Sample records for cryptic conserved conformationally

  1. DNA barcoding applied to ex situ tropical amphibian conservation programme reveals cryptic diversity in captive populations.


    Crawford, Andrew J; Cruz, Catalina; Griffith, Edgardo; Ross, Heidi; Ibáñez, Roberto; Lips, Karen R; Driskell, Amy C; Bermingham, Eldredge; Crump, Paul


    Amphibians constitute a diverse yet still incompletely characterized clade of vertebrates, in which new species are still being discovered and described at a high rate. Amphibians are also increasingly endangered, due in part to disease-driven threats of extinctions. As an emergency response, conservationists have begun ex situ assurance colonies for priority species. The abundance of cryptic amphibian diversity, however, may cause problems for ex situ conservation. In this study we used a DNA barcoding approach to survey mitochondrial DNA (mtDNA) variation in captive populations of 10 species of Neotropical amphibians maintained in an ex situ assurance programme at El Valle Amphibian Conservation Center (EVACC) in the Republic of Panama. We combined these mtDNA sequences with genetic data from presumably conspecific wild populations sampled from across Panama, and applied genetic distance-based and character-based analyses to identify cryptic lineages. We found that three of ten species harboured substantial cryptic genetic diversity within EVACC, and an additional three species harboured cryptic diversity among wild populations, but not in captivity. Ex situ conservation efforts focused on amphibians are therefore vulnerable to an incomplete taxonomy leading to misidentification among cryptic species. DNA barcoding may therefore provide a simple, standardized protocol to identify cryptic diversity readily applicable to any amphibian community.

  2. Evolutionary Conserved Positions Define Protein Conformational Diversity.


    Saldaño, Tadeo E; Monzon, Alexander M; Parisi, Gustavo; Fernandez-Alberti, Sebastian


    Conformational diversity of the native state plays a central role in modulating protein function. The selection paradigm sustains that different ligands shift the conformational equilibrium through their binding to highest-affinity conformers. Intramolecular vibrational dynamics associated to each conformation should guarantee conformational transitions, which due to its importance, could possibly be associated with evolutionary conserved traits. Normal mode analysis, based on a coarse-grained model of the protein, can provide the required information to explore these features. Herein, we present a novel procedure to identify key positions sustaining the conformational diversity associated to ligand binding. The method is applied to an adequate refined dataset of 188 paired protein structures in their bound and unbound forms. Firstly, normal modes most involved in the conformational change are selected according to their corresponding overlap with structural distortions introduced by ligand binding. The subspace defined by these modes is used to analyze the effect of simulated point mutations on preserving the conformational diversity of the protein. We find a negative correlation between the effects of mutations on these normal mode subspaces associated to ligand-binding and position-specific evolutionary conservations obtained from multiple sequence-structure alignments. Positions whose mutations are found to alter the most these subspaces are defined as key positions, that is, dynamically important residues that mediate the ligand-binding conformational change. These positions are shown to be evolutionary conserved, mostly buried aliphatic residues localized in regular structural regions of the protein like β-sheets and α-helix. PMID:27008419

  3. Evolutionary Conserved Positions Define Protein Conformational Diversity

    PubMed Central

    Saldaño, Tadeo E.; Monzon, Alexander M.; Parisi, Gustavo; Fernandez-Alberti, Sebastian


    Conformational diversity of the native state plays a central role in modulating protein function. The selection paradigm sustains that different ligands shift the conformational equilibrium through their binding to highest-affinity conformers. Intramolecular vibrational dynamics associated to each conformation should guarantee conformational transitions, which due to its importance, could possibly be associated with evolutionary conserved traits. Normal mode analysis, based on a coarse-grained model of the protein, can provide the required information to explore these features. Herein, we present a novel procedure to identify key positions sustaining the conformational diversity associated to ligand binding. The method is applied to an adequate refined dataset of 188 paired protein structures in their bound and unbound forms. Firstly, normal modes most involved in the conformational change are selected according to their corresponding overlap with structural distortions introduced by ligand binding. The subspace defined by these modes is used to analyze the effect of simulated point mutations on preserving the conformational diversity of the protein. We find a negative correlation between the effects of mutations on these normal mode subspaces associated to ligand-binding and position-specific evolutionary conservations obtained from multiple sequence-structure alignments. Positions whose mutations are found to alter the most these subspaces are defined as key positions, that is, dynamically important residues that mediate the ligand-binding conformational change. These positions are shown to be evolutionary conserved, mostly buried aliphatic residues localized in regular structural regions of the protein like β-sheets and α-helix. PMID:27008419

  4. Interview-based sighting histories can inform regional conservation prioritization for highly threatened cryptic species

    PubMed Central

    Turvey, Samuel T; Trung, Cao Tien; Quyet, Vo Dai; Nhu, Hoang Van; Thoai, Do Van; Tuan, Vo Cong Anh; Hoa, Dang Thi; Kacha, Kouvang; Sysomphone, Thongsay; Wallate, Sousakhone; Hai, Chau Thi Thanh; Thanh, Nguyen Van; Wilkinson, Nicholas M


    The use of robust ecological data to make evidence-based management decisions is frequently prevented by limited data quantity or quality, and local ecological knowledge (LEK) is increasingly seen as an important source of information for conservation. However, there has been little assessment of LEK's usefulness for informing prioritization and management of landscapes for threatened species, or assessing comparative species status across landscapes. A large-scale interview survey in the Annamite Mountains (Vietnam and Lao PDR) compiled the first systematic LEK data set for saola Pseudoryx nghetinhensis, one of the world's rarest mammals, and eight other ungulates. Saola conservation is hindered by uncertainty over continued presence across much of its proposed distribution. We analysed comparative LEK-based last-sighting data across three landscapes to determine whether regional sighting histories support previous suggestions of landscape importance for saola conservation (Hue-Quang Nam: top-priority Vietnamese landscape; Pu Mat: lower priority Vietnamese landscape; Viengthong: high-priority Lao landscape) and whether they constitute an effective spatial prioritization tool for cryptic species management. Wild pig and red muntjac may be the only Annamite ungulates with stable populations; the regional status of all other species appears to be worse. Saola have declined more severely and/or are significantly rarer than most other ungulates and have been seen by relatively few respondents. Saola were also frequently considered locally rarest or declining, and never as species that had not declined. In contrast to other species, there are no regional differences in saola sighting histories, with continued persistence in all landscapes challenging suggestions that regional status differs greatly. Remnant populations persist in Vietnam despite heavy hunting, but even remote landscapes in Lao may be under intense pressure. Synthesis and applications. Our local

  5. Conservation Genetics of the Philippine Tarsier: Cryptic Genetic Variation Restructures Conservation Priorities for an Island Archipelago Primate

    PubMed Central

    Brown, Rafe M.; Weghorst, Jennifer A.; Olson, Karen V.; Duya, Mariano R. M.; Barley, Anthony J.; Duya, Melizar V.; Shekelle, Myron; Neri-Arboleda, Irene; Esselstyn, Jacob A.; Dominy, Nathaniel J.; Ong, Perry S.; Moritz, Gillian L.; Luczon, Adrian; Diesmos, Mae Lowe L.; Diesmos, Arvin C.; Siler, Cameron D.


    Establishment of conservation priorities for primates is a particular concern in the island archipelagos of Southeast Asia, where rates of habitat destruction are among the highest in the world. Conservation programs require knowledge of taxonomic diversity to ensure success. The Philippine tarsier is a flagship species that promotes environmental awareness and a thriving ecotourism economy in the Philippines. However, assessment of its conservation status has been impeded by taxonomic uncertainty, a paucity of field studies, and a lack of vouchered specimens and genetic samples available for study in biodiversity repositories. Consequently, conservation priorities are unclear. In this study we use mitochondrial and nuclear DNA to empirically infer geographic partitioning of genetic variation and to identify evolutionarily distinct lineages for conservation action. The distribution of Philippine tarsier genetic diversity is neither congruent with expectations based on biogeographical patterns documented in other Philippine vertebrates, nor does it agree with the most recent Philippine tarsier taxonomic arrangement. We identify three principal evolutionary lineages that do not correspond to the currently recognized subspecies, highlight the discovery of a novel cryptic and range-restricted subcenter of genetic variation in an unanticipated part of the archipelago, and identify additional geographically structured genetic variation that should be the focus of future studies and conservation action. Conservation of this flagship species necessitates establishment of protected areas and targeted conservation programs within the range of each genetically distinct variant of the Philippine tarsier. PMID:25136854

  6. Conservation genetics of the Philippine tarsier: cryptic genetic variation restructures conservation priorities for an island archipelago primate.


    Brown, Rafe M; Weghorst, Jennifer A; Olson, Karen V; Duya, Mariano R M; Barley, Anthony J; Duya, Melizar V; Shekelle, Myron; Neri-Arboleda, Irene; Esselstyn, Jacob A; Dominy, Nathaniel J; Ong, Perry S; Moritz, Gillian L; Luczon, Adrian; Diesmos, Mae Lowe L; Diesmos, Arvin C; Siler, Cameron D


    Establishment of conservation priorities for primates is a particular concern in the island archipelagos of Southeast Asia, where rates of habitat destruction are among the highest in the world. Conservation programs require knowledge of taxonomic diversity to ensure success. The Philippine tarsier is a flagship species that promotes environmental awareness and a thriving ecotourism economy in the Philippines. However, assessment of its conservation status has been impeded by taxonomic uncertainty, a paucity of field studies, and a lack of vouchered specimens and genetic samples available for study in biodiversity repositories. Consequently, conservation priorities are unclear. In this study we use mitochondrial and nuclear DNA to empirically infer geographic partitioning of genetic variation and to identify evolutionarily distinct lineages for conservation action. The distribution of Philippine tarsier genetic diversity is neither congruent with expectations based on biogeographical patterns documented in other Philippine vertebrates, nor does it agree with the most recent Philippine tarsier taxonomic arrangement. We identify three principal evolutionary lineages that do not correspond to the currently recognized subspecies, highlight the discovery of a novel cryptic and range-restricted subcenter of genetic variation in an unanticipated part of the archipelago, and identify additional geographically structured genetic variation that should be the focus of future studies and conservation action. Conservation of this flagship species necessitates establishment of protected areas and targeted conservation programs within the range of each genetically distinct variant of the Philippine tarsier. PMID:25136854

  7. Conservation genetics of the Philippine tarsier: cryptic genetic variation restructures conservation priorities for an island archipelago primate.


    Brown, Rafe M; Weghorst, Jennifer A; Olson, Karen V; Duya, Mariano R M; Barley, Anthony J; Duya, Melizar V; Shekelle, Myron; Neri-Arboleda, Irene; Esselstyn, Jacob A; Dominy, Nathaniel J; Ong, Perry S; Moritz, Gillian L; Luczon, Adrian; Diesmos, Mae Lowe L; Diesmos, Arvin C; Siler, Cameron D


    Establishment of conservation priorities for primates is a particular concern in the island archipelagos of Southeast Asia, where rates of habitat destruction are among the highest in the world. Conservation programs require knowledge of taxonomic diversity to ensure success. The Philippine tarsier is a flagship species that promotes environmental awareness and a thriving ecotourism economy in the Philippines. However, assessment of its conservation status has been impeded by taxonomic uncertainty, a paucity of field studies, and a lack of vouchered specimens and genetic samples available for study in biodiversity repositories. Consequently, conservation priorities are unclear. In this study we use mitochondrial and nuclear DNA to empirically infer geographic partitioning of genetic variation and to identify evolutionarily distinct lineages for conservation action. The distribution of Philippine tarsier genetic diversity is neither congruent with expectations based on biogeographical patterns documented in other Philippine vertebrates, nor does it agree with the most recent Philippine tarsier taxonomic arrangement. We identify three principal evolutionary lineages that do not correspond to the currently recognized subspecies, highlight the discovery of a novel cryptic and range-restricted subcenter of genetic variation in an unanticipated part of the archipelago, and identify additional geographically structured genetic variation that should be the focus of future studies and conservation action. Conservation of this flagship species necessitates establishment of protected areas and targeted conservation programs within the range of each genetically distinct variant of the Philippine tarsier.

  8. The conformal supercurrents in diverse dimensions and conserved superconformal currents

    NASA Astrophysics Data System (ADS)

    Korovin, Yegor; Kuzenko, Sergei M.; Theisen, Stefan


    Given a conserved and traceless energy-momentum tensor and a conformal Killing vector, one obtains a conserved current. We generalise this construction to superconformal theories in three, four, five and six dimensions with various amounts of supersymmetry by working in the appropriate superspaces.

  9. Cryptic Diversity in Indo-Australian Rainbowfishes Revealed by DNA Barcoding: Implications for Conservation in a Biodiversity Hotspot Candidate

    PubMed Central

    Kadarusman; Hubert, Nicolas; Hadiaty, Renny Kurnia; Sudarto; Paradis, Emmanuel; Pouyaud, Laurent


    The rainbowfishes of the family Melanotaeniidae represent one of the largest radiations of freshwater fishes from the Indo-Australian archipelago. A total of 75 nominal species have been described, among which several have become very popular among tropical fish hobbyists because of their tendency to form large schools of colourful individuals. Facing habitat loss and competition or predation by introduced species, this group has become a priority in the conservation of ornamental fishes in Indonesia. In this context, several expeditions have been conducted between 2007 and 2010 in Indonesian Papua with the aim to initiate a large-scale survey of the genetic resources in this group. We assessed the diversity of the Papua rainbowfishes with DNA barcoding. We sequenced the mitochondrial COI gene for 350 specimens belonging to 53 nominal species throughout the Indo-Australian archipelago. Unexpected levels of cryptic diversity and endemism were detected since additional cryptic lineages were detected in several watersheds from the Vogelkop and the Lengguru massif. DNA barcoding supports the presence of nearly 30 evolutionary lineages among the 15 nominal species sampled in the Vogelkop and all these lineages are endemic to a single lake or watershed. This result highlights that the diversity of the family has been largely underestimated and urges for the identification of conservation priorities in Papua. PMID:22829879

  10. Phylogenetic conservation of the 3' cryptic recombination signal sequence (3'cRSS) in the VH genes of jawed vertebrates.


    Sun, Yi; Liu, Zhancai; Li, Zhaoyong; Lian, Zhengxing; Zhao, Yaofeng


    The VH replacement process is a RAG-mediated secondary recombination in which the variable region of a rearranged VHDJH is replaced by a different germline VH gene. In almost all human and mouse VH genes, two sequence features appear to be crucial for VH replacement. First, an embedded heptamer, which is located near the 3' end of the rearranged VH gene, serves as a cryptic recombination signal sequence (3'cRSS) for the VH replacement process. Second, a short stretch of nucleotides located downstream of the 3'cRSS serve as a footprint of the original VH region, frequently encoding charged amino acids. In this review, we show that both of these two features are conserved in the VH genes of all jawed vertebrates, which suggests that the VH replacement process may be a conserved mechanism.

  11. Conformal field theories with infinitely many conservation laws

    SciTech Connect

    Todorov, Ivan


    Globally conformal invariant quantum field theories in a D-dimensional space-time (D even) have rational correlation functions and admit an infinite number of conserved (symmetric traceless) tensor currents. In a theory of a scalar field of dimension D-2 they were demonstrated to be generated by bilocal normal products of free massless scalar fields with an O(N), U(N), or Sp(2N) (global) gauge symmetry [B. Bakalov, N. M. Nikolov, K.-H. Rehren, and I. Todorov, 'Unitary positive energy representations of scalar bilocal fields,' Commun. Math. Phys. 271, 223-246 (2007); e-print arXiv:math-ph/0604069v3; and 'Infinite dimensional Lie algebras in 4D conformal quantum field theory,' J. Phys. A Math Theor. 41, 194002 (2008); e-print arXiv:0711.0627v2 [hep-th

  12. Conservation of the conformation of the porphyrin macrocycle in hemoproteins.


    Jentzen, W; Ma, J G; Shelnutt, J A


    The out-of-plane distortions of porphyrins in hemoproteins are characterized by displacements along the lowest-frequency out-of-plane normal coordinates of the D4h-symmetric macrocycle. X-ray crystal structures are analyzed using a computational procedure developed for determining these orthogonal displacements. The x-ray crystal structures of the heme groups are described within experimental error, using the set composed of only the lowest frequency normal coordinate of each out-of-plane symmetry type. That is, the distortion is accurately simulated by a linear combination of these orthonormal deformations, which include saddling (B2u), ruffling (B1u), doming (A2u), waving (Eg), and propellering (A1u). For example, orthonormal structural decomposition of the hemes in deoxymyoglobins reveals a predominantly dom heme deformation combined with a smaller wav(y) deformation. Generally, the heme conformation is remarkably similar for proteins from different species. For cytochromes c, the conformation is conserved as long as the amino acids between the cysteine linkages to the heme are homologous. Differences occur if this short segment varies in the number or type of residues, suggesting that this small segment causes the nonplanar distortion. Some noncovalently linked hemes like those in the peroxidases also have highly conserved characteristic distortions. Conservation occurs even for some proteins with a large natural variation in the amino acid sequence.

  13. Exploring the conformational diversity of loops on conserved frameworks.


    Li, W; Liang, S; Wang, R; Lai, L; Han, Y


    Loops are structurally variable regions, but the secondary structural elements bracing loops are often conserved. Motifs with similar secondary structures exist in the same and different protein families. In this study, we made an all-PDB-based analysis and produced 495 motif families accessible from the Internet. Every motif family contains some variable loops spanning a common framework (a pair of secondary structures). The diversity of loops and the convergence of frameworks were examined. In addition, we also identified 119 loops with conformational changes in different PDB files. These materials can give some directions for functional loop design and flexible docking. PMID:10611401

  14. The role of integrative taxonomy in the conservation management of cryptic species: the taxonomic status of endangered earless dragons (Agamidae: Tympanocryptis) in the grasslands of Queensland, Australia.


    Melville, Jane; Smith, Katie; Hobson, Rod; Hunjan, Sumitha; Shoo, Luke


    Molecular phylogenetics is increasingly highlighting the prevalence of cryptic species, where morphologically similar organisms have long independent evolutionary histories. When such cryptic species are known to be declining in numbers and are at risk of extinction due to a range of threatening processes, the disjunction between molecular systematics research and conservation policy becomes a significant problem. We investigate the taxonomic status of Tympanocryptis populations in Queensland, which have previously been assigned to T. tetraporophora, using three species delimitation approaches. The taxonomic uncertainties in this species-group are of particular importance in the Darling Downs Earless Dragon (T. cf. tetraporophora), which is ranked as an endangered 'species' of high priority for conservation by the Queensland Department of Environment and Heritage Protection. We undertook a morphological study, integrated with a comprehensive genetic study and species delimitation analyses, to investigate the species status of populations in the region. Phylogenetic analyses of two gene regions (mtDNA: ND2; nuclear: RAG1) revealed high levels of genetic divergence between populations, indicating isolation over long evolutionary time frames, and strongly supporting two independent evolutionary lineages in southeastern Queensland, from the Darling Downs, and a third in the Gulf Region of northern Queensland. Of the three species delimitation protocols used, we found integrative taxonomy the most applicable to this cryptic species complex. Our study demonstrates the utility of integrative taxonomy as a species delimitation approach in cryptic complexes of species with conservation significance, where limited numbers of specimens are available.

  15. The Role of Integrative Taxonomy in the Conservation Management of Cryptic Species: The Taxonomic Status of Endangered Earless Dragons (Agamidae: Tympanocryptis) in the Grasslands of Queensland, Australia

    PubMed Central

    Melville, Jane; Smith, Katie; Hobson, Rod; Hunjan, Sumitha; Shoo, Luke


    Molecular phylogenetics is increasingly highlighting the prevalence of cryptic species, where morphologically similar organisms have long independent evolutionary histories. When such cryptic species are known to be declining in numbers and are at risk of extinction due to a range of threatening processes, the disjunction between molecular systematics research and conservation policy becomes a significant problem. We investigate the taxonomic status of Tympanocryptis populations in Queensland, which have previously been assigned to T. tetraporophora, using three species delimitation approaches. The taxonomic uncertainties in this species-group are of particular importance in the Darling Downs Earless Dragon (T. cf. tetraporophora), which is ranked as an endangered ‘species’ of high priority for conservation by the Queensland Department of Environment and Heritage Protection. We undertook a morphological study, integrated with a comprehensive genetic study and species delimitation analyses, to investigate the species status of populations in the region. Phylogenetic analyses of two gene regions (mtDNA: ND2; nuclear: RAG1) revealed high levels of genetic divergence between populations, indicating isolation over long evolutionary time frames, and strongly supporting two independent evolutionary lineages in southeastern Queensland, from the Darling Downs, and a third in the Gulf Region of northern Queensland. Of the three species delimitation protocols used, we found integrative taxonomy the most applicable to this cryptic species complex. Our study demonstrates the utility of integrative taxonomy as a species delimitation approach in cryptic complexes of species with conservation significance, where limited numbers of specimens are available. PMID:25076129

  16. Conformal field theories with infinitely many conservation laws

    NASA Astrophysics Data System (ADS)

    Todorov, Ivan


    Globally conformal invariant quantum field theories in a D-dimensional space-time (D even) have rational correlation functions and admit an infinite number of conserved (symmetric traceless) tensor currents. In a theory of a scalar field of dimension D-2 they were demonstrated to be generated by bilocal normal products of free massless scalar fields with an O(N), U(N), or Sp(2N) (global) gauge symmetry [B. Bakalov, N. M. Nikolov, K.-H. Rehren, and I. Todorov, "Unitary positive energy representations of scalar bilocal fields," Commun. Math. Phys. 271, 223-246 (2007), 10.1007/s00220-006-0182-2; e-print arXiv:math-ph/0604069v3; B. Bakalov, N. M. Nikolov, K.-H. Rehren, and I. Todorov, "Infinite dimensional Lie algebras in 4D conformal quantum field theory," J. Phys. A Math Theor. 41, 194002 (2008), 10.1088/1751-8113/41/19/194002; e-print arXiv:0711.0627v2 [hep-th

  17. CryptoSite: Expanding the Druggable Proteome by Characterization and Prediction of Cryptic Binding Sites.


    Cimermancic, Peter; Weinkam, Patrick; Rettenmaier, T Justin; Bichmann, Leon; Keedy, Daniel A; Woldeyes, Rahel A; Schneidman-Duhovny, Dina; Demerdash, Omar N; Mitchell, Julie C; Wells, James A; Fraser, James S; Sali, Andrej


    Many proteins have small-molecule binding pockets that are not easily detectable in the ligand-free structures. These cryptic sites require a conformational change to become apparent; a cryptic site can therefore be defined as a site that forms a pocket in a holo structure, but not in the apo structure. Because many proteins appear to lack druggable pockets, understanding and accurately identifying cryptic sites could expand the set of drug targets. Previously, cryptic sites were identified experimentally by fragment-based ligand discovery and computationally by long molecular dynamics simulations and fragment docking. Here, we begin by constructing a set of structurally defined apo-holo pairs with cryptic sites. Next, we comprehensively characterize the cryptic sites in terms of their sequence, structure, and dynamics attributes. We find that cryptic sites tend to be as conserved in evolution as traditional binding pockets but are less hydrophobic and more flexible. Relying on this characterization, we use machine learning to predict cryptic sites with relatively high accuracy (for our benchmark, the true positive and false positive rates are 73% and 29%, respectively). We then predict cryptic sites in the entire structurally characterized human proteome (11,201 structures, covering 23% of all residues in the proteome). CryptoSite increases the size of the potentially "druggable" human proteome from ~40% to ~78% of disease-associated proteins. Finally, to demonstrate the utility of our approach in practice, we experimentally validate a cryptic site in protein tyrosine phosphatase 1B using a covalent ligand and NMR spectroscopy. The CryptoSite Web server is available at

  18. Quorum sensing-controlled Evr regulates a conserved cryptic pigment biosynthetic cluster and a novel phenomycin-like locus in the plant pathogen, Pectobacterium carotovorum.


    Williamson, Neil R; Commander, Paul M B; Salmond, George P C


    Pectobacterium carotovorum SCRI193 is a phytopathogenic Gram-negative bacterium. In this study, we have identified a novel cryptic pigment biosynthetic locus in P. carotovorum SCRI193 which we have called the Pectobacterium orange pigment (pop) cluster. The pop cluster is flanked by two tRNA genes and contains genes that encode non-ribosomal peptide synthases and polyketide synthase and produces a negatively charged polar orange pigment. Orange pigment production is activated when an adjacent transcriptional activator sharing sequence similarity with the Erwinia virulence regulator (Evr) is overexpressed. Evr was shown to positively activate its own transcription and that of the pigment biosynthetic genes and an unlinked locus encoding a phenomycin homologue. In addition, the expression of Evr and orange pigment production was shown to be regulated by N-(3-oxohexanoyl)-HSL (OHHL) quorum sensing and have a virulence phenotype in potato. Finally, by comparative genomics and Southern blotting we demonstrate that this pigment biosynthetic cluster is present in multiple P. carotovorum spp., Pectobacterium brasiliensis 1692 and a truncated version of the cluster is present in Pectobacterium atrosepticum. The conserved nature of this cluster in P. carotovorum and P. brasiliensis suggests that the pop cluster has an important function in these broad-host-range soft rotting bacteria, which is no longer required in the narrow-host-range P. atrosepticum SCRI1043.

  19. [Interconnection between architecture of protein globule and disposition of conformational conservative oligopeptides in proteins from one protein family].


    Batianovskiĭ, A V; Filatov, I V; Namiot, V A; Esipova, N G; Volotovskiĭ, I D


    It was shown that selective interactions between helical segments of macromolecules can realize in globular proteins in the segments characterized by the same periodicities of charge distribution i.e. between conformationally conservative oligopeptides. It was found that in the macromolecules of alpha-helical proteins conformationally conservative oligopeptides are disposed at a distance being characteristic of direct interactions. For representatives of many structural families of alpha-type proteins specific disposition of conformationally conservative segments is observed. This disposition is inherent to a particular structural family. Disposition of conformationally conservative segments is not related to homology of the amino acid sequence but reflects peculiarities of native 3D-architectures of protein globules.

  20. Anthropogenic impacts drive niche and conservation metrics of a cryptic rattlesnake on the Colorado Plateau of western North America.


    Douglas, M R; Davis, M A; Amarello, M; Smith, J J; Schuett, G W; Herrmann, H-W; Holycross, A T; Douglas, M E


    Ecosystems transition quickly in the Anthropocene, whereas biodiversity adapts more slowly. Here we simulated a shifting woodland ecosystem on the Colorado Plateau of western North America by using as its proxy over space and time the fundamental niche of the Arizona black rattlesnake (Crotalus cerberus). We found an expansive (= end-of-Pleistocene) range that contracted sharply (= present), but is blocked topographically by Grand Canyon/Colorado River as it shifts predictably northwestward under moderate climate change (= 2080). Vulnerability to contemporary wildfire was quantified from available records, with forested area reduced more than 27% over 13 years. Both 'ecosystem metrics' underscore how climate and wildfire are rapidly converting the Plateau ecosystem into novel habitat. To gauge potential effects on C. cerberus, we derived a series of relevant 'conservation metrics' (i.e. genetic variability, dispersal capacity, effective population size) by sequencing 118 individuals across 846 bp of mitochondrial (mt)DNA-ATPase8/6. We identified five significantly different clades (net sequence divergence = 2.2%) isolated by drainage/topography, with low dispersal (F ST = 0.82) and small sizes (2N ef = 5.2). Our compiled metrics (i.e. small-populations, topographic-isolation, low-dispersal versus conserved-niche, vulnerable-ecosystem, dispersal barriers) underscore the susceptibility of this woodland specialist to a climate and wildfire tandem. We offer adaptive management scenarios that may counterbalance these metrics and avoid the extirpation of this and other highly specialized, relictual woodland clades.

  1. Anthropogenic impacts drive niche and conservation metrics of a cryptic rattlesnake on the Colorado Plateau of western North America

    PubMed Central

    Douglas, M. R.; Davis, M. A.; Amarello, M.; Smith, J. J.; Schuett, G. W.; Herrmann, H.-W.; Holycross, A. T.; Douglas, M. E.


    Ecosystems transition quickly in the Anthropocene, whereas biodiversity adapts more slowly. Here we simulated a shifting woodland ecosystem on the Colorado Plateau of western North America by using as its proxy over space and time the fundamental niche of the Arizona black rattlesnake (Crotalus cerberus). We found an expansive (= end-of-Pleistocene) range that contracted sharply (= present), but is blocked topographically by Grand Canyon/Colorado River as it shifts predictably northwestward under moderate climate change (= 2080). Vulnerability to contemporary wildfire was quantified from available records, with forested area reduced more than 27% over 13 years. Both ‘ecosystem metrics' underscore how climate and wildfire are rapidly converting the Plateau ecosystem into novel habitat. To gauge potential effects on C. cerberus, we derived a series of relevant ‘conservation metrics' (i.e. genetic variability, dispersal capacity, effective population size) by sequencing 118 individuals across 846 bp of mitochondrial (mt)DNA-ATPase8/6. We identified five significantly different clades (net sequence divergence = 2.2%) isolated by drainage/topography, with low dispersal (FST = 0.82) and small sizes (2Nef = 5.2). Our compiled metrics (i.e. small-populations, topographic-isolation, low-dispersal versus conserved-niche, vulnerable-ecosystem, dispersal barriers) underscore the susceptibility of this woodland specialist to a climate and wildfire tandem. We offer adaptive management scenarios that may counterbalance these metrics and avoid the extirpation of this and other highly specialized, relictual woodland clades. PMID:27152218

  2. Anthropogenic impacts drive niche and conservation metrics of a cryptic rattlesnake on the Colorado Plateau of western North America.


    Douglas, M R; Davis, M A; Amarello, M; Smith, J J; Schuett, G W; Herrmann, H-W; Holycross, A T; Douglas, M E


    Ecosystems transition quickly in the Anthropocene, whereas biodiversity adapts more slowly. Here we simulated a shifting woodland ecosystem on the Colorado Plateau of western North America by using as its proxy over space and time the fundamental niche of the Arizona black rattlesnake (Crotalus cerberus). We found an expansive (= end-of-Pleistocene) range that contracted sharply (= present), but is blocked topographically by Grand Canyon/Colorado River as it shifts predictably northwestward under moderate climate change (= 2080). Vulnerability to contemporary wildfire was quantified from available records, with forested area reduced more than 27% over 13 years. Both 'ecosystem metrics' underscore how climate and wildfire are rapidly converting the Plateau ecosystem into novel habitat. To gauge potential effects on C. cerberus, we derived a series of relevant 'conservation metrics' (i.e. genetic variability, dispersal capacity, effective population size) by sequencing 118 individuals across 846 bp of mitochondrial (mt)DNA-ATPase8/6. We identified five significantly different clades (net sequence divergence = 2.2%) isolated by drainage/topography, with low dispersal (F ST = 0.82) and small sizes (2N ef = 5.2). Our compiled metrics (i.e. small-populations, topographic-isolation, low-dispersal versus conserved-niche, vulnerable-ecosystem, dispersal barriers) underscore the susceptibility of this woodland specialist to a climate and wildfire tandem. We offer adaptive management scenarios that may counterbalance these metrics and avoid the extirpation of this and other highly specialized, relictual woodland clades. PMID:27152218

  3. A conserved karyotype of Sternopygus macrurus (Sternopygidae, Gymnotiformes) in the Amazon region: differences from other hydrographic basins suggest cryptic speciation.


    dos Santos Silva, Danillo; Milhomem, Susana Suely Rodrigues; de Souza, Augusto Cezar Paes; Pieczarka, Julio Cesar; Nagamachi, Cleusa Yoshiko


    We studied the karyotypes of 35 Sternopygus macrurus fishes of four localities from rivers of the Eastern Amazon basin. In these four places the karyotypes have 2n=46 chromosomes, NF=92, where 30 are metacentric (M) and 16 submetacentric (SM). The constitutive heterochromatin (CH) is found in the centromeric region of most chromosomes and in the pericentromeric region of pairs 5, 17 and 19. Pair 1 has a large and not common heterochromatic block in the short arm, useful as a marker for this species if not found in other Sternopygus taxa. The NOR is located in the distal region of the short arm of pair 1, showing a size heteromorphism in some specimens. The CMA(3) and DAPI fluorochrome bandings and the fluorescent in situ hybridization (FISH), using pantelomeric human probes techniques are described for the first time for this species. DAPI has banding coincident with the C-banded regions, which suggests that the CH is AT base-pair-rich. CMA(3) banding is coincident with the NOR, meaning that this region is GC base-pair-rich. The FISH showed that the probes hybridized only with the telomeric regions, without any sign of interstitial telomeric regions. The karyotype of the samples from different places in the Amazon basin is quite conserved, probably because of the gene flow among the populations. The karyotype differences among the Sternopygus macrurus from the Amazon basin and the São Francisco and Paraná rivers suggest that these taxa may be different species. PMID:18486480

  4. Conformational changes in the archaerhodopsin-3 proton pump: detection of conserved strongly hydrogen bonded water networks.


    Clair, Erica C Saint; Ogren, John I; Mamaev, Sergey; Kralj, Joel M; Rothschild, Kenneth J


    Archaerhodopsin-3 (AR3) is a light-driven proton pump from Halorubrum sodomense, but little is known about its photocycle. Recent interest has focused on AR3 because of its ability to serve both as a high-performance, genetically-targetable optical silencer of neuronal activity and as a membrane voltage sensor. We examined light-activated structural changes of the protein, retinal chromophore, and internal water molecules during the photocycle of AR3. Low-temperature and rapid-scan time-resolved FTIR-difference spectroscopy revealed that conformational changes during formation of the K, M, and N photocycle intermediates are similar, although not identical, to bacteriorhodopsin (BR). Positive/negative bands in the region above 3,600 cm( - 1), which have previously been assigned to structural changes of weakly hydrogen bonded internal water molecules, were substantially different between AR3 and BR. This included the absence of positive bands recently associated with a chain of proton transporting water molecules in the cytoplasmic channel and a weakly hydrogen bonded water (W401), which is part of a hydrogen-bonded pentagonal cluster located near the retinal Schiff base. However, many of the broad IR continuum absorption changes below 3,000 cm( - 1) assigned to networks of water molecules involved in proton transport through cytoplasmic and extracellular portions in BR were very similar in AR3. This work and subsequent studies comparing BR and AR3 structural changes will help identify conserved elements in BR-like proton pumps as well as bioengineer AR3 to optimize neural silencing and voltage sensing. PMID:23277676

  5. The "Cryptic" Escherichia.


    Walk, Seth T


    In 2009, five monophyletic Escherichia clades were described and referred to as "cryptic" based on the inability to distinguish them from representative E. coli isolates using diagnostic biochemical reactions. Since this original publication, a number of studies have explored the genomic, transcriptomic, and phenotypic diversity of cryptic clade isolates to better understand their phylogenetic, physiological, and ecological distinctiveness with respect to previously named Escherichia species. This chapter reviews the original discovery of the cryptic clades, discusses available evidence that some are environmentally adapted, and evaluates current support for taxonomic designations of these microorganisms. The importance of these clades to clinical research, epidemiology, population genetics, and microbial speciation is also discussed.

  6. Multiple conformations are a conserved and regulatory feature of the RB1 5′ UTR

    PubMed Central

    Kutchko, Katrina M.; Sanders, Wes; Ziehr, Ben; Phillips, Gabriela; Solem, Amanda; Halvorsen, Matthew; Weeks, Kevin M.; Moorman, Nathaniel


    Folding to a well-defined conformation is essential for the function of structured ribonucleic acids (RNAs) like the ribosome and tRNA. Structured elements in the untranslated regions (UTRs) of specific messenger RNAs (mRNAs) are known to control expression. The importance of unstructured regions adopting multiple conformations, however, is still poorly understood. High-resolution SHAPE-directed Boltzmann suboptimal sampling of the Homo sapiens Retinoblastoma 1 (RB1) 5′ UTR yields three distinct conformations compatible with the experimental data. Private single nucleotide variants (SNVs) identified in two patients with retinoblastoma each collapse the structural ensemble to a single but distinct well-defined conformation. The RB1 5′ UTRs from Bos taurus (cow) and Trichechus manatus latirostris (manatee) are divergent in sequence from H. sapiens (human) yet maintain structural compatibility with high-probability base pairs. SHAPE chemical probing of the cow and manatee RB1 5′ UTRs reveals that they also adopt multiple conformations. Luciferase reporter assays reveal that 5′ UTR mutations alter RB1 expression. In a traditional model of disease, causative SNVs disrupt a key structural element in the RNA. For the subset of patients with heritable retinoblastoma-associated SNVs in the RB1 5′ UTR, the absence of multiple structures is likely causative of the cancer. Our data therefore suggest that selective pressure will favor multiple conformations in eukaryotic UTRs to regulate expression. PMID:25999316

  7. Multiple conformations are a conserved and regulatory feature of the RB1 5' UTR.


    Kutchko, Katrina M; Sanders, Wes; Ziehr, Ben; Phillips, Gabriela; Solem, Amanda; Halvorsen, Matthew; Weeks, Kevin M; Moorman, Nathaniel; Laederach, Alain


    Folding to a well-defined conformation is essential for the function of structured ribonucleic acids (RNAs) like the ribosome and tRNA. Structured elements in the untranslated regions (UTRs) of specific messenger RNAs (mRNAs) are known to control expression. The importance of unstructured regions adopting multiple conformations, however, is still poorly understood. High-resolution SHAPE-directed Boltzmann suboptimal sampling of the Homo sapiens Retinoblastoma 1 (RB1) 5' UTR yields three distinct conformations compatible with the experimental data. Private single nucleotide variants (SNVs) identified in two patients with retinoblastoma each collapse the structural ensemble to a single but distinct well-defined conformation. The RB1 5' UTRs from Bos taurus (cow) and Trichechus manatus latirostris (manatee) are divergent in sequence from H. sapiens (human) yet maintain structural compatibility with high-probability base pairs. SHAPE chemical probing of the cow and manatee RB1 5' UTRs reveals that they also adopt multiple conformations. Luciferase reporter assays reveal that 5' UTR mutations alter RB1 expression. In a traditional model of disease, causative SNVs disrupt a key structural element in the RNA. For the subset of patients with heritable retinoblastoma-associated SNVs in the RB1 5' UTR, the absence of multiple structures is likely causative of the cancer. Our data therefore suggest that selective pressure will favor multiple conformations in eukaryotic UTRs to regulate expression. PMID:25999316

  8. Range-wide molecular analysis of the western pond turtle (Emys marmorata): cryptic variation, isolation by distance, and their conservation implications.


    Spinks, Phillip Q; Shaffer, H Bradley


    We analysed phylogeography and population genetic variation across the range of the western pond turtle (Emys marmorata) using rapidly evolving mitochondrial and nuclear DNA sequence data. Nuclear DNA sequences from two unlinked introns displayed extremely low levels of variation, but phylogenetic analyses based on mtDNA recovered four well-supported and geographically coherent clades. These included a large Northern clade composed of populations from Washington south to San Luis Obispo County, California, west of the Coast Ranges; a San Joaquin Valley clade from the southern Great Central Valley; a geographically restricted Santa Barbara clade from a limited region in Santa Barbara and Ventura counties; and a Southern clade that occurs south of the Tehachapi Mountains and west of the Transverse Range south to Baja California, Mexico. An analysis of molecular variance (amova) based on regional hydrographic units revealed that populations from the Sacramento Valley north to Washington were virtually invariant, with no evidence of population substructure among northern river drainage basins. In other areas, E. marmorata contains considerable unrecognized variation, particularly in central and southern California and in northern Baja California, Mexico. Our northern clade is congruent with the distribution of the subspecies Emys marmorata marmorata (Washington-central California). However, no clade is congruent with the distribution of the southern subspecies Emys marmorata pallida from central California-Baja. Thus, recognition of the current subspecies split is not warranted, based on the available genetic evidence. Our amova and phylogenetic results, in conjunction with a growing comparative database for other codistributed aquatic taxa, confirm the occurrence of genetic breaks across the Tehachapi Mountains and Transverse Range bounding the southern end of the Great Central Valley, and point to southern California as a rich source of cryptic genetic variation

  9. Evolutionarily conserved and conformationally constrained short peptides might serve as DNA recognition elements in intrinsically disordered regions.


    Tayal, Nitish; Choudhary, Preeti; Pandit, Shashi B; Sandhu, Kuljeet Singh


    Despite recent advances, it is yet not clear how intrinsically disordered regions in proteins recognize their targets without any defined structures. Short linear motifs had been proposed to mediate molecular recognition by disordered regions; however, the underlying structural prerequisite remains elusive. Moreover, the role of short linear motifs in DNA recognition has not been studied. We report a repertoire of short evolutionarily Conserved Recognition Elements (CoREs) in long intrinsically disordered regions, which have very distinct amino-acid propensities from those of known motifs, and exhibit a strong tendency to retain their three-dimensional conformations compared to adjacent regions. The majority of CoREs directly interact with the DNA in the available 3D structures, which is further supported by literature evidence, analyses of ΔΔG values of DNA-binding energies and threading-based prediction of DNA binding potential. CoREs were enriched in cancer-associated missense mutations, further strengthening their functional nature. Significant enrichment of glycines in CoREs and the preference of glycyl ϕ-Ψ values within the left-handed bridge range in the l-disallowed region of the Ramachandran plot suggest that Gly-to-nonGly mutations within CoREs might alter the backbone conformation and consequently the function, a hypothesis that we reconciled using available mutation data. We conclude that CoREs might serve as bait for DNA recognition by long disordered regions and that certain mutations in these peptides can disrupt their DNA binding potential and consequently the protein function. We further hypothesize that the preferred conformations of CoREs and of glycyl residues therein might play an important role in DNA binding. The highly ordered nature of CoREs hints at a therapeutic strategy to inhibit malicious molecular interactions using small molecules mimicking CoRE conformations.

  10. Conserved Proline-Directed Phosphorylation Regulates SR Protein Conformation and Splicing Function

    PubMed Central

    Keshwani, Malik M.; Aubol, Brandon E.; Fattet, Laurent; Ma, Chen-Ting; Qiu, Jinsong; Jennings, Patricia A.; Fu, Xiang-Dong; Adams, Joseph A.


    The alternative splicing of human genes is dependent on SR proteins, a family of essential splicing factors whose name derives from a signature C-terminal domain rich in arginine-serine dipeptide repeats (RS domains). Although the SRPKs (SR-specific protein kinases) phosphorylate these repeats, RS domains also contain prolines with flanking serines that are phosphorylated by a second family of protein kinases known as the CLKs (Cdc2-like kinases). The role of specific serine-proline phosphorylation within the RS domain has been difficult to assign since CLKs also phosphorylate arginine-serine dipeptides and, thus, display overlapping residue specificities with the SRPKs. In this study, we address the effects of discrete serine-proline phosphorylation on the conformation and cellular function of the SR protein SRSF1. Using chemical tagging and dephosphorylation experiments, we show that modification of serine-proline dipeptides broadly amplifies the conformational ensemble of SRSF1. The induction of these new structural forms triggers SRSF1 mobilization in the nucleus and alters its binding mechanism to an exonic splicing enhancer in precursor mRNA. These physical events correlate with changes in the alternative splicing of over one hundred human genes based on a global splicing assay. Overall, these studies draw a direct causal relationship between a specific type of chemical modification in an SR protein and the regulation of alternative gene splicing programs. PMID:25529026

  11. Conserved proline-directed phosphorylation regulates SR protein conformation and splicing function.


    Keshwani, Malik M; Aubol, Brandon E; Fattet, Laurent; Ma, Chen-Ting; Qiu, Jinsong; Jennings, Patricia A; Fu, Xiang-Dong; Adams, Joseph A


    The alternative splicing of human genes is dependent on SR proteins, a family of essential splicing factors whose name derives from a signature C-terminal domain rich in arginine-serine dipeptide repeats (RS domains). Although the SRPKs (SR-specific protein kinases) phosphorylate these repeats, RS domains also contain prolines with flanking serines that are phosphorylated by a second family of protein kinases known as the CLKs (Cdc2-like kinases). The role of specific serine-proline phosphorylation within the RS domain has been difficult to assign since CLKs also phosphorylate arginine-serine dipeptides and, thus, display overlapping residue specificities with the SRPKs. In the present study, we address the effects of discrete serine-proline phosphorylation on the conformation and cellular function of the SR protein SRSF1 (SR protein splicing factor 1). Using chemical tagging and dephosphorylation experiments, we show that modification of serine-proline dipeptides broadly amplifies the conformational ensemble of SRSF1. The induction of these new structural forms triggers SRSF1 mobilization in the nucleus and alters its binding mechanism to an exonic splicing enhancer in precursor mRNA. These physical events correlate with changes in the alternative splicing of over 100 human genes based on a global splicing assay. Overall, these studies draw a direct causal relationship between a specific type of chemical modification in an SR protein and the regulation of alternative gene splicing programmes.

  12. Computational identification of riboswitches based on RNA conserved functional sequences and conformations.


    Chang, Tzu-Hao; Huang, Hsien-Da; Wu, Li-Ching; Yeh, Chi-Ta; Liu, Baw-Jhiune; Horng, Jorng-Tzong


    Riboswitches are cis-acting genetic regulatory elements within a specific mRNA that can regulate both transcription and translation by interacting with their corresponding metabolites. Recently, an increasing number of riboswitches have been identified in different species and investigated for their roles in regulatory functions. Both the sequence contexts and structural conformations are important characteristics of riboswitches. None of the previously developed tools, such as covariance models (CMs), Riboswitch finder, and RibEx, provide a web server for efficiently searching homologous instances of known riboswitches or considers two crucial characteristics of each riboswitch, such as the structural conformations and sequence contexts of functional regions. Therefore, we developed a systematic method for identifying 12 kinds of riboswitches. The method is implemented and provided as a web server, RiboSW, to efficiently and conveniently identify riboswitches within messenger RNA sequences. The predictive accuracy of the proposed method is comparable with other previous tools. The efficiency of the proposed method for identifying riboswitches was improved in order to achieve a reasonable computational time required for the prediction, which makes it possible to have an accurate and convenient web server for biologists to obtain the results of their analysis of a given mRNA sequence. RiboSW is now available on the web at PMID:19460868

  13. Conformational Melding Permits a Conserved Binding Geometry in TCR Recognition of Foreign and Self Molecular Mimics

    SciTech Connect

    Borbulevych, Oleg Y.; Piepenbrink, Kurt H.; Baker, Brian M.


    Molecular mimicry between foreign and self Ags is a mechanism of TCR cross-reactivity and is thought to contribute to the development of autoimmunity. The {alpha}{beta} TCR A6 recognizes the foreign Ag Tax from the human T cell leukemia virus-1 when presented by the class I MHC HLA-A2. In a possible link with the autoimmune disease human T cell leukemia virus-1-associated myelopathy/tropical spastic paraparesis, A6 also recognizes a self peptide from the neuronal protein HuD in the context of HLA-A2. We found in our study that the complexes of the HuD and Tax epitopes with HLA-A2 are close but imperfect structural mimics and that in contrast with other recent structures of TCRs with self Ags, A6 engages the HuD Ag with the same traditional binding mode used to engage Tax. Although peptide and MHC conformational changes are needed for recognition of HuD but not Tax and the difference of a single hydroxyl triggers an altered TCR loop conformation, TCR affinity toward HuD is still within the range believed to result in negative selection. Probing further, we found that the HuD-HLA-A2 complex is only weakly stable. Overall, these findings help clarify how molecular mimicry can drive self/nonself cross-reactivity and illustrate how low peptide-MHC stability can permit the survival of T cells expressing self-reactive TCRs that nonetheless bind with a traditional binding mode.

  14. Drug design from the cryptic inhibitor envelope

    PubMed Central

    Lee, Chul-Jin; Liang, Xiaofei; Wu, Qinglin; Najeeb, Javaria; Zhao, Jinshi; Gopalaswamy, Ramesh; Titecat, Marie; Sebbane, Florent; Lemaitre, Nadine; Toone, Eric J.; Zhou, Pei


    Conformational dynamics plays an important role in enzyme catalysis, allosteric regulation of protein functions and assembly of macromolecular complexes. Despite these well-established roles, such information has yet to be exploited for drug design. Here we show by nuclear magnetic resonance spectroscopy that inhibitors of LpxC—an essential enzyme of the lipid A biosynthetic pathway in Gram-negative bacteria and a validated novel antibiotic target—access alternative, minor population states in solution in addition to the ligand conformation observed in crystal structures. These conformations collectively delineate an inhibitor envelope that is invisible to crystallography, but is dynamically accessible by small molecules in solution. Drug design exploiting such a hidden inhibitor envelope has led to the development of potent antibiotics with inhibition constants in the single-digit picomolar range. The principle of the cryptic inhibitor envelope approach may be broadly applicable to other lead optimization campaigns to yield improved therapeutics. PMID:26912110

  15. ‘Naked’ and Hydrated Conformers of the Conserved Core Pentasaccharide of N-linked Glycoproteins and Its Building Blocks

    PubMed Central


    N-glycosylation of eukaryotic proteins is widespread and vital to survival. The pentasaccharide unit −Man3GlcNAc2– lies at the protein-junction core of all oligosaccharides attached to asparagine side chains during this process. Although its absolute conservation implies an indispensable role, associated perhaps with its structure, its unbiased conformation and the potential modulating role of solvation are unknown; both have now been explored through a combination of synthesis, laser spectroscopy, and computation. The proximal −GlcNAc-GlcNAc– unit acts as a rigid rod, while the central, and unusual, −Man-β-1,4-GlcNAc– linkage is more flexible and is modulated by the distal Man-α-1,3– and Man-α-1,6– branching units. Solvation stiffens the ‘rod’ but leaves the distal residues flexible, through a β-Man pivot, ensuring anchored projection from the protein shell while allowing flexible interaction of the distal portion of N-glycosylation with bulk water and biomolecular assemblies. PMID:24127839

  16. Taxonomic distribution of cryptic diversity among metazoans: not so homogeneous after all.


    Pérez-Ponce de León, Gerardo; Poulin, Robert


    Cryptic diversity plagues estimates of biodiversity, conservation efforts and attempts to control diseases and invasive species. Here, we re-visit a decade-old assessment of whether or not cryptic species are homogeneously reported among higher metazoan taxa. We compiled information from an extensive survey of the literature to recover all reports of cryptic species among metazoans. After correcting for currently known species richness and research effort per taxon, we find that cryptic species are over-reported in some taxa and under-reported in others. Although several taxa showing either a lack or an excess of reported cryptic species were poorly studied invertebrate groups, we found that cryptic species were over-reported in amphibians, reptiles and crustaceans, all relatively well-studied groups. The observed heterogeneity in the distribution of reported cryptic species may reflect taxon-specific properties affecting either the propensity for cryptic species to be formed or their likelihood of being detected by conventional taxonomy. Either way, the implications of cryptic diversity may not apply equally across all taxonomic groups. PMID:27555648

  17. Cryptic exposure to arsenic.


    Rossy, Kathleen M; Janusz, Christopher A; Schwartz, Robert A


    Arsenic is an odorless, colorless and tasteless element long linked with effects on the skin and viscera. Exposure to it may be cryptic. Although human intake can occur from four forms, elemental, inorganic (trivalent and pentavalent arsenic) and organic arsenic, the trivalent inorganic arsenicals constitute the major human hazard. Arsenic usually reaches the skin from occupational, therapeutic, or environmental exposure, although it still may be employed as a poison. Occupations involving new technologies are not exempt from arsenic exposure. Its acute and chronic effects are noteworthy. Treatment options exist for arsenic-induced pathology, but prevention of toxicity remains the main focus. Vitamin and mineral supplementation may play a role in the treatment of arsenic toxicity. PMID:16394429

  18. Cryptic exposure to arsenic.


    Rossy, Kathleen M; Janusz, Christopher A; Schwartz, Robert A


    Arsenic is an odorless, colorless and tasteless element long linked with effects on the skin and viscera. Exposure to it may be cryptic. Although human intake can occur from four forms, elemental, inorganic (trivalent and pentavalent arsenic) and organic arsenic, the trivalent inorganic arsenicals constitute the major human hazard. Arsenic usually reaches the skin from occupational, therapeutic, or environmental exposure, although it still may be employed as a poison. Occupations involving new technologies are not exempt from arsenic exposure. Its acute and chronic effects are noteworthy. Treatment options exist for arsenic-induced pathology, but prevention of toxicity remains the main focus. Vitamin and mineral supplementation may play a role in the treatment of arsenic toxicity.

  19. The conserved disulfide bond of human tear lipocalin modulates conformation and lipid binding in a ligand selective manner

    PubMed Central

    Gasymov, Oktay K.; Abduragimov, Adil R.; Glasgow, Ben J.


    The primary aim of this study is the elucidation of the mechanism of disulfide induced alteration of ligand binding in human tear lipocalin (TL). Disulfide bonds may act as dynamic scaffolds to regulate conformational changes that alter protein function including receptor-ligand interactions. A single disulfide bond, (Cys61-Cys153), exists in TL that is highly conserved in the lipocalin superfamily. Circular dichroism and fluorescence spectroscopies were applied to investigate the mechanism by which disulfide bond removal effects protein stability, dynamics and ligand binding properties. Although the secondary structure is not altered by disulfide elimination, TL shows decreased stability against urea denaturation. Free energy change (ΔG0) decreases from 4.9± 0.2 to 2.1± 0.3 kcal/mol with removal of the disulfide bond. Furthermore, ligand binding properties of TL without the disulfide vary according to the type of ligand. The binding of a bulky ligand, NBD-cholesterol, has a decreased time constant (from 11.8± 0.2 to 3.3 s). In contrast, the NBD-labeled phospholipid shows a moderate decrease in the time constant for binding, from 33.2± 0.2 to 22.2± 0.4 s. FRET experiments indicate that the hairpin CD is directly involved in modulation of both ligand binding and flexibility of TL. In TL complexed with palmitc acid (PA-TL), the distance between the residues 62 of strand D and 81 of loop EF is decreased by disulfide bond reduction. Consequently, removal of the disulfide bond boosts flexibility of the protein to reach a CD-EF loop distance (24.3 Å, between residues 62 and 81), which is not accessible for the protein with an intact disulfide bond (26.2 Å). The results suggest that enhanced flexibility of the protein promotes a faster accommodation of the ligand inside the cavity and energetically favorable ligand-protein complex. PMID:21466861

  20. Conservation.

    ERIC Educational Resources Information Center

    National Audubon Society, New York, NY.

    This set of teaching aids consists of seven Audubon Nature Bulletins, providing the teacher and student with informational reading on various topics in conservation. The bulletins have these titles: Plants as Makers of Soil, Water Pollution Control, The Ground Water Table, Conservation--To Keep This Earth Habitable, Our Threatened Air Supply,…

  1. Cryptic Terrain on Mars

    NASA Technical Reports Server (NTRS)


    [figure removed for brevity, see original site] Figure 1

    There is an enigmatic region near the south pole of Mars known as the 'cryptic' terrain. It stays cold in the spring, even as its albedo darkens and the sun rises in the sky.

    This region is covered by a layer of translucent seasonal carbon dioxide ice that warms and evaporates from below. As carbon dioxide gas escapes from below the slab of seasonal ice it scours dust from the surface. The gas vents to the surface, where the dust is carried downwind by the prevailing wind.

    The channels carved by the escaping gas are often radially organized and are known informally as 'spiders' (figure 1).

    Observation Geometry Image PSP_003179_0945 was taken by the High Resolution Imaging Science Experiment (HiRISE) camera onboard the Mars Reconnaissance Orbiter spacecraft on 01-Apr-2007. The complete image is centered at -85.4 degrees latitude, 104.0 degrees East longitude. The range to the target site was 245.9 km (153.7 miles). At this distance the image scale is 49.2 cm/pixel (with 2 x 2 binning) so objects 148 cm across are resolved. The image shown here has been map-projected to 50 cm/pixel . The image was taken at a local Mars time of 06:19 PM and the scene is illuminated from the west with a solar incidence angle of 78 degrees, thus the sun was about 12 degrees above the horizon. At a solar longitude of 210.8 degrees, the season on Mars is Northern Autumn.

  2. Crystallographic and online spectral evidence for role of conformational change and conserved water in cytochrome oxidase proton pump.


    Liu, Jian; Qin, Ling; Ferguson-Miller, Shelagh


    Crystal structures in both oxidized and reduced forms are reported for two bacterial cytochrome c oxidase mutants that define the D and K proton paths, showing conformational change in response to reduction and the loss of strategic waters that can account for inhibition of proton transfer. In the oxidized state both mutants of the Rhodobacter sphaeroides enzyme, D132A and K362M, show overall structures similar to wild type, indicating no long-range effects of mutation. In the reduced state, the mutants show an altered conformation similar to that seen in reduced wild type, confirming this reproducible, reversible response to reduction. In the strongly inhibited D132A mutant, positions of residues and waters in the D pathway are unaffected except in the entry region close to the mutation, where a chloride ion replaces the missing carboxyl and a 2-Å shift in N207 results in loss of its associated water. In K362M, the methionine occupies the same position as the original lysine, but K362- and T359-associated waters in the wild-type structure are missing, likely accounting for the severe inhibition. Spectra of oxidized frozen crystals taken during X-ray radiation show metal center reduction, but indicate development of a strained configuration that only relaxes to a native form upon annealing. Resistance of the frozen crystal to structural change clarifies why the oxidized conformation is observable and supports the conclusion that the reduced conformation has functional significance. A mechanism is described that explains the conformational change and the incomplete response of the D-path mutant. PMID:21205904

  3. High levels of cryptic species diversity uncovered in Amazonian frogs

    PubMed Central

    Funk, W. Chris; Caminer, Marcel; Ron, Santiago R.


    One of the greatest challenges for biodiversity conservation is the poor understanding of species diversity. Molecular methods have dramatically improved our ability to uncover cryptic species, but the magnitude of cryptic diversity remains unknown, particularly in diverse tropical regions such as the Amazon Basin. Uncovering cryptic diversity in amphibians is particularly pressing because amphibians are going extinct globally at an alarming rate. Here, we use an integrative analysis of two independent Amazonian frog clades, Engystomops toadlets and Hypsiboas treefrogs, to test whether species richness is underestimated and, if so, by how much. We sampled intensively in six countries with a focus in Ecuador (Engystomops: 252 individuals from 36 localities; Hypsiboas: 208 individuals from 65 localities) and combined mitochondrial DNA, nuclear DNA, morphological, and bioacoustic data to detect cryptic species. We found that in both clades, species richness was severely underestimated, with more undescribed species than described species. In Engystomops, the two currently recognized species are actually five to seven species (a 150–250% increase in species richness); in Hypsiboas, two recognized species represent six to nine species (a 200–350% increase). Our results suggest that Amazonian frog biodiversity is much more severely underestimated than previously thought. PMID:22130600

  4. When to stop managing or surveying cryptic threatened species.


    Chadès, Iadine; McDonald-Madden, Eve; McCarthy, Michael A; Wintle, Brendan; Linkie, Matthew; Possingham, Hugh P


    Threatened species become increasingly difficult to detect as their populations decline. Managers of such cryptic threatened species face several dilemmas: if they are not sure the species is present, should they continue to manage for that species or invest the limited resources in surveying? We find optimal solutions to this problem using a Partially Observable Markov Decision Process and rules of thumb derived from an analytical approximation. We discover that managing a protected area for a cryptic threatened species can be optimal even if we are not sure the species is present. The more threatened and valuable the species is, relative to the costs of management, the more likely we are to manage this species without determining its continued persistence by using surveys. If a species remains unseen, our belief in the persistence of the species declines to a point where the optimal strategy is to shift resources from saving the species to surveying for it. Finally, when surveys lead to a sufficiently low belief that the species is extant, we surrender resources to other conservation actions. We illustrate our findings with a case study using parameters based on the critically endangered Sumatran tiger (Panthera tigris sumatrae), and we generate rules of thumb on how to allocate conservation effort for any cryptic species. Using Partially Observable Markov Decision Processes in conservation science, we determine the conditions under which it is better to abandon management for that species because our belief that it continues to exist is too low.

  5. When to stop managing or surveying cryptic threatened species

    PubMed Central

    Chadès, Iadine; McDonald-Madden, Eve; McCarthy, Michael A.; Wintle, Brendan; Linkie, Matthew; Possingham, Hugh P.


    Threatened species become increasingly difficult to detect as their populations decline. Managers of such cryptic threatened species face several dilemmas: if they are not sure the species is present, should they continue to manage for that species or invest the limited resources in surveying? We find optimal solutions to this problem using a Partially Observable Markov Decision Process and rules of thumb derived from an analytical approximation. We discover that managing a protected area for a cryptic threatened species can be optimal even if we are not sure the species is present. The more threatened and valuable the species is, relative to the costs of management, the more likely we are to manage this species without determining its continued persistence by using surveys. If a species remains unseen, our belief in the persistence of the species declines to a point where the optimal strategy is to shift resources from saving the species to surveying for it. Finally, when surveys lead to a sufficiently low belief that the species is extant, we surrender resources to other conservation actions. We illustrate our findings with a case study using parameters based on the critically endangered Sumatran tiger (Panthera tigris sumatrae), and we generate rules of thumb on how to allocate conservation effort for any cryptic species. Using Partially Observable Markov Decision Processes in conservation science, we determine the conditions under which it is better to abandon management for that species because our belief that it continues to exist is too low. PMID:18779594

  6. When to stop managing or surveying cryptic threatened species.


    Chadès, Iadine; McDonald-Madden, Eve; McCarthy, Michael A; Wintle, Brendan; Linkie, Matthew; Possingham, Hugh P


    Threatened species become increasingly difficult to detect as their populations decline. Managers of such cryptic threatened species face several dilemmas: if they are not sure the species is present, should they continue to manage for that species or invest the limited resources in surveying? We find optimal solutions to this problem using a Partially Observable Markov Decision Process and rules of thumb derived from an analytical approximation. We discover that managing a protected area for a cryptic threatened species can be optimal even if we are not sure the species is present. The more threatened and valuable the species is, relative to the costs of management, the more likely we are to manage this species without determining its continued persistence by using surveys. If a species remains unseen, our belief in the persistence of the species declines to a point where the optimal strategy is to shift resources from saving the species to surveying for it. Finally, when surveys lead to a sufficiently low belief that the species is extant, we surrender resources to other conservation actions. We illustrate our findings with a case study using parameters based on the critically endangered Sumatran tiger (Panthera tigris sumatrae), and we generate rules of thumb on how to allocate conservation effort for any cryptic species. Using Partially Observable Markov Decision Processes in conservation science, we determine the conditions under which it is better to abandon management for that species because our belief that it continues to exist is too low. PMID:18779594

  7. The Highly Conserved Layer-3 Component of the HIV-1 gp120 Inner Domain Is Critical for CD4-Required Conformational Transitions

    PubMed Central

    Désormeaux, Anik; Coutu, Mathieu; Medjahed, Halima; Pacheco, Beatriz; Herschhorn, Alon; Gu, Christopher; Xiang, Shi-Hua; Mao, Youdong; Sodroski, Joseph


    The trimeric envelope glycoprotein (Env) of human immunodeficiency virus type 1 (HIV-1) mediates virus entry into host cells. CD4 engagement with the gp120 exterior envelope glycoprotein subunit represents the first step during HIV-1 entry. CD4-induced conformational changes in the gp120 inner domain involve three potentially flexible topological layers (layers 1, 2, and 3). Structural rearrangements between layer 1 and layer 2 have been shown to facilitate the transition of the envelope glycoprotein trimer from the unliganded to the CD4-bound state and to stabilize gp120-CD4 interaction. However, our understanding of CD4-induced conformational changes in the gp120 inner domain remains incomplete. Here, we report that a highly conserved element of the gp120 inner domain, layer 3, plays a pivot-like role in these allosteric changes. In the unliganded state, layer 3 modulates the association of gp120 with the Env trimer, probably by influencing the relationship of the gp120 inner and outer domains. Importantly, layer 3 governs the efficiency of the initial gp120 interaction with CD4, a function that can also be fulfilled by filling the Phe43 cavity. This work defines the functional importance of layer 3 and completes a picture detailing the role of the gp120 inner domain in CD4-induced conformational transitions in the HIV-1 Env trimer. PMID:23255784

  8. α-Fluorophosphonates reveal how a phosphomutase conserves transition state conformation over hexose recognition in its two-step reaction

    PubMed Central

    Jin, Yi; Bhattasali, Debabrata; Pellegrini, Erika; Forget, Stephanie M.; Baxter, Nicola J.; Cliff, Matthew J.; Bowler, Matthew W.; Jakeman, David L.; Blackburn, G. Michael; Waltho, Jonathan P.


    β-Phosphoglucomutase (βPGM) catalyzes isomerization of β-d-glucose 1-phosphate (βG1P) into d-glucose 6-phosphate (G6P) via sequential phosphoryl transfer steps using a β-d-glucose 1,6-bisphosphate (βG16BP) intermediate. Synthetic fluoromethylenephosphonate and methylenephosphonate analogs of βG1P deliver novel step 1 transition state analog (TSA) complexes for βPGM, incorporating trifluoromagnesate and tetrafluoroaluminate surrogates of the phosphoryl group. Within an invariant protein conformation, the β-d-glucopyranose ring in the βG1P TSA complexes (step 1) is flipped over and shifted relative to the G6P TSA complexes (step 2). Its equatorial hydroxyl groups are hydrogen-bonded directly to the enzyme rather than indirectly via water molecules as in step 2. The (C)O–P bond orientation for binding the phosphate in the inert phosphate site differs by ∼30° between steps 1 and 2. By contrast, the orientations for the axial O–Mg–O alignment for the TSA of the phosphoryl group in the catalytic site differ by only ∼5°, and the atoms representing the five phosphorus-bonded oxygens in the two transition states (TSs) are virtually superimposable. The conformation of βG16BP in step 1 does not fit into the same invariant active site for step 2 by simple positional interchange of the phosphates: the TS alignment is achieved by conformational change of the hexose rather than the protein. PMID:25104750

  9. The Conformational Stability and Biophysical Properties of the Eukaryotic Thioredoxins of Pisum Sativum Are Not Family-Conserved

    PubMed Central

    Aguado-Llera, David; Martínez-Gómez, Ana Isabel; Prieto, Jesús; Marenchino, Marco; Traverso, José Angel; Gómez, Javier; Chueca, Ana; Neira, José L.


    Thioredoxins (TRXs) are ubiquitous proteins involved in redox processes. About forty genes encode TRX or TRX-related proteins in plants, grouped in different families according to their subcellular localization. For instance, the h-type TRXs are located in cytoplasm or mitochondria, whereas f-type TRXs have a plastidial origin, although both types of proteins have an eukaryotic origin as opposed to other TRXs. Herein, we study the conformational and the biophysical features of TRXh1, TRXh2 and TRXf from Pisum sativum. The modelled structures of the three proteins show the well-known TRX fold. While sharing similar pH-denaturations features, the chemical and thermal stabilities are different, being PsTRXh1 (Pisum sativum thioredoxin h1) the most stable isoform; moreover, the three proteins follow a three-state denaturation model, during the chemical-denaturations. These differences in the thermal- and chemical-denaturations result from changes, in a broad sense, of the several ASAs (accessible surface areas) of the proteins. Thus, although a strong relationship can be found between the primary amino acid sequence and the structure among TRXs, that between the residue sequence and the conformational stability and biophysical properties is not. We discuss how these differences in the biophysical properties of TRXs determine their unique functions in pea, and we show how residues involved in the biophysical features described (pH-titrations, dimerizations and chemical-denaturations) belong to regions involved in interaction with other proteins. Our results suggest that the sequence demands of protein-protein function are relatively rigid, with different protein-binding pockets (some in common) for each of the three proteins, but the demands of structure and conformational stability per se (as long as there is a maintained core), are less so. PMID:21364950

  10. Unexpected layers of cryptic diversity in wood white Leptidea butterflies.


    Dincă, Vlad; Lukhtanov, Vladimir A; Talavera, Gerard; Vila, Roger


    Uncovering cryptic biodiversity is essential for understanding evolutionary processes and patterns of ecosystem functioning, as well as for nature conservation. As European butterflies are arguably the best-studied group of invertebrates in the world, the discovery of a cryptic species, twenty years ago, within the common wood white Leptidea sinapis was a significant event, and these butterflies have become a model to study speciation. Here we show that the so-called 'sibling' Leptidea actually consist of three species. The new species can be discriminated on the basis of either DNA or karyological data. Such an unexpected discovery challenges our current knowledge on biodiversity, exemplifying how a widespread species can remain unnoticed even within an intensely studied natural model system for speciation.

  11. Mutational and Structural Analysis of Conserved Residues in Ribose-5-Phosphate Isomerase B from Leishmania donovani: Role in Substrate Recognition and Conformational Stability

    PubMed Central

    Kaur, Preet Kamal; Tripathi, Neha; Desale, Jayesh; Neelagiri, Soumya; Yadav, Shailendra; Bharatam, Prasad V.; Singh, Sushma


    Ribose-5-phosphate isomerase B from Leishmania donovani (LdRpiB) is one of the potential drug targets against visceral leishmaniasis. In the present study, we have targeted several conserved amino acids for mutational analysis (i.e. Cys69, His11, His102, His138, Asp45, Tyr46, Pro47 and Glu149) to gain crucial insights into their role in substrate binding, catalysis and conformational stability of the enzyme. All the eight LdRpiB variants were cloned, sequenced, expressed and purified. C69S, H102N, D45N and E149A mutants exhibited complete loss of enzyme activity indicating that they are indispensable for the enzyme activity. Kinetic parameters were altered in case of H138N, H11N and P47A variants; however Y46F exhibited similar kinetic behaviour as wild type. All the mutants except H138N exhibited altered protein structure as determined by CD and fluorescence spectral analysis. This data was supported by the atomic level details of the conformational changes and substrate binding using molecular dynamic simulations. LdRpiB also exhibited activity with D-form of various aldose substrates in the order of D-ribose > D-talose > D-allose > D-arabinose. Our study provides insights for better understanding of substrate enzyme interactions which can rationalize the process of drug design against parasite RpiB. PMID:26953696

  12. The Tomato Defensin TPP3 Binds Phosphatidylinositol (4,5)-Bisphosphate via a Conserved Dimeric Cationic Grip Conformation To Mediate Cell Lysis

    PubMed Central

    Baxter, Amy A.; Richter, Viviane; Lay, Fung T.; Poon, Ivan K. H.; Adda, Christopher G.; Veneer, Prem K.; Phan, Thanh Kha; Bleackley, Mark R.; Anderson, Marilyn A.


    Defensins are a class of ubiquitously expressed cationic antimicrobial peptides (CAPs) that play an important role in innate defense. Plant defensins are active against a broad range of microbial pathogens and act via multiple mechanisms, including cell membrane permeabilization. The cytolytic activity of defensins has been proposed to involve interaction with specific lipid components in the target cell wall or membrane and defensin oligomerization. Indeed, the defensin Nicotiana alata defensin 1 (NaD1) binds to a broad range of membrane phosphatidylinositol phosphates and forms an oligomeric complex with phosphatidylinositol (4,5)-bisphosphate (PIP2) that facilitates membrane lysis of both mammalian tumor and fungal cells. Here, we report that the tomato defensin TPP3 has a unique lipid binding profile that is specific for PIP2 with which it forms an oligomeric complex that is critical for cytolytic activity. Structural characterization of TPP3 by X-ray crystallography and site-directed mutagenesis demonstrated that it forms a dimer in a “cationic grip” conformation that specifically accommodates the head group of PIP2 to mediate cooperative higher-order oligomerization and subsequent membrane permeabilization. These findings suggest that certain plant defensins are innate immune receptors for phospholipids and adopt conserved dimeric configurations to mediate PIP2 binding and membrane permeabilization. This mechanism of innate defense may be conserved across defensins from different species. PMID:25802281

  13. Gauge natural formulation of conformal gravity

    SciTech Connect

    Campigotto, M.; Fatibene, L.


    We consider conformal gravity as a gauge natural theory. We study its conservation laws and superpotentials. We also consider the Mannheim and Kazanas spherically symmetric vacuum solution and discuss conserved quantities associated to conformal and diffeomorphism symmetries.

  14. The great repression: chromatin and cryptic transcription.


    Hennig, Bianca P; Fischer, Tamás


    The eukaryotic chromatin structure is essential in correctly defining transcription units. Impairing this structure can activate cryptic promoters, and lead to the accumulation of aberrant RNA transcripts. Here we discuss critical pathways that are responsible for the repression of cryptic transcription and the maintenance of genome integrity.

  15. Cryptic species in Stachybotrys chartarum.


    Cruse, Michael; Telerant, Robin; Gallagher, Thomas; Lee, Thomas; Taylor, John W


    Stachybotrys chartarum has received much attention as a possible cause of sick-building syndrome. Because morphological species recognition in fungi can hide diversity, we applied a phylogenetic approach to search for cryptic species. We examined 23 isolates from the San Francisco Bay Area, and another seven from around the US. Using markers we developed for three polymorphic protein coding loci (chitin synthase 1, beta-tubulin 2, and trichodiene synthase 5), we infer that two distinct phylogenetic species exist within the single described morphological species. We have found no correlation between genetic isolation and geographic distance. PMID:21156555

  16. Role of cryptic genes in microbial evolution.


    Hall, B G; Yokoyama, S; Calhoun, D H


    Cryptic genes are phenotypically silent DNA sequences, not normally expressed during the life cycle of an individual. They may, however, be activated in a few individuals of a large population by mutation, recombination, insertion elements, or other genetic mechanisms. A consideration of the microbial literature concerning biochemical evolution, physiology, and taxonomy provides the basis for a hypothesis of microbial adaptation and evolution by mutational activation of cryptic genes. Evidence is presented, and a mathematical model is derived, indicating that powerful and biologically important mechanisms exist to prevent the loss of cryptic genes. We propose that cryptic genes persist as a vital element of the genetic repertoire, ready for recall by mutational activation in future generations. Cryptic genes provide a versatile endogenous genetic reservoir that enhances the adaptive potential of a species by a mechanism that is independent of genetic exchange.

  17. Pay Attention to the Overlooked Cryptic Diversity in Existing Barcoding Data: the Case of Mollusca with Character-Based DNA Barcoding.


    Zou, Shanmei; Li, Qi


    With the global biodiversity crisis, DNA barcoding aims for fast species identification and cryptic species diversity revelation. For more than 10 years, large amounts of DNA barcode data have been accumulating in publicly available databases, most of which were conducted by distance or tree-building methods that have often been argued, especially for cryptic species revelation. In this context, overlooked cryptic diversity may exist in the available barcoding data. The character-based DNA barcoding, however, has a good chance for detecting the overlooked cryptic diversity. In this study, marine mollusk was as the ideal case for detecting the overlooked potential cryptic species from existing cytochrome c oxidase I (COI) sequences with character-based DNA barcode. A total of 1081 COI sequences of mollusks, belonging to 176 species of 25 families of Gastropoda, Cephalopoda, and Lamellibranchia, were conducted by character analysis. As a whole, the character-based barcoding results were consistent with previous distance and tree-building analysis for species discrimination. More importantly, quite a number of species analyzed were divided into distinct clades with unique diagnostical characters. Based on the concept of cryptic species revelation of character-based barcoding, these species divided into separate taxonomic groups might be potential cryptic species. The detection of the overlooked potential cryptic diversity proves that the character-based barcoding mode possesses more advantages of revealing cryptic biodiversity. With the development of DNA barcoding, making the best use of barcoding data is worthy of our attention for species conservation.

