan L.K.; Freeze, Hudson H.; Abdenur, Jose E.

    2017-01-01

    We report the clinical, biochemical, and molecular findings in two brothers with encephalopathy and multi-systemic disease. Abnormal transferrin glycoforms were suggestive of a type I congenital disorder of glycosylation (CDG). While exome sequencing was negative for CDG related candidate genes, the testing revealed compound heterozygous mutations in the mitochondrial elongation factor G gene (GFM1). One of the mutations had been reported previously while the second, novel variant was found deep in intron 6, activating a cryptic splice site. Functional studies demonstrated decreased GFM1 protein levels, suggested disrupted assembly of mitochondrial complexes III and V and decreased activities of mitochondrial complexes I and IV, all indicating combined OXPHOS deficiency. PMID:28216230

  10. Actomyosin-dependent formation of the mechanosensitive talin–vinculin complex reinforces actin anchoring

    PubMed Central

    Ciobanasu, Corina; Faivre, Bruno; Le Clainche, Christophe

    2014-01-01

    The force generated by the actomyosin cytoskeleton controls focal adhesion dynamics during cell migration. This process is thought to involve the mechanical unfolding of talin to expose cryptic vinculin-binding sites. However, the ability of the actomyosin cytoskeleton to directly control the formation of a talin–vinculin complex and the resulting activity of the complex are not known. Here we develop a microscopy assay with pure proteins in which the self-assembly of actomyosin cables controls the association of vinculin to a talin-micropatterned surface in a reversible manner. Quantifications indicate that talin refolding is limited by vinculin dissociation and modulated by the actomyosin network stability. Finally, we show that the activation of vinculin by stretched talin induces a positive feedback that reinforces the actin–talin–vinculin association. This in vitro reconstitution reveals the mechanism by which a key molecular switch senses and controls the connection between adhesion complexes and the actomyosin cytoskeleton. PMID:24452080

  11. Oviposition site of the southern torrent salamander (Rhyacotriton variegatus) in northwestern California

    Treesearch

    Nancy E. Karraker; Lisa M. Ollivier; Garth R. Hodgson

    2005-01-01

    Oviposition sites and reproductive ecology of the southern-torrent salamander (Rhyacotriton variegatus) remain poorly documented. This species oviposits in cryptic locations making the detection of eggs difficult. Here we describe the discovery of 1 clutch of eggs of R. variegatus from northern California, which further expands our...

  12. Simian virus 40 T-antigen-related cell surface antigen: serological demonstration on simian virus 40-transformed monolayer cells in situ.

    PubMed Central

    Deppert, W; Hanke, K; Henning, R

    1980-01-01

    Simian virus 40 (SV40)-transformed monolayer cells were analyzed in situ by indirect immunofluorescence microscopy for the postulated cell surface location of SV40 T-antigen-related molecules. With antisera prepared against purified, sodium dodecyl sulfate-denatured SV40 T-antigen, positive surface staining was obtained when the cells had been treated with formaldehyde before immunofluorescence analysis. In contrast, living SV40-transformed cells analyzed in monolayer were surface fluorescence negative. The fixation procedure developed in this study combined with a double staining immunofluorescence technique allowed the simultaneous analysis of the same cells for the expression of both SV40 T-antigen-related surface antigen and nuclear T-antigen. The localization of SV40 T-antigen-related surface antigen on the outer surface of the plasma membrane of formaldehyde-fixed SV40-transformed cells was demonstrated directly by the protein A-mediated binding of Staphylococcus aureus bacteria on formaldehyde-fixed SV40-transformed cells precoated with antiserum against sodium dodecyl sulfate-denatured T-antigen. Both cell surface staining and S. aureus binding were found to be highly specific for SV40 T-antigen-related binding sites. These results indicate that T-antigen-related molecules in a cryptic form are located on the surface of SV40-transformed monolayer cells and can be detected in situ after modification of the cell surface architecture. Images PMID:6255189

  13. Consortium for Osteogenesis Imperfecta Mutations in the Helical Domain of Type I Collagen: Regions Rich in Lethal Mutations Align With Collagen Binding Sites for Integrins and Proteoglycans

    PubMed Central

    Marini, Joan C.; Forlino, Antonella; Cabral, Wayne A.; Barnes, Aileen M.; San Antonio, James D.; Milgrom, Sarah; Hyland, James C.; Körkkö, Jarmo; Prockop, Darwin J.; De Paepe, Anne; Coucke, Paul; Symoens, Sofie; Glorieux, Francis H.; Roughley, Peter J.; Lund, Alan M.; Kuurila-Svahn, Kaija; Hartikka, Heini; Cohn, Daniel H.; Krakow, Deborah; Mottes, Monica; Schwarze, Ulrike; Chen, Diana; Yang, Kathleen; Kuslich, Christine; Troendle, James; Dalgleish, Raymond; Byers, Peter H.

    2014-01-01

    Osteogenesis imperfecta (OI) is a generalized disorder of connective tissue characterized by fragile bones and easy susceptibility to fracture. Most cases of OI are caused by mutations in type I collagen. We have identified and assembled structural mutations in type I collagen genes (COL1A1 and COL1A2, encoding the proα1(I) and proα2(I) chains, respectively) that result in OI. Quantitative defects causing type I OI were not included. Of these 832 independent mutations, 682 result in substitution for glycine residues in the triple helical domain of the encoded protein and 150 alter splice sites. Distinct genotype–phenotype relationships emerge for each chain. One-third of the mutations that result in glycine substitutions in α1(I) are lethal, especially when the substituting residues are charged or have a branched side chain. Substitutions in the first 200 residues are nonlethal and have variable outcome thereafter, unrelated to folding or helix stability domains. Two exclusively lethal regions (helix positions 691–823 and 910–964) align with major ligand binding regions (MLBRs), suggesting crucial interactions of collagen monomers or fibrils with integrins, matrix metalloproteinases (MMPs), fibronectin, and cartilage oligomeric matrix protein (COMP). Mutations in COL1A2 are predominantly nonlethal (80%). Lethal substitutions are located in eight regularly spaced clusters along the chain, supporting a regional model. The lethal regions align with proteoglycan binding sites along the fibril, suggesting a role in fibril–matrix interactions. Recurrences at the same site in α2(I) are generally concordant for outcome, unlike α1(I). Splice site mutations comprise 20% of helical mutations identified in OI patients, and may lead to exon skipping, intron inclusion, or the activation of cryptic splice sites. Splice site mutations in COL1A1 are rarely lethal; they often lead to frameshifts and the mild type I phenotype. In α2(I), lethal exon skipping events are located in the carboxyl half of the chain. Our data on genotype–phenotype relationships indicate that the two collagen chains play very different roles in matrix integrity and that phenotype depends on intracellular and extracellular events. PMID:17078022

  14. Efficacy of Visual Surveys for White-Nose Syndrome at Bat Hibernacula.

    PubMed

    Janicki, Amanda F; Frick, Winifred F; Kilpatrick, A Marm; Parise, Katy L; Foster, Jeffrey T; McCracken, Gary F

    2015-01-01

    White-Nose Syndrome (WNS) is an epizootic disease in hibernating bats caused by the fungus Pseudogymnoascus destructans. Surveillance for P. destructans at bat hibernacula consists primarily of visual surveys of bats, collection of potentially infected bats, and submission of these bats for laboratory testing. Cryptic infections (bats that are infected but display no visual signs of fungus) could lead to the mischaracterization of the infection status of a site and the inadvertent spread of P. destructans. We determined the efficacy of visual detection of P. destructans by examining visual signs and molecular detection of P. destructans on 928 bats of six species at 27 sites during surveys conducted from January through March in 2012-2014 in the southeastern USA on the leading edge of the disease invasion. Cryptic infections were widespread with 77% of bats that tested positive by qPCR showing no visible signs of infection. The probability of exhibiting visual signs of infection increased with sampling date and pathogen load, the latter of which was substantially higher in three species (Myotis lucifugus, M. septentrionalis, and Perimyotis subflavus). In addition, M. lucifugus was more likely to show visual signs of infection than other species given the same pathogen load. Nearly all infections were cryptic in three species (Eptesicus fuscus, M. grisescens, and M. sodalis), which had much lower fungal loads. The presence of M. lucifugus or M. septentrionalis at a site increased the probability that P. destructans was visually detected on bats. Our results suggest that cryptic infections of P. destructans are common in all bat species, and visible infections rarely occur in some species. However, due to very high infection prevalence and loads in some species, we estimate that visual surveys examining at least 17 individuals of M. lucifugus and M. septentrionalis, or 29 individuals of P. subflavus are still effective to determine whether a site has bats infected with P. destructans. In addition, because the probability of visually detecting the fungus was higher later in winter, surveys should be done as close to the end of the hibernation period as possible.

  15. Efficacy of Visual Surveys for White-Nose Syndrome at Bat Hibernacula

    PubMed Central

    Janicki, Amanda F.; Frick, Winifred F.; Kilpatrick, A. Marm; Parise, Katy L.; Foster, Jeffrey T.; McCracken, Gary F.

    2015-01-01

    White-Nose Syndrome (WNS) is an epizootic disease in hibernating bats caused by the fungus Pseudogymnoascus destructans. Surveillance for P. destructans at bat hibernacula consists primarily of visual surveys of bats, collection of potentially infected bats, and submission of these bats for laboratory testing. Cryptic infections (bats that are infected but display no visual signs of fungus) could lead to the mischaracterization of the infection status of a site and the inadvertent spread of P. destructans. We determined the efficacy of visual detection of P. destructans by examining visual signs and molecular detection of P. destructans on 928 bats of six species at 27 sites during surveys conducted from January through March in 2012–2014 in the southeastern USA on the leading edge of the disease invasion. Cryptic infections were widespread with 77% of bats that tested positive by qPCR showing no visible signs of infection. The probability of exhibiting visual signs of infection increased with sampling date and pathogen load, the latter of which was substantially higher in three species (Myotis lucifugus, M. septentrionalis, and Perimyotis subflavus). In addition, M. lucifugus was more likely to show visual signs of infection than other species given the same pathogen load. Nearly all infections were cryptic in three species (Eptesicus fuscus, M. grisescens, and M. sodalis), which had much lower fungal loads. The presence of M. lucifugus or M. septentrionalis at a site increased the probability that P. destructans was visually detected on bats. Our results suggest that cryptic infections of P. destructans are common in all bat species, and visible infections rarely occur in some species. However, due to very high infection prevalence and loads in some species, we estimate that visual surveys examining at least 17 individuals of M. lucifugus and M. septentrionalis, or 29 individuals of P. subflavus are still effective to determine whether a site has bats infected with P. destructans. In addition, because the probability of visually detecting the fungus was higher later in winter, surveys should be done as close to the end of the hibernation period as possible. PMID:26197236

  16. Relationships Between RNA Polymerase II Activity and Spt Elongation Factors to Spt- Phenotype and Growth in Saccharomyces cerevisiae

    PubMed Central

    Cui, Ping; Jin, Huiyan; Vutukuru, Manjula Ramya; Kaplan, Craig D.

    2016-01-01

    The interplay between adjacent transcription units can result in transcription-dependent alterations in chromatin structure or recruitment of factors that determine transcription outcomes, including the generation of intragenic or other cryptic transcripts derived from cryptic promoters. Mutations in a number of genes in Saccharomyces cerevisiae confer both cryptic intragenic transcription and the Suppressor of Ty (Spt-) phenotype for the lys2-128∂ allele of the LYS2 gene. Mutants that suppress lys2-128∂ allow transcription from a normally inactive Ty1 ∂ promoter, conferring a LYS+ phenotype. The arrangement of transcription units at lys2-128∂ is reminiscent of genes containing cryptic promoters within their open reading frames. We set out to examine the relationship between RNA Polymerase II (Pol II) activity, functions of Spt elongation factors, and cryptic transcription because of the previous observation that increased-activity Pol II alleles confer an Spt- phenotype. We identify both cooperating and antagonistic genetic interactions between Pol II alleles and alleles of elongation factors SPT4, SPT5, and SPT6. We find that cryptic transcription at FLO8 and STE11 is distinct from that at lys2-128∂, though all show sensitivity to reduction in Pol II activity, especially the expression of lys2-128∂ found in Spt- mutants. We determine that the lys2-128∂ Spt- phenotypes for spt6-1004 and increased activity rpo21/rpb1 alleles each require transcription from the LYS2 promoter. Furthermore, we identify the Ty1 transcription start site (TSS) within the ∂ element as the position of Spt- transcription in tested Spt- mutants. PMID:27261007

  17. The cushion–star Parvulastra exigua in South Africa: one species or more?

    PubMed Central

    Payne, Robyn P.; Griffiths, Charles L.; von der Heyden, Sophie; Koch, Erich

    2015-01-01

    Abstract The cushion–star Parvulastra exigua (Lamarck, 1816) is a widely distributed member of the temperate intertidal fauna in the southern hemisphere. In South Africa, it occurs in sympatry with the endemic Parvulastra dyscrita (Clark, 1923), the two species being differentiated predominantly by gonopore placement. Several recent studies have suggested that there may be additional cryptic species within the Parvulastra exigua complex in South Africa, based variously on color morphology, genetic evidence and the differential placement of the gonopores. This paper attempts to resolve whether one or more species are represented within Parvulastra exigua. A total of 346 Parvulastra exigua and 8 Parvulastra dyscrita were collected from sites on the west and south–west coasts of South Africa; morphological, anatomical and genetic analyses were performed to determine whether cryptic species and/or Parvulastra exigua specimens with aboral gonopores were present. Results show that neither cryptic species nor Parvulastra exigua specimens with aboral gonopores occur at these sites. This study thus refutes previous claims of the existence of aboral gonopores in South African Parvulastra exigua, and suggests that a single species is represented. The distinction between Parvulastra exigua and Parvulastra dyscrita is also confirmed, and features separating these two species are clarified and documented. PMID:26478703

  18. The Interaction of FABP with Kapα

    PubMed Central

    Amber-Vitos, Ortal; Kucherenko, Nataly; Nachliel, Esther; Gutman, Menachem; Tsfadia, Yossi

    2015-01-01

    Gene-activating lipophilic compounds are carried into the nucleus when loaded on fatty-acid-binding proteins (FABP). Some of these proteins are recognized by the α-Karyopherin (Kapα) through its nuclear localization signal (NLS) consisting of three positive residues that are not in a continuous sequence. The Importin system can distinguish between FABP loaded with activating and non-activating compounds. In the present study, we introduced molecular dynamics as a tool for clarifying the mechanism by which FABP4, loaded with activating ligand (linoleate) is recognized by Kapα. In the first phase, we simulated the complex between KapαΔIBB (termed “Armadillo”) that was crystallized with two NLS hepta-peptides. The trajectory revealed that the crystal-structure orientation of the peptides is rapidly lost and new interactions dominate. Though, the NLS sequence of FABP4 is cryptic, since the functional residues are not in direct sequence, implicating more than one possible conformation. Therefore, four possible docked conformations were generated, in which the NLS of FABP4 is interacting with either the major or the minor sites of Kapα, and the N → C vectors are parallel or anti-parallel. Out of these four basic starting positions, only the FABP4-minor site complex exhibited a large number of contact points. In this complex, the FABP interacts with the minor and the major sites, suppressing the self-inhibitory interaction of the Kapα, rendering it free to react with Kapβ. Finally, we propose that the transportable conformation generated an extended hydrophobic domain which expanded out of the boundary of the FABP4, allowing the loaded linoleate to partially migrate out of the FABP into a joint complex in which the Kapα contributes part of a combined binding pocket. PMID:26284534

  19. Genetic diversity of Timarete punctata (Annelida: Cirratulidae): Detection of pseudo-cryptic species and a potential biological invader

    NASA Astrophysics Data System (ADS)

    Seixas, Victor Corrêa; Zanol, Joana; Magalhães, Wagner F.; Paiva, Paulo Cesar

    2017-10-01

    Among the processes that drive biological invasions, the presence of asexual reproduction, as observed in many polychaetes, is an important feature because it allows a rapid spread and colonization in the invaded site. Despite its ecological importance for benthic communities, studies on the biological invasive context are rare for this abundant taxon. Here, the phylogeographic pattern of a common asexual reproducer polychaete, Timarete punctata, was analyzed at five sites along the Atlantic and Pacific Oceans to investigate if its wide distribution is associated to human-mediated transport. Sequences of COI and 16S revealed the presence of two cryptic species. One of them exhibits a wide distribution range (∼14,000 km), very low level of genetic diversity and a high frequency of shared haplotypes along sampled sites. The genetic pattern indicates that this species has probably been introduced in all sampled sites, and its wide distribution is associated to human-mediated transport. In addition, the great capability of T. punctata to reproduce by fragmentation makes the colonization process easier. Thus, the number of alien polychaete species is probably underestimated and future studies are necessary to reach a more realistic perspective.

  20. Comprehensive microarray-based analysis for stage-specific larval camouflage pattern-associated genes in the swallowtail butterfly, Papilio xuthus

    PubMed Central

    2012-01-01

    Background Body coloration is an ecologically important trait that is often involved in prey-predator interactions through mimicry and crypsis. Although this subject has attracted the interest of biologists and the general public, our scientific knowledge on the subject remains fragmentary. In the caterpillar of the swallowtail butterfly Papilio xuthus, spectacular changes in the color pattern are observed; the insect mimics bird droppings (mimetic pattern) as a young larva, and switches to a green camouflage coloration (cryptic pattern) in the final instar. Despite the wide variety and significance of larval color patterns, few studies have been conducted at a molecular level compared with the number of studies on adult butterfly wing patterns. Results To obtain a catalog of genes involved in larval mimetic and cryptic pattern formation, we constructed expressed sequence tag (EST) libraries of larval epidermis for P. xuthus, and P. polytes that contained 20,736 and 5,376 clones, respectively, representing one of the largest collections available in butterflies. A comparison with silkworm epidermal EST information revealed the high expression of putative blue and yellow pigment-binding proteins in Papilio species. We also designed a microarray from the EST dataset information, analyzed more than five stages each for six markings, and confirmed spatial expression patterns by whole-mount in situ hybridization. Hence, we succeeded in elucidating many novel marking-specific genes for mimetic and cryptic pattern formation, including pigment-binding protein genes, the melanin-associated gene yellow-h3, the ecdysteroid synthesis enzyme gene 3-dehydroecdysone 3b-reductase, and Papilio-specific genes. We also found many cuticular protein genes with marking specificity that may be associated with the unique surface nanostructure of the markings. Furthermore, we identified two transcription factors, spalt and ecdysteroid signal-related E75, as genes expressed in larval eyespot markings. This finding suggests that E75 is a strong candidate mediator of the hormone-dependent coordination of larval pattern formation. Conclusions This study is one of the most comprehensive molecular analyses of complicated morphological features, and it will serve as a new resource for studying insect mimetic and cryptic pattern formation in general. The wide variety of marking-associated genes (both regulatory and structural genes) identified by our screening indicates that a similar strategy will be effective for understanding other complex traits. PMID:22651552

  1. Genetic monitoring detects an overlooked cryptic species and reveals the diversity and distribution of three invasive Rattus congeners in south Africa

    PubMed Central

    2011-01-01

    Background South Africa's long and extensive trade activity has ensured ample opportunities for exotic species introduction. Whereas the rich biodiversity of endemic southern African fauna has been the focus of many studies, invasive vertebrates are generally overlooked despite potential impacts on biodiversity, health and agriculture. Genetic monitoring of commensal rodents in South Africa which uncovered the presence of Rattus tanezumi, a South-East Asian endemic not previously known to occur in Africa, provided the impetus for expanded studies on all invasive Rattus species present. Results To this end, intensified sampling at 28 South African localities and at one site in Swaziland, identified 149 Rattus specimens. Cytochrome b gene sequencing revealed the presence of two R. tanezumi, seven Rattus rattus and five Rattus norvegicus haplotypes in south Africa. Phylogenetic results were consistent with a single, recent R. tanezumi introduction and indicated that R. norvegicus and R. rattus probably became established following at least two and three independent introductions, respectively. Intra- and inter-specific diversity was highest in informal human settlements, with all three species occurring at a single metropolitan township site. Rattus norvegicus and R. rattus each occurred sympatrically with Rattus tanezumi at one and five sites, respectively. Karyotyping of selected R. rattus and R. tanezumi individuals identified diploid numbers consistent with those reported previously for these cryptic species. Ordination of bioclimatic variables and MaxEnt ecological niche modelling confirmed that the bioclimatic niche occupied by R. tanezumi in south Africa was distinct from that occupied in its naturalised range in south-east Asia suggesting that factors other than climate may influence the distribution of this species. Conclusions This study has highlighted the value of genetic typing for detecting cryptic invasive species, providing historical insights into introductions and for directing future sampling. The apparent ease with which a cryptic species can become established signals the need for broader implementation of genetic monitoring programmes. In addition to providing baseline data and potentially identifying high-risk introduction routes, the predictive power of ecological niche modelling is enhanced when species records are genetically verified. PMID:21324204

  2. RNAP-II transcribes two small RNAs at the promoter and terminator regions of the RNAP-I gene in Saccharomyces cerevisiae.

    PubMed

    Mayán, Maria D

    2013-01-01

    Three RNA polymerases coexist in the ribosomal DNA of Saccharomyces cerevisiae. RNAP-I transcribes the 35S rRNA, RNAP-III transcribes the 5S rRNA and RNAP-II is found in both intergenic non-coding regions. Previously, we demonstrated that RNAP-II molecules bound to the intergenic non-coding regions (IGS) of the ribosomal locus are mainly found in a stalled conformation, and the stalled polymerase mediates chromatin interactions, which isolate RNAP-I from the RNAP-III transcriptional domain. Besides, RNAP-II transcribes both IGS regions at low levels, using different cryptic promoters. This report demonstrates that RNAP-II also transcribes two sequences located in the 5'- and 3'-ends of the 35S rRNA gene that overlap with the sequences of the 35S rRNA precursor transcribed by RNAP-I. The sequence located at the promoter region of RNAP-I, called the p-RNA transcript, binds to the transcription termination-related protein, Reb1p, while the T-RNA sequence, located in the termination sites of RNAP-I gene, contains the stem-loop recognized by Rtn1p, which is necessary for proper termination of RNAP-I. Because of their location, these small RNAs may play a key role in the initiation and termination of RNAP-I transcription. To correctly synthesize proteins, eukaryotic cells may retain a mechanism that connects the three main polymerases. This report suggests that cryptic transcription by RNAP-II may be required for normal transcription by RNAP-I in the ribosomal locus of S. cerevisiae. Copyright © 2012 John Wiley & Sons, Ltd.

  3. Use of a cryptic splice site for the expression of huntingtin interacting protein 1 in select normal and neoplastic tissues.

    PubMed

    Graves, Chiron W; Philips, Steven T; Bradley, Sarah V; Oravecz-Wilson, Katherine I; Li, Lina; Gauvin, Alice; Ross, Theodora S

    2008-02-15

    Huntingtin interacting protein 1 (HIP1) is a 116-kDa endocytic protein, which is necessary for the maintenance of several tissues in vivo as its deficiency leads to degenerative adult phenotypes. HIP1 deficiency also inhibits prostate tumor progression in mice. To better understand how deficiency of HIP1 leads to such phenotypes, we analyzed tumorigenic potential in mice homozygous for a Hip1 mutant allele, designated Hip1(Delta 3-5), which is predicted to result in a frame-shifted, nonsense mutation in the NH(2) terminus of HIP1. In contrast to our previous studies using the Hip1 null allele, an inhibition of tumorigenesis was not observed as a result of the homozygosity of the nonsense Delta 3-5 allele. To further examine the contrasting results from the prior Hip1 mutant mice, we cultured tumor cells from homozygous Delta 3-5 allele-bearing mice and discovered the presence of a 110-kDa form of HIP1 in tumor cells. Upon sequencing of Hip1 DNA and message from these tumors, we determined that this 110-kDa form of HIP1 is the product of splicing of a cryptic U12-type AT-AC intron. This event results in the insertion of an AG dinucleotide between exons 2 and 6 and restoration of the reading frame. Remarkably, this mutant protein retains its capacity to bind lipids, clathrin, AP2, and epidermal growth factor receptor providing a possible explanation for why tumorigenesis was not altered after this knockout mutation. Our data show how knowledge of the transcript that is produced by a knockout allele can lead to discovery of novel types of molecular compensation at the level of splicing.

  4. Use of a Cryptic Splice Site for the Expression of Huntingtin Interacting Protein 1 in Select Normal and Neoplastic Tissues

    PubMed Central

    Graves, Chiron W.; Philips, Steven T.; Bradley, Sarah V.; Oravecz-Wilson, Katherine I.; Li, Lina; Gauvin, Alice; Ross, Theodora S.

    2011-01-01

    Huntingtin interacting protein 1 (HIP1) is a 116-kDa endocytic protein, which is necessary for the maintenance of several tissues in vivo as its deficiency leads to degenerative adult phenotypes. HIP1 deficiency also inhibits prostate tumor progression in mice. To better understand how deficiency of HIP1 leads to such phenotypes, we analyzed tumorigenic potential in mice homozygous for a Hip1 mutant allele, designated Hip1Δ3-5, which is predicted to result in a frame-shifted, nonsense mutation in the NH2 terminus of HIP1. In contrast to our previous studies using the Hip1 null allele, an inhibition of tumorigenesis was not observed as a result of the homozygosity of the nonsense Δ3-5 allele. To further examine the contrasting results from the prior Hip1 mutant mice, we cultured tumor cells from homozygous Δ3-5 allele–bearing mice and discovered the presence of a 110-kDa form of HIP1 in tumor cells. Upon sequencing of Hip1 DNA and message from these tumors, we determined that this 110-kDa form of HIP1 is the product of splicing of a cryptic U12-type AT-AC intron. This event results in the insertion of an AG dinucleotide between exons 2 and 6 and restoration of the reading frame. Remarkably, this mutant protein retains its capacity to bind lipids, clathrin, AP2, and epidermal growth factor receptor providing a possible explanation for why tumorigenesis was not altered after this knockout mutation. Our data show how knowledge of the transcript that is produced by a knockout allele can lead to discovery of novel types of molecular compensation at the level of splicing. PMID:18281481

  5. Cryptic diversity in the estuarine copepod Acartia tonsa: reproductive isolation and lineage-specific divergence in transcriptomic response to salinity stress

    NASA Astrophysics Data System (ADS)

    Plough, L. V.

    2016-02-01

    Discovery of the near ubiquity of cryptic species among planktonic taxa marks a major advance in marine science over the last two decades. However, little is known about the potential drivers of divergence among species, and particularly how cryptic taxa may respond differentially to environmental stress as climate change and ocean acidification proceed. Here we report results from experimental studies characterizing reproduction and transcriptomic response to stress in Acartia tonsa, a dominant estuarine copepod that exhibits three sympatric (but morphologically cryptic) lineages that sort by salinity along the US Atlantic coast (lineage F - fresh, S - saline, and X - intermediate). Pair crosses between F and S individuals collected from Chesapeake Bay at a common ambient salinity (13ppt) revealed that while inter-lineage (FxS) crosses produced eggs, only eggs from intra-lineage (FxF or SxS) crosses successfully hatched. Analysis of whether 'hybrid' eggs were fertilized and failed to develop or did not fertilize, which could indicate pre vs post-zygotic isolation, is ongoing. Exposing replicate groups of 2nd gen. lab-cultured F and S individuals to ambient and low salinity (7 ppt) stress produced very different patterns of gene expression measured with RNAseq. First, the dynamic range of expression was much greater in the S lineage overall (both salinities), with more differentially expressed genes (DEG's) in comparisons of low vs control salinity (232 vs 77 DEGs at 0.01 FDR level for S, and F respectively). Gene ontology analysis of DEG function revealed a more targeted response in F to ion stress (up and down regulation of genes involved in ion transport, catalytic activity, and binding) while the S lineage showed a more varied and general response (up-regulation of metabolism, nucleic acid synthesis, and general stress response). Overall, these experiments confirm reproductive isolation among two cryptic A. tonsa ineages and identify key differences in thier physiological response to salinity stress. Future work will examine lineage-specific responses to other significant stressors such as hypoxia.

  6. Deep intronic GPR143 mutation in a Japanese family with ocular albinism

    PubMed Central

    Naruto, Takuya; Okamoto, Nobuhiko; Masuda, Kiyoshi; Endo, Takao; Hatsukawa, Yoshikazu; Kohmoto, Tomohiro; Imoto, Issei

    2015-01-01

    Deep intronic mutations are often ignored as possible causes of human disease. Using whole-exome sequencing, we analysed genomic DNAs of a Japanese family with two male siblings affected by ocular albinism and congenital nystagmus. Although mutations or copy number alterations of coding regions were not identified in candidate genes, the novel intronic mutation c.659-131 T > G within GPR143 intron 5 was identified as hemizygous in affected siblings and as heterozygous in the unaffected mother. This mutation was predicted to create a cryptic splice donor site within intron 5 and activate a cryptic acceptor site at 41nt upstream, causing the insertion into the coding sequence of an out-of-frame 41-bp pseudoexon with a premature stop codon in the aberrant transcript, which was confirmed by minigene experiments. This result expands the mutational spectrum of GPR143 and suggests the utility of next-generation sequencing integrated with in silico and experimental analyses for improving the molecular diagnosis of this disease. PMID:26061757

  7. Deep intronic GPR143 mutation in a Japanese family with ocular albinism.

    PubMed

    Naruto, Takuya; Okamoto, Nobuhiko; Masuda, Kiyoshi; Endo, Takao; Hatsukawa, Yoshikazu; Kohmoto, Tomohiro; Imoto, Issei

    2015-06-10

    Deep intronic mutations are often ignored as possible causes of human disease. Using whole-exome sequencing, we analysed genomic DNAs of a Japanese family with two male siblings affected by ocular albinism and congenital nystagmus. Although mutations or copy number alterations of coding regions were not identified in candidate genes, the novel intronic mutation c.659-131 T > G within GPR143 intron 5 was identified as hemizygous in affected siblings and as heterozygous in the unaffected mother. This mutation was predicted to create a cryptic splice donor site within intron 5 and activate a cryptic acceptor site at 41nt upstream, causing the insertion into the coding sequence of an out-of-frame 41-bp pseudoexon with a premature stop codon in the aberrant transcript, which was confirmed by minigene experiments. This result expands the mutational spectrum of GPR143 and suggests the utility of next-generation sequencing integrated with in silico and experimental analyses for improving the molecular diagnosis of this disease.

  8. The Disordered C-Terminus of Yeast Hsf1 Contains a Cryptic Low-Complexity Amyloidogenic Region.

    PubMed

    Pujols, Jordi; Santos, Jaime; Pallarès, Irantzu; Ventura, Salvador

    2018-05-06

    Response mechanisms to external stress rely on networks of proteins able to activate specific signaling pathways to ensure the maintenance of cell proteostasis. Many of the proteins mediating this kind of response contain intrinsically disordered regions, which lack a defined structure, but still are able to interact with a wide range of clients that modulate the protein function. Some of these interactions are mediated by specific short sequences embedded in the longer disordered regions. Because the physicochemical properties that promote functional and abnormal interactions are similar, it has been shown that, in globular proteins, aggregation-prone and binding regions tend to overlap. It could be that the same principle applies for disordered protein regions. In this context, we show here that a predicted low-complexity interacting region in the disordered C-terminus of the stress response master regulator heat shock factor 1 (Hsf1) protein corresponds to a cryptic amyloid region able to self-assemble into fibrillary structures resembling those found in neurodegenerative disorders.

  9. Identification of new members of the Escherichia coli K-12 MG1655 SlyA regulon

    PubMed Central

    Curran, Thomas D; Abacha, Fatima; Hibberd, Stephen P; Green, Jeffrey

    2017-01-01

    SlyA is a member of the MarR family of bacterial transcriptional regulators. Previously, SlyA has been shown to directly regulate only two operons in Escherichia coli K-12 MG1655, fimB and hlyE (clyA). In both cases, SlyA activates gene expression by antagonizing repression by the nucleoid-associated protein H-NS. Here, the transcript profiles of aerobic glucose-limited steady-state chemostat cultures of E. coli K-12 MG1655, slyA mutant and slyA over-expression strains are reported. The transcript profile of the slyA mutant was not significantly different from that of the parent; however, that of the slyA expression strain was significantly different from that of the vector control. Transcripts representing 27 operons were increased in abundance, whereas 3 were decreased. Of the 30 differentially regulated operons, 24 have previously been associated with sites of H-NS binding, suggesting that antagonism of H-NS repression is a common feature of SlyA-mediated transcription regulation. Direct binding of SlyA to DNA located upstream of a selection of these targets permitted the identification of new operons likely to be directly regulated by SlyA. Transcripts of four operons coding for cryptic adhesins exhibited enhanced expression, and this was consistent with enhanced biofilm formation associated with the SlyA over-producing strain. PMID:28073397

  10. Identification of new members of the Escherichia coli K-12 MG1655 SlyA regulon.

    PubMed

    Curran, Thomas D; Abacha, Fatima; Hibberd, Stephen P; Rolfe, Matthew D; Lacey, Melissa M; Green, Jeffrey

    2017-03-01

    SlyA is a member of the MarR family of bacterial transcriptional regulators. Previously, SlyA has been shown to directly regulate only two operons in Escherichia coli K-12 MG1655, fimB and hlyE (clyA). In both cases, SlyA activates gene expression by antagonizing repression by the nucleoid-associated protein H-NS. Here, the transcript profiles of aerobic glucose-limited steady-state chemostat cultures of E. coli K-12 MG1655, slyA mutant and slyA over-expression strains are reported. The transcript profile of the slyA mutant was not significantly different from that of the parent; however, that of the slyA expression strain was significantly different from that of the vector control. Transcripts representing 27 operons were increased in abundance, whereas 3 were decreased. Of the 30 differentially regulated operons, 24 have previously been associated with sites of H-NS binding, suggesting that antagonism of H-NS repression is a common feature of SlyA-mediated transcription regulation. Direct binding of SlyA to DNA located upstream of a selection of these targets permitted the identification of new operons likely to be directly regulated by SlyA. Transcripts of four operons coding for cryptic adhesins exhibited enhanced expression, and this was consistent with enhanced biofilm formation associated with the SlyA over-producing strain.

  11. Cryptic or pseudocryptic: can morphological methods inform copepod taxonomy? An analysis of publications and a case study of the Eurytemora affinis species complex

    PubMed Central

    Lajus, Dmitry; Sukhikh, Natalia; Alekseev, Victor

    2015-01-01

    Interest in cryptic species has increased significantly with current progress in genetic methods. The large number of cryptic species suggests that the resolution of traditional morphological techniques may be insufficient for taxonomical research. However, some species now considered to be cryptic may, in fact, be designated pseudocryptic after close morphological examination. Thus the “cryptic or pseudocryptic” dilemma speaks to the resolution of morphological analysis and its utility for identifying species. We address this dilemma first by systematically reviewing data published from 1980 to 2013 on cryptic species of Copepoda and then by performing an in-depth morphological study of the former Eurytemora affinis complex of cryptic species. Analyzing the published data showed that, in 5 of 24 revisions eligible for systematic review, cryptic species assignment was based solely on the genetic variation of forms without detailed morphological analysis to confirm the assignment. Therefore, some newly described cryptic species might be designated pseudocryptic under more detailed morphological analysis as happened with Eurytemora affinis complex. Recent genetic analyses of the complex found high levels of heterogeneity without morphological differences; it is argued to be cryptic. However, next detailed morphological analyses allowed to describe a number of valid species. Our study, using deep statistical analyses usually not applied for new species describing, of this species complex confirmed considerable differences between former cryptic species. In particular, fluctuating asymmetry (FA), the random variation of left and right structures, was significantly different between forms and provided independent information about their status. Our work showed that multivariate statistical approaches, such as principal component analysis, can be powerful techniques for the morphological discrimination of cryptic taxons. Despite increasing cryptic species designations, morphological techniques have great potential in determining copepod taxonomy. PMID:26120427

  12. Novel compound heterozygous Thyroglobulin mutations c.745+1G>A/c.7036+2T>A associated with congenital goiter and hypothyroidism in a Vietnamese family. Identification of a new cryptic 5' splice site in the exon 6.

    PubMed

    Citterio, Cintia E; Morales, Cecilia M; Bouhours-Nouet, Natacha; Machiavelli, Gloria A; Bueno, Elena; Gatelais, Frédérique; Coutant, Regis; González-Sarmiento, Rogelio; Rivolta, Carina M; Targovnik, Héctor M

    2015-03-15

    Several patients were identified with dyshormonogenesis caused by mutations in the thyroglobulin (TG) gene. These defects are inherited in an autosomal recessive manner and affected individuals are either homozygous or compound heterozygous for the mutations. The aim of the present study was to identify new TG mutations in a patient of Vietnamese origin affected by congenital hypothyroidism, goiter and low levels of serum TG. DNA sequencing identified the presence of compound heterozygous mutations in the TG gene: the maternal mutation consists of a novel c.745+1G>A (g.IVS6 + 1G>A), whereas the hypothetical paternal mutation consists of a novel c.7036+2T>A (g.IVS40 + 2T>A). The father was not available for segregation analysis. Ex-vivo splicing assays and subsequent RT-PCR analyses were performed on mRNA isolated from the eukaryotic-cells transfected with normal and mutant expression vectors. Minigene analysis of the c.745+1G>A mutant showed that the exon 6 is skipped during pre-mRNA splicing or partially included by use of a cryptic 5' splice site located to 55 nucleotides upstream of the authentic exon 6/intron 6 junction site. The functional analysis of c.7036+2T>A mutation showed a complete skipping of exon 40. The theoretical consequences of splice site mutations, predicted with the bioinformatics tool NNSplice, Fsplice, SPL, SPLM and MaxEntScan programs were investigated and evaluated in relation with the experimental evidence. These analyses predicted that both mutant alleles would result in the abolition of the authentic splice donor sites. The c.745+1G>A mutation originates two putative truncated proteins of 200 and 1142 amino acids, whereas c.7036+2T>A mutation results in a putative truncated protein of 2277 amino acids. In conclusion, we show that the c.745+1G>A mutation promotes the activation of a new cryptic donor splice site in the exon 6 of the TG gene. The functional consequences of these mutations could be structural changes in the protein molecule that alter the biosynthesis of thyroid hormones. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  13. Cyanomargarita gen. nov. (Nostocales, Cyanobacteria): convergent evolution resulting in a cryptic genus.

    PubMed

    Shalygin, Sergei; Shalygina, Regina; Johansen, Jeffrey R; Pietrasiak, Nicole; Berrendero Gómez, Esther; Bohunická, Markéta; Mareš, Jan; Sheil, Christopher A

    2017-08-01

    Two populations of Rivularia-like cyanobacteria were isolated from ecologically distinct and biogeographically distant sites. One population was from an unpolluted stream in the Kola Peninsula of Russia, whereas the other was from a wet wall in the Grand Staircase-Escalante National Monument, a desert park-land in Utah. Though both were virtually indistinguishable from Rivularia in field and cultured material, they were both phylogenetically distant from Rivularia and the Rivulariaceae based on both 16S rRNA and rbcLX phylogenies. We here name the new cryptic genus Cyanomargarita gen. nov., with type species C. melechinii sp. nov., and additional species C. calcarea sp. nov. We also name a new family for these taxa, the Cyanomargaritaceae. © 2017 Phycological Society of America.

  14. Molecular-based rapid inventories of sympatric diversity: a comparison of DNA barcode clustering methods applied to geography-based vs clade-based sampling of amphibians.

    PubMed

    Paz, Andrea; Crawford, Andrew J

    2012-11-01

    Molecular markers offer a universal source of data for quantifying biodiversity. DNA barcoding uses a standardized genetic marker and a curated reference database to identify known species and to reveal cryptic diversity within wellsampled clades. Rapid biological inventories, e.g. rapid assessment programs (RAPs), unlike most barcoding campaigns, are focused on particular geographic localities rather than on clades. Because of the potentially sparse phylogenetic sampling, the addition of DNA barcoding to RAPs may present a greater challenge for the identification of named species or for revealing cryptic diversity. In this article we evaluate the use of DNA barcoding for quantifying lineage diversity within a single sampling site as compared to clade-based sampling, and present examples from amphibians. We compared algorithms for identifying DNA barcode clusters (e.g. species, cryptic species or Evolutionary Significant Units) using previously published DNA barcode data obtained from geography-based sampling at a site in Central Panama, and from clade-based sampling in Madagascar. We found that clustering algorithms based on genetic distance performed similarly on sympatric as well as clade-based barcode data, while a promising coalescent-based method performed poorly on sympatric data. The various clustering algorithms were also compared in terms of speed and software implementation. Although each method has its shortcomings in certain contexts, we recommend the use of the ABGD method, which not only performs fairly well under either sampling method, but does so in a few seconds and with a user-friendly Web interface.

  15. Cryptic extinction of a common Pacific lizard Emoia impar (Squamata, Scincidae) from the Hawaiian Islands.

    USGS Publications Warehouse

    Fisher, Robert; Ineich, Ivan

    2012-01-01

    Most documented declines of tropical reptiles are of dramatic or enigmatic species. Declines of widespread species tend to be cryptic. The early (1900s) decline and extinction of the common Pacific skink Emoia impar from the Hawaiian Islands is documented here through an assessment of literature, museum vouchers and recent fieldwork. This decline appears contemporaneous with the documented declines of invertebrates and birds across the Hawaiian Islands. A review of the plausible causal factors indicates that the spread of the introduced big-headed ant Pheidole megacephala is the most likely factor in this lizard decline. The introduction and spread of a similar skink Lampropholis delicata across the islands appears to temporally follow the decline of E. impar, although there is no evidence of competition between these species. It appears that L. delicata is spreading to occupy the niche vacated by the extirpated E. impar. Further confusion exists because the skink E. cyanura, which is very similar in appearance to E. impar, appears to have been introduced to one site within a hotel on Kaua'i and persisted as a population at that site for approximately 2 decades (1970s–1990s) but is now also extirpated. This study highlights the cryptic nature of this early species extinction as evidence that current biogeographical patterns of non-charismatic or enigmatic reptiles across the Pacific may be the historical result of early widespread invasion by ants. Conservation and restoration activities for reptiles in the tropical Pacific should consider this possibility and evaluate all evidence prior to any implementation.

  16. DNA barcoding reveals new insights into the diversity of Antarctic species of Orchomene sensu lato (Crustacea: Amphipoda: Lysianassoidea)

    NASA Astrophysics Data System (ADS)

    Havermans, C.; Nagy, Z. T.; Sonet, G.; De Broyer, C.; Martin, P.

    2011-03-01

    Recent molecular analyses revealed that several so-called "circum-Antarctic" benthic crustacean species appeared to be complexes of cryptic species with restricted distributions. In this study we used a DNA barcoding approach based on mitochondrial cytochrome oxidase I gene sequences in order to detect possible cryptic diversity and to test the circumpolarity of some lysianassoid species. The orchomenid genus complex consists of the genera Abyssorchomene, Falklandia, Orchomenella, Orchomenyx and Pseudorchomene. Species of this genus complex are found throughout the Southern Ocean and show a high species richness and level of endemism. In the majority of the studied species, a genetic homogeneity was found even among specimens from remote sampling sites, which indicates a possible circum-Antarctic and eurybathic distribution. In four investigated species ( Orchomenella ( Orchomenopsis) acanthurus, Orchomenella ( Orchomenopsis) cavimanus, Orchomenella ( Orchomenella) franklini and Orchomenella ( Orchomenella) pinguides), genetically divergent lineages and possible cryptic taxa were revealed. After a detailed morphological analysis, O. ( O.) pinguides appeared to be composed of two distinct species, formerly synonymized under O. ( O.) pinguides. The different genetic patterns observed in these orchomenid species might be explained by the evolutionary histories undergone by these species and by their different dispersal and gene flow capacities.

  17. FIELD OBSERVATIONS OF THE ECOLOGY AND HABITS OF MANGROVE RIVULUS (RIVULUS MARMORATUS) IN BELIZE AND FLORIDA

    EPA Science Inventory

    This report provides a synopsis of field studies of Rivulus marmaratus from two population surveys of mangrove islands adjacent to the Belize barrier reef and observations made over fifteen years at several sites in south Florida. his small, cryptically colored killifish is the o...

  18. Cryptic no more: soil macrofossils uncover Pleistocene forest microrefugia within a periglacial desert.

    PubMed

    de Lafontaine, Guillaume; Amasifuen Guerra, Carlos Alberto; Ducousso, Alexis; Petit, Rémy J

    2014-11-01

    Despite their critical importance for understanding the local effects of global climate change on biodiversity, glacial microrefugia are not well studied because they are difficult to detect by using classical palaeoecological or population genetics approaches. We used soil macrofossil charcoal analysis to uncover the presence of cryptic glacial refugia for European beech (Fagus sylvatica) and other tree species in the Landes de Gascogne (southwestern France). Using botanical identification and direct radiocarbon dating (140 (14) C-dates) of macrofossil charcoal extracted from mineral soils, we reconstructed the glacial and postglacial history of all extant beech stands in the region (n = 11). Soil charcoal macrofossils were found in all sites, allowing the identification of up to at least 14 distinct fire events per site. There was direct evidence of the presence of beech during the last glacial period at three sites. Beech was detected during Heinrich stadial-1, one of the coldest and driest intervals of the last glacial period in Western Europe. Together with previous results on the genetic structure of the species in the region, these findings suggest that beech persisted in situ in several microrefugia through full glacial and interglacial periods up to the present day. © 2014 The Authors. New Phytologist © 2014 New Phytologist Trust.

  19. Characterizing HSF1 Binding and Post-Translational Modifications of hsp70 Promoter in Cultured Cortical Neurons: Implications in the Heat-Shock Response

    PubMed Central

    Gómez, Andrea V.; Córdova, Gonzalo; Munita, Roberto; Parada, Guillermo E.; Barrios, Álvaro P.; Cancino, Gonzalo I.; Álvarez, Alejandra R.; Andrés, María E.

    2015-01-01

    Causes of lower induction of Hsp70 in neurons during heat shock are still a matter of debate. To further inquire into the mechanisms regulating Hsp70 expression in neurons, we studied the activity of Heat Shock Factor 1 (HSF1) and histone posttranslational modifications (PTMs) at the hsp70 promoter in rat cortical neurons. Heat shock induced a transient and efficient translocation of HSF1 to neuronal nuclei. However, no binding of HSF1 at the hsp70 promoter was detected while it bound to the hsp25 promoter in cortical neurons during heat shock. Histone PTMs analysis showed that the hsp70 promoter harbors lower levels of histone H3 and H4 acetylation in cortical neurons compared to PC12 cells under basal conditions. Transcriptomic profiling data analysis showed a predominant usage of cryptic transcriptional start sites at hsp70 gene in the rat cerebral cortex, compared with the whole brain. These data support a weaker activation of hsp70 canonical promoter. Heat shock increased H3Ac at the hsp70 promoter in PC12 cells, which correlated with increased Hsp70 expression while no modifications occurred at the hsp70 promoter in cortical neurons. Increased histone H3 acetylation by Trichostatin A led to hsp70 mRNA and protein induction in cortical neurons. In conclusion, we found that two independent mechanisms maintain a lower induction of Hsp70 in cortical neurons. First, HSF1 fails to bind specifically to the hsp70 promoter in cortical neurons during heat shock and, second, the hsp70 promoter is less accessible in neurons compared to non-neuronal cells due to histone deacetylases repression. PMID:26053851

  20. DNA barcoding, ecology and geography of the cryptic species of Aneura pinguis and their relationships with Aneura maxima and Aneura mirabilis (Metzgeriales, Marchantiophyta)

    PubMed Central

    Szczecińska, Monika; Sawicki, Jakub; Stebel, Adam; Buczkowska, Katarzyna

    2017-01-01

    Aneura pinguis is a thalloid liverwort species with broad geographical distribution. It is composed of cryptic species, however, the number of cryptic species within A. pinguis is not known. Five cpDNA regions (matK, rbcL, rpoC1, trnH-psbA and trnL-trnF) and the entire nuclear ITS region were studied in 130 samples of A. pinguis from different geographical regions. The relationships between the cryptic species of A. pinguis, A. maxima and A. mirabilis were analyzed. All of the examined samples were clustered into 10 clades corresponding to 10 cryptic species of A. pinguis (marked A to J). Aneura mirabilis and A. maxima were nested among different cryptic species of A. pinguis, which indicates that A. pinguis is a paraphyletic taxon. Subgroups were found in cryptic species A, B, C and E. As single barcodes, all tested DNA regions had 100% discriminant power and fulfilled DNA barcode criteria for species identification; however, the only combination detected in all subgroups was trnL-trnF with trnH-psbA or ITS2. The distances between cryptic species were 11- to 35-fold higher than intraspecific distances. In all analyzed DNA regions, the distances between most pairs of cryptic A. pinguis species were higher than between A. maxima and A. mirabilis. All cryptic species of A. pinguis clearly differed in their habitat preferences, which suggests that habitat adaptation could be the main driving force behind cryptic speciation within this taxon. PMID:29206876

  1. DNA barcoding, ecology and geography of the cryptic species of Aneura pinguis and their relationships with Aneura maxima and Aneura mirabilis (Metzgeriales, Marchantiophyta).

    PubMed

    Bączkiewicz, Alina; Szczecińska, Monika; Sawicki, Jakub; Stebel, Adam; Buczkowska, Katarzyna

    2017-01-01

    Aneura pinguis is a thalloid liverwort species with broad geographical distribution. It is composed of cryptic species, however, the number of cryptic species within A. pinguis is not known. Five cpDNA regions (matK, rbcL, rpoC1, trnH-psbA and trnL-trnF) and the entire nuclear ITS region were studied in 130 samples of A. pinguis from different geographical regions. The relationships between the cryptic species of A. pinguis, A. maxima and A. mirabilis were analyzed. All of the examined samples were clustered into 10 clades corresponding to 10 cryptic species of A. pinguis (marked A to J). Aneura mirabilis and A. maxima were nested among different cryptic species of A. pinguis, which indicates that A. pinguis is a paraphyletic taxon. Subgroups were found in cryptic species A, B, C and E. As single barcodes, all tested DNA regions had 100% discriminant power and fulfilled DNA barcode criteria for species identification; however, the only combination detected in all subgroups was trnL-trnF with trnH-psbA or ITS2. The distances between cryptic species were 11- to 35-fold higher than intraspecific distances. In all analyzed DNA regions, the distances between most pairs of cryptic A. pinguis species were higher than between A. maxima and A. mirabilis. All cryptic species of A. pinguis clearly differed in their habitat preferences, which suggests that habitat adaptation could be the main driving force behind cryptic speciation within this taxon.

  2. The TLR4 agonist fibronectin extra domain A is cryptic, exposed by elastase-2; use in a fibrin matrix cancer vaccine

    DOE PAGES

    Julier, Ziad; Martino, Mikaël M.; de Titta, Alexandre; ...

    2015-02-24

    Fibronectin (FN) is an extracellular matrix (ECM) protein including numerous fibronectin type III (FNIII) repeats with different functions. The alternatively spliced FN variant containing the extra domain A (FNIII EDA), located between FNIII 11 and FNIII 12, is expressed in sites of injury, chronic inflammation, and solid tumors. Although its function is not well understood, FNIII EDA is known to agonize Toll-like receptor 4 (TLR4). Here, by producing various FN fragments containing FNIII EDA, we found that FNIII EDA's immunological activity depends upon its local intramolecular context within the FN chain. N-terminal extension of the isolated FNIII EDA with itsmore » neighboring FNIII repeats (FNIII 9-10-11) enhanced its activity in agonizing TLR4, while C-terminal extension with the native FNIII 12-13-14 heparin-binding domain abrogated it. We reveal that an elastase 2 cleavage site is present between FNIII EDA and FNIII 12. Activity of the C-terminally extended FNIII EDA could be restored after cleavage of the FNIII 12-13-14 domain by elastase 2. FN being naturally bound to the ECM, we immobilized FNIII EDA-containing FN fragments within a fibrin matrix model along with antigenic peptides. Such matrices were shown to stimulate cytotoxic CD8 + T cell responses in two murine cancer models.« less

  3. Partial characterization of the cross-reacting determinant, a carbohydrate epitope shared by decay accelerating factor and the variant surface glycoprotein of the African Trypanosoma brucei.

    PubMed

    Shak, S; Davitz, M A; Wolinsky, M L; Nussenzweig, V; Turner, M J; Gurnett, A

    1988-03-15

    The variant surface glycoprotein (VSG) of the African trypanosome is anchored in the cell membrane by a complex glycan attached to phosphatidylinositol. The carboxyl terminal portion of VSG contains a cryptic carbohydrate epitope, the cross-reacting determinant (CRD), that is revealed only after removal of the diacylglycerol by phosphatidylinositol-specific phospholipase C (PIPLC) or VSG lipase. Recently, we have shown that after hydrolysis by PIPLC, decay-accelerating factor (DAF)--a mammalian phosphatidylinositol-anchored protein--also contains the CRD epitope. Using a two site immunoradiometric assay in which the capturing antibody is a monoclonal antibody to DAF and the revealing antibody is anti-CRD, we now show that sugar phosphates significantly inhibited the binding of anti-CRD antibody to DAF released by PIPLC. DL-myo-inositol 1,2-cyclic phosphate was the most potent inhibitor of binding (IC50 less than 10(-8) M). Other sugar phosphates, such as alpha-D-glucose-1-phosphate, which also possess adjacent hydroxyl and phosphate moieties in cis also inhibited binding at low concentrations (IC50 = 10(-5) to 10(-4) M). In contrast, sugar phosphates which do not possess adjacent hydroxyl and phosphate moieties in cis and simple sugars weakly inhibited binding (IC50 greater than 10(-3) M). These results suggest that myo-inositol 1,2-cyclic phosphate contributes significantly to the epitope recognized by the anti-CRD antibody and is consistent with analysis of the carboxyl terminus of VSG, which also suggested the presence of the cyclic inositol phosphate. In light of the recent findings that human serum contains a glycan-phosphatidyl-inositol-specific phospholipase D, which converts DAF from a hydrophobic to a hydrophilic form lacking the CRD, the observation that the phosphate is crucial for expression of the epitope may be relevant in understanding the origin of CRD-negative DAF in urine and plasma.

  4. The force-sensing device region of α-catenin is an intrinsically disordered segment in the absence of intramolecular stabilization of the autoinhibitory form.

    PubMed

    Hirano, Yoshinori; Amano, Yu; Yonemura, Shigenobu; Hakoshima, Toshio

    2018-05-01

    Mechanotransduction by α-catenin facilitates the force-dependent development of adherens junctions (AJs) by recruiting vinculin to reinforce actin anchoring of AJs. The α-catenin mechanotransducing action is facilitated by its force-sensing device region that autoinhibits the vinculin-binding site 1 (VBS1). Here, we report the high-resolution structure of the force-sensing device region of α-catenin, which shows the autoinhibited form comprised of helix bundles E, F and G. The cryptic VBS1 is embedded into helix bundle E stabilized by direct interactions with the autoinhibitory region forming helix bundles F and G. Our molecular dissection study showed that helix bundles F and G are stable in solution in each isolated form, whereas helix bundle E that contains VBS1 is unstable and intrinsically disordered in solution in the isolated form. We successfully identified key residues mediating the autoinhibition and produced mutated α-catenins that display variable force sensitivity and autoinhibition. Using these mutants, we demonstrate both in vitro and in vivo that, in the absence of this stabilization, the helix bundle containing VBS1 would adopt an unfolded form, thus exposing VBS for vinculin binding. We provide evidence for importance of mechanotransduction with the intrinsic force sensitivity for vinculin recruitment to adherens junctions of epithelial cell sheets with mutated α-catenins. © 2018 Molecular Biology Society of Japan and John Wiley & Sons Australia, Ltd.

  5. Goldspotted oak borer effects on tree health and colonization patterns at six newly-established sites

    Treesearch

    Laurel J. Haavik; Mary L. Flint; Tom W. Coleman; Robert C. Venette; Steven J. Seybold

    2015-01-01

    Newly-established populations of invasive wood-inhabiting insects provide an opportunity for the study of invasion dynamics and for collecting information to improve management options for these cryptic species. From 2011 to 2013, we studied the dynamics of the goldspotted oak borer Agrilus auroguttatus Schaeffer (Coleoptera: Buprestidae), a new pest...

  6. Biofluorescence as a survey tool for cryptic marine species.

    PubMed

    De Brauwer, Maarten; Hobbs, Jean-Paul A; Ambo-Rappe, Rohani; Jompa, Jamaluddin; Harvey, Euan S; McIlwain, Jennifer L

    2017-10-06

    As ecosystems come under increasing anthropogenic pressure, rare species face the highest risk of extinction. Paradoxically, data necessary to evaluate the conservation status of rare species are often lacking because of the challenges of detecting species with low abundance. One group of fishes subject to this undersampling bias are those with cryptic body patterns. Twenty-one percent of cryptic fish species assessed for their extinction risk (International Union for Conservation of Nature [IUCN]) are data deficient. We developed a nondestructive method for surveying cryptically patterned marine fishes based on the presence of biofluorescence (underwater biofluorescence census, UBC). Blue LED torches were used to investigate how widespread biofluorescence was in cryptic reef fishes in the Coral Triangle region. The effectiveness of UBC to generate abundance data was tested on a data-deficient pygmy seahorse species (Hippocampus bargibanti) and compared with data obtained from standard underwater visual census (UVC) surveys. We recorded 95 reef fish species displaying biofluorescence, 73 of which had not been previously described as biofluorescent. Of those fish with cryptic patterns, 87% were biofluorescent compared with 9% for noncryptic fishes. The probability of species displaying biofluorescence was 70.9 times greater for cryptic species than for noncryptic species. Almost twice the number of H. bargibanti was counted using the UBC compared with UVC. For 2 triplefin species (Ucla xenogrammus, Enneapterygius tutuilae), the abundance detected with UBC was triple that detected with UVC. The UBC method was effective at finding cryptic species that would otherwise be difficult to detect and thus will reduce interobserver variability inherent to UVC surveys. Biofluorescence is ubiquitous in cryptic fishes, making this method applicable across a wide range of species. Data collected using UBC could be used with multiple IUCN criteria to assess the extinction risk of cryptic species. Adopting this technique will enhance researchers' ability to survey cryptic species and facilitate management and conservation of cryptic marine species. © 2017 Society for Conservation Biology.

  7. The force-dependent mechanism of DnaK-mediated mechanical folding

    PubMed Central

    Perales-Calvo, Judit; Giganti, David; Stirnemann, Guillaume; Garcia-Manyes, Sergi

    2018-01-01

    It is well established that chaperones modulate the protein folding free-energy landscape. However, the molecular determinants underlying chaperone-mediated mechanical folding remain largely elusive, primarily because the force-extended unfolded conformation fundamentally differs from that characterized in biochemistry experiments. We use single-molecule force-clamp spectroscopy, combined with molecular dynamics simulations, to study the effect that the Hsp70 system has on the mechanical folding of three mechanically stiff model proteins. Our results demonstrate that, when working independently, DnaJ (Hsp40) and DnaK (Hsp70) work as holdases, blocking refolding by binding to distinct substrate conformations. Whereas DnaK binds to molten globule–like forms, DnaJ recognizes a cryptic sequence in the extended state in an unanticipated force-dependent manner. By contrast, the synergetic coupling of the Hsp70 system exhibits a marked foldase behavior. Our results offer unprecedented molecular and kinetic insights into the mechanisms by which mechanical force finely regulates chaperone binding, directly affecting protein elasticity. PMID:29487911

  8. Pay Attention to the Overlooked Cryptic Diversity in Existing Barcoding Data: the Case of Mollusca with Character-Based DNA Barcoding.

    PubMed

    Zou, Shanmei; Li, Qi

    2016-06-01

    With the global biodiversity crisis, DNA barcoding aims for fast species identification and cryptic species diversity revelation. For more than 10 years, large amounts of DNA barcode data have been accumulating in publicly available databases, most of which were conducted by distance or tree-building methods that have often been argued, especially for cryptic species revelation. In this context, overlooked cryptic diversity may exist in the available barcoding data. The character-based DNA barcoding, however, has a good chance for detecting the overlooked cryptic diversity. In this study, marine mollusk was as the ideal case for detecting the overlooked potential cryptic species from existing cytochrome c oxidase I (COI) sequences with character-based DNA barcode. A total of 1081 COI sequences of mollusks, belonging to 176 species of 25 families of Gastropoda, Cephalopoda, and Lamellibranchia, were conducted by character analysis. As a whole, the character-based barcoding results were consistent with previous distance and tree-building analysis for species discrimination. More importantly, quite a number of species analyzed were divided into distinct clades with unique diagnostical characters. Based on the concept of cryptic species revelation of character-based barcoding, these species divided into separate taxonomic groups might be potential cryptic species. The detection of the overlooked potential cryptic diversity proves that the character-based barcoding mode possesses more advantages of revealing cryptic biodiversity. With the development of DNA barcoding, making the best use of barcoding data is worthy of our attention for species conservation.

  9. Comprehensive Analysis of Contributions from Protein Conformational Stability and Major Histocompatibility Complex Class II-Peptide Binding Affinity to CD4+ Epitope Immunogenicity in HIV-1 Envelope Glycoprotein

    PubMed Central

    Li, Tingfeng; Steede, N. Kalaya; Nguyen, Hong-Nam P.; Freytag, Lucy C.; McLachlan, James B.; Mettu, Ramgopal R.; Robinson, James E.

    2014-01-01

    ABSTRACT Helper T-cell epitope dominance in human immunodeficiency virus type 1 (HIV-1) envelope glycoprotein gp120 is not adequately explained by peptide binding to major histocompatibility complex (MHC) proteins. Antigen processing potentially influences epitope dominance, but few, if any, studies have attempted to reconcile the influences of antigen processing and MHC protein binding for all helper T-cell epitopes of an antigen. Epitopes of gp120 identified in both humans and mice occur on the C-terminal flanks of flexible segments that are likely to be proteolytic cleavage sites. In this study, the influence of gp120 conformation on the dominance pattern in gp120 from HIV strain 89.6 was examined in CBA mice, whose MHC class II protein has one of the most well defined peptide-binding preferences. Only one of six dominant epitopes contained the most conserved element of the I-Ak binding motif, an aspartic acid. Destabilization of the gp120 conformation by deletion of single disulfide bonds preferentially enhanced responses to the cryptic I-Ak motif-containing sequences, as reported by T-cell proliferation or cytokine secretion. Conversely, inclusion of CpG in the adjuvant with gp120 enhanced responses to the dominant CD4+ T-cell epitopes. The gp120 destabilization affected secretion of some cytokines more than others, suggesting that antigen conformation could modulate T-cell functions through mechanisms of antigen processing. IMPORTANCE CD4+ helper T cells play an essential role in protection against HIV and other pathogens. Thus, the sites of helper T-cell recognition, the dominant epitopes, are targets for vaccine design; and the corresponding T cells may provide markers for monitoring infection and immunity. However, T-cell epitopes are difficult to identify and predict. It is also unclear whether CD4+ T cells specific for one epitope are more protective than T cells specific for other epitopes. This work shows that the three-dimensional (3D) structure of an HIV protein partially determines which epitopes are dominant, most likely by controlling the breakdown of HIV into peptides. Moreover, some types of signals from CD4+ T cells are affected by the HIV protein 3D structure; and thus the protectiveness of a particular peptide vaccine could be related to its location in the 3D structure. PMID:24920818

  10. Members of Bemisia tabaci (Hemiptera: Aleyrodidae) Cryptic Species and the Status of Two Invasive Alien Species in the Yunnan Province (China)

    PubMed Central

    Hu, Jian; Jiang, Zhi-Lin; Nardi, Francesco; Liu, Yuan-Yuan; Luo, Xiao-Rong; Li, Hong-Xiang; Zhang, Zhong-Kai

    2014-01-01

    Abstract Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae) is a cryptic species complex that includes some of the most significant pests of agriculture and horticulture worldwide. To understand the diversity and distribution of B. tabaci cryptic species in Yunnan, a famous biodiversity hotspot in China, a large-scale sampling was conducted from year 2010 to 2013 in 10 prefectures. Mitochondrial cytochrome oxidase I gene sequences were used to identify different cryptic species. Phylogenetic analyses were performed using Bayesian methods to assess the position of a new B. tabaci cryptic species in the context of the B. tabaci diversity in Asia. The survey indicates at least eight B. tabaci cryptic species are present in Yunnan, two invasive (MEAM1 and MED) and six indigenous (China 2, China3, China 4, Asia I, Asia II 1, and Asia II 6), MEAM1, MED, and Asia I being the three predominant cryptic species in Yunnan. Compared with MEAM1, MED has a wider distribution. Based on molecular data, a new cryptic species, here named China 4, was identified that appears to be related to China 1, China 2, and China 3. Future efforts should focus on the interactions between predominant B. tabaci cryptic species and begomoviruses and on the development of effective control strategies. PMID:25502045

  11. Members of Bemisia tabaci (Hemiptera: Aleyrodidae) cryptic species and the status of two invasive alien species in the Yunnan Province (China).

    PubMed

    Hu, Jian; Jiang, Zhi-Lin; Nardi, Francesco; Liu, Yuan-Yuan; Luo, Xiao-Rong; Li, Hong-Xiang; Zhang, Zhong-Kai

    2014-01-01

    Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae) is a cryptic species complex that includes some of the most significant pests of agriculture and horticulture worldwide. To understand the diversity and distribution of B. tabaci cryptic species in Yunnan, a famous biodiversity hotspot in China, a large-scale sampling was conducted from year 2010 to 2013 in 10 prefectures. Mitochondrial cytochrome oxidase I gene sequences were used to identify different cryptic species. Phylogenetic analyses were performed using Bayesian methods to assess the position of a new B. tabaci cryptic species in the context of the B. tabaci diversity in Asia. The survey indicates at least eight B. tabaci cryptic species are present in Yunnan, two invasive (MEAM1 and MED) and six indigenous (China 2, China3, China 4, Asia I, Asia II 1, and Asia II 6), MEAM1, MED, and Asia I being the three predominant cryptic species in Yunnan. Compared with MEAM1, MED has a wider distribution. Based on molecular data, a new cryptic species, here named China 4, was identified that appears to be related to China 1, China 2, and China 3. Future efforts should focus on the interactions between predominant B. tabaci cryptic species and begomoviruses and on the development of effective control strategies. © The Author 2014. Published by Oxford University Press on behalf of the Entomological Society of America.

  12. Cryptic Species Identification and Composition of Bemisia tabaci (Hemiptera: Aleyrodidae) Complex in Henan Province, China

    PubMed Central

    Hu, Jian; Wang, Lun-Ji; Dong, Jun-Feng; Song, Yue-Qin; Sun, Hui-Zhong

    2017-01-01

    Abstract Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae) is a cryptic species complex, causing significant crop losses in China during the last decade. Although knowledge of cryptic species composition and dynamics within B. tabaci complex is critical for developing sustainable pest management strategies, limited information is available on this pest in the Henan province of China. A systematic survey of the cryptic species composition and distribution of B. tabaci complex in different locations of Henan province was conducted in 2012. The results of RAPD-PCR and the gene for the mitochondrial cytochrome oxidase subunit-1 (mtCOI) based phylogenetic relationships established using Bayesian method indicated there were four known cryptic species MEAM1, MED, Asia II 3, Asia II 9 and a new cryptic species named China 6 in Henan province. In the survey, the invasive cryptic species MED and MEAM1 were found to be predominant with wide spread distribution across the surveyed regions. On the contrary, the indigenous B. tabaci cryptic species including Asia II 3, Asia II 9 and China 6 remained with low prevalence in some surveyed regions. Cryptic species MEAM1 and MED have not completely displaced the native B. tabaci in Henan province. This current study for the first time unifies our knowledge of the diversity and distribution of B. tabaci across Henan province of China. PMID:28973577

  13. Intronic L1 Retrotransposons and Nested Genes Cause Transcriptional Interference by Inducing Intron Retention, Exonization and Cryptic Polyadenylation

    PubMed Central

    Kaer, Kristel; Branovets, Jelena; Hallikma, Anni; Nigumann, Pilvi; Speek, Mart

    2011-01-01

    Background Transcriptional interference has been recently recognized as an unexpectedly complex and mostly negative regulation of genes. Despite a relatively few studies that emerged in recent years, it has been demonstrated that a readthrough transcription derived from one gene can influence the transcription of another overlapping or nested gene. However, the molecular effects resulting from this interaction are largely unknown. Methodology/Principal Findings Using in silico chromosome walking, we searched for prematurely terminated transcripts bearing signatures of intron retention or exonization of intronic sequence at their 3′ ends upstream to human L1 retrotransposons, protein-coding and noncoding nested genes. We demonstrate that transcriptional interference induced by intronic L1s (or other repeated DNAs) and nested genes could be characterized by intron retention, forced exonization and cryptic polyadenylation. These molecular effects were revealed from the analysis of endogenous transcripts derived from different cell lines and tissues and confirmed by the expression of three minigenes in cell culture. While intron retention and exonization were comparably observed in introns upstream to L1s, forced exonization was preferentially detected in nested genes. Transcriptional interference induced by L1 or nested genes was dependent on the presence or absence of cryptic splice sites, affected the inclusion or exclusion of the upstream exon and the use of cryptic polyadenylation signals. Conclusions/Significance Our results suggest that transcriptional interference induced by intronic L1s and nested genes could influence the transcription of the large number of genes in normal as well as in tumor tissues. Therefore, this type of interference could have a major impact on the regulation of the host gene expression. PMID:22022525

  14. Dual-treatment autodissemination station with enhanced transfer of an insect growth regulator to mosquito oviposition sites.

    PubMed

    Wang, Yi; Suman, Devi S; Bertrand, Jacques; Dong, Limin; Gaugler, Randy

    2014-08-01

    The Asian tiger mosquito, Aedes albopictus (Skuse), transmits important arboviral diseases and displaces native species. This peridomestic mosquito deposits eggs in natural and artificial containers. Container larval habitats tend to be cryptic and, therefore, difficult to reach by conventional insecticide treatments. We have developed an autodissemination station that transfers the insect growth regulator, pyriproxyfen, from the station to oviposition sites. Mosquitoes visiting the station become contaminated with an oil sticker followed by pyriproxyfen powder before exiting. In a room (31 m(3) ) bioassay a single station consistently achieved 100% Ae. albopictus pupal mortality against 10 oviposition containers. In a greenhouse (200 m(3) ) assay with two stations and 12 oviposition cups, 91.7% of the cups had been contaminated as shown, and 57.1% pupal mortality was recorded. Pyriproxyfen transfer was also detected by visualizing mosquito 'tarsal prints' using a fluorescent dye. The oil and pyriproxyfen powder dual-treatment station enhanced autodissemination efficacy by increasing toxicant attachment and retention on contaminated females. The autodissemination station offers a targeted, less environmentally damaging approach to manage cryptic container species. © 2013 Society of Chemical Industry.

  15. Targeting a Hidden Enemy: Pyriproxyfen Autodissemination Strategy for the Control of the Container Mosquito Aedes albopictus in Cryptic Habitats

    PubMed Central

    Suman, Devi Shankar; Wang, Yi; Unlu, Isik; Williges, Eric; Williams, Gregory M.; Gaugler, Randy

    2016-01-01

    Background The Asian tiger mosquito, Aedes albopictus, is a vector of dengue, Chikungunya, and Zika viruses. This mosquito inhabits a wide range of artificial water-holding containers in urban and suburban areas making it difficult to control. We tested the hypothesis that female-driven autodissemination of an insect growth regulator could penetrate cryptic oviposition habitats difficult to treat with conventional insecticidal sprays. Methodology Oviposition preferences of Ae. albopictus females for open and cryptic cups were tested in semi-field experiments. Two conventional larvicidal sprayers were tested to determine droplet penetration and larvicidal efficacy in open and cryptic habitats using Bacillus thuringiensis var. israelensis (Bti) in the field. Finally, the efficacy of pyriproxyfen autodissemination stations was assessed in cryptic and open cups in residential areas during 2013 and 2014. Principal Findings Gravid females strongly preferred cryptic (53.1±12.9 eggs/cup) over open (10.3±4.3 eggs/cup) cups for oviposition. Cryptic cups showed limited droplet penetration and produced 0.1–0.3% larval mortality with a conventional backpack and low-volume sprays of Bti. The autodissemination stations effectively contaminated these cryptic cups (59.3–84.6%) and produced 29.7–40.8% pupal mortality during 2013–2014. Significant pupal mortality was also observed in open cups. Conclusions The autodissemination station effectively exploits the oviposition behavior of wild gravid females to deliver pyriproxyfen to targeted oviposition habitats. Although the pupal mortality in cryptic cups was relatively lower than expected for the effective vector control. Autodissemination approach may be a suitable supporting tool to manage Ae. albopictus immatures in the cryptic habitats those are less accessible to conventional larvicidal sprays. PMID:28033379

  16. Cryptic Species Identification and Composition of Bemisia tabaci (Hemiptera: Aleyrodidae) Complex in Henan Province, China.

    PubMed

    Jiu, Min; Hu, Jian; Wang, Lun-Ji; Dong, Jun-Feng; Song, Yue-Qin; Sun, Hui-Zhong

    2017-05-01

    Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae) is a cryptic species complex, causing significant crop losses in China during the last decade. Although knowledge of cryptic species composition and dynamics within B. tabaci complex is critical for developing sustainable pest management strategies, limited information is available on this pest in the Henan province of China. A systematic survey of the cryptic species composition and distribution of B. tabaci complex in different locations of Henan province was conducted in 2012. The results of RAPD-PCR and the gene for the mitochondrial cytochrome oxidase subunit-1 (mtCOI) based phylogenetic relationships established using Bayesian method indicated there were four known cryptic species MEAM1, MED, Asia II 3, Asia II 9 and a new cryptic species named China 6 in Henan province. In the survey, the invasive cryptic species MED and MEAM1 were found to be predominant with wide spread distribution across the surveyed regions. On the contrary, the indigenous B. tabaci cryptic species including Asia II 3, Asia II 9 and China 6 remained with low prevalence in some surveyed regions. Cryptic species MEAM1 and MED have not completely displaced the native B. tabaci in Henan province. This current study for the first time unifies our knowledge of the diversity and distribution of B. tabaci across Henan province of China. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America.

  17. Cryptic diversity in a fig wasp community-morphologically differentiated species are sympatric but cryptic species are parapatric.

    PubMed

    Darwell, C T; Cook, J M

    2017-02-01

    A key debate in ecology centres on the relative importance of niche and neutral processes in determining patterns of community assembly with particular focus on whether ecologically similar species with similar functional traits are able to coexist. Meanwhile, molecular studies are increasingly revealing morphologically indistinguishable cryptic species with presumably similar ecological roles. Determining the geographic distribution of such cryptic species provides opportunities to contrast predictions of niche vs. neutral models. Discovery of sympatric cryptic species increases alpha diversity and supports neutral models, while documentation of allopatric/parapatric cryptic species increases beta diversity and supports niche models. We tested these predictions using morphological and molecular data, coupled with environmental niche modelling analyses, of a fig wasp community along its 2700-km latitudinal range. Molecular methods increased previous species diversity estimates from eight to eleven species, revealing morphologically cryptic species in each of the four wasp genera studied. Congeneric species pairs that were differentiated by a key morphological functional trait (ovipositor length) coexisted sympatrically over large areas. In contrast, morphologically similar species, with similar ovipositor lengths, typically showed parapatric ranges with very little overlap. Despite parapatric ranges, environmental niche models of cryptic congeneric pairs indicate large regions of potential sympatry, suggesting that competitive processes are important in determining the distributions of ecologically similar species. Niche processes appear to structure this insect community, and cryptic diversity may typically contribute mostly to beta rather than alpha diversity. © 2016 John Wiley & Sons Ltd.

  18. How hidden are hidden processes? A primer on crypticity and entropy convergence

    NASA Astrophysics Data System (ADS)

    Mahoney, John R.; Ellison, Christopher J.; James, Ryan G.; Crutchfield, James P.

    2011-09-01

    We investigate a stationary process's crypticity—a measure of the difference between its hidden state information and its observed information—using the causal states of computational mechanics. Here, we motivate crypticity and cryptic order as physically meaningful quantities that monitor how hidden a hidden process is. This is done by recasting previous results on the convergence of block entropy and block-state entropy in a geometric setting, one that is more intuitive and that leads to a number of new results. For example, we connect crypticity to how an observer synchronizes to a process. We show that the block-causal-state entropy is a convex function of block length. We give a complete analysis of spin chains. We present a classification scheme that surveys stationary processes in terms of their possible cryptic and Markov orders. We illustrate related entropy convergence behaviors using a new form of foliated information diagram. Finally, along the way, we provide a variety of interpretations of crypticity and cryptic order to establish their naturalness and pervasiveness. This is also a first step in developing applications in spatially extended and network dynamical systems.

  19. Ontogenetic and sex-based differences in habitat preferences and site fidelity of White's seahorse Hippocampus whitei.

    PubMed

    Harasti, D; Martin-Smith, K; Gladstone, W

    2014-11-01

    The aim of this study was to determine and compare habitat preferences for male and female adult and juvenile White's seahorse Hippocampus whitei and assess their movements and site fidelity over 4 years. Data were collected from three sites along 1.5 km of estuarine shoreline in Port Stephens, New South Wales, Australia, from 2006 to 2009 using H. whitei that had been tagged with visible implant fluorescent elastomer. Relative availability of 12 habitats and habitat preferences of H. whitei was determined, based on the habitat that H. whitei used as a holdfast. Hippocampus whitei occurred in nine different habitats; adults preferred sponge and soft coral Dendronephthya australis habitats with no difference between male and female habitat preferences whilst juveniles preferred gorgonian Euplexaura sp. habitat. There was a significant preference by adults for D. australis colonies with height >40 cm and avoidance of colonies <20 cm. Neither adults nor juveniles used sand or the seagrasses Zostera muelleri subsp. capricorni and Halophila ovalis. Hippocampus whitei showed cryptic behaviour with c. 50% of adult sightings cryptic and c. 75% for juveniles with crypsis occurring predominantly in Sargassum sp. for adults and Euplexaura sp. habitat for juveniles. Within sites, females moved significantly longer distances (maximum of 70 m) than males (maximum of 38 m) over 20 months. Strong site fidelity was displayed by H. whitei with males persisting at the same site for up to 56 months and females for 49 months and no H. whitei moved between sites. The longest period that an H. whitei was recorded on the same holdfast was 17 months for a male and 10 months for a female. As this species displays strong site fidelity, specific habitat preferences and has a limited distribution, future management needs to minimize the risk of habitat disturbance as loss of key habitats could have a negative effect on species abundance and distribution. © 2014 The Fisheries Society of the British Isles.

  20. Rare Autosomal Recessive Cardiac Valvular Form of Ehlers-Danlos Syndrome Results from Mutations in the COL1A2 Gene That Activate the Nonsense-Mediated RNA Decay Pathway

    PubMed Central

    Schwarze, Ulrike; Hata, Ryu-Ichiro; McKusick, Victor A.; Shinkai, Hiroshi; Hoyme, H. Eugene; Pyeritz, Reed E.; Byers, Peter H.

    2004-01-01

    Splice site mutations in the COL1A2 gene of type I collagen can give rise to forms of Ehlers-Danlos syndrome (EDS) because of partial or complete skipping of exon 6, as well as to mild, moderate, or lethal forms of osteogenesis imperfecta as a consequence of skipping of other exons. We identified three unrelated individuals with a rare recessively inherited form of EDS (characterized by joint hypermobility, skin hyperextensibility, and cardiac valvular defects); in two of them, COL1A2 messenger RNA (mRNA) instability results from compound heterozygosity for splice site mutations in the COL1A2 gene, and, in the third, it results from homozygosity for a nonsense codon. The splice site mutations led to use of cryptic splice donor sites, creation of a downstream premature termination codon, and extremely unstable mRNA. In the wild-type allele, the two introns (IVS11 and IVS24) in which these mutations occurred were usually spliced slowly in relation to their respective immediate upstream introns. In the mutant alleles, the upstream intron was removed, so that exon skipping could not occur. In the context of the mutation in IVS24, computer-generated folding of a short stretch of mRNA surrounding the mutation site demonstrated realignment of the relationships between the donor and acceptor sites that could facilitate use of a cryptic donor site. These findings suggest that the order of intron removal is an important variable in prediction of mutation outcome at splice sites and that folding of the nascent mRNA could be one element that contributes to determination of order of splicing. The complete absence of proα2(I) chains has the surprising effect of producing cardiac valvular disease without bone involvement. PMID:15077201

  1. Rare autosomal recessive cardiac valvular form of Ehlers-Danlos syndrome results from mutations in the COL1A2 gene that activate the nonsense-mediated RNA decay pathway.

    PubMed

    Schwarze, Ulrike; Hata, Ryu-Ichiro; McKusick, Victor A; Shinkai, Hiroshi; Hoyme, H Eugene; Pyeritz, Reed E; Byers, Peter H

    2004-05-01

    Splice site mutations in the COL1A2 gene of type I collagen can give rise to forms of Ehlers-Danlos syndrome (EDS) because of partial or complete skipping of exon 6, as well as to mild, moderate, or lethal forms of osteogenesis imperfecta as a consequence of skipping of other exons. We identified three unrelated individuals with a rare recessively inherited form of EDS (characterized by joint hypermobility, skin hyperextensibility, and cardiac valvular defects); in two of them, COL1A2 messenger RNA (mRNA) instability results from compound heterozygosity for splice site mutations in the COL1A2 gene, and, in the third, it results from homozygosity for a nonsense codon. The splice site mutations led to use of cryptic splice donor sites, creation of a downstream premature termination codon, and extremely unstable mRNA. In the wild-type allele, the two introns (IVS11 and IVS24) in which these mutations occurred were usually spliced slowly in relation to their respective immediate upstream introns. In the mutant alleles, the upstream intron was removed, so that exon skipping could not occur. In the context of the mutation in IVS24, computer-generated folding of a short stretch of mRNA surrounding the mutation site demonstrated realignment of the relationships between the donor and acceptor sites that could facilitate use of a cryptic donor site. These findings suggest that the order of intron removal is an important variable in prediction of mutation outcome at splice sites and that folding of the nascent mRNA could be one element that contributes to determination of order of splicing. The complete absence of pro alpha 2(I) chains has the surprising effect of producing cardiac valvular disease without bone involvement.