  18. Mutating a Conserved Proline Residue within the Trimerization Domain Modifies Na+ Binding to Excitatory Amino Acid Transporters and Associated Conformational Changes*

    PubMed Central

    Hotzy, Jasmin; Schneider, Nicole; Kovermann, Peter; Fahlke, Christoph


    Excitatory amino acid transporters (EAATs) are crucial for glutamate homeostasis in the mammalian central nervous system. They are not only secondary active glutamate transporters but also function as anion channels, and different EAATs vary considerably in glutamate transport rates and associated anion current amplitudes. A naturally occurring mutation, which was identified in a patient with episodic ataxia type 6 and that predicts the substitution of a highly conserved proline at position 290 by arginine (P290R), was recently shown to reduce glutamate uptake and to increase anion conduction by hEAAT1. We here used voltage clamp fluorometry to define how the homologous P259R mutation modifies the functional properties of hEAAT3. P259R inverts the voltage dependence, changes the sodium dependence, and alters the time dependence of hEAAT3 fluorescence signals. Kinetic analysis of fluorescence signals indicate that P259R decelerates a conformational change associated with sodium binding to the glutamate-free mutant transporters. This alteration in the glutamate uptake cycle accounts for the experimentally observed changes in glutamate transport and anion conduction by P259R hEAAT3. PMID:24214974

  19. Cryptic vascular malformations involving the brainstem

    SciTech Connect

    Yeates, A.; Enzmann, D.


    Six patients with angiographically cryptic vascular malformations involving the brainstem were examined with computed tomography (CT). The clinical and CT findings of cryptic vascular malformations of the brainstem are described and distinguished from those of brainstem glioma and multiple sclerosis. Calcification within a brainstem lesion that displays relatively little mass effect and shows little contrast enhancement, particularly when associated with a long history of waxing and waning brainstem symptoms, should suggest a vascular malformation.

  20. Cryptic prophages as targets for drug development.


    Wang, Xiaoxue; Wood, Thomas K


    Bacterial chromosomes may contain up to 20% phage DNA that encodes diverse proteins ranging from those for photosynthesis to those for autoimmunity; hence, phages contribute greatly to the metabolic potential of pathogens. Active prophages carrying genes encoding virulence factors and antibiotic resistance can be excised from the host chromosome to form active phages and are transmissible among different bacterial hosts upon SOS responses. Cryptic prophages are artifacts of mutagenesis in which lysogenic phage are captured in the bacterial chromosome: they may excise but they do not form active phage particles or lyse their captors. Hence, cryptic prophages are relatively permanent reservoirs of genes, many of which benefit pathogens, in ways we are just beginning to discern. Here we explore the role of active prophage- and cryptic prophage-derived proteins in terms of (i) virulence, (ii) antibiotic resistance, and (iii) antibiotic tolerance; antibiotic tolerance occurs as a result of the non-heritable phenotype of dormancy which is a result of activation of toxins of toxin/antitoxin loci that are frequently encoded in cryptic prophages. Therefore, cryptic prophages are promising targets for drug development. PMID:27449596

  1. Cryptic prophages as targets for drug development.


    Wang, Xiaoxue; Wood, Thomas K


    Bacterial chromosomes may contain up to 20% phage DNA that encodes diverse proteins ranging from those for photosynthesis to those for autoimmunity; hence, phages contribute greatly to the metabolic potential of pathogens. Active prophages carrying genes encoding virulence factors and antibiotic resistance can be excised from the host chromosome to form active phages and are transmissible among different bacterial hosts upon SOS responses. Cryptic prophages are artifacts of mutagenesis in which lysogenic phage are captured in the bacterial chromosome: they may excise but they do not form active phage particles or lyse their captors. Hence, cryptic prophages are relatively permanent reservoirs of genes, many of which benefit pathogens, in ways we are just beginning to discern. Here we explore the role of active prophage- and cryptic prophage-derived proteins in terms of (i) virulence, (ii) antibiotic resistance, and (iii) antibiotic tolerance; antibiotic tolerance occurs as a result of the non-heritable phenotype of dormancy which is a result of activation of toxins of toxin/antitoxin loci that are frequently encoded in cryptic prophages. Therefore, cryptic prophages are promising targets for drug development.

  2. Cryptic Peptides from Collagen: A Critical Review.


    Banerjee, Pradipta; Shanthi, C


    Collagen, a predominant structural protein in extracellular matrix (ECM), is now considered to have probable roles in many biological activities and hence, in different forms have found application as nutraceutical or pharmaceutical therapy option. Many of the biological properties are believed to be due to small hidden peptide residues in the collagen molecules, which come into play after the biodegradation or biosorption of the parent molecule. These peptide regions are called cryptic peptides or by some, as cryptides. The proteolytic hydrolysis of the ECM protein releases the cryptic peptides with many novel biological activities not exhibited directly by the parental protein which include angiogenic, antimicrobial, mitogenic and chemotactic properties. The research for understanding the role of these cryptic peptide regions and making use of them in medical field is very active. Such an understanding could lead to the development of peptide supplements for many biomedical applications. The prolific research in this area is reviewed in this paper. PMID:27173646

  3. Empirical evidence supporting frequent cryptic speciation in epiphyllous liverworts: a case study of the Cololejeunea lanciloba complex.


    Yu, Ying; Heinrichs, Jochen; Zhu, Rui-Liang; Schneider, Harald


    Cryptic species are frequently recovered in plant lineages, and considered an important cause for divergent of morphological disparity and species diversity. The identification of cryptic species has important implications for the assessment of conservation needs of species aggregates. The mechanisms and processes of the origin of cryptic species diversity are still poorly understand based on the lack of studies especially in context of environment factors. Here we explored evidence for cryptic species within the epiphyllous liverworts Cololejeunea lanciloba complex based on two loci, the plastid trnL-F region and the nuclear ribosomal ITS region. Several analytic approaches were employed to delimit species based on DNA sequence variation including phylogenetic reconstruction, statistical parsimony networks analysis and two recently introduced species delimitation criteria: Rosenberg's reciprocal monophyly and Rodrigo's randomly distinct. We found evidence for thirteen genetically distinct putative species, each consisting of more than one haplotype, rather than four morphologically-circumscribed species. The results implied that the highly conserved phenotypes are not congruent with the genetic differentiation, contributing to incorrect assessments of the biodiversity of epiphyllous liverworts. We hypothesize that evolution of cryptic species recovered may be caused by selection of traits critical to the survival in epiphyllous habitats combined with limited developmental options designed in the small body.

  4. Cryptic transposable phages of Pseudomonas aeruginosa

    SciTech Connect

    Krylov, V.N.; Mit`kina, L.N.; Pleteneva, E.A.; Aleshin, V.V.


    Frequencies of nucleotide sequences homologous to phage transposons (PT) of two species, D3112 and B3, were assessed in genomes of natural Pseudomonas aeruginosa strains by the dot-blot hybridization method. These strains were incapable of liberating viable phages on a lawn of the PA01 standard indicator strain of P. aeruginosa. It was shown that the homologies detected belong to two groups, high and intermediate, with respect to homology level. Homology patterns were classified as high when they provided signals comparable to those for hybridization in a positive control; patterns were classified as intermediate when the hybridization level was higher than the background level, but lower than in the positive control. Homologous PT sequences were designated as cryptic PT. Intact cryptic PT prophages were shown to exist in genomes of particular natural strains manifesting a higher level of hybridization. However, the growth of these phages was limited by the restriction system of strain PA01. It is possible to isolate strains maintaining the growth of some cryptic PT. These strains differed from P. aeruginosa with respect to the specificity of the restriction and modification system. Nevertheless, in most cases, the attempt to identify a novel host capable of maintaining growth of a cryptic PT failed. Natural strains often carry cryptic PT related to both known PT species, D3112 and B3. The frequency of cryptic PT is extremely high, reaching 30% in strains with a high level of homology only and up to 50% in all strains exhibiting homology. This high PT frequency is assumed to be associated with the considerable variation of P. aeruginosa. 15 refs., 1 fig., 2 tabs.

  5. Properties of cryptic epitopes and their corresponding antibodies as indicated by the study of human and ovine growth hormones.


    Loureiro, M E; Marino, V J; Mathieu, P A; Duhalde, M; Roguin, L P; Peña, C; Retegui, L A


    Antibodies (Ab) directed to hidden antigenic determinants (cryptotopes) are undesirable because they are not neutralizing. Additionally, we have previously demonstrated a close association between the extent of Ab to cryptic determinants and the expression of autoantibodies (autoAb) under some experimental conditions. Thus, the first objective of this work was to establish the physicochemical characteristics of Ab to cryptotopes and the second one was to examine the structural features of cryptic epitopes themselves. Using human and ovine growth hormones (hGH and oGH) as antigenic models and competition ELISA under different conditions of temperature, pH or ionic strength, we did not find any difference between the binding properties of anti-cryptic epitope antibodies (Ab) and anti-native epitope Ab. Then, using synthetic peptides and tryptic digests and direct and competition ELISAs we studied the structures of cryptic hGH and oGH epitopes. Isolated peptides either in solution or adsorbed on microplates failed to react. Partially digested hGH was recognized only when insolubilized on microplates, and anti-oGH Ab only reacted with a large fragment of the hormone either in solution or insolubilized. These results indicate that, at least in the case of hGH and oGH, cryptic epitopes are not simple linear sequences, as commonly referred without any evidence, but new exposed conformational structures different from those found in the native antigen.

  6. Cryptic variation in vulva development by cis-regulatory evolution of a HAIRY-binding site.


    Kienle, Simone; Sommer, Ralf J


    Robustness to mutations is a general principle of biological systems that allows for the accumulation of cryptic variation. However, little is known about robustness and cryptic variation in core developmental pathways. Here we show through gonad-ablation screens in natural isolates of Pristionchus pacificus cryptic variation in nematode vulva development. This variation is mainly caused by cis-regulatory evolution in the conserved Notch ligand apx-1/Delta and involves binding sites for the transcription factor HAIRY. In some isolates, including a Bolivian strain, absence of a HAIRY-binding site results in Ppa-apx-1 expression in the vulva precursor cell P6.p and causes gonad-independent vulva differentiation. In contrast, a Californian strain that gained a HAIRY-binding site lacks Ppa-apx-1 vulval expression and shows gonad-dependence of vulva development. Addition of this HAIRY-binding site to the Bolivian Ppa-apx-1 promoter eliminates expression in the vulva. Our findings indicate significant cis-regulatory evolution in a core developmental pathway leading to intraspecific cryptic variation.

  7. Discrimination, crypticity, and incipient taxa in entamoeba.


    Espinosa, Avelina; Paz-Y-Miño-C, Guillermo


    Persistent difficulties in resolving clear lineages in diverging populations of prokaryotes or unicellular eukaryotes (protistan polyphyletic groups) are challenging the classical species concept. Although multiple integrated approaches would render holistic taxonomies, most phylogenetic studies are still based on single-gene or morphological traits. Such methodologies conceal natural lineages, which are considered "cryptic." The concept of species is considered artificial and inadequate to define natural populations. Social organisms display differential behaviors toward kin than to nonrelated individuals. In "social" microbes, kin discrimination has been used to help resolve crypticity. Aggregative behavior could be explored in a nonsocial protist to define phylogenetic varieties that are considered "cryptic." Two Entamoeba invadens strains, IP-1 and VK-1:NS are considered close populations of the same "species." This study demonstrates that IP-1 and VK-1:NS trophozoites aggregate only with alike members and discriminate members of different strains based on behavioral and chemical signals. Combined morphological, behavioral/chemical, and ecological studies could improve Archamoebae phylogenies and define cryptic varieties. Evolutionary processes in which selection acted continuously and cumulatively on ancestors of Entamoeba populations gave rise to chemical and behavioral signals that allowed individuals to discriminate nonpopulation members and, gradually, to the emergence of new lineages; alternative views that claim a "Designer" or "Creator" as responsible for protistan diversity are unfounded.

  8. Conformational studies of a short linear peptide corresponding to a major conserved neutralizing epitope of human respiratory syncytial virus fusion glycoprotein.


    Toiron, C; López, J A; Rivas, G; Andreu, D; Melero, J A; Bruix, M


    The conformational properties of a 21-residue peptide, corresponding to amino acids 255 to 275 (F255-275) of the human respiratory syncytial virus fusion (F) glycoprotein have been studied by CD and nmr spectroscopy. This peptide includes residues 262, 268, and 272 of the F polypeptide that are essential for integrity of most epitopes that mapped into a major antigenic site of the F molecule. CD data indicate that F255-275 adopts a random coil conformation in aqueous solution at low peptide concentrations. However, as the concentration of peptide is increased, a higher percentage of peptide molecules adopts an organized structure. This effect can be more easily observed when trifluoroethanol (30%) is added to peptide solutions, giving rise to CD spectra that resemble those of alpha-helix structures. These conformational changes were confirmed by nmr spectroscopy. The nuclear Overhauser effects observed in 30% trifluoroethanol/ water together with the conformational H alpha chemical shift data allowed us to propose a structural model of helix-loop-helix for the peptide in solution. In addition, these helical regions contain the amino acid residues essential for epitope integrity in the native F molecule. These results give new insights into the antigenic structure of the respiratory syncytical virus F glycoprotein. PMID:8837519

  9. PRP8 intein in cryptic species of Histoplasma capsulatum: evolution and phylogeny.


    Theodoro, Raquel Cordeiro; Scheel, Christina M; Brandt, Mary E; Kasuga, Takao; Bagagli, Eduardo


    The PRP8 intein is the most widespread intein among the Kingdom Fungi. This genetic element occurs within the prp8 gene, and is transcribed and translated simultaneously with the gene. After translation, the intein excises itself from the Prp8 protein by an autocatalytic splicing reaction, subsequently joining the N and C terminals of the host protein, which retains its functional conformation. Besides the splicing domain, some PRP8 inteins also have a homing endonuclease (HE) domain which, if functional, makes the intein a mobile element capable of becoming fixed in a population. This work aimed to study (1) The occurrence of this intein in Histoplasma capsulatum isolates (n=99) belonging to different cryptic species collected in diverse geographical locations, and (2) The functionality of the endonuclease domains of H. capsulatum PRP8 inteins and their phylogenetic relationship among the cryptic species. Our results suggest that the PRP8 intein is fixed in H. capsulatum populations and that an admixture or a probable ancestral polymorphism of the PRP8 intein sequences is responsible for the apparent paraphyletic pattern of the LAmA clade which, in the intein phylogeny, also encompasses sequences from LAmB isolates. The PRP8 intein sequences clearly separate the different cryptic species, and may serve as an additional molecular typing tool, as previously proposed for other fungi genus, such as Cryptococcus and Paracoccidioides. PMID:23665464

  10. Activation and Characterization of a Cryptic Polycyclic Tetramate Macrolactam Biosynthetic Gene Cluster

    PubMed Central

    Luo, Yunzi; Huang, Hua; Liang, Jing; Wang, Meng; Lu, Lu; Shao, Zengyi; Cobb, Ryan E.; Zhao, Huimin


    Polycyclic tetramate macrolactams (PTMs) are a widely distributed class of natural products with important biological activities. However, many of them have not been characterized. Here we apply a plug and play synthetic biology strategy to activate a cryptic PTM biosynthetic gene cluster SGR810-815 from Streptomyces griseus and discover three potential PTMs. This gene cluster is highly conserved in phylogenetically diverse bacterial strains and contains an unusual hybrid polyketide synthase-nonribosomal peptide synthetase (PKS-NRPS) which resembles iterative PKSs known in fungi. To further characterize this gene cluster, we use the same synthetic biology approach to create a series of gene deletion constructs and elucidate the biosynthetic steps for the formation of the polycyclic system. The strategy we employ bypasses the traditional laborious processes to elicit gene cluster expression and should be generally applicable to many other silent or cryptic gene clusters for discovery and characterization of new natural products. PMID:24305602

  11. Evolution of cryptic coloration in ectoparasites.


    Bush, Sarah E; Kim, Dukgun; Reed, Michelle; Clayton, Dale H


    Cryptic coloration is a classic example of evolution by natural selection. However, it has been studied almost exclusively in predator-prey systems, despite the fact that it may evolve in other groups, such as ectoparasites. The principle defense of hosts against ectoparasites is grooming behavior, which has a visual component. Host-imposed selection should lead to the evolution of background matching if it helps ectoparasites escape from grooming. Here we use sister taxa comparisons to show that avian feather lice (Phthiraptera: Ischnocera) have evolved coloration that matches the host's plumage, except in the case of head lice, which are protected from grooming. We also show covariation of parasite and host color within a single species of louse. Thus, cryptic coloration has evolved both within and between species of feather lice. Other examples of the evolution of crypsis presumably exist among the 70,000 known species of ectoparasites that collectively represent five animal phyla.

  12. Cryptic splice sites and split genes

    PubMed Central

    Kapustin, Yuri; Chan, Elcie; Sarkar, Rupa; Wong, Frederick; Vorechovsky, Igor; Winston, Robert M.; Tatusova, Tatiana; Dibb, Nick J.


    We describe a new program called cryptic splice finder (CSF) that can reliably identify cryptic splice sites (css), so providing a useful tool to help investigate splicing mutations in genetic disease. We report that many css are not entirely dormant and are often already active at low levels in normal genes prior to their enhancement in genetic disease. We also report a fascinating correlation between the positions of css and introns, whereby css within the exons of one species frequently match the exact position of introns in equivalent genes from another species. These results strongly indicate that many introns were inserted into css during evolution and they also imply that the splicing information that lies outside some introns can be independently recognized by the splicing machinery and was in place prior to intron insertion. This indicates that non-intronic splicing information had a key role in shaping the split structure of eukaryote genes. PMID:21470962

  13. Cryptic function loss in animal populations.


    McConkey, Kim R; O'Farrill, Georgina


    The essential functional roles performed by animal species are lost when they become locally extinct, and ecosystems are critically threatened by this decline in functional diversity. Theory that links function, diversity, and ecosystem stability exists but fails to assess function loss that occurs in species with persistent populations. The entire functional role of a species, or a critical component of it, can be lost following large population declines (functional extinction), following population increase, or after behavioural adaptations to changes in the population, community, habitat, or climate. Here, we provide a framework that identifies the scenarios under which 'cryptic' function loss can occur in persistent populations. Cryptic function loss is potentially widespread and critically threatens ecosystem stability across the globe. PMID:25678379

  14. DNA barcode reference library for Iberian butterflies enables a continental-scale preview of potential cryptic diversity.


    Dincă, Vlad; Montagud, Sergio; Talavera, Gerard; Hernández-Roldán, Juan; Munguira, Miguel L; García-Barros, Enrique; Hebert, Paul D N; Vila, Roger


    How common are cryptic species--those overlooked because of their morphological similarity? Despite its wide-ranging implications for biology and conservation, the answer remains open to debate. Butterflies constitute the best-studied invertebrates, playing a similar role as birds do in providing models for vertebrate biology. An accurate assessment of cryptic diversity in this emblematic group requires meticulous case-by-case assessments, but a preview to highlight cases of particular interest will help to direct future studies. We present a survey of mitochondrial genetic diversity for the butterfly fauna of the Iberian Peninsula with unprecedented resolution (3502 DNA barcodes for all 228 species), creating a reliable system for DNA-based identification and for the detection of overlooked diversity. After compiling available data for European butterflies (5782 sequences, 299 species), we applied the Generalized Mixed Yule-Coalescent model to explore potential cryptic diversity at a continental scale. The results indicate that 27.7% of these species include from two to four evolutionary significant units (ESUs), suggesting that cryptic biodiversity may be higher than expected for one of the best-studied invertebrate groups and regions. The ESUs represent important units for conservation, models for studies of evolutionary and speciation processes, and sentinels for future research to unveil hidden diversity.

  15. DNA barcode reference library for Iberian butterflies enables a continental-scale preview of potential cryptic diversity

    PubMed Central

    Dincă, Vlad; Montagud, Sergio; Talavera, Gerard; Hernández-Roldán, Juan; Munguira, Miguel L.; García-Barros, Enrique; Hebert, Paul D. N.; Vila, Roger


    How common are cryptic species - those overlooked because of their morphological similarity? Despite its wide-ranging implications for biology and conservation, the answer remains open to debate. Butterflies constitute the best-studied invertebrates, playing a similar role as birds do in providing models for vertebrate biology. An accurate assessment of cryptic diversity in this emblematic group requires meticulous case-by-case assessments, but a preview to highlight cases of particular interest will help to direct future studies. We present a survey of mitochondrial genetic diversity for the butterfly fauna of the Iberian Peninsula with unprecedented resolution (3502 DNA barcodes for all 228 species), creating a reliable system for DNA-based identification and for the detection of overlooked diversity. After compiling available data for European butterflies (5782 sequences, 299 species), we applied the Generalized Mixed Yule-Coalescent model to explore potential cryptic diversity at a continental scale. The results indicate that 27.7% of these species include from two to four evolutionary significant units (ESUs), suggesting that cryptic biodiversity may be higher than expected for one of the best-studied invertebrate groups and regions. The ESUs represent important units for conservation, models for studies of evolutionary and speciation processes, and sentinels for future research to unveil hidden diversity. PMID:26205828

  16. DNA barcode reference library for Iberian butterflies enables a continental-scale preview of potential cryptic diversity.


    Dincă, Vlad; Montagud, Sergio; Talavera, Gerard; Hernández-Roldán, Juan; Munguira, Miguel L; García-Barros, Enrique; Hebert, Paul D N; Vila, Roger


    How common are cryptic species--those overlooked because of their morphological similarity? Despite its wide-ranging implications for biology and conservation, the answer remains open to debate. Butterflies constitute the best-studied invertebrates, playing a similar role as birds do in providing models for vertebrate biology. An accurate assessment of cryptic diversity in this emblematic group requires meticulous case-by-case assessments, but a preview to highlight cases of particular interest will help to direct future studies. We present a survey of mitochondrial genetic diversity for the butterfly fauna of the Iberian Peninsula with unprecedented resolution (3502 DNA barcodes for all 228 species), creating a reliable system for DNA-based identification and for the detection of overlooked diversity. After compiling available data for European butterflies (5782 sequences, 299 species), we applied the Generalized Mixed Yule-Coalescent model to explore potential cryptic diversity at a continental scale. The results indicate that 27.7% of these species include from two to four evolutionary significant units (ESUs), suggesting that cryptic biodiversity may be higher than expected for one of the best-studied invertebrate groups and regions. The ESUs represent important units for conservation, models for studies of evolutionary and speciation processes, and sentinels for future research to unveil hidden diversity. PMID:26205828

  17. Cryptic organelles in parasitic protists and fungi.


    Williams, Bryony A P; Keeling, Patrick J


    A number of parasitic protists and fungi have adopted extremely specialised characteristics of morphology, biochemistry, and molecular biology, sometimes making it difficult to discern their evolutionary origins. One aspect of several parasitic groups that reflects this is their metabolic organelles, mitochondria and plastids. These organelles are derived from endosymbiosis with an alpha-proteobacterium and a cyanobacterium respectively, and are home to a variety of core metabolic processes. As parasites adapted, new demands, or perhaps a relaxation of demands, frequently led to significant changes in these organelles. At the extreme, the organelles are degenerated and transformed beyond recognition, and are referred to as "cryptic". Generally, there is no prior cytological evidence for a cryptic organelle, and its presence is only discovered through phylogenetic analysis of molecular relicts followed by their localisation to organelle-like structures. Since the organelles are derived from eubacteria, the genes for proteins and RNAs associated with them are generally easily recognisable, and since the metabolic activities retained in these organelles are prokaryotic, or at least very unusual, they often serve as an important target for therapeutics. Cryptic mitochondria are now known in several protist and fungal parasites. In some cases (e.g., Trichomonas), well characterised but evolutionarily enigmatic organelles called hydrogenosomes were shown to be derived from mitochondria. In other cases (e.g., Entamoeba and microsporidia), "amitochondriate" parasites have been shown to harbour a previously undetected mitochondrial organelle. Typically, little is known about the functions of these newly discovered organelles, but recent progress in several groups has revealed a number of potential functions. Cryptic plastids have now been found in a small number of parasites that were not previously suspected to have algal ancestors. One recent case is the discovery that

  18. Wolbachia Infections Mimic Cryptic Speciation in Two Parasitic Butterfly Species, Phengaris teleius and P. nausithous (Lepidoptera: Lycaenidae)

    PubMed Central

    Ritter, Sylvia; Michalski, Stefan G.; Settele, Josef; Wiemers, Martin; Fric, Zdenek F.; Sielezniew, Marcin; Šašić, Martina; Rozier, Yves; Durka, Walter


    Deep mitochondrial divergence within species may result from cryptic speciation, from phylogeographic isolation or from endosymbiotic bacteria like Wolbachia that manipulate host reproduction. Phengaris butterflies are social parasites that spend most of their life in close relationship with ants. Previously, cryptic speciation has been hypothesised for two Phengaris species based on divergent mtDNA sequences. Since Phengaris species are highly endangered, the existence of cryptic species would have drastic consequences for conservation and management. We tested for cryptic speciation and alternative scenarios in P. teleius and P. nausithous based on a comprehensive sample across their Palaearctic ranges using COI gene sequences, nuclear microsatellites and tests for Wolbachia. In both species a deep mitochondrial split occurring 0.65–1.97 myrs ago was observed that did not correspond with microsatellite data but was concordant with Wolbachia infection. Haplotypes previously attributed to cryptic species were part of the Wolbachia-infected clades. In both species remaining phylogeographic structure was largely consistent between mitochondrial and nuclear genomes. In P. teleius several mitochondrial and nuclear groups were observed in East Asia while a single haplogroup and nuclear cluster prevailed across continental Eurasia. Neutrality tests suggested rapid demographic expansion into that area. In contrast, P. nausithous had several mitochondrial and nuclear groups in Europe, suggesting a complex phylogeographic history in the western part of the species range. We conclude that deep intraspecific divergences found in DNA barcode studies do not necessarily need to represent cryptic speciation but instead can be due to both infection by Wolbachia and phylogeographic structure. PMID:24223136

  19. The Conformational Changes Induced by Ubiquinone Binding in the Na+-pumping NADH:Ubiquinone Oxidoreductase (Na+-NQR) Are Kinetically Controlled by Conserved Glycines 140 and 141 of the NqrB Subunit*

    PubMed Central

    Strickland, Madeleine; Juárez, Oscar; Neehaul, Yashvin; Cook, Darcie A.; Barquera, Blanca; Hellwig, Petra


    Na+-pumping NADH:ubiquinone oxidoreductase (Na+-NQR) is responsible for maintaining a sodium gradient across the inner bacterial membrane. This respiratory enzyme, which couples sodium pumping to the electron transfer between NADH and ubiquinone, is not present in eukaryotes and as such could be a target for antibiotics. In this paper it is shown that the site of ubiquinone reduction is conformationally coupled to the NqrB subunit, which also hosts the final cofactor in the electron transport chain, riboflavin. Previous work showed that mutations in conserved NqrB glycine residues 140 and 141 affect ubiquinone reduction and the proper functioning of the sodium pump. Surprisingly, these mutants did not affect the dissociation constant of ubiquinone or its analog HQNO (2-n-heptyl-4-hydroxyquinoline N-oxide) from Na+-NQR, which indicates that these residues do not participate directly in the ubiquinone binding site but probably control its accessibility. Indeed, redox-induced difference spectroscopy showed that these mutations prevented the conformational change involved in ubiquinone binding but did not modify the signals corresponding to bound ubiquinone. Moreover, data are presented that demonstrate the NqrA subunit is able to bind ubiquinone but with a low non-catalytically relevant affinity. It is also suggested that Na+-NQR contains a single catalytic ubiquinone binding site and a second site that can bind ubiquinone but is not active. PMID:25006248

  20. Separation in flowering time contributes to the maintenance of sympatric cryptic plant lineages

    PubMed Central

    Michalski, Stefan G; Durka, Walter


    Sympatric cryptic lineages are a challenge for the understanding of species coexistence and lineage diversification as well as for management, conservation, and utilization of plant genetic resources. In higher plants studies providing insights into the mechanisms creating and maintaining sympatric cryptic lineages are rare. Here, using microsatellites and chloroplast sequence data, morphometric analyses, and phenological observations, we ask whether sympatrically coexisting lineages in the common wetland plant Juncus effusus are ecologically differentiated and reproductively isolated. Our results show two genetically highly differentiated, homoploid lineages within J. effusus that are morphologically cryptic and have similar preference for soil moisture content. However, flowering time differed significantly between the lineages contributing to reproductive isolation and the maintenance of these lineages. Furthermore, the later flowering lineage suffered less from predispersal seed predation by a Coleophora moth species. Still, we detected viable and reproducing hybrids between both lineages and the earlier flowering lineage and J. conglomeratus, a coexisting close relative. Flowering time differentiation between the lineages can be explained by neutral divergence alone and together with a lack of postzygotic isolation mechanisms; the sympatric coexistence of these lineages is most likely the result of an allopatric origin with secondary contact. PMID:26078854

  1. Phylogeny and cryptic diversity in geckos (Phyllopezus; Phyllodactylidae; Gekkota) from South America's open biomes.


    Gamble, Tony; Colli, Guarino R; Rodrigues, Miguel T; Werneck, Fernanda P; Simons, Andrew M


    The gecko genus Phyllopezus occurs across South America's open biomes: Cerrado, Seasonally Dry Tropical Forests (SDTF, including Caatinga), and Chaco. We generated a multi-gene dataset and estimated phylogenetic relationships among described Phyllopezus taxa and related species. We included exemplars from both described Phyllopezus pollicaris subspecies, P. p. pollicaris and P. p.przewalskii. Phylogenies from the concatenated data as well as species trees constructed from individual gene trees were largely congruent. All phylogeny reconstruction methods showed Bogertia lutzae as the sister species of Phyllopezus maranjonensis, rendering Phyllopezus paraphyletic. We synonymized the monotypic genus Bogertia with Phyllopezus to maintain a taxonomy that is isomorphic with phylogenetic history. We recovered multiple, deeply divergent, cryptic lineages within P. pollicaris. These cryptic lineages possessed mtDNA distances equivalent to distances among other gekkotan sister taxa. Described P. pollicaris subspecies are not reciprocally monophyletic and current subspecific taxonomy does not accurately reflect evolutionary relationships among cryptic lineages. We highlight the conservation significance of these results in light of the ongoing habitat loss in South America's open biomes.

  2. Empirical Evidence Supporting Frequent Cryptic Speciation in Epiphyllous Liverworts: A Case Study of the Cololejeunea lanciloba Complex

    PubMed Central

    Yu, Ying; Heinrichs, Jochen; Zhu, Rui-Liang; Schneider, Harald


    Cryptic species are frequently recovered in plant lineages, and considered an important cause for divergent of morphological disparity and species diversity. The identification of cryptic species has important implications for the assessment of conservation needs of species aggregates. The mechanisms and processes of the origin of cryptic species diversity are still poorly understand based on the lack of studies especially in context of environment factors. Here we explored evidence for cryptic species within the epiphyllous liverworts Cololejeunea lanciloba complex based on two loci, the plastid trnL-F region and the nuclear ribosomal ITS region. Several analytic approaches were employed to delimit species based on DNA sequence variation including phylogenetic reconstruction, statistical parsimony networks analysis and two recently introduced species delimitation criteria: Rosenberg’s reciprocal monophyly and Rodrigo’s randomly distinct. We found evidence for thirteen genetically distinct putative species, each consisting of more than one haplotype, rather than four morphologically-circumscribed species. The results implied that the highly conserved phenotypes are not congruent with the genetic differentiation, contributing to incorrect assessments of the biodiversity of epiphyllous liverworts. We hypothesize that evolution of cryptic species recovered may be caused by selection of traits critical to the survival in epiphyllous habitats combined with limited developmental options designed in the small body. PMID:24367634

  3. Cryptic genetic variation, evolution's hidden substrate

    PubMed Central

    Paaby, Annalise B.; Rockman, Matthew V.


    Cryptic genetic variation is invisible under normal conditions but fuel for evolution when circumstances change. In theory, CGV can represent a massive cache of adaptive potential or a pool of deleterious alleles in need of constant suppression. CGV emerges from both neutral and selective processes and it may inform how human populations respond to change. In experimental settings, CGV facilitates adaptation, but does it play an important role in the real world? We review the empirical support for widespread CGV in natural populations, including its potential role in emerging human diseases and the growing evidence of its contribution to evolution. PMID:24614309

  4. Recursion relations for conformal blocks

    NASA Astrophysics Data System (ADS)

    Penedones, João; Trevisani, Emilio; Yamazaki, Masahito


    In the context of conformal field theories in general space-time dimension, we find all the possible singularities of the conformal blocks as functions of the scaling dimension Δ of the exchanged operator. In particular, we argue, using representation theory of parabolic Verma modules, that in odd spacetime dimension the singularities are only simple poles. We discuss how to use this information to write recursion relations that determine the conformal blocks. We first recover the recursion relation introduced in [1] for conformal blocks of external scalar operators. We then generalize this recursion relation for the conformal blocks associated to the four point function of three scalar and one vector operator. Finally we specialize to the case in which the vector operator is a conserved current.

  5. Familial cryptic translocation in Angelman syndrome

    SciTech Connect

    Weyerts, L.K.; Wiley, J.E.; Loud, K.M.


    The majority of patients with Angelman syndrome have been shown to have a cytogenetic or molecular deletion on the maternally derived chromosome 15. We report on a case of Angelman syndrome in which this deletion occurs as an unbalanced cryptic translocation involving chromosomes 14 and 15. The proband was diagnosed clinically as having Angelman syndrome. Multiple cytogenetic studies were done without detecting any deletion. When DNA probes (Oncor) specific for the Prader Willi/Angelman locus became available, the patient was restudied and found to be deleted for {open_quotes}region A{close_quotes} (D15S11) but not for {open_quotes}region B{close_quotes} (GABRB3). No other abnormality was detected. The proband`s mother was then studied. The chromosome 15 marker probe and D15S11 were detected on different chromosomes. Using alpha-satellite probes, a cryptic 14;15 translocation was uncovered. This balanced translocation was also found to be carried by the sister of the proband. This case, along with a case presented at the 1993 ASHG meeting, illustrates the need for using acrocentric probes when studying Angelman syndrome patients. The proband was studied using additional probes specific for this region and found to be deleted for SNRPN but not for D15S10. The breakpoint of the translocation in this patient delineates the smallest deletion of the Angelman syndrome region reported to date and therefore may represent the specific gene involved.

  6. Shoot, shovel and shut up: cryptic poaching slows restoration of a large carnivore in Europe.


    Liberg, Olof; Chapron, Guillaume; Wabakken, Petter; Pedersen, Hans Christian; Hobbs, N Thompson; Sand, Håkan


    Poaching is a widespread and well-appreciated problem for the conservation of many threatened species. Because poaching is illegal, there is strong incentive for poachers to conceal their activities, and consequently, little data on the effects of poaching on population dynamics are available. Quantifying poaching mortality should be a required knowledge when developing conservation plans for endangered species but is hampered by methodological challenges. We show that rigorous estimates of the effects of poaching relative to other sources of mortality can be obtained with a hierarchical state-space model combined with multiple sources of data. Using the Scandinavian wolf (Canis lupus) population as an illustrative example, we show that poaching accounted for approximately half of total mortality and more than two-thirds of total poaching remained undetected by conventional methods, a source of mortality we term as 'cryptic poaching'. Our simulations suggest that without poaching during the past decade, the population would have been almost four times as large in 2009. Such a severe impact of poaching on population recovery may be widespread among large carnivores. We believe that conservation strategies for large carnivores considering only observed data may not be adequate and should be revised by including and quantifying cryptic poaching. PMID:21849323

  7. The N-terminus of the Montano virus nucleocapsid protein possesses broadly cross-reactive conformation-dependent epitopes conserved in rodent-borne hantaviruses.


    Saasa, Ngonda; Yoshida, Haruka; Shimizu, Kenta; Sánchez-Hernández, Cornelio; Romero-Almaraz, María de Lourdes; Koma, Takaaki; Sanada, Takahiro; Seto, Takahiro; Yoshii, Kentaro; Ramos, Celso; Yoshimatsu, Kumiko; Arikawa, Jiro; Takashima, Ikuo; Kariwa, Hiroaki


    The hantavirus nucleocapsid (N) protein is an important immunogen that stimulates a strong and cross-reactive immune response in humans and rodents. A large proportion of the response to N protein has been found to target its N-terminus. However, the exact nature of this bias towards the N-terminus is not yet fully understood. We characterized six monoclonal antibodies (mAbs) against the N protein of Montano virus (MTNV), a Mexican hantavirus. Five of these mAbs recognized eight American hantaviruses and six European and Asian hantaviruses, but not the Soricomorpha-borne Thottapalayam hantavirus. The N protein-reactive binding regions of the five mAbs were mapped to discontinuous epitopes within the N-terminal 13-51 amino acid residues, while a single serotype-specific mAb was mapped to residues 1-25 and 49-75. Our findings suggest that discontinuous epitopes at the N-terminus are conserved, at least in rodent-borne hantaviruses, and that they contribute considerably to N protein cross-reactivity.

  8. Range of CD4-Bound Conformations of HIV-1 gp120, as Defined Using Conditional CD4-Induced Antibodies

    PubMed Central

    Kaplan, Gilad; Roitburd-Berman, Anna; Lewis, George K.


    ABSTRACT The HIV envelope binds cellular CD4 and undergoes a range of conformational changes that lead to membrane fusion and delivery of the viral nucleocapsid into the cellular cytoplasm. This binding to CD4 reveals cryptic and highly conserved epitopes, the molecular nature of which is still not fully understood. The atomic structures of CD4 complexed with gp120 core molecules (a form of gp120 in which the V1, V2, and V3 loops and N and C termini have been truncated) have indicated that a hallmark feature of the CD4-bound conformation is the bridging sheet minidomain. Variations in the orientation of the bridging sheet hairpins have been revealed when CD4-liganded gp120 was compared to CD4-unliganded trimeric envelope structures. Hence, there appears to be a number of conformational transitions possible in HIV-1 monomeric gp120 that are affected by CD4 binding. The spectrum of CD4-bound conformations has been interrogated in this study by using a well-characterized panel of conditional, CD4-induced (CD4i) monoclonal antibodies (MAbs) that bind HIV-1 gp120 and its mutations under various conditions. Two distinct CD4i epitopes of the outer domain were studied: the first comprises the bridging sheet, while the second contains elements of the V2 loop. Furthermore, we show that the unliganded extended monomeric core of gp120 (coree) assumes an intermediate CD4i conformation in solution that further undergoes detectable rearrangements upon association with CD4. These discoveries impact both accepted paradigms concerning gp120 structure and the field of HIV immunogen design. IMPORTANCE Elucidation of the conformational transitions that the HIV-1 envelope protein undergoes during the course of entry into CD4+ cells is fundamental to our understanding of HIV biology. The binding of CD4 triggers a range of gp120 structural rearrangements that could present targets for future drug design and development of preventive vaccines. Here we have systematically interrogated and

  9. Conformable seal


    Neef, W.S.; Lambert, D.R.


    Sealing apparatus and method, comprising first and second surfaces or membranes, at least one of which surfaces is deformable, placed in proximity to one another. Urging means cause these surfaces to contact one another in a manner such that the deformable surface deforms to conform to the geometry of the other surface, thereby creating a seal. The seal is capable of undergoing multiple cycles of sealing and unsealing.

  10. Cryptic Species or Inadequate Taxonomy? Implementation of 2D Geometric Morphometrics Based on Integumental Organs as Landmarks for Delimitation and Description of Copepod Taxa.


    Karanovic, Tomislav; Djurakic, Marko; Eberhard, Stefan M


    Discovery of cryptic species using molecular tools has become common in many animal groups but it is rarely accompanied by morphological revision, creating ongoing problems in taxonomy and conservation. In copepods, cryptic species have been discovered in most groups where fast-evolving molecular markers were employed. In this study at Yeelirrie in Western Australia we investigate a subterranean species complex belonging to the harpacticoid genus Schizopera Sars, 1905, using both the barcoding mitochondrial COI gene and landmark-based two-dimensional geometric morphometrics. Integumental organs (sensilla and pores) are used as landmarks for the first time in any crustacean group. Complete congruence between DNA-based species delimitation and relative position of integumental organs in two independent morphological structures suggests the existence of three distinct evolutionary units. We describe two of them as new species, employing a condensed taxonomic format appropriate for cryptic species. We argue that many supposedly cryptic species might not be cryptic if researchers focus on analyzing morphological structures with multivariate tools that explicitly take into account geometry of the phenotype. A perceived supremacy of molecular methods in detecting cryptic species is in our view a consequence of disparity of investment and unexploited recent advancements in morphometrics among taxonomists. Our study shows that morphometric data alone could be used to find diagnostic morphological traits and gives hope to anyone studying small animals with a hard integument or shell, especially opening the door to assessing fossil diversity and rich museum collections. We expect that simultaneous use of molecular tools with geometry-oriented morphometrics may yield faster formal description of species. Decrypted species in this study are a good example for urgency of formal descriptions, as they display short-range endemism in small groundwater calcrete aquifers in a

  11. Ecological divergence promotes the evolution of cryptic reproductive isolation.


    Nosil, Patrik; Crespi, Bernard J


    Speciation can involve the evolution of 'cryptic' reproductive isolation that occurs after copulation but before hybrid offspring are produced. Because such cryptic barriers to gene exchange involve post-mating sexual interactions, analyses of their evolution have focused on sexual conflict or traditional sexual selection. Here, we show that ecological divergence between populations of herbivorous walking sticks is integral to the evolution of cryptic reproductive isolation. Low female fitness following between-population mating can reduce gene exchange between populations, thus acting as a form of cryptic isolation. Female walking sticks show reduced oviposition rate and lower lifetime fecundity following between-population versus within-population mating, but only for mating between populations using different host-plant species. Our results indicate that even inherently sexual forms of reproductive isolation can evolve as a by-product of ecological divergence and that post-mating sexual interactions do not necessarily evolve independently of the ecological environment.

  12. Compound heterozygous DUOX2 gene mutations (c.2335-1G>C/c.3264_3267delCAGC) associated with congenital hypothyroidism. Characterization of complex cryptic splice sites by minigene analysis.


    Belforte, Fiorella S; Citterio, Cintia E; Testa, Graciela; Olcese, María Cecilia; Sobrero, Gabriela; Miras, Mirta B; Targovnik, Héctor M; Rivolta, Carina M


    Iodide Organification defects (IOD) represent 10% of cases of congenital hypothyroidism (CH) being the main genes affected that of TPO (thyroid peroxidase) and DUOX2 (dual oxidasa 2). From a patient with clinical and biochemical criteria suggestive with CH associated with IOD, TPO and DUOX2 genes were analyzed by means of PCR-Single Strand Conformation Polymorphism analysis and sequencing. A novel heterozygous compound to the mutations c.2335-1G>C (paternal mutation, intron 17) and c.3264_3267delCAGC (maternal mutation, exon 24) was identified in the DUOX2 gene. Ex-vivo splicing assays and subsequent RT-PCR and sequencing analyses were performed on mRNA isolated from the HeLa cells transfected with wild-type and mutant pSPL3 expression vectors. The wild-type and c.2335-1G>C mutant alleles result in the complete inclusion or exclusion of exon 18, or in the activation of an exonic cryptic 5' ss with the consequent deletion of 169 bp at the end of this exon. However, we observed only a band of the expected size in normal thyroid tissue by RT-PCR. Additionally, the c.2335-1G>C mutation activates an unusual cryptic donor splice site in intron 17, located at position -14 of the authentic intron 17/exon 18 junction site, with an insertion of the last 14 nucleotides of the intron 17 in mutant transcripts with complete and partial inclusion of exon 18. The theoretical consequences of splice site mutation, predicted with the bioinformatics NNSplice, Fsplice, SPL, SPLM and MaxEntScan programs were investigated and evaluated in relation with the experimental evidence. These analyses confirm that c.2335-1G>C mutant allele would result in the abolition of the authentic splice acceptor site. The results suggest the coexistence in our patient of four putative truncated proteins of 786, 805, 806 and 1105 amino acids, with conservation of peroxidase-like domain and loss of gp91(phox)/NOX2-like domain. In conclusion a novel heterozygous compound was identified being responsible of

  13. Transcriptional Derepression Uncovers Cryptic Higher-Order Genetic Interactions

    PubMed Central

    Taylor, Matthew B.; Ehrenreich, Ian M.


    Disruption of certain genes can reveal cryptic genetic variants that do not typically show phenotypic effects. Because this phenomenon, which is referred to as ‘phenotypic capacitance’, is a potential source of trait variation and disease risk, it is important to understand how it arises at the genetic and molecular levels. Here, we use a cryptic colony morphology trait that segregates in a yeast cross to explore the mechanisms underlying phenotypic capacitance. We find that the colony trait is expressed when a mutation in IRA2, a negative regulator of the Ras pathway, co-occurs with specific combinations of cryptic variants in six genes. Four of these genes encode transcription factors that act downstream of the Ras pathway, indicating that the phenotype involves genetically complex changes in the transcriptional regulation of Ras targets. We provide evidence that the IRA2 mutation reveals the phenotypic effects of the cryptic variants by disrupting the transcriptional silencing of one or more genes that contribute to the trait. Supporting this role for the IRA2 mutation, deletion of SFL1, a repressor that acts downstream of the Ras pathway, also reveals the phenotype, largely due to the same cryptic variants that were detected in the IRA2 mutant cross. Our results illustrate how higher-order genetic interactions among mutations and cryptic variants can result in phenotypic capacitance in specific genetic backgrounds, and suggests these interactions might reflect genetically complex changes in gene expression that are usually suppressed by negative regulation. PMID:26484664

  14. Hidden Diversity in Sardines: Genetic and Morphological Evidence for Cryptic Species in the Goldstripe Sardinella, Sardinella gibbosa (Bleeker, 1849)

    PubMed Central

    Thomas, Rey C.; Willette, Demian A.; Carpenter, Kent E.; Santos, Mudjekeewis D.


    Cryptic species continue to be uncovered in many fish taxa, posing challenges for fisheries conservation and management. In Sardinella gibbosa, previous investigations revealed subtle intra-species variations, resulting in numerous synonyms and a controversial taxonomy for this sardine. Here, we tested for cryptic diversity within S. gibbosa using genetic data from two mitochondrial and one nuclear gene regions of 248 individuals of S. gibbosa, collected from eight locations across the Philippine archipelago. Deep genetic divergence and subsequent clustering was consistent across both mitochondrial and nuclear markers. Clade distribution is geographically limited: Clade 1 is widely distributed in the central Philippines, while Clade 2 is limited to the northernmost sampling site. In addition, morphometric analyses revealed a unique head shape that characterized each genetic clade. Hence, both genetic and morphological evidence strongly suggests a hidden diversity within this common and commercially-important sardine. PMID:24416271

  15. Epidermolytic palmoplantar keratoderma caused by activation of a cryptic splice site in KRT9.


    Fuchs-Telem, D; Padalon-Brauch, G; Sarig, O; Sprecher, E


    Epidermolytic palmoplantar keratoderma (EPPK) is caused by mutations in KRT9 and less often, KRT1. All known mutations in KRT9 have been found in regions of the gene encoding the conserved central α-helix rod domain. In the present study, we investigated the molecular basis of EPPK in a patient of Ashkenazi Jewish origin. The patient was found to carry a novel missense mutation in KRT9, resulting in the substitution of a poorly conserved leucine for valine at position 11 of the amino acid sequence. Despite its unusual location, the mutation was shown to be pathogenic through activation of a cryptic donor splice site, resulting in the deletion of 162 amino acids. The present data indicate the need to screen keratin genes in their entirety, as mutations altering domains of lesser functional importance may exert their deleterious effect at the transcriptional level.

  16. Crystal Structures of Beryllium Fluoride-Free and Beryllium Fluoride-Bound CheY in Complex with the Conserved C-Terminal Peptide of CheZ Reveal Dual Binding Modes Specific to CheY Conformation

    SciTech Connect

    Guhaniyogi,J.; Robinson, V.; Stock, A.


    Chemotaxis, the environment-specific swimming behavior of a bacterial cell is controlled by flagellar rotation. The steady-state level of the phosphorylated or activated form of the response regulator CheY dictates the direction of flagellar rotation. CheY phosphorylation is regulated by a fine equilibrium of three phosphotransfer activities: phosphorylation by the kinase CheA, its auto-dephosphorylation and dephosphorylation by its phosphatase CheZ. Efficient dephosphorylation of CheY by CheZ requires two spatially distinct protein-protein contacts: tethering of the two proteins to each other and formation of an active site for dephosphorylation. The former involves interaction of phosphorylated CheY with the small highly conserved C-terminal helix of CheZ (CheZ{sub C}), an indispensable structural component of the functional CheZ protein. To understand how the CheZ{sub C} helix, representing less than 10% of the full-length protein, ascertains molecular specificity of binding to CheY, we have determined crystal structures of CheY in complex with a synthetic peptide corresponding to 15 C-terminal residues of CheZ (CheZ{sub 200-214}) at resolutions ranging from 2.0 Angstroms to 2.3 Angstroms. These structures provide a detailed view of the CheZC peptide interaction both in the presence and absence of the phosphoryl analog, BeF{sub 3}{sup -}. Our studies reveal that two different modes of binding the CheZ{sub 200-214} peptide are dictated by the conformational state of CheY in the complex. Our structures suggest that the CheZ{sub C} helix binds to a 'meta-active' conformation of inactive CheY and it does so in an orientation that is distinct from the one in which it binds activated CheY. Our dual binding mode hypothesis provides implications for reverse information flow in CheY and extends previous observations on inherent resilience in CheY-like signaling domains.

  17. Crystal Structures of Beryllium Fluoride-Free and Beryllium Fluoride-Bound CheY in Complex with the Conserved C-Terminal Peptide of CheZ Reveal Dual Binding Modes Specific to CheY Conformation

    PubMed Central

    Guhaniyogi, Jayita; Robinson, Victoria L.; Stock, Ann M.


    Summary Chemotaxis, the environment-specific swimming behavior of a bacterial cell is controlled by flagellar rotation. The steady-state level of the phosphorylated or activated form of the response regulator CheY dictates the direction of flagellar rotation. CheY phosphorylation is regulated by a fine equilibrium of three phosphotransfer activities: phosphorylation by the kinase CheA, its auto-dephosphorylation and dephosphorylation by its phosphatase CheZ. Efficient dephosphorylation of CheY by CheZ requires two spatially distinct protein-protein contacts: tethering of the two proteins to each other and formation of an active site for dephosphorylation. The latter involves interaction of phosphorylated CheY with the small highly conserved C-terminal helix of CheZ (CheZC), an indispensable structural component of the functional CheZ protein. To understand how the CheZC helix, representing less than 1% of the full-length protein, ascertains molecular specificity of binding to CheY, we have determined crystal structures of CheY in complex with a synthetic peptide corresponding to 15 C-terminal residues of CheZ (CheZ200-214) at resolutions ranging from 2.0 Å to 2.3 Å. These structures provide a detailed view of the CheZC peptide interaction both in the presence and absence of the phosphoryl analog, BeF3−. Our studies reveal that two different modes of binding the CheZ200-214 peptide are dictated by the conformational state of CheY in the complex. Our structures suggest that the CheZC helix binds to a “meta-active” conformation of inactive CheY and it does so in an orientation that is distinct from the one in which it binds activated CheY. Our dual binding mode hypothesis provides implications for reverse information flow in CheY and extends previous observations on inherent resilience in CheY-like signaling domains. PMID:16674976

  18. Cryptic sex in the smallest eukaryotic marine green alga.


    Grimsley, Nigel; Péquin, Bérangère; Bachy, Charles; Moreau, Hervé; Piganeau, Gwenaël


    Ostreococcus spp. are common worldwide oceanic picoeukaryotic pelagic algae. The complete genomes of three strains from different ecological niches revealed them to represent biologically distinct species despite their identical cellular morphologies (cryptic species). Their tiny genomes (13 Mb), with approximately 20 chromosomes, are colinear and densely packed with coding sequences, but no sexual life cycle has been described. Seventeen new strains of one of these species, Ostreococcus tauri, were isolated from 98 seawater samplings from the NW Mediterranean by filtering, culturing, cloning, and plating for single colonies and identification by sequencing their ribosomal 18S gene. In order to find the genetic markers for detection of polymorphisms and sexual recombination, we used an in silico approach to screen available genomic data. Intergenic regions of DNA likely to evolve neutrally were analyzed following polymerase chain reaction amplification of sequences using flanking primers from adjacent conserved coding sequences that were present as syntenic pairs in two different species of Ostreococcus. Analyses of such DNA regions from eight marker loci on two chromosomes from each strain revealed that the isolated O. tauri clones were haploid and that the overall level of polymorphism was approximately 0.01. Four different genetic tests for recombination showed that sexual exchanges must be inferred to account for the between-locus and between-chromosome marker combinations observed. However, our data suggest that sexual encounters are infrequent because we estimate the frequency of meioses/mitoses among the sampled strains to be 10(-6). Ostreococcus tauri and related species encode and express core genes for mitosis and meiosis, but their mechanisms of cell division and recombination, nevertheless, remain enigmatic because a classical eukaryotic spindle with 40 canonical microtubules would be much too large for the available approximately 0.9-microm(3) cellular

  19. River barriers and cryptic biodiversity in an evolutionary museum

    PubMed Central

    Voelker, G; Marks, B D; Kahindo, C; A'genonga, U; Bapeamoni, F; Duffie, L E; Huntley, J W; Mulotwa, E; Rosenbaum, S A; Light, J E


    The Riverine Barriers Hypothesis (RBH) posits that tropical rivers can be effective barriers to gene flow, based on observations that range boundaries often coincide with river barriers. Over the last 160 years, the RBH has received attention from various perspectives, with a particular focus on vertebrates in the Amazon Basin. To our knowledge, no molecular assessment of the RBH has been conducted on birds in the Afrotropics, despite its rich avifauna and many Afrotropical bird species being widely distributed across numerous watersheds and basins. Here, we provide the first genetic evidence that an Afrotropical river has served as a barrier for birds and for their lice, based on four understory bird species collected from sites north and south of the Congo River. Our results indicate near-contemporaneous, Pleistocene lineage diversification across the Congo River in these species. Our results further indicate differing levels of genetic variation in bird lice; the extent of this variation appears linked to the life-history of both the host and the louse. Extensive cryptic diversity likely is being harbored in Afrotropical forests, in both understory birds and their lice. Therefore, these forests may not be “museums” of old lineages. Rather, substantial evolutionary diversification may have occurred in Afrotropical forests throughout the Pleistocene, supporting the Pleistocene Forest Refuge Hypothesis. Strong genetic variation in birds and their lice within a small part of the Congo Basin forest indicates that we may have grossly underestimated diversity in the Afrotropics, making these forests home of substantial biodiversity in need of conservation. PMID:23532272

  20. DNA sequences identify numerous cryptic species of the vertebrate: a lesson from the gobioid fish Schindleria.


    Kon, Takeshi; Yoshino, Tetsuo; Mukai, Takahiko; Nishida, Mutsumi


    Schindleria (Gobioidei, Schindleriidae), believed to include one of the smallest and youngest reproducing vertebrates, is broadly distributed in the Indo-Pacific Oceans, inhabiting coral reef lagoons. They are all characterized by a reduced larval-like form, such as a slender translucent and scaleless body. The three nominal species recognized in the genus to date have been distinguished by only combination of dorsal and anal fin-ray counts, and the existence of some undescribed species has been suggested in Schindleria; thus a total picture of species composition of the genus is poorly known. Towards the disclosure of diversity of Schindleria, a molecular phylogenetic analysis using partial mitochondrial 16S rRNA sequences was conducted for specimens from the Ryukyu and Ogasawara Islands, Japan. This analysis showed clearly that as many as 21 genetically distinguishable species occurred within the geographical areas. The degree of species crypticness of "S. praematura" [15.0=15 (new cryptic species + known species)/1 (known species)] is higher than the values of well-known animal examples, such as the pan-mesopelagic bristlemouth fish Cyclothone alba (5.0) and the South American skipper butterfly Astraptes fulgerator (10.0). This discovery of many cryptic species in Schindleria suggests that the use of DNA sequences is necessary for species identification of such morphologically conserved taxa. Because molecular analyses should increase the number of hitherto unnamed and pseudonymous species, especially in tropical areas, it is proposed that DNA-based designation is necessary for such taxa in order to compile the full "species lists", although there is presently no consensus for the inclusion of DNA sequencing data in the formal descriptions of new species.

  1. Cryptic cuckoo eggs hide from competing cuckoos.


    Gloag, Ros; Keller, Laurie-Anne; Langmore, Naomi E


    Interspecific arms races between cuckoos and their hosts have produced remarkable examples of mimicry, with parasite eggs evolving to match host egg appearance and so evade removal by hosts. Certain bronze-cuckoo species, however, lay eggs that are cryptic rather than mimetic. These eggs are coated in a low luminance pigment that camouflages them within the dark interiors of hosts' nests. We investigated whether cuckoo egg crypsis is likely to have arisen from the same coevolutionary processes known to favour egg mimicry. We added high and low luminance-painted eggs to the nests of large-billed gerygones (Gerygone magnirostris), a host of the little bronze-cuckoo (Chalcites minutillus). Gerygones rarely rejected either egg type, and did not reject natural cuckoo eggs. Cuckoos, by contrast, regularly removed an egg from clutches before laying their own and were five times more likely to remove a high luminance model than its low luminance counterpart. Given that we found one-third of all parasitized nests were exploited by multiple cuckoos, our results suggest that competition between cuckoos has been the key selective agent for egg crypsis. In such intraspecific arms races, crypsis may be favoured over mimicry because it can reduce the risk of egg removal to levels below chance. PMID:25122227

  2. Cryptic cuckoo eggs hide from competing cuckoos.


    Gloag, Ros; Keller, Laurie-Anne; Langmore, Naomi E


    Interspecific arms races between cuckoos and their hosts have produced remarkable examples of mimicry, with parasite eggs evolving to match host egg appearance and so evade removal by hosts. Certain bronze-cuckoo species, however, lay eggs that are cryptic rather than mimetic. These eggs are coated in a low luminance pigment that camouflages them within the dark interiors of hosts' nests. We investigated whether cuckoo egg crypsis is likely to have arisen from the same coevolutionary processes known to favour egg mimicry. We added high and low luminance-painted eggs to the nests of large-billed gerygones (Gerygone magnirostris), a host of the little bronze-cuckoo (Chalcites minutillus). Gerygones rarely rejected either egg type, and did not reject natural cuckoo eggs. Cuckoos, by contrast, regularly removed an egg from clutches before laying their own and were five times more likely to remove a high luminance model than its low luminance counterpart. Given that we found one-third of all parasitized nests were exploited by multiple cuckoos, our results suggest that competition between cuckoos has been the key selective agent for egg crypsis. In such intraspecific arms races, crypsis may be favoured over mimicry because it can reduce the risk of egg removal to levels below chance.

  3. Cryptic genetic variation and paraphyly in ravens.

    PubMed Central

    Omland, K E; Tarr, C L; Boarma, W I; Marzluff, J M; Fleischer, R C


    Widespread species that are morphologically uniform may be likely to harbour cryptic genetic variation. Common ravens (Corvus corax) have an extensive range covering nearly the entire Northern Hemisphere, but show little discrete phenotypic variation. We obtained tissue samples from throughout much of this range and collected mitochondrial sequence and nuclear microsatellite data. Our study revealed a deep genetic break between ravens from the western United States and ravens from throughout the rest of the world. These two groups, the 'California clade' and the 'Holarctic clade' are well supported and over 4% divergent in mitochondrial coding sequence. Microsatellites also reveal significant differentiation between these two groups. Ravens from Minnesota, Maine and Alaska are more similar to ravens from Asia and Europe than they are to ravens from California. The two clades come in contact over a huge area of the western United States, with mixtures of the two mitochondrial groups present in Washington, Idaho and California. In addition, the restricted range Chihuahuan raven (Corvus cryptoleucus) of the south-west United States and Mexico is genetically nested within the paraphyletic common raven. Our findings suggest that the common raven may have formerly consisted of two allopatric groups that may be in the process of remerging. PMID:11197122

  4. Contemporary cryptic sexuality in Trypanosoma cruzi.


    Ramírez, Juan David; Guhl, Felipe; Messenger, Louisa A; Lewis, Michael D; Montilla, Marleny; Cucunuba, Zulma; Miles, Michael A; Llewellyn, Martin S


    Clonal propagation is considered to be the predominant mode of reproduction among many parasitic protozoa. However, this assumption may overlook unorthodox, infrequent or cryptic sexuality. Trypanosoma cruzi, which causes Chagas disease, is known to undergo non-Mendelian genetic exchange in the laboratory. In the field, evidence of extant genetic exchange is limited. In this study, we undertook intensive sampling of T. cruzi Discrete Typing Unit I in endemic eastern Colombia. Using Fluorescence-activated cell sorting, we generated 269 biological clones from 67 strains. Each clone was genotyped across 24 microsatellite loci. Subsequently, 100 representative clones were typed using 10 mitochondrial sequence targets (3.76 Kbp total). Clonal diversity among humans, reservoir hosts and vectors suggested complex patterns of superinfection and/or coinfection in oral and vector-borne Chagas disease cases. Clonal diversity between mother and foetus in a congenital case demonstrates that domestic TcI genotypes are infective in utero. Importantly, gross incongruence between nuclear and mitochondrial markers is strong evidence for widespread genetic exchange throughout the data set. Furthermore, a confirmed mosaic maxicircle sequence suggests intermolecular recombination between individuals as a further mechanism of genetic reassortment. Finally, robust dating based on mitochondrial DNA indicates that the emergence of a widespread domestic TcI clade that we now name TcI(DOM) (formerly TcIa/VEN(Dom)) occurred 23 000 ± 12 000 years ago and was followed by population expansion, broadly corresponding with the earliest human migration into the Americas. PMID:22774844

  5. Cryptic cuckoo eggs hide from competing cuckoos

    PubMed Central

    Gloag, Ros; Keller, Laurie-Anne; Langmore, Naomi E.


    Interspecific arms races between cuckoos and their hosts have produced remarkable examples of mimicry, with parasite eggs evolving to match host egg appearance and so evade removal by hosts. Certain bronze-cuckoo species, however, lay eggs that are cryptic rather than mimetic. These eggs are coated in a low luminance pigment that camouflages them within the dark interiors of hosts' nests. We investigated whether cuckoo egg crypsis is likely to have arisen from the same coevolutionary processes known to favour egg mimicry. We added high and low luminance-painted eggs to the nests of large-billed gerygones (Gerygone magnirostris), a host of the little bronze-cuckoo (Chalcites minutillus). Gerygones rarely rejected either egg type, and did not reject natural cuckoo eggs. Cuckoos, by contrast, regularly removed an egg from clutches before laying their own and were five times more likely to remove a high luminance model than its low luminance counterpart. Given that we found one-third of all parasitized nests were exploited by multiple cuckoos, our results suggest that competition between cuckoos has been the key selective agent for egg crypsis. In such intraspecific arms races, crypsis may be favoured over mimicry because it can reduce the risk of egg removal to levels below chance. PMID:25122227

  6. Cryptic Genetic Variation in Evolutionary Developmental Genetics

    PubMed Central

    Paaby, Annalise B.; Gibson, Greg


    Evolutionary developmental genetics has traditionally been conducted by two groups: Molecular evolutionists who emphasize divergence between species or higher taxa, and quantitative geneticists who study variation within species. Neither approach really comes to grips with the complexities of evolutionary transitions, particularly in light of the realization from genome-wide association studies that most complex traits fit an infinitesimal architecture, being influenced by thousands of loci. This paper discusses robustness, plasticity and lability, phenomena that we argue potentiate major evolutionary changes and provide a bridge between the conceptual treatments of macro- and micro-evolution. We offer cryptic genetic variation and conditional neutrality as mechanisms by which standing genetic variation can lead to developmental system drift and, sheltered within canalized processes, may facilitate developmental transitions and the evolution of novelty. Synthesis of the two dominant perspectives will require recognition that adaptation, divergence, drift and stability all depend on similar underlying quantitative genetic processes—processes that cannot be fully observed in continuously varying visible traits. PMID:27304973

  7. Interim Cosmetic Results and Toxicity Using 3D Conformal External Beam Radiotherapy to Deliver Accelerated Partial Breast Irradiation in Patients With Early-Stage Breast Cancer Treated With Breast-Conserving Therapy

    SciTech Connect

    Vicini, Frank A. Chen, Peter; Wallace, Michelle; Mitchell, Christina; Hasan, Yasmin; Grills, Inga; Kestin, Larry; Schell, Scott; Goldstein, Neal S.; Kunzman, Jonathan; Gilbert, Sam; Martinez, Alvaro


    Purpose: We present our ongoing clinical experience utilizing three-dimensional (3D)-conformal radiation therapy (3D-CRT) to deliver accelerated partial breast irradiation (APBI) in patients with early-stage breast cancer treated with breast-conserving therapy. Methods and Materials: Ninety-one consecutive patients were treated with APBI using our previously reported 3D-CRT technique. The clinical target volume consisted of the lumpectomy cavity plus a 10- to 15 -mm margin. The prescribed dose was 34 or 38.5 Gy in 10 fractions given over 5 consecutive days. The median follow-up was 24 months. Twelve patients have been followed for {>=}4 years, 20 for {>=}3.5 years, 29 for >3.0 years, 33 for {>=}2.5 years, and 46 for {>=}2.0 years. Results: No local recurrences developed. Cosmetic results were rated as good/excellent in 100% of evaluable patients at {>=} 6 months (n = 47), 93% at 1 year (n = 43), 91% at 2 years (n = 21), and in 90% at {>=}3 years (n = 10). Erythema, hyperpigmentation, breast edema, breast pain, telangiectasias, fibrosis, and fat necrosis were evaluated at 6, 24, and 36 months after treatment. All factors stabilized by 3 years posttreatment with grade I or II rates of 0%, 0%, 0%, 0%, 9%, 18%, and 9%, respectively. Only 2 patients (3%) developed grade III toxicity (breast pain), which resolved with time. Conclusions: Delivery of APBI with 3D-CRT resulted in minimal chronic ({>=}6 months) toxicity to date with good/excellent cosmetic results. Additional follow-up is needed to assess the long-term efficacy of this form of APBI.

  8. Causes and methods to estimate cryptic sources of fishing mortality.


    Gilman, E; Suuronen, P; Hall, M; Kennelly, S


    Cryptic, not readily detectable, components of fishing mortality are not routinely accounted for in fisheries management because of a lack of adequate data, and for some components, a lack of accurate estimation methods. Cryptic fishing mortalities can cause adverse ecological effects, are a source of wastage, reduce the sustainability of fishery resources and, when unaccounted for, can cause errors in stock assessments and population models. Sources of cryptic fishing mortality are (1) pre-catch losses, where catch dies from the fishing operation but is not brought onboard when the gear is retrieved, (2) ghost-fishing mortality by fishing gear that was abandoned, lost or discarded, (3) post-release mortality of catch that is retrieved and then released alive but later dies as a result of stress and injury sustained from the fishing interaction, (4) collateral mortalities indirectly caused by various ecological effects of fishing and (5) losses due to synergistic effects of multiple interacting sources of stress and injury from fishing operations, or from cumulative stress and injury caused by repeated sub-lethal interactions with fishing operations. To fill a gap in international guidance on best practices, causes and methods for estimating each component of cryptic fishing mortality are described, and considerations for their effective application are identified. Research priorities to fill gaps in understanding the causes and estimating cryptic mortality are highlighted. PMID:24090548

  9. Causes and methods to estimate cryptic sources of fishing mortality.


    Gilman, E; Suuronen, P; Hall, M; Kennelly, S


    Cryptic, not readily detectable, components of fishing mortality are not routinely accounted for in fisheries management because of a lack of adequate data, and for some components, a lack of accurate estimation methods. Cryptic fishing mortalities can cause adverse ecological effects, are a source of wastage, reduce the sustainability of fishery resources and, when unaccounted for, can cause errors in stock assessments and population models. Sources of cryptic fishing mortality are (1) pre-catch losses, where catch dies from the fishing operation but is not brought onboard when the gear is retrieved, (2) ghost-fishing mortality by fishing gear that was abandoned, lost or discarded, (3) post-release mortality of catch that is retrieved and then released alive but later dies as a result of stress and injury sustained from the fishing interaction, (4) collateral mortalities indirectly caused by various ecological effects of fishing and (5) losses due to synergistic effects of multiple interacting sources of stress and injury from fishing operations, or from cumulative stress and injury caused by repeated sub-lethal interactions with fishing operations. To fill a gap in international guidance on best practices, causes and methods for estimating each component of cryptic fishing mortality are described, and considerations for their effective application are identified. Research priorities to fill gaps in understanding the causes and estimating cryptic mortality are highlighted.

  10. 18 CFR 415.51 - Prior non-conforming structures.

    Code of Federal Regulations, 2010 CFR


    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Prior non-conforming... ADMINISTRATIVE MANUAL BASIN REGULATIONS-FLOOD PLAIN REGULATIONS Enforcement § 415.51 Prior non-conforming... this part): (a) A non-conforming structure in the floodway may not be expanded, except that it may...

  11. Identification and dynamics of a cryptic suture zone in tropical rainforest

    PubMed Central

    Moritz, C.; Hoskin, C.J.; MacKenzie, J.B.; Phillips, B.L.; Tonione, M.; Silva, N.; VanDerWal, J.; Williams, S.E.; Graham, C.H.


    Suture zones, shared regions of secondary contact between long-isolated lineages, are natural laboratories for studying divergence and speciation. For tropical rainforest, the existence of suture zones and their significance for speciation has been controversial. Using comparative phylogeographic evidence, we locate a morphologically cryptic suture zone in the Australian Wet Tropics rainforest. Fourteen out of 18 contacts involve morphologically cryptic phylogeographic lineages, with mtDNA sequence divergences ranging from 2 to 15 per cent. Contact zones are significantly clustered in a suture zone located between two major Quaternary refugia. Within this area, there is a trend for secondary contacts to occur in regions with low environmental suitability relative to both adjacent refugia and, by inference, the parental lineages. The extent and form of reproductive isolation among interacting lineages varies across species, ranging from random admixture to speciation, in one case via reinforcement. Comparative phylogeographic studies, combined with environmental analysis at a fine-scale and across varying climates, can generate new insights into suture zone formation and to diversification processes in species-rich tropical rainforests. As arenas for evolutionary experimentation, suture zones merit special attention for conservation. PMID:19203915

  12. Delimiting species using multilocus data: diagnosing cryptic diversity in the southern cavefish, Typhlichthys subterraneus (Teleostei: Amblyopsidae).


    Niemiller, Matthew L; Near, Thomas J; Fitzpatrick, Benjamin M


    A major challenge facing biodiversity conservation and management is that a significant portion of species diversity remains undiscovered or undescribed. This is particularly evident in subterranean animals in which species delimitation based on morphology is difficult because differentiation is often obscured by phenotypic convergence. Multilocus genetic data constitute a valuable source of information for species delimitation in such organisms, but until recently, few methods were available to objectively test species delimitation hypotheses using genetic data. Here, we use recently developed methods for discovering and testing species boundaries and relationships using a multilocus dataset in a widely distributed subterranean teleost fish, Typhlichthys subterraneus, endemic to Eastern North America. We provide evidence that species diversity in T. subterraneus is currently underestimated and that the picture of a single, widely distributed species is not supported. Rather, several morphologically cryptic lineages comprise the diversity in this clade, including support for the recognition of T. eigenmanni. The high number of cryptic species in Typhlichthys highlights the utility of multilocus genetic data in delimiting species, particularly in lineages that exhibit slight morphological disparity, such as subterranean organisms. However, results depend on sampling of individuals and loci; this issue needs further study. PMID:22380444

  13. Integrative taxonomy detects cryptic and overlooked fish species in a neotropical river basin.


    Gomes, Laís Carvalho; Pessali, Tiago Casarim; Sales, Naiara Guimarães; Pompeu, Paulo Santos; Carvalho, Daniel Cardoso


    The great freshwater fish diversity found in the neotropical region makes management and conservation actions challenging. Due to shortage of taxonomists and insufficient infrastructure to deal with such great biodiversity (i.e. taxonomic impediment), proposed remedies to accelerate species identification and descriptions include techniques that combine DNA-based identification and concise morphological description. The building of a DNA barcode reference database correlating meristic and genetic data was developed for 75 % of the Mucuri River basin's freshwater fish. We obtained a total of 141 DNA barcode sequences from 37 species belonging to 30 genera, 19 families, and 5 orders. Genetic distances within species, genera, and families were 0.74, 9.5, and 18.86 %, respectively. All species could be clearly identified by the DNA barcodes. Divergences between meristic morphological characteristics and DNA barcodes revealed two cryptic species among the Cyphocharax gilbert and Astyanax gr. bimaculatus specimens, and helped to identify two overlooked species within the Gymnotus and Astyanax taxa. Therefore, using a simplified model of neotropical biodiversity, we tested the efficiency of an integrative taxonomy approach for species discovery, identification of cryptic diversity, and accelerating biodiversity descriptions.

  14. 18 CFR 415.51 - Prior non-conforming structures.

    Code of Federal Regulations, 2011 CFR


    ... 18 Conservation of Power and Water Resources 2 2011-04-01 2011-04-01 false Prior non-conforming structures. 415.51 Section 415.51 Conservation of Power and Water Resources DELAWARE RIVER BASIN COMMISSION... the level of the 100-year flood. (b) A non-conforming structure in the floodway which is destroyed...

  15. 18 CFR 153.21 - Conformity with requirements.

    Code of Federal Regulations, 2010 CFR


    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Conformity with requirements. 153.21 Section 153.21 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY... Requirements § 153.21 Conformity with requirements. (a) General Rule. Applications under subparts B and C...

  16. Alpine scree plants benefit from cryptic coloration with limited cost.


    Niu, Yang; Sun, Hang


    Like animals, plants are attacked by enemies (herbivores) that forage using visual cues; however, the defensive coloration type known as cryptic coloration was rarely reported in plants. For most autotrophic plants, because photosynthesis relies on the presence of chlorophyll, a green leaf appearance is standard. However, if having leaves that are not green is more beneficial than costly, such coloration may evolve under certain conditions. Taking advantage of the leaf color dimorphism of Corydalis benecincta, we showed that the cryptically colored leaves confer a clear benefit without obvious cost in natural populations. Based on this study, we try to provide a framework on which to base a cost-benefit analysis to investigate the evolution of cryptic leaf coloration in plants.