  2. New Splice Site Acceptor Mutation in AIRE Gene in Autoimmune Polyendocrine Syndrome Type 1

    PubMed Central

    Mora, Mireia; Hanzu, Felicia A.; Pradas-Juni, Marta; Aranda, Gloria B.; Halperin, Irene; Puig-Domingo, Manuel; Aguiló, Sira; Fernández-Rebollo, Eduardo

    2014-01-01

    Autoimmune polyglandular syndrome type 1 (APS-1, OMIM 240300) is a rare autosomal recessive disorder, characterized by the presence of at least two of three major diseases: hypoparathyroidism, Addison’s disease, and chronic mucocutaneous candidiasis. We aim to identify the molecular defects and investigate the clinical and mutational characteristics in an index case and other members of a consanguineous family. We identified a novel homozygous mutation in the splice site acceptor (SSA) of intron 5 (c.653-1G>A) in two siblings with different clinical outcomes of APS-1. Coding DNA sequencing revealed that this AIRE mutation potentially compromised the recognition of the constitutive SSA of intron 5, splicing upstream onto a nearby cryptic SSA in intron 5. Surprisingly, the use of an alternative SSA entails the uncovering of a cryptic donor splice site in exon 5. This new transcript generates a truncated protein (p.A214fs67X) containing the first 213 amino acids and followed by 68 aberrant amino acids. The mutation affects the proper splicing, not only at the acceptor but also at the donor splice site, highlighting the complexity of recognizing suitable splicing sites and the importance of sequencing the intron-exon junctions for a more precise molecular diagnosis and correct genetic counseling. As both siblings were carrying the same mutation but exhibited a different APS-1 onset, and one of the brothers was not clinically diagnosed, our finding highlights the possibility to suspect mutations in the AIRE gene in cases of childhood chronic candidiasis and/or hypoparathyroidism otherwise unexplained, especially when the phenotype is associated with other autoimmune diseases. PMID:24988226

  3. Differences in life-histories refute ecological equivalence of cryptic species and provide clues to the origin of bathyal Halomonhystera (Nematoda).

    PubMed

    Van Campenhout, Jelle; Derycke, Sofie; Moens, Tom; Vanreusel, Ann

    2014-01-01

    The discovery of morphologically very similar but genetically distinct species complicates a proper understanding of the link between biodiversity and ecosystem functioning. Cryptic species have been frequently observed to co-occur and are thus expected to be ecological equivalent. The marine nematode Halomonhystera disjuncta contains five cryptic species (GD1-5) that co-occur in the Westerschelde estuary. In this study, we investigated the effect of three abiotic factors (salinity, temperature and sulphide) on life-history traits of three cryptic H. disjuncta species (GD1-3). Our results show that temperature had the most profound influence on all life-cycle parameters compared to a smaller effect of salinity. Life-history traits of closely related cryptic species were differentially affected by temperature, salinity and presence of sulphides which shows that cryptic H. disjuncta species are not ecologically equivalent. Our results further revealed that GD1 had the highest tolerance to a combination of sulphides, high salinities and low temperatures. The close phylogenetic position of GD1 to Halomonhystera hermesi, the dominant species in sulphidic sediments of the Håkon Mosby mud volcano (Barent Sea, 1280 m depth), indicates that both species share a recent common ancestor. Differential life-history responses to environmental changes among cryptic species may have crucial consequences for our perception on ecosystem functioning and coexistence of cryptic species.

  4. The Fc Region of an Antibody Impacts the Neutralization of West Nile Viruses in Different Maturation States

    PubMed Central

    Lee, Phong D.; Mukherjee, Swati; Edeling, Melissa A.; Dowd, Kimberly A.; Austin, S. Kyle; Manhart, Carolyn J.; Diamond, Michael S.; Fremont, Daved H.

    2013-01-01

    Flavivirus-infected cells secrete a structurally heterogeneous population of viruses because of an inefficient virion maturation process. Flaviviruses assemble as noninfectious, immature virions composed of trimers of envelope (E) and precursor membrane (prM) protein heterodimers. Cleavage of prM is a required process during virion maturation, although this often remains incomplete for infectious virus particles. Previous work demonstrated that the efficiency of virion maturation could impact antibody neutralization through changes in the accessibility of otherwise cryptic epitopes on the virion. In this study, we show that the neutralization potency of monoclonal antibody (MAb) E33 is sensitive to the maturation state of West Nile virus (WNV), despite its recognition of an accessible epitope, the domain III lateral ridge (DIII-LR). Comprehensive epitope mapping studies with 166 E protein DIII-LR variants revealed that the functional footprint of MAb E33 on the E protein differs subtly from that of the well-characterized DIII-LR MAb E16. Remarkably, aromatic substitutions at E protein residue 306 ablated the maturation state sensitivity of E33 IgG, and the neutralization efficacy of E33 Fab fragments was not affected by changes in the virion maturation state. We propose that E33 IgG binding on mature virions orients the Fc region in a manner that impacts subsequent antibody binding to nearby sites. This Fc-mediated steric constraint is a novel mechanism by which the maturation state of a virion modulates the efficacy of the humoral immune response to flavivirus infection. PMID:24109224

  5. Comparative Genome Analysis of Trichophyton rubrum and Related Dermatophytes Reveals Candidate Genes Involved in Infection

    PubMed Central

    Martinez, Diego A.; Oliver, Brian G.; Gräser, Yvonne; Goldberg, Jonathan M.; Li, Wenjun; Martinez-Rossi, Nilce M.; Monod, Michel; Shelest, Ekaterina; Barton, Richard C.; Birch, Elizabeth; Brakhage, Axel A.; Chen, Zehua; Gurr, Sarah J.; Heiman, David; Heitman, Joseph; Kosti, Idit; Rossi, Antonio; Saif, Sakina; Samalova, Marketa; Saunders, Charles W.; Shea, Terrance; Summerbell, Richard C.; Xu, Jun; Young, Sarah; Zeng, Qiandong; Birren, Bruce W.; Cuomo, Christina A.; White, Theodore C.

    2012-01-01

    ABSTRACT The major cause of athlete’s foot is Trichophyton rubrum, a dermatophyte or fungal pathogen of human skin. To facilitate molecular analyses of the dermatophytes, we sequenced T. rubrum and four related species, Trichophyton tonsurans, Trichophyton equinum, Microsporum canis, and Microsporum gypseum. These species differ in host range, mating, and disease progression. The dermatophyte genomes are highly colinear yet contain gene family expansions not found in other human-associated fungi. Dermatophyte genomes are enriched for gene families containing the LysM domain, which binds chitin and potentially related carbohydrates. These LysM domains differ in sequence from those in other species in regions of the peptide that could affect substrate binding. The dermatophytes also encode novel sets of fungus-specific kinases with unknown specificity, including nonfunctional pseudokinases, which may inhibit phosphorylation by competing for kinase sites within substrates, acting as allosteric effectors, or acting as scaffolds for signaling. The dermatophytes are also enriched for a large number of enzymes that synthesize secondary metabolites, including dermatophyte-specific genes that could synthesize novel compounds. Finally, dermatophytes are enriched in several classes of proteases that are necessary for fungal growth and nutrient acquisition on keratinized tissues. Despite differences in mating ability, genes involved in mating and meiosis are conserved across species, suggesting the possibility of cryptic mating in species where it has not been previously detected. These genome analyses identify gene families that are important to our understanding of how dermatophytes cause chronic infections, how they interact with epithelial cells, and how they respond to the host immune response. PMID:22951933

  6. Immunodominance and Functional Activities of Antibody Responses to Inactivated West Nile Virus and Recombinant Subunit Vaccines in Mice▿

    PubMed Central

    Zlatkovic, Juergen; Stiasny, Karin; Heinz, Franz X.

    2011-01-01

    Factors controlling the dominance of antibody responses to specific sites in viruses and/or protein antigens are ill defined but can be of great importance for the induction of potent immune responses to vaccines. West Nile virus and other related important human-pathogenic flaviviruses display the major target of neutralizing antibodies, the E protein, in an icosahedral shell at the virion surface. Potent neutralizing antibodies were shown to react with the upper surface of domain III (DIII) of this protein. Using the West Nile virus system, we conducted a study on the immunodominance and functional quality of E-specific antibody responses after immunization of mice with soluble protein E (sE) and isolated DIII in comparison to those after immunization with inactivated whole virions. With both virion and sE, the neutralizing response was dominated by DIII-specific antibodies, but the functionality of these antibodies was almost four times higher after virion immunization. Antibodies induced by the isolated DIII had an at least 15-fold lower specific neutralizing activity than those induced by the virion, and only 50% of these antibodies were able to bind to virus particles. Our results suggest that immunization with the tightly packed E in virions focuses the DIII antibody response to the externally exposed sites of this domain which are the primary targets for virus neutralization, different from sE and isolated DIII, which also display protein surfaces that are cryptic in the virion. Despite its low potency for priming, DIII was an excellent boosting antigen, suggesting novel vaccination strategies that strengthen and focus the antibody response to critical neutralizing sites in DIII. PMID:21147919

  7. cDNA sequences and organization of IgM heavy chain genes in two holostean fish.

    PubMed

    Wilson, M R; van Ravenstein, E; Miller, N W; Clem, L W; Middleton, D L; Warr, G W

    1995-01-01

    Immunoglobulin M heavy chain (mu) sequences of two holostean fish, the bowfin, Amia calva, and the longnose gar, Lepisosteus osseus, were amplified from spleen mRNA by RACE-PCR, cloned, and sequenced. Each mu chain showed the conserved four constant domain structure typical of a secreted mu chain. Southern blot analyses with specific heavy chain variable (VH) and constant (CH) region probes suggest that both fish possess an IgH locus that resembles that of the teleosts, amphibians, and mammals in its organization. The overall sequence similarity of gar and bowfin mu chains was 60% and 48% at the nucleotide and amino acid levels, respectively, while similarity to the mu chains of teleosts and elasmobranchs was lower. The bowfin mu chain possesses a distinctive proline-rich sequence at the C mu 1/C mu 2 boundary; a shorter proline-rich sequence is present at this position in the gar mu chain. Both gar and bowfin show, in their C mu 4 sequences, motifs that could serve as cryptic splice donor sites for the production of mRNA encoding the membrane-bound form of the mu chains, and the bowfin also shows a potential cryptic splice donor site in the C mu 3 exon.

  8. Aerial ULV control of Aedes aegypti with naled (Dibrom) inside simulated rural village and urban cryptic habitats.

    PubMed

    Britch, Seth C; Linthicum, Kenneth J; Aldridge, Robert L; Breidenbaugh, Mark S; Latham, Mark D; Connelly, Peter H; Rush, Mattie J E; Remmers, Jennifer L; Kerce, Jerry D; Silcox, Charles A

    2018-01-01

    We conducted aerial fixed wing ultra low volume (ULV) spray trials with naled to investigate penetration of exposed and simulated cryptic habitat within opened buildings, partially sealed buildings, and outdoor locations targeting sentinel adult Aedes aegypti mosquitoes in north central Florida. Mortality was observed in open and closed buildings and outdoors, even in mosquitoes placed in cryptic habitats. Observations on the impact of building type, mosquito exposure method such as placement in cryptic habitat, and spray nozzle size on mosquito mortality are described and analyzed.

  9. New putative cryptic species detection and genetic network analysis of Bemisia tabaci (Hempitera: Aleyrodidae) in China based on mitochondrial COI sequences.

    PubMed

    Hu, Jian; Zhang, Xiaoyun; Jiang, Zhilin; Zhang, Feifei; Liu, Yuanyuan; Li, Zhan; Zhang, Zhongkai

    2018-04-01

    The whitefly Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae) is a cryptic species complex and widely distributed throughout tropical and subtropical regions. To understand the B. tabaci cryptic species diversity in China more comprehensively, in the year 2014 and 2016, a large-scale sampling was conducted from the famous biodiversity hotspot of China, Yunnan province. Mitochondrial cytochrome oxidase I gene sequences were used to identify new putative cryptic species. Phylogenetic analyses were performed using Bayesian methods to evaluate the position of new cryptic species in the context of the B. tabaci diversity in Asia. Two new cryptic species, China 5 and Asia V were identified. In total, 19 B. tabaci cryptic species are present in China, two invasive (MED and MEAM1) and 17 indigenous. A new sibling species of B. tabaci was first defined and reported. Based on the mtCOI sequences and haplotype network analyses, the genetic diversity of MED was far higher than MEAM1. We confirmed the exotic MED was originated from the western Mediterranean regions and first invaded into Yunnan, China. The genetic structures of other four indigenous species (Asia I, Asia II 1, Asia II 6, and China 1) with relatively wide distribution ranges in China were also discussed.

  10. Volatile compounds in cryptic species of the Aneura pinguis complex and Aneura maxima (Marchantiophyta, Metzgeriidae).

    PubMed

    Wawrzyniak, Rafał; Wasiak, Wiesław; Bączkiewicz, Alina; Buczkowska, Katarzyna

    2014-09-01

    Aneura pinguis is one of the liverwort species complexes that consist of several cryptic species. Ten samples collected from different regions in Poland are in the focus of our research. Eight of the A. pinguis complex belonging to four cryptic species (A, B, C, E) and two samples of closely related species Aneura maxima were tested for the composition of volatile compounds. The HS-SPME technique coupled to GC/FID and GC/MS analysis has been applied. The fiber coated with DVB/CAR/PDMS has been used. The results of the present study, revealed the qualitative and quantitative differences in the composition of the volatile compounds between the studied species. Mainly they are from the group of sesquiterpenoids, oxygenated sesquiterpenoids and aliphatic hydrocarbons. The statistical methods (CA and PCA) showed that detected volatile compounds allow to distinguish cryptic species of A. pinguis. All examined cryptic species of the A. pinguis complex differ from A. maxima. Species A and E of A. pinguis, in CA and PCA, form separate clusters remote from two remaining cryptic species of A. pinguis (B and C) and A. maxima. Relationship between the cryptic species appeared from the chemical studies are in accordance with that revealed on the basis of DNA sequences. Copyright © 2014 Elsevier Ltd. All rights reserved.

  11. Differential responses of cryptic bat species to the urban landscape.

    PubMed

    Lintott, Paul R; Barlow, Kate; Bunnefeld, Nils; Briggs, Philip; Gajas Roig, Clara; Park, Kirsty J

    2016-04-01

    Urbanization is a key global driver in the modification of land use and has been linked to population declines even in widespread and relatively common species. Cities comprise a complex assortment of habitat types yet we know relatively little about the effects of their composition and spatial configuration on species distribution. Although many bat species exploit human resources, the majority of species are negatively impacted by urbanization. Here, we use data from the National Bat Monitoring Programme, a long-running citizen science scheme, to assess how two cryptic European bat species respond to the urban landscape. A total of 124 × 1 km(2) sites throughout Britain were surveyed. The landscape surrounding each site was mapped and classified into discrete biotope types (e.g., woodland). Generalized linear models were used to assess differences in the response to the urban environment between the two species, and which landscape factors were associated with the distributions of P. pipistrellus and P. pygmaeus. The relative prevalence of P. pygmaeus compared to P. pipistrellus was greater in urban landscapes with a higher density of rivers and lakes, whereas P. pipistrellus was frequently detected in landscapes comprising a high proportion of green space (e.g., parklands). Although P. pipistrellus is thought to be well adapted to the urban landscape, we found a strong negative response to urbanization at a relatively local scale (1 km), whilst P. pygmaeus was detected more regularly in wooded urban landscapes containing freshwater. These results show differential habitat use at a landscape scale of two morphologically similar species, indicating that cryptic species may respond differently to anthropogenic disturbance. Even species considered relatively common and well adapted to the urban landscape may respond negatively to the built environment highlighting the future challenges involved in maintaining biodiversity within an increasingly urbanized world.

  12. Detection of {open_quotes}cryptic{close_quotes}karyotypic rearrangements in closely related primate species by fluorescence in situ hybridization (FISH) using human subtelomeric DNA probes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Youngblom, J.J.; Trask, B.J.; Friedman, C.

    Specific human subtelomeric DNA probes were used to reveal cryptic chromosomal rearrangements that cannot be detected by conventional high resolution cytogenetic techniques, or by chromosomal in situ suppression hybridization using whole chromosome paint analysis. Two cosmids containing different subtelomeric DNA sequences were derived from human chromosome 19 and designated as 7501 and 16432. Cosmid 7501 was hybridized to chromosomes from humans, chimpanzee, gorilla and orangutan. In humans, 7501 consistently labeled chromosomes 3q, 15q, and 19p. Additional chromosomes were labeled in different individuals, indicating a polymorphic distribution of this sequence in the human genome. In contrast, 7501 consistently and strongly labeledmore » only the q arm terminus of chromosome 3 in both chimp and gorilla. The identification of the chromosome was made by two-color FISH analysis using human chromosome 4-specific paint and homologous to human chromosome 4. None of the human subjects showed labeling of chromosome 4 with 7501. This finding suggests that in the course of human evolution, subsequent to the divergence of humans and African apes, a cryptic translocation occurred between the ancestral human chromosome 4 and one or more of the other human chromosomes that now contain this DNA segment. In orangutan, 7501 labeled a single acrocentric chromosome pair, a distinctly different chromosome than that labeled in chimp and gorilla. Comparison of chromosome sites labeled with cosmid 16432 showed the distribution of signals on chromosome 1q arm is the same for humans and chimp, but different in the gorilla. Humans and chimps show distinct labeling on sites 1q terminus and 1q41-42. In gorilla, there is instead a large cluster of intense signal near the terminus of 1q that clearly does not extend all the way to the terminus. A paracentric inversion or an unequal cross-over event may account for the observed difference between these species.« less

  13. Cryptic species diversity reveals biogeographic support for the ‘mountain passes are higher in the tropics’ hypothesis

    PubMed Central

    Gill, B. A.; Kondratieff, B. C.; Casner, K. L.; Encalada, A. C.; Flecker, A. S.; Gannon, D. G.; Ghalambor, C. K.; Guayasamin, J. M.; Poff, N. L.; Simmons, M. P.; Thomas, S. A.; Zamudio, K. R.; Funk, W. C.

    2016-01-01

    The ‘mountain passes are higher in the tropics’ (MPHT) hypothesis posits that reduced climate variability at low latitudes should select for narrower thermal tolerances, lower dispersal and smaller elevational ranges compared with higher latitudes. These latitudinal differences could increase species richness at low latitudes, but that increase may be largely cryptic, because physiological and dispersal traits isolating populations might not correspond to morphological differences. Yet previous tests of the MPHT hypothesis have not addressed cryptic diversity. We use integrative taxonomy, combining morphology (6136 specimens) and DNA barcoding (1832 specimens) to compare the species richness, cryptic diversity and elevational ranges of mayflies (Ephemeroptera) in the Rocky Mountains (Colorado; approx. 40°N) and the Andes (Ecuador; approx. 0°). We find higher species richness and smaller elevational ranges in Ecuador than Colorado, but only after quantifying and accounting for cryptic diversity. The opposite pattern is found when comparing diversity based on morphology alone, underscoring the importance of uncovering cryptic species to understand global biodiversity patterns. PMID:27306051

  14. In the shadows: Phylogenomics and coalescent species delimitation unveil cryptic diversity in a Cerrado endemic lizard (Squamata: Tropidurus).

    PubMed

    Domingos, Fabricius M C B; Colli, Guarino R; Lemmon, Alan; Lemmon, Emily Moriarty; Beheregaray, Luciano B

    2017-02-01

    The recognition of cryptic diversity within geographically widespread species is gradually becoming a trend in the highly speciose Neotropical biomes. The statistical methods to recognise such cryptic lineages are rapidly advancing, but have rarely been applied to genomic-scale datasets. Herein, we used phylogenomic data to investigate phylogenetic history and cryptic diversity within Tropidurus itambere, a lizard endemic to the Cerrado biodiversity hotspot. We applied a series of phylogenetic methods to reconstruct evolutionary relationships and a coalescent Bayesian species delimitation approach (BPP) to clarify species limits. The BPP results suggest that the widespread nominal taxon comprises a complex of 5 highly supported and geographically structured cryptic species. We highlight and discuss the different topological patterns recovered by concatenated and coalescent species tree methods for these closely related lineages. Finally, we suggest that the existence of cryptic lineages in the Cerrado is much more common than traditionally thought, highlighting the value of using NGS data and coalescent techniques to investigate patterns of species diversity. Copyright © 2016 Elsevier Inc. All rights reserved.

  15. Integrating molecular and morphological approaches for characterizing parasite cryptic species: implications for parasitology.

    PubMed

    Nadler, Steven A; DE León, Gerardo Pérez-Ponce

    2011-11-01

    Herein we review theoretical and methodological considerations important for finding and delimiting cryptic species of parasites (species that are difficult to recognize using traditional systematic methods). Applications of molecular data in empirical investigations of cryptic species are discussed from an historical perspective, and we evaluate advantages and disadvantages of approaches that have been used to date. Developments concerning the theory and practice of species delimitation are emphasized because theory is critical to interpretation of data. The advantages and disadvantages of different molecular methodologies, including the number and kind of loci, are discussed relative to tree-based approaches for detecting and delimiting cryptic species. We conclude by discussing some implications that cryptic species have for research programmes in parasitology, emphasizing that careful attention to the theory and operational practices involved in finding, delimiting, and describing new species (including cryptic species) is essential, not only for fully characterizing parasite biodiversity and broader aspects of comparative biology such as systematics, evolution, ecology and biogeography, but to applied research efforts that strive to improve development and understanding of epidemiology, diagnostics, control and potential eradication of parasitic diseases.

  16. The development of a preliminary rock reef fish multimetric index for assessing thermal and urban impacts in a tropical bay.

    PubMed

    Teixeira-Neves, Tatiana Pires; Neves, Leonardo Mitrano; Araújo, Francisco Gerson

    2016-08-15

    We developed a multimetric index for assessing ecological conditions in rocky reefs areas to evaluate thermal and urban influences on fish community. Eight metrics were selected to assess thermal influence: (1) total number of species; (2) number of water column species; (3) number of transient species; (4) density of individuals with low resilience; (5) density of omnivores; (6) density of carnivores; (7) number of cryptic species; (8) density of herbivores. For urban influence, six metrics were selected: (1) total density; (2) ratio between the number of rare species and the total number of species; (3) density of individuals with heavy fishing pressure; (4) number of resident species; (5) number of cryptic species; (6) density of herbivores. This preliminary index succeed in discriminating control/impacted sites and proved to be an important tool to assess impacts that alter fish community and have potential to be used in tropical rock reef coastal areas. Copyright © 2016 Elsevier Ltd. All rights reserved.

  17. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Not Available

    Seagrass communities are a major feature of shallow marine areas throughout the world. The marine spermatophyte, Thalassia testudinum Konig, is the dominant seagrass in southeast Florida and the Florida Gulf coast. The trophic interaction between the fishes and the macrobenthic and cryptic fauna found in the area was examined. Based on digestive tract analysis, the principal interaction between the primary consumers of the study area and the higher trophic level predators was via the polychaetes and peracaridean crustaceans. The mollusks which contributed significantly to the benthic biomass were not a preferred food for the animals frequenting the study site. Themore » maximum biomass in any benthic and cryptic samples was 3.35 g dry/m/sup 2/. The majority of the fishes captured were foragers over a wide area. The main residents were the syngnathids and the goldspotted killifish, Floridichthys carpio. It was felt that the predator population was limited by the small stock of polychaetes and peracaridean crustaceans which had a maximum biomass in any one sample equivalent to 1.40 g dry/m/sup 2/.« less

  18. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Brook, I.M.

    Seagrass communities are a major feature of shallow marine areas throughout the world. The marine spermatophyte Thalassia testudinum is the dominant seagrass in southeast Florida and the Florida Gulf coast. The trophic interaction between the fishes and the macrobenthic and cryptic fauna found in the area was examined. Based on digestive tract analysis, the principal interaction between the primary consumers of the study area and the higher trophic level predators was via the polychaetes and peracaridean crustaceans. The mollusks which contributed significantly to the benthic biomass were not a preferred food for the animals frequenting the study site. The maximummore » mollusk biomass in any benthic and cryptic sample was 2.31 g dry/m/sup 2/. It was felt that the predator population was limited by the small stock of polychaetes and peracaridean crustaceans which had a maximum biomass in any one sample equivalent to 1.74 g dry/m/sup 2/. The majority of the fishes captured were foragers over a wide area. The main residents were the syngnathids and the gold-spotted killifish, Floridichthys carpio.« less

  19. Tracing the Divergence of `Cryptic' Forms of the Planktic Foraminifer Globigerinella siphonifera: Possible Links to Pliocene Climate Change

    NASA Astrophysics Data System (ADS)

    Steel, B. A.; Kucera, M.; Darling, K. F.

    2003-04-01

    The origination of new species is contingent on the build up of mutations within isolated sub-populations, and results from interruptions to gene flow caused by tectonic, ecological or climatic barriers. Whilst the advent of new species is traditionally recognised in the fossil record by the appearance of clearly divergent phenotypes, recent studies have demonstrated that "Cryptic" speciation (cladogenesis without obvious concomitant morphological change) is common amongst planktic protists. Equally, they have raised the prospect that high-resolution microscopy can identify subtle but consistently expressed morphological features that may eventually allow the evolution and dispersal of these "Cryptic" types to be traced in the fossil record. We have conducted a pilot study using the planktic foraminifer Globigerinella siphonifera, previously shown to be a complex of several genotypes, two of which can be discriminated on the basis of test pore characteristics. Pore size, shape and density have been quantified using scanning electron microscopy combined with semi-automated image analysis of several hundred specimens from two ODP sites (926A (Ceara Rise) and 846 (Eastern Equatorial Pacific)) and a diaspora of Holocene samples. The fossil dataset does not show the same sharp bimodality seen in modern material, and pore morphology may be affected by abiotic factors such as dissolution. Nevertheless, we have tentatively identified a pore size expansion event at ˜ 3.5 Ma, possibly coincident with the uplift of the Panamanian Isthmus. This date differs considerably from previous estimates based on "molecular clock" analysis of ribosomal RNA, but confirms that such techniques at least return divergence times that are within the scope of palaeontological credibility. Whether reproductive isolation arose directly from tectonic isolation or sympatrically from associated changes to the biological, chemical and physical structure of the oceans is unclear. However, our data imply that "Cryptic" foraminiferal genotypes have been a feature of the oceanic biosphere for millions of years, and that their evolution and appearance are spurred by the same factors affecting traditional species.

  20. Gamma-aminobutyric acid-modulated benzodiazepine binding sites in bacteria

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lummis, S.C.R.; Johnston, G.A.R.; Nicoletti, G.

    1991-01-01

    Benzodiazepine binding sites, which were once considered to exist only in higher vertebrates, are here demonstrated in the bacteria E. coli. The bacterial ({sup 3}H)diazepam binding sites are modulated by GABA; the modulation is dose dependent and is reduced at high concentrations. The most potent competitors of E.Coli ({sup 3}H)diazepam binding are those that are active in displacing ({sup 3}H)benzodiazepines from vertebrate peripheral benzodiazepine binding sites. These vertebrate sites are not modulated by GABA, in contrast to vertebrate neuronal benzodiazepine binding sites. The E.coli benzodiazepine binding sites therefore differ from both classes of vertebrate benzodiazepine binding sites; however the ligandmore » spectrum and GABA-modulatory properties of the E.coli sites are similar to those found in insects. This intermediate type of receptor in lower species suggests a precursor for at least one class of vertebrate benzodiazepine binding sites may have existed.« less

  1. Multiple binding sites for transcriptional repressors can produce regular bursting and enhance noise suppression

    NASA Astrophysics Data System (ADS)

    Lengyel, Iván M.; Morelli, Luis G.

    2017-04-01

    Cells may control fluctuations in protein levels by means of negative autoregulation, where transcription factors bind DNA sites to repress their own production. Theoretical studies have assumed a single binding site for the repressor, while in most species it is found that multiple binding sites are arranged in clusters. We study a stochastic description of negative autoregulation with multiple binding sites for the repressor. We find that increasing the number of binding sites induces regular bursting of gene products. By tuning the threshold for repression, we show that multiple binding sites can also suppress fluctuations. Our results highlight possible roles for the presence of multiple binding sites of negative autoregulators.

  2. Invasion of the lyme disease vector Ixodes scapularis: implications for Borrelia burgdorferi endemicity.

    PubMed

    Hamer, Sarah A; Tsao, Jean I; Walker, Edward D; Hickling, Graham J

    2010-08-01

    Lyme disease risk is increasing in the United States due in part to the spread of blacklegged ticks Ixodes scapularis, the principal vector of the spirochetal pathogen Borrelia burgdorferi. A 5-year study was undertaken to investigate hypothesized coinvasion of I. scapularis and B. burgdorferi in Lower Michigan. We tracked the spatial and temporal dynamics of the tick and spirochete using mammal, bird, and vegetation drag sampling at eight field sites along coastal and inland transects originating in a zone of recent I. scapularis establishment. We document northward invasion of these ticks along Michigan's west coast during the study period; this pattern was most evident in ticks removed from rodents. B. burgdorferi infection prevalences in I. scapularis sampled from vegetation in the invasion zone were 9.3% and 36.6% in nymphs and adults, respectively, with the majority of infection (95.1%) found at the most endemic site. There was no evidence of I. scapularis invasion along the inland transect; however, low-prevalence B. burgdorferi infection was detected in other tick species and in wildlife at inland sites, and at northern coastal sites in years before the arrival of I. scapularis. These infections suggest that cryptic B. burgdorferi transmission by other vector-competent tick species is occurring in the absence of I. scapularis. Other Borrelia spirochetes, including those that group with B. miyamotoi and B. andersonii, were present at a low prevalence within invading ticks and local wildlife. Reports of Lyme disease have increased significantly in the invasion zone in recent years. This rapid blacklegged tick invasion--measurable within 5 years--in combination with cryptic pathogen maintenance suggests a complex ecology of Lyme disease emergence in which wildlife sentinels can provide an early warning of disease emergence.

  3. Aerial ULV control of Aedes aegypti with naled (Dibrom) inside simulated rural village and urban cryptic habitats

    PubMed Central

    Linthicum, Kenneth J.; Aldridge, Robert L.; Breidenbaugh, Mark S.; Latham, Mark D.; Connelly, Peter H.; Rush, Mattie J. E.; Remmers, Jennifer L.; Kerce, Jerry D.; Silcox, Charles A.

    2018-01-01

    We conducted aerial fixed wing ultra low volume (ULV) spray trials with naled to investigate penetration of exposed and simulated cryptic habitat within opened buildings, partially sealed buildings, and outdoor locations targeting sentinel adult Aedes aegypti mosquitoes in north central Florida. Mortality was observed in open and closed buildings and outdoors, even in mosquitoes placed in cryptic habitats. Observations on the impact of building type, mosquito exposure method such as placement in cryptic habitat, and spray nozzle size on mosquito mortality are described and analyzed. PMID:29352307

  4. Reduction of excess sludge in a sequencing batch reactor by lysis-cryptic growth using quick lime for disintegration under low temperature.

    PubMed

    Lv, Xiao-Mei; Song, Ju-Sheng; Li, Ji; Zhai, Kun

    2017-08-01

    In the present study, quick-lime-based thermal-alkaline sludge disintegration (SD) under low temperature was combined with cryptic growth to investigate the excess sludge reduction efficiency in the sequencing batch reactor (SBR). The optimized condition of SD was as follows: T = 80℃, pH = 11, t = 180 min, and the SD rate was about 42.1%. With 65.6% of excess sludge disintegrated and returned to the SBR, the system achieved sludge reduction rate of about 40.1%. The lysis-cryptic growth still obtained satisfactory sludge reduction efficiency despite the comparative low SD rate, which suggested that disintegration rate might not be the decisive factor for cryptic-growth-based sludge reduction. Lysis-cryptic growth did not impact the effluent quality, yet the phosphorus removal performance was enhanced, with effluent total phosphorus concentration decreased by 0.3 mg/L (33%). Crystal compounds of calcium phosphate precipitate were detected in the system by Fourier transform infrared spectroscopy and X-ray diffraction, which indicated the phosphorus removal potential of SD using lime. Moreover, endogenous dehydrogenase activity of activated sludge in the lysis-cryptic system was enhanced, which was beneficial for sludge reduction. SD and cryptic growth in the present study demonstrates an economical and effective approach for sludge reduction.

  5. DNA barcoding applied to ex situ tropical amphibian conservation programme reveals cryptic diversity in captive populations.

    PubMed

    Crawford, Andrew J; Cruz, Catalina; Griffith, Edgardo; Ross, Heidi; Ibáñez, Roberto; Lips, Karen R; Driskell, Amy C; Bermingham, Eldredge; Crump, Paul

    2013-11-01

    Amphibians constitute a diverse yet still incompletely characterized clade of vertebrates, in which new species are still being discovered and described at a high rate. Amphibians are also increasingly endangered, due in part to disease-driven threats of extinctions. As an emergency response, conservationists have begun ex situ assurance colonies for priority species. The abundance of cryptic amphibian diversity, however, may cause problems for ex situ conservation. In this study we used a DNA barcoding approach to survey mitochondrial DNA (mtDNA) variation in captive populations of 10 species of Neotropical amphibians maintained in an ex situ assurance programme at El Valle Amphibian Conservation Center (EVACC) in the Republic of Panama. We combined these mtDNA sequences with genetic data from presumably conspecific wild populations sampled from across Panama, and applied genetic distance-based and character-based analyses to identify cryptic lineages. We found that three of ten species harboured substantial cryptic genetic diversity within EVACC, and an additional three species harboured cryptic diversity among wild populations, but not in captivity. Ex situ conservation efforts focused on amphibians are therefore vulnerable to an incomplete taxonomy leading to misidentification among cryptic species. DNA barcoding may therefore provide a simple, standardized protocol to identify cryptic diversity readily applicable to any amphibian community. © 2012 John Wiley & Sons Ltd.

  6. A novel approach to biocontrol: Release of live insect hosts pre-infected with entomopathogenic nematodes.

    PubMed

    Gumus, Arife; Karagoz, Mehmet; Shapiro-Ilan, David; Hazir, Selcuk

    2015-09-01

    As a new application approach, we tested the efficacy of releasing live insect hosts that were pre-infected with entomopathogenic nematodes against insect pests living in cryptic habitats. We hypothesized that the pre-infected hosts could carry the next generation of emerging nematode infective juveniles to hard-to-reach target sites, and thereby facilitate enhanced control in cryptic habitats. Thus, the infected hosts act as "living insect bombs" against the target pest. We tested this approach using two model insect pests: a chestnut tree pest, the goat moth Cossus cossus (Lepidiptera: Cossidae), and a lawn caterpillar, Spodoptera cilium (Lepidoptera: Noctuidae). One pest is considered hard-to-reach via aqueous spray (C. cossus) and the other is more openly exposed in the environment (S. cilium). C. cossus and S. cilium studies were conducted in chestnut logs and Bermudagrass arenas, respectively. The living bomb approach was compared with standard nematode application in aqueous spray and controls (without nematode application); Steinernema carpocapsae (Rize isolate) was used in all experiments. The percentage larval mortality of C. cossus was 86% in the living insect bomb treatment, whereas, all other treatments and controls exhibited less than 4% mortality. The new approach (living bomb) was equally successful as standard aqueous application for the control of S. cilium larvae. Both methods exhibited more than 90% mortality in the turfgrass arena. Our new approach showed an immense potential to control insect pests living in hard-to-reach cryptic habitats. Copyright © 2015 Elsevier Inc. All rights reserved.

  7. Real-time TIRF observation of vinculin recruitment to stretched α-catenin by AFM.

    PubMed

    Maki, Koichiro; Han, Sung-Woong; Hirano, Yoshinori; Yonemura, Shigenobu; Hakoshima, Toshio; Adachi, Taiji

    2018-01-25

    Adherens junctions (AJs) adaptively change their intensities in response to intercellular tension; therefore, they integrate tension generated by individual cells to drive multicellular dynamics, such as morphogenetic change in embryos. Under intercellular tension, α-catenin, which is a component protein of AJs, acts as a mechano-chemical transducer to recruit vinculin to promote actin remodeling. Although in vivo and in vitro studies have suggested that α-catenin-mediated mechanotransduction is a dynamic molecular process, which involves a conformational change of α-catenin under tension to expose a cryptic vinculin binding site, there are no suitable experimental methods to directly explore the process. Therefore, in this study, we developed a novel system by combining atomic force microscopy (AFM) and total internal reflection fluorescence (TIRF). In this system, α-catenin molecules (residues 276-634; the mechano-sensitive M 1 -M 3 domain), modified on coverslips, were stretched by AFM and their recruitment of Alexa-labeled full-length vinculin molecules, dissolved in solution, were observed simultaneously, in real time, using TIRF. We applied a physiologically possible range of tensions and extensions to α-catenin and directly observed its vinculin recruitment. Our new system could be used in the fields of mechanobiology and biophysics to explore functions of proteins under tension by coupling biomechanical and biochemical information.

  8. Characterization of nicotine binding to the rat brain P/sub 2/ preparation: the identification of multiple binding sites which include specific up-regulatory site(s)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sloan, J.W.

    1984-01-01

    These studies show that nicotine binds to the rat brain P/sub 2/ preparation by saturable and reversible processes. Multiple binding sites were revealed by the configuration of saturation, kinetic and Scatchard plots. A least squares best fit of Scatchard data using nonlinear curve fitting programs confirmed the presence of a very high affinity site, an up-regulatory site, a high affinity site and one or two low affinity sites. Stereospecificity was demonstrated for the up-regulatory site where (+)-nicotine was more effective and for the high affinity site where (-)-nicotine had a higher affinity. Drugs which selectively up-regulate nicotine binding site(s) havemore » been identified. Further, separate very high and high affinity sites were identified for (-)- and (+)-(/sup 3/H)nicotine, based on evidence that the site density for the (-)-isomer is 10 times greater than that for the (+)-isomer at these sites. Enhanced nicotine binding has been shown to be a statistically significant phenomenon which appears to be a consequence of drugs binding to specific site(s) which up-regulate binding at other site(s). Although Scatchard and Hill plots indicate positive cooperatively, up-regulation more adequately describes the function of these site(s). A separate up-regulatory site is suggested by the following: (1) Drugs vary markedly in their ability to up-regulate binding. (2) Both the affinity and the degree of up-regulation can be altered by structural changes in ligands. (3) Drugs with specificity for up-regulation have been identified. (4) Some drugs enhance binding in a dose-related manner. (5) Competition studies employing cold (-)- and (+)-nicotine against (-)- and (+)-(/sup 3/H)nicotine show that the isomers bind to separate sites which up-regulate binding at the (-)- and (+)-nicotine high affinity sites and in this regard (+)-nicotine is more specific and efficacious than (-)-nicotine.« less

  9. Causative Agents of Aspergillosis Including Cryptic Aspergillus Species and A. fumigatus.

    PubMed

    Toyotome, Takahito

    2016-01-01

    Aspergillosis is an important deep mycosis. The causative agents are Aspergillus fumigatus, Aspergillus flavus, Aspergillus niger, and Aspergillus terreus, of which A. fumigatus is the most prevalent. Cryptic Aspergillus spp., which morphologically resemble representative species of each Aspergillus section, also cause aspergillosis. Most of the cryptic species reveal different susceptibility patterns and/or different secondary metabolite profiles, also called exometabolome in this manuscript, from those representative species. On the other hand, azole-resistant A. fumigatus strains in clinical specimens and in the environment have been reported. Therefore, it is imperative to precisely identify the species, including cryptic Aspergillus spp., and evaluate the susceptibility of isolates.In this manuscript, some of the causative cryptic Aspergillus spp. are briefly reviewed. In addition, the exometabolome of Aspergillus section Fumigati is described. Finally, azole resistance of A. fumigatus is also discussed, in reference to several studies from Japan.

  10. Multi-resistant aspergillosis due to cryptic species.

    PubMed

    Howard, Susan Julie

    2014-12-01

    Reports of cryptic species causing aspergillosis in humans are increasing in the literature. Cryptic species are defined as those which are morphologically indistinguishable, although their identifications can be confirmed using molecular or other techniques which continue to become more widely available in the clinical setting. Antifungal resistance has often been noted in these cases, and indeed there does appear to be a higher prevalence of reduced susceptibility in cryptic species. Many of these observations are published as individual case reports or as a small component of larger data sets, making it challenging to review and compare the data fully. This review article seeks to describe the susceptibility trends and key learning outcomes of specific cases of infections caused by cryptic species, including Aspergillus alliaceus, Aspergillus calidoustus, Aspergillus felis, Aspergillus lentulus, Aspergillus tubingensis, Aspergillus viridinutans and Neosartorya pseudofischeri. These reports highlight the clinical need for full accurate identification and susceptibility testing to guide patient care.

  11. Discovery and information-theoretic characterization of transcription factor binding sites that act cooperatively.

    PubMed

    Clifford, Jacob; Adami, Christoph

    2015-09-02

    Transcription factor binding to the surface of DNA regulatory regions is one of the primary causes of regulating gene expression levels. A probabilistic approach to model protein-DNA interactions at the sequence level is through position weight matrices (PWMs) that estimate the joint probability of a DNA binding site sequence by assuming positional independence within the DNA sequence. Here we construct conditional PWMs that depend on the motif signatures in the flanking DNA sequence, by conditioning known binding site loci on the presence or absence of additional binding sites in the flanking sequence of each site's locus. Pooling known sites with similar flanking sequence patterns allows for the estimation of the conditional distribution function over the binding site sequences. We apply our model to the Dorsal transcription factor binding sites active in patterning the Dorsal-Ventral axis of Drosophila development. We find that those binding sites that cooperate with nearby Twist sites on average contain about 0.5 bits of information about the presence of Twist transcription factor binding sites in the flanking sequence. We also find that Dorsal binding site detectors conditioned on flanking sequence information make better predictions about what is a Dorsal site relative to background DNA than detection without information about flanking sequence features.

  12. Prevalence of cryptic species in morphologically uniform taxa - fast speciation and evolutionary radiation in Asian toads.

    PubMed

    Liu, Zuyao; Chen, Guoling; Zhu, Tianqi; Zeng, Zhaochi; Lyu, Zhitong; Wang, Jian; Messenger, Kevin; Greenberg, Anthony J; Guo, Zixiao; Yang, Ziheng; Shi, Suhua; Wang, Yingyong

    2018-06-16

    Diversity and distributions of cryptic species have long been a vexing issue. Identification of species boundaries is made difficult by the lack of obvious morphological differences. Here, we investigate the cryptic diversity and evolutionary history of an underappreciated group of Asian frog species (Megophrys) to explore the pattern and dynamic of amphibian cryptic species. We sequenced four mitochondrial genes and five nuclear genes and delineated species using multiple approaches, combining DNA and mating-call data. A Bayesian species tree was generated to estimate divergence times and to reconstruct ancestral ranges. Macroevolutionary analyses and hybridization tests were conducted to explore the evolutionary dynamics of this cryptic group. Our phylogenies support the current subgenera. We revealed 43 cryptic species, 158% higher than previously thought. The species-delimitation results were further confirmed by mating-call data and morphological divergence. We found that these Asian frogss entered China from the Sunda Shelf 48 Mya, followed by an ancient radiation event during middle Miocene. We confirmed the efficiency of the multispecies coalescent model for delimitation of species with low morphological diversity. Species diversity of Megophrys is severely underappreciated, and species distributions have been misestimated as a result. Copyright © 2018. Published by Elsevier Inc.

  13. Is the detection of aquatic environmental DNA influenced by substrate type?

    PubMed

    Buxton, Andrew S; Groombridge, Jim J; Griffiths, Richard A

    2017-01-01

    The use of environmental DNA (eDNA) to assess the presence-absence of rare, cryptic or invasive species is hindered by a poor understanding of the factors that can remove DNA from the system. In aquatic systems, eDNA can be transported out either horizontally in water flows or vertically by incorporation into the sediment. Equally, eDNA may be broken down by various biotic and abiotic processes if the target organism leaves the system. We use occupancy modelling and a replicated mesocosm experiment to examine how detection probability of eDNA changes once the target species is no longer present. We hypothesise that detection probability falls faster with a sediment which has a large number of DNA binding sites such as topsoil or clay, over lower DNA binding capacity substrates such as sand. Water removed from ponds containing the target species (the great crested newt) initially showed high detection probabilities, but these fell to between 40% and 60% over the first 10 days and to between 10% and 22% by day 15: eDNA remained detectable at very low levels until day 22. Very little difference in detection was observed between the control group (no substrate) and the sand substrate. A small reduction in detection probability was observed between the control and clay substrates, but this was not significant. However, a highly significant reduction in detection probability was observed with a topsoil substrate. This result is likely to have stemmed from increased levels of PCR inhibition, suggesting that incorporation of DNA into the sentiment is of only limited importance. Surveys of aquatic species using eDNA clearly need to take account of substrate type as well as other environmental factors when collecting samples, analysing data and interpreting the results.

  14. Reproductive isolation and patterns of genetic differentiation in a cryptic butterfly species complex

    PubMed Central

    Dincâ, V; Wiklund, C; Lukhtanov, V A; Kodandaramaiah, U; Norén, K; Dapporto, L; Wahlberg, N; Vila, R; Friberg, M

    2013-01-01

    Molecular studies of natural populations are often designed to detect and categorize hidden layers of cryptic diversity, and an emerging pattern suggests that cryptic species are more common and more widely distributed than previously thought. However, these studies are often decoupled from ecological and behavioural studies of species divergence. Thus, the mechanisms by which the cryptic diversity is distributed and maintained across large spatial scales are often unknown. In 1988, it was discovered that the common Eurasian Wood White butterfly consisted of two species (Leptidea sinapis and Leptidea reali), and the pair became an emerging model for the study of speciation and chromosomal evolution. In 2011, the existence of a third cryptic species (Leptidea juvernica) was proposed. This unexpected discovery raises questions about the mechanisms preventing gene flow and about the potential existence of additional species hidden in the complex. Here, we compare patterns of genetic divergence across western Eurasia in an extensive data set of mitochondrial and nuclear DNA sequences with behavioural data on inter- and intraspecific reproductive isolation in courtship experiments. We show that three species exist in accordance with both the phylogenetic and biological species concepts and that additional hidden diversity is unlikely to occur in Europe. The Leptidea species are now the best studied cryptic complex of butterflies in Europe and a promising model system for understanding the formation of cryptic species and the roles of local processes, colonization patterns and heterospecific interactions for ecological and evolutionary divergence. PMID:23909947

  15. Tracing shifts of oceanic fronts using the cryptic diversity of the planktonic foraminifera Globorotalia inflata

    NASA Astrophysics Data System (ADS)

    Morard, Raphaël.; Reinelt, Melanie; Chiessi, Cristiano M.; Groeneveld, Jeroen; Kucera, Michal

    2016-09-01

    The use of planktonic foraminifera in paleoceanographic studies relies on the assumption that morphospecies represent biological species with ecological preferences that are stable through time and space. However, genetic surveys unveiled a considerable level of diversity in most morphospecies of planktonic foraminifera. This diversity is significant for paleoceanographic applications because cryptic species were shown to display distinct ecological preferences that could potentially help refine paleoceanographic proxies. Subtle morphological differences between cryptic species of planktonic foraminifera have been reported, but so far, their applicability within paleoceanographic studies remains largely unexplored. Here we show how information on genetic diversity can be transferred to paleoceanography using Globorotalia inflata as a case study. The two cryptic species of G. inflata are separated by the Brazil-Malvinas Confluence (BMC), a major oceanographic feature in the South Atlantic. Based on this observation, we developed a morphological model of cryptic species detection in core top material. The application of the cryptic species detection model to Holocene samples implies latitudinal oscillations in the position of the confluence that are largely consistent with reconstructions obtained from stable isotope data. We show that the occurrence of cryptic species in G. inflata can be detected in the fossil record and used to trace the migration of the BMC. Since a similar degree of morphological separation as in G. inflata has been reported from other species of planktonic foraminifera, the approach presented in this study can potentially yield a wealth of new paleoceanographical proxies.

  16. Cryptic biodiversity and phylogeographic patterns of Seychellois Ligia isopods

    PubMed Central

    Bluemel, Joanna K.; Bunbury, Nancy; Curran, Melinda

    2017-01-01

    Ligia isopods are conspicuous inhabitants of rocky intertidal habitats exhibiting several biological traits that severely limit their dispersal potential. Their presence in patchy habitats and low vagility may lead to long term isolation, allopatric isolation and possible cryptic speciation. Indeed, various species of Ligia have been suggested to represent instead cryptic species complexes. Past studies; however, have largely focused in Eastern Pacific and Atlantic species of Ligia, leaving in doubt whether cryptic diversity occurs in other highly biodiverse areas. The Seychelles consists of 115 islands of different ages and geological origins spread across the western Indian Ocean. They are well known for their rich biodiversity with recent reports of cryptic species in terrestrial Seychellois organisms. Despite these studies, it is unclear whether coastal invertebrates from the Seychelles harbor any cryptic diversity. In this study, we examined patterns of genetic diversity and isolation within Ligia isopods across the Seychelles archipelago by characterizing individuals from locations across both inner and outer islands of the Seychelles using mitochondrial and nuclear markers. We report the presence of highly divergent lineages of independent origin. At Aldabra Atoll, we uncovered a lineage closely related to the Ligia vitiensis cryptic species complex. Within the inner islands of Cousine, Silhouette, and Mahé we detected the presence of two moderately divergent and geographically disjunct lineages most closely related to Ligia dentipes. Our findings suggest that the Seychelles may harbor at least three novel species of Ligia in need of description and that these species may have originated independently. PMID:29018626

  17. Deconvoluting AMP-activated protein kinase (AMPK) adenine nucleotide binding and sensing

    PubMed Central

    Gu, Xin; Yan, Yan; Novick, Scott J.; Kovach, Amanda; Goswami, Devrishi; Ke, Jiyuan; Tan, M. H. Eileen; Wang, Lili; Li, Xiaodan; de Waal, Parker W.; Webb, Martin R.; Griffin, Patrick R.; Xu, H. Eric

    2017-01-01

    AMP-activated protein kinase (AMPK) is a central cellular energy sensor that adapts metabolism and growth to the energy state of the cell. AMPK senses the ratio of adenine nucleotides (adenylate energy charge) by competitive binding of AMP, ADP, and ATP to three sites (CBS1, CBS3, and CBS4) in its γ-subunit. Because these three binding sites are functionally interconnected, it remains unclear how nucleotides bind to individual sites, which nucleotides occupy each site under physiological conditions, and how binding to one site affects binding to the other sites. Here, we comprehensively analyze nucleotide binding to wild-type and mutant AMPK protein complexes by quantitative competition assays and by hydrogen-deuterium exchange MS. We also demonstrate that NADPH, in addition to the known AMPK ligand NADH, directly and competitively binds AMPK at the AMP-sensing CBS3 site. Our findings reveal how AMP binding to one site affects the conformation and adenine nucleotide binding at the other two sites and establish CBS3, and not CBS1, as the high affinity exchangeable AMP/ADP/ATP-binding site. We further show that AMP binding at CBS4 increases AMP binding at CBS3 by 2 orders of magnitude and reverses the AMP/ATP preference of CBS3. Together, these results illustrate how the three CBS sites collaborate to enable highly sensitive detection of cellular energy states to maintain the tight ATP homeostastis required for cellular metabolism. PMID:28615457

  18. An Electrostatic Funnel in the GABA-Binding Pathway

    PubMed Central

    Lightstone, Felice C.

    2016-01-01

    The γ-aminobutyric acid type A receptor (GABAA-R) is a major inhibitory neuroreceptor that is activated by the binding of GABA. The structure of the GABAA-R is well characterized, and many of the binding site residues have been identified. However, most of these residues are obscured behind the C-loop that acts as a cover to the binding site. Thus, the mechanism by which the GABA molecule recognizes the binding site, and the pathway it takes to enter the binding site are both unclear. Through the completion and detailed analysis of 100 short, unbiased, independent molecular dynamics simulations, we have investigated this phenomenon of GABA entering the binding site. In each system, GABA was placed quasi-randomly near the binding site of a GABAA-R homology model, and atomistic simulations were carried out to observe the behavior of the GABA molecules. GABA fully entered the binding site in 19 of the 100 simulations. The pathway taken by these molecules was consistent and non-random; the GABA molecules approach the binding site from below, before passing up behind the C-loop and into the binding site. This binding pathway is driven by long-range electrostatic interactions, whereby the electrostatic field acts as a ‘funnel’ that sweeps the GABA molecules towards the binding site, at which point more specific atomic interactions take over. These findings define a nuanced mechanism whereby the GABAA-R uses the general zwitterionic features of the GABA molecule to identify a potential ligand some 2 nm away from the binding site. PMID:27119953

  19. Modeling Complex Equilibria in ITC Experiments: Thermodynamic Parameters Estimation for a Three Binding Site Model

    PubMed Central

    Le, Vu H.; Buscaglia, Robert; Chaires, Jonathan B.; Lewis, Edwin A.

    2013-01-01

    Isothermal Titration Calorimetry, ITC, is a powerful technique that can be used to estimate a complete set of thermodynamic parameters (e.g. Keq (or ΔG), ΔH, ΔS, and n) for a ligand binding interaction described by a thermodynamic model. Thermodynamic models are constructed by combination of equilibrium constant, mass balance, and charge balance equations for the system under study. Commercial ITC instruments are supplied with software that includes a number of simple interaction models, for example one binding site, two binding sites, sequential sites, and n-independent binding sites. More complex models for example, three or more binding sites, one site with multiple binding mechanisms, linked equilibria, or equilibria involving macromolecular conformational selection through ligand binding need to be developed on a case by case basis by the ITC user. In this paper we provide an algorithm (and a link to our MATLAB program) for the non-linear regression analysis of a multiple binding site model with up to four overlapping binding equilibria. Error analysis demonstrates that fitting ITC data for multiple parameters (e.g. up to nine parameters in the three binding site model) yields thermodynamic parameters with acceptable accuracy. PMID:23262283

  20. A tool for calculating binding-site residues on proteins from PDB structures.

    PubMed

    Hu, Jing; Yan, Changhui

    2009-08-03

    In the research on protein functional sites, researchers often need to identify binding-site residues on a protein. A commonly used strategy is to find a complex structure from the Protein Data Bank (PDB) that consists of the protein of interest and its interacting partner(s) and calculate binding-site residues based on the complex structure. However, since a protein may participate in multiple interactions, the binding-site residues calculated based on one complex structure usually do not reveal all binding sites on a protein. Thus, this requires researchers to find all PDB complexes that contain the protein of interest and combine the binding-site information gleaned from them. This process is very time-consuming. Especially, combing binding-site information obtained from different PDB structures requires tedious work to align protein sequences. The process becomes overwhelmingly difficult when researchers have a large set of proteins to analyze, which is usually the case in practice. In this study, we have developed a tool for calculating binding-site residues on proteins, TCBRP http://yanbioinformatics.cs.usu.edu:8080/ppbindingsubmit. For an input protein, TCBRP can quickly find all binding-site residues on the protein by automatically combining the information obtained from all PDB structures that consist of the protein of interest. Additionally, TCBRP presents the binding-site residues in different categories according to the interaction type. TCBRP also allows researchers to set the definition of binding-site residues. The developed tool is very useful for the research on protein binding site analysis and prediction.

  1. X-linked Alport syndrome caused by splicing mutations in COL4A5.

    PubMed

    Nozu, Kandai; Vorechovsky, Igor; Kaito, Hiroshi; Fu, Xue Jun; Nakanishi, Koichi; Hashimura, Yuya; Hashimoto, Fusako; Kamei, Koichi; Ito, Shuichi; Kaku, Yoshitsugu; Imasawa, Toshiyuki; Ushijima, Katsumi; Shimizu, Junya; Makita, Yoshio; Konomoto, Takao; Yoshikawa, Norishige; Iijima, Kazumoto

    2014-11-07

    X-linked Alport syndrome is caused by mutations in the COL4A5 gene. Although many COL4A5 mutations have been detected, the mutation detection rate has been unsatisfactory. Some men with X-linked Alport syndrome show a relatively mild phenotype, but molecular basis investigations have rarely been conducted to clarify the underlying mechanism. In total, 152 patients with X-linked Alport syndrome who were suspected of having Alport syndrome through clinical and pathologic investigations and referred to the hospital for mutational analysis between January of 2006 and January of 2013 were genetically diagnosed. Among those patients, 22 patients had suspected splice site mutations. Transcripts are routinely examined when suspected splice site mutations for abnormal transcripts are detected; 11 of them showed expected exon skipping, but others showed aberrant splicing patterns. The mutation detection strategy had two steps: (1) genomic DNA analysis using PCR and direct sequencing and (2) mRNA analysis using RT-PCR to detect RNA processing abnormalities. Six splicing consensus site mutations resulting in aberrant splicing patterns, one exonic mutation leading to exon skipping, and four deep intronic mutations producing cryptic splice site activation were identified. Interestingly, one case produced a cryptic splice site with a single nucleotide substitution in the deep intron that led to intronic exonization containing a stop codon; however, the patient showed a clearly milder phenotype for X-linked Alport syndrome in men with a truncating mutation. mRNA extracted from the kidney showed both normal and abnormal transcripts, with the normal transcript resulting in the milder phenotype. This novel mechanism leads to mild clinical characteristics. This report highlights the importance of analyzing transcripts to enhance the mutation detection rate and provides insight into genotype-phenotype correlations. This approach can clarify the cause of atypically mild phenotypes in X-linked Alport syndrome. Copyright © 2014 by the American Society of Nephrology.

  2. The use of ene adducts to study and engineer enoyl-thioester reductases.

    PubMed

    Rosenthal, Raoul G; Vögeli, Bastian; Quade, Nick; Capitani, Guido; Kiefer, Patrick; Vorholt, Julia A; Ebert, Marc-Olivier; Erb, Tobias J

    2015-06-01

    An improved understanding of enzymes' catalytic proficiency and stereoselectivity would further enable applications in chemistry, biocatalysis and industrial biotechnology. We use a chemical probe to dissect individual catalytic steps of enoyl-thioester reductases (Etrs), validating an active site tyrosine as the cryptic proton donor and explaining how it had eluded definitive identification. This information enabled the rational redesign of Etr, yielding mutants that create products with inverted stereochemistry at wild type-like turnover frequency.

  3. Mutation of the C/EBP binding sites in the Rous sarcoma virus long terminal repeat and gag enhancers.

    PubMed Central

    Ryden, T A; de Mars, M; Beemon, K

    1993-01-01

    Several C/EBP binding sites within the Rous sarcoma virus (RSV) long terminal repeat (LTR) and gag enhancers were mutated, and the effect of these mutations on viral gene expression was assessed. Minimal site-specific mutations in each of three adjacent C/EBP binding sites in the LTR reduced steady-state viral RNA levels. Double mutation of the two 5' proximal LTR binding sites resulted in production of 30% of wild-type levels of virus. DNase I footprinting analysis of mutant DNAs indicated that the mutations blocked C/EBP binding at the affected sites. Additional C/EBP binding sites were identified upstream of the 3' LTR and within the 5' end of the LTRs. Point mutations in the RSV gag intragenic enhancer region, which blocked binding of C/EBP at two of three adjacent C/EBP sites, also reduced virus production significantly. Nuclear extracts prepared from both chicken embryo fibroblasts (CEFs) and chicken muscle contained proteins binding to the same RSV DNA sites as did C/EBP, and mutations that prevented C/EBP binding also blocked binding of these chicken proteins. It appears that CEFs and chicken muscle contain distinct proteins binding to these RSV DNA sites; the CEF binding protein was heat stable, as is C/EBP, while the chicken muscle protein was heat sensitive. Images PMID:8386280

  4. The Binding Sites of miR-619-5p in the mRNAs of Human and Orthologous Genes.

    PubMed

    Atambayeva, Shara; Niyazova, Raigul; Ivashchenko, Anatoliy; Pyrkova, Anna; Pinsky, Ilya; Akimniyazova, Aigul; Labeit, Siegfried

    2017-06-01

    Normally, one miRNA interacts with the mRNA of one gene. However, there are miRNAs that can bind to many mRNAs, and one mRNA can be the target of many miRNAs. This significantly complicates the study of the properties of miRNAs and their diagnostic and medical applications. The search of 2,750 human microRNAs (miRNAs) binding sites in 12,175 mRNAs of human genes using the MirTarget program has been completed. For the binding sites of the miR-619-5p the hybridization free energy of the bonds was equal to 100% of the maximum potential free energy. The mRNAs of 201 human genes have complete complementary binding sites of miR-619-5p in the 3'UTR (214 sites), CDS (3 sites), and 5'UTR (4 sites). The mRNAs of CATAD1, ICA1L, GK5, POLH, and PRR11 genes have six miR-619-5p binding sites, and the mRNAs of OPA3 and CYP20A1 genes have eight and ten binding sites, respectively. All of these miR-619-5p binding sites are located in the 3'UTRs. The miR-619-5p binding site in the 5'UTR of mRNA of human USP29 gene is found in the mRNAs of orthologous genes of primates. Binding sites of miR-619-5p in the coding regions of mRNAs of C8H8orf44, C8orf44, and ISY1 genes encode the WLMPVIP oligopeptide, which is present in the orthologous proteins. Binding sites of miR-619-5p in the mRNAs of transcription factor genes ZNF429 and ZNF429 encode the AHACNP oligopeptide in another reading frame. Binding sites of miR-619-5p in the 3'UTRs of all human target genes are also present in the 3'UTRs of orthologous genes of mammals. The completely complementary binding sites for miR-619-5p are conservative in the orthologous mammalian genes. The majority of miR-619-5p binding sites are located in the 3'UTRs but some genes have miRNA binding sites in the 5'UTRs of mRNAs. Several genes have binding sites for miRNAs in the CDSs that are read in different open reading frames. Identical nucleotide sequences of binding sites encode different amino acids in different proteins. The binding sites of miR-619-5p in 3'UTRs, 5'UTRs and CDSs are conservative in the orthologous mammalian genes.

  5. Developmental regulation of collagenase-3 mRNA in normal, differentiating osteoblasts through the activator protein-1 and the runt domain binding sites

    NASA Technical Reports Server (NTRS)

    Winchester, S. K.; Selvamurugan, N.; D'Alonzo, R. C.; Partridge, N. C.

    2000-01-01

    Collagenase-3 mRNA is initially detectable when osteoblasts cease proliferation, increasing during differentiation and mineralization. We showed that this developmental expression is due to an increase in collagenase-3 gene transcription. Mutation of either the activator protein-1 or the runt domain binding site decreased collagenase-3 promoter activity, demonstrating that these sites are responsible for collagenase-3 gene transcription. The activator protein-1 and runt domain binding sites bind members of the activator protein-1 and core-binding factor family of transcription factors, respectively. We identified core-binding factor a1 binding to the runt domain binding site and JunD in addition to a Fos-related antigen binding to the activator protein-1 site. Overexpression of both c-Fos and c-Jun in osteoblasts or core-binding factor a1 increased collagenase-3 promoter activity. Furthermore, overexpression of c-Fos, c-Jun, and core-binding factor a1 synergistically increased collagenase-3 promoter activity. Mutation of either the activator protein-1 or the runt domain binding site resulted in the inability of c-Fos and c-Jun or core-binding factor a1 to increase collagenase-3 promoter activity, suggesting that there is cooperative interaction between the sites and the proteins. Overexpression of Fra-2 and JunD repressed core-binding factor a1-induced collagenase-3 promoter activity. Our results suggest that members of the activator protein-1 and core-binding factor families, binding to the activator protein-1 and runt domain binding sites are responsible for the developmental regulation of collagenase-3 gene expression in osteoblasts.

  6. New insight into the binding modes of TNP-AMP to human liver fructose-1,6-bisphosphatase

    NASA Astrophysics Data System (ADS)

    Han, Xinya; Huang, Yunyuan; Zhang, Rui; Xiao, San; Zhu, Shuaihuan; Qin, Nian; Hong, Zongqin; Wei, Lin; Feng, Jiangtao; Ren, Yanliang; Feng, Lingling; Wan, Jian

    2016-08-01

    Human liver fructose-1,6-bisphosphatase (FBPase) contains two binding sites, a substrate fructose-1,6-bisphosphate (FBP) active site and an adenosine monophosphate (AMP) allosteric site. The FBP active site works by stabilizing the FBPase, and the allosteric site impairs the activity of FBPase through its binding of a nonsubstrate molecule. The fluorescent AMP analogue, 2‧,3‧-O-(2,4,6-trinitrophenyl)adenosine 5‧-monophosphate (TNP-AMP) has been used as a fluorescent probe as it is able to competitively inhibit AMP binding to the AMP allosteric site and, therefore, could be used for exploring the binding modes of inhibitors targeted on the allosteric site. In this study, we have re-examined the binding modes of TNP-AMP to FBPase. However, our present enzyme kinetic assays show that AMP and FBP both can reduce the fluorescence from the bound TNP-AMP through competition for FBPase, suggesting that TNP-AMP binds not only to the AMP allosteric site but also to the FBP active site. Mutagenesis assays of K274L (located in the FBP active site) show that the residue K274 is very important for TNP-AMP to bind to the active site of FBPase. The results further prove that TNP-AMP is able to bind individually to the both sites. Our present study provides a new insight into the binding mechanism of TNP-AMP to the FBPase. The TNP-AMP fluorescent probe can be used to exam the binding site of an inhibitor (the active site or the allosteric site) using FBPase saturated by AMP and FBP, respectively, or the K247L mutant FBPase.

  7. New insight into the binding modes of TNP-AMP to human liver fructose-1,6-bisphosphatase.

    PubMed

    Han, Xinya; Huang, Yunyuan; Zhang, Rui; Xiao, San; Zhu, Shuaihuan; Qin, Nian; Hong, Zongqin; Wei, Lin; Feng, Jiangtao; Ren, Yanliang; Feng, Lingling; Wan, Jian

    2016-08-05

    Human liver fructose-1,6-bisphosphatase (FBPase) contains two binding sites, a substrate fructose-1,6-bisphosphate (FBP) active site and an adenosine monophosphate (AMP) allosteric site. The FBP active site works by stabilizing the FBPase, and the allosteric site impairs the activity of FBPase through its binding of a nonsubstrate molecule. The fluorescent AMP analogue, 2',3'-O-(2,4,6-trinitrophenyl)adenosine 5'-monophosphate (TNP-AMP) has been used as a fluorescent probe as it is able to competitively inhibit AMP binding to the AMP allosteric site and, therefore, could be used for exploring the binding modes of inhibitors targeted on the allosteric site. In this study, we have re-examined the binding modes of TNP-AMP to FBPase. However, our present enzyme kinetic assays show that AMP and FBP both can reduce the fluorescence from the bound TNP-AMP through competition for FBPase, suggesting that TNP-AMP binds not only to the AMP allosteric site but also to the FBP active site. Mutagenesis assays of K274L (located in the FBP active site) show that the residue K274 is very important for TNP-AMP to bind to the active site of FBPase. The results further prove that TNP-AMP is able to bind individually to the both sites. Our present study provides a new insight into the binding mechanism of TNP-AMP to the FBPase. The TNP-AMP fluorescent probe can be used to exam the binding site of an inhibitor (the active site or the allosteric site) using FBPase saturated by AMP and FBP, respectively, or the K247L mutant FBPase. Copyright © 2016 Elsevier B.V. All rights reserved.

  8. Mechanism of Metal Ion Activation of the Diphtheria Toxin Repressor DtxR

    NASA Astrophysics Data System (ADS)

    D'Aquino, J. Alejandro; Ringe, Dagmar

    2006-08-01

    The diphtheria toxin repressor, DtxR, is a metal ion-activated transcriptional regulator that has been linked to the virulence of Corynebacterium diphtheriae. Structure determination has shown that there are two metal ion binding sites per repressor monomer, and site-directed mutagenesis has demonstrated that binding site 2 (primary) is essential for recognition of the target DNA repressor, leaving the role of binding site 1 (ancillary) unclear (1 - 3). Calorimetric techniques have demonstrated that while binding site 1 (ancillary) has high affinity for metal ion with a binding constant of 2 × 10-7, binding site 2 (primary) is a low affinity binding site with a binding constant of 6.3 × 10-4. These two binding sites act independently and their contribution can be easily dissected by traditional mutational analysis. Our results clearly demonstrate that binding site 1 (ancillary) is the first one to be occupied during metal ion activation, playing a critical role in stabilization of the repressor. In addition, structural data obtained for the mutants Ni-DtxR(H79A,C102D), reported here and the previously reported DtxR(H79A) (4) has allowed us to propose a mechanism of metal ion activation for DtxR.

  9. Allosteric binding sites in Rab11 for potential drug candidates

    PubMed Central

    2018-01-01

    Rab11 is an important protein subfamily in the RabGTPase family. These proteins physiologically function as key regulators of intracellular membrane trafficking processes. Pathologically, Rab11 proteins are implicated in many diseases including cancers, neurodegenerative diseases and type 2 diabetes. Although they are medically important, no previous study has found Rab11 allosteric binding sites where potential drug candidates can bind to. In this study, by employing multiple clustering approaches integrating principal component analysis, independent component analysis and locally linear embedding, we performed structural analyses of Rab11 and identified eight representative structures. Using these representatives to perform binding site mapping and virtual screening, we identified two novel binding sites in Rab11 and small molecules that can preferentially bind to different conformations of these sites with high affinities. After identifying the binding sites and the residue interaction networks in the representatives, we computationally showed that these binding sites may allosterically regulate Rab11, as these sites communicate with switch 2 region that binds to GTP/GDP. These two allosteric binding sites in Rab11 are also similar to two allosteric pockets in Ras that we discovered previously. PMID:29874286

  10. The identification of sympatric cryptic free-living nematode species in the Antarctic intertidal

    PubMed Central

    Canales-Aguirre, Cristian B.; Nuñez, Daniela; Pérez, Karla; Hernández, Crisitan E.; Brante, Antonio

    2017-01-01

    The diversity of free-living nematodes in the beaches of two Antarctic islands, King George and Deception islands was investigated. We used morphological and molecular (LSU, and two fragments of SSU sequences) approaches to evaluate 236 nematodes. Specimens were assigned to at least genera using morphology and were assessed for the presence of cryptic speciation. The following genera were identified: Halomonhystera, Litoditis, Enoploides, Chromadorita, Theristus, Oncholaimus, Viscosia, Gammanema, Bathylaimus, Choanolaimus, and Paracanthonchus; along with specimens from the families Anticomidae and Linhomoeidae. Cryptic speciation was identified within the genera Halomonhystera and Litoditis. All of the cryptic species identified live sympatrically. The two cryptic species of Halomonhystera exhibited no significant morphological differences. However, Litoditis species 2 was significantly larger than Litoditis species 1. The utility of molecular data in confirming the identifications of some of the morphologically more challenging families of nematodes was demonstrated. In terms of which molecular sequences to use for the identification of free-living nematodes, the SSU sequences were more variable than the LSU sequences, and thus provided more resolution in the identification of cryptic speciation. Finally, despite the considerable amount of time and effort required to put together genetic and morphological data, the resulting advance in our understanding of diversity and ecology of free-living marine nematodes, makes that effort worthwhile. PMID:28982192

  11. Laminar and regional distribution of galanin binding sites in cat and monkey visual cortex determined by in vitro receptor autoradiography

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rosier, A.M.; Vandesande, F.; Orban, G.A.

    1991-03-08

    The distribution of galanin (GAL) binding sites in the visual cortex of cat and monkey was determined by autoradiographic visualization of ({sup 125}I)-GAL binding to tissue sections. Binding conditions were optimized and, as a result, the binding was saturable and specific. In cat visual cortex, GAL binding sites were concentrated in layers I, IVc, V, and VI. Areas 17, 18, and 19 exhibited a similar distribution pattern. In monkey primary visual cortex, the highest density of GAL binding sites was observed in layers II/III, lower IVc, and upper V. Layers IVA and VI contained moderate numbers of GAL binding sites,more » while layer I and the remaining parts of layer IV displayed the lowest density. In monkey secondary visual cortex, GAL binding sites were mainly concentrated in layers V-VI. Layer IV exhibited a moderate density, while the supragranular layers contained the lowest proportion of GAL binding sites. In both cat and monkey, we found little difference between regions subserving central and those subserving peripheral vision. Similarities in the distribution of GAL and acetylcholine binding sites are discussed.« less

  12. Analysis of Cryptic, Systemic Botrytis Infections in Symptomless Hosts

    PubMed Central

    Shaw, Michael W.; Emmanuel, Christy J.; Emilda, Deni; Terhem, Razak B.; Shafia, Aminath; Tsamaidi, Dimitra; Emblow, Mark; van Kan, Jan A. L.

    2016-01-01

    Botrytis species are generally considered to be aggressive, necrotrophic plant pathogens. By contrast to this general perception, however, Botrytis species could frequently be isolated from the interior of multiple tissues in apparently healthy hosts of many species. Infection frequencies reached 50% of samples or more, but were commonly less, and cryptic infections were rare or absent in some plant species. Prevalence varied substantially from year to year and from tissue to tissue, but some host species routinely had high prevalence. The same genotype was found to occur throughout a host, representing mycelial spread. Botrytis cinerea and Botrytis pseudocinerea are the species that most commonly occur as cryptic infections, but phylogenetically distant isolates of Botrytis were also detected, one of which does not correspond to previously described species. Sporulation and visible damage occurred only when infected tissues were stressed, or became mature or senescent. There was no evidence of cryptic infection having a deleterious effect on growth of the host, and prevalence was probably greater in plants grown in high light conditions. Isolates from cryptic infections were often capable of causing disease (to varying extents) when spore suspensions were inoculated onto their own host as well as on distinct host species, arguing against co-adaptation between cryptic isolates and their hosts. These data collectively suggest that several Botrytis species, including the most notorious pathogenic species, exist frequently in cryptic form to an extent that has thus far largely been neglected, and do not need to cause disease on healthy hosts in order to complete their life-cycles. PMID:27242829

  13. Identification and characterization of a novel high affinity metal-binding site in the hammerhead ribozyme.

    PubMed Central

    Hansen, M R; Simorre, J P; Hanson, P; Mokler, V; Bellon, L; Beigelman, L; Pardi, A

    1999-01-01

    A novel metal-binding site has been identified in the hammerhead ribozyme by 31P NMR. The metal-binding site is associated with the A13 phosphate in the catalytic core of the hammerhead ribozyme and is distinct from any previously identified metal-binding sites. 31P NMR spectroscopy was used to measure the metal-binding affinity for this site and leads to an apparent dissociation constant of 250-570 microM at 25 degrees C for binding of a single Mg2+ ion. The NMR data also show evidence of a structural change at this site upon metal binding and these results are compared with previous data on metal-induced structural changes in the core of the hammerhead ribozyme. These NMR data were combined with the X-ray structure of the hammerhead ribozyme (Pley HW, Flaherty KM, McKay DB. 1994. Nature 372:68-74) to model RNA ligands involved in binding the metal at this A13 site. In this model, the A13 metal-binding site is structurally similar to the previously identified A(g) metal-binding site and illustrates the symmetrical nature of the tandem G x A base pairs in domain 2 of the hammerhead ribozyme. These results demonstrate that 31P NMR represents an important method for both identification and characterization of metal-binding sites in nucleic acids. PMID:10445883

  14. Identification of the quinolinedione inhibitor binding site in Cdc25 phosphatase B through docking and molecular dynamics simulations.

    PubMed

    Ge, Yushu; van der Kamp, Marc; Malaisree, Maturos; Liu, Dan; Liu, Yi; Mulholland, Adrian J

    2017-11-01

    Cdc25 phosphatase B, a potential target for cancer therapy, is inhibited by a series of quinones. The binding site and mode of quinone inhibitors to Cdc25B remains unclear, whereas this information is important for structure-based drug design. We investigated the potential binding site of NSC663284 [DA3003-1 or 6-chloro-7-(2-morpholin-4-yl-ethylamino)-quinoline-5, 8-dione] through docking and molecular dynamics simulations. Of the two main binding sites suggested by docking, the molecular dynamics simulations only support one site for stable binding of the inhibitor. Binding sites in and near the Cdc25B catalytic site that have been suggested previously do not lead to stable binding in 50 ns molecular dynamics (MD) simulations. In contrast, a shallow pocket between the C-terminal helix and the catalytic site provides a favourable binding site that shows high stability. Two similar binding modes featuring protein-inhibitor interactions involving Tyr428, Arg482, Thr547 and Ser549 are identified by clustering analysis of all stable MD trajectories. The relatively flexible C-terminal region of Cdc25B contributes to inhibitor binding. The binding mode of NSC663284, identified through MD simulation, likely prevents the binding of protein substrates to Cdc25B. The present results provide useful information for the design of quinone inhibitors and their mechanism of inhibition.

  15. Identification of the quinolinedione inhibitor binding site in Cdc25 phosphatase B through docking and molecular dynamics simulations

    NASA Astrophysics Data System (ADS)

    Ge, Yushu; van der Kamp, Marc; Malaisree, Maturos; Liu, Dan; Liu, Yi; Mulholland, Adrian J.

    2017-11-01

    Cdc25 phosphatase B, a potential target for cancer therapy, is inhibited by a series of quinones. The binding site and mode of quinone inhibitors to Cdc25B remains unclear, whereas this information is important for structure-based drug design. We investigated the potential binding site of NSC663284 [DA3003-1 or 6-chloro-7-(2-morpholin-4-yl-ethylamino)-quinoline-5, 8-dione] through docking and molecular dynamics simulations. Of the two main binding sites suggested by docking, the molecular dynamics simulations only support one site for stable binding of the inhibitor. Binding sites in and near the Cdc25B catalytic site that have been suggested previously do not lead to stable binding in 50 ns molecular dynamics (MD) simulations. In contrast, a shallow pocket between the C-terminal helix and the catalytic site provides a favourable binding site that shows high stability. Two similar binding modes featuring protein-inhibitor interactions involving Tyr428, Arg482, Thr547 and Ser549 are identified by clustering analysis of all stable MD trajectories. The relatively flexible C-terminal region of Cdc25B contributes to inhibitor binding. The binding mode of NSC663284, identified through MD simulation, likely prevents the binding of protein substrates to Cdc25B. The present results provide useful information for the design of quinone inhibitors and their mechanism of inhibition.

  16. ATP and AMP Mutually Influence Their Interaction with the ATP-binding Cassette (ABC) Adenylate Kinase Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) at Separate Binding Sites*

    PubMed Central

    Randak, Christoph O.; Dong, Qian; Ver Heul, Amanda R.; Elcock, Adrian H.; Welsh, Michael J.

    2013-01-01

    Cystic fibrosis transmembrane conductance regulator (CFTR) is an anion channel in the ATP-binding cassette (ABC) transporter protein family. In the presence of ATP and physiologically relevant concentrations of AMP, CFTR exhibits adenylate kinase activity (ATP + AMP ⇆ 2 ADP). Previous studies suggested that the interaction of nucleotide triphosphate with CFTR at ATP-binding site 2 is required for this activity. Two other ABC proteins, Rad50 and a structural maintenance of chromosome protein, also have adenylate kinase activity. All three ABC adenylate kinases bind and hydrolyze ATP in the absence of other nucleotides. However, little is known about how an ABC adenylate kinase interacts with ATP and AMP when both are present. Based on data from non-ABC adenylate kinases, we hypothesized that ATP and AMP mutually influence their interaction with CFTR at separate binding sites. We further hypothesized that only one of the two CFTR ATP-binding sites is involved in the adenylate kinase reaction. We found that 8-azidoadenosine 5′-triphosphate (8-N3-ATP) and 8-azidoadenosine 5′-monophosphate (8-N3-AMP) photolabeled separate sites in CFTR. Labeling of the AMP-binding site with 8-N3-AMP required the presence of ATP. Conversely, AMP enhanced photolabeling with 8-N3-ATP at ATP-binding site 2. The adenylate kinase active center probe P1,P5-di(adenosine-5′) pentaphosphate interacted simultaneously with an AMP-binding site and ATP-binding site 2. These results show that ATP and AMP interact with separate binding sites but mutually influence their interaction with the ABC adenylate kinase CFTR. They further indicate that the active center of the adenylate kinase comprises ATP-binding site 2. PMID:23921386

  17. Candida glabrata species complex prevalence and antifungal susceptibility testing in a culture collection: First description of Candida nivariensis in Argentina.

    PubMed

    Morales-López, Soraya Eugenia; Taverna, Constanza G; Bosco-Borgeat, María Eugenia; Maldonado, Ivana; Vivot, Walter; Szusz, Wanda; Garcia-Effron, Guillermo; Córdoba, Susana B

    2016-12-01

    The presence of the cryptic species belonging to the Candida glabrata complex has not been studied in Argentina. We analyzed a collection of 117 clinical isolates of C. glabrata complex belonging to a National Culture Collection of Instituto Nacional de Microbiología "Dr. Carlos G. Malbrán" from Argentina (40 isolates from blood samples, 18 from other normally sterile sites, 20 from vagina, 14 from urine, 7 from oral cavity, 3 from catheter, 1 from a stool sample and 14 isolates whose clinical origin was not recorded). The aims of this work were to determine the prevalence of the cryptic species Candida nivariensis and Candida bracarensis and to evaluate the susceptibility profile of isolates against nine antifungal drugs. Identification was carried out by using classical phenotypic tests, CHROMagar™ Candida, PCR and MALDI-TOF. The minimal inhibitory concentrations of amphotericin B, 5-fluorocytosine, fluconazole, itraconazole, voriconazole, ketoconazole, posaconazole, caspofungin and anidulafungin were determined according to the EDef 7.3 (EUCAST) reference document. Of the 117 isolates, 114 were identified as C. glabrata and three as C. nivariensis by using PCR and MALDI-TOF. There were no major differences between C. nivariensis and C. glabrata susceptibility profiles. No resistant strains were found to echinocandins. We have found that the percentage of C. nivariensis in our culture collection was 2.56. This is the first description of C. nivariensis in Argentina, and data obtained could contribute to the knowledge of the epidemiology of this cryptic species.

  18. Cryptic mosaicism involving a second chromosome X in patients with Turner syndrome.

    PubMed

    Araújo, A; Ramos, E S

    2008-05-01

    The high abortion rate of 45,X embryos indicates that patients with Turner syndrome and 45,X karyotype could be mosaics, in at least one phase of embryo development or cellular lineage, due to the need for the other sex chromosome presence for conceptus to be compatible with life. In cases of structural chromosomal aberrations or hidden mosaicism, conventional cytogenetic techniques can be ineffective and molecular investigation is indicated. Two hundred and fifty patients with Turner syndrome stigmata were studied and 36 who had female genitalia and had been cytogenetically diagnosed as having "pure" 45,X karyotype were selected after 100 metaphases were analyzed in order to exclude mosaicism and the presence of genomic Y-specific sequences (SRY, TSPY, and DAZ) was excluded by PCR. Genomic DNA was extracted from peripheral blood and screened by the human androgen receptor (HUMARA) assay. The HUMARA gene has a polymorphic CAG repeat and, in the presence of a second chromosome with a different HUMARA allele, a second band will be amplified by PCR. Additionally, the CAG repeats contain two methylation-sensitive HpaII enzyme restriction sites, which can be used to verify skewed inactivation. Twenty-five percent (9/36) of the cases showed a cryptic mosaicism involving a second X and approximately 14% (5/36), or 55% (5/9) of the patients with cryptic mosaicism, also presented skewed inactivation. The laboratory identification of the second X chromosome and its inactivation pattern are important for the clinical management (hormone replacement therapy, and inclusion in an oocyte donation program) and prognostic counseling of patients with Turner syndrome.