  17. Analysis of Cryptic, Systemic Botrytis Infections in Symptomless Hosts.


    Shaw, Michael W; Emmanuel, Christy J; Emilda, Deni; Terhem, Razak B; Shafia, Aminath; Tsamaidi, Dimitra; Emblow, Mark; van Kan, Jan A L


    Botrytis species are generally considered to be aggressive, necrotrophic plant pathogens. By contrast to this general perception, however, Botrytis species could frequently be isolated from the interior of multiple tissues in apparently healthy hosts of many species. Infection frequencies reached 50% of samples or more, but were commonly less, and cryptic infections were rare or absent in some plant species. Prevalence varied substantially from year to year and from tissue to tissue, but some host species routinely had high prevalence. The same genotype was found to occur throughout a host, representing mycelial spread. Botrytis cinerea and Botrytis pseudocinerea are the species that most commonly occur as cryptic infections, but phylogenetically distant isolates of Botrytis were also detected, one of which does not correspond to previously described species. Sporulation and visible damage occurred only when infected tissues were stressed, or became mature or senescent. There was no evidence of cryptic infection having a deleterious effect on growth of the host, and prevalence was probably greater in plants grown in high light conditions. Isolates from cryptic infections were often capable of causing disease (to varying extents) when spore suspensions were inoculated onto their own host as well as on distinct host species, arguing against co-adaptation between cryptic isolates and their hosts. These data collectively suggest that several Botrytis species, including the most notorious pathogenic species, exist frequently in cryptic form to an extent that has thus far largely been neglected, and do not need to cause disease on healthy hosts in order to complete their life-cycles.

  18. Analysis of Cryptic, Systemic Botrytis Infections in Symptomless Hosts

    PubMed Central

    Shaw, Michael W.; Emmanuel, Christy J.; Emilda, Deni; Terhem, Razak B.; Shafia, Aminath; Tsamaidi, Dimitra; Emblow, Mark; van Kan, Jan A. L.


    Botrytis species are generally considered to be aggressive, necrotrophic plant pathogens. By contrast to this general perception, however, Botrytis species could frequently be isolated from the interior of multiple tissues in apparently healthy hosts of many species. Infection frequencies reached 50% of samples or more, but were commonly less, and cryptic infections were rare or absent in some plant species. Prevalence varied substantially from year to year and from tissue to tissue, but some host species routinely had high prevalence. The same genotype was found to occur throughout a host, representing mycelial spread. Botrytis cinerea and Botrytis pseudocinerea are the species that most commonly occur as cryptic infections, but phylogenetically distant isolates of Botrytis were also detected, one of which does not correspond to previously described species. Sporulation and visible damage occurred only when infected tissues were stressed, or became mature or senescent. There was no evidence of cryptic infection having a deleterious effect on growth of the host, and prevalence was probably greater in plants grown in high light conditions. Isolates from cryptic infections were often capable of causing disease (to varying extents) when spore suspensions were inoculated onto their own host as well as on distinct host species, arguing against co-adaptation between cryptic isolates and their hosts. These data collectively suggest that several Botrytis species, including the most notorious pathogenic species, exist frequently in cryptic form to an extent that has thus far largely been neglected, and do not need to cause disease on healthy hosts in order to complete their life-cycles. PMID:27242829

  19. Antifungal susceptibility profile of cryptic species of Aspergillus.


    Alastruey-Izquierdo, Ana; Alcazar-Fuoli, Laura; Cuenca-Estrella, Manuel


    The use of molecular tools has led to the description of new cryptic species among different Aspergillus species complexes. Their frequency in the clinical setting has been reported to be between 10 and 15%. The susceptibility to azoles and amphotericin B of many of these species is low, and some of them, such as Aspergillus calidoustus or Aspergillus lentulus, are considered multi-resistant. The changing epidemiology, the frequency of cryptic species, and the different susceptibility profiles make antifungal susceptibility testing an important tool to identify the optimal antifungal agent to treat the infections caused by these species.

  20. The complete nucleotide sequence and genome organization of Fig cryptic virus, a novel bipartite dsRNA virus infecting fig, widely distributed in the Mediterranean basin.


    Elbeaino, Toufic; Kubaa, Raied Abou; Digiaro, Michele; Minafra, Angelantonio; Martelli, Giovanni P


    Two double-stranded RNA (dsRNA) segments of a virus with a bipartite genome identified in fig (Ficus carica L.) and denoted Fig cryptic virus (FCV) were cloned and sequenced. Viral dsRNAs are 1696 bp (RNA-1) and 1415 bp (RNA-2) in size. RNA-1 contains a single ORF (1419 nt) potentially encoding a 54 kDa protein and comprising the conserved amino acid motifs of the RNA-dependent RNA polymerase (RdRp) domain of species of the genus Alphacryptovirus. Its full-length amino acid sequence has the highest identity with Raphanus sativus cryptic virus 2 (RsCV-2) (36%), Beet cryptic virus 3 (BCV-3) (36%) and Fragaria chiloensis cryptic virus (FCCV) (34%). RNA-2 has also a single ORF (1014 nt) coding for a polypeptide with a predicted molecular mass of 38 kDa, identified as the viral coat protein (CP). In a phylogenetic tree constructed with the amino acid sequences of the RdRp domain, FCV clusters in a clade comprising BCV-3 and a number of tentative species of the genus Alphacryptovirus. FCV is not mechanically transmissible. It was detected in fig orchards of six Mediterranean countries (Albania, Algeria, Italy, Lebanon, Syria and Tunisia) where it does not seem to induce a visible disease.

  1. South Polar Cryptic Terrain in Early Spring

    NASA Technical Reports Server (NTRS)


    This image of the south polar region of Mars was taken by the Compact Reconnaissance Imaging Spectrometer for Mars (CRISM) at 1557 UTC (10:57 a.m. EST) on Feb. 10, 2007, near 77.55 degrees south latitude, 131.98 degrees east longitude. CRISM's image was taken in 544 colors covering 0.36-3.92 micrometers, and shows features as small as 30 meters (98 feet) across. The region covered is just over 9 kilometers (5.6 miles) wide at its narrowest point, and is one of several in which CRISM is monitoring the evaporation (or 'sublimation') of the seasonal frost cap.

    The Martian south polar seasonal cap consists of carbon dioxide ice and frost, whose sublimation in the Martian spring creates a variety of features unlike anything in Earth's circumpolar regions. Part of the cap known as the 'cryptic region' is so cold that it must be covered with carbon dioxide frost, but it is also unexpectedly low in brightness and exhibits a variety of unusual dark blotches. Many scientists believe that carbon dioxide gas trapped below the sublimating ice is released in bursts, which carry along dust that gradually darkens the ice. One idea is that geyser-like dust eruptions form the dark blotches, and that the blotches grow, coalesce, and eventually hide the frost under a thin layer of dust.

    This image was taken shortly after sunrise with the Sun only about five degrees above the horizon. The left version shows brightness of the surface at 1.3 micrometers. The right version shows strength of an absorption band due to carbon dioxide frost at 1.435 micrometers; brighter areas have a stronger absorption and more carbon dioxide frost. However, even the darkest areas still have frost. The correlation between brightness and carbon dioxide frost abundance is striking, supporting the idea that the frost is being darkened by dust. Frost in the upper right corner shows the expected dark blotches, whereas the frost over the rest of the image is more uniformly dark, hinting that another

  2. Stridulations Reveal Cryptic Speciation in Neotropical Sympatric Ants

    PubMed Central

    Ferreira, Ronara Souza; Poteaux, Chantal; Delabie, Jacques Hubert Charles; Fresneau, Dominique; Rybak, Fanny


    The taxonomic challenge posed by cryptic species underlines the importance of using multiple criteria in species delimitation. In the current paper we tested the use of acoustic analysis as a tool to assess the real diversity in a cryptic species complex of Neotropical ants. In order to understand the potential of acoustics and to improve consistency in the conclusions by comparing different approaches, phylogenetic relationships of all the morphs considered were assessed by the analysis of a fragment of the mitochondrial DNA cytochrome b. We observed that each of the cryptic morph studied presents a morphologically distinct stridulatory organ and that all sympatric morphs produce distinctive stridulations. This is the first evidence of such a degree of specialization in the acoustic organ and signals in ants, which suggests that stridulations may be among the cues used by these ants during inter-specific interactions. Mitochondrial DNA variation corroborated the acoustic differences observed, confirming acoustics as a helpful tool to determine cryptic species in this group of ants, and possibly in stridulating ants in general. Congruent morphological, acoustic and genetic results constitute sufficient evidence to propose each morph studied here as a valid new species, suggesting that P. apicalis is a complex of at least 6 to 9 species, even if they present different levels of divergence. Finally, our results highlight that ant stridulations may be much more informative than hitherto thought, as much for ant communication as for integrative taxonomists. PMID:21203529

  3. The first nearly cryptic Scorpionfly (Mecoptera: Panorpidae) from North America

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The first, nearly cryptic species of scorpionfly from the United States, Panorpa cryptica Bicha and Schiff, n. sp., is described from northern Georgia, southwestern North Carolina and northwestern South Carolina. This insect was initially differentiated from the very similar Panorpa nebulosa Westwoo...

  4. The cryptic beta-fructofuranosidase of Saccharomyces rouxii.


    Arnold, W N


    The synthesis of beta-fructofuranosidase in synchronously dividing cells of S. rouxii was continuous (as opposed to periodic) throughout the budding cycle and followed the increase in cell mass. Similar patterns for cell mass and enzyme increases were observed even in phosphate-deprived cells which did not divide. The beta-fructofuranosidase activity remained physically cryptic throughout the cell cycle as evidenced by analyses on equilibrium density gradient fractions. The beta-fructofuranosidase activity released from mechanically disrupted cells resisted sedimentation when subjected to 131 000 g for 1 h, thus ruling out membrane association. Ethyl acetate was routinely employed to break the crypticity barrier. Enzyme in cell-free extract or in cells was equally sensitive to inactivation at pH values below 5 in the presence of ethyl acetate, which suggested that this is an inherent property of the enzyme in question and not a reflection of proteolytic inactivation. The status of beta-fructofuranosidase in selected species of Saccharomyces was compared with that for S. rouxii and a close similarity with S. bisporus var. mellis was noted. The degree of crypticity encountered in genetically defined strains of S. cerevisiae (e.g. X2180 a/alpha) was relatively high (42%) compared with that for commercially derived bakers' and brewers' strains (about 6%). Extant data on the cryptic beta-fructofuranosidase of S. rouxii are evaluated and the utility of this system for studying enzyme translocation is discussed.

  5. Geochemical evidence for cryptic sulfur cycling in salt marsh sediments

    NASA Astrophysics Data System (ADS)

    Mills, Jennifer V.; Antler, Gilad; Turchyn, Alexandra V.


    Cryptic sulfur cycling is an enigmatic process in which sulfate is reduced to some lower-valence state sulfur species and subsequently quantitatively reoxidized; the rate and microbial energetics of this process and how prevalent it may be in the environment remain controversial. Here we investigate sulfur cycling in salt marsh sediments from Norfolk, England where we observe high ferrous iron concentrations with no depletion of sulfate or change in the sulfur isotope ratio of that sulfate, but a 5‰ increase in the oxygen isotope ratio in sulfate, indicating that sulfate has been through a reductive cycle replacing its oxygen atoms. This cryptic sulfur cycle was replicated in laboratory incubations using 18O-enriched water, demonstrating that the field results do not solely result from mixing processes in the natural environment. Numerical modeling of the laboratory incubations scaled to represent the salt marsh sediments suggests that the uptake rate of sulfate during this cryptic sulfur cycling is similar to the uptake rate of sulfate during the fastest microbial sulfate reduction that has been measured in the natural environment. The difference is that during cryptic sulfur cycling, all of the sulfur is subsequently reoxidized to sulfate. We discuss mechanisms for this pathway of sulfur cycling including the possible link to the subsurface iron cycle.

  6. Cryptic and conspicuous coloration in the pelagic environment.

    PubMed Central

    Johnsen, Sönke


    Despite the importance of cryptic and conspicuous coloration in pelagic ecosystems, few researchers have investigated the optimal reflectance spectra for either trait. In this study, the underwater radiance distribution in tropical oceanic water was modelled using measured inherent optical properties and radiative transfer calculations. The modelled light field was then used to predict the reflectance spectra that resulted in minimal or maximal object contrast as a function of depth, viewing angle, azimuth and solar elevation. The results matched commonly observed trends in the coloration of many pelagic organisms and showed that optimal coloration for either crypticity or conspicuity is a complex function of the parameters examined. The effects of viewing angle and depth were substantial and non-intuitive, showing that red coloration is most cryptic at depth. The effects of viewing azimuth were less significant and the effects of solar elevation were minor. White coloration and black coloration were equally cryptic/conspicuous when viewed from below. Although conspicuous objects viewed from below had the lowest contrast when viewed from a short distance, they had the longest sighting distances. The contrast of maximally conspicuous objects viewed from short distances was greatest at wavelengths displaced from the wavelength of maximum light penetration. PMID:11839193

  7. Stridulations reveal cryptic speciation in neotropical sympatric ants.


    Ferreira, Ronara Souza; Poteaux, Chantal; Delabie, Jacques Hubert Charles; Fresneau, Dominique; Rybak, Fanny


    The taxonomic challenge posed by cryptic species underlines the importance of using multiple criteria in species delimitation. In the current paper we tested the use of acoustic analysis as a tool to assess the real diversity in a cryptic species complex of Neotropical ants. In order to understand the potential of acoustics and to improve consistency in the conclusions by comparing different approaches, phylogenetic relationships of all the morphs considered were assessed by the analysis of a fragment of the mitochondrial DNA cytochrome b. We observed that each of the cryptic morph studied presents a morphologically distinct stridulatory organ and that all sympatric morphs produce distinctive stridulations. This is the first evidence of such a degree of specialization in the acoustic organ and signals in ants, which suggests that stridulations may be among the cues used by these ants during inter-specific interactions. Mitochondrial DNA variation corroborated the acoustic differences observed, confirming acoustics as a helpful tool to determine cryptic species in this group of ants, and possibly in stridulating ants in general. Congruent morphological, acoustic and genetic results constitute sufficient evidence to propose each morph studied here as a valid new species, suggesting that P. apicalis is a complex of at least 6 to 9 species, even if they present different levels of divergence. Finally, our results highlight that ant stridulations may be much more informative than hitherto thought, as much for ant communication as for integrative taxonomists.

  8. [Caucasian cryptic species of rodents as models for studying the problem of species and speciation].


    Baskevich, M I; Potapov, S G; Mironova, T A


    The problem of species and speciation is considered using as a model the cryptic species of rodents inhabiting the Caucasus, the mountain chain with prominent altitude environmental gradient and insular pattern of mountain habitats. These circumstances open additional possibilities for the choice of species conception (biological or phylogenetic), exploration of ancestry pathways (sympatric or allopatric speciation) of model cryptic species groups, and testing the 'refuge' hypothesis. As model species, sibling-species Sicista from the group 'caucasica' (a group of unstriped birch mice) and representatives of the vole subspecies Terricola (Microtus, Arvicolinae) were used. Based on the new data on karyology, nucleotide sequences of mitochondrial gene cytb, multivariate statistical analysis of odontologic traits, and biogeography of sibling-species Sicista from the group 'caucasica' and voles from subspecies Terricola (Microtus, Arvicolinae), their evolutionary history is reconstructed and applicable species concepts are examined. For the present sibling-species Sicista from the group 'caucasica' the allopatric dispersion is typical, which agrees with the hypothesis of speciation in refuges. The sympatry of Terricola sibling-species in the Caucasus is considered as being secondary, and their phenotypic likeness--as an adaptation to similar environmental conditions. Affirmed coexistence of sibling-species Microtus (Terricola) majori and Microtus (Terricola) daghestanicus in the Caucasus (without their hybridization) supports the biological conception of species. The existence of Sicista allospecies from the group of Caucasian unstriped birch mice is best conformed to the phylogenetic conception. However, the high level of chromosomal differences between sibling-species and, in particular, between extreme variants of common evolutionary line (Sicista kazbegica, Sicista kluchorica) does not contradict the biological conception of species. PMID:26353399

  9. Conformal operators in QCD

    SciTech Connect

    Makeenko, Y.M.


    Utilizing the properties of the representations of the conformal group, we obtain new expressions for the conformal operators composed of spinor or scalar fields of arbitrary dimension in terms of Jacobi polynomials. These expressions generalize the known formulas in terms of Gegenbauer polynomials. Using the conformal Ward identities, we prove the multiplicative renormalizability of conformal operators in the leading logarithmic approximation.

  10. Why do cryptic species tend not to co-occur? A case study on two cryptic pairs of butterflies.


    Vodă, Raluca; Dapporto, Leonardo; Dincă, Vlad; Vila, Roger


    As cryptic diversity is being discovered, mostly thanks to advances in molecular techniques, it is becoming evident that many of these taxa display parapatric distributions in mainland and that they rarely coexist on islands. Genetic landscapes, haplotype networks and ecological niche modeling analyses were performed for two pairs of non-sister cryptic butterfly species, Aricia agestis-A. cramera and Polyommatus icarus-P. celina (Lycaenidae), to specifically assess non-coexistence on western Mediterranean islands, and to test potential causes producing such chequered distribution patterns. We show that the morphologically and ecologically equivalent pairs of species do not coexist on any of the studied islands, although nearly all islands are colonized by one of them. According to our models, the cryptic pairs displayed marked climatic preferences and 'precipitation during the driest quarter' was recovered as the most important climatic determinant. However, neither dispersal capacity, nor climatic or ecological factors fully explain the observed distributions across particular sea straits, and the existence of species interactions resulting in mutual exclusion is suggested as a necessary hypothesis. Given that the studied species are habitat generalists, feeding on virtually unlimited resources, we propose that reproductive interference, together with climatic preferences, sustain density-dependent mechanisms like "founder takes all" and impede coexistence on islands. Chequered distributions among cryptic taxa, both sister and non-sister, are common in butterflies, suggesting that the phenomenon revealed here could be important in determining biodiversity patterns. PMID:25692577

  11. Why Do Cryptic Species Tend Not to Co-Occur? A Case Study on Two Cryptic Pairs of Butterflies

    PubMed Central

    Vodă, Raluca; Dapporto, Leonardo; Dincă, Vlad; Vila, Roger


    As cryptic diversity is being discovered, mostly thanks to advances in molecular techniques, it is becoming evident that many of these taxa display parapatric distributions in mainland and that they rarely coexist on islands. Genetic landscapes, haplotype networks and ecological niche modeling analyses were performed for two pairs of non-sister cryptic butterfly species, Aricia agestis-A. cramera and Polyommatus icarus—P. celina (Lycaenidae), to specifically assess non-coexistence on western Mediterranean islands, and to test potential causes producing such chequered distribution patterns. We show that the morphologically and ecologically equivalent pairs of species do not coexist on any of the studied islands, although nearly all islands are colonized by one of them. According to our models, the cryptic pairs displayed marked climatic preferences and ‘precipitation during the driest quarter’ was recovered as the most important climatic determinant. However, neither dispersal capacity, nor climatic or ecological factors fully explain the observed distributions across particular sea straits, and the existence of species interactions resulting in mutual exclusion is suggested as a necessary hypothesis. Given that the studied species are habitat generalists, feeding on virtually unlimited resources, we propose that reproductive interference, together with climatic preferences, sustain density-dependent mechanisms like “founder takes all” and impede coexistence on islands. Chequered distributions among cryptic taxa, both sister and non-sister, are common in butterflies, suggesting that the phenomenon revealed here could be important in determining biodiversity patterns. PMID:25692577

  12. Why do cryptic species tend not to co-occur? A case study on two cryptic pairs of butterflies.


    Vodă, Raluca; Dapporto, Leonardo; Dincă, Vlad; Vila, Roger


    As cryptic diversity is being discovered, mostly thanks to advances in molecular techniques, it is becoming evident that many of these taxa display parapatric distributions in mainland and that they rarely coexist on islands. Genetic landscapes, haplotype networks and ecological niche modeling analyses were performed for two pairs of non-sister cryptic butterfly species, Aricia agestis-A. cramera and Polyommatus icarus-P. celina (Lycaenidae), to specifically assess non-coexistence on western Mediterranean islands, and to test potential causes producing such chequered distribution patterns. We show that the morphologically and ecologically equivalent pairs of species do not coexist on any of the studied islands, although nearly all islands are colonized by one of them. According to our models, the cryptic pairs displayed marked climatic preferences and 'precipitation during the driest quarter' was recovered as the most important climatic determinant. However, neither dispersal capacity, nor climatic or ecological factors fully explain the observed distributions across particular sea straits, and the existence of species interactions resulting in mutual exclusion is suggested as a necessary hypothesis. Given that the studied species are habitat generalists, feeding on virtually unlimited resources, we propose that reproductive interference, together with climatic preferences, sustain density-dependent mechanisms like "founder takes all" and impede coexistence on islands. Chequered distributions among cryptic taxa, both sister and non-sister, are common in butterflies, suggesting that the phenomenon revealed here could be important in determining biodiversity patterns.

  13. Undiagnosed cryptic diversity in small, microendemic frogs (Leptolalax) from the Central Highlands of Vietnam.


    Rowley, Jodi J L; Tran, Dao T A; Frankham, Greta J; Dekker, Anthony H; Le, Duong T T; Nguyen, Truong Q; Dau, Vinh Q; Hoang, Huy D


    A major obstacle in prioritizing species or habitats for conservation is the degree of unrecognized diversity hidden within complexes of morphologically similar, "cryptic" species. Given that amphibians are one of the most threatened groups of organisms on the planet, our inability to diagnose their true diversity is likely to have significant conservation consequences. This is particularly true in areas undergoing rapid deforestation, such as Southeast Asia. The Southeast Asian genus Leptolalax is a group of small-bodied, morphologically conserved frogs that inhabit the forest-floor. We examined a particularly small-bodied and morphologically conserved subset, the Leptolalax applebyi group, using a combination of molecular, morphometric, and acoustic data to identify previously unknown diversity within. In order to predict the geographic distribution of the group, estimate the effects of habitat loss and assess the degree of habitat protection, we used our locality data to perform ecological niche modelling using MaxEnt. Molecular (mtDNA and nuDNA), acoustic and subtle morphometric differences revealed a significant underestimation of diversity in the L. applebyi group; at least two-thirds of the diversity may be unrecognised. Patterns of diversification and microendemism in the group appear driven by limited dispersal, likely due to their small body size, with several lineages restricted to watershed basins. The L. applebyi group is predicted to have historically occurred over a large area of the Central Highlands of Vietnam, a considerable portion of which has already been deforested. Less than a quarter of the remaining forest predicted to be suitable for the group falls within current protected areas. The predicted distribution of the L. applebyi group extends into unsurveyed watershed basins, each potentially containing unsampled diversity, some of which may have already been lost due to deforestation. Current estimates of amphibian diversity based on

  14. Undiagnosed cryptic diversity in small, microendemic frogs (Leptolalax) from the Central Highlands of Vietnam.


    Rowley, Jodi J L; Tran, Dao T A; Frankham, Greta J; Dekker, Anthony H; Le, Duong T T; Nguyen, Truong Q; Dau, Vinh Q; Hoang, Huy D


    A major obstacle in prioritizing species or habitats for conservation is the degree of unrecognized diversity hidden within complexes of morphologically similar, "cryptic" species. Given that amphibians are one of the most threatened groups of organisms on the planet, our inability to diagnose their true diversity is likely to have significant conservation consequences. This is particularly true in areas undergoing rapid deforestation, such as Southeast Asia. The Southeast Asian genus Leptolalax is a group of small-bodied, morphologically conserved frogs that inhabit the forest-floor. We examined a particularly small-bodied and morphologically conserved subset, the Leptolalax applebyi group, using a combination of molecular, morphometric, and acoustic data to identify previously unknown diversity within. In order to predict the geographic distribution of the group, estimate the effects of habitat loss and assess the degree of habitat protection, we used our locality data to perform ecological niche modelling using MaxEnt. Molecular (mtDNA and nuDNA), acoustic and subtle morphometric differences revealed a significant underestimation of diversity in the L. applebyi group; at least two-thirds of the diversity may be unrecognised. Patterns of diversification and microendemism in the group appear driven by limited dispersal, likely due to their small body size, with several lineages restricted to watershed basins. The L. applebyi group is predicted to have historically occurred over a large area of the Central Highlands of Vietnam, a considerable portion of which has already been deforested. Less than a quarter of the remaining forest predicted to be suitable for the group falls within current protected areas. The predicted distribution of the L. applebyi group extends into unsurveyed watershed basins, each potentially containing unsampled diversity, some of which may have already been lost due to deforestation. Current estimates of amphibian diversity based on

  15. CCProf: exploring conformational change profile of proteins

    PubMed Central

    Chang, Che-Wei; Chou, Chai-Wei; Chang, Darby Tien-Hao


    In many biological processes, proteins have important interactions with various molecules such as proteins, ions or ligands. Many proteins undergo conformational changes upon these interactions, where regions with large conformational changes are critical to the interactions. This work presents the CCProf platform, which provides conformational changes of entire proteins, named conformational change profile (CCP) in the context. CCProf aims to be a platform where users can study potential causes of novel conformational changes. It provides 10 biological features, including conformational change, potential binding target site, secondary structure, conservation, disorder propensity, hydropathy propensity, sequence domain, structural domain, phosphorylation site and catalytic site. All these information are integrated into a well-aligned view, so that researchers can capture important relevance between different biological features visually. The CCProf contains 986 187 protein structure pairs for 3123 proteins. In addition, CCProf provides a 3D view in which users can see the protein structures before and after conformational changes as well as binding targets that induce conformational changes. All information (e.g. CCP, binding targets and protein structures) shown in CCProf, including intermediate data are available for download to expedite further analyses. Database URL: PMID:27016699

  16. Cryptic invasions of the crab Carcinus detected by molecular phylogeography.


    Geller, J B; Walton, E D; Grosholz, E D; Ruiz, G M


    Coastal marine ecosystems world-wide are threatened by invasions of nonindigenous species. The ubiquity of marine sibling species identifiable only by genetic analysis suggests that many invasions are cryptic and therefore undetected, causing an underestimation of the actual number and impacts of invading species. We test this hypothesis with European crabs in the genus Carcinus that have invaded five regions globally. Partial 16S ribosomal RNA gene sequences confirm sibling species status of morphologically similar Atlantic C. maenas and Mediterranean C. aestuarii. Based on 16S rRNA haplotypes, crabs from California, New England and Tasmania were all C. maenas. However, we report the cryptic multiple invasion of both species in Japan and South Africa, where only C. aestuarii and C. maenas, respectively, were previously recognized. PMID:9348700

  17. Cryptic extinction of a common Pacific lizard Emoia impar (Squamata, Scincidae) from the Hawaiian Islands.

    USGS Publications Warehouse

    Fisher, Robert; Ineich, Ivan


    Most documented declines of tropical reptiles are of dramatic or enigmatic species. Declines of widespread species tend to be cryptic. The early (1900s) decline and extinction of the common Pacific skink Emoia impar from the Hawaiian Islands is documented here through an assessment of literature, museum vouchers and recent fieldwork. This decline appears contemporaneous with the documented declines of invertebrates and birds across the Hawaiian Islands. A review of the plausible causal factors indicates that the spread of the introduced big-headed ant Pheidole megacephala is the most likely factor in this lizard decline. The introduction and spread of a similar skink Lampropholis delicata across the islands appears to temporally follow the decline of E. impar, although there is no evidence of competition between these species. It appears that L. delicata is spreading to occupy the niche vacated by the extirpated E. impar. Further confusion exists because the skink E. cyanura, which is very similar in appearance to E. impar, appears to have been introduced to one site within a hotel on Kaua'i and persisted as a population at that site for approximately 2 decades (1970s–1990s) but is now also extirpated. This study highlights the cryptic nature of this early species extinction as evidence that current biogeographical patterns of non-charismatic or enigmatic reptiles across the Pacific may be the historical result of early widespread invasion by ants. Conservation and restoration activities for reptiles in the tropical Pacific should consider this possibility and evaluate all evidence prior to any implementation.

  18. The cryptic enhancer elements of the tCUP promoter.


    Wu, Keqiang; Hu, Ming; Martin, Teresa; Wang, Changming; Li, Xiu-Qing; Tian, Lining; Brown, Dan; Miki, Brian


    Examination of the tCUP cryptic promoter from tobacco demonstrates that cryptic gene regulatory elements in the plant genome are functionally equivalent to elements responsible for the expression of plant genes. They are also organized in a similar fashion. Analysis of the expression pattern of the GUS reporter gene in transgenic Arabidopsis plants revealed that all of the information needed for strong constitutive expression was located in the truncated, -394tCUP promoter fragment. A series of 5' deletion and linker-scan mutagenesis constructs identified two separate enhancer elements. A long AT-rich region was identified between positions -350 and -161 bp relative to the transcription start site. 5' deletions that removed this A/T-rich fragment resulted in a significant decrease in promoter activity; whereas, oligomerization enhanced activity. A 21 bp sequence (TAGCCCCAATTTCAAATTCAA) spanning nucleotides -150 to -130 relative to transcription start site was also identified in a similar fashion and defined a novel cryptic constitutive enhancer element (Cce). Electrophoretic mobility-shift assays showed that tobacco nuclear proteins that interacted strongly with the tCUP promoter bound specifically to the 21-bp Cce element, suggesting that this sequence is probably a binding site(s) for transcription factors. The Cce element was dependent on the AT-rich element for activity indicating combinatorial control. The combined effects of the A/T rich and Cce elements appear to be responsible for the constitutive transcriptional activity of the tCUP promoter. PMID:12602866

  19. Conservation genetics and genomics of amphibians and reptiles.


    Shaffer, H Bradley; Gidiş, Müge; McCartney-Melstad, Evan; Neal, Kevin M; Oyamaguchi, Hilton M; Tellez, Marisa; Toffelmier, Erin M


    Amphibians and reptiles as a group are often secretive, reach their greatest diversity often in remote tropical regions, and contain some of the most endangered groups of organisms on earth. Particularly in the past decade, genetics and genomics have been instrumental in the conservation biology of these cryptic vertebrates, enabling work ranging from the identification of populations subject to trade and exploitation, to the identification of cryptic lineages harboring critical genetic variation, to the analysis of genes controlling key life history traits. In this review, we highlight some of the most important ways that genetic analyses have brought new insights to the conservation of amphibians and reptiles. Although genomics has only recently emerged as part of this conservation tool kit, several large-scale data sources, including full genomes, expressed sequence tags, and transcriptomes, are providing new opportunities to identify key genes, quantify landscape effects, and manage captive breeding stocks of at-risk species.

  20. Integration of bacteriophage. lambda. into the cryptic lambdoid prophages of Escherichia coli

    SciTech Connect

    Lichens-Park, A. ); Smith, C.L. ); Syvanen, M. )


    Bacteriophage lambda missing its chromosomal attachment site will integrate into recA{sup +} Escherichia coli K-12 and C at the site of cryptic prophages. The specific regions in which these recombination events occur were identified in both lambda and the bacterial chromosomes. A NotI restriction site on the prophage allowed its physical mapping. This allowed them to identify the locations of Rac, Qin, and Qsr{prime} cryptic prophages on the NotI map of E. coli K-12 and, by analogy, to identify the cryptic prophage in E. coli C as Qin. No new cryptic prophages were detected in E. coli K-12.

  1. Identification of cryptic species within liverwort Conocephalum conicum based on the volatile components.


    Ludwiczuk, Agnieszka; Odrzykoski, Ireneusz J; Asakawa, Yoshinori


    Cryptic speciation refers to cases where species are clearly genetically differentiated, but show little or no morphological differences. This study investigated whether volatile components can be used to distinguish the cryptic species within the Conocephalum conicum complex. Thirteen samples were included in this study representing four cryptic species (A, F, J, L) and the recently described Conocephalum salebrosum (formerly cryptic species S) detected in a worldwide collection. Results received from GC-MS analyses showed some differences between samples, indicating the existence of chemical polymorphism. It is evident from both statistical analyses (CA and PCA), that cryptic species L appears to be the most differentiated species, with the volatile components not significantly shared with the rest of the types. The most characteristic compound of this type is the sesquiterpene alcohol, conocephalenol. Distinction between other examined cryptic species were also indicated. However species F and J, as well as species A and C. salebrosum, share a great similarity in their volatile composition and are grouped together in both CA and PCA. Despite their similarities, we were able to find chemical markers which can describe each species. Cubebol is characteristic for C. salebrosum, while cryptic species A produces (E)-methylcinnamate. The presence of a large amount of the monoterpene hydrocarbon, sabinene, is characteristic for cryptic species J. In one of the analyzed specimens belonging to the cryptic species F, a large amount of cyclocolorenone was detected. Chemical differentiation was correlated with the geographical distribution of the analyzed samples.

  2. Coalescent Method in Conjunction with Niche Modeling Reveals Cryptic Diversity among Centipedes in the Western Ghats of South India

    PubMed Central

    Joshi, Jahnavi; Karanth, K. Praveen


    Background There has been growing interest in integrative taxonomy that uses data from multiple disciplines for species delimitation. Typically, in such studies, monophyly is taken as a proxy for taxonomic distinctiveness and these units are treated as potential species. However, monophyly could arise due to stochastic processes. Thus here, we have employed a recently developed tool based on coalescent approach to ascertain the taxonomic distinctiveness of various monophyletic units. Subsequently, the species status of these taxonomic units was further tested using corroborative evidence from morphology and ecology. This inter-disciplinary approach was implemented on endemic centipedes of the genus Digitipes (Attems 1930) from the Western Ghats (WG) biodiversity hotspot of India. The species of the genus Digitipes are morphologically conserved, despite their ancient late Cretaceous origin. Principal Findings Our coalescent analysis based on mitochondrial dataset indicated the presence of nine putative species. The integrative approach, which includes nuclear, morphology, and climate datasets supported distinctiveness of eight putative species, of which three represent described species and five were new species. Among the five new species, three were morphologically cryptic species, emphasizing the effectiveness of this approach in discovering cryptic diversity in less explored areas of the tropics like the WG. In addition, species pairs showed variable divergence along the molecular, morphological and climate axes. Conclusions A multidisciplinary approach illustrated here is successful in discovering cryptic diversity with an indication that the current estimates of invertebrate species richness for the WG might have been underestimated. Additionally, the importance of measuring multiple secondary properties of species while defining species boundaries was highlighted given variable divergence of each species pair across the disciplines. PMID:22876311

  3. Colour patterns do not diagnose species: quantitative evaluation of a DNA barcoded cryptic bumblebee complex.


    Carolan, James C; Murray, Tomás E; Fitzpatrick, Úna; Crossley, John; Schmidt, Hans; Cederberg, Björn; McNally, Luke; Paxton, Robert J; Williams, Paul H; Brown, Mark J F


    Cryptic diversity within bumblebees (Bombus) has the potential to undermine crucial conservation efforts designed to reverse the observed decline in many bumblebee species worldwide. Central to such efforts is the ability to correctly recognise and diagnose species. The B. lucorum complex (Bombus lucorum, B. cryptarum and B. magnus) comprises one of the most abundant and important group of wild plant and crop pollinators in northern Europe. Although the workers of these species are notoriously difficult to diagnose morphologically, it has been claimed that queens are readily diagnosable from morphological characters. Here we assess the value of colour-pattern characters in species identification of DNA-barcoded queens from the B. lucorum complex. Three distinct molecular operational taxonomic units were identified each representing one species. However, no uniquely diagnostic colour-pattern character state was found for any of these three molecular units and most colour-pattern characters showed continuous variation among the units. All characters previously deemed to be unique and diagnostic for one species were displayed by specimens molecularly identified as a different species. These results presented here raise questions on the reliability of species determinations in previous studies and highlights the benefits of implementing DNA barcoding prior to ecological, taxonomic and conservation studies of these important key pollinators.

  4. Differential Responses to Woodland Character and Landscape Context by Cryptic Bats in Urban Environments

    PubMed Central

    Lintott, Paul R.; Bunnefeld, Nils; Minderman, Jeroen; Fuentes-Montemayor, Elisa; Mayhew, Rebekah J.; Olley, Lena; Park, Kirsty J.


    Urbanisation is one of the most dramatic forms of land use change which relatively few species can adapt to. Determining how and why species respond differently to urban habitats is important in predicting future biodiversity loss as urban areas rapidly expand. Understanding how morphological or behavioural traits can influence species adaptability to the built environment may enable us to improve the effectiveness of conservation efforts. Although many bat species are able to exploit human resources, bat species richness generally declines with increasing urbanisation and there is considerable variation in the responses of different bat species to urbanisation. Here, we use acoustic recordings from two cryptic, and largely sympatric European bat species to assess differential responses in their use of fragmented urban woodland and the surrounding urban matrix. There was a high probability of P. pygmaeus activity relative to P. pipistrellus in woodlands with low clutter and understory cover which were surrounded by low levels of built environment. Additionally, the probability of recording P. pygmaeus relative to P. pipistrellus was considerably higher in urban woodland interior or edge habitat in contrast to urban grey or non-wooded green space. These results show differential habitat use occurring between two morphologically similar species; whilst the underlying mechanism for this partitioning is unknown it may be driven by competition avoidance over foraging resources. Their differing response to urbanisation indicates the difficulties involved when attempting to assess how adaptable a species is to urbanisation for conservation purposes. PMID:25978034

  5. Colour Patterns Do Not Diagnose Species: Quantitative Evaluation of a DNA Barcoded Cryptic Bumblebee Complex

    PubMed Central

    Carolan, James C.; Murray, Tomás E.; Fitzpatrick, Úna; Crossley, John; Schmidt, Hans; Cederberg, Björn; McNally, Luke; Paxton, Robert J.; Williams, Paul H.; Brown, Mark J. F.


    Cryptic diversity within bumblebees (Bombus) has the potential to undermine crucial conservation efforts designed to reverse the observed decline in many bumblebee species worldwide. Central to such efforts is the ability to correctly recognise and diagnose species. The B. lucorum complex (Bombus lucorum, B. cryptarum and B. magnus) comprises one of the most abundant and important group of wild plant and crop pollinators in northern Europe. Although the workers of these species are notoriously difficult to diagnose morphologically, it has been claimed that queens are readily diagnosable from morphological characters. Here we assess the value of colour-pattern characters in species identification of DNA-barcoded queens from the B. lucorum complex. Three distinct molecular operational taxonomic units were identified each representing one species. However, no uniquely diagnostic colour-pattern character state was found for any of these three molecular units and most colour-pattern characters showed continuous variation among the units. All characters previously deemed to be unique and diagnostic for one species were displayed by specimens molecularly identified as a different species. These results presented here raise questions on the reliability of species determinations in previous studies and highlights the benefits of implementing DNA barcoding prior to ecological, taxonomic and conservation studies of these important key pollinators. PMID:22238595

  6. Hiding in Plain Sight: A Case for Cryptic Metapopulations in Brook Trout (Salvelinus fontinalis).


    Kazyak, David C; Hilderbrand, Robert H; King, Tim L; Keller, Stephen R; Chhatre, Vikram E


    A fundamental issue in the management and conservation of biodiversity is how to define a population. Spatially contiguous fish occupying a stream network have often been considered to represent a single, homogenous population. However, they may also represent multiple discrete populations, a single population with genetic isolation-by-distance, or a metapopulation. We used microsatellite DNA and a large-scale mark-recapture study to assess population structure in a spatially contiguous sample of Brook Trout (Salvelinus fontinalis), a species of conservation concern. We found evidence for limited genetic exchange across small spatial scales and in the absence of barriers to physical movement. Mark-recapture and stationary passive integrated transponder antenna records demonstrated that fish from two tributaries very seldom moved into the opposite tributary, but movements between the tributaries and mainstem were more common. Using Bayesian genetic clustering, we identified two genetic groups that exhibited significantly different growth rates over three years of study, yet survival rates were very similar. Our study highlights the importance of considering the possibility of multiple genetically distinct populations occurring within spatially contiguous habitats, and suggests the existence of a cryptic metapopulation: a spatially continuous distribution of organisms exhibiting metapopulation-like behaviors.

  7. Hiding in Plain Sight: A Case for Cryptic Metapopulations in Brook Trout (Salvelinus fontinalis)

    PubMed Central

    Kazyak, David C.; Hilderbrand, Robert H.; King, Tim L.; Keller, Stephen R.; Chhatre, Vikram E.


    A fundamental issue in the management and conservation of biodiversity is how to define a population. Spatially contiguous fish occupying a stream network have often been considered to represent a single, homogenous population. However, they may also represent multiple discrete populations, a single population with genetic isolation-by-distance, or a metapopulation. We used microsatellite DNA and a large-scale mark-recapture study to assess population structure in a spatially contiguous sample of Brook Trout (Salvelinus fontinalis), a species of conservation concern. We found evidence for limited genetic exchange across small spatial scales and in the absence of barriers to physical movement. Mark-recapture and stationary passive integrated transponder antenna records demonstrated that fish from two tributaries very seldom moved into the opposite tributary, but movements between the tributaries and mainstem were more common. Using Bayesian genetic clustering, we identified two genetic groups that exhibited significantly different growth rates over three years of study, yet survival rates were very similar. Our study highlights the importance of considering the possibility of multiple genetically distinct populations occurring within spatially contiguous habitats, and suggests the existence of a cryptic metapopulation: a spatially continuous distribution of organisms exhibiting metapopulation-like behaviors. PMID:26730588

  8. Hiding in Plain Sight: A Case for Cryptic Metapopulations in Brook Trout (Salvelinus fontinalis).


    Kazyak, David C; Hilderbrand, Robert H; King, Tim L; Keller, Stephen R; Chhatre, Vikram E


    A fundamental issue in the management and conservation of biodiversity is how to define a population. Spatially contiguous fish occupying a stream network have often been considered to represent a single, homogenous population. However, they may also represent multiple discrete populations, a single population with genetic isolation-by-distance, or a metapopulation. We used microsatellite DNA and a large-scale mark-recapture study to assess population structure in a spatially contiguous sample of Brook Trout (Salvelinus fontinalis), a species of conservation concern. We found evidence for limited genetic exchange across small spatial scales and in the absence of barriers to physical movement. Mark-recapture and stationary passive integrated transponder antenna records demonstrated that fish from two tributaries very seldom moved into the opposite tributary, but movements between the tributaries and mainstem were more common. Using Bayesian genetic clustering, we identified two genetic groups that exhibited significantly different growth rates over three years of study, yet survival rates were very similar. Our study highlights the importance of considering the possibility of multiple genetically distinct populations occurring within spatially contiguous habitats, and suggests the existence of a cryptic metapopulation: a spatially continuous distribution of organisms exhibiting metapopulation-like behaviors. PMID:26730588

  9. Mitochondrial DNA sequences support allozyme evidence for cryptic radiation of New Zealand Peripatoides (Onychophora).


    Trewick, S A


    A combination of single-strand conformation polymorphism analysis (SSCP) and sequencing were used to survey cytochrome oxidase I (COI) mitochondrial DNA (mtDNA) diversity among New Zealand ovoviviparous Onychophora. Most of the sites and individuals had previously been analysed using allozyme electrophoresis. A total of 157 peripatus collected at 54 sites throughout New Zealand were screened yielding 62 different haplotypes. Comparison of 540-bp COI sequences from Peripatoides revealed mean among-clade genetic distances of up to 11. 4% using Kimura 2-parameter (K2P) analysis or 17.5% using general time-reversible (GTR + I + Gamma) analysis. Phylogenetic analysis revealed eight well-supported clades that were consistent with the allozyme analysis. Five of the six cryptic peripatus species distinguished by allozymes were confirmed by mtDNA analysis. The sixth taxon appeared to be paraphyletic, but genetic and geographical evidence suggested recent speciation. Two additional taxa were evident from the mtDNA data but neither occurred within the areas surveyed using allozymes. Among the peripatus surveyed with both mtDNA and allozymes, only one clear instance of recent introgression was evident, even though several taxa occurred in sympatry. This suggests well-developed mate recognition despite minimal morphological variation and low overall genetic diversity.

  10. Phylogeography of the sand dollar genus Mellita: cryptic speciation along the coasts of the Americas.


    Coppard, Simon E; Zigler, Kirk S; Lessios, H A


    Sand dollars of the genus Mellita are members of the sandy shallow-water fauna. The genus ranges in tropical and subtropical regions on the two coasts of the Americas. To reconstruct the phylogeography of the genus we sequenced parts of the mitochondrial cytochrome oxidase I and of 16S rRNA as well as part of the nuclear 28S rRNA gene from a total of 185 specimens of all ten described morphospecies from 31 localities. Our analyses revealed the presence of eleven species, including six cryptic species. Sequences of five morphospecies do not constitute monophyletic molecular units and thus probably represent ecophenotypic variants. The fossil-calibrated phylogeny showed that the ancestor of Mellita diverged into a Pacific lineage and an Atlantic+Pacific lineage close to the Miocene/Pliocene boundary. Atlantic M. tenuis, M. quinquiesperforata and two undescribed species of Mellita have non-overlapping distributions. Pacific Mellita consist of two highly divergent lineages that became established at different times, resulting in sympatric M. longifissa and M. notabilis. Judged by modern day ranges, not all divergence in this genus conforms to an allopatric speciation model. Only the separation of M. quinquiesperforata from M. notabilis is clearly due to vicariance as the result of the completion of the Isthmus of Panama. The molecular phylogeny calibrated on fossil evidence estimated this event as having occurred ~3 Ma, thus providing evidence that, contrary to a recent proposal, the central American Isthmus was not completed until this date. PMID:23792155

  11. DNA barcodes reveal cryptic host-specificity within the presumed polyphagous members of a genus of parasitoid flies (Diptera: Tachinidae)

    PubMed Central

    Smith, M. Alex; Woodley, Norman E.; Janzen, Daniel H.; Hallwachs, Winnie; Hebert, Paul D. N.


    Insect parasitoids are a major component of global biodiversity and affect the population dynamics of their hosts. However, identification of insect parasitoids is often difficult, and they are suspected to contain many cryptic species. Here, we ask whether the cytochrome c oxidase I DNA barcode could function as a tool for species identification and discovery for the 20 morphospecies of Belvosia parasitoid flies (Diptera: Tachinidae) that have been reared from caterpillars (Lepidoptera) in Area de Conservación Guanacaste (ACG), northwestern Costa Rica. Barcoding not only discriminates among all 17 highly host-specific morphospecies of ACG Belvosia, but it also raises the species count to 32 by revealing that each of the three generalist species are actually arrays of highly host-specific cryptic species. We also identified likely hybridization among Belvosia by using a variable internal transcribed spacer region 1 nuclear rDNA sequence as a genetic covariate in addition to the strategy of overlaying barcode clusters with ecological information. If general, these results will increase estimates of global species richness and imply that tropical conservation and host–parasite interactions may be more complex than expected. PMID:16505365

  12. Cryptic species of planktonic foraminifera: their effect on palaeoceanographic reconstructions.


    Kucera, Michal; Darling, Kate F


    Shells of planktonic foraminifera recovered from marine sediments provide a multitude of important palaeoproxies. Most of these proxies are based on the assumption that each morphospecies of planktonic foraminifera represents a genetically continuous species with a unique habitat. Recent discovery of hitherto hidden genetic diversity among modern planktonic foraminifera has significant repercussions on palaeoproxies derived from their fossil shells. We have compiled all available data on this genetic diversity. To date, 33 cryptic genetic types were found in 9 out of the 22 sequenced morphospecies of modern planktonic foraminifera. An examination of this database suggests that cryptic genetic diversity may be a prevalent pattern among modern planktonic foraminifera, but that the total number of cryptic genetic types per morphospecies is not large and that most genetic types show a non-random pattern of distribution in the oceans. Using modern distribution data from the Atlantic Ocean as constraints, the relationship between abundances of three genetic types of Globigerina bulloides and sea-surface temperature has been modelled and this model has been applied to a database of species counts in Atlantic coretops (761 samples). Trials with artificial neural networks (ANNs), the modern analogue technique and Imbrie-Kipp transfer functions showed that the splitting of G. bulloides into three genetic types resulted in substantial reduction in the prediction error rate (by 5 to 34%) and that this improvement was by far greatest in ANN trials (on average more than 20%). We conclude that such a large reduction in error rate occurred because the models resonated with a real pattern in the original data. This study indicates that genetic diversity among planktonic foraminifera may become more of a gift than malaise to palaeoproxies. If it becomes possible to distinguish these genetic types in the fossil record, the accuracy of proxies based on planktonic foraminifera will

  13. Complete sequence of a cryptic virus from hemp (Cannabis sativa).


    Ziegler, Angelika; Matoušek, Jaroslav; Steger, Gerhard; Schubert, Jörg


    Hemp (Cannabis sativa) was found to be a useful propagation host for hop latent virus, a carlavirus. However, when virus preparations were analysed by electron microscopy, along with the expected filamentous particles, spherical particles with a diameter of around 34 nm were found. RNA from virus preparations was purified, and cDNA was prepared and cloned. Sequence information was used to search databases, and the greatest similarity was found with Primula malacoides virus 1, a putative new member of the genus Partitivirus. The full sequences of RNA 1 and RNA 2 of this new hemp cryptic virus were obtained.

  14. Cryptic habitats and cryptic diversity: unexpected patterns of connectivity and phylogeographical breaks in a Mediterranean endemic marine cave mysid.


    Rastorgueff, Pierre-Alexandre; Chevaldonné, Pierre; Arslan, Defne; Verna, Caroline; Lejeusne, Christophe


    The marine cave-dwelling mysid Hemimysis margalefi is distributed over the whole Mediterranean Sea, which contrasts with the poor dispersal capabilities of this brooding species. In addition, underwater marine caves are a highly fragmented habitat which further promotes strong genetic structuring, therefore providing highly informative data on the levels of marine population connectivity across biogeographical regions. This study investigates how habitat and geography have shaped the connectivity network of this poor disperser over the entire Mediterranean Sea through the use of several mitochondrial and nuclear markers. Five deeply divergent lineages were observed among H. margalefi populations resulting from deep phylogeographical breaks, some dating back to the Oligo-Miocene. Whether looking at the intralineage or interlineage levels, H. margalefi populations present a high genetic diversity and population structuring. This study suggests that the five distinct lineages observed in H. margalefi actually correspond to as many separate cryptic taxa. The nominal species, H. margalefi sensu stricto, corresponds to the westernmost lineage here surveyed from the Alboran Sea to southeastern Italy. Typical genetic breaks such as the Almeria-Oran Front or the Siculo-Tunisian Strait do not appear to be influential on the studied loci in H. margalefi sensu stricto. Instead, population structuring appears more complex and subtle than usually found for model species with a pelagic dispersal phase. The remaining four cryptic taxa are all found in the eastern basin, but incomplete lineage sorting is suspected and speciation might still be in process. Present-day population structure of the different H. margalefi cryptic species appears to result from past vicariance events started in the Oligo-Miocene and maintained by present-day coastal topography, water circulation and habitat fragmentation.

  15. 18 CFR 415.51 - Prior non-conforming structures.

    Code of Federal Regulations, 2012 CFR


    ... 18 Conservation of Power and Water Resources 2 2012-04-01 2012-04-01 false Prior non-conforming structures. 415.51 Section 415.51 Conservation of Power and Water Resources DELAWARE RIVER BASIN COMMISSION ADMINISTRATIVE MANUAL BASIN REGULATIONS-FLOOD PLAIN REGULATIONS Enforcement § 415.51 Prior...

  16. 18 CFR 415.51 - Prior non-conforming structures.

    Code of Federal Regulations, 2013 CFR


    ... 18 Conservation of Power and Water Resources 2 2013-04-01 2012-04-01 true Prior non-conforming structures. 415.51 Section 415.51 Conservation of Power and Water Resources DELAWARE RIVER BASIN COMMISSION ADMINISTRATIVE MANUAL BASIN REGULATIONS-FLOOD PLAIN REGULATIONS Enforcement § 415.51 Prior...

  17. 18 CFR 415.51 - Prior non-conforming structures.

    Code of Federal Regulations, 2014 CFR


    ... 18 Conservation of Power and Water Resources 2 2014-04-01 2014-04-01 false Prior non-conforming structures. 415.51 Section 415.51 Conservation of Power and Water Resources DELAWARE RIVER BASIN COMMISSION ADMINISTRATIVE MANUAL BASIN REGULATIONS-FLOOD PLAIN REGULATIONS Enforcement § 415.51 Prior...

  18. Allopatric speciation within a cryptic species complex of Australasian octopuses.


    Amor, Michael D; Norman, Mark D; Cameron, Hayley E; Strugnell, Jan M


    Despite extensive revisions over recent decades, the taxonomy of benthic octopuses (Family Octopodidae) remains in a considerable flux. Among groups of unresolved status is a species complex of morphologically similar shallow-water octopods from subtropical Australasia, including: Allopatric populations of Octopus tetricus on the eastern and western coasts of Australia, of which the Western Australian form is speculated to be a distinct or sub-species; and Octopus gibbsi from New Zealand, a proposed synonym of Australian forms. This study employed a combination of molecular and morphological techniques to resolve the taxonomic status of the 'tetricus complex'. Phylogenetic analyses (based on five mitochondrial genes: 12S rRNA, 16S rRNA, COI, COIII and Cytb) and Generalised Mixed Yule Coalescent (GMYC) analysis (based on COI, COIII and Cytb) distinguished eastern and Western Australian O. tetricus as distinct species, while O. gibbsi was found to be synonymous with the east Australian form (BS = >97, PP = 1; GMYC p = 0.01). Discrete morphological differences in mature male octopuses (based on sixteen morphological traits) provided further evidence of cryptic speciation between east (including New Zealand) and west coast populations; although females proved less useful in morphological distinction among members of the tetricus complex. In addition, phylogenetic analyses suggested populations of octopuses currently treated under the name Octopus vulgaris are paraphyletic; providing evidence of cryptic speciation among global populations of O. vulgaris, the most commercially valuable octopus species worldwide.

  19. Placing an upper limit on cryptic marine sulphur cycling

    NASA Astrophysics Data System (ADS)

    Johnston, D. T.; Gill, B. C.; Masterson, A.; Beirne, E.; Casciotti, K. L.; Knapp, A. N.; Berelson, W.


    A quantitative understanding of sources and sinks of fixed nitrogen in low-oxygen waters is required to explain the role of oxygen-minimum zones (OMZs) in controlling the fixed nitrogen inventory of the global ocean. Apparent imbalances in geochemical nitrogen budgets have spurred numerous studies to measure the contributions of heterotrophic and autotrophic N2-producing metabolisms (denitrification and anaerobic ammonia oxidation, respectively). Recently, `cryptic' sulphur cycling was proposed as a partial solution to the fundamental biogeochemical problem of closing marine fixed-nitrogen budgets in intensely oxygen-deficient regions. The degree to which the cryptic sulphur cycle can fuel a loss of fixed nitrogen in the modern ocean requires the quantification of sulphur recycling in OMZ settings. Here we provide a new constraint for OMZ sulphate reduction based on isotopic profiles of oxygen (18O/16O) and sulphur (33S/32S, 34S/32S) in seawater sulphate through oxygenated open-ocean and OMZ-bearing water columns. When coupled with observations and models of sulphate isotope dynamics and data-constrained model estimates of OMZ water-mass residence time, we find that previous estimates for sulphur-driven remineralization and loss of fixed nitrogen from the oceans are near the upper limit for what is possible given in situ sulphate isotope data.

  20. Monitoring cryptic amphibians and reptiles in a Florida state park.


    Engeman, Richard M; Meshaka, Walter E; Severson, Robert; Severson, Mary Ann; Kaufman, Greg; Groninger, N Paige; Smith, Henry T


    We monitored cryptic herpetofauna at Savannas Preserve State Park, Florida, by combining artificial cover counts with a quantitative paradigm for constructing and calculating population indices. Weekly indices were calculated from two consecutive days of data collection each week for 7 months from mid-winter to mid-summer in three habitats. Seventeen species were observed at least once, and time trends using index values were followed for six species. Among these, abundance and seasonal pattern information were obtained for an exotic species (greenhouse frog) and a species identified by the Florida Committee on Rare and Endangered Plants and Animals as threatened (Florida scrub lizard). We identified winter as the optimal time in this area to monitor populations for conducting annual assessments. This combined observation and indexing approach could provide managers or researchers with an economical means to quantitatively index population trends for multiple cryptic herpetofauna species simultaneously. Using artificial cover to sample within a population indexing design can be generalized beyond monitoring herpetofauna. Other forms of artificial cover that can be used as observation stations include aquatic artificial substrates, artificial tree cavities, artificial reefs, and other artificial aquatic structures and artificial sea grass units, among many others, and a wide range of taxa are suitable for population monitoring using artificial cover as observation stations in the approach we present, including insects, soil invertebrates, micro and macro aquatic invertebrates, fish, crustaceans, and small mammals.

  1. Allopatric speciation within a cryptic species complex of Australasian octopuses.


    Amor, Michael D; Norman, Mark D; Cameron, Hayley E; Strugnell, Jan M


    Despite extensive revisions over recent decades, the taxonomy of benthic octopuses (Family Octopodidae) remains in a considerable flux. Among groups of unresolved status is a species complex of morphologically similar shallow-water octopods from subtropical Australasia, including: Allopatric populations of Octopus tetricus on the eastern and western coasts of Australia, of which the Western Australian form is speculated to be a distinct or sub-species; and Octopus gibbsi from New Zealand, a proposed synonym of Australian forms. This study employed a combination of molecular and morphological techniques to resolve the taxonomic status of the 'tetricus complex'. Phylogenetic analyses (based on five mitochondrial genes: 12S rRNA, 16S rRNA, COI, COIII and Cytb) and Generalised Mixed Yule Coalescent (GMYC) analysis (based on COI, COIII and Cytb) distinguished eastern and Western Australian O. tetricus as distinct species, while O. gibbsi was found to be synonymous with the east Australian form (BS = >97, PP = 1; GMYC p = 0.01). Discrete morphological differences in mature male octopuses (based on sixteen morphological traits) provided further evidence of cryptic speciation between east (including New Zealand) and west coast populations; although females proved less useful in morphological distinction among members of the tetricus complex. In addition, phylogenetic analyses suggested populations of octopuses currently treated under the name Octopus vulgaris are paraphyletic; providing evidence of cryptic speciation among global populations of O. vulgaris, the most commercially valuable octopus species worldwide. PMID:24964133

  2. DNA repair by the cryptic endonuclease activity of Mu transposase.


    Choi, Wonyoung; Harshey, Rasika M


    Phage Mu transposes by two distinct pathways depending on the specific stage of its life cycle. A common strand transfer intermediate is resolved differentially in the two pathways. During lytic growth, the intermediate is resolved by replication of Mu initiated within the flanking target DNA; during integration of infecting Mu, it is resolved without replication, by removal and repair of DNA from a previous host that is still attached to the ends of the incoming Mu genome. We have discovered that the cryptic endonuclease activity reported for the isolated C-terminal domain of the transposase MuA [Wu Z, Chaconas G (1995) A novel DNA binding and nuclease activity in domain III of Mu transposase: Evidence for a catalytic region involved in donor cleavage. EMBO J 14:3835-3843], which is not observed in the full-length protein or in the assembled transpososome in vitro, is required in vivo for removal of the attached host DNA or "5'flap" after the infecting Mu genome has integrated into the E. coli chromosome. Efficient flap removal also requires the host protein ClpX, which is known to interact with the C-terminus of MuA to remodel the transpososome for replication. We hypothesize that ClpX constitutes part of a highly regulated mechanism that unmasks the cryptic nuclease activity of MuA specifically in the repair pathway. PMID:20167799

  3. Uncovering Cryptic Parasitoid Diversity in Horismenus (Chalcidoidea, Eulophidae)

    PubMed Central

    Hansson, Christer; Alvarez, Nadir; Benrey, Betty


    Horismenus parasitoids are an abundant and understudied group of eulophid wasps found mainly in the New World. Recent surveys based on morphological analyses in Costa Rica have quadrupled the number of named taxa, with more than 400 species described so far. This recent revision suggests that there is still a vast number of unknown species to be identified. As Horismenus wasps have been widely described as parasitoids of insect pests associated with crop plants, it is of high importance to properly establish the extant diversity of the genus, in order to provide biological control practitioners with an exhaustive catalog of putative control agents. In this study, we first collected Horismenus wasps from wild Phaseolus bean seeds in Central Mexico and Arizona to assess the genetic relatedness of three morphologically distinct species with overlapping host and geographical ranges. Sequence data from two nuclear and two mitochondrial gene regions uncovered three cryptic species within each of the three focal species (i.e., H. missouriensis, H. depressus and H. butcheri). The monophyly of each cryptic group is statistically supported (except in two of them represented by one single tip in which monophyly cannot be tested). The phylogenetic reconstruction is discussed with respect to differences between gene regions as well as likely reasons for the differences in variability between species. PMID:26352700

  4. Long-Term Coexistence of Rotifer Cryptic Species

    PubMed Central

    Serra, Manuel; Gómez, Africa


    Despite their high morphological similarity, cryptic species often coexist in aquatic habitats presenting a challenge in the framework of niche differentiation theory and coexistence mechanisms. Here we use a rotifer species complex inhabiting highly unpredictable and fluctuating salt lakes to gain insights into the mechanisms involved in stable coexistence in cryptic species. We combined molecular barcoding surveys of planktonic populations and paleogenetic analysis of diapausing eggs to reconstruct the current and historical coexistence dynamics of two highly morphologically similar rotifer species, B. plicatilis and B. manjavacas. In addition, we carried out laboratory experiments using clones isolated from eight lakes where both species coexist to explore their clonal growth responses to salinity, a challenging, highly variable and unpredictable condition in Mediterranean salt lakes. We show that both species have co-occurred in a stable way in one lake, with population fluctuations in which no species was permanently excluded. The seasonal occurrence patterns of the plankton in two lakes agree with laboratory experiments showing that both species differ in their optimal salinity. These results suggest that stable species coexistence is mediated by differential responses to salinity and its fluctuating regime. We discuss the role of fluctuating salinity and a persistent diapausing egg banks as a mechanism for species coexistence in accordance with the ‘storage effect’. PMID:21738691

  5. Uncovering Cryptic Parasitoid Diversity in Horismenus (Chalcidoidea, Eulophidae).


    Kenyon, Sarah G; Buerki, Sven; Hansson, Christer; Alvarez, Nadir; Benrey, Betty


    Horismenus parasitoids are an abundant and understudied group of eulophid wasps found mainly in the New World. Recent surveys based on morphological analyses in Costa Rica have quadrupled the number of named taxa, with more than 400 species described so far. This recent revision suggests that there is still a vast number of unknown species to be identified. As Horismenus wasps have been widely described as parasitoids of insect pests associated with crop plants, it is of high importance to properly establish the extant diversity of the genus, in order to provide biological control practitioners with an exhaustive catalog of putative control agents. In this study, we first collected Horismenus wasps from wild Phaseolus bean seeds in Central Mexico and Arizona to assess the genetic relatedness of three morphologically distinct species with overlapping host and geographical ranges. Sequence data from two nuclear and two mitochondrial gene regions uncovered three cryptic species within each of the three focal species (i.e., H. missouriensis, H. depressus and H. butcheri). The monophyly of each cryptic group is statistically supported (except in two of them represented by one single tip in which monophyly cannot be tested). The phylogenetic reconstruction is discussed with respect to differences between gene regions as well as likely reasons for the differences in variability between species. PMID:26352700

  6. Placing an upper limit on cryptic marine sulphur cycling.


    Johnston, D T; Gill, B C; Masterson, A; Beirne, E; Casciotti, K L; Knapp, A N; Berelson, W


    A quantitative understanding of sources and sinks of fixed nitrogen in low-oxygen waters is required to explain the role of oxygen-minimum zones (OMZs) in controlling the fixed nitrogen inventory of the global ocean. Apparent imbalances in geochemical nitrogen budgets have spurred numerous studies to measure the contributions of heterotrophic and autotrophic N2-producing metabolisms (denitrification and anaerobic ammonia oxidation, respectively). Recently, 'cryptic' sulphur cycling was proposed as a partial solution to the fundamental biogeochemical problem of closing marine fixed-nitrogen budgets in intensely oxygen-deficient regions. The degree to which the cryptic sulphur cycle can fuel a loss of fixed nitrogen in the modern ocean requires the quantification of sulphur recycling in OMZ settings. Here we provide a new constraint for OMZ sulphate reduction based on isotopic profiles of oxygen ((18)O/(16)O) and sulphur ((33)S/(32)S, (34)S/(32)S) in seawater sulphate through oxygenated open-ocean and OMZ-bearing water columns. When coupled with observations and models of sulphate isotope dynamics and data-constrained model estimates of OMZ water-mass residence time, we find that previous estimates for sulphur-driven remineralization and loss of fixed nitrogen from the oceans are near the upper limit for what is possible given in situ sulphate isotope data. PMID:25209667

  7. Placing an upper limit on cryptic marine sulphur cycling.


    Johnston, D T; Gill, B C; Masterson, A; Beirne, E; Casciotti, K L; Knapp, A N; Berelson, W


    A quantitative understanding of sources and sinks of fixed nitrogen in low-oxygen waters is required to explain the role of oxygen-minimum zones (OMZs) in controlling the fixed nitrogen inventory of the global ocean. Apparent imbalances in geochemical nitrogen budgets have spurred numerous studies to measure the contributions of heterotrophic and autotrophic N2-producing metabolisms (denitrification and anaerobic ammonia oxidation, respectively). Recently, 'cryptic' sulphur cycling was proposed as a partial solution to the fundamental biogeochemical problem of closing marine fixed-nitrogen budgets in intensely oxygen-deficient regions. The degree to which the cryptic sulphur cycle can fuel a loss of fixed nitrogen in the modern ocean requires the quantification of sulphur recycling in OMZ settings. Here we provide a new constraint for OMZ sulphate reduction based on isotopic profiles of oxygen ((18)O/(16)O) and sulphur ((33)S/(32)S, (34)S/(32)S) in seawater sulphate through oxygenated open-ocean and OMZ-bearing water columns. When coupled with observations and models of sulphate isotope dynamics and data-constrained model estimates of OMZ water-mass residence time, we find that previous estimates for sulphur-driven remineralization and loss of fixed nitrogen from the oceans are near the upper limit for what is possible given in situ sulphate isotope data.

  8. Current methods for identifying clinically important cryptic Candida species.


    Criseo, Giuseppe; Scordino, Fabio; Romeo, Orazio


    In recent years, the taxonomy of the most important pathogenic Candida species (Candida albicans, Candida parapsilosis and Candida glabrata) has undergone profound changes due to the description of new closely-related species. This has resulted in the establishment of cryptic species complexes difficult to recognize in clinical diagnostic laboratories. The identification of these novel Candida species seems to be clinically relevant because it is likely that they differ in virulence and drug resistance. Nevertheless, current phenotypic methods are not suitable to accurately distinguish all the species belonging to a specific cryptic complex and therefore their recognition still requires molecular methods. Since traditional mycological techniques have not been useful, a number of molecular based methods have recently been developed. These range from simple PCR-based methods to more sophisticated real-time PCR and/or MALDI-TOF methods. In this article, we review the current methods designed for discriminating among closely related Candida species by highlighting, in particular, the limits of the existing phenotypic tests and the development of rapid and specific molecular tools for their proper identification.

  9. Monitoring cryptic amphibians and reptiles in a Florida state park.


    Engeman, Richard M; Meshaka, Walter E; Severson, Robert; Severson, Mary Ann; Kaufman, Greg; Groninger, N Paige; Smith, Henry T


    We monitored cryptic herpetofauna at Savannas Preserve State Park, Florida, by combining artificial cover counts with a quantitative paradigm for constructing and calculating population indices. Weekly indices were calculated from two consecutive days of data collection each week for 7 months from mid-winter to mid-summer in three habitats. Seventeen species were observed at least once, and time trends using index values were followed for six species. Among these, abundance and seasonal pattern information were obtained for an exotic species (greenhouse frog) and a species identified by the Florida Committee on Rare and Endangered Plants and Animals as threatened (Florida scrub lizard). We identified winter as the optimal time in this area to monitor populations for conducting annual assessments. This combined observation and indexing approach could provide managers or researchers with an economical means to quantitatively index population trends for multiple cryptic herpetofauna species simultaneously. Using artificial cover to sample within a population indexing design can be generalized beyond monitoring herpetofauna. Other forms of artificial cover that can be used as observation stations include aquatic artificial substrates, artificial tree cavities, artificial reefs, and other artificial aquatic structures and artificial sea grass units, among many others, and a wide range of taxa are suitable for population monitoring using artificial cover as observation stations in the approach we present, including insects, soil invertebrates, micro and macro aquatic invertebrates, fish, crustaceans, and small mammals. PMID:26739988

  10. Allopatric Speciation within a Cryptic Species Complex of Australasian Octopuses

    PubMed Central

    Amor, Michael D.; Norman, Mark D.; Cameron, Hayley E.; Strugnell, Jan M.


    Despite extensive revisions over recent decades, the taxonomy of benthic octopuses (Family Octopodidae) remains in a considerable flux. Among groups of unresolved status is a species complex of morphologically similar shallow-water octopods from subtropical Australasia, including: Allopatric populations of Octopus tetricus on the eastern and western coasts of Australia, of which the Western Australian form is speculated to be a distinct or sub-species; and Octopus gibbsi from New Zealand, a proposed synonym of Australian forms. This study employed a combination of molecular and morphological techniques to resolve the taxonomic status of the ‘tetricus complex’. Phylogenetic analyses (based on five mitochondrial genes: 12S rRNA, 16S rRNA, COI, COIII and Cytb) and Generalised Mixed Yule Coalescent (GMYC) analysis (based on COI, COIII and Cytb) distinguished eastern and Western Australian O. tetricus as distinct species, while O. gibbsi was found to be synonymous with the east Australian form (BS = >97, PP = 1; GMYC p = 0.01). Discrete morphological differences in mature male octopuses (based on sixteen morphological traits) provided further evidence of cryptic speciation between east (including New Zealand) and west coast populations; although females proved less useful in morphological distinction among members of the tetricus complex. In addition, phylogenetic analyses suggested populations of octopuses currently treated under the name Octopus vulgaris are paraphyletic; providing evidence of cryptic speciation among global populations of O. vulgaris, the most commercially valuable octopus species worldwide. PMID:24964133


    ERIC Educational Resources Information Center



  12. Barcoding of ancient lake ostracods (crustacea) reveals cryptic speciation with extremely low distances.


    Karanovic, Ivana


    Ostracods are drastically reduced crustaceans, with never more than eight appendages enclosed between two valves, leaving only a limited number of morphological characters for species delineation. Conservative morphology of characters used to define genera, along with high variability of characters used to define species are creating problems in applying a morphospecies concept. A high intraspecific variability in a Lake Biwa (Japan) endemic, Physocypria biwaensis (Okubo, 1990), has been observed previously but was never studied in detail. Two sympatric forms, differing in pigmentation and size, suggest a presence of reproductive isolation. The aim of this study is to employ molecular and morphometric tools to aid in species delineation within P. biwaensis complex and reconstruct their phylogenetic relationships. A fragment of the mtCOI gene was amplified from 30 specimens, and an additional 37 specimens were studied for morphological characters. Resulting phylogenies showed that each morphologically distinct form is associated with a distinct phylogenetic group based on mtDNA. The average pairwise distance is very low (5%), indicating a recent divergence time. I speculate that there is a possibility that one of them originated in the lake, while the other probably colonized it afterwards. This seems to be supported with an apparent niche partitioning at different depths. In spite of the fact that traditionally used sexual characters are highly variable in these two species, the morphometric analysis of shell and soft part related characters clearly delineates them and suggests that such characters may be useful for future detection of seemingly cryptic ostracod species.

  13. Vietnam, a Hotspot for Chromosomal Diversity and Cryptic Species in Black Flies (Diptera: Simuliidae)

    PubMed Central

    Takaoka, Hiroyuki; Sofian-Azirun, Mohd; Low, Van Lun; Ya’cob, Zubaidah; Chen, Chee Dhang; Lau, Koon Weng; Pham, Xuan Da


    The increasing attention on Vietnam as a biodiversity hotspot prompted an investigation of the potential for cryptic diversity in black flies, a group well known elsewhere for its high frequency of isomorphic species. We analyzed the banding structure of the larval polytene chromosomes in the Simulium tuberosum species group to probe for diversity beyond the morphological level. Among 272 larvae, 88 different chromosomal rearrangements, primarily paracentric inversions, were discovered in addition to 25 already known in the basic sequences of the group in Asia. Chromosomal diversity in Vietnam far exceeds that known for the group in Thailand, with only about 5% of the rearrangements shared between the two countries. Fifteen cytoforms and nine morphoforms were revealed among six nominal species in Vietnam. Chromosomal evidence, combined with available molecular and morphological evidence, conservatively suggests that at least five of the cytoforms are valid species, two of which require formal names. The total chromosomal rearrangements and species (15) now known from the group in Vietnam far exceed those of any other area of comparable size in the world, supporting the country’s status as a biodiversity hotspot. Phylogenetic inference based on uniquely shared, derived chromosomal rearrangements supports the clustering of cytoforms into two primary lineages, the Simulium tani complex and the Southeast Asian Simulium tuberosum subgroup. Some of these taxa could be threatened by habitat destruction, given their restricted geographical distributions and the expanding human population of Vietnam. PMID:27695048

  14. Exceptionally preserved crustaceans from western Canada reveal a cryptic Cambrian radiation

    PubMed Central

    Harvey, Thomas H. P.; Vélez, Maria I.; Butterfield, Nicholas J.


    The early history of crustaceans is obscured by strong biases in fossil preservation, but a previously overlooked taphonomic mode yields important complementary insights. Here we describe diverse crustacean appendages of Middle and Late Cambrian age from shallow-marine mudstones of the Deadwood Formation in western Canada. The fossils occur as flattened and fragmentary carbonaceous cuticles but provide a suite of phylogenetic and ecological data by virtue of their detailed preservation. In addition to an unprecedented range of complex, largely articulated filtering limbs, we identify at least four distinct types of mandible. Together, these fossils provide the earliest evidence for crown-group branchiopods and total-group copepods and ostracods, extending the respective ranges of these clades back from the Devonian, Pennsylvanian, and Ordovician. Detailed similarities with living forms demonstrate the early origins and subsequent conservation of various complex food-handling adaptations, including a directional mandibular asymmetry that has persisted through half a billion years of evolution. At the same time, the Deadwood fossils indicate profound secular changes in crustacean ecology in terms of body size and environmental distribution. The earliest radiation of crustaceans is largely cryptic in the fossil record, but “small carbonaceous fossils” reveal organisms of surprisingly modern aspect operating in an unfamiliar biosphere. PMID:22307616

  15. Phylogeography of a Morphologically Cryptic Golden Mole Assemblage from South-Eastern Africa.


    Mynhardt, Samantha; Maree, Sarita; Pelser, Illona; Bennett, Nigel C; Bronner, Gary N; Wilson, John W; Bloomer, Paulette


    The Greater Maputaland-Pondoland-Albany (GMPA) region of southern Africa was recently designated as a centre of vertebrate endemism. The phylogeography of the vertebrate taxa occupying this region may provide insights into the evolution of faunal endemism in south-eastern Africa. Here we investigate the phylogeographic patterns of an understudied small mammal species assemblage (Amblysomus) endemic to the GMPA, to test for cryptic diversity within the genus, and to better understand diversification across the region. We sampled specimens from 50 sites across the distributional range of Amblysomus, with emphasis on the widespread A. hottentotus, to analyse geographic patterns of genetic diversity using mitochondrial DNA (mtDNA) and nuclear intron data. Molecular dating was used to elucidate the evolutionary and phylogeographic history of Amblysomus. Our phylogenetic reconstructions show that A. hottentotus comprises several distinct lineages, or evolutionarily significant units (ESUs), some with restricted geographic ranges and thus worthy of conservation attention. Divergence of the major lineages dated to the early Pliocene, with later radiations in the GMPA during the late-Pliocene to early-Pleistocene. Evolutionary diversification within Amblysomus may have been driven by uplift of the Great Escarpment c. 5-3 million years ago (Ma), habitat changes associated with intensification of the east-west rainfall gradient across South Africa and the influence of subsequent global climatic cycles. These drivers possibly facilitated geographic spread of ancestral lineages, local adaptation and vicariant isolation. Our study adds to growing empirical evidence identifying East and southern Africa as cradles of vertebrate diversity. PMID:26683828

  16. Exceptionally preserved crustaceans from western Canada reveal a cryptic Cambrian radiation

    NASA Astrophysics Data System (ADS)

    Harvey, Thomas H. P.; Vélez, Maria I.; Butterfield, Nicholas J.