  19. Chromatin-Specific Regulation of Mammalian rDNA Transcription by Clustered TTF-I Binding Sites

    PubMed Central

    Diermeier, Sarah D.; Németh, Attila; Rehli, Michael; Grummt, Ingrid; Längst, Gernot

    2013-01-01

    Enhancers and promoters often contain multiple binding sites for the same transcription factor, suggesting that homotypic clustering of binding sites may serve a role in transcription regulation. Here we show that clustering of binding sites for the transcription termination factor TTF-I downstream of the pre-rRNA coding region specifies transcription termination, increases the efficiency of transcription initiation and affects the three-dimensional structure of rRNA genes. On chromatin templates, but not on free rDNA, clustered binding sites promote cooperative binding of TTF-I, loading TTF-I to the downstream terminators before it binds to the rDNA promoter. Interaction of TTF-I with target sites upstream and downstream of the rDNA transcription unit connects these distal DNA elements by forming a chromatin loop between the rDNA promoter and the terminators. The results imply that clustered binding sites increase the binding affinity of transcription factors in chromatin, thus influencing the timing and strength of DNA-dependent processes. PMID:24068958

  20. Metabolism of Cryptic Peptides Derived from Neuropeptide FF Precursors: The Involvement of Insulin-Degrading Enzyme

    PubMed Central

    Grasso, Giuseppe; Mielczarek, Przemyslaw; Niedziolka, Magdalena; Silberring, Jerzy

    2014-01-01

    The term “cryptome” refers to the subset of cryptic peptides with bioactivities that are often unpredictable and very different from the parent protein. These cryptic peptides are generated by proteolytic cleavage of proteases, whose identification in vivo can be very challenging. In this work, we show that insulin-degrading enzyme (IDE) is able to degrade specific amino acid sequences present in the neuropeptide pro-NPFFA (NPFF precursor), generating some cryptic peptides that are also observed after incubation with rat brain cortex homogenate. The reported experimental findings support the increasingly accredited hypothesis, according to which, due to its wide substrate selectivity, IDE is involved in a wide variety of physiopathological processes. PMID:25247577

  1. Vsx2 Controls Eye Organogenesis and Retinal Progenitor Identity Via Homeodomain and Non-Homeodomain Residues Required for High Affinity DNA Binding

    PubMed Central

    Zou, Changjiang; Levine, Edward M.

    2012-01-01

    The homeodomain and adjacent CVC domain in the visual system homeobox (VSX) proteins are conserved from nematodes to humans. Humans with missense mutations in these regions of VSX2 have microphthalmia, suggesting both regions are critical for function. To assess this, we generated the corresponding mutations in mouse Vsx2. The homeodomain mutant protein lacked DNA binding activity and the knock-in mutant phenocopied the null mutant, ocular retardation J. The CVC mutant protein exhibited weakened DNA binding; and, although the corresponding knock-in allele was recessive, it unexpectedly caused the strongest phenotype, as indicated by severe microphthalmia and hyperpigmentation of the neural retina. This occurred through a cryptic transcriptional feedback loop involving the transcription factors Mitf and Otx1 and the Cdk inhibitor p27Kip1. Our data suggest that the phenotypic severity of the CVC mutant depends on the weakened DNA binding activity elicited by the CVC mutation and a previously unknown protein interaction between Vsx2 and its regulatory target Mitf. Our data also suggest that an essential function of the CVC domain is to assist the homeodomain in high-affinity DNA binding, which is required for eye organogenesis and unhindered execution of the retinal progenitor program in mammals. Finally, the genetic and phenotypic behaviors of the CVC mutation suggest it has the characteristics of a recessive neomorph, a rare type of genetic allele. PMID:23028343

  2. A ternary metal binding site in the C2 domain of phosphoinositide-specific phospholipase C-delta1.

    PubMed

    Essen, L O; Perisic, O; Lynch, D E; Katan, M; Williams, R L

    1997-03-11

    We have determined the crystal structures of complexes of phosphoinositide-specific phospholipase C-delta1 from rat with calcium, barium, and lanthanum at 2.5-2.6 A resolution. Binding of these metal ions is observed in the active site of the catalytic TIM barrel and in the calcium binding region (CBR) of the C2 domain. The C2 domain of PLC-delta1 is a circularly permuted topological variant (P-variant) of the synaptotagmin I C2A domain (S-variant). On the basis of sequence analysis, we propose that both the S-variant and P-variant topologies are present among other C2 domains. Multiple adjacent binding sites in the C2 domain were observed for calcium and the other metal/enzyme complexes. The maximum number of binding sites observed was for the calcium analogue lanthanum. This complex shows an array-like binding of three lanthanum ions (sites I-III) in a crevice on one end of the C2 beta-sandwich. Residues involved in metal binding are contained in three loops, CBR1, CBR2, and CBR3. Sites I and II are maintained in the calcium and barium complexes, whereas sites II and III coincide with a binary calcium binding site in the C2A domain of synaptotagmin I. Several conformers for CBR1 are observed. The conformation of CBR1 does not appear to be strictly dependent on metal binding; however, metal binding may stabilize certain conformers. No significant structural changes are observed for CBR2 or CBR3. The surface of this ternary binding site provides a cluster of freely accessible liganding positions for putative phospholipid ligands of the C2 domain. It may be that the ternary metal binding site is also a feature of calcium-dependent phospholipid binding in solution. A ternary metal binding site might be a conserved feature among C2 domains that contain the critical calcium ligands in their CBR's. The high cooperativity of calcium-mediated lipid binding by C2 domains described previously is explained by this novel type of calcium binding site.

  3. The fission yeast CENP-B protein Abp1 prevents pervasive transcription of repetitive DNA elements.

    PubMed

    Daulny, Anne; Mejía-Ramírez, Eva; Reina, Oscar; Rosado-Lugo, Jesus; Aguilar-Arnal, Lorena; Auer, Herbert; Zaratiegui, Mikel; Azorin, Fernando

    2016-10-01

    It is well established that eukaryotic genomes are pervasively transcribed producing cryptic unstable transcripts (CUTs). However, the mechanisms regulating pervasive transcription are not well understood. Here, we report that the fission yeast CENP-B homolog Abp1 plays an important role in preventing pervasive transcription. We show that loss of abp1 results in the accumulation of CUTs, which are targeted for degradation by the exosome pathway. These CUTs originate from different types of genomic features, but the highest increase corresponds to Tf2 retrotransposons and rDNA repeats, where they map along the entire elements. In the absence of abp1, increased RNAPII-Ser5P occupancy is observed throughout the Tf2 coding region and, unexpectedly, RNAPII-Ser5P is enriched at rDNA repeats. Loss of abp1 also results in Tf2 derepression and increased nucleolus size. Altogether these results suggest that Abp1 prevents pervasive RNAPII transcription of repetitive DNA elements (i.e., Tf2 and rDNA repeats) from internal cryptic sites. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. A novel mutation of the NDUFS7 gene leads to activation of a cryptic exon and impaired assembly of mitochondrial complex I in a patient with Leigh syndrome.

    PubMed

    Lebon, Sophie; Minai, Limor; Chretien, Dominique; Corcos, Johanna; Serre, Valérie; Kadhom, Noman; Steffann, Julie; Pauchard, Jean-Yves; Munnich, Arnold; Bonnefont, Jean-Paul; Rötig, Agnès

    2007-01-01

    Complex I deficiency is a frequent cause of mitochondrial disease as it accounts for one third of these disorders. By genotyping several putative disease loci using microsatellite markers we were able to describe a new NDUFS7 mutation in a consanguineous family with Leigh syndrome and isolated complex I deficiency. This mutation lies in the first intron of the NDUFS7 gene (c.17-1167 C>G) and creates a strong donor splice site resulting in the generation of a cryptic exon. This mutation is predicted to result in a shortened mutant protein of 41 instead of 213 amino acids containing only the first five amino acids of the normal protein. Analysis of the assembly state of the respiratory chain complexes under native condition revealed a marked decrease of fully assembled complex I while the quantity of the other complexes was not altered. These results report the first intronic NDUFS7 gene mutation and demonstrate the crucial role of NDUFS7 in the biogenesis of complex I.

  5. Molecular investigation of active binding site of isoniazid (INH) and insight into resistance mechanism of S315T-MtKatG in Mycobacterium tuberculosis.

    PubMed

    Srivastava, Gaurava; Tripathi, Shubhandra; Kumar, Akhil; Sharma, Ashok

    2017-07-01

    Multi drug resistant tuberculosis is a major threat for mankind. Resistance against Isoniazid (INH), targeting MtKatG protein, is one of the most commonly occurring resistances in MDR TB strains. S315T-MtKatG mutation is widely reported for INH resistance. Despite having knowledge about the mechanism of INH, exact binding site of INH to MtKatG is still uncertain and proposed to have three presumable binding sites (site-1, site-2, and site-3). In the current study docking, molecular dynamics simulation, binding free energy estimation, principal component analysis and free energy landscape analysis were performed to get molecular level details of INH binding site on MtKatG, and to probe the effect of S315T mutation on INH binding. Molecular docking and MD analysis suggested site-1 as active binding site of INH, where the effects of S315T mutation were observed on both access tunnel as well as molecular interaction between INH and its neighboring residues. MMPBSA also supported site-1 as potential binding site with lowest binding energy of -44.201 kJ/mol. Moreover, PCA and FEL revealed that S315T mutation not only reduces the dimension of heme access tunnel but also showed that extra methyl group at 315 position altered heme cavity, enforcing heme group distantly from INH, and thus preventing INH activation. The present study not only investigated the active binding site of INH but also provides a new insight about the conformational changes in the binding site of S315T-MtKatG. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. Mechanism of Metal Ion Activation of the Diphtheria Toxin Repressor DtxR

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    D'Aquino,J.; Tetenbaum-Novatt, J.; White, A.

    2005-01-01

    The diphtheria toxin repressor (DtxR) is a metal ion-activated transcriptional regulator that has been linked to the virulence of Corynebacterium diphtheriae. Structure determination has shown that there are two metal ion binding sites per repressor monomer, and site-directed mutagenesis has demonstrated that binding site 2 (primary) is essential for recognition of the target DNA repressor, leaving the role of binding site 1 (ancillary) unclear. Calorimetric techniques have demonstrated that although binding site 1 (ancillary) has high affinity for metal ion with a binding constant of 2 x 10{sup -7}, binding site 2 (primary) is a low-affinity binding site with amore » binding constant of 6.3 x 10{sup -4}. These two binding sites act in an independent fashion, and their contribution can be easily dissected by traditional mutational analysis. Our results clearly demonstrate that binding site 1 (ancillary) is the first one to be occupied during metal ion activation, playing a critical role in stabilization of the repressor. In addition, structural data obtained for the mutants Ni-DtxR(H79A, C102D), reported here, and the previously reported DtxR(H79A) have allowed us to propose a mechanism of metal activation for DtxR.« less

  7. Identification of a Second Substrate-binding Site in Solute-Sodium Symporters*

    PubMed Central

    Li, Zheng; Lee, Ashley S. E.; Bracher, Susanne; Jung, Heinrich; Paz, Aviv; Kumar, Jay P.; Abramson, Jeff; Quick, Matthias; Shi, Lei

    2015-01-01

    The structure of the sodium/galactose transporter (vSGLT), a solute-sodium symporter (SSS) from Vibrio parahaemolyticus, shares a common structural fold with LeuT of the neurotransmitter-sodium symporter family. Structural alignments between LeuT and vSGLT reveal that the crystallographically identified galactose-binding site in vSGLT is located in a more extracellular location relative to the central substrate-binding site (S1) in LeuT. Our computational analyses suggest the existence of an additional galactose-binding site in vSGLT that aligns to the S1 site of LeuT. Radiolabeled galactose saturation binding experiments indicate that, like LeuT, vSGLT can simultaneously bind two substrate molecules under equilibrium conditions. Mutating key residues in the individual substrate-binding sites reduced the molar substrate-to-protein binding stoichiometry to ∼1. In addition, the related and more experimentally tractable SSS member PutP (the Na+/proline transporter) also exhibits a binding stoichiometry of 2. Targeting residues in the proposed sites with mutations results in the reduction of the binding stoichiometry and is accompanied by severely impaired translocation of proline. Our data suggest that substrate transport by SSS members requires both substrate-binding sites, thereby implying that SSSs and neurotransmitter-sodium symporters share common mechanistic elements in substrate transport. PMID:25398883

  8. Microfluidic affinity and ChIP-seq analyses converge on a conserved FOXP2-binding motif in chimp and human, which enables the detection of evolutionarily novel targets.

    PubMed

    Nelson, Christopher S; Fuller, Chris K; Fordyce, Polly M; Greninger, Alexander L; Li, Hao; DeRisi, Joseph L

    2013-07-01

    The transcription factor forkhead box P2 (FOXP2) is believed to be important in the evolution of human speech. A mutation in its DNA-binding domain causes severe speech impairment. Humans have acquired two coding changes relative to the conserved mammalian sequence. Despite intense interest in FOXP2, it has remained an open question whether the human protein's DNA-binding specificity and chromatin localization are conserved. Previous in vitro and ChIP-chip studies have provided conflicting consensus sequences for the FOXP2-binding site. Using MITOMI 2.0 microfluidic affinity assays, we describe the binding site of FOXP2 and its affinity profile in base-specific detail for all substitutions of the strongest binding site. We find that human and chimp FOXP2 have similar binding sites that are distinct from previously suggested consensus binding sites. Additionally, through analysis of FOXP2 ChIP-seq data from cultured neurons, we find strong overrepresentation of a motif that matches our in vitro results and identifies a set of genes with FOXP2 binding sites. The FOXP2-binding sites tend to be conserved, yet we identified 38 instances of evolutionarily novel sites in humans. Combined, these data present a comprehensive portrait of FOXP2's-binding properties and imply that although its sequence specificity has been conserved, some of its genomic binding sites are newly evolved.

  9. Microfluidic affinity and ChIP-seq analyses converge on a conserved FOXP2-binding motif in chimp and human, which enables the detection of evolutionarily novel targets

    PubMed Central

    Nelson, Christopher S.; Fuller, Chris K.; Fordyce, Polly M.; Greninger, Alexander L.; Li, Hao; DeRisi, Joseph L.

    2013-01-01

    The transcription factor forkhead box P2 (FOXP2) is believed to be important in the evolution of human speech. A mutation in its DNA-binding domain causes severe speech impairment. Humans have acquired two coding changes relative to the conserved mammalian sequence. Despite intense interest in FOXP2, it has remained an open question whether the human protein’s DNA-binding specificity and chromatin localization are conserved. Previous in vitro and ChIP-chip studies have provided conflicting consensus sequences for the FOXP2-binding site. Using MITOMI 2.0 microfluidic affinity assays, we describe the binding site of FOXP2 and its affinity profile in base-specific detail for all substitutions of the strongest binding site. We find that human and chimp FOXP2 have similar binding sites that are distinct from previously suggested consensus binding sites. Additionally, through analysis of FOXP2 ChIP-seq data from cultured neurons, we find strong overrepresentation of a motif that matches our in vitro results and identifies a set of genes with FOXP2 binding sites. The FOXP2-binding sites tend to be conserved, yet we identified 38 instances of evolutionarily novel sites in humans. Combined, these data present a comprehensive portrait of FOXP2’s-binding properties and imply that although its sequence specificity has been conserved, some of its genomic binding sites are newly evolved. PMID:23625967

  10. Evolution of Metal(Loid) Binding Sites in Transcriptional Regulators

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ordonez, E.; Thiyagarajan, S.; Cook, J.D.

    2009-05-22

    Expression of the genes for resistance to heavy metals and metalloids is transcriptionally regulated by the toxic ions themselves. Members of the ArsR/SmtB family of small metalloregulatory proteins respond to transition metals, heavy metals, and metalloids, including As(III), Sb(III), Cd(II), Pb(II), Zn(II), Co(II), and Ni(II). These homodimeric repressors bind to DNA in the absence of inducing metal(loid) ion and dissociate from the DNA when inducer is bound. The regulatory sites are often three- or four-coordinate metal binding sites composed of cysteine thiolates. Surprisingly, in two different As(III)-responsive regulators, the metalloid binding sites were in different locations in the repressor, andmore » the Cd(II) binding sites were in two different locations in two Cd(II)-responsive regulators. We hypothesize that ArsR/SmtB repressors have a common backbone structure, that of a winged helix DNA-binding protein, but have considerable plasticity in the location of inducer binding sites. Here we show that an As(III)-responsive member of the family, CgArsR1 from Corynebacterium glutamicum, binds As(III) to a cysteine triad composed of Cys{sup 15}, Cys{sup 16}, and Cys{sup 55}. This binding site is clearly unrelated to the binding sites of other characterized ArsR/SmtB family members. This is consistent with our hypothesis that metal(loid) binding sites in DNA binding proteins evolve convergently in response to persistent environmental pressures.« less

  11. Combining fragment homology modeling with molecular dynamics aims at prediction of Ca2+ binding sites in CaBPs

    NASA Astrophysics Data System (ADS)

    Pang, ChunLi; Cao, TianGuang; Li, JunWei; Jia, MengWen; Zhang, SuHua; Ren, ShuXi; An, HaiLong; Zhan, Yong

    2013-08-01

    The family of calcium-binding proteins (CaBPs) consists of dozens of members and contributes to all aspects of the cell's function, from homeostasis to learning and memory. However, the Ca2+-binding mechanism is still unclear for most of CaBPs. To identify the Ca2+-binding sites of CaBPs, this study presented a computational approach which combined the fragment homology modeling with molecular dynamics simulation. For validation, we performed a two-step strategy as follows: first, the approach is used to identify the Ca2+-binding sites of CaBPs, which have the EF-hand Ca2+-binding site and the detailed binding mechanism. To accomplish this, eighteen crystal structures of CaBPs with 49 Ca2+-binding sites are selected to be analyzed including calmodulin. The computational method identified 43 from 49 Ca2+-binding sites. Second, we performed the approach to large-conductance Ca2+-activated K+ (BK) channels which don't have clear Ca2+-binding mechanism. The simulated results are consistent with the experimental data. The computational approach may shed some light on the identification of Ca2+-binding sites in CaBPs.

  12. Autoradiographic evidence for two classes of mu opioid binding sites in rat brain using (/sup 125/I)FK33824

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rothman, R.B.; Jacobson, A.E.; Rice, K.C.

    1987-11-01

    Previous studies demonstrated that pretreatment of brain membranes with the irreversible mu antagonist, beta-funaltrexamine (beta-FNA), partially eliminated mu binding sites (25,35), consistent with the existence of two mu binding sites distinguished by beta-FNA. This paper tests the hypothesis that the FNA-sensitive and FNA-insensitive mu binding sites have different anatomical distributions in rat brain. Prior to autoradiographic visualization of mu binding sites, (/sup 3/H)oxymorphone, (/sup 3/H)D-ala2-MePhe4, Gly-ol5-enkephalin (DAGO), and (/sup 125/I)D-ala2-Me-Phe4-met(o)-ol)enkephalin (FK33824) were shown to selectively label mu binding sites using slide mounted sections of molded minced rat brain. As found using membranes, beta-FNA eliminated only a portion of mu bindingmore » sites. Autoradiographic visualization of mu binding sites using the mu-selective ligand (/sup 125/I)FK33824 in control and FNA-treated sections of rat brain demonstrated that the proportion of mu binding sites sensitive to beta-FNA varied across regions of the brain, particularly the dorsal thalamus, ventrobasal complex and the hypothalamus, providing anatomical data supporting the existence of two classes of mu binding sites in rat brain.« less

  13. Widespread evidence of cooperative DNA binding by transcription factors in Drosophila development

    PubMed Central

    Kazemian, Majid; Pham, Hannah; Wolfe, Scot A.; Brodsky, Michael H.; Sinha, Saurabh

    2013-01-01

    Regulation of eukaryotic gene transcription is often combinatorial in nature, with multiple transcription factors (TFs) regulating common target genes, often through direct or indirect mutual interactions. Many individual examples of cooperative binding by directly interacting TFs have been identified, but it remains unclear how pervasive this mechanism is during animal development. Cooperative TF binding should be manifest in genomic sequences as biased arrangements of TF-binding sites. Here, we explore the extent and diversity of such arrangements related to gene regulation during Drosophila embryogenesis. We used the DNA-binding specificities of 322 TFs along with chromatin accessibility information to identify enriched spacing and orientation patterns of TF-binding site pairs. We developed a new statistical approach for this task, specifically designed to accurately assess inter-site spacing biases while accounting for the phenomenon of homotypic site clustering commonly observed in developmental regulatory regions. We observed a large number of short-range distance preferences between TF-binding site pairs, including examples where the preference depends on the relative orientation of the binding sites. To test whether these binding site patterns reflect physical interactions between the corresponding TFs, we analyzed 27 TF pairs whose binding sites exhibited short distance preferences. In vitro protein–protein binding experiments revealed that >65% of these TF pairs can directly interact with each other. For five pairs, we further demonstrate that they bind cooperatively to DNA if both sites are present with the preferred spacing. This study demonstrates how DNA-binding motifs can be used to produce a comprehensive map of sequence signatures for different mechanisms of combinatorial TF action. PMID:23847101

  14. Widespread evidence of cooperative DNA binding by transcription factors in Drosophila development.

    PubMed

    Kazemian, Majid; Pham, Hannah; Wolfe, Scot A; Brodsky, Michael H; Sinha, Saurabh

    2013-09-01

    Regulation of eukaryotic gene transcription is often combinatorial in nature, with multiple transcription factors (TFs) regulating common target genes, often through direct or indirect mutual interactions. Many individual examples of cooperative binding by directly interacting TFs have been identified, but it remains unclear how pervasive this mechanism is during animal development. Cooperative TF binding should be manifest in genomic sequences as biased arrangements of TF-binding sites. Here, we explore the extent and diversity of such arrangements related to gene regulation during Drosophila embryogenesis. We used the DNA-binding specificities of 322 TFs along with chromatin accessibility information to identify enriched spacing and orientation patterns of TF-binding site pairs. We developed a new statistical approach for this task, specifically designed to accurately assess inter-site spacing biases while accounting for the phenomenon of homotypic site clustering commonly observed in developmental regulatory regions. We observed a large number of short-range distance preferences between TF-binding site pairs, including examples where the preference depends on the relative orientation of the binding sites. To test whether these binding site patterns reflect physical interactions between the corresponding TFs, we analyzed 27 TF pairs whose binding sites exhibited short distance preferences. In vitro protein-protein binding experiments revealed that >65% of these TF pairs can directly interact with each other. For five pairs, we further demonstrate that they bind cooperatively to DNA if both sites are present with the preferred spacing. This study demonstrates how DNA-binding motifs can be used to produce a comprehensive map of sequence signatures for different mechanisms of combinatorial TF action.

  15. Cooperative activation of cardiac transcription through myocardin bridging of paired MEF2 sites

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Anderson, Courtney M.; Hu, Jianxin; Thomas, Reuben

    2017-03-28

    Enhancers frequently contain multiple binding sites for the same transcription factor. These homotypic binding sites often exhibit synergy, whereby the transcriptional output from two or more binding sites is greater than the sum of the contributions of the individual binding sites alone. Although this phenomenon is frequently observed, the mechanistic basis for homotypic binding site synergy is poorly understood. Here in this paper, we identify a bona fide cardiac-specific Prkaa2 enhancer that is synergistically activated by homotypic MEF2 binding sites. We show that two MEF2 sites in the enhancer function cooperatively due to bridging of the MEF2C-bound sites by themore » SAP domain-containing co-activator protein myocardin, and we show that paired sites buffer the enhancer from integration site-dependent effects on transcription in vivo. Paired MEF2 sites are prevalent in cardiac enhancers, suggesting that this might be a common mechanism underlying synergy in the control of cardiac gene expression in vivo.« less

  16. Risk of Gonadoblastoma Development in Patients with Turner Syndrome with Cryptic Y Chromosome Material.

    PubMed

    Kwon, Ahreum; Hyun, Sei Eun; Jung, Mo Kyung; Chae, Hyun Wook; Lee, Woo Jung; Kim, Tae Hyuk; Kim, Duk Hee; Kim, Ho-Seong

    2017-06-01

    Current guidelines recommend that testing for Y chromosome material should be performed only in patients with Turner syndrome harboring a marker chromosome and exhibiting virilization in order to detect individuals who are at high risk of gonadoblastoma. However, cryptic Y chromosome material is suggested to be a risk factor for gonadoblastoma in patients with Turner syndrome. Here, we aimed to estimate the frequency of cryptic Y chromosome material in patients with Turner syndrome and determine whether Y chromosome material increased the risk for development of gonadoblastoma. A total of 124 patients who were diagnosed with Turner syndrome by conventional cytogenetic techniques underwent additional molecular analysis to detect cryptic Y chromosome material. In addition, patients with Turner syndrome harboring Y chromosome cell lines had their ovaries removed prophylactically. Finally, we assessed the occurrence of gonadoblastoma in patients with Turner syndrome. Molecular analysis demonstrated that 10 patients had Y chromosome material among 118 patients without overt Y chromosome (8.5%). Six patients with overt Y chromosome and four patients with cryptic Y chromosome material underwent oophorectomy. Histopathological analysis revealed that the occurrence of gonadoblastoma in the total group was 2.4%, and gonadoblastoma occurred in one of six patients with an overt Y chromosome (16.7%) and 2 of 10 patients with cryptic Y chromosome material (20.0%). The risk of developing gonadoblastoma in patients with cryptic Y chromosome material was similar to that in patients with overt Y chromosome. Therefore, molecular screening for Y chromosome material should be recommended for all patients with Turner syndrome to detect individuals at a high risk of gonadoblastoma and to facilitate proper management of the disease.

  17. Please mind the gap - Visual census and cryptic biodiversity assessment at central Red Sea coral reefs.

    PubMed

    Pearman, John K; Anlauf, Holger; Irigoien, Xabier; Carvalho, Susana

    2016-07-01

    Coral reefs harbor the most diverse assemblages in the ocean, however, a large proportion of the diversity is cryptic and, therefore, undetected by standard visual census techniques. Cryptic and exposed communities differ considerably in species composition and ecological function. This study compares three different coral reef assessment protocols: i) visual benthic reef surveys: ii) visual census of Autonomous Reef Monitoring Structures (ARMS) plates; and iii) metabarcoding techniques of the ARMS (including sessile, 106-500 μm and 500-2000 μm size fractions), that target the cryptic and exposed communities of three reefs in the central Red Sea. Visual census showed a dominance of Cnidaria (Anthozoa) and Rhodophyta on the reef substrate, while Porifera, Bryozoa and Rhodophyta were the most abundant groups on the ARMS plates. Metabarcoding, targeting the 18S rRNA gene, significantly increased estimates of the species diversity (p < 0.001); revealing that Annelida were generally the dominant phyla (in terms of reads) of all fractions and reefs. Furthermore, metabarcoding detected microbial eukaryotic groups such as Syndiniophyceae, Mamiellophyceae and Bacillariophyceae as relevant components of the sessile fraction. ANOSIM analysis showed that the three reef sites showed no differences based on the visual census data. Metabarcoding showed a higher sensitivity for identifying differences between reef communities at smaller geographic scales than standard visual census techniques as significant differences in the assemblages were observed amongst the reefs. Comparison of the techniques showed no similar patterns for the visual techniques while the metabarcoding of the ARMS showed similar patterns amongst fractions. Establishing ARMS as a standard tool in reef monitoring will not only advance our understanding of local processes and ecological community response to environmental changes, as different faunal components will provide complementary information but also improve the estimates of biodiversity in coral reef benthic communities. This study lays the foundations for further studies looking at integrating traditional reef survey methodologies with complementary approaches, such as metabarcoding, which investigate other components of the reef community. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

  18. Empirical Evidence Supporting Frequent Cryptic Speciation in Epiphyllous Liverworts: A Case Study of the Cololejeunea lanciloba Complex

    PubMed Central

    Yu, Ying; Heinrichs, Jochen; Zhu, Rui-Liang; Schneider, Harald

    2013-01-01

    Cryptic species are frequently recovered in plant lineages, and considered an important cause for divergent of morphological disparity and species diversity. The identification of cryptic species has important implications for the assessment of conservation needs of species aggregates. The mechanisms and processes of the origin of cryptic species diversity are still poorly understand based on the lack of studies especially in context of environment factors. Here we explored evidence for cryptic species within the epiphyllous liverworts Cololejeunea lanciloba complex based on two loci, the plastid trnL-F region and the nuclear ribosomal ITS region. Several analytic approaches were employed to delimit species based on DNA sequence variation including phylogenetic reconstruction, statistical parsimony networks analysis and two recently introduced species delimitation criteria: Rosenberg’s reciprocal monophyly and Rodrigo’s randomly distinct. We found evidence for thirteen genetically distinct putative species, each consisting of more than one haplotype, rather than four morphologically-circumscribed species. The results implied that the highly conserved phenotypes are not congruent with the genetic differentiation, contributing to incorrect assessments of the biodiversity of epiphyllous liverworts. We hypothesize that evolution of cryptic species recovered may be caused by selection of traits critical to the survival in epiphyllous habitats combined with limited developmental options designed in the small body. PMID:24367634

  19. xRRM

    PubMed Central

    Singh, Mahavir; Choi, Charles P.; Feigon, Juli

    2013-01-01

    Genuine La and La-related proteins group 7 (LARP7) bind to the non-coding RNAs transcribed by RNA polymerase III (RNAPIII), which end in UUU-3′OH. The La motif and RRM1 of these proteins (the La module) cooperate to bind the UUU-3′OH, protecting the RNA from degradation, while other domains may be important for RNA folding or other functions. Among the RNAPIII transcripts is ciliate telomerase RNA (TER). p65, a member of the LARP7 family, is an integral Tetrahymena thermophila telomerase holoenzyme protein required for TER biogenesis and telomerase RNP assembly. p65, together with TER and telomerase reverse transcriptase (TERT), form the Tetrahymena telomerase RNP catalytic core. p65 has an N-terminal domain followed by a La module and a C-terminal domain, which binds to the TER stem 4. We recently showed that the p65 C-terminal domain harbors a cryptic, atypical RRM, which uses a unique mode of single- and double-strand RNA binding and is required for telomerase RNP catalytic core assembly. This domain, which we named xRRM, appears to be present in and unique to genuine La and LARP7 proteins. Here we review the structure of the xRRM, discuss how this domain could recognize diverse substrates of La and LARP7 proteins and discuss the functional implications of the xRRM as an RNP chaperone. PMID:23328630

  20. Understanding the physical and chemical nature of the warfarin drug binding site in human serum albumin: experimental and theoretical studies.

    PubMed

    Abou-Zied, Osama K

    2015-01-01

    Human serum albumin (HSA) is one of the major carrier proteins in the body and constitutes approximately half of the protein found in blood plasma. It plays an important role in lipid metabolism, and its ability to reversibly bind a large variety of pharmaceutical compounds makes it a crucial determinant of drug pharmacokinetics and pharmacodynamics. This review deals with one of the protein's major binding sites "Sudlow I" which includes a binding pocket for the drug warfarin (WAR). The binding nature of this important site can be characterized by measuring the spectroscopic changes when a ligand is bound. Using several drugs, including WAR, and other drug-like molecules as ligands, the results emphasize the nature of Sudlow I as a flexible binding site, capable of binding a variety of ligands by adapting its binding pockets. The high affinity of the WAR pocket for binding versatile molecular structures stems from the flexibility of the amino acids forming the pocket. The binding site is shown to have an ionization ability which is important to consider when using drugs that are known to bind in Sudlow I. Several studies point to the important role of water molecules trapped inside the binding site in molecular recognition and ligand binding. Water inside the protein's cavity is crucial in maintaining the balance between the hydrophobic and hydrophilic nature of the binding site. Upon the unfolding and refolding of HSA, more water molecules are trapped inside the binding site which cause some swelling that prevents a full recovery from the denatured state. Better understanding of the mechanism of binding in macromolecules such as HSA and other proteins can be achieved by combining experimental and theoretical studies which produce significant synergies in studying complex biochemical phenomena.

  1. Nuclear binding of progesterone in hen oviduct. Binding to multiple sites in vitro.

    PubMed Central

    Pikler, G M; Webster, R A; Spelsberg, T C

    1976-01-01

    Steroid hormones, including progesterone, are known to bind with high affinity (Kd approximately 1x10(-10)M) to receptor proteins once they enter target cells. This complex (the progesterone-receptor) then undergoes a temperature-and/or salt-dependent activation which allows it to migrate to the cell nucleus and to bind to the deoxyribonucleoproteins. The present studies demonstrate that binding the hormone-receptor complex in vitro to isolated nuclei from the oviducts of laying hens required the same conditions as do other studies of bbinding in vitro reported previously, e.g. the hormone must be complexed to intact and activated receptor. The assay of the nuclear binding by using multiple concentrations of progesterone receptor reveals the presence of more than one class of binding site in the oviduct nuclei. The affinity of each of these classes of binding sites range from Kd approximately 1x10(-9)-1x10(-8)M. Assays using free steroid (not complexed with receptor) show no binding to these sites. The binding to each of the classes of sites, displays a differential stability to increasing ionic concentrations, suggesting primarily an ionic-type interaction for all classes. Only the highest-affinity class of binding site is capable of binding progesterone receptor under physioligical-saline conditions. This class represent 6000-10000 sites per cell nucleus and resembles the sites detected in vivo (Spelsberg, 1976, Biochem. J. 156, 391-398) which cause maximal transcriptional response when saturated with the progesterone receptor. The multiple binding sites for the progesterone receptor either are not present or are found in limited numbers in the nuclei of non-target organs. Differences in extent of binding to the nuclear material between a target tissue (oviduct) and other tissues (spleen or erythrocyte) are markedly dependent on the ionic conditions, and are probably due to binding to different classes of sites in the nuclei. PMID:182147

  2. Cryptic seedling herbivory by nocturnal introduced generalists impacts survival, performance of native and exotic plants.

    PubMed

    Strauss, Sharon Y; Stanton, Maureen L; Emery, Nancy C; Bradley, Carrie A; Carleton, Alexandra; Dittrich-Reed, Dylan R; Ervin, Olivia A; Gray, Levi N; Hamilton, Andrew M; Rogge, Jennifer Harrington; Harper, Skye D; Law, Kimberley Cook; Pham, Vinh Q; Putnam, Matthew E; Roth, Tara M; Theil, Jacob H; Wells, Lara M; Yoshizuka, Eric M

    2009-02-01

    Although much of the theory on the success of invasive species has been geared at escape from specialist enemies, the impact of introduced generalist invertebrate herbivores on both native and introduced plant species has been underappreciated. The role of nocturnal invertebrate herbivores in structuring plant communities has been examined extensively in Europe, but less so in North America. Many nocturnal generalists (slugs, snails, and earwigs) have been introduced to North America, and 96% of herbivores found during a night census at our California Central Valley site were introduced generalists. We explored the role of these herbivores in the distribution, survivorship, and growth of 12 native and introduced plant species from six families. We predicted that introduced species sharing an evolutionary history with these generalists might be less vulnerable than native plant species. We quantified plant and herbivore abundances within our heterogeneous site and also established herbivore removal experiments in 160 plots spanning the gamut of microhabitats. As 18 collaborators, we checked 2000 seedling sites every day for three weeks to assess nocturnal seedling predation. Laboratory feeding trials allowed us to quantify the palatability of plant species to the two dominant nocturnal herbivores at the site (slugs and earwigs) and allowed us to account for herbivore microhabitat preferences when analyzing attack rates on seedlings. The relationship between local slug abundance and percent cover of five common plant taxa at the field site was significantly negatively associated with the mean palatability of these taxa to slugs in laboratory trials. Moreover, seedling mortality of 12 species in open-field plots was positively correlated with mean palatability of these taxa to both slugs and earwigs in laboratory trials. Counter to expectations, seedlings of native species were neither more vulnerable nor more palatable to nocturnal generalists than those of introduced species. Growth comparison of plants within and outside herbivore exclosures also revealed no differences between native and introduced plant species, despite large impacts of herbivores on growth. Cryptic nocturnal predation on seedlings was common and had large effects on plant establishment at our site. Without intensive monitoring, such predation could easily be misconstrued as poor seedling emergence.

  3. Molecular Analysis of Echinostome Metacercariae from Their Second Intermediate Host Found in a Localised Geographic Region Reveals Genetic Heterogeneity and Possible Cryptic Speciation

    PubMed Central

    Noikong, Waraporn; Wongsawad, Chalobol; Chai, Jong-Yil; Saenphet, Supap; Trudgett, Alan

    2014-01-01

    Echinostome metacercariae are the infective stage for humans and animals. The identification of echinostomes has been based until recently on morphology but molecular techniques using sequences of ribosomal RNA and mitochondrial DNA have indicated major clades within the group. In this study we have used the ITS2 region of ribosomal RNA and the ND1 region of mitochondrial DNA to identify metacercariae from snails collected from eight well-separated sites from an area of 4000 km2 in Lamphun Province, Thailand. The derived sequences have been compared to those collected from elsewhere and have been deposited in the nucleotide databases. There were two aims of this study; firstly, to determine the species of echinostome present in an endemic area, and secondly, to assess the intra-specific genetic diversity, as this may be informative with regard to the potential for the development of anthelmintic resistance and with regard to the spread of infection by the definitive hosts. Our results indicate that the most prevalent species are most closely related to E. revolutum, E. trivolvis, E. robustum, E. malayanum and Euparyphium albuferensis. Some sites harbour several species and within a site there could be considerable intra-species genetic diversity. There is no significant geographical structuring within this area. Although the molecular techniques used in this study allowed the assignment of the samples to clades within defined species, however, within these groupings there were significant differences indicating that cryptic speciation may have occurred. The degree of genetic diversity present would suggest the use of targeted regimes designed to minimise the selection of anthelmintic resistance. The apparent lack of geographic structuring is consistent with the transmission of the parasites by the avian hosts. PMID:24699358

  4. PREST-plus identifies pedigree errors and cryptic relatedness in the GAW18 sample using genome-wide SNP data.

    PubMed

    Sun, Lei; Dimitromanolakis, Apostolos

    2014-01-01

    Pedigree errors and cryptic relatedness often appear in families or population samples collected for genetic studies. If not identified, these issues can lead to either increased false negatives or false positives in both linkage and association analyses. To identify pedigree errors and cryptic relatedness among individuals from the 20 San Antonio Family Studies (SAFS) families and cryptic relatedness among the 157 putatively unrelated individuals, we apply PREST-plus to the genome-wide single-nucleotide polymorphism (SNP) data and analyze estimated identity-by-descent (IBD) distributions for all pairs of genotyped individuals. Based on the given pedigrees alone, PREST-plus identifies the following putative pairs: 1091 full-sib, 162 half-sib, 360 grandparent-grandchild, 2269 avuncular, 2717 first cousin, 402 half-avuncular, 559 half-first cousin, 2 half-sib+first cousin, 957 parent-offspring and 440,546 unrelated. Using the genotype data, PREST-plus detects 7 mis-specified relative pairs, with their IBD estimates clearly deviating from the null expectations, and it identifies 4 cryptic related pairs involving 7 individuals from 6 families.

  5. Nicotinic Cholinergic Receptor Binding Sites in the Brain: Regulation in vivo

    NASA Astrophysics Data System (ADS)

    Schwartz, Rochelle D.; Kellar, Kenneth J.

    1983-04-01

    Tritiated acetylcholine was used to measure binding sites with characteristics of nicotinic cholinergic receptors in rat brain. Regulation of the binding sites in vivo was examined by administering two drugs that stimulate nicotinic receptors directly or indirectly. After 10 days of exposure to the cholinesterase inhibitor diisopropyl fluorophosphate, binding of tritiated acetylcholine in the cerebral cortex was decreased. However, after repeated administration of nicotine for 10 days, binding of tritiated acetylcholine in the cortex was increased. Saturation analysis of tritiated acetylcholine binding in the cortices of rats treated with diisopropyl fluorophosphate or nicotine indicated that the number of binding sites decreased and increased, respectively, while the affinity of the sites was unaltered.

  6. Substance P binding sites in the nucleus tractus solitarius of the cat

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maley, B.E.; Sasek, C.A.; Seybold, V.S.

    1988-11-01

    Substance P binding sites in the nucleus tractus solitarius were visualized with receptor autoradiography using Bolton-Hunter (/sup 125/I)substance P. Substance P binding sites were found to have distinct patterns within the cat nucleus tractus solitarius. The majority of substance P binding sites were present in the medial, intermediate and the peripheral rim of the parvocellular subdivisions. Lower amounts of substance P binding sites were present in the commissural, ventrolateral, interstitial and dorsolateral subdivisions. No substance P binding sites were present in the central region of the parvocellular subdivision or the solitary tract. The localization of substance P binding sites inmore » the nucleus tractus solitarius is very similar to the patterns of substance P immunoreactive fibers previously described for this region. Results of this study add further support for a functional role of substance P in synaptic circuits of the nucleus tractus solitarius.« less

  7. Structural analysis of substrate recognition by glucose isomerase in Mn2+ binding mode at M2 site in S. rubiginosus.

    PubMed

    Bae, Ji-Eun; Hwang, Kwang Yeon; Nam, Ki Hyun

    2018-06-16

    Glucose isomerase (GI) catalyzes the reversible enzymatic isomerization of d-glucose and d-xylose to d-fructose and d-xylulose, respectively. This is one of the most important enzymes in the production of high-fructose corn syrup (HFCS) and biofuel. We recently determined the crystal structure of GI from S. rubiginosus (SruGI) complexed with a xylitol inhibitor in one metal binding mode. Although we assessed inhibitor binding at the M1 site, the metal binding at the M2 site and the substrate recognition mechanism for SruGI remains the unclear. Here, we report the crystal structure of the two metal binding modes of SruGI and its complex with glucose. This study provides a snapshot of metal binding at the SruGI M2 site in the presence of Mn 2+ , but not in the presence of Mg 2+ . Metal binding at the M2 site elicits a configuration change at the M1 site. Glucose molecule can only bind to the M1 site in presence of Mn 2+ at the M2 site. Glucose and Mn 2+ at the M2 site were bridged by water molecules using a hydrogen bonding network. The metal binding geometry of the M2 site indicates a distorted octahedral coordination with an angle of 55-110°, whereas the M1 site has a relatively stable octahedral coordination with an angle of 85-95°. We suggest a two-step sequential process for SruGI substrate recognition, in Mn 2+ binding mode, at the M2 site. Our results provide a better understanding of the molecular role of the M2 site in GI substrate recognition. Copyright © 2018. Published by Elsevier Inc.

  8. Characterization of diadenosine tetraphosphate (Ap4A) binding sites in cultured chromaffin cells: evidence for a P2y site.

    PubMed Central

    Pintor, J.; Torres, M.; Castro, E.; Miras-Portugal, M. T.

    1991-01-01

    1. Diadenosine tetraphosphate (Ap4A) a dinucleotide, which is stored in secretory granules, presents two types of high affinity binding sites in chromaffin cells. A Kd value of 8 +/- 0.65 x 10(-11) M and Bmax value of 5420 +/- 450 sites per cell were obtained for the high affinity binding site. A Kd value of 5.6 +/- 0.53 x 10(-9) M and a Bmax value close to 70,000 sites per cell were obtained for the second binding site with high affinity. 2. The diadenosine polyphosphates, Ap3A, Ap4A, Ap5A and Ap6A, displaced [3H]-Ap4A from the two binding sites, the Ki values being 1.0 nM, 0.013 nM, 0.013 nM and 0.013 nM for the very high affinity binding site and 0.5 microM, 0.13 microM, 0.062 microM and 0.75 microM for the second binding site. 3. The ATP analogues displaced [3H]-Ap4A with the potency order of the P2y receptors, adenosine 5'-O-(2 thiodiphosphate) (ADP-beta-S) greater than 5'-adenylyl imidodiphosphate (AMP-PNP) greater than alpha, beta-methylene ATP (alpha, beta-MeATP), in both binding sites. The Ki values were respectively 0.075 nM, 0.2 nM and 0.75 nM for the very high affinity binding site and 0.125 microM, 0.5 microM and 0.9 microM for the second binding site. PMID:1912985

  9. Distinct roles of beta1 metal ion-dependent adhesion site (MIDAS), adjacent to MIDAS (ADMIDAS), and ligand-associated metal-binding site (LIMBS) cation-binding sites in ligand recognition by integrin alpha2beta1.

    PubMed

    Valdramidou, Dimitra; Humphries, Martin J; Mould, A Paul

    2008-11-21

    Integrin-ligand interactions are regulated in a complex manner by divalent cations, and previous studies have identified ligand-competent, stimulatory, and inhibitory cation-binding sites. In collagen-binding integrins, such as alpha2beta1, ligand recognition takes place exclusively at the alpha subunit I domain. However, activation of the alphaI domain depends on its interaction with a structurally similar domain in the beta subunit known as the I-like or betaI domain. The top face of the betaI domain contains three cation-binding sites: the metal-ion dependent adhesion site (MIDAS), the ADMIDAS (adjacent to MIDAS), and LIMBS (ligand-associated metal-binding site). The role of these sites in controlling ligand binding to the alphaI domain has yet to be elucidated. Mutation of the MIDAS or LIMBS completely blocked collagen binding to alpha2beta1; in contrast mutation of the ADMIDAS reduced ligand recognition but this effect could be overcome by the activating monoclonal antibody TS2/16. Hence, the MIDAS and LIMBS appear to be essential for the interaction between alphaI and betaI, whereas occupancy of the ADMIDAS has an allosteric effect on the conformation of betaI. An activating mutation in the alpha2 I domain partially restored ligand binding to the MIDAS and LIMBS mutants. Analysis of the effects of Ca(2+), Mg(2+), and Mn(2+) on ligand binding to these mutants showed that the MIDAS is a ligand-competent site through which Mn(2+) stimulates ligand binding, whereas the LIMBS is a stimulatory Ca(2+)-binding site, occupancy of which increases the affinity of Mg(2+) for the MIDAS.

  10. Identification and partial characterization of a low affinity metal-binding site in the light chain of tetanus toxin.

    PubMed

    Wright, J F; Pernollet, M; Reboul, A; Aude, C; Colomb, M G

    1992-05-05

    Tetanus toxin was shown to contain a metal-binding site for zinc and copper. Equilibrium dialysis binding experiments using 65Zn indicated an association constant of 9-15 microM, with one zinc-binding site/toxin molecule. The zinc-binding site was localized to the toxin light chain as determined by binding of 65Zn to the light chain but not to the heavy chain after separation by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transfer to Immobilon membranes. Copper was an efficient inhibitor of 65Zn binding to tetanus toxin and caused two peptide bond cleavages in the toxin light chain in the presence of ascorbate. These metal-catalyzed oxidative cleavages were inhibited by the presence of zinc. Partial characterization of metal-catalyzed oxidative modifications of a peptide based on a putative metal-binding site (HELIH) in the toxin light chain was used to map the metal-binding site in the protein.

  11. CORE_TF: a user-friendly interface to identify evolutionary conserved transcription factor binding sites in sets of co-regulated genes

    PubMed Central

    Hestand, Matthew S; van Galen, Michiel; Villerius, Michel P; van Ommen, Gert-Jan B; den Dunnen, Johan T; 't Hoen, Peter AC

    2008-01-01

    Background The identification of transcription factor binding sites is difficult since they are only a small number of nucleotides in size, resulting in large numbers of false positives and false negatives in current approaches. Computational methods to reduce false positives are to look for over-representation of transcription factor binding sites in a set of similarly regulated promoters or to look for conservation in orthologous promoter alignments. Results We have developed a novel tool, "CORE_TF" (Conserved and Over-REpresented Transcription Factor binding sites) that identifies common transcription factor binding sites in promoters of co-regulated genes. To improve upon existing binding site predictions, the tool searches for position weight matrices from the TRANSFACR database that are over-represented in an experimental set compared to a random set of promoters and identifies cross-species conservation of the predicted transcription factor binding sites. The algorithm has been evaluated with expression and chromatin-immunoprecipitation on microarray data. We also implement and demonstrate the importance of matching the random set of promoters to the experimental promoters by GC content, which is a unique feature of our tool. Conclusion The program CORE_TF is accessible in a user friendly web interface at . It provides a table of over-represented transcription factor binding sites in the users input genes' promoters and a graphical view of evolutionary conserved transcription factor binding sites. In our test data sets it successfully predicts target transcription factors and their binding sites. PMID:19036135

  12. [The role of glycine binding site in NMDA receptor--interactions between NMDA and D-serine in artificial anoxia/agycemia rat hippocampus].

    PubMed

    Kawasaki, Kazuyoshi; Ogawa, Seturou

    2003-01-01

    NMDA receptor contributes to cause neuronal death in anoxic condition. It is not known how a part of NMDA receptors, NMDA-binding site and/or glycine-binding site, influence neuronal damage in rats' hippocampus in vitro. Rats' hippocampus, labeled with norepinephrine (3H-NE), was incubated in artificial cerebrospinal fluid (aCSF) and we measured 3H-NE in superfusion solution and remaining tissue. Glucose was eliminated from aCSF and 95% N2 + 5% CO2 produced the anoxic state. The amount of 3H-NE release increased in anoxia with NMDA (NMDA-binding site agonist), while there was no influence on NMDA receptor in non-anoxic state even after D-serine (glycine-binding site agonist) has been administered. The 3H-NE was released more when D-serine (100 mu mM) and NMDA (100 mu mM) were administered together than when only D-serine (10 mu mM, 100 mu mM, 1000 mu mM) in anoxia or NMDA (10 mu mM, 100 mu mM, 1000 mu mM) in anoxia was administered. Glycine-binding site agonist alone does not act significantly but ion channels in NMDA receptor open more and become more effective when both glycine-binding site agonist and NMDA-binding site agonist exist, suggesting that there are interactions between NMDA-binding site and glycine-binding site in NMDA-receptor during anoxia.

  13. CaMELS: In silico prediction of calmodulin binding proteins and their binding sites.

    PubMed

    Abbasi, Wajid Arshad; Asif, Amina; Andleeb, Saiqa; Minhas, Fayyaz Ul Amir Afsar

    2017-09-01

    Due to Ca 2+ -dependent binding and the sequence diversity of Calmodulin (CaM) binding proteins, identifying CaM interactions and binding sites in the wet-lab is tedious and costly. Therefore, computational methods for this purpose are crucial to the design of such wet-lab experiments. We present an algorithm suite called CaMELS (CalModulin intEraction Learning System) for predicting proteins that interact with CaM as well as their binding sites using sequence information alone. CaMELS offers state of the art accuracy for both CaM interaction and binding site prediction and can aid biologists in studying CaM binding proteins. For CaM interaction prediction, CaMELS uses protein sequence features coupled with a large-margin classifier. CaMELS models the binding site prediction problem using multiple instance machine learning with a custom optimization algorithm which allows more effective learning over imprecisely annotated CaM-binding sites during training. CaMELS has been extensively benchmarked using a variety of data sets, mutagenic studies, proteome-wide Gene Ontology enrichment analyses and protein structures. Our experiments indicate that CaMELS outperforms simple motif-based search and other existing methods for interaction and binding site prediction. We have also found that the whole sequence of a protein, rather than just its binding site, is important for predicting its interaction with CaM. Using the machine learning model in CaMELS, we have identified important features of protein sequences for CaM interaction prediction as well as characteristic amino acid sub-sequences and their relative position for identifying CaM binding sites. Python code for training and evaluating CaMELS together with a webserver implementation is available at the URL: http://faculty.pieas.edu.pk/fayyaz/software.html#camels. © 2017 Wiley Periodicals, Inc.

  14. Rapid comparison of protein binding site surfaces with Property Encoded Shape Distributions (PESD)

    PubMed Central

    Das, Sourav; Kokardekar, Arshad

    2009-01-01

    Patterns in shape and property distributions on the surface of binding sites are often conserved across functional proteins without significant conservation of the underlying amino-acid residues. To explore similarities of these sites from the viewpoint of a ligand, a sequence and fold-independent method was created to rapidly and accurately compare binding sites of proteins represented by property-mapped triangulated Gauss-Connolly surfaces. Within this paradigm, signatures for each binding site surface are produced by calculating their property-encoded shape distributions (PESD), a measure of the probability that a particular property will be at a specific distance to another on the molecular surface. Similarity between the signatures can then be treated as a measure of similarity between binding sites. As postulated, the PESD method rapidly detected high levels of similarity in binding site surface characteristics even in cases where there was very low similarity at the sequence level. In a screening experiment involving each member of the PDBBind 2005 dataset as a query against the rest of the set, PESD was able to retrieve a binding site with identical E.C. (Enzyme Commission) numbers as the top match in 79.5% of cases. The ability of the method in detecting similarity in binding sites with low sequence conservations were compared with state-of-the-art binding site comparison methods. PMID:19919089

  15. Estimating animal populations and body sizes from burrows: Marine ecologists have their heads buried in the sand

    NASA Astrophysics Data System (ADS)

    Schlacher, Thomas A.; Lucrezi, Serena; Peterson, Charles H.; Connolly, Rod M.; Olds, Andrew D.; Althaus, Franziska; Hyndes, Glenn A.; Maslo, Brooke; Gilby, Ben L.; Leon, Javier X.; Weston, Michael A.; Lastra, Mariano; Williams, Alan; Schoeman, David S.

    2016-06-01

    Most ecological studies require knowledge of animal abundance, but it can be challenging and destructive of habitat to obtain accurate density estimates for cryptic species, such as crustaceans that tunnel deeply into the seafloor, beaches, or mudflats. Such fossorial species are, however, widely used in environmental impact assessments, requiring sampling techniques that are reliable, efficient, and environmentally benign for these species and environments. Counting and measuring the entrances of burrows made by cryptic species is commonly employed to index population and body sizes of individuals. The fundamental premise is that burrow metrics consistently predict density and size. Here we review the evidence for this premise. We also review criteria for selecting among sampling methods: burrow counts, visual censuses, and physical collections. A simple 1:1 correspondence between the number of holes and population size cannot be assumed. Occupancy rates, indexed by the slope of regression models, vary widely between species and among sites for the same species. Thus, 'average' or 'typical' occupancy rates should not be extrapolated from site- or species specific field validations and then be used as conversion factors in other situations. Predictions of organism density made from burrow counts often have large uncertainty, being double to half of the predicted mean value. Whether such prediction uncertainty is 'acceptable' depends on investigators' judgements regarding the desired detectable effect sizes. Regression models predicting body size from burrow entrance dimensions are more precise, but parameter estimates of most models are specific to species and subject to site-to-site variation within species. These results emphasise the need to undertake thorough field validations of indirect census techniques that include tests of how sensitive predictive models are to changes in habitat conditions or human impacts. In addition, new technologies (e.g. drones, thermal-, acoustic- or chemical sensors) should be used to enhance visual census techniques of burrows and surface-active animals.

  16. Droplet Characterization and Penetration of an Ultra-Low Volume Mosquito Adulticide Spray Targeting the Asian Tiger Mosquito, Aedes albopictus, within Urban and Suburban Environments of Northeastern USA

    PubMed Central

    Faraji, Ary; Unlu, Isik; Crepeau, Taryn; Healy, Sean; Crans, Scott; Lizarraga, Griffith; Fonseca, Dina; Gaugler, Randy

    2016-01-01

    Adult control of Aedes albopictus via ultra-low volume is difficult because this species occurs primarily in peridomestic habitats where obstacles such as buildings and vegetation can disrupt spray plumes and droplet dispersion. We determined droplet penetration and characterization of a pyrethroid adulticide applied from the ground at mid (46.77 ml/ha) and maximum (93.53 ml/ha) label rates within cryptic habitats of urban and suburban environments. Droplets were collected from all habitats, with no significant differences detected between locations within the same application rate or collection method. No differences were detected in droplet densities (drops per mm2) between rates within urban environments, but more droplets were collected in urban (149.93 ± 11.07 SE) than suburban sites (114.37 ± 11.32) at the maximum label rate (P = 0.003). The excellent penetration of aerosols into cryptic habitats of an urban site was likely due to the shorter spray paths afforded by our network of roads and alleys. Mid label rates displayed similar droplet density values as maximum label rates in urban areas, indicating that lower rates may be used effectively to reduce costs, lessen non-target effects, and increase environmental stewardship. Advances in formulations and technology are driving changes in adulticide applications, leading to use of the minimum effective dose for maximum efficacy, precision, and accountability. PMID:27116103

  17. Geographic range and structure of cryptic genetic diversity among Pacific North American populations of the non-native amphipod Grandidierella japonica

    USGS Publications Warehouse

    Pilgrim, Erik M.; Blum, Michael J.; Reusser, Deborah A.; Lee, Henry; Darling, John A.

    2013-01-01

    Reconstructing the invasion history of aquatic invasive species can enhance understanding of invasion risks by recognizing areas most susceptible to invasion and forecasting future spread based on past patterns of population expansion. Here we reconstruct the invasion history of the Japanese amphipod Grandidierella japonica Stephensen 1938 combining information from historical collection data with molecular genetic data to better understand post-invasion range expansion and anthropogenic connectivity across the Pacific coast of North America. Compilation of collection data from bays and estuaries of the Pacific North American coast show many new localities have been colonized in the last two decades, moving outward from harbors and bays with high commercial traffic into smaller coastal locations dominated by local recreational traffic. DNA barcode sequence data for G. japonica reveals two distinct clades: one found in San Francisco Bay and sites to the north, and one also found in San Francisco Bay and sites to the south. The two clades differ by an average 7.28 % genetic distance, large enough to consider these invasive amphipods two separate species. Both northern and southern clades exhibit low levels of genetic diversity, suggesting a single introduction event for each. The presence of cryptic diversity within this invasive amphipod highlights the need for more extensive study of the invasive and native populations of aquatic invasive invertebrates to address questions of taxonomy, diversity, and invasion history.

  18. Platelet binding sites for factor VIII in relation to fibrin and phosphatidylserine

    PubMed Central

    Novakovic, Valerie A.; Shi, Jialan; Rasmussen, Jan; Pipe, Steven W.

    2015-01-01

    Thrombin-stimulated platelets expose very little phosphatidylserine (PS) but express binding sites for factor VIII (fVIII), casting doubt on the role of exposed PS as the determinant of binding sites. We previously reported that fVIII binding sites are increased three- to sixfold when soluble fibrin (SF) binds the αIIbβ3 integrin. This study focuses on the hypothesis that platelet-bound SF is the major source of fVIII binding sites. Less than 10% of fVIII was displaced from thrombin-stimulated platelets by lactadherin, a PS-binding protein, and an fVIII mutant defective in PS-dependent binding retained platelet affinity. Therefore, PS is not the determinant of most binding sites. FVIII bound immobilized SF and paralleled platelet binding in affinity, dependence on separation from von Willebrand factor, and mediation by the C2 domain. SF also enhanced activity of fVIII in the factor Xase complex by two- to fourfold. Monoclonal antibody (mAb) ESH8, against the fVIII C2 domain, inhibited binding of fVIII to SF and platelets but not to PS-containing vesicles. Similarly, mAb ESH4 against the C2 domain, inhibited >90% of platelet-dependent fVIII activity vs 35% of vesicle-supported activity. These results imply that platelet-bound SF is a component of functional fVIII binding sites. PMID:26162408

  19. Differences between high-affinity forskolin binding sites in dopamine-riche and other regions of rat brain

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Poat, J.A.; Cripps, H.E.; Iversen, L.L.

    1988-05-01

    Forskolin labelled with (/sup 3/H) bound to high- and low-affinity sites in the rat brain. The high-affinity site was discretely located, with highest densities in the striatum, nucleus accumbens, olfactory tubercule, substantia nigra, hippocampus, and the molecular layers of the cerebellum. This site did not correlate well with the distribution of adenylate cyclase. The high-affinity striatal binding site may be associated with a stimulatory guanine nucleotide-binding protein. Thus, the number of sites was increased by the addition of Mg/sup 2 +/ and guanylyl imidodiphosphate. Cholera toxin stereotaxically injected into rat striatum increased the number of binding sites, and no furthermore » increase was noted following the subsequent addition of guanyl nucleotide. High-affinity forskolin binding sites in non-dopamine-rich brain areas (hippocampus and cerebullum) were modulated in a qualitatively different manner by guanyl nucleotides. In these areas the number of binding sites was significantly reduced by the addition of guanyl nucleotide. These results suggest that forskolin may have a potential role in identifying different functional/structural guanine nucleotide-binding proteins.« less

  20. Solubilization and characterization of haloperidol-sensitive (+)-( sup 3 H)SKF-10,047 binding sites (sigma sites) from rat liver membranes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    McCann, D.J.; Su, T.P.

    1991-05-01

    The zwitterionic detergent 3-((3-cholamidopropyl)dimethylamino)-1-propanesulfonate (CHAPS) produced optimal solubilization of (+)-({sup 3}H)SKF-10,047 binding sites from rat liver membranes at a concentration of 0.2%, well below the critical micellular concentration of the detergent. The pharmacological selectivity of the liver (+)-({sup 3}H)SKF-10,047 binding sites corresponds to that of sigma sites from rat and guinea pig brain. When the affinities of 18 different drugs at (+)-({sup 3}H)SKF-10,047 binding sites in membranes and solubilized preparations were compared, a correlation coefficient of 0.99 and a slope of 1.03 were obtained, indicating that the pharmacological selectivity of rat liver sigma sites is retained after solubilization. In addition,more » the binding of 20 nM ({sup 3}H)progesterone to solubilized rat liver preparations was found to exhibit a pharmacological selectivity appropriate for sigma sites. A stimulatory effect of phenytoin on (+)-({sup 3}H)SKF-10,047 binding to sigma sites persisted after solubilization. When the solubilized preparation was subjected to molecular sizing chromatography, a single peak exhibiting specific (+)-({sup 3}H)SKF-10,047 binding was obtained. The binding activity of this peak was stimulated symmetrically when assays were performed in the presence of 300 microM phenytoin. The molecular weight of the CHAPS-solubilized sigma site complex was estimated to be 450,000 daltons. After solubilization with CHAPS, rat liver sigma sites were enriched to 12 pmol/mg of protein. The present results demonstrate a successful solubilization of sigma sites from rat liver membranes and provide direct evidence that the gonadal steroid progesterone binds to sigma sites. The results also suggest that the anticonvulsant phenytoin binds to an associated allosteric site on the sigma site complex.« less

  1. Binding mode of cytochalasin B to F-actin is altered by lateral binding of regulatory proteins.

    PubMed

    Suzuki, N; Mihashi, K

    1991-01-01

    The binding of cytochalasin B (CB) to F-actin was studied using a trace amount of [3H]-cytochalasin B. F-Actin-bound CB was separated from free CB by ultracentrifugation and the amount of F-actin-bound CB was determined by comparing the radioactivity both in the supernatant and in the precipitate. A filament of pure F-actin possessed one high-affinity binding site for CB (Kd = 5.0 nM) at the B-end. When the filament was bound to native tropomyosin (complex of tropomyosin and troponin), two low-affinity binding sites for CB (Kd = 230 nM) were created, while the high-affinity binding site was reserved (Kd = 3.4 nM). It was concluded that the creation of low-affinity binding sites was primarily due to binding of tropomyosin to F-actin, as judged from the following two observations: (1) a filament of F-actin/tropomyosin complex possessed one high-affinity binding site (Kd = 3.9 nM) plus two low-affinity binding sites (Kd = 550 nM); (2) the Ca2(+)-receptive state of troponin C in F-actin/native tropomyosin complex did not affect CB binding.

  2. Ehlers-Danlos syndrome with lethal cardiac valvular dystrophy in males carrying a novel splice mutation in FLNA.

    PubMed

    Ritelli, Marco; Morlino, Silvia; Giacopuzzi, Edoardo; Carini, Giulia; Cinquina, Valeria; Chiarelli, Nicola; Majore, Silvia; Colombi, Marina; Castori, Marco

    2017-01-01

    Filamin A is an X-linked, ubiquitous actin-binding protein whose mutations are associated to multiple disorders with limited genotype-phenotype correlations. While gain-of-function mutations cause various bone dysplasias, loss-of-function variants are the most common cause of periventricular nodular heterotopias with variable soft connective tissue involvement, as well as X-linked cardiac valvular dystrophy (XCVD). The term "Ehlers-Danlos syndrome (EDS) with periventricular heterotopias" has been used in females with neurological, cardiovascular, integument and joint manifestations, but this nosology is still a matter of debate. We report the clinical and molecular update of an Italian family with an X-linked recessive soft connective tissue disorder and which was described, in 1975, as the first example of EDS type V of the Berlin nosology. The cutaneous phenotype of the index patient was close to classical EDS and all males died for a lethal cardiac valvular dystrophy. Whole exome sequencing identified the novel c.1829-1G>C splice variation in FLNA in two affected cousins. The nucleotide change was predicted to abolish the canonical splice acceptor site of exon 13 and to activate a cryptic acceptor site 15 bp downstream, leading to in frame deletion of five amino acid residues (p.Phe611_Gly615del). The predicted in frame deletion clusters with all the mutations previously identified in XCVD and falls within the N-terminus rod 1 domain of filamin A. Our findings expand the male-specific phenotype of FLNA mutations that now includes classical-like EDS with lethal cardiac valvular dystrophy, and offer further insights for the genotype-phenotype correlations within this spectrum. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  3. Differential splicing of human androgen receptor pre-mRNA in X-linked reifenstein syndrome, because of a deletion involving a putative branch site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ris-Stalpers, C.; Verleun-Mooijman, M.C.T.; Blaeij, T.J.P. de

    1994-04-01

    The analysis of the androgen receptor (AR) gene, mRNA, and protein in a subject with X-linked Reifenstein syndrome (partial androgen insensitivity) is reported. The presence of two mature AR transcripts in genital skin fibroblasts of the patient is established, and, by reverse transcriptase-PCR and RNase transcription analysis, the wild-type transcript and a transcript in which exon 3 sequences are absent without disruption of the translational reading frame are identified. Sequencing and hybridization analysis show a deletion of >6 kb in intron 2 of the human AR gene, starting 18 bp upstream of exon 3. The deletion includes the putative branch-pointmore » sequence (BPS) but not the acceptor splice site on the intron 2/exon 3 boundary. The deletion of the putative intron 2 BPS results in 90% inhibition of wild-type splicing. The mutant transcript encodes an AR protein lacking the second zinc finger of the DNA-binding domain. Western/immunoblotting analysis is used to show that the mutant AR protein is expressed in genital skin fibroblasts of the patient. The residual 10% wild-type transcript can be the result of the use of a cryptic BPS located 63 bp upstream of the intron 2/exon 3 boundary of the mutant AR gene. The mutated AR protein has no transcription-activating potential and does not influence the transactivating properties of the wild-type AR, as tested in cotransfection studies. It is concluded that the partial androgen-insensitivity syndrome of this patient is the consequence of the limited amount of wild-type AR protein expressed in androgen target cells, resulting from the deletion of the intron 2 putative BPS. 42 refs., 6 figs., 1 tab.« less

  4. Molecular and Functional Effects of a Splice Site Mutation in the MYL2 Gene Associated with Cardioskeletal Myopathy and Early Cardiac Death in Infants

    PubMed Central

    Zhou, Zhiqun; Huang, Wenrui; Liang, Jingsheng; Szczesna-Cordary, Danuta

    2016-01-01

    The homozygous appearance of the intronic mutation (IVS6-1) in the MYL2 gene encoding for myosin ventricular/slow-twitch skeletal regulatory light chain (RLC) was recently linked to the development of slow skeletal muscle fiber type I hypotrophy and early cardiac death. The IVS6-1 (c403-1G>C) mutation resulted from a cryptic splice site in MYL2 causing a frameshift and replacement of the last 32 codons by 19 different amino acids in the RLC mutant protein. Infants who were IVS6-1+∕+-positive died between 4 and 6 months of age due to cardiomyopathy and heart failure. In this report we have investigated the molecular mechanism and functional consequences associated with the IVS6-1 mutation using recombinant human cardiac IVS6-1 and wild-type (WT) RLC proteins. Recombinant proteins were reconstituted into RLC-depleted porcine cardiac muscle preparations and subjected to enzymatic and functional assays. IVS6-1-RLC showed decreased binding to the myosin heavy chain (MHC) compared with WT, and IVS6-1-reconstituted myosin displayed reduced binding to actin in rigor. The IVS6-1 myosin demonstrated a significantly lower Vmax of the actin-activated myosin ATPase activity compared with WT. In stopped-flow experiments, IVS6-1 myosin showed slower kinetics of the ATP induced dissociation of the acto-myosin complex and a significantly reduced slope of the kobs-[MgATP] relationship compared to WT. In skinned porcine cardiac muscles, RLC-depleted and IVS6-1 reconstituted muscle strips displayed a significant decrease in maximal contractile force and a significantly increased Ca2+ sensitivity, both hallmarks of hypertrophic cardiomyopathy-associated mutations in MYL2. Our results showed that the amino-acid changes in IVS6-1 were sufficient to impose significant conformational alterations in the RLC protein and trigger a series of abnormal protein-protein interactions in the cardiac muscle sarcomere. Notably, the mutation disrupted the RLC-MHC interaction and the steady-state and kinetics of the acto-myosin interaction. Specifically, slower myosin cross-bridge turnover rates and slower second-order MgATP binding rates of acto-myosin interactions were observed in IVS6-1 vs. WT reconstituted cardiac preparations. Our in vitro results suggest that when placed in vivo, IVS6-1 may lead to cardiomyopathy and early death of homozygous infants by severely compromising the ability of myosin to develop contractile force and maintain normal systolic and diastolic cardiac function. PMID:27378946

  5. Comparison of (/sup 3/H)pirenzepine and (/sup 3/H)quinuclidinylbenzilate binding to muscarinic cholinergic receptors in rat brain

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Luthin, G.R.; Wolfe, B.B.

    The properties of (/sup 3/H)quinuclidinylbenzilate ( (/sup 3/H)QNB) binding and (/sup 3/H)pirenzepine ( (/sup 3/H)PZ) binding to various regions of rat brain were compared. (/sup 3/H)PZ appeared to bind with high affinity to a single site, with a Kd value of approximately 15 nM in the cerebral cortex. The rank order of potencies of muscarinic drugs to inhibit binding of either (/sup 3/H)QNB or (/sup 3/H)PZ was QNB greater than atropine . scopolamine greater than pirenzepine greater than oxotremorine greater than bethanechol. Muscarinic antagonists (except PZ) inhibited both (/sup 3/H)PZ and (/sup 3/H)QNB binding with Hill coefficients of approximately 1.more » PZ inhibited (/sup 3/H)QNB binding in cortex with a Hill coefficient of 0.7, but inhibited (/sup 3/H)PZ binding with a Hill coefficient of 1.0. Hill coefficients for agonists were less than 1. The density of (/sup 3/H)PZ binding sites was approximately half the density of (/sup 3/H)QNB binding sites in cortex, striatum and hippocampus. In pons-medulla and cerebellum, the densities of (/sup 3/H)PZ binding sites were 20 and 0%, respectively, relative to the densities of (/sup 3/H)QNB binding sites. When unlabeled PZ was used to compete for (/sup 3/H)QNB binding, the relative number of high-affinity PZ binding sites in cortex, pons and cerebellum agreed with the relative number of (/sup 3/H)PZ binding sites in those regions. The binding of (/sup 3/H)PZ and (/sup 3/H)QNB was nonadditive in cortex. GTP inhibited high-affinity oxotremorine binding, but not PZ binding. Together, these data suggest that (/sup 3/H)PZ binds to a subset of (/sup 3/H)QNB binding sites. Whether this subset reflects the existence of subtypes of muscarinic receptors or is a consequence of coupling to another membrane protein remains to be seen.« less

  6. Direct association of Csk homologous kinase (CHK) with the diphosphorylated site Tyr568/570 of the activated c-KIT in megakaryocytes.

    PubMed

    Price, D J; Rivnay, B; Fu, Y; Jiang, S; Avraham, S; Avraham, H

    1997-02-28

    The Csk homologous kinase (CHK), formerly MATK, has previously been shown to bind to activated c-KIT. In this report, we characterize the binding of SH2(CHK) to specific phosphotyrosine sites on the c-KIT protein sequence. Phosphopeptide inhibition of the in vitro interaction of SH2(CHK)-glutathione S-transferase fusion protein/c-KIT from SCF/KL-treated Mo7e megakaryocytic cells indicated that two sites on c-KIT were able to bind SH2(CHK). These sites were the Tyr568/570 diphosphorylated sequence and the monophosphorylated Tyr721 sequence. To confirm this, we precipitated native CHK from cellular extracts using phosphorylated peptides linked to Affi-Gel 15. In addition, purified SH2(CHK)-glutathione S-transferase fusion protein was precipitated with the same peptide beads. All of the peptide bead-binding studies were consistent with the direct binding of SH2(CHK) to phosphorylated Tyr568/570 and Tyr721 sites. Binding of FYN and SHC to the diphosphorylated Tyr568/570 site was observed, while binding of Csk to this site was not observed. The SH2(CHK) binding to the two sites is direct and not through phosphorylated intermediates such as FYN or SHC. Site-directed mutagenesis of the full-length c-KIT cDNA followed by transient transfection indicated that only the Tyr568/570, and not the Tyr721, is able to bind SH2(CHK). This indicates that CHK binds to the same site on c-KIT to which FYN binds, possibly bringing the two into proximity on associated c-KIT subunits and leading to the down-regulation of FYN by CHK.

  7. The spacing between adjacent binding sites in the family of repeats affects the functions of Epstein-Barr nuclear antigen 1 in transcription activation and stable plasmid maintenance.

    PubMed

    Hebner, Christy; Lasanen, Julie; Battle, Scott; Aiyar, Ashok

    2003-07-05

    Epstein-Barr virus (EBV) and the closely related Herpesvirus papio (HVP) are stably replicated as episomes in proliferating latently infected cells. Maintenance and partitioning of these viral plasmids requires a viral sequence in cis, termed the family of repeats (FR), that is bound by a viral protein, Epstein-Barr nuclear antigen 1 (EBNA1). Upon binding FR, EBNA1 maintains viral genomes in proliferating cells and activates transcription from viral promoters required for immortalization. FR from either virus encodes multiple binding sites for the viral maintenance protein, EBNA1, with the FR from the prototypic B95-8 strain of EBV containing 20 binding sites, and FR from HVP containing 8 binding sites. In addition to differences in the number of EBNA1-binding sites, adjacent binding sites in the EBV FR are typically separated by 14 base pairs (bp), but are separated by 10 bp in HVP. We tested whether the number of binding sites, as well as the distance between adjacent binding sites, affects the function of EBNA1 in transcription activation or plasmid maintenance. Our results indicate that EBNA1 activates transcription more efficiently when adjacent binding sites are separated by 10 bp, the spacing observed in HVP. In contrast, using two separate assays, we demonstrate that plasmid maintenance is greatly augmented when adjacent EBNA1-binding sites are separated by 14 bp, and therefore, presumably lie on the same face of the DNA double helix. These results provide indication that the functions of EBNA1 in transcription activation and plasmid maintenance are separable.

  8. Cuticular hydrocarbon phenotypes do not indicate cryptic species in fungus-growing termites (Isoptera: Macrotermitinae).

    PubMed

    Marten, Andreas; Kaib, Manfred; Brandl, Roland

    2009-05-01

    In several termite species, distinct differences in the composition of cuticular hydrocarbons among colonies correspond to high genetic divergence of mitochondrial DNA sequences. These observations suggest that hydrocarbon phenotypes represent cryptic species. Different cuticular hydrocarbon phenotypes also are found among colonies of fungus-growing termites of the genus Macrotermes. To determine if these hydrocarbon differences in Macrotermes also indicate cryptic species, we sequenced the mitochondrial CO I gene from species in West and East Africa. Among individuals of a supposed species but belonging to different cuticular hydrocarbon phenotypes, the genetic distances are much smaller than distances between species. Unlike what has been observed in other termites, Macrotermes hydrocarbon phenotypes do not represent cryptic species. Our findings suggest fundamental differences in the evolution and/or function of cuticular hydrocarbons among different termite lineages.

  9. Existence of three subtypes of bradykinin B2 receptors in guinea pig.

    PubMed

    Seguin, L; Widdowson, P S; Giesen-Crouse, E

    1992-12-01

    We describe the binding of [3H]bradykinin to homogenates of guinea pig brain, lung, and ileum. Analysis of [3H]bradykinin binding kinetics in guinea pig brain, lung, and ileum suggests the existence of two binding sites in each tissue. The finding of two binding sites for [3H]bradykinin in ileum, lung, and brain was further supported by Scatchard analysis of equilibrium binding in each tissue. [3H]Bradykinin binds to a high-affinity site in brain, lung, and ileum (KD = 70-200 pM), which constitutes approximately 20% of the bradykinin binding, and to a second, lower-affinity site (0.63-0.95 nM), which constitutes the remaining 80% of binding. Displacement studies with various bradykinin analogues led us to subdivide the high- and lower-affinity sites in each tissue and to suggest the existence of three subtypes of B2 receptors in the guinea pig, which we classify as B2a, B2b, and B2c. Binding of [3H]bradykinin is largely to a B2b receptor subtype, which constitutes the majority of binding in brain, lung, and ileum and represents the lower-affinity site in our binding studies. Receptor subtype B2c constitutes approximately 20% of binding sites in the brain and lung and is equivalent to the high-affinity site in brain and lung. We suggest that a third subtype of B2 receptor (high-affinity site in ileum), B2a, is found only in the ileum. All three subtypes of B2 receptors display a high affinity for bradykinin, whereas they show different affinities for various bradykinin analogues displaying agonist or antagonist activities.(ABSTRACT TRUNCATED AT 250 WORDS)

  10. Involvement of two classes of binding sites in the interactions of cyclophilin B with peripheral blood T-lymphocytes.

    PubMed

    Denys, A; Allain, F; Carpentier, M; Spik, G

    1998-12-15

    Cyclophilin B (CyPB) is a cyclosporin A (CsA)-binding protein, mainly associated with the secretory pathway, and is released in biological fluids. We recently reported that CyPB specifically binds to T-lymphocytes and promotes enhanced incorporation of CsA. The interactions with cellular binding sites involved, at least in part, the specific N-terminal extension of the protein. In this study, we intended to specify further the nature of the CyPB-binding sites on peripheral blood T-lymphocytes. We first provide evidence that the CyPB binding to heparin-Sepharose is prevented by soluble sulphated glycosaminoglycans (GAG), raising the interesting possibility that such interactions may occur on the T-cell surface. We then characterized CyPB binding to T-cell surface GAG and found that these interactions involved the N-terminal extension of CyPB, but not its conserved CsA-binding domain. In addition, we determined the presence of a second CyPB binding site, which we termed a type I site, in contrast with type II for GAG interactions. The two binding sites exhibit a similar affinity but the expression of the type I site was 3-fold lower. The conclusion that CyPB binding to the type I site is distinct from the interactions with GAG was based on the findings that it was (1) resistant to NaCl wash and GAG-degrading enzyme treatments, (2) reduced in the presence of CsA or cyclophilin C, and (3) unmodified in the presence of either the N-terminal peptide of CyPB or protamine. Finally, we showed that the type I binding sites were involved in an endocytosis process, supporting the hypothesis that they may correspond to a functional receptor for CyPB.

  11. Why do cryptic species tend not to co-occur? A case study on two cryptic pairs of butterflies.

    PubMed

    Vodă, Raluca; Dapporto, Leonardo; Dincă, Vlad; Vila, Roger

    2015-01-01

    As cryptic diversity is being discovered, mostly thanks to advances in molecular techniques, it is becoming evident that many of these taxa display parapatric distributions in mainland and that they rarely coexist on islands. Genetic landscapes, haplotype networks and ecological niche modeling analyses were performed for two pairs of non-sister cryptic butterfly species, Aricia agestis-A. cramera and Polyommatus icarus-P. celina (Lycaenidae), to specifically assess non-coexistence on western Mediterranean islands, and to test potential causes producing such chequered distribution patterns. We show that the morphologically and ecologically equivalent pairs of species do not coexist on any of the studied islands, although nearly all islands are colonized by one of them. According to our models, the cryptic pairs displayed marked climatic preferences and 'precipitation during the driest quarter' was recovered as the most important climatic determinant. However, neither dispersal capacity, nor climatic or ecological factors fully explain the observed distributions across particular sea straits, and the existence of species interactions resulting in mutual exclusion is suggested as a necessary hypothesis. Given that the studied species are habitat generalists, feeding on virtually unlimited resources, we propose that reproductive interference, together with climatic preferences, sustain density-dependent mechanisms like "founder takes all" and impede coexistence on islands. Chequered distributions among cryptic taxa, both sister and non-sister, are common in butterflies, suggesting that the phenomenon revealed here could be important in determining biodiversity patterns.

  12. Cryptic diversity and ecosystem functioning: a complex tale of differential effects on decomposition.

    PubMed

    De Meester, N; Gingold, R; Rigaux, A; Derycke, S; Moens, T

    2016-10-01

    Marine ecosystems are experiencing accelerating population and species loss. Some ecosystem functions are decreasing and there is growing interest in the link between biodiversity and ecosystem functioning. The role of cryptic (morphologically identical but genetically distinct) species in this biodiversity-ecosystem functioning link is unclear and has not yet been formally tested. We tested if there is a differential effect of four cryptic species of the bacterivorous nematode Litoditis marina on the decomposition process of macroalgae. Bacterivorous nematodes can stimulate or slow down bacterial activity and modify the bacterial assemblage composition. Moreover, we tested if interspecific interactions among the four cryptic species influence the decomposition process. A laboratory experiment with both mono- and multispecific nematode cultures was conducted, and loss of organic matter and the activity of two key extracellular enzymes for the degradation of phytodetritus were assessed. L. marina mainly influenced qualitative aspects of the decomposition process rather than its overall rate: an effect of the nematodes on the enzymatic activities became manifest, although no clear nematode effect on bulk organic matter weight loss was found. We also demonstrated that species-specific effects on the decomposition process existed. Combining the four cryptic species resulted in high competition, with one dominant species, but without complete exclusion of other species. These interspecific interactions translated into different effects on the decomposition process. The species-specific differences indicated that each cryptic species may play an important and distinct role in ecosystem functioning. Functional differences may result in coexistence among very similar species.

  13. Why Do Cryptic Species Tend Not to Co-Occur? A Case Study on Two Cryptic Pairs of Butterflies

    PubMed Central

    Vodă, Raluca; Dapporto, Leonardo; Dincă, Vlad; Vila, Roger

    2015-01-01

    As cryptic diversity is being discovered, mostly thanks to advances in molecular techniques, it is becoming evident that many of these taxa display parapatric distributions in mainland and that they rarely coexist on islands. Genetic landscapes, haplotype networks and ecological niche modeling analyses were performed for two pairs of non-sister cryptic butterfly species, Aricia agestis-A. cramera and Polyommatus icarus—P. celina (Lycaenidae), to specifically assess non-coexistence on western Mediterranean islands, and to test potential causes producing such chequered distribution patterns. We show that the morphologically and ecologically equivalent pairs of species do not coexist on any of the studied islands, although nearly all islands are colonized by one of them. According to our models, the cryptic pairs displayed marked climatic preferences and ‘precipitation during the driest quarter’ was recovered as the most important climatic determinant. However, neither dispersal capacity, nor climatic or ecological factors fully explain the observed distributions across particular sea straits, and the existence of species interactions resulting in mutual exclusion is suggested as a necessary hypothesis. Given that the studied species are habitat generalists, feeding on virtually unlimited resources, we propose that reproductive interference, together with climatic preferences, sustain density-dependent mechanisms like “founder takes all” and impede coexistence on islands. Chequered distributions among cryptic taxa, both sister and non-sister, are common in butterflies, suggesting that the phenomenon revealed here could be important in determining biodiversity patterns. PMID:25692577

  14. Evolution in karst massifs: Cryptic diversity among bent-toed geckos along the Truong Son Range with descriptions of three new species and one new country record from Laos.

    PubMed

    Luu, Vinh Quang; Bonkowski, Michael; Nguyen, Truong Quang; Le, Minh Duc; Schneider, Nicole; Ngo, Hanh Thi; Ziegler, Thomas

    2016-05-02

    Species designated as 'cryptic' share a similar morphotype, and are often only clearly separable by molecular data. Cyrtodactylus, the most diverse gecko genus of the family Gekkonidae, is a prime example, because many morphologically similar taxa have only recently been identified as new species as a result of available genetic evidence. However, while cryptic diversity of Cyrtodactylus is already well documented on the Vietnamese side of the Truong Son range, only scarce data is available from central Laos. In this study, we address this issue by means of an integrative approach, which employs morphological, molecular, and ecological data to distinguish cryptic species of the Cyrtodacylus phongnhakebangensis species group primarily distributed along the northern Truong Son Range. Our analyses based on 12 selected morphological characters, a partial mitochondrial gene (COI), and five ecological parameters revealed three undescribed cryptic Cyrtodactylus species from Hin Nam No National Protected Area, which are described as Cyrtodactylus calamei sp. nov., Cyrtodactylus hinnamnoensis sp. nov., and Cyrtodactylus sommerladi sp. nov. A fourth discovered Cyrtodactylus population in Hin Nam No proved to be the first country record of C. cryptus for Laos. Our results highlight the importance of applying an integrative approach to resolving the taxonomy of complex and cryptic species groups, and the role of the Truong Son Range in maintaining the high level of biodiversity over time.

  15. Causes and methods to estimate cryptic sources of fishing mortality.

    PubMed

    Gilman, E; Suuronen, P; Hall, M; Kennelly, S

    2013-10-01

    Cryptic, not readily detectable, components of fishing mortality are not routinely accounted for in fisheries management because of a lack of adequate data, and for some components, a lack of accurate estimation methods. Cryptic fishing mortalities can cause adverse ecological effects, are a source of wastage, reduce the sustainability of fishery resources and, when unaccounted for, can cause errors in stock assessments and population models. Sources of cryptic fishing mortality are (1) pre-catch losses, where catch dies from the fishing operation but is not brought onboard when the gear is retrieved, (2) ghost-fishing mortality by fishing gear that was abandoned, lost or discarded, (3) post-release mortality of catch that is retrieved and then released alive but later dies as a result of stress and injury sustained from the fishing interaction, (4) collateral mortalities indirectly caused by various ecological effects of fishing and (5) losses due to synergistic effects of multiple interacting sources of stress and injury from fishing operations, or from cumulative stress and injury caused by repeated sub-lethal interactions with fishing operations. To fill a gap in international guidance on best practices, causes and methods for estimating each component of cryptic fishing mortality are described, and considerations for their effective application are identified. Research priorities to fill gaps in understanding the causes and estimating cryptic mortality are highlighted. © 2013 The Authors. Journal of Fish Biology © 2013 The Fisheries Society of the British Isles.

  16. Down-regulation of tryptamine binding sites following chronic molindone administration. A comparison with responses of dopamine and 5-hydroxytryptamine receptors.

    PubMed

    Nguyen, T V; Juorio, A V

    1989-10-01

    The present study assessed changes of tryptamine, dopamine D2, 5-HT1 and 5-HT2 binding sites in rat brain following chronic treatment with low (5 mg/kg/day) and high (40 mg/kg/day) doses of molindone, a clinically effective psychotropic drug. The high-dose molindone treatment produced a decrease in the number of tryptamine binding sites while both high and low doses caused an increase in the number of dopamine D2 binding sites in the striatum. No significant changes were observed in either 5-HT1 or 5-HT2 binding sites in the cerebral cortex. Competition binding experiments showed that molindone was a potent inhibitor at dopamine D2 but less effective at tryptamine, 5-HT1 and 5-HT2 binding sites. The inhibition activity of molindone towards type A monoamine oxidase produced a significant increase in endogenous tryptamine accumulation rate which was much higher than that of dopamine and 5-HT. These findings suggest that the reduction in the number of tryptamine binding sites produced by chronic molindone administration is related to monoamine oxidase inhibition and that the increase in the number of dopamine D2 binding sites is correlated to receptor blocking activity of the drug.

  17. Impact of germline and somatic missense variations on drug binding sites.

    PubMed

    Yan, C; Pattabiraman, N; Goecks, J; Lam, P; Nayak, A; Pan, Y; Torcivia-Rodriguez, J; Voskanian, A; Wan, Q; Mazumder, R

    2017-03-01

    Advancements in next-generation sequencing (NGS) technologies are generating a vast amount of data. This exacerbates the current challenge of translating NGS data into actionable clinical interpretations. We have comprehensively combined germline and somatic nonsynonymous single-nucleotide variations (nsSNVs) that affect drug binding sites in order to investigate their prevalence. The integrated data thus generated in conjunction with exome or whole-genome sequencing can be used to identify patients who may not respond to a specific drug because of alterations in drug binding efficacy due to nsSNVs in the target protein's gene. To identify the nsSNVs that may affect drug binding, protein-drug complex structures were retrieved from Protein Data Bank (PDB) followed by identification of amino acids in the protein-drug binding sites using an occluded surface method. Then, the germline and somatic mutations were mapped to these amino acids to identify which of these alter protein-drug binding sites. Using this method we identified 12 993 amino acid-drug binding sites across 253 unique proteins bound to 235 unique drugs. The integration of amino acid-drug binding sites data with both germline and somatic nsSNVs data sets revealed 3133 nsSNVs affecting amino acid-drug binding sites. In addition, a comprehensive drug target discovery was conducted based on protein structure similarity and conservation of amino acid-drug binding sites. Using this method, 81 paralogs were identified that could serve as alternative drug targets. In addition, non-human mammalian proteins bound to drugs were used to identify 142 homologs in humans that can potentially bind to drugs. In the current protein-drug pairs that contain somatic mutations within their binding site, we identified 85 proteins with significant differential gene expression changes associated with specific cancer types. Information on protein-drug binding predicted drug target proteins and prevalence of both somatic and germline nsSNVs that disrupt these binding sites can provide valuable knowledge for personalized medicine treatment. A web portal is available where nsSNVs from individual patient can be checked by scanning against DrugVar to determine whether any of the SNVs affect the binding of any drug in the database.

  18. Patterns and plasticity in RNA-protein interactions enable recruitment of multiple proteins through a single site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Valley, Cary T.; Porter, Douglas F.; Qiu, Chen

    2012-06-28

    mRNA control hinges on the specificity and affinity of proteins for their RNA binding sites. Regulatory proteins must bind their own sites and reject even closely related noncognate sites. In the PUF [Pumilio and fem-3 binding factor (FBF)] family of RNA binding proteins, individual proteins discriminate differences in the length and sequence of binding sites, allowing each PUF to bind a distinct battery of mRNAs. Here, we show that despite these differences, the pattern of RNA interactions is conserved among PUF proteins: the two ends of the PUF protein make critical contacts with the two ends of the RNA sites.more » Despite this conserved 'two-handed' pattern of recognition, the RNA sequence is flexible. Among the binding sites of yeast Puf4p, RNA sequence dictates the pattern in which RNA bases are flipped away from the binding surface of the protein. Small differences in RNA sequence allow new modes of control, recruiting Puf5p in addition to Puf4p to a single site. This embedded information adds a new layer of biological meaning to the connections between RNA targets and PUF proteins.« less

  19. Thermodynamic compensation upon binding to exosite 1 and the active site of thrombin.

    PubMed

    Treuheit, Nicholas A; Beach, Muneera A; Komives, Elizabeth A

    2011-05-31

    Several lines of experimental evidence including amide exchange and NMR suggest that ligands binding to thrombin cause reduced backbone dynamics. Binding of the covalent inhibitor dPhe-Pro-Arg chloromethyl ketone to the active site serine, as well as noncovalent binding of a fragment of the regulatory protein, thrombomodulin, to exosite 1 on the back side of the thrombin molecule both cause reduced dynamics. However, the reduced dynamics do not appear to be accompanied by significant conformational changes. In addition, binding of ligands to the active site does not change the affinity of thrombomodulin fragments binding to exosite 1; however, the thermodynamic coupling between exosite 1 and the active site has not been fully explored. We present isothermal titration calorimetry experiments that probe changes in enthalpy and entropy upon formation of binary ligand complexes. The approach relies on stringent thrombin preparation methods and on the use of dansyl-l-arginine-(3-methyl-1,5-pantanediyl)amide and a DNA aptamer as ligands with ideal thermodynamic signatures for binding to the active site and to exosite 1. Using this approach, the binding thermodynamic signatures of each ligand alone as well as the binding signatures of each ligand when the other binding site was occupied were measured. Different exosite 1 ligands with widely varied thermodynamic signatures cause a similar reduction in ΔH and a concomitantly lower entropy cost upon DAPA binding at the active site. The results suggest a general phenomenon of enthalpy-entropy compensation consistent with reduction of dynamics/increased folding of thrombin upon ligand binding to either the active site or exosite 1.

  20. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dissanayake, V.U.; Hughes, J.; Hunter, J.C.

    The specific binding of the selective {mu}-, {delta}-, and {kappa}-opioid ligands (3H)(D-Ala2,MePhe4,Gly-ol5)enkephalin ((3H) DAGOL), (3H)(D-Pen2,D-Pen5)enkephalin ((3H)DPDPE), and (3H)U69593, respectively, to crude membranes of the guinea pig and rat whole kidney, kidney cortex, and kidney medulla was investigated. In addition, the distribution of specific 3H-opioid binding sites in the guinea pig and rat kidney was visualized by autoradiography. Homogenate binding and autoradiography demonstrated the absence of {mu}- and {kappa}-opioid binding sites in the guinea pig kidney. No opioid binding sites were demonstrable in the rat kidney. In the guinea pig whole kidney, cortex, and medulla, saturation studies demonstrated that (3H)DPDPE boundmore » with high affinity (KD = 2.6-3.5 nM) to an apparently homogeneous population of binding sites (Bmax = 8.4-30 fmol/mg of protein). Competition studies using several opioid compounds confirmed the nature of the {delta}-opioid binding site. Autoradiography experiments demonstrated that specific (3H)DPDPE binding sites were distributed radially in regions of the inner and outer medulla and at the corticomedullary junction of the guinea pig kidney. Computer-assisted image analysis of saturation data yielded KD values (4.5-5.0 nM) that were in good agreement with those obtained from the homogenate binding studies. Further investigation of the {delta}-opioid binding site in medulla homogenates, using agonist ((3H)DPDPE) and antagonist ((3H)diprenorphine) binding in the presence of Na+, Mg2+, and nucleotides, suggested that the {delta}-opioid site is linked to a second messenger system via a GTP-binding protein. Further studies are required to establish the precise localization of the {delta} binding site in the guinea pig kidney and to determine the nature of the second messenger linked to the GTP-binding protein in the medulla.« less

  1. Evaluation of simultaneous binding of Chromomycin A3 to the multiple sites of DNA by the new restriction enzyme assay.

    PubMed

    Murase, Hirotaka; Noguchi, Tomoharu; Sasaki, Shigeki

    2018-06-01

    Chromomycin A3 (CMA3) is an aureolic acid-type antitumor antibiotic. CMA3 forms dimeric complexes with divalent cations, such as Mg 2+ , which strongly binds to the GC rich sequence of DNA to inhibit DNA replication and transcription. In this study, the binding property of CMA3 to the DNA sequence containing multiple GC-rich binding sites was investigated by measuring the protection from hydrolysis by the restriction enzymes, AccII and Fnu4HI, for the center of the CGCG site and the 5'-GC↓GGC site, respectively. In contrast to the standard DNase I footprinting method, the DNA substrates are fully hydrolyzed by the restriction enzymes, therefore, the full protection of DNA at all the cleavable sites indicates that CMA3 simultaneously binds to all the binding sites. The restriction enzyme assay has suggested that CMA3 has a high tendency to bind the successive CGCG sites and the CGG repeat. Copyright © 2018 Elsevier Ltd. All rights reserved.

  2. Distinct p53 genomic binding patterns in normal and cancer-derived human cells

    PubMed Central

    McCorkle, Sean R; McCombie, WR; Dunn, John J

    2011-01-01

    Here, we report genome-wide analysis of the tumor suppressor p53 binding sites in normal human cells. 743 high-confidence ChIP-seq peaks representing putative genomic binding sites were identified in normal IMR90 fibroblasts using a reference chromatin sample. More than 40% were located within 2 kb of a transcription start site (TSS), a distribution similar to that documented for individually studied, functional p53 binding sites and, to date, not observed by previous p53 genome-wide studies. Nearly half of the high-confidence binding sites in the IMR90 cells reside in CpG islands in marked contrast to sites reported in cancer-derived cells. The distinct genomic features of the IMR90 binding sites do not reflect a distinct preference for specific sequences, since the de novo developed p53 motif based on our study is similar to those reported by genome-wide studies of cancer cells. More likely, the different chromatin landscape in normal, compared with cancer-derived cells, influences p53 binding via modulating availability of the sites. We compared the IMR90 ChIP-seq peaks to the recently published IMR90 methylome1 and demonstrated that they are enriched at hypomethylated DNA. Our study represents the first genome-wide, de novo mapping of p53 binding sites in normal human cells and reveals that p53 binding sites reside in distinct genomic landscapes in normal and cancer-derived human cells. PMID:22127205

  3. Ethylene binding site affinity in ripening apples

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Blankenship, S.M.; Sisler, E.C.

    1993-09-01

    Scatchard plots for ethylene binding in apples (Malus domestica Borkh.), which were harvested weekly for 5 weeks to include the ethylene climacteric rise, showed C[sub 50] values (concentration of ethylene needed to occupy 50% of the ethylene binding sites) of 0.10, 0.11, 0.34, 0.40, and 0.57 [mu]l ethylene/liter[sup [minus]1], respectively, for each of the 5 weeks. Higher ethylene concentrations were required to saturate the binding sites during the climacteric rise than at other times. Diffusion of [sup 14]C-ethylene from the binding sites was curvilinear and did not show any indication of multiple binding sites. Ethylene was not metabolized by applemore » tissue.« less

  4. Physical interaction of the activator protein-1 factors c-Fos and c-Jun with Cbfa1 for collagenase-3 promoter activation

    NASA Technical Reports Server (NTRS)

    D'Alonzo, Richard C.; Selvamurugan, Nagarajan; Karsenty, Gerard; Partridge, Nicola C.

    2002-01-01

    Previously, we determined that the activator protein-1 (AP-1)-binding site and the runt domain (RD)-binding site and their binding proteins, c-Fos.c-Jun and Cbfa, regulate the collagenase-3 promoter in parathyroid hormone-treated and differentiating osteoblasts. Here we show that Cbfa1 and c-Fos.c-Jun appear to cooperatively bind the RD- and AP-1-binding sites and form ternary structures in vitro. Both in vitro and in vivo co-immunoprecipitation and yeast two-hybrid studies further demonstrate interaction between Cbfa1 with c-Fos and c-Jun in the absence of phosphorylation and without binding to DNA. Additionally, only the runt domain of Cbfa1 was required for interaction with c-Jun and c-Fos. In mammalian cells, overexpression of Cbfa1 enhanced c-Jun activation of AP-1-binding site promoter activity, demonstrating functional interaction. Finally, insertion of base pairs that disrupted the helical phasing between the AP-1- and RD-binding sites also inhibited collagenase-3 promoter activation. Thus, we provide direct evidence that Cbfa1 and c-Fos.c-Jun physically interact and cooperatively bind the AP-1- and RD-binding sites in the collagenase-3 promoter. Moreover, the AP-1- and RD-binding sites appear to be organized in a specific required helical arrangement that facilitates transcription factor interaction and enables promoter activation.

  5. The Trouble with MEAM2: Implications of Pseudogenes on Species Delimitation in the Globally Invasive Bemisia tabaci (Hemiptera: Aleyrodidae) Cryptic Species Complex.

    PubMed

    Tay, Wee Tek; Elfekih, Samia; Court, Leon N; Gordon, Karl H J; Delatte, Hélène; De Barro, Paul J

    2017-10-01

    Molecular species identification using suboptimal PCR primers can over-estimate species diversity due to coamplification of nuclear mitochondrial (NUMT) DNA/pseudogenes. For the agriculturally important whitefly Bemisia tabaci cryptic pest species complex, species identification depends primarily on characterization of the mitochondrial DNA cytochrome oxidase I (mtDNA COI) gene. The lack of robust PCR primers for the mtDNA COI gene can undermine correct species identification which in turn compromises management strategies. This problem is identified in the B. tabaci Africa/Middle East/Asia Minor clade which comprises the globally invasive Mediterranean (MED) and Middle East Asia Minor I (MEAM1) species, Middle East Asia Minor 2 (MEAM2), and the Indian Ocean (IO) species. Initially identified from the Indian Ocean island of Réunion, MEAM2 has since been reported from Japan, Peru, Turkey and Iraq. We identified MEAM2 individuals from a Peruvian population via Sanger sequencing of the mtDNA COI gene. In attempting to characterize the MEAM2 mitogenome, we instead characterized mitogenomes of MEAM1. We also report on the mitogenomes of MED, AUS, and IO thereby increasing genomic resources for members of this complex. Gene synteny (i.e., same gene composition and orientation) was observed with published B. tabaci cryptic species mitogenomes. Pseudogene fragments matching MEAM2 partial mtDNA COI gene exhibited low frequency single nucleotide polymorphisms that matched low copy number DNA fragments (<3%) of MEAM1 genomes, whereas presence of internal stop codons, loss of expected stop codons and poor primer annealing sites, all suggested MEAM2 as a pseudogene artifact and so not a real species. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  6. [Construction of screening system for mutation of negative regulatory genes in Streptomyces].

    PubMed

    Zhu, Yu; Feng, Chi; Tan, Huarong; Tian, Yuqing

    2013-10-04

    We aimed to create a novel report system for screening the mutation of the negative regulatory genes, especially for those repressing the expression of cryptic antibiotics clusters. We used marker-free gene disruption strategy, which combines with the "REDIRECT (Rapid Efficient Directed Recombination Time Saving)" technology and in vivo site-specific recombination by Streptomyces phage phiBT1 integrase, to construct a scbR2/inoA double mutant strain of S. coelicolor M145. This strain was used as the host of the report system. For the construction of the reporter plasmid, the ScbR2 repressed promoter of cpkO from CPK (cryptic polyketide) cluster was used to drive the expression of a promoterless conserved gene inoA of S. coelicolor. Then the reporter plasmid was introduced into the host strain described above to test the availability of inoA as a reporter gene in this system. The scbR2/inoA double mutant strain gave rise to a bald pheno type on MM medium in the absence of inositol, and produced yellow pigmented secondary metabolite by the disruption of scbR2 to release the repression of cpkO, a pathway specific activator gene situated in CPK cluster. After introducing the reporter plasmid into this test stain, the resulting strain recovered the phenotype as wild-type strain, indicating that the promoter of cpkO can drive the expression of inoA in scbR2 mutant and consequently restore the biosynthesis of inositol. Our results indicated that inoA can be used as a novel reporter gene for Streptomyces, especially for detecting the activation of the "silent" promoter. This report system might be available for screening the mutation of the negative regulatory genes for the cryptic secondary metabolic gene clusters.

  7. Functional identification and characterization of sodium binding sites in Na symporters

    PubMed Central

    Loo, Donald D. F.; Jiang, Xuan; Gorraitz, Edurne; Hirayama, Bruce A.; Wright, Ernest M.

    2013-01-01

    Sodium cotransporters from several different gene families belong to the leucine transporter (LeuT) structural family. Although the identification of Na+ in binding sites is beyond the resolution of the structures, two Na+ binding sites (Na1 and Na2) have been proposed in LeuT. Na2 is conserved in the LeuT family but Na1 is not. A biophysical method has been used to measure sodium dissociation constants (Kd) of wild-type and mutant human sodium glucose cotransport (hSGLT1) proteins to identify the Na+ binding sites in hSGLT1. The Na1 site is formed by residues in the sugar binding pocket, and their mutation influences sodium binding to Na1 but not to Na2. For the canonical Na2 site formed by two –OH side chains, S392 and S393, and three backbone carbonyls, mutation of S392 to cysteine increased the sodium Kd by sixfold. This was accompanied by a dramatic reduction in the apparent sugar and phlorizin affinities. We suggest that mutation of S392 in the Na2 site produces a structural rearrangement of the sugar binding pocket to disrupt both the binding of the second Na+ and the binding of sugar. In contrast, the S393 mutations produce no significant changes in sodium, sugar, and phlorizin affinities. We conclude that the Na2 site is conserved in hSGLT1, the side chain of S392 and the backbone carbonyl of S393 are important in the first Na+ binding, and that Na+ binding to Na2 promotes binding to Na1 and also sugar binding. PMID:24191006

  8. Inactivation by Phenylglyoxal of the Specific Binding of 1-Naphthyl Acetic Acid with Membrane-Bound Auxin Binding Sites from Maize Coleoptiles

    PubMed Central

    Navé, Jean-François; Benveniste, Pierre

    1984-01-01

    The specific binding of 1-[3H]naphthyl acetic acid (NAA) to membrane-bound binding sites from maize (Zea mays cv INRA 258) coleoptiles is inactivated by phenylglyoxal. The inactivation obeys pseudo first-order kinetics. The rate of inactivation is proportional to phenylglyoxal concentration. Under conditions at which significant binding occurs, NAA, R and S-1-naphthyl 2-propionic acids protect the auxin binding site against inactivation by phenylglyoxal. Scatchard analysis shows that the inhibition of binding corresponds to a decrease in the concentration of sites but not in the affinity. The results of the present chemical modification study indicate that at least one arginyl residue is involved in the positively charged recognition site of the carboxylate anion of NAA. PMID:16663499

  9. High levels of cryptic species diversity uncovered in Amazonian frogs

    PubMed Central

    Funk, W. Chris; Caminer, Marcel; Ron, Santiago R.

    2012-01-01

    One of the greatest challenges for biodiversity conservation is the poor understanding of species diversity. Molecular methods have dramatically improved our ability to uncover cryptic species, but the magnitude of cryptic diversity remains unknown, particularly in diverse tropical regions such as the Amazon Basin. Uncovering cryptic diversity in amphibians is particularly pressing because amphibians are going extinct globally at an alarming rate. Here, we use an integrative analysis of two independent Amazonian frog clades, Engystomops toadlets and Hypsiboas treefrogs, to test whether species richness is underestimated and, if so, by how much. We sampled intensively in six countries with a focus in Ecuador (Engystomops: 252 individuals from 36 localities; Hypsiboas: 208 individuals from 65 localities) and combined mitochondrial DNA, nuclear DNA, morphological, and bioacoustic data to detect cryptic species. We found that in both clades, species richness was severely underestimated, with more undescribed species than described species. In Engystomops, the two currently recognized species are actually five to seven species (a 150–250% increase in species richness); in Hypsiboas, two recognized species represent six to nine species (a 200–350% increase). Our results suggest that Amazonian frog biodiversity is much more severely underestimated than previously thought. PMID:22130600

  10. High-model abundance may permit the gradual evolution of Batesian mimicry: an experimental test

    PubMed Central

    Kikuchi, David W.; Pfennig, David W.

    2010-01-01

    In Batesian mimicry, a harmless species (the ‘mimic’) resembles a dangerous species (the ‘model’) and is thus protected from predators. It is often assumed that the mimetic phenotype evolves from a cryptic phenotype, but it is unclear how a population can transition through intermediate phenotypes; such intermediates may receive neither the benefits of crypsis nor mimicry. Here, we ask if selection against intermediates weakens with increasing model abundance. We also ask if mimicry has evolved from cryptic phenotypes in a mimetic clade. We first present an ancestral character-state reconstruction showing that mimicry of a coral snake (Micrurus fulvius) by the scarlet kingsnake (Lampropeltis elapsoides) evolved from a cryptic phenotype. We then evaluate predation rates on intermediate phenotypes relative to cryptic and mimetic phenotypes under conditions of both high- and low-model abundances. Our results indicate that where coral snakes are rare, intermediate phenotypes are attacked more often than cryptic and mimetic phenotypes, indicating the presence of an adaptive valley. However, where coral snakes are abundant, intermediate phenotypes are not attacked more frequently, resulting in an adaptive landscape without a valley. Thus, high-model abundance may facilitate the evolution of Batesian mimicry. PMID:19955153

  11. High-model abundance may permit the gradual evolution of Batesian mimicry: an experimental test.

    PubMed

    Kikuchi, David W; Pfennig, David W

    2010-04-07

    In Batesian mimicry, a harmless species (the 'mimic') resembles a dangerous species (the 'model') and is thus protected from predators. It is often assumed that the mimetic phenotype evolves from a cryptic phenotype, but it is unclear how a population can transition through intermediate phenotypes; such intermediates may receive neither the benefits of crypsis nor mimicry. Here, we ask if selection against intermediates weakens with increasing model abundance. We also ask if mimicry has evolved from cryptic phenotypes in a mimetic clade. We first present an ancestral character-state reconstruction showing that mimicry of a coral snake (Micrurus fulvius) by the scarlet kingsnake (Lampropeltis elapsoides) evolved from a cryptic phenotype. We then evaluate predation rates on intermediate phenotypes relative to cryptic and mimetic phenotypes under conditions of both high- and low-model abundances. Our results indicate that where coral snakes are rare, intermediate phenotypes are attacked more often than cryptic and mimetic phenotypes, indicating the presence of an adaptive valley. However, where coral snakes are abundant, intermediate phenotypes are not attacked more frequently, resulting in an adaptive landscape without a valley. Thus, high-model abundance may facilitate the evolution of Batesian mimicry.

  12. Cryptic introductions and the interpretation of island biodiversity.

    PubMed

    Avery, Julian D; Fonseca, Dina M; Campagne, Pascal; Lockwood, Julie L

    2013-04-01

    Species with cryptic origins (i.e. those that cannot be reliably classed as native or non-native) present a particular challenge to our understanding of the generation and maintenance of biodiversity. Such species may be especially common on islands given that some islands have had a relatively recent history of human settlement. It is likely that select island species considered native might have achieved their current distributions via direct or indirect human actions. As an example, we explore the origins of eastern bluebirds (Sialia sialis bermudensis) on the island of Bermuda. Considered native to the island and a distinct subspecies, this population has diverged in morphology relative to mainland North America. Using microsatellite markers and simulation of island colonization, we show that the Bermuda population of bluebirds is the likely result of a single colonization event that occurred during the 1600s, making this a cryptic invader. To our knowledge, this is one of the youngest examples of a terrestrial vertebrate cryptic invader. We suggest that the eastern bluebird is not an isolated case of cryptic invader on either Bermuda or elsewhere and that caution be exercised when studying present-day distributions of organisms. © 2013 Blackwell Publishing Ltd.

  13. Molecular blueprint of allosteric binding sites in a homologue of the agonist-binding domain of the α7 nicotinic acetylcholine receptor

    PubMed Central

    Spurny, Radovan; Debaveye, Sarah; Farinha, Ana; Veys, Ken; Vos, Ann M.; Gossas, Thomas; Atack, John; Bertrand, Sonia; Bertrand, Daniel; Danielson, U. Helena; Tresadern, Gary; Ulens, Chris

    2015-01-01

    The α7 nicotinic acetylcholine receptor (nAChR) belongs to the family of pentameric ligand-gated ion channels and is involved in fast synaptic signaling. In this study, we take advantage of a recently identified chimera of the extracellular domain of the native α7 nicotinic acetylcholine receptor and acetylcholine binding protein, termed α7-AChBP. This chimeric receptor was used to conduct an innovative fragment-library screening in combination with X-ray crystallography to identify allosteric binding sites. One allosteric site is surface-exposed and is located near the N-terminal α-helix of the extracellular domain. Ligand binding at this site causes a conformational change of the α-helix as the fragment wedges between the α-helix and a loop homologous to the main immunogenic region of the muscle α1 subunit. A second site is located in the vestibule of the receptor, in a preexisting intrasubunit pocket opposite the agonist binding site and corresponds to a previously identified site involved in positive allosteric modulation of the bacterial homolog ELIC. A third site is located at a pocket right below the agonist binding site. Using electrophysiological recordings on the human α7 nAChR we demonstrate that the identified fragments, which bind at these sites, can modulate receptor activation. This work presents a structural framework for different allosteric binding sites in the α7 nAChR and paves the way for future development of novel allosteric modulators with therapeutic potential. PMID:25918415

  14. Muscarinic binding sites in cultured bovine pulmonary arterial endothelial cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Aronstam, R.S.; Catravas, J.D.; Ryan, U.S.

    The authors have previously reported a) the presence of muscarinic binding sites on cultured bovine pulmonary arterial endothelial cells (BPAE; 2,000 sites/cell) and b) that acetylcholine inhibits the release of thromboxane B/sub 2/ fro BPAE. Since the authors findings could reflect muscarinic receptors (mAChR) on BPAE, they have further investigated the nature of BPAE muscarinic binding sites and contrast them to those of known functional mAChR. Muscarinic binding sites on BPAE resembled mAChR in that a) the binding of 3 nM /sup 3/H QNB was inhibited by muscarinic agonists and antagonists; b) /sup 3/H QNB binding was 30 times moremore » sensitive to R(-)- than to S(+)-QNB; c) carbamylcholine binding was resolved into high and low affinity components (IC50's = 0.04 and 2 ..mu..M; d) 5'-guanylylimidodiphosphate (100 ..mu..M) shifted agonist binding curves to the right by a factor of 3; 4) the atropine-sensitive binding of /sup 3/H oxotremorine-M (/sup 3/H-OXO-M) was depressed by the guanine nucleotide (IC50 + 60 ..mu..M). However, although gallamine allosterically regulates mAChR binding in other tissues, it did not affect the rates of dissociation of /sup 3/H QNB, /sup 3/H methylscopolamine or /sup 3/H OXO-M from BPAE binding sites. Thus, BPAE muscarinic binding sites posses many but not all of the properties associated with functional mAChR.« less

  15. Autoradiographic localization of endothelin-1 binding sites in porcine skin

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhao, Y.D.; Springall, D.R.; Wharton, J.

    Autoradiographic techniques and {sup 125}I-labeled endothelin-1 were used to study the distribution of endothelin-1 binding sites in porcine skin. Specific endothelin-1 binding sites were localized to blood vessels (capillaries, deep cutaneous vascular plexus, arteries, and arterioles), the deep dermal and connective tissue sheath of hair follicles, sebaceous and sweat glands, and arrector pili muscle. Specific binding was inhibited by endothelin-2 and endothelin-3 as well as endothelin-1. Non-specific binding was found in the epidermis and the medulla of hair follicles. No binding was found in connective tissue or fat. These vascular binding sites may represent endothelin receptors, in keeping with themore » known cutaneous vasoconstrictor actions of the peptide. If all binding sites are receptors, the results suggest that endothelin could also regulate the function of sweat glands and may have trophic effects in the skin.« less

  16. Activation of both acfA and acfD transcription by Vibrio cholerae ToxT requires binding to two centrally located DNA sites in an inverted repeat conformation.

    PubMed

    Withey, Jeffrey H; DiRita, Victor J

    2005-05-01

    The Gram-negative bacterium Vibrio cholerae is the infectious agent responsible for the disease Asiatic cholera. The genes required for V. cholerae virulence, such as those encoding the cholera toxin (CT) and toxin-coregulated pilus (TCP), are controlled by a cascade of transcriptional activators. Ultimately, the direct transcriptional activator of the majority of V. cholerae virulence genes is the AraC/XylS family member ToxT protein, the expression of which is activated by the ToxR and TcpP proteins. Previous studies have identified the DNA sites to which ToxT binds upstream of the ctx operon, encoding CT, and the tcpA operon, encoding, among other products, the major subunit of the TCP. These known ToxT binding sites are seemingly dissimilar in sequence other than being A/T rich. Further results suggested that ctx and tcpA each has a pair of ToxT binding sites arranged in a direct repeat orientation upstream of the core promoter elements. In this work, using both transcriptional lacZ fusions and in vitro copper-phenanthroline footprinting experiments, we have identified the ToxT binding sites between the divergently transcribed acfA and acfD genes, which encode components of the accessory colonization factor required for efficient intestinal colonization by V. cholerae. Our results indicate that ToxT binds to a pair of DNA sites between acfA and acfD in an inverted repeat orientation. Moreover, a mutational analysis of the ToxT binding sites indicates that both binding sites are required by ToxT for transcriptional activation of both acfA and acfD. Using copper-phenanthroline footprinting to assess the occupancy of ToxT on DNA having mutations in one of these binding sites, we found that protection by ToxT of the unaltered binding site was not affected, whereas protection by ToxT of the mutant binding site was significantly reduced in the region of the mutations. The results of further footprinting experiments using DNA templates having +5 bp and +10 bp insertions between the two ToxT binding sites indicate that both binding sites are occupied by ToxT regardless of their positions relative to each other. Based on these results, we propose that ToxT binds independently to two DNA sites between acfA and acfD to activate transcription of both genes.

  17. MONKEY: Identifying conserved transcription-factor binding sitesin multiple alignments using a binding site-specific evolutionarymodel

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Moses, Alan M.; Chiang, Derek Y.; Pollard, Daniel A.

    2004-10-28

    We introduce a method (MONKEY) to identify conserved transcription-factor binding sites in multispecies alignments. MONKEY employs probabilistic models of factor specificity and binding site evolution, on which basis we compute the likelihood that putative sites are conserved and assign statistical significance to each hit. Using genomes from the genus Saccharomyces, we illustrate how the significance of real sites increases with evolutionary distance and explore the relationship between conservation and function.

  18. In silico evolution of the Drosophila gap gene regulatory sequence under elevated mutational pressure.

    PubMed

    Chertkova, Aleksandra A; Schiffman, Joshua S; Nuzhdin, Sergey V; Kozlov, Konstantin N; Samsonova, Maria G; Gursky, Vitaly V

    2017-02-07

    Cis-regulatory sequences are often composed of many low-affinity transcription factor binding sites (TFBSs). Determining the evolutionary and functional importance of regulatory sequence composition is impeded without a detailed knowledge of the genotype-phenotype map. We simulate the evolution of regulatory sequences involved in Drosophila melanogaster embryo segmentation during early development. Natural selection evaluates gene expression dynamics produced by a computational model of the developmental network. We observe a dramatic decrease in the total number of transcription factor binding sites through the course of evolution. Despite a decrease in average sequence binding energies through time, the regulatory sequences tend towards organisations containing increased high affinity transcription factor binding sites. Additionally, the binding energies of separate sequence segments demonstrate ubiquitous mutual correlations through time. Fewer than 10% of initial TFBSs are maintained throughout the entire simulation, deemed 'core' sites. These sites have increased functional importance as assessed under wild-type conditions and their binding energy distributions are highly conserved. Furthermore, TFBSs within close proximity of core sites exhibit increased longevity, reflecting functional regulatory interactions with core sites. In response to elevated mutational pressure, evolution tends to sample regulatory sequence organisations with fewer, albeit on average, stronger functional transcription factor binding sites. These organisations are also shaped by the regulatory interactions among core binding sites with sites in their local vicinity.

  19. Prediction of Carbohydrate Binding Sites on Protein Surfaces with 3-Dimensional Probability Density Distributions of Interacting Atoms

    PubMed Central

    Tsai, Keng-Chang; Jian, Jhih-Wei; Yang, Ei-Wen; Hsu, Po-Chiang; Peng, Hung-Pin; Chen, Ching-Tai; Chen, Jun-Bo; Chang, Jeng-Yih; Hsu, Wen-Lian; Yang, An-Suei

    2012-01-01

    Non-covalent protein-carbohydrate interactions mediate molecular targeting in many biological processes. Prediction of non-covalent carbohydrate binding sites on protein surfaces not only provides insights into the functions of the query proteins; information on key carbohydrate-binding residues could suggest site-directed mutagenesis experiments, design therapeutics targeting carbohydrate-binding proteins, and provide guidance in engineering protein-carbohydrate interactions. In this work, we show that non-covalent carbohydrate binding sites on protein surfaces can be predicted with relatively high accuracy when the query protein structures are known. The prediction capabilities were based on a novel encoding scheme of the three-dimensional probability density maps describing the distributions of 36 non-covalent interacting atom types around protein surfaces. One machine learning model was trained for each of the 30 protein atom types. The machine learning algorithms predicted tentative carbohydrate binding sites on query proteins by recognizing the characteristic interacting atom distribution patterns specific for carbohydrate binding sites from known protein structures. The prediction results for all protein atom types were integrated into surface patches as tentative carbohydrate binding sites based on normalized prediction confidence level. The prediction capabilities of the predictors were benchmarked by a 10-fold cross validation on 497 non-redundant proteins with known carbohydrate binding sites. The predictors were further tested on an independent test set with 108 proteins. The residue-based Matthews correlation coefficient (MCC) for the independent test was 0.45, with prediction precision and sensitivity (or recall) of 0.45 and 0.49 respectively. In addition, 111 unbound carbohydrate-binding protein structures for which the structures were determined in the absence of the carbohydrate ligands were predicted with the trained predictors. The overall prediction MCC was 0.49. Independent tests on anti-carbohydrate antibodies showed that the carbohydrate antigen binding sites were predicted with comparable accuracy. These results demonstrate that the predictors are among the best in carbohydrate binding site predictions to date. PMID:22848404

  20. Selective labeling of serotonin uptake sites in rat brain by (/sup 3/H)citalopram contrasted to labeling of multiple sites by (/sup 3/H)imipramine

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    D'Amato, R.J.; Largent, B.L.; Snowman, A.M.

    1987-07-01

    Citalopram is a potent and selective inhibitor of neuronal serotonin uptake. In rat brain membranes (/sup 3/H)citalopram demonstrates saturable and reversible binding with a KD of 0.8 nM and a maximal number of binding sites (Bmax) of 570 fmol/mg of protein. The drug specificity for (/sup 3/H)citalopram binding and synaptosomal serotonin uptake are closely correlated. Inhibition of (/sup 3/H)citalopram binding by both serotonin and imipramine is consistent with a competitive interaction in both equilibrium and kinetic analyses. The autoradiographic pattern of (/sup 3/H)citalopram binding sites closely resembles the distribution of serotonin. By contrast, detailed equilibrium-saturation analysis of (/sup 3/H)imipramine bindingmore » reveals two binding components, i.e., high affinity (KD = 9 nM, Bmax = 420 fmol/mg of protein) and low affinity (KD = 553 nM, Bmax = 8560 fmol/mg of protein) sites. Specific (/sup 3/H)imipramine binding, defined as the binding inhibited by 100 microM desipramine, is displaced only partially by serotonin. Various studies reveal that the serotonin-sensitive portion of binding corresponds to the high affinity sites of (/sup 3/H)imipramine binding whereas the serotonin-insensitive binding corresponds to the low affinity sites. Lesioning of serotonin neurons with p-chloroamphetamine causes a large decrease in (/sup 3/H)citalopram and serotonin-sensitive (/sup 3/H)imipramine binding with only a small effect on serotonin-insensitive (/sup 3/H)imipramine binding. The dissociation rate of (/sup 3/H)imipramine or (/sup 3/H)citalopram is not altered by citalopram, imipramine or serotonin up to concentrations of 10 microM. The regional distribution of serotonin sensitive (/sup 3/H)imipramine high affinity binding sites closely resembles that of (/sup 3/H)citalopram binding.« less

  1. Computational assessment of the cooperativity between RNA binding proteins and MicroRNAs in Transcript Decay.

    PubMed

    Jiang, Peng; Singh, Mona; Coller, Hilary A

    2013-01-01

    Transcript degradation is a widespread and important mechanism for regulating protein abundance. Two major regulators of transcript degradation are RNA Binding Proteins (RBPs) and microRNAs (miRNAs). We computationally explored whether RBPs and miRNAs cooperate to promote transcript decay. We defined five RBP motifs based on the evolutionary conservation of their recognition sites in 3'UTRs as the binding motifs for Pumilio (PUM), U1A, Fox-1, Nova, and UAUUUAU. Recognition sites for some of these RBPs tended to localize at the end of long 3'UTRs. A specific group of miRNA recognition sites were enriched within 50 nts from the RBP recognition sites for PUM and UAUUUAU. The presence of both a PUM recognition site and a recognition site for preferentially co-occurring miRNAs was associated with faster decay of the associated transcripts. For PUM and its co-occurring miRNAs, binding of the RBP to its recognition sites was predicted to release nearby miRNA recognition sites from RNA secondary structures. The mammalian miRNAs that preferentially co-occur with PUM binding sites have recognition seeds that are reverse complements to the PUM recognition motif. Their binding sites have the potential to form hairpin secondary structures with proximal PUM binding sites that would normally limit RISC accessibility, but would be more accessible to miRNAs in response to the binding of PUM. In sum, our computational analyses suggest that a specific set of RBPs and miRNAs work together to affect transcript decay, with the rescue of miRNA recognition sites via RBP binding as one possible mechanism of cooperativity.

  2. Zn(II) stimulation of Fe(II)-activated repression in the iron-dependent repressor from Mycobacterium tuberculosis.

    PubMed

    Stapleton, Brian; Walker, Lawrence R; Logan, Timothy M

    2013-03-19

    Thermodynamic measurements of Fe(II) binding and activation of repressor function in the iron-dependent repressor from Mycobacterium tuberculosis (IdeR) are reported. IdeR, a member of the diphtheria toxin repressor family of proteins, regulates iron homeostasis and contributes to the virulence response in M. tuberculosis. Although iron is the physiological ligand, this is the first detailed analysis of iron binding and activation in this protein. The results showed that IdeR binds 2 equiv of Fe(II) with dissociation constants that differ by a factor of 25. The high- and low-affinity iron binding sites were assigned to physical binding sites I and II, respectively, using metal binding site mutants. IdeR was also found to contain a high-affinity Zn(II) binding site that was assigned to physical metal binding site II through the use of binding site mutants and metal competition assays. Fe(II) binding was modestly weaker in the presence of Zn(II), but the coupled metal binding-DNA binding affinity was significantly stronger, requiring 30-fold less Fe(II) to activate DNA binding compared to Fe(II) alone. Together, these results suggest that IdeR is a mixed-metal repressor, where Zn(II) acts as a structural metal and Fe(II) acts to trigger the physiologically relevant promoter binding. This new model for IdeR activation provides a better understanding of IdeR and the biology of iron homeostasis in M. tuberculosis.

  3. Sigma opiates and certain antipsychotic drugs mutually inhibit (+)-[3H] SKF 10,047 and [3H]haloperidol binding in guinea pig brain membranes.

    PubMed Central

    Tam, S W; Cook, L

    1984-01-01

    The relationship between binding of antipsychotic drugs and sigma psychotomimetic opiates to binding sites for the sigma agonist (+)-[3H]SKF 10,047 (N-allylnormetazocine) and to dopamine D2 sites was investigated. In guinea pig brain membranes, (+)-[3H]SKF 10,047 bound to a single class of sites with a Kd of 4 X 10(-8) M and a Bmax of 333 fmol/mg of protein. This binding was different from mu, kappa, or delta opiate receptor binding. It was inhibited by opiates that produce psychotomimetic activities but not by opiates that lack such activities. Some antipsychotic drugs inhibited (+)-[3H]SKF 10,047 binding with high to moderate affinities in the following order of potency: haloperidol greater than perphenazine greater than fluphenazine greater than acetophenazine greater than trifluoperazine greater than molindone greater than or equal to pimozide greater than or equal to thioridazine greater than or equal to chlorpromazine greater than or equal to triflupromazine. However, there were other antipsychotic drugs such as spiperone and clozapine that showed low affinity for the (+)-[3H]SKF 10,047 binding sites. Affinities of antipsychotic drugs for (+)-[3H]SKF 10,047 binding sites did not correlate with those for [3H]spiperone (dopamine D2) sites. [3H]-Haloperidol binding in whole brain membranes was also inhibited by the sigma opiates pentazocine, cyclazocine, and (+)-SKF 10,047. In the striatum, about half of the saturable [3H]haloperidol binding was to [3H]spiperone (D2) sites and the other half was to sites similar to (+)-[3H]SKF 10,047 binding sites. PMID:6147851

  4. Uncoupling metallonuclease metal ion binding sites via nudge mutagenesis.

    PubMed

    Papadakos, Grigorios A; Nastri, Horacio; Riggs, Paul; Dupureur, Cynthia M

    2007-05-01

    The hydrolysis of phosphodiester bonds by nucleases is critical to nucleic acid processing. Many nucleases utilize metal ion cofactors, and for a number of these enzymes two active-site metal ions have been detected. Testing proposed mechanistic roles for individual bound metal ions has been hampered by the similarity between the sites and cooperative behavior. In the homodimeric PvuII restriction endonuclease, the metal ion dependence of DNA binding is sigmoidal and consistent with two classes of coupled metal ion binding sites. We reasoned that a conservative active-site mutation would perturb the ligand field sufficiently to observe the titration of individual metal ion binding sites without significantly disturbing enzyme function. Indeed, mutation of a Tyr residue 5.5 A from both metal ions in the enzyme-substrate crystal structure (Y94F) renders the metal ion dependence of DNA binding biphasic: two classes of metal ion binding sites become distinct in the presence of DNA. The perturbation in metal ion coordination is supported by 1H-15N heteronuclear single quantum coherence spectra of enzyme-Ca(II) and enzyme-Ca(II)-DNA complexes. Metal ion binding by free Y94F is basically unperturbed: through multiple experiments with different metal ions, the data are consistent with two alkaline earth metal ion binding sites per subunit of low millimolar affinity, behavior which is very similar to that of the wild type. The results presented here indicate a role for the hydroxyl group of Tyr94 in the coupling of metal ion binding sites in the presence of DNA. Its removal causes the affinities for the two metal ion binding sites to be resolved in the presence of substrate. Such tuning of metal ion affinities will be invaluable to efforts to ascertain the contributions of individual bound metal ions to metallonuclease function.

  5. Identification of the heparin binding site on adeno-associated virus serotype 3B (AAV-3B)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lerch, Thomas F.; Chapman, Michael S., E-mail: chapmami@ohsu.edu

    2012-02-05

    Adeno-associated virus is a promising vector for gene therapy. In the current study, the binding site on AAV serotype 3B for the heparan sulfate proteoglycan (HSPG) receptor has been characterized. X-ray diffraction identified a disaccharide binding site at the most positively charged region on the virus surface. The contributions of basic amino acids at this and other sites were characterized using site-directed mutagenesis. Both heparin and cell binding are correlated to positive charge at the disaccharide binding site, and transduction is significantly decreased in AAV-3B vectors mutated at this site to reduce heparin binding. While the receptor attachment sites ofmore » AAV-3B and AAV-2 are both in the general vicinity of the viral spikes, the exact amino acids that participate in electrostatic interactions are distinct. Diversity in the mechanisms of cell attachment by AAV serotypes will be an important consideration for the rational design of improved gene therapy vectors.« less

  6. Identification of the heparin binding site on adeno-associated virus serotype 3B (AAV-3B)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lerch, Thomas F.; Chapman, Michael S.

    2012-05-24

    Adeno-associated virus is a promising vector for gene therapy. In the current study, the binding site on AAV serotype 3B for the heparan sulfate proteoglycan (HSPG) receptor has been characterized. X-ray diffraction identified a disaccharide binding site at the most positively charged region on the virus surface. The contributions of basic amino acids at this and other sites were characterized using site-directed mutagenesis. Both heparin and cell binding are correlated to positive charge at the disaccharide binding site, and transduction is significantly decreased in AAV-3B vectors mutated at this site to reduce heparin binding. While the receptor attachment sites ofmore » AAV-3B and AAV-2 are both in the general vicinity of the viral spikes, the exact amino acids that participate in electrostatic interactions are distinct. Diversity in the mechanisms of cell attachment by AAV serotypes will be an important consideration for the rational design of improved gene therapy vectors.« less

  7. Location of Bromide Ions in Tetragonal Lysozyme Crystals

    NASA Technical Reports Server (NTRS)

    Lim, Kap; Nadarajah, Arunan; Forsythe, Elizabeth L.; Pusey, Marc L.

    1998-01-01

    Anions have been shown to play a dominant role in the crystallization of chicken egg white lysozyme from salt solutions. Previous studies employing X-ray crystallography had found one chloride ion binding site in the tetragonal crystal form of the protein and four nitrate ion binding sites in the monoclinic form. In this study the anion positions in the tetragonal form were determined from the difference Fourier map obtained from lysozyme crystal grown in bromide and chloride solutions. Five possible anion binding sites were found in this manner. Some of these sites were in pockets containing basic residues while others were near neutral, but polar, residues. The sole chloride ion binding site found in previous studies was confirmed, while four of these sites corresponded to four binding sites found for nitrate ions in monoclinic crystals. The study suggests that most of the anion binding sites in lysozyme remain unchanged, even when different anions and different crystal forms of lysozyme are employed.

  8. Locations of Bromide Ions in Tetragonal Lysozyme Crystals

    NASA Technical Reports Server (NTRS)

    Lim, Kap; Nadarajah, Arunan; Forsythe, Elizabeth L.; Pusey, Marc L.

    1998-01-01

    Anions have been shown to play a dominant role in the crystallization of chicken egg-white lysozyme from salt solutions. Previous studies employing X-ray crystallography have found one chloride ion binding site in the tetragonal crystal form of the protein and four nitrate ion binding sites in the monoclinic form. In this study the anion positions in the tetragonal form were determined from the difference Fourier map obtained from lysozyme crystals grown in bromide and chloride solutions. Five possible anion-binding sites were found in this manner. Some of these sites were in pockets containing basic residues while others were near neutral, but polar, residues. The sole chloride ion binding site found in previous studies was confirmed, while four further sites were found which corresponded to the four binding sites found for nitrate ions in monoclinic crystals. The study suggests that most of the anion-binding sites in lysozyme remain unchanged even when different anions and different crystal forms of lysozyme are employed.

  9. Discovering amino acid patterns on binding sites in protein complexes

    PubMed Central

    Kuo, Huang-Cheng; Ong, Ping-Lin; Lin, Jung-Chang; Huang, Jen-Peng

    2011-01-01

    Discovering amino acid (AA) patterns on protein binding sites has recently become popular. We propose a method to discover the association relationship among AAs on binding sites. Such knowledge of binding sites is very helpful in predicting protein-protein interactions. In this paper, we focus on protein complexes which have protein-protein recognition. The association rule mining technique is used to discover geographically adjacent amino acids on a binding site of a protein complex. When mining, instead of treating all AAs of binding sites as a transaction, we geographically partition AAs of binding sites in a protein complex. AAs in a partition are treated as a transaction. For the partition process, AAs on a binding site are projected from three-dimensional to two-dimensional. And then, assisted with a circular grid, AAs on the binding site are placed into grid cells. A circular grid has ten rings: a central ring, the second ring with 6 sectors, the third ring with 12 sectors, and later rings are added to four sectors in order. As for the radius of each ring, we examined the complexes and found that 10Å is a suitable range, which can be set by the user. After placing these recognition complexes on the circular grid, we obtain mining records (i.e. transactions) from each sector. A sector is regarded as a record. Finally, we use the association rule to mine these records for frequent AA patterns. If the support of an AA pattern is larger than the predetermined minimum support (i.e. threshold), it is called a frequent pattern. With these discovered patterns, we offer the biologists a novel point of view, which will improve the prediction accuracy of protein-protein recognition. In our experiments, we produced the AA patterns by data mining. As a result, we found that arginine (arg) most frequently appears on the binding sites of two proteins in the recognition protein complexes, while cysteine (cys) appears the fewest. In addition, if we discriminate the shape of binding sites between concave and convex further, we discover that patterns {arg, glu, asp} and {arg, ser, asp} on the concave shape of binding sites in a protein more frequently (i.e. higher probability) make contact with {lys} or {arg} on the convex shape of binding sites in another protein. Thus, we can confidently achieve a rate of at least 78%. On the other hand {val, gly, lys} on the convex surface of binding sites in proteins is more frequently in contact with {asp} on the concave site of another protein, and the confidence achieved is over 81%. Applying data mining in biology can reveal more facts that may otherwise be ignored or not easily discovered by the naked eye. Furthermore, we can discover more relationships among AAs on binding sites by appropriately rotating these residues on binding sites from a three-dimension to two-dimension perspective. We designed a circular grid to deposit the data, which total to 463 records consisting of AAs. Then we used the association rules to mine these records for discovering relationships. The proposed method in this paper provides an insight into the characteristics of binding sites for recognition complexes. PMID:21464838

  10. A complex mechanism determines polarity of DNA replication fork arrest by the replication terminator complex of Bacillus subtilis.

    PubMed

    Duggin, Iain G; Matthews, Jacqueline M; Dixon, Nicholas E; Wake, R Gerry; Mackay, Joel P

    2005-04-01

    Two dimers of the replication terminator protein (RTP) of Bacillus subtilis bind to a chromosomal DNA terminator site to effect polar replication fork arrest. Cooperative binding of the dimers to overlapping half-sites within the terminator is essential for arrest. It was suggested previously that polarity of fork arrest is the result of the RTP dimer at the blocking (proximal) side within the complex binding very tightly and the permissive-side RTP dimer binding relatively weakly. In order to investigate this "differential binding affinity" model, we have constructed a series of mutant terminators that contain half-sites of widely different RTP binding affinities in various combinations. Although there appeared to be a correlation between binding affinity at the proximal half-site and fork arrest efficiency in vivo for some terminators, several deviated significantly from this correlation. Some terminators exhibited greatly reduced binding cooperativity (and therefore have reduced affinity at each half-site) but were highly efficient in fork arrest, whereas one terminator had normal affinity over the proximal half-site, yet had low fork arrest efficiency. The results show clearly that there is no direct correlation between the RTP binding affinity (either within the full complex or at the proximal half-site within the full complex) and the efficiency of replication fork arrest in vivo. Thus, the differential binding affinity over the proximal and distal half-sites cannot be solely responsible for functional polarity of fork arrest. Furthermore, efficient fork arrest relies on features in addition to the tight binding of RTP to terminator DNA.

  11. A new cryptic virus belonging to the family Partitiviridae was found in watermelon co-infected with Melon necrotic spot virus.

    PubMed

    Sela, Noa; Lachman, Oded; Reingold, Victoria; Dombrovsky, Aviv

    2013-10-01

    A novel virus was detected in watermelon plants (Citrullus lanatus Thunb.) infected with Melon necrotic spot virus (MNSV) using SOLiD next-generation sequence analysis. In addition to the expected MSNV genome, two double-stranded RNA (dsRNA) segments of 1,312 and 1,118 bp were also identified and sequenced from the purified virus preparations. These two dsRNA segments encode two putative partitivirus-related proteins, an RNA-dependent RNA polymerase (RdRP) and a capsid protein, which were sequenced. Genomic-sequence analysis and analysis of phylogenetic relationships indicate that these two dsRNAs together make up the genome of a novel Partitivirus. This virus was found to be closely related to the Pepper cryptic virus 1 and Raphanus sativus cryptic virus. It is suggested that this novel virus putatively named Citrullus lanatus cryptic virus be considered as a new member of the family Partitiviridae.

  12. Principal component analysis of chemical shift perturbation data of a multiple-ligand-binding system for elucidation of respective binding mechanism.

    PubMed

    Konuma, Tsuyoshi; Lee, Young-Ho; Goto, Yuji; Sakurai, Kazumasa

    2013-01-01

    Chemical shift perturbations (CSPs) in NMR spectra provide useful information about the interaction of a protein with its ligands. However, in a multiple-ligand-binding system, determining quantitative parameters such as a dissociation constant (K(d) ) is difficult. Here, we used a method we named CS-PCA, a principal component analysis (PCA) of chemical shift (CS) data, to analyze the interaction between bovine β-lactoglobulin (βLG) and 1-anilinonaphthalene-8-sulfonate (ANS), which is a multiple-ligand-binding system. The CSP on the binding of ANS involved contributions from two distinct binding sites. PCA of the titration data successfully separated the CSP pattern into contributions from each site. Docking simulations based on the separated CSP patterns provided the structures of βLG-ANS complexes for each binding site. In addition, we determined the K(d) values as 3.42 × 10⁻⁴ M² and 2.51 × 10⁻³ M for Sites 1 and 2, respectively. In contrast, it was difficult to obtain reliable K(d) values for respective sites from the isothermal titration calorimetry experiments. Two ANS molecules were found to bind at Site 1 simultaneously, suggesting that the binding occurs cooperatively with a partial unfolding of the βLG structure. On the other hand, the binding of ANS to Site 2 was a simple attachment without a significant conformational change. From the present results, CS-PCA was confirmed to provide not only the positions and the K(d) values of binding sites but also information about the binding mechanism. Thus, it is anticipated to be a general method to investigate protein-ligand interactions. Copyright © 2012 Wiley Periodicals, Inc.

  13. Thermodynamic compensation upon binding to exosite 1 and the active site of thrombin

    PubMed Central

    Treuheit, Nicholas A.; Beach, Muneera A.; Komives, Elizabeth A.

    2011-01-01

    Several lines of experimental evidence including amide exchange and NMR suggest that ligands binding to thrombin cause reduced backbone dynamics. Binding of the covalent inhibitor dPhe-Pro-Arg chloromethylketone to the active site serine, as well as non-covalent binding of a fragment of the regulatory protein, thrombomodulin, to exosite 1 on the back side of the thrombin molecule both cause reduced dynamics. However, the reduced dynamics do not appear to be accompanied by significant conformational changes. In addition, binding of ligands to the active site does not change the affinity of thrombomodulin fragments binding to exosite 1, however, the thermodynamic coupling between exosite 1 and the active site has not been fully explored. We present isothermal titration calorimetry experiments that probe changes in enthalpy and entropy upon formation of binary ligand complexes. The approach relies on stringent thrombin preparation methods and on the use of dansyl-L-arginine-(3-methyl-1,5-pantanediyl) amide and a DNA aptamer as ligands with ideal thermodynamic signatures for binding to the active site and to exosite 1. Using this approach, the binding thermodynamic signatures of each ligand alone as well as the binding signatures of each ligand when the other binding site was occupied were measured. Different exosite 1 ligands with widely varied thermodynamic signatures cause the same reduction in ΔH and a concomitantly lower entropy cost upon DAPA binding at the active site. The results suggest a general phenomenon of enthalpy-entropy compensation consistent with reduction of dynamics/increased folding of thrombin upon ligand binding to either the active site or to exosite 1. PMID:21526769

  14. Using Carbohydrate Interaction Assays to Reveal Novel Binding Sites in Carbohydrate Active Enzymes.

    PubMed

    Cockburn, Darrell; Wilkens, Casper; Dilokpimol, Adiphol; Nakai, Hiroyuki; Lewińska, Anna; Abou Hachem, Maher; Svensson, Birte

    2016-01-01

    Carbohydrate active enzymes often contain auxiliary binding sites located either on independent domains termed carbohydrate binding modules (CBMs) or as so-called surface binding sites (SBSs) on the catalytic module at a certain distance from the active site. The SBSs are usually critical for the activity of their cognate enzyme, though they are not readily detected in the sequence of a protein, but normally require a crystal structure of a complex for their identification. A variety of methods, including affinity electrophoresis (AE), insoluble polysaccharide pulldown (IPP) and surface plasmon resonance (SPR) have been used to study auxiliary binding sites. These techniques are complementary as AE allows monitoring of binding to soluble polysaccharides, IPP to insoluble polysaccharides and SPR to oligosaccharides. Here we show that these methods are useful not only for analyzing known binding sites, but also for identifying new ones, even without structural data available. We further verify the chosen assays discriminate between known SBS/CBM containing enzymes and negative controls. Altogether 35 enzymes are screened for the presence of SBSs or CBMs and several novel binding sites are identified, including the first SBS ever reported in a cellulase. This work demonstrates that combinations of these methods can be used as a part of routine enzyme characterization to identify new binding sites and advance the study of SBSs and CBMs, allowing them to be detected in the absence of structural data.

  15. Using Carbohydrate Interaction Assays to Reveal Novel Binding Sites in Carbohydrate Active Enzymes

    PubMed Central

    Wilkens, Casper; Dilokpimol, Adiphol; Nakai, Hiroyuki; Lewińska, Anna; Abou Hachem, Maher; Svensson, Birte

    2016-01-01

    Carbohydrate active enzymes often contain auxiliary binding sites located either on independent domains termed carbohydrate binding modules (CBMs) or as so-called surface binding sites (SBSs) on the catalytic module at a certain distance from the active site. The SBSs are usually critical for the activity of their cognate enzyme, though they are not readily detected in the sequence of a protein, but normally require a crystal structure of a complex for their identification. A variety of methods, including affinity electrophoresis (AE), insoluble polysaccharide pulldown (IPP) and surface plasmon resonance (SPR) have been used to study auxiliary binding sites. These techniques are complementary as AE allows monitoring of binding to soluble polysaccharides, IPP to insoluble polysaccharides and SPR to oligosaccharides. Here we show that these methods are useful not only for analyzing known binding sites, but also for identifying new ones, even without structural data available. We further verify the chosen assays discriminate between known SBS/CBM containing enzymes and negative controls. Altogether 35 enzymes are screened for the presence of SBSs or CBMs and several novel binding sites are identified, including the first SBS ever reported in a cellulase. This work demonstrates that combinations of these methods can be used as a part of routine enzyme characterization to identify new binding sites and advance the study of SBSs and CBMs, allowing them to be detected in the absence of structural data. PMID:27504624

  16. Volatile anesthetics compete for common binding sites on bovine serum albumin: a 19F-NMR study.

    PubMed Central

    Dubois, B W; Cherian, S F; Evers, A S

    1993-01-01

    There is controversy as to the molecular nature of volatile anesthetic target sites. One proposal is that volatile anesthetics bind directly to hydrophobic binding sites on certain sensitive target proteins. Consistent with this hypothesis, we have previously shown that a fluorinated volatile anesthetic, isoflurane, binds saturably [Kd (dissociation constant) = 1.4 +/- 0.2 mM, Bmax = 4.2 +/- 0.3 sites] to fatty acid-displaceable domains on serum albumin. In the current study, we used 19F-NMR T2 relaxation to examine whether other volatile anesthetics bind to the same sites on albumin and, if so, whether they vary in their affinity for these sites. We show that three other fluorinated volatile anesthetics bind with varying affinity to fatty acid-displaceable domains on serum albumin: halothane, Kd = 1.3 +/- 0.2 mM; methoxyflurane, Kd = 2.6 +/- 0.3 mM; and sevoflurane, Kd = 4.5 +/- 0.6 mM. These three anesthetics inhibit isoflurane binding in a competitive manner: halothane, K(i) (inhibition constant) = 1.3 +/- 0.2 mM; methoxyflurane, K(i) = 2.5 +/- 0.4 mM; and sevoflurane, K(i) = 5.4 +/- 0.7 mM--similar to each anesthetic's respective Kd of binding to fatty acid displaceable sites. These results illustrate that a variety of volatile anesthetics can compete for binding to specific sites on a protein. PMID:8341659

  17. Characterization of melatonin binding sites in the Harderian gland and median eminence of the rat

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lopez-Gonzalez, M.A.; Calvo, J.R.; Rubio, A.

    The characterization of specific melatonin binding sites in the Harderian gland (HG) and median eminence (ME) of the rat was studied using ({sup 125}I)melatonin. Binding of melatonin to membrane crude preparations of both tissues was dependent on time and temperature. Thus, maximal binding was obtained at 37{degree}C after 30-60 min incubation. Binding was also dependent on protein concentration. The specific binding of ({sup 125}I)melatonin was saturable, exhibiting only the class of binding sites in both tissues. The dissociation constants (Kd) were 170 and 190 pM for ME and HG, respectively. The concentration of the binding sites in ME was 8more » fmol/mg protein, and in the HG 4 fmol/mg protein. In competition studies, binding of ({sup 125}I)melatonin to ME or HG was inhibited by increasing concentration of native melatonin; 50% inhibition was observed at about 702 and 422 nM for ME and HG, respectively. Additionally, the ({sup 125}I)melatonin binding to the crude membranes was not affected by the addition of different drugs such as norepinephrine, isoproterenol, phenylephrine, propranolol, or prazosin. The results confirm the presence of melatonin binding sites in median eminence and show, for the first time, the existence of melatonin binding sites in the Harderian gland.« less

  18. In vivo binding of PRDM9 reveals interactions with noncanonical genomic sites

    PubMed Central

    Grey, Corinne; Clément, Julie A.J.; Buard, Jérôme; Leblanc, Benjamin; Gut, Ivo; Gut, Marta; Duret, Laurent

    2017-01-01

    In mouse and human meiosis, DNA double-strand breaks (DSBs) initiate homologous recombination and occur at specific sites called hotspots. The localization of these sites is determined by the sequence-specific DNA binding domain of the PRDM9 histone methyl transferase. Here, we performed an extensive analysis of PRDM9 binding in mouse spermatocytes. Unexpectedly, we identified a noncanonical recruitment of PRDM9 to sites that lack recombination activity and the PRDM9 binding consensus motif. These sites include gene promoters, where PRDM9 is recruited in a DSB-dependent manner. Another subset reveals DSB-independent interactions between PRDM9 and genomic sites, such as the binding sites for the insulator protein CTCF. We propose that these DSB-independent sites result from interactions between hotspot-bound PRDM9 and genomic sequences located on the chromosome axis. PMID:28336543

  19. Localization and characterization of (/sup 3/H)desmethylimipramine binding sites in rat brain by quantitative autoradiography

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Biegon, A.; Rainbow, T.C.

    1983-05-01

    The high affinity binding sites for the antidepressant desmethlyimipramine (DMI) have been localized in rat brain by quantitative autoradiography. There are high concentrations of binding sites in the locus ceruleus, the anterior ventral thalamus, the ventral portion of the bed nucleus of the stria terminalis, the paraventricular and the dorsomedial nuclei of the hypothalamus. The distribution of DMI binding sites is in striking accord with the distribution of norepinephrine terminals. Pretreatment of rats with the neurotoxin 6-hydroxydopamine, which causes a selective degeneration of catecholamine terminals, results in 60 to 90% decrease in DMI binding. These data support the idea thatmore » high affinity binding sites for DMI are located on presynaptic noradrenergic terminals.« less

  20. A Novel Cryptic Binding Motif, LRSKSRSFQVSDEQY, in the C-Terminal Fragment of MMP-3/7-Cleaved Osteopontin as a Novel Ligand for α9β1 Integrin Is Involved in the Anti-Type II Collagen Antibody-Induced Arthritis

    PubMed Central

    Kon, Shigeyuki; Nakayama, Yosuke; Matsumoto, Naoki; Ito, Koyu; Kanayama, Masashi; Kimura, Chiemi; Kouro, Hitomi; Ashitomi, Dai; Matsuda, Tadashi; Uede, Toshimitsu

    2014-01-01

    Osteopontin (OPN) is a multifunctional protein that has been linked to various intractable inflammatory diseases. One way by which OPN induces inflammation is the production of various functional fragments by enzyme cleavage. It has been well appreciated that OPN is cleaved by thrombin, and/or matrix metalloproteinase-3 and -7 (MMP-3/7). Although the function of thrombin-cleaved OPN is well characterized, little is known about the function of MMP-3/7-cleaved OPN. In this study, we found a novel motif, LRSKSRSFQVSDEQY, in the C-terminal fragment of MMP-3/7-cleaved mouse OPN binds to α9β1 integrin. Importantly, this novel motif is involved in the development of anti-type II collagen antibody-induced arthritis (CAIA). This study provides the first in vitro and in vivo evidence that OPN cleavage by MMP-3/7 is an important regulatory mechanism for CAIA. PMID:25545242

  1. Structural Basis for Telomerase RNA Recognition and RNP Assembly by the Holoenzyme La Family Protein p65

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Singh, Mahavir; Wang, Zhonghua; Koo, Bon-Kyung

    2012-07-01

    Telomerase is a ribonucleoprotein complex essential for maintenance of telomere DNA at linear chromosome ends. The catalytic core of Tetrahymena telomerase comprises a ternary complex of telomerase RNA (TER), telomerase reverse transcriptase (TERT), and the essential La family protein p65. NMR and crystal structures of p65 C-terminal domain and its complex with stem IV of TER reveal that RNA recognition is achieved by a combination of single- and double-stranded RNA binding, which induces a 105{sup o} bend in TER. The domain is a cryptic, atypical RNA recognition motif with a disordered C-terminal extension that forms an {alpha} helix in themore » complex necessary for hierarchical assembly of TERT with p65-TER. This work provides the first structural insight into biogenesis and assembly of TER with a telomerase-specific protein. Additionally, our studies define a structurally homologous domain (xRRM) in genuine La and LARP7 proteins and suggest a general mode of RNA binding for biogenesis of their diverse RNA targets.« less

  2. Structural and functional dissection reveals distinct roles of Ca2+-binding sites in the giant adhesin SiiE of Salmonella enterica

    PubMed Central

    Klingl, Stefan; Sandmann, Achim; Taccardi, Nicola; Sticht, Heinrich; Muller, Yves A.; Hensel, Michael

    2017-01-01

    The giant non-fimbrial adhesin SiiE of Salmonella enterica mediates the first contact to the apical site of epithelial cells and enables subsequent invasion. SiiE is a 595 kDa protein composed of 53 repetitive bacterial immunoglobulin (BIg) domains and the only known substrate of the SPI4-encoded type 1 secretion system (T1SS). The crystal structure of BIg50-52 of SiiE revealed two distinct Ca2+-binding sites per BIg domain formed by conserved aspartate or glutamate residues. In a mutational analysis Ca2+-binding sites were disrupted by aspartate to serine exchange at various positions in the BIg domains of SiiE. Amounts of secreted SiiE diminish with a decreasing number of intact Ca2+-binding sites. BIg domains of SiiE contain distinct Ca2+-binding sites, with type I sites being similar to other T1SS-secreted proteins and type II sites newly identified in SiiE. We functionally and structurally dissected the roles of type I and type II Ca2+-binding sites in SiiE, as well as the importance of Ca2+-binding sites in various positions of SiiE. Type I Ca2+-binding sites were critical for efficient secretion of SiiE and a decreasing number of type I sites correlated with reduced secretion. Type II sites were less important for secretion, stability and surface expression of SiiE, however integrity of type II sites in the C-terminal portion was required for the function of SiiE in mediating adhesion and invasion. PMID:28558023

  3. Binding of N-methylscopolamine to the extracellular domain of muscarinic acetylcholine receptors

    NASA Astrophysics Data System (ADS)

    Jakubík, Jan; Randáková, Alena; Zimčík, Pavel; El-Fakahany, Esam E.; Doležal, Vladimír

    2017-01-01

    Interaction of orthosteric ligands with extracellular domain was described at several aminergic G protein-coupled receptors, including muscarinic acetylcholine receptors. The orthosteric antagonists quinuclidinyl benzilate (QNB) and N-methylscopolamine (NMS) bind to the binding pocket of the muscarinic acetylcholine receptor formed by transmembrane α-helices. We show that high concentrations of either QNB or NMS slow down dissociation of their radiolabeled species from all five subtypes of muscarinic acetylcholine receptors, suggesting allosteric binding. The affinity of NMS at the allosteric site is in the micromolar range for all receptor subtypes. Using molecular modelling of the M2 receptor we found that E172 and E175 in the second extracellular loop and N419 in the third extracellular loop are involved in allosteric binding of NMS. Mutation of these amino acids to alanine decreased affinity of NMS for the allosteric binding site confirming results of molecular modelling. The allosteric binding site of NMS overlaps with the binding site of some allosteric, ectopic and bitopic ligands. Understanding of interactions of NMS at the allosteric binding site is essential for correct analysis of binding and action of these ligands.

  4. Neogene paleogeography provides context for understanding the origin and spatial distribution of cryptic diversity in a widespread Balkan freshwater amphipod

    PubMed Central

    Mamos, Tomasz; Bącela-Spychalska, Karolina; Rewicz, Tomasz; Wattier, Remi A.

    2017-01-01

    Background The Balkans are a major worldwide biodiversity and endemism hotspot. Among the freshwater biota, amphipods are known for their high cryptic diversity. However, little is known about the temporal and paleogeographic aspects of their evolutionary history. We used paleogeography as a framework for understanding the onset of diversification in Gammarus roeselii: (1) we hypothesised that, given the high number of isolated waterbodies in the Balkans, the species is characterised by high level of cryptic diversity, even on a local scale; (2) the long geological history of the region might promote pre-Pleistocene divergence between lineages; (3) given that G. roeselii thrives both in lakes and rivers, its evolutionary history could be linked to the Balkan Neogene paleolake system; (4) we inspected whether the Pleistocene decline of hydrological networks could have any impact on the diversification of G. roeselii. Material and Methods DNA was extracted from 177 individuals collected from 26 sites all over Balkans. All individuals were amplified for ca. 650 bp long fragment of the mtDNA cytochrome oxidase subunit I (COI). After defining molecular operational taxonomic units (MOTU) based on COI, 50 individuals were amplified for ca. 900 bp long fragment of the nuclear 28S rDNA. Molecular diversity, divergence, differentiation and historical demography based on COI sequences were estimated for each MOTU. The relative frequency, geographic distribution and molecular divergence between COI haplotypes were presented as a median-joining network. COI was used also to reconstruct time-calibrated phylogeny with Bayesian inference. Probabilities of ancestors’ occurrence in riverine or lacustrine habitats, as well their possible geographic locations, were estimated with the Bayesian method. A Neighbour Joining tree was constructed to illustrate the phylogenetic relationships between 28S rDNA haplotypes. Results We revealed that G. roeselii includes at least 13 cryptic species or molecular operational taxonomic units (MOTUs), mostly of Miocene origin. A substantial Pleistocene diversification within-MOTUs was observed in several cases. We evidenced secondary contacts between very divergent MOTUs and introgression of nDNA. The Miocene ancestors could live in either lacustrine or riverine habitats yet their presumed geographic localisations overlapped with those of the Neogene lakes. Several extant riverine populations had Pleistocene lacustrine ancestors. Discussion Neogene divergence of lineages resulting in substantial cryptic diversity may be a common phenomenon in extant freshwater benthic crustaceans occupying areas that were not glaciated during the Pleistocene. Evolution of G. roeselii could be associated with gradual deterioration of the paleolakes. The within-MOTU diversification might be driven by fragmentation of river systems during the Pleistocene. Extant ancient lakes could serve as local microrefugia during that time. PMID:28265503

  5. STUDIES OF VERAPAMIL BINDING TO HUMAN SERUM ALBUMIN BY HIGH-PERFORMANCE AFFINITY CHROMATOGRAPHY

    PubMed Central

    Mallik, Rangan; Yoo, Michelle J.; Chen, Sike; Hage, David S.

    2008-01-01

    The binding of verapamil to the protein human serum albumin (HSA) was examined by using high-performance affinity chromatography. Many previous reports have investigated the binding of verapamil with HSA, but the exact strength and nature of this interaction (e.g., the number and location of binding sites) is still unclear. In this study, frontal analysis indicated that at least one major binding site was present for R- and S-verapamil on HSA, with estimated association equilibrium constants on the order of 104 M−1 and a 1.4-fold difference in these values for the verapamil enantiomers at pH 7.4 and 37°C. The presence of a second, weaker group of binding sites on HSA was also suggested by these results. Competitive binding studies using zonal elution were carried out between verapamil and various probe compounds that have known interactions with several major and minor sites on HSA. R/S-Verapamil was found to have direct competition with S-warfarin, indicating that verapamil was binding to Sudlow site I (i.e., the warfarin-azapropazone site of HSA). The average association equilibrium constant for R- and S-verapamil at this site was 1.4 (±0.1) × 104 M−1. Verapamil did not have any notable binding to Sudlow site II of HSA but did appear to have some weak allosteric interactions with L-tryptophan, a probe for this site. An allosteric interaction between verapamil and tamoxifen (a probe for the tamoxifen site) was also noted, which was consistent with the binding of verapamil at Sudlow site I. No interaction was seen between verapamil and digitoxin, a probe for the digitoxin site of HSA. These results gave good agreement with previous observations made in the literature and help provide a more detailed description of how verapamil is transported in blood and of how it may interact with other drugs in the body. PMID:18980867

  6. Neurotensin receptor binding levels in basal ganglia are not altered in Huntington's chorea or schizophrenia

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Palacios, J.M.; Chinaglia, G.; Rigo, M.

    1991-02-01

    Autoradiographic techniques were used to examine the distribution and levels of neurotensin receptor binding sites in the basal ganglia and related regions of the human brain. Monoiodo ({sup 125}I-Tyr3)neurotensin was used as a ligand. High amounts of neurotensin receptor binding sites were found in the substantia nigra pars compacta. Lower but significant quantities of neurotensin receptor binding sites characterized the caudate, putamen, and nucleus accumbens, while very low quantities were seen in both medial and lateral segments of the globus pallidus. In Huntington's chorea, the levels of neurotensin receptor binding sites were found to be comparable to those of controlmore » cases. Only slight but not statistically significant decreases in amounts of receptor binding sites were detected in the dorsal part of the head and in the body of caudate nucleus. No alterations in the levels of neurotensin receptor binding sites were observed in the substantia nigra pars compacta and reticulata. These results suggest that a large proportion of neurotensin receptor binding sites in the basal ganglia are located on intrinsic neurons and on extrinsic afferent fibers that do not degenerate in Huntington's disease.« less

  7. Accurate population genetic measurements require cryptic species identification in corals

    NASA Astrophysics Data System (ADS)

    Sheets, Elizabeth A.; Warner, Patricia A.; Palumbi, Stephen R.

    2018-06-01

    Correct identification of closely related species is important for reliable measures of gene flow. Incorrectly lumping individuals of different species together has been shown to over- or underestimate population differentiation, but examples highlighting when these different results are observed in empirical datasets are rare. Using 199 single nucleotide polymorphisms, we assigned 768 individuals in the Acropora hyacinthus and A. cytherea morphospecies complexes to each of eight previously identified cryptic genetic species and measured intraspecific genetic differentiation across three geographic scales (within reefs, among reefs within an archipelago, and among Pacific archipelagos). We then compared these calculations to estimated genetic differentiation at each scale with all cryptic genetic species mixed as if we could not tell them apart. At the reef scale, correct genetic species identification yielded lower F ST estimates and fewer significant comparisons than when species were mixed, raising estimates of short-scale gene flow. In contrast, correct genetic species identification at large spatial scales yielded higher F ST measurements than mixed-species comparisons, lowering estimates of long-term gene flow among archipelagos. A meta-analysis of published population genetic studies in corals found similar results: F ST estimates at small spatial scales were lower and significance was found less often in studies that controlled for cryptic species. Our results and these prior datasets controlling for cryptic species suggest that genetic differentiation among local reefs may be lower than what has generally been reported in the literature. Not properly controlling for cryptic species structure can bias population genetic analyses in different directions across spatial scales, and this has important implications for conservation strategies that rely on these estimates.

  8. n-Dodecyl β-D-maltoside specifically competes with general anesthetics for anesthetic binding sites.

    PubMed

    Xu, Longhe; Matsunaga, Felipe; Xi, Jin; Li, Min; Ma, Jingyuan; Liu, Renyu

    2014-01-01

    We recently demonstrated that the anionic detergent sodium dodecyl sulfate (SDS) specifically interacts with the anesthetic binding site in horse spleen apoferritin, a soluble protein which models anesthetic binding sites in receptors. This raises the possibility of other detergents similarly interacting with and occluding such sites from anesthetics, thereby preventing the proper identification of novel anesthetic binding sites. n-Dodecyl β-D-maltoside (DDM) is a non-ionic detergent commonly used during protein-anesthetic studies because of its mild and non-denaturing properties. In this study, we demonstrate that SDS and DDM occupy anesthetic binding sites in the model proteins human serum albumin (HSA) and horse spleen apoferritin and thereby inhibit the binding of the general anesthetics propofol and isoflurane. DDM specifically interacts with HSA (Kd = 40 μM) with a lower affinity than SDS (Kd = 2 μM). DDM exerts all these effects while not perturbing the native structures of either model protein. Computational calculations corroborated the experimental results by demonstrating that the binding sites for DDM and both anesthetics on the model proteins overlapped. Collectively, our results indicate that DDM and SDS specifically interact with anesthetic binding sites and may thus prevent the identification of novel anesthetic sites. Special precaution should be taken when undertaking and interpreting results from protein-anesthetic investigations utilizing detergents like SDS and DDM.

  9. High-Affinity Quasi-Specific Sites in the Genome: How the DNA-Binding Proteins Cope with Them

    PubMed Central

    Chakrabarti, J.; Chandra, Navin; Raha, Paromita; Roy, Siddhartha

    2011-01-01

    Many prokaryotic transcription factors home in on one or a few target sites in the presence of a huge number of nonspecific sites. Our analysis of λ-repressor in the Escherichia coli genome based on single basepair substitution experiments shows the presence of hundreds of sites having binding energy within 3 Kcal/mole of the OR1 binding energy, and thousands of sites with binding energy above the nonspecific binding energy. The effect of such sites on DNA-based processes has not been fully explored. The presence of such sites dramatically lowers the occupation probability of the specific site far more than if the genome were composed of nonspecific sites only. Our Brownian dynamics studies show that the presence of quasi-specific sites results in very significant kinetic effects as well. In contrast to λ-repressor, the E. coli genome has orders of magnitude lower quasi-specific sites for GalR, an integral transcription factor, thus causing little competition for the specific site. We propose that GalR and perhaps repressors of the same family have evolved binding modes that lead to much smaller numbers of quasi-specific sites to remove the untoward effects of genomic DNA. PMID:21889449

  10. Pharmacological characterization of CCKB receptors in human brain: no evidence for receptor heterogeneity.

    PubMed

    Kinze, S; Schöneberg, T; Meyer, R; Martin, H; Kaufmann, R

    1996-10-11

    In this paper, cholecystokinin (CCK) B-type binding sites were characterized with receptor binding studies in different human brain regions (various parts of cerebral cortex, basal ganglia, hippocampus, thalamus, cerebellar cortex) collected from 22 human postmortem brains. With the exception of the thalamus, where no specific CCK binding sites were found, a pharmacological characterization demonstrated a single class of high affinity CCK sites in all brain areas investigated. Receptor densities ranged from 0.5 fmol/mg protein (hippocampus) to 8.4 fmol/mg protein (nucleus caudatus). These CCK binding sites displayed a typical CCKA binding profile as shown in competition studies by using different CCK-related compounds and non peptide CCK antagonists discriminating between CCKA and CCKB sites. The rank order of agonist or antagonist potency in inhibiting specific sulphated [propionyl-3H]cholecystokinin octapeptide binding was similar and highly correlated for the brain regions investigated as demonstrated by a computer-assisted analysis. Therefore it is concluded that CCKB binding sites in human cerebral cortex, basal ganglia, cerebellar cortex share identical ligand binding characteristics.