    The early history of crustaceans is obscured by strong biases in fossil preservation, but a previously overlooked taphonomic mode yields important complementary insights. Here we describe diverse crustacean appendages of Middle and Late Cambrian age from shallow-marine mudstones of the Deadwood Formation in western Canada. The fossils occur as flattened and fragmentary carbonaceous cuticles but provide a suite of phylogenetic and ecological data by virtue of their detailed preservation. In addition to an unprecedented range of complex, largely articulated filtering limbs, we identify at least four distinct types of mandible. Together, these fossils provide the earliest evidence for crown-group branchiopods and total-group copepods and ostracods, extending the respective ranges of these clades back from the Devonian, Pennsylvanian, and Ordovician. Detailed similarities with living forms demonstrate the early origins and subsequent conservation of various complex food-handling adaptations, including a directional mandibular asymmetry that has persisted through half a billion years of evolution. At the same time, the Deadwood fossils indicate profound secular changes in crustacean ecology in terms of body size and environmental distribution. The earliest radiation of crustaceans is largely cryptic in the fossil record, but "small carbonaceous fossils" reveal organisms of surprisingly modern aspect operating in an unfamiliar biosphere.

  17. Heterogeneous rates of molecular evolution among cryptic species of the ciliate morphospecies Chilodonella uncinata

    PubMed Central

    Katz, Laura A.; DeBerardinis, Jennifer; Hall, Meaghan S.; Kovner, Alexandra M.; Dunthorn, Micah; Muse, Spencer V.


    While molecular analyses have provided insight into the phylogeny of ciliates, the few studies assessing intraspecific variation have largely relied on just a single locus (e.g. nuclear small subunit rDNA (nSSU-rDNA) or mitochondrial cytochrome oxidase I). In this study, we characterize the diversity of several nuclear protein-coding genes plus both nSSU-rDNA and mitochondrial small subunit rDNA (mtSSU-rDNA) of five isolates of the ciliate morphospecies Chilodonella uncinata. Although these isolates have nearly identical nSSU-rDNA sequences, they differ by up to 8.0% in mtSSU-rDNA. Comparative analyses of all loci, including β-tubulin paralogs, indicate a lack of recombination between strains, demonstrating that the morphospecies C. uncinata consists of multiple cryptic species. Further, there is considerable variation in substitution rates among loci as some protein-coding domains are nearly identical between isolates while others differ by up to 13.2% at the amino acid level. Combining insights on macronuclear variation among isolates, the focus of this study, with published data from the micronucleus of two of these isolates indicates that C. uncinata lineages are able to maintain both highly divergent and highly conserved genes within a rapidly evolving germline genome. PMID:22258433

  18. Phylogeography of a Morphologically Cryptic Golden Mole Assemblage from South-Eastern Africa

    PubMed Central

    Mynhardt, Samantha; Maree, Sarita; Pelser, Illona; Bennett, Nigel C.; Bronner, Gary N.; Wilson, John W.; Bloomer, Paulette


    The Greater Maputaland-Pondoland-Albany (GMPA) region of southern Africa was recently designated as a centre of vertebrate endemism. The phylogeography of the vertebrate taxa occupying this region may provide insights into the evolution of faunal endemism in south-eastern Africa. Here we investigate the phylogeographic patterns of an understudied small mammal species assemblage (Amblysomus) endemic to the GMPA, to test for cryptic diversity within the genus, and to better understand diversification across the region. We sampled specimens from 50 sites across the distributional range of Amblysomus, with emphasis on the widespread A. hottentotus, to analyse geographic patterns of genetic diversity using mitochondrial DNA (mtDNA) and nuclear intron data. Molecular dating was used to elucidate the evolutionary and phylogeographic history of Amblysomus. Our phylogenetic reconstructions show that A. hottentotus comprises several distinct lineages, or evolutionarily significant units (ESUs), some with restricted geographic ranges and thus worthy of conservation attention. Divergence of the major lineages dated to the early Pliocene, with later radiations in the GMPA during the late-Pliocene to early-Pleistocene. Evolutionary diversification within Amblysomus may have been driven by uplift of the Great Escarpment c. 5–3 million years ago (Ma), habitat changes associated with intensification of the east-west rainfall gradient across South Africa and the influence of subsequent global climatic cycles. These drivers possibly facilitated geographic spread of ancestral lineages, local adaptation and vicariant isolation. Our study adds to growing empirical evidence identifying East and southern Africa as cradles of vertebrate diversity. PMID:26683828

  19. 18 CFR 1309.9 - How does TVA provide financial assistance in conformity with the Act?

    Code of Federal Regulations, 2010 CFR


    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false How does TVA provide financial assistance in conformity with the Act? 1309.9 Section 1309.9 Conservation of Power and Water... financial assistance in conformity with the Act? (a) TVA contributes financial assistance only...

  20. How hidden are hidden processes? A primer on crypticity and entropy convergence.


    Mahoney, John R; Ellison, Christopher J; James, Ryan G; Crutchfield, James P


    We investigate a stationary process's crypticity--a measure of the difference between its hidden state information and its observed information--using the causal states of computational mechanics. Here, we motivate crypticity and cryptic order as physically meaningful quantities that monitor how hidden a hidden process is. This is done by recasting previous results on the convergence of block entropy and block-state entropy in a geometric setting, one that is more intuitive and that leads to a number of new results. For example, we connect crypticity to how an observer synchronizes to a process. We show that the block-causal-state entropy is a convex function of block length. We give a complete analysis of spin chains. We present a classification scheme that surveys stationary processes in terms of their possible cryptic and Markov orders. We illustrate related entropy convergence behaviors using a new form of foliated information diagram. Finally, along the way, we provide a variety of interpretations of crypticity and cryptic order to establish their naturalness and pervasiveness. This is also a first step in developing applications in spatially extended and network dynamical systems. PMID:21974675

  1. Causality constraints in conformal field theory

    NASA Astrophysics Data System (ADS)

    Hartman, Thomas; Jain, Sachin; Kundu, Sandipan


    Causality places nontrivial constraints on QFT in Lorentzian signature, for example fixing the signs of certain terms in the low energy Lagrangian. In d dimensional conformal field theory, we show how such constraints are encoded in crossing symmetry of Euclidean correlators, and derive analogous constraints directly from the conformal bootstrap (analytically). The bootstrap setup is a Lorentzian four-point function corresponding to propagation through a shockwave. Crossing symmetry fixes the signs of certain log terms that appear in the conformal block expansion, which constrains the interactions of low-lying operators. As an application, we use the bootstrap to rederive the well known sign constraint on the (∂ ϕ)4 coupling in effective field theory, from a dual CFT. We also find constraints on theories with higher spin conserved currents. Our analysis is restricted to scalar correlators, but we argue that similar methods should also impose nontrivial constraints on the interactions of spinning operators.

  2. Geochemical Evidence of Cryptic Sulfur Cycling in Salt Marsh Sediments

    NASA Astrophysics Data System (ADS)

    Mills, J. V.; Antler, G.; Turchyn, A. V.


    In modern marine and marginal marine sediments, bacterial sulfate reduction dominates the subsurface oxidation of organic carbon due to the abundance of sulfate in many surface environments. While bacterial sulfate reduction may control anaerobic organic carbon oxidation, there is increasing evidence that iron redox chemistry may be intimately linked to sulfur redox chemistry in the anoxic subsurface, with iron species acting as catalysts or electron shuttles for the microbial use of sulfur, and vice versa. We use stable isotope and geochemical techniques to explore the coupling of the iron and sulfur cycles in salt marsh sediments in North Norfolk, UK. Unique among previously studied environments, these sediments contain high concentrations of both sulfate (20-40mM) and ferrous iron (1-3mM). High ferrous iron concentrations require extended regions of bacterial iron reduction. Within these zones of iron reduction we would predict no sulfate reduction, and lack of change in sulfur isotopes and no loss of sulfate suggest that there is no net sulfate reduction in this zone. However, coincident with the increase in ferrous iron concentrations, the δ18Osulfate exhibits significant increases of up to 5‰. The decoupling of the sulfur and oxygen isotopes of sulfate is suggestive of a cryptic sulfur cycle in which sulfate is reduced to an intermediate valence state sulfur species and subsequently reoxidized to sulfate; this cycle must by quasi-quantitative to produce the suite of geochemical observations. We further explore the nature of this cycling through a series of batch reactor incubation experiments. When sediments are incubated in 18O-enriched water, significant shifts (>15‰) in the δ18Osulfate are observed with no corresponding shift in sulfur isotopes. This provides direct evidence that microbial assemblages in these salt marsh sediments facilitate a cryptic cycling of sulfur, potentially mediated by iron species in the zone of iron reduction. We contrast

  3. Effects of cryptic mortality and the hidden costs of using length limits in fishery management

    USGS Publications Warehouse

    Coggins, L.G.; Catalano, M.J.; Allen, M.S.; Pine, William E.; Walters, C.J.


    Fishery collapses cause substantial economic and ecological harm, but common management actions often fail to prevent overfishing. Minimum length limits are perhaps the most common fishing regulation used in both commercial and recreational fisheries, but their conservation benefits can be influenced by discard mortality of fish caught and released below the legal length. We constructed a computer model to evaluate how discard mortality could influence the conservation utility of minimum length regulations. We evaluated policy performance across two disparate fish life-history types: short-lived high-productivity (SLHP) and long-lived low-productivity (LLLP) species. For the life-history types, fishing mortality rates and minimum length limits that we examined, length limits alone generally failed to achieve sustainability when discard mortality rate exceeded about 0.2 for SLHP species and 0.05 for LLLP species. At these levels of discard mortality, reductions in overall fishing mortality (e.g. lower fishing effort) were required to prevent recruitment overfishing if fishing mortality was high. Similarly, relatively low discard mortality rates (>0.05) rendered maximum yield unobtainable and caused a substantial shift in the shape of the yield response surfaces. An analysis of fishery efficiency showed that length limits caused the simulated fisheries to be much less efficient, potentially exposing the target species and ecosystem to increased negative effects of the fishing process. Our findings suggest that for overexploited fisheries with moderate-to-high discard mortality rates, reductions in fishing mortality will be required to meet management goals. Resource managers should carefully consider impacts of cryptic mortality sources (e.g. discard mortality) on fishery sustainability, especially in recreational fisheries where release rates are high and effort is increasing in many areas of the world. ?? 2007 Blackwell Publishing Ltd.

  4. Metabolism of cryptic peptides derived from neuropeptide FF precursors: the involvement of insulin-degrading enzyme.


    Grasso, Giuseppe; Mielczarek, Przemyslaw; Niedziolka, Magdalena; Silberring, Jerzy


    The term "cryptome" refers to the subset of cryptic peptides with bioactivities that are often unpredictable and very different from the parent protein. These cryptic peptides are generated by proteolytic cleavage of proteases, whose identification in vivo can be very challenging. In this work, we show that insulin-degrading enzyme (IDE) is able to degrade specific amino acid sequences present in the neuropeptide pro-NPFFA (NPFF precursor), generating some cryptic peptides that are also observed after incubation with rat brain cortex homogenate. The reported experimental findings support the increasingly accredited hypothesis, according to which, due to its wide substrate selectivity, IDE is involved in a wide variety of physiopathological processes.

  5. Conformance Testing: Measurement Decision Rules

    NASA Technical Reports Server (NTRS)

    Mimbs, Scott M.


    The goal of a Quality Management System (QMS) as specified in ISO 9001 and AS9100 is to provide assurance to the customer that end products meet specifications. Measuring devices, often called measuring and test equipment (MTE), are used to provide the evidence of product conformity to specified requirements. Unfortunately, processes that employ MTE can become a weak link to the overall QMS if proper attention is not given to the measurement process design, capability, and implementation. Documented "decision rules" establish the requirements to ensure measurement processes provide the measurement data that supports the needs of the QMS. Measurement data are used to make the decisions that impact all areas of technology. Whether measurements support research, design, production, or maintenance, ensuring the data supports the decision is crucial. Measurement data quality can be critical to the resulting consequences of measurement-based decisions. Historically, most industries required simplistic, one-size-fits-all decision rules for measurements. One-size-fits-all rules in some cases are not rigorous enough to provide adequate measurement results, while in other cases are overly conservative and too costly to implement. Ideally, decision rules should be rigorous enough to match the criticality of the parameter being measured, while being flexible enough to be cost effective. The goal of a decision rule is to ensure that measurement processes provide data with a sufficient level of quality to support the decisions being made - no more, no less. This paper discusses the basic concepts of providing measurement-based evidence that end products meet specifications. Although relevant to all measurement-based conformance tests, the target audience is the MTE end-user, which is anyone using MTE other than calibration service providers. Topics include measurement fundamentals, the associated decision risks, verifying conformance to specifications, and basic measurement

  6. Biofilm architecture of Phanerozoic cryptic carbonate marine veneers

    NASA Astrophysics Data System (ADS)

    Riding, Robert


    Thin (<150 μm) micritic veneers lining crypts in Paleozoic and Mesozoic reef, microbial, and bioclastic carbonates have the dimensions and architecture of modern uncalcified bacterial biofilm. Morphologic attributes include rounded aggregate nanofabric, internal channels, external towers, mushrooms, and plumes. All can be interpreted as characteristics of attached bacterial communities, i.e., aggregates as microcolonies, originally embedded in a matrix of extracellular polymeric substances; channels as water conduits and/or uncolonized nutrient-poor spaces; external protuberances as localized growths; and plumes as surface streamers. Cryptic habitat favored pristine biofilm preservation by precluding disturbance and overgrowth, and suggests aphotic and anoxic conditions. These examples provide diagnostic morphologic criteria for wider recognition of biofilm in Phanerozoic and older carbonates.

  7. Cryptic ecology among host generalist Campylobacter jejuni in domestic animals.


    Sheppard, Samuel K; Cheng, Lu; Méric, Guillaume; de Haan, Caroline P A; Llarena, Ann-Katrin; Marttinen, Pekka; Vidal, Ana; Ridley, Anne; Clifton-Hadley, Felicity; Connor, Thomas R; Strachan, Norval J C; Forbes, Ken; Colles, Frances M; Jolley, Keith A; Bentley, Stephen D; Maiden, Martin C J; Hänninen, Marja-Liisa; Parkhill, Julian; Hanage, William P; Corander, Jukka


    Homologous recombination between bacterial strains is theoretically capable of preventing the separation of daughter clusters, and producing cohesive clouds of genotypes in sequence space. However, numerous barriers to recombination are known. Barriers may be essential such as adaptive incompatibility, or ecological, which is associated with the opportunities for recombination in the natural habitat. Campylobacter jejuni is a gut colonizer of numerous animal species and a major human enteric pathogen. We demonstrate that the two major generalist lineages of C. jejuni do not show evidence of recombination with each other in nature, despite having a high degree of host niche overlap and recombining extensively with specialist lineages. However, transformation experiments show that the generalist lineages readily recombine with one another in vitro. This suggests ecological rather than essential barriers to recombination, caused by a cryptic niche structure within the hosts.

  8. Is the Kapuskasing structure the site of a cryptic suture

    NASA Technical Reports Server (NTRS)

    Burke, K.


    The demonstration that the Kapuskasing structure involves substantial thrusting of deep continental crustal rocks over shallower continental rocks calls into question an earlier suggestion (by Wilson) that the Circum-Ungaua suture zone continued through the Kapuskasing to join the Penokean fold belt (implying that the Kapuskasing marked the site of what has since come to be called a cryptic suture). Problems are discussed which arose in attempting to reconcile Wilson's idea with data from more recent studies: whether the Kapuskasing and the Thompson belt both mark sutures of about 1700 Ma age; why there is no age difference across the Kapuskasing if it does mark the site of continental collision, and why there is no offset of Superior subprovinces across the Kapuskasing.

  9. High cryptic soil ciliate (Ciliophora, Hypotrichida) diversity in Australia.


    Kumar, Santosh; Foissner, Wilhelm


    The diversity and distribution of soil ciliates from Australia is poorly known. Thus, we studied eight taxa, using the non-flooded Petri dish culture method, live observation, silver impregnation, detailed morphometrics, ontogenesis, and reinvestigation of type slides. At first glance, the Australian taxa looked very similar to described species, however, detailed investigations resulted in the identification of six cryptic species: Afroamphisiella multinucleata minima nov. subspec., Cladotricha similis nov. spec., Erimophrya similis nov. spec., Heterogonostomum salinarum nov. gen., nov. spec., Pseudohemisincirra arabica australiensis nov. subspec., and Pattersoniella (Pattersoniellides) australiensis nov. subgen., nov. spec. This new subgenus is unique among all described hypotrichs in having reduced some anterior paroral dikinetids the fibrillar associates of which are, however, still present. Only two of the eight taxa are possibly cosmopolitans: Apourosomoida halophilaFoissner et al., 2002 and Urosoma karinaeFoissner, 1987. This supports the moderate endemicity model, i.e., that a third of protists have a restricted distribution (Foissner, Chao and Katz 2008).

  10. Hyper-Cryptic Marine Meiofauna: Species Complexes in Nemertodermatida

    PubMed Central

    Meyer-Wachsmuth, Inga; Curini Galletti, Marco; Jondelius, Ulf


    Nemertodermatida are microscopically small, benthic marine worms. Specimens of two nominal species, Sterreria psammicola and Nemertinoides elongatus from 33 locations worldwide were sequenced for three molecular markers. Species delimitation and validation was done using gene trees, haplotype networks and multilocus Bayesian analysis. We found 20 supported species of which nine: Nemertinoides glandulosum n.sp., N. wolfgangi n.sp., Sterreria boucheti n.sp., S. lundini n.sp., S. martindalei n.sp., S. monolithes n.sp., S. papuensis n.sp., S. variabilis n.sp. and S. ylvae n.sp., are described including nucleotide-based diagnoses. The distribution patterns indicate transoceanic dispersal in some of the species. Sympatric species were found in many cases. The high level of cryptic diversity in this meiofauna group implies that marine diversity may be higher than previously estimated. PMID:25225981

  11. Ovarian fluid allows directional cryptic female choice despite external fertilization.


    Alonzo, Suzanne H; Stiver, Kelly A; Marsh-Rollo, Susan E


    In species with internal fertilization, females can favour certain males over others, not only before mating but also within the female's reproductive tract after mating. Here, we ask whether such directional post-mating (that is, cryptic) female mate choice can also occur in species with external fertilization. Using an in vitro sperm competition experiment, we demonstrate that female ovarian fluid (ovarian fluid) changes the outcome of sperm competition by decreasing the importance of sperm number thereby increasing the relative importance of sperm velocity. We further show that ovarian fluid does not differentially affect sperm from alternative male phenotypes, but generally enhances sperm velocity, motility, straightness and chemoattraction. Under natural conditions, female ovarian fluid likely increases the paternity of the preferred parental male phenotype, as these males release fewer but faster sperm. These results imply females have greater control over fertilization and potential to exert selection on males in species with external fertilization than previously thought possible. PMID:27529581

  12. Ovarian fluid allows directional cryptic female choice despite external fertilization

    PubMed Central

    Alonzo, Suzanne H.; Stiver, Kelly A.; Marsh-Rollo, Susan E.


    In species with internal fertilization, females can favour certain males over others, not only before mating but also within the female's reproductive tract after mating. Here, we ask whether such directional post-mating (that is, cryptic) female mate choice can also occur in species with external fertilization. Using an in vitro sperm competition experiment, we demonstrate that female ovarian fluid (ovarian fluid) changes the outcome of sperm competition by decreasing the importance of sperm number thereby increasing the relative importance of sperm velocity. We further show that ovarian fluid does not differentially affect sperm from alternative male phenotypes, but generally enhances sperm velocity, motility, straightness and chemoattraction. Under natural conditions, female ovarian fluid likely increases the paternity of the preferred parental male phenotype, as these males release fewer but faster sperm. These results imply females have greater control over fertilization and potential to exert selection on males in species with external fertilization than previously thought possible. PMID:27529581

  13. Differential responses of cryptic bat species to the urban landscape.


    Lintott, Paul R; Barlow, Kate; Bunnefeld, Nils; Briggs, Philip; Gajas Roig, Clara; Park, Kirsty J


    Urbanization is a key global driver in the modification of land use and has been linked to population declines even in widespread and relatively common species. Cities comprise a complex assortment of habitat types yet we know relatively little about the effects of their composition and spatial configuration on species distribution. Although many bat species exploit human resources, the majority of species are negatively impacted by urbanization. Here, we use data from the National Bat Monitoring Programme, a long-running citizen science scheme, to assess how two cryptic European bat species respond to the urban landscape. A total of 124 × 1 km(2) sites throughout Britain were surveyed. The landscape surrounding each site was mapped and classified into discrete biotope types (e.g., woodland). Generalized linear models were used to assess differences in the response to the urban environment between the two species, and which landscape factors were associated with the distributions of P. pipistrellus and P. pygmaeus. The relative prevalence of P. pygmaeus compared to P. pipistrellus was greater in urban landscapes with a higher density of rivers and lakes, whereas P. pipistrellus was frequently detected in landscapes comprising a high proportion of green space (e.g., parklands). Although P. pipistrellus is thought to be well adapted to the urban landscape, we found a strong negative response to urbanization at a relatively local scale (1 km), whilst P. pygmaeus was detected more regularly in wooded urban landscapes containing freshwater. These results show differential habitat use at a landscape scale of two morphologically similar species, indicating that cryptic species may respond differently to anthropogenic disturbance. Even species considered relatively common and well adapted to the urban landscape may respond negatively to the built environment highlighting the future challenges involved in maintaining biodiversity within an increasingly urbanized

  14. Cryptic trace-element alteration of Anorthosite, Stillwater complex, Montana

    USGS Publications Warehouse

    Czamanske, G.K.; Loferski, P.J.


    Evidence of cryptic alteration and correlations among K, Ba, and LREE concentrations indicate that a post-cumulus, low-density aqueous fluid phase significantly modified the trace-element contents of samples from Anorthosite zones I and II of the Stillwater Complex, Montana. Concentrations of Ba, Ca, Co, Cr, Cu, Fe, Hf, K, Li, Mg, Mn, Na, Ni, Sc, Sr, Th, Zn, and the rare-earth elements (REE) were measured in whole rocks and plagioclase separates from five traverses across the two main plagioclase cumulate (anorthosite) zones and the contiguous cumulates of the Stillwater Complex in an attempt to better understand the origin and solidification of the anorthosites. However, nearly the entire observed compositional range for many trace elements can be duplicated at a single locality by discriminating between samples rich in oikocrystic pyroxene and those which are composed almost entirely of plagioclase and show anhedral-granular texture. Plagioclase separates with high trace-element contents were obtained from the pyroxene-poor samples, for which maps of K concentration show plagioclase grains to contain numerous fractures hosting a fine-grained, K-rich phase, presumed to be sericite. Secondary processes in layered intrusions have the potential to cause cryptic disturbance, and the utmost care must be taken to ensure that samples provide information about primary processes. Although plagioclase from Anorthosite zones I and II shows significant compositional variation, there are no systematic changes in the major- or trace-element compositions of plagioclase over as much as 630 m of anorthosite thickness or 18 km of strike length. Plagioclase in the two major anorthosite zones shows little distinction in trace-element concentrations from plagioclase in the cumulates immediately below, between, and above these zones.

  15. Differential responses of cryptic bat species to the urban landscape.


    Lintott, Paul R; Barlow, Kate; Bunnefeld, Nils; Briggs, Philip; Gajas Roig, Clara; Park, Kirsty J


    Urbanization is a key global driver in the modification of land use and has been linked to population declines even in widespread and relatively common species. Cities comprise a complex assortment of habitat types yet we know relatively little about the effects of their composition and spatial configuration on species distribution. Although many bat species exploit human resources, the majority of species are negatively impacted by urbanization. Here, we use data from the National Bat Monitoring Programme, a long-running citizen science scheme, to assess how two cryptic European bat species respond to the urban landscape. A total of 124 × 1 km(2) sites throughout Britain were surveyed. The landscape surrounding each site was mapped and classified into discrete biotope types (e.g., woodland). Generalized linear models were used to assess differences in the response to the urban environment between the two species, and which landscape factors were associated with the distributions of P. pipistrellus and P. pygmaeus. The relative prevalence of P. pygmaeus compared to P. pipistrellus was greater in urban landscapes with a higher density of rivers and lakes, whereas P. pipistrellus was frequently detected in landscapes comprising a high proportion of green space (e.g., parklands). Although P. pipistrellus is thought to be well adapted to the urban landscape, we found a strong negative response to urbanization at a relatively local scale (1 km), whilst P. pygmaeus was detected more regularly in wooded urban landscapes containing freshwater. These results show differential habitat use at a landscape scale of two morphologically similar species, indicating that cryptic species may respond differently to anthropogenic disturbance. Even species considered relatively common and well adapted to the urban landscape may respond negatively to the built environment highlighting the future challenges involved in maintaining biodiversity within an increasingly urbanized

  16. Assemblies of Conformal Tanks

    NASA Technical Reports Server (NTRS)

    DeLay, Tom


    Assemblies of tanks having shapes that conform to each other and/or conform to other proximate objects have been investigated for use in storing fuels and oxidizers in small available spaces in upper stages of spacecraft. Such assemblies might also prove useful in aircraft, automobiles, boats, and other terrestrial vehicles in which space available for tanks is limited. The basic concept of using conformal tanks to maximize the utilization of limited space is not new in itself: for example, conformal tanks are used in some automobiles to store windshield -washer liquid and coolant that overflows from radiators. The novelty of the present development lies in the concept of an assembly of smaller conformal tanks, as distinguished from a single larger conformal tank. In an assembly of smaller tanks, it would be possible to store different liquids in different tanks. Even if the same liquid were stored in all the tanks, the assembly would offer an advantage by reducing the mechanical disturbance caused by sloshing of fuel in a single larger tank: indeed, the requirement to reduce sloshing is critical in some applications. The figure shows a prototype assembly of conformal tanks. Each tank was fabricated by (1) copper plating a wax tank mandrel to form a liner and (2) wrapping and curing layers of graphite/epoxy composite to form a shell supporting the liner. In this case, the conformal tank surfaces are flat ones where they come in contact with the adjacent tanks. A band of fibers around the outside binds the tanks together tightly in the assembly, which has a quasi-toroidal shape. For proper functioning, it would be necessary to maintain equal pressure in all the tanks.

  17. Unexpectedly High Levels of Cryptic Diversity Uncovered by a Complete DNA Barcoding of Reptiles of the Socotra Archipelago.


    Vasconcelos, Raquel; Montero-Mendieta, Santiago; Simó-Riudalbas, Marc; Sindaco, Roberto; Santos, Xavier; Fasola, Mauro; Llorente, Gustavo; Razzetti, Edoardo; Carranza, Salvador


    Few DNA barcoding studies of squamate reptiles have been conducted. Due to the significance of the Socotra Archipelago (a UNESCO Natural World Heritage site and a biodiversity hotspot) and the conservation interest of its reptile fauna (94% endemics), we performed the most comprehensive DNA barcoding study on an island group to date to test its applicability to specimen identification and species discovery. Reptiles constitute Socotra's most important vertebrate fauna, yet their taxonomy remains under-studied. We successfully DNA-barcoded 380 individuals of all 31 presently recognized species. The specimen identification success rate is moderate to high, and almost all species presented local barcoding gaps. The unexpected high levels of intra-specific variability found within some species suggest cryptic diversity. Species richness may be under-estimated by 13.8-54.4%. This has implications in the species' ranges and conservation status that should be considered for conservation planning. Other phylogenetic studies using mitochondrial and nuclear markers are congruent with our results. We conclude that, despite its reduced length (663 base pairs), cytochrome c oxidase 1, COI, is very useful for specimen identification and for detecting intra-specific diversity, and has a good phylogenetic signal. We recommend DNA barcoding to be applied to other biodiversity hotspots for quickly and cost-efficiently flagging species discovery, preferentially incorporated into an integrative taxonomic framework.

  18. Unexpectedly High Levels of Cryptic Diversity Uncovered by a Complete DNA Barcoding of Reptiles of the Socotra Archipelago

    PubMed Central

    Simó-Riudalbas, Marc; Sindaco, Roberto; Santos, Xavier; Fasola, Mauro; Llorente, Gustavo; Razzetti, Edoardo; Carranza, Salvador


    Few DNA barcoding studies of squamate reptiles have been conducted. Due to the significance of the Socotra Archipelago (a UNESCO Natural World Heritage site and a biodiversity hotspot) and the conservation interest of its reptile fauna (94% endemics), we performed the most comprehensive DNA barcoding study on an island group to date to test its applicability to specimen identification and species discovery. Reptiles constitute Socotra’s most important vertebrate fauna, yet their taxonomy remains under-studied. We successfully DNA-barcoded 380 individuals of all 31 presently recognized species. The specimen identification success rate is moderate to high, and almost all species presented local barcoding gaps. The unexpected high levels of intra-specific variability found within some species suggest cryptic diversity. Species richness may be under-estimated by 13.8–54.4%. This has implications in the species’ ranges and conservation status that should be considered for conservation planning. Other phylogenetic studies using mitochondrial and nuclear markers are congruent with our results. We conclude that, despite its reduced length (663 base pairs), cytochrome c oxidase 1, COI, is very useful for specimen identification and for detecting intra-specific diversity, and has a good phylogenetic signal. We recommend DNA barcoding to be applied to other biodiversity hotspots for quickly and cost-efficiently flagging species discovery, preferentially incorporated into an integrative taxonomic framework. PMID:26930572

  19. Unexpectedly High Levels of Cryptic Diversity Uncovered by a Complete DNA Barcoding of Reptiles of the Socotra Archipelago.


    Vasconcelos, Raquel; Montero-Mendieta, Santiago; Simó-Riudalbas, Marc; Sindaco, Roberto; Santos, Xavier; Fasola, Mauro; Llorente, Gustavo; Razzetti, Edoardo; Carranza, Salvador


    Few DNA barcoding studies of squamate reptiles have been conducted. Due to the significance of the Socotra Archipelago (a UNESCO Natural World Heritage site and a biodiversity hotspot) and the conservation interest of its reptile fauna (94% endemics), we performed the most comprehensive DNA barcoding study on an island group to date to test its applicability to specimen identification and species discovery. Reptiles constitute Socotra's most important vertebrate fauna, yet their taxonomy remains under-studied. We successfully DNA-barcoded 380 individuals of all 31 presently recognized species. The specimen identification success rate is moderate to high, and almost all species presented local barcoding gaps. The unexpected high levels of intra-specific variability found within some species suggest cryptic diversity. Species richness may be under-estimated by 13.8-54.4%. This has implications in the species' ranges and conservation status that should be considered for conservation planning. Other phylogenetic studies using mitochondrial and nuclear markers are congruent with our results. We conclude that, despite its reduced length (663 base pairs), cytochrome c oxidase 1, COI, is very useful for specimen identification and for detecting intra-specific diversity, and has a good phylogenetic signal. We recommend DNA barcoding to be applied to other biodiversity hotspots for quickly and cost-efficiently flagging species discovery, preferentially incorporated into an integrative taxonomic framework. PMID:26930572

  20. Prone Whole-Breast Irradiation Using Three-Dimensional Conformal Radiotherapy in Women Undergoing Breast Conservation for Early Disease Yields High Rates of Excellent to Good Cosmetic Outcomes in Patients With Large and/or Pendulous Breasts

    SciTech Connect

    Bergom, Carmen; Kelly, Tracy; Morrow, Natalya; Wilson, J. Frank; Walker, Alonzo; Xiang Qun; Ahn, Kwang Woo; White, Julia


    Purpose: To report our institution's experience using prone positioning for three-dimensional conformal radiotherapy (3D-CRT) to deliver post-lumpectomy whole breast irradiation (WBI) in a cohort of women with large and/or pendulous breasts, to determine the rate of acute and late toxicities and, more specifically, cosmetic outcomes. We hypothesized that using 3D-CRT for WBI in the prone position would reduce or eliminate patient and breast size as negative prognostic indicators for toxicities associated with WBI. Methods and Materials: From 1998 to 2006, 110 cases were treated with prone WBI using 3D-CRT. The lumpectomy, breast target volumes, heart, and lung were contoured on all computed tomography scans. A dose of 45-50 Gy was prescribed to the breast volume using standard fractionation schemes. The planning goals were {>=}95% of prescription to 95% of the breast volume, and 100% of boost dose to 95% of lumpectomy planning target volume. Toxicities and cosmesis were prospectively scored using the Common Terminology Criteria for Adverse Effects Version 3.0 and the Harvard Scale. The median follow-up was 40 months. Results: The median body mass index (BMI) was 33.6 kg/m{sup 2}, and median breast volume was 1396 cm{sup 3}. The worst toxicity encountered during radiation was Grade 3 dermatitis in 5% of our patient population. Moist desquamation occurred in 16% of patients, with only 2% of patients with moist desquamation outside the inframammary/axillary folds. Eleven percent of patients had Grade {>=}2 late toxicities, including Grade 3 induration/fibrosis in 2%. Excellent to good cosmesis was achieved in 89%. Higher BMI was associated with moist desquamation and breast pain, but BMI and breast volume did not impact fibrosis or excellent to good cosmesis. Conclusion: In patients with higher BMI and/or large-pendulous breasts, delivering prone WBI using 3D-CRT results in favorable toxicity profiles and high excellent to good cosmesis rates. Higher BMI was

  1. Variability in the South Seasonal Cryptic Terrain in MY 28-31 as Observed by MARCI

    NASA Astrophysics Data System (ADS)

    Calvin, W. M.; Cantor, B. C.; James, P. B.


    New processing techniques for MARCI daily polar mosaics show abundant variation in small scale features of the cryptic terrain. The general outline is similar in MY28-31, but local variation occurs in both bright and dark patches.

  2. Shock Condition Forensics and Cryptic Phase Transformations from Crystallographic Orientation Relationships in Zircon

    NASA Astrophysics Data System (ADS)

    Timms, N. E.; Erickson, T. M.; Cavosie, A. J.; Pearce, M. A.; Reddy, S. M.; Zanetti, M.; Tohver, E.; Schmieder, M.; Nemchin, A. A.; Wittmann, A.


    We present an approach to constrain pressure and temperature conditions during impact events involving identification of cryptic histories of phase transformations from orientation relationships in shocked zircon, linked to new P-T phase diagrams.

  3. How hidden are hidden processes? A primer on crypticity and entropy convergence

    NASA Astrophysics Data System (ADS)

    Mahoney, John R.; Ellison, Christopher J.; James, Ryan G.; Crutchfield, James P.


    We investigate a stationary process's crypticity—a measure of the difference between its hidden state information and its observed information—using the causal states of computational mechanics. Here, we motivate crypticity and cryptic order as physically meaningful quantities that monitor how hidden a hidden process is. This is done by recasting previous results on the convergence of block entropy and block-state entropy in a geometric setting, one that is more intuitive and that leads to a number of new results. For example, we connect crypticity to how an observer synchronizes to a process. We show that the block-causal-state entropy is a convex function of block length. We give a complete analysis of spin chains. We present a classification scheme that surveys stationary processes in terms of their possible cryptic and Markov orders. We illustrate related entropy convergence behaviors using a new form of foliated information diagram. Finally, along the way, we provide a variety of interpretations of crypticity and cryptic order to establish their naturalness and pervasiveness. This is also a first step in developing applications in spatially extended and network dynamical systems.

  4. Tracing shifts of oceanic fronts using the cryptic diversity of the planktonic foraminifera Globorotalia inflata

    NASA Astrophysics Data System (ADS)

    Morard, Raphaël.; Reinelt, Melanie; Chiessi, Cristiano M.; Groeneveld, Jeroen; Kucera, Michal


    The use of planktonic foraminifera in paleoceanographic studies relies on the assumption that morphospecies represent biological species with ecological preferences that are stable through time and space. However, genetic surveys unveiled a considerable level of diversity in most morphospecies of planktonic foraminifera. This diversity is significant for paleoceanographic applications because cryptic species were shown to display distinct ecological preferences that could potentially help refine paleoceanographic proxies. Subtle morphological differences between cryptic species of planktonic foraminifera have been reported, but so far, their applicability within paleoceanographic studies remains largely unexplored. Here we show how information on genetic diversity can be transferred to paleoceanography using Globorotalia inflata as a case study. The two cryptic species of G. inflata are separated by the Brazil-Malvinas Confluence (BMC), a major oceanographic feature in the South Atlantic. Based on this observation, we developed a morphological model of cryptic species detection in core top material. The application of the cryptic species detection model to Holocene samples implies latitudinal oscillations in the position of the confluence that are largely consistent with reconstructions obtained from stable isotope data. We show that the occurrence of cryptic species in G. inflata can be detected in the fossil record and used to trace the migration of the BMC. Since a similar degree of morphological separation as in G. inflata has been reported from other species of planktonic foraminifera, the approach presented in this study can potentially yield a wealth of new paleoceanographical proxies.

  5. Reproductive isolation and patterns of genetic differentiation in a cryptic butterfly species complex

    PubMed Central

    Dincâ, V; Wiklund, C; Lukhtanov, V A; Kodandaramaiah, U; Norén, K; Dapporto, L; Wahlberg, N; Vila, R; Friberg, M


    Molecular studies of natural populations are often designed to detect and categorize hidden layers of cryptic diversity, and an emerging pattern suggests that cryptic species are more common and more widely distributed than previously thought. However, these studies are often decoupled from ecological and behavioural studies of species divergence. Thus, the mechanisms by which the cryptic diversity is distributed and maintained across large spatial scales are often unknown. In 1988, it was discovered that the common Eurasian Wood White butterfly consisted of two species (Leptidea sinapis and Leptidea reali), and the pair became an emerging model for the study of speciation and chromosomal evolution. In 2011, the existence of a third cryptic species (Leptidea juvernica) was proposed. This unexpected discovery raises questions about the mechanisms preventing gene flow and about the potential existence of additional species hidden in the complex. Here, we compare patterns of genetic divergence across western Eurasia in an extensive data set of mitochondrial and nuclear DNA sequences with behavioural data on inter- and intraspecific reproductive isolation in courtship experiments. We show that three species exist in accordance with both the phylogenetic and biological species concepts and that additional hidden diversity is unlikely to occur in Europe. The Leptidea species are now the best studied cryptic complex of butterflies in Europe and a promising model system for understanding the formation of cryptic species and the roles of local processes, colonization patterns and heterospecific interactions for ecological and evolutionary divergence. PMID:23909947

  6. Are cryptic species a problem for parasitological biological tagging for stock identification of aquatic organisms?


    Bray, Rodney A; Cribb, Thomas H


    The effective use of biological tags in stock assessment relies on the reliable identification of the parasites concerned. This may be compromised if cryptic species are not recognized. Here we review what is known about cryptic species in aquatic hosts and its potential importance in this respect. Although strictly cryptic species may be considered as species which can be distinguished only by molecular data, we accept the far looser but more practical definition of species that cannot be readily distinguished morphologically. Cryptic species appear to have been identified most frequently as occurring in separate host species; this is heartening in that this has no significant impact on tagging studies. But cryptic species have occasionally been identified in single hosts sympatrically and are relatively common in geographically distinct populations of the same host species. Ignorance of both kinds of occurrences has the capacity to undermine the reliability of tagging analysis. We review in detail what is known of intra- and interspecific genetic variation over geographical ranges in the trematodes, based on recent molecular studies. Although the existence of cryptic species and evidence of intraspecific variability may appear daunting, we suspect that these complexities will add, and indeed have already added, to the sophistication of the information that can be derived from tagging studies.

  7. Volatile compounds in cryptic species of the Aneura pinguis complex and Aneura maxima (Marchantiophyta, Metzgeriidae).


    Wawrzyniak, Rafał; Wasiak, Wiesław; Bączkiewicz, Alina; Buczkowska, Katarzyna


    Aneura pinguis is one of the liverwort species complexes that consist of several cryptic species. Ten samples collected from different regions in Poland are in the focus of our research. Eight of the A. pinguis complex belonging to four cryptic species (A, B, C, E) and two samples of closely related species Aneura maxima were tested for the composition of volatile compounds. The HS-SPME technique coupled to GC/FID and GC/MS analysis has been applied. The fiber coated with DVB/CAR/PDMS has been used. The results of the present study, revealed the qualitative and quantitative differences in the composition of the volatile compounds between the studied species. Mainly they are from the group of sesquiterpenoids, oxygenated sesquiterpenoids and aliphatic hydrocarbons. The statistical methods (CA and PCA) showed that detected volatile compounds allow to distinguish cryptic species of A. pinguis. All examined cryptic species of the A. pinguis complex differ from A. maxima. Species A and E of A. pinguis, in CA and PCA, form separate clusters remote from two remaining cryptic species of A. pinguis (B and C) and A. maxima. Relationship between the cryptic species appeared from the chemical studies are in accordance with that revealed on the basis of DNA sequences.

  8. The Cryptic dsdA Gene Encodes a Functional D-Serine Dehydratase in Pseudomonas aeruginosa PAO1.


    Li, Guoqing; Lu, Chung-Dar


    D-Serine, an important neurotransmitter, also contributes to bacterial adaptation and virulence in humans. It was reported that Pseudomonas aeruginosa PAO1 can grow on D-serine as the sole nitrogen source, and growth was severely reduced in the dadA mutant devoid of the D-alanine dehydrogenase with broad substrate specificity. In this study, the dsdA gene (PA3357) encoding a putative D-serine dehydratase was subjected to further characterization. Growth on D-serine as the sole source of nitrogen was retained in the ∆dsdA mutant and was abolished completely in the ∆dadA and ∆dadA-∆dsdA mutants. However, when complemented by dsdA on a plasmid, the double mutant was able to grow on D-serine as the sole source of carbon and nitrogen, supporting the proposed biochemical function of DsdA in the conversion of D-serine into pyruvate and ammonia. Among D- and L-amino acids tested, only D-serine and D-threonine could serve as the substrates of DsdA, and the Km of DsdA with D-serine was calculated to be 330 μM. Comparative genomics revealed that this cryptic dsdA gene was highly conserved in strains of P. aeruginosa, and that most strains of Pseudomonas putida possess putative dsdCAX genes encoding a transcriptional regulator DsdC and a D-serine transporter DsdX as in enteric bacteria. In conclusion, this study supports the presence of a cryptic dsdA gene encoding a functional D-serine dehydratase in P. aeruginosa, and the absence of dsdA expression in response to exogenous D-serine might be due to the loss of regulatory elements for gene activation during evolution. PMID:26957519

  9. The Cryptic dsdA Gene Encodes a Functional D-Serine Dehydratase in Pseudomonas aeruginosa PAO1.


    Li, Guoqing; Lu, Chung-Dar


    D-Serine, an important neurotransmitter, also contributes to bacterial adaptation and virulence in humans. It was reported that Pseudomonas aeruginosa PAO1 can grow on D-serine as the sole nitrogen source, and growth was severely reduced in the dadA mutant devoid of the D-alanine dehydrogenase with broad substrate specificity. In this study, the dsdA gene (PA3357) encoding a putative D-serine dehydratase was subjected to further characterization. Growth on D-serine as the sole source of nitrogen was retained in the ∆dsdA mutant and was abolished completely in the ∆dadA and ∆dadA-∆dsdA mutants. However, when complemented by dsdA on a plasmid, the double mutant was able to grow on D-serine as the sole source of carbon and nitrogen, supporting the proposed biochemical function of DsdA in the conversion of D-serine into pyruvate and ammonia. Among D- and L-amino acids tested, only D-serine and D-threonine could serve as the substrates of DsdA, and the Km of DsdA with D-serine was calculated to be 330 μM. Comparative genomics revealed that this cryptic dsdA gene was highly conserved in strains of P. aeruginosa, and that most strains of Pseudomonas putida possess putative dsdCAX genes encoding a transcriptional regulator DsdC and a D-serine transporter DsdX as in enteric bacteria. In conclusion, this study supports the presence of a cryptic dsdA gene encoding a functional D-serine dehydratase in P. aeruginosa, and the absence of dsdA expression in response to exogenous D-serine might be due to the loss of regulatory elements for gene activation during evolution.

  10. Resolving cryptic species complexes of major tephritid pests

    PubMed Central

    Hendrichs, Jorge; Vera, M. Teresa; De Meyer, Marc; Clarke, Anthony R.


    Abstract An FAO/IAEA Co-ordinated Research Project (CRP) on “Resolution of Cryptic Species Complexes of Tephritid Pests to Overcome Constraints to SIT Application and International Trade” was conducted from 2010 to 2015. As captured in the CRP title, the objective was to undertake targeted research into the systematics and diagnostics of taxonomically challenging fruit fly groups of economic importance. The scientific output was the accurate alignment of biological species with taxonomic names; which led to the applied outcome of assisting FAO and IAEA Member States in overcoming technical constraints to the application of the Sterile Insect Technique (SIT) against pest fruit flies and the facilitation of international agricultural trade. Close to 50 researchers from over 20 countries participated in the CRP, using coordinated, multidisciplinary research to address, within an integrative taxonomic framework, cryptic species complexes of major tephritid pests. The following progress was made for the four complexes selected and studied: Anastrepha fraterculus complex – Eight morphotypes and their geographic and ecological distributions in Latin America were defined. The morphotypes can be considered as distinct biological species on the basis of differences in karyotype, sexual incompatibility, post-mating isolation, cuticular hydrocarbon, pheromone, and molecular analyses. Discriminative taxonomic tools using linear and geometric morphometrics of both adult and larval morphology were developed for this complex. Bactrocera dorsalis complex – Based on genetic, cytogenetic, pheromonal, morphometric, and behavioural data, which showed no or only minor variation between the Asian/African pest fruit flies Bactrocera dorsalis, Bactrocera papayae, Bactrocera philippinensis and Bactrocera invadens, the latter three species were synonymized with Bactrocera dorsalis. Of the five target pest taxa studied, only Bactrocera dorsalis and Bactrocera carambolae remain as

  11. Resolving cryptic species complexes of major tephritid pests.


    Hendrichs, Jorge; Vera, M Teresa; De Meyer, Marc; Clarke, Anthony R


    An FAO/IAEA Co-ordinated Research Project (CRP) on "Resolution of Cryptic Species Complexes of Tephritid Pests to Overcome Constraints to SIT Application and International Trade" was conducted from 2010 to 2015. As captured in the CRP title, the objective was to undertake targeted research into the systematics and diagnostics of taxonomically challenging fruit fly groups of economic importance. The scientific output was the accurate alignment of biological species with taxonomic names; which led to the applied outcome of assisting FAO and IAEA Member States in overcoming technical constraints to the application of the Sterile Insect Technique (SIT) against pest fruit flies and the facilitation of international agricultural trade. Close to 50 researchers from over 20 countries participated in the CRP, using coordinated, multidisciplinary research to address, within an integrative taxonomic framework, cryptic species complexes of major tephritid pests. The following progress was made for the four complexes selected and studied: Anastrepha fraterculus complex - Eight morphotypes and their geographic and ecological distributions in Latin America were defined. The morphotypes can be considered as distinct biological species on the basis of differences in karyotype, sexual incompatibility, post-mating isolation, cuticular hydrocarbon, pheromone, and molecular analyses. Discriminative taxonomic tools using linear and geometric morphometrics of both adult and larval morphology were developed for this complex. Bactrocera dorsalis complex - Based on genetic, cytogenetic, pheromonal, morphometric, and behavioural data, which showed no or only minor variation between the Asian/African pest fruit flies Bactrocera dorsalis, Bactrocera papayae, Bactrocera philippinensis and Bactrocera invadens, the latter three species were synonymized with Bactrocera dorsalis. Of the five target pest taxa studied, only Bactrocera dorsalis and Bactrocera carambolae remain as scientifically valid

  12. Charged conformal Killing spinors

    SciTech Connect

    Lischewski, Andree


    We study the twistor equation on pseudo-Riemannian Spin{sup c}-manifolds whose solutions we call charged conformal Killing spinors (CCKSs). We derive several integrability conditions for the existence of CCKS and study their relations to spinor bilinears. A construction principle for Lorentzian manifolds admitting CCKS with nontrivial charge starting from CR-geometry is presented. We obtain a partial classification result in the Lorentzian case under the additional assumption that the associated Dirac current is normal conformal and complete the classification of manifolds admitting CCKS in all dimensions and signatures ≤5 which has recently been initiated in the study of supersymmetric field theories on curved space.

  13. Early Miocene origin and cryptic diversification of South American salamanders

    PubMed Central


    Background The currently recognized species richness of South American salamanders is surprisingly low compared to North and Central America. In part, this low richness may be due to the salamanders being a recent arrival to South America. Additionally, the number of South American salamander species may be underestimated because of cryptic diversity. The aims of our present study were to infer evolutionary relationships, lineage diversity, and timing of divergence of the South American Bolitoglossa using mitochondrial and nuclear sequence data from specimens primarily from localities in the Andes and upper Amazon Basin. We also estimated time of colonization of South America to test whether it is consistent with arrival via the Panamanian Isthmus, or land bridge connection, at its traditionally assumed age of 3 million years. Results Divergence time estimates suggest that Bolitoglossa arrived in South America from Central America by at least the Early Miocene, ca. 23.6 MYA (95% HPD 15.9-30.3 MYA), and subsequently diversified. South American salamanders of the genus Bolitoglossa show strong phylogeographic structure at fine geographic scales and deep divergences at the mitochondrial gene cytochrome b (Cytb) and high diversity at the nuclear recombination activating gene-1 (Rag1). Species often contain multiple genetically divergent lineages that are occasionally geographically overlapping. Single specimens from two southeastern localities in Ecuador are sister to the equatoriana-peruviana clade and genetically distinct from all other species investigated to date. Another single exemplar from the Andes of northwestern Ecuador is highly divergent from all other specimens and is sister to all newly studied samples. Nevertheless, all sampled species of South American Bolitoglossa are members of a single clade that is one of several constituting the subgenus Eladinea, one of seven subgenera in this large genus. Conclusions The ancestors of South American salamanders

  14. Morphological and molecular evidence for cryptic species of springsnails [genus Pseudamnicola ( Corrosella) (Mollusca, Caenogastropoda, Hydrobiidae)

    PubMed Central

    Delicado, Diana; Ramos, Marian A.


    Abstract Several Pseudamnicola (Corrosella) populations of the central and eastern Iberian Peninsula have been ascribed to Pseudamnicola (Corrosella) astieri (Dupuy, 1851), though recent evidence demonstrates the species could be endemic to the departments of Var and Alpes-Maritimes in France. Through the identification of cryptic species using a combined morphological and phylogenetic approach, this paper provides a detailed morphological description of Pseudamnicola (Corrosella) astieri, clarifying its taxonomic boundaries and confirming it as a French endemic. In parallel, by comparing Pseudamnicola (Corrosella) populations from the provinces of Castellón and Valencia in Eastern Spain, it was observed that rather than Pseudamnicola (Corrosella) astieri they represented a new species here described as Pseudamnicola (Corrosella) hauffei sp. n. Among other characters, the two species show marked differences in shell shape, male and female genital systems, radular formula and concentration of the nervous system. Pseudamnicola (Corrosella) hauffei sp. n. was also compared morphologically to another two Pseudamnicola (Corrosella) species living in nearby areas [Pseudamnicola (Corrosella) hinzi Boeters, 1986 and Pseudamnicola (Corrosella) navasiana (Fagot, 1907)], molecularly to Pseudamnicola (Corrosella) falkneri (Boeters, 1970), the type species of the subgenus, and to the rest of the Pseudamnicola (Corrosella) species described so far. Morphological differentiation between the species is supported by a genetic divergence of 7.4% inferred from a partial sequence (658 bp) of the mitochondrial gene cytochrome c oxidase subunit I (COI). On the basis of an average 8% (5.39 to 11.15%) divergence estimated for the COI gene in other Pseudamnicola (Corrosella) species reported in GenBank, the existence of two specific entities is here proposed, which will have impact on conservation policies both in France and in Spain. PMID:22639531

  15. Color perception influences microhabitat selection of refugia and affects monitoring success for a cryptic anuran species.


    Cohen, Bradley S; MacKenzie, Michelle L; Maerz, John C; Farrell, Christopher B; Castleberry, Steven B


    Perceptual-biases are important for understanding an animal's natural history, identifying potential ecological traps, and for developing effective means to monitor individuals and populations. Despite research demonstrating anurans having a positive phototactic response towards blue colors, we do not yet understand if color cues are used functionally beyond sexual selection. The aim of our study was to determine if color cues are used in selecting microhabitat, and if anuran's blue-positive phototactic response could increase selection of artificial PVC refugia used to monitor cryptic camouflaging anuran species. We captured 32 Cope's Gray Treefrogs and placed them in mesh enclosures with three PVC tubes painted blue, brown, and white. Concurrently, we placed blue, brown, or unpainted white PVC tubes in stratified arrays around a treefrog breeding pond, and counted the number of occasions treefrogs occupied different colored PVC tubes. In the confined choice experiment, treefrogs selected blue tubes (48.3%) significantly more often than brown (28.5%) or white (23.2%) tubes. Our field experiment mirrored these findings (52.0% of capture events in blue, 29.0% in brown, and 19.0% in unpainted white tubes). Our results suggest color influences Cope's Gray Treefrog microhabitat selection, and they utilize color vision when choosing refugia. We demonstrate simple, small changes based on perceptual-biases can induce behaviors that may in turn have large impacts on sampling techniques used in monitoring and inventorying. Incorporating non-traditional physiological measures into animal inventorying and monitoring programs can be used in the future to improve conservation efforts. PMID:27235736

  16. From Cryptic Toward Canonical Pre-mRNA Splicing in Pompe Disease: a Pipeline for the Development of Antisense Oligonucleotides.


    Bergsma, Atze J; In 't Groen, Stijn Lm; Verheijen, Frans W; van der Ploeg, Ans T; Pijnappel, Wwm Pim


    While 9% of human pathogenic variants have an established effect on pre-mRNA splicing, it is suspected that an additional 20% of otherwise classified variants also affect splicing. Aberrant splicing includes disruption of splice sites or regulatory elements, or creation or strengthening of cryptic splice sites. For the majority of variants, it is poorly understood to what extent and how these may affect splicing. We have identified cryptic splicing in an unbiased manner. Three types of cryptic splicing were analyzed in the context of pathogenic variants in the acid α-glucosidase gene causing Pompe disease. These involved newly formed deep intronic or exonic cryptic splice sites, and a natural cryptic splice that was utilized due to weakening of a canonical splice site. Antisense oligonucleotides that targeted the identified cryptic splice sites repressed cryptic splicing at the expense of canonical splicing in all three cases, as shown by reverse-transcriptase-quantitative polymerase chain reaction analysis and by enhancement of acid α-glucosidase enzymatic activity. This argues for a competition model for available splice sites, including intact or weakened canonical sites and natural or newly formed cryptic sites. The pipeline described here can detect cryptic splicing and correct canonical splicing using antisense oligonucleotides to restore the gene defect. PMID:27623443

  17. From Cryptic Toward Canonical Pre-mRNA Splicing in Pompe Disease: a Pipeline for the Development of Antisense Oligonucleotides

    PubMed Central

    Bergsma, Atze J; in ‘t Groen, Stijn LM; Verheijen, Frans W; van der Ploeg, Ans T; Pijnappel, WWM Pim


    While 9% of human pathogenic variants have an established effect on pre-mRNA splicing, it is suspected that an additional 20% of otherwise classified variants also affect splicing. Aberrant splicing includes disruption of splice sites or regulatory elements, or creation or strengthening of cryptic splice sites. For the majority of variants, it is poorly understood to what extent and how these may affect splicing. We have identified cryptic splicing in an unbiased manner. Three types of cryptic splicing were analyzed in the context of pathogenic variants in the acid α-glucosidase gene causing Pompe disease. These involved newly formed deep intronic or exonic cryptic splice sites, and a natural cryptic splice that was utilized due to weakening of a canonical splice site. Antisense oligonucleotides that targeted the identified cryptic splice sites repressed cryptic splicing at the expense of canonical splicing in all three cases, as shown by reverse-transcriptase-quantitative polymerase chain reaction analysis and by enhancement of acid α-glucosidase enzymatic activity. This argues for a competition model for available splice sites, including intact or weakened canonical sites and natural or newly formed cryptic sites. The pipeline described here can detect cryptic splicing and correct canonical splicing using antisense oligonucleotides to restore the gene defect. PMID:27623443

  18. Extended conformal field theories

    NASA Astrophysics Data System (ADS)

    Taormina, Anne


    Some extended conformal field theories are briefly reviewed. They illustrate how non minimal models of the Virasoro algebra (c≥1) can become minimal with respect to a larger algebra. The accent is put on N-extended superconformal algebras, which are relevant in superstring compactification.

  19. Conservative management.


    Kruis, W; Leifeld, L; Pfützer, R


    Treatment of diverticulitis comprises at least two options: conservative or surgical management. There is a recent trend to limit surgical treatment of acute diverticulitis and to favor conservative management. This review addresses general aspects of conservative patient care with special focus on the treatment of patients with a first attack of diverticulitis. The presentation does not include a discussion of specific drugs which is given in other sections of this issue.

  20. Conformational changes in biopolymers

    NASA Astrophysics Data System (ADS)

    Ivanov, Vassili


    Biopolymer conformational changes are involved in many biological processes. This thesis summarizes some theoretical and experimental approaches which I have taken at UCLA to explore conformational changes in biopolymers. The reversible thermal denaturation of the DNA double helix is, perhaps, the simplest example of biopolymer conformational change. I have developed a statistical mechanics model of DNA melting with reduced degrees of freedom, which allows base stacking interaction to be taken into account and treat base pairing and stacking separately. Unlike previous models, this model describes both the unpairing and unstacking parts of the experimental melting curves and explains the observed temperature dependence of the effective thermodynamic parameters used in models of the nearest neighbor type. I developed a basic kinetic model for irreversible thermal denaturation of F-actin, which incorporates depolymerization of F-actin from the ends and breaking of F-actin fiber in the middle. The model explains the cooperativity of F-actin thermal denaturation observed by D. Pavlov et al. in differential calorimetry measurements. CG-rich DNA sequences form left-handed Z-DNA at high ionic strength or upon binding of polyvalent ions and some proteins. I studied experimentally the B-to-Z transition of the (CG)6 dodecamer. Improvement of the locally linearized model used to interpret the data gives evidence for an intermediate state in the B-to-Z transition of DNA, contrary to previous research on this subject. In the past 15 years it has become possible to study the conformational changes of biomolecules using single-molecule techniques. In collaboration with other lab members I performed a single-molecule experiment, where we monitored the displacement of a micrometer-size bead tethered to a surface by a DNA probe undergoing the conformational change. This technique allows probing of conformational changes with subnanometer accuracy. We applied the method to detect

  1. The use of photographic rates to estimate densities of tigers and other cryptic mammals: a comment on misleading conclusions

    USGS Publications Warehouse

    Jennelle, C.S.; Runge, M.C.; MacKenzie, D.I.


    The search for easy-to-use indices that substitute for direct estimation of animal density is a common theme in wildlife and conservation science, but one fraught with well-known perils (Nichols & Conroy, 1996; Yoccoz, Nichols & Boulinier, 2001; Pollock et al., 2002). To establish the utility of an index as a substitute for an estimate of density, one must: (1) demonstrate a functional relationship between the index and density that is invariant over the desired scope of inference; (2) calibrate the functional relationship by obtaining independent measures of the index and the animal density; (3) evaluate the precision of the calibration (Diefenbach et al., 1994). Carbone et al. (2001) argue that the number of camera-days per photograph is a useful index of density for large, cryptic, forest-dwelling animals, and proceed to calibrate this index for tigers (Panthera tigris). We agree that a properly calibrated index may be useful for rapid assessments in conservation planning. However, Carbone et al. (2001), who desire to use their index as a substitute for density, do not adequately address the three elements noted above. Thus, we are concerned that others may view their methods as justification for not attempting directly to estimate animal densities, without due regard for the shortcomings of their approach.

  2. Role of pleiotropy in the evolution of a cryptic developmental variation in Caenorhabditis elegans.


    Duveau, Fabien; Félix, Marie-Anne


    Robust biological systems are expected to accumulate cryptic genetic variation that does not affect the system output in standard conditions yet may play an evolutionary role once phenotypically expressed under a strong perturbation. Genetic variation that is cryptic relative to a robust trait may accumulate neutrally as it does not change the phenotype, yet it could also evolve under selection if it affects traits related to fitness in addition to its cryptic effect. Cryptic variation affecting the vulval intercellular signaling network was previously uncovered among wild isolates of Caenorhabditis elegans. Using a quantitative genetic approach, we identify a non-synonymous polymorphism of the previously uncharacterized nath-10 gene that affects the vulval phenotype when the system is sensitized with different mutations, but not in wild-type strains. nath-10 is an essential protein acetyltransferase gene and the homolog of human NAT10. The nath-10 polymorphism also presents non-cryptic effects on life history traits. The nath-10 allele carried by the N2 reference strain leads to a subtle increase in the egg laying rate and in the total number of sperm, a trait affecting the trade-off between fertility and minimal generation time in hermaphrodite individuals. We show that this allele appeared during early laboratory culture of N2, which allowed us to test whether it may have evolved under selection in this novel environment. The derived allele indeed strongly outcompetes the ancestral allele in laboratory conditions. In conclusion, we identified the molecular nature of a cryptic genetic variation and characterized its evolutionary history. These results show that cryptic genetic variation does not necessarily accumulate neutrally at the whole-organism level, but may evolve through selection for pleiotropic effects that alter fitness. In addition, cultivation in the laboratory has led to adaptive evolution of the reference strain N2 to the laboratory environment

  3. Role of Pleiotropy in the Evolution of a Cryptic Developmental Variation in Caenorhabditis elegans

    PubMed Central

    Duveau, Fabien; Félix, Marie-Anne


    Robust biological systems are expected to accumulate cryptic genetic variation that does not affect the system output in standard conditions yet may play an evolutionary role once phenotypically expressed under a strong perturbation. Genetic variation that is cryptic relative to a robust trait may accumulate neutrally as it does not change the phenotype, yet it could also evolve under selection if it affects traits related to fitness in addition to its cryptic effect. Cryptic variation affecting the vulval intercellular signaling network was previously uncovered among wild isolates of Caenorhabditis elegans. Using a quantitative genetic approach, we identify a non-synonymous polymorphism of the previously uncharacterized nath-10 gene that affects the vulval phenotype when the system is sensitized with different mutations, but not in wild-type strains. nath-10 is an essential protein acetyltransferase gene and the homolog of human NAT10. The nath-10 polymorphism also presents non-cryptic effects on life history traits. The nath-10 allele carried by the N2 reference strain leads to a subtle increase in the egg laying rate and in the total number of sperm, a trait affecting the trade-off between fertility and minimal generation time in hermaphrodite individuals. We show that this allele appeared during early laboratory culture of N2, which allowed us to test whether it may have evolved under selection in this novel environment. The derived allele indeed strongly outcompetes the ancestral allele in laboratory conditions. In conclusion, we identified the molecular nature of a cryptic genetic variation and characterized its evolutionary history. These results show that cryptic genetic variation does not necessarily accumulate neutrally at the whole-organism level, but may evolve through selection for pleiotropic effects that alter fitness. In addition, cultivation in the laboratory has led to adaptive evolution of the reference strain N2 to the laboratory environment

  4. Quantifying polypeptide conformational space: sensitivity to conformation and ensemble definition.


    Sullivan, David C; Lim, Carmay


    Quantifying the density of conformations over phase space (the conformational distribution) is needed to model important macromolecular processes such as protein folding. In this work, we quantify the conformational distribution for a simple polypeptide (N-mer polyalanine) using the cumulative distribution function (CDF), which gives the probability that two randomly selected conformations are separated by less than a "conformational" distance and whose inverse gives conformation counts as a function of conformational radius. An important finding is that the conformation counts obtained by the CDF inverse depend critically on the assignment of a conformation's distance span and the ensemble (e.g., unfolded state model): varying ensemble and conformation definition (1 --> 2 A) varies the CDF-based conformation counts for Ala(50) from 10(11) to 10(69). In particular, relatively short molecular dynamics (MD) relaxation of Ala(50)'s random-walk ensemble reduces the number of conformers from 10(55) to 10(14) (using a 1 A root-mean-square-deviation radius conformation definition) pointing to potential disconnections in comparing the results from simplified models of unfolded proteins with those from all-atom MD simulations. Explicit waters are found to roughen the landscape considerably. Under some common conformation definitions, the results herein provide (i) an upper limit to the number of accessible conformations that compose unfolded states of proteins, (ii) the optimal clustering radius/conformation radius for counting conformations for a given energy and solvent model, (iii) a means of comparing various studies, and (iv) an assessment of the applicability of random search in protein folding.

  5. Two sisters in the same dress: Heliconius cryptic species

    PubMed Central


    Background Sister species divergence and reproductive isolation commonly results from ecological adaptation. In mimetic Heliconius butterflies, shifts in colour pattern contribute to pre- and post-mating reproductive isolation and are commonly correlated with speciation. Closely related mimetic species are therefore not expected, as they should lack several important sources of reproductive isolation. Results Here we present phenotypic, behavioral and genetic evidence for the coexistence of two sympatric 'cryptic' species near Florencia in the eastern Andes of Colombia that share the same orange rayed colour pattern. These represent H. melpomene malleti and a novel taxon in the H. cydno group, here designated as novel race of Heliconius timareta, Heliconius timareta florencia. No-choice mating experiments show that these sympatric forms have strong assortative mating (≈96%) despite great similarity in colour pattern, implying enhanced divergence in pheromonal signals. Conclusion We hypothesize that these species might have resulted from recent convergence in colour pattern, perhaps facilitated by hybrid introgression of wing pattern genes. PMID:19040737

  6. Decrypting Cryptic Click Beetle Species by Analysis of Sex Pheromones.


    König, Christian; Steidle, Johannes L M; Tolasch, Till


    Despite sex pheromones being highly species specific, their use as phylogenetic characters and a tool for the verification of species status are still relatively few compared to use of morphological and molecular characters. Earlier studies revealed that within the click beetle species Idolus picipennis, two types can be separated based on pheromone composition. Gas chromatography/mass spectrometry analysis of pheromone from a third type of Idolus revealed the presence of geranyl hexanoate and geranyl octanoate in a ratio of ca. 1:9. Neryl esters and farnesyl esters, present in the glands of the other two species, are absent in this type. In field experiments, males of all three types were attracted specifically to synthetic mixtures of pheromone resembling their own females. This suggests that cross attraction among different types is unlikely and indicates that they are likely distinct species. Using the large numbers of male beetles caught in pheromone traps, morphological differences between the species were studied and an identification key derived. This study highlights the role of sex pheromones as a powerful tool in integrative taxonomy and systematics to study the phylogenetic position and evolution of taxa and to determine the taxonomic status of cryptic species.

  7. Cryptic biodiversity loss linked to global climate change

    NASA Astrophysics Data System (ADS)

    Bálint, M.; Domisch, S.; Engelhardt, C. H. M.; Haase, P.; Lehrian, S.; Sauer, J.; Theissinger, K.; Pauls, S. U.; Nowak, C.


    Global climate change (GCC) significantly affects distributional patterns of organisms, and considerable impacts on biodiversity are predicted for the next decades. Inferred effects include large-scale range shifts towards higher altitudes and latitudes, facilitation of biological invasions and species extinctions. Alterations of biotic patterns caused by GCC have usually been predicted on the scale of taxonomically recognized morphospecies. However, the effects of climate change at the most fundamental level of biodiversity--intraspecific genetic diversity--remain elusive. Here we show that the use of morphospecies-based assessments of GCC effects will result in underestimations of the true scale of biodiversity loss. Species distribution modelling and assessments of mitochondrial DNA variability in nine montane aquatic insect species in Europe indicate that future range contractions will be accompanied by severe losses of cryptic evolutionary lineages and genetic diversity within these lineages. These losses greatly exceed those at the scale of morphospecies. We also document that the extent of range reduction may be a useful proxy when predicting losses of genetic diversity. Our results demonstrate that intraspecific patterns of genetic diversity should be considered when estimating the effects of climate change on biodiversity.

  8. Introduced cryptic species of parasites exhibit different invasion pathways

    PubMed Central

    Miura, Osamu; Torchin, Mark E.; Kuris, Armand M.; Hechinger, Ryan F.; Chiba, Satoshi


    Sometimes infectious agents invade and become established in new geographic regions. Others may be introduced yet never become established because of the absence of suitable hosts in the new region. This phenomenon may be particularly true for the many parasites with complex life cycles, where various life stages require different host species. Homogenization of the world's biota through human-mediated invasions may reunite hosts and parasites, resulting in disease outbreaks in novel regions. Here we use molecular genetics to differentiate invasion pathways for two digenean trematode parasites and their exotic host, the Asian mud snail, Batillaria attramentaria. All of the snail haplotypes found in introduced populations in North America were identical to haplotypes common in the areas of Japan that provided oysters for cultivation in North America, supporting the hypothesis that the snails were introduced from Japan with seed oysters. Two cryptic trematode species were introduced to North American populations in high frequencies. We found a marked reduction of genetic variation in one of these species, suggesting it experienced a bottleneck or founder event comparable to that of the host snail. In contrast, no genetic variation was lost in the other parasite species. We hypothesize that this parasite was and is dispersed naturally by migratory shorebirds and was able to establish only after the host snail, B. attramentaria, was introduced to North America. Evaluation of the nature of invasion pathways and postinvasion consequences will aid mitigation of spreading diseases of humans, livestock, and wildlife in an increasingly globalized world. PMID:17179044

  9. Cryptic adaptive radiation in tropical forest trees in New Caledonia.


    Pillon, Yohan; Hopkins, Helen C F; Rigault, Frédéric; Jaffré, Tanguy; Stacy, Elizabeth A


    The causes of the species richness of tropical trees are poorly understood, in particular the roles of ecological factors such as soil composition. The nickel(Ni)-hyperaccumulating tree genus Geissois (Cunoniaceae) from the South-west Pacific was chosen as a model of diversification on different substrates. Here, we investigated the leaf element compositions, spatial distributions and phylogeny of all species of Geissois occurring on New Caledonia. We found that New Caledonian Geissois descended from a single colonist and diversified relatively quickly into 13 species. Species on ultramafic and nonultramafic substrates showed contrasting patterns of leaf element composition and range overlap. Those on nonultramafic substrates were largely sympatric but had distinct leaf element compositions. By contrast, species on ultramafic substrates showed similar leaf element composition, but occurred in many cases exclusively in allopatry. Further, earlier work showed that at least three out of these seven species use different molecules to bind Ni. Geissois qualifies as a cryptic adaptive radiation, and may be the first such example in a lineage of tropical forest trees. Variation in biochemical strategies for coping with both typical and adverse soil conditions may help to explain the diversification and coexistence of tropical forest trees on similar soil types.

  10. Copepod Behavior in ``Cryptic Blooms'' of Toxic Algae

    NASA Astrophysics Data System (ADS)

    True, A. C.; Webster, D. R.; Weissburg, M. J.; Yen, J.


    Copepods,Acartia tonsa and Temora longicornis, were exposed to thin layers of exudates from the toxic dinoflagellate Karenia brevis (1 - 10,000 cells/mL) (i.e. models of ``cryptic blooms'' of toxic phytoplankton). Planar laser-induced fluorescence (PLIF) was used to quantify the spatiotemporal structure of the layer allowing for correlation of behavioral responses with toxin levels. Both species explicitly avoided the exudate layer and the vicinity of the layer. Measures of path kinematics (swimming speed, turn frequency) by location (in-layer vs. out-of-layer) and exposure (pre-contact vs. post-contact) revealed some similarities, but also significant differences, in trends for each species. A. tonsa significantly increases swimming speed and swimming speed variability in the exudate layer and post-contact, whereas T. longicornis slightly increases both in-layer and slightly reduces both post-contact. Both species increase turn frequency in-layer and post-contact with increasing K. brevis exudate concentration. Path fracticality indicates that A. tonsatrajectories became more diffuse/sinuous and T. longicornis trajectories became more linear/ballistic (trending effects). Regression analyses revealed that the rate of change of behavior with increasing exudate concentration for A. tonsa was thrice to fifty times that of T. longicornis. Toxic K. brevis can essentially eliminate top-down grazer control ,another sinister means by which it gains a competitive advantage over the local phytoplankton taxa.

  11. Investigation into the cyto-protective and wound healing properties of cryptic peptides from bovine Achilles tendon collagen.


    Banerjee, Pradipta; Mehta, Alka; Shanthi, C


    Many proteins have concealed regions in their amino acid sequences that when liberated or exposed by conformational changes can exhibit bioactivity. Two such cryptic bioactive peptides, C2 (with cell adhesive properties) and E1 (with cell adhesive and antioxidant properties) have been isolated from bovine tendon collagen. This investigation deals with the efficacy of these peptides in countering externally generated stress and imparting cyto-protection in mammalian cell systems. The cell survival activity was studied with two cell lines, viz., HeLa and Vero, with varying concentrations of five oxidative stress-generating agents. The activities of the peptides in supporting cell adhesion and countering stress were determined in their coated and dissolved forms. C2 and E1 coated dishes registered 8 times (p<0.01) higher rate of cell survival against oxidative stress than collagen coated dishes. E1 increased stress tolerance levels by >100 times in dissolved form and C2, by 8 times in coated form. The peptides supported faster wound closure than collagen under normal as well as stressed condition. Maximum stress tolerance was observed on C2 coated dishes in the presence of E1 in the medium suggesting that both enhanced cell adhesion and antioxidative activities significantly contribute to the cell survival during stress. The present study emphasizes that collagen peptides, apart from providing a suitable surface for cell adhesion, also confer protection to cells against oxidative stress. PMID:24434246

  12. 50 CFR 635.40 - Restrictions to enhance conservation.

    Code of Federal Regulations, 2014 CFR


    ... products of an American fishery and were lawfully taken in conformity with applicable conservation laws and... 50, Code of Federal Regulations, and such other conservation laws and regulations as were applicable... 50 Wildlife and Fisheries 12 2014-10-01 2014-10-01 false Restrictions to enhance conservation....

  13. 50 CFR 635.40 - Restrictions to enhance conservation.

    Code of Federal Regulations, 2012 CFR


    ... products of an American fishery and were lawfully taken in conformity with applicable conservation laws and... 50, Code of Federal Regulations, and such other conservation laws and regulations as were applicable... 50 Wildlife and Fisheries 12 2012-10-01 2012-10-01 false Restrictions to enhance conservation....

  14. 50 CFR 635.40 - Restrictions to enhance conservation.

    Code of Federal Regulations, 2011 CFR


    ... products of an American fishery and were lawfully taken in conformity with applicable conservation laws and... 50, Code of Federal Regulations, and such other conservation laws and regulations as were applicable... 50 Wildlife and Fisheries 10 2011-10-01 2011-10-01 false Restrictions to enhance conservation....