  11. Six independent fucose-binding sites in the crystal structure of Aspergillus oryzae lectin

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Makyio, Hisayoshi; Shimabukuro, Junpei; Suzuki, Tatsuya

    The crystal structure of AOL (a fucose-specific lectin of Aspergillus oryzae) has been solved by SAD (single-wavelength anomalous diffraction) and MAD (multi-wavelength anomalous diffraction) phasing of seleno-fucosides. The overall structure is a six-bladed β-propeller similar to that of other fucose-specific lectins. The fucose moieties of the seleno-fucosides are located in six fucose-binding sites. Although the Arg and Glu/Gln residues bound to the fucose moiety are common to all fucose-binding sites, the amino-acid residues involved in fucose binding at each site are not identical. The varying peak heights of the seleniums in the electron density map suggest that each fucose-binding sitemore » has a different carbohydrate binding affinity. - Highlights: • The six-bladed β-propeller structure of AOL was solved by seleno-sugar phasing. • The mode of fucose binding is essentially conserved at all six binding sites. • The seleno-fucosides exhibit slightly different interactions and electron densities. • These findings suggest that the affinity for fucose is not identical at each site.« less

  12. Binding Leverage as a Molecular Basis for Allosteric Regulation

    PubMed Central

    Mitternacht, Simon; Berezovsky, Igor N.

    2011-01-01

    Allosteric regulation involves conformational transitions or fluctuations between a few closely related states, caused by the binding of effector molecules. We introduce a quantity called binding leverage that measures the ability of a binding site to couple to the intrinsic motions of a protein. We use Monte Carlo simulations to generate potential binding sites and either normal modes or pairs of crystal structures to describe relevant motions. We analyze single catalytic domains and multimeric allosteric enzymes with complex regulation. For the majority of the analyzed proteins, we find that both catalytic and allosteric sites have high binding leverage. Furthermore, our analysis of the catabolite activator protein, which is allosteric without conformational change, shows that its regulation involves other types of motion than those modulated at sites with high binding leverage. Our results point to the importance of incorporating dynamic information when predicting functional sites. Because it is possible to calculate binding leverage from a single crystal structure it can be used for characterizing proteins of unknown function and predicting latent allosteric sites in any protein, with implications for drug design. PMID:21935347

  13. Spectroscopic and Thermodynamic Characterization of the Metal-Binding Sites in the LH1-RC Complex from Thermophilic Photosynthetic Bacterium Thermochromatium tepidum.

    PubMed

    Kimura, Yukihiro; Yura, Yuki; Hayashi, Yusuke; Li, Yong; Onoda, Moe; Yu, Long-Jiang; Wang-Otomo, Zheng-Yu; Ohno, Takashi

    2016-12-15

    The light-harvesting 1 reaction center (LH1-RC) complex from thermophilic photosynthetic bacterium Thermochromatium (Tch.) tepidum exhibits enhanced thermostability and an unusual LH1 Q y transition, both induced by Ca 2+ binding. In this study, metal-binding sites and metal-protein interactions in the LH1-RC complexes from wild-type (B915) and biosynthetically Sr 2+ -substituted (B888) Tch. tepidum were investigated by isothermal titration calorimetry (ITC), atomic absorption (AA), and attenuated total reflection (ATR) Fourier transform infrared (FTIR) spectroscopies. The ITC measurements revealed stoichiometric ratios of approximately 1:1 for binding of Ca 2+ , Sr 2+ , or Ba 2+ to the LH1 αβ-subunit, indicating the presence of 16 binding sites in both B915 and B888. The AA analysis provided direct evidence for Ca 2+ and Sr 2+ binding to B915 and B888, respectively, in their purified states. Metal-binding experiments supported that Ca 2+ and Sr 2+ (or Ba 2+ ) competitively associate with the binding sites in both species. The ATR-FTIR difference spectra upon Ca 2+ depletion and Sr 2+ substitution demonstrated that dissociation and binding of Ca 2+ are predominantly responsible for metal-dependent conformational changes of B915 and B888. The present results are largely compatible with the recent structural evidence that another binding site for Sr 2+ (or Ba 2+ ) exists in the vicinity of the Ca 2+ -binding site, a part of which is shared in both metal-binding sites.

  14. Characterizing low affinity epibatidine binding to α4β2 nicotinic acetylcholine receptors with ligand depletion and nonspecific binding

    PubMed Central

    2011-01-01

    Background Along with high affinity binding of epibatidine (Kd1≈10 pM) to α4β2 nicotinic acetylcholine receptor (nAChR), low affinity binding of epibatidine (Kd2≈1-10 nM) to an independent binding site has been reported. Studying this low affinity binding is important because it might contribute understanding about the structure and synthesis of α4β2 nAChR. The binding behavior of epibatidine and α4β2 AChR raises a question about interpreting binding data from two independent sites with ligand depletion and nonspecific binding, both of which can affect equilibrium binding of [3H]epibatidine and α4β2 nAChR. If modeled incorrectly, ligand depletion and nonspecific binding lead to inaccurate estimates of binding constants. Fitting total equilibrium binding as a function of total ligand accurately characterizes a single site with ligand depletion and nonspecific binding. The goal of this study was to determine whether this approach is sufficient with two independent high and low affinity sites. Results Computer simulations of binding revealed complexities beyond fitting total binding for characterizing the second, low affinity site of α4β2 nAChR. First, distinguishing low-affinity specific binding from nonspecific binding was a potential problem with saturation data. Varying the maximum concentration of [3H]epibatidine, simultaneously fitting independently measured nonspecific binding, and varying α4β2 nAChR concentration were effective remedies. Second, ligand depletion helped identify the low affinity site when nonspecific binding was significant in saturation or competition data, contrary to a common belief that ligand depletion always is detrimental. Third, measuring nonspecific binding without α4β2 nAChR distinguished better between nonspecific binding and low-affinity specific binding under some circumstances of competitive binding than did presuming nonspecific binding to be residual [3H]epibatidine binding after adding a large concentration of cold competitor. Fourth, nonspecific binding of a heterologous competitor changed estimates of high and low inhibition constants but did not change the ratio of those estimates. Conclusions Investigating the low affinity site of α4β2 nAChR with equilibrium binding when ligand depletion and nonspecific binding are present likely needs special attention to experimental design and data interpretation beyond fitting total binding data. Manipulation of maximum ligand and receptor concentrations and intentionally increasing ligand depletion are potentially helpful approaches. PMID:22112852

  15. Shock Condition Forensics and Cryptic Phase Transformations from Crystallographic Orientation Relationships in Zircon

    NASA Astrophysics Data System (ADS)

    Timms, N. E.; Erickson, T. M.; Cavosie, A. J.; Pearce, M. A.; Reddy, S. M.; Zanetti, M.; Tohver, E.; Schmieder, M.; Nemchin, A. A.; Wittmann, A.

    2016-08-01

    We present an approach to constrain pressure and temperature conditions during impact events involving identification of cryptic histories of phase transformations from orientation relationships in shocked zircon, linked to new P-T phase diagrams.

  16. Evaluation of the Significance of Starch Surface Binding Sites on Human Pancreatic α-Amylase.

    PubMed

    Zhang, Xiaohua; Caner, Sami; Kwan, Emily; Li, Chunmin; Brayer, Gary D; Withers, Stephen G

    2016-11-01

    Starch provides the major source of caloric intake in many diets. Cleavage of starch into malto-oligosaccharides in the gut is catalyzed by pancreatic α-amylase. These oligosaccharides are then further cleaved by gut wall α-glucosidases to release glucose, which is absorbed into the bloodstream. Potential surface binding sites for starch on the pancreatic amylase, distinct from the active site of the amylase, have been identified through X-ray crystallographic analyses. The role of these sites in the degradation of both starch granules and soluble starch was probed by the generation of a series of surface variants modified at each site to disrupt binding. Kinetic analysis of the binding and/or cleavage of substrates ranging from simple maltotriosides to soluble starch and insoluble starch granules has allowed evaluation of the potential role of each such surface site. In this way, two key surface binding sites, on the same face as the active site, are identified. One site, containing a pair of aromatic residues, is responsible for attachment to starch granules, while a second site featuring a tryptophan residue around which a malto-oligosaccharide wraps is shown to heavily influence soluble starch binding and hydrolysis. These studies provide insights into the mechanisms by which enzymes tackle the degradation of largely insoluble polymers and also present some new approaches to the interrogation of the binding sites involved.

  17. Cooperative DNA binding and sequence discrimination by the Opaque2 bZIP factor.

    PubMed Central

    Yunes, J A; Vettore, A L; da Silva, M J; Leite, A; Arruda, P

    1998-01-01

    The maize Opaque2 (O2) protein is a basic leucine zipper transcription factor that controls the expression of distinct classes of endosperm genes through the recognition of different cis-acting elements in their promoters. The O2 target region in the promoter of the alpha-coixin gene was analyzed in detail and shown to comprise two closely adjacent binding sites, named O2u and O2d, which are related in sequence to the GCN4 binding site. Quantitative DNase footprint analysis indicated that O2 binding to alpha-coixin target sites is best described by a cooperative model. Transient expression assays showed that the two adjacent sites act synergistically. This synergy is mediated in part by cooperative DNA binding. In tobacco protoplasts, O2 binding at the O2u site is more important for enhancer activity than is binding at the O2d site, suggesting that the architecture of the O2-DNA complex is important for interaction with the transcriptional machinery. PMID:9811800

  18. Cooperative DNA binding and sequence discrimination by the Opaque2 bZIP factor.

    PubMed

    Yunes, J A; Vettore, A L; da Silva, M J; Leite, A; Arruda, P

    1998-11-01

    The maize Opaque2 (O2) protein is a basic leucine zipper transcription factor that controls the expression of distinct classes of endosperm genes through the recognition of different cis-acting elements in their promoters. The O2 target region in the promoter of the alpha-coixin gene was analyzed in detail and shown to comprise two closely adjacent binding sites, named O2u and O2d, which are related in sequence to the GCN4 binding site. Quantitative DNase footprint analysis indicated that O2 binding to alpha-coixin target sites is best described by a cooperative model. Transient expression assays showed that the two adjacent sites act synergistically. This synergy is mediated in part by cooperative DNA binding. In tobacco protoplasts, O2 binding at the O2u site is more important for enhancer activity than is binding at the O2d site, suggesting that the architecture of the O2-DNA complex is important for interaction with the transcriptional machinery.

  19. DNA Barcoding Reveals High Cryptic Diversity of the Freshwater Halfbeak Genus Hemirhamphodon from Sundaland

    PubMed Central

    Zainal Abidin, Muchlisin; Pulungan, Chaidir Parlindungan

    2016-01-01

    DNA barcoding of the cytochrome oxidase subunit I (COI) gene was utilized to assess the species diversity of the freshwater halfbeak genus Hemirhamphodon. A total of 201 individuals from 46 locations in Peninsular Malaysia, north Borneo (Sarawak) and Sumatra were successfully amplified for 616 base pairs of the COI gene revealing 231 variable and 213 parsimony informative sites. COI gene trees showed that most recognized species form monophyletic clades with high bootstrap support. Pairwise within species comparisons exhibited a wide range of intraspecific diversity from 0.0% to 14.8%, suggesting presence of cryptic diversity. This finding was further supported by barcode gap analysis, ABGD and the constructed COI gene trees. In particular, H. pogonognathus from Kelantan (northeast Peninsular Malaysia) diverged from the other H. pogonognathus groups with distances ranging from 7.8 to 11.8%, exceeding the nearest neighbor taxon. High intraspecific diversity was also observed in H. byssus and H. kuekanthali, but of a lower magnitude. This study also provides insights into endemism and phylogeographic structuring, and limited support for the Paleo-drainage divergence hypothesis as a driver of speciation in the genus Hemirhamphodon. PMID:27657915

  20. Development and evaluation of a species diagnostic polymerase chain reaction-restriction fragment-length polymorphism procedure for cryptic members of the Culex sitiens (Diptera: Culicidae) subgroup in Australia and the southwest Pacific.

    PubMed

    Beebe, N W; van den Hurk, A F; Chapman, H F; Frances, S P; Williams, C R; Cooper, R D

    2002-03-01

    Members of the Culex sitiens subgroup are important vectors of arboviruses, including Japanese encephalitis virus, Murray Valley encephalitis virus and Ross River virus. Of the eight described species, Cx. annulirostris Skuse, Cx. sitiens Wiedemann, and Cx. palpalis Taylor appear to be the most abundant and widespread throughout northern Australia and Papua New Guinea (PNG). Recent investigations using allozymes have shown this subgroup to contain cryptic species that possess overlapping adult morphology. We report the development of a polymerase chain reaction-restriction fragment-length polymorphism (PCR-RFLP) procedure that reliably separates these three species. This procedure utilizes the sequence variation in the ribosomal DNA ITS1 and demonstrates species-specific PCR-RFLP profiles from both colony and field collected material. Assessment of the consistency of this procedure was undertaken on mosquitoes sampled from a wide geographic area including Australia, PNG, and the Solomon Islands. Overlapping adult morphology was observed for Cx. annulirostris and Cx. palpalis in both northern Queensland and PNG and for all three species at one site in northwest Queensland.

  1. Position specific variation in the rate of evolution in transcription factor binding sites

    PubMed Central

    Moses, Alan M; Chiang, Derek Y; Kellis, Manolis; Lander, Eric S; Eisen, Michael B

    2003-01-01

    Background The binding sites of sequence specific transcription factors are an important and relatively well-understood class of functional non-coding DNAs. Although a wide variety of experimental and computational methods have been developed to characterize transcription factor binding sites, they remain difficult to identify. Comparison of non-coding DNA from related species has shown considerable promise in identifying these functional non-coding sequences, even though relatively little is known about their evolution. Results Here we analyse the genome sequences of the budding yeasts Saccharomyces cerevisiae, S. bayanus, S. paradoxus and S. mikatae to study the evolution of transcription factor binding sites. As expected, we find that both experimentally characterized and computationally predicted binding sites evolve slower than surrounding sequence, consistent with the hypothesis that they are under purifying selection. We also observe position-specific variation in the rate of evolution within binding sites. We find that the position-specific rate of evolution is positively correlated with degeneracy among binding sites within S. cerevisiae. We test theoretical predictions for the rate of evolution at positions where the base frequencies deviate from background due to purifying selection and find reasonable agreement with the observed rates of evolution. Finally, we show how the evolutionary characteristics of real binding motifs can be used to distinguish them from artefacts of computational motif finding algorithms. Conclusion As has been observed for protein sequences, the rate of evolution in transcription factor binding sites varies with position, suggesting that some regions are under stronger functional constraint than others. This variation likely reflects the varying importance of different positions in the formation of the protein-DNA complex. The characterization of the pattern of evolution in known binding sites will likely contribute to the effective use of comparative sequence data in the identification of transcription factor binding sites and is an important step toward understanding the evolution of functional non-coding DNA. PMID:12946282

  2. Hydrolysis at One of the Two Nucleotide-binding Sites Drives the Dissociation of ATP-binding Cassette Nucleotide-binding Domain Dimers

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zoghbi, M. E.; Altenberg, G. A.

    The functional unit of ATP-binding cassette (ABC) transporters consists of two transmembrane domains and two nucleotide-binding domains (NBDs). ATP binding elicits association of the two NBDs, forming a dimer in a head-to-tail arrangement, with two nucleotides “sandwiched” at the dimer interface. Each of the two nucleotide-binding sites is formed by residues from the two NBDs. We recently found that the prototypical NBD MJ0796 from Methanocaldococcus jannaschii dimerizes in response to ATP binding and dissociates completely following ATP hydrolysis. However, it is still unknown whether dissociation of NBD dimers follows ATP hydrolysis at one or both nucleotide-binding sites. Here, we usedmore » luminescence resonance energy transfer to study heterodimers formed by one active (donor-labeled) and one catalytically defective (acceptor-labeled) NBD. Rapid mixing experiments in a stop-flow chamber showed that NBD heterodimers with one functional and one inactive site dissociated at a rate indistinguishable from that of dimers with two hydrolysis-competent sites. Comparison of the rates of NBD dimer dissociation and ATP hydrolysis indicated that dissociation followed hydrolysis of one ATP. We conclude that ATP hydrolysis at one nucleotide-binding site drives NBD dimer dissociation.« less

  3. Functional asymmetry in the lysyl-tRNA synthetase explored by molecular dynamics, free energy calculations and experiment

    PubMed Central

    Hughes, Samantha J; Tanner, Julian A; Hindley, Alison D; Miller, Andrew D; Gould, Ian R

    2003-01-01

    Background Charging of transfer-RNA with cognate amino acid is accomplished by the aminoacyl-tRNA synthetases, and proceeds through an aminoacyl adenylate intermediate. The lysyl-tRNA synthetase has evolved an active site that specifically binds lysine and ATP. Previous molecular dynamics simulations of the heat-inducible Escherichia coli lysyl-tRNA synthetase, LysU, have revealed differences in the binding of ATP and aspects of asymmetry between the nominally equivalent active sites of this dimeric enzyme. The possibility that this asymmetry results in different binding affinities for the ligands is addressed here by a parallel computational and biochemical study. Results Biochemical experiments employing isothermal calorimetry, steady-state fluorescence and circular dichroism are used to determine the order and stoichiometries of the lysine and nucleotide binding events, and the associated thermodynamic parameters. An ordered mechanism of substrate addition is found, with lysine having to bind prior to the nucleotide in a magnesium dependent process. Two lysines are found to bind per dimer, and trigger a large conformational change. Subsequent nucleotide binding causes little structural rearrangement and crucially only occurs at a single catalytic site, in accord with the simulations. Molecular dynamics based free energy calculations of the ATP binding process are used to determine the binding affinities of each site. Significant differences in ATP binding affinities are observed, with only one active site capable of realizing the experimental binding free energy. Half-of-the-sites models in which the nucleotide is only present at one active site achieve their full binding potential irrespective of the subunit choice. This strongly suggests the involvement of an anti-cooperative mechanism. Pathways for relaying information between the two active sites are proposed. Conclusions The asymmetry uncovered here appears to be a common feature of oligomeric aminoacyl-tRNA synthetases, and may play an important functional role. We suggest a manner in which catalytic efficiency could be improved by LysU operating in an alternating sites mechanism. PMID:12787471

  4. xRRM: a new class of RRM found in the telomerase La family protein p65.

    PubMed

    Singh, Mahavir; Choi, Charles P; Feigon, Juli

    2013-03-01

    Genuine La and La-related proteins group 7 (LARP7) bind to the non-coding RNAs transcribed by RNA polymerase III (RNAPIII), which end in UUU-3'OH. The La motif and RRM1 of these proteins (the La module) cooperate to bind the UUU-3'OH, protecting the RNA from degradation, while other domains may be important for RNA folding or other functions. Among the RNAPIII transcripts is ciliate telomerase RNA (TER). p65, a member of the LARP7 family, is an integral Tetrahymena thermophila telomerase holoenzyme protein required for TER biogenesis and telomerase RNP assembly. p65, together with TER and telomerase reverse transcriptase (TERT), form the Tetrahymena telomerase RNP catalytic core. p65 has an N-terminal domain followed by a La module and a C-terminal domain, which binds to the TER stem 4. We recently showed that the p65 C-terminal domain harbors a cryptic, atypical RRM, which uses a unique mode of single- and double-strand RNA binding and is required for telomerase RNP catalytic core assembly. This domain, which we named xRRM, appears to be present in and unique to genuine La and LARP7 proteins. Here we review the structure of the xRRM, discuss how this domain could recognize diverse substrates of La and LARP7 proteins and discuss the functional implications of the xRRM as an RNP chaperone.

  5. Carbohydrate binding properties of the stinging nettle (Urtica dioica) rhizome lectin.

    PubMed

    Shibuya, N; Goldstein, I J; Shafer, J A; Peumans, W J; Broekaert, W F

    1986-08-15

    The interaction of the stinging nettle rhizome lectin (UDA) with carbohydrates was studied by using the techniques of quantitative precipitation, hapten inhibition, equilibrium dialysis, and uv difference spectroscopy. The Carbohydrate binding site of UDA was determined to be complementary to an N,N',N"-triacetylchitotriose unit and proposed to consist of three subsites, each of which has a slightly different binding specificity. UDA also has a hydrophobic interacting region adjacent to the carbohydrate binding site. Equilibrium dialysis and uv difference spectroscopy revealed that UDA has two carbohydrate binding sites per molecule consisting of a single polypeptide chain. These binding sites either have intrinsically different affinities for ligand molecules, or they may display negative cooperativity toward ligand binding.

  6. Statistical Profiling of One Promiscuous Protein Binding Site: Illustrated by Urokinase Catalytic Domain.

    PubMed

    Cerisier, Natacha; Regad, Leslie; Triki, Dhoha; Petitjean, Michel; Flatters, Delphine; Camproux, Anne-Claude

    2017-10-01

    While recent literature focuses on drug promiscuity, the characterization of promiscuous binding sites (ability to bind several ligands) remains to be explored. Here, we present a proteochemometric modeling approach to analyze diverse ligands and corresponding multiple binding sub-pockets associated with one promiscuous binding site to characterize protein-ligand recognition. We analyze both geometrical and physicochemical profile correspondences. This approach was applied to examine the well-studied druggable urokinase catalytic domain inhibitor binding site, which results in a large number of complex structures bound to various ligands. This approach emphasizes the importance of jointly characterizing pocket and ligand spaces to explore the impact of ligand diversity on sub-pocket properties and to establish their main profile correspondences. This work supports an interest in mining available 3D holo structures associated with a promiscuous binding site to explore its main protein-ligand recognition tendency. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. RBind: computational network method to predict RNA binding sites.

    PubMed

    Wang, Kaili; Jian, Yiren; Wang, Huiwen; Zeng, Chen; Zhao, Yunjie

    2018-04-26

    Non-coding RNA molecules play essential roles by interacting with other molecules to perform various biological functions. However, it is difficult to determine RNA structures due to their flexibility. At present, the number of experimentally solved RNA-ligand and RNA-protein structures is still insufficient. Therefore, binding sites prediction of non-coding RNA is required to understand their functions. Current RNA binding site prediction algorithms produce many false positive nucleotides that are distance away from the binding sites. Here, we present a network approach, RBind, to predict the RNA binding sites. We benchmarked RBind in RNA-ligand and RNA-protein datasets. The average accuracy of 0.82 in RNA-ligand and 0.63 in RNA-protein testing showed that this network strategy has a reliable accuracy for binding sites prediction. The codes and datasets are available at https://zhaolab.com.cn/RBind. yjzhaowh@mail.ccnu.edu.cn. Supplementary data are available at Bioinformatics online.

  8. Insulation and wiring specificity of BceR-like response regulators and their target promoters in Bacillus subtilis.

    PubMed

    Fang, Chong; Nagy-Staroń, Anna; Grafe, Martin; Heermann, Ralf; Jung, Kirsten; Gebhard, Susanne; Mascher, Thorsten

    2017-04-01

    BceRS and PsdRS are paralogous two-component systems in Bacillus subtilis controlling the response to antimicrobial peptides. In the presence of extracellular bacitracin and nisin, respectively, the two response regulators (RRs) bind their target promoters, P bceA or P psdA , resulting in a strong up-regulation of target gene expression and ultimately antibiotic resistance. Despite high sequence similarity between the RRs BceR and PsdR and their known binding sites, no cross-regulation has been observed between them. We therefore investigated the specificity determinants of P bceA and P psdA that ensure the insulation of these two paralogous pathways at the RR-promoter interface. In vivo and in vitro analyses demonstrate that the regulatory regions within these two promoters contain three important elements: in addition to the known (main) binding site, we identified a linker region and a secondary binding site that are crucial for functionality. Initial binding to the high-affinity, low-specificity main binding site is a prerequisite for the subsequent highly specific binding of a second RR dimer to the low-affinity secondary binding site. In addition to this hierarchical cooperative binding, discrimination requires a competition of the two RRs for their respective binding site mediated by only slight differences in binding affinities. © 2016 John Wiley & Sons Ltd.

  9. A novel substance P binding site in bovine adrenal medulla.

    PubMed

    Geraghty, D P; Livett, B G; Rogerson, F M; Burcher, E

    1990-05-04

    Radioligand binding techniques were used to characterize the substance P (SP) binding site on membranes prepared from bovine adrenal medullae. 125I-labelled Bolton-Hunter substance P (BHSP), which recognises the C-terminally directed, SP-preferring NK1 receptor, showed no specific binding. In contrast, binding of [3H]SP was saturable (at 6 nM) and reversible, with an equilibrium dissociation constant (Kd) 1.46 +/- 0.73 nM, Bmax 0.73 +/- 0.06 pmol/g wet weight and Hill coefficient 0.98 +/- 0.01. Specific binding of [3H]SP was displaced by SP greater than neurokinin A (NKA) greater than SP(3-11) approximately SP(1-9) greater than SP(1-7) approximately SP(1-4) approximately SP(1-6), with neurokinin B (NKB) and SP(1-3) very weak competitors and SP(5-11), SP(7-11) and SP(9-11) causing negligible inhibition (up to 10 microM). This potency order is quite distinct from that seen with binding to an NK1 site, a conclusion confirmed by the lack of BHSP binding. It appears that Lys3 and/or Pro4 are critical for binding, suggesting an anionic binding site. These data suggest the existence of an unusual binding site which may represent a novel SP receptor. This site appears to require the entire sequence of the SP molecule for full recognition.

  10. sigma opiates and certain antipsychotic drugs mutually inhibit (+)-(/sup 3/H)SKF 10,047 and (/sup 3/H)haloperidol binding in guinea pig brain membranes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tam, S.W.; Cook, L.

    1984-09-01

    The relationship between binding of antipsychotic drugs and sigma psychotomimetic opiates to binding sites for the sigma agonist (+)-(/sup 3/H)SKF 10,047 (N-allylnormetazocine) and to dopamine D/sub 2/ sites was investigated. In guinea pig brain membranes, (+)-(/sup 3/H)SKF 10,047 bound to single class of sites with a K/sub d/ of 4 x 10/sup -8/ M and a B/sub max/ of 333 fmol/mg of protein. This binding was different from ..mu.., kappa, or delta opiate receptor binding. It was inhibited by opiates that produce psychotomimetic activities but not by opiates that lack such activities. Some antipsychotic drugs inhibited (+)-(/sup 3/H)SKF 10,047 bindingmore » with high to moderate affinities in the following order of potency: haloperidol > perphenazine > fluphenazine > acetophenazine > trifluoperazine > molindone greater than or equal to pimozide greater than or equal to thioridazine greater than or equal to chlorpromazine greater than or equal to triflupromazine. However, there were other antipsychotic drugs such as spiperone and clozapine that showed low affinity for the (+)-(/sup 3/H)SKF 10,047 binding sites. Affinities of antipsychotic drugs for (+)-(/sup 3/H)SKF 10,047 binding sites did not correlate with those for (/sup 3/H)spiperone (dopamine D/sub 2/) sites. (/sup 3/H)-Haloperidol binding in whole brain membranes was also inhibited by the sigma opiates pentazocine, cyclazocine, and (+)-(/sup 3/H)SKF 10,047. In the striatum, about half of the saturable (/sup 3/H)haloperidol binding was to (/sup 3/H)spiperone (D/sub 2/) sites and the other half was to sites similar to (+)-(/sup 3/H)SKF 10,047 binding sites. 15 references, 4 figures, 1 table.« less

  11. Clotrimazole and efaroxan inhibit red cell Gardos channel independently of imidazoline I1 and I2 binding sites.

    PubMed

    Coupry, I; Armsby, C C; Alper, S L; Brugnara, C; Parini, A

    1996-01-04

    In the present report, we investigated the potential involvement of imidazoline I1 and I2 binding sites in the inhibition of the Ca(2+)-activated K+ channel (Gardos channel) by clotrimazole in human red cells. Ca(2+)-activated 86Rb influx was inhibited by clotrimazole and efaroxan but not by the imidazoline binding site ligands clonidine, moxonidine, cirazoline and idazoxan (100 microM). Binding studies with [3H]idazoxan and [3H]p-aminoclonidine did not reveal the expression of I1 and I2 binding sites in erythrocytes. These data indicate that the effects of clotrimazole and efaroxan on the erythrocyte Ca(2+)-activated K+ channel may be mediated by a 'non-I1/non-I2' binding site.

  12. Accurate and sensitive quantification of protein-DNA binding affinity.

    PubMed

    Rastogi, Chaitanya; Rube, H Tomas; Kribelbauer, Judith F; Crocker, Justin; Loker, Ryan E; Martini, Gabriella D; Laptenko, Oleg; Freed-Pastor, William A; Prives, Carol; Stern, David L; Mann, Richard S; Bussemaker, Harmen J

    2018-04-17

    Transcription factors (TFs) control gene expression by binding to genomic DNA in a sequence-specific manner. Mutations in TF binding sites are increasingly found to be associated with human disease, yet we currently lack robust methods to predict these sites. Here, we developed a versatile maximum likelihood framework named No Read Left Behind (NRLB) that infers a biophysical model of protein-DNA recognition across the full affinity range from a library of in vitro selected DNA binding sites. NRLB predicts human Max homodimer binding in near-perfect agreement with existing low-throughput measurements. It can capture the specificity of the p53 tetramer and distinguish multiple binding modes within a single sample. Additionally, we confirm that newly identified low-affinity enhancer binding sites are functional in vivo, and that their contribution to gene expression matches their predicted affinity. Our results establish a powerful paradigm for identifying protein binding sites and interpreting gene regulatory sequences in eukaryotic genomes. Copyright © 2018 the Author(s). Published by PNAS.

  13. Accurate and sensitive quantification of protein-DNA binding affinity

    PubMed Central

    Rastogi, Chaitanya; Rube, H. Tomas; Kribelbauer, Judith F.; Crocker, Justin; Loker, Ryan E.; Martini, Gabriella D.; Laptenko, Oleg; Freed-Pastor, William A.; Prives, Carol; Stern, David L.; Mann, Richard S.; Bussemaker, Harmen J.

    2018-01-01

    Transcription factors (TFs) control gene expression by binding to genomic DNA in a sequence-specific manner. Mutations in TF binding sites are increasingly found to be associated with human disease, yet we currently lack robust methods to predict these sites. Here, we developed a versatile maximum likelihood framework named No Read Left Behind (NRLB) that infers a biophysical model of protein-DNA recognition across the full affinity range from a library of in vitro selected DNA binding sites. NRLB predicts human Max homodimer binding in near-perfect agreement with existing low-throughput measurements. It can capture the specificity of the p53 tetramer and distinguish multiple binding modes within a single sample. Additionally, we confirm that newly identified low-affinity enhancer binding sites are functional in vivo, and that their contribution to gene expression matches their predicted affinity. Our results establish a powerful paradigm for identifying protein binding sites and interpreting gene regulatory sequences in eukaryotic genomes. PMID:29610332

  14. DISTINCT ROLES OF β1 MIDAS, ADMIDAS AND LIMBS CATION-BINDING SITES IN LIGAND RECOGNITION BY INTEGRIN α2β1*

    PubMed Central

    Valdramidou, Dimitra; Humphries, Martin J.; Mould, A. Paul

    2012-01-01

    Integrin-ligand interactions are regulated in a complex manner by divalent cations, and previous studies have identified ligand-competent, stimulatory, and inhibitory cation-binding sites. In collagen-binding integrins, such as α2β1, ligand recognition takes place exclusively at the α subunit I domain. However, activation of the αI domain depends on its interaction with a structurally similar domain in the β subunit known as the I-like or βI domain. The top face of the βI domain contains three cation-binding sites: the metal-ion dependent adhesion site (MIDAS), the ADMIDAS (adjacent to MIDAS) and LIMBS (ligand-associated metal binding site). The role of these sites in controlling ligand binding to the αI domain has yet to be elucidated. Mutation of the MIDAS or LIMBS completely blocked collagen binding to α2β1; in contrast mutation of the ADMIDAS reduced ligand recognition but this effect could be overcome by the activating mAb TS2/16. Hence, the MIDAS and LIMBS appear to be essential for the interaction between αI and βI whereas occupancy of the ADMIDAS has an allosteric effect on the conformation of βI. An activating mutation in the α2 I domain partially restored ligand binding to the MIDAS and LIMBS mutants. Analysis of the effects of Ca2+, Mg2+ and Mn2+ on ligand binding to these mutants showed that the MIDAS is a ligand-competent site through which Mn2+ stimulates ligand binding, whereas the LIMBS is a stimulatory Ca2+-binding site, occupancy of which increases the affinity of Mg2+ for the MIDAS. PMID:18820259

  15. Insight into the binding mechanism of imipenem to human serum albumin by spectroscopic and computational approaches.

    PubMed

    Rehman, Md Tabish; Shamsi, Hira; Khan, Asad U

    2014-06-02

    The mechanism of interaction between imipenem and HSA was investigated by various techniques like fluorescence, UV.vis absorbance, FRET, circular dichroism, urea denaturation, enzyme kinetics, ITC, and molecular docking. We found that imipenem binds to HSA at a high affinity site located in subdomain IIIA (Sudlow's site I) and a low affinity site located in subdomain IIA.IIB. Electrostatic interactions played a vital role along with hydrogen bonding and hydrophobic interactions in stabilizing the imipenem.HSA complex at subdomain IIIA, while only electrostatic and hydrophobic interactions were present at subdomain IIA.IIB. The binding and thermodynamic parameters obtained by ITC showed that the binding of imipenem to HSA was a spontaneous process (ΔGD⁰(D)= -32.31 kJ mol(-1) for high affinity site and ΔGD⁰(D) = -23.02 kJ mol(-1) for low affinity site) with binding constants in the range of 10(4)-10(5) M(-1). Spectroscopic investigation revealed only one binding site of imipenem on HSA (Ka∼10(4) M(-1)). FRET analysis showed that the binding distance between imipenem and HSA (Trp-214) was optimal (r = 4.32 nm) for quenching to occur. Decrease in esterase-like activity of HSA in the presence of imipenem showed that Arg-410 and Tyr-411 of subdomain IIIA (Sudlow's site II) were directly involved in the binding process. CD spectral analysis showed altered conformation of HSA upon imipenem binding. Moreover, the binding of imipenem to subdomain IIIA (Sudlow's site II) of HSA also affected its folding pathway as clear from urea-induced denaturation studies.

  16. Direct optical mapping of transcription factor binding sites on field-stretched λ-DNA in nanofluidic devices

    PubMed Central

    Sriram, K. K.; Yeh, Jia-Wei; Lin, Yii-Lih; Chang, Yi-Ren; Chou, Chia-Fu

    2014-01-01

    Mapping transcription factor (TF) binding sites along a DNA backbone is crucial in understanding the regulatory circuits that control cellular processes. Here, we deployed a method adopting bioconjugation, nanofluidic confinement and fluorescence single molecule imaging for direct mapping of TF (RNA polymerase) binding sites on field-stretched single DNA molecules. Using this method, we have mapped out five of the TF binding sites of E. coli RNA polymerase to bacteriophage λ-DNA, where two promoter sites and three pseudo-promoter sites are identified with the corresponding binding frequency of 45% and 30%, respectively. Our method is quick, robust and capable of resolving protein-binding locations with high accuracy (∼ 300 bp), making our system a complementary platform to the methods currently practiced. It is advantageous in parallel analysis and less prone to false positive results over other single molecule mapping techniques such as optical tweezers, atomic force microscopy and molecular combing, and could potentially be extended to general mapping of protein–DNA interaction sites. PMID:24753422

  17. Geochemical evidence for cryptic sulfur cycling in salt marsh sediments

    NASA Astrophysics Data System (ADS)

    Mills, Jennifer V.; Antler, Gilad; Turchyn, Alexandra V.

    2016-11-01

    Cryptic sulfur cycling is an enigmatic process in which sulfate is reduced to some lower-valence state sulfur species and subsequently quantitatively reoxidized; the rate and microbial energetics of this process and how prevalent it may be in the environment remain controversial. Here we investigate sulfur cycling in salt marsh sediments from Norfolk, England where we observe high ferrous iron concentrations with no depletion of sulfate or change in the sulfur isotope ratio of that sulfate, but a 5‰ increase in the oxygen isotope ratio in sulfate, indicating that sulfate has been through a reductive cycle replacing its oxygen atoms. This cryptic sulfur cycle was replicated in laboratory incubations using 18O-enriched water, demonstrating that the field results do not solely result from mixing processes in the natural environment. Numerical modeling of the laboratory incubations scaled to represent the salt marsh sediments suggests that the uptake rate of sulfate during this cryptic sulfur cycling is similar to the uptake rate of sulfate during the fastest microbial sulfate reduction that has been measured in the natural environment. The difference is that during cryptic sulfur cycling, all of the sulfur is subsequently reoxidized to sulfate. We discuss mechanisms for this pathway of sulfur cycling including the possible link to the subsurface iron cycle.

  18. DNA barcode reference library for Iberian butterflies enables a continental-scale preview of potential cryptic diversity

    PubMed Central

    Dincă, Vlad; Montagud, Sergio; Talavera, Gerard; Hernández-Roldán, Juan; Munguira, Miguel L.; García-Barros, Enrique; Hebert, Paul D. N.; Vila, Roger

    2015-01-01

    How common are cryptic species - those overlooked because of their morphological similarity? Despite its wide-ranging implications for biology and conservation, the answer remains open to debate. Butterflies constitute the best-studied invertebrates, playing a similar role as birds do in providing models for vertebrate biology. An accurate assessment of cryptic diversity in this emblematic group requires meticulous case-by-case assessments, but a preview to highlight cases of particular interest will help to direct future studies. We present a survey of mitochondrial genetic diversity for the butterfly fauna of the Iberian Peninsula with unprecedented resolution (3502 DNA barcodes for all 228 species), creating a reliable system for DNA-based identification and for the detection of overlooked diversity. After compiling available data for European butterflies (5782 sequences, 299 species), we applied the Generalized Mixed Yule-Coalescent model to explore potential cryptic diversity at a continental scale. The results indicate that 27.7% of these species include from two to four evolutionary significant units (ESUs), suggesting that cryptic biodiversity may be higher than expected for one of the best-studied invertebrate groups and regions. The ESUs represent important units for conservation, models for studies of evolutionary and speciation processes, and sentinels for future research to unveil hidden diversity. PMID:26205828

  19. Clinical and genetic features of dyskeratosis congenita, cryptic dyskeratosis congenita, and Hoyeraal-Hreidarsson syndrome in Japan.

    PubMed

    Yamaguchi, Hiroki; Sakaguchi, Hirotoshi; Yoshida, Kenichi; Yabe, Miharu; Yabe, Hiromasa; Okuno, Yusuke; Muramatsu, Hideki; Takahashi, Yoshiyuki; Yui, Shunsuke; Shiraishi, Yuichi; Chiba, Kenichi; Tanaka, Hiroko; Miyano, Satoru; Inokuchi, Koiti; Ito, Etsuro; Ogawa, Seishi; Kojima, Seiji

    2015-11-01

    Dyskeratosis congenita (DKC) is an inherited bone marrow failure (BMF) syndrome typified by reticulated skin pigmentation, nail dystrophy, and mucosal leukoplakia. Hoyeraal-Hreidarsson syndrome (HHS) is considered to be a severe form of DKC. Unconventional forms of DKC, which develop slowly in adulthood but without the physical anomalies characteristic of DKC (cryptic DKC), have been reported. Clinical and genetic features of DKC have been investigated in Caucasian, Black, and Hispanic populations, but not in Asian populations. The present study aimed to determine the clinical and genetic features of DKC, HHS, and cryptic DKC among Japanese patients. We analyzed 16 patients diagnosed with DKC, three patients with HHS, and 15 patients with cryptic DKC. We found that platelet count was significantly more depressed than neutrophil count or hemoglobin value in DKC patients, and identified DKC patients with large deletions in the telomerase reverse transcriptase and cryptic DKC patients with RTEL1 mutations on both alleles. This led to some patients previously considered to have unclassifiable BMF being diagnosed with cDKC through identification of new gene mutations. It thus seems important from a clinical viewpoint to re-examine the clinical characteristics, frequency of genetic mutations, and treatment efficacy in DKC, HHS, and cDKC.

  20. A Microphysically-based Approach to Inferring Porosity, Grain Size, and Dust Abundance in the Seasonal Caps from Atmospherically-corrected TES Spectra

    NASA Technical Reports Server (NTRS)

    Eluszkiewicz, J.; Titus, T. N.

    2003-01-01

    One of the highlights of the TES observations in the polar regions has been the identification of a "cryptic" region in the south where CO2 appears to be in the form of a solid slab rather than a fluffy frost. While the exact mechanism(s) by which the cryptic region is formed are still subject of some debate, it appears certain that a type of rapid metamorphism related to the high volatility of CO2 ice is involved. The high volatility of CO2 ice under martian conditions has several Solar System analogs (N2 on Triton and Pluto, SO2 on Io), thus making the martian cryptic region somewhat less cryptic and certainly non-unique among planetary objects. In an endmember scenario, both the formation and the spectral properties of the cryptic region (and of other areas in the seasonal caps) can be quantitatively modeled by considering sintering of an ensemble of quasi-spherical CO2 grains. This model includes the special case of instanteneous slab formation, which occurs when the grains are sufficiently small (in the submicron range) so that their sintering timescale is short relative to the deposition timescale (a situation analogous to the "sintering" of water droplets falling into a pond).

  1. Molecular simulations and Markov state modeling reveal the structural diversity and dynamics of a theophylline-binding RNA aptamer in its unbound state

    PubMed Central

    Warfield, Becka M.

    2017-01-01

    RNA aptamers are oligonucleotides that bind with high specificity and affinity to target ligands. In the absence of bound ligand, secondary structures of RNA aptamers are generally stable, but single-stranded and loop regions, including ligand binding sites, lack defined structures and exist as ensembles of conformations. For example, the well-characterized theophylline-binding aptamer forms a highly stable binding site when bound to theophylline, but the binding site is unstable and disordered when theophylline is absent. Experimental methods have not revealed at atomic resolution the conformations that the theophylline aptamer explores in its unbound state. Consequently, in the present study we applied 21 microseconds of molecular dynamics simulations to structurally characterize the ensemble of conformations that the aptamer adopts in the absence of theophylline. Moreover, we apply Markov state modeling to predict the kinetics of transitions between unbound conformational states. Our simulation results agree with experimental observations that the theophylline binding site is found in many distinct binding-incompetent states and show that these states lack a binding pocket that can accommodate theophylline. The binding-incompetent states interconvert with binding-competent states through structural rearrangement of the binding site on the nanosecond to microsecond timescale. Moreover, we have simulated the complete theophylline binding pathway. Our binding simulations supplement prior experimental observations of slow theophylline binding kinetics by showing that the binding site must undergo a large conformational rearrangement after the aptamer and theophylline form an initial complex, most notably, a major rearrangement of the C27 base from a buried to solvent-exposed orientation. Theophylline appears to bind by a combination of conformational selection and induced fit mechanisms. Finally, our modeling indicates that when Mg2+ ions are present the population of binding-competent aptamer states increases more than twofold. This population change, rather than direct interactions between Mg2+ and theophylline, accounts for altered theophylline binding kinetics. PMID:28437473

  2. The gammaPE complex contains both SATB1 and HOXB2 and has positive and negative roles in human gamma-globin gene regulation.

    PubMed

    Case, S S; Huber, P; Lloyd, J A

    1999-11-01

    A large nuclear protein complex, termed gammaPE (for gamma-globin promoter and enhancer binding factor), binds to five sites located 5' and 3' of the human y-globin gene. Two proteins, SATB1 (special A-T-rich binding protein 1) and HOXB2, can bind to yPE binding sites. SATB1 binds to nuclear matrix-attachment sites, and HOXB2 is a homeodomain protein important in neural development that is also expressed during erythropoiesis. The present work showed that antisera directed against either SATB1 or HOXB2 reacted specifically with the entire gammaPE complex in electrophoretic mobility shift assays (EMSAs), suggesting that the two proteins can bind to the gammaPE binding site simultaneously. When SATB1 or HOXB2 was expressed in vitro, they could bind independently to gammaPE binding sites in EMSA. Interestingly, the proteins expressed in vitro competed effectively with each other for the gammaPE binding site, suggesting that this may occur under certain conditions in vivo. Transient cotransfections of a HOXB2 cDNA and a y-globin-luciferase reporter gene construct into cells expressing SATB1 suggested that SATB1 has a positive and HOXB2 a negative regulatory effect on transcription. Taking into account their potentially opposing effects and binding activities, SATB1 and HOXB2 may modulate the amount of gamma-globin mRNA expressed during development and differentiation.

  3. Antagonism of human CC-chemokine receptor 4 can be achieved through three distinct binding sites on the receptor

    PubMed Central

    Slack, Robert J; Russell, Linda J; Barton, Nick P; Weston, Cathryn; Nalesso, Giovanna; Thompson, Sally-Anne; Allen, Morven; Chen, Yu Hua; Barnes, Ashley; Hodgson, Simon T; Hall, David A

    2013-01-01

    Chemokine receptor antagonists appear to access two distinct binding sites on different members of this receptor family. One class of CCR4 antagonists has been suggested to bind to a site accessible from the cytoplasm while a second class did not bind to this site. In this report, we demonstrate that antagonists representing a variety of structural classes bind to two distinct allosteric sites on CCR4. The effects of pairs of low-molecular weight and/or chemokine CCR4 antagonists were evaluated on CCL17- and CCL22-induced responses of human CCR4+ T cells. This provided an initial grouping of the antagonists into sets which appeared to bind to distinct binding sites. Binding studies were then performed with radioligands from each set to confirm these groupings. Some novel receptor theory was developed to allow the interpretation of the effects of the antagonist combinations. The theory indicates that, generally, the concentration-ratio of a pair of competing allosteric modulators is maximally the sum of their individual effects while that of two modulators acting at different sites is likely to be greater than their sum. The low-molecular weight antagonists could be grouped into two sets on the basis of the functional and binding experiments. The antagonistic chemokines formed a third set whose behaviour was consistent with that of simple competitive antagonists. These studies indicate that there are two allosteric regulatory sites on CCR4. PMID:25505571

  4. BindML/BindML+: Detecting Protein-Protein Interaction Interface Propensity from Amino Acid Substitution Patterns.

    PubMed

    Wei, Qing; La, David; Kihara, Daisuke

    2017-01-01

    Prediction of protein-protein interaction sites in a protein structure provides important information for elucidating the mechanism of protein function and can also be useful in guiding a modeling or design procedures of protein complex structures. Since prediction methods essentially assess the propensity of amino acids that are likely to be part of a protein docking interface, they can help in designing protein-protein interactions. Here, we introduce BindML and BindML+ protein-protein interaction sites prediction methods. BindML predicts protein-protein interaction sites by identifying mutation patterns found in known protein-protein complexes using phylogenetic substitution models. BindML+ is an extension of BindML for distinguishing permanent and transient types of protein-protein interaction sites. We developed an interactive web-server that provides a convenient interface to assist in structural visualization of protein-protein interactions site predictions. The input data for the web-server are a tertiary structure of interest. BindML and BindML+ are available at http://kiharalab.org/bindml/ and http://kiharalab.org/bindml/plus/ .

  5. Computational Optimization and Characterization of Molecularly Imprinted Polymers

    NASA Astrophysics Data System (ADS)

    Terracina, Jacob J.

    Molecularly imprinted polymers (MIPs) are a class of materials containing sites capable of selectively binding to the imprinted target molecule. Computational chemistry techniques were used to study the effect of different fabrication parameters (the monomer-to-target ratios, pre-polymerization solvent, temperature, and pH) on the formation of the MIP binding sites. Imprinted binding sites were built in silico for the purposes of better characterizing the receptor - ligand interactions. Chiefly, the sites were characterized with respect to their selectivities and the heterogeneity between sites. First, a series of two-step molecular mechanics (MM) and quantum mechanics (QM) computational optimizations of monomer -- target systems was used to determine optimal monomer-to-target ratios for the MIPs. Imidazole- and xanthine-derived target molecules were studied. The investigation included both small-scale models (one-target) and larger scale models (five-targets). The optimal ratios differed between the small and larger scales. For the larger models containing multiple targets, binding-site surface area analysis was used to evaluate the heterogeneity of the sites. The more fully surrounded sites had greater binding energies. Molecular docking was then used to measure the selectivities of the QM-optimized binding sites by comparing the binding energies of the imprinted target to that of a structural analogue. Selectivity was also shown to improve as binding sites become more fully encased by the monomers. For internal sites, docking consistently showed selectivity favoring the molecules that had been imprinted via QM geometry optimizations. The computationally imprinted sites were shown to exhibit size-, shape-, and polarity-based selectivity. This represented a novel approach to investigate the selectivity and heterogeneity of imprinted polymer binding sites, by applying the rapid orientation screening of MM docking to the highly accurate QM-optimized geometries. Next, we sought to computationally construct and investigate binding sites for their enantioselectivity. Again, a two-step MM [special characters removed] QM optimization scheme was used to "computationally imprint" chiral molecules. Using docking techniques, the imprinted binding sites were shown to exhibit an enantioselective preference for the imprinted molecule over its enantiomer. Docking of structurally similar chiral molecules showed that the sites computationally imprinted with R- or S-tBOC-tyrosine were able to differentiate between R- and S-forms of other tyrosine derivatives. The cross-enantioselectivity did not hold for chiral molecules that did not share the tyrosine H-bonding functional group orientations. Further analysis of the individual monomer - target interactions within the binding site led us to conclude that H-bonding functional groups that are located immediately next to the target's chiral center, and therefore spatially fixed relative to the chiral center, will have a stronger contribution to the enantioselectivity of the site than those groups separated from the chiral center by two or more rotatable bonds. These models were the first computationally imprinted binding sites to exhibit this enantioselective preference for the imprinted target molecules. Finally, molecular dynamics (MD) was used to quantify H-bonding interactions between target molecules, monomers, and solvents representative of the pre-polymerization matrix. It was found that both target dimerization and solvent interference decrease the number of monomer - target H-bonds present. Systems were optimized via simulated annealing to create binding sites that were then subjected to molecular docking analysis. Docking showed that the presence of solvent had a detrimental effect on the sensitivity and selectivity of the sites, and that solvents with more H-bonding capabilities were more disruptive to the binding properties of the site. Dynamic simulations also showed that increasing the temperature of the solution can significantly decrease the number of H-bonds formed between the targets and monomers. It is believed that the monomer - target complexes formed within the pre-polymerization matrix are translated into the selective binding cavities formed during polymerization. Elucidating the nature of these interactions in silico improves our understanding of MIPs, ultimately allowing for more optimized sensing materials.

  6. Hydration in drug design. 3. Conserved water molecules at the ligand-binding sites of homologous proteins

    NASA Astrophysics Data System (ADS)

    Poornima, C. S.; Dean, P. M.

    1995-12-01

    Water molecules are known to play an important rôle in mediating protein-ligand interactions. If water molecules are conserved at the ligand-binding sites of homologous proteins, such a finding may suggest the structural importance of water molecules in ligand binding. Structurally conserved water molecules change the conventional definition of `binding sites' by changing the shape and complementarity of these sites. Such conserved water molecules can be important for site-directed ligand/drug design. Therefore, five different sets of homologous protein/protein-ligand complexes have been examined to identify the conserved water molecules at the ligand-binding sites. Our analysis reveals that there are as many as 16 conserved water molecules at the FAD binding site of glutathione reductase between the crystal structures obtained from human and E. coli. In the remaining four sets of high-resolution crystal structures, 2-4 water molecules have been found to be conserved at the ligand-binding sites. The majority of these conserved water molecules are either bound in deep grooves at the protein-ligand interface or completely buried in cavities between the protein and the ligand. All these water molecules, conserved between the protein/protein-ligand complexes from different species, have identical or similar apolar and polar interactions in a given set. The site residues interacting with the conserved water molecules at the ligand-binding sites have been found to be highly conserved among proteins from different species; they are more conserved compared to the other site residues interacting with the ligand. These water molecules, in general, make multiple polar contacts with protein-site residues.

  7. Altered binding of thioflavin t to the peripheral anionic site of acetylcholinesterase after phosphorylation of the active site by chlorpyrifos oxon or dichlorvos

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sultatos, L.G.; Kaushik, R.

    2008-08-01

    The peripheral anionic site of acetylcholinesterase, when occupied by a ligand, is known to modulate reaction rates at the active site of this important enzyme. The current report utilized the peripheral anionic site specific fluorogenic probe thioflavin t to determine if the organophosphates chlorpyrifos oxon and dichlorvos bind to the peripheral anionic site of human recombinant acetylcholinesterase, since certain organophosphates display concentration-dependent kinetics when inhibiting this enzyme. Incubation of 3 nM acetylcholinesterase active sites with 50 nM or 2000 nM inhibitor altered both the B{sub max} and K{sub d} for thioflavin t binding to the peripheral anionic site. However, thesemore » changes resulted from phosphorylation of Ser203 since increasing either inhibitor from 50 nM to 2000 nM did not alter further thioflavin t binding kinetics. Moreover, the organophosphate-induced decrease in B{sub max} did not represent an actual reduction in binding sites, but instead likely resulted from conformational interactions between the acylation and peripheral anionic sites that led to a decrease in the rigidity of bound thioflavin t. A drop in fluorescence quantum yield, leading to an apparent decrease in B{sub max}, would accompany the decreased rigidity of bound thioflavin t molecules. The organophosphate-induced alterations in K{sub d} represented changes in binding affinity of thioflavin t, with diethylphosphorylation of Ser203 increasing K{sub d}, and dimethylphosphorylation of Ser203 decreasing K{sub d}. These results indicate that chlorpyrifos oxon and dichlorvos do not bind directly to the peripheral anionic site of acetylcholinesterase, but can affect binding to that site through phosphorylation of Ser203.« less

  8. The Binding of Silibinin, the Main Constituent of Silymarin, to Site I on Human Serum Albumin.

    PubMed

    Yamasaki, Keishi; Sato, Hiroki; Minagoshi, Saori; Kyubun, Karin; Anraku, Makoto; Miyamura, Shigeyuki; Watanabe, Hiroshi; Taguchi, Kazuaki; Seo, Hakaru; Maruyama, Toru; Otagiri, Masaki

    2017-01-01

    Silibinin is the main constituent of silymarin, an extract from the seeds of milk thistle (Silybum marianum). Because silibinin has many pharmacological activities, extending its clinical use in the treatment of a wider variety of diseases would be desirable. In this study, we report on the binding of silibinin to plasma proteins, an issue that has not previously been extensively studied. The findings indicated that silibinin mainly binds to human serum albumin (HSA). Mutual displacement experiments using ligands that primarily bind to sites I and II clearly revealed that silibinin binds tightly and selectively to site I (subsites Ia and/or Ic) of HSA, which is located in subdomain IIA. Thermodynamic analyses suggested that hydrogen bonding and van der Waals interactions are major contributors to silibinin-HSA interactions. Furthermore, the binding of silibinin to HSA was found to be decreased with increasing ionic strength and detergent concentration of the media, suggesting that electrostatic and hydrophobic interactions are involved in the binding. Trp214 and Arg218 were identified as being involved in the binding of silibinin to site I, based on binding experiments using chemically modified- and mutant-HSAs. In conclusion, the available evidence indicates that silibinin binds to the region close to Trp214 and Arg218 in site I of HSA with assistance by multiple forces and can displace site I drugs (e.g., warfarin or iodipamide), but not site II drugs (e.g., ibuprofen).

  9. Characterization and localization of arginine vasotocin receptors in the brain and kidney of an amphibian

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Boyd, S.K.

    1987-01-01

    Because arginine vasotocin (AVT) activates male sexual behaviors in the rough-skinned newt (Taricha granulosa), quantitative autoradiography with radiolabeled arginine vasopressin (/sup 3/H-AVP) was used to localize and characterize putative AVT receptors in the brain of this amphibian. Binding of /sup 3/H-AVP to sites within the medial pallium was saturable, specific, reversible, of high affinity and low capacity. These binding sites appear to represent authentic central nervous system receptors for AVT. Furthermore, ligand specificity for the binding sites in this amphibian differs from that reported for AVP binding sites in rat brains. Dense concentrations of specific binding sites were located inmore » the olfactory nerve as it entered the olfactory bulb within the medial pallium, dorsal pallium, and amygdala pars lateralis of the telencephalon, and in the tegmental region of the medulla. Concentrations of binding sites differed significantly among various brain regions. A comparison of male and female newts collected during the breeding season revealed no sexual dimorphism. These areas may represent site(s) of action where AVT elicits sexual behaviors in male T. granulosa.« less

  10. sc-PDB: a database for identifying variations and multiplicity of 'druggable' binding sites in proteins.

    PubMed

    Meslamani, Jamel; Rognan, Didier; Kellenberger, Esther

    2011-05-01

    The sc-PDB database is an annotated archive of druggable binding sites extracted from the Protein Data Bank. It contains all-atoms coordinates for 8166 protein-ligand complexes, chosen for their geometrical and physico-chemical properties. The sc-PDB provides a functional annotation for proteins, a chemical description for ligands and the detailed intermolecular interactions for complexes. The sc-PDB now includes a hierarchical classification of all the binding sites within a functional class. The sc-PDB entries were first clustered according to the protein name indifferent of the species. For each cluster, we identified dissimilar sites (e.g. catalytic and allosteric sites of an enzyme). SCOPE AND APPLICATIONS: The classification of sc-PDB targets by binding site diversity was intended to facilitate chemogenomics approaches to drug design. In ligand-based approaches, it avoids comparing ligands that do not share the same binding site. In structure-based approaches, it permits to quantitatively evaluate the diversity of the binding site definition (variations in size, sequence and/or structure). The sc-PDB database is freely available at: http://bioinfo-pharma.u-strasbg.fr/scPDB.

  11. Screening Mixtures of Small Molecules for Binding to Multiple Sites on the Surface Tetanus Toxin C Fragment by Bioaffinity NMR

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cosman, M; Zeller, L; Lightstone, F C

    2002-01-01

    The clostridial neurotoxins include the closely related tetanus (TeNT) and botulinum (BoNT) toxins. Botulinum toxin is used to treat severe muscle disorders and as a cosmetic wrinkle reducer. Large quantities of botulinum toxin have also been produced by terrorists for use as a biological weapon. Because there are no known antidotes for these toxins, they thus pose a potential threat to human health whether by an accidental overdose or by a hostile deployment. Thus, the discovery of high specificity and affinity compounds that can inhibit their binding to neural cells can be used as antidotes or in the design ofmore » chemical detectors. Using the crystal structure of the C fragment of the tetanus toxin (TetC), which is the cell recognition and cell surface binding domain, and the computational program DOCK, sets of small molecules have been predicted to bind to two different sites located on the surface of this protein. While Site-1 is common to the TeNT and BoNTs, Site-2 is unique to TeNT. Pairs of these molecules from each site can then be linked together synthetically to thereby increase the specificity and affinity for this toxin. Electrospray ionization mass spectroscopy was used to experimentally screen each compound for binding. Mixtures containing binders were further screened for activity under biologically relevant conditions using nuclear magnetic resonance (NMR) methods. The screening of mixtures of compounds offers increased efficiency and throughput as compared to testing single compounds and can also evaluate how possible structural changes induced by the binding of one ligand can influence the binding of the second ligand. In addition, competitive binding experiments with mixtures containing ligands predicted to bind the same site could identify the best binder for that site. NMR transfer nuclear Overhauser effect (trNOE) confirm that TetC binds doxorubicin but that this molecule is displaced by N-acetylneuraminic acid (sialic acid) in a mixture that also contains 3-sialyllactose (another predicted site 1 binder) and bisbenzimide 33342 (non-binder). A series of five predicted Site-2 binders were then screened sequentially in the presence of the Site-1 binder doxorubicin. These experiments showed that the compounds lavendustin A and naphthofluorescein-di-({beta}-D-galactopyranoside) binds along with doxorubicin to TetC. Further experiments indicate that doxorubicin and lavendustin are potential candidates to use in preparing a bidendate inhibitor specific for TetC. The simultaneous binding of two different predicted Site-2 ligands to TetC suggests that they may bind multiple sites. Another possibility is that the conformations of the binding sites are dynamic and can bind multiple diverse ligands at a single site depending on the pre-existing conformation of the protein, especially when doxorubicin is already bound.« less

  12. Ap4A and ADP-beta-S binding to P2 purinoceptors present on rat brain synaptic terminals.

    PubMed Central

    Pintor, J.; Díaz-Rey, M. A.; Miras-Portugal, M. T.

    1993-01-01

    1. Diadenosine tetraphosphate (Ap4A) a dinucleotide stored and released from rat brain synaptic terminals presents two types of affinity binding sites in synaptosomes. When [3H]-Ap4A was used for binding studies a Kd value of 0.10 +/- 0.014 nM and a Bmax value of 16.6 +/- 1.2 fmol mg-1 protein were obtained for the high affinity binding site from the Scatchard analysis. The second binding site, obtained by displacement studies, showed a Ki value of 0.57 +/- 0.09 microM. 2. Displacement of [3H]-Ap4A by non-labelled Ap4A and P2-purinoceptor ligands showed a displacement order of Ap4A > adenosine 5'-O-(2-thiodiphosphate) (ADP-beta-S) > 5'-adenylyl-imidodiphosphate (AMP-PNP) > alpha,beta-methylene adenosine 5'-triphosphate (alpha,beta-MeATP) in both sites revealed by the Ki values of 0.017 nM, 0.030 nM, 0.058 nM and 0.147 nM respectively for the high affinity binding site and values of 0.57 microM, 0.87 microM, 2.20 microM and 4.28 microM respectively for the second binding site. 3. Studies of the P2-purinoceptors present in synaptosomes were also performed with [35S]-ADP-beta-S. This radioligand showed two binding sites the first with Kd and Bmax values of 0.11 +/- 0.022 nM and 3.9 +/- 2.1 fmol mg-1 of protein respectively for the high affinity binding site obtained from the Scatchard plot. The second binding site showed a Ki of 0.018 +/- 0.0035 microM obtained from displacement curves. 4. Competition studies with diadenosine polyphosphates of [35S]-ADP-beta-S binding showed a displacement order of Ap4A > Ap5A > Ap6A in the high affinity binding site and Ki values of 0.023 nM, 0.081 nM and 5.72 nM respectively.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:8485620

  13. Influence of sulfhydryl sites on metal binding by bacteria

    NASA Astrophysics Data System (ADS)

    Nell, Ryan M.; Fein, Jeremy B.

    2017-02-01

    The role of sulfhydryl sites within bacterial cell envelopes is still unknown, but the sites may control the fate and bioavailability of metals. Organic sulfhydryl compounds are important complexing ligands in aqueous systems and they can influence metal speciation in natural waters. Though representing only approximately 5-10% of the total available binding sites on bacterial surfaces, sulfhydryl sites exhibit high binding affinities for some metals. Due to the potential importance of bacterial sulfhydryl sites in natural systems, metal-bacterial sulfhydryl site binding constants must be determined in order to construct accurate models of the fate and distribution of metals in these systems. To date, only Cd-sulfhydryl binding has been quantified. In this study, the thermodynamic stabilities of Mn-, Co-, Ni-, Zn-, Sr- and Pb-sulfhydryl bacterial cell envelope complexes were determined for the bacterial species Shewanella oneidensis MR-1. Metal adsorption experiments were conducted as a function of both pH, ranging from 5.0 to 7.0, and metal loading, from 0.5 to 40.0 μmol/g (wet weight) bacteria, in batch experiments in order to determine if metal-sulfhydryl binding occurs. Initially, the data were used to calculate the value of the stability constants for the important metal-sulfhydryl bacterial complexes for each metal-loading condition studied, assuming a single binding reaction for the dominant metal-binding site type under the pH conditions of the experiments. For most of the metals that we studied, these calculated stability constant values increased significantly with decreasing metal loading, strongly suggesting that our initial assumption was not valid and that more than one type of binding occurs at the assumed binding site. We then modeled each dataset with two distinct site types with identical acidity constants: one site with a high metal-site stability constant value, which we take to represent metal-sulfhydryl binding and which dominates under low metal loading conditions, and another more abundant site that we term non-sulfhydryl sites that becomes important at high metal loadings. The resulting calculated stability constants do not vary significantly as a function of metal loading and yield reasonable fits to the observed adsorption behaviors as a function of both pH and metal loading. We use the results to calculate the speciation of metals bound by the bacterial envelope in realistic bacteria-bearing, heavy metal contaminated systems in order to demonstrate the potential importance of metal-sulfhydryl binding in the budget of bacterially-adsorbed metals under low metal-loading conditions.

  14. Discovery of the ammonium substrate site on glutamine synthetase, a third cation binding site.

    PubMed Central

    Liaw, S. H.; Kuo, I.; Eisenberg, D.

    1995-01-01

    Glutamine synthetase (GS) catalyzes the ATP-dependent condensation of ammonia and glutamate to yield glutamine, ADP, and inorganic phosphate in the presence of divalent cations. Bacterial GS is an enzyme of 12 identical subunits, arranged in two rings of 6, with the active site between each pair of subunits in a ring. In earlier work, we have reported the locations within the funnel-shaped active site of the substrates glutamate and ATP and of the two divalent cations, but the site for ammonia (or ammonium) has remained elusive. Here we report the discovery by X-ray crystallography of a binding site on GS for monovalent cations, Tl+ and Cs+, which is probably the binding site for the substrate ammonium ion. Fourier difference maps show the following. (1) Tl+ and Cs+ bind at essentially the same site, with ligands being Glu 212, Tyr 179, Asp 50', Ser 53' of the adjacent subunit, and the substrate glutamate. From its position adjacent to the substrate glutamate and the cofactor ADP, we propose that this monovalent cation site is the substrate ammonium ion binding site. This proposal is supported by enzyme kinetics. Our kinetic measurements show that Tl+, Cs+, and NH4+ are competitive inhibitors to NH2OH in the gamma-glutamyl transfer reaction. (2) GS is a trimetallic enzyme containing two divalent cation sites (n1, n2) and one monovalent cation site per subunit. These three closely spaced ions are all at the active site: the distance between n1 and n2 is 6 A, between n1 and Tl+ is 4 A, and between n2 and Tl+ is 7 A. Glu 212 and the substrate glutamate are bridging ligands for the n1 ion and Tl+. (3) The presence of a monovalent cation in this site may enhance the structural stability of GS, because of its effect of balancing the negative charges of the substrate glutamate and its ligands and because of strengthening the "side-to-side" intersubunit interaction through the cation-protein bonding. (4) The presence of the cofactor ADP increases the Tl+ binding to GS because ADP binding induces movement of Asp 50' toward this monovalent cation site, essentially forming the site. This observation supports a two-step mechanism with ordered substrate binding: ATP first binds to GS, then Glu binds and attacks ATP to form gamma-glutamyl phosphate and ADP, which complete the ammonium binding site. The third substrate, an ammonium ion, then binds to GS, and then loses a proton to form the more active species ammonia, which attacks the gamma-glutamyl phosphate to yield Gln. (5) Because the products (Glu or Gln) of the reactions catalyzed by GS are determined by the molecule (water or ammonium) attacking the intermediate gamma-glutamyl phosphate, this negatively charged ammonium binding pocket has been designed naturally for high affinity of ammonium to GS, permitting glutamine synthesis to proceed in aqueous solution. PMID:8563633

  15. RNA binding protein and binding site useful for expression of recombinant molecules

    DOEpatents

    Mayfield, Stephen P.

    2006-10-17

    The present invention relates to a gene expression system in eukaryotic and prokaryotic cells, preferably plant cells and intact plants. In particular, the invention relates to an expression system having a RB47 binding site upstream of a translation initiation site for regulation of translation mediated by binding of RB47 protein, a member of the poly(A) binding protein family. Regulation is further effected by RB60, a protein disulfide isomerase. The expression system is capable of functioning in the nuclear/cytoplasm of cells and in the chloroplast of plants. Translation regulation of a desired molecule is enhanced approximately 100 fold over that obtained without RB47 binding site activation.

  16. RNA binding protein and binding site useful for expression of recombinant molecules

    DOEpatents

    Mayfield, Stephen

    2000-01-01

    The present invention relates to a gene expression system in eukaryotic and prokaryotic cells, preferably plant cells and intact plants. In particular, the invention relates to an expression system having a RB47 binding site upstream of a translation initiation site for regulation of translation mediated by binding of RB47 protein, a member of the poly(A) binding protein family. Regulation is further effected by RB60, a protein disulfide isomerase. The expression system is capable of functioning in the nuclear/cytoplasm of cells and in the chloroplast of plants. Translation regulation of a desired molecule is enhanced approximately 100 fold over that obtained without RB47 binding site activation.

  17. Acceleration of Binding Site Comparisons by Graph Partitioning.

    PubMed

    Krotzky, Timo; Klebe, Gerhard

    2015-08-01

    The comparison of protein binding sites is a prominent task in computational chemistry and has been studied in many different ways. For the automatic detection and comparison of putative binding cavities the Cavbase system has been developed which uses a coarse-grained set of pseudocenters to represent the physicochemical properties of a binding site and employs a graph-based procedure to calculate similarities between two binding sites. However, the comparison of two graphs is computationally quite demanding which makes large-scale studies such as the rapid screening of entire databases hardly feasible. In a recent work, we proposed the method Local Cliques (LC) for the efficient comparison of Cavbase binding sites. It employs a clique heuristic to detect the maximum common subgraph of two binding sites and an extended graph model to additionally compare the shape of individual surface patches. In this study, we present an alternative to further accelerate the LC method by partitioning the binding-site graphs into disjoint components prior to their comparisons. The pseudocenter sets are split with regard to their assigned phyiscochemical type, which leads to seven much smaller graphs than the original one. Applying this approach on the same test scenarios as in the former comprehensive way results in a significant speed-up without sacrificing accuracy. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. GenProBiS: web server for mapping of sequence variants to protein binding sites.

    PubMed

    Konc, Janez; Skrlj, Blaz; Erzen, Nika; Kunej, Tanja; Janezic, Dusanka

    2017-07-03

    Discovery of potentially deleterious sequence variants is important and has wide implications for research and generation of new hypotheses in human and veterinary medicine, and drug discovery. The GenProBiS web server maps sequence variants to protein structures from the Protein Data Bank (PDB), and further to protein-protein, protein-nucleic acid, protein-compound, and protein-metal ion binding sites. The concept of a protein-compound binding site is understood in the broadest sense, which includes glycosylation and other post-translational modification sites. Binding sites were defined by local structural comparisons of whole protein structures using the Protein Binding Sites (ProBiS) algorithm and transposition of ligands from the similar binding sites found to the query protein using the ProBiS-ligands approach with new improvements introduced in GenProBiS. Binding site surfaces were generated as three-dimensional grids encompassing the space occupied by predicted ligands. The server allows intuitive visual exploration of comprehensively mapped variants, such as human somatic mis-sense mutations related to cancer and non-synonymous single nucleotide polymorphisms from 21 species, within the predicted binding sites regions for about 80 000 PDB protein structures using fast WebGL graphics. The GenProBiS web server is open and free to all users at http://genprobis.insilab.org. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  19. Cryptic Terrain on Mars

    NASA Technical Reports Server (NTRS)

    2007-01-01

    [figure removed for brevity, see original site] Figure 1

    There is an enigmatic region near the south pole of Mars known as the 'cryptic' terrain. It stays cold in the spring, even as its albedo darkens and the sun rises in the sky.

    This region is covered by a layer of translucent seasonal carbon dioxide ice that warms and evaporates from below. As carbon dioxide gas escapes from below the slab of seasonal ice it scours dust from the surface. The gas vents to the surface, where the dust is carried downwind by the prevailing wind.

    The channels carved by the escaping gas are often radially organized and are known informally as 'spiders' (figure 1).

    Observation Geometry Image PSP_003179_0945 was taken by the High Resolution Imaging Science Experiment (HiRISE) camera onboard the Mars Reconnaissance Orbiter spacecraft on 01-Apr-2007. The complete image is centered at -85.4 degrees latitude, 104.0 degrees East longitude. The range to the target site was 245.9 km (153.7 miles). At this distance the image scale is 49.2 cm/pixel (with 2 x 2 binning) so objects 148 cm across are resolved. The image shown here has been map-projected to 50 cm/pixel . The image was taken at a local Mars time of 06:19 PM and the scene is illuminated from the west with a solar incidence angle of 78 degrees, thus the sun was about 12 degrees above the horizon. At a solar longitude of 210.8 degrees, the season on Mars is Northern Autumn.

  20. Characterization of the patterns of polymorphism in a [open quotes]cryptic repeat[close quotes] reveals a novel type of hypervariable sequence

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jacobson, D.P.; Schmeling, P.; Sommer, S.S.

    Alternating purine and pyrimidine repeats (RY(i)) are an abundant source of polymorphism. The subset with long tandem repeats of GT or AC (GT(i)) have been studied extensively, but cryptic RY(i) (i.e., no single tandem repeat predominates) have received little attention. The factor IX gene has a polymorphic cryptic RY(i) of 142-216 bp. Previously, there were four known polymorphic alleles, of the form AB, A[sub 2]B, A[sub 2]B[sub 2], and A[sub 3]B[sub 2], where A = (GT)(AC)[sub 3](AT)[sub 3](GT)(AT)[sub 4] and B = A with an additional 3' AT dinucleotide. To further characterize this locus, the authors examined more than 1,700more » additional human chromosomes and determined the sequences of the homologous sites in orangutans and chimpanzees. The novel alleles found in humans expand the repertoire of A/B alleles to A[sub 0-4]B[sub 1] and A[sub 1-3]B[sub 2]. The A[sub n]B[sub 2] series are abundant in Caucasians but are absent in blacks and Asians. Conversely, the A[sub 0]B[sub 1] allele is common in blacks but is not found in more than 1,700 Caucasian chromosomes. The data are compatible with a model in which recombination is more frequent than polymerase slippage at this locus. In orangutans, the RY(i) is present, but the sequence is markedly different. An A/B-type of pattern was discerned in which B differs from A by an additional six (AT) dinucleotides at the 3' end. In chimpanzees, the size of the RY(i) locus was greatly expanded, and the sequence showed a novel pattern of hypervariability in which there are many tandem repeats of the form (GT)[sub n](AC)[sub 0](AT)[sub p](GT)[sub q](AT)[sub s], where n, o, p, q, and s are different integers. The sequences of the factor IX intron 1 cryptic RY(i) in three primates provide perspective on the range of possible patterns of polymorphism. Analysis of the patterns suggests how the RY(i) can be conserved during evolution, while the precise sequence varies. 25 refs., 5 figs., 3 tabs.« less

  1. Determination of structure of the MinD-ATP complex reveals the orientation of MinD on the membrane and the relative location of the binding sites for MinE and MinC

    PubMed Central

    Wu, Wei; Park, Kyung-Tae; Holyoak, Todd; Lutkenhaus, Joe

    2011-01-01

    Summary The three Min proteins spatially regulate Z ring positioning in E. coli and are dynamically associated with the membrane. MinD binds to vesicles in the presence of ATP and can recruit MinC or MinE. Biochemical and genetic evidence indicate the binding sites for these two proteins on MinD overlap. Here we solved the structure of a hydrolytic-deficient mutant of MinD truncated for the C-terminal amphipathic helix involved in binding to the membrane. The structure solved in the presence of ATP is a dimer and reveals the face of MinD abutting the membrane. Using a combination of random and extensive site-directed mutagenesis additional residues important for MinE and MinC binding were identified. The location of these residues on the MinD structure confirms that the binding sites overlap and reveals that the binding sites are at the dimer interface and exposed to the cytosol. The location of the binding sites at the dimer interface offers a simple explanation for the ATP-dependency of MinC and MinE binding to MinD. PMID:21231967

  2. Interaction between phloretin and the red blood cell membrane

    PubMed Central

    1976-01-01

    Phloretin binding to red blood cell components has been characterized at pH6, where binding and inhibitory potency are maximal. Binding to intact red cells and to purified hemoglobin are nonsaturated processes approximately equal in magnitude, which strongly suggests that most of the red cell binding may be ascribed to hemoglobin. This conclusion is supported by the fact that homoglobin-free red cell ghosts can bind only 10% as much phloretin as an equivalent number of red cells. The permeability of the red cell membrane to phloretin has been determined by a direct measurement at the time-course of the phloretin uptake. At a 2% hematocrit, the half time for phloretin uptake is 8.7s, corresponding to a permeability coefficient of 2 x 10(-4) cm/s. The concentration dependence of the binding to ghosts reveals two saturable components. Phloretin binds with high affinity (K diss = 1.5 muM) to about 2.5 x 10(6) sites per cell; it also binds with lower affinity (Kdiss = 54 muM) to a second (5.5 x 10(7) per cell) set of sites. In sonicated total lipid extracts of red cell ghosts, phloretin binding consists of a single, saturable component. Its affinity and total number of sites are not significantly different from those of the low affinity binding process in ghosts. No high affinity binding of phloretin is exhibited by the red cell lipid extracts. Therefore, the high affinity phloretin binding sites are related to membrane proteins, and the low affinity sites result from phloretin binding to lipid. The identification of these two types of binding sites allows phloretin effects on protein-mediated transport processes to be distinguished from effects on the lipid region of the membrane. PMID:5575

  3. A peek into tropomyosin binding and unfolding on the actin filament.

    PubMed

    Singh, Abhishek; Hitchcock-Degregori, Sarah E

    2009-07-24

    Tropomyosin is a prototypical coiled coil along its length with subtle variations in structure that allow interactions with actin and other proteins. Actin binding globally stabilizes tropomyosin. Tropomyosin-actin interaction occurs periodically along the length of tropomyosin. However, it is not well understood how tropomyosin binds actin. Tropomyosin's periodic binding sites make differential contributions to two components of actin binding, cooperativity and affinity, and can be classified as primary or secondary sites. We show through mutagenesis and analysis of recombinant striated muscle alpha-tropomyosins that primary actin binding sites have a destabilizing coiled-coil interface, typically alanine-rich, embedded within a non-interface recognition sequence. Introduction of an Ala cluster in place of the native, more stable interface in period 2 and/or period 3 sites (of seven) increased the affinity or cooperativity of actin binding, analysed by cosedimentation and differential scanning calorimetry. Replacement of period 3 with period 5 sequence, an unstable region of known importance for cooperative actin binding, increased the cooperativity of binding. Introduction of the fluorescent probe, pyrene, near the mutation sites in periods 2 and 3 reported local instability, stabilization by actin binding, and local unfolding before or coincident with dissociation from actin (measured using light scattering), and chain dissociation (analyzed using circular dichroism). This, and previous work, suggests that regions of tropomyosin involved in binding actin have non-interface residues specific for interaction with actin and an unstable interface that is locally stabilized upon binding. The destabilized interface allows residues on the coiled-coil surface to obtain an optimal conformation for interaction with actin by increasing the number of local substates that the side chains can sample. We suggest that local disorder is a property typical of coiled coil binding sites and proteins that have multiple binding partners, of which tropomyosin is one type.

  4. sc-PDB: a 3D-database of ligandable binding sites--10 years on.

    PubMed

    Desaphy, Jérémy; Bret, Guillaume; Rognan, Didier; Kellenberger, Esther

    2015-01-01

    The sc-PDB database (available at http://bioinfo-pharma.u-strasbg.fr/scPDB/) is a comprehensive and up-to-date selection of ligandable binding sites of the Protein Data Bank. Sites are defined from complexes between a protein and a pharmacological ligand. The database provides the all-atom description of the protein, its ligand, their binding site and their binding mode. Currently, the sc-PDB archive registers 9283 binding sites from 3678 unique proteins and 5608 unique ligands. The sc-PDB database was publicly launched in 2004 with the aim of providing structure files suitable for computational approaches to drug design, such as docking. During the last 10 years we have improved and standardized the processes for (i) identifying binding sites, (ii) correcting structures, (iii) annotating protein function and ligand properties and (iv) characterizing their binding mode. This paper presents the latest enhancements in the database, specifically pertaining to the representation of molecular interaction and to the similarity between ligand/protein binding patterns. The new website puts emphasis in pictorial analysis of data. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  5. Piracetam defines a new binding site for allosteric modulators of alpha-amino-3-hydroxy-5-methyl-4-isoxazole-propionic acid (AMPA) receptors.

    PubMed

    Ahmed, Ahmed H; Oswald, Robert E

    2010-03-11

    Glutamate receptors are the most prevalent excitatory neurotransmitter receptors in the vertebrate central nervous system and are important potential drug targets for cognitive enhancement and the treatment of schizophrenia. Allosteric modulators of AMPA receptors promote dimerization by binding to a dimer interface and reducing desensitization and deactivation. The pyrrolidine allosteric modulators, piracetam and aniracetam, were among the first of this class of drugs to be discovered. We have determined the structure of the ligand binding domain of the AMPA receptor subtypes GluA2 and GluA3 with piracetam and a corresponding structure of GluA3 with aniracetam. Both drugs bind to GluA2 and GluA3 in a very similar manner, suggesting little subunit specificity. However, the binding sites for piracetam and aniracetam differ considerably. Aniracetam binds to a symmetrical site at the center of the dimer interface. Piracetam binds to multiple sites along the dimer interface with low occupation, one of which is a unique binding site for potential allosteric modulators. This new site may be of importance in the design of new allosteric regulators.

  6. Piracetam Defines a New Binding Site for Allosteric Modulators of α-amino-3-hydroxy-5-methyl-4-isoxazole-propionic acid (AMPA) receptors§

    PubMed Central

    Ahmed, Ahmed H.; Oswald, Robert E.

    2010-01-01

    Glutamate receptors are the most prevalent excitatory neurotransmitter receptors in the vertebrate central nervous system and are important potential drug targets for cognitive enhancement and the treatment of schizophrenia. Allosteric modulators of AMPA receptors promote dimerization by binding to a dimer interface and reducing desensitization and deactivation. The pyrrolidine allosteric modulators, piracetam and aniracetam, were among the first of this class of drugs to be discovered. We have determined the structure of the ligand binding domain of the AMPA receptor subtypes GluA2 and GluA3 with piracetam and a corresponding structure of GluA3 with aniracetam. Both drugs bind to both GluA2 and GluA3 in a very similar manner, suggesting little subunit specificity. However, the binding sites for piracetam and aniracetam differ considerably. Aniracetam binds to a symmetrical site at the center of the dimer interface. Piracetam binds to multiple sites along the dimer interface with low occupation, one of which is a unique binding site for potential allosteric modulators. This new site may be of importance in the design of new allosteric regulators. PMID:20163115

  7. Amyloid tracers detect multiple binding sites in Alzheimer's disease brain tissue.

    PubMed

    Ni, Ruiqing; Gillberg, Per-Göran; Bergfors, Assar; Marutle, Amelia; Nordberg, Agneta

    2013-07-01

    Imaging fibrillar amyloid-β deposition in the human brain in vivo by positron emission tomography has improved our understanding of the time course of amyloid-β pathology in Alzheimer's disease. The most widely used amyloid-β imaging tracer so far is (11)C-Pittsburgh compound B, a thioflavin derivative but other (11)C- and (18)F-labelled amyloid-β tracers have been studied in patients with Alzheimer's disease and cognitively normal control subjects. However, it has not yet been established whether different amyloid tracers bind to identical sites on amyloid-β fibrils, offering the same ability to detect the regional amyloid-β burden in the brains. In this study, we characterized (3)H-Pittsburgh compound B binding in autopsied brain regions from 23 patients with Alzheimer's disease and 20 control subjects (aged 50 to 88 years). The binding properties of the amyloid tracers FDDNP, AV-45, AV-1 and BF-227 were also compared with those of (3)H-Pittsburgh compound B in the frontal cortices of patients with Alzheimer's disease. Saturation binding studies revealed the presence of high- and low-affinity (3)H-Pittsburgh compound B binding sites in the frontal cortex (K(d1): 3.5 ± 1.6 nM; K(d2): 133 ± 30 nM) and hippocampus (K(d1):5.6 ± 2.2 nM; K(d2): 181 ± 132 nM) of Alzheimer's disease brains. The relative proportion of high-affinity to low-affinity sites was 6:1 in the frontal cortex and 3:1 in the hippocampus. One control showed both high- and low-affinity (3)H-Pittsburgh compound B binding sites (K(d1): 1.6 nM; K(d2): 330 nM) in the cortex while the others only had a low-affinity site (K(d2): 191 ± 70 nM). (3)H-Pittsburgh compound B binding in Alzheimer's disease brains was higher in the frontal and parietal cortices than in the caudate nucleus and hippocampus, and negligible in the cerebellum. Competitive binding studies with (3)H-Pittsburgh compound B in the frontal cortices of Alzheimer's disease brains revealed high- and low-affinity binding sites for BTA-1 (Ki: 0.2 nM, 70 nM), florbetapir (1.8 nM, 53 nM) and florbetaben (1.0 nM, 65 nM). BF-227 displaced 83% of (3)H-Pittsburgh compound B binding, mainly at a low-affinity site (311 nM), whereas FDDNP only partly displaced (40%). We propose a multiple binding site model for the amyloid tracers (binding sites 1, 2 and 3), where AV-45 (florbetapir), AV-1 (florbetaben), and Pittsburgh compound B, all show nanomolar affinity for the high-affinity site (binding site 1), as visualized by positron emission tomography. BF-227 shows mainly binding to site 3 and FDDNP shows only some binding to site 2. Different amyloid tracers may provide new insight into the pathophysiological mechanisms in the progression of Alzheimer's disease.

  8. Role of Electrostatics in Protein-RNA Binding: The Global vs the Local Energy Landscape.

    PubMed

    Ghaemi, Zhaleh; Guzman, Irisbel; Gnutt, David; Luthey-Schulten, Zaida; Gruebele, Martin

    2017-09-14

    U1A protein-stem loop 2 RNA association is a basic step in the assembly of the spliceosomal U1 small nuclear ribonucleoprotein. Long-range electrostatic interactions due to the positive charge of U1A are thought to provide high binding affinity for the negatively charged RNA. Short range interactions, such as hydrogen bonds and contacts between RNA bases and protein side chains, favor a specific binding site. Here, we propose that electrostatic interactions are as important as local contacts in biasing the protein-RNA energy landscape toward a specific binding site. We show by using molecular dynamics simulations that deletion of two long-range electrostatic interactions (K22Q and K50Q) leads to mutant-specific alternative RNA bound states. One of these states preserves short-range interactions with aromatic residues in the original binding site, while the other one does not. We test the computational prediction with experimental temperature-jump kinetics using a tryptophan probe in the U1A-RNA binding site. The two mutants show the distinct predicted kinetic behaviors. Thus, the stem loop 2 RNA has multiple binding sites on a rough RNA-protein binding landscape. We speculate that the rough protein-RNA binding landscape, when biased to different local minima by electrostatics, could be one way that protein-RNA interactions evolve toward new binding sites and novel function.

  9. CavityPlus: a web server for protein cavity detection with pharmacophore modelling, allosteric site identification and covalent ligand binding ability prediction.

    PubMed

    Xu, Youjun; Wang, Shiwei; Hu, Qiwan; Gao, Shuaishi; Ma, Xiaomin; Zhang, Weilin; Shen, Yihang; Chen, Fangjin; Lai, Luhua; Pei, Jianfeng

    2018-05-10

    CavityPlus is a web server that offers protein cavity detection and various functional analyses. Using protein three-dimensional structural information as the input, CavityPlus applies CAVITY to detect potential binding sites on the surface of a given protein structure and rank them based on ligandability and druggability scores. These potential binding sites can be further analysed using three submodules, CavPharmer, CorrSite, and CovCys. CavPharmer uses a receptor-based pharmacophore modelling program, Pocket, to automatically extract pharmacophore features within cavities. CorrSite identifies potential allosteric ligand-binding sites based on motion correlation analyses between cavities. CovCys automatically detects druggable cysteine residues, which is especially useful to identify novel binding sites for designing covalent allosteric ligands. Overall, CavityPlus provides an integrated platform for analysing comprehensive properties of protein binding cavities. Such analyses are useful for many aspects of drug design and discovery, including target selection and identification, virtual screening, de novo drug design, and allosteric and covalent-binding drug design. The CavityPlus web server is freely available at http://repharma.pku.edu.cn/cavityplus or http://www.pkumdl.cn/cavityplus.

  10. TmiRUSite and TmiROSite scripts: searching for mRNA fragments with miRNA binding sites with encoded amino acid residues.

    PubMed

    Berillo, Olga; Régnier, Mireille; Ivashchenko, Anatoly

    2014-01-01

    microRNAs are small RNA molecules that inhibit the translation of target genes. microRNA binding sites are located in the untranslated regions as well as in the coding domains. We describe TmiRUSite and TmiROSite scripts developed using python as tools for the extraction of nucleotide sequences for miRNA binding sites with their encoded amino acid residue sequences. The scripts allow for retrieving a set of additional sequences at left and at right from the binding site. The scripts presents all received data in table formats that are easy to analyse further. The predicted data finds utility in molecular and evolutionary biology studies. They find use in studying miRNA binding sites in animals and plants. TmiRUSite and TmiROSite scripts are available for free from authors upon request and at https: //sites.google.com/site/malaheenee/downloads for download.

  11. LHRH-pituitary plasma membrane binding: the presence of specific binding sites in other tissues.

    PubMed

    Marshall, J C; Shakespear, R A; Odell, W D

    1976-11-01

    Two specific binding sites for LHRH are present on plasma membranes prepared from rat and bovine anterior pituitary glands. One site is of high affinity (K = 2X108 1/MOL) and the second is of lower affinity (8-5X105 1/mol) and much greater capacity. Studies on membrane fractions prepared from other tissues showed the presence of a single specific site for LHRH. The kinetics and specificity of this site were similar to those of the lower affinity pituitary receptor. These results indicate that only pituitary membranes possess the higher affinity binding site and suggest that the low affinity site is not of physiological importance in the regulation of gonadotrophin secretion. After dissociation from membranes of non-pituitary tissues 125I-LHRH rebound to pituitary membrane preparations. Thus receptor binding per se does not result in degradation of LHRH and the function of these peripheral receptors remains obscure.

  12. Computational design of trimeric influenza-neutralizing proteins targeting the hemagglutinin receptor binding site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Strauch, Eva-Maria; Bernard, Steffen M.; La, David

    Many viral surface glycoproteins and cell surface receptors are homo-oligomers1, 2, 3, 4, and thus can potentially be targeted by geometrically matched homo-oligomers that engage all subunits simultaneously to attain high avidity and/or lock subunits together. The adaptive immune system cannot generally employ this strategy since the individual antibody binding sites are not arranged with appropriate geometry to simultaneously engage multiple sites in a single target homo-oligomer. We describe a general strategy for the computational design of homo-oligomeric protein assemblies with binding functionality precisely matched to homo-oligomeric target sites5, 6, 7, 8. In the first step, a small protein ismore » designed that binds a single site on the target. In the second step, the designed protein is assembled into a homo-oligomer such that the designed binding sites are aligned with the target sites. We use this approach to design high-avidity trimeric proteins that bind influenza A hemagglutinin (HA) at its conserved receptor binding site. The designed trimers can both capture and detect HA in a paper-based diagnostic format, neutralizes influenza in cell culture, and completely protects mice when given as a single dose 24 h before or after challenge with influenza.« less

  13. An alternate binding site for PPARγ ligands

    PubMed Central

    Hughes, Travis S.; Giri, Pankaj Kumar; de Vera, Ian Mitchelle S.; Marciano, David P.; Kuruvilla, Dana S.; Shin, Youseung; Blayo, Anne-Laure; Kamenecka, Theodore M.; Burris, Thomas P.; Griffin, Patrick R.; Kojetin, Douglas J.

    2014-01-01

    PPARγ is a target for insulin sensitizing drugs such as glitazones, which improve plasma glucose maintenance in patients with diabetes. Synthetic ligands have been designed to mimic endogenous ligand binding to a canonical ligand-binding pocket to hyperactivate PPARγ. Here we reveal that synthetic PPARγ ligands also bind to an alternate site, leading to unique receptor conformational changes that impact coregulator binding, transactivation and target gene expression. Using structure-function studies we show that alternate site binding occurs at pharmacologically relevant ligand concentrations, and is neither blocked by covalently bound synthetic antagonists nor by endogenous ligands indicating non-overlapping binding with the canonical pocket. Alternate site binding likely contributes to PPARγ hyperactivation in vivo, perhaps explaining why PPARγ full and partial or weak agonists display similar adverse effects. These findings expand our understanding of PPARγ activation by ligands and suggest that allosteric modulators could be designed to fine tune PPARγ activity without competing with endogenous ligands. PMID:24705063

  14. Concerted formation of macromolecular Suppressor–mutator transposition complexes

    PubMed Central

    Raina, Ramesh; Schläppi, Michael; Karunanandaa, Balasulojini; Elhofy, Adam; Fedoroff, Nina

    1998-01-01

    Transposition of the maize Suppressor–mutator (Spm) transposon requires two element-encoded proteins, TnpA and TnpD. Although there are multiple TnpA binding sites near each element end, binding of TnpA to DNA is not cooperative, and the binding affinity is not markedly affected by the number of binding sites per DNA fragment. However, intermolecular complexes form cooperatively between DNA fragments with three or more TnpA binding sites. TnpD, itself not a sequence-specific DNA-binding protein, binds to TnpA and stabilizes the TnpA–DNA complex. The high redundancy of TnpA binding sites at both element ends and the protein–protein interactions between DNA-bound TnpA complexes and between these and TnpD imply a concerted transition of the element from a linear to a protein crosslinked transposition complex within a very narrow protein concentration range. PMID:9671711

  15. Accelerated molecular dynamics simulations of ligand binding to a muscarinic G-protein-coupled receptor.

    PubMed

    Kappel, Kalli; Miao, Yinglong; McCammon, J Andrew

    2015-11-01

    Elucidating the detailed process of ligand binding to a receptor is pharmaceutically important for identifying druggable binding sites. With the ability to provide atomistic detail, computational methods are well poised to study these processes. Here, accelerated molecular dynamics (aMD) is proposed to simulate processes of ligand binding to a G-protein-coupled receptor (GPCR), in this case the M3 muscarinic receptor, which is a target for treating many human diseases, including cancer, diabetes and obesity. Long-timescale aMD simulations were performed to observe the binding of three chemically diverse ligand molecules: antagonist tiotropium (TTP), partial agonist arecoline (ARc) and full agonist acetylcholine (ACh). In comparison with earlier microsecond-timescale conventional MD simulations, aMD greatly accelerated the binding of ACh to the receptor orthosteric ligand-binding site and the binding of TTP to an extracellular vestibule. Further aMD simulations also captured binding of ARc to the receptor orthosteric site. Additionally, all three ligands were observed to bind in the extracellular vestibule during their binding pathways, suggesting that it is a metastable binding site. This study demonstrates the applicability of aMD to protein-ligand binding, especially the drug recognition of GPCRs.

  16. Oligomycin frames a common drug-binding site in the ATP synthase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Symersky, Jindrich; Osowski, Daniel; Walters, D. Eric

    We report the high-resolution (1.9 {angstrom}) crystal structure of oligomycin bound to the subunit c10 ring of the yeast mitochondrial ATP synthase. Oligomycin binds to the surface of the c10 ring making contact with two neighboring molecules at a position that explains the inhibitory effect on ATP synthesis. The carboxyl side chain of Glu59, which is essential for proton translocation, forms an H-bond with oligomycin via a bridging water molecule but is otherwise shielded from the aqueous environment. The remaining contacts between oligomycin and subunit c are primarily hydrophobic. The amino acid residues that form the oligomycin-binding site are 100%more » conserved between human and yeast but are widely different from those in bacterial homologs, thus explaining the differential sensitivity to oligomycin. Prior genetics studies suggest that the oligomycin-binding site overlaps with the binding site of other antibiotics, including those effective against Mycobacterium tuberculosis, and thereby frames a common 'drug-binding site.' We anticipate that this drug-binding site will serve as an effective target for new antibiotics developed by rational design.« less

  17. Alignment-independent comparison of binding sites based on DrugScore potential fields encoded by 3D Zernike descriptors.

    PubMed

    Nisius, Britta; Gohlke, Holger

    2012-09-24

    Analyzing protein binding sites provides detailed insights into the biological processes proteins are involved in, e.g., into drug-target interactions, and so is of crucial importance in drug discovery. Herein, we present novel alignment-independent binding site descriptors based on DrugScore potential fields. The potential fields are transformed to a set of information-rich descriptors using a series expansion in 3D Zernike polynomials. The resulting Zernike descriptors show a promising performance in detecting similarities among proteins with low pairwise sequence identities that bind identical ligands, as well as within subfamilies of one target class. Furthermore, the Zernike descriptors are robust against structural variations among protein binding sites. Finally, the Zernike descriptors show a high data compression power, and computing similarities between binding sites based on these descriptors is highly efficient. Consequently, the Zernike descriptors are a useful tool for computational binding site analysis, e.g., to predict the function of novel proteins, off-targets for drug candidates, or novel targets for known drugs.

  18. Analysis of the reaction of carbachol with acetylcholinesterase using thioflavin T as a coupled fluorescence reporter.

    PubMed

    Rosenberry, Terrone L; Sonoda, Leilani K; Dekat, Sarah E; Cusack, Bernadette; Johnson, Joseph L

    2008-12-09

    Acetylcholinesterase (AChE) contains a narrow and deep active site gorge with two sites of ligand binding, an acylation site (or A-site) at the base of the gorge and a peripheral site (or P-site) near the gorge entrance. The P-site contributes to catalytic efficiency by transiently binding substrates on their way to the acylation site, where a short-lived acylated enzyme intermediate is produced. Carbamates are very poor substrates that, like other AChE substrates, form an initial enzyme-substrate complex with free AChE (E) and proceed to an acylated enzyme intermediate (EC), which is then hydrolyzed. However, the hydrolysis of EC is slow enough to resolve the acylation and deacylation steps on the catalytic pathway. Here, we focus on the reaction of carbachol (carbamoylcholine) with AChE. The kinetics and thermodynamics of this reaction are of special interest because carbachol is an isosteric analogue of the physiological substrate acetylcholine. We show that the reaction can be monitored with thioflavin T as a fluorescent reporter group. The fluorescence of thioflavin T is strongly enhanced when it binds to the P-site of AChE, and this fluorescence is partially quenched when a second ligand binds to the A-site to form a ternary complex. Analysis of the fluorescence reaction profiles was challenging because four thermodynamic parameters and two fluorescence coefficients were fitted from the combined data both for E and for EC. Respective equilibrium dissociation constants of 6 and 26 mM were obtained for carbachol binding to the A- and P-sites in E and of 2 and 32 mM for carbachol binding to the A- and P-sites in EC. These constants for the binding of carbachol to the P-site are about an order of magnitude larger (i.e., indicating lower affinity) than previous estimates for the binding of acetylthiocholine to the P-site.

  19. Analysis of the reaction of carbachol with acetylcholinesterase with thioflavin T as a coupled fluorescence reporter†

    PubMed Central

    Rosenberry, Terrone L.; Sonoda, Leilani K.; Dekat, Sarah E.; Cusack, Bernadette; Johnson, Joseph L.

    2009-01-01

    Acetylcholinesterase (AChE) contains a narrow and deep active site gorge with two sites of ligand binding, an acylation site (or A-site) at the base of the gorge and a peripheral site (or P-site) near the gorge entrance. The P-site contributes to catalytic efficiency by transiently binding substrates on their way to the acylation site, where a short-lived acylated enzyme intermediate is produced. Carbamates are very poor substrates that, like other AChE substrates, form an initial enzyme-substrate complex with free AChE (E) and proceed to an acylated enzyme intermediate (EC) which is then hydrolyzed. However, the hydrolysis of EC is slow enough to resolve the acylation and deacylation steps on the catalytic pathway. Here we focus on the reaction of carbachol (carbamoylcholine) with AChE. The kinetics and thermodynamics of this reaction are of special interest because carbachol is an isosteric analog of the physiological substrate acetylcholine. We show that the reaction can be monitored with thioflavin T as a fluorescent reporter group. The fluorescence of thioflavin T is strongly enhanced when it binds to the P-site of AChE, and this fluorescence is partially quenched when a second ligand binds to the A-site to form a ternary complex. Analysis of the fluorescence reaction profiles was challenging, because four thermodynamic parameters and two fluorescence coefficients were fitted from the combined data both for E and for EC. Respective equilibrium dissociation constants of 6 and 26 mM were obtained for carbachol binding to the A- and P-sites in E and of 2 and 32 mM for carbachol binding to the A- and P-sites in EC. These constants for the binding of carbachol to the P-site are about an order of magnitude larger (i.e., indicating lower affinity) than previous estimates for the binding of acetylthiocholine to the P-site. PMID:19006330

  20. Drug Promiscuity in PDB: Protein Binding Site Similarity Is Key.

    PubMed

    Haupt, V Joachim; Daminelli, Simone; Schroeder, Michael

    2013-01-01

    Drug repositioning applies established drugs to new disease indications with increasing success. A pre-requisite for drug repurposing is drug promiscuity (polypharmacology) - a drug's ability to bind to several targets. There is a long standing debate on the reasons for drug promiscuity. Based on large compound screens, hydrophobicity and molecular weight have been suggested as key reasons. However, the results are sometimes contradictory and leave space for further analysis. Protein structures offer a structural dimension to explain promiscuity: Can a drug bind multiple targets because the drug is flexible or because the targets are structurally similar or even share similar binding sites? We present a systematic study of drug promiscuity based on structural data of PDB target proteins with a set of 164 promiscuous drugs. We show that there is no correlation between the degree of promiscuity and ligand properties such as hydrophobicity or molecular weight but a weak correlation to conformational flexibility. However, we do find a correlation between promiscuity and structural similarity as well as binding site similarity of protein targets. In particular, 71% of the drugs have at least two targets with similar binding sites. In order to overcome issues in detection of remotely similar binding sites, we employed a score for binding site similarity: LigandRMSD measures the similarity of the aligned ligands and uncovers remote local similarities in proteins. It can be applied to arbitrary structural binding site alignments. Three representative examples, namely the anti-cancer drug methotrexate, the natural product quercetin and the anti-diabetic drug acarbose are discussed in detail. Our findings suggest that global structural and binding site similarity play a more important role to explain the observed drug promiscuity in the PDB than physicochemical drug properties like hydrophobicity or molecular weight. Additionally, we find ligand flexibility to have a minor influence.

  1. Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome.

    PubMed

    Dresch, Jacqueline M; Zellers, Rowan G; Bork, Daniel K; Drewell, Robert A

    2016-01-01

    A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development.

  2. Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome

    PubMed Central

    Dresch, Jacqueline M.; Zellers, Rowan G.; Bork, Daniel K.; Drewell, Robert A.

    2016-01-01

    A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development. PMID:27330274

  3. [3H]MK-801 binding sites in post-mortem human frontal cortex.

    PubMed

    Kornhuber, J; Mack-Burkhardt, F; Kornhuber, M E; Riederer, P

    1989-03-29

    The binding of [3H]MK-801 ((+)-5-methyl-10,11-dihydro-5H-dibenzo[a,d]cyclohepten-5,10-imine maleate) was investigated in extensively washed homogenates of post-mortem human frontal cortex. The association of [3H]MK-801 proceeded slowly (t1/2 = 553 min) and reached equilibrium only after a prolonged incubation (greater than 24 h). The dissociation of [3H]MK-801 from the binding site was also slow (t1/2 = 244 min). Glutamate, glycine and magnesium markedly increased the rate of association (t1/2 = 14.8 min) and dissociation (t1/2 = 36.5 min). At equilibrium, the binding was not altered by these substances. Specific binding was linear with protein concentration, was saturable, reversible, stereoselective, heat-labile and was nearly absent in the white matter. Scatchard analysis of the saturation curves obtained at equilibrium indicated that there was a high-affinity (Kd1 1.39 +/- 0.21 nM, Bmax1 0.483 +/- 0.084 pmol/mg protein) and a low-affinity (Kd2 116.25 +/- 50.79 nM, Bmax2 3.251 +/- 0.991 pmol/mg protein) binding site. All competition curves obtained with (+)-MK-801, (-)-MK-801, phencyclidine and ketamine had Hill coefficients of less than unity and were best explained by a two-site model. Thus, our results demonstrate the presence of binding sites for MK-801 in post-mortem human brains and provide evidence for binding site heterogeneity. Furthermore, glutamate, glycine and magnesium accelerate the association and dissociation of [3H]MK-801 to and from its binding sites. The results add support to the hypothesis that MK-801, glutamate, glycine and magnesium all bind to different sites on the NMDA receptor-ion channel complex.

  4. The binding sites of inhibitory monoclonal antibodies on acetylcholinesterase. Identification of a novel regulatory site at the putative "back door".

    PubMed

    Simon, S; Le Goff, A; Frobert, Y; Grassi, J; Massoulié, J

    1999-09-24

    We investigated the target sites of three inhibitory monoclonal antibodies on Electrophorus acetylcholinesterase (AChE). Previous studies showed that Elec-403 and Elec-410 are directed to overlapping but distinct epitopes in the peripheral site, at the entrance of the catalytic gorge, whereas Elec-408 binds to a different region. Using Electrophorus/rat AChE chimeras, we identified surface residues that differed between sensitive and insensitive AChEs: the replacement of a single Electrophorus residue by its rat homolog was able to abolish binding and inhibition, for each antibody. Reciprocally, binding and inhibition by Elec-403 and by Elec-410 could be conferred to rat AChE by the reverse mutation. Elec-410 appears to bind to one side of the active gorge, whereas Elec-403 covers its opening, explaining why the AChE-Elec-410 complex reacts faster than the AChE-Elec-403 or AChE-fasciculin complexes with two active site inhibitors, m-(N,N, N-trimethyltammonio)trifluoro-acetophenone and echothiophate. Elec-408 binds to the region of the putative "back door," distant from the peripheral site, and does not interfere with the access of inhibitors to the active site. The binding of an antibody to this novel regulatory site may inhibit the enzyme by blocking the back door or by inducing a conformational distortion within the active site.

  5. Integrative Taxonomic Approach for Describing a New Cryptic Species of Bush Frog (Raorchestes: Anura: Rhacophoridae) from the Western Ghats, India

    PubMed Central

    Roshmi, Rekha Sarma; Ramya, Badrinath; Sudhira, H. S.; Ravikanth, G.; Aravind, Neelavara Anantharam

    2016-01-01

    A new cryptic species of bush frog Raorchestes honnametti sp. nov. is described from the south-eastern part of the Western Ghats, India. This newly described species belongs to the Charius clade and is morphologically similar to other clade members—R. charius and R. griet. Therefore, an integrative taxonomic approach based on molecular and bioacoustic analysis along with morphology was used to delimit the new species. Raorchestes honnametti sp. nov., is currently known only from Biligiri Rangaswamy Temple Tiger Reserve, a part of Biligiri Rangaswamy horst mountain range (a mountain formed due movement of two faults) formed during the Late Quaternary period (1.8–2.58 Ma). Discovery of cryptic species from a highly speciose and well-studied genus Raorchestes hints at the possible existence of several more cryptic species in this genus. We discuss the possible reasons for crypsis and emphasize the need for continued systematic surveys of amphibians across the Western Ghats. PMID:26934213

  6. Carbohydrate Microarrays Identify Blood Group Precursor Cryptic Epitopes as Potential Immunological Targets of Breast Cancer

    PubMed Central

    Wang, Denong; Tang, Jin; Liu, Shaoyi

    2015-01-01

    Using carbohydrate microarrays, we explored potential natural ligands of antitumor monoclonal antibody HAE3. This antibody was raised against a murine mammary tumor antigen but was found to cross-react with a number of human epithelial tumors in tissues. Our carbohydrate microarray analysis reveals that HAE3 is specific for an O-glycan cryptic epitope that is normally hidden in the cores of blood group substances. Using HAE3 to screen tumor cell surface markers by flow cytometry, we found that the HAE3 glycoepitope, gpHAE3, was highly expressed by a number of human breast cancer cell lines, including some triple-negative cancers that lack the estrogen, progesterone, and Her2/neu receptors. Taken together, we demonstrate that HAE3 recognizes a conserved cryptic glycoepitope of blood group precursors, which is nevertheless selectively expressed and surface-exposed in certain breast tumor cells. The potential of this class of O-glycan cryptic antigens in breast cancer subtyping and targeted immunotherapy warrants further investigation. PMID:26539555

  7. Searching for putative binding sites of the bispyridinium compound MB327 in the nicotinic acetylcholine receptor.

    PubMed

    Wein, Thomas; Höfner, Georg; Rappenglück, Sebastian; Sichler, Sonja; Niessen, Karin V; Seeger, Thomas; Worek, Franz; Thiermann, Horst; Wanner, Klaus T

    2018-09-01

    Irreversible inhibition of the acetylcholine esterase upon intoxication with organophosphorus compounds leads to an accumulation of acetylcholine in the synaptic cleft and a subsequent desensitization of nicotinic acetylcholine receptors which may ultimately result in respiratory failure. The bispyridinium compound MB327 has been found to restore functional activity of nAChR thus representing a promising starting point for the development of new drugs for the treatment of organophosphate poisoning. In order to optimize the resensitizing effect of MB327 on nAChR, it would be very helpful to know the MB327 specific binding site to apply structure based molecular modeling. The binding site for MB327 at the nAChR is not known and so far goal of speculations, but it has been shown that MB327 does not bind to the orthosteric acetylcholine binding site. We have used docking calculations to screen the surface of nAChR for possible binding sites of MB327. The results indicate that at least two potential binding sites for MB327 at nAChR are present inside the channel pore. In these binding sites, MB327 intercalates between the γ-α and β-δ subunits of nAChR, respectively. Both putative MB327 binding sites show an unsymmetrical distribution of surrounding hydrophilic and lipophilic amino acids. This suggests that substitution of MB327-related bispyridinium compounds on one of the two pyridinium rings with polar substituents should have a favorable effect on the pharmacological function. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. Probing conformational changes in the I-like domain and the cysteine-rich repeat of human beta 3 integrins following disulfide bond disruption by cysteine mutations: identification of cysteine 598 involved in alphaIIbbeta3 activation.

    PubMed

    Chen, P; Melchior, C; Brons, N H; Schlegel, N; Caen, J; Kieffer, N

    2001-10-19

    We have investigated receptor function and epitope expression of recombinant alpha(IIb)beta(3) mutated at Cys(177) or Cys(273) in the I-like domain as well as Cys(598), located in the fourth repeat of the membrane-proximal cysteine-rich region and mutated in a Glanzmann's thrombasthenia type II patient. The beta(3) mutants beta(3)C177A, beta(3)C273A, and beta(3)C598Y exhibited a decreased electrophoretic mobility in SDS-polyacrylamide gel electrophoresis under nonreducing conditions, confirming the disruption of the respective disulfide loops. Despite reduced surface expression, the alpha(IIb)beta(3)C177A, alpha(IIb)beta(3)C273A, and alpha(IIb)beta(3)C598Y receptors mediated cell adhesion to immobilized fibrinogen and translocated into focal adhesion plaques. The beta(3)C598Y mutation, but not the beta(3)C177A or beta(3)C273A mutations, induced spontaneous binding of the ligand mimetic monoclonal antibody PAC-1, while the beta(3)C177A and beta(3)C273A mutants exhibited reduced complex stability in the absence of Ca(2+). Epitope mapping of function-blocking monoclonal antibodies (mAbs) allowed the identification of two distinct subgroups; mAbs A2A9, pl2-46, 10E5, and P256 did not interact with alpha(IIb)beta(3)C273A and bound only weakly to alpha(IIb)beta(3)C177A, while mAbs AP2, LM609 and 7E3 bound normally to mutant alpha(IIb)beta(3)C273A, but interacted only weakly with mutant alpha(IIb)beta(3)C177A. Furthermore, a cryptic epitope recognized by mAb 4D10G3 and not exposed on wild type alpha(IIb)beta(3) became accessible only on mutant alpha(IIb)beta(3)C177A and was mapped to the 60-kDa chymotrypsin fragment of beta(3). Finally, the ligand-induced binding site (LIBS) epitopes AP5, D3, LIBS1, and LIBS2 were spontaneously expressed on all three mutants independent of RGDS or dithiothreitol treatment. Our results provide evidence that disruption of a single cysteine disulfide bond in the cysteine-rich repeat domain, but not in the I-like domain, activates integrin alpha(IIb)beta(3). In contrast, disruption of each of the disulfide bonds in the two long insertions of the I-like domain predicted to be in close contact with the alpha subunit beta-propeller domain affect the stability of the alpha(IIb)beta(3) heterodimer and inhibit complex-specific mAb binding without affecting the RGD binding capacity of the metal ion-dependent adhesion site-like domain.

  9. Cryptic Species or Inadequate Taxonomy? Implementation of 2D Geometric Morphometrics Based on Integumental Organs as Landmarks for Delimitation and Description of Copepod Taxa.

    PubMed

    Karanovic, Tomislav; Djurakic, Marko; Eberhard, Stefan M

    2016-03-01

    Discovery of cryptic species using molecular tools has become common in many animal groups but it is rarely accompanied by morphological revision, creating ongoing problems in taxonomy and conservation. In copepods, cryptic species have been discovered in most groups where fast-evolving molecular markers were employed. In this study at Yeelirrie in Western Australia we investigate a subterranean species complex belonging to the harpacticoid genus Schizopera Sars, 1905, using both the barcoding mitochondrial COI gene and landmark-based two-dimensional geometric morphometrics. Integumental organs (sensilla and pores) are used as landmarks for the first time in any crustacean group. Complete congruence between DNA-based species delimitation and relative position of integumental organs in two independent morphological structures suggests the existence of three distinct evolutionary units. We describe two of them as new species, employing a condensed taxonomic format appropriate for cryptic species. We argue that many supposedly cryptic species might not be cryptic if researchers focus on analyzing morphological structures with multivariate tools that explicitly take into account geometry of the phenotype. A perceived supremacy of molecular methods in detecting cryptic species is in our view a consequence of disparity of investment and unexploited recent advancements in morphometrics among taxonomists. Our study shows that morphometric data alone could be used to find diagnostic morphological traits and gives hope to anyone studying small animals with a hard integument or shell, especially opening the door to assessing fossil diversity and rich museum collections. We expect that simultaneous use of molecular tools with geometry-oriented morphometrics may yield faster formal description of species. Decrypted species in this study are a good example for urgency of formal descriptions, as they display short-range endemism in small groundwater calcrete aquifers in a paleochannel, where their conservation may be threatened by proposed mining. ©The Author(s) 2015. Published by Oxford University Press, on behalf of the Society of Systematic Biologists. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  10. Intrasteric inhibition mediates the interaction of the I/LWEQ module proteins Talin1, Talin2, Hip1, and Hip12 with actin.

    PubMed

    Senetar, Melissa A; Foster, Stanley J; McCann, Richard O

    2004-12-14

    The I/LWEQ module superfamily is a class of actin-binding proteins that contains a conserved C-terminal actin-binding element known as the I/LWEQ module. I/LWEQ module proteins include the metazoan talins, the cellular slime mold talin homologues TalA and TalB, fungal Sla2p, and the metazoan Sla2 homologues Hip1 and Hip12 (Hip1R). These proteins possess a similar modular organization that includes an I/LWEQ module at their C-termini and either a FERM domain or an ENTH domain at their N-termini. As a result of this modular organization, I/LWEQ module proteins may serve as linkers between cellular compartments, such as the plasma membrane and the endocytic machinery, and the actin cytoskeleton. Previous studies have shown that I/LWEQ module proteins bind to F-actin. In this report, we have determined the affinity of the I/LWEQ module proteins Talin1, Talin2, huntingtin interacting protein-1 (Hip1), and the Hip1-related protein (Hip1R/Hip12) for F-actin and identified a conserved structural element that interferes with the actin binding capacity of these proteins. Our data support the hypothesis that the actin-binding determinants in native talin and other I/LWEQ module proteins are cryptic and indicate that the actin binding capacities of Talin1, Talin2, Hip1, and Hip12 are regulated by intrasteric occlusion of primary actin-binding determinants within the I/LWEQ module. We have also found that the I/LWEQ module contains a dimerization motif and stabilizes actin filaments against depolymerization. This activity may contribute to the function of talin in cell adhesion and the roles of Hip1, Hip12 (Hip1R), and Sla2p in endocytosis.

  11. Comparison of the fibrin-binding activities in the N- and C-termini of fibronectin.

    PubMed

    Rostagno, A A; Schwarzbauer, J E; Gold, L I

    1999-03-01

    Fibronectin (Fn) binds to fibrin in clots by covalent and non-covalent interactions. The N- and C-termini of Fn each contain one non-covalent fibrin-binding site, which are composed of type 1 (F1) structural repeats. We have previously localized the N-terminal site to the fourth and fifth F1 repeats (4F1.5F1). In the current studies, using proteolytic and recombinant proteins representing both the N- and C-terminal fibrin-binding regions, we localized and characterized the C-terminal fibrin-binding site, compared the relative fibrin-binding activities of both sites and determined the contribution of each site to the fibrin-binding activity of intact Fn. By fibrin-affinity chromatography, a protein composed of the 10F1 repeat through to the C-terminus of Fn (10F1-COOH), expressed in COS-1 cells, and 10F1-12F1, produced in Saccharomyces cerevisiae, displayed fibrin-binding activity. However, since 10F1 and 10F1.11F1 were not active, the presence of 12F1 is required for fibrin binding. A proteolytic fragment of 14.4 kDa, beginning 14 residues N-terminal to 10F1, was isolated from the fibrin-affinity matrix. Radio-iodinated 14.4 kDa fibrin-binding peptide/protein (FBP) demonstrated a dose-dependent and saturable binding to fibrin-coated wells that was both competitively inhibited and reversed by unlabelled 14.4 kDa FBP. Comparison of the fibrin-binding affinities of proteolytic FBPs from the N-terminus (25.9 kDa FBP), the C-terminus (14.4 kDa) and intact Fn by ELISA yielded estimated Kd values of 216, 18 and 2.1 nM, respectively. The higher fibrin-binding affinity of the N-terminus was substantiated by the ability of both a recombinant 4F1.5F1 and a monoclonal antibody (mAb) to this site to maximally inhibit biotinylated Fn binding to fibrin by 80%, and by blocking the 90% inhibitory activity of a polyclonal anti-Fn, by absorption with the 25.9 kDa FBP. We propose that whereas the N-terminal site appears to contribute to most of the binding activity of native Fn to fibrin, the specific binding of the C-terminal site may strengthen this interaction.

  12. Comparison of the fibrin-binding activities in the N- and C-termini of fibronectin.

    PubMed Central

    Rostagno, A A; Schwarzbauer, J E; Gold, L I

    1999-01-01

    Fibronectin (Fn) binds to fibrin in clots by covalent and non-covalent interactions. The N- and C-termini of Fn each contain one non-covalent fibrin-binding site, which are composed of type 1 (F1) structural repeats. We have previously localized the N-terminal site to the fourth and fifth F1 repeats (4F1.5F1). In the current studies, using proteolytic and recombinant proteins representing both the N- and C-terminal fibrin-binding regions, we localized and characterized the C-terminal fibrin-binding site, compared the relative fibrin-binding activities of both sites and determined the contribution of each site to the fibrin-binding activity of intact Fn. By fibrin-affinity chromatography, a protein composed of the 10F1 repeat through to the C-terminus of Fn (10F1-COOH), expressed in COS-1 cells, and 10F1-12F1, produced in Saccharomyces cerevisiae, displayed fibrin-binding activity. However, since 10F1 and 10F1.11F1 were not active, the presence of 12F1 is required for fibrin binding. A proteolytic fragment of 14.4 kDa, beginning 14 residues N-terminal to 10F1, was isolated from the fibrin-affinity matrix. Radio-iodinated 14.4 kDa fibrin-binding peptide/protein (FBP) demonstrated a dose-dependent and saturable binding to fibrin-coated wells that was both competitively inhibited and reversed by unlabelled 14.4 kDa FBP. Comparison of the fibrin-binding affinities of proteolytic FBPs from the N-terminus (25.9 kDa FBP), the C-terminus (14.4 kDa) and intact Fn by ELISA yielded estimated Kd values of 216, 18 and 2.1 nM, respectively. The higher fibrin-binding affinity of the N-terminus was substantiated by the ability of both a recombinant 4F1.5F1 and a monoclonal antibody (mAb) to this site to maximally inhibit biotinylated Fn binding to fibrin by 80%, and by blocking the 90% inhibitory activity of a polyclonal anti-Fn, by absorption with the 25.9 kDa FBP. We propose that whereas the N-terminal site appears to contribute to most of the binding activity of native Fn to fibrin, the specific binding of the C-terminal site may strengthen this interaction. PMID:10024513

  13. sc-PDB: a 3D-database of ligandable binding sites—10 years on

    PubMed Central

    Desaphy, Jérémy; Bret, Guillaume; Rognan, Didier; Kellenberger, Esther

    2015-01-01

    The sc-PDB database (available at http://bioinfo-pharma.u-strasbg.fr/scPDB/) is a comprehensive and up-to-date selection of ligandable binding sites of the Protein Data Bank. Sites are defined from complexes between a protein and a pharmacological ligand. The database provides the all-atom description of the protein, its ligand, their binding site and their binding mode. Currently, the sc-PDB archive registers 9283 binding sites from 3678 unique proteins and 5608 unique ligands. The sc-PDB database was publicly launched in 2004 with the aim of providing structure files suitable for computational approaches to drug design, such as docking. During the last 10 years we have improved and standardized the processes for (i) identifying binding sites, (ii) correcting structures, (iii) annotating protein function and ligand properties and (iv) characterizing their binding mode. This paper presents the latest enhancements in the database, specifically pertaining to the representation of molecular interaction and to the similarity between ligand/protein binding patterns. The new website puts emphasis in pictorial analysis of data. PMID:25300483

  14. Allosteric Coupling of CARMIL and V-1 Binding to Capping Protein Revealed by Hydrogen-Deuterium Exchange.

    PubMed

    Johnson, Britney; McConnell, Patrick; Kozlov, Alex G; Mekel, Marlene; Lohman, Timothy M; Gross, Michael L; Amarasinghe, Gaya K; Cooper, John A

    2018-05-29

    Actin assembly is important for cell motility. The ability of actin subunits to join or leave filaments via the barbed end is critical to actin dynamics. Capping protein (CP) binds to barbed ends to prevent subunit gain and loss and is regulated by proteins that include V-1 and CARMIL. V-1 inhibits CP by sterically blocking one binding site for actin. CARMILs bind at a distal site and decrease the affinity of CP for actin, suggested to be caused by conformational changes. We used hydrogen-deuterium exchange with mass spectrometry (HDX-MS) to probe changes in structural dynamics induced by V-1 and CARMIL binding to CP. V-1 and CARMIL induce changes in both proteins' binding sites on the surface of CP, along with a set of internal residues. Both also affect the conformation of CP's ββ subunit "tentacle," a second distal actin-binding site. Concerted regulation of actin assembly by CP occurs through allosteric couplings between CP modulator and actin binding sites. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

  15. Elucidation of the Human Serum Albumin (HSA) Binding Site for the Cu-PTSM and Cu-ATSM Radiopharmaceuticals

    PubMed Central

    Basken, Nathan E.; Mathias, Carla J.; Green, Mark A.

    2008-01-01

    The Cu-PTSM (pyruvaldehyde bis(N4-methylthiosemicarbazonato)copper(II)) and Cu-ATSM (diacetyl bis(N4-methylthiosemicarbazonato)copper(II)) radiopharmaceuticals exhibit strong, species-dependent binding to human serum albumin (HSA), while Cu-ETS (ethylglyoxal bis(thiosemicarbazonato)copper(II)) appears to only exhibit non-specific binding to human and animal serum albumins. This study examines the structural basis for HSA binding of Cu-PTSM and Cu-ATSM via competition with drugs having known albumin binding sites. Warfarin, furosemide, ibuprofen, phenylbutazone, benzylpenicillin, and cephmandole were added to HSA solutions at drug:HSA mole ratios from 0 to 8:1, followed by quantification of radiopharmaceutical binding to HSA by ultrafiltration. Warfarin, a site IIA drug, progressively displaced both [64Cu]Cu-PTSM and [64Cu]Cu-ATSM from HSA. At 8:1 warfarin:HSA mole ratios, free [64Cu]Cu-PTSM and [64Cu]Cu-ATSM levels increased 300–500%. This was in contrast to solutions containing ibuprofen, a site IIIA drug; no increase in free [64Cu]Cu-PTSM or [64Cu]Cu-ATSM was observed except at high ibuprofen:HSA ratios, where secondary ibuprofen binding to the IIA site may cause modest radiopharmaceutical displacement. By contrast, and consistent with earlier findings suggesting Cu-ETS exhibits only non-specific associations, [64Cu]Cu-ETS binding to HSA was unaffected by the addition of drugs that bind in either site. We conclude that the species-dependence of Cu-PTSM and Cu-ATSM albumin binding arises from interaction(s) with the IIA site of HSA. PMID:18937368

  16. Binding and Translocation of Termination Factor Rho Studied at the Single-Molecule Level

    PubMed Central

    Koslover, Daniel J.; Fazal, Furqan M.; Mooney, Rachel A.; Landick, Robert; Block, Steven M.

    2012-01-01

    Rho termination factor is an essential hexameric helicase responsible for terminating 20–50% of all mRNA synthesis in E. coli. We used single- molecule force spectroscopy to investigate Rho-RNA binding interactions at the Rho- utilization (rut) site of the ? tR1 terminator. Our results are consistent with Rho complexes adopting two states, one that binds 57 ±2 nucleotides of RNA across all six of the Rho primary binding sites, and another that binds 85 ±2 nucleotides at the six primary sites plus a single secondary site situated at the center of the hexamer. The single-molecule data serve to establish that Rho translocates 5′-to-3′ towards RNA polymerase (RNAP) by a tethered-tracking mechanism, looping out the intervening RNA between the rut site and RNAP. These findings lead to a general model for Rho binding and translocation, and establish a novel experimental approach that should facilitate additional single- molecule studies of RNA-binding proteins. PMID:22885804

  17. OnTheFly: a database of Drosophila melanogaster transcription factors and their binding sites.

    PubMed

    Shazman, Shula; Lee, Hunjoong; Socol, Yakov; Mann, Richard S; Honig, Barry

    2014-01-01

    We present OnTheFly (http://bhapp.c2b2.columbia.edu/OnTheFly/index.php), a database comprising a systematic collection of transcription factors (TFs) of Drosophila melanogaster and their DNA-binding sites. TFs predicted in the Drosophila melanogaster genome are annotated and classified and their structures, obtained via experiment or homology models, are provided. All known preferred TF DNA-binding sites obtained from the B1H, DNase I and SELEX methodologies are presented. DNA shape parameters predicted for these sites are obtained from a high throughput server or from crystal structures of protein-DNA complexes where available. An important feature of the database is that all DNA-binding domains and their binding sites are fully annotated in a eukaryote using structural criteria and evolutionary homology. OnTheFly thus provides a comprehensive view of TFs and their binding sites that will be a valuable resource for deciphering non-coding regulatory DNA.

  18. Zampanolide Binding to Tubulin Indicates Cross-Talk of Taxane Site with Colchicine and Nucleotide Sites.

    PubMed

    Field, Jessica J; Pera, Benet; Gallego, Juan Estévez; Calvo, Enrique; Rodríguez-Salarichs, Javier; Sáez-Calvo, Gonzalo; Zuwerra, Didier; Jordi, Michel; Andreu, José M; Prota, Andrea E; Ménchon, Grégory; Miller, John H; Altmann, Karl-Heinz; Díaz, J Fernando

    2018-03-23

    The marine natural product zampanolide and analogues thereof constitute a new chemotype of taxoid site microtubule-stabilizing agents with a covalent mechanism of action. Zampanolide-ligated tubulin has the switch-activation loop (M-loop) in the assembly prone form and, thus, represents an assembly activated state of the protein. In this study, we have characterized the biochemical properties of the covalently modified, activated tubulin dimer, and we have determined the effect of zampanolide on tubulin association and the binding of tubulin ligands at other binding sites. Tubulin activation by zampanolide does not affect its longitudinal oligomerization but does alter its lateral association properties. The covalent binding of zampanolide to β-tubulin affects both the colchicine site, causing a change of the quantum yield of the bound ligand, and the exchangeable nucleotide binding site, reducing the affinity for the nucleotide. While these global effects do not change the binding affinity of 2-methoxy-5-(2,3,4-trimethoxyphenyl)-2,4,6-cycloheptatrien-1-one (MTC) (a reversible binder of the colchicine site), the binding affinity of a fluorescent analogue of GTP (Mant-GTP) at the nucleotide E-site is reduced from 12 ± 2 × 10 5 M -1 in the case of unmodified tubulin to 1.4 ± 0.3 × 10 5 M -1 in the case of the zampanolide tubulin adduct, indicating signal transmission between the taxane site and the colchicine and nucleotide sites of β-tubulin.

  19. Binding Pathway of Opiates to μ-Opioid Receptors Revealed by Machine Learning

    NASA Astrophysics Data System (ADS)

    Barati Farimani, Amir; Feinberg, Evan; Pande, Vijay

    2018-02-01

    Many important analgesics relieve pain by binding to the $\\mu$-Opioid Receptor ($\\mu$OR), which makes the $\\mu$OR among the most clinically relevant proteins of the G Protein Coupled Receptor (GPCR) family. Despite previous studies on the activation pathways of the GPCRs, the mechanism of opiate binding and the selectivity of $\\mu$OR are largely unknown. We performed extensive molecular dynamics (MD) simulation and analysis to find the selective allosteric binding sites of the $\\mu$OR and the path opiates take to bind to the orthosteric site. In this study, we predicted that the allosteric site is responsible for the attraction and selection of opiates. Using Markov state models and machine learning, we traced the pathway of opiates in binding to the orthosteric site, the main binding pocket. Our results have important implications in designing novel analgesics.

  20. Stability and Sugar Recognition Ability of Ricin-Like Carbohydrate Binding Domains

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yao, Jianzhuang; Nellas, Ricky B; Glover, Mary M

    2011-01-01

    Lectins are a class of proteins known for their novel binding to saccharides. Understanding this sugar recognition process can be crucial in creating structure-based designs of proteins with various biological roles. We focus on the sugar binding of a particular lectin, ricin, which has two -trefoil carbohydrate-binding domains (CRDs) found in several plant protein toxins. The binding ability of possible sites of ricin-like CRD has been puzzling. The apo and various (multiple) ligand-bound forms of the sugar-binding domains of ricin were studied by molecular dynamics simulations. By evaluating structural stability, hydrogen bond dynamics, flexibility, and binding energy, we obtained amore » detailed picture of the sugar recognition of the ricin-like CRD. Unlike what was previously believed, we found that the binding abilities of the two known sites are not independent of each other. The binding ability of one site is positively affected by the other site. While the mean positions of different binding scenarios are not altered significantly, the flexibility of the binding pockets visibly decreases upon multiple ligand binding. This change in flexibility seems to be the origin of the binding cooperativity. All the hydrogen bonds that are strong in the monoligand state are also strong in the double-ligand complex, although the stability is much higher in the latter form due to cooperativity. These strong hydrogen bonds in a monoligand state are deemed to be the essential hydrogen bonds. Furthermore, by examining the structural correlation matrix, the two domains are structurally one entity. Galactose hydroxyl groups, OH4 and OH3, are the most critical parts in both site 1 and site 2 recognition.« less

  1. Identification of new 2,5-diketopiperazine derivatives as simultaneous effective inhibitors of αβ-tubulin and BCRP proteins: Molecular docking, Structure-Activity Relationships and virtual consensus docking studies

    NASA Astrophysics Data System (ADS)

    Fani, Najmeh; Sattarinezhad, Elham; Bordbar, Abdol-Khalegh

    2017-06-01

    In the first part of this paper, docking method was employed in order to study the binding mechanism of breast cancer resistance protein (BCRP) with a group of previously synthesized TPS-A derivatives which known as potent inhibitors of this protein to get insight into drug binding site of BCRP and to explore structure-activity relationship of these compounds. Molecular docking results showed that most of these compounds bind in the binding site of BCRP at the interface between the membrane and outer environment. In the second part, a group of designed TPS-A derivatives which showed good binding energies in the binding site of αβ-tubulin in the previous study were chosen to study their binding energies in the binding site of BCRP to investigate their simultaneous inhibitory effect on both αβ-tubulin and BCRP. The results showed that all of these compounds bind to the binding site of BCRP with relatively suitable binding energies and therefore could be potential inhibitors of both αβ-tubulin and BCRP proteins. Finally, virtual consensus docking method was utilized with the aim of design of new 2,5-diketopiperazine derivatives with significant inhibitory effect on both αβ-tubulin and BCRP proteins. For this purpose binding energies of a library of 2,5-diketopiperazine derivatives in the binding sites of αβ-tubulin and BCRP was investigated by using AutoDock and AutoDock vina tools. Molecular docking results revealed that a group of 36 compounds among them exhibit strong anti-tubulin and anti-BCRP activity.

  2. A deep learning framework for modeling structural features of RNA-binding protein targets

    PubMed Central

    Zhang, Sai; Zhou, Jingtian; Hu, Hailin; Gong, Haipeng; Chen, Ligong; Cheng, Chao; Zeng, Jianyang

    2016-01-01

    RNA-binding proteins (RBPs) play important roles in the post-transcriptional control of RNAs. Identifying RBP binding sites and characterizing RBP binding preferences are key steps toward understanding the basic mechanisms of the post-transcriptional gene regulation. Though numerous computational methods have been developed for modeling RBP binding preferences, discovering a complete structural representation of the RBP targets by integrating their available structural features in all three dimensions is still a challenging task. In this paper, we develop a general and flexible deep learning framework for modeling structural binding preferences and predicting binding sites of RBPs, which takes (predicted) RNA tertiary structural information into account for the first time. Our framework constructs a unified representation that characterizes the structural specificities of RBP targets in all three dimensions, which can be further used to predict novel candidate binding sites and discover potential binding motifs. Through testing on the real CLIP-seq datasets, we have demonstrated that our deep learning framework can automatically extract effective hidden structural features from the encoded raw sequence and structural profiles, and predict accurate RBP binding sites. In addition, we have conducted the first study to show that integrating the additional RNA tertiary structural features can improve the model performance in predicting RBP binding sites, especially for the polypyrimidine tract-binding protein (PTB), which also provides a new evidence to support the view that RBPs may own specific tertiary structural binding preferences. In particular, the tests on the internal ribosome entry site (IRES) segments yield satisfiable results with experimental support from the literature and further demonstrate the necessity of incorporating RNA tertiary structural information into the prediction model. The source code of our approach can be found in https://github.com/thucombio/deepnet-rbp. PMID:26467480

  3. Functional Characterization of the Mannitol Promoter of Pseudomonas fluorescens DSM 50106 and Its Application for a Mannitol-Inducible Expression System for Pseudomonas putida KT2440

    PubMed Central

    Hoffmann, Jana; Altenbuchner, Josef

    2015-01-01

    A new pBBR1MCS-2-derived vector containing the Pseudomonas fluorescens DSM10506 mannitol promoter PmtlE and mtlR encoding its AraC/XylS type transcriptional activator was constructed and optimized for low basal expression. Mannitol, arabitol, and glucitol-inducible gene expression was demonstrated with Pseudomonas putida and eGFP as reporter gene. The new vector was applied for functional characterization of PmtlE. Identification of the DNA binding site of MtlR was achieved by in vivo eGFP measurement with PmtlE wild type and mutants thereof. Moreover, purified MtlR was applied for detailed in vitro investigations using electrophoretic mobility shift assays and DNaseI footprinting experiments. The obtained data suggest that MtlR binds to PmtlE as a dimer. The proposed DNA binding site of MtlR is AGTGC-N5-AGTAT-N7-AGTGC-N5-AGGAT. The transcription activation mechanism includes two binding sites with different binding affinities, a strong upstream binding site and a weaker downstream binding site. The presence of the weak downstream binding site was shown to be necessary to sustain mannitol-inducibility of PmtlE. Two possible functions of mannitol are discussed; the effector might stabilize binding of the second monomer to the downstream half site or promote transcription activation by inducing a conformational change of the regulator that influences the contact to the RNA polymerase. PMID:26207762

  4. The structure of binding curves and practical identifiability of equilibrium ligand-binding parameters

    PubMed Central

    Middendorf, Thomas R.

    2017-01-01

    A critical but often overlooked question in the study of ligands binding to proteins is whether the parameters obtained from analyzing binding data are practically identifiable (PI), i.e., whether the estimates obtained from fitting models to noisy data are accurate and unique. Here we report a general approach to assess and understand binding parameter identifiability, which provides a toolkit to assist experimentalists in the design of binding studies and in the analysis of binding data. The partial fraction (PF) expansion technique is used to decompose binding curves for proteins with n ligand-binding sites exactly and uniquely into n components, each of which has the form of a one-site binding curve. The association constants of the PF component curves, being the roots of an n-th order polynomial, may be real or complex. We demonstrate a fundamental connection between binding parameter identifiability and the nature of these one-site association constants: all binding parameters are identifiable if the constants are all real and distinct; otherwise, at least some of the parameters are not identifiable. The theory is used to construct identifiability maps from which the practical identifiability of binding parameters for any two-, three-, or four-site binding curve can be assessed. Instructions for extending the method to generate identifiability maps for proteins with more than four binding sites are also given. Further analysis of the identifiability maps leads to the simple rule that the maximum number of structurally identifiable binding parameters (shown in the previous paper to be equal to n) will also be PI only if the binding curve line shape contains n resolved components. PMID:27993951

  5. Super-high-affinity binding site for [3H]diazepam in the presence of Co2+, Ni2+, Cu2+, or Zn2+.

    PubMed

    Mizuno, S; Ogawa, N; Mori, A

    1982-12-01

    Chloride salts of Li+, Na+, K+, Mg2+, Ca2+, Cr3+, Mn2+, Fe2+, and Fe3+ had no effect on [3H]diazepam binding. Chloride salts of Co2+, Ni2+, Cu2+, and Zn2+ increased [3H]diazepam binding by 34 to 68% in a concentration-dependent fashion. Since these divalent cations potentiated the GABA-enhanced [3H]diazepam binding and the effect of each divalent cation was nearly additive with GABA, these cations probably act at a site different from the GABA recognition site in the benzodiazepine-receptor complex. Scatchard plots of [3H]diazepam binding without an effective divalent cation showed a single class of binding, with a Kd value of 5.3 nM. In the presence of 1 mM Co2+, Ni2+, Cu2+, or Zn2+, two distinct binding sites were evident with apparent Kd values of 1.0 nM and 5.7 nM. The higher-affinity binding was not detected in the absence of an effective divalent cation and is probably a novel, super-high-affinity binding site.

  6. Point mutations abolishing the mannose-binding capability of boar spermadhesin AQN-1.

    PubMed

    Ekhlasi-Hundrieser, Mahnaz; Calvete, Juan J; Von Rad, Bettina; Hettel, Christiane; Nimtz, Manfred; Töpfer-Petersen, Edda

    2008-05-01

    The mannose-binding capability of recombinant wild-type boar spermadhesin AQN-1 and of its site-directed mutants in the highly-conserved region around of the single glycosylation site (asparagine 50) of some spermadhesins, where the carbohydrate binding site has been proposed to be located, was checked using a solid-phase assay and a biotinylated mannose ligand. Substitution of glycine 54 by amino acids bearing an unipolar side chain did not cause significant decrease in the mannose-binding activity. However, amino acids with uncharged polar side chains or having a charged polar side chain abolished the binding of biotinylated mannose to the corresponding AQN-1 mutants. The results suggest that the higher surface accessibility of amino acids possessing polar side chains compared to those bearing nonpolar groups may sterically interfere with monosaccharide binding. The location of the mannose-binding site in AQN-1 appears to be topologically conserved in other heparin-binding boar spermadhesins, i.e., AQN-3 and AWN, but departs from the location of the mannose-6-phosphate-recognition site of PSP-II. This indicates that different spermadhesin molecules have evolved non-equivalent carbohydrate-binding capabilities, which may underlie their distinct patterns of biological activities.

  7. Virtual screening of potential inhibitors from TCM for the CPSF30 binding site on the NS1A protein of influenza A virus.

    PubMed

    Ai, Haixin; Zhang, Li; Chang, Alan K; Wei, Hongyun; Che, Yuchen; Liu, Hongsheng

    2014-03-01

    Inhibition of CPSF30 function by the effector domain of influenza A virus of non-structural protein 1 (NS1A) protein plays a critical role in the suppression of host key antiviral response. The CPSF30-binding site of NS1A appears to be a very attractive target for the development of new drugs against influenza A virus. In this study, structure-based molecular docking was utilized to screen more than 30,000 compounds from a Traditional Chinese Medicine (TCM) database. Four drug-like compounds were selected as potential inhibitors for the CPSF30-binding site of NS1A. Docking conformation analysis results showed that these potential inhibitors could bind to the CPSF30-binding site with strong hydrophobic interactions and weak hydrogen bonds. Molecular dynamics simulations and MM-PBSA calculations suggested that two of the inhibitors, compounds 32056 and 31674, could stably bind to the CPSF30-binding site with high binding free energy. These two compounds could be modified to achieve higher binding affinity, so that they may be used as potential leads in the development of new anti-influenza drugs.

  8. Expression and GTP sensitivity of peptide histidine isoleucine high-affinity-binding sites in rat.

    PubMed

    Debaigt, Colin; Meunier, Annie-Claire; Goursaud, Stephanie; Montoni, Alicia; Pineau, Nicolas; Couvineau, Alain; Laburthe, Marc; Muller, Jean-Marc; Janet, Thierry

    2006-07-01

    High-affinity-binding sites for the vasoactive intestinal peptide (VIP) analogs peptide histidine/isoleucine-amide (PHI)/carboxyterminal methionine instead of isoleucine (PHM) are expressed in numerous tissues in the body but the nature of their receptors remains to be elucidated. The data presented indicate that PHI discriminated a high-affinity guanosine 5'-triphosphate (GTP)-insensitive-binding subtype that represented the totality of the PHI-binding sites in newborn rat tissues but was differentially expressed in adult animals. The GTP-insensitive PHI/PHM-binding sites were also observed in CHO cells over expressing the VPAC2 but not the VPAC1 VIP receptor.

  9. Selectivity of externally facing ion-binding sites in the Na/K pump to alkali metals and organic cations

    PubMed Central

    Ratheal, Ian M.; Virgin, Gail K.; Yu, Haibo; Roux, Benoît; Gatto, Craig; Artigas, Pablo

    2010-01-01

    The Na/K pump is a P-type ATPase that exchanges three intracellular Na+ ions for two extracellular K+ ions through the plasmalemma of nearly all animal cells. The mechanisms involved in cation selection by the pump's ion-binding sites (site I and site II bind either Na+ or K+; site III binds only Na+) are poorly understood. We studied cation selectivity by outward-facing sites (high K+ affinity) of Na/K pumps expressed in Xenopus oocytes, under voltage clamp. Guanidinium+, methylguanidinium+, and aminoguanidinium+ produced two phenomena possibly reflecting actions at site III: (i) voltage-dependent inhibition (VDI) of outwardly directed pump current at saturating K+, and (ii) induction of pump-mediated, guanidinium-derivative–carried inward current at negative potentials without Na+ and K+. In contrast, formamidinium+ and acetamidinium+ induced K+-like outward currents. Measurement of ouabain-sensitive ATPase activity and radiolabeled cation uptake confirmed that these cations are external K+ congeners. Molecular dynamics simulations indicate that bound organic cations induce minor distortion of the binding sites. Among tested metals, only Li+ induced Na+-like VDI, whereas all metals tested except Na+ induced K+-like outward currents. Pump-mediated K+-like organic cation transport challenges the concept of rigid structural models in which ion specificity at site I and site II arises from a precise and unique arrangement of coordinating ligands. Furthermore, actions by guanidinium+ derivatives suggest that Na+ binds to site III in a hydrated form and that the inward current observed without external Na+ and K+ represents cation transport when normal occlusion at sites I and II is impaired. These results provide insights on external ion selectivity at the three binding sites. PMID:20937860

  10. Mechanistic Insight from Calorimetric Measurements of the Assembly of the Binuclear Metal Active Site of Glycerophosphodiesterase (GpdQ) from Enterobacter aerogenes.

    PubMed

    Pedroso, Marcelo M; Ely, Fernanda; Carpenter, Margaret C; Mitić, Nataša; Gahan, Lawrence R; Ollis, David L; Wilcox, Dean E; Schenk, Gerhard

    2017-07-05

    Glycerophosphodiesterase (GpdQ) from Enterobacter aerogenes is a binuclear metallohydrolase with a high affinity for metal ions at its α site but a lower affinity at its β site in the absence of a substrate. Isothermal titration calorimetry (ITC) has been used to quantify the Co(II) and Mn(II) binding affinities and thermodynamics of the two sites in wild-type GpdQ and two mutants, both in the absence and in the presence of phosphate. Metal ions bind to the six-coordinate α site in an entropically driven process with loss of a proton, while binding at the β site is not detected by ITC. Phosphate enhances the metal affinity of the α site by increasing the binding entropy and the metal affinity of the β site by enthalpic (Co) or entropic (Mn) contributions, but no additional loss of protons. Mutations of first- and second-coordination sphere residues at the β site increase the metal affinity of both sites by enhancing the binding enthalpy. In particular, loss of the hydrogen bond from second-sphere Ser127 to the metal-coordinating Asn80 has a significant effect on the metal binding thermodynamics that result in a resting binuclear active site with high catalytic activity. While structural and spectroscopic data with excess metal ions have indicated a bridging hydroxide in the binuclear GpdQ site, analysis of ITC data here reveals the loss of a single proton in the assembly of this site, indicating that the metal-bound hydroxide nucleophile is formed in the resting inactive mononuclear form, which becomes catalytically competent upon binding the second metal ion.

  11. Volatile anesthetic binding to proteins is influenced by solvent and aliphatic residues.

    PubMed

    Streiff, John H; Jones, Keith A

    2008-10-01

    The main objective of this work was to characterize VA binding sites in multiple anesthetic target proteins. A computational algorithm was used to quantify the solvent exclusion and aliphatic character of amphiphilic pockets in the structures of VA binding proteins. VA binding sites in the protein structures were defined as the pockets with solvent exclusion and aliphatic character that exceeded minimum values observed in the VA binding sites of serum albumin, firefly luciferase, and apoferritin. We found that the structures of VA binding proteins are enriched in these pockets and that the predicted binding sites were consistent with experimental determined binding locations in several proteins. Autodock3 was used to dock the simulated molecules of 1,1,1,2,2-pentafluoroethane, difluoromethyl 1,1,1,2-tetrafluoroethyl ether, and sevoflurane and the isomers of halothane and isoflurane into these potential binding sites. We found that the binding of the various VA molecules to the amphiphilic pockets is driven primarily by VDW interactions and to a lesser extent by weak hydrogen bonding and electrostatic interactions. In addition, the trend in Delta G binding values follows the Meyer-Overton rule. These results suggest that VA potencies are related to the VDW interactions between the VA ligand and protein target. It is likely that VA bind to sites with a high degree of solvent exclusion and aliphatic character because aliphatic residues provide favorable VDW contacts and weak hydrogen bond donors. Water molecules occupying these sites maintain pocket integrity, associate with the VA ligand, and diminish the unfavorable solvation enthalpy of the VA. Water molecules displaced into the bulk by the VA ligand may provide an additional favorable enthalpic contribution to VA binding. Anesthesia is a component of many health related procedures, the outcomes of which could be improved with a better understanding of the molecular targets and mechanisms of anesthetic action.

  12. Fold independent structural comparisons of protein-ligand binding sites for exploring functional relationships.

    PubMed

    Gold, Nicola D; Jackson, Richard M

    2006-02-03

    The rapid growth in protein structural data and the emergence of structural genomics projects have increased the need for automatic structure analysis and tools for function prediction. Small molecule recognition is critical to the function of many proteins; therefore, determination of ligand binding site similarity is important for understanding ligand interactions and may allow their functional classification. Here, we present a binding sites database (SitesBase) that given a known protein-ligand binding site allows rapid retrieval of other binding sites with similar structure independent of overall sequence or fold similarity. However, each match is also annotated with sequence similarity and fold information to aid interpretation of structure and functional similarity. Similarity in ligand binding sites can indicate common binding modes and recognition of similar molecules, allowing potential inference of function for an uncharacterised protein or providing additional evidence of common function where sequence or fold similarity is already known. Alternatively, the resource can provide valuable information for detailed studies of molecular recognition including structure-based ligand design and in understanding ligand cross-reactivity. Here, we show examples of atomic similarity between superfamily or more distant fold relatives as well as between seemingly unrelated proteins. Assignment of unclassified proteins to structural superfamiles is also undertaken and in most cases substantiates assignments made using sequence similarity. Correct assignment is also possible where sequence similarity fails to find significant matches, illustrating the potential use of binding site comparisons for newly determined proteins.

  13. Analysis of functional importance of binding sites in the Drosophila gap gene network model.

    PubMed

    Kozlov, Konstantin; Gursky, Vitaly V; Kulakovskiy, Ivan V; Dymova, Arina; Samsonova, Maria

    2015-01-01

    The statistical thermodynamics based approach provides a promising framework for construction of the genotype-phenotype map in many biological systems. Among important aspects of a good model connecting the DNA sequence information with that of a molecular phenotype (gene expression) is the selection of regulatory interactions and relevant transcription factor bindings sites. As the model may predict different levels of the functional importance of specific binding sites in different genomic and regulatory contexts, it is essential to formulate and study such models under different modeling assumptions. We elaborate a two-layer model for the Drosophila gap gene network and include in the model a combined set of transcription factor binding sites and concentration dependent regulatory interaction between gap genes hunchback and Kruppel. We show that the new variants of the model are more consistent in terms of gene expression predictions for various genetic constructs in comparison to previous work. We quantify the functional importance of binding sites by calculating their impact on gene expression in the model and calculate how these impacts correlate across all sites under different modeling assumptions. The assumption about the dual interaction between hb and Kr leads to the most consistent modeling results, but, on the other hand, may obscure existence of indirect interactions between binding sites in regulatory regions of distinct genes. The analysis confirms the previously formulated regulation concept of many weak binding sites working in concert. The model predicts a more or less uniform distribution of functionally important binding sites over the sets of experimentally characterized regulatory modules and other open chromatin domains.

  14. Regulation of CCL2 expression by an upstream TALE homeodomain protein-binding site that synergizes with the site created by the A-2578G SNP.

    PubMed

    Page, Stephen H; Wright, Edward K; Gama, Lucio; Clements, Janice E

    2011-01-01

    CC Chemokine Ligand 2 (CCL2) is a potent chemoattractant produced by macrophages and activated astrocytes during periods of inflammation within the central nervous system. Increased CCL2 expression is correlated with disease progression and severity, as observed in pulmonary tuberculosis, HCV-related liver disease, and HIV-associated dementia. The CCL2 distal promoter contains an A/G polymorphism at position -2578 and the homozygous -2578 G/G genotype is associated with increased CCL2 production and inflammation. However, the mechanisms that contribute to the phenotypic differences in CCL2 expression are poorly understood. We previously demonstrated that the -2578 G polymorphism creates a TALE homeodomain protein binding site (TALE binding site) for PREP1/PBX2 transcription factors. In this study, we identified the presence of an additional TALE binding site 22 bp upstream of the site created by the -2578 G polymorphism and demonstrated the synergistic effects of the two sites on the activation of the CCL2 promoter. Using chromatin immunoprecipitation (ChIP) assays, we demonstrated increased binding of the TALE proteins PREP1 and PBX2 to the -2578 G allele, and binding of IRF1 to both the A and G alleles. The presence of TALE binding sites that form inverted repeats within the -2578 G allele results in increased transcriptional activation of the CCL2 distal promoter while the presence of only the upstream TALE binding site within the -2578 A allele exerts repression of promoter activity.

  15. Factors governing the substitution of La3+ for Ca2+ and Mg2+ in metalloproteins: a DFT/CDM study.

    PubMed

    Dudev, Todor; Chang, Li-Ying; Lim, Carmay

    2005-03-23

    Trivalent lanthanide cations are extensively being used in biochemical experiments to probe various dication-binding sites in proteins; however, the factors governing the binding specificity of lanthanide cations for these binding sites remain unclear. Hence, we have performed systematic studies to evaluate the interactions between La3+ and model Ca2+ - and Mg2+ -binding sites using density functional theory combined with continuum dielectric methods. The calculations reveal the key factors and corresponding physical bases favoring the substitution of trivalent lanthanides for divalent Ca2+ and Mg2+ in holoproteins. Replacing Ca2+ or Mg2+ with La3+ is facilitated by (1) minimizing the solvent exposure and the flexibility of the metal-binding cavity, (2) freeing both carboxylate oxygen atoms of Asp/Glu side chains in the metal-binding site so that they could bind bidentately to La3+, (3) maximizing the number of metal-bound carboxylate groups in buried sites, but minimizing the number of metal-bound carboxylate groups in solvent-exposed sites, and (4) including an Asn/Gln side chain for sites lined with four Asp/Glu side chains. In proteins bound to both Mg2+ and Ca2+, La3+ would prefer to replace Ca2+, as compared to Mg2+. A second Mg2+-binding site with a net positive charge would hamper the Mg2+ --> La3+ exchange, as compared to the respective mononuclear site, although the La3+ substitution of the first native metal is more favorable than the second one. The findings of this work are in accord with available experimental data.

  16. Sequence of ligand binding and structure change in the diphtheria toxin repressor upon activation by divalent transition metals.

    PubMed

    Rangachari, Vijayaraghavan; Marin, Vedrana; Bienkiewicz, Ewa A; Semavina, Maria; Guerrero, Luis; Love, John F; Murphy, John R; Logan, Timothy M

    2005-04-19

    The diphtheria toxin repressor (DtxR) is an Fe(II)-activated transcriptional regulator of iron homeostatic and virulence genes in Corynebacterium diphtheriae. DtxR is a two-domain protein that contains two structurally and functionally distinct metal binding sites. Here, we investigate the molecular steps associated with activation by Ni(II)Cl(2) and Cd(II)Cl(2). Equilibrium binding energetics for Ni(II) were obtained from isothermal titration calorimetry, indicating apparent metal dissociation constants of 0.2 and 1.7 microM for two independent sites. The binding isotherms for Ni(II) and Cd(II) exhibited a characteristic exothermic-endothermic pattern that was used to infer the metal binding sequence by comparing the wild-type isotherm with those of several binding site mutants. These data were complemented by measuring the distance between specific backbone amide nitrogens and the first equivalent of metal through heteronuclear NMR relaxation measurements. Previous studies indicated that metal binding affects a disordered to ordered transition in the metal binding domain. The coupling between metal binding and structure change was investigated using near-UV circular dichroism spectroscopy. Together, the data show that the first equivalent of metal is bound by the primary metal binding site. This binding orients the DNA binding helices and begins to fold the N-terminal domain. Subsequent binding at the ancillary site completes the folding of this domain and formation of the dimer interface. This model is used to explain the behavior of several mutants.

  17. Nest Construction by a Ground-nesting Bird Represents a Potential Trade-off Between Egg Crypticity and Thermoregulation

    EPA Science Inventory

    Predation selects against conspicuous colors in bird eggs and nests, while thermoregulatory constraints select for nest building behavior that regulates incubation temperatures. We present results that reveal a trade-off between nest crypticity and thermoregulation of eggs base...

  18. Adaptive Evolution of Eel Fluorescent Proteins from Fatty Acid Binding Proteins Produces Bright Fluorescence in the Marine Environment.

    PubMed

    Gruber, David F; Gaffney, Jean P; Mehr, Shaadi; DeSalle, Rob; Sparks, John S; Platisa, Jelena; Pieribone, Vincent A

    2015-01-01

    We report the identification and characterization of two new members of a family of bilirubin-inducible fluorescent proteins (FPs) from marine chlopsid eels and demonstrate a key region of the sequence that serves as an evolutionary switch from non-fluorescent to fluorescent fatty acid-binding proteins (FABPs). Using transcriptomic analysis of two species of brightly fluorescent Kaupichthys eels (Kaupichthys hyoproroides and Kaupichthys n. sp.), two new FPs were identified, cloned and characterized (Chlopsid FP I and Chlopsid FP II). We then performed phylogenetic analysis on 210 FABPs, spanning 16 vertebrate orders, and including 163 vertebrate taxa. We show that the fluorescent FPs diverged as a protein family and are the sister group to brain FABPs. Our results indicate that the evolution of this family involved at least three gene duplication events. We show that fluorescent FABPs possess a unique, conserved tripeptide Gly-Pro-Pro sequence motif, which is not found in non-fluorescent fatty acid binding proteins. This motif arose from a duplication event of the FABP brain isoforms and was under strong purifying selection, leading to the classification of this new FP family. Residues adjacent to the motif are under strong positive selection, suggesting a further refinement of the eel protein's fluorescent properties. We present a phylogenetic reconstruction of this emerging FP family and describe additional fluorescent FABP members from groups of distantly related eels. The elucidation of this class of fish FPs with diverse properties provides new templates for the development of protein-based fluorescent tools. The evolutionary adaptation from fatty acid-binding proteins to fluorescent fatty acid-binding proteins raises intrigue as to the functional role of bright green fluorescence in this cryptic genus of reclusive eels that inhabit a blue, nearly monochromatic, marine environment.

  19. Functional analysis of the EspR binding sites upstream of espR in Mycobacterium tuberculosis.

    PubMed

    Cao, Guangxiang; Howard, Susan T; Zhang, Peipei; Hou, Guihua; Pang, Xiuhua

    2013-11-01

    The ESX-1 secretion system exports substrate proteins into host cells and is crucial for the pathogenesis of Mycobacterium tuberculosis. EspR is one of the characterized transcriptional regulators that modulates the ESX-1 system by binding the conserved EspR binding sites in the promoter of espA, the encoding gene of EspA, which is also a substrate protein of the ESX-1 system and is required for the ESX-1 activity. EspR is autoregulatory and conserved EspR binding sites are present upstream of espR. In this study, we showed that these EspR sites had varying affinities for EspR, with site B being the strongest one. Point mutations of the DNA sequence at site B abolished binding of EspR to oligonucleotides containing site B alone or with other sites, further suggesting that site B is a major binding site for EspR. Complementation studies showed that constructs containing espR, and the upstream intergenic region fully restored espR expression in a ΔespR mutant strain. Although recombinant strains with mutations at more than one EspR site showed minimal differences in espR expression, reduced expression of other EspR target genes was observed, suggesting that slight changes in EspR levels can have downstream regulatory effects. These findings contribute to our understanding of the regulation of the ESX-1 system.

  20. DNA breathing dynamics distinguish binding from nonbinding consensus sites for transcription factor YY1 in cells.

    PubMed

    Alexandrov, Boian S; Fukuyo, Yayoi; Lange, Martin; Horikoshi, Nobuo; Gelev, Vladimir; Rasmussen, Kim Ø; Bishop, Alan R; Usheva, Anny

    2012-11-01

    The genome-wide mapping of the major gene expression regulators, the transcription factors (TFs) and their DNA binding sites, is of great importance for describing cellular behavior and phenotypic diversity. Presently, the methods for prediction of genomic TF binding produce a large number of false positives, most likely due to insufficient description of the physiochemical mechanisms of protein-DNA binding. Growing evidence suggests that, in the cell, the double-stranded DNA (dsDNA) is subject to local transient strands separations (breathing) that contribute to genomic functions. By using site-specific chromatin immunopecipitations, gel shifts, BIOBASE data, and our model that accurately describes the melting behavior and breathing dynamics of dsDNA we report a specific DNA breathing profile found at YY1 binding sites in cells. We find that the genomic flanking sequence variations and SNPs, may exert long-range effects on DNA dynamics and predetermine YY1 binding. The ubiquitous TF YY1 has a fundamental role in essential biological processes by activating, initiating or repressing transcription depending upon the sequence context it binds. We anticipate that consensus binding sequences together with the related DNA dynamics profile may significantly improve the accuracy of genomic TF binding sites and TF binding-related functional SNPs.

  1. A multiplex PCR method for rapid identification of Brachionus rotifers.

    PubMed

    Vasileiadou, Kalliopi; Papakostas, Spiros; Triantafyllidis, Alexander; Kappas, Ilias; Abatzopoulos, Theodore J

    2009-01-01

    Cryptic species are increasingly being recognized in many organisms. In Brachionus rotifers, many morphologically similar yet genetically distinct species/biotypes have been described. A number of Brachionus cryptic species have been recognized among hatchery strains. In this study, we present a simple, one-step genetic method to detect the presence of those Brachionus sp. rotifers that have been found in hatcheries. With the proposed technique, each of the B. plicatilis sensu stricto, B. ibericus, Brachionus sp. Nevada, Brachionus sp. Austria, Brachionus sp. Manjavacas, and Brachionus sp. Cayman species and/or biotypes can be identified with polymerase chain reaction (PCR) analysis. Based on 233 cytochrome c oxidase subunit I sequences, we reviewed all the available cryptic Brachionus sp. genetic polymorphisms, and we designed six nested primers. With these primers, a specific amplicon of distinct size is produced for every one of the involved species/biotypes. Two highly sensitive protocols were developed for using the primers. Many of the primers can be combined in the same PCR. The proposed method has been found to be an effective and practical tool to investigate the presence of the above six cryptic species/biotypes in both individual and communal (bulk) rotifer deoxyribonucleic acid extractions from hatcheries. With this technique, hatchery managers could easily determine their rotifer composition at the level of cryptic species and monitor their cultures more efficiently.

  2. Predation cues rather than resource availability promote cryptic behaviour in a habitat-forming sea urchin.

    PubMed

    Spyksma, Arie J P; Taylor, Richard B; Shears, Nick T

    2017-03-01

    It is well known that predators often influence the foraging behaviour of prey through the so-called "fear effect". However, it is also possible that predators could change prey behaviour indirectly by altering the prey's food supply through a trophic cascade. The predator-sea urchin-kelp trophic cascade is widely assumed to be driven by the removal of sea urchins by predators, but changes in sea urchin behaviour in response to predators or increased food availability could also play an important role. We tested whether increased crevice occupancy by herbivorous sea urchins in the presence of abundant predatory fishes and lobsters is a response to the increased risk of predation, or an indirect response to higher kelp abundances. Inside two New Zealand marine reserves with abundant predators and kelp, individuals of the sea urchin Evechinus chloroticus were rarer and remained cryptic (i.e. found in crevices) to larger sizes than on adjacent fished coasts where predators and kelp are rare. In a mesocosm experiment, cryptic behaviour was induced by simulated predation (the addition of crushed conspecifics), but the addition of food in the form of drift kelp did not induce cryptic behaviour. These findings demonstrate that the 'fear' of predators is more important than food availability in promoting sea urchin cryptic behaviour and suggest that both density- and behaviourally mediated interactions are important in the predator-sea urchin-kelp trophic cascade.

  3. Morphometric study of third-instar larvae from five morphotypes of the Anastrepha fraterculus cryptic species complex (Diptera, Tephritidae)

    PubMed Central

    Canal, Nelson A.; Hernández-Ortiz, Vicente; Salas, Juan O. Tigrero; Selivon, Denise

    2015-01-01

    Abstract The occurrence of cryptic species among economically important fruit flies strongly affects the development of management tactics for these pests. Tools for studying cryptic species not only facilitate evolutionary and systematic studies, but they also provide support for fruit fly management and quarantine activities. Previous studies have shown that the South American fruit fly, Anastrepha fraterculus, is a complex of cryptic species, but few studies have been performed on the morphology of its immature stages. An analysis of mandible shape and linear morphometric variability was applied to third-instar larvae of five morphotypes of the Anastrepha fraterculus complex: Mexican, Andean, Ecuadorian, Peruvian and Brazilian-1. Outline geometric morphometry was used to study the mouth hook shape and linear morphometry analysis was performed using 24 linear measurements of the body, cephalopharyngeal skeleton, mouth hook and hypopharyngeal sclerite. Different morphotypes were grouped accurately using canonical discriminant analyses of both the geometric and linear morphometry. The shape of the mandible differed among the morphotypes, and the anterior spiracle length, number of tubules of the anterior spiracle, length and height of the mouth hook and length of the cephalopharyngeal skeleton were the most significant variables in the linear morphometric analysis. Third-instar larvae provide useful characters for studies of cryptic species in the Anastrepha fraterculus complex. PMID:26798253

  4. Mitochondrial phylogeny of grey mullets (Acanthopterygii: Mugilidae) suggests high proportion of cryptic species.

    PubMed

    Durand, Jean-Dominique; Borsa, Philippe

    2015-04-01

    The low level of morphometric variability and the poor phylogenetic information borne by the morpho-anatomical characters used thus far in the systematics of grey mullets (Mugilidae) emphasize the utility of molecular systematics in this family. A recent mitochondrial phylogeny of grey mullets has uncovered multiple deep lineages within several species, flagging putative cryptic species. Here, we considered that several of the deeply divergent lineages represent separate species based on either the tree topology, independent data from nuclear markers, geographic distributions, or a combination of the foregoing. By analogy with these well-documented cases, we considered other deep lineages in seven genera we focused on to represent putative cryptic species. Up to two cryptic species were thus potentially detected in the genus Chelon, three in Crenimugil (including two within the single Crenimugil seheli), two in Dajaus, one in Ellochelon, 16 in Mugil (including 13 within the single M. cephalus), two in Osteomugil, and 10 in Planiliza. Wherever possible, we kept the current species epithets to designate those lineages that unambiguously correspond to the type material, based on type locality, and we assigned arbitrary letters (sp. A, B, etc.) to the other lineages. We present a molecular diagnosis for 24 of the species analysed in this work, as well as for 25 putative cryptic species. Copyright © 2015 Académie des sciences. Published by Elsevier SAS. All rights reserved.