  15. 50 CFR 635.40 - Restrictions to enhance conservation.

    Code of Federal Regulations, 2013 CFR


    ... products of an American fishery and were lawfully taken in conformity with applicable conservation laws and... 50, Code of Federal Regulations, and such other conservation laws and regulations as were applicable... 50 Wildlife and Fisheries 12 2013-10-01 2013-10-01 false Restrictions to enhance conservation....

  16. 50 CFR 635.40 - Restrictions to enhance conservation.

    Code of Federal Regulations, 2010 CFR


    ... products of an American fishery and were lawfully taken in conformity with applicable conservation laws and... 50, Code of Federal Regulations, and such other conservation laws and regulations as were applicable... 50 Wildlife and Fisheries 8 2010-10-01 2010-10-01 false Restrictions to enhance conservation....

  17. Cryptic diversity and ecosystem functioning: a complex tale of differential effects on decomposition.


    De Meester, N; Gingold, R; Rigaux, A; Derycke, S; Moens, T


    Marine ecosystems are experiencing accelerating population and species loss. Some ecosystem functions are decreasing and there is growing interest in the link between biodiversity and ecosystem functioning. The role of cryptic (morphologically identical but genetically distinct) species in this biodiversity-ecosystem functioning link is unclear and has not yet been formally tested. We tested if there is a differential effect of four cryptic species of the bacterivorous nematode Litoditis marina on the decomposition process of macroalgae. Bacterivorous nematodes can stimulate or slow down bacterial activity and modify the bacterial assemblage composition. Moreover, we tested if interspecific interactions among the four cryptic species influence the decomposition process. A laboratory experiment with both mono- and multispecific nematode cultures was conducted, and loss of organic matter and the activity of two key extracellular enzymes for the degradation of phytodetritus were assessed. L. marina mainly influenced qualitative aspects of the decomposition process rather than its overall rate: an effect of the nematodes on the enzymatic activities became manifest, although no clear nematode effect on bulk organic matter weight loss was found. We also demonstrated that species-specific effects on the decomposition process existed. Combining the four cryptic species resulted in high competition, with one dominant species, but without complete exclusion of other species. These interspecific interactions translated into different effects on the decomposition process. The species-specific differences indicated that each cryptic species may play an important and distinct role in ecosystem functioning. Functional differences may result in coexistence among very similar species. PMID:27337962

  18. Speed-accuracy tradeoffs and false alarms in bee responses to cryptic predators.


    Ings, Thomas C; Chittka, Lars


    Learning plays a crucial role in predator avoidance [1-3], but little is known about how the type of experience with predators molds future prey behavior. Specifically, is predator-avoidance learning and memory retention disrupted by cryptic coloration of predators, such as crab spiders [4, 5]? How does experience with different predators affect foraging decisions? We evaluated these questions by exposing foraging bumblebees to controlled predation risk from predators (robotic crab spiders) that were either cryptic or highly contrasting, as assessed by a quantitative model of bee color perception [6]. Our results from 3D tracking software reveal a speed-accuracy tradeoff [7]: Bees slow their inspection flights after learning that there is a risk from cryptic spiders. The adjustment of inspection effort results in accurate predator detection, leveling out predation risk at the expense of foraging time. Overnight-retention tests reveal no decline in performance, but bees that had experienced cryptic predators are more prone to "false alarms" (rejection of foraging opportunities on safe flowers) than those that had experienced conspicuous predators. Therefore, bees in the cryptic-spider treatment made a functional decision to trade off reduced foraging efficiency via increased inspection times and false-alarm rates against higher potential fitness loss from being injured or eaten.

  19. Integrating molecular and morphological approaches for characterizing parasite cryptic species: implications for parasitology.


    Nadler, Steven A; DE León, Gerardo Pérez-Ponce


    Herein we review theoretical and methodological considerations important for finding and delimiting cryptic species of parasites (species that are difficult to recognize using traditional systematic methods). Applications of molecular data in empirical investigations of cryptic species are discussed from an historical perspective, and we evaluate advantages and disadvantages of approaches that have been used to date. Developments concerning the theory and practice of species delimitation are emphasized because theory is critical to interpretation of data. The advantages and disadvantages of different molecular methodologies, including the number and kind of loci, are discussed relative to tree-based approaches for detecting and delimiting cryptic species. We conclude by discussing some implications that cryptic species have for research programmes in parasitology, emphasizing that careful attention to the theory and operational practices involved in finding, delimiting, and describing new species (including cryptic species) is essential, not only for fully characterizing parasite biodiversity and broader aspects of comparative biology such as systematics, evolution, ecology and biogeography, but to applied research efforts that strive to improve development and understanding of epidemiology, diagnostics, control and potential eradication of parasitic diseases.

  20. Cryptic diversity and ecosystem functioning: a complex tale of differential effects on decomposition.


    De Meester, N; Gingold, R; Rigaux, A; Derycke, S; Moens, T


    Marine ecosystems are experiencing accelerating population and species loss. Some ecosystem functions are decreasing and there is growing interest in the link between biodiversity and ecosystem functioning. The role of cryptic (morphologically identical but genetically distinct) species in this biodiversity-ecosystem functioning link is unclear and has not yet been formally tested. We tested if there is a differential effect of four cryptic species of the bacterivorous nematode Litoditis marina on the decomposition process of macroalgae. Bacterivorous nematodes can stimulate or slow down bacterial activity and modify the bacterial assemblage composition. Moreover, we tested if interspecific interactions among the four cryptic species influence the decomposition process. A laboratory experiment with both mono- and multispecific nematode cultures was conducted, and loss of organic matter and the activity of two key extracellular enzymes for the degradation of phytodetritus were assessed. L. marina mainly influenced qualitative aspects of the decomposition process rather than its overall rate: an effect of the nematodes on the enzymatic activities became manifest, although no clear nematode effect on bulk organic matter weight loss was found. We also demonstrated that species-specific effects on the decomposition process existed. Combining the four cryptic species resulted in high competition, with one dominant species, but without complete exclusion of other species. These interspecific interactions translated into different effects on the decomposition process. The species-specific differences indicated that each cryptic species may play an important and distinct role in ecosystem functioning. Functional differences may result in coexistence among very similar species.

  1. Cryptic species diversity reveals biogeographic support for the 'mountain passes are higher in the tropics' hypothesis.


    Gill, B A; Kondratieff, B C; Casner, K L; Encalada, A C; Flecker, A S; Gannon, D G; Ghalambor, C K; Guayasamin, J M; Poff, N L; Simmons, M P; Thomas, S A; Zamudio, K R; Funk, W C


    The 'mountain passes are higher in the tropics' (MPHT) hypothesis posits that reduced climate variability at low latitudes should select for narrower thermal tolerances, lower dispersal and smaller elevational ranges compared with higher latitudes. These latitudinal differences could increase species richness at low latitudes, but that increase may be largely cryptic, because physiological and dispersal traits isolating populations might not correspond to morphological differences. Yet previous tests of the MPHT hypothesis have not addressed cryptic diversity. We use integrative taxonomy, combining morphology (6136 specimens) and DNA barcoding (1832 specimens) to compare the species richness, cryptic diversity and elevational ranges of mayflies (Ephemeroptera) in the Rocky Mountains (Colorado; approx. 40°N) and the Andes (Ecuador; approx. 0°). We find higher species richness and smaller elevational ranges in Ecuador than Colorado, but only after quantifying and accounting for cryptic diversity. The opposite pattern is found when comparing diversity based on morphology alone, underscoring the importance of uncovering cryptic species to understand global biodiversity patterns. PMID:27306051

  2. Cryptic species diversity reveals biogeographic support for the 'mountain passes are higher in the tropics' hypothesis.


    Gill, B A; Kondratieff, B C; Casner, K L; Encalada, A C; Flecker, A S; Gannon, D G; Ghalambor, C K; Guayasamin, J M; Poff, N L; Simmons, M P; Thomas, S A; Zamudio, K R; Funk, W C


    The 'mountain passes are higher in the tropics' (MPHT) hypothesis posits that reduced climate variability at low latitudes should select for narrower thermal tolerances, lower dispersal and smaller elevational ranges compared with higher latitudes. These latitudinal differences could increase species richness at low latitudes, but that increase may be largely cryptic, because physiological and dispersal traits isolating populations might not correspond to morphological differences. Yet previous tests of the MPHT hypothesis have not addressed cryptic diversity. We use integrative taxonomy, combining morphology (6136 specimens) and DNA barcoding (1832 specimens) to compare the species richness, cryptic diversity and elevational ranges of mayflies (Ephemeroptera) in the Rocky Mountains (Colorado; approx. 40°N) and the Andes (Ecuador; approx. 0°). We find higher species richness and smaller elevational ranges in Ecuador than Colorado, but only after quantifying and accounting for cryptic diversity. The opposite pattern is found when comparing diversity based on morphology alone, underscoring the importance of uncovering cryptic species to understand global biodiversity patterns.

  3. Uneven distribution of cryptic diversity among higher taxa of parasitic worms

    PubMed Central

    Poulin, Robert


    Cryptic species cause problems for estimates of biodiversity. In the case of parasites, cryptic species also plague efforts to detect potential zoonotic diseases or invasive pathogens. It is crucial to determine whether the likelihood of finding cryptic species differs among higher parasite taxa, to better calibrate estimates of diversity and monitor diseases. Using published reports of cryptic species of helminth parasites identified using molecular tools, I show that the number of species found is strongly related to the number of parasite individuals sequenced, weakly influenced by the number of host species from which parasites were obtained, and unaffected by the genetic markers used. After correction for these factors, more cryptic species of trematodes are found than in other helminth taxa. Although several features distinguish trematodes from other helminths, it is probable that our inability to discriminate among sibling species of trematodes results from their lack of structures serving as species-specific morphological markers. The available data suggest that current estimates of helminth diversity may need to be doubled (tripled for trematodes) to better reflect extant diversity. PMID:20861036

  4. Conformational flexibility of aspartame.


    Toniolo, Claudio; Temussi, Pierandrea


    L-Aspartyl-L-phenylalanine methyl ester, better known as aspartame, is not only one of the most used artificial sweeteners, but also a very interesting molecule with respect to the correlation between molecular structure and taste. The extreme conformational flexibility of this dipeptide posed a huge difficulty when researchers tried to use it as a lead compound to design new sweeteners. In particular, it was difficult to take advantage of its molecular model as a mold to infer the shape of the, then unknown, active site of the sweet taste receptor. Here, we follow the story of the 3D structural aspects of aspartame from early conformational studies to recent docking into homology models of the receptor. © 2016 Wiley Periodicals, Inc. Biopolymers (Pept Sci) 106: 376-384, 2016. PMID:27038223

  5. Conformal complementarity maps

    NASA Astrophysics Data System (ADS)

    Barbón, José L. F.; Rabinovici, Eliezer


    We study quantum cosmological models for certain classes of bang/crunch singularities, using the duality between expanding bubbles in AdS with a FRW interior cosmology and perturbed CFTs on de Sitter space-time. It is pointed out that horizon complementarity in the AdS bulk geometries is realized as a conformal transformation in the dual deformed CFT. The quantum version of this map is described in full detail in a toy model involving conformal quantum mechanics. In this system the complementarity map acts as an exact duality between eternal and apocalyptic Hamiltonian evolutions. We calculate the commutation relation between the Hamiltonians corresponding to the different frames. It vanishes only on scale invariant states.

  6. Multiscale conformal pattern transfer.


    Lodewijks, Kristof; Miljkovic, Vladimir; Massiot, Inès; Mekonnen, Addis; Verre, Ruggero; Olsson, Eva; Dmitriev, Alexandre


    We demonstrate a method for seamless transfer from a parent flat substrate of basically any lithographic top-down or bottom-up pattern onto essentially any kind of surface. The nano- or microscale patterns, spanning macroscopic surface areas, can be transferred with high conformity onto a large variety of surfaces when such patterns are produced on a thin carbon film, grown on top of a sacrificial layer. The latter allows lifting the patterns from the flat parent substrate onto a water-air interface to be picked up by the host surface of choice. We illustrate the power of this technique by functionalizing broad range of materials including glass, plastics, metals, rough semiconductors and polymers, highlighting the potential applications in in situ colorimetry of the chemistry of materials, anti-counterfeit technologies, biomolecular and biomedical studies, light-matter interactions at the nanoscale, conformal photovoltaics and flexible electronics. PMID:27329824

  7. Multiscale conformal pattern transfer

    PubMed Central

    Lodewijks, Kristof; Miljkovic, Vladimir; Massiot, Inès; Mekonnen, Addis; Verre, Ruggero; Olsson, Eva; Dmitriev, Alexandre


    We demonstrate a method for seamless transfer from a parent flat substrate of basically any lithographic top-down or bottom-up pattern onto essentially any kind of surface. The nano- or microscale patterns, spanning macroscopic surface areas, can be transferred with high conformity onto a large variety of surfaces when such patterns are produced on a thin carbon film, grown on top of a sacrificial layer. The latter allows lifting the patterns from the flat parent substrate onto a water-air interface to be picked up by the host surface of choice. We illustrate the power of this technique by functionalizing broad range of materials including glass, plastics, metals, rough semiconductors and polymers, highlighting the potential applications in in situ colorimetry of the chemistry of materials, anti-counterfeit technologies, biomolecular and biomedical studies, light-matter interactions at the nanoscale, conformal photovoltaics and flexible electronics. PMID:27329824

  8. Multiscale conformal pattern transfer

    NASA Astrophysics Data System (ADS)

    Lodewijks, Kristof; Miljkovic, Vladimir; Massiot, Inès; Mekonnen, Addis; Verre, Ruggero; Olsson, Eva; Dmitriev, Alexandre


    We demonstrate a method for seamless transfer from a parent flat substrate of basically any lithographic top-down or bottom-up pattern onto essentially any kind of surface. The nano- or microscale patterns, spanning macroscopic surface areas, can be transferred with high conformity onto a large variety of surfaces when such patterns are produced on a thin carbon film, grown on top of a sacrificial layer. The latter allows lifting the patterns from the flat parent substrate onto a water-air interface to be picked up by the host surface of choice. We illustrate the power of this technique by functionalizing broad range of materials including glass, plastics, metals, rough semiconductors and polymers, highlighting the potential applications in in situ colorimetry of the chemistry of materials, anti-counterfeit technologies, biomolecular and biomedical studies, light-matter interactions at the nanoscale, conformal photovoltaics and flexible electronics.

  9. Conformational flexibility of aspartame.


    Toniolo, Claudio; Temussi, Pierandrea


    L-Aspartyl-L-phenylalanine methyl ester, better known as aspartame, is not only one of the most used artificial sweeteners, but also a very interesting molecule with respect to the correlation between molecular structure and taste. The extreme conformational flexibility of this dipeptide posed a huge difficulty when researchers tried to use it as a lead compound to design new sweeteners. In particular, it was difficult to take advantage of its molecular model as a mold to infer the shape of the, then unknown, active site of the sweet taste receptor. Here, we follow the story of the 3D structural aspects of aspartame from early conformational studies to recent docking into homology models of the receptor. © 2016 Wiley Periodicals, Inc. Biopolymers (Pept Sci) 106: 376-384, 2016.

  10. Conformal scalar field wormholes

    NASA Technical Reports Server (NTRS)

    Halliwell, Jonathan J.; Laflamme, Raymond


    The Euclidian Einstein equations with a cosmological constant and a conformally coupled scalar field are solved, taking the metric to be of the Robertson-Walker type. In the case Lambda = 0, solutions are found which represent a wormhole connecting two asymptotically flat Euclidian regions. In the case Lambda greater than 0, the solutions represent tunneling from a small Tolman-like universe to a large Robertson-Walker universe.

  11. The conformal bootstrap

    NASA Astrophysics Data System (ADS)

    Poland, David; Simmons-Duffin, David


    The conformal bootstrap was proposed in the 1970s as a strategy for calculating the properties of second-order phase transitions. After spectacular success elucidating two-dimensional systems, little progress was made on systems in higher dimensions until a recent renaissance beginning in 2008. We report on some of the main results and ideas from this renaissance, focusing on new determinations of critical exponents and correlation functions in the three-dimensional Ising and O(N) models.

  12. Characterization of an insertion sequence-like element, ISBlo15, identified in a size-increased cryptic plasmid pBK283 in Bifidobacterium longum BK28.


    Fukiya, Satoru; Sugiyama, Tomohiko; Kano, Yasunobu; Yokota, Atsushi


    The characteristics of mobile genetic elements in bifidobacteria are not well understood. We characterized an insertion sequence-like element of the IS200/IS605 family found in a size-increased cryptic plasmid in Bifidobacterium longum. During a plasmid profile analysis of B. longum BK strains, we encountered a 6.5-kbp cryptic plasmid pBK283 in B. longum BK28, the size of which has not been identified in bifidobacteria. Nucleotide sequence analysis indicated that an insertion sequence-like element was inserted into the 5.0-kbp pKJ50-like plasmid and resulted in a size increase of pBK283. The element, named ISBlo15, was 1593 bp in length and contained a single ORF encoding a putative transposase, which is similar to the transposase OrfB encoded by IS200/IS605 family elements. Several sequence characteristics, including conserved transposase motifs in OrfB and terminal palindromic sequences that differ from the typical terminal inverted repeats, strongly suggested that ISBlo15 is a member of the IS200/IS605 family. Sequences similar to ISBlo15 were widely distributed among the nine Bifidobacterium species tested, and those of highly homologous sequences were detected only in Bifidobacterium gallicum JCM8224(T).

  13. Conformations of organophosphine oxides

    SciTech Connect

    De Silva, Nuwan; Zahariev, Federico; Hay, Benjamin P.; Gordon, Mark S.; Windus, Theresa L.


    The conformations of a series of organophosphine oxides, OP(CH3)2R, where R = methyl, ethyl, isopropyl, tert-butyl, vinyl, and phenyl, are predicted using the MP2/cc-pVTZ level of theory. Comparison of potential energy surfaces for rotation about P–C bonds with crystal structure data reveals a strong correlation between predicted location and energetics of minima and histograms of dihedral angle distributions observed in the solid state. In addition, the most stable conformers are those that minimize the extent of steric repulsion between adjacent rotor substituents, and the torsional barriers tend to increase with the steric bulk of the rotating alkyl group. MM3 force field parameters were adjusted to fit the MP2 results, providing a fast and accurate model for predicting organophosphine oxides shapes—an essential part of understanding the chemistry of these compounds. As a result, the predictive power of the modified MM3 model was tested against MP2/cc-pVTZ conformations for triethylphosphine oxide, OP(CH2CH3)3, and triphenylphosphine oxide, OP(Ph)3.

  14. Conformational stability of apoflavodoxin.

    PubMed Central

    Genzor, C. G.; Beldarraín, A.; Gómez-Moreno, C.; López-Lacomba, J. L.; Cortijo, M.; Sancho, J.


    Flavodoxins are alpha/beta proteins that mediate electron transfer reactions. The conformational stability of apoflavodoxin from Anaboena PCC 7119 has been studied by calorimetry and urea denaturation as a function of pH and ionic strength. At pH > 12, the protein is unfolded. Between pH 11 and pH 6, the apoprotein is folded properly as judged from near-ultraviolet (UV) circular dichroism (CD) and high-field 1H NMR spectra. In this pH interval, apoflavodoxin is a monomer and its unfolding by urea or temperature follows a simple two-state mechanism. The specific heat capacity of unfolding for this native conformation is unusually low. Near its isoelectric point (3.9), the protein is highly insoluble. At lower pH values (pH 3.5-2.0), apoflavodoxin adopts a conformation with the properties of a molten globule. Although apoflavodoxin at pH 2 unfolds cooperatively with urea in a reversible fashion and the fluorescence and far-UV CD unfolding curves coincide, the transition midpoint depends on the concentration of protein, ruling out a simple two-state process at acidic pH. Apoflavodoxin constitutes a promising system for the analysis of the stability and folding of alpha/beta proteins and for the study of the interaction between apoflavoproteins and their corresponding redox cofactors. PMID:8819170

  15. Conformations of organophosphine oxides


    De Silva, Nuwan; Zahariev, Federico; Hay, Benjamin P.; Gordon, Mark S.; Windus, Theresa L.


    The conformations of a series of organophosphine oxides, OP(CH3)2R, where R = methyl, ethyl, isopropyl, tert-butyl, vinyl, and phenyl, are predicted using the MP2/cc-pVTZ level of theory. Comparison of potential energy surfaces for rotation about P–C bonds with crystal structure data reveals a strong correlation between predicted location and energetics of minima and histograms of dihedral angle distributions observed in the solid state. In addition, the most stable conformers are those that minimize the extent of steric repulsion between adjacent rotor substituents, and the torsional barriers tend to increase with the steric bulk of the rotating alkyl group. MM3 forcemore » field parameters were adjusted to fit the MP2 results, providing a fast and accurate model for predicting organophosphine oxides shapes—an essential part of understanding the chemistry of these compounds. As a result, the predictive power of the modified MM3 model was tested against MP2/cc-pVTZ conformations for triethylphosphine oxide, OP(CH2CH3)3, and triphenylphosphine oxide, OP(Ph)3.« less

  16. Evidence of cryptic individual specialization in an opportunistic insectivorous bat

    USGS Publications Warehouse

    Cryan, Paul M.; Stricker, Craig A.; Wunder, Michael B.


    Habitat use and feeding behaviors of cryptic animals are often poorly understood. Analyses of stable isotope ratios in animal body tissues can help reveal an individual's location and resource use during tissue growth. We investigated variation in stable isotope ratios of 4 elements (H, C, N, and S) in the hair of a sedentary species of insectivorous bat (Eptesicus fuscus) inhabiting a chemically complex urban landscape. Our objective was to quantify population-level isotopic variation and test for evidence of resource specialization by individuals. Bats were sampled over 3 annual molt cycles at maternity roosts in buildings and variance components analysis was used to test whether intraindividual isotopic variation among molts differed from interindividual variation, after controlling for year and roost-group effects. Consistent with prior evidence that E. fuscus is opportunistic in its habitat use and foraging at the population level, we observed wide population-level variation for all isotopes. This variation likely reflects the chemical complexity of the urban landscape studied. However, isotopic variation among years within marked individuals was lower than variation among marked individuals within year for all isotopes, and carbon signatures indicated resource specialization by roost groups and individuals. This is the 1st study to examine variation in stable isotope ratios of individual wild bats over multiple years. Although our results suggest this population tends toward opportunistic habitat use or prey selection, or both, during molt periods, results also indicate that individuals and groups of bats composing the population might be habitat or dietary specialists—a novel finding for insectivorous bats.

  17. Cryptic diversity and symbiont interactions in rock-posy lichens.


    Leavitt, Steven D; Kraichak, Ekaphan; Vondrak, Jan; Nelsen, Matthew P; Sohrabi, Mohammad; Perez-Ortega, Sergio; St Clair, Larry L; Lumbsch, H Thorsten


    Identifying factors that influence species interactions is central to research in symbiotic systems. While lichens represent iconic models of symbiosis and play important roles in understanding the biology of symbiotic interactions, patterns of interactions in lichen symbionts and mechanisms governing these relationships are not well characterized. This is due, in part to the fact that current taxonomic approaches for recognizing diversity in lichen symbionts commonly fail to accurately reflect actual species diversity. In this study, we employed DNA-based approaches to circumscribed candidate species-level lineages in rock-posy lichen symbionts (mycobiont=Rhizoplaca s. lat. species; photobiont=Trebouxia species). Our results revealed a high degree of cryptic diversity in both the myco- and photobionts in these lichens. Using the candidate species circumscribed here, we investigated the specificity of the symbionts toward their partners and inferred the relative importance of various factors influencing symbiont interactions. Distinct mycobiont species complexes, ecozones, and biomes are significantly correlated with the occurrence of photobiont OTUs, indicating that complex interactions among mycobiont lineages, ecogeography, and microhabitat determine interactions between photobionts and their mycobionts in lichen symbiosis. One-to-one specificity between mycobiont and photobiont species was not found, with the exception of R. maheui that associated with a single Trebouxia OTU that was not found with other Rhizoplaca s. lat. species. We estimated the most recent common ancestor of the core Rhizoplaca group at c. 62.5Ma, similar in age to the diverse parmelioid core group in the well-studied family Parmeliaceae. However, in contrast to Parmeliaceae, species in Rhizoplaca were found to associate with a narrow range of photobionts. Our study provides important perspectives into species diversity and interactions in iconic lichen symbiotic systems and establishes a

  18. Uncovering Cryptic Asexuality in Daphnia magna by RAD Sequencing.


    Svendsen, Nils; Reisser, Celine M O; Dukić, Marinela; Thuillier, Virginie; Ségard, Adeline; Liautard-Haag, Cathy; Fasel, Dominique; Hürlimann, Evelin; Lenormand, Thomas; Galimov, Yan; Haag, Christoph R


    The breeding systems of many organisms are cryptic and difficult to investigate with observational data, yet they have profound effects on a species' ecology, evolution, and genome organization. Genomic approaches offer a novel, indirect way to investigate breeding systems, specifically by studying the transmission of genetic information from parents to offspring. Here we exemplify this method through an assessment of self-fertilization vs. automictic parthenogenesis in Daphnia magna. Self-fertilization reduces heterozygosity by 50% compared to the parents, but under automixis, whereby two haploid products from a single meiosis fuse, the expected heterozygosity reduction depends on whether the two meiotic products are separated during meiosis I or II (i.e., central vs. terminal fusion). Reviewing the existing literature and incorporating recombination interference, we derive an interchromosomal and an intrachromosomal prediction of how to distinguish various forms of automixis from self-fertilization using offspring heterozygosity data. We then test these predictions using RAD-sequencing data on presumed automictic diapause offspring of so-called nonmale producing strains and compare them with "self-fertilized" offspring produced by within-clone mating. The results unequivocally show that these offspring were produced by automixis, mostly, but not exclusively, through terminal fusion. However, the results also show that this conclusion was only possible owing to genome-wide heterozygosity data, with phenotypic data as well as data from microsatellite markers yielding inconclusive or even misleading results. Our study thus demonstrates how to use the power of genomic approaches for elucidating breeding systems, and it provides the first demonstration of automictic parthenogenesis in Daphnia.

  19. Cryptic Population Dynamics: Rapid Evolution Masks Trophic Interactions

    PubMed Central

    Yoshida, Takehito; Ellner, Stephen P; Jones, Laura E; Bohannan, Brendan J. M; Lenski, Richard E; Hairston, Nelson G


    Trophic relationships, such as those between predator and prey or between pathogen and host, are key interactions linking species in ecological food webs. The structure of these links and their strengths have major consequences for the dynamics and stability of food webs. The existence and strength of particular trophic links has often been assessed using observational data on changes in species abundance through time. Here we show that very strong links can be completely missed by these kinds of analyses when changes in population abundance are accompanied by contemporaneous rapid evolution in the prey or host species. Experimental observations, in rotifer-alga and phage-bacteria chemostats, show that the predator or pathogen can exhibit large-amplitude cycles while the abundance of the prey or host remains essentially constant. We know that the species are tightly linked in these experimental microcosms, but without this knowledge, we would infer from observed patterns in abundance that the species are weakly or not at all linked. Mathematical modeling shows that this kind of cryptic dynamics occurs when there is rapid prey or host evolution for traits conferring defense against attack, and the cost of defense (in terms of tradeoffs with other fitness components) is low. Several predictions of the theory that we developed to explain the rotifer-alga experiments are confirmed in the phage-bacteria experiments, where bacterial evolution could be tracked. Modeling suggests that rapid evolution may also confound experimental approaches to measuring interaction strength, but it identifies certain experimental designs as being more robust against potential confounding by rapid evolution. PMID:17803356

  20. Cryptic diversity and symbiont interactions in rock-posy lichens.


    Leavitt, Steven D; Kraichak, Ekaphan; Vondrak, Jan; Nelsen, Matthew P; Sohrabi, Mohammad; Perez-Ortega, Sergio; St Clair, Larry L; Lumbsch, H Thorsten


    Identifying factors that influence species interactions is central to research in symbiotic systems. While lichens represent iconic models of symbiosis and play important roles in understanding the biology of symbiotic interactions, patterns of interactions in lichen symbionts and mechanisms governing these relationships are not well characterized. This is due, in part to the fact that current taxonomic approaches for recognizing diversity in lichen symbionts commonly fail to accurately reflect actual species diversity. In this study, we employed DNA-based approaches to circumscribed candidate species-level lineages in rock-posy lichen symbionts (mycobiont=Rhizoplaca s. lat. species; photobiont=Trebouxia species). Our results revealed a high degree of cryptic diversity in both the myco- and photobionts in these lichens. Using the candidate species circumscribed here, we investigated the specificity of the symbionts toward their partners and inferred the relative importance of various factors influencing symbiont interactions. Distinct mycobiont species complexes, ecozones, and biomes are significantly correlated with the occurrence of photobiont OTUs, indicating that complex interactions among mycobiont lineages, ecogeography, and microhabitat determine interactions between photobionts and their mycobionts in lichen symbiosis. One-to-one specificity between mycobiont and photobiont species was not found, with the exception of R. maheui that associated with a single Trebouxia OTU that was not found with other Rhizoplaca s. lat. species. We estimated the most recent common ancestor of the core Rhizoplaca group at c. 62.5Ma, similar in age to the diverse parmelioid core group in the well-studied family Parmeliaceae. However, in contrast to Parmeliaceae, species in Rhizoplaca were found to associate with a narrow range of photobionts. Our study provides important perspectives into species diversity and interactions in iconic lichen symbiotic systems and establishes a

  1. "Cryptic" diagenesis and its implications for speleothem geochronologies

    NASA Astrophysics Data System (ADS)

    Bajo, Petra; Hellstrom, John; Frisia, Silvia; Drysdale, Russell; Black, Jay; Woodhead, Jon; Borsato, Andrea; Zanchetta, Giovanni; Wallace, Malcolm W.; Regattieri, Eleonora; Haese, Ralf


    Speleothems are usually considered as one of the most amenable palaeoclimate archives for U-series dating. A number of studies in recent years, however, report cases of diagenetic alteration which compromises the use of U-series systematics in speleothems, resulting in inaccurate U-Th ages. Here we present the results of a high-resolution U-Th dating study of a stalagmite (CC26) from Corchia Cave in Italy where we document a number of departures from an otherwise well-defined age-depth model, and explore potential causes for these outliers. Unlike examples illustrated in previous studies, CC26 contains no visible evidence of neomorphism, and appears, at least superficially, ideally suited to dating. Good reproducibility obtained between multi-aliquot U-Th analyses removes any possibility of analytical issues contributing to these outliers. Furthermore, replicate analyses of samples from the same stratigraphic layer yielded ages in stratigraphic sequence, implying very localized open-system behavior. Uranium loss is suggested as a causative mechanism on account of the fact that all the outliers are older than their assumed true age. A limited number of micro-voids were observed under micro-CT analyses, and it is proposed that these were pathways for U loss. Uranium-loss modelling allows us to constrain the possible timing of diagenetic alteration and indicates that the precursor for the outlier with the largest age discrepancy (309%) must have been aragonite. This study indicates that visibly unaltered speleothems may still contain small domains that have experienced post-depositional alteration. Such "cryptic" diagenesis, as recorded in this stalagmite, has implications for the constancy of accuracy of the U-series dating technique, and suggests a need for careful examination of speleothems prior to dating, particularly in low-resolution U-Th studies.

  2. Botrytis californica, a new cryptic species in the B. cinerea species complex causing gray mold in blueberries and table grapes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Botrytis cinerea consists of two cryptic species, referred to as Group I and Group II based on Bc-hch gene RFLP haplotyping, and Group I has been described as a new cryptic species B. pseudocinerea. During a survey for Botrytis spp. causing gray mold in blueberries and table grapes in the Central Va...

  3. Deformed Conformal and Supersymmetric Quantum Mechanics

    NASA Astrophysics Data System (ADS)

    Spiridonov, Vyacheslav

    Within the standard quantum mechanics a q-deformation of the simplest N=2 supersymmetry algebra is suggested. Resulting physical systems do not have conserved charges and degeneracies in the spectra. Instead, superpartner Hamiltonians are q-isospectral, i.e., the spectrum of one can be obtained from another (with possible exception of the lowest level) by the q2-factor scaling. A special class of the self-similar potentials is shown to obey the dynamical conformal symmetry algebra suq(1,1). These potentials exhibit exponential spectra and corresponding raising and lowering operators satisfy the q-deformed harmonic oscillator algebra of Biedenharn and Macfarlane.

  4. Nucleotide sequence of a small cryptic plasmid from Acidithiobacillus ferrooxidans strain A-6

    SciTech Connect

    F. Roberto


    A 2.1 kb cryptic plasmid from Acidithiobacillus ferrooxidans strain A-6 was isolated and cloned into the E. coli vector plasmid, pUC128. The cloned plasmid was mapped by restriction enzyme fragment analysis and subsequently sequenced. At this time over half the plasmid sequence has been determined and compared to sequences in the GenBank nucleotide and protein sequence databases. Much of the plasmid remains cryptic, but substantial nucleotide and protein sequence similarities have been observed to the putative replication protein, RepA, of the small cryptic plasmids pAYS and pAYL found in the ammonia-oxidizing Nitrosomonas sp. Strain ENI-11. These results suggest an entirely new class of plasmid is maintained in at least one strain of Acidithiobacillus ferrooxidans and other acidophilic bacteria, and raises interesting questions about the origin of this plasmid in acidic environments.

  5. A Distinct Translation Initiation Mechanism Generates Cryptic Peptides for Immune Surveillance

    PubMed Central

    Starck, Shelley R.; Ow, Yongkai; Jiang, Vivian; Tokuyama, Maria; Rivera, Mark; Qi, Xin; Roberts, Richard W.; Shastri, Nilabh


    MHC class I molecules present a comprehensive mixture of peptides on the cell surface for immune surveillance. The peptides represent the intracellular protein milieu produced by translation of endogenous mRNAs. Unexpectedly, the peptides are encoded not only in conventional AUG initiated translational reading frames but also in alternative cryptic reading frames. Here, we analyzed how ribosomes recognize and use cryptic initiation codons in the mRNA. We find that translation initiation complexes assemble at non-AUG codons but differ from canonical AUG initiation in response to specific inhibitors acting within the peptidyl transferase and decoding centers of the ribosome. Thus, cryptic translation at non-AUG start codons can utilize a distinct initiation mechanism which could be differentially regulated to provide peptides for immune surveillance. PMID:18941630

  6. Cryptic speciation or global spread? The case of a cosmopolitan marine invertebrate with limited dispersal capabilities.


    R, Pérez-Portela; V, Arranz; M, Rius; X, Turon


    The existence of globally-distributed species with low dispersal capabilities is a paradox that has been explained as a result of human-mediated transport and by hidden diversity in the form of unrecognized cryptic species. Both factors are not mutually exclusive, but relatively few studies have demonstrated the presence of both. Here we analyse the genetic patterns of the colonial ascidian Diplosoma listerianum, a species nowadays distributed globally. The study of a fragment of a mitochondrial gene in localities worldwide revealed the existence of multiple cryptic species. In addition, we found a complex geographic structure and multiple clades occurred in sympatry. One of the species showed strong population structure irrespective of geographical distances, which is coherent with stochastic dispersal linked to human transport. The present study shows the complexity of discerning the role of cryptic diversity from human-driven range shifts worldwide, as well as disentangling the effects of natural and artificial dispersal.

  7. Cuticular hydrocarbon phenotypes do not indicate cryptic species in fungus-growing termites (Isoptera: Macrotermitinae).


    Marten, Andreas; Kaib, Manfred; Brandl, Roland


    In several termite species, distinct differences in the composition of cuticular hydrocarbons among colonies correspond to high genetic divergence of mitochondrial DNA sequences. These observations suggest that hydrocarbon phenotypes represent cryptic species. Different cuticular hydrocarbon phenotypes also are found among colonies of fungus-growing termites of the genus Macrotermes. To determine if these hydrocarbon differences in Macrotermes also indicate cryptic species, we sequenced the mitochondrial CO I gene from species in West and East Africa. Among individuals of a supposed species but belonging to different cuticular hydrocarbon phenotypes, the genetic distances are much smaller than distances between species. Unlike what has been observed in other termites, Macrotermes hydrocarbon phenotypes do not represent cryptic species. Our findings suggest fundamental differences in the evolution and/or function of cuticular hydrocarbons among different termite lineages.

  8. Features of Cryptic Promoters and Their Varied Reliance on Bromodomain-Containing Factors

    PubMed Central

    Pattenden, Samantha G.; Gogol, Madelaine M.; Workman, Jerry L.


    The Set2-Rpd3S pathway is important for the control of transcription memory. Mutation of components of this pathway results in cryptic transcription initiation within the coding region of approximately 30% of yeast genes. Specifically, deletion of the Set2 histone methyltransferase or Rco1, a component of the Rpd3S histone deacetylase complex leads to hyperacetylation of certain open reading frames (ORFs). We used this mutant as a system to study the role of histone modifications and co-activator recruitment in preinitiation complex (PIC) formation. Specifically, we looked at the dependence of promoters on the bromodomain-containing RSC complex and the Bdf1 protein. We found that the dependence of cryptic promoters for these proteins varied. Overall, our data indicate that cryptic promoters are independently regulated, and their activation is dependent on factors that govern gene activation at canonical promoters. PMID:20886085

  9. Conservation Presentation.

    ERIC Educational Resources Information Center

    Friday, Gerald


    Introduces a project in which students teach about the importance of recycling and conservation by presenting demonstrations. Includes demonstrations on water, plastic, and other recycling products such as steel. (YDS)

  10. Conformal killing tensors and covariant Hamiltonian dynamics

    SciTech Connect

    Cariglia, M.; Gibbons, G. W.; Holten, J.-W. van; Horvathy, P. A.; Zhang, P.-M.


    A covariant algorithm for deriving the conserved quantities for natural Hamiltonian systems is combined with the non-relativistic framework of Eisenhart, and of Duval, in which the classical trajectories arise as geodesics in a higher dimensional space-time, realized by Brinkmann manifolds. Conserved quantities which are polynomial in the momenta can be built using time-dependent conformal Killing tensors with flux. The latter are associated with terms proportional to the Hamiltonian in the lower dimensional theory and with spectrum generating algebras for higher dimensional quantities of order 1 and 2 in the momenta. Illustrations of the general theory include the Runge-Lenz vector for planetary motion with a time-dependent gravitational constant G(t), motion in a time-dependent electromagnetic field of a certain form, quantum dots, the Hénon-Heiles and Holt systems, respectively, providing us with Killing tensors of rank that ranges from one to six.

  11. In silico Exploration of the Conformational Universe of GPCRs.


    Rodríguez-Espigares, Ismael; Kaczor, Agnieszka A; Selent, Jana


    The structural plasticity of G protein coupled receptors (GPCRs) leads to a conformational universe going from inactive to active receptor states with several intermediate states. Many of them have not been captured yet and their role for GPCR activation is not well understood. The study of this conformational space and the transition dynamics between different receptor populations is a major challenge in molecular biophysics. The rational design of effector molecules that target such receptor populations allows fine-tuning receptor signalling with higher specificity to produce drugs with safer therapeutic profiles. In this minireview, we outline highly conserved receptor regions which are considered determinant for the establishment of distinct receptor states. We then discuss in-silico approaches such as dimensionality reduction methods and Markov State Models to explore the GPCR conformational universe and exploit the obtained conformations through structure-based drug design. PMID:27492237

  12. In silico Exploration of the Conformational Universe of GPCRs.


    Rodríguez-Espigares, Ismael; Kaczor, Agnieszka A; Selent, Jana


    The structural plasticity of G protein coupled receptors (GPCRs) leads to a conformational universe going from inactive to active receptor states with several intermediate states. Many of them have not been captured yet and their role for GPCR activation is not well understood. The study of this conformational space and the transition dynamics between different receptor populations is a major challenge in molecular biophysics. The rational design of effector molecules that target such receptor populations allows fine-tuning receptor signalling with higher specificity to produce drugs with safer therapeutic profiles. In this minireview, we outline highly conserved receptor regions which are considered determinant for the establishment of distinct receptor states. We then discuss in-silico approaches such as dimensionality reduction methods and Markov State Models to explore the GPCR conformational universe and exploit the obtained conformations through structure-based drug design.

  13. Conformation and hydration of aspartame.


    Kang, Y K


    Conformational free energy calculations using an empirical potential (ECEPP/2) and the hydration shell model were carried out on the neutral, acidic, zwitterionic, and basic forms of aspartame in the hydrated state. The results indicate that as the molecule becomes more charged, the number of low energy conformations becomes smaller and the molecule becomes less flexible. The calculated free energies of hydration of charged aspartames show that hydration has a significant effect on the conformation in solution. Only two feasible conformations were found for the zwitterionic form, and these are consistent with the conformations deduced from NMR and X-ray diffraction experiments. The calculated free energy difference between these two conformations was 1.25 kcal/mol. The less favored of the two solvated conformations can be expected to be stabilized by hydrophobic interaction of the phenyl groups in the crystal.

  14. Conformal superalgebras via tractor calculus

    NASA Astrophysics Data System (ADS)

    Lischewski, Andree


    We use the manifestly conformally invariant description of a Lorentzian conformal structure in terms of a parabolic Cartan geometry in order to introduce a superalgebra structure on the space of twistor spinors and normal conformal vector fields formulated in purely algebraic terms on parallel sections in tractor bundles. Via a fixed metric in the conformal class, one reproduces a conformal superalgebra structure that has been considered in the literature before. The tractor approach, however, makes clear that the failure of this object to be a Lie superalgebra in certain cases is due to purely algebraic identities on the spinor module and to special properties of the conformal holonomy representation. Moreover, it naturally generalizes to higher signatures. This yields new formulas for constructing new twistor spinors and higher order normal conformal Killing forms out of existing ones, generalizing the well-known spinorial Lie derivative. Moreover, we derive restrictions on the possible dimension of the space of twistor spinors in any metric signature.

  15. Leaf growth is conformal

    NASA Astrophysics Data System (ADS)

    Alim, Karen; Armon, Shahaf; Shraiman, Boris I.; Boudaoud, Arezki


    Growth pattern dynamics lie at the heart of morphogenesis. Here, we investigate the growth of plant leaves. We compute the conformal transformation that maps the contour of a leaf at a given stage onto the contour of the same leaf at a later stage. Based on the mapping we predict the local displacement field in the leaf blade and find it to agree with the experimentally measured displacement field to 92%. This approach is applicable to any two-dimensional system with locally isotropic growth, enabling the deduction of the whole growth field just from observation of the tissue contour.

  16. Leaf growth is conformal.


    Alim, Karen; Armon, Shahaf; Shraiman, Boris I; Boudaoud, Arezki


    Growth pattern dynamics lie at the heart of morphogenesis. Here, we investigate the growth of plant leaves. We compute the conformal transformation that maps the contour of a leaf at a given stage onto the contour of the same leaf at a later stage. Based on the mapping we predict the local displacement field in the leaf blade and find it to agree with the experimentally measured displacement field to 92%. This approach is applicable to any two-dimensional system with locally isotropic growth, enabling the deduction of the whole growth field just from observation of the tissue contour. PMID:27597439

  17. OSI Conformance Testing for Bibliographic Applications.

    ERIC Educational Resources Information Center

    Arbez, Gilbert; Swain, Leigh


    Describes the development of Open Systems Interconnection (OSI) conformance testing sites, conformance testing tools, and conformance testing services. Discusses related topics such as interoperability testing, arbitration testing, and international harmonization of conformance testing. A glossary is included. (24 references) (SD)

  18. Technidilaton at the conformal edge

    SciTech Connect

    Hashimoto, Michio; Yamawaki, Koichi


    Technidilaton (TD) was proposed long ago in the technicolor near criticality/conformality. To reveal the critical behavior of TD, we explicitly compute the nonperturbative contributions to the scale anomaly <{theta}{sub {mu}}{sup {mu}>} and to the technigluon condensate <{alpha}G{sub {mu}{nu}}{sup 2}>, which are generated by the dynamical mass m of the technifermions. Our computation is based on the (improved) ladder Schwinger-Dyson equation, with the gauge coupling {alpha} replaced by the two-loop running coupling {alpha}({mu}) having the Caswell-Banks-Zaks infrared fixed point {alpha}{sub *}: {alpha}({mu}){approx_equal}{alpha}={alpha}{sub *} for the infrared region m<{mu}<{Lambda}{sub TC}, where {Lambda}{sub TC} is the intrinsic scale (analogue of {Lambda}{sub QCD} of QCD) relevant to the perturbative scale anomaly. We find that -<{theta}{sub {mu}}{sup {mu}}>/m{sup 4}{yields}const{ne}0 and <{alpha}G{sub {mu}}{nu}{sup 2}>/m{sup 4}{yields}({alpha}/{alpha}{sub cr}-1){sup -3/2}{yields}{infinity} in the criticality limit m/{Lambda}{sub TC}{approx}exp(-{pi}/({alpha}/{alpha}{sub cr}-1){sup 1/2}){yields}0 ({alpha}={alpha}{sub *}=>{alpha}{sub cr}, or N{sub f} approaches N{sub f}{sup cr}) ('conformal edge'). Our result precisely reproduces the formal identity <{theta}{sub {mu}}{sup {mu}>}=({beta}({alpha})/4{alpha}{sup 2})<{alpha}G{sub {mu}{nu}}{sup 2}>, where {beta}({alpha})={Lambda}{sub TC}({partial_derivative}{alpha}/{partial_derivative}{Lambda}{sub TC})=-(2{alpha}{sub cr}/{pi}){center_dot}({alpha}/{alpha}{sub cr}-1){sup 3/2} is the nonperturbative beta function corresponding to the above essential singularity scaling of m/{Lambda}{sub TC}. Accordingly, the partially conserved dilatation current implies (M{sub TD}/m){sup 2}(F{sub TD}/m){sup 2}=-4<{theta}{sub {mu}}{sup {mu}}>/m{sup 4}{yields}const{ne}0 at criticality limit, where M{sub TD} is the mass of TD and F{sub TD} the decay constant of TD. We thus conclude that at criticality limit the TD could become a ''true

  19. Technidilaton at the conformal edge

    NASA Astrophysics Data System (ADS)

    Hashimoto, Michio; Yamawaki, Koichi


    Technidilaton (TD) was proposed long ago in the technicolor near criticality/conformality. To reveal the critical behavior of TD, we explicitly compute the nonperturbative contributions to the scale anomaly ⟨θμμ⟩ and to the technigluon condensate ⟨αGμν2⟩, which are generated by the dynamical mass m of the technifermions. Our computation is based on the (improved) ladder Schwinger-Dyson equation, with the gauge coupling α replaced by the two-loop running coupling α(μ) having the Caswell-Banks-Zaks infrared fixed point α*: α(μ)≃α=α* for the infrared region m<μ<ΛTC, where ΛTC is the intrinsic scale (analogue of ΛQCD of QCD) relevant to the perturbative scale anomaly. We find that -⟨θμμ⟩/m4→const≠0 and ⟨αGμν2⟩/m4→(α/αcr-1)-3/2→∞ in the criticality limit m/ΛTC˜exp⁡(-π/(α/αcr-1)1/2)→0 (α=α*↘αcr, or Nf↗Nfcr) (“conformal edge”). Our result precisely reproduces the formal identity ⟨θμμ⟩=(β(α)/4α2)⟨αGμν2⟩, where β(α)=ΛTC(∂α)/(∂ΛTC)=-(2αcr/π)·(α/αcr-1)3/2 is the nonperturbative beta function corresponding to the above essential singularity scaling of m/ΛTC. Accordingly, the partially conserved dilatation current implies (MTD/m)2(FTD/m)2=-4⟨θμμ⟩/m4→const≠0 at criticality limit, where MTD is the mass of TD and FTD the decay constant of TD. We thus conclude that at criticality limit the TD could become a “true (massless) Nambu-Goldstone boson” MTD/m→0, only when m/FTD→0, namely, getting decoupled, as was the case of “holographic technidilaton” of Haba-Matsuzaki-Yamawaki. The decoupled TD can be a candidate of dark matter.

  20. Conserved higher-spin charges in AdS4

    NASA Astrophysics Data System (ADS)

    Gelfond, O. A.; Vasiliev, M. A.


    Gauge invariant conserved conformal currents built from massless fields of all spins in 4d Minkowski space-time and AdS4 are described in the unfolded dynamics approach. The current cohomology associated with non-zero conserved charges is found. The resulting list of charges is shown to match the space of parameters of the conformal higher-spin symmetry algebra in four dimensions.

  1. Targeting Inactive Enzyme Conformation

    PubMed Central

    Liu, Sijiu; Zeng, Li-Fan; Wu, Li; Yu, Xiao; Xue, Ting; Gunawan, Andrea M.; Ya-Qiu, Long; Zhang, Zhong-Yin


    There has been considerable interest in protein tyrosine phosphatase 1B (PTP1B) as a therapeutic target for diabetes, obesity, as well as cancer. Identifying inhibitory compounds with good bioavailability is a major challenge of drug discovery programs targeted toward PTPs. Most current PTP active site-directed pharmacophores are negatively charged pTyr mimetics which cannot readily enter the cell. This lack of cell permeability limits the utility of such compounds in signaling studies and further therapeutic development. We identify aryl diketoacids as novel pTyr surrogates and show that neutral amide-linked aryl diketoacid dimers also exhibit excellent PTP inhibitory activity. Kinetic studies establish that these aryl diketoacid derivatives act as noncompetitive inhibitors of PTP1B. Crystal structures of ligand-bound PTP1B reveal that both the aryl diketoacid and its dimeric derivative bind PTP1B at the active site, albeit with distinct modes of interaction, in the catalytically inactive, WPD loop open conformation. Furthermore, dimeric aryl diketoacids are cell permeable and enhance insulin signaling in hepatoma cells, suggesting that targeting the inactive conformation may provide a unique opportunity for creating active site-directed PTP1B inhibitors with improved pharmacological properties. PMID:19012396

  2. Conformally symmetric traversable wormholes

    SciTech Connect

    Boehmer, Christian G.; Harko, Tiberiu; Lobo, Francisco S. N.


    Exact solutions of traversable wormholes are found under the assumption of spherical symmetry and the existence of a nonstatic conformal symmetry, which presents a more systematic approach in searching for exact wormhole solutions. In this work, a wide variety of solutions are deduced by considering choices for the form function, a specific linear equation of state relating the energy density and the pressure anisotropy, and various phantom wormhole geometries are explored. A large class of solutions impose that the spatial distribution of the exotic matter is restricted to the throat neighborhood, with a cutoff of the stress-energy tensor at a finite junction interface, although asymptotically flat exact solutions are also found. Using the 'volume integral quantifier', it is found that the conformally symmetric phantom wormhole geometries may, in principle, be constructed by infinitesimally small amounts of averaged null energy condition violating matter. Considering the tidal acceleration traversability conditions for the phantom wormhole geometry, specific wormhole dimensions and the traversal velocity are also deduced.

  3. Eikonalization of conformal blocks

    SciTech Connect

    Fitzpatrick, A. Liam; Kaplan, Jared; Walters, Matthew T.; Wang, Junpu


    Classical field configurations such as the Coulomb potential and Schwarzschild solution are built from the t-channel exchange of many light degrees of freedom. We study the CFT analog of this phenomenon, which we term the 'eikonalization' of conformal blocks. We show that when an operator T appears in the OPE Ο(x)Ο(0), then the large spin Fock space states [TT···T] also appear in this OPE with a computable coefficient. The sum over the exchange of these Fock space states in an correlator build the classical 'T field' in the dual AdS description. In some limits the sum of all Fock space exchanges can be represented as the exponential of a single T exchange in the 4-pt correlator of O. Our results should be useful for systematizing 1/ℓ perturbation theory in general CFTs and simplifying the computation of large spin OPE coefficients. As examples we obtain the leading log ℓ dependence of Fock space conformal block coefficients, and we directly compute the OPE coefficients of the simplest ‘triple-trace’ operators.

  4. Eikonalization of conformal blocks


    Fitzpatrick, A. Liam; Kaplan, Jared; Walters, Matthew T.; Wang, Junpu


    Classical field configurations such as the Coulomb potential and Schwarzschild solution are built from the t-channel exchange of many light degrees of freedom. We study the CFT analog of this phenomenon, which we term the 'eikonalization' of conformal blocks. We show that when an operator T appears in the OPE Ο(x)Ο(0), then the large spin Fock space states [TT···T]ℓ also appear in this OPE with a computable coefficient. The sum over the exchange of these Fock space states in an correlator build the classical 'T field' in the dual AdS description. In some limits the sum of all Fock spacemore » exchanges can be represented as the exponential of a single T exchange in the 4-pt correlator of O. Our results should be useful for systematizing 1/ℓ perturbation theory in general CFTs and simplifying the computation of large spin OPE coefficients. As examples we obtain the leading log ℓ dependence of Fock space conformal block coefficients, and we directly compute the OPE coefficients of the simplest ‘triple-trace’ operators.« less

  5. Unified biogenesis of ambiguine, fischerindole, hapalindole and welwitindolinone: Identification of a monogeranylated indolenine as a cryptic common biosynthetic intermediate by an unusual magnesium-dependent aromatic prenyltransferase

    PubMed Central

    Liu, Xinyu; Hillwig, Matthew L.; Koharudin, Leonardus M.I.; Gronenborn, Angela M.


    Biochemical characterizations of aromatic prenyltransferase AmbP1 and its close homologs WelP1/FidP1 in hapalindole-type alkaloid biosynthetic pathways are reported. These enzymes mediate the magnesium-dependent selective formation of 3-geranyl 3-isocyanovinyl indolenine (2) from cis-indolyl vinyl isonitrile and GPP. The role of magnesium cofactor in AmbP1/WelP1/FidP1 catalysis is highly unusual for a microbial aromatic prenyltransferase, as it not only facilitates the formation of 2 but also prevents its rearrangement to an isomeric 2-geranyl 3-isocyanovinyl indole (3). The discovery of 2 as a cryptically conserved common biosynthetic intermediate to all hapalindole-type alkaloids, suggests an enzyme-mediated Cope rearrangment and aza-Prins-type cyclization cascade is required to transform 2 to a polycyclic hapalindole-like scaffold. PMID:26740122

  6. Causality constraints in conformal field theory


    Hartman, Thomas; Jain, Sachin; Kundu, Sandipan


    Causality places nontrivial constraints on QFT in Lorentzian signature, for example fixing the signs of certain terms in the low energy Lagrangian. In d dimensional conformal field theory, we show how such constraints are encoded in crossing symmetry of Euclidean correlators, and derive analogous constraints directly from the conformal bootstrap (analytically). The bootstrap setup is a Lorentzian four-point function corresponding to propagation through a shockwave. Crossing symmetry fixes the signs of certain log terms that appear in the conformal block expansion, which constrains the interactions of low-lying operators. As an application, we use the bootstrap to rederive the well knownmore » sign constraint on the (Φ)4 coupling in effective field theory, from a dual CFT. We also find constraints on theories with higher spin conserved currents. As a result, our analysis is restricted to scalar correlators, but we argue that similar methods should also impose nontrivial constraints on the interactions of spinning operators« less

  7. Cryptic confounding compounds: A brief consideration of the influences of anthropogenic contaminants on courtship and mating behavior

    PubMed Central

    Blocker, Tomica D.; Ophir, Alexander G.


    Contaminants, like pesticides, polychlorinated biphenyls (PCBs), dioxins and metals, are persistent and ubiquitous and are known to threaten the environment. Traditionally, scientists have considered the direct physiological risks that these contaminants pose. However, scientists have just begun to integrate ethology and toxicology to investigate the effects that contaminants have on behavior. This review considers the potential for contaminant effects on mating behavior. Here we assess the growing body of research concerning disruptions in sexual differentiation, courtship, sexual receptivity, arousal, and mating. We discuss the implications of these disruptions on conservation efforts and highlight the importance of recognizing the potential for environmental stressors to affect behavioral experimentation. More specifically, we consider the negative implications for anthropogenic contaminants to affect the immediate behavior of animals, and their potential to have cascading and/or long-term effects on the behavioral ecology and evolution of populations. Overall, we aim to raise awareness of the confounding influence that contaminants can have, and promote caution when interpreting results where the potential for cryptic affects are possible. PMID:24244068

  8. The genome of the xerotolerant mold Wallemia sebi reveals adaptations to osmotic stress and suggests cryptic sexual reproduction

    SciTech Connect

    Mahajabeen, Padamsee; Kumas, T. K. Arun; Riley, Robert; Binder, Manfred; Boyd, Alex; Calvo, Ann M.; Furukawa, Kentaro; Hesse, Cedar; Hohmann, Stefan; James, Tim Y.; LaButti, Kurt; Lapidus, Alla; Lindquist, Erika; Lucas, Susan; Miller, Kari; Shantappa, Sourabha; Grigoriev, Igor V.; Hibbett, David S.; McLaughlin, David J.; Spatafora, Joseph W.; Aime, Mary C.


    Wallemia (Wallemiales, Wallemiomycetes) is a genus of xerophilic Fungi of uncertain phylogenetic position within Basidiomycota. Most commonly found as food contaminants, species of Wallemia have also been isolated from hypersaline environments. The ability to tolerate environments with reduced water activity is rare in Basidiomycota. We sequenced the genome of W. sebi in order to understand its adaptations for surviving in osmotically challenging environments, and we performed phylogenomic and ultrastructural analyses to address its systematic placement and reproductive biology. W. sebi has a compact genome (9.8 Mb), with few repeats and the largest fraction of genes with functional domains compared with other Basidiomycota. We applied several approaches to searching for osmotic stress-related proteins. In silico analyses identied 93 putative osmotic stress proteins; homology searches showed the HOG (High Osmolarity Glycerol) pathway to be mostly conserved. Despite the seemingly reduced genome, several gene family expansions and a high number of transporters (549) were found that also provide clues to the ability of W. sebito colonize harsh environments. Phylogenetic analyses of a 71-protein dataset support the position of Wallemia as the earliest diverging lineage of Agaricomycotina, which is conrmed by septal pore ultrastructure that shows the septal pore apparatus as a variant of the Tremella-type. Mating type gene homologs were idented although we found no evidence of meiosis during conidiogenesis, suggesting there may be aspects of the life cycle of W. sebi that remain cryptic

  9. The cryptic African wolf: Canis aureus lupaster is not a golden jackal and is not endemic to Egypt.


    Rueness, Eli Knispel; Asmyhr, Maria Gulbrandsen; Sillero-Zubiri, Claudio; Macdonald, David W; Bekele, Afework; Atickem, Anagaw; Stenseth, Nils Chr


    The Egyptian jackal (Canis aureus lupaster) has hitherto been considered a large, rare subspecies of the golden jackal (C. aureus). It has maintained its taxonomical status to date, despite studies demonstrating morphological similarities to the grey wolf (C. lupus). We have analyzed 2055 bp of mitochondrial DNA from C. a. lupaster and investigated the similarity to C. aureus and C. lupus. Through phylogenetic comparison with all wild wolf-like canids (based on 726 bp of the Cytochrome b gene) we conclusively (100% bootstrap support) place the Egyptian jackal within the grey wolf species complex, together with the Holarctic wolf, the Indian wolf and the Himalayan wolf. Like the two latter taxa, C. a. lupaster seems to represent an ancient wolf lineage which most likely colonized Africa prior to the northern hemisphere radiation. We thus refer to C. a. lupaster as the African wolf. Furthermore, we have detected C. a. lupaster individuals at two localities in the Ethiopian highlands, extending the distribution by at least 2,500 km southeast. The only grey wolf species to inhabit the African continent is a cryptic species for which the conservation status urgently needs assessment. PMID:21298107

  10. Cryptic diversity within the choanoflagellate morphospecies complex Codosiga botrytis - phylogeny and morphology of ancient and modern isolates.


    Stoupin, Daniel; Kiss, Aron K; Arndt, Hartmut; Shatilovich, Anastasia V; Gilichinsky, David A; Nitsche, Frank


    Choanoflagellates are closely related to metazoans and fungi according to recent phylogenetic studies; therefore the systematics of these organisms is of particular interest. The choanoflagellate morphospecies Codosiga botrytis is the first described choanoflagellate, and is one of the most frequently reported choanoflagellate species. In this study we present phylogenetic and morphological data on eight different strains of Codosiga botrytis. Among these there are five ancient strains; these cultures have been established from up to 43,000 years old cysts from Siberian permafrost. We found that based on the variable V4 region of the small subunit (SSU) of the rDNA, all the investigated freshwater isolates of Codosiga botrytis, together with Sphaeroeca volvox, form a cluster at the base of all other choanoflagellate species. Moreover, the morphospecies described classically as Codosiga botrytis contains at least four different genotypes separated by considerably high genetic distance. All these 'cryptic species' have identical general morphology and cell structure. Strains have a similar life cycle with several different life forms and large morphological plasticity. For the first time we were able to establish cultures from cryo-conserved cysts of choanoflagellates. The ancient strains did not differ significantly in partial SSU rDNA from the modern ones. Besides, no biogeographically pattern could be established. This fact and the low genetic distances of some strains from remote locations support the distribution of dormant stages via air. PMID:22342133

  11. The Cryptic African Wolf: Canis aureus lupaster Is Not a Golden Jackal and Is Not Endemic to Egypt

    PubMed Central

    Rueness, Eli Knispel; Asmyhr, Maria Gulbrandsen; Sillero-Zubiri, Claudio; Macdonald, David W.; Bekele, Afework; Atickem, Anagaw; Stenseth, Nils Chr.


    The Egyptian jackal (Canis aureus lupaster) has hitherto been considered a large, rare subspecies of the golden jackal (C. aureus). It has maintained its taxonomical status to date, despite studies demonstrating morphological similarities to the grey wolf (C. lupus). We have analyzed 2055 bp of mitochondrial DNA from C. a. lupaster and investigated the similarity to C. aureus and C. lupus. Through phylogenetic comparison with all wild wolf-like canids (based on 726 bp of the Cytochrome b gene) we conclusively (100% bootstrap support) place the Egyptian jackal within the grey wolf species complex, together with the Holarctic wolf, the Indian wolf and the Himalayan wolf. Like the two latter taxa, C. a. lupaster seems to represent an ancient wolf lineage which most likely colonized Africa prior to the northern hemisphere radiation. We thus refer to C. a. lupaster as the African wolf. Furthermore, we have detected C. a. lupaster individuals at two localities in the Ethiopian highlands, extending the distribution by at least 2,500 km southeast. The only grey wolf species to inhabit the African continent is a cryptic species for which the conservation status urgently needs assessment. PMID:21298107

  12. Evidence for cryptic speciation in Carchesium polypinum Linnaeus, 1758 (Ciliophora: Peritrichia) inferred from mitochondrial, nuclear, and morphological markers.


    Gentekaki, Eleni; Lynn, Denis H


    Protist diversity is currently a much debated issue in eukaryotic microbiology. Recent evidence suggests that morphological and genetic diversity might be decoupled in some groups of protists, including ciliates, and that these organisms might be much more diverse than their morphology implies. We sought to assess the genetic and morphological diversity of Carchesium polypinum, a widely distributed peritrich ciliate. The mitochondrial marker cytochrome c oxidase subunit I and the nuclear small subunit ribosomal RNA were used to examine genetic diversity. For the morphological assessment, live microscopy and Protargol staining were used. The mitochondrial marker revealed six robust, deeply diverging, and strongly supported clades, while the nuclear gene was congruent for three of these clades. There were no major differences among individuals from the different clades in any of the morphological features examined. Thus, the underlying genetic diversity in C. polypinum is greater than what its morphology suggests, indicating that morphology and genetics are not congruent in this organism. Furthermore, because the clades identified by the mitochondrial marker are so genetically diverse and are confirmed by a conserved nuclear marker in at least three cases, we propose that C. polypinum be designated as a "cryptic species complex." Our results provide another example where species diversity can be underestimated in microbial eukaryotes when using only morphological criteria to estimate species richness.

  13. Cryptic confounding compounds: A brief consideration of the influences of anthropogenic contaminants on courtship and mating behavior.


    Blocker, Tomica D; Ophir, Alexander G


    Contaminants, like pesticides, polychlorinated biphenyls (PCBs), dioxins and metals, are persistent and ubiquitous and are known to threaten the environment. Traditionally, scientists have considered the direct physiological risks that these contaminants pose. However, scientists have just begun to integrate ethology and toxicology to investigate the effects that contaminants have on behavior. This review considers the potential for contaminant effects on mating behavior. Here we assess the growing body of research concerning disruptions in sexual differentiation, courtship, sexual receptivity, arousal, and mating. We discuss the implications of these disruptions on conservation efforts and highlight the importance of recognizing the potential for environmental stressors to affect behavioral experimentation. More specifically, we consider the negative implications for anthropogenic contaminants to affect the immediate behavior of animals, and their potential to have cascading and/or long-term effects on the behavioral ecology and evolution of populations. Overall, we aim to raise awareness of the confounding influence that contaminants can have, and promote caution when interpreting results where the potential for cryptic affects are possible.

  14. Multilocus phylogeny and Bayesian estimates of species boundaries reveal hidden evolutionary relationships and cryptic diversity in Southeast Asian monitor lizards.


    Welton, L J; Siler, C D; Oaks, J R; Diesmos, A C; Brown, R M


    Recent conceptual, technological and methodological advances in phylogenetics have enabled increasingly robust statistical species delimitation in studies of biodiversity. As the variety of evidence purporting species diversity has increased, so too have the kinds of tools and inferential power of methods for delimiting species. Here, we showcase an organismal system for a data-rich, comparative molecular approach to evaluating strategies of species delimitation among monitor lizards of the genus Varanus. The water monitors (Varanus salvator Complex), a widespread group distributed throughout Southeast Asia and southern India, have been the subject of numerous taxonomic treatments, which have drawn recent attention due to the possibility of undocumented species diversity. To date, studies of this group have relied on purportedly diagnostic morphological characters, with no attention given to the genetic underpinnings of species diversity. Using a 5-gene data set, we estimated phylogeny and used multilocus genetic networks, analysis of population structure and a Bayesian coalescent approach to infer species boundaries. Our results contradict previous systematic hypotheses, reveal surprising relationships between island and mainland lineages and uncover novel, cryptic evolutionary lineages (i.e. new putative species). Our study contributes to a growing body of literature suggesting that, used in concert with other sources of data (e.g. morphology, ecology, biogeography), multilocus genetic data can be highly informative to systematists and biodiversity specialists when attempting to estimate species diversity and identify conservation priorities. We recommend holding in abeyance taxonomic decisions until multiple, converging lines of evidence are available to best inform taxonomists, evolutionary biologists and conservationists.

  15. Evidence of cryptic introgression in tomato (Solanum lycopersicum L.) based on wild tomato species alleles

    PubMed Central


    Background Many highly beneficial traits (e.g. disease or abiotic stress resistance) have been transferred into crops through crosses with their wild relatives. The 13 recognized species of tomato (Solanum section Lycopersicon) are closely related to each other and wild species genes have been extensively used for improvement of the crop, Solanum lycopersicum L. In addition, the lack of geographical barriers has permitted natural hybridization between S. lycopersicum and its closest wild relative Solanum pimpinellifolium in Ecuador, Peru and northern Chile. In order to better understand patterns of S. lycopersicum diversity, we sequenced 47 markers ranging in length from 130 to 1200 bp (total of 24 kb) in genotypes of S. lycopersicum and wild tomato species S. pimpinellifolium, Solanum arcanum, Solanum peruvianum, Solanum pennellii and Solanum habrochaites. Between six and twelve genotypes were comparatively analyzed per marker. Several of the markers had previously been hypothesized as carrying wild species alleles within S. lycopersicum, i.e., cryptic introgressions. Results Each marker was mapped with high confidence (e<1 x 10-30) to a single genomic location using BLASTN against tomato whole genome shotgun chromosomes (SL2.40) database. Neighbor-joining trees showed high mean bootstrap support (86.8 ± 2.34%) for distinguishing red-fruited from green-fruited taxa for 38 of the markers. Hybridization and parsimony splits networks, genomic map positions of markers relative to documented introgressions, and historical origins of accessions were used to interpret evolutionary patterns at nine markers with putatively introgressed alleles. Conclusion Of the 47 genetic markers surveyed in this study, four were involved in linkage drag on chromosome 9 during introgression breeding, while alleles at five markers apparently originated from natural hybridization with S. pimpinellifolium and were associated with primitive genotypes of S. lycopersicum. The positive

  16. Temporal Exposure of Cryptic Collagen Epitopes within Ischemic Muscle during Hindlimb Reperfusion

    PubMed Central

    Gagne, Paul J.; Tihonov, Nikita; Li, Xialou; Glaser, Joseph; Qiao, Jhenrong; Silberstein, Michael; Yee, Herman; Gagne, Elizabeth; Brooks, Peter


    Chronic limb-threatening ischemia is a devastating disease with limited surgical options. However, inducing controlled angiogenesis and enhancing reperfusion holds therapeutic promise. To gain a better understanding of the mechanisms that contribute to limb reperfusion, we examined the temporal biochemical and structural changes occurring within the extracellular matrix of ischemic skeletal muscle. Both the latent and active forms of MMP-2 and -9 significantly increased during the active phase of limb reperfusion. Moreover, small but significant alterations in tissue inhibitors of metalloproteinase levels also occurred during a similar time course, consistent with a net increase in extracellular matrix remodeling. This temporal increase in MMP activity coincided with enhanced exposure of the unique HU177 cryptic collagen epitope. Although the HUIV26 cryptic collagen epitope has been implicated in angiogenesis, little is known concerning such epitopes within ischemic muscle tissue. Here, we provide the first evidence that a functionally distinct cryptic collagen epitope (HU177) is temporally exposed in ischemic muscle tissue during the active phase of reperfusion. Interestingly, the exposure of the HU177 epitope was greatly diminished in MMP-9 null mice, corresponding with significantly reduced limb reperfusion. Therefore, the regulated exposure of a unique cryptic collagen epitope within ischemic muscle suggests an important role for collagen remodeling during the active phase of ischemic limb reperfusion. PMID:16251419

  17. Genetic diversity of a Botrytis cinerea cryptic species complex in Hungary.


    Fekete, Éva; Fekete, Erzsébet; Irinyi, László; Karaffa, Levente; Árnyasi, Mariann; Asadollahi, Mojtaba; Sándor, Erzsébet


    Botrytis cinerea has been described as a species complex containing two cryptic species, referred to as groups I and II. The first B. cinerea group I strains outside of Western Europe were collected in Hungary in 2008 from strawberry and rape plants. Sympatric B. cinerea cryptic species were analyzed using a population genetic approach and phenotypic markers. Statistically significant, but moderate population differentiation was found between the two groups in Hungary. Group I was originally typified by the lack of the transposable elements Boty and Flipper. However, all the Hungarian group I isolates carried the Boty element and one isolate additionally contained Flipper, indicating a much wider genetic variation than previously believed. Vegetative compatibility analyses showed that twelve of the thirteen B. cinerea group I isolates studied belonged to a unique vegetative compatibility group (VCG), but VCGs overlapped between groups. Phenotypic markers such as fenhexamid resistance or asexual spore size were found unsuitable to differentiate between the cryptic species. The results did not confirm the complete separation of the two cryptic species, previously determined with genealogical concordance of the phylogenetic species recognition using multiple gene sequences, and suggest instead the possibility of information exchange between them.

  18. Restricted Gene Flow among Lineages of Thrips tabaci Supports Genetic Divergence Among Cryptic Species Groups

    PubMed Central

    Jacobson, Alana L.; Nault, Brian A.; Vargo, Edward L.; Kennedy, George G.


    Knowledge of the relative influence of population- versus species-level genetic variation is important to understand patterns of phenotypic variation and ecological relationships that exist among and within morphologically indistinguishable cryptic species and subspecies. In the case of cryptic species groups that are pests, such knowledge is also essential for devising effective population management strategies. The globally important crop pest Thrips tabaci is a taxonomically difficult group of putatively cryptic species. This study examines population genetic structure of T. tabaci and reproductive isolation among lineages of this species complex using microsatellite markers and mitochondrial COI sequences. Overall, genetic structure supports T. tabaci as a cryptic species complex, although limited interbreeding occurs between different clonal groups from the same lineage as well as between individuals from different lineages. These results also provide evidence that thelytoky and arrhenotoky are not fixed phenotypes among members of different T. tabaci lineages that have been generally associated with either reproductive mode. Possible biological and ecological factors contributing to these observations are discussed. PMID:27690317

  19. Cryptic genetic variation can make "irreducible complexity" a common mode of adaptation in sexual populations.


    Trotter, Meredith V; Weissman, Daniel B; Peterson, Grant I; Peck, Kayla M; Masel, Joanna


    The existence of complex (multiple-step) genetic adaptations that are "irreducible" (i.e., all partial combinations are less fit than the original genotype) is one of the longest standing problems in evolutionary biology. In standard genetics parlance, these adaptations require the crossing of a wide adaptive valley of deleterious intermediate stages. Here, we demonstrate, using a simple model, that evolution can cross wide valleys to produce "irreducibly complex" adaptations by making use of previously cryptic mutations. When revealed by an evolutionary capacitor, previously cryptic mutants have higher initial frequencies than do new mutations, bringing them closer to a valley-crossing saddle in allele frequency space. Moreover, simple combinatorics implies an enormous number of candidate combinations exist within available cryptic genetic variation. We model the dynamics of crossing of a wide adaptive valley after a capacitance event using both numerical simulations and analytical approximations. Although individual valley crossing events become less likely as valleys widen, by taking the combinatorics of genotype space into account, we see that revealing cryptic variation can cause the frequent evolution of complex adaptations.

  20. A near-infrared spectroscopy routine for unambiguous identification of cryptic ant species

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The identification of species – of importance for most biological disciplines – is not always straightforward as cryptic species present a hurdle for traditional species discrimination. Fibre-optic near-infrared spectroscopy (NIRS) is a rapid and cheap method for a wide range of different applicatio...

  1. Population genetics of invasive Bemisia tabaci cryptic species in the United States based on microsatellite markers

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The Bemisia tabaci cryptic species complex of whiteflies contains two species, MEAM1 and MED, that are highly invasive in supportive climates the world over. In the U.S. MEAM1 occurs both in the field and in the greenhouse but MED is only found in the greenhouse. In order to make inferences about th...

  2. Population genetics of invasive Bemisia tabaci cryptic species in the United States based on microsatellite markers

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The Bemisia tabaci cryptic species complex of whiteflies contains two species, MEAM1 and MED, that are highly invasive in supportive climates the world over. In the United States MEAM1 occurs both in the field and in the greenhouse, but MED is only found in the greenhouse. In order to make inference...


    EPA Science Inventory

    D-serine inhibits growth of P. cepacia 17616; however, resistant mutants able to express an ordinarily cryptic D-serine deaminase (dsd) gene were isolated readily. The resistant strains formed high levels of a D-serine deaminase active on D-threonine as well as D-serine. IS eleme...