  5. Prostaglandin E and F2 alpha receptors in human myometrium during the menstrual cycle and in pregnancy and labor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Giannopoulos, G.; Jackson, K.; Kredentser, J.

    The binding of prostaglandins E1 and F2 alpha has been studied in the human myometrium and cervix during the menstrual cycle and in the myometrium of pregnant patients at term before and during labor. Tritium-labeled prostaglandin E1 and F2 alpha binding was saturable and reversible. Scatchard analysis of tritium-labeled prostaglandin E1 binding was linear, which suggests a single class of high-affinity binding sites with an estimated apparent equilibrium dissociation constant of 2.5 to 5.4 nmol/L and inhibitor affinities of 0.9, 273, 273, and 217 nmol/L for prostaglandins E2, A1, B1, and F2 alpha, respectively. Scatchard analysis of tritium-labeled prostaglandin F2more » alpha, binding was also linear, but the affinity of these binding sites was much lower, with an average dissociation constant of 50 nmol/L and inhibitor affinities of 1.6, 2.2, and 11.2 nmol/L for prostaglandins E1, E2, and A1, respectively. In nonpregnant patients, the concentrations and affinities of tritium-labeled prostaglandin E1 binding sites were similar in the myometrium during the proliferative and secretory phases of the menstrual cycle, but the concentration of these sites was much lower in the cervix. The concentration of the tritium-labeled prostaglandin E1 binding sites was significantly lower in the myometrium of pregnant patients at term than in the myometrium of nonpregnant patients. The concentrations and affinities of tritium-labeled prostaglandin E1 binding sites were not significantly different in the upper and lower myometrium of pregnant patients at term or in the myometrium of such patients before and during labor. The concentrations of the tritium-labeled prostaglandin F2 alpha binding sites during the menstrual cycle and in pregnancy at term were similar to those of tritium-labeled prostaglandin E1 binding sites.« less

  6. Poly(ornithine-co-arginine-co-glycine-co-aspartic Acid): Preparation via NCA Polymerization and its Potential as a Polymeric Tumor-Penetrating Agent.

    PubMed

    Yu, Haiyang; Tang, Zhaohui; Zhang, Dawei; Song, Wantong; Duan, Taicheng; Gu, Jingkai; Chen, Xuesi

    2015-06-01

    A novel random copolypeptide of ornithine, arginine, glycine, and aspartic acid [Poly(ornithine-co-arginine-co-glycine-co-aspartic acid), Poly(O,R,G,D)] has been prepared through ring-opening polymerization of N-δ-carbobenzoxy-l-ornithine N-carboxyanhydride [Orn(Cbz)-NCA)], l-glycine N-carboxyanhydride (Gly-NCA) and β-benzyl l-aspartate N-carboxyanhydride [Asp(Bn)-NCA], following by subsequent deprotection and guanidization. The structure of Poly(O,R,G,D) was confirmed by nuclear magnetic resonance (NMR) spectroscopy and gel permeation chromatography (GPC). Low cytotoxicity of Poly(O,R,G,D) was confirmed from MTT assay. The Poly(O,R,G,D) contain some internal sequences of RXXR (X = O, R, G, or D) that could be proteolytically cleaved to expose the cryptic CendR element and bind to Neuropilin-1. This would lead to vascular and tissue permeabilization. Therefore trypsin-cleaved Poly(O,R,G,D) increase the vascular leakage of Evans blue from dermal microvessels at the injection site in vivo skin permeability assay. The intratumoral injection of the Poly(O,R,G,D) significantly enhanced the concentration of cisplatin-loaded nanoparticles in MCF-7 solid tumors. These results show that Poly(O,R,G,D) could increase the vascular leakage and tissue penetration of nanoparticles in a solid tumor and can be used as a potential polymeric tumor-penetrating agent. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Role of gelsolin interaction with actin in regulation and creation of actin nuclei in chemotactic peptide activated polymorphonuclear neutrophils.

    PubMed Central

    Deaton, J D; Guerrero, T; Howard, T H

    1992-01-01

    In vitro Ca++ activates gelsolin to sever F-actin and form a gelsolin-actin (GA) complex at the+end of F-actin that is not dissociated by ethylene glycol-bis(beta-aminoethyl ether)-N,N,N',N'-tetraacetic acid (EGTA) but is separated by EGTA+PIP/PIP2. The gelsolin blocks the+end on the actin filament, but the-end of the filament can still initiate actin polymerization. In thrombin activated platelets, evidence suggests that severing of F-actin by gelsolin increases GA complex, creates one-end actin nucleus and one cryptic+end actin nucleus per cut, and then dissociates to yield free+ends to nucleate rapid actin assembly. We examined the role of F-actin severing in creation and regulation of nuclei and polymerization in polymorphonuclear neutrophils (PMNs). At 2-s intervals after formyl peptide (FMLP) activation of endotoxin free (ETF) PMNs, change in GA complex was correlated with change in+end actin nuclei,-end actin nuclei, and F-actin content. GA complex was quantitated by electrophoretograms of proteins absorbed by antigelsolin from cells lysed in 10 mM EGTA,+end actin nuclei as cytochalasin (CD) sensitive and-end actin nuclei as CD insensitive increases in G-pyrenyl actin polymerization rates induced by the same PMNs, and F-actin content by NBDphallacidin binding to fixed cells. Thirty three percent of gelsolin was in GA complex in basal ETF PMNs; from 2-6 s, GA complexes dissociate (low = 15% at 10 s) and sequentially+end nuclei and F-actin content and then-end nuclei increase to a maximum at 10 s. At > s GA complex increase toward basal and + end nuclei and F-actin content returned toward basal. These kinetic data show gelsolin regulates availability of + end nuclei and actin polymerization in FMLP. However, absence of an initial increase in GA complex or - end nucleating activity shows FMLP activation does not cause gelsolin to sever F- or to bind G-actin to create cryptic + end nuclei in PMNs; the results suggest the + nucleus formation is gelsolin independent. PMID:1337290

  8. Role of gelsolin interaction with actin in regulation and creation of actin nuclei in chemotactic peptide activated polymorphonuclear neutrophils.

    PubMed

    Deaton, J D; Guerrero, T; Howard, T H

    1992-12-01

    In vitro Ca++ activates gelsolin to sever F-actin and form a gelsolin-actin (GA) complex at the+end of F-actin that is not dissociated by ethylene glycol-bis(beta-aminoethyl ether)-N,N,N',N'-tetraacetic acid (EGTA) but is separated by EGTA+PIP/PIP2. The gelsolin blocks the+end on the actin filament, but the-end of the filament can still initiate actin polymerization. In thrombin activated platelets, evidence suggests that severing of F-actin by gelsolin increases GA complex, creates one-end actin nucleus and one cryptic+end actin nucleus per cut, and then dissociates to yield free+ends to nucleate rapid actin assembly. We examined the role of F-actin severing in creation and regulation of nuclei and polymerization in polymorphonuclear neutrophils (PMNs). At 2-s intervals after formyl peptide (FMLP) activation of endotoxin free (ETF) PMNs, change in GA complex was correlated with change in+end actin nuclei,-end actin nuclei, and F-actin content. GA complex was quantitated by electrophoretograms of proteins absorbed by antigelsolin from cells lysed in 10 mM EGTA,+end actin nuclei as cytochalasin (CD) sensitive and-end actin nuclei as CD insensitive increases in G-pyrenyl actin polymerization rates induced by the same PMNs, and F-actin content by NBDphallacidin binding to fixed cells. Thirty three percent of gelsolin was in GA complex in basal ETF PMNs; from 2-6 s, GA complexes dissociate (low = 15% at 10 s) and sequentially+end nuclei and F-actin content and then-end nuclei increase to a maximum at 10 s. At > s GA complex increase toward basal and + end nuclei and F-actin content returned toward basal. These kinetic data show gelsolin regulates availability of + end nuclei and actin polymerization in FMLP. However, absence of an initial increase in GA complex or - end nucleating activity shows FMLP activation does not cause gelsolin to sever F- or to bind G-actin to create cryptic + end nuclei in PMNs; the results suggest the + nucleus formation is gelsolin independent.

  9. Two classes of cholesterol binding sites for the β2AR revealed by thermostability and NMR.

    PubMed

    Gater, Deborah L; Saurel, Olivier; Iordanov, Iordan; Liu, Wei; Cherezov, Vadim; Milon, Alain

    2014-11-18

    Cholesterol binding to G protein-coupled receptors (GPCRs) and modulation of their activities in membranes is a fundamental issue for understanding their function. Despite the identification of cholesterol binding sites in high-resolution x-ray structures of the ?2 adrenergic receptor (β2AR) and other GPCRs, the binding affinity of cholesterol for this receptor and exchange rates between the free and bound cholesterol remain unknown. In this study we report the existence of two classes of cholesterol binding sites in β2AR. By analyzing the β2AR unfolding temperature in lipidic cubic phase (LCP) as a function of cholesterol concentration we observed high-affinity cooperative binding of cholesterol with sub-nM affinity constant. In contrast, saturation transfer difference (STD) NMR experiments revealed the existence of a second class of cholesterol binding sites, in fast exchange on the STD NMR timescale. Titration of the STD signal as a function of cholesterol concentration provided a lower limit of 100 mM for their dissociation constant. However, these binding sites are specific for both cholesterol and β2AR, as shown with control experiments using ergosterol and a control membrane protein (KpOmpA). We postulate that this specificity is mediated by the high-affinity bound cholesterol molecules and propose the formation of transient cholesterol clusters around the high-affinity binding sites.

  10. Prediction of the binding sites of huperzine A in acetylcholinesterase by docking studies

    NASA Astrophysics Data System (ADS)

    Pang, Yuan-Ping; Kozikowski, Alan P.

    1994-12-01

    We have performed docking studies with the SYSDOC program on acetylcholinesterase (AChE) to predict the binding sites in AChE of huperzine A (HA), which is a potent and selective, reversible inhibitor of AChE. The unique aspects of our docking studies include the following: (i) Molecular flexibility of the guest and the host is taken into account, which permits both to change their conformations upon binding. (ii) The binding energy is evaluated by a sum of energies of steric, electrostatic and hydrogen bonding interactions. In the energy calculation no grid approximation is used, and all hydrogen atoms of the system are treated explicitly. (iii) The energy of cation-π interactions between the guest and the host, which is important in the binding of AChE, is included in the calculated binding energy. (iv) Docking is performed in all regions of the host's binding cavity. Based on our docking studies and the pharmacological results reported for HA and its analogs, we predict that HA binds to the bottom of the binding cavity of AChE (the gorge) with its ammonium group interacting with Trp84, Phe330, Glu199 and Asp72 (catalytic site). At the the opening of the gorge with its ammonium group partially interacting with Trp279 (peripheral site). At the catalytic site, three partially overlapping subsites of HA were identified which might provide a dynamic view of binding of HA to the catalytic site.

  11. Stereoselective L-(3H)quinuclidinyl benzilate-binding sites in nervous tissue of Aplysia californica: evidence for muscarinic receptors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Murray, T.F.; Mpitsos, G.J.; Siebenaller, J.F.

    The muscarinic antagonist L-(/sup 3/H)quinuclidinyl benzilate (L-(/sup 3/H)QNB) binds with a high affinity (Kd = 0.77 nM) to a single population of specific sites (Bmax = 47 fmol/mg of protein) in nervous tissue of the gastropod mollusc, Aplysia. The specific L-(/sup 3/H)QNB binding is displaced stereoselectively by the enantiomers of benzetimide, dexetimide, and levetimide. The pharmacologically active enantiomer, dexetimide, is more potent than levetimide as an inhibitor of L-(/sup 3/H)QNB binding. Moreover, the muscarinic cholinergic ligands, scopolamine, atropine, oxotremorine, and pilocarpine are effective inhibitors of the specific L-(/sup 3/H)QNB binding, whereas nicotinic receptor antagonists, decamethonium and d-tubocurarine, are considerably lessmore » effective. These pharmacological characteristics of the L-(/sup 3/H)QNB-binding site provide evidence for classical muscarinic receptors in Aplysia nervous tissue. The physiological relevance of the dexetimide-displaceable L-(/sup 3/H)QNB-binding site was supported by the demonstration of the sensitivity of the specific binding to thermal denaturation. Specific binding of L-(/sup 3/H)QNB was also detected in nervous tissue of another marine gastropod, Pleurobranchaea californica. The characteristics of the Aplysia L-(/sup 3/H)QNB-binding site are in accordance with studies of numerous vertebrate and invertebrate tissues indicating that the muscarinic cholinergic receptor site has been highly conserved through evolution.« less

  12. Tyrosine411 and Arginine410 of Human Serum Albumin Play an Important Role in the Binding of Sodium 4-Phenylbutyrate to Site II.

    PubMed

    Enokida, Taisuke; Yamasaki, Keishi; Okamoto, Yuko; Taguchi, Kazuaki; Ishiguro, Takako; Maruyama, Toru; Seo, Hakaru; Otagiri, Masaki

    2016-06-01

    Sodium 4-phenylbutyrate (PB) has many pharmacological activities; therefore extending its clinical use to the treatment of a wider variety of diseases would be desirable. However, our knowledge of the binding of PB to plasma proteins is not extensive. To address this issue in more detail, we characterized the protein binding of PB. Binding experiments showed that PB mainly binds to human serum albumin (HSA) in plasma. PB was also found to bind to a single site on HSA, which was identified as site II by fluorescent probe displacement experiment. Furthermore, an appropriate alkyl chain length and a carboxylic group in the PB structure were required for PB binding to HSA, suggesting that hydrophobic (and van der Waals) and electrostatic interactions are involved as binding modes. The contributions of hydrogen bonding and/or van der Waals interactions were also indicated by thermodynamic analyses. Tyrosine411 and arginine410 were identified as being involved in the binding of PB to site II, based on binding experiments using chemically modified- and mutant-HSA preparations. In conclusion, the available evidence indicates that PB binds to site II of HSA with assistance by multiple forces and that tyrosine411 and arginine410 both play important roles in this phenomenon. Copyright © 2016 American Pharmacists Association®. Published by Elsevier Inc. All rights reserved.

  13. Energetics and kinetics of cooperative cofilin-actin filament interactions.

    PubMed

    Cao, Wenxiang; Goodarzi, Jim P; De La Cruz, Enrique M

    2006-08-11

    We have evaluated the thermodynamic parameters associated with cooperative cofilin binding to actin filaments, accounting for contributions of ion-linked equilibria, and determined the kinetic basis of cooperative cofilin binding. Ions weaken non-contiguous (isolated, non-cooperative) cofilin binding to an actin filament without affecting cooperative filament interactions. Non-contiguous cofilin binding is coupled to the dissociation of approximately 1.7 thermodynamically bound counterions. Counterion dissociation contributes approximately 40% of the total cofilin binding free energy (in the presence of 50 mM KCl). The non-contiguous and cooperative binding free energies are driven entirely by large, positive entropy changes, consistent with a cofilin-mediated increase in actin filament structural dynamics. The rate constant for cofilin binding to an isolated site on an actin filament is slow and likely to be limited by filament breathing. Cooperative cofilin binding arises from an approximately tenfold more rapid association rate constant and an approximately twofold slower dissociation rate constant. The more rapid association rate constant is presumably a consequence of cofilin-dependent changes in the average orientation of subdomain 2, subunit angular disorder and filament twist, which increase the accessibility of a neighboring cofilin-binding site on an actin filament. Cooperative association is more rapid than binding to an isolated site, but still slow for a second-order reaction, suggesting that cooperative binding is limited also by binding site accessibility. We suggest that the dissociation of actin-associated ions weakens intersubunit interactions in the actin filament lattice that enhance cofilin-binding site accessibility, favor cooperative binding and promote filament severing.

  14. Structure, Function, and Evolution of Biogenic Amine-binding Proteins in Soft Ticks

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mans, Ben J.; Ribeiro, Jose M.C.; Andersen, John F.

    2008-08-19

    Two highly abundant lipocalins, monomine and monotonin, have been isolated from the salivary gland of the soft tick Argas monolakensis and shown to bind histamine and 5-hydroxytryptamine (5-HT), respectively. The crystal structures of monomine and a paralog of monotonin were determined in the presence of ligands to compare the determinants of ligand binding. Both the structures and binding measurements indicate that the proteins have a single binding site rather than the two sites previously described for the female-specific histamine-binding protein (FS-HBP), the histamine-binding lipocalin of the tick Rhipicephalus appendiculatus. The binding sites of monomine and monotonin are similar to themore » lower, low affinity site of FS-HBP. The interaction of the protein with the aliphatic amine group of the ligand is very similar for the all of the proteins, whereas specificity is determined by interactions with the aromatic portion of the ligand. Interestingly, protein interaction with the imidazole ring of histamine differs significantly between the low affinity binding site of FS-HBP and monomine, suggesting that histamine binding has evolved independently in the two lineages. From the conserved features of these proteins, a tick lipocalin biogenic amine-binding motif could be derived that was used to predict biogenic amine-binding function in other tick lipocalins. Heterologous expression of genes from salivary gland libraries led to the discovery of biogenic amine-binding proteins in soft (Ornithodoros) and hard (Ixodes) tick genera. The data generated were used to reconstruct the most probable evolutionary pathway for the evolution of biogenic amine-binding in tick lipocalins.« less

  15. Functional studies of p.R132C, p.R149C, p.M283V, p.E431K, and a novel c.652-2A>G mutations of the CYP21A2 gene.

    PubMed

    Taboas, Melisa; Gómez Acuña, Luciana; Scaia, María Florencia; Bruque, Carlos D; Buzzalino, Noemí; Stivel, Mirta; Ceballos, Nora R; Dain, Liliana

    2014-01-01

    Congenital adrenal hyperplasia (CAH) due to 21-hydroxylase deficiency is the most frequent inborn error of metabolism and accounts for 90-95% of CAH cases. In the present work, we analyzed the functional consequence of four novel previously reported point CYP21A2 mutations -p.R132C, p.R149C, p.M283V, p.E431K- found in Argentinean 21-hydroxylase deficient patients. In addition, we report an acceptor splice site novel point mutation, c.652-2A>G, found in a classical patient in compound heterozygosity with the rare p.R483Q mutation. We performed bioinformatic and functional assays to evaluate the biological implication of the novel mutation. Our analyses revealed that the residual enzymatic activity of the isolated mutants coding for CYP21A2 aminoacidic substitutions was reduced to a lesser than 50% of the wild type with both progesterone and 17-OH progesterone as substrates. Accordingly, all the variants would predict mild non-classical alleles. In one non-classical patient, the p.E431K mutation was found in cis with the p.D322G one. The highest decrease in enzyme activity was obtained when both mutations were assayed in the same construction, with a residual activity most likely related to the simple virilizing form of the disease. For the c.652-2A>G mutation, bioinformatic tools predicted the putative use of two different cryptic splicing sites. Nevertheless, functional analyses revealed the use of only one cryptic splice acceptor site located within exon 6, leading to the appearance of an mRNA with a 16 nt deletion. A severe allele is strongly suggested due to the presence of a premature stop codon in the protein only 12 nt downstream.

  16. Functional Studies of p.R132C, p.R149C, p.M283V, p.E431K, and a Novel c.652-2A>G Mutations of the CYP21A2 Gene

    PubMed Central

    Taboas, Melisa; Gómez Acuña, Luciana; Scaia, María Florencia; Bruque, Carlos D.; Buzzalino, Noemí; Stivel, Mirta

    2014-01-01

    Congenital adrenal hyperplasia (CAH) due to 21-hydroxylase deficiency is the most frequent inborn error of metabolism and accounts for 90–95% of CAH cases. In the present work, we analyzed the functional consequence of four novel previously reported point CYP21A2 mutations -p.R132C, p.R149C, p.M283V, p.E431K- found in Argentinean 21-hydroxylase deficient patients. In addition, we report an acceptor splice site novel point mutation, c.652-2A>G, found in a classical patient in compound heterozygosity with the rare p.R483Q mutation. We performed bioinformatic and functional assays to evaluate the biological implication of the novel mutation. Our analyses revealed that the residual enzymatic activity of the isolated mutants coding for CYP21A2 aminoacidic substitutions was reduced to a lesser than 50% of the wild type with both progesterone and 17-OH progesterone as substrates. Accordingly, all the variants would predict mild non-classical alleles. In one non-classical patient, the p.E431K mutation was found in cis with the p.D322G one. The highest decrease in enzyme activity was obtained when both mutations were assayed in the same construction, with a residual activity most likely related to the simple virilizing form of the disease. For the c.652-2A>G mutation, bioinformatic tools predicted the putative use of two different cryptic splicing sites. Nevertheless, functional analyses revealed the use of only one cryptic splice acceptor site located within exon 6, leading to the appearance of an mRNA with a 16 nt deletion. A severe allele is strongly suggested due to the presence of a premature stop codon in the protein only 12 nt downstream. PMID:24667412

  17. Anesthetic Binding in a Pentameric Ligand-Gated Ion Channel: GLIC

    PubMed Central

    Chen, Qiang; Cheng, Mary Hongying; Xu, Yan; Tang, Pei

    2010-01-01

    Cys-loop receptors are molecular targets of general anesthetics, but the knowledge of anesthetic binding to these proteins remains limited. Here we investigate anesthetic binding to the bacterial Gloeobacter violaceus pentameric ligand-gated ion channel (GLIC), a structural homolog of cys-loop receptors, using an experimental and computational hybrid approach. Tryptophan fluorescence quenching experiments showed halothane and thiopental binding at three tryptophan-associated sites in the extracellular (EC) domain, transmembrane (TM) domain, and EC-TM interface of GLIC. An additional binding site at the EC-TM interface was predicted by docking analysis and validated by quenching experiments on the N200W GLIC mutant. The binding affinities (KD) of 2.3 ± 0.1 mM and 0.10 ± 0.01 mM were derived from the fluorescence quenching data of halothane and thiopental, respectively. Docking these anesthetics to the original GLIC crystal structure and the structures relaxed by molecular dynamics simulations revealed intrasubunit sites for most halothane binding and intersubunit sites for thiopental binding. Tryptophans were within reach of both intra- and intersubunit binding sites. Multiple molecular dynamics simulations on GLIC in the presence of halothane at different sites suggested that anesthetic binding at the EC-TM interface disrupted the critical interactions for channel gating, altered motion of the TM23 linker, and destabilized the open-channel conformation that can lead to inhibition of GLIC channel current. The study has not only provided insights into anesthetic binding in GLIC, but also demonstrated a successful fusion of experiments and computations for understanding anesthetic actions in complex proteins. PMID:20858424

  18. ProBiS-ligands: a web server for prediction of ligands by examination of protein binding sites.

    PubMed

    Konc, Janez; Janežič, Dušanka

    2014-07-01

    The ProBiS-ligands web server predicts binding of ligands to a protein structure. Starting with a protein structure or binding site, ProBiS-ligands first identifies template proteins in the Protein Data Bank that share similar binding sites. Based on the superimpositions of the query protein and the similar binding sites found, the server then transposes the ligand structures from those sites to the query protein. Such ligand prediction supports many activities, e.g. drug repurposing. The ProBiS-ligands web server, an extension of the ProBiS web server, is open and free to all users at http://probis.cmm.ki.si/ligands. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  19. 1-3-A Resolution Structure of Human Glutathione S-Transferase With S-Hexyl Glutathione Bound Reveals Possible Extended Ligandin Binding Site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Trong, I.Le; Stenkamp, R.E.; Ibarra, C.

    2005-08-22

    Cytosolic glutathione S-transferases (GSTs) play a critical role in xenobiotic binding and metabolism, as well as in modulation of oxidative stress. Here, the high-resolution X-ray crystal structures of homodimeric human GSTA1-1 in the apo form and in complex with S-hexyl glutathione (two data sets) are reported at 1.8, 1.5, and 1.3A respectively. At this level of resolution, distinct conformations of the alkyl chain of S-hexyl glutathione are observed, reflecting the nonspecific nature of the hydrophobic substrate binding site (H-site). Also, an extensive network of ordered water, including 75 discrete solvent molecules, traverses the open subunit-subunit interface and connects the glutathionemore » binding sites in each subunit. In the highest-resolution structure, three glycerol moieties lie within this network and directly connect the amino termini of the glutathione molecules. A search for ligand binding sites with the docking program Molecular Operating Environment identified the ordered water network binding site, lined mainly with hydrophobic residues, suggesting an extended ligand binding surface for nonsubstrate ligands, the so-called ligandin site. Finally, detailed comparison of the structures reported here with previously published X-ray structures reveal a possible reaction coordinate for ligand-dependent conformational changes in the active site and the C-terminus.« less

  20. Characterizing multiple metal ion binding sites within a ribozyme by cadmium-induced EPR silencing

    PubMed Central

    Kisseleva, Natalia; Kraut, Stefanie; Jäschke, Andres; Schiemann, Olav

    2007-01-01

    In ribozyme catalysis, metal ions are generally known to make structural and∕or mechanistic contributions. The catalytic activity of a previously described Diels-Alderase ribozyme was found to depend on the concentration of divalent metal ions, and crystallographic data revealed multiple binding sites. Here, we elucidate the interactions of this ribozyme with divalent metal ions in solution using electron paramagnetic resonance (EPR) spectroscopy. Manganese ion titrations revealed five high-affinity Mn2+ binding sites with an upper Kd of 0.6±0.2 μM. In order to characterize each binding site individually, EPR-silent Cd2+ ions were used to saturate the other binding sites. This cadmium-induced EPR silencing showed that the Mn2+ binding sites possess different affinities. In addition, these binding sites could be assigned to three different types, including innersphere, outersphere, and a Mn2+ dimer. Based on simulations, the Mn2+-Mn2+ distance within the dimer was found to be ∼6 Å, which is in good agreement with crystallographic data. The EPR-spectroscopic characterization reveals no structural changes upon addition of a Diels-Alder product, supporting the concept of a preorganized catalytic pocket in the Diels-Alder ribozyme and the structural role of these ions. PMID:19404418

  1. Pharmacological characterization of the cloned kappa opioid receptor as a kappa 1b subtype.

    PubMed

    Lai, J; Ma, S W; Zhu, R H; Rothman, R B; Lentes, K U; Porreca, F

    1994-10-27

    Substantial pharmacological evidence in vitro and in vivo has suggested the existence of subtypes of the kappa opioid receptor. Quantitative radioligand binding techniques resolved the presence of two high affinity binding sites for the kappa 1 ligand [3H]U69,593 in mouse brain membranes, termed kappa 1a and kappa 1b, respectively. Whereas the kappa 1a site has high affinity for fedotozine and oxymorphindole and low affinity for bremazocine and alpha-neoendorphin, site kappa 1b has high affinity for bremazocine and alpha-neoendorphin and low affinity for fedotozine and oxymorphindole. CI-977 and U69,593 bind equally well at both sites. To determine the relationship between these kappa 1 receptor subtypes and the recently cloned mouse kappa 1 receptor (KOR), we examined [3H]U69,593 binding to the KOR in stably transfected cells (KORCHN-8). Competition of [3H]U69,593 binding to the KOR by bremazocine, alpha-neoendorphin, fedotozine and oxymorphindole resolved a single class of binding sites at which these agents had binding affinities similar to that of the kappa 1b site present in mouse brain. These results suggest that the cloned KOR corresponds to the kappa 1 site in mouse brain defined as kappa 1b.

  2. A near-infrared spectroscopy routine for unambiguous identification of cryptic ant species

    USDA-ARS?s Scientific Manuscript database

    The identification of species – of importance for most biological disciplines – is not always straightforward as cryptic species present a hurdle for traditional species discrimination. Fibre-optic near-infrared spectroscopy (NIRS) is a rapid and cheap method for a wide range of different applicatio...

  3. Anisotropic energy flow and allosteric ligand binding in albumin

    NASA Astrophysics Data System (ADS)

    Li, Guifeng; Magana, Donny; Dyer, R. Brian

    2014-01-01

    Allosteric interactions in proteins generally involve propagation of local structural changes through the protein to a remote site. Anisotropic energy transport is thought to couple the remote sites, but the nature of this process is poorly understood. Here, we report the relationship between energy flow through the structure of bovine serum albumin and allosteric interactions between remote ligand binding sites of the protein. Ultrafast infrared spectroscopy is used to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic and anisotropic energy flow through the protein structure following input of thermal energy into the flexible ligand binding sites, without local heating of the rigid helix bundles that connect these sites. This efficient energy transport mechanism enables the allosteric propagation of binding energy through the connecting helix structures.

  4. Anisotropic energy flow and allosteric ligand binding in albumin.

    PubMed

    Li, Guifeng; Magana, Donny; Dyer, R Brian

    2014-01-01

    Allosteric interactions in proteins generally involve propagation of local structural changes through the protein to a remote site. Anisotropic energy transport is thought to couple the remote sites, but the nature of this process is poorly understood. Here, we report the relationship between energy flow through the structure of bovine serum albumin and allosteric interactions between remote ligand binding sites of the protein. Ultrafast infrared spectroscopy is used to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic and anisotropic energy flow through the protein structure following input of thermal energy into the flexible ligand binding sites, without local heating of the rigid helix bundles that connect these sites. This efficient energy transport mechanism enables the allosteric propagation of binding energy through the connecting helix structures.

  5. Anisotropic energy flow and allosteric ligand binding in albumin

    PubMed Central

    Li, Guifeng; Magana, Donny; Dyer, R. Brian

    2014-01-01

    Allosteric interactions in proteins generally involve propagation of local structural changes through the protein to a remote site. Anisotropic energy transport is thought to couple the remote sites, but the nature of this process is poorly understood. Here, we report the relationship between energy flow through the structure of bovine serum albumin and allosteric interactions between remote ligand binding sites of the protein. Ultrafast infrared spectroscopy is used to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic and anisotropic energy flow through the protein structure following input of thermal energy into the flexible ligand binding sites, without local heating of the rigid helix bundles that connect these sites. This efficient energy transport mechanism enables the allosteric propagation of binding energy through the connecting helix structures. PMID:24445265

  6. An Experimental and Theoretical Evaluation of Multi-site Cadmium(II) Exchange in Designed Three-Stranded Coiled Coil Peptides

    PubMed Central

    Chakraborty, Saumen; Iranzo, Olga; Zuiderweg, Erik R.P.; Pecoraro, Vincent L.

    2012-01-01

    An important factor that defines the toxicity of elements such as cadmium(II), mercury(II), and lead(II) with biological macromolecules is metal ion exchange dynamics. Intriguingly, little is known about the fundamental rates and mechanisms of metal ion exchange into proteins, especially helical bundles. Herein, we investigate the exchange kinetics of cadmium(II) using de novo designed three-stranded coiled coil peptides that contain metal complexing cysteine thiolates as a model for the incorporation of this ion into trimeric, parallel helical bundles. Peptides were designed containing both single cadmium(II) binding site, GrandL12AL16C [Grand=AcG-(LKALEEK)5-GNH2], GrandL26AL30C, and GrandL26AE28QL30C, as well as GrandL12AL16CL26AL30C with two cadmium(II) binding sites. The binding of cadmium(II) to any of these sites is of high affinity (KA > 3×107 M−1). Using 113Cd NMR spectroscopy, cadmium(II) binding to these designed peptides was monitored. While the cadmium(II) binding is in extreme slow exchange without showing any chemical shift changes, incremental line broadening for the bound 113cadmium(II) signal is observed when excess 113cadmium(II) is titrated into the peptides. Most dramatically, for one site, L26AL30C, all 113cadmium(II) NMR signals disappear once a 1.7:1 ratio of cadmium(II)/(peptide)3 is reached. The observed processes are not compatible with simple “free-bound” two-site exchange kinetics at any time regime. The experimental results can, however, be simulated in detail with a multi-site binding model, which features additional cadmium(II) binding site(s) which, once occupied, perturb the primary binding site. This model is expanded into differential equations for five-site NMR chemical exchange. The numerical integration of these equations exhibits progressive loss of the primary site NMR signal without a chemical shift change and with limited line broadening, in good agreement with the observed experimental data. The mathematical model is interpreted in molecular terms as representing binding of excess cadmium(II) to surface Glu residues located at the helical interfaces. In the absence of cadmium(II), the Glu residues stabilize the three-helical structure though salt bridge interactions with surface Lys residues. We hypothesize that cadmium(II) interferes with these surface ion pairs, destabilizing the helical structure, and perturbing the primary cadmium(II) binding site. This hypothesis is supported by the observation that the cadmium(II)-excess line broadening is attenuated in GrandL26AE28QL30C where a surface Glu(28), close to the metal binding site, was changed to Gln. The external binding site may function as an entry pathway for cadmium(II) to find its internal binding site following a molecular rearrangement which may serve as a basis for our understanding of metal complexation, transport and exchange in complex native systems containing α-helical bundles. PMID:22394049

  7. The crystal structure of the AgamOBP1•Icaridin complex reveals alternative binding modes and stereo-selective repellent recognition.

    PubMed

    Drakou, Christina E; Tsitsanou, Katerina E; Potamitis, Constantinos; Fessas, Dimitrios; Zervou, Maria; Zographos, Spyros E

    2017-01-01

    Anopheles gambiae Odorant Binding Protein 1 in complex with the most widely used insect repellent DEET, was the first reported crystal structure of an olfactory macromolecule with a repellent, and paved the way for OBP1-structure-based approaches for discovery of new host-seeking disruptors. In this work, we performed STD-NMR experiments to directly monitor and verify the formation of a complex between AgamOBP1 and Icaridin, an efficient DEET alternative. Furthermore, Isothermal Titration Calorimetry experiments provided evidence for two Icaridin-binding sites with different affinities (Kd = 0.034 and 0.714 mM) and thermodynamic profiles of ligand binding. To elucidate the binding mode of Icaridin, the crystal structure of AgamOBP1•Icaridin complex was determined at 1.75 Å resolution. We found that Icaridin binds to the DEET-binding site in two distinct orientations and also to a novel binding site located at the C-terminal region. Importantly, only the most active 1R,2S-isomer of Icaridin's equimolar diastereoisomeric mixture binds to the AgamOBP1 crystal, providing structural evidence for the possible contribution of OBP1 to the stereoselectivity of Icaridin perception in mosquitoes. Structural analysis revealed two ensembles of conformations differing mainly in spatial arrangement of their sec-butyl moieties. Moreover, structural comparison with DEET indicates a common recognition mechanism for these structurally related repellents. Ligand interactions with both sites and binding modes were further confirmed by 2D 1 H- 15 N HSQC NMR spectroscopy. The identification of a novel repellent-binding site in AgamOBP1 and the observed structural conservation and stereoselectivity of its DEET/Icaridin-binding sites open new perspectives for the OBP1-structure-based discovery of next-generation insect repellents.

  8. AF64A depletes hippocampal high-affinity choline uptake but does not alter the density of alpha-bungarotoxin binding sites or modify the effect of exogenous choline.

    PubMed

    Morley, B J; Garner, L L

    1990-06-11

    Sodium-dependent, high-affinity choline uptake (HACU) and the density of alpha-bungarotoxin (BuTX) receptor-binding sites were measured in the hippocampus following the intraventricular infusion of ethylcholine aziridinium ion (AF64A), a neurotoxin that competes with choline at high-affinity choline transport sites and may result in the degeneration of cholinergic axons. Eight days after the infusion of AF64A into the lateral ventricles (2.5 nmol/side), HACU was depleted by 60% in the hippocampus of experimental animals in comparison with controls, but the density of BuTX-binding sites was not altered. The administration of 15 mg/ml of choline chloride in the drinking water increased the density of BuTX-binding sites, as previously reported by this laboratory. The administration of AF64A did not prevent the effect of exogenous choline on the density of binding sites, nor did choline treatment alter the effect of AF64A on HACU. These data indicate that the density of BuTX-binding sites in the hippocampus is not altered following a substantial decrease in HACU and presumed degeneration of cholinergic axons. Since the effect of exogenous choline was not prevented by AF64A treatment, the data are interpreted to support the hypothesis that the increase in the density of BuTX-binding sites following dietary choline supplementation is attributable to a direct effect of choline on receptor sites.

  9. Circular dichroism study of the interaction between mutagens and bilirubin bound to different binding sites of serum albumins

    NASA Astrophysics Data System (ADS)

    Orlov, Sergey; Goncharova, Iryna; Urbanová, Marie

    Although recent investigations have shown that bilirubin not only has a negative role in the organism but also exhibits significant antimutagenic properties, the mechanisms of interactions between bilirubin and mutagens are not clear. In this study, interaction between bilirubin bound to different binding sites of mammalian serum albumins with structural analogues of the mutagens 2-aminofluorene, 2,7-diaminofluorene and mutagen 2,4,7-trinitrofluorenone were investigated by circular dichroism and absorption spectroscopy. Homological human and bovine serum albumins were used as chiral matrices, which preferentially bind different conformers of bilirubin in the primary binding sites and make it observable by circular dichroism. These molecular systems approximated a real system for the study of mutagens in blood serum. Differences between the interaction of bilirubin bound to primary and to secondary binding sites of serum albumins with mutagens were shown. For bilirubin bound to secondary binding sites with low affinity, partial displacement and the formation of self-associates were observed in all studied mutagens. The associates of bilirubin bound to primary binding sites of serum albumins are formed with 2-aminofluorene and 2,4,7-trinitrofluorenone. It was proposed that 2,7-diaminofluorene does not interact with bilirubin bound to primary sites of human and bovine serum albumins due to the spatial hindrance of the albumins binding domains. The spatial arrangement of the bilirubin bound to serum albumin along with the studied mutagens was modelled using ligand docking, which revealed a possibility of an arrangement of the both bilirubin and 2-aminofluorene and 2,4,7-trinitrofluorenone in the primary binding site of human serum albumin.

  10. Genome-Wide Motif Statistics are Shaped by DNA Binding Proteins over Evolutionary Time Scales

    NASA Astrophysics Data System (ADS)

    Qian, Long; Kussell, Edo

    The composition of genomes with respect to short DNA motifs impacts the ability of DNA binding proteins to locate and bind their target sites. Since nonfunctional DNA binding can be detrimental to cellular functions and ultimately to organismal fitness, organisms could benefit from reducing the number of nonfunctional binding sites genome wide. Using in vitro measurements of binding affinities for a large collection of DNA binding proteins, in multiple species, we detect a significant global avoidance of weak binding sites in genomes. The underlying evolutionary process leaves a distinct genomic hallmark in that similar words have correlated frequencies, which we detect in all species across domains of life. We hypothesize that natural selection against weak binding sites contributes to this process, and using an evolutionary model we show that the strength of selection needed to maintain global word compositions is on the order of point mutation rates. Alternative contributions may come from interference of protein-DNA binding with replication and mutational repair processes, which operates with similar rates. We conclude that genome-wide word compositions have been molded by DNA binding proteins through tiny evolutionary steps over timescales spanning millions of generations.

  11. Multi-Mode Binding of Cellobiohydrolase Cel7A from Trichoderma reesei to Cellulose

    PubMed Central

    Jalak, Jürgen; Väljamäe, Priit

    2014-01-01

    Enzymatic hydrolysis of recalcitrant polysaccharides like cellulose takes place on the solid-liquid interface. Therefore the adsorption of enzymes to the solid surface is a pre-requisite for catalysis. Here we used enzymatic activity measurements with fluorescent model-substrate 4-methyl-umbelliferyl-β-D-lactoside for sensitive monitoring of the binding of cellobiohydrolase TrCel7A from Trichoderma reesei to bacterial cellulose (BC). The binding at low nanomolar free TrCel7A concentrations was exclusively active site mediated and was consistent with Langmuir's one binding site model with K d and A max values of 2.9 nM and 126 nmol/g BC, respectively. This is the strongest binding observed with non-complexed cellulases and apparently represents the productive binding of TrCel7A to cellulose chain ends on the hydrophobic face of BC microfibril. With increasing free TrCel7A concentrations the isotherm gradually deviated from the Langmuir's one binding site model. This was caused by the increasing contribution of lower affinity binding modes that included both active site mediated binding and non-productive binding with active site free from cellulose chain. The binding of TrCel7A to BC was found to be only partially reversible. Furthermore, the isotherm was dependent on the concentration of BC with more efficient binding observed at lower BC concentrations. The phenomenon can be ascribed to the BC concentration dependent aggregation of BC microfibrils with concomitant reduction of specific surface area. PMID:25265511

  12. Concentration-Dependent Multiple Binding Sites on Saliva-Treated Hydroxyapatite for Streptococcus sanguis

    PubMed Central

    Gibbons, R. J.; Moreno, E. C.; Etherden, I.

    1983-01-01

    The influence of bacterial cell concentration on estimates of the number of binding sites and the affinity for the adsorption of a strain of Streptococcus sanguis to saliva-treated hydroxyapatite was determined, and the possible presence of multiple binding sites for this organism was tested. The range of concentrations of available bacteria varied from 4.7 × 106 to 5,960 × 106 cells per ml. The numbers of adsorbed bacteria increased over the entire range tested, but a suggestion of a break in an otherwise smooth adsorption isotherm was evident. Values for the number of binding sites and the affinity varied considerably depending upon the range of available bacterial concentrations used to estimate them; high correlation coefficients were obtained in all cases. The use of low bacterial cell concentrations yielded lower values for the number of sites and much higher values for the affinity constant than did the use of high bacterial cell concentrations. When data covering the entire range of bacterial concentrations were employed, values for the number of sites and the affinity were similar to those obtained by using only high bacterial cell concentrations. The simplest explanation for these results is that there are multiple binding sites for S. sanguis on saliva-treated hydroxyapatite surfaces. When present in low concentration, the streptococci evidently attach to more specific high-affinity sites which become saturated when higher bacterial concentrations are employed. The possibility of multiple binding sites was substantiated by comparing estimates of the adsorption parameters from a computer-simulated isotherm with those derived from the experimentally generated isotherm. A mathematical model describing bacterial adsorption to binary binding sites was further evidence for the existence of at least two classes of binding sites for S. sanguis. Far fewer streptococci adsorbed to experimental pellicles prepared from saliva depleted of bacterial aggregating activity when low numbers of streptococci were used, but the magnitude of this difference was considerably less when high streptococcal concentrations were employed. This suggests an association between salivary components which possess bacterial-aggregating activity and bacterial adsorption to high-affinity specific binding sites on saliva-treated hydroxyapatite surfaces. PMID:6822416

  13. Ropizine concurrently enhances and inhibits ( sup 3 H) dextromethorpan binding to different structures of the guinea pig brain: Autoradiographic evidence for multiple binding sites

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Canoll, P.D.; Smith, P.R.; and Musacchio, J.M.

    1990-01-01

    Ropizine produces a simultaneous enhancement and inhibition of ({sup 3}H) dextromethorphan (DM) high-affinity binding to different areas of the guinea pig brain. These results imply that there are two distinct types of high-affinity ({sup 3}H)DM binding sites, which are present in variable proportions in different brain structures. The ropizine-enhances ({sup 3}H)DM binding type was preferentially inhibited by (+)-pentazocine. This is consistent with the presumption that the (+)-pentazocine-sensitive site is identical with the common site for DM and 3-(-3-Hydroxphenyl)-N-(1-propyl)piperidine ((+)-3-PPP). The second binding type, which is inhibited by ropizine and is not so sensitive to (+){minus} pentazocine, has not been fullymore » characterized. This study demonstrates that the biphasic effects to ropizine are due, at least in part, to the effects of ropizine on two different types of ({sup 3}H)DM binding sites. However, this study does not rule out that the common DM/(+)-3-PPP site also might be inhibited by higher concentrations of ropizine.« less

  14. The Structural Basis of ATP as an Allosteric Modulator

    PubMed Central

    Wang, Qi; Shen, Qiancheng; Li, Shuai; Nussinov, Ruth; Zhang, Jian

    2014-01-01

    Adenosine-5’-triphosphate (ATP) is generally regarded as a substrate for energy currency and protein modification. Recent findings uncovered the allosteric function of ATP in cellular signal transduction but little is understood about this critical behavior of ATP. Through extensive analysis of ATP in solution and proteins, we found that the free ATP can exist in the compact and extended conformations in solution, and the two different conformational characteristics may be responsible for ATP to exert distinct biological functions: ATP molecules adopt both compact and extended conformations in the allosteric binding sites but conserve extended conformations in the substrate binding sites. Nudged elastic band simulations unveiled the distinct dynamic processes of ATP binding to the corresponding allosteric and substrate binding sites of uridine monophosphate kinase, and suggested that in solution ATP preferentially binds to the substrate binding sites of proteins. When the ATP molecules occupy the allosteric binding sites, the allosteric trigger from ATP to fuel allosteric communication between allosteric and functional sites is stemmed mainly from the triphosphate part of ATP, with a small number from the adenine part of ATP. Taken together, our results provide overall understanding of ATP allosteric functions responsible for regulation in biological systems. PMID:25211773

  15. Using 15N-Ammonium to Characterise and Map Potassium Binding Sites in Proteins by NMR Spectroscopy

    PubMed Central

    Werbeck, Nicolas D; Kirkpatrick, John; Reinstein, Jochen; Hansen, D Flemming

    2014-01-01

    A variety of enzymes are activated by the binding of potassium ions. The potassium binding sites of these enzymes are very specific, but ammonium ions can often replace potassium ions in vitro because of their similar ionic radii. In these cases, ammonium can be used as a proxy for potassium to characterise potassium binding sites in enzymes: the 1H,15N spin-pair of enzyme-bound 15NH4+ can be probed by 15N-edited heteronuclear NMR experiments. Here, we demonstrate the use of NMR spectroscopy to characterise binding of ammonium ions to two different enzymes: human histone deacetylase 8 (HDAC8), which is activated allosterically by potassium, and the bacterial Hsp70 homologue DnaK, for which potassium is an integral part of the active site. Ammonium activates both enzymes in a similar way to potassium, thus supporting this non-invasive approach. Furthermore, we present an approach to map the observed binding site onto the structure of HDAC8. Our method for mapping the binding site is general and does not require chemical shift assignment of the enzyme resonances. PMID:24520048

  16. Organizational requirements of the SaeR binding sites for a functional P1 promoter of the sae operon in Staphylococcus aureus.

    PubMed

    Cho, Hoonsik; Jeong, Do-Won; Li, Chunling; Bae, Taeok

    2012-06-01

    In Staphylococcus aureus, the SaeRS two-component system controls the expression of multiple virulence factors. Of the two promoters in the sae operon, P1 is autoinduced and has two binding sites for the response regulator SaeR. In this study, we examined the organizational requirements of the SaeR binding sites in P1 for transcription activation. Mutational studies showed that both binding sites are essential for binding to phosphorylated SaeR (P-SaeR) and transcription activation. When the 21-bp distance between the centers of the two SaeR binding sites was altered to 26 bp, 31 bp, 36 bp, or 41 bp, only the 31-bp mutant retained approximately 40% of the original promoter activity. When the -1-bp spacing (i.e.,1-bp overlap) between the primary SaeR binding site and the -35 promoter region was altered, all mutant P1 promoters failed to initiate transcription; however, when the first nucleotide of the -35 region was changed from A to T, the mutants with 0-bp or 22-bp spacing showed detectable promoter activity. Although P-SaeR was essential for the binding of RNA polymerase to P1, it was not essential for the binding of the enzyme to the alpha-hemolysin promoter. When the nonoptimal spacing between promoter elements in P1 or the coagulase promoter was altered to the optimal spacing of 17 bp, both promoters failed to initiate transcription. These results suggest that SaeR binding sites are under rather strict organizational restrictions and provide clues for understanding the molecular mechanism of sae-mediated transcription activation.

  17. Human antibody recognition of antigenic site IV on Pneumovirus fusion proteins.

    PubMed

    Mousa, Jarrod J; Binshtein, Elad; Human, Stacey; Fong, Rachel H; Alvarado, Gabriela; Doranz, Benjamin J; Moore, Martin L; Ohi, Melanie D; Crowe, James E

    2018-02-01

    Respiratory syncytial virus (RSV) is a major human pathogen that infects the majority of children by two years of age. The RSV fusion (F) protein is a primary target of human antibodies, and it has several antigenic regions capable of inducing neutralizing antibodies. Antigenic site IV is preserved in both the pre-fusion and post-fusion conformations of RSV F. Antibodies to antigenic site IV have been described that bind and neutralize both RSV and human metapneumovirus (hMPV). To explore the diversity of binding modes at antigenic site IV, we generated a panel of four new human monoclonal antibodies (mAbs) and competition-binding suggested the mAbs bind at antigenic site IV. Mutagenesis experiments revealed that binding and neutralization of two mAbs (3M3 and 6F18) depended on arginine (R) residue R429. We discovered two R429-independent mAbs (17E10 and 2N6) at this site that neutralized an RSV R429A mutant strain, and one of these mAbs (17E10) neutralized both RSV and hMPV. To determine the mechanism of cross-reactivity, we performed competition-binding, recombinant protein mutagenesis, peptide binding, and electron microscopy experiments. It was determined that the human cross-reactive mAb 17E10 binds to RSV F with a binding pose similar to 101F, which may be indicative of cross-reactivity with hMPV F. The data presented provide new concepts in RSV immune recognition and vaccine design, as we describe the novel idea that binding pose may influence mAb cross-reactivity between RSV and hMPV. Characterization of the site IV epitope bound by human antibodies may inform the design of a pan-Pneumovirus vaccine.

  18. Elimination of a ligand gating site generates a supersensitive olfactory receptor.

    PubMed

    Sharma, Kanika; Ahuja, Gaurav; Hussain, Ashiq; Balfanz, Sabine; Baumann, Arnd; Korsching, Sigrun I

    2016-06-21

    Olfaction poses one of the most complex ligand-receptor matching problems in biology due to the unparalleled multitude of odor molecules facing a large number of cognate olfactory receptors. We have recently deorphanized an olfactory receptor, TAAR13c, as a specific receptor for the death-associated odor cadaverine. Here we have modeled the cadaverine/TAAR13c interaction, exchanged predicted binding residues by site-directed mutagenesis, and measured the activity of the mutant receptors. Unexpectedly we observed a binding site for cadaverine at the external surface of the receptor, in addition to an internal binding site, whose mutation resulted in complete loss of activity. In stark contrast, elimination of the external binding site generated supersensitive receptors. Modeling suggests this site to act as a gate, limiting access of the ligand to the internal binding site and thereby downregulating the affinity of the native receptor. This constitutes a novel mechanism to fine-tune physiological sensitivity to socially relevant odors.

  19. Elimination of a ligand gating site generates a supersensitive olfactory receptor

    PubMed Central

    Sharma, Kanika; Ahuja, Gaurav; Hussain, Ashiq; Balfanz, Sabine; Baumann, Arnd; Korsching, Sigrun I.

    2016-01-01

    Olfaction poses one of the most complex ligand-receptor matching problems in biology due to the unparalleled multitude of odor molecules facing a large number of cognate olfactory receptors. We have recently deorphanized an olfactory receptor, TAAR13c, as a specific receptor for the death-associated odor cadaverine. Here we have modeled the cadaverine/TAAR13c interaction, exchanged predicted binding residues by site-directed mutagenesis, and measured the activity of the mutant receptors. Unexpectedly we observed a binding site for cadaverine at the external surface of the receptor, in addition to an internal binding site, whose mutation resulted in complete loss of activity. In stark contrast, elimination of the external binding site generated supersensitive receptors. Modeling suggests this site to act as a gate, limiting access of the ligand to the internal binding site and thereby downregulating the affinity of the native receptor. This constitutes a novel mechanism to fine-tune physiological sensitivity to socially relevant odors. PMID:27323929

  20. An unexpected phosphate binding site in Glyceraldehyde 3-Phosphate Dehydrogenase: Crystal structures of apo, holo and ternary complex of Cryptosporidium parvum enzyme

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cook, William J; Senkovich, Olga; Chattopadhyay, Debasish

    2009-06-08

    The structure, function and reaction mechanism of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) have been extensively studied. Based on these studies, three anion binding sites have been identified, one 'Ps' site (for binding the C-3 phosphate of the substrate) and two sites, 'Pi' and 'new Pi', for inorganic phosphate. According to the original flip-flop model, the substrate phosphate group switches from the 'Pi' to the 'Ps' site during the multistep reaction. In light of the discovery of the 'new Pi' site, a modified flip-flop mechanism, in which the C-3 phosphate of the substrate binds to the 'new Pi' site and flips tomore » the 'Ps' site before the hydride transfer, was proposed. An alternative model based on a number of structures of B. stearothermophilus GAPDH ternary complexes (non-covalent and thioacyl intermediate) proposes that in the ternary Michaelis complex the C-3 phosphate binds to the 'Ps' site and flips from the 'Ps' to the 'new Pi' site during or after the redox step. We determined the crystal structure of Cryptosporidium parvum GAPDH in the apo and holo (enzyme + NAD) state and the structure of the ternary enzyme-cofactor-substrate complex using an active site mutant enzyme. The C. parvum GAPDH complex was prepared by pre-incubating the enzyme with substrate and cofactor, thereby allowing free movement of the protein structure and substrate molecules during their initial encounter. Sulfate and phosphate ions were excluded from purification and crystallization steps. The quality of the electron density map at 2{angstrom} resolution allowed unambiguous positioning of the substrate. In three subunits of the homotetramer the C-3 phosphate group of the non-covalently bound substrate is in the 'new Pi' site. A concomitant movement of the phosphate binding loop is observed in these three subunits. In the fourth subunit the C-3 phosphate occupies an unexpected site not seen before and the phosphate binding loop remains in the substrate-free conformation. Orientation of the substrate with respect to the active site histidine and serine (in the mutant enzyme) also varies in different subunits. The structures of the C. parvum GAPDH ternary complex and other GAPDH complexes demonstrate the plasticity of the substrate binding site. We propose that the active site of GAPDH can accommodate the substrate in multiple conformations at multiple locations during the initial encounter. However, the C-3 phosphate group clearly prefers the 'new Pi' site for initial binding in the active site.« less

  1. Activation of erythropoietin receptor in the absence of hormone by a peptide that binds to a domain different from the hormone binding site

    PubMed Central

    Naranda, Tatjana; Wong, Kenneth; Kaufman, R. Ilene; Goldstein, Avram; Olsson, Lennart

    1999-01-01

    Applying a homology search method previously described, we identified a sequence in the extracellular dimerization site of the erythropoietin receptor, distant from the hormone binding site. A peptide identical to that sequence was synthesized. Remarkably, it activated receptor signaling in the absence of erythropoietin. Neither the peptide nor the hormone altered the affinity of the other for the receptor; thus, the peptide does not bind to the hormone binding site. The combined activation of signal transduction by hormone and peptide was strongly synergistic. In mice, the peptide acted like the hormone, protecting against the decrease in hematocrit caused by carboplatin. PMID:10377456

  2. Kinetic and Spectroscopic Studies of Bicupin Oxalate Oxidase and Putative Active Site Mutants

    PubMed Central

    Moomaw, Ellen W.; Hoffer, Eric; Moussatche, Patricia; Salerno, John C.; Grant, Morgan; Immelman, Bridget; Uberto, Richard; Ozarowski, Andrew; Angerhofer, Alexander

    2013-01-01

    Ceriporiopsis subvermispora oxalate oxidase (CsOxOx) is the first bicupin enzyme identified that catalyzes manganese-dependent oxidation of oxalate. In previous work, we have shown that the dominant contribution to catalysis comes from the monoprotonated form of oxalate binding to a form of the enzyme in which an active site carboxylic acid residue must be unprotonated. CsOxOx shares greatest sequence homology with bicupin microbial oxalate decarboxylases (OxDC) and the 241-244DASN region of the N-terminal Mn binding domain of CsOxOx is analogous to the lid region of OxDC that has been shown to determine reaction specificity. We have prepared a series of CsOxOx mutants to probe this region and to identify the carboxylate residue implicated in catalysis. The pH profile of the D241A CsOxOx mutant suggests that the protonation state of aspartic acid 241 is mechanistically significant and that catalysis takes place at the N-terminal Mn binding site. The observation that the D241S CsOxOx mutation eliminates Mn binding to both the N- and C- terminal Mn binding sites suggests that both sites must be intact for Mn incorporation into either site. The introduction of a proton donor into the N-terminal Mn binding site (CsOxOx A242E mutant) does not affect reaction specificity. Mutation of conserved arginine residues further support that catalysis takes place at the N-terminal Mn binding site and that both sites must be intact for Mn incorporation into either site. PMID:23469254

  3. Architecture of a Fur Binding Site: a Comparative Analysis

    PubMed Central

    Lavrrar, Jennifer L.; McIntosh, Mark A.

    2003-01-01

    Fur is an iron-binding transcriptional repressor that recognizes a 19-bp consensus site of the sequence 5′-GATAATGATAATCATTATC-3′. This site can be defined as three adjacent hexamers of the sequence 5′-GATAAT-3′, with the third being slightly imperfect (an F-F-F configuration), or as two hexamers in the forward orientation separated by one base pair from a third hexamer in the reverse orientation (an F-F-x-R configuration). Although Fur can bind synthetic DNA sequences containing the F-F-F arrangement, most natural binding sites are variations of the F-F-x-R arrangement. The studies presented here compared the ability of Fur to recognize synthetic DNA sequences containing two to four adjacent hexamers with binding to sequences containing variations of the F-F-x-R arrangement (including natural operator sequences from the entS and fepB promoter regions of Escherichia coli). Gel retardation assays showed that the F-F-x-R architecture was necessary for high-affinity Fur-DNA interactions and that contiguous hexamers were not recognized as effectively. In addition, the stoichiometry of Fur at each binding site was determined, showing that Fur interacted with its minimal 19-bp binding site as two overlapping dimers. These data confirm the proposed overlapping-dimer binding model, where the unit of interaction with a single Fur dimer is two inverted hexamers separated by a C:G base pair, with two overlapping units comprising the 19-bp consensus binding site required for the high-affinity interaction with two Fur dimers. PMID:12644489

  4. 2-(/sup 125/I)iodomelatonin binding sites in hamster brain membranes: pharmacological characteristics and regional distribution

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Duncan, M.J.; Takahashi, J.S.; Dubocovich, M.L.

    1988-05-01

    Studies in a variety of seasonally breeding mammals have shown that melatonin mediates photoperiodic effects on reproduction. Relatively little is known, however, about the site(s) or mechanisms of action of this hormone for inducing reproductive effects. Although binding sites for (3H)melatonin have been reported previously in bovine, rat, and hamster brain, the pharmacological selectivity of these sites was never demonstrated. In the present study, we have characterized binding sites for a new radioligand, 2-(125I)iodomelatonin, in brains from a photoperiodic species, the Syrian hamster. 2-(125I)Iodomelatonin labels a high affinity binding site in hamster brain membranes. Specific binding of 2-(125I)iodomelatonin is rapid,more » stable, saturable, and reversible. Saturation studies demonstrated that 2-(125I)iodomelatonin binds to a single class of sites with an affinity constant (Kd) of 3.3 +/- 0.5 nM and a total binding capacity (Bmax) of 110.2 +/- 13.4 fmol/mg protein (n = 4). The Kd value determined from kinetic analysis (3.1 +/- 0.9 nM; n = 5) was very similar to that obtained from saturation experiments. Competition experiments showed that the relative order of potency of a variety of indoles for inhibition of 2-(125I)iodomelatonin binding site to hamster brain membranes was as follows: 6-chloromelatonin greater than or equal to 2-iodomelatonin greater than N-acetylserotonin greater than or equal to 6-methoxymelatonin greater than or equal to melatonin greater than 6-hydroxymelatonin greater than or equal to 6,7-dichloro-2-methylmelatonin greater than 5-methoxytryptophol greater than 5-methoxytryptamine greater than or equal to 5-methoxy-N,N-dimethyltryptamine greater than N-acetyltryptamine greater than serotonin greater than 5-methoxyindole (inactive).« less

  5. Purification of L-( sup 3 H) Nicotine eliminates low affinity binding

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Romm, E.; Marks, M.J.; Collins, A.C.

    1990-01-01

    Some studies of L-({sup 3}H) nicotine binding to rodent and human brain tissue have detected two binding sites as evidenced by nonlinear Scatchard plots. Evidence presented here indicated that the low affinity binding site is not stereospecific, is not inhibited by low concentrations of cholinergic agonists and is probably due to breakdown products of nicotine since purification of the L-({sup 3}H)nicotine eliminates the low affinity site.

  6. Binding of (/sup 3/H)Forskolin to rat brain membranes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Seamon, K.B.; Vaillancourt, R.; Edwards, M.

    1984-08-01

    (12-/sup 3/H)Forskolin (27 Ci/mmol) has been used to study binding sites in rat brain tissue by using both centrifugation and filtration assays. The binding isotherm measured in the presence of 5 mM MgCl/sub 2/ by using the centrifugation assay is described best by a two-site model: K/sub d1/ = 15 nM, B/sub max/sub 1// (maximal binding) = 270 fmol/mg of protein; K/sub d2/ = 1.1 ..mu..M; B/sub max/sub 2// = 4.2 pmol/mg of protein. Only the high-affinity binding sites are detected when the binding is determined by using a filtration assay; K/sub d/ = 26 nM, B/sub max/ = 400more » fmol/mg of protein. Analogs of forskolin that do not activate adenylate cyclase (EC 4.6.1.1) do not compete effectively for (/sup 3/H)forskolin binding sites. Analogs of forskolin that are less potent than forskolin in activating adenylate cyclase are also less potent in competing for forskolin binding sites. The presence of 5 mM MgCl/sub 2/ or MnCl/sub 2/ was found to enhance binding. In the presence of 1 mM EDTA the amount of high-affinity binding is reduced to 110 fmol/mg of protein with no change in K/sub d/. There is no effect of CaCl/sub 2/ (20 mM) or NaCl (100 mM) on the binding. No high-affinity binding can be detected in membranes from ram sperm, which contains an adenylate cyclase that is not activated by forskolin. It is proposed that the high-affinity binding sites for forskolin are associated with the activated complex of catalytic subunit and stimulatory guanine nucleotide binding protein. 23 references, 5 figures, 2 tables.« less

  7. Biophysical Fitness Landscapes for Transcription Factor Binding Sites

    PubMed Central

    Haldane, Allan; Manhart, Michael; Morozov, Alexandre V.

    2014-01-01

    Phenotypic states and evolutionary trajectories available to cell populations are ultimately dictated by complex interactions among DNA, RNA, proteins, and other molecular species. Here we study how evolution of gene regulation in a single-cell eukaryote S. cerevisiae is affected by interactions between transcription factors (TFs) and their cognate DNA sites. Our study is informed by a comprehensive collection of genomic binding sites and high-throughput in vitro measurements of TF-DNA binding interactions. Using an evolutionary model for monomorphic populations evolving on a fitness landscape, we infer fitness as a function of TF-DNA binding to show that the shape of the inferred fitness functions is in broad agreement with a simple functional form inspired by a thermodynamic model of two-state TF-DNA binding. However, the effective parameters of the model are not always consistent with physical values, indicating selection pressures beyond the biophysical constraints imposed by TF-DNA interactions. We find little statistical support for the fitness landscape in which each position in the binding site evolves independently, indicating that epistasis is common in the evolution of gene regulation. Finally, by correlating TF-DNA binding energies with biological properties of the sites or the genes they regulate, we are able to rule out several scenarios of site-specific selection, under which binding sites of the same TF would experience different selection pressures depending on their position in the genome. These findings support the existence of universal fitness landscapes which shape evolution of all sites for a given TF, and whose properties are determined in part by the physics of protein-DNA interactions. PMID:25010228

  8. SP transcription factor paralogs and DNA-binding sites coevolve and adaptively converge in mammals and birds.

    PubMed

    Yokoyama, Ken Daigoro; Pollock, David D

    2012-01-01

    Functional modification of regulatory proteins can affect hundreds of genes throughout the genome, and is therefore thought to be almost universally deleterious. This belief, however, has recently been challenged. A potential example comes from transcription factor SP1, for which statistical evidence indicates that motif preferences were altered in eutherian mammals. Here, we set out to discover possible structural and theoretical explanations, evaluate the role of selection in SP1 evolution, and discover effects on coregulatory proteins. We show that SP1 motif preferences were convergently altered in birds as well as mammals, inducing coevolutionary changes in over 800 regulatory regions. Structural and phylogenic evidence implicates a single causative amino acid replacement at the same SP1 position along both lineages. Furthermore, paralogs SP3 and SP4, which coregulate SP1 target genes through competitive binding to the same sites, have accumulated convergent replacements at the homologous position multiple times during eutherian and bird evolution, presumably to preserve competitive binding. To determine plausibility, we developed and implemented a simple model of transcription factor and binding site coevolution. This model predicts that, in contrast to prevailing beliefs, even small selective benefits per locus can drive concurrent fixation of transcription factor and binding site mutants under a broad range of conditions. Novel binding sites tend to arise de novo, rather than by mutation from ancestral sites, a prediction substantiated by SP1-binding site alignments. Thus, multiple lines of evidence indicate that selection has driven convergent evolution of transcription factors along with their binding sites and coregulatory proteins.

  9. SP Transcription Factor Paralogs and DNA-Binding Sites Coevolve and Adaptively Converge in Mammals and Birds

    PubMed Central

    Yokoyama, Ken Daigoro; Pollock, David D.

    2012-01-01

    Functional modification of regulatory proteins can affect hundreds of genes throughout the genome, and is therefore thought to be almost universally deleterious. This belief, however, has recently been challenged. A potential example comes from transcription factor SP1, for which statistical evidence indicates that motif preferences were altered in eutherian mammals. Here, we set out to discover possible structural and theoretical explanations, evaluate the role of selection in SP1 evolution, and discover effects on coregulatory proteins. We show that SP1 motif preferences were convergently altered in birds as well as mammals, inducing coevolutionary changes in over 800 regulatory regions. Structural and phylogenic evidence implicates a single causative amino acid replacement at the same SP1 position along both lineages. Furthermore, paralogs SP3 and SP4, which coregulate SP1 target genes through competitive binding to the same sites, have accumulated convergent replacements at the homologous position multiple times during eutherian and bird evolution, presumably to preserve competitive binding. To determine plausibility, we developed and implemented a simple model of transcription factor and binding site coevolution. This model predicts that, in contrast to prevailing beliefs, even small selective benefits per locus can drive concurrent fixation of transcription factor and binding site mutants under a broad range of conditions. Novel binding sites tend to arise de novo, rather than by mutation from ancestral sites, a prediction substantiated by SP1-binding site alignments. Thus, multiple lines of evidence indicate that selection has driven convergent evolution of transcription factors along with their binding sites and coregulatory proteins. PMID:23019068

  10. Nucleotide-dependent bisANS binding to tubulin.

    PubMed

    Chakraborty, S; Sarkar, N; Bhattacharyya, B

    1999-07-13

    Non-covalent hydrophobic probes such as 5, 5'-bis(8-anilino-1-naphthalenesulfonate) (bisANS) have become increasingly popular to gain information about protein structure and conformation. However, there are limitations as bisANS binds non-specifically at multiple sites of many proteins. Successful use of this probe depends upon the development of binding conditions where only specific dye-protein interaction will occur. In this report, we have shown that the binding of bisANS to tubulin occurs instantaneously, specifically at one high affinity site when 1 mM guanosine 5'-triphosphate (GTP) is included in the reaction medium. Substantial portions of protein secondary structure and colchicine binding activity of tubulin are lost upon bisANS binding in absence of GTP. BisANS binding increases with time and occurs at multiple sites in the absence of GTP. Like GTP, other analogs, guanosine 5'-diphosphate, guanosine 5'-monophosphate and adenosine 5'-triphosphate, also displace bisANS from the lower affinity sites of tubulin. We believe that these multiple binding sites are generated due to the bisANS-induced structural changes on tubulin and the presence of GTP and other nucleotides protect those structural changes.

  11. Development of a Fluorescence Assay for the Characterization of Brevenal Binding to Rat Brain Synaptosomes

    PubMed Central

    2015-01-01

    The marine dinoflagellate Karenia brevis produces a family of neurotoxins known as brevetoxins. Brevetoxins elicit their effects by binding to and activating voltage-sensitive sodium channels (VSSCs) in cell membranes. K. brevis also produces brevenal, a brevetoxin antagonist, which is able to inhibit and/or negate many of the detrimental effects of brevetoxins. Brevenal binding to VSSCs has yet to be fully characterized, in part due to the difficulty and expense of current techniques. In this study, we have developed a novel fluorescence binding assay for the brevenal binding site. Several fluorescent compounds were conjugated to brevenal to assess their effects on brevenal binding. The assay was validated against the radioligand assay for the brevenal binding site and yielded comparable equilibrium inhibition constants. The fluorescence-based assay was shown to be quicker and far less expensive and did not generate radioactive waste or need facilities for handling radioactive materials. In-depth studies using the brevenal conjugates showed that, while brevenal conjugates do bind to a binding site in the VSSC protein complex, they are not displaced by known VSSC site specific ligands. As such, brevenal elicits its action through a novel mechanism and/or currently unknown receptor site on VSSCs. PMID:25226846

  12. Characterization of (/sup 3/H)forskolin binding sites in the iris-ciliary body of the albino rabbit

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Goldman, M.E.; Mallorga, P.; Pettibone, D.J.

    1988-01-01

    (/sup 3/H)forskolin binding sites were identified using membranes prepared from the iris-ciliary body of adult, albino rabbits. Scatchard analysis of saturation binding experiments demonstrated that (/sup 3/H)forskolin bound to a single population of high affinity sites. The K/sub d/ and B/sub max/ values were 8.7 +- 0.9 nM and 119.0 +- 30.9 fmolmg prot. using membranes prepared from frozen tissue and 17.0 +- 6.2 nM and 184.4 +- 47.2 fmolmg prot. using fresh tissue. The binding of (/sup 3/H)forskolin was magnesium-dependent. The B/sub max/ was enhanced by sodium fluoride and Gpp(NH)p, a nonhydrolyzable guanine nucleotide analog. Forskolin was the mostmore » potent inhibitor of (/sup 3/H)forskolin binding; two commercially-available analogs were weaker inhibitors. In an adenylate cyclase assay, there was the same rank order of potency to enhance enzyme activity. Based upon binding affinities, magnesium-dependence, sensitivity to sodium fluoride and Gpp(NH)p, rank order of potencies of analogs and correlation of binding with adenylate cyclase activity, these studies suggest that the (/sup 3/H)forskolin binding site in the iris-ciliary body is similar to the binding site in other tissues« less

  13. Impact of disruption of secondary binding site S2 on dopamine transporter function.

    PubMed

    Zhen, Juan; Reith, Maarten E A

    2016-09-01

    The structures of the leucine transporter, drosophila dopamine transporter, and human serotonin transporter show a secondary binding site (designated S2 ) for drugs and substrate in the extracellular vestibule toward the membrane exterior in relation to the primary substrate recognition site (S1 ). The present experiments are aimed at disrupting S2 by mutating Asp476 and Ile159 to Ala. Both mutants displayed a profound decrease in [(3) H]DA uptake compared with wild-type associated with a reduced turnover rate kcat . This was not caused by a conformational bias as the mutants responded to Zn(2+) (10 μM) similarly as WT. The dopamine transporters with either the D476A or I159A mutation both displayed a higher Ki for dopamine for the inhibition of [3H](-)-2-β-carbomethoxy-3-β-(4-fluorophenyl)tropane binding than did the WT transporter, in accordance with an allosteric interaction between the S1 and S2 sites. The results provide evidence in favor of a general applicability of the two-site allosteric model of the Javitch/Weinstein group from LeuT to dopamine transporter and possibly other monoamine transporters. X-ray structures of transporters closely related to the dopamine (DA) transporter show a secondary binding site S2 in the extracellular vestibule proximal to the primary binding site S1 which is closely linked to one of the Na(+) binding sites. This work examines the relationship between S2 and S1 sites. We found that S2 site impairment severely reduced DA transport and allosterically reduced S1 site affinity for the cocaine analog [(3) H]CFT. Our results are the first to lend direct support for the application of the two-site allosteric model, advanced for bacterial LeuT, to the human DA transporter. The model states that, after binding of the first DA molecule (DA1 ) to the primary S1 site (along with Na(+) ), binding of a second DA (DA2 ) to the S2 site triggers, through an allosteric interaction, the release of DA1 and Na(+) into the cytoplasm. © 2016 International Society for Neurochemistry.

  14. Mössbauer properties of the diferric cluster and the differential iron(II)-binding affinity of the iron sites in protein R2 of class Ia Escherichia coli ribonucleotide reductase: a DFT/electrostatics study.

    PubMed

    Han, Wen-Ge; Sandala, Gregory M; Giammona, Debra Ann; Bashford, Donald; Noodleman, Louis

    2011-11-14

    The R2 subunit of class-Ia ribonucleotide reductase (RNR) from Escherichia coli (E. coli) contains a diiron active site. Starting from the apo-protein and Fe(II) in solution at low Fe(II)/apoR2 ratios, mononuclear Fe(II) binding is observed indicating possible different Fe(II) binding affinities for the two alternative sites. Further, based on their Mössbauer spectroscopy and two-iron-isotope reaction experiments, Bollinger et al. (J. Am. Chem. Soc., 1997, 119, 5976-5977) proposed that the site Fe1, which bonds to Asp84, should be associated with the higher observed (57)Fe Mössbauer quadrupole splitting (2.41 mm s(-1)) and lower isomer shift (0.45 mm s(-1)) in the Fe(III)Fe(III) state, site Fe2, which is further from Tyr122, should have a greater affinity for Fe(II) binding than site Fe1, and Fe(IV) in the intermediate X state should reside at site Fe2. In this paper, using density functional theory (DFT) incorporated with the conductor-like screening (COSMO) solvation model and with the finite-difference Poisson-Boltzmann self-consistent reaction field (PB-SCRF) methodologies, we have demonstrated that the observed large quadrupole splitting for the diferric state R2 does come from site Fe1(III) and it is mainly caused by the binding position of the carboxylate group of the Asp84 sidechain. Further, a series of active site clusters with mononuclear Fe(II) binding at either site Fe1 or Fe2 have been studied, which show that with a single dielectric medium outside the active site quantum region, there is no energetic preference for Fe(II) binding at one site over another. However, when including the explicit extended protein environment in the PB-SCRF model, the reaction field favors the Fe(II) binding at site Fe2 rather than at site Fe1 by ~9 kcal mol(-1). Therefore our calculations support the proposal of the previous Mössbauer spectroscopy and two-iron-isotope reaction experiments by Bollinger et al.

  15. Minute Virus of Mice Initiator Protein NS1 and a Host KDWK Family Transcription Factor Must Form a Precise Ternary Complex with Origin DNA for Nicking To Occur

    PubMed Central

    Christensen, Jesper; Cotmore, Susan F.; Tattersall, Peter

    2001-01-01

    Parvoviral rolling hairpin replication generates palindromic genomic concatemers whose junctions are resolved to give unit-length genomes by a process involving DNA replication initiated at origins derived from each viral telomere. The left-end origin of minute virus of mice (MVM), oriL, contains binding sites for the viral initiator nickase, NS1, and parvovirus initiation factor (PIF), a member of the emerging KDWK family of transcription factors. oriL is generated as an active form, oriLTC, and as an inactive form, oriLGAA, which contains a single additional nucleotide inserted between the NS1 and PIF sites. Here we examined the interactions on oriLTC which lead to activation of NS1 by PIF. The two subunits of PIF, p79 and p96, cooperatively bind two ACGT half-sites, which can be flexibly spaced. When coexpressed from recombinant baculoviruses, the PIF subunits preferentially form heterodimers which, in the presence of ATP, show cooperative binding with NS1 on oriL, but this interaction is preferentially enhanced on oriLTC compared to oriLGAA. Without ATP, NS1 is unable to bind stably to its cognate site, but PIF facilitates this interaction, rendering the NS1 binding site, but not the nick site, resistant to DNase I. Varying the spacing of the PIF half-sites shows that the distance between the NS1 binding site and the NS1-proximal half-site is critical for nickase activation, whereas the position of the distal half-site is unimportant. When expressed separately, both PIF subunits form homodimers that bind site specifically to oriL, but only complexes containing p79 activate the NS1 nickase function. PMID:11435581

  16. Phyloscan: locating transcription-regulating binding sites in mixed aligned and unaligned sequence data.

    PubMed

    Palumbo, Michael J; Newberg, Lee A

    2010-07-01

    The transcription of a gene from its DNA template into an mRNA molecule is the first, and most heavily regulated, step in gene expression. Especially in bacteria, regulation is typically achieved via the binding of a transcription factor (protein) or small RNA molecule to the chromosomal region upstream of a regulated gene. The protein or RNA molecule recognizes a short, approximately conserved sequence within a gene's promoter region and, by binding to it, either enhances or represses expression of the nearby gene. Since the sought-for motif (pattern) is short and accommodating to variation, computational approaches that scan for binding sites have trouble distinguishing functional sites from look-alikes. Many computational approaches are unable to find the majority of experimentally verified binding sites without also finding many false positives. Phyloscan overcomes this difficulty by exploiting two key features of functional binding sites: (i) these sites are typically more conserved evolutionarily than are non-functional DNA sequences; and (ii) these sites often occur two or more times in the promoter region of a regulated gene. The website is free and open to all users, and there is no login requirement. Address: (http://bayesweb.wadsworth.org/phyloscan/).

  17. Autoradiographic demonstration of oxytocin-binding sites in the macula densa

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Stoeckel, M.E.; Freund-Mercier, M.J.

    1989-08-01

    Specific oxytocin (OT)-binding sites were localized in the rat kidney with use of a selective {sup 125}I-labeled OT antagonist ({sup 125}I-OTA). High concentrations of OT binding sites were detected on the juxtaglomerular apparatus with use of the conventional film autoradiographic technique. No labeling occurred on other renal structures. The cellular localization of the OT binding sites within the juxtaglomerular apparatus was studied in light microscope autoradiography, on semithin sections from paraformaldehyde-fixed kidney slices incubated in the presence of {sup 125}I-OTA. These preparations revealed selective labeling of the macula densa, mainly concentrated at the basal pole of the cells. Control experimentsmore » showed first that {sup 125}I-OTA binding characteristics were not noticeably altered by prior paraformaldehyde fixation of the kidneys and second that autoradiographic detection of the binding sites was not impaired by histological treatments following binding procedures. In view of the role of the macula densa in the tubuloglomerular feedback, the putative OT receptors of this structure might mediate the stimulatory effect of OT on glomerular filtration.« less

  18. High-affinity cannabinoid binding site in brain: A possible marijuana receptor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nye, J.S.

    The mechanism by which delta{sup 9} tetrahydrocannabinol (delta{sup 9}THC), the major psychoactive component of marijuana or hashish, produces its potent psychological and physiological effects is unknown. To find receptor binding sites for THC, we designed a water-soluble analog for use as a radioligand. 5{prime}-Trimethylammonium-delta{sup 8}THC (TMA) is a positively charged analog of delta-{sup 8}THC modified on the 5{prime} carbon, a portion of the molecule not important for its psychoactivity. We have studied the binding of ({sup 3}H)-5{prime}-trimethylammonium-delta-{sup 8}THC (({sup 3}H)TMA) to rat neuronal membranes. ({sup 3}H)TMA binds saturably and reversibly to brain membranes with high affinity to apparently one classmore » of sites. Highest binding site density occurs in brain, but several peripheral organs also display specific binding. Detergent solubilizes the sites without affecting their pharmacologial properties. Molecular sieve chromatography reveals a bimodal peak of ({sup 3}H)TMA binding activity of approximately 60,000 daltons apparent molecular weight.« less

  19. Binding characteristics of levetiracetam to synaptic vesicle protein 2A (SV2A) in human brain and in CHO cells expressing the human recombinant protein.

    PubMed

    Gillard, Michel; Chatelain, Pierre; Fuks, Bruno

    2006-04-24

    A specific binding site for the antiepileptic drug levetiracetam (2S-(oxo-1-pyrrolidinyl)butanamide, Keppra) in rat brain, referred to as the levetiracetam binding site, was discovered several years ago. More recently, this binding site has been identified as the synaptic vesicle protein 2A (SV2A), a protein present in synaptic vesicles [Lynch, B., Lambeng, N., Nocka, K., Kensel-Hammes, P., Bajjalieh, S.M., Matagne, A., Fuks, B., 2004. The synaptic vesicle protein SV2A is the binding site for the antiepileptic drug levetiracetam. Proc. Natl. Acad. Sci. USA, 101, 9861-9866.]. In this study, we characterized the binding properties of levetiracetam in post-mortem human brain and compared them to human SV2A expressed in Chinese hamster ovary (CHO) cells. The results showed that the binding properties of levetiracetam and [3H]ucb 30889, an analogue that was previously characterized as a suitable ligand for levetiracetam binding site/SV2A in rat brain [Gillard, M., Fuks, B., Michel, P., Vertongen, P., Massingham, R. Chatelain, P., 2003. Binding characteristics of [3H]ucb 30889 to levetiracetam binding sites in rat brain. Eur. J. Pharmacol. 478, 1-9.], are almost identical in human brain samples (cerebral cortex, hippocampus and cerebellum) and in CHO cell membranes expressing the human SV2A protein. Moreover, the results are also similar to those previously obtained in rat brain. [3H]ucb 30889 binding in human brain and to SV2A was saturable and reversible. At 4 degrees C, its binding kinetics were best fitted assuming a two-phase model in all tissues. The half-times of association for the fast component ranged between 1 to 2 min and represent 30% to 36% of the sites whereas the half-times for the slow component ranged from 20 to 29 min. In dissociation experiments, the half-times were from 2 to 4 min for the fast component (33% to 49% of the sites) and 20 to 41 min for the slow component. Saturation binding curves led to Kd values for [3H]ucb 30889 of 53+/-7, 55+/-9, 70+/-11 and 75+/-33 nM in human cerebral cortex, hippocampus, cerebellum and CHO cells expressing SV2A respectively. Bmax values around 3-4 pmol/mg protein were calculated in all brain regions. Some of the saturation curves displayed curvilinear Scatchard plots indicating the presence of high and low affinity binding sites. When this was the case, Kd values from 25 to 30 nM for the high affinity sites (24% to 34% of total sites) and from 200 to 275 nM for the low affinity sites were calculated. This was observed in all brain regions and in CHO cell membranes expressing the SV2A protein. It cannot be explained by putative binding of [3H]ucb 30889 to SV2B or C isoforms but may reflect different patterns of SV2A glycosylation or the formation of SV2A oligomers. Competition experiments were performed to determine the affinities for SV2A of a variety of compounds including levetiracetam, some of its analogues and other molecules known to interact with levetiracetam binding sites in rat brain such as bemegride, pentylenetetrazol and chlordiazepoxide. We found an excellent correlation between the affinities of these compounds measured in human brain, rat brain and CHO cells expressing human SV2A. In conclusion, we report for the first time that the binding characteristics of native levetiracetam binding sites/SV2A in human brain and rat brain share very similar properties with human recombinant SV2A expressed in CHO cells.