  4. Formal nomenclature and description of cryptic species of the Encyrtus sasakii complex (Hymenoptera: Encyrtidae)

    PubMed Central

    Wang, Ying; Zhou, Qing-Song; Qiao, Hui-Jie; Zhang, Ai-Bing; Yu, Fang; Wang, Xu-Bo; Zhu, Chao-Dong; Zhang, Yan-Zhou


    With the recent development of molecular approaches to species delimitation, a growing number of cryptic species have been discovered in what had previously been thought to be single morpho-species. Molecular methods, such as DNA barcoding, have greatly enhanced our knowledge of taxonomy, but taxonomy remains incomplete and needs a formal species nomenclature and description to facilitate its use in other scientific fields. A previous study using DNA barcoding, geometric morphometrics and mating tests revealed at least two cryptic species in the Encyrtus sasakii complex. (Hymenoptera: Encyrtidae). To describe these two new species formally (Encyrtus eulecaniumiae sp. nov. and Encyrtus rhodococcusiae sp. nov.), a detailed morphometric study of Encyrtus spp. was performed in addition to the molecular analysis and evaluation of biological data. Morphometric analyses, a multivariate ratio analysis (MRA) and a geometric morphometric analysis (GMA) revealed a great number of differences between the species, but reliable characteristics were not observed for diagnosing the cryptic species. We thus diagnosed these three Encyrtus species on the basis of the characteristics that resulted from genetic markers (mitochondrial cytochrome c oxidase subunit I and nuclear 28S rRNA) and biological data. A formal nomenclature and description of cryptic species was provided on the basis of an integrated taxonomy. PMID:27698441

  5. First report of Persimmon cryptic virus and Persimmon virus A in Korea

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In 2014, a total of 77 persimmon (Diospyros kaki Thunb.) trees from Korean commercial persimmon orchards were surveyed for Persimmon cryptic virus (PeCV) and Persimmon virus A (PeVA). Leaf samples were collected from symptomatic trees with necrosis (two), or mosaic and leaf malformations (one) and 7...

  6. Cryptic species diversity in sub-Antarctic islands: A case study of Lepidonotothen.


    Dornburg, Alex; Federman, Sarah; Eytan, Ron I; Near, Thomas J


    The marine fauna of the Southern Ocean is well known for an impressive adaptive radiation of fishes, the notothenioids. However, when compared to other marine areas, the frigid waters of the Southern Ocean also contain a seemingly large proportion of cryptic species. The documented instances of speciation in the absence of morphological change are largely observed in invertebrate taxa, in particular around peri- and sub-Antarctic islands such as South Georgia, which has been dubbed a cryptic species hotspot. This prevalence of cryptic species raises the question of how generalizable these patterns are for Antarctic vertebrates. Here we examine aspects of genotype and phenotype in an Antarctic notothenioid fish species, Lepidonotothen nudifrons, which is distributed in near shore habitats of the Antarctic Peninsula, South Orkney Islands, South Georgia, and the South Sandwich Islands. The results of our analyses show that L. nudifrons comprises two species. We highlight that cryptic species are phenomena not restricted to invertebrate lineages, raising the possibility that the species diversity of notothenioids and other Southern Ocean fishes is under-described. In addition, our findings raise several questions about the evolutionary origin and maintenance of morphological stasis in one of the most extreme habitats on earth.

  7. Cryptic genetic variation can make "irreducible complexity" a common mode of adaptation in sexual populations.


    Trotter, Meredith V; Weissman, Daniel B; Peterson, Grant I; Peck, Kayla M; Masel, Joanna


    The existence of complex (multiple-step) genetic adaptations that are "irreducible" (i.e., all partial combinations are less fit than the original genotype) is one of the longest standing problems in evolutionary biology. In standard genetics parlance, these adaptations require the crossing of a wide adaptive valley of deleterious intermediate stages. Here, we demonstrate, using a simple model, that evolution can cross wide valleys to produce "irreducibly complex" adaptations by making use of previously cryptic mutations. When revealed by an evolutionary capacitor, previously cryptic mutants have higher initial frequencies than do new mutations, bringing them closer to a valley-crossing saddle in allele frequency space. Moreover, simple combinatorics implies an enormous number of candidate combinations exist within available cryptic genetic variation. We model the dynamics of crossing of a wide adaptive valley after a capacitance event using both numerical simulations and analytical approximations. Although individual valley crossing events become less likely as valleys widen, by taking the combinatorics of genotype space into account, we see that revealing cryptic variation can cause the frequent evolution of complex adaptations. PMID:25178652

  8. Through thick and thin: cryptic sympatric speciation in the submersed genus Najas (Hydrocharitaceae).


    Les, Donald H; Peredo, Elena L; King, Ursula M; Benoit, Lori K; Tippery, Nicholas P; Ball, Cassandra J; Shannon, Robynn K


    Cryptic sympatric species arise when reproductive isolation is established in sympatry, leading to genetically divergent lineages that are highly similar morphologically or virtually indistinguishable. Although cryptic sympatric species have been reported in various animals, fungi, and protists, there are few compelling examples for plants. This investigation presents a case for cryptic sympatric speciation in Najas flexilis, a widespread aquatic plant, which extends throughout northern North America and Eurasia. The taxon is noted for its variable seed morphology, which earlier research associated with cytotypes; i.e., diploids were characterized by thicker seeds and tetraploids by thinner seeds. However, cytotypes are not patterned geographically with diploid and tetraploid plants often found in close proximity within the same lake. Using digital image and DNA sequence analyses, we found that diploids and tetraploids are well-isolated and remain genetically distinct throughout their sympatric range, where sterile hybrids occur frequently. Incorporation of sequence data from the single-copy nuclear phytoene desaturase locus revealed further that the tetraploids are allopolyploid derivatives of N. flexilis and N. guadalupensis, the latter a closely related species with an overlapping distribution. We conclude that the taxon widely known as N. flexilis actually comprises two cryptic, sibling species, which diverged in sympatry by interspecific hybridization and subsequent chromosomal isolation. By comparing seed morphology of type specimens, we associated the names N. flexilis and N. canadensis to the diploids and tetraploids respectively. Additionally, the narrowly restricted taxon known formerly as N. muenscheri is shown via morphological and genetic evidence to be synonymous with N. canadensis.

  9. Genetic diversity of a Botrytis cinerea cryptic species complex in Hungary.


    Fekete, Éva; Fekete, Erzsébet; Irinyi, László; Karaffa, Levente; Árnyasi, Mariann; Asadollahi, Mojtaba; Sándor, Erzsébet


    Botrytis cinerea has been described as a species complex containing two cryptic species, referred to as groups I and II. The first B. cinerea group I strains outside of Western Europe were collected in Hungary in 2008 from strawberry and rape plants. Sympatric B. cinerea cryptic species were analyzed using a population genetic approach and phenotypic markers. Statistically significant, but moderate population differentiation was found between the two groups in Hungary. Group I was originally typified by the lack of the transposable elements Boty and Flipper. However, all the Hungarian group I isolates carried the Boty element and one isolate additionally contained Flipper, indicating a much wider genetic variation than previously believed. Vegetative compatibility analyses showed that twelve of the thirteen B. cinerea group I isolates studied belonged to a unique vegetative compatibility group (VCG), but VCGs overlapped between groups. Phenotypic markers such as fenhexamid resistance or asexual spore size were found unsuitable to differentiate between the cryptic species. The results did not confirm the complete separation of the two cryptic species, previously determined with genealogical concordance of the phylogenetic species recognition using multiple gene sequences, and suggest instead the possibility of information exchange between them. PMID:22130648

  10. Cryptic speciation in the Acari: a function of species lifestyles or our ability to separate species?

    Technology Transfer Automated Retrieval System (TEKTRAN)

    There are approximately 55,000 described Acari species, accounting for almost half of all known Arachnida species, but total estimated Acari diversity is reckoned to be far greater. One important source of currently hidden Acari diversity is cryptic speciation, which poses challenges to taxonomists ...

  11. Molecular species identification of cryptic apple and snowberry maggots (Diptera: Tephritidae) in Western and Central Washington

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In Washington state, identification of the quarantine apple pest Rhagoletis pomonella (Walsh) is complicated by the presence of the cryptic species R. zephyria Snow (Diptera: Tephritidae). Distinguishing the two flies is important because there is a zero tolerance policy for R. pomonella in apple p...

  12. Recent Advances in Conformal Gravity

    NASA Astrophysics Data System (ADS)

    O'Brien, James; Chaykov, Spasen


    In recent years, significant advances have been made in alternative gravitational theories. Although MOND remains the leading candidate among the alternative models, Conformal Gravity has been studied by Mannheim and O'Brien to solve the rotation curve problem without the need for dark matter. Recently, Mannheim, O'Brien and Chaykov have begun solving other gravitational questions in Conformal Gravity. In this presentation, we highlight the new work of Conformal Gravity's application to random motions of clusters (the original Zwicky problem), gravitational bending of light, gravitational lensing and a very recent survey of dwarf galaxy rotation curves. We will show in each case that Conformal Gravity can provide an accurate explanation and prediction of the data without the need for dark matter. Coupled with the fact that Conformal Gravity is a fully re-normalizable metric theory of gravity, these results help to push Conformal Gravity onto a competitive stage against other alternative models.

  13. Fermion-scalar conformal blocks


    Iliesiu, Luca; Kos, Filip; Poland, David; Pufu, Silviu S.; Simmons-Duffin, David; Yacoby, Ran


    In this study, we compute the conformal blocks associated with scalar-scalar-fermionfermion 4-point functions in 3D CFTs. Together with the known scalar conformal blocks, our result completes the task of determining the so-called ‘seed blocks’ in three dimensions. In addition, conformal blocks associated with 4-point functions of operators with arbitrary spins can now be determined from these seed blocks by using known differential operators.

  14. Killing and conformal Killing tensors

    NASA Astrophysics Data System (ADS)

    Heil, Konstantin; Moroianu, Andrei; Semmelmann, Uwe


    We introduce an appropriate formalism in order to study conformal Killing (symmetric) tensors on Riemannian manifolds. We reprove in a simple way some known results in the field and obtain several new results, like the classification of conformal Killing 2-tensors on Riemannian products of compact manifolds, Weitzenböck formulas leading to non-existence results, and construct various examples of manifolds with conformal Killing tensors.

  15. Phylogeography of the dark kangaroo mouse, Microdipodops megacephalus: cryptic lineages and dispersal routes in North America's Great Basin.


    Hafner, John C; Upham, Nathan S


    AIM: The rodent genus Microdipodops (kangaroo mice) includes two sand-obligate endemics of the Great Basin Desert: M. megacephalus and M. pallidus. The dark kangaroo mouse, M. megacephalus, is distributed throughout the Great Basin and our principal aims were to formulate phylogenetic hypotheses for this taxon and make phylogeographical comparisons with its congener. LOCATION: The Great Basin Desert of western North America. METHODS: DNA sequence data from three mitochondrial genes were examined from 186 individuals of M. megacephalus, representing 47 general localities. Phylogenetic inference was used to analyse the sequence data. Directional analysis of phylogeographical patterns was used to examine haplotype sharing patterns and recover routes of gene exchange. Haplotype-area curves were constructed to evaluate the relationship between genetic variation and distributional island size for M. megacephalus and M. pallidus. RESULTS: Microdipodops megacephalus is a rare desert rodent (trapping success was 2.67%). Temporal comparison of trapping data shows that kangaroo mice are becoming less abundant in the study area. The distribution has changed slightly since the 1930s but many northern populations now appear to be small, fragmented, or locally extinct. Four principal phylogroups (the Idaho isolate and the western, central and eastern clades) are evident; mean sequence divergence between phylogroups for cytochrome b is c. 8%. Data from haplotype sharing show two trends: a north-south trend and a web-shaped trend. Analyses of haplotype-area curves reveal significant positive relationships. MAIN CONCLUSIONS: The four phylogroups of M. megacephalus appear to represent morphologically cryptic species; in comparison, a companion study revealed two cryptic lineages in M. pallidus. Estimated divergence times of the principal clades of M. megacephalus (c. 2-4 Ma) indicate that these kangaroo mice were Pleistocene invaders into the Great Basin coincident with the formation

  16. Phylogeography of the dark kangaroo mouse, Microdipodops megacephalus: cryptic lineages and dispersal routes in North America's Great Basin.


    Hafner, John C; Upham, Nathan S


    AIM: The rodent genus Microdipodops (kangaroo mice) includes two sand-obligate endemics of the Great Basin Desert: M. megacephalus and M. pallidus. The dark kangaroo mouse, M. megacephalus, is distributed throughout the Great Basin and our principal aims were to formulate phylogenetic hypotheses for this taxon and make phylogeographical comparisons with its congener. LOCATION: The Great Basin Desert of western North America. METHODS: DNA sequence data from three mitochondrial genes were examined from 186 individuals of M. megacephalus, representing 47 general localities. Phylogenetic inference was used to analyse the sequence data. Directional analysis of phylogeographical patterns was used to examine haplotype sharing patterns and recover routes of gene exchange. Haplotype-area curves were constructed to evaluate the relationship between genetic variation and distributional island size for M. megacephalus and M. pallidus. RESULTS: Microdipodops megacephalus is a rare desert rodent (trapping success was 2.67%). Temporal comparison of trapping data shows that kangaroo mice are becoming less abundant in the study area. The distribution has changed slightly since the 1930s but many northern populations now appear to be small, fragmented, or locally extinct. Four principal phylogroups (the Idaho isolate and the western, central and eastern clades) are evident; mean sequence divergence between phylogroups for cytochrome b is c. 8%. Data from haplotype sharing show two trends: a north-south trend and a web-shaped trend. Analyses of haplotype-area curves reveal significant positive relationships. MAIN CONCLUSIONS: The four phylogroups of M. megacephalus appear to represent morphologically cryptic species; in comparison, a companion study revealed two cryptic lineages in M. pallidus. Estimated divergence times of the principal clades of M. megacephalus (c. 2-4 Ma) indicate that these kangaroo mice were Pleistocene invaders into the Great Basin coincident with the formation

  17. Reflections on conformal spectra

    NASA Astrophysics Data System (ADS)

    Kim, Hyungrok; Kravchuk, Petr; Ooguri, Hirosi


    We use modular invariance and crossing symmetry of conformal field theory to reveal approximate reflection symmetries in the spectral decompositions of the partition function in two dimensions in the limit of large central charge and of the four-point function in any dimension in the limit of large scaling dimensions Δ0 of external operators. We use these symmetries to motivate universal upper bounds on the spectrum and the operator product expansion coefficients, which we then derive by independent techniques. Some of the bounds for four-point functions are valid for finite Δ0 as well as for large Δ0. We discuss a similar symmetry in a large spacetime dimension limit. Finally, we comment on the analogue of the Cardy formula and sparse light spectrum condition for the four-point function.

  18. Capturing Chromosome Conformation

    NASA Astrophysics Data System (ADS)

    Dekker, Job; Rippe, Karsten; Dekker, Martijn; Kleckner, Nancy


    We describe an approach to detect the frequency of interaction between any two genomic loci. Generation of a matrix of interaction frequencies between sites on the same or different chromosomes reveals their relative spatial disposition and provides information about the physical properties of the chromatin fiber. This methodology can be applied to the spatial organization of entire genomes in organisms from bacteria to human. Using the yeast Saccharomyces cerevisiae, we could confirm known qualitative features of chromosome organization within the nucleus and dynamic changes in that organization during meiosis. We also analyzed yeast chromosome III at the G1 stage of the cell cycle. We found that chromatin is highly flexible throughout. Furthermore, functionally distinct AT- and GC-rich domains were found to exhibit different conformations, and a population-average 3D model of chromosome III could be determined. Chromosome III emerges as a contorted ring.

  19. Protective CD4 T cells targeting cryptic epitopes of Mycobacterium tuberculosis resist infection-driven terminal differentiation.


    Woodworth, Joshua S; Aagaard, Claus Sindbjerg; Hansen, Paul R; Cassidy, Joseph P; Agger, Else Marie; Andersen, Peter


    CD4 T cells are crucial to the control of Mycobacterium tuberculosis infection and are a key component of current vaccine strategies. Conversely, immune-mediated pathology drives disease, and recent evidence suggests that adaptive and innate responses are evolutionarily beneficial to M. tuberculosis. We compare the functionality of CD4 T cell responses mounted against dominant and cryptic epitopes of the M. tuberculosis 6-kDa early secreted Ag (ESAT-6) before and postinfection. Protective T cells against cryptic epitopes not targeted during natural infection were induced by vaccinating mice with a truncated ESAT-6 protein, lacking the dominant epitope. The ability to generate T cells that recognize multiple cryptic epitopes was MHC-haplotype dependent, including increased potential via heterologous MHC class II dimers. Before infection, cryptic epitope-specific T cells displayed enhanced proliferative capacity and delayed cytokine kinetics. After aerosol M. tuberculosis challenge, vaccine-elicited CD4 T cells expanded and recruited to the lung. In chronic infection, dominant epitope-specific T cells developed a terminal differentiated KLRG1(+)/PD-1(lo) surface phenotype that was significantly reduced in the cryptic epitope-specific T cell populations. Dominant epitope-specific T cells in vaccinated animals developed into IFN-γ- and IFN-γ,TNF-α-coproducing effector cells, characteristic of the endogenous response. In contrast, cryptic epitope-specific CD4 T cells maintained significantly greater IFN-γ(+)TNF-α(+)IL-2(+) and TNF-α(+)IL-2(+) memory-associated polyfunctionality and enhanced proliferative capacity. Vaccine-associated IL-17A production by cryptic CD4 T cells was also enhanced, but without increased neutrophilia/pathology. Direct comparison of dominant/cryptic epitope-specific CD4 T cells within covaccinated mice confirmed the superior ability of protective cryptic epitope-specific T cells to resist M. tuberculosis infection-driven T cell

  20. Energy Conservation.

    ERIC Educational Resources Information Center

    Land, Amy A.

    This selection of class activities involves a sequence of 10 class sessions. The goal of the collection is to aid students in learning the concepts of energy conservation and to put this knowledge into practice. Attention is also given to the development of alternate energy sources. Each lesson includes an activity title, motivational hints,…

  1. [Conservation Units.

    ERIC Educational Resources Information Center

    Texas Education Agency, Austin.

    Instructional units deal with each aspect of conservation: forests, wildlife, rangelands, water, minerals, and soil. The area of the secondary school curriculum with which each is correlated is indicated. Lists of general and specific objectives are followed by suggested teaching procedures, including ideas for introducing the topic, questions to…

  2. [Conservation Units.

    ERIC Educational Resources Information Center

    Texas Education Agency, Austin.

    Each of the six instructional units deals with one aspect of conservation: forests, water, rangeland, minerals (petroleum), and soil. The area of the elementary school curriculum with which each correlates is indicated. Lists of general and specific objectives are followed by suggested teaching procedures, including ideas for introducing the…

  3. Colorful Conservation

    ERIC Educational Resources Information Center

    Skophammer, Karen


    Some people only think about conservation on Earth Day. Being in the "art business" however, this author is always conscious of the many products she thinks get wasted when they could be reused, recycled, and restored--especially in a school building and art room. In this article, she describes an art lesson that allows students to paint…

  4. Variation in Phenotype, Parasite Load and Male Competitive Ability across a Cryptic Hybrid Zone

    PubMed Central

    Stuart-Fox, Devi; Godinho, Raquel; Goüy de Bellocq, Joëlle; Irwin, Nancy R.; Brito, José Carlos; Moussalli, Adnan; Široký, Pavel; Hugall, Andrew F.; Baird, Stuart J. E.


    Background Molecular genetic studies are revealing an increasing number of cryptic lineages or species, which are highly genetically divergent but apparently cannot be distinguished morphologically. This observation gives rise to three important questions: 1) have these cryptic lineages diverged in phenotypic traits that may not be obvious to humans; 2) when cryptic lineages come into secondary contact, what are the evolutionary consequences: stable co-existence, replacement, admixture or differentiation and 3) what processes influence the evolutionary dynamics of these secondary contact zones? Methodology/Principal Findings To address these questions, we first tested whether males of the Iberian lizard Lacerta schreiberi from two highly genetically divergent, yet morphologically cryptic lineages on either side of an east-west secondary contact could be differentiated based on detailed analysis of morphology, coloration and parasite load. Next, we tested whether these differences could be driven by pre-copulatory intra-sexual selection (male-male competition). Compared to eastern males, western males had fewer parasites, were in better body condition and were more intensely coloured. Although subtle environmental variation across the hybrid zone could explain the differences in parasite load and body condition, these were uncorrelated with colour expression, suggesting that the differences in coloration reflect heritable divergence. The lineages did not differ in their aggressive behaviour or competitive ability. However, body size, which predicted male aggressiveness, was positively correlated with the colour traits that differed between genetic backgrounds. Conclusions/Significance Our study confirms that these cryptic lineages differ in several aspects that are likely to influence fitness. Although there were no clear differences in male competitive ability, our results suggest a potential indirect role for intra-sexual selection. Specifically, if lizards use

  5. Imatinib (Gleevec@) conformations observed in single crystals, protein-Imatinib co-crystals and molecular dynamics: Implications for drug selectivity

    NASA Astrophysics Data System (ADS)

    Golzarroshan, B.; Siddegowda, M. S.; Li, Hong qi; Yathirajan, H. S.; Narayana, B.; Rathore, R. S.


    Structure and dynamics of the Leukemia drug, Imatinib, were examined using X-ray crystallography and molecular dynamics studies. Comparison of conformations observed in single crystals with several reported co-crystals of protein-drug complexes suggests existence of two conserved conformations of Imatinib, extended and compact (or folded), corresponding to two binding modes of interaction with the receptor. Furthermore, these conformations are conserved throughout a dynamics simulation. The present study attempts to draw a parallel on conformations and binding patterns of interactions, obtained from small-molecule single-crystal and macromolecule co-crystal studies, and provides structural insights for understanding the high selectivity of this drug molecule.

  6. Replacement between conformity and counter-conformity in consumption decisions.


    Chou, Ting-Jui; Chang, En-Chung; Dai, Qi; Wong, Veronica


    This study assessed, in a Chinese context, how self-esteem interacts with perceived similarity and uniqueness to yield cognitive dissonance, and whether the dissonance leads to self-reported conformity or counter-conformity behavior. Participants were 408 respondents from 4 major Chinese cities (M age = 33.0 yr., SD = 4.3; 48% men). Self-perceptions of uniqueness, similarity, cognitive dissonance, self-esteem and need to behave in conformity or counter-conformity were measured. A theoretical model was assessed in four situations, relating the ratings of self-esteem and perceived similarity/uniqueness to the way other people at a wedding were dressed, and the resultant cognitive dissonance and conformity/ counter-conformity behavior. Regardless of high or low self-esteem, all participants reported cognitive dissonance when they were told that they were dressed extremely similarly to or extremely differently from the other people attending the wedding. However, the conforming/counter-conforming strategies used by participants to resolve the cognitive dissonance differed. When encountering dissonance induced by the perceived extreme uniqueness of dress, participants with low self-esteem tended to say they would dress next time so as to conform with the way others were dressed, while those with high self-esteem indicated they would continue their counter-conformity in attire. When encountering dissonance induced by the perceived extreme similarity to others, both those with high and low self-esteem tended to say they would dress in an unorthodox manner to surprise other people in the future. PMID:23654033

  7. Replacement between conformity and counter-conformity in consumption decisions.


    Chou, Ting-Jui; Chang, En-Chung; Dai, Qi; Wong, Veronica


    This study assessed, in a Chinese context, how self-esteem interacts with perceived similarity and uniqueness to yield cognitive dissonance, and whether the dissonance leads to self-reported conformity or counter-conformity behavior. Participants were 408 respondents from 4 major Chinese cities (M age = 33.0 yr., SD = 4.3; 48% men). Self-perceptions of uniqueness, similarity, cognitive dissonance, self-esteem and need to behave in conformity or counter-conformity were measured. A theoretical model was assessed in four situations, relating the ratings of self-esteem and perceived similarity/uniqueness to the way other people at a wedding were dressed, and the resultant cognitive dissonance and conformity/ counter-conformity behavior. Regardless of high or low self-esteem, all participants reported cognitive dissonance when they were told that they were dressed extremely similarly to or extremely differently from the other people attending the wedding. However, the conforming/counter-conforming strategies used by participants to resolve the cognitive dissonance differed. When encountering dissonance induced by the perceived extreme uniqueness of dress, participants with low self-esteem tended to say they would dress next time so as to conform with the way others were dressed, while those with high self-esteem indicated they would continue their counter-conformity in attire. When encountering dissonance induced by the perceived extreme similarity to others, both those with high and low self-esteem tended to say they would dress in an unorthodox manner to surprise other people in the future.

  8. Conformal gravity and time

    NASA Astrophysics Data System (ADS)

    Hazboun, Jeffrey Shafiq


    Cartan geometry provides a rich formalism from which to look at various geometrically motivated extensions to general relativity. In this manuscript, we start by motivating reasons to extend the theory of general relativity. We then introduce the reader to our technique, called the quotient manifold method, for extending the geometry of spacetime. We will specifically look at the class of theories formed from the various quotients of the conformal group. Starting with the conformal symmetries of Euclidean space, we construct a manifold where time manifests as a part of the geometry. Though there is no matter present in the geome- try studied here, geometric terms analogous to dark energy and dark matter appear when we write down the Einstein tensor. Specifically, the quotient of the conformal group of Euclidean four-space by its Weyl subgroup results in a geometry possessing many of the properties of relativistic phase space, including both a natural symplectic form and nondegenerate Killing metric. We show the general solution possesses orthogonal Lagrangian submanifolds, with the induced metric and the spin connection on the submanifolds necessarily Lorentzian, despite the Euclidean starting point. By examining the structure equations of the biconformal space in an orthonormal frame adapted to its phase space properties, we also find two new tensor fields exist in this geometry, not present in Riemannian geometry. The first is a combination of the Weyl vector with the scale factor on the metric, and determines the time-like directions on the submanifolds. The second comes from the components of the spin connection, symmetric with respect to the new metric. Though this field comes from the spin connection, it transforms ho- mogeneously. Finally, we show in the absence of Cartan curvature or sources, the configuration space has geometric terms equivalent to a perfect fluid and a cosmological constant. We complete the analysis of this homogeneous space by

  9. Conformal Transformations and Space Travel.


    Gupta, S N


    Conformal transformations are applied to the motion of a space ship experiencing a constant acceleration. The role of proper time is interpreted in terms of atomic periods, and the relationship between the conformal transformations and the general theory of relativity is clarified.

  10. Counselor Identity: Conformity or Distinction?

    ERIC Educational Resources Information Center

    McLaughlin, Jerry E.; Boettcher, Kathryn


    The authors explore 3 debates in other disciplines similar to counseling's identity debate in order to learn about common themes and outcomes. Conformity, distinction, and cohesion emerged as common themes. They conclude that counselors should retain their distinctive, humanistic approach rather than conforming to the dominant, medical approach.

  11. [Conformal radiotherapy: principles and classification].


    Rosenwald, J C; Gaboriaud, G; Pontvert, D


    'Conformal radiotherapy' is the name fixed by usage and given to a new form of radiotherapy resulting from the technological improvements observed during, the last ten years. While this terminology is now widely used, no precise definition can be found in the literature. Conformal radiotherapy refers to an approach in which the dose distribution is more closely 'conformed' or adapted to the actual shape of the target volume. However, the achievement of a consensus on a more specific definition is hampered by various difficulties, namely in characterizing the degree of 'conformality'. We have therefore suggested a classification scheme be established on the basis of the tools and the procedures actually used for all steps of the process, i.e., from prescription to treatment completion. Our classification consists of four levels: schematically, at level 0, there is no conformation (rectangular fields); at level 1, a simple conformation takes place, on the basis of conventional 2D imaging; at level 2, a 3D reconstruction of the structures is used for a more accurate conformation; and level 3 includes research and advanced dynamic techniques. We have used our personal experience, contacts with colleagues and data from the literature to analyze all the steps of the planning process, and to define the tools and procedures relevant to a given level. The corresponding tables have been discussed and approved at the European level within the Dynarad concerted action. It is proposed that the term 'conformal radiotherapy' be restricted to procedures where all steps are at least at level 2.

  12. Taxonomic circumscription of Adenomera martinezi (Bokermann, 1956) (Anura: Leptodactylidae: Leptodactylinae) with the recognition of a new cryptic taxon through a bioacoustic approach.


    De Carvalho, Thiago Ribeiro; Giaretta, Ariovaldo Antonio


    In this paper, we provide a taxonomic circumscription of Adenomera martinezi from its type locality (Cachimbo, southwestern State of Pará) since its description (57 years ago) based on a newly collected series of eleven adult topotypes, and through a bioacoustic approach, recognize an undescribed cryptic taxon under this nominal species, which is widely distributed in central and northern Brazil. Adenomera martinezi and Adenomera saci sp. nov. can be diagnosed from all congeners by their distinctive 4-6 symmetrically arranged rows of longitudinal dark-colored spots on dorsum. They differ from each other through advertisement call structure, pulsed in Adenomera martinezi (audibly pulsed to the human ear), and non-pulsed in Adenomera saci sp. nov. (a whistle to the human ear). The recognition of Adenomera saci sp. nov. has conservation implications. Based on our assumed distribution of A. martinezi and A denomera saci sp. nov., the IUCN conservation status of A. martinezi requires a reassessment, inasmuch as we herein reconsider this species, as far as we know, as endemic to Cachimbo, southwestern State of Pará, Brazil. The 2004 extinction risk assessment included both A. martinezi and Adenomera saci sp. nov., and the conservation status category of 'Least Concern' might only be applied to Adenomera saci sp. nov., a widely distributed and abundant species in central and northern Brazil.

  13. Heron conservation

    USGS Publications Warehouse

    Kushlan, J.A.; Hafner, H.


    Herons are large, popular and, in many cases, spectacular birds found in wetlands world-wide, both tropical and temperate, natural and man-made. Some populations are very small and localized, some have decreased, some have expanded their ranges, and a few are pests of human activities. In the fifteen years since the publication of the latest monographic treatment of the family, The Herons Handbook, there has been a tremendous increase in our knowledge of heron status and conservation requirements, set against a backdrop of increasing concern about the future of the world?s wetland habitats. This book provides a comprehensive update following two distinct threads. The status and conservation needs of herons are first presented on a regional basis, in a series of chapters set at a continental or subcontinental scale. Over 200 biologists and heron conservationists have contributed to the data summarized here, and the very latest census and survey results provide the most up-to-date and detailed picture of heron populations currently available. Chapters discussing several critical issues in heron conservation follow, tending to focus on the international nature of the problems.

  14. Activation of a cryptic splice site in the growth hormone receptor associated with growth hormone insensitivity syndrome in a genetic isolate of Laron Syndrome

    SciTech Connect

    Schiavi, A.; Bartlett, R.; Brown, M.


    Laron syndrome (LS) is a rare, autosomal recessive disease found worldwide. Despite various ethnic differences, all patients with LS described display classic dysmorphic features and extreme short stature due to defects in the growth hormone receptor (GHR). The vast majority of these patients are sporadic occurrences resulting from consanguineous matings; however, an Ecuadorian genetic isolate of LS has been reported. Our investigations have identified a genetic isolate of LS of Anglo Saxon origin. Seven individuals, by all clinical and biochemical criteria, have LS. As a result of extensive review of family and medical histories we have constructed a pedigree tracing the lineage of our affected patients through the 17th century. No GHR gross deletions were detected using an exon-specific PCR assay developed in our laboratory. Previous molecular analyses have identified mutations in exons 2-7 in numerous patients with classical LS. Single strand conformational polymorphism (SSCP) analysis was performed on GHR exons 2-7, and a marked conformational shift was noted in exon 7. Cycle sequencing of exon 7 from three affected individuals, and from four first-degree relatives, revealed a C{r_arrow}T transition at position 766 of the cDNA, and a heterozygous C{r_arrow}T transition at the identical position in the obligate carriers studied. This mutation is predicted to activate a cryptic donor splice site 63 base pairs upstream from the 3{prime} end of exon 7, effectively truncating the GHR cDNA without changing the reading frame. The resultant GHR protein is shortened by a proposed 21 amino acids. The identification and conformation of this mutation not only identifies a novel mutation in the GHR, and the first to be described in LS patients of English descent, but also allows for comparisons between genotypes and phenotypes in an inbred population.

  15. Conformal Fermi Coordinates

    SciTech Connect

    Dai, Liang; Pajer, Enrico; Schmidt, Fabian E-mail:


    Fermi Normal Coordinates (FNC) are a useful frame for isolating the locally observable, physical effects of a long-wavelength spacetime perturbation. Their cosmological application, however, is hampered by the fact that they are only valid on scales much smaller than the horizon. We introduce a generalization that we call Conformal Fermi Coordinates (CFC). CFC preserve all the advantages of FNC, but in addition are valid outside the horizon. They allow us to calculate the coupling of long- and short-wavelength modes on all scales larger than the sound horizon of the cosmological fluid, starting from the epoch of inflation until today, by removing the complications of the second order Einstein equations to a large extent, and eliminating all gauge ambiguities. As an application, we present a calculation of the effect of long-wavelength tensor modes on small scale density fluctuations. We recover previous results, but clarify the physical content of the individual contributions in terms of locally measurable effects and ''projection'' terms.

  16. Dynamics of protein conformations

    NASA Astrophysics Data System (ADS)

    Stepanova, Maria


    A novel theoretical methodology is introduced to identify dynamic structural domains and analyze local flexibility in proteins. The methodology employs a multiscale approach combining identification of essential collective coordinates based on the covariance analysis of molecular dynamics trajectories, construction of the Mori projection operator with these essential coordinates, and analysis of the corresponding generalized Langevin equations [M.Stepanova, Phys.Rev.E 76(2007)051918]. Because the approach employs a rigorous theory, the outcomes are physically transparent: the dynamic domains are associated with regions of relative rigidity in the protein, whereas off-domain regions are relatively soft. This also allows scoring the flexibility in the macromolecule with atomic-level resolution [N.Blinov, M.Berjanskii, D.S.Wishart, and M.Stepanova, Biochemistry, 48(2009)1488]. The applications include the domain coarse-graining and characterization of conformational stability in protein G and prion proteins. The results are compared with published NMR experiments. Potential applications for structural biology, bioinformatics, and drug design are discussed.

  17. Cloning vectors based on cryptic plasmids isolated from lactic acid bacteria: their characteristics and potential applications in biotechnology.


    Shareck, Julie; Choi, Young; Lee, Byong; Miguez, Carlos B


    Lactic acid bacteria (LAB) are Gram positive bacteria, widely distributed in nature, and industrially important as they are used in a variety of industrial food fermentations. The use of genetic engineering techniques is an effective means of enhancing the industrial applicability of LAB. However, when using genetic engineering technology, safety becomes an essential factor for the application of improved LAB to the food industry. Cloning and expression systems should be derived preferably from LAB cryptic plasmids that generally encode genes for which functions can be proposed, but no phenotypes can be observed. However, some plasmid-encoded functions have been discovered in cryptic plasmids originating from Lactobacillus, Streptococcus thermophilus, and Pediococcus spp. and can be used as selective marker systems in vector construction. This article presents information concerning LAB cryptic plasmids, and their structures, functions, and applications. A total of 134 cryptic plasmids collated are discussed.

  18. Nest Construction by a Ground-nesting Bird Represents a Potential Trade-off Between Egg Crypticity and Thermoregulation

    EPA Science Inventory

    Predation selects against conspicuous colors in bird eggs and nests, while thermoregulatory constraints select for nest building behavior that regulates incubation temperatures. We present results that reveal a trade-off between nest crypticity and thermoregulation of eggs base...

  19. CD4+ T Cells Targeting Dominant and Cryptic Epitopes from Bacillus anthracis Lethal Factor.


    Ascough, Stephanie; Ingram, Rebecca J; Chu, Karen K Y; Musson, Julie A; Moore, Stephen J; Gallagher, Theresa; Baillie, Les; Williamson, Ethel D; Robinson, John H; Maillere, Bernard; Boyton, Rosemary J; Altmann, Daniel M


    Anthrax is an endemic infection in many countries, particularly in the developing world. The causative agent, Bacillus anthracis, mediates disease through the secretion of binary exotoxins. Until recently, research into adaptive immunity targeting this bacterial pathogen has largely focused on the humoral response to these toxins. There is, however, growing recognition that cellular immune responses involving IFNγ producing CD4+ T cells also contribute significantly to a protective memory response. An established concept in adaptive immunity to infection is that during infection of host cells, new microbial epitopes may be revealed, leading to immune recognition of so called 'cryptic' or 'subdominant' epitopes. We analyzed the response to both cryptic and immunodominant T cell epitopes derived from the toxin component lethal factor and presented by a range of HLA-DR alleles. Using IFNγ-ELISpot assays we characterized epitopes that elicited a response following immunization with synthetic peptide and the whole protein and tested their capacities to bind purified HLA-DR molecules in vitro. We found that DR1 transgenics demonstrated T cell responses to a greater number of domain III cryptic epitopes than other HLA-DR transgenics, and that this pattern was repeated with the immunodominant epitopes, as a greater proportion of these epitopes induced a T cell response when presented within the context of the whole protein. Immunodominant epitopes LF457-476 and LF467-487 were found to induce a T cell response to the peptide, as well as to the whole native LF protein in DR1 and DR15, but not in DR4 transgenics. The analysis of Domain I revealed the presence of several unique cryptic epitopes all of which showed a strong to moderate relative binding affinity to HLA-DR4 molecules. However, none of the cryptic epitopes from either domain III or I displayed notably high binding affinities across all HLA-DR alleles assayed. These responses were influenced by the specific HLA

  20. Towards conformal loop quantum gravity

    NASA Astrophysics Data System (ADS)

    H-T Wang, Charles


    A discussion is given of recent developments in canonical gravity that assimilates the conformal analysis of gravitational degrees of freedom. The work is motivated by the problem of time in quantum gravity and is carried out at the metric and the triad levels. At the metric level, it is shown that by extending the Arnowitt-Deser-Misner (ADM) phase space of general relativity (GR), a conformal form of geometrodynamics can be constructed. In addition to the Hamiltonian and Diffeomorphism constraints, an extra first class constraint is introduced to generate conformal transformations. This phase space consists of York's mean extrinsic curvature time, conformal three-metric and their momenta. At the triad level, the phase space of GR is further enlarged by incorporating spin-gauge as well as conformal symmetries. This leads to a canonical formulation of GR using a new set of real spin connection variables. The resulting gravitational constraints are first class, consisting of the Hamiltonian constraint and the canonical generators for spin-gauge and conformorphism transformations. The formulation has a remarkable feature of being parameter-free. Indeed, it is shown that a conformal parameter of the Barbero-Immirzi type can be absorbed by the conformal symmetry of the extended phase space. This gives rise to an alternative approach to loop quantum gravity that addresses both the conceptual problem of time and the technical problem of functional calculus in quantum gravity.

  1. A topological and conformational stability alphabet for multipass membrane proteins.


    Feng, Xiang; Barth, Patrick


    Multipass membrane proteins perform critical signal transduction and transport across membranes. How transmembrane helix (TMH) sequences encode the topology and conformational flexibility regulating these functions remains poorly understood. Here we describe a comprehensive analysis of the sequence-structure relationships at multiple interacting TMHs from all membrane proteins with structures in the Protein Data Bank (PDB). We found that membrane proteins can be deconstructed in interacting TMH trimer units, which mostly fold into six distinct structural classes of topologies and conformations. Each class is enriched in recurrent sequence motifs from functionally unrelated proteins, revealing unforeseen consensus and evolutionary conserved networks of stabilizing interhelical contacts. Interacting TMHs' topology and local protein conformational flexibility were remarkably well predicted in a blinded fashion from the identified binding-hotspot motifs. Our results reveal universal sequence-structure principles governing the complex anatomy and plasticity of multipass membrane proteins that may guide de novo structure prediction, design, and studies of folding and dynamics. PMID:26780406

  2. Logarithmic conformal field theory

    NASA Astrophysics Data System (ADS)

    Gainutdinov, Azat; Ridout, David; Runkel, Ingo


    Conformal field theory (CFT) has proven to be one of the richest and deepest subjects of modern theoretical and mathematical physics research, especially as regards statistical mechanics and string theory. It has also stimulated an enormous amount of activity in mathematics, shaping and building bridges between seemingly disparate fields through the study of vertex operator algebras, a (partial) axiomatisation of a chiral CFT. One can add to this that the successes of CFT, particularly when applied to statistical lattice models, have also served as an inspiration for mathematicians to develop entirely new fields: the Schramm-Loewner evolution and Smirnov's discrete complex analysis being notable examples. When the energy operator fails to be diagonalisable on the quantum state space, the CFT is said to be logarithmic. Consequently, a logarithmic CFT is one whose quantum space of states is constructed from a collection of representations which includes reducible but indecomposable ones. This qualifier arises because of the consequence that certain correlation functions will possess logarithmic singularities, something that contrasts with the familiar case of power law singularities. While such logarithmic singularities and reducible representations were noted by Rozansky and Saleur in their study of the U (1|1) Wess-Zumino-Witten model in 1992, the link between the non-diagonalisability of the energy operator and logarithmic singularities in correlators is usually ascribed to Gurarie's 1993 article (his paper also contains the first usage of the term 'logarithmic conformal field theory'). The class of CFTs that were under control at this time was quite small. In particular, an enormous amount of work from the statistical mechanics and string theory communities had produced a fairly detailed understanding of the (so-called) rational CFTs. However, physicists from both camps were well aware that applications from many diverse fields required significantly more


    SciTech Connect

    Randall S. Seright


    This technical progress report describes work performed from June 20 through December 19, 2001, for the project, ''Conformance Improvement Using Gels''. Interest has increased in some new polymeric products that purport to substantially reduce permeability to water while causing minimum permeability reduction to oil. In view of this interest, we are currently studying BJ's Aqua Con. Results from six corefloods revealed that the Aqua Con gelant consistently reduced permeability to water more than that to oil. However, the magnitude of the disproportionate permeability reduction varied significantly for the various experiments. Thus, as with most materials tested to date, the issue of reproducibility and control of the disproportionate permeability remains to be resolved. Concern exists about the ability of gels to resist washout after placement in fractures. We examined whether a width constriction in the middle of a fracture would cause different gel washout behavior upstream versus downstream of the constriction. Tests were performed using a formed Cr(III)-acetate-HPAM gel in a 48-in.-long fracture with three sections of equal length, but with widths of 0.08-, 0.02-, and 0.08-in., respectively. The pressure gradients during gel extrusion (i.e., placement) were similar in the two 0.08-in.-wide fracture sections, even though they were separated by a 0.02-in.-wide fracture section. The constriction associated with the middle fracture section may have inhibited gel washout during the first pulse of brine injection after gel placement. However, during subsequent phases of brine injection, the constriction did not inhibit washout in the upstream fracture section any more than in the downstream section.

  4. Cryptic variation in morphological evolution: HSP90 as a capacitor for loss of eyes in cavefish.


    Rohner, Nicolas; Jarosz, Dan F; Kowalko, Johanna E; Yoshizawa, Masato; Jeffery, William R; Borowsky, Richard L; Lindquist, Susan; Tabin, Clifford J


    In the process of morphological evolution, the extent to which cryptic, preexisting variation provides a substrate for natural selection has been controversial. We provide evidence that heat shock protein 90 (HSP90) phenotypically masks standing eye-size variation in surface populations of the cavefish Astyanax mexicanus. This variation is exposed by HSP90 inhibition and can be selected for, ultimately yielding a reduced-eye phenotype even in the presence of full HSP90 activity. Raising surface fish under conditions found in caves taxes the HSP90 system, unmasking the same phenotypic variation as does direct inhibition of HSP90. These results suggest that cryptic variation played a role in the evolution of eye loss in cavefish and provide the first evidence for HSP90 as a capacitor for morphological evolution in a natural setting.

  5. Cryptic variation in morphological evolution: HSP90 as a capacitor for loss of eyes in cavefish.


    Rohner, Nicolas; Jarosz, Dan F; Kowalko, Johanna E; Yoshizawa, Masato; Jeffery, William R; Borowsky, Richard L; Lindquist, Susan; Tabin, Clifford J


    In the process of morphological evolution, the extent to which cryptic, preexisting variation provides a substrate for natural selection has been controversial. We provide evidence that heat shock protein 90 (HSP90) phenotypically masks standing eye-size variation in surface populations of the cavefish Astyanax mexicanus. This variation is exposed by HSP90 inhibition and can be selected for, ultimately yielding a reduced-eye phenotype even in the presence of full HSP90 activity. Raising surface fish under conditions found in caves taxes the HSP90 system, unmasking the same phenotypic variation as does direct inhibition of HSP90. These results suggest that cryptic variation played a role in the evolution of eye loss in cavefish and provide the first evidence for HSP90 as a capacitor for morphological evolution in a natural setting. PMID:24337296

  6. Amplification of phytochrome induced morphogenesis in plants by the cryptic red light signal (CRS)

    PubMed Central

    Narayanaswamy, Guruprasad Kadur


    The regulation of endogenous levels of ascorbic acid in soybean by far-red absorbing form of phytochrome (Pfr) and by cryptic red light signal (CRS) was studied. Cryptic red light signal is produced by red light pre-irradiation of a photoreceptor other than far-red absorbing form of phytochrome (Pfr) and CRS amplifies the action of phytochrome. The endogenous level of ascorbic acid levels enhanced by phytochrome was amplified by CRS. The lifetime of CRS was from 0 to 2 h and the peak of enhancement of ascorbic acid due to CRS was between 16 to 24 h of dark incubation after the end of the treatment. CRS was found to be ineffective on UV-B enhanced endogenous levels of ascorbic acid. PMID:19816105

  7. Conformational Landscape of Nicotinoids: Solving the "conformational - Rity" of Anabasine

    NASA Astrophysics Data System (ADS)

    Lesarri, Alberto; Cocinero, Emilio J.; Evangelisti, Luca; Suenram, Richard D.; Caminati, Walther; Grabow, Jens-Uwe


    The conformational landscape of the alkaloid anabasine (neonicotine) has been investigated using rotational spectroscopy and ab initio calculations. The results allow a detailed comparison of the structural properties of the prototype piperidinic and pyrrolidinic nicotinoids (anabasine vs. nicotine). Anabasine adopts two most stable conformations in isolation conditions, for which we determined accurate rotational and nuclear quadrupole coupling parameters. The preferred conformations are characterized by an equatorial pyridine moiety and additional N-H equatorial stereochemistry at the piperidine ring (Eq-Eq). The two rings of anabasine are close to a bisecting arrangement, with the observed conformations differing in a ca. 180° rotation of the pyridine subunit, denoted either Syn or Anti. The preference of anabasine for the Eq-Eq-Syn conformation has been established by relative intensity measurements (Syn/Anti˜5(2)). The conformational preferences of free anabasine are directed by a N\\cdot\\cdot\\cdotH-C weak hydrogen bond interaction between the nitrogen lone pair at piperidine and the closest hydrogen bond in pyridine, with N\\cdot\\cdot\\cdotN distances ranging from 4.750 Å (Syn) to 4.233 Å (Anti). R. J. Lavrich, R. D. Suenram, D. F. Plusquellic and S. Davis, 58^th OSU Int. Symp. on Mol. Spectrosc., Columbus, OH, 2003, Comm. RH13.

  8. Energy Conservation

    SciTech Connect

    Simpson, P.


    There are two fundamental reasons or motivations for energy conservation: (1) economics; and (2) consideration of energy - its sources and availability. Economics speaks for itself and needs little explanation: a project is undertaken, the cost is recovered in a given period of time (we hope) and our company realizes cost savings thereafter. We study and propose a project; we estimate the payback. If approved, we implement the project. Then, we eagerly watch for its effectiveness - for the proposed payback. The second consideration in regard to energy conservation might - in the foreseeable future - become by far the most important - that of availability. Very knowledgeable persons have stated that this - in reality - is the most serious problem facing our nation today. Readily available, reasonably priced energy has given to the US the high form of living experienced today. An interruption in this flow could catapult our nation in an awesome catastrophe. The energy shortage of the late 70`s might be a forerunner of such an experience.

  9. Conservative Remapper


    Conservative Remapper (CORE) is a C++ language software library for remapping cell masses and cell-averaged densities on unstructured two dimensional grids, maintaining conservation of total mass in the process. CORE contains implementation of two remapping algorithms: a new, efficient "swept region" algorithm, and a more traditional algorithm basedon the computation of cell intersections. Grids may be Cartesian or cylindrical, and cells may have three or more vertices, with no upper limit. CORE can run inmore » serial and in parallel, but in order to achieve wide applicability, CORE used no particular parallel communication library. Instead it achieves parallel communication through strategically placed, user defined callbacks. Users can also provide callbacks to redefine different parts or subcomponents of the remapping process. CORE allows the use of different data types, e.g. single-, double-, and quadruple- precision floating-point numbers, through the use of C++ templates. Using CORE is simple, and requires no configuration scripts or makefiles.« less

  10. Arboreal Ant Colonies as ‘Hot-Points’ of Cryptic Diversity for Myrmecophiles: The Weaver Ant Camponotus sp. aff. textor and Its Interaction Network with Its Associates

    PubMed Central

    Pérez-Lachaud, Gabriela; Lachaud, Jean-Paul


    Introduction Systematic surveys of macrofaunal diversity within ant colonies are lacking, particularly for ants nesting in microhabitats that are difficult to sample. Species associated with ants are generally small and rarely collected organisms, which makes them more likely to be unnoticed. We assumed that this tendency is greater for arthropod communities in microhabitats with low accessibility, such as those found in the nests of arboreal ants that may constitute a source of cryptic biodiversity. Materials and Methods We investigated the invertebrate diversity associated with an undescribed, but already threatened, Neotropical Camponotus weaver ant. As most of the common sampling methods used in studies of ant diversity are not suited for evaluating myrmecophile diversity within ant nests, we evaluated the macrofauna within ant nests through exhaustive colony sampling of three nests and examination of more than 80,000 individuals. Results We identified invertebrates from three classes belonging to 18 taxa, some of which were new to science, and recorded the first instance of the co-occurrence of two brood parasitoid wasp families attacking the same ant host colony. This diversity of ant associates corresponded to a highly complex interaction network. Agonistic interactions prevailed, but the prevalence of myrmecophiles was remarkably low. Conclusions Our data support the hypothesis of the evolution of low virulence in a variety of symbionts associated with large insect societies. Because most myrmecophiles found in this work are rare, strictly specific, and exhibit highly specialized biology, the risk of extinction for these hitherto unknown invertebrates and their natural enemies is high. The cryptic, far unappreciated diversity within arboreal ant nests in areas at high risk of habitat loss qualifies these nests as ‘hot-points’ of biodiversity that urgently require special attention as a component of conservation and management programs. PMID:24941047

  11. Cryptic Diversity in Indo-Pacific Coral-Reef Fishes Revealed by DNA-Barcoding Provides New Support to the Centre-of-Overlap Hypothesis

    PubMed Central

    Hubert, Nicolas; Meyer, Christopher P.; Bruggemann, Henrich J.; Guérin, Fabien; Komeno, Roberto J. L.; Espiau, Benoit; Causse, Romain; Williams, Jeffrey T.; Planes, Serge


    Diversity in coral reef fishes is not evenly distributed and tends to accumulate in the Indo-Malay-Philippines Archipelago (IMPA). The comprehension of the mechanisms that initiated this pattern is in its infancy despite its importance for the conservation of coral reefs. Considering the IMPA either as an area of overlap or a cradle of marine biodiversity, the hypotheses proposed to account for this pattern rely on extant knowledge about taxonomy and species range distribution. The recent large-scale use of standard molecular data (DNA barcoding), however, has revealed the importance of taking into account cryptic diversity when assessing tropical biodiversity. We DNA barcoded 2276 specimens belonging to 668 coral reef fish species through a collaborative effort conducted concomitantly in both Indian and Pacific oceans to appraise the importance of cryptic diversity in species with an Indo-Pacific distribution range. Of the 141 species sampled on each side of the IMPA, 62 presented no spatial structure whereas 67 exhibited divergent lineages on each side of the IMPA with K2P distances ranging between 1% and 12%, and 12 presented several lineages with K2P distances ranging between 3% and 22%. Thus, from this initial pool of 141 nominal species with Indo-Pacific distribution, 79 dissolved into 165 biological units among which 162 were found in a single ocean. This result is consistent with the view that the IMPA accumulates diversity as a consequence of its geological history, its location on the junction between the two main tropical oceans and the presence of a land bridge during glacial times in the IMPA that fostered allopatric divergence and secondary contacts between the Indian and Pacific oceans. PMID:22438862

  12. Duality of force laws and conformal transformations

    NASA Astrophysics Data System (ADS)

    Kothawala, Dawood


    As was first noted by Isaac Newton, the two most famous ellipses of classical mechanics, arising from the force laws F ∝r and F ∝1/r2, can be mapped onto each other by changing the location of the center of force. Less well known is that this mapping can also be achieved by the complex transformation, z →z2. We derive this result and its generalization by writing the Gaussian curvature in its covariant form, and then changing the metric by a conformal transformation which mimics this mapping of the curves. We indicate how the conserved Laplace-Runge-Lenz vector for the 1/r2 force law transforms under this transformation, and compare it with the corresponding quantities for the linear force law. Our main aim is to present this duality by introducing concepts from differential geometry.

  13. Evidence for cryptic speciation in directly transmitted gyrodactylid parasites of Trinidadian guppies.


    Xavier, Raquel; Faria, Patricia J; Paladini, Giuseppe; van Oosterhout, Cock; Johnson, Mireille; Cable, Jo


    Cryptic species complexes are common among parasites, which tend to have large populations and are subject to rapid evolution. Such complexes may arise through host-parasite co-evolution and/or host switching. For parasites that reproduce directly on their host, there might be increased opportunities for sympatric speciation, either by exploiting different hosts or different micro-habitats within the same host. The genus Gyrodactylus is a specious group of viviparous monogeneans. These ectoparasites transfer between teleosts during social contact and cause significant host mortality. Their impact on the guppy (Poecilia reticulata), an iconic evolutionary and ecological model species, is well established and yet the population genetics and phylogenetics of these parasites remains understudied. Using mtDNA sequencing of the host and its parasites, we provide evidence of cryptic speciation in Gyrodactylus bullatarudis, G. poeciliae and G. turnbulli. For the COII gene, genetic divergence of lineages within each parasite species ranged between 5.7 and 17.2%, which is typical of the divergence observed between described species in this genus. Different lineages of G. turnbulli and G. poeciliae appear geographically isolated, which could imply allopatric speciation. In addition, for G. poeciliae, co-evolution with a different host species cannot be discarded due to its host range. This parasite was originally described on P. caucana, but for the first time here it is also recorded on the guppy. The two cryptic lineages of G. bullatarudis showed considerable geographic overlap. G. bullatarudis has a known wide host range and it can also utilize a killifish (Anablepsoides hartii) as a temporary host. This killifish is capable of migrating overland and it could act as a transmission vector between otherwise isolated populations. Additional genetic markers are needed to confirm the presence of these cryptic Gyrodactylus species complexes, potentially leading to more in

  14. Temperature effects on gametophyte life-history traits and geographic distribution of two cryptic kelp species.


    Oppliger, L Valeria; Correa, Juan A; Engelen, Aschwin H; Tellier, Florence; Vieira, Vasco; Faugeron, Sylvain; Valero, Myriam; Gomez, Gonzalo; Destombe, Christophe


    A major determinant of the geographic distribution of a species is expected to be its physiological response to changing abiotic variables over its range. The range of a species often corresponds to the geographic extent of temperature regimes the organism can physiologically tolerate. Many species have very distinct life history stages that may exhibit different responses to environmental factors. In this study we emphasized the critical role of the haploid microscopic stage (gametophyte) of the life cycle to explain the difference of edge distribution of two related kelp species. Lessonia nigrescens was recently identified as two cryptic species occurring in parapatry along the Chilean coast: one located north and the other south of a biogeographic boundary at latitude 29-30°S. Six life history traits from microscopic stages were identified and estimated under five treatments of temperature in eight locations distributed along the Chilean coast in order to (1) estimate the role of temperature in the present distribution of the two cryptic L. nigrescens species, (2) compare marginal populations to central populations of the two cryptic species. In addition, we created a periodic matrix model to estimate the population growth rate (λ) at the five temperature treatments. Differential tolerance to temperature was demonstrated between the two species, with the gametophytes of the Northern species being more tolerant to higher temperatures than gametophytes from the south. Second, the two species exhibited different life history strategies with a shorter haploid phase in the Northern species contrasted with considerable vegetative growth in the Southern species haploid stage. These results provide strong ecological evidence for the differentiation process of the two cryptic species and show local adaptation of the life cycle at the range limits of the distribution. Ecological and evolutionary implications of these findings are discussed.

  15. Widespread prevalence of cryptic Symbiodinium D in the key Caribbean reef builder, Orbicella annularis

    NASA Astrophysics Data System (ADS)

    Kennedy, Emma V.; Foster, Nicola L.; Mumby, Peter J.; Stevens, Jamie R.


    Symbiodinium D, a relatively rare clade of algal endosymbiont with a global distribution, has attracted interest as some of its sub-cladal types induce increased thermal tolerance and associated trade-offs, including reduced growth rate in its coral hosts. Members of Symbiodinium D are increasingly reported to comprise low-abundance `cryptic' (<10 %) proportions of mixed coral endosymbiont communities, with unknown ecological implications. Real-time PCR (RT-PCR) targeted to specific types is sufficiently sensitive to detect these background symbiont levels. In this study, RT-PCR was employed to screen 552 colonies of the key Caribbean reef builder Orbicella annularis sampled across a 5.4 million km2 range for the presence of cryptic Symbiodinium `D1' (i.e., the principal Caribbean ITS2 variants, D1 and D1-4). All but one out of 33 populations analysed were shown to host low abundances of Symbiodinium D1, with an average of >30 % of corals per site found to harbour the symbiont. When the same samples were analysed using the conventional screening technique, denaturing gradient gel electrophoresis, Symbiodinium D1 was only detected in 12 populations and appeared to be hosted by <12 % of colonies where present (in agreement with other reported low prevalence/absences in O. annularis). Cryptic Symbiodinium D1 showed a mainly uniform distribution across the wider Caribbean region, although significantly more Mesoamerican Barrier Reef corals hosted cryptic Symbiodinium D1 than might be expected by chance, possibly as a consequence of intense warming in the region in 1998. Widespread prevalence of thermally tolerant Symbiodinium in O. annularis may potentially reflect a capacity for the coral to temporarily respond to warming events through symbiont shuffling. However, association with reduced coral calcification means that the ubiquitous nature of Symbiodinium D1 in O. annularis populations is unlikely to prevent long-term declines in reef health, at a time when

  16. Temperature Effects on Gametophyte Life-History Traits and Geographic Distribution of Two Cryptic Kelp Species

    PubMed Central

    Oppliger, L. Valeria; Correa, Juan A.; Engelen, Aschwin H.; Tellier, Florence; Vieira, Vasco; Faugeron, Sylvain; Valero, Myriam; Gomez, Gonzalo; Destombe, Christophe


    A major determinant of the geographic distribution of a species is expected to be its physiological response to changing abiotic variables over its range. The range of a species often corresponds to the geographic extent of temperature regimes the organism can physiologically tolerate. Many species have very distinct life history stages that may exhibit different responses to environmental factors. In this study we emphasized the critical role of the haploid microscopic stage (gametophyte) of the life cycle to explain the difference of edge distribution of two related kelp species. Lessonia nigrescens was recently identified as two cryptic species occurring in parapatry along the Chilean coast: one located north and the other south of a biogeographic boundary at latitude 29–30°S. Six life history traits from microscopic stages were identified and estimated under five treatments of temperature in eight locations distributed along the Chilean coast in order to (1) estimate the role of temperature in the present distribution of the two cryptic L. nigrescens species, (2) compare marginal populations to central populations of the two cryptic species. In addition, we created a periodic matrix model to estimate the population growth rate (λ) at the five temperature treatments. Differential tolerance to temperature was demonstrated between the two species, with the gametophytes of the Northern species being more tolerant to higher temperatures than gametophytes from the south. Second, the two species exhibited different life history strategies with a shorter haploid phase in the Northern species contrasted with considerable vegetative growth in the Southern species haploid stage. These results provide strong ecological evidence for the differentiation process of the two cryptic species and show local adaptation of the life cycle at the range limits of the distribution. Ecological and evolutionary implications of these findings are discussed. PMID:22723987

  17. Isolation of eight microsatellite markers from Moina macrocopa for assessing cryptic genetic structure in the wild.


    Tatsuta, Haruki; Yao, Izumi; Tanaka, Yoshinari


    We isolated eight polymorphic microsatellite loci from the zooplankton Moina macrocopa (Straus), which is sensitive to pollutants such as insecticides and heavy metals. The isolated loci were polymorphic, with three to seven alleles among 23 individuals. Expected heterozygosities ranged from 0.167 to 0.787. These loci can be used to examine cryptic genetic structure and to infer the connectivity among metapopulations. PMID:21564785

  18. Evidence for Cryptic Speciation in Directly Transmitted Gyrodactylid Parasites of Trinidadian Guppies

    PubMed Central

    Xavier, Raquel; Faria, Patricia J.; Paladini, Giuseppe; van Oosterhout, Cock; Johnson, Mireille; Cable, Jo


    Cryptic species complexes are common among parasites, which tend to have large populations and are subject to rapid evolution. Such complexes may arise through host-parasite co-evolution and/or host switching. For parasites that reproduce directly on their host, there might be increased opportunities for sympatric speciation, either by exploiting different hosts or different micro-habitats within the same host. The genus Gyrodactylus is a specious group of viviparous monogeneans. These ectoparasites transfer between teleosts during social contact and cause significant host mortality. Their impact on the guppy (Poecilia reticulata), an iconic evolutionary and ecological model species, is well established and yet the population genetics and phylogenetics of these parasites remains understudied. Using mtDNA sequencing of the host and its parasites, we provide evidence of cryptic speciation in Gyrodactylus bullatarudis, G. poeciliae and G. turnbulli. For the COII gene, genetic divergence of lineages within each parasite species ranged between 5.7 and 17.2%, which is typical of the divergence observed between described species in this genus. Different lineages of G. turnbulli and G. poeciliae appear geographically isolated, which could imply allopatric speciation. In addition, for G. poeciliae, co-evolution with a different host species cannot be discarded due to its host range. This parasite was originally described on P. caucana, but for the first time here it is also recorded on the guppy. The two cryptic lineages of G. bullatarudis showed considerable geographic overlap. G. bullatarudis has a known wide host range and it can also utilize a killifish (Anablepsoides hartii) as a temporary host. This killifish is capable of migrating overland and it could act as a transmission vector between otherwise isolated populations. Additional genetic markers are needed to confirm the presence of these cryptic Gyrodactylus species complexes, potentially leading to more in

  19. "Nested" cryptic diversity in a widespread marine ecosystem engineer: a challenge for detecting biological invasions

    PubMed Central


    Background Ecosystem engineers facilitate habitat formation and enhance biodiversity, but when they become invasive, they present a critical threat to native communities because they can drastically alter the receiving habitat. Management of such species thus needs to be a priority, but the poorly resolved taxonomy of many ecosystem engineers represents a major obstacle to correctly identifying them as being either native or introduced. We address this dilemma by studying the sea squirt Pyura stolonifera, an important ecosystem engineer that dominates coastal communities particularly in the southern hemisphere. Using DNA sequence data from four independently evolving loci, we aimed to determine levels of cryptic diversity, the invasive or native status of each regional population, and the most appropriate sampling design for identifying the geographic ranges of each evolutionary unit. Results Extensive sampling in Africa, Australasia and South America revealed the existence of "nested" levels of cryptic diversity, in which at least five distinct species can be further subdivided into smaller-scale genetic lineages. The ranges of several evolutionary units are limited by well-documented biogeographic disjunctions. Evidence for both cryptic native diversity and the existence of invasive populations allows us to considerably refine our view of the native versus introduced status of the evolutionary units within Pyura stolonifera in the different coastal communities they dominate. Conclusions This study illustrates the degree of taxonomic complexity that can exist within widespread species for which there is little taxonomic expertise, and it highlights the challenges involved in distinguishing between indigenous and introduced populations. The fact that multiple genetic lineages can be native to a single geographic region indicates that it is imperative to obtain samples from as many different habitat types and biotic zones as possible when attempting to identify the

  20. Two Large, Related, Cryptic Plasmids from Geographically Distinct Isolates of Sulfobacillus thermotolerans▿†

    PubMed Central

    Deane, S. M.; Rawlings, D. E.


    Two large cryptic plasmids (59.2 and 65.9 kb) from isolates of Sulfobacillus thermotolerans from Yellowstone National Park (United States) and the Caribbean island of Montserrat were isolated and sequenced. This analysis revealed a common “backbone” region coding for a potential plasmid stability system plus a nonpheromone conjugation system containing homologues of both type IV and type II (tight adherence, or Tad-like) secretion systems. PMID:21926204

  1. Adhesion of marine cryptic Escherichia isolates to human intestinal epithelial cells

    PubMed Central

    Vignaroli, Carla; Sante, Laura Di; Magi, Gloria; Luna, Gian Marco; Di Cesare, Andrea; Pasquaroli, Sonia; Facinelli, Bruna; Biavasco, Francesca


    Five distinct cryptic lineages (clades I–V) have recently been recognized in the Escherichia genus. The five clades encompass strains that are phenotypically and taxonomically indistinguishable from Escherichia coli sensu stricto; however, scant data are available on their ecology, virulence and pathogenic properties. In this study 20 cryptic E. coli strains isolated from marine sediments were investigated to gain insights into their virulence characteristics and genetic traits. The ability to adhere to intestinal cells was highest among clade V strains, which also harbored the genes involved in gut colonization as well as the genes (pduC and eut operon) typically found in environmentally adapted E. coli strains. The pduC gene was significantly associated with clade V. Multilocus sequence typing of three representative clade V isolates revealed new sequence types (STs) and showed that the strains shared two allelic loci (adk 51 and recA 37). Our findings suggest that cryptic Escherichia lineages are common in coastal marine sediments and that this habitat may be suitable for their growth and persistence outside the host. On the other hand, detection in clade V strains of a gene repertoire and adhesion properties similar to those of intestinal pathogenic strains could indicate their potential virulence. It could be argued that there is a dual nature of cryptic clade V strains, where the ability to survive and persist in a secondary habitat does not involve the loss of the host-associated lifestyle. Clade V could be a group of closely related, environmentally adapted E. coli strains. PMID:25216085

  2. Adhesion of marine cryptic Escherichia isolates to human intestinal epithelial cells.


    Vignaroli, Carla; Di Sante, Laura; Magi, Gloria; Luna, Gian Marco; Di Cesare, Andrea; Pasquaroli, Sonia; Facinelli, Bruna; Biavasco, Francesca


    Five distinct cryptic lineages (clades I-V) have recently been recognized in the Escherichia genus. The five clades encompass strains that are phenotypically and taxonomically indistinguishable from Escherichia coli sensu stricto; however, scant data are available on their ecology, virulence and pathogenic properties. In this study 20 cryptic E. coli strains isolated from marine sediments were investigated to gain insights into their virulence characteristics and genetic traits. The ability to adhere to intestinal cells was highest among clade V strains, which also harbored the genes involved in gut colonization as well as the genes (pduC and eut operon) typically found in environmentally adapted E. coli strains. The pduC gene was significantly associated with clade V. Multilocus sequence typing of three representative clade V isolates revealed new sequence types (STs) and showed that the strains shared two allelic loci (adk 51 and recA 37). Our findings suggest that cryptic Escherichia lineages are common in coastal marine sediments and that this habitat may be suitable for their growth and persistence outside the host. On the other hand, detection in clade V strains of a gene repertoire and adhesion properties similar to those of intestinal pathogenic strains could indicate their potential virulence. It could be argued that there is a dual nature of cryptic clade V strains, where the ability to survive and persist in a secondary habitat does not involve the loss of the host-associated lifestyle. Clade V could be a group of closely related, environmentally adapted E. coli strains.

  3. Opening a can of worms: unprecedented sympatric cryptic diversity within British lumbricid earthworms.


    King, R Andrew; Tibble, Amy L; Symondson, William O C


    Earthworms play a major role in many aspects of soil fertility, food web ecology and ecosystem functioning, and hence are frequently the subjects of, for example, ecological and toxicological research. Our aim was to examine the genetic structure of common earthworm species, to identify cryptic lineages or species that may be distinct ecotypes or biotypes (and hence confound current research based upon morphotypes) and to try to explain the massive cryptic diversity that eventually emerged. We demonstrated that species such as Allolobophora chlorotica, Aporrectodea longa, Aporrectodea rosea and Lumbricus rubellus all comprise highly divergent lineages with species-level divergence at the mitochondrial cytochrome oxidase I (COI) gene. In Allo. chlorotica alone, we found 55 haplotypes for COI, with 35 of these being found in pink and 20 in green morph worms. There were no cases of the two colour morphs sharing COI haplotypes. Phylogenetic analyses of mitochondrial COI and 16S genes showed the presence of five highly divergent lineages, suggesting the presence of multiple cryptic species within Allo. chlorotica. There was no clear geographical pattern to lineage distribution and many populations were polymorphic for both mitochondrial DNA lineage and colour morph. Amplified fragment length polymorphism results, based on two primer combinations, were broadly congruent with mitochondrial DNA results with one significant exception. Despite showing over 14% divergence at COI, amplified fragment length polymorphism markers showed that the two green morph lineages may be interbreeding and therefore represent a single taxon. The cryptic diversity revealed by these results has profound consequences for all areas of earthworm research.

  4. Logarithmic conformal field theory

    NASA Astrophysics Data System (ADS)

    Gainutdinov, Azat; Ridout, David; Runkel, Ingo


    Conformal field theory (CFT) has proven to be one of the richest and deepest subjects of modern theoretical and mathematical physics research, especially as regards statistical mechanics and string theory. It has also stimulated an enormous amount of activity in mathematics, shaping and building bridges between seemingly disparate fields through the study of vertex operator algebras, a (partial) axiomatisation of a chiral CFT. One can add to this that the successes of CFT, particularly when applied to statistical lattice models, have also served as an inspiration for mathematicians to develop entirely new fields: the Schramm-Loewner evolution and Smirnov's discrete complex analysis being notable examples. When the energy operator fails to be diagonalisable on the quantum state space, the CFT is said to be logarithmic. Consequently, a logarithmic CFT is one whose quantum space of states is constructed from a collection of representations which includes reducible but indecomposable ones. This qualifier arises because of the consequence that certain correlation functions will possess logarithmic singularities, something that contrasts with the familiar case of power law singularities. While such logarithmic singularities and reducible representations were noted by Rozansky and Saleur in their study of the U (1|1) Wess-Zumino-Witten model in 1992, the link between the non-diagonalisability of the energy operator and logarithmic singularities in correlators is usually ascribed to Gurarie's 1993 article (his paper also contains the first usage of the term 'logarithmic conformal field theory'). The class of CFTs that were under control at this time was quite small. In particular, an enormous amount of work from the statistical mechanics and string theory communities had produced a fairly detailed understanding of the (so-called) rational CFTs. However, physicists from both camps were well aware that applications from many diverse fields required significantly more


    SciTech Connect

    Randall S. Seright


    This report describes work performed during the third and final year of the project, ''Conformance Improvement Using Gels.'' Corefloods revealed throughput dependencies of permeability reduction by polymers and gels that were much more prolonged during oil flow than water flow. This behavior was explained using simple mobility ratio arguments. A model was developed that quantitatively fits the results and predicts ''clean up'' times for oil productivity when production wells are returned to service after application of a polymer or gel treatment. X-ray computed microtomography studies of gels in strongly water-wet Berea sandstone and strongly oil-wet porous polyethylene suggested that oil penetration through gel-filled pores occurs by a gel-dehydration mechanism, rather than gel-ripping or gel-displacement mechanisms. In contrast, analysis of data from the University of Kansas suggests that the gel-ripping or displacement mechanisms are more important in more permeable, strongly water-wet sandpacks. These findings help to explain why aqueous gels can reduce permeability to water more than to oil under different conditions. Since cement is the most commonly used material for water shutoff, we considered when gels are preferred over cements. Our analysis and experimental results indicated that cement cannot be expected to completely fill (top to bottom) a vertical fracture of any width, except near the wellbore. For vertical fractures with apertures less than 4 mm, the cement slurry will simply not penetrate very far into the fracture. For vertical fractures with apertures greater than 4 mm, the slurry may penetrate a substantial distance into the bottom part of the fracture. However, except near the wellbore, the upper part of the fracture will remain open due to gravity segregation. We compared various approaches to plugging fractures using gels, including (1) varying polymer content, (2) varying placement (extrusion) rate, (3) using partially formed gels, (4


    SciTech Connect

    Randall S. Seright


    This technical progress report describes work performed from September 1, 2003, through February 29, 2004, for the project, ''Conformance Improvement Using Gels.'' We examined the properties of several ''partially formed'' gels that were formulated with a combination of high and low molecular weight HPAM polymers. After placement in 4-mm-wide fractures, these gels required about 25 psi/ft for brine to breach the gel (the best performance to date in fractures this wide). After this breach, stabilized residual resistance factors decreased significantly with increased flow rate. Also, residual resistance factors were up to 9 times greater for water than for oil. Nevertheless, permeability reduction factors were substantial for both water and oil flow. Gel with 2.5% chopped fiberglass effectively plugged 4-mm-wide fractures if a 0.5-mm-wide constriction was present. The ability to screen-out at a constriction appears crucial for particulate incorporation to be useful in plugging fractures. In addition to fiberglass, we examined incorporation of polypropylene fibers into gels. Once dispersed in brine or gelant, the polypropylene fibers exhibited the least gravity segregation of any particulate that we have tested to date. In fractures with widths of at least 2 mm, 24-hr-old gels (0.5% high molecular weight HPAM) with 0.5% fiber did not exhibit progressive plugging during placement and showed extrusion pressure gradients similar to those of gels without the fiber. The presence of the fiber roughly doubled the gel's resistance to first breach by brine flow. The breaching pressure gradients were not as large as for gels made with high and low molecular weight polymers (mentioned above). However, their material requirements and costs (i.e., polymer and/or particulate concentrations) were substantially lower than for those gels. A partially formed gel made with 0.5% HPAM did not enter a 0.052-mm-wide fracture when applying a pressure gradient of 65 psi/ft. This result

  7. Radial coordinates for conformal blocks

    NASA Astrophysics Data System (ADS)

    Hogervorst, Matthijs; Rychkov, Slava


    We develop the theory of conformal blocks in CFTd expressing them as power series with Gegenbauer polynomial coefficients. Such series have a clear physical meaning when the conformal block is analyzed in radial quantization: individual terms describe contributions of descendants of a given spin. Convergence of these series can be optimized by a judicious choice of the radial quantization origin. We argue that the best choice is to insert the operators symmetrically. We analyze in detail the resulting “ρ-series” and show that it converges much more rapidly than for the commonly used variable z. We discuss how these conformal block representations can be used in the conformal bootstrap. In particular, we use them to derive analytically some bootstrap bounds whose existence was previously found numerically.

  8. Conformal mapping of rectangular heptagons

    SciTech Connect

    Bogatyrev, Andrei B


    A new effective approach to calculating the direct and inverse conformal mapping of rectangular polygons onto a half-plane is put forward; it is based on the use of Riemann theta functions. Bibliography: 14 titles.

  9. Lattice Simulations and Infrared Conformality


    Appelquist, Thomas; Fleming, George T.; Lin, Meifeng; Neil, Ethan T.; Schaich, David A


    We examine several recent lattice-simulation data sets, asking whether they are consistent with infrared conformality. We observe, in particular, that for an SU(3) gauge theory with 12 Dirac fermions in the fundamental representation, recent simulation data can be described assuming infrared conformality. Lattice simulations include a fermion mass m which is then extrapolated to zero, and we note that this data can be fit by a small-m expansion, allowing a controlled extrapolation. We also note that the conformal hypothesis does not work well for two theories that are known or expected to be confining and chirally broken, and that itmore » does work well for another theory expected to be infrared conformal.« less

  10. Solution NMR conformation of glycosaminoglycans.


    Pomin, Vitor H


    Nuclear magnetic resonance (NMR) spectroscopy has been giving a pivotal contribution to the progress of glycomics, mostly by elucidating the structural, dynamical, conformational and intermolecular binding aspects of carbohydrates. Particularly in the field of conformation, NOE resonances, scalar couplings, residual dipolar couplings, and chemical shift anisotropy offsets have been the principal NMR parameters utilized. Molecular dynamics calculations restrained by NMR-data input are usually employed in conjunction to generate glycosidic bond dihedral angles. Glycosaminoglycans (GAGs) are a special class of sulfated polysaccharides extensively studied worldwide. Besides regulating innumerous physiological processes, these glycans are also widely explored in the global market as either clinical or nutraceutical agents. The conformational aspects of GAGs are key regulators to the quality of interactions with the functional proteins involved in biological events. This report discusses the solution conformation of each GAG type analyzed by one or more of the above-mentioned methods.

  11. Evidence for Horizontal Transmission of Secondary Endosymbionts in the Bemisia tabaci Cryptic Species Complex

    PubMed Central

    Ahmed, Muhammad Z.; De Barro, Paul J.; Ren, Shun-Xiang; Greeff, Jaco M.; Qiu, Bao-Li


    Bemisia tabaci (Hemiptera: Aleyrodidae) is a globally distributed pest composed of at least 34 morphologically indistinguishable cryptic species. At least seven species of endosymbiont have been found infecting some or all members of the complex. The origin(s) of the associations between specific endosymbionts and their whitefly hosts is unknown. Infection is normally vertical, but horizontal transmission does occur and is one way for new infections to be introduced into individuals. The relationships between the different members of the cryptic species complex and the endosymbionts have not been well explored. In this study, the phylogenies of different cryptic species of the host with those of their endosymbionts were compared. Of particular interest was whether there was evidence for both coevolution and horizontal transmission. Congruence was observed for the primary endosymbiont, Portiera aleyrodidarum, and partial incongruence in the case of two secondary endosymbionts, Arsenophonus and Cardinium and incongruence for a third, Wolbachia. The patterns observed for the primary endosymbiont supported cospeciation with the host while the patterns for the secondary endosymbionts, and especially Wolbachia showed evidence of host shifts and extinctions through horizontal transmission rather than cospeciation. Of particular note is the observation of several very recent host shift events in China between exotic invader and indigenous members of the complex. These shifts were from indigenous members of the complex to the invader as well as from the invader to indigenous relatives. PMID:23308142

  12. Cryptic female choice favours sperm from major histocompatibility complex-dissimilar males.


    Løvlie, Hanne; Gillingham, Mark A F; Worley, Kirsty; Pizzari, Tommaso; Richardson, David S


    Cryptic female choice may enable polyandrous females to avoid inbreeding or bias offspring variability at key loci after mating. However, the role of these genetic benefits in cryptic female choice remains poorly understood. Female red junglefowl, Gallus gallus, bias sperm use in favour of unrelated males. Here, we experimentally investigate whether this bias is driven by relatedness per se, or by similarity at the major histocompatibility complex (MHC), genes central to vertebrate acquired immunity, where polymorphism is critical to an individual's ability to combat pathogens. Through experimentally controlled natural matings, we confirm that selection against related males' sperm occurs within the female reproductive tract but demonstrate that this is more accurately predicted by MHC similarity: controlling for relatedness per se, more sperm reached the eggs when partners were MHC--dissimilar. Importantly, this effect appeared largely owing to similarity at a single MHC locus (class I minor). Further, the effect of MHC similarity was lost following artificial insemination, suggesting that male phenotypic cues might be required for females to select sperm differentially. These results indicate that postmating mechanisms that reduce inbreeding may do so as a consequence of more specific strategies of cryptic female choice promoting MHC diversity in offspring. PMID:24004935

  13. Multiple cryptic species in the blue-spotted maskray (Myliobatoidei: Dasyatidae: Neotrygon spp.): An update.


    Borsa, Philippe; Shen, Kang-Ning; Arlyza, Irma S; Hoareau, Thierry B


    Previous investigations have uncovered divergent mitochondrial clades within the blue-spotted maskray, previously Neotrygon kuhlii (Müller and Henle). The hypothesis that the blue-spotted maskray may consist of a complex of multiple cryptic species has been proposed, and four species have been recently described or resurrected. To test the multiple cryptic species hypothesis, we investigated the phylogenetic relationships and coalescence patterns of mitochondrial sequences in a sample of 127 new individuals from the Indian Ocean and the Coral Triangle region, sequenced at both the CO1 and cytochrome b loci. The maximum-likelihood (ML) tree of concatenated CO1+cytochrome b gene sequences, rooted by the New Caledonian maskray N. trigonoides, yielded 9 strongly supported, main clades. Puillandre's ABGD algorithm detected gaps in nucleotide distance consistent with the ML phylogeny. The general mixed Yule-coalescent algorithm partitioned the dataset into putative species generally consistent with the ML phylogeny. Nuclear markers generally confirmed that distinct mitochondrial clades correspond to genetically isolated lineages. The nine main lineages identified by ML analysis were geographically distributed in a parapatric fashion, indicating reproductive isolation. The hypothesis of multiple cryptic species is thus validated. PMID:27543138

  14. Cryptic photosynthesis--extrasolar planetary oxygen without a surface biological signature.


    Cockell, Charles S; Kaltenegger, Lisa; Raven, John A


    On Earth, photosynthetic organisms are responsible for the production of virtually all the oxygen in the atmosphere. On land, vegetation reflects in the visible and leads to a "red edge," which developed about 450 million years ago on Earth and has been proposed as a biosignature for life on extrasolar planets. However, in many regions on Earth, particularly where surface conditions are extreme--in hot and cold deserts, for example--photosynthetic organisms can be driven into and under substrates where light is still sufficient for photosynthesis. These communities exhibit no detectable surface spectral signature to indicate life. The same is true of the assemblages of photosynthetic organisms at more than a few meters' depth in water bodies. These communities are widespread and dominate local photosynthetic productivity. We review known cryptic photosynthetic communities and their productivity. We have linked geomicrobiology with observational astronomy by calculating the disk-averaged spectra of cryptic habitats and identifying detectable features on an exoplanet dominated by such a biota. The hypothetical cryptic photosynthesis worlds discussed here are Earth analogues that show detectable atmospheric biosignatures like our own planet but do not exhibit a discernable biological surface feature in the disc-averaged spectrum.

  15. Host Control of Symbiont Natural Product Chemistry in Cryptic Populations of the Tunicate Lissoclinum patella

    PubMed Central

    Kwan, Jason C.; Tianero, Ma. Diarey B.; Donia, Mohamed S.; Wyche, Thomas P.; Bugni, Tim S.; Schmidt, Eric W.


    Natural products (secondary metabolites) found in marine invertebrates are often thought to be produced by resident symbiotic bacteria, and these products appear to play a major role in the symbiotic interaction of bacteria and their hosts. In these animals, there is extensive variation, both in chemistry and in the symbiotic bacteria that produce them. Here, we sought to answer the question of what factors underlie chemical variation in the ocean. As a model, we investigated the colonial tunicate Lissoclinum patella because of its rich and varied chemistry and its broad geographic range. We sequenced mitochondrial cytochrome c oxidase 1 (COXI) genes, and found that animals classified as L. patella fall into three phylogenetic groups that may encompass several cryptic species. The presence of individual natural products followed the phylogenetic relationship of the host animals, even though the compounds are produced by symbiotic bacteria that do not follow host phylogeny. In sum, we show that cryptic populations of animals underlie the observed chemical diversity, suggesting that the host controls selection for particular secondary metabolite pathways. These results imply novel approaches to obtain chemical diversity from the oceans, and also demonstrate that the diversity of marine natural products may be greatly impacted by cryptic local extinctions. PMID:24788869

  16. Diversity of sponges (Porifera) from cryptic habitats on the Belize barrier reef near Carrie Bow Cay.


    Rützler, Klaus; Piantoni, Carla; Van Soest, Rob W M; Díaz, M Cristina


    The Caribbean barrier reef near Carrie Bow Cay, Belize, has been a focus of Smithsonian Institution (Washington) reef and mangrove investigations since the early 1970s. Systematics and biology of sponges (Porifera) were addressed by several researchers but none of the studies dealt with cryptic habitats, such as the shaded undersides of coral rubble, reef crevices, and caves, although a high species diversity was recognized and samples were taken for future reference and study. This paper is the result of processing samples taken between 1972 and 2012. In all, 122 species were identified, 14 of them new (including one new genus). The new species are Tetralophophora (new genus) mesoamericana, Geodia cribrata, Placospongia caribica, Prosuberites carriebowensis, Timea diplasterina, Timea oxyasterina, Rhaphidhistia belizensis, Wigginsia curlewensis, Phorbas aurantiacus, Myrmekioderma laminatum, Niphates arenata, Siphonodictyon occultum, Xestospongia purpurea, and Aplysina sciophila. We determined that about 75 of the 122 cryptic sponge species studied (61%) are exclusive members of the sciophilic community, 47 (39 %) occur in both, light-exposed and shaded or dark habitats. Since we estimate the previously known sponge population of Carrie Bow reefs and mangroves at about 200 species, the cryptic fauna makes up 38 % of total diversity. PMID:24871152

  17. Population structure and cryptic genetic variation in the mango fruit fly, Ceratitis cosyra (Diptera, Tephritidae)

    PubMed Central

    Virgilio, Massimiliano; Delatte, Hélène; Nzogela, Yasinta Beda; Simiand, Christophe; Quilici, Serge; De Meyer, Marc; Mwatawala, Maulid


    Abstract The fruit fly Ceratitis cosyra is an important agricultural pest negatively affecting the mango crop production throughout Africa and also feeding on a variety of other wild and cultivated hosts. The occurrence of deeply divergent haplotypes, as well as extensive morphological variability, previously suggested possible cryptic speciation within Ceratitis cosyra. Here we provide the first large-scale characterisation of the population structure of Ceratitis cosyra with the main objective of verifying cryptic genetic variation. A total of 348 specimens from 13 populations were genotyped at 16 polymorphic microsatellite loci. Hardy-Weinberg equilibrium (HWE) deviations were observed in 40.4% of locus-population combinations and suggested the occurrence of genetic substructuring within populations. Discriminant Analysis of Principal Components (DAPC) showed genetic divergence between the vast majority of vouchers from Burundi and Tanzania (plus a few outliers from other African countries) and all other specimens sampled. Individual Bayesian assignments confirmed the existence of two main genotypic groups also occurring in sympatry. These data provided further support to the hypothesis that Ceratitis cosyra might include cryptic species. However, additional integrative taxonomy, possibly combining morphological, ecological and physiological approaches, is required to provide the necessary experimental support to this model. PMID:26798276

  18. Diversity of sponges (Porifera) from cryptic habitats on the Belize barrier reef near Carrie Bow Cay.


    Rützler, Klaus; Piantoni, Carla; Van Soest, Rob W M; Díaz, M Cristina


    The Caribbean barrier reef near Carrie Bow Cay, Belize, has been a focus of Smithsonian Institution (Washington) reef and mangrove investigations since the early 1970s. Systematics and biology of sponges (Porifera) were addressed by several researchers but none of the studies dealt with cryptic habitats, such as the shaded undersides of coral rubble, reef crevices, and caves, although a high species diversity was recognized and samples were taken for future reference and study. This paper is the result of processing samples taken between 1972 and 2012. In all, 122 species were identified, 14 of them new (including one new genus). The new species are Tetralophophora (new genus) mesoamericana, Geodia cribrata, Placospongia caribica, Prosuberites carriebowensis, Timea diplasterina, Timea oxyasterina, Rhaphidhistia belizensis, Wigginsia curlewensis, Phorbas aurantiacus, Myrmekioderma laminatum, Niphates arenata, Siphonodictyon occultum, Xestospongia purpurea, and Aplysina sciophila. We determined that about 75 of the 122 cryptic sponge species studied (61%) are exclusive members of the sciophilic community, 47 (39 %) occur in both, light-exposed and shaded or dark habitats. Since we estimate the previously known sponge population of Carrie Bow reefs and mangroves at about 200 species, the cryptic fauna makes up 38 % of total diversity.

  19. DNA barcoding of freshwater rotifera in Mexico: evidence of cryptic speciation in common rotifers.


    García-Morales, A E; Elías-Gutiérrez, M


    DNA barcodes are useful tools to identify and discover new species in a wide range of taxa. Here, we report the first barcode study of monogonont rotifers from fresh and brackish waters in Mexico, and discuss the taxonomic implications of this work. We used DNA barcodes based on the sequence of cytochrome oxidase I to examine patterns of divergence among 417 specimens that represented 63 morphological taxa of rotifers. The mean sequence divergence among conspecific rotifer individuals was 0.75%, whereas the mean sequence divergence among congeneric taxa was 20.8%. The barcodes could discriminate between all the morphospecies identified. Moreover, the barcoding data revealed the presence of possible cryptic species in Ascomorpha ovalis, Lecane bulla, L. cornuta, L. curvicornis, L. crepida, L. lunaris, L. hastata, Platyias quadricornis, Keratella cochlearis, Brachionus calyciflorus and Testudinella patina, as well as in some forms and varieties such as B. quadridentatus f. brevispinus, B. quadridentatus f. cluniorbicularis and Mytilina ventralis var. macracantha. Barcode analysis also enabled some forms and varieties of common species to be identified as separate species. The results obtained support recent taxonomic revisions, such as the recognition of the genus Plationus, and the presence of cryptic speciation in L. bulla. This work shows that DNA barcoding identifies species effectively, can aid taxonomists by identifying cryptic species, and is an important tool for resolving taxonomic controversies.

  20. Multiple cryptic species in the blue-spotted maskray (Myliobatoidei: Dasyatidae: Neotrygon spp.): An update.


    Borsa, Philippe; Shen, Kang-Ning; Arlyza, Irma S; Hoareau, Thierry B


    Previous investigations have uncovered divergent mitochondrial clades within the blue-spotted maskray, previously Neotrygon kuhlii (Müller and Henle). The hypothesis that the blue-spotted maskray may consist of a complex of multiple cryptic species has been proposed, and four species have been recently described or resurrected. To test the multiple cryptic species hypothesis, we investigated the phylogenetic relationships and coalescence patterns of mitochondrial sequences in a sample of 127 new individuals from the Indian Ocean and the Coral Triangle region, sequenced at both the CO1 and cytochrome b loci. The maximum-likelihood (ML) tree of concatenated CO1+cytochrome b gene sequences, rooted by the New Caledonian maskray N. trigonoides, yielded 9 strongly supported, main clades. Puillandre's ABGD algorithm detected gaps in nucleotide distance consistent with the ML phylogeny. The general mixed Yule-coalescent algorithm partitioned the dataset into putative species generally consistent with the ML phylogeny. Nuclear markers generally confirmed that distinct mitochondrial clades correspond to genetically isolated lineages. The nine main lineages identified by ML analysis were geographically distributed in a parapatric fashion, indicating reproductive isolation. The hypothesis of multiple cryptic species is thus validated.


    PubMed Central

    Yeates, Sarah E; Diamond, Sian E; Einum, Sigurd; Emerson, Brent C; Holt, William V; Gage, Matthew J G


    Despite evidence that variation in male–female reproductive compatibility exists in many fertilization systems, identifying mechanisms of cryptic female choice at the gamete level has been a challenge. Here, under risks of genetic incompatibility through hybridization, we show how salmon and trout eggs promote fertilization by conspecific sperm. Using in vitro fertilization experiments that replicate the gametic microenvironment, we find complete interfertility between both species. However, if either species’ ova were presented with equivalent numbers of both sperm types, conspecific sperm gained fertilization precedence. Surprisingly, the species’ identity of the eggs did not explain this cryptic female choice, which instead was primarily controlled by conspecific ovarian fluid, a semiviscous, protein-rich solution that bathes the eggs and is released at spawning. Video analyses revealed that ovarian fluid doubled sperm motile life span and straightened swimming trajectory, behaviors allowing chemoattraction up a concentration gradient. To confirm chemoattraction, cell migration tests through membranes containing pores that approximated to the egg micropyle showed that conspecific ovarian fluid attracted many more spermatozoa through the membrane, compared with heterospecific fluid or water. These combined findings together identify how cryptic female choice can evolve at the gamete level and promote reproductive isolation, mediated by a specific chemoattractive influence of ovarian fluid on sperm swimming behavior. PMID:24299405

  2. Cryptic female choice favours sperm from major histocompatibility complex-dissimilar males

    PubMed Central

    Løvlie, Hanne; Gillingham, Mark A. F.; Worley, Kirsty; Pizzari, Tommaso; Richardson, David S.


    Cryptic female choice may enable polyandrous females to avoid inbreeding or bias offspring variability at key loci after mating. However, the role of these genetic benefits in cryptic female choice remains poorly understood. Female red junglefowl, Gallus gallus, bias sperm use in favour of unrelated males. Here, we experimentally investigate whether this bias is driven by relatedness per se, or by similarity at the major histocompatibility complex (MHC), genes central to vertebrate acquired immunity, where polymorphism is critical to an individual's ability to combat pathogens. Through experimentally controlled natural matings, we confirm that selection against related males' sperm occurs within the female reproductive tract but demonstrate that this is more accurately predicted by MHC similarity: controlling for relatedness per se, more sperm reached the eggs when partners were MHC-dissimilar. Importantly, this effect appeared largely owing to similarity at a single MHC locus (class I minor). Further, the effect of MHC similarity was lost following artificial insemination, suggesting that male phenotypic cues might be required for females to select sperm differentially. These results indicate that postmating mechanisms that reduce inbreeding may do so as a consequence of more specific strategies of cryptic female choice promoting MHC diversity in offspring. PMID:24004935

  3. Scale invariance vs conformal invariance

    NASA Astrophysics Data System (ADS)

    Nakayama, Yu


    In this review article, we discuss the distinction and possible equivalence between scale invariance and conformal invariance in relativistic quantum field theories. Under some technical assumptions, we can prove that scale invariant quantum field theories in d = 2 space-time dimensions necessarily possess the enhanced conformal symmetry. The use of the conformal symmetry is well appreciated in the literature, but the fact that all the scale invariant phenomena in d = 2 space-time dimensions enjoy the conformal property relies on the deep structure of the renormalization group. The outstanding question is whether this feature is specific to d = 2 space-time dimensions or it holds in higher dimensions, too. As of January 2014, our consensus is that there is no known example of scale invariant but non-conformal field theories in d = 4 space-time dimensions under the assumptions of (1) unitarity, (2) Poincaré invariance (causality), (3) discrete spectrum in scaling dimensions, (4) existence of scale current and (5) unbroken scale invariance in the vacuum. We have a perturbative proof of the enhancement of conformal invariance from scale invariance based on the higher dimensional analogue of Zamolodchikov's c-theorem, but the non-perturbative proof is yet to come. As a reference we have tried to collect as many interesting examples of scale invariance in relativistic quantum field theories as possible in this article. We give a complementary holographic argument based on the energy-condition of the gravitational system and the space-time diffeomorphism in order to support the claim of the symmetry enhancement. We believe that the possible enhancement of conformal invariance from scale invariance reveals the sublime nature of the renormalization group and space-time with holography. This review is based on a lecture note on scale invariance vs conformal invariance, on which the author gave lectures at Taiwan Central University for the 5th Taiwan School on Strings and

  4. Seasonally-Dynamic Presence-Only Species Distribution Models for a Cryptic Migratory Bat Impacted by Wind Energy Development

    PubMed Central

    Hayes, Mark A.; Cryan, Paul M.; Wunder, Michael B.


    Understanding seasonal distribution and movement patterns of animals that migrate long distances is an essential part of monitoring and conserving their populations. Compared to migratory birds and other more conspicuous migrants, we know very little about the movement patterns of many migratory bats. Hoary bats (Lasiurus cinereus), a cryptic, wide-ranging, long-distance migrant, comprise a substantial proportion of the tens to hundreds of thousands of bat fatalities estimated to occur each year at wind turbines in North America. We created seasonally-dynamic species distribution models (SDMs) from 2,753 museum occurrence records collected over five decades in North America to better understand the seasonal geographic distributions of hoary bats. We used 5 SDM approaches: logistic regression, multivariate adaptive regression splines, boosted regression trees, random forest, and maximum entropy and consolidated outputs to generate ensemble maps. These maps represent the first formal hypotheses for sex- and season-specific hoary bat distributions. Our results suggest that North American hoary bats winter in regions with relatively long growing seasons where temperatures are moderated by proximity to oceans, and then move to the continental interior for the summer. SDMs suggested that hoary bats are most broadly distributed in autumn—the season when they are most susceptible to mortality from wind turbines; this season contains the greatest overlap between potentially suitable habitat and wind energy facilities. Comparing wind-turbine fatality data to model outputs could test many predictions, such as ‘risk from turbines is highest in habitats between hoary bat summering and wintering grounds’. Although future field studies are needed to validate the SDMs, this study generated well-justified and testable hypotheses of hoary bat migration patterns and seasonal distribution. PMID:26208098

  5. Phylogeographic pattern of range expansion provides evidence for cryptic species lineages in Silene nutans in Western Europe.


    Martin, H; Touzet, P; Van Rossum, F; Delalande, D; Arnaud, J-F


    As a result of recent or past evolutionary processes, a single species might consist of distinct Evolutionary Significant Units (ESUs), even corresponding to cryptic species. Determining the underlying mechanisms of range shifts and the processes at work in the build-up of divergent ESUs requires elucidating the factors that contribute to population genetic divergence across a species' range. We investigated the large-scale patterns of genetic structure in the perennial herbaceous plant species Silene nutans (Caryophyllaceae) in Western Europe. We sampled and genotyped 111 populations using 13 nuclear microsatellite loci and 6 plastid single-nucleotide polymorphisms. Broad-scale spatial population genetic structure was examined using Bayesian clustering, spatial multivariate analyses and measures of hierarchical genetic differentiation. The genotypic structure of S. nutans was typical of a predominantly allogamous mating system. We also identified plastid lineages with no intra-population polymorphism, mirroring two genetically differentiated nuclear lineages. No evidence of admixture was found. Spatial trends in genetic diversity further suggested independent leading-edge expansion associated with founding events and subsequent genetic erosion. Overall, our findings suggested speciation processes in S. nutans and highlighted striking patterns of distinct stepwise recolonisation of Western Europe shaped by Quaternary climate oscillations. Two main potential ESUs can be defined in Western Europe, corresponding to Eastern and Western nuclear-plastid lineages. In situ preservation of populations and genetic rescue implying ex situ conservation techniques should take the lineage identity into account. This is particularly true in Great Britain, northern France and Belgium, where S. nutans is rare and where distinct lineages co-occur in close contact. PMID:26647652

  6. Seasonally-dynamic presence-only species distribution models for a cryptic migratory bat impacted by wind energy development

    USGS Publications Warehouse

    Hayes, Mark A.; Cryan, Paul M.; Wunder, Michael B.


    Understanding seasonal distribution and movement patterns of animals that migrate long distances is an essential part of monitoring and conserving their populations. Compared to migratory birds and other more conspicuous migrants, we know very little about the movement patterns of many migratory bats. Hoary bats (Lasiurus cinereus), a cryptic, wide-ranging, long-distance migrant, comprise a substantial proportion of the tens to hundreds of thousands of bat fatalities estimated to occur each year at wind turbines in North America. We created seasonally-dynamic species distribution models (SDMs) from 2,753 museum occurrence records collected over five decades in North America to better understand the seasonal geographic distributions of hoary bats. We used 5 SDM approaches: logistic regression, multivariate adaptive regression splines, boosted regression trees, random forest, and maximum entropy and consolidated outputs to generate ensemble maps. These maps represent the first formal hypotheses for sex- and season-specific hoary bat distributions. Our results suggest that North American hoary bats winter in regions with relatively long growing seasons where temperatures are moderated by proximity to oceans, and then move to the continental interior for the summer. SDMs suggested that hoary bats are most broadly distributed in autumn—the season when they are most susceptible to mortality from wind turbines; this season contains the greatest overlap between potentially suitable habitat and wind energy facilities. Comparing wind-turbine fatality data to model outputs could test many predictions, such as ‘risk from turbines is highest in habitats between hoary bat summering and wintering grounds’. Although future field studies are needed to validate the SDMs, this study generated well-justified and testable hypotheses of hoary bat migration patterns and seasonal distribution.

  7. Bergmann's Body Size Rule Operates in Facultatively Endothermic Insects: Evidence from a Complex of Cryptic Bumblebee Species

    PubMed Central

    Whitehorn, Penelope R.; Goulson, Dave; Tinsley, Matthew C.


    According to Bergmann’s rule we expect species with larger body size to inhabit locations with a cooler climate, where they may be well adapted to conserve heat and resist starvation. This rule is generally applied to endotherms. In contrast, body size in ectothermic invertebrates has been suggested to follow the reverse ecogeographic trend: these converse Bergmann’s patterns may be driven by the ecological constraints of shorter season length and lower food availability in cooler high latitude locations. Such patterns are particularly common in large insects due to their longer development times. As large and facultatively endothermic insects, bumblebees could thus be expected to follow either trend. In this investigation, we studied body size of three bumblebee species over a large spatial area and investigated whether interspecific trends in body size correspond to differences in their distribution consistent with either Bergmann’s or a converse Bergmann’s rule. We examined the body size of queens, males and workers of the Bombus lucorum complex of cryptic bumblebee species from across the whole of Great Britain. We found interspecific differences in body size corresponding to Bergmann’s rule: queens and males of the more northerly distributed, cool-adapted, species were largest. In contrast, the mean body size of the worker caste did not vary between the three species. These differences in body size may have evolved under selection pressures for thermoregulation or starvation resistance. We suggest that this case study in facultatively endothermic insects may help clarify the selection pressures governing Bergmann rule trends more generally. PMID:27741245

  8. Seasonally-Dynamic Presence-Only Species Distribution Models for a Cryptic Migratory Bat Impacted by Wind Energy Development.


    Hayes, Mark A; Cryan, Paul M; Wunder, Michael B


    Understanding seasonal distribution and movement patterns of animals that migrate long distances is an essential part of monitoring and conserving their populations. Compared to migratory birds and other more conspicuous migrants, we know very little about the movement patterns of many migratory bats. Hoary bats (Lasiurus cinereus), a cryptic, wide-ranging, long-distance migrant, comprise a substantial proportion of the tens to hundreds of thousands of bat fatalities estimated to occur each year at wind turbines in North America. We created seasonally-dynamic species distribution models (SDMs) from 2,753 museum occurrence records collected over five decades in North America to better understand the seasonal geographic distributions of hoary bats. We used 5 SDM approaches: logistic regression, multivariate adaptive regression splines, boosted regression trees, random forest, and maximum entropy and consolidated outputs to generate ensemble maps. These maps represent the first formal hypotheses for sex- and season-specific hoary bat distributions. Our results suggest that North American hoary bats winter in regions with relatively long growing seasons where temperatures are moderated by proximity to oceans, and then move to the continental interior for the summer. SDMs suggested that hoary bats are most broadly distributed in autumn-the season when they are most susceptible to mortality from wind turbines; this season contains the greatest overlap between potentially suitable habitat and wind energy facilities. Comparing wind-turbine fatality data to model outputs could test many predictions, such as 'risk from turbines is highest in habitats between hoary bat summering and wintering grounds'. Although future field studies are needed to validate the SDMs, this study generated well-justified and testable hypotheses of hoary bat migration patterns and seasonal distribution.

  9. Molecular variability in the Celleporella hyalina (Bryozoa; Cheilostomata) species complex: evidence for cryptic speciation from complete mitochondrial genomes.


    Waeschenbach, Andrea; Porter, Joanne S; Hughes, Roger N


    The bryozoan Celleporella has been shown to be composed of multiple, often cryptic, lineages. We sequenced two complete mitochondrial (mt) genomes of the Celleporella hyalina species complex from Wales, UK and Norway (i) to determine genetic divergence at the complete mt genome level, and (ii) to design new molecular markers for examining the interrelationships amongst the major lineages. In addressing (i), we estimated genetic divergence at three levels: (a) nucleotide diversity (π), (b) genome size, and (c) gene order. Genes nad4L, nad6, and atp8 showed the highest levels of divergence, and rrnL, rrnS, and cox1 showed the lowest levels. Inter-genome nucleotide divergence of protein-coding and ribosomal RNA genes, measured as π, was 0.21. The two genomes differed substantially in size, with the Norwegian genome being 2,573 base pairs (bp) longer than the Welsh genome, 17,265 and 14,692 bp, respectively. This difference in size is attributable to long non-coding regions present in the Norwegian genome. Both genomes exhibit similar gene orders, except for the translocation of one transfer RNA (trnA). Considering the high nucleotide diversity, genome size difference and change in gene order, these mt genomes are considered sufficiently divergent to have originated from two distinct species. In addressing (ii) we designed PCR primers that flank the most conserved regions of the genome: 1,300 bp of cox1 and a contiguous 2,000 bp fragment of rrnL + rrnS. The primers have yielded products for tissue from Wales, Norway, New Zealand, Alaska and Chile and should provide useful tools in establishing species- and population-level diversity within the Celleporella complex.

  10. Phylogeographic pattern of range expansion provides evidence for cryptic species lineages in Silene nutans in Western Europe.


    Martin, H; Touzet, P; Van Rossum, F; Delalande, D; Arnaud, J-F


    As a result of recent or past evolutionary processes, a single species might consist of distinct Evolutionary Significant Units (ESUs), even corresponding to cryptic species. Determining the underlying mechanisms of range shifts and the processes at work in the build-up of divergent ESUs requires elucidating the factors that contribute to population genetic divergence across a species' range. We investigated the large-scale patterns of genetic structure in the perennial herbaceous plant species Silene nutans (Caryophyllaceae) in Western Europe. We sampled and genotyped 111 populations using 13 nuclear microsatellite loci and 6 plastid single-nucleotide polymorphisms. Broad-scale spatial population genetic structure was examined using Bayesian clustering, spatial multivariate analyses and measures of hierarchical genetic differentiation. The genotypic structure of S. nutans was typical of a predominantly allogamous mating system. We also identified plastid lineages with no intra-population polymorphism, mirroring two genetically differentiated nuclear lineages. No evidence of admixture was found. Spatial trends in genetic diversity further suggested independent leading-edge expansion associated with founding events and subsequent genetic erosion. Overall, our findings suggested speciation processes in S. nutans and highlighted striking patterns of distinct stepwise recolonisation of Western Europe shaped by Quaternary climate oscillations. Two main potential ESUs can be defined in Western Europe, corresponding to Eastern and Western nuclear-plastid lineages. In situ preservation of populations and genetic rescue implying ex situ conservation techniques should take the lineage identity into account. This is particularly true in Great Britain, northern France and Belgium, where S. nutans is rare and where distinct lineages co-occur in close contact.

  11. Seasonally-Dynamic Presence-Only Species Distribution Models for a Cryptic Migratory Bat Impacted by Wind Energy Development.


    Hayes, Mark A; Cryan, Paul M; Wunder, Michael B


    Understanding seasonal distribution and movement patterns of animals that migrate long distances is an essential part of monitoring and conserving their populations. Compared to migratory birds and other more conspicuous migrants, we know very little about the movement patterns of many migratory bats. Hoary bats (Lasiurus cinereus), a cryptic, wide-ranging, long-distance migrant, comprise a substantial proportion of the tens to hundreds of thousands of bat fatalities estimated to occur each year at wind turbines in North America. We created seasonally-dynamic species distribution models (SDMs) from 2,753 museum occurrence records collected over five decades in North America to better understand the seasonal geographic distributions of hoary bats. We used 5 SDM approaches: logistic regression, multivariate adaptive regression splines, boosted regression trees, random forest, and maximum entropy and consolidated outputs to generate ensemble maps. These maps represent the first formal hypotheses for sex- and season-specific hoary bat distributions. Our results suggest that North American hoary bats winter in regions with relatively long growing seasons where temperatures are moderated by proximity to oceans, and then move to the continental interior for the summer. SDMs suggested that hoary bats are most broadly distributed in autumn-the season when they are most susceptible to mortality from wind turbines; this season contains the greatest overlap between potentially suitable habitat and wind energy facilities. Comparing wind-turbine fatality data to model outputs could test many predictions, such as 'risk from turbines is highest in habitats between hoary bat summering and wintering grounds'. Although future field studies are needed to validate the SDMs, this study generated well-justified and testable hypotheses of hoary bat migration patterns and seasonal distribution. PMID:26208098


    SciTech Connect

    Randall S. Seright


    This report describes work performed during the second year of the project, ''Conformance Improvement Using Gels.'' The project has two objectives. The first objective is to identify gel compositions and conditions that substantially reduce flow through fractures that allow direct channeling between wells, while leaving secondary fractures open so that high fluid injection and production rates can be maintained. The second objective is to optimize treatments in fractured production wells, where the gel must reduce permeability to water much more than that to oil. Pore-level images from X-ray computed microtomography were re-examined for Berea sandstone and porous polyethylene. This analysis suggests that oil penetration through gel-filled pores occurs by a gel-dehydration mechanism, rather than a gel-ripping mechanism. This finding helps to explain why aqueous gels can reduce permeability to water more than to oil. We analyzed a Cr(III)-acetate-HPAM gel treatment in a production well in the Arbuckle formation. The availability of accurate pressure data before, during, and after the treatment was critical for the analysis. After the gel treatment, water productivity was fairly constant at about 20% of the pre-treatment value. However, oil productivity was stimulated by a factor of 18 immediately after the treatment. During the six months after the treatment, oil productivity gradually decreased to approach the pre-treatment value. To explain this behavior, we proposed that the fracture area open to oil flow was increased substantially by the gel treatment, followed by a gradual closing of the fractures during subsequent production. For a conventional Cr(III)-acetate-HPAM gel, the delay between gelant preparation and injection into a fracture impacts the placement, leakoff, and permeability reduction behavior. Formulations placed as partially formed gels showed relatively low pressure gradients during placement, and yet substantially reduced the flow capacity of

  13. To conform or not to conform: spontaneous conformity diminishes the sensitivity to monetary outcomes.


    Yu, Rongjun; Sun, Sai


    When people have different opinions in a group, they often adjust their own attitudes and behaviors to match the group opinion, known as social conformity. The affiliation account of normative conformity states that people conform to norms in order to 'fit in', whereas the accuracy account of informative conformity posits that the motive to learn from others produces herding. Here, we test another possibility that following the crowd reduces the experienced negative emotion when the group decision turns out to be a bad one. Using event related potential (ERP) combined with a novel group gambling task, we found that participants were more likely to choose the option that was predominately chosen by other players in previous trials, although there was little explicit normative pressure at the decision stage and group choices were not informative. When individuals' choices were different from others, the feedback related negativity (FRN), an ERP component sensitive to losses and errors, was enhanced, suggesting that being independent is aversive. At the outcome stage, the losses minus wins FRN effect was significantly reduced following conformity choices than following independent choices. Analyses of the P300 revealed similar patterns both in the response and outcome period. Our study suggests that social conformity serves as an emotional buffer that protects individuals from experiencing strong negative emotion when the outcomes are bad.

  14. Utilisation of a cryptic non-canonical donor splice site of the gene encoding PARAFIBROMIN is associated with familial isolated primary hyperparathyroidism

    PubMed Central

    Bradley, K; Cavaco, B; Bowl, M; Harding, B; Young, A; Thakker, R


    More than 99% of all splice sites conform to consensus sequences that usually include the invariant dinucleotides gt and ag at the 5' and 3' ends of the introns, respectively. We report on the utilisation of a non-consensus (non-canonical) donor splice site within exon 1 of the HRPT2 gene in familial isolated primary hyperparathyroidism (FIHP). HRPT2 mutations are more frequently associated with the hyperparathyroidism-jaw tumour syndrome (HPT-JT). Patients with FIHP were identified to have a donor splice site mutation, IVS1+1 g→a, and the consequences of this for RNA processing were investigated. The mutant mRNA lacked 30 bp and DNA sequence analysis revealed this to result from utilisation of an alternative cryptic non-canonical donor splice site (gaatgt) in exon 1 together with the normally occurring acceptor splice site in intron 1. Translation of this mutant mRNA predicted the in-frame loss of 10 amino acids in the encoded protein, termed PARAFIBROMIN. Thus, these FIHP patients are utilising a ga-ag splice site pair, which until recently was considered to be incompatible with splicing but is now known to occur as a rare (<0.02%) normal splicing variant. PMID:16061557

  15. Thelephora versatilis and Thelephora pseudoversatilis: two new cryptic species with polymorphic basidiomes inhabiting tropical deciduous and sub-perennial forests of the Mexican Pacific coast.


    Ramírez-López, Itzel; Villegas-Ríos, Margarita; Salas-Lizana, Rodolfo; Garibay-Orijel, Roberto; Alvarez-Manjarrez, Julieta


    Thelephora is a genus of ectomycorrhizal basidiomycetes with basidiomes of varied shape which has been poorly studied in tropical ecosystems. In this paper, we present Thelephora versatilis and Thelephora pseudoversatilis, two new species collected in the same localities of deciduous and sub-perennial tropical forests of Jalisco, Mexico. Basidiomes of both species are brownish gray to violet brown with clavarioid-mesopodal, sub-resupinate or completely resupinate growth forms. In turn, phylogenetic analyses using nrDNA ITS sequences showed that these species are not closed related, nevertheless they are part of a well-supported clade conformed by several species of Thelephora, Tomentella and some undescribed Thelephorales. Morphological segregation of these species was attained by analyzing spore and hyphae characters using a wide sample. Significant statistical differences between the new species were observed regarding spore size, spine size and context hyphae width. This work exemplifies the relevance of integrating both morphological and molecular data, as well of the use of an appropriate sample size in order to discriminate among morphological cryptic species.

  16. 40 CFR 93.154 - Conformity analysis.

    Code of Federal Regulations, 2010 CFR


    ... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Conformity analysis. 93.154 Section 93...) DETERMINING CONFORMITY OF FEDERAL ACTIONS TO STATE OR FEDERAL IMPLEMENTATION PLANS Determining Conformity of General Federal Actions to State or Federal Implementation Plans § 93.154 Conformity analysis. Any...

  17. Universality class in conformal inflation

    SciTech Connect

    Kallosh, Renata; Linde, Andrei E-mail:


    We develop a new class of chaotic inflation models with spontaneously broken conformal invariance. Observational consequences of a broad class of such models are stable with respect to strong deformations of the scalar potential. This universality is a critical phenomenon near the point of enhanced symmetry, SO(1,1), in case of conformal inflation. It appears because of the exponential stretching of the moduli space and the resulting exponential flattening of scalar potentials upon switching from the Jordan frame to the Einstein frame in this class of models. This result resembles stretching and flattening of inhomogeneities during inflationary expansion. It has a simple interpretation in terms of velocity versus rapidity near the Kähler cone in the moduli space, similar to the light cone of special theory of relativity. This effect makes inflation possible even in the models with very steep potentials. We describe conformal and superconformal versions of this cosmological attractor mechanism.

  18. Conformation-sensitive capillary electrophoresis.


    Ashton, Emma Jane


    Conformation-sensitive capillary electrophoresis (CSCE) is a rapid, high-throughput screening method that can be applied to any region of a genome for detection of sequence variants. Slab gel-based conformation-sensitive gel electrophoresis was first described by Ganguly et al., and the transfer from slab gels to capillaries for higher throughput was reported by Rozycka et al. CSCE is based on the principle that DNA homoduplexes and heteroduplexes migrate at different rates during electrophoresis under mildly denaturing conditions. Fragments showing an altered peak morphology compared to the wild type are then sequenced to determine the precise nature of the sequence variant detected.

  19. Systematic Conservation Planning for Groundwater Ecosystems Using Phylogenetic Diversity

    PubMed Central

    Asmyhr, Maria G.; Linke, Simon; Hose, Grant; Nipperess, David A.


    Aquifer ecosystems provide a range of important services including clean drinking water. These ecosystems, which are largely inaccessible to humans, comprise a distinct invertebrate fauna (stygofauna), which is characterized by narrow distributions, high levels of endemism and cryptic species. Although being under enormous anthropogenic pressure, aquifers have rarely been included in conservation planning because of the general lack of knowledge of species diversity and distribution. Here we use molecular sequence data and phylogenetic diversity as surrogates for stygofauna diversity in aquifers of New South Wales, Australia. We demonstrate how to incorporate these data as conservation features in the systematic conservation planning software Marxan. We designated each branch of the phylogenetic tree as a conservation feature, with the branch length as a surrogate for the number of distinct characters represented by each branch. Two molecular markers (nuclear 18S ribosomal DNA and mitochondrial cytochrome oxidase subunit I) were used to evaluate how marker variability and the resulting tree topology affected the site-selection process. We found that the sites containing the deepest phylogenetic branches were deemed the most irreplaceable by Marxan. By integrating phylogenetic data, we provide a method for including taxonomically undescribed groundwater fauna in systematic conservation planning. PMID:25514422

  20. Systematic conservation planning for groundwater ecosystems using phylogenetic diversity.


    Asmyhr, Maria G; Linke, Simon; Hose, Grant; Nipperess, David A


    Aquifer ecosystems provide a range of important services including clean drinking water. These ecosystems, which are largely inaccessible to humans, comprise a distinct invertebrate fauna (stygofauna), which is characterized by narrow distributions, high levels of endemism and cryptic species. Although being under enormous anthropogenic pressure, aquifers have rarely been included in conservation planning because of the general lack of knowledge of species diversity and distribution. Here we use molecular sequence data and phylogenetic diversity as surrogates for stygofauna diversity in aquifers of New South Wales, Australia. We demonstrate how to incorporate these data as conservation features in the systematic conservation planning software Marxan. We designated each branch of the phylogenetic tree as a conservation feature, with the branch length as a surrogate for the number of distinct characters represented by each branch. Two molecular markers (nuclear 18S ribosomal DNA and mitochondrial cytochrome oxidase subunit I) were used to evaluate how marker variability and the resulting tree topology affected the site-selection process. We found that the sites containing the deepest phylogenetic branches were deemed the most irreplaceable by Marxan. By integrating phylogenetic data, we provide a method for including taxonomically undescribed groundwater fauna in systematic conservation planning.

  1. The King of the Dwarves: a new cryptic species of Dainty Frog (Anura: Pyxicephalidae: Cacosternum) from the eastern Great Escarpment of South Africa.


    Conradie, Werner


    Phylogenetic reconstruction using the mitochondrial 16S marker shows the presence of a cryptic species of Cacosternum (Anura: Pyxicephalidae) from the eastern Great Escarpment of South Africa, supporting the Greater Maputaland-Pondoland-Albany region of vertebrate endemism. Bioacoustic and morphological characteristics, in conjunction with colouration differences, allow the description of this cryptic species. Tadpoles and details of life history are described. PMID:24872236

  2. The King of the Dwarves: a new cryptic species of Dainty Frog (Anura: Pyxicephalidae: Cacosternum) from the eastern Great Escarpment of South Africa.


    Conradie, Werner


    Phylogenetic reconstruction using the mitochondrial 16S marker shows the presence of a cryptic species of Cacosternum (Anura: Pyxicephalidae) from the eastern Great Escarpment of South Africa, supporting the Greater Maputaland-Pondoland-Albany region of vertebrate endemism. Bioacoustic and morphological characteristics, in conjunction with colouration differences, allow the description of this cryptic species. Tadpoles and details of life history are described.

  3. The Grounded Expertise Components Approach in the Novel Area of Cryptic Crossword Solving.


    Friedlander, Kathryn J; Fine, Philip A


    This paper presents a relatively unexplored area of expertise research which focuses on the solving of British-style cryptic crossword puzzles. Unlike its American "straight-definition" counterparts, which are primarily semantically-cued retrieval tasks, the British cryptic crossword is an exercise in code-cracking detection work. Solvers learn to ignore the superficial "surface reading" of the clue, which is phrased to be deliberately misleading, and look instead for a grammatical set of coded instructions which, if executed precisely, will lead to the correct (and only) answer. Sample clues are set out to illustrate the task requirements and demands. Hypothesized aptitudes for the field might include high fluid intelligence, skill at quasi-algebraic puzzles, pattern matching, visuospatial manipulation, divergent thinking and breaking frame abilities. These skills are additional to the crystallized knowledge and word-retrieval demands which are also a feature of American crossword puzzles. The authors present results from an exploratory survey intended to identify the characteristics of the cryptic crossword solving population, and outline the impact of these results on the direction of their subsequent research. Survey results were strongly supportive of a number of hypothesized skill-sets and guided the selection of appropriate test content and research paradigms which formed the basis of an extensive research program to be reported elsewhere. The paper concludes by arguing the case for a more grounded approach to expertise studies, termed the Grounded Expertise Components Approach. In this, the design and scope of the empirical program flows from a detailed and objectively-based characterization of the research population at the very onset of the program. PMID:27199805

  4. The Grounded Expertise Components Approach in the Novel Area of Cryptic Crossword Solving.


    Friedlander, Kathryn J; Fine, Philip A


    This paper presents a relatively unexplored area of expertise research which focuses on the solving of British-style cryptic crossword puzzles. Unlike its American "straight-definition" counterparts, which are primarily semantically-cued retrieval tasks, the British cryptic crossword is an exercise in code-cracking detection work. Solvers learn to ignore the superficial "surface reading" of the clue, which is phrased to be deliberately misleading, and look instead for a grammatical set of coded instructions which, if executed precisely, will lead to the correct (and only) answer. Sample clues are set out to illustrate the task requirements and demands. Hypothesized aptitudes for the field might include high fluid intelligence, skill at quasi-algebraic puzzles, pattern matching, visuospatial manipulation, divergent thinking and breaking frame abilities. These skills are additional to the crystallized knowledge and word-retrieval demands which are also a feature of American crossword puzzles. The authors present results from an exploratory survey intended to identify the characteristics of the cryptic crossword solving population, and outline the impact of these results on the direction of their subsequent research. Survey results were strongly supportive of a number of hypothesized skill-sets and guided the selection of appropriate test content and research paradigms which formed the basis of an extensive research program to be reported elsewhere. The paper concludes by arguing the case for a more grounded approach to expertise studies, termed the Grounded Expertise Components Approach. In this, the design and scope of the empirical program flows from a detailed and objectively-based characterization of the research population at the very onset of the program.

  5. Cryptic laminar and columnar organization in the dorsolateral pallium of a weakly electric fish.


    Trinh, Anh-Tuan; Harvey-Girard, Erik; Teixeira, Fellipe; Maler, Leonard


    In the weakly electric gymnotiform fish, Apteronotus leptorhynchus, the dorsolateral pallium (DL) receives diencephalic inputs representing electrosensory input utilized for communication and navigation. Cell counts reveal that, similar to thalamocortical projections, many more cells are present in DL than in the diencephalic nucleus that provides it with sensory input. DL is implicated in learning and memory and considered homologous to medial and/or dorsal pallium. The gymnotiform DL has an apparently simple architecture with a random distribution of simple multipolar neurons. We used multiple neurotracer injections in order to study the microcircuitry of DL. Surprisingly, we demonstrated that the intrinsic connectivity of DL is highly organized. It consists of orthogonal laminar and vertical excitatory synaptic connections. The laminar synaptic connections are symmetric sparse, random, and drop off exponentially with distance; they parcellate DL into narrow (60 μm) overlapping cryptic layers. At distances greater than 100 μm, the laminar connections generate a strongly connected directed graph architecture within DL. The vertical connectivity suggests that DL is also organized into cryptic columns; these connections are highly asymmetric, with superficial DL cells preferentially projecting towards deeper cells. Our experimental analyses suggest that the overlapping cryptic columns have a width of 100 μm, in agreement with the minimal distance for strong connectivity. The architecture of DL and the expansive representation of its input, taken together with the strong expression of N-methyl-D-aspartate (NMDA) receptors by its cells, are consistent with theoretical ideas concerning the cortical computations of pattern separation and memory storage via bump attractors.

  6. Cryptic genetic variation uncovers evolution of environmentally sensitive parameters in Caenorhabditis vulval development.


    Grimbert, Stéphanie; Braendle, Christian


    Understanding the robustness of developmental systems requires insights into the sensitivity of underlying molecular and cellular parameters to perturbations, and how such sensitivity evolves. We address these issues using vulval cell fate determination--a reproducible and robust patterning process regulated by a cross-talk of EGF-Ras-MAPK and Delta-Notch pathways. Although the final vulval cell fate pattern is identical in all Caenorhabditis species, the patterning process underlies extensive cryptic genetic variation between and within species. Here, we tested whether this cryptic genetic variation translates into variation in developmental sensitivity to environmental perturbations. We disrupted vulval patterning using thermal perturbations to quantify and compare environmental sensitivity of different system parameters between distinct genotypes of C. elegans and C. briggsae. Thermal perturbations globally debuffered vulval development, triggering diverse pattering variants, whose frequency and spectra were strongly species- and genotype-dependent. This condition-dependent variation indicates that environmental sensitivity of different system properties, such as vulval competence or vulval induction, is subject to evolutionary change. High temperature induced a genotype-specific decrease of secondary fate induction and corresponding Notch pathway activity in the C. elegans N2 strain; in contrast, hypoinduction of the primary cell fate was never observed. Vulval precursor cells therefore differ in temperature sensitivity and such cell-specific sensitivity shows evolutionary variation. We further compared spectra of temperature-induced vulval variants to the ones induced by mutation accumulation in the same genotypes. In response to either perturbation, we observed similar genotype-dependence of variant production, allowing identification of distinct system features most sensitive to both mutation and environment. Taken together, we show how sensitivity of system

  7. The Grounded Expertise Components Approach in the Novel Area of Cryptic Crossword Solving

    PubMed Central

    Friedlander, Kathryn J.; Fine, Philip A.


    This paper presents a relatively unexplored area of expertise research which focuses on the solving of British-style cryptic crossword puzzles. Unlike its American “straight-definition” counterparts, which are primarily semantically-cued retrieval tasks, the British cryptic crossword is an exercise in code-cracking detection work. Solvers learn to ignore the superficial “surface reading” of the clue, which is phrased to be deliberately misleading, and look instead for a grammatical set of coded instructions which, if executed precisely, will lead to the correct (and only) answer. Sample clues are set out to illustrate the task requirements and demands. Hypothesized aptitudes for the field might include high fluid intelligence, skill at quasi-algebraic puzzles, pattern matching, visuospatial manipulation, divergent thinking and breaking frame abilities. These skills are additional to the crystallized knowledge and word-retrieval demands which are also a feature of American crossword puzzles. The authors present results from an exploratory survey intended to identify the characteristics of the cryptic crossword solving population, and outline the impact of these results on the direction of their subsequent research. Survey results were strongly supportive of a number of hypothesized skill-sets and guided the selection of appropriate test content and research paradigms which formed the basis of an extensive research program to be reported elsewhere. The paper concludes by arguing the case for a more grounded approach to expertise studies, termed the Grounded Expertise Components Approach. In this, the design and scope of the empirical program flows from a detailed and objectively-based characterization of the research population at the very onset of the program. PMID:27199805

  8. Cryptic Species? Patterns of Maternal and Paternal Gene Flow in Eight Neotropical Bats

    PubMed Central

    Clare, Elizabeth L.


    Levels of sequence divergence at mitochondrial loci are frequently used in phylogeographic analysis and species delimitation though single marker systems cannot assess bi-parental gene flow. In this investigation I compare the phylogeographic patterns revealed through the maternally inherited mitochondrial COI region and the paternally inherited 7th intron region of the Dby gene on the Y-chromosome in eight common Neotropical bat species. These species are diverse and include members of two families from the feeding guilds of sanguivores, nectarivores, frugivores, carnivores and insectivores. In each case, the currently recognized taxon is comprised of distinct, substantially divergent intraspecific mitochondrial lineages suggesting cryptic species complexes. In Chrotopterus auritus, and Saccopteryx bilineata I observed congruent patterns of divergence in both genetic regions suggesting a cessation of gene flow between intraspecific groups. This evidence supports the existence of cryptic species complexes which meet the criteria of the genetic species concept. In Glossophaga soricina two intraspecific groups with largely sympatric South American ranges show evidence for incomplete lineage sorting or frequent hybridization while a third group with a Central American distribution appears to diverge congruently at both loci suggesting speciation. Within Desmodus rotundus and Trachops cirrhosus the paternally inherited region was monomorphic and thus does not support or refute the potential for cryptic speciation. In Uroderma bilobatum, Micronycteris megalotis and Platyrrhinus helleri the gene regions show conflicting patterns of divergence and I cannot exclude ongoing gene flow between intraspecific groups. This analysis provides a comprehensive comparison across taxa and employs both maternally and paternally inherited gene regions to validate patterns of gene flow. I present evidence for previously unrecognized species meeting the criteria of the genetic species

  9. Cryptic Speciation Patterns in Iranian Rock Lizards Uncovered by Integrative Taxonomy

    PubMed Central

    Ahmadzadeh, Faraham; Flecks, Morris; Carretero, Miguel A.; Mozaffari, Omid; Böhme, Wolfgang; Harris, D. James; Freitas, Susana; Rödder, Dennis


    While traditionally species recognition has been based solely on morphological differences either typological or quantitative, several newly developed methods can be used for a more objective and integrative approach on species delimitation. This may be especially relevant when dealing with cryptic species or species complexes, where high overall resemblance between species is coupled with comparatively high morphological variation within populations. Rock lizards, genus Darevskia, are such an example, as many of its members offer few diagnostic morphological features. Herein, we use a combination of genetic, morphological and ecological criteria to delimit cryptic species within two species complexes, D. chlorogaster and D. defilippii, both distributed in northern Iran. Our analyses are based on molecular information from two nuclear and two mitochondrial genes, morphological data (15 morphometric, 16 meristic and four categorical characters) and eleven newly calculated spatial environmental predictors. The phylogeny inferred for Darevskia confirmed monophyly of each species complex, with each of them comprising several highly divergent clades, especially when compared to other congeners. We identified seven candidate species within each complex, of which three and four species were supported by Bayesian species delimitation within D. chlorogaster and D. defilippii, respectively. Trained with genetically determined clades, Ecological Niche Modeling provided additional support for these cryptic species. Especially those within the D. defilippii-complex exhibit well-differentiated niches. Due to overall morphological resemblance, in a first approach PCA with mixed variables only showed the separation between the two complexes. However, MANCOVA and subsequent Discriminant Analysis performed separately for both complexes allowed for distinction of the species when sample size was large enough, namely within the D. chlorogaster-complex. In conclusion, the results

  10. Cryptic gametic interactions confer both conspecific and heterospecific advantages in the Chrysochus (Coleoptera: Chrysomelidae) hybrid zone.


    Peterson, Merrill A; Larson, Erica L; Brassil, Margaret; Buckingham, Kati J; Juárez, Danielle; Deas, Joseph; Mangloña, Donna; White, Michael A; Maslan, Jonathan; Schweitzer, Andrew; Monsen, Kirsten J


    Most species pairs are isolated through the collective action of a suite of barriers. Recent work has shown that cryptic barriers such as conspecific sperm precedence can be quite strong, suggesting that they evolve quickly. However, because the strength of multiple barriers has been formally quantified in very few systems, the relative speed with which conspecific sperm precedence evolves remains unclear. Here, we measure the strength of both conspecific sperm precedence and cryptic non-competitive isolation between the hybridizing sister species, Chrysochus auratus and C. cobaltinus (Coleoptera: Chrysomelidae), and compare the strength of those barriers to the strength of other known reproductive barriers in this system. Overall, cryptic barriers in this system are weaker than other barriers, indicating that they have not evolved rapidly. Furthermore, their evolution has been asymmetric. Non-competitive barriers substantially reduce the production of hybrid offspring by C. auratus females but not by C. cobaltinus females. In multiply-mated C. cobaltinus females, heterospecific sperm outcompete conspecific sperm, as evidenced by the fact that heterospecific males sired disproportionately more offspring than predicted from the results for singly-mated females. In C. auratus females, neither sperm type has a competitive advantage. Such asymmetries explain why nearly all F1 hybrids in the field are from crosses between C. cobaltinus females and C. auratus males. We discuss these findings in terms of understanding the cost of mating 'mistakes' in the Chrysochus hybrid zone. In addition, our discovery that 95% confidence intervals for commonly-used isolation statistics can be very wide has important implications for speciation research. Specifically, to avoid biases in the interpretation of such isolation metrics, we suggest that studies should routinely include error estimates in their analyses of reproductive isolation.

  11. The carotenoid-continuum: carotenoid-based plumage ranges from conspicuous to cryptic and back again

    PubMed Central


    Background Carotenoids are frequently used by birds to colour their plumage with green, yellow, orange or red hues, and carotenoid-based colours are considered honest signals of quality, although they may have other functions, such as crypsis. It is usually assumed that red through yellow colours have a signalling function while green is cryptic. Here we challenge this notion using the yellow and green colouration of blue tits (Cyanistes caeruleus), great tits (Parus major) and greenfinches (Carduelis chloris) as a model. Results The relationship between colouration (chroma, computed using visual sensitivities of conspecifics) and detectability (contrast against natural backgrounds as perceived by conspecifics and avian predators) followed a similar curvilinear pattern for yellow and green plumage with minimum detectability at intermediate levels of carotenoid deposition. Thus, for yellow and green plumage, colours at or close to the point of minimum detectability may aid in crypsis. This may be the case for blue and great tit green and yellow plumage, and greenfinch green plumage, all of which had comparably low levels of detectability, while greenfinch yellow plumage was more chromatic and detectable. As yellow and green blue tit colouration are strongly affected by carotenoid availability during moult, variation in pigment availability between habitats may affect the degree of background-matching or the costliness of producing cryptic plumage. Conclusions Increasing carotenoid-deposition in the integument does not always lead to more conspicuous colours. In some cases, such as in blue or great tits, carotenoid deposition may be selected through enhanced background-matching, which in turn suggests that producing cryptic plumage may entail costs. We stress however, that our data do not rule out a signalling function of carotenoid-based plumage in tits. Rather, it shows that alternative functions are plausible and that assuming a signalling function based solely on

  12. Integrative Taxonomic Approach for Describing a New Cryptic Species of Bush Frog (Raorchestes: Anura: Rhacophoridae) from the Western Ghats, India

    PubMed Central

    Roshmi, Rekha Sarma; Ramya, Badrinath; Sudhira, H. S.; Ravikanth, G.; Aravind, Neelavara Anantharam


    A new cryptic species of bush frog Raorchestes honnametti sp. nov. is described from the south-eastern part of the Western Ghats, India. This newly described species belongs to the Charius clade and is morphologically similar to other clade members—R. charius and R. griet. Therefore, an integrative taxonomic approach based on molecular and bioacoustic analysis along with morphology was used to delimit the new species. Raorchestes honnametti sp. nov., is currently known only from Biligiri Rangaswamy Temple Tiger Reserve, a part of Biligiri Rangaswamy horst mountain range (a mountain formed due movement of two faults) formed during the Late Quaternary period (1.8–2.58 Ma). Discovery of cryptic species from a highly speciose and well-studied genus Raorchestes hints at the possible existence of several more cryptic species in this genus. We discuss the possible reasons for crypsis and emphasize the need for continued systematic surveys of amphibians across the Western Ghats. PMID:26934213

  13. Integrative Taxonomic Approach for Describing a New Cryptic Species of Bush Frog (Raorchestes: Anura: Rhacophoridae) from the Western Ghats, India.


    Priti, H; Roshmi, Rekha Sarma; Ramya, Badrinath; Sudhira, H S; Ravikanth, G; Aravind, Neelavara Anantharam; Gururaja, Kotambylu Vasudeva


    A new cryptic species of bush frog Raorchestes honnametti sp. nov. is described from the south-eastern part of the Western Ghats, India. This newly described species belongs to the Charius clade and is morphologically similar to other clade members--R. charius and R. griet. Therefore, an integrative taxonomic approach based on molecular and bioacoustic analysis along with morphology was used to delimit the new species. Raorchestes honnametti sp. nov., is currently known only from Biligiri Rangaswamy Temple Tiger Reserve, a part of Biligiri Rangaswamy horst mountain range (a mountain formed due movement of two faults) formed during the Late Quaternary period (1.8-2.58 Ma). Discovery of cryptic species from a highly speciose and well-studied genus Raorchestes hints at the possible existence of several more cryptic species in this genus. We discuss the possible reasons for crypsis and emphasize the need for continued systematic surveys of amphibians across the Western Ghats.

  14. Integrative Taxonomic Approach for Describing a New Cryptic Species of Bush Frog (Raorchestes: Anura: Rhacophoridae) from the Western Ghats, India.


    Priti, H; Roshmi, Rekha Sarma; Ramya, Badrinath; Sudhira, H S; Ravikanth, G; Aravind, Neelavara Anantharam; Gururaja, Kotambylu Vasudeva


    A new cryptic species of bush frog Raorchestes honnametti sp. nov. is described from the south-eastern part of the Western Ghats, India. This newly described species belongs to the Charius clade and is morphologically similar to other clade members--R. charius and R. griet. Therefore, an integrative taxonomic approach based on molecular and bioacoustic analysis along with morphology was used to delimit the new species. Raorchestes honnametti sp. nov., is currently known only from Biligiri Rangaswamy Temple Tiger Reserve, a part of Biligiri Rangaswamy horst mountain range (a mountain formed due movement of two faults) formed during the Late Quaternary period (1.8-2.58 Ma). Discovery of cryptic species from a highly speciose and well-studied genus Raorchestes hints at the possible existence of several more cryptic species in this genus. We discuss the possible reasons for crypsis and emphasize the need for continued systematic surveys of amphibians across the Western Ghats. PMID:26934213

  15. Cryptic speciation of hormogastrid earthworms revealed by mitochondrial and nuclear data.


    Novo, Marta; Almodóvar, Ana; Fernández, Rosa; Trigo, Dolores; Díaz Cosín, Darío J


    Species delimitation of earthworms has been difficult to determine with certainty due to their structural simplicity. We sequenced fragments of COI, 16S, t-RNAs and 28S for 202 Hormogastridae individuals from the central Iberian Peninsula and three outgroup taxa. A morphological constancy was found but a high genetic diversity suggests the presence of five cryptic allopatric species. Results showed a pattern of isolation by distance and a positive but weak correlation between some soil properties (coarse sand and total loam content) and genetic distances, which indicates that these populations may have been shaped genetically but not morphologically, by the environment.

  16. DNA barcoding reveals a cryptic nemertean invasion in Atlantic and Mediterranean waters

    NASA Astrophysics Data System (ADS)

    Fernández-Álvarez, Fernando Ángel; Machordom, Annie


    For several groups, like nemerteans, morphology-based identification is a hard discipline, but DNA barcoding may help non-experts in the identification process. In this study, DNA barcoding is used to reveal the cryptic invasion of Pacific Cephalothrix cf. simula into Atlantic and Mediterranean coasts. Although DNA barcoding is a promising method for the identification of Nemertea, only 6 % of the known number of nemertean species is currently associated with a correct DNA barcode. Therefore, additional morphological and molecular studies are necessary to advance the utility of DNA barcoding in the characterisation of possible nemertean alien invasions.

  17. Anisotropy of anhysteretic remanent magnetization (AARM) reveals a cryptic flow fabric of tsunami deposits

    NASA Astrophysics Data System (ADS)

    Kon, S.; Nakamura, N.; Sugawara, D.; Goto, K.; Chague-Goff, C.; Goff, J. R.


    Sandy tsunami deposits may provide valuable information on tsunami inundation as well as hydrodynamics, such as flow speed. However, if the layer does not have sedimentary structures such as cross laminations, it is difficult to infer the flow direction, which is important to interpret the behavior of the tsunami, such as inflow and outflow as well as repetition of waves. Anisotropy of magnetic susceptibility (AMS), in combination with grain size data, can provide information about the hydrodynamic conditions prevailing during the emplacement of tsunami sequences. It might also allow the reconstruction of transport directions because it provides a cryptic alignment of ferromagnetic and paramagnetic minerals, such as coarse-grained magnetite or platy phyllosilicate minerals (e.g. biotite). These minerals behave differently in different hydrodynamic conditions: for example, platy biotite may deposit in a cryptic micro-ripple. This therefore suggests that the usefulness of bulk AMS together with optical observations is limited in the study of flow fabric in tsunami deposits. The anisotropy of anhysteretic remanent magnetization (AARM) on the other hand isolates the fine-grained magnetite subfabric of needle-shaped inclusions exsolved in silicate minerals. Samples (18) from tsunami deposits, believed to have been laid down by the Jogan event (869 AD), were collected from a section on the Sendai Plain, east Japan. The transport direction in these deposits could not be determined by AMS analysis due to large declination and inclination errors. The AARM technique was thus used to determine the cryptic subfabric of magnetite exsolutions along cleavages in biotite and amphibole. Our scanning electron microscopy (SEM) observations confirmed that the maximum AARM orientation is parallel to the needle-shaped magnetite microexsolutions in biotite and amphibole. We therefore infer that the large error of AMS is caused by the alteration of these paramagnetic minerals, and AARM

  18. How to describe a cryptic species? Practical challenges of molecular taxonomy

    PubMed Central


    Background Molecular methods of species delineation are rapidly developing and widely considered as fast and efficient means to discover species and face the 'taxonomic impediment’ in times of biodiversity crisis. So far, however, this form of DNA taxonomy frequently remains incomplete, lacking the final step of formal species description, thus enhancing rather than reducing impediments in taxonomy. DNA sequence information contributes valuable diagnostic characters and –at least for cryptic species – could even serve as the backbone of a taxonomic description. To this end solutions for a number of practical problems must be found, including a way in which molecular data can be presented to fulfill the formal requirements every description must meet. Multi-gene barcoding and a combined molecular species delineation approach recently revealed a radiation of at least 12 more or less cryptic species in the marine meiofaunal slug genus Pontohedyle (Acochlidia, Heterobranchia). All identified candidate species are well delimited by a consensus across different methods based on mitochondrial and nuclear markers. Results The detailed microanatomical redescription of Pontohedyle verrucosa provided in the present paper does not reveal reliable characters for diagnosing even the two major clades identified within the genus on molecular data. We thus characterize three previously valid Pontohedyle species based on four genetic markers (mitochondrial cytochrome c oxidase subunit I, 16S rRNA, nuclear 28S and 18S rRNA) and formally describe nine cryptic new species (P. kepii sp. nov., P. joni sp. nov., P. neridae sp. nov., P. liliae sp. nov., P. wiggi sp. nov., P. wenzli sp. nov., P. peteryalli sp. nov., P. martynovi sp. nov., P. yurihookeri sp. nov.) applying molecular taxonomy, based on diagnostic nucleotides in DNA sequences of the four markers. Due to the minute size of the animals, entire specimens were used for extraction, consequently the holotype is a voucher of

  19. Optimized tumor cryptic peptides: the basis for universal neo-antigen-like tumor vaccines.


    Menez-Jamet, Jeanne; Gallou, Catherine; Rougeot, Aude; Kosmatopoulos, Kostas


    The very impressive clinical results recently obtained in cancer patients treated with immune response checkpoint inhibitors boosted the interest in immunotherapy as a therapeutic choice in cancer treatment. However, these inhibitors require a pre-existing tumor specific immune response and the presence of tumor infiltrating T cells to be efficient. This immune response can be triggered by cancer vaccines. One of the main issues in tumor vaccination is the choice of the right antigen to target. All vaccines tested to date targeted tumor associated antigens (TAA) that are self-antigens and failed to show a clinical efficacy because of the immune self-tolerance to TAA. A new class of tumor antigens has recently been described, the neo-antigens that are created by point mutations of tumor expressing proteins and are recognized by the immune system as non-self. Neo-antigens exhibit two main properties: they are not involved in the immune self-tolerance process and are immunogenic. However, the majority of the neo-antigens are patient specific and their use as cancer vaccines requires their previous identification in each patient individualy that can be done only in highly specialized research centers. It is therefore evident that neo-antigens cannot be used for patient vaccination worldwide. This raises the question of whether we can find neo-antigen like vaccines, which would not be patient specific. In this review we show that optimized cryptic peptides from TAA are neo-antigen like peptides. Optimized cryptic peptides are recognized by the immune system as non-self because they target self-cryptic peptides that escape self-tolerance; in addition they are strongly immunogenic because their sequence is modified in order to enhance their affinity for the HLA molecule. The first vaccine based on the optimized cryptic peptide approach, Vx-001, which targets the widely expressed tumor antigen telomerase reverse transcriptase (TERT), has completed a large phase I clinical

  20. Temperature: Human Regulating, Ants Conforming

    ERIC Educational Resources Information Center

    Clopton, Joe R.


    Biological processes speed up as temperature rises. Procedures for demonstrating this with ants traveling on trails, and data gathered by students on the Argentine ant ("Linepithema humile") are presented. The concepts of temperature regulation and conformity are detailed with a focus on the processes rather than on terms that label the organisms.

  1. Conformal coating using parylene polymers.


    Noordegraaf, J


    Parylene, a conformal polymer film, is being used increasingly in Europe to provide environmental and dielectric isolation. Application areas include electronic circuitry, sensors, and medical substrates. This article describes the variants of parylene and their characteristics, together with the process and applications of parylene coating. PMID:10167681

  2. Caspase Allostery and Conformational Selection.


    Clark, A Clay


    The role of caspase proteases in regulated processes such as apoptosis and inflammation has been studied for more than two decades, and the activation cascades are known in detail. Apoptotic caspases also are utilized in critical developmental processes, although it is not known how cells maintain the exquisite control over caspase activity in order to retain subthreshold levels required for a particular adaptive response while preventing entry into apoptosis. In addition to active site-directed inhibitors, caspase activity is modulated by post-translational modifications or metal binding to allosteric sites on the enzyme, which stabilize inactive states in the conformational ensemble. This review provides a comprehensive global view of the complex conformational landscape of caspases and mechanisms used to select states in the ensemble. The caspase structural database provides considerable detail on the active and inactive conformations in the ensemble, which provide the cell multiple opportunities to fine tune caspase activity. In contrast, the current database on caspase modifications is largely incomplete and thus provides only a low-resolution picture of global allosteric communications and their effects on the conformational landscape. In recent years, allosteric control has been utilized in the design of small drug compounds or other allosteric effectors to modulate caspase activity.

  3. The conformational analysis of 2-halocyclooctanones.


    Rozada, Thiago C; Gauze, Gisele F; Rosa, Fernanda A; Favaro, Denize C; Rittner, Roberto; Pontes, Rodrigo M; Basso, Ernani A


    The establishment of the most stable structures of eight membered rings is a challenging task to the field of conformational analysis. In this work, a series of 2-halocyclooctanones were synthesized (including fluorine, chlorine, bromine and iodine derivatives) and submitted to conformational studies using a combination of theoretical calculation and infrared spectroscopy. For each compound, four conformations were identified as the most important ones. These conformations are derived from the chair-boat conformation of cyclooctanone. The pseudo-equatorial (with respect to the halogen) conformer is preferred in vacuum and in low polarity solvents for chlorine, bromine and iodine derivatives. For 2-fluorocyclooctanone, the preferred conformation in vacuum is pseudo-axial. In acetonitrile, the pseudo-axial conformer becomes the most stable for the chlorine derivative. According to NBO calculations, the conformational preference is not dictated by electron delocalization, but by classical electrostatic repulsions.

  4. Two in one: cryptic species discovered in biological control agent populations using molecular data and crossbreeding experiments.


    Paterson, Iain D; Mangan, Rosie; Downie, Douglas A; Coetzee, Julie A; Hill, Martin P; Burke, Ashley M; Downey, Paul O; Henry, Thomas J; Compton, Stephe G


    There are many examples of cryptic species that have been identified through DNA-barcoding or other genetic techniques. There are, however, very few confirmations of cryptic species being reproductively isolated. This study presents one of the few cases of cryptic species that has been confirmed to be reproductively isolated and therefore true species according to the biological species concept. The cryptic species are of special interest because they were discovered within biological control agent populations. Two geographically isolated populations of Eccritotarsus catarinensis (Carvalho) [Hemiptera: Miridae], a biological control agent for the invasive aquatic macrophyte, water hyacinth, Eichhornia crassipes (Mart.) Solms [Pontederiaceae], in South Africa, were sampled from the native range of the species in South America. Morphological characteristics indicated that both populations were the same species according to the current taxonomy, but subsequent DNA analysis and breeding experiments revealed that the two populations are reproductively isolated. Crossbreeding experiments resulted in very few hybrid offspring when individuals were forced to interbreed with individuals of the other population, and no hybrid offspring were recorded when a choice of mate from either population was offered. The data indicate that the two populations are cryptic species that are reproductively incompatible. Subtle but reliable diagnostic characteristics were then identified to distinguish between the two species which would have been considered intraspecific variation without the data from the genetics and interbreeding experiments. These findings suggest that all consignments of biological control agents from allopatric populations should be screened for cryptic species using genetic techniques and that the importation of multiple consignments of the same species for biological control should be conducted with caution. PMID:27648231

  5. Conformational studies of nucleic acids

    SciTech Connect

    Pearlman, D.A.


    Techniques are developed for thorough examinations of the conformational energetics of nucleic acids and their constituents. The first one is a method for modeling the furanose sugar ring in nucleic acids. This method allows the coordinates corresponding to any sugar conformation to be generated rapidly and unambiguously from just the phase angle of pseudorotation. Taking advantage of this simplification, we carry out the first calculations to completely explore the conformational spaces available to the eight commonly occurring nucleosides using experimentally consistent furanose geometries and an appropriate classical potential energy force field. Results are in excellent agreement with experiment. We also develop empirically fit multiple correlation functions between the torsion angles of nucleic acids. This reduces the number of conformations which need to be considered in a thorough energetic survey for a nucleic acid. Such surveys are then carried out for two single-stranded nucleic acid tetramers: d(ApApApA) and ApApApA. We create energy contour maps for each of the 21 possible torsion angle pairs in a nucleotide repeating unit. The maps are quite consistent with the experimental distribution of oligonucleotide data and provide rationalizations for several experimentally observed angle-angle correlations. Complete energy minimization is carried out on all local minima found in the surveys. Both the maps and minimizations indicate DNA and RNA to be highly polymorphic. Conformational changes in DNA upon damage by uv radiation are also studied using energy minimization techniques. Finally, we derive a set of partial charges for a nucleotide (2'-deoxycytidine 5'-monophosphate monohydrate) from high resolution x-ray data.