  20. Phylogeographic insights into cryptic glacial refugia.

    PubMed

    Provan, Jim; Bennett, K D

    2008-10-01

    The glacial episodes of the Quaternary (2.6 million years ago-present) were a major factor in shaping the present-day distributions of extant flora and fauna, with expansions and contractions of the ice sheets rendering large areas uninhabitable for most species. Fossil records suggest that many species survived glacial maxima by retreating to refugia, usually at lower latitudes. Recently, phylogeographic studies have given support to the existence of previously unknown, or cryptic, refugia. Here we summarise many of these insights into the glacial histories of species in cryptic refugia gained through phylogeographic approaches. Understanding such refugia might be important as the Earth heads into another period of climate change, in terms of predicting the effects on species distribution and survival.

  1. The Polar and Electrical Nature of Dye Binding Sites on Human Red Blood Cell Membranes.

    DTIC Science & Technology

    positive charges at the binding sites. By increasing the concentration of the anionic BPB (or by the addition of the anionic detergent sodium lauryl ... sulfate ) these positive charges appear to be successively titrated, rendering the membrane binding sites electrically neutral at this pH. The average

  2. Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP

    PubMed Central

    Hafner, Markus; Landthaler, Markus; Burger, Lukas; Khorshid, Mohsen; Hausser, Jean; Berninger, Philipp; Rothballer, Andrea; Ascano, Manuel; Jungkamp, Anna-Carina; Munschauer, Mathias; Ulrich, Alexander; Wardle, Greg S.; Dewell, Scott; Zavolan, Mihaela; Tuschl, Thomas

    2010-01-01

    Summary RNA transcripts are subject to post-transcriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases. PMID:20371350

  3. Pharmacophore screening of the protein data bank for specific binding site chemistry.

    PubMed

    Campagna-Slater, Valérie; Arrowsmith, Andrew G; Zhao, Yong; Schapira, Matthieu

    2010-03-22

    A simple computational approach was developed to screen the Protein Data Bank (PDB) for putative pockets possessing a specific binding site chemistry and geometry. The method employs two commonly used 3D screening technologies, namely identification of cavities in protein structures and pharmacophore screening of chemical libraries. For each protein structure, a pocket finding algorithm is used to extract potential binding sites containing the correct types of residues, which are then stored in a large SDF-formatted virtual library; pharmacophore filters describing the desired binding site chemistry and geometry are then applied to screen this virtual library and identify pockets matching the specified structural chemistry. As an example, this approach was used to screen all human protein structures in the PDB and identify sites having chemistry similar to that of known methyl-lysine binding domains that recognize chromatin methylation marks. The selected genes include known readers of the histone code as well as novel binding pockets that may be involved in epigenetic signaling. Putative allosteric sites were identified on the structures of TP53BP1, L3MBTL3, CHEK1, KDM4A, and CREBBP.

  4. Identification of a p53-response element in the promoter of the proline oxidase gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-05-02

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

  5. The Role and Specificity of the Catalytic and Regulatory Cation-binding Sites of the Na+-pumping NADH:Quinone Oxidoreductase from Vibrio cholerae*

    PubMed Central

    Juárez, Oscar; Shea, Michael E.; Makhatadze, George I.; Barquera, Blanca

    2011-01-01

    The Na+-translocating NADH:quinone oxidoreductase is the entry site for electrons into the respiratory chain and the main sodium pump in Vibrio cholerae and many other pathogenic bacteria. In this work, we have employed steady-state and transient kinetics, together with equilibrium binding measurements to define the number of cation-binding sites and characterize their roles in the enzyme. Our results show that sodium and lithium ions stimulate enzyme activity, and that Na+-NQR enables pumping of Li+, as well as Na+ across the membrane. We also confirm that the enzyme is not able to translocate other monovalent cations, such as potassium or rubidium. Although potassium is not used as a substrate, Na+-NQR contains a regulatory site for this ion, which acts as a nonessential activator, increasing the activity and affinity for sodium. Rubidium can bind to the same site as potassium, but instead of being activated, enzyme turnover is inhibited. Activity measurements in the presence of both sodium and lithium indicate that the enzyme contains at least two functional sodium-binding sites. We also show that the binding sites are not exclusively responsible for ion selectivity, and other steps downstream in the mechanism also play a role. Finally, equilibrium-binding measurements with 22Na+ show that, in both its oxidized and reduced states, Na+-NQR binds three sodium ions, and that the affinity for sodium is the same for both of these states. PMID:21652714

  6. Characterization of [3H] oxymorphone binding sites in mouse brain: Quantitative autoradiography in opioid receptor knockout mice.

    PubMed

    Yoo, Ji Hoon; Borsodi, Anna; Tóth, Géza; Benyhe, Sándor; Gaspar, Robert; Matifas, Audrey; Kieffer, Brigitte L; Metaxas, Athanasios; Kitchen, Ian; Bailey, Alexis

    2017-03-16

    Oxymorphone, one of oxycodone's metabolic products, is a potent opioid receptor agonist which is thought to contribute to the analgesic effect of its parent compound and may have high potential abuse liability. Nonetheless, the in vivo pharmacological binding profile of this drug is still unclear. This study uses mice lacking mu (MOP), kappa (KOP) or delta (DOP) opioid receptors as well as mice lacking all three opioid receptors to provide full characterisation of oxymorphone binding sites in the brain. Saturation binding studies using [ 3 H]oxymorphone revealed high affinity binding sites in mouse brain displaying Kd of 1.7nM and Bmax of 147fmol/mg. Furthermore, we performed quantitative autoradiography binding studies using [ 3 H]oxymorphone in mouse brain. The distribution of [ 3 H]oxymorphone binding sites was found to be similar to the selective MOP agonist [ 3 H]DAMGO in the mouse brain. [ 3 H]Oxymorphone binding was completely abolished across the majority of the brain regions in mice lacking MOP as well as in mice lacking all three opioid receptors. DOP and KOP knockout mice retained [ 3 H]oxymorphone binding sites suggesting oxymorphone may not target DOP or KOP. These results confirm that the MOP, and not the DOP or the KOP is the main high affinity binding target for oxymorphone. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. Autoradiographic localization of sigma receptor binding sites in guinea pig and rat central nervous system with (+)3H-3-(3-hydroxyphenyl)-N-(1-propyl)piperidine

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gundlach, A.L.; Largent, B.L.; Snyder, S.H.

    1986-06-01

    (+)3H-3-PPP ((+)3H-3-(3-Hydroxyphenyl)-N-(1-propyl)-piperidine) binds with high affinity to brain membranes with a pharmacological profile consistent with that of sigma receptors. The distribution of (+)3H-3-PPP binding sites in brain and spinal cord of both guinea pig and rat has been determined by in vitro autoradiography with binding densities quantitated by computer-assisted densitometry. (+)3H-3-PPP binding to slide-mounted brain sections is saturable and displays high affinity and a pharmacological specificity very similar to sites labeled in homogenates. (+)3H-3-PPP binding sites are heterogeneously distributed. Highest concentrations of binding sites occur in spinal cord, particularly the ventral horn and dorsal root ganglia; the pons-medulla, associated withmore » the cranial nerve and pontine nuclei and throughout the brain stem reticular formation; the cerebellum, over the Purkinje cell layer; the midbrain, particularly the central gray and red nucleus; and hippocampus, over the pyramidal cell layer. Lowest levels are seen in the basal ganglia and parts of the thalamus, while all other areas, including hypothalamus and cerebral cortex, exhibit moderate grain densities. Quinolinic acid-induced lesions of the hippocampus indicate that (+)3H-3-PPP labels hippocampal pyramidal cells and granule cells in the dentate gyrus. Intrastriatal injection of ibotenic acid dramatically reduces (+)3H-3-PPP binding in this area, while injection of 6-hydroxydopamine produces a relatively slight decrease. The distribution of (+)3H-3-PPP binding sites does not correlate with the receptor distribution of any recognized neurotransmitter or neuropeptide, including dopamine. However, there is a notable similarity between the distribution of (+)3H-3-PPP sites and high-affinity binding sites for psychotomimetic opioids, such as the benzomorphan (+)SKF 10,047.« less

  8. DNA binding site characterization by means of Rényi entropy measures on nucleotide transitions.

    PubMed

    Perera, A; Vallverdu, M; Claria, F; Soria, J M; Caminal, P

    2008-06-01

    In this work, parametric information-theory measures for the characterization of binding sites in DNA are extended with the use of transitional probabilities on the sequence. We propose the use of parametric uncertainty measures such as Rényi entropies obtained from the transition probabilities for the study of the binding sites, in addition to nucleotide frequency-based Rényi measures. Results are reported in this work comparing transition frequencies (i.e., dinucleotides) and base frequencies for Shannon and parametric Rényi entropies for a number of binding sites found in E. Coli, lambda and T7 organisms. We observe that the information provided by both approaches is not redundant. Furthermore, under the presence of noise in the binding site matrix we observe overall improved robustness of nucleotide transition-based algorithms when compared with nucleotide frequency-based method.

  9. Modeling the Embrace of a Mutator: APOBEC Selection of Nucleic Acid Ligands.

    PubMed

    Salter, Jason D; Smith, Harold C

    2018-05-23

    The 11-member APOBEC (apolipoprotein B mRNA editing catalytic polypeptide-like) family of zinc-dependent cytidine deaminases bind to RNA and single-stranded DNA (ssDNA) and, in specific contexts, modify select (deoxy)cytidines to (deoxy)uridines. In this review, we describe advances made through high-resolution co-crystal structures of APOBECs bound to mono- or oligonucleotides that reveal potential substrate-specific binding sites at the active site and non-sequence-specific nucleic acid binding sites distal to the active site. We also discuss the effect of APOBEC oligomerization on functionality. Future structural studies will need to address how ssDNA binding away from the active site may enhance catalysis and the mechanism by which RNA binding may modulate catalytic activity on ssDNA. Copyright © 2018 The Author(s). Published by Elsevier Ltd.. All rights reserved.

  10. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bidlack, J.M.; Frey, D.K.; Seyed-Mozaffari, A.

    The binding properties of 14{beta}-(bromoacetamido)morphine (BAM) and the ability of BAM to irreversibly inhibit opioid binding to rat brain membranes were examined to characterize the affinity and selectivity of BAM as an irreversible affinity ligand for opioid receptors. BAM had the same receptor selectivity as morphine, with a 3-5-fold decrease in affinity for the different types of opioid receptors. When brain membranes were incubated with BAM, followed by extensive washing, opioid binding was restored to control levels. However, when membranes were incubated with dithiothreitol (DTT), followed by BAM, and subsequently washed, 90% of the 0.25 nM ({sup 3}H)(D-Ala{sup 2},(Me)Phe{sup 4},Gly(ol){supmore » 5})enkephalin (DAGO) binding was irreversibly inhibited as a result of the specific alkylation of a sulfhydryl group at the {mu} binding site. This inhibition was dependent on the concentrations of both DTT and BAM. The {mu} receptor specificity of BAM alkylation was demonstrated by the ability of BAM alkylated membranes to still bind the {delta}-selective peptide ({sup 3}H)(D-penicillamine{sup 2},D-penicillamine{sup 5})enkephalin (DPDPE) and (-)-({sup 3}H)bremazocine in the presence of {mu} and {delta} blockers, selective for {kappa} binding sites. Morphine and naloxone partially protected the binding site from alkylation with BAM, while ligands that did not bind to the {mu}s site did not afford protection. These studies have demonstrated that when a disulfide bond at or near {mu} opioid binding sites was reduced, BAM could then alkylate this site, resulting in the specific irreversible labeling of {mu} opioid receptors.« less

  11. ( sup 3 H)RO15-4513 binding to cerebellar diazepam-sensitive and insensitive GABAA receptors is unchanged by one week of ethanol intake

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Martin, M.W.; Chen, J.P.; Wallis, C.

    1992-02-26

    ({sup 3}H)RO15-4513, a partial inverse agonist at GABAA receptors, binds to two sites in cerebellar membranes, one sensitive (DZ-S) and one insensitive (DZ-IS) to inhibition by diazepam. These binding sites may represent different isoforms of the GABAA receptor and may play a role in ethanol (EtOH) dependence. The authors tested the hypothesis that chronic intake of EtOH induces changes in the binding properties of one or both of these putative GABBA receptors. Rats were fed a liquid diet of 4.5% EtOH for 7 d, gavaged with a 3g/kg dose of EtOH, and then sacrificed after 2 h, 12 h, ormore » 4.5 d. Binding of ({sup 3}H)RO15-4513 to cerebellar membranes was performed in the absence or presence of 10{mu}M diazepam (DZ-IS binding); DZ-S binding was calculated as the difference between total and DZ-IS. Nonlinear regression analysis showed that each class of binding site fit a model of mass action binding to a single, noninteractive population of sites. No significant difference was observed between any of the treatment groups in the apparent affinity (Kd) for ({sup 3}H)RO15-4513 at total, DZ-S, or DZ-IS sites following chronic EtOH intake or withdrawal. In addition, no significant difference was observed in the apparent number of DZ-S or DZ-IS binding sites or the ratio of DZ-S to DZ-IS.« less

  12. High Structural Resolution Hydroxyl Radical Protein Footprinting Reveals an Extended Robo1-Heparin Binding Interface*

    PubMed Central

    Li, Zixuan; Moniz, Heather; Wang, Shuo; Ramiah, Annapoorani; Zhang, Fuming; Moremen, Kelley W.; Linhardt, Robert J.; Sharp, Joshua S.

    2015-01-01

    Interaction of transmembrane receptors of the Robo family and the secreted protein Slit provides important signals in the development of the central nervous system and regulation of axonal midline crossing. Heparan sulfate, a sulfated linear polysaccharide modified in a complex variety of ways, serves as an essential co-receptor in Slit-Robo signaling. Previous studies have shown that closely related heparin octasaccharides bind to Drosophila Robo directly, and surface plasmon resonance analysis revealed that Robo1 binds more tightly to full-length unfractionated heparin. For the first time, we utilized electron transfer dissociation-based high spatial resolution hydroxyl radical protein footprinting to identify two separate binding sites for heparin interaction with Robo1: one binding site at the previously identified site for heparin dp8 and a second binding site at the N terminus of Robo1 that is disordered in the x-ray crystal structure. Mutagenesis of the identified N-terminal binding site exhibited a decrease in binding affinity as measured by surface plasmon resonance and heparin affinity chromatography. Footprinting also indicated that heparin binding induces a minor change in the conformation and/or dynamics of the Ig2 domain, but no major conformational changes were detected. These results indicate a second low affinity binding site in the Robo-Slit complex as well as suggesting the role of the Ig2 domain of Robo1 in heparin-mediated signal transduction. This study also marks the first use of electron transfer dissociation-based high spatial resolution hydroxyl radical protein footprinting, which shows great utility for the characterization of protein-carbohydrate complexes. PMID:25752613

  13. Point mutation increases a form of the NK1 receptor with high affinity for neurokinin A and B and septide

    PubMed Central

    Ciucci, Alessandra; Palma, Carla; Manzini, Stefano; Werge, Thomas M

    1998-01-01

    The binding modalities of substance P and neurokinin A on the wild type and Gly166 to-Cys mutant NK1 receptors expressed on CHO cells were investigated in homologous and heterologous binding experiments using both radiolabelled substance P and neurokinin A.On the wild type NK1 receptor NKA displaces radiolabelled substance P with very low apparent affinity, despite its high-affinity binding constant (determined in homologous binding experiments). The Gly166 to-Cys substitution in the NK1 tachykinin receptor greatly enhances the apparent affinity of neurokinin A in competition for radiolabelled substance P, but it does not change the binding constant of neurokinin A. The mutation, thereby, eliminates the discrepancy between the low apparent affinity and the high binding constant of neurokinin A.On the wild type receptor the binding capacity of neurokinin A is significantly smaller than that of substance P. In contrast, the two tachykinins bind to approximately the same number of sites on the mutant receptor.Simultaneous mass action law analysis of binding data in which multiple radioligands were employed in parallel demonstrated that a one-site model was unable to accommodate all the experimental data, whereas a two-site model provided a dramatically better description.These two receptor-sites display equally high affinity for substance P, while neurokinin A strongly discriminates between a high and a low affinity component. The binding affinities of neurokinin A are not affected by the mutation, which instead specifically alters the distribution between receptor sites in favour of a high affinity neurokinin A binding form.The low apparent affinity and binding capacity of neurokinin A on the wild type receptor results from neurokinin A binding with high affinity only to a fraction of the sites labelled by substance P. The mutation increases the proportion of this site, and consequently enhances the apparent affinity and binding capacity of neurokinin A.The binding modalities of septide-like ligands (i.e. neurokinin B, SP(6-11), SP-methyl ester) are affected similarly to neurokinin A and are better resolved into two sites. The mutation leaves the affinity of these ligands for the two receptor forms unchanged, but increases the fraction of high-affinity sites. On the other hand, the binding of non-peptide and peptide antagonists (SR140.333 and FK888) behaved similarly to substance P with a single high affinity site that is unaffected by the mutation.These findings may suggest that the NK1 receptor exists in two different forms with similar affinity for substance P and NK1 antagonists, but with a high and a low affinity for neurokinin A and septide-like ligands. Hence, the Gly166 in the NK1 receptor would seem to control the distribution between a pan-reactive form and a substance P-selective form of the receptor. PMID:9786514

  14. Denervation does not alter the number of neuronal bungarotoxin binding sites on autonomic neurons in the frog cardiac ganglion.

    PubMed

    Sargent, P B; Bryan, G K; Streichert, L C; Garrett, E N

    1991-11-01

    The binding of neuronal bungarotoxin (n-BuTX; also known as bungarotoxin 3.1, kappa-bungarotoxin, and toxin F) was analyzed in normal and denervated parasympathetic cardiac ganglia of the frog Rana pipiens, n-BuTX blocks both EPSPs and ACh potentials at 5-20 nM, as determined by intracellular recording techniques. Scatchard analysis on homogenates indicates that cardiac ganglia have two classes of binding sites for 125I-n-BuTX: a high-affinity site with an apparent dissociation constant (Kd,app) of 1.7 nM and a Bmax (number of binding sites) of 3.8 fmol/ganglion and a low-affinity site with a Kd,app of 12 microM and a Bmax of 14 pmol/ganglion. alpha-Bungarotoxin does not appear to interfere with the binding of 125I-n-BuTX to either site. The high-affinity binding site is likely to be the functional nicotinic ACh receptor (AChR), given the similarity between its affinity for 125I-n-BuTX and the concentration of n-BuTX required to block AChR function. Light microscopic autoradiographic analysis of 125I-n-BuTX binding to the ganglion cell surface reveals that toxin binding is concentrated at synaptic sites, which were identified using a synaptic vesicle-specific antibody. Scatchard analysis of autoradiographic data reveals that 125I-n-BuTX binding to the neuronal surface is saturable and has a Kd,app similar to that of the high-affinity binding site characterized in homogenates. Surface binding of 125I-n-BuTX is blocked by nicotine, carbachol, and d-tubocurarine (IC50 less than 20 microM), but not by atropine (IC50 greater than 10 mM). Denervation of the heart increases the ACh sensitivity of cardiac ganglion cells but has no effect upon the number of high-affinity binding sites for 125I-n-BuTX in tissue homogenates. Moreover, autoradiographic analysis indicates that denervation does not alter the number of 125I-n-BuTX binding sites on the ganglion cell surface. n-BuTX is as effective in reducing ganglion cell responses to ACh in denervated ganglia as it is in normally innervated ganglia. These results suggest that denervation alters neither the total number of nicotinic AChRs in the cardiac ganglion nor the number found on the surface of ganglion cells. These autonomic neurons thus respond differently to denervation than do skeletal myofibers. The increase in ACh sensitivity displayed by cardiac ganglion cells upon denervation cannot be explained by changes in AChR number.

  15. Calorimetric studies of the interactions of metalloenzyme active site mimetics with zinc-binding inhibitors.

    PubMed

    Robinson, Sophia G; Burns, Philip T; Miceli, Amanda M; Grice, Kyle A; Karver, Caitlin E; Jin, Lihua

    2016-07-19

    The binding of drugs to metalloenzymes is an intricate process that involves several interactions, including binding of the drug to the enzyme active site metal, as well as multiple interactions between the drug and the enzyme residues. In order to determine the free energy contribution of Zn(2+) binding by known metalloenzyme inhibitors without the other interactions, valid active site zinc structural mimetics must be formed and binding studies need to be performed in biologically relevant conditions. The potential of each of five ligands to form a structural mimetic with Zn(2+) was investigated in buffer using Isothermal Titration Calorimetry (ITC). All five ligands formed strong 1 : 1 (ligand : Zn(2+)) binary complexes. The complexes were used in further ITC experiments to study their interaction with 8-hydroxyquinoline (8-HQ) and/or acetohydroxamic acid (AHA), two bidentate anionic zinc-chelating enzyme inhibitors. It was found that tetradentate ligands were not suitable for creating zinc structural mimetics for inhibitor binding in solution due to insufficient coordination sites remaining on Zn(2+). A stable binary complex, [Zn(BPA)](2+), which was formed by a tridentate ligand, bis(2-pyridylmethyl)amine (BPA), was found to bind one AHA in buffer or a methanol : buffer mixture (60 : 40 by volume) at pH 7.25 or one 8-HQ in the methanol : buffer mixture at pH 6.80, making it an effective structural mimetic for the active site of zinc metalloenzymes. These results are consistent with the observation that metalloenzyme active site zinc ions have three residues coordinated to them, leaving one or two sites open for inhibitors to bind. Our findings indicate that Zn(BPA)X2 can be used as an active site structural mimetic for zinc metalloenzymes for estimating the free energy contribution of zinc binding to the overall inhibitor active site interactions. Such use will help aid in the rational design of inhibitors to a variety of zinc metalloenzymes.

  16. Identification of 50- and 23-/25-kDa HeLa cell membrane glycoproteins involved in poliovirus infection: occurrence of poliovirus specific binding sites on susceptible and nonsusceptible cells.

    PubMed

    Barnert, R H; Zeichhardt, H; Habermehl, K O

    1992-02-01

    Glycoproteins in the range 50 and 23/25 kDa were identified as poliovirus specific binding sites on HeLa cells with the monoclonal antibody mAb 122. mAb 122 is characterized by its partial inhibiting effect on poliovirus reproduction and adsorption when prebound to HeLa cells. The binding sites are endocytosed in native cells and specific for poliovirus as mAb 122 did not interfere with the adsorption of human rhinovirus type 14 (HRV 14). The poliovirus binding sites are present also on nonprimate so called nonsusceptible cells, e.g., mouse L-cells, as could be shown with sensitive ELISA based binding assays and performance of binding studies with fixed cells at 37 degrees.

  17. Cooperative interplay of let-7 mimic and HuR with MYC RNA.

    PubMed

    Gunzburg, Menachem J; Sivakumaran, Andrew; Pendini, Nicole R; Yoon, Je-Hyun; Gorospe, Myriam; Wilce, Matthew C J; Wilce, Jacqueline A

    2015-01-01

    Both RNA-binding proteins (RBP) and miRNA play important roles in the regulation of mRNA expression, often acting together to regulate a target mRNA. In some cases the RBP and miRNA have been reported to act competitively, but in other instances they function cooperatively. Here, we investigated HuR function as an enhancer of let-7-mediated translational repression of c-Myc despite the separation of their binding sites. Using an in vitro system, we determined that a let-7 mimic, consisting of single-stranded (ss)DNA complementary to the let-7 binding site, enhanced the affinity of HuR for a 122-nt MYC RNA encompassing both binding sites. This finding supports the biophysical principle of cooperative binding by an RBP and miRNA purely through interactions at distal mRNA binding sites.

  18. The binding properties of cycloxaprid on insect native nAChRs partially explain the low cross-resistance with imidacloprid in Nilaparvata lugens.

    PubMed

    Zhang, Yixi; Xu, Xiaoyong; Bao, Haibo; Shao, Xusheng; Li, Zhong; Liu, Zewen

    2018-06-06

    Neonicotinoids, such as imidacloprid, are selective agonists of insect nicotinic acetylcholine receptors (nAChRs) to control Nilaparvata lugens, a major rice insect pest. High imidacloprid resistance has been reported in N. lugens in laboratory and in fields. Cycloxaprid, an oxabridged cis-nitromethylene neonicotinoid, showed high insecticidal activity against N. lugens and low cross-resistance in the imidacloprid resistant strains and field populations. Binding studies have demonstrated that imidacloprid had two binding sites with different affinities (Kd = 3.18 ± 0.43 pM and 1.78 ± 0.19 nM) in N. lugens nAChRs. Cycloxaprid was poor at displacing [ 3 H]imidacloprid at its high-affinity binding site (Ki = 159.38±20.43 nM), but quite efficient at the low-affinity binding site (Ki = 1.27±0.35 nM). These data showed that cycloxaprid had overlapping binding sites with imidacloprid only at its low-affinity binding site. Therefore, the low displacement ability of cycloxaprid against imidacloprid binding at its high affinity site could partially explain the low cross-resistance of cycloxaprid in the imidacloprid resistant populations. The high insecticidal activity, low cross-resistance and different binding properties on insect nAChRs of cycloxaprid demonstrating it a potential insecticide to control N. lugens and related insect pests, especially the ones with high resistance to neonicotinoids. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  19. CCL22-specific Antibodies Reveal That Engagement of Two Distinct Binding Domains on CCL22 Is Required for CCR4-mediated Function.

    PubMed

    Santulli-Marotto, Sandra; Wheeler, John; Lacy, Eilyn R; Boakye, Ken; Luongo, Jennifer; Wu, Sheng-Jiun; Ryan, Mary

    2015-12-01

    CCL22 inactivation in vivo occurs by cleavage at the N-terminus; however, it is unclear whether this encompasses the entire site of CCR4 interaction. CCL17 also binds CCR4 and its function requires binding via two discrete binding sites. Using monoclonal antibodies (MAbs), we report that there are two separate sites on CCL22 that are required for CCR4-mediated function. The CCL22-specific antibodies bind with affinities of 632 ± 297 pM (MC2B7) and 308 ± 43 pM (MAB4391) and neither exhibited detectable binding to CCL17. Both antibodies are comparable in their ability to inhibit CCL22-mediated calcium mobilization; however, competition binding studies demonstrate that MC2B7 and MAB4391 bind to distinct epitopes on CCL22. Both antibodies inhibit function through CCR4, which is demonstrated by loss of β-arrestin recruitment in a reporter cell line. In both assays, blocking either site independently abolished CCL22 function, suggesting that concurrent engagement of both sites with CCR4 is necessary for function. This is the first demonstration that CCL22 has two distinct binding sites that are required for CCR4 function. These antibodies are valuable tools for better understanding the interaction and function of CCL22 and CCR4 and will potentially help further understanding of the differential outcomes of CCL17 and CCL22 interaction with CCR4.

  20. Investigation of glucose binding sites on insulin.

    PubMed

    Zoete, Vincent; Meuwly, Markus; Karplus, Martin

    2004-05-15

    Possible insulin binding sites for D-glucose have been investigated theoretically by docking and molecular dynamics (MD) simulations. Two different docking programs for small molecules were used; Multiple Copy Simultaneous Search (MCSS) and Solvation Energy for Exhaustive Docking (SEED) programs. The configurations resulting from the MCSS search were evaluated with a scoring function developed to estimate the binding free energy. SEED calculations were performed using various values for the dielectric constant of the solute. It is found that scores emphasizing non-polar interactions gave a preferential binding site in agreement with that inferred from recent fluorescence and NMR NOESY experiments. The calculated binding affinity of -1.4 to -3.5 kcal/mol is within the measured range of -2.0 +/- 0.5 kcal/mol. The validity of the binding site is suggested by the dynamical stability of the bound glucose when examined with MD simulations with explicit solvent. Alternative binding sites were found in the simulations and their relative stabilities were estimated. The motions of the bound glucose during molecular dynamics simulations are correlated with the motions of the insulin side chains that are in contact with it and with larger scale insulin motions. These results raise the question of whether glucose binding to insulin could play a role in its activity. The results establish the complementarity of molecular dynamics simulations and normal mode analyses with the search for binding sites proposed with small molecule docking programs. Copyright 2004 Wiley-Liss, Inc.

  1. Evidence that Chemical Chaperone 4-Phenylbutyric Acid Binds to Human Serum Albumin at Fatty Acid Binding Sites

    PubMed Central

    James, Joel; Shihabudeen, Mohamed Sham; Kulshrestha, Shweta; Goel, Varun; Thirumurugan, Kavitha

    2015-01-01

    Endoplasmic reticulum stress elicits unfolded protein response to counteract the accumulating unfolded protein load inside a cell. The chemical chaperone, 4-Phenylbutyric acid (4-PBA) is a FDA approved drug that alleviates endoplasmic reticulum stress by assisting protein folding. It is found efficacious to augment pathological conditions like type 2 diabetes, obesity and neurodegeneration. This study explores the binding nature of 4-PBA with human serum albumin (HSA) through spectroscopic and molecular dynamics approaches, and the results show that 4-PBA has high binding specificity to Sudlow Site II (Fatty acid binding site 3, subdomain IIIA). Ligand displacement studies, RMSD stabilization profiles and MM-PBSA binding free energy calculation confirm the same. The binding constant as calculated from fluorescence spectroscopic studies was found to be kPBA = 2.69 x 105 M-1. Like long chain fatty acids, 4-PBA induces conformational changes on HSA as shown by circular dichroism, and it elicits stable binding at Sudlow Site II (fatty acid binding site 3) by forming strong hydrogen bonding and a salt bridge between domain II and III of HSA. This minimizes the fluctuation of HSA backbone as shown by limited conformational space occupancy in the principal component analysis. The overall hydrophobicity of W214 pocket (located at subdomain IIA), increases upon occupancy of 4-PBA at any FA site. Descriptors of this pocket formed by residues from other subdomains largely play a role in compensating the dynamic movement of W214. PMID:26181488

  2. A Sequence in the loop domain of hepatitis C virus E2 protein identified in silico as crucial for the selective binding to human CD81

    PubMed Central

    Chang, Chun-Chun; Hsu, Hao-Jen; Yen, Jui-Hung; Lo, Shih-Yen

    2017-01-01

    Hepatitis C virus (HCV) is a species-specific pathogenic virus that infects only humans and chimpanzees. Previous studies have indicated that interactions between the HCV E2 protein and CD81 on host cells are required for HCV infection. To determine the crucial factors for species-specific interactions at the molecular level, this study employed in silico molecular docking involving molecular dynamic simulations of the binding of HCV E2 onto human and rat CD81s. In vitro experiments including surface plasmon resonance measurements and cellular binding assays were applied for simple validations of the in silico results. The in silico studies identified two binding regions on the HCV E2 loop domain, namely E2-site1 and E2-site2, as being crucial for the interactions with CD81s, with the E2-site2 as the determinant factor for human-specific binding. Free energy calculations indicated that the E2/CD81 binding process might follow a two-step model involving (i) the electrostatic interaction-driven initial binding of human-specific E2-site2, followed by (ii) changes in the E2 orientation to facilitate the hydrophobic and van der Waals interaction-driven binding of E2-site1. The sequence of the human-specific, stronger-binding E2-site2 could serve as a candidate template for the future development of HCV-inhibiting peptide drugs. PMID:28481946

  3. Biological Control Potential of Neoaplectanid Nematodes

    PubMed Central

    Gaugler, Randy

    1981-01-01

    The neoaplectanids are among the most studied of all entomogenous nematodes. Because these nematodes kill their insect hosts, they are regarded as having excellent potential as biological control agents. While the host specificity of most entontogenous nematodes tends to limit their potential usefulness, the broad host range and high virulence of neoaplectanids make them attractive candidates for industrial development. Also, recent development of economical mass rearing procedures appears to make production on a commercial basis feasible. Infective stages may be stored for years trader various laboratory conditions. Although entomogenous nematodes, as parasites, are exempt from govermnent registration requirements, the mutualistic association of neoaplectanid nematodes with a bacterium will likely necessitate a detailed safety evaluation. Studies conducted to date indicate a lack of pathogenicity to mammals. Field trial success has been limited by the intolerance of infective stages to mffavorable environmental conditions, particularly low moisture. Applications against pests on exposed plant foliage have been especially disappointing. More encouraging anti consistent results have been obtained in more favorable environments, including soil and aquatic habitats, but the most promising treatment sites ntay be cryptic habitats where infective stages are shehered from environmental extremes. Cryptic habitats also exploit the ability of neoaplectanids to actively seek out hosts in recessed places where conventional insecticide applications are intpractical. PMID:19300757

  4. DNA Barcoding Survey of Anurans across the Eastern Cordillera of Colombia and the Impact of the Andes on Cryptic Diversity

    PubMed Central

    Guarnizo, Carlos E.; Paz, Andrea; Muñoz-Ortiz, Astrid; Flechas, Sandra V.; Méndez-Narváez, Javier; Crawford, Andrew J.

    2015-01-01

    Colombia hosts the second highest amphibian species diversity on Earth, yet its fauna remains poorly studied, especially using molecular genetic techniques. We present the results of the first wide-scale DNA barcoding survey of anurans of Colombia, focusing on a transect across the Eastern Cordillera. We surveyed 10 sites between the Magdalena Valley to the west and the eastern foothills of the Eastern Cordillera, sequencing portions of the mitochondrial 16S ribosomal RNA and cytochrome oxidase subunit 1 (CO1) genes for 235 individuals from 52 nominal species. We applied two barcode algorithms, Automatic Barcode Gap Discovery and Refined Single Linkage Analysis, to estimate the number of clusters or “unconfirmed candidate species” supported by DNA barcode data. Our survey included ~7% of the anuran species known from Colombia. While barcoding algorithms differed slightly in the number of clusters identified, between three and ten nominal species may be obscuring candidate species (in some cases, more than one cryptic species per nominal species). Our data suggest that the high elevations of the Eastern Cordillera and the low elevations of the Chicamocha canyon acted as geographic barriers in at least seven nominal species, promoting strong genetic divergences between populations associated with the Eastern Cordillera. PMID:26000447

  5. Consequences of prescribed fire and grazing on grassland ant communities.

    PubMed

    Underwood, Emma C; Christian, Caroline E

    2009-04-01

    Prescribed fire and livestock grazing are used for the management and restoration of native grasslands the world over; however, the effects of these management techniques on ant communities are unclear. We examined the response of ants to these disturbances in grasslands in northern California. Twenty-four 30 by 30 m plots were established across two sites that received one of four treatments: grazing, fire, grazing and fire, or no treatment. Ants were censused using 240 pitfall traps with one preburn and two postburn samples (14 d and 1 yr after burning). We analyzed ant abundance using broadly defined groups based on feeding habit and/or habitat use and detected no grazing effect but a significant fire effect that differed by group. Immediate postfire sampling showed an increase in cryptic species (particularly Brachymyrmex depilis). One year after the fire, no response was detected for cryptic species, but burned plots had greater abundance of seed harvesters. Analysis of vegetation showed burned plots had significantly greater forb cover, which might have provided greater food resources, and also lower biomass, which might have facilitated foraging. Understanding the effects of these management tools on ant abundance complements our understanding of their effect on vegetation and assists conservation practitioners effectively manage grassland ecosystems both in California and beyond.

  6. First report of Persimmon cryptic virus and Persimmon virus A in Korea

    USDA-ARS?s Scientific Manuscript database

    In 2014, a total of 77 persimmon (Diospyros kaki Thunb.) trees from Korean commercial persimmon orchards were surveyed for Persimmon cryptic virus (PeCV) and Persimmon virus A (PeVA). Leaf samples were collected from symptomatic trees with necrosis (two), or mosaic and leaf malformations (one) and 7...

  7. ACTIVATION OF A CRYPTIC D-SERINE DEAMINASE (DSD) GENE FROM PSEUDOMONAS CEPACIA 17616

    EPA Science Inventory

    D-serine inhibits growth of P. cepacia 17616; however, resistant mutants able to express an ordinarily cryptic D-serine deaminase (dsd) gene were isolated readily. The resistant strains formed high levels of a D-serine deaminase active on D-threonine as well as D-serine. IS eleme...

  8. A nearly cryptic scorpionfly, Panorpa cryptica n sp.(Mecoptera: Panorpidae) from North America

    Treesearch

    Wesley Bicha; Nathan Schiff; Aaron Lancaster; Brian Scheffler

    2015-01-01

    The first nearly cryptic species of scorpionfly from the United States, Strong>Panorpa cryptica Bicha and Schiff, n. sp., is described from northern Georgia, southwestern North Carolina and northwestern South Carolina. This insect was initially differentiated from the very similar Panorpa nebulosa Westwood by its unique cytochrome...

  9. Molecular species identification of cryptic apple and snowberry maggots (Diptera: Tephritidae) in Western and Central Washington

    USDA-ARS?s Scientific Manuscript database

    In Washington state, identification of the quarantine apple pest Rhagoletis pomonella (Walsh) is complicated by the presence of the cryptic species R. zephyria Snow (Diptera: Tephritidae). Distinguishing the two flies is important because there is a zero tolerance policy for R. pomonella in apple p...

  10. Field identification of the cryptic vespertilionid bats, Myotis lucifugus and M. yumanensis

    Treesearch

    Theodore J. Weller; Shonene A. Scott; Thomas J. Rodhouse; Patricia C. Ormsbee; Jan M. Zinck

    2007-01-01

    Recent advances in molecular techniques have provided new tools for confirming species identities, however they can be expensive and results are not immediately available. Myotis lucificugus and M. yumanensis are morphologically cryptic species of bats sympatric in western North America that can be difficult to distinguish in the...

  11. Cryptic speciation in the Acari: a function of species lifestyles or our ability to separate species?

    USDA-ARS?s Scientific Manuscript database

    There are approximately 55,000 described Acari species, accounting for almost half of all known Arachnida species, but total estimated Acari diversity is reckoned to be far greater. One important source of currently hidden Acari diversity is cryptic speciation, which poses challenges to taxonomists ...

  12. Desensitization of the nicotinic acetylcholine receptor by diisopropylfluorophosphate.

    PubMed

    Eldefrawi, M E; Schweizer, G; Bakry, N M; Valdes, J J

    1988-01-01

    The interaction of diisopropylfluorophosphate (DFP) with the nicotinic acetylcholine (ACh) receptor of Torpedo electric organ was studied, using [3H]-phencyclidine ([3H]-PCP) as a reporter probe. Phencyclidine binds with different kinetics to resting, activated, and desensitized receptor conformations. Although DFP did not inhibit binding of [3H]-ACh or 125I-alpha-bungarotoxin (BGT) to the receptor recognition sites and potentiated in a time-dependent manner [3H]-PCP binding to the receptor's high-affinity allosteric site, it inhibited the ACh- or carbamylcholine-stimulated [3H]-PCP binding. This suggested that DFP bound to a third kind of site on the receptor and affected receptor conformation. Preincubation of the membranes with DFP increased the receptor's affinity for carbamylcholine by eightfold and raised the pseudo-first-order rate of [3H]-PCP binding to that of an agonist-desensitized receptor. Accordingly, it is suggested that DFP induces receptor desensitization by binding to a site that is distinct from the recognition or high-affinity noncompetitive sites.

  13. Excess sludge reduction using pilot-scale lysis-cryptic growth system integrated ultrasonic/alkaline disintegration and hydrolysis/acidogenesis pretreatment.

    PubMed

    Ma, Huaji; Zhang, Shuting; Lu, Xuebin; Xi, Bo; Guo, Xingli; Wang, Han; Duan, Jingxiao

    2012-07-01

    A pilot-scale lysis-cryptic growth system was built and operated continuously for excess sludge reduction. Combined ultrasonic/alkaline disintegration and hydrolysis/acidogenesis were integrated into its sludge pretreatment system. Continuous operation showed that the observed biomass yield and the sludge reduction efficiency of the lysis-cryptic growth system were 0.27 kg VSS/kg COD consumed and 56.5%, respectively. The water quality of its effluent was satisfactory. The sludge pretreatment system performed well and its TCOD removal efficiency was 7.9% which contributed a sludge reduction efficiency of 2.1%. The SCOD, VFA, TN, NH(4)(+)-N, TP and pH in the supernatant of pretreated sludge were 1790 mg/L, 1530 mg COD/L, 261.1mg/L, 114.0mg/L, 93.1mg/L and 8.69, respectively. The total operation cost of the lysis-cryptic growth system was $ 0.186/m(3) wastewater, which was 11.4% less than that of conventional activated sludge (CAS) system without excess sludge pretreatment. Copyright © 2012 Elsevier Ltd. All rights reserved.

  14. Discovery and validation of information theory-based transcription factor and cofactor binding site motifs.

    PubMed

    Lu, Ruipeng; Mucaki, Eliseos J; Rogan, Peter K

    2017-03-17

    Data from ChIP-seq experiments can derive the genome-wide binding specificities of transcription factors (TFs) and other regulatory proteins. We analyzed 765 ENCODE ChIP-seq peak datasets of 207 human TFs with a novel motif discovery pipeline based on recursive, thresholded entropy minimization. This approach, while obviating the need to compensate for skewed nucleotide composition, distinguishes true binding motifs from noise, quantifies the strengths of individual binding sites based on computed affinity and detects adjacent cofactor binding sites that coordinate with the targets of primary, immunoprecipitated TFs. We obtained contiguous and bipartite information theory-based position weight matrices (iPWMs) for 93 sequence-specific TFs, discovered 23 cofactor motifs for 127 TFs and revealed six high-confidence novel motifs. The reliability and accuracy of these iPWMs were determined via four independent validation methods, including the detection of experimentally proven binding sites, explanation of effects of characterized SNPs, comparison with previously published motifs and statistical analyses. We also predict previously unreported TF coregulatory interactions (e.g. TF complexes). These iPWMs constitute a powerful tool for predicting the effects of sequence variants in known binding sites, performing mutation analysis on regulatory SNPs and predicting previously unrecognized binding sites and target genes. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  15. Cone arrestin binding to JNK3 and Mdm2: conformational preference and localization of interaction sites

    PubMed Central

    Song, Xiufeng; Gurevich, Eugenia V.; Gurevich, Vsevolod V.

    2008-01-01

    Arrestins are multi-functional regulators of G protein-coupled receptors. Receptor-bound arrestins interact with >30 remarkably diverse proteins and redirect the signaling to G protein-independent pathways. The functions of free arrestins are poorly understood, and the interaction sites of the non-receptor arrestin partners are largely unknown. In this study, we show that cone arrestin, the least studied member of the family, binds c-Jun N-terminal kinase (JNK3) and Mdm2 and regulates their subcellular distribution. Using arrestin mutants with increased or reduced structural flexibility, we demonstrate that arrestin in all conformations binds JNK3 comparably, whereas Mdm2 preferentially binds cone arrestin ‘frozen’ in the basal state. To localize the interaction sites, we expressed separate N- and C-domains of cone and rod arrestins and found that individual domains bind JNK3 and remove it from the nucleus as efficiently as full-length proteins. Thus, the arrestin binding site for JNK3 includes elements in both domains with the affinity of partial sites on individual domains sufficient for JNK3 relocalization. N-domain of rod arrestin binds Mdm2, which localizes its main interaction site to this region. Comparable binding of JNK3 and Mdm2 to four arrestin subtypes allowed us to identify conserved residues likely involved in these interactions. PMID:17680991

  16. An additional substrate binding site in a bacterial phenylalanine hydroxylase

    PubMed Central

    Ronau, Judith A.; Paul, Lake N.; Fuchs, Julian E.; Corn, Isaac R.; Wagner, Kyle T.; Liedl, Klaus R.; Abu-Omar, Mahdi M.; Das, Chittaranjan

    2014-01-01

    Phenylalanine hydroxylase (PAH) is a non-heme iron enzyme that catalyzes phenylalanine oxidation to tyrosine, a reaction that must be kept under tight regulatory control. Mammalian PAH features a regulatory domain where binding of the substrate leads to allosteric activation of the enzyme. However, existence of PAH regulation in evolutionarily distant organisms, such as certain bacteria in which it occurs, has so far been underappreciated. In an attempt to crystallographically characterize substrate binding by PAH from Chromobacterium violaceum (cPAH), a single-domain monomeric enzyme, electron density for phenylalanine was observed at a distal site, 15.7Å from the active site. Isothermal titration calorimetry (ITC) experiments revealed a dissociation constant of 24 ± 1.1 µM for phenylalanine. Under the same conditions, no detectable binding was observed in ITC for alanine, tyrosine, or isoleucine, indicating the distal site may be selective for phenylalanine. Point mutations of residues in the distal site that contact phenylalanine (F258A, Y155A, T254A) lead to impaired binding, consistent with the presence of distal site binding in solution. Kinetic analysis reveals that the distal site mutants suffer a discernible loss in their catalytic activity. However, x-ray structures of Y155A and F258A, two of the mutants showing more noticeable defect in their activity, show no discernible change in their active site structure, suggesting that the effect of distal binding may transpire through protein dynamics in solution. PMID:23860686

  17. HLA Epitopes: The Targets of Monoclonal and Alloantibodies Defined

    PubMed Central

    Nguyen, Anh

    2017-01-01

    Sensitization to human leukocyte antigens (HLA) in organ transplant patients causes graft rejection, according to the humoral theory of transplantation. Sensitization is almost ubiquitous as anti-HLA antibodies are found in almost all sera of transplant recipients. Advances in testing assays and amino acid sequencing of HLA along with computer software contributed further to the understanding of antibody-antigen reactivity. It is commonly understood that antibodies bind to HLA antigens. With current knowledge of epitopes, it is more accurate to describe that antibodies bind to their target epitopes on the surface of HLA molecular chains. Epitopes are present on a single HLA (private epitope) or shared by multiple antigens (public epitope). The phenomenon of cross-reactivity in HLA testing, often explained as cross-reactive groups (CREGs) of antigens with antibody, can be clearly explained now by public epitopes. Since 2006, we defined and reported 194 HLA class I unique epitopes, including 56 cryptic epitopes on dissociated HLA class I heavy chains, 83 HLA class II epitopes, 60 epitopes on HLA-DRB1, 15 epitopes on HLA-DQB1, 3 epitopes on HLA-DQA1, 5 epitopes on HLA-DPB1, and 7 MICA epitopes. In this paper, we provide a summary of our findings. PMID:28626773

  18. The E3 ubiquitin ligase and RNA-binding protein ZNF598 orchestrates ribosome quality control of premature polyadenylated mRNAs

    PubMed Central

    Garzia, Aitor; Jafarnejad, Seyed Mehdi; Meyer, Cindy; Chapat, Clément; Gogakos, Tasos; Morozov, Pavel; Amiri, Mehdi; Shapiro, Maayan; Molina, Henrik; Tuschl, Thomas; Sonenberg, Nahum

    2017-01-01

    Cryptic polyadenylation within coding sequences (CDS) triggers ribosome-associated quality control (RQC), followed by degradation of the aberrant mRNA and polypeptide, ribosome disassembly and recycling. Although ribosomal subunit dissociation and nascent peptide degradation are well-understood, the molecular sensors of aberrant mRNAs and their mechanism of action remain unknown. We studied the Zinc Finger Protein 598 (ZNF598) using PAR-CLIP and revealed that it cross-links to tRNAs, mRNAs and rRNAs, thereby placing the protein on translating ribosomes. Cross-linked reads originating from AAA-decoding tRNALys(UUU) were 10-fold enriched over its cellular abundance, and poly-lysine encoded by poly(AAA) induced RQC in a ZNF598-dependent manner. Encounter with translated polyA segments by ZNF598 triggered ubiquitination of several ribosomal proteins, requiring the E2 ubiquitin ligase UBE2D3 to initiate RQC. Considering that human CDS are devoid of >4 consecutive AAA codons, sensing of prematurely placed polyA tails by a specialized RNA-binding protein is a novel nucleic-acid-based surveillance mechanism of RQC. PMID:28685749

  19. The E3 ubiquitin ligase and RNA-binding protein ZNF598 orchestrates ribosome quality control of premature polyadenylated mRNAs.

    PubMed

    Garzia, Aitor; Jafarnejad, Seyed Mehdi; Meyer, Cindy; Chapat, Clément; Gogakos, Tasos; Morozov, Pavel; Amiri, Mehdi; Shapiro, Maayan; Molina, Henrik; Tuschl, Thomas; Sonenberg, Nahum

    2017-07-07

    Cryptic polyadenylation within coding sequences (CDS) triggers ribosome-associated quality control (RQC), followed by degradation of the aberrant mRNA and polypeptide, ribosome disassembly and recycling. Although ribosomal subunit dissociation and nascent peptide degradation are well-understood, the molecular sensors of aberrant mRNAs and their mechanism of action remain unknown. We studied the Zinc Finger Protein 598 (ZNF598) using PAR-CLIP and revealed that it cross-links to tRNAs, mRNAs and rRNAs, thereby placing the protein on translating ribosomes. Cross-linked reads originating from AAA-decoding tRNA Lys (UUU) were 10-fold enriched over its cellular abundance, and poly-lysine encoded by poly(AAA) induced RQC in a ZNF598-dependent manner. Encounter with translated polyA segments by ZNF598 triggered ubiquitination of several ribosomal proteins, requiring the E2 ubiquitin ligase UBE2D3 to initiate RQC. Considering that human CDS are devoid of >4 consecutive AAA codons, sensing of prematurely placed polyA tails by a specialized RNA-binding protein is a novel nucleic-acid-based surveillance mechanism of RQC.

  20. Rate constants for proteins binding to substrates with multiple binding sites using a generalized forward flux sampling expression

    NASA Astrophysics Data System (ADS)

    Vijaykumar, Adithya; ten Wolde, Pieter Rein; Bolhuis, Peter G.

    2018-03-01

    To predict the response of a biochemical system, knowledge of the intrinsic and effective rate constants of proteins is crucial. The experimentally accessible effective rate constant for association can be decomposed in a diffusion-limited rate at which proteins come into contact and an intrinsic association rate at which the proteins in contact truly bind. Reversely, when dissociating, bound proteins first separate into a contact pair with an intrinsic dissociation rate, before moving away by diffusion. While microscopic expressions exist that enable the calculation of the intrinsic and effective rate constants by conducting a single rare event simulation of the protein dissociation reaction, these expressions are only valid when the substrate has just one binding site. If the substrate has multiple binding sites, a bound enzyme can, besides dissociating into the bulk, also hop to another binding site. Calculating transition rate constants between multiple states with forward flux sampling requires a generalized rate expression. We present this expression here and use it to derive explicit expressions for all intrinsic and effective rate constants involving binding to multiple states, including rebinding. We illustrate our approach by computing the intrinsic and effective association, dissociation, and hopping rate constants for a system in which a patchy particle model enzyme binds to a substrate with two binding sites. We find that these rate constants increase as a function of the rotational diffusion constant of the particles. The hopping rate constant decreases as a function of the distance between the binding sites. Finally, we find that blocking one of the binding sites enhances both association and dissociation rate constants. Our approach and results are important for understanding and modeling association reactions in enzyme-substrate systems and other patchy particle systems and open the way for large multiscale simulations of such systems.

  1. Enhanced recognition of HIV-1 Cryptic Epitopes Restricted by HLA-Class I alleles Associated with a Favorable Clinical Outcome

    PubMed Central

    Bansal, Anju; Mann, Tiffanie; Sterrett, Sarah; Peng, Binghao J.; Bet, Anne; Carlson, Jonathan M.; Goepfert, Paul A.

    2015-01-01

    Background Cryptic Epitopes (CE) are peptides derived from the translation of one or more of the five alternative reading frames (ARFs; 2 sense and 3 antisense) of genes. Here, we compared response rates to HIV-1 specific CE predicted to be restricted by HLA-I alleles associated with protection against disease progression to those without any such association. Methods Peptides (9–11mer) were designed based on HLA-I binding algorithms for B*27, B*57 or B*5801 (protective alleles) and HLA-B*5301 or B*5501 (non-protective allele) in all five ARFs of the nine HIV-1 encoded proteins. Peptides with >50% probability of being an epitope (n=231) were tested for T cell responses in an IFN-γ ELISpot assay. PBMC samples from HIV-1 seronegative donors (n=42) and HIV-1 seropositive patients with chronic clade B infections (n=129) were used. Results Overall, 16%, 2%, and 2% of CHI patients had CE responses by IFN-γ ELISpot in the protective, non-protective, and seronegative groups, respectively (p=0.009, Fischer’s exact test). Twenty novel CE specific responses were mapped (median magnitude of 95 SFC/106 PBMC) and the majority were both anti-sense derived (90%) as well as represented ARFs of accessory proteins (55%). CE-specific CD8 T cells were multifunctional and proliferated when assessed by intracellular cytokine staining. Conclusions CE responses were preferentially restricted by the protective HLA-I alleles in HIV-1 infection suggesting that they may contribute to viral control in this group of patients. PMID:26322665

  2. Symmetry of Fv architecture is conducive to grafting a second antibody binding site in the Fv region.

    PubMed Central

    Keck, P C; Huston, J S

    1996-01-01

    Molecular modeling studies on antibody Fv regions have been pursued to design a second antigen-binding site (chi-site) in a chimeric single-chain Fv (chi sFv) species of about 30 kDa. This analysis has uncovered an architectural basis common to many Fv regions that permits grafting a chi-site onto the Fv surface that diametrically opposes the normal combining site. By using molecular graphics analysis, chimeric complementarity-determining regions (chi CDRs) were defined that comprised most of the CDRs from an antibody binding site of interest. The chain directionality of chi CDRs was consistent with that of specific bottom loops of the sFv, which allowed for grafting of chi CDRs with an overall geometry approximating CDRs in the parent combining site. Analysis of 10 different Fv crystal structures indicates that the positions for inserting chi CDRs are very highly conserved, as are the corresponding chi CDR boundaries in the parent binding site. The results of this investigation suggest that it should be possible to generally apply this approach to the development of chimeric bispecific antibody binding site (chi BABS) proteins. Images FIGURE 2 FIGURE 3 PMID:8889174

  3. Deciphering common recognition principles of nucleoside mono/di and tri-phosphates binding in diverse proteins via structural matching of their binding sites.

    PubMed

    Bhagavat, Raghu; Srinivasan, Narayanaswamy; Chandra, Nagasuma

    2017-09-01

    Nucleoside triphosphate (NTP) ligands are of high biological importance and are essential for all life forms. A pre-requisite for them to participate in diverse biochemical processes is their recognition by diverse proteins. It is thus of great interest to understand the basis for such recognition in different proteins. Towards this, we have used a structural bioinformatics approach and analyze structures of 4677 NTP complexes available in Protein Data Bank (PDB). Binding sites were extracted and compared exhaustively using PocketMatch, a sensitive in-house site comparison algorithm, which resulted in grouping the entire dataset into 27 site-types. Each of these site-types represent a structural motif comprised of two or more residue conservations, derived using another in-house tool for superposing binding sites, PocketAlign. The 27 site-types could be grouped further into 9 super-types by considering partial similarities in the sites, which indicated that the individual site-types comprise different combinations of one or more site features. A scan across PDB using the 27 structural motifs determined the motifs to be specific to NTP binding sites, and a computational alanine mutagenesis indicated that residues identified to be highly conserved in the motifs are also most contributing to binding. Alternate orientations of the ligand in several site-types were observed and rationalized, indicating the possibility of some residues serving as anchors for NTP recognition. The presence of multiple site-types and the grouping of multiple folds into each site-type is strongly suggestive of convergent evolution. Knowledge of determinants obtained from this study will be useful for detecting function in unknown proteins. Proteins 2017; 85:1699-1712. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  4. Catalytic site interactions in yeast OMP synthase.

    PubMed

    Hansen, Michael Riis; Barr, Eric W; Jensen, Kaj Frank; Willemoës, Martin; Grubmeyer, Charles; Winther, Jakob R

    2014-01-15

    The enigmatic kinetics, half-of-the-sites binding, and structural asymmetry of the homodimeric microbial OMP synthases (orotate phosphoribosyltransferase, EC 2.4.2.10) have been proposed to result from an alternating site mechanism in these domain-swapped enzymes [R.W. McClard et al., Biochemistry 45 (2006) 5330-5342]. This behavior was investigated in the yeast enzyme by mutations in the conserved catalytic loop and 5-phosphoribosyl-1-diphosphate (PRPP) binding motif. Although the reaction is mechanistically sequential, the wild-type (WT) enzyme shows parallel lines in double reciprocal initial velocity plots. Replacement of Lys106, the postulated intersubunit communication device, produced intersecting lines in kinetic plots with a 2-fold reduction of kcat. Loop (R105G K109S H111G) and PRPP-binding motif (D131N D132N) mutant proteins, each without detectable enzymatic activity and ablated ability to bind PRPP, complemented to produce a heterodimer with a single fully functional active site showing intersecting initial velocity plots. Equilibrium binding of PRPP and orotidine 5'-monophosphate showed a single class of two binding sites per dimer in WT and K106S enzymes. Evidence here shows that the enzyme does not follow half-of-the-sites cooperativity; that interplay between catalytic sites is not an essential feature of the catalytic mechanism; and that parallel lines in steady-state kinetics probably arise from tight substrate binding. Copyright © 2013. Published by Elsevier Inc.

  5. T Cell Adaptive Immunity Proceeds through Environment-Induced Adaptation from the Exposure of Cryptic Genetic Variation

    PubMed Central

    Whitacre, James M.; Lin, Joseph; Harding, Angus

    2011-01-01

    Evolution is often characterized as a process involving incremental genetic changes that are slowly discovered and fixed in a population through genetic drift and selection. However, a growing body of evidence is finding that changes in the environment frequently induce adaptations that are much too rapid to occur by an incremental genetic search process. Rapid evolution is hypothesized to be facilitated by mutations present within the population that are silent or “cryptic” within the first environment but are co-opted or “exapted” to the new environment, providing a selective advantage once revealed. Although cryptic mutations have recently been shown to facilitate evolution in RNA enzymes, their role in the evolution of complex phenotypes has not been proven. In support of this wider role, this paper describes an unambiguous relationship between cryptic genetic variation and complex phenotypic responses within the immune system. By reviewing the biology of the adaptive immune system through the lens of evolution, we show that T cell adaptive immunity constitutes an exemplary model system where cryptic alleles drive rapid adaptation of complex traits. In naive T cells, normally cryptic differences in T cell receptor reveal diversity in activation responses when the cellular population is presented with a novel environment during infection. We summarize how the adaptive immune response presents a well studied and appropriate experimental system that can be used to confirm and expand upon theoretical evolutionary models describing how seemingly small and innocuous mutations can drive rapid cellular evolution. PMID:22363338

  6. Molecular species delimitation methods and population genetics data reveal extensive lineage diversity and cryptic species in Aglaopheniidae (Hydrozoa).

    PubMed

    Postaire, Bautisse; Magalon, Hélène; Bourmaud, Chloé A-F; Bruggemann, J Henrich

    2016-12-01

    A comprehensive inventory of global biodiversity would be greatly improved by automating methods for species delimitation. The Automatic Barcode Gap Discovery method, the Poisson tree processes algorithm and the Generalized mixed Yule-coalescent model have been proposed as means of increasing the rate of biodiversity description using single locus data. We applied these methods to explore the diversity within the Aglaopheniidae, a hydrozoan family with many species widely distributed across tropical and temperate oceans. Our analyses revealed widespread cryptic diversity in this family, almost half of the morpho-species presenting several independent evolutionary lineages, as well as support for cases of synonymy. For two common species of this family, Lytocarpia brevirostris and Macrorhynchia phoenicea, we compared the outputs to clustering analyses based on microsatellite data and to nuclear gene phylogenies. For L. brevirostris, microsatellite data were congruent with results of the species delimitation methods, revealing the existence of two cryptic species with Indo-Pacific distribution. For M. phoenicea, all analyses confirmed the presence of two cryptic species within the South-Western Indian Ocean. Our study suggests that the diversity of Aglaopheniidae might be much higher than assumed, likely related to low dispersal capacities. Sequence-based species delimitation methods seem highly valuable to reveal cryptic diversity in hydrozoans; their application in an integrative framework will be very useful in describing the phyletic diversity of these organisms. Copyright © 2016 Elsevier Inc. All rights reserved.

  7. Stridulations Reveal Cryptic Speciation in Neotropical Sympatric Ants

    PubMed Central

    Ferreira, Ronara Souza; Poteaux, Chantal; Delabie, Jacques Hubert Charles; Fresneau, Dominique; Rybak, Fanny

    2010-01-01

    The taxonomic challenge posed by cryptic species underlines the importance of using multiple criteria in species delimitation. In the current paper we tested the use of acoustic analysis as a tool to assess the real diversity in a cryptic species complex of Neotropical ants. In order to understand the potential of acoustics and to improve consistency in the conclusions by comparing different approaches, phylogenetic relationships of all the morphs considered were assessed by the analysis of a fragment of the mitochondrial DNA cytochrome b. We observed that each of the cryptic morph studied presents a morphologically distinct stridulatory organ and that all sympatric morphs produce distinctive stridulations. This is the first evidence of such a degree of specialization in the acoustic organ and signals in ants, which suggests that stridulations may be among the cues used by these ants during inter-specific interactions. Mitochondrial DNA variation corroborated the acoustic differences observed, confirming acoustics as a helpful tool to determine cryptic species in this group of ants, and possibly in stridulating ants in general. Congruent morphological, acoustic and genetic results constitute sufficient evidence to propose each morph studied here as a valid new species, suggesting that P. apicalis is a complex of at least 6 to 9 species, even if they present different levels of divergence. Finally, our results highlight that ant stridulations may be much more informative than hitherto thought, as much for ant communication as for integrative taxonomists. PMID:21203529

  8. Characterization of local polarity and hydrophobic binding sites of beta-lactoglobulin by using N-terminal specific fluorescence labeling.

    PubMed

    Dong, Su-Ying; Zhao, Zhen-Wen; Ma, Hui-Min

    2006-01-01

    Because of wide ligand-binding ability and significant industrial interest of beta-lactoglobulin (beta-LG), its binding properties have been extensively studied. However, there still exists a controversy as to where a ligand binds, since at least two potential hydrophobic binding sites in beta-LG have been postulated for ligand binding: an internal one (calyx) and an external one (near the N-terminus). In this work, the local polarity and hydrophobic binding sites of beta-LG have been characterized by using N-terminal specific fluorescence labeling combined with a polarity-sensitive fluorescent probe 3-(4-chloro-6-hydrazino- 1,3,5-triazinylamino)-7-(dimethylamino)-2-methylphenazine (CHTDP). The polarity within the calyx is found to be extremely low, which is explained in terms of superhydrophobicity possibly resulting from its nanostructure, and the polarity is increased with the destruction of the calyx by heat treatment. However, the polarity of the N-terminal domain in native beta-LG is decreased after thermal denaturation. This polarity trend toward decreasing instead of increasing shows that beta-LG may have no definite external hydrophobic binding site. The hydrophobic binding of a ligand such as CHTDP at the surface of the protein is probably achieved via appropriate assembling of corresponding hydrophobic residues rather than via a fixed external hydrophobic binding site. Also, the ligand-binding location in beta-LG is found to be relevant to not only experimental conditions (pH < or = 6.2 or pH > 7.1) but also binding mechanisms (hydrophobic affinity or electrostatic interaction).

  9. Biochemical study of prolactin binding sites in Xenopus laevis brain and choroid plexus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Muccioli, G.; Guardabassi, A.; Pattono, P.

    1990-03-01

    The occurrence of prolactin binding sites in some brain structures (telencephalon, ventral hypothalamus, myelencephalon, hypophysis, and choroid plexus) from Xenopus laevis (anuran amphibian) was studied by the in vitro biochemical technique. The higher binding values were obtained at the level of the choroid plexus and above all of the hypothalamus. On the bases of hormonal specificity and high affinity, these binding sites are very similar to those of prolactin receptors of classical target tissues as well as of those described by us in other structures from Xenopus. To our knowledge, the present results provide the first demonstration of the occurrencemore » of prolactin specific binding sites in Xenopus laevis choroid plexus cells.« less

  10. Study of DNA binding sites using the Rényi parametric entropy measure.

    PubMed

    Krishnamachari, A; moy Mandal, Vijnan; Karmeshu

    2004-04-07

    Shannon's definition of uncertainty or surprisal has been applied extensively to measure the information content of aligned DNA sequences and characterizing DNA binding sites. In contrast to Shannon's uncertainty, this study investigates the applicability and suitability of a parametric uncertainty measure due to Rényi. It is observed that this measure also provides results in agreement with Shannon's measure, pointing to its utility in analysing DNA binding site region. For facilitating the comparison between these uncertainty measures, a dimensionless quantity called "redundancy" has been employed. It is found that Rényi's measure at low parameter values possess a better delineating feature of binding sites (of binding regions) than Shannon's measure. The critical value of the parameter is chosen with an outlier criterion.

  11. The Potential of Dark Septate Endophytes to Form Root Symbioses with Ectomycorrhizal and Ericoid Mycorrhizal Middle European Forest Plants

    PubMed Central

    Lukešová, Tereza; Kohout, Petr; Větrovský, Tomáš; Vohník, Martin

    2015-01-01

    The unresolved ecophysiological significance of Dark Septate Endophytes (DSE) may be in part due to existence of morphologically indistinguishable cryptic species in the most common Phialocephala fortinii s. l.—Acephala applanata species complex (PAC). We inoculated three middle European forest plants (European blueberry, Norway spruce and silver birch) with 16 strains of eight PAC cryptic species and other DSE and ectomycorrhizal/ericoid mycorrhizal fungi and focused on intraradical structures possibly representing interfaces for plant-fungus nutrient transfer and on host growth response. The PAC species Acephala applanata simultaneously formed structures resembling ericoid mycorrhiza (ErM) and DSE microsclerotia in blueberry. A. macrosclerotiorum, a close relative to PAC, formed ectomycorrhizae with spruce but not with birch, and structures resembling ErM in blueberry. Phialocephala glacialis, another close relative to PAC, formed structures resembling ErM in blueberry. In blueberry, six PAC strains significantly decreased dry shoot biomass compared to ErM control. In birch, one A. macrosclerotiorum strain increased root biomass and the other shoot biomass in comparison with non-inoculated control. The dual mycorrhizal ability of A. macrosclerotiorum suggested that it may form mycorrhizal links between Ericaceae and Pinaceae. However, we were unable to detect this species in Ericaceae roots growing in a forest with presence of A. macrosclerotiorum ectomycorrhizae. Nevertheless, the diversity of Ericaceae mycobionts was high (380 OTUs) with individual sites often dominated by hitherto unreported helotialean and chaetothyrialean/verrucarialean species; in contrast, typical ErM fungi were either absent or low in abundance. Some DSE apparently have a potential to form mycorrhizae with typical middle European forest plants. However, except A. applanata, the tested representatives of all hitherto described PAC cryptic species formed typical DSE colonization without specific structures necessary for mycorrhizal nutrient transport. A. macrosclerotiorum forms ectomycorrhiza with conifers but not with broadleaves and probably does not form common mycorrhizal networks between conifers with Ericaceae. PMID:25905493

  12. The necessity of DNA taxonomy to reveal cryptic diversity and spatial distribution of meiofauna, with a focus on Nemertea.

    PubMed

    Leasi, Francesca; Norenburg, Jon L

    2014-01-01

    Meiofauna represent one of the most abundant and diverse communities in marine benthic ecosystems. However, an accurate assessment of diversity at the level of species has been and remains challenging for these microscopic organisms. Therefore, for many taxa, especially the soft body forms such as nemerteans, which often lack clear diagnostic morphological traits, DNA taxonomy is an effective means to assess species diversity. Morphological taxonomy of Nemertea is well documented as complicated by scarcity of unambiguous character states and compromised by diagnoses of a majority of species (and higher clades) being inadequate or based on ambiguous characters and character states. Therefore, recent studies have advocated for the primacy of molecular tools to solve the taxonomy of this group. DNA taxonomy uncovers possible hidden cryptic species, provides a coherent means to systematize taxa in definite clades, and also reveals possible biogeographic patterns. Here, we analyze diversity of nemertean species by considering the barcode region of the mitochondrial gene Cytochrome Oxidase subunit I (COI) and different species delineation approaches in order to infer evolutionarily significant units. In the aim to uncover actual diversity of meiofaunal nemerteans across different sites in Central America, COI sequences were obtained for specimens assigned here to the genera Cephalothrix, Ototyphlonemertes, and Tetrastemma-like worms, each commonly encountered in our sampling. Additional genetic, taxonomic, and geographic data of other specimens belonging to these genera were added from GenBank. Results are consistent across different DNA taxonomy approaches, and revealed (i) the presence of several hidden cryptic species and (ii) numerous potential misidentifications due to traditional taxonomy. (iii) We additionally test a possible biogeographic pattern of taxonomic units revealed by this study, and, except for a few cases, the putative species seem not to be widely distributed, in contrast to what traditional taxonomy would suggest for the recognized morphotypes.

  13. Association of 5-hydroxymethylation and 5-methylation of DNA cytosine with tissue-specific gene expression

    PubMed Central

    Ponnaluri, V. K. Chaithanya; Ehrlich, Kenneth C.; Zhang, Guoqiang; Lacey, Michelle; Johnston, Douglas; Pradhan, Sriharsa; Ehrlich, Melanie

    2017-01-01

    ABSTRACT Differentially methylated or hydroxymethylated regions (DMRs) in mammalian DNA are often associated with tissue-specific gene expression but the functional relationships are still being unraveled. To elucidate these relationships, we studied 16 human genes containing myogenic DMRs by analyzing profiles of their epigenetics and transcription and quantitatively assaying 5-hydroxymethylcytosine (5hmC) and 5-methylcytosine (5mC) at specific sites in these genes in skeletal muscle (SkM), myoblasts, heart, brain, and diverse other samples. Although most human promoters have little or no methylation regardless of expression, more than half of the genes that we chose to study—owing to their myogenic DMRs—overlapped tissue-specific alternative or cryptic promoters displaying corresponding tissue-specific differences in histone modifications. The 5mC levels in myoblast DMRs were significantly associated with 5hmC levels in SkM at the same site. Hypermethylated myogenic DMRs within CDH15, a muscle- and cerebellum-specific cell adhesion gene, and PITX3, a homeobox gene, were used for transfection in reporter gene constructs. These intragenic DMRs had bidirectional tissue-specific promoter activity that was silenced by in vivo-like methylation. The CDH15 DMR, which was previously associated with an imprinted maternal germline DMR in mice, had especially strong promoter activity in myogenic host cells. These findings are consistent with the controversial hypothesis that intragenic DNA methylation can facilitate transcription and is not just a passive consequence of it. Our results support varied roles for tissue-specific 5mC- or 5hmC-enrichment in suppressing inappropriate gene expression from cryptic or alternative promoters and in increasing the plasticity of gene expression required for development and rapid responses to tissue stress or damage. PMID:27911668

  14. SITEHOUND-web: a server for ligand binding site identification in protein structures.

    PubMed

    Hernandez, Marylens; Ghersi, Dario; Sanchez, Roberto

    2009-07-01

    SITEHOUND-web (http://sitehound.sanchezlab.org) is a binding-site identification server powered by the SITEHOUND program. Given a protein structure in PDB format SITEHOUND-web will identify regions of the protein characterized by favorable interactions with a probe molecule. These regions correspond to putative ligand binding sites. Depending on the probe used in the calculation, sites with preference for different ligands will be identified. Currently, a carbon probe for identification of binding sites for drug-like molecules, and a phosphate probe for phosphorylated ligands (ATP, phoshopeptides, etc.) have been implemented. SITEHOUND-web will display the results in HTML pages including an interactive 3D representation of the protein structure and the putative sites using the Jmol java applet. Various downloadable data files are also provided for offline data analysis.

  15. Common Anesthetic-binding Site for Inhibition of Pentameric Ligand-gated Ion Channels.

    PubMed

    Kinde, Monica N; Bu, Weiming; Chen, Qiang; Xu, Yan; Eckenhoff, Roderic G; Tang, Pei

    2016-03-01

    Identifying functionally relevant anesthetic-binding sites in pentameric ligand-gated ion channels (pLGICs) is an important step toward understanding the molecular mechanisms underlying anesthetic action. The anesthetic propofol is known to inhibit cation-conducting pLGICs, including a prokaryotic pLGIC from Erwinia chrysanthemi (ELIC), but the sites responsible for functional inhibition remain undetermined. We photolabeled ELIC with a light-activated derivative of propofol (AziPm) and performed fluorine-19 nuclear magnetic resonance experiments to support propofol binding to a transmembrane domain (TMD) intrasubunit pocket. To differentiate sites responsible for propofol inhibition from those that are functionally irrelevant, we made an ELIC-γ-aminobutyric acid receptor (GABAAR) chimera that replaced the ELIC-TMD with the α1β3GABAAR-TMD and compared functional responses of ELIC-GABAAR and ELIC with propofol modulations. Photolabeling showed multiple AziPm-binding sites in the extracellular domain (ECD) but only one site in the TMD with labeled residues M265 and F308 in the resting state of ELIC. Notably, this TMD site is an intrasubunit pocket that overlaps with binding sites for anesthetics, including propofol, found previously in other pLGICs. Fluorine-19 nuclear magnetic resonance experiments supported propofol binding to this TMD intrasubunit pocket only in the absence of agonist. Functional measurements of ELIC-GABAAR showed propofol potentiation of the agonist-elicited current instead of inhibition observed on ELIC. The distinctly different responses of ELIC and ELIC-GABAAR to propofol support the functional relevance of propofol binding to the TMD. Combining the newly identified TMD intrasubunit pocket in ELIC with equivalent TMD anesthetic sites found previously in other cationic pLGICs, we propose this TMD pocket as a common site for anesthetic inhibition of pLGICs.

  16. Multiple binding sites involved in the effect of choline esters on decarbamoylation of monomethylcarbamoyl- or dimethylcarbamoly-acetylcholinesterase.

    PubMed Central

    Sok, D E; Kim, Y B; Choi, S J; Jung, C H; Cha, S H

    1994-01-01

    Multiple binding sites for inhibitory choline esters in spontaneous decarbamoylation of dimethylcarbamoyl-acetylcholinesterase (AChE) were suggested from a wide range of IC50 values, in contrast with a limited range of AC50 values (concentration giving 50% of maximal activation) at a peripheral activatory site. Association of choline esters containing a long acyl chain (C7-C12) with the hydrophobic zone in the active site could be deduced from a linear relationship between the size of the acyl group and the inhibitory potency in either spontaneous decarbamoylation or acetylthiocholine hydrolysis. Direct support for laurylcholine binding to the active site might come from the competitive inhibition (Ki 33 microM) of choline-catalysed decarbamoylation by laurylcholine. Moreover, its inhibitory action was greater for monomethylcarbamoyl-AChE than for dimethylcarbamoyl-AChE, where there is a greater steric hindrance at the active centre. In further support, the inhibition of pentanoylthiocholine-induced decarbamoylation by laurylcholine was suggested to be due to laurylcholine binding to a central site rather than a peripheral site, similar to the inhibition of spontaneous decarbamoylation by laurylcholine. Supportive data for acetylcholine binding to the active site are provided by the results that acetylcholine is a competitive inhibitor (Ki 7.6 mM) of choline-catalysed decarbamoylation, and its inhibitory action was greater for monomethylcarbamoyl-AChE than for dimethylcarbamoyl-AChE. Meanwhile, choline esters with an acyl group of an intermediate size (C4-C6), more subject to steric exclusion at the active centre, and less associable with the hydrophobic zone, appear to bind preferentially to a peripheral activity site. Thus the multiple effects of choline esters may be governed by hydrophobicity and/or a steric effect exerted by the acyl moiety at the binding sites. PMID:8053896

  17. Binding site and affinity prediction of general anesthetics to protein targets using docking.

    PubMed

    Liu, Renyu; Perez-Aguilar, Jose Manuel; Liang, David; Saven, Jeffery G

    2012-05-01

    The protein targets for general anesthetics remain unclear. A tool to predict anesthetic binding for potential binding targets is needed. In this study, we explored whether a computational method, AutoDock, could serve as such a tool. High-resolution crystal data of water-soluble proteins (cytochrome C, apoferritin, and human serum albumin), and a membrane protein (a pentameric ligand-gated ion channel from Gloeobacter violaceus [GLIC]) were used. Isothermal titration calorimetry (ITC) experiments were performed to determine anesthetic affinity in solution conditions for apoferritin. Docking calculations were performed using DockingServer with the Lamarckian genetic algorithm and the Solis and Wets local search method (http://www.dockingserver.com/web). Twenty general anesthetics were docked into apoferritin. The predicted binding constants were compared with those obtained from ITC experiments for potential correlations. In the case of apoferritin, details of the binding site and their interactions were compared with recent cocrystallization data. Docking calculations for 6 general anesthetics currently used in clinical settings (isoflurane, sevoflurane, desflurane, halothane, propofol, and etomidate) with known 50% effective concentration (EC(50)) values were also performed in all tested proteins. The binding constants derived from docking experiments were compared with known EC(50) values and octanol/water partition coefficients for the 6 general anesthetics. All 20 general anesthetics docked unambiguously into the anesthetic binding site identified in the crystal structure of apoferritin. The binding constants for 20 anesthetics obtained from the docking calculations correlate significantly with those obtained from ITC experiments (P = 0.04). In the case of GLIC, the identified anesthetic binding sites in the crystal structure are among the docking predicted binding sites, but not the top ranked site. Docking calculations suggest a most probable binding site located in the extracellular domain of GLIC. The predicted affinities correlated significantly with the known EC(50) values for the 6 frequently used anesthetics in GLIC for the site identified in the experimental crystal data (P = 0.006). However, predicted affinities in apoferritin, human serum albumin, and cytochrome C did not correlate with these 6 anesthetics' known experimental EC(50) values. A weak correlation between the predicted affinities and the octanol/water partition coefficients was observed for the sites in GLIC. We demonstrated that anesthetic binding sites and relative affinities can be predicted using docking calculations in an automatic docking server (AutoDock) for both water-soluble and membrane proteins. Correlation of predicted affinity and EC(50) for 6 frequently used general anesthetics was only observed in GLIC, a member of a protein family relevant to anesthetic mechanism.

  18. Binding Site and Affinity Prediction of General Anesthetics to Protein Targets Using Docking

    PubMed Central

    Liu, Renyu; Perez-Aguilar, Jose Manuel; Liang, David; Saven, Jeffery G.

    2012-01-01

    Background The protein targets for general anesthetics remain unclear. A tool to predict anesthetic binding for potential binding targets is needed. In this study, we explore whether a computational method, AutoDock, could serve as such a tool. Methods High-resolution crystal data of water soluble proteins (cytochrome C, apoferritin and human serum albumin), and a membrane protein (a pentameric ligand-gated ion channel from Gloeobacter violaceus, GLIC) were used. Isothermal titration calorimetry (ITC) experiments were performed to determine anesthetic affinity in solution conditions for apoferritin. Docking calculations were performed using DockingServer with the Lamarckian genetic algorithm and the Solis and Wets local search method (https://www.dockingserver.com/web). Twenty general anesthetics were docked into apoferritin. The predicted binding constants are compared with those obtained from ITC experiments for potential correlations. In the case of apoferritin, details of the binding site and their interactions were compared with recent co-crystallization data. Docking calculations for six general anesthetics currently used in clinical settings (isoflurane, sevoflurane, desflurane, halothane, propofol, and etomidate) with known EC50 were also performed in all tested proteins. The binding constants derived from docking experiments were compared with known EC50s and octanol/water partition coefficients for the six general anesthetics. Results All 20 general anesthetics docked unambiguously into the anesthetic binding site identified in the crystal structure of apoferritin. The binding constants for 20 anesthetics obtained from the docking calculations correlate significantly with those obtained from ITC experiments (p=0.04). In the case of GLIC, the identified anesthetic binding sites in the crystal structure are among the docking predicted binding sites, but not the top ranked site. Docking calculations suggest a most probable binding site located in the extracellular domain of GLIC. The predicted affinities correlated significantly with the known EC50s for the six commonly used anesthetics in GLIC for the site identified in the experimental crystal data (p=0.006). However, predicted affinities in apoferritin, human serum albumin, and cytochrome C did not correlate with these six anesthetics’ known experimental EC50s. A weak correlation between the predicted affinities and the octanol/water partition coefficients was observed for the sites in GLIC. Conclusion We demonstrated that anesthetic binding sites and relative affinities can be predicted using docking calculations in an automatic docking server (Autodock) for both water soluble and membrane proteins. Correlation of predicted affinity and EC50 for six commonly used general anesthetics was only observed in GLIC, a member of a protein family relevant to anesthetic mechanism. PMID:22392968

  19. AutoSite: an automated approach for pseudo-ligands prediction—from ligand-binding sites identification to predicting key ligand atoms

    PubMed Central

    Ravindranath, Pradeep Anand; Sanner, Michel F.

    2016-01-01

    Motivation: The identification of ligand-binding sites from a protein structure facilitates computational drug design and optimization, and protein function assignment. We introduce AutoSite: an efficient software tool for identifying ligand-binding sites and predicting pseudo ligand corresponding to each binding site identified. Binding sites are reported as clusters of 3D points called fills in which every point is labelled as hydrophobic or as hydrogen bond donor or acceptor. From these fills AutoSite derives feature points: a set of putative positions of hydrophobic-, and hydrogen-bond forming ligand atoms. Results: We show that AutoSite identifies ligand-binding sites with higher accuracy than other leading methods, and produces fills that better matches the ligand shape and properties, than the fills obtained with a software program with similar capabilities, AutoLigand. In addition, we demonstrate that for the Astex Diverse Set, the feature points identify 79% of hydrophobic ligand atoms, and 81% and 62% of the hydrogen acceptor and donor hydrogen ligand atoms interacting with the receptor, and predict 81.2% of water molecules mediating interactions between ligand and receptor. Finally, we illustrate potential uses of the predicted feature points in the context of lead optimization in drug discovery projects. Availability and Implementation: http://adfr.scripps.edu/AutoDockFR/autosite.html Contact: sanner@scripps.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:27354702

  20. Characterization of the binding of 8-anilinonaphthalene sulphonate to rat class Mu GST M1-1

    PubMed Central

    Kinsley, Nichole; Sayed, Yasien; Armstrong, Richard N.; Dirr, Heini W.

    2008-01-01

    Molecular docking and ANS-displacement experiments indicated that 8-anilinonaphthalene sulphonate (ANS) binds the hydrophobic site (H-site) in the active site of dimeric class Mu rGST M1-1. The naphthalene moiety provides most of the van der Waals contacts at the ANS-binding interface while the anilino group is able to sample different rotamers. The energetics of ANS binding were studied by isothermal titration calorimetry (ITC) over the temperature range of 5–30 °C. Binding is both enthalpically and entropically driven and displays a stoichiometry of one ANS molecule per subunit (or H-site). ANS binding is linked to the uptake of 0.5 protons at pH 6.5. Enthalpy of binding depends linearly upon temperature yielding a ΔCp of −80 ± 4 cal K−1 mol−1 indicating the burial of solvent-exposed nonpolar surface area upon ANS-protein complex formation. While ion-pair interactions between the sulfonate moiety of ANS and protein cationic groups may be significant for other ANS-binding proteins, the binding of ANS to rGST M1-1 is primarily hydrophobic in origin. The binding properties are compared with those of other GSTs and ANS-binding proteins. PMID:18703268

Top