  6. Activating the expression of bacterial cryptic genes by rpoB mutations in RNA polymerase or by rare earth elements.


    Ochi, Kozo; Tanaka, Yukinori; Tojo, Shigeo


    Since bacteria were found to contain genes encoding enzymes that synthesize a plethora of potential secondary metabolites, interest has grown in the activation of these cryptic pathways. Homologous and heterologous expression of these cryptic secondary metabolite-biosynthetic genes, often "silent" under ordinary laboratory fermentation conditions, may lead to the discovery of novel secondary metabolites. We review current progress on this topic, describing concepts for activating silent genes. We especially focus on genetic manipulation of transcription and translation, as well as the utilization of rare earth elements as a novel method to activate the silent genes. The possible roles of silent genes in bacterial physiology are also discussed. PMID:24127067

  7. Fake conformal symmetry in unimodular gravity

    NASA Astrophysics Data System (ADS)

    Oda, Ichiro


    We study Weyl symmetry (local conformal symmetry) in unimodular gravity. It is shown that the Noether currents for both Weyl symmetry and global scale symmetry vanish exactly as in conformally invariant scalar-tensor gravity. We clearly explain why in the class of conformally invariant gravitational theories, the Noether currents vanish by starting with conformally invariant scalar-tensor gravity. Moreover, we comment on both classical and quantum-mechanical equivalences in Einstein's general relativity, conformally invariant scalar-tensor gravity, and the Weyl-transverse gravity. Finally, we discuss the Weyl current in the conformally invariant scalar action and see that it is also vanishing.

  8. Conformal Gravity rotation curves with a conformal Higgs halo

    NASA Astrophysics Data System (ADS)

    Horne, Keith


    We discuss the effect of a conformally coupled Higgs field on conformal gravity (CG) predictions for the rotation curves of galaxies. The Mannheim-Kazanas (MK) metric is a valid vacuum solution of CG's fourth-order Poisson equation if and only if the Higgs field has a particular radial profile, S(r) = S0 a/(r + a), decreasing from S0 at r = 0 with radial scalelength a. Since particle rest masses scale with S(r)/S0, their world lines do not follow time-like geodesics of the MK metric gμν, as previously assumed, but rather those of the Higgs-frame MK metric tilde{g}_{μ ν }=Ω ^2 g_{μ ν }, with the conformal factor Ω(r) = S(r)/S0. We show that the required stretching of the MK metric exactly cancels the linear potential that has been invoked to fit galaxy rotation curves without dark matter. We also formulate, for spherical structures with a Higgs halo S(r), the CG equations that must be solved for viable astrophysical tests of CG using galaxy and cluster dynamics and lensing.

  9. Conformational Switching in the Fungal Light Sensor Vivid

    SciTech Connect

    Zoltowski,B.; Schwerdtgeger, C.; Widom, J.; Loros, J.; Bilwes, A.; Dunlap, J.; Crane, B.


    The Neurospora crassa photoreceptor Vivid tunes blue-light responses and modulates gating of the circadian clock. Crystal structures of dark-state and light-state Vivid reveal a light, oxygen, or voltage Per-Arnt-Sim domain with an unusual N-terminal cap region and a loop insertion that accommodates the flavin cofactor. Photoinduced formation of a cystein-flavin adduct drives flavin protonation to induce an N-terminal conformational change. A cysteine-to-serine substitution remote from the flavin adenine dinucleotide binding site decouples conformational switching from the flavin photocycle and prevents Vivid from sending signals in Neurospora. Key elements of this activation mechanism are conserved by other photosensors such as White Collar-1, ZEITLUPE, ENVOY, and flavin-binding, kelch repeat, F-BOX 1 (FKF1).

  10. Grey leaves in an alpine plant: a cryptic colouration to avoid attack?


    Niu, Yang; Chen, Gao; Peng, De-Li; Song, Bo; Yang, Yang; Li, Zhi-Min; Sun, Hang


    Cryptic colouration is a common predation-avoidance strategy in animals that is postulated to occur in plants, but few experimental studies have rigorously tested this hypothesis. We investigated the colouration of Corydalis benecincta, an alpine plant with remarkably dimorphic leaf colours (grey and green), based on a cost-benefit analysis. First we tested the premise that herbivores (Parnassius butterflies) cannot distinguish grey leaves from a scree background by spectrographic measurements and by estimating discriminability between leaves and scree using a butterfly colour vision model. Then we estimated the potential costs of inconspicuousness by comparing the photosynthetic performance and visual attractiveness to flower visitors of the two colour morphs. Finally, we examined the potential benefits of inconspicuousness by comparing damage, survivorship and female reproductive success. It is difficult for herbivores to distinguish grey-coloured morphs against the background. This grey colour originates in a combination of anthocyanins and chlorophylls. The two colour morphs had similar photosynthetic performance, visual attractiveness and female reproductive success. However, grey morphs had significantly lower herbivore damage and higher survivorship. Grey leaves benefit C. benecincta by reducing herbivory with low investment in anthocyanin synthesis, and little cost on photosynthesis and mating opportunity. This cryptic colouration may have evolved through selection pressure imposed by visually foraging herbivores. PMID:24800901

  11. Concordant phylogeography and cryptic speciation in two Western Palaearctic oak gall parasitoid species complexes.


    Nicholls, James A; Preuss, Sonja; Hayward, Alexander; Melika, George; Csóka, György; Nieves-Aldrey, José-Luis; Askew, Richard R; Tavakoli, Majid; Schönrogge, Karsten; Stone, Graham N


    Little is known about the evolutionary history of most complex multi-trophic insect communities. Widespread species from different trophic levels might evolve in parallel, showing similar spatial patterns and either congruent temporal patterns (Contemporary Host-tracking) or later divergence in higher trophic levels (Delayed Host-tracking). Alternatively, host shifts by natural enemies among communities centred on different host resources could disrupt any common community phylogeographic pattern. We examined these alternative models using two Megastigmus parasitoid morphospecies associated with oak cynipid galls sampled throughout their Western Palaearctic distributions. Based on existing host cynipid data, a parallel evolution model predicts that eastern regions of the Western Palaearctic should contain ancestral populations with range expansions across Europe about 1.6 million years ago and deeper species-level divergence at both 8-9 and 4-5 million years ago. Sequence data from mitochondrial cytochrome b and multiple nuclear genes showed similar phylogenetic patterns and revealed cryptic genetic species within both morphospecies, indicating greater diversity in these communities than previously thought. Phylogeographic divergence was apparent in most cryptic species between relatively stable, diverse, putatively ancestral populations in Asia Minor and the Middle East, and genetically depauperate, rapidly expanding populations in Europe, paralleling patterns in host gallwasp species. Mitochondrial and nuclear data also suggested that Europe may have been colonized multiple times from eastern source populations since the late Miocene. Temporal patterns of lineage divergence were congruent within and across trophic levels, supporting the Contemporary Host-tracking Hypothesis for community evolution.

  12. Cryptic speciation on the high seas; global phylogenetics of the copepod family Eucalanidae.

    PubMed Central

    Goetze, Erica


    Few genetic data are currently available to assess patterns of population differentiation and speciation in planktonic taxa that inhabit the open ocean. A phylogenetic study of the oceanic copepod family Eucalanidae was undertaken to develop a model zooplankton taxon in which speciation events can be confidently identified. A global survey of 20 described species (526 individuals) sampled from 88 locations worldwide found high levels of cryptic diversity at the species level. Mitochondrial (16S rRNA, CO1) and nuclear (ITS2) DNA sequence data support 12 new genetic lineages as highly distinct from other populations with which they are currently considered conspecific. Out of these 12, at least four are new species. The circumglobal, boundary current species Rhincalanus nasutus was found to be a cryptic species complex, with genetic divergence between populations unrelated to geographic distance. 'Conspecific' populations of seven species exhibited varying levels of genetic differentiation between Atlantic and Pacific basins, suggesting that continental landmasses form barriers to dispersal for a subset of circumglobal species. A molecular phylogeny of the family based on both mitochondrial (16S rRNA) and nuclear (ITS2, 18S rRNA) gene loci supports monophyly of the family Eucalanidae, all four eucalanid genera and the 'pileatus' and 'subtenuis' species groups. PMID:14667347

  13. Novel Functions and Regulation of Cryptic Cellobiose Operons in Escherichia coli

    PubMed Central

    Parisutham, Vinuselvi; Lee, Sung Kuk


    Presence of cellobiose as a sole carbon source induces mutations in the chb and asc operons of Escherichia coli and allows it to grow on cellobiose. We previously engineered these two operons with synthetic constitutive promoters and achieved efficient cellobiose metabolism through adaptive evolution. In this study, we characterized two mutations observed in the efficient cellobiose metabolizing strain: duplication of RBS of ascB gene, (β-glucosidase of asc operon) and nonsense mutation in yebK, (an uncharacterized transcription factor). Mutations in yebK play a dominant role by modulating the length of lag phase, relative to the growth rate of the strain when transferred from a rich medium to minimal cellobiose medium. Mutations in ascB, on the other hand, are specific for cellobiose and help in enhancing the specific growth rate. Taken together, our results show that ascB of the asc operon is controlled by an internal putative promoter in addition to the native cryptic promoter, and the transcription factor yebK helps to remodel the host physiology for cellobiose metabolism. While previous studies characterized the stress-induced mutations that allowed growth on cellobiose, here, we characterize the adaptation-induced mutations that help in enhancing cellobiose metabolic ability. This study will shed new light on the regulatory changes and factors that are needed for the functional coupling of the host physiology to the activated cryptic cellobiose metabolism. PMID:26121029

  14. Geographical distribution of cryptic genetic types in the planktonic foraminifer Globigerinoides ruber.


    Aurahs, Ralf; Grimm, Guido W; Hemleben, Vera; Hemleben, Christoph; Kucera, Michal


    We present SSU rDNA data resolving the seasonal and geographical distribution of 'cryptic' genetic types of the planktonic foraminifer morphospecies Globigerinoides ruber in the eastern Atlantic Ocean and the Mediterranean Sea. Analysis of 262 sequences revealed the presence of five genetic types belonging to two distinct lineages. Although the morphospecies G. ruber occurs throughout the investigated region, its constituent 'cryptic' genetic types show a pattern of widespread exclusion, which is difficult to reconcile with the concept of ubiquitous dispersal. One of the newly discovered genetic types was exclusively found at stations in the Mediterranean Sea, possibly representing the smallest-scale example of endemism known in planktonic foraminifera. In general, our results suggest that the geographical scale of mutual exclusion between the genotypes is negatively correlated with their phylogenetic relatedness: the most similar and most recently diverged pair of siblings showed the strongest evidence for small-scale competitive exclusion. This pattern is consistent with the concept of niche partitioning, implying decreasing level of competition between genetic types with increasing degree of genetic divergence. PMID:19302352

  15. Novel Functions and Regulation of Cryptic Cellobiose Operons in Escherichia coli.


    Parisutham, Vinuselvi; Lee, Sung Kuk


    Presence of cellobiose as a sole carbon source induces mutations in the chb and asc operons of Escherichia coli and allows it to grow on cellobiose. We previously engineered these two operons with synthetic constitutive promoters and achieved efficient cellobiose metabolism through adaptive evolution. In this study, we characterized two mutations observed in the efficient cellobiose metabolizing strain: duplication of RBS of ascB gene, (β-glucosidase of asc operon) and nonsense mutation in yebK, (an uncharacterized transcription factor). Mutations in yebK play a dominant role by modulating the length of lag phase, relative to the growth rate of the strain when transferred from a rich medium to minimal cellobiose medium. Mutations in ascB, on the other hand, are specific for cellobiose and help in enhancing the specific growth rate. Taken together, our results show that ascB of the asc operon is controlled by an internal putative promoter in addition to the native cryptic promoter, and the transcription factor yebK helps to remodel the host physiology for cellobiose metabolism. While previous studies characterized the stress-induced mutations that allowed growth on cellobiose, here, we characterize the adaptation-induced mutations that help in enhancing cellobiose metabolic ability. This study will shed new light on the regulatory changes and factors that are needed for the functional coupling of the host physiology to the activated cryptic cellobiose metabolism.

  16. Cryptic and biochemical responses of young cuttlefish Sepia officinalis exposed to environmentally relevant concentrations of fluoxetine.


    Di Poi, Carole; Bidel, Flavie; Dickel, Ludovic; Bellanger, Cécile


    Antidepressants released in the environment have the potential to generate neural disrupting effects in non-target organisms, yet their putative effects on behaviors have never been studied in cephalopod molluscs. This study assessed the impact of the antidepressant fluoxetine (FLX) on the efficiency of cryptic behaviors (body patterns on uniform, checkerboard and sandy substrates), locomotor activity, and brain chemistry in young cuttlefish exposed to environmental concentrations (1 and 100ngL(-1) of FLX) during the perinatal period. Behavioral responses of cuttlefish were monitored at hatching and two weeks later, and brain monoamine contents were quantified at one month of age. FLX significantly altered the camouflage efficiencies on uniform and sandy backgrounds only at the lowest concentration, but not at 100ngL(-1). Hatchlings exposed to 1ngL(-1) of FLX exhibited a duration exposure-dependent decrease in the uniform camouflage. They also showed a significant increase of the frequency of sand digging behaviors which might make them highly visible to predators in nature. When tested again two weeks later, cuttlefish seemed to have recovered and no more behavioral alterations were observed showing a transitory effect of the antidepressant. FLX did not affect the levels of serotonin, norepinephrine and their metabolites; however, it seemed to influence dopaminergic activity between the two FLX-exposed groups. The results show for the time that environmentally realistic concentrations of a single SSRI significantly impair the cryptic performances of newly hatched cuttlefish, and may ultimately reduce their chance for survival.

  17. Sexual development and cryptic sexuality in fungi: insights from Aspergillus species.


    Dyer, Paul S; O'Gorman, Céline M


    Major insights into sexual development and cryptic sexuality within filamentous fungi have been gained from investigations using Aspergillus species. Here, an overview is first given into sexual morphogenesis in the aspergilli, describing the different types of sexual structures formed and how their production is influenced by a variety of environmental and nutritional factors. It is argued that the formation of cleistothecia and accessory tissues, such as Hülle cells and sclerotia, should be viewed as two independent but co-ordinated developmental pathways. Next, a comprehensive survey of over 75 genes associated with sexual reproduction in the aspergilli is presented, including genes relating to mating and the development of cleistothecia, sclerotia and ascospores. Most of these genes have been identified from studies involving the homothallic Aspergillus nidulans, but an increasing number of studies have now in addition characterized 'sex-related' genes from the heterothallic species Aspergillus fumigatus and Aspergillus flavus. A schematic developmental genetic network is proposed showing the inter-relatedness between these genes. Finally, the discovery of sexual reproduction in certain Aspergillus species that were formerly considered to be strictly asexual is reviewed, and the importance of these findings for cryptic sexuality in the aspergilli as a whole is discussed.

  18. Cryptic preference for MHC-dissimilar females in male red junglefowl, Gallus gallus.


    Gillingham, Mark A F; Richardson, David S; Løvlie, Hanne; Moynihan, Anna; Worley, Kirsty; Pizzari, Tom


    An increasing number of studies test the idea that females increase offspring fitness by biasing fertilization in favour of genetically compatible partners; however, few have investigated or controlled for corresponding preferences in males. Here, we experimentally test whether male red junglefowl, Gallus gallus, prefer genetically compatible females, measured by similarity at the major histocompatibility complex (MHC), a key gene complex in vertebrate immune function. Theory predicts that because some degree of MHC heterozygosity favours viability, individuals should prefer partners that carry MHC alleles different from their own. While male fowl showed no preference when simultaneously presented with an MHC-similar and an MHC-dissimilar female, they showed a 'cryptic' preference, by allocating more sperm to the most MHC-dissimilar of two sequentially presented females. These results provide the first experimental evidence that males might respond to the MHC similarity of a female through differential ejaculate expenditure. By revealing that cryptic male behaviours may bias fertilization success in favour of genetically compatible partners, this study demonstrates the need to experimentally disentangle male and female effects when studying preferences for genetically compatible partners. PMID:19129124

  19. New cryptic karyotypic differences between cattle (Bos taurus) and goat (Capra hircus).


    De Lorenzi, Lisa; Planas, Jordi; Rossi, Elena; Malagutti, Luca; Parma, Pietro


    Cattle (Bos taurus) and goat (Capra hircus) belong to the Bovidae family, and they share a common ancestor 19.7-21.5 Ma ago (MYA). The Bovidae family apparently experienced a rapid species radiation in the middle Miocene. The present day cattle and goat possess the same diploid chromosome number (2n = 60) and structurally similar autosomes, except that a small subcentromeric portion of cattle chromosome nine has been translocated to goat chromosome 14. In this study, we adopted a new strategy that involves the use of bioinformatics approach to detect unknown cryptic chromosome divergences between cattle and goat using and subsequent validation using the fluorescence in situ hybridization (FISH) of bacterial artificial chromosome clones. We identified two hypothetical discrepancies between the cattle and goat genome assemblies: an inversion in the goat chromosome 13 and a transposition in the goat chromosome 6. The FISH technique allowed clear validation of the existence of a new 7.4 Mb chromosomal inversion in the goat chromosome 13. Regarding the transposition in the goat chromosome six, FISH analyses revealed that the cattle and goat genomes shared the same organization, with the assembly of the goat genome being the correct one. Moreover, we defined, for the first time, the size and orientation of the translocated fragment involved in the evolutionary translocation between cattle chromosomes 9 and goat chromosome 14. Our results suggest that bioinformatics represents an efficient method for detecting cryptic chromosome divergences among species.

  20. Quantitative Genetics Identifies Cryptic Genetic Variation Involved in the Paternal Regulation of Seed Development.


    Pires, Nuno D; Bemer, Marian; Müller, Lena M; Baroux, Célia; Spillane, Charles; Grossniklaus, Ueli


    Embryonic development requires a correct balancing of maternal and paternal genetic information. This balance is mediated by genomic imprinting, an epigenetic mechanism that leads to parent-of-origin-dependent gene expression. The parental conflict (or kinship) theory proposes that imprinting can evolve due to a conflict between maternal and paternal alleles over resource allocation during seed development. One assumption of this theory is that paternal alleles can regulate seed growth; however, paternal effects on seed size are often very low or non-existent. We demonstrate that there is a pool of cryptic genetic variation in the paternal control of Arabidopsis thaliana seed development. Such cryptic variation can be exposed in seeds that maternally inherit a medea mutation, suggesting that MEA acts as a maternal buffer of paternal effects. Genetic mapping using recombinant inbred lines, and a novel method for the mapping of parent-of-origin effects using whole-genome sequencing of segregant bulks, indicate that there are at least six loci with small, paternal effects on seed development. Together, our analyses reveal the existence of a pool of hidden genetic variation on the paternal control of seed development that is likely shaped by parental conflict.

  1. Spatially structured populations with a low level of cryptic diversity in European marine Gastrotricha.


    Kieneke, Alexander; Martínez Arbizu, Pedro M; Fontaneto, Diego


    Species of the marine meiofauna such as Gastrotricha are known to lack dispersal stages and are thus assumed to have low dispersal ability and low levels of gene flow between populations. Yet, most species are widely distributed, and this creates a paradox. To shed light on this apparent paradox, we test (i) whether such wide distribution may be due to misidentification and lumping of cryptic species with restricted distributions and (ii) whether spatial structures exist for the phylogeography of gastrotrichs. As a model, we used the genus Turbanella in NW Europe. DNA taxonomy using a mitochondrial and a nuclear marker supports distinctness of four traditional species (Turbanella ambronensis, T. bocqueti, T. mustela and T. cornuta) and provides evidence for two cryptic species within T. hyalina. An effect of geography on the within-species genetic structure is indeed present, with the potential for understanding colonization processes and for performing phylogeographic inference from microscopic animals. On the other hand, the occurrence of widely distributed haplotypes indicates long-distance dispersal as well, despite the assumed low dispersal ability of gastrotrichs. PMID:22257178

  2. Genetic diversity in the social amoeba Dictyostelium discoideum: population differentiation and cryptic species.


    Douglas, Tracy E; Kronforst, Marcus R; Queller, David C; Strassmann, Joan E


    The social amoeba Dictyostelium discoideum is a commonly used model organism for the study of social evolution, multicellularity, and cell biology. But the boundaries and structure of the species have not been explored. The lack of morphological traits to distinguish D. discoideum makes even knowing whether a given clone is D. discoideum a challenge. We address this with a phylogeny of a widespread collection of clones from a range of locations and including clones identified previously as potential cryptic species. We sequenced portions of nuclear ribosomal DNA and mitochondrial DNA, analyzing approximately 5500 and 2500 base pairs from the two regions respectively. We compared these sequences to known reference sequences for both D. discoideum and other closely related Dictyostelium species to create Bayesian and neighbor-joining phylogenetic trees representing the evolutionary relationships among the clones. We identified 51 unique D. discoideum concatenated sequences based on the combined mitochondrial and ribosomal sequence data. We also identified four unique D. citrinum concatenated sequences, three of which were previously classified as D. discoideum clones. Our analysis of the data revealed that all D. discoideum clones form a monophyletic group, but there are several well-supported subclades and pronounced genetic differentiation among locations (F(ST)=0.242, P=0.011), suggesting the presence of geographic or other barriers between populations. Our results reveal the need for further investigation into potential tropical cryptic species. PMID:21601638

  3. Parallel changes in genital morphology delineate cryptic diversification of planktonic nudibranchs

    PubMed Central

    Churchill, Celia K. C.; Alejandrino, Alvin; Valdés, Ángel; Ó Foighil, Diarmaid


    The relative roles of geographical and non-geographical barriers in the genesis of genetic isolation are highly debated in evolutionary biology, yet knowing how speciation occurs is essential to our understanding of biodiversity. In the open ocean, differentiating between the two is particularly difficult, because of the high levels of gene flow found in pelagic communities. Here, we use molecular phylogenetics to test the hypothesis that geography is the primary isolating mechanism in a clade of pelagic nudibranchs, Glaucinae. Our results contradict allopatric expectations: the cosmopolitan Glaucus atlanticus is panmictic, whereas the Indo-Pacific Glaucus marginatus contains two pairs of cryptic species with overlapping distributions. Within the G. marginatus species complex, a parallel reproductive change has occurred in each cryptic species pair: the loss of a bursa copulatrix. Available G. marginatus data are most consistent with non-geographical speciation events, but we cannot rule out the possibility of allopatric speciation, followed by iterative range extension and secondary overlap. Irrespective of ancestral range distributions, our results implicate a central role for reproductive character differentiation in glaucinin speciation—a novel result in a planktonic system. PMID:23825213

  4. Cryptic species of cardinalfish with evidence for old and new divergence

    NASA Astrophysics Data System (ADS)

    Gerlach, Gabriele; Atema, Jelle; Raupach, Michael J.; Deister, Fabian; Müller, Anke; Kingsford, Michael J.


    Larval dispersal and limited knowledge of physical boundaries challenge our understanding of the processes that drive genetic divergence and potential speciation in the marine environment. Divergence, both within and between populations of marine taxa, is not uncommon, but spatial and temporal stability of observed genetic structure is not well known. Previously, we detected large genetic differences among populations of the cardinalfish species Ostorhinchus doederleini inhabiting adjacent coral reefs. Here, we determined the spatial and temporal persistence of these genetic structures over the course of ten consecutive generations. Using microsatellite markers, we detected large changes (genetic population distance, D est, ranged from 0.04 to 0.46) in the genetic structure in some years, but some reefs maintained the same populations for nearly all sampling years. As this species' life span does not exceed 1 yr, persistence of distinct reef populations suggests natal homing. Mitochondrial identity based on two mtDNA markers corroborates the nuclear genetic evidence for genetic differences large enough to constitute different clades and even cryptic species in O. doederleini, which, based on gross morphology, was thought to be a single taxon. Habitat specialization was observed in one clade that exclusively inhabited reef lagoons, while all clades could be observed on reef slopes. We suggest that local habitat recognition combined with local population recognition and selection against hybrids can form barriers that maintain a cryptic species complex.

  5. Overlapping distributions of cryptic Scoloplos cf. armiger species in the western Wadden Sea

    NASA Astrophysics Data System (ADS)

    Luttikhuizen, Pieternella C.; Bol, Anneke; Cardoso, Joana F. M. F.; Dekker, Rob


    Unknowingly lumping cryptic species in biological monitoring studies hinders progress in understanding their functioning in a wide range of research fields including population dynamics, ecophysiology and community ecology. The common polychaete worm Scoloplos cf. armiger is a cryptic species complex comprising entirely different developmental modes: holobenthic and pelago-benthic development. In the northeast Atlantic, three putative species have been described on the basis of molecular data and a breeding study. We report on the development of a fast genotyping assay and on the occurrence and distribution of different molecular types in the western Wadden Sea. The genotyping assay consists of PCR-RFLP analysis by two enzymes of a mitochondrial ( cox3-trnQ-nad6) DNA segment. A new, fourth type was observed and this was the only type whose geographical distribution was not uniform but instead skewed toward the eastern part of the study area. All three hitherto known types were also observed and these three displayed a significant difference in depth distribution within the study area. This is the first ecological difference reported for the 'Subtidal Clade' (SC) versus the 'Type Locality Clade' (TLC). The new type ('Intertidal Clade 2') had a similar distribution to what is known as the Intertidal Clade (IC). However, the most striking observation is the large degree of overlap between the depth distributions in the western Wadden Sea, where the clade names 'Intertidal' and 'Subtidal' do not necessarily reflect local species composition. The necessity to genotype Scoloplos cf. armiger in monitoring programs is emphasized.

  6. Medical data sheet in safe havens - A tri-layer cryptic solution.


    Praveenkumar, Padmapriya; Amirtharajan, Rengarajan; Thenmozhi, K; Balaguru Rayappan, John Bosco


    Secured sharing of the diagnostic reports and scan images of patients among doctors with complementary expertise for collaborative treatment will help to provide maximum care through faster and decisive decisions. In this context, a tri-layer cryptic solution has been proposed and implemented on Digital Imaging and Communications in Medicine (DICOM) images to establish a secured communication for effective referrals among peers without compromising the privacy of patients. In this approach, a blend of three cryptic schemes, namely Latin square image cipher (LSIC), discrete Gould transform (DGT) and Rubik׳s encryption, has been adopted. Among them, LSIC provides better substitution, confusion and shuffling of the image blocks; DGT incorporates tamper proofing with authentication; and Rubik renders a permutation of DICOM image pixels. The developed algorithm has been successfully implemented and tested in both the software (MATLAB 7) and hardware Universal Software Radio Peripheral (USRP) environments. Specifically, the encrypted data were tested by transmitting them through an additive white Gaussian noise (AWGN) channel model. Furthermore, the sternness of the implemented algorithm was validated by employing standard metrics such as the unified average changing intensity (UACI), number of pixels change rate (NPCR), correlation values and histograms. The estimated metrics have also been compared with the existing methods and dominate in terms of large key space to defy brute force attack, cropping attack, strong key sensitivity and uniform pixel value distribution on encryption.

  7. Human cartilage aggrecan CS1 region contains cryptic T-cell recognition sites.

    PubMed Central

    Goodacre, J A; Middleton, S; Lynn, S; Ross, D A; Pearson, J


    Cartilage proteoglycan aggregates (PG) are candidate T-cell autoantigens in the pathogenesis of rheumatoid arthritis (RA). We have investigated the possibility that responses to class II-restricted T-cell recognition sites in human cartilage aggrecan (core protein) may depend upon whether these sites are available as free peptide antigens or as part of intact monomers. Analysis of mouse T-cell responses to intact or deglycosylated monomers, purified from human articular cartilage, and to synthetic peptides of the chondroitin sulphate (CS) attachment region homologous repeat sequence showed that recognition of T-cell epitopes in the CS1 region was strongly dependent upon the form of antigen used. The results show that the CS1 region contains cryptic T-cell recognition sites and raise the possibility that fragments of PG, released through the action of extracellular proteases in inflamed joints, may be capable of activating T cells with specificities for epitopes which are not made available following processing of intact PG. T cells with specificities for cryptic epitopes in PG may play a role in the pathogenesis of RA. PMID:8388364

  8. The allele-specific suppressor sup-39 alters use of cryptic splice sites in Caenorhabditis elegans.

    PubMed Central

    Roller, A B; Hoffman, D C; Zahler, A M


    Mutations in the Caenorhabditis elegans sup-39 gene cause allele-specific suppression of the uncoordination defect of unc-73(e936). e936 is a point mutation that changes the canonical G at the 5' end of intron 16 to a U. This mutation activates three splice donors, two of which define introns beginning with the canonical GU. Use of these two cryptic splice sites causes loss of reading frame; interestingly these messages are not substrates for nonsense-mediated decay. The third splice donor, used in 10% of steady-state e936 messages, is the mutated splice donor at the wild-type position, which defines an intron beginning with UU. In the presence of a sup-39 mutation, these same three splice donors are used, but the ratio of messages produced by splicing at these sites changes. The percentage of unc-73(e936) messages containing the wild-type splice junction is increased to 33% with a corresponding increase in the level of UNC-73 protein. This sup-39-induced change was also observed when the e936 mutant intron region was inserted into a heterologous splicing reporter construct transfected into worms. Experiments with splicing reporter constructs showed that the degree of 5' splice site match to the splicing consensus sequence can strongly influence cryptic splice site choice. We propose that mutant SUP-39 is a new type of informational suppressor that alters the use of weak splice donors. PMID:10757761

  9. Comparison of morphological and genetic analyses reveals cryptic divergence and morphological plasticity in Stylophora (Cnidaria, Scleractinia)

    NASA Astrophysics Data System (ADS)

    Stefani, Fabrizio; Benzoni, F.; Yang, S.-Y.; Pichon, M.; Galli, P.; Chen, C. A.


    A combined morphological and genetic study of the coral genus Stylophora investigated species boundaries in the Gulf of Aden, Yemen. Two mitochondrial regions, including the hypervariable IGS9 spacer and the control region, and a fragment of rDNA were used for phylogenetic analysis. Results were compared by multivariate analysis on the basis of branch morphology and corallite morphometry. Two species were clearly discriminated by both approaches. The first species was characterised by small corallites and a low morphological variability and was ascribed to a new geographical record of Stylophora madagascarensis on the basis of its phylogenetic distinction and its morphological similarity to the type material. The second species was characterised by larger corallite size and greater morphological variability and was ascribed to Stylophora pistillata. The analysis was extended to the intrageneric level for other S. pistillata populations from the Red Sea and the Pacific Ocean. Strong internal divergence was evident in the genus Sty lophora. S. pistillata populations were split into two highly divergent Red Sea/Gulf of Aden and western Pacific lineages with significant morphological overlap, which suggests they represent two distinct cryptic species. The combined use of morphological and molecular approaches, so far proved to be a powerful tool for the re-delineation of species boundaries in corals, provided novel evidence of cryptic divergence in this group of marine metazoans.

  10. Morphology and Molecules Reveal Unexpected Cryptic Diversity in the Enigmatic Genus Sinobirma Bryk, 1944 (Lepidoptera: Saturniidae)

    PubMed Central

    Rougerie, Rodolphe; Naumann, Stefan; Nässig, Wolfgang A.


    The wild silkmoth genus Sinobirma Bryk, 1944 is a poorly known monotypic taxon from the eastern end of the Himalaya Range. It was convincingly proposed to be closely related to some members of an exclusively Afro-tropical group of Saturniidae, but its biogeographical and evolutionary history remains enigmatic. After examining recently collected material from Tibet, northern India, and northeastern Myanmar, we realized that this unique species, S. malaisei Bryk, 1944 only known so far from a few specimens and from a very restricted area near the border between north-eastern Myanmar and the Yunnan province of China, may in fact belong to a group of closely related cryptic species. In this work, we combined morphological comparative study, DNA barcoding, and the sequences of a nuclear marker (D2 expansion segment of the 28S rRNA gene) to unequivocally delimit three distinct species in the genus Sinobirma, of which two are described as new to science: S. myanmarensis sp. n. and S. bouyeri sp. n. An informative DNA barcode sequence was obtained from the female holotype of S. malaisei—collected in 1934—ensuring the proper assignation of this name to the newly collected and studied specimens. Our findings represent another example of the potential of coupling traditional taxonomy and DNA barcoding for revealing and solving difficult cases of cryptic diversity. This approach is now being generalized to the world fauna of Saturniidae, with the participation of most of the taxonomists studying these moths. PMID:23028478

  11. Cryptic diversity of caddisflies in the Balkans: the curious case of Ecclisopteryx species (Trichoptera: Limnephilidae)

    PubMed Central

    Kučinić, Mladen; Bálint, Miklós; Keresztes, Lujza; Pauls, Steffen U.; Waringer, Johann


    Adults and larvae of two new cryptic, endemic caddisflies, Ecclisopteryx keroveci sp.n. and Ecclisopteryx ivkae sp.n., are described and illustrated from the Western Balkans. Phylogenetic analysis (Bayesian MCMCMC) and association of different life history stages in both cryptic species were achieved through comparison of morphological characters and mitochondrial (mtCOI and mtLSU) and nuclear (nuWG) gene sequence data. The new species form a sister clade to the widely distributed E. dalecarlica and E. guttulata, with which they were formerly misidentified. Adults differ from each other and other species in the genus by the uniquely shaped inferior appendages in males and segment X in females. The larvae differ from each other and their congeners in the shape of the pronotum, and presence and constitution of additional spines on the parietalia. Larvae of both species are grazers and prefer stony substrate. Ecclisopteryx keroveci sp.n. has a wide distribution in the Western Balkans, while E. ivkae sp.n. is endemic to Dalmatia. Our findings demonstrate the significance of the Western Balkans as a freshwater biodiversity hotspot, and accentuate the importance of research focused on freshwater biodiversity and biogeography in southern Europe. PMID:25810791

  12. Environmental Enrichment Accelerates the Ontogeny of Cryptic Behavior in Pharaoh Cuttlefish (Sepia pharaonis).


    Yasumuro, Haruhiko; Ikeda, Yuzuru


    We examined effect of environmental enrichment on cuttlefish, the most neutrally advanced invertebrate, to compare species variation of genetic and environmental influences. Cuttlefish were reared from seven to 117 days in one of three environments, namely, "poor" (artificial bottom without objects), "standard" (sandy bottom), and "enriched" (sandy bottom with objects). In Experiment 1, we explored whether enrichment affects the exhibition of crypsis in the cuttlefish. The cuttlefish in the standard and enriched environments spent most of their time at the bottom, exhibiting the mottled or disruptive pattern starting at 27 days of age. On the contrary, those in the poor environment exhibited uniform pattern starting at 87 days of age. Additionally, they repeatedly attempted to dig from 27 to 87 days of age, and moved around by hovering from 77 to 117 days of age. In Experiment 2, we exposed the cuttlefish to six novel substrates every other month after 53 days of age to verify whether enrichment actually affected the maturation of cryptic ability. Cuttlefish from the poor environment tended not to dig into white sandy bottom at 53-55 days of age. Additionally, they did not clearly exhibit appropriate body patterns in response to the six substrates compared to those from the other two environments at 81-83 days of age. However, at 113-115 days of age, most cuttlefish from the three environments exhibited similar cryptic behaviors in response to novel substrates. We conclude that physical enrichment promotes crypsis and accelerates the maturation of this ability in cuttlefish.

  13. Molecular cytogenetic search for cryptic sex chromosomes in painted turtles Chrysemys picta.


    Valenzuela, Nicole; Badenhorst, Daleen; Montiel, Eugenia E; Literman, Robert


    Sex determination is triggered by factors ranging from genotypic (GSD) to environmental (ESD), or both GSD + EE (GSD susceptible to environmental effects), and its evolution remains enigmatic. The presence/absence of sex chromosomes purportedly separates species at the ESD end of the continuum from the rest (GSD and GSD + EE) because the evolutionary dynamics of sex chromosomes and autosomes differ. However, studies suggest that turtles with temperature-dependent sex determination (TSD) are cryptically GSD and possess sex chromosomes. Here, we test this hypothesis in painted turtles Chrysemys picta (TSD), using comparative-genome-hybridization (CGH), a technique known to detect morphologically indistinguishable sex chromosomes in other turtles and reptiles. Our results show no evidence for the existence of sex chromosomes in painted turtles. While it remains plausible that cryptic sex chromosomes may exist in TSD turtles that are characterized by minor genetic differences that cannot be detected at the resolution of CGH, previous attempts have failed to identify sex-specific markers. Genomic sequencing should prove useful in providing conclusive evidence in this regard. If such efforts uncover sex chromosomes in TSD turtles, it may reveal the existence of a fundamental constraint for the evolution of a full spectrum of sex determination (from pure GSD to pure TSD) that is predicted theoretically. Finding sex chromosomes in ESD organisms would question whether pure ESD mechanisms exist at all in nature, or whether those systems currently considered pure ESD simply await the characterization of an underlying GSD architecture.

  14. Quantitative Genetics Identifies Cryptic Genetic Variation Involved in the Paternal Regulation of Seed Development

    PubMed Central

    Pires, Nuno D.; Bemer, Marian; Müller, Lena M.; Baroux, Célia; Spillane, Charles; Grossniklaus, Ueli


    Embryonic development requires a correct balancing of maternal and paternal genetic information. This balance is mediated by genomic imprinting, an epigenetic mechanism that leads to parent-of-origin-dependent gene expression. The parental conflict (or kinship) theory proposes that imprinting can evolve due to a conflict between maternal and paternal alleles over resource allocation during seed development. One assumption of this theory is that paternal alleles can regulate seed growth; however, paternal effects on seed size are often very low or non-existent. We demonstrate that there is a pool of cryptic genetic variation in the paternal control of Arabidopsis thaliana seed development. Such cryptic variation can be exposed in seeds that maternally inherit a medea mutation, suggesting that MEA acts as a maternal buffer of paternal effects. Genetic mapping using recombinant inbred lines, and a novel method for the mapping of parent-of-origin effects using whole-genome sequencing of segregant bulks, indicate that there are at least six loci with small, paternal effects on seed development. Together, our analyses reveal the existence of a pool of hidden genetic variation on the paternal control of seed development that is likely shaped by parental conflict. PMID:26811909

  15. Zucchini yellow mosaic virus (ZYMV, Potyvirus): vertical transmission, seed infection and cryptic infections.


    Simmons, H E; Dunham, J P; Zinn, K E; Munkvold, G P; Holmes, E C; Stephenson, A G


    The role played by seed transmission in the evolution and epidemiology of viral crop pathogens remains unclear. We determined the seed infection and vertical transmission rates of zucchini yellow mosaic virus (ZYMV), in addition to undertaking Illumina sequencing of nine vertically transmitted ZYMV populations. We previously determined the seed-to-seedling transmission rate of ZYMV in Cucurbita pepo ssp. texana (a wild gourd) to be 1.6%, and herein observed a similar rate (1.8%) in the subsequent generation. We also observed that the seed infection rate is substantially higher (21.9%) than the seed-to-seedling transmission rate, suggesting that a major population bottleneck occurs during seed germination and seedling growth. In contrast, that two thirds of the variants present in the horizontally transmitted inoculant population were also present in the vertically transmitted populations implies that the bottleneck at vertical transmission may not be particularly severe. Strikingly, all of the vertically infected plants were symptomless in contrast to those infected horizontally, suggesting that vertical infection may be cryptic. Although no known virulence determining mutations were observed in the vertically infected samples, the 5' untranslated region was highly variable, with at least 26 different major haplotypes in this region compared to the two major haplotypes observed in the horizontally transmitted population. That the regions necessary for vector transmission are retained in the vertically infected populations, combined with the cryptic nature of vertical infection, suggests that seed transmission may be a significant contributor to the spread of ZYMV.

  16. Grey leaves in an alpine plant: a cryptic colouration to avoid attack?


    Niu, Yang; Chen, Gao; Peng, De-Li; Song, Bo; Yang, Yang; Li, Zhi-Min; Sun, Hang


    Cryptic colouration is a common predation-avoidance strategy in animals that is postulated to occur in plants, but few experimental studies have rigorously tested this hypothesis. We investigated the colouration of Corydalis benecincta, an alpine plant with remarkably dimorphic leaf colours (grey and green), based on a cost-benefit analysis. First we tested the premise that herbivores (Parnassius butterflies) cannot distinguish grey leaves from a scree background by spectrographic measurements and by estimating discriminability between leaves and scree using a butterfly colour vision model. Then we estimated the potential costs of inconspicuousness by comparing the photosynthetic performance and visual attractiveness to flower visitors of the two colour morphs. Finally, we examined the potential benefits of inconspicuousness by comparing damage, survivorship and female reproductive success. It is difficult for herbivores to distinguish grey-coloured morphs against the background. This grey colour originates in a combination of anthocyanins and chlorophylls. The two colour morphs had similar photosynthetic performance, visual attractiveness and female reproductive success. However, grey morphs had significantly lower herbivore damage and higher survivorship. Grey leaves benefit C. benecincta by reducing herbivory with low investment in anthocyanin synthesis, and little cost on photosynthesis and mating opportunity. This cryptic colouration may have evolved through selection pressure imposed by visually foraging herbivores.

  17. Environmental Enrichment Accelerates the Ontogeny of Cryptic Behavior in Pharaoh Cuttlefish (Sepia pharaonis).


    Yasumuro, Haruhiko; Ikeda, Yuzuru


    We examined effect of environmental enrichment on cuttlefish, the most neutrally advanced invertebrate, to compare species variation of genetic and environmental influences. Cuttlefish were reared from seven to 117 days in one of three environments, namely, "poor" (artificial bottom without objects), "standard" (sandy bottom), and "enriched" (sandy bottom with objects). In Experiment 1, we explored whether enrichment affects the exhibition of crypsis in the cuttlefish. The cuttlefish in the standard and enriched environments spent most of their time at the bottom, exhibiting the mottled or disruptive pattern starting at 27 days of age. On the contrary, those in the poor environment exhibited uniform pattern starting at 87 days of age. Additionally, they repeatedly attempted to dig from 27 to 87 days of age, and moved around by hovering from 77 to 117 days of age. In Experiment 2, we exposed the cuttlefish to six novel substrates every other month after 53 days of age to verify whether enrichment actually affected the maturation of cryptic ability. Cuttlefish from the poor environment tended not to dig into white sandy bottom at 53-55 days of age. Additionally, they did not clearly exhibit appropriate body patterns in response to the six substrates compared to those from the other two environments at 81-83 days of age. However, at 113-115 days of age, most cuttlefish from the three environments exhibited similar cryptic behaviors in response to novel substrates. We conclude that physical enrichment promotes crypsis and accelerates the maturation of this ability in cuttlefish. PMID:27268979

  18. Spatially structured populations with a low level of cryptic diversity in European marine Gastrotricha.


    Kieneke, Alexander; Martínez Arbizu, Pedro M; Fontaneto, Diego


    Species of the marine meiofauna such as Gastrotricha are known to lack dispersal stages and are thus assumed to have low dispersal ability and low levels of gene flow between populations. Yet, most species are widely distributed, and this creates a paradox. To shed light on this apparent paradox, we test (i) whether such wide distribution may be due to misidentification and lumping of cryptic species with restricted distributions and (ii) whether spatial structures exist for the phylogeography of gastrotrichs. As a model, we used the genus Turbanella in NW Europe. DNA taxonomy using a mitochondrial and a nuclear marker supports distinctness of four traditional species (Turbanella ambronensis, T. bocqueti, T. mustela and T. cornuta) and provides evidence for two cryptic species within T. hyalina. An effect of geography on the within-species genetic structure is indeed present, with the potential for understanding colonization processes and for performing phylogeographic inference from microscopic animals. On the other hand, the occurrence of widely distributed haplotypes indicates long-distance dispersal as well, despite the assumed low dispersal ability of gastrotrichs.

  19. Global dispersal and ancient cryptic species in the smallest marine eukaryotes.


    Slapeta, Jan; López-García, Purificación; Moreira, David


    Small eukaryotic species (<1 mm) are thought to behave as prokaryotes in that, lacking geographical barriers to their dispersal due to their tiny size, they are ubiquitous. Accordingly, the absence of geographical insulation would imply the existence of a relatively small number of microeukaryotic species. To test these ideas, we sequenced and compared several nuclear, mitochondrial, and chloroplast genes from the isolates of a marine picoeukaryotic alga (approximately 2 microm), Micromonas pusilla, collected worldwide. Independent and combined phylogenetic analyses demonstrate that this traditional single morphospecies actually comprises several independent lineages, some of which are shown to be ubiquitous in oceans. However, while some lineages group closely related strains, others form distant clusters, revealing the existence of cryptic species. Moreover, molecular dating using a relaxed clock suggests that their first diversification may have started as early as during the Late Cretaceous (approximately 65 MYA), implying that "M. pusilla" is the oldest group of cryptic species known to date. Our results illustrate that global dispersal of a picoeukaryote is possible in oceans, but this does not imply a reduced species number. On the contrary, we show that the morphospecies concept is untenable because it overlooks a large genetic and species diversity and may lead to incorrect biological assumptions.

  20. Multilocus phylogeography of the European ground squirrel: cryptic interglacial refugia of continental climate in Europe.


    Říčanová, Štěpánka; Koshev, Yordan; Říčan, Oldřich; Ćosić, Nada; Ćirović, Duško; Sedláček, František; Bryja, Josef


    The theory of classical and cryptic Pleistocene refugia is based mainly on historical changes in temperature, and the refugia are usually defined within a latitudinal gradient. However, the gradient of oceanic-continental climate (i.e. longitudinal) was also significantly variable during glacial cycles with important biotic consequences. Range-wide phylogeography of the European ground squirrel (EGS) was used to interpret the evolutionary and palaeogeographical history of the species in Europe and to shed light on its glacial-interglacial dynamic. The EGS is a steppe-inhabiting species and the westernmost member of the genus in the Palaearctic region. We have analysed 915 specimens throughout the present natural range by employing mitochondrial DNA sequences (cytochrome b gene) and 12 nuclear microsatellite markers. The reconstructed phylogeography divides the species into two main geographical groups, with deep substructuring within both groups. Bulgaria is the centre of the ancestral area, and it also has the highest genetic diversity within the species. The northernmost group of the EGS survived in the southern part of Pannonia throughout several glacial-interglacial cycles. Animals from this population probably repeatedly colonized areas further to the north and west during the glacial periods, while in the interglacial periods, the EGS distribution contracted back to this Pannonian refugium. The EGS thus represents a species with a glacial expansion/interglacial contraction palaeogeographical dynamics, and the Pannonian and southeastern Balkanian steppes are supported as cryptic refugia of continental climate during Pleistocene interglacials.

  1. Quantitative Genetics Identifies Cryptic Genetic Variation Involved in the Paternal Regulation of Seed Development.


    Pires, Nuno D; Bemer, Marian; Müller, Lena M; Baroux, Célia; Spillane, Charles; Grossniklaus, Ueli


    Embryonic development requires a correct balancing of maternal and paternal genetic information. This balance is mediated by genomic imprinting, an epigenetic mechanism that leads to parent-of-origin-dependent gene expression. The parental conflict (or kinship) theory proposes that imprinting can evolve due to a conflict between maternal and paternal alleles over resource allocation during seed development. One assumption of this theory is that paternal alleles can regulate seed growth; however, paternal effects on seed size are often very low or non-existent. We demonstrate that there is a pool of cryptic genetic variation in the paternal control of Arabidopsis thaliana seed development. Such cryptic variation can be exposed in seeds that maternally inherit a medea mutation, suggesting that MEA acts as a maternal buffer of paternal effects. Genetic mapping using recombinant inbred lines, and a novel method for the mapping of parent-of-origin effects using whole-genome sequencing of segregant bulks, indicate that there are at least six loci with small, paternal effects on seed development. Together, our analyses reveal the existence of a pool of hidden genetic variation on the paternal control of seed development that is likely shaped by parental conflict. PMID:26811909

  2. Conformal Window and Correlation Functions in Lattice Conformal QCD

    NASA Astrophysics Data System (ADS)

    Iwasaki, Y.

    We discuss various aspects of Conformal Field Theories on the Lattice. We mainly investigate the SU(3) gauge theory with Nf degenerate fermions in the fundamental representation, employing the one-plaquette gauge action and the Wilson fermion action. First we make a brief review of our previous works on the phase structure of lattice gauge theories in terms of the gauge coupling constant and the quark mass. We thereby clarify the reason why we conjecture that the conformal window is 7 ≤ Nf ≤ 16. Secondly, we introduce a new concept, "conformal theories with IR cutof" and point out that any numerical simulation on a lattice is bounded by an IR cutoff ∧IR. Then we make predictions that when Nf is within the conformal window, the propagator of a meson G(t) behaves at large t, as G(t) = c exp (-mHt)/tα, that is, a modified Yukawa-type decay form, instead of the usual exponential decay form exp (-mHt), in the small quark mass region. This holds on an any lattice for any coupling constant g, as far as g is between 0 and g*, where g* is the IR fixed point. We verify that numerical results really satisfy the predictions for the Nf = 7 case and the Nf = 16 case. Thirdly, we discuss small number of flavors (Nf = 2 ˜ 6) QCD at finite temperatures. We point out theoretically and verify numerically that the correlation functions at T/Tc > 1 exhibit the characteristics of the conformal function with IR cutoff, an exponential decay with power correction. Investigating our numerical data by a new method which we call the "local-analysis" of propagators, we observe that the Nf = 7 case and the Nf = 2 at T ˜ 2Tc case are similar to each other, while the Nf = 16 case and the Nf = 2 at T = 102 ˜ 105Tc cases are similar to each other. Further, we observe our data are consistent with the picture that the Nf = 7 case and the Nf = 2 at T ˜ 2Tc case are close to the meson unparticle model. On the other hand, the Nf = 16 case and the Nf = 2 at T = 102 ˜ 105Tc cases are close to

  3. Conformal triality of the Kepler problem

    NASA Astrophysics Data System (ADS)

    Cariglia, Marco


    We show that the Kepler problem is projectively equivalent to null geodesic motion on the conformal compactification of Minkowski-4 space. This space realises the conformal triality of Minkowski, dS and AdS spaces.

  4. Killing Initial Data on spacelike conformal boundaries

    NASA Astrophysics Data System (ADS)

    Paetz, Tim-Torben


    We analyze Killing Initial Data on Cauchy surfaces in conformally rescaled vacuum space-times satisfying Friedrich's conformal field equations. As an application, we derive the KID equations on a spacelike ℐ-.

  5. [Conformal radiotherapy of brain tumors].


    Haie-Meder, C; Beaudré, A; Breton, C; Biron, B; Cordova, A; Dubray, B; Mazeron, J J


    Conformal irradiation of brain tumours is based on the three-dimensional reconstruction of the targeted volumes and at-risk organ images, the three-dimensional calculation of the dose distribution and a treatment device (immobilisation, beam energy, collimation, etc.) adapted to the high precision required by the procedure. Each step requires an appropriate methodology and a quality insurance program. Specific difficulties in brain tumour management are related to GTV and CTV definition depending upon the histological type, the quality of the surgical resection and the medical team. Clinical studies have reported dose escalation trials, mostly in high-grade gliomas and tumours at the base of the skull. Clinical data are now providing a better knowledge of the tolerance of normal tissues. As for small tumours, the implementation of beam intensity modulation is likely to narrow the gap between conformal and stereotaxic radiotherapy. PMID:10572510

  6. The Conformational Behaviour of Glucosamine

    NASA Astrophysics Data System (ADS)

    Peña, Isabel; Kolesniková, Lucie; Cabezas, Carlos; Bermúdez, Celina; Berdakin, Matías; Simao, Alcides; Alonso, José L.


    A laser ablation method has been successfully used to vaporize the bioactive amino monosaccharide D-glucosamine. Three cyclic α-4C1 pyranose forms have been identified using a combination of CP-FTMW and LA-MB-FTMW spectroscopy. Stereoelectronic hyperconjugative factors, like those associated with anomeric or gauche effects, as well as the cooperative OH\\cdotsO, OH\\cdotsN and NH\\cdotsO chains, extended along the entire molecule, are the main factors driving the conformational behavior. All observed conformers exhibit a counter-clockwise arrangement (cc) of the network of intramolecular hydrogen bonds. The results are compared with those recently obtained for D-glucose. J. L. Alonso, M. A. Lozoya, I. Peña, J. C. López, C. Cabezas, S. Mata, S. Blanco, Chem. Sci. 2014, 5, 515.

  7. The conformational cycle of kinesin.

    PubMed Central

    Cross, R A; Crevel, I; Carter, N J; Alonso, M C; Hirose, K; Amos, L A


    The stepping mechanism of kinesin can be thought of as a programme of conformational changes. We briefly review protein chemical, electron microscopic and transient kinetic evidence for conformational changes, and working from this evidence, outline a model for the mechanism. In the model, both kinesin heads initially trap Mg x ADP. Microtubule binding releases ADP from one head only (the trailing head). Subsequent ATP binding and hydrolysis by the trailing head progressively accelerate attachment of the leading head, by positioning it closer to its next site. Once attached, the leading head releases its ADP and exerts a sustained pull on the trailing head. The rate of closure of the molecular gate which traps ADP on the trailing head governs its detachment rate. A speculative but crucial coordinating feature is that this rate is strain sensitive, slowing down under negative strain and accelerating under positive strain. PMID:10836499

  8. Holographic multiverse and conformal invariance

    SciTech Connect

    Garriga, Jaume; Vilenkin, Alexander E-mail:


    We consider a holographic description of the inflationary multiverse, according to which the wave function of the universe is interpreted as the generating functional for a lower dimensional Euclidean theory. We analyze a simple model where transitions between inflationary vacua occur through bubble nucleation, and the inflating part of spacetime consists of de Sitter regions separated by thin bubble walls. In this model, we present some evidence that the dual theory is conformally invariant in the UV.

  9. Anomalous dimensions of conformal baryons

    NASA Astrophysics Data System (ADS)

    Pica, Claudio; Sannino, Francesco


    We determine the anomalous dimensions of baryon operators for the three-color theory as functions of the number of massless flavors within the conformal window to the maximum known order in perturbation theory. We show that the anomalous dimension of the baryon is controllably small, within the δ expansion, for a wide range of number of flavors. We also find that this is always smaller than the anomalous dimension of the fermion mass operator. These findings challenge the partial compositeness paradigm.

  10. Stabilizing the boat conformation of cyclohexane rings

    SciTech Connect

    Dasgupta, S.; Goddard, W.A. III; Moldowan, J.M.; Carlson, R.M.K.; Goddard, W.A. III.


    In calculating the energetics for various conformers of the A, B, and C series of hopanoid hydrocarbons present in mature oil reservoirs, we find that the B series prefers the boat conformation (by 1.3-2.5 kcal/mol) for the D cyclohexane ring. We analyze the structural elements responsible for stabilizing this boat conformation, identify the key features, and illustrate how one might stabilize boat conformations of other systems. 5 refs., 3 figs., 2 tabs.

  11. Cryptic Diversity in Metropolis: Confirmation of a New Leopard Frog Species (Anura: Ranidae) from New York City and Surrounding Atlantic Coast Regions

    PubMed Central

    Feinberg, Jeremy A.; Newman, Catherine E.; Watkins-Colwell, Gregory J.; Schlesinger, Matthew D.; Zarate, Brian; Curry, Brian R.; Shaffer, H. Bradley; Burger, Joanna


    We describe a new cryptic species of leopard frog from the New York City metropolitan area and surrounding coastal regions. This species is morphologically similar to two largely parapatric eastern congeners, Rana sphenocephala and R. pipiens. We primarily use bioacoustic and molecular data to characterize the new species, but also examine other lines of evidence. This discovery is unexpected in one of the largest and most densely populated urban parts of the world. It also demonstrates that new vertebrate species can still be found periodically even in well-studied locales rarely associated with undocumented biodiversity. The new species typically occurs in expansive open-canopied wetlands interspersed with upland patches, but centuries of loss and impact to these habitats give some cause for conservation concern. Other concerns include regional extirpations, fragmented extant populations, and a restricted overall geographic distribution. We assign a type locality within New York City and report a narrow and largely coastal lowland distribution from central Connecticut to northern New Jersey (based on genetic data) and south to North Carolina (based on call data). PMID:25354068

  12. Cryptic diversity in metropolis: confirmation of a new leopard frog species (Anura: Ranidae) from New York City and surrounding Atlantic coast regions.


    Feinberg, Jeremy A; Newman, Catherine E; Watkins-Colwell, Gregory J; Schlesinger, Matthew D; Zarate, Brian; Curry, Brian R; Shaffer, H Bradley; Burger, Joanna


    We describe a new cryptic species of leopard frog from the New York City metropolitan area and surrounding coastal regions. This species is morphologically similar to two largely parapatric eastern congeners, Rana sphenocephala and R. pipiens. We primarily use bioacoustic and molecular data to characterize the new species, but also examine other lines of evidence. This discovery is unexpected in one of the largest and most densely populated urban parts of the world. It also demonstrates that new vertebrate species can still be found periodically even in well-studied locales rarely associated with undocumented biodiversity. The new species typically occurs in expansive open-canopied wetlands interspersed with upland patches, but centuries of loss and impact to these habitats give some cause for conservation concern. Other concerns include regional extirpations, fragmented extant populations, and a restricted overall geographic distribution. We assign a type locality within New York City and report a narrow and largely coastal lowland distribution from central Connecticut to northern New Jersey (based on genetic data) and south to North Carolina (based on call data).

  13. Anomalies, conformal manifolds, and spheres

    NASA Astrophysics Data System (ADS)

    Gomis, Jaume; Hsin, Po-Shen; Komargodski, Zohar; Schwimmer, Adam; Seiberg, Nathan; Theisen, Stefan


    The two-point function of exactly marginal operators leads to a universal contribution to the trace anomaly in even dimensions. We study aspects of this trace anomaly, emphasizing its interpretation as a sigma model, whose target space {M} is the space of conformal field theories (a.k.a. the conformal manifold). When the underlying quantum field theory is supersymmetric, this sigma model has to be appropriately supersymmetrized. As examples, we consider in some detail {N}=(2,2) and {N}=(0,2) supersymmetric theories in d = 2 and {N}=2 supersymmetric theories in d = 4. This reasoning leads to new information about the conformal manifolds of these theories, for example, we show that the manifold is Kähler-Hodge and we further argue that it has vanishing Kähler class. For {N}=(2,2) theories in d = 2 and {N}=2 theories in d = 4 we also show that the relation between the sphere partition function and the Kähler potential of {M} follows immediately from the appropriate sigma models that we construct. Along the way we find several examples of potential trace anomalies that obey the Wess-Zumino consistency conditions, but can be ruled out by a more detailed analysis.

  14. Conformal Invariance of Graphene Sheets.


    Giordanelli, I; Posé, N; Mendoza, M; Herrmann, H J


    Suspended graphene sheets exhibit correlated random deformations that can be studied under the framework of rough surfaces with a Hurst (roughness) exponent 0.72 ± 0.01. Here, we show that, independent of the temperature, the iso-height lines at the percolation threshold have a well-defined fractal dimension and are conformally invariant, sharing the same statistical properties as Schramm-Loewner evolution (SLEκ) curves with κ = 2.24 ± 0.07. Interestingly, iso-height lines of other rough surfaces are not necessarily conformally invariant even if they have the same Hurst exponent, e.g. random Gaussian surfaces. We have found that the distribution of the modulus of the Fourier coefficients plays an important role on this property. Our results not only introduce a new universality class and place the study of suspended graphene membranes within the theory of critical phenomena, but also provide hints on the long-standing question about the origin of conformal invariance in iso-height lines of rough surfaces.

  15. Limit cycles and conformal invariance

    NASA Astrophysics Data System (ADS)

    Fortin, Jean-François; Grinstein, Benjamín; Stergiou, Andreas


    There is a widely held belief that conformal field theories (CFTs) require zero beta functions. Nevertheless, the work of Jack and Osborn implies that the beta functions are not actually the quantites that decide conformality, but until recently no such behavior had been exhibited. Our recent work has led to the discovery of CFTs with nonzero beta functions, more precisely CFTs that live on recurrent trajectories, e.g., limit cycles, of the beta-function vector field. To demonstrate this we study the S function of Jack and Osborn. We use Weyl consistency conditions to show that it vanishes at fixed points and agrees with the generator Q of limit cycles on them. Moreover, we compute S to third order in perturbation theory, and explicitly verify that it agrees with our previous determinations of Q. A byproduct of our analysis is that, in perturbation theory, unitarity and scale invariance imply conformal invariance in four-dimensional quantum field theories. Finally, we study some properties of these new, "cyclic" CFTs, and point out that the a-theorem still governs the asymptotic behavior of renormalization-group flows.

  16. The Conformational Landscape of Serinol

    NASA Astrophysics Data System (ADS)

    Sanz, M. Eugenia; Loru, Donatella; Peña, Isabel; Alonso, José L.


    The rotational spectrum of the amino alcohol serinol CH_2OH--CH(NH_2)--CH_2OH, which constitutes the hydrophilic head of the lipid sphingosine, has been investigated using chirped-pulsed Fourier transform microwave spectroscopy in combination with laser ablation Five different forms of serinol have been observed and conclusively identified by the comparison between the experimental values of their rotational and 14N quadrupole coupling constants and those predicted by ab initio calculations. In all observed conformers several hydrogen bonds are established between the two hydroxyl groups and the amino groups in a chain or circular arrangement. The most abundant conformer is stabilised by O--H···N and N--H···O hydrogen bonds forming a chain rather than a cycle. One of the detected conformers presents a tunnelling motion of the hydrogen atoms of the functional groups similar to that observed in glycerol. S. Mata, I. Peña, C. Cabezas, J. C. López, J. L. Alonso, J. Mol. Spectrosc. 2012, 280, 91 V. V. Ilyushin, R. A. Motiyenko, F. J. Lovas, D. F. Plusquellic, J. Mol. Spectrosc. 2008, 251, 129.

  17. Anomalies, conformal manifolds, and spheres


    Gomis, Jaume; Hsin, Po-Shen; Komargodski, Zohar; Schwimmer, Adam; Seiberg, Nathan; Theisen, Stefan


    The two-point function of exactly marginal operators leads to a universal contribution to the trace anomaly in even dimensions. We study aspects of this trace anomaly, emphasizing its interpretation as a sigma model, whose target space $M$ is the space of conformal field theories (a.k.a. the conformal manifold). When the underlying quantum field theory is supersymmetric, this sigma model has to be appropriately supersymmetrized. As examples, we consider in some detail $N$ = (2; 2) and $N$ = (0; 2) supersymmetric theories in d = 2 and $N$ = 2 supersymmetric theories in d = 4. This reasoning leads tomore » new information about the conformal manifolds of these theories, for example, we show that the manifold is K ahler-Hodge and we further argue that it has vanishing K ahler class. For $N$ = (2; 2) theories in d = 2 and N = 2 theories in d = 4 we also show that the relation between the sphere partition function and the K ahler potential of $M$ follows immediately from the appropriate sigma models that we construct. Ultimately, along the way we find several examples of potential trace anomalies that obey the Wess-Zumino consistency conditions, but can be ruled out by a more detailed analysis.« less

  18. Electrophysiological precursors of social conformity.


    Shestakova, Anna; Rieskamp, Jörg; Tugin, Sergey; Ossadtchi, Alexey; Krutitskaya, Janina; Klucharev, Vasily


    Humans often change their beliefs or behavior due to the behavior or opinions of others. This study explored, with the use of human event-related potentials (ERPs), whether social conformity is based on a general performance-monitoring mechanism. We tested the hypothesis that conflicts with a normative group opinion evoke a feedback-related negativity (FRN) often associated with performance monitoring and subsequent adjustment of behavior. The experimental results show that individual judgments of facial attractiveness were adjusted in line with a normative group opinion. A mismatch between individual and group opinions triggered a frontocentral negative deflection with the maximum at 200 ms, similar to FRN. Overall, a conflict with a normative group opinion triggered a cascade of neuronal responses: from an earlier FRN response reflecting a conflict with the normative opinion to a later ERP component (peaking at 380 ms) reflecting a conforming behavioral adjustment. These results add to the growing literature on neuronal mechanisms of social influence by disentangling the conflict-monitoring signal in response to the perceived violation of social norms and the neural signal of a conforming behavioral adjustment.

  19. Conformal Invariance of Graphene Sheets

    PubMed Central

    Giordanelli, I.; Posé, N.; Mendoza, M.; Herrmann, H. J.


    Suspended graphene sheets exhibit correlated random deformations that can be studied under the framework of rough surfaces with a Hurst (roughness) exponent 0.72 ± 0.01. Here, we show that, independent of the temperature, the iso-height lines at the percolation threshold have a well-defined fractal dimension and are conformally invariant, sharing the same statistical properties as Schramm-Loewner evolution (SLEκ) curves with κ = 2.24 ± 0.07. Interestingly, iso-height lines of other rough surfaces are not necessarily conformally invariant even if they have the same Hurst exponent, e.g. random Gaussian surfaces. We have found that the distribution of the modulus of the Fourier coefficients plays an important role on this property. Our results not only introduce a new universality class and place the study of suspended graphene membranes within the theory of critical phenomena, but also provide hints on the long-standing question about the origin of conformal invariance in iso-height lines of rough surfaces. PMID:26961723

  20. Electrophysiological precursors of social conformity.


    Shestakova, Anna; Rieskamp, Jörg; Tugin, Sergey; Ossadtchi, Alexey; Krutitskaya, Janina; Klucharev, Vasily


    Humans often change their beliefs or behavior due to the behavior or opinions of others. This study explored, with the use of human event-related potentials (ERPs), whether social conformity is based on a general performance-monitoring mechanism. We tested the hypothesis that conflicts with a normative group opinion evoke a feedback-related negativity (FRN) often associated with performance monitoring and subsequent adjustment of behavior. The experimental results show that individual judgments of facial attractiveness were adjusted in line with a normative group opinion. A mismatch between individual and group opinions triggered a frontocentral negative deflection with the maximum at 200 ms, similar to FRN. Overall, a conflict with a normative group opinion triggered a cascade of neuronal responses: from an earlier FRN response reflecting a conflict with the normative opinion to a later ERP component (peaking at 380 ms) reflecting a conforming behavioral adjustment. These results add to the growing literature on neuronal mechanisms of social influence by disentangling the conflict-monitoring signal in response to the perceived violation of social norms and the neural signal of a conforming behavioral adjustment. PMID:22683703

  1. On the cohomology of Leibniz conformal algebras

    NASA Astrophysics Data System (ADS)

    Zhang, Jiao


    We construct a new cohomology complex of Leibniz conformal algebras with coefficients in a representation instead of a module. The low-dimensional cohomology groups of this complex are computed. Meanwhile, we construct a Leibniz algebra from a Leibniz conformal algebra and prove that the category of Leibniz conformal algebras is equivalent to the category of equivalence classes of formal distribution Leibniz algebras.

  2. Flexible ligand docking using conformational ensembles.

    PubMed Central

    Lorber, D. M.; Shoichet, B. K.


    Molecular docking algorithms suggest possible structures for molecular complexes. They are used to model biological function and to discover potential ligands. A present challenge for docking algorithms is the treatment of molecular flexibility. Here, the rigid body program, DOCK, is modified to allow it to rapidly fit multiple conformations of ligands. Conformations of a given molecule are pre-calculated in the same frame of reference, so that each conformer shares a common rigid fragment with all other conformations. The ligand conformers are then docked together, as an ensemble, into a receptor binding site. This takes advantage of the redundancy present in differing conformers of the same molecule. The algorithm was tested using three organic ligand protein systems and two protein-protein systems. Both the bound and unbound conformations of the receptors were used. The ligand ensemble method found conformations that resembled those determined in X-ray crystal structures (RMS values typically less than 1.5 A). To test the method's usefulness for inhibitor discovery, multi-compound and multi-conformer databases were screened for compounds known to bind to dihydrofolate reductase and compounds known to bind to thymidylate synthase. In both cases, known inhibitors and substrates were identified in conformations resembling those observed experimentally. The ligand ensemble method was 100-fold faster than docking a single conformation at a time and was able to screen a database of over 34 million conformations from 117,000 molecules in one to four CPU days on a workstation. PMID:9568900

  3. 40 CFR 52.799 - Transportation conformity.

    Code of Federal Regulations, 2014 CFR


    ... 40 Protection of Environment 3 2014-07-01 2014-07-01 false Transportation conformity. 52.799... (CONTINUED) APPROVAL AND PROMULGATION OF IMPLEMENTATION PLANS Indiana § 52.799 Transportation conformity. On June 4, 2010, Indiana submitted the Transportation Conformity Consultation SIP consisting...

  4. 40 CFR 52.799 - Transportation conformity.

    Code of Federal Regulations, 2012 CFR


    ... 40 Protection of Environment 3 2012-07-01 2012-07-01 false Transportation conformity. 52.799... (CONTINUED) APPROVAL AND PROMULGATION OF IMPLEMENTATION PLANS Indiana § 52.799 Transportation conformity. On June 4, 2010, Indiana submitted the Transportation Conformity Consultation SIP consisting...

  5. 40 CFR 52.799 - Transportation conformity.

    Code of Federal Regulations, 2013 CFR


    ... 40 Protection of Environment 3 2013-07-01 2013-07-01 false Transportation conformity. 52.799... (CONTINUED) APPROVAL AND PROMULGATION OF IMPLEMENTATION PLANS Indiana § 52.799 Transportation conformity. On June 4, 2010, Indiana submitted the Transportation Conformity Consultation SIP consisting...

  6. 40 CFR 52.799 - Transportation conformity.

    Code of Federal Regulations, 2011 CFR


    ... 40 Protection of Environment 3 2011-07-01 2011-07-01 false Transportation conformity. 52.799... (CONTINUED) APPROVAL AND PROMULGATION OF IMPLEMENTATION PLANS Indiana § 52.799 Transportation conformity. On June 4, 2010, Indiana submitted the Transportation Conformity Consultation SIP consisting...

  7. 40 CFR 51.854 - Conformity analysis.

    Code of Federal Regulations, 2010 CFR


    ... 40 Protection of Environment 2 2010-07-01 2010-07-01 false Conformity analysis. 51.854 Section 51... FOR PREPARATION, ADOPTION, AND SUBMITTAL OF IMPLEMENTATION PLANS Determining Conformity of General Federal Actions to State or Federal Implementation Plans § 51.854 Conformity analysis. Link to...

  8. Reduction of excess sludge production in sequencing batch reactor (SBR) by lysis-cryptic growth using homogenization disruption.


    Lan, Wangcheng; Li, Yiyong; Bi, Qi; Hu, Yongyou


    A lysis-cryptic growth system, which combined high-pressure-homogenization (HPH) for sludge disruption, was proposed to reduce excess sludge production in SBR. Experimental data was analyzed with the aid of response surface models to determine the optimal HPH disruption pressure, which was 70 MPa. By combining a 5.4 m3/d pilot SBR with HPH disruption, the new system achieved a 42.4% sludge reduction rate over a 75 days operation. Based on measurement of oxygen uptake rate and activity of the dehydrogenase, the lysis-cryptic growth system resulted in negligible change of the sludge activity. However, an increase of 0.04 mg/L of total-phosphorus (TP) and 2.40 mg/L suspended-solids (SS) was observed in the effluent due to the process of lysis-cryptic growth. Except for above listed points, the new system demonstrated improved sludge reduction performance while the direct cost of pilot SBR lysis-cryptic growth was only 0.177US dollar per kilogram (dry sludge) according to estimation.

  9. Clinical and genetic features of dyskeratosis congenita, cryptic dyskeratosis congenita, and Hoyeraal-Hreidarsson syndrome in Japan.


    Yamaguchi, Hiroki; Sakaguchi, Hirotoshi; Yoshida, Kenichi; Yabe, Miharu; Yabe, Hiromasa; Okuno, Yusuke; Muramatsu, Hideki; Takahashi, Yoshiyuki; Yui, Shunsuke; Shiraishi, Yuichi; Chiba, Kenichi; Tanaka, Hiroko; Miyano, Satoru; Inokuchi, Koiti; Ito, Etsuro; Ogawa, Seishi; Kojima, Seiji


    Dyskeratosis congenita (DKC) is an inherited bone marrow failure (BMF) syndrome typified by reticulated skin pigmentation, nail dystrophy, and mucosal leukoplakia. Hoyeraal-Hreidarsson syndrome (HHS) is considered to be a severe form of DKC. Unconventional forms of DKC, which develop slowly in adulthood but without the physical anomalies characteristic of DKC (cryptic DKC), have been reported. Clinical and genetic features of DKC have been investigated in Caucasian, Black, and Hispanic populations, but not in Asian populations. The present study aimed to determine the clinical and genetic features of DKC, HHS, and cryptic DKC among Japanese patients. We analyzed 16 patients diagnosed with DKC, three patients with HHS, and 15 patients with cryptic DKC. We found that platelet count was significantly more depressed than neutrophil count or hemoglobin value in DKC patients, and identified DKC patients with large deletions in the telomerase reverse transcriptase and cryptic DKC patients with RTEL1 mutations on both alleles. This led to some patients previously considered to have unclassifiable BMF being diagnosed with cDKC through identification of new gene mutations. It thus seems important from a clinical viewpoint to re-examine the clinical characteristics, frequency of genetic mutations, and treatment efficacy in DKC, HHS, and cDKC.

  10. Molecular species delimitation methods and population genetics data reveal extensive lineage diversity and cryptic species in Aglaopheniidae (Hydrozoa).


    Postaire, Bautisse; Magalon, Hélène; Bourmaud, Chloé A-F; Bruggemann, J Henrich


    A comprehensive inventory of global biodiversity would be greatly improved by automating methods for species delimitation. The Automatic Barcode Gap Discovery method, the Poisson tree processes algorithm and the Generalized mixed Yule-coalescent model have been proposed as means of increasing the rate of biodiversity description using single locus data. We applied these methods to explore the diversity within the Aglaopheniidae, a hydrozoan family with many species widely distributed across tropical and temperate oceans. Our analyses revealed widespread cryptic diversity in this family, almost half of the morpho-species presenting several independent evolutionary lineages, as well as support for cases of synonymy. For two common species of this family, Lytocarpia brevirostris and Macrorhynchia phoenicea, we compared the outputs to clustering analyses based on microsatellite data and to nuclear gene phylogenies. For L. brevirostris, microsatellite data were congruent with results of the species delimitation methods, revealing the existence of two cryptic species with Indo-Pacific distribution. For M. phoenicea, all analyses confirmed the presence of two cryptic species within the South-Western Indian Ocean. Our study suggests that the diversity of Aglaopheniidae might be much higher than assumed, likely related to low dispersal capacities. Sequence-based species delimitation methods seem highly valuable to reveal cryptic diversity in hydrozoans; their application in an integrative framework will be very useful in describing the phyletic diversity of these organisms. PMID:27566414

  11. T Cell Adaptive Immunity Proceeds through Environment-Induced Adaptation from the Exposure of Cryptic Genetic Variation

    PubMed Central

    Whitacre, James M.; Lin, Joseph; Harding, Angus


    Evolution is often characterized as a process involving incremental genetic changes that are slowly discovered and fixed in a population through genetic drift and selection. However, a growing body of evidence is finding that changes in the environment frequently induce adaptations that are much too rapid to occur by an incremental genetic search process. Rapid evolution is hypothesized to be facilitated by mutations present within the population that are silent or “cryptic” within the first environment but are co-opted or “exapted” to the new environment, providing a selective advantage once revealed. Although cryptic mutations have recently been shown to facilitate evolution in RNA enzymes, their role in the evolution of complex phenotypes has not been proven. In support of this wider role, this paper describes an unambiguous relationship between cryptic genetic variation and complex phenotypic responses within the immune system. By reviewing the biology of the adaptive immune system through the lens of evolution, we show that T cell adaptive immunity constitutes an exemplary model system where cryptic alleles drive rapid adaptation of complex traits. In naive T cells, normally cryptic differences in T cell receptor reveal diversity in activation responses when the cellular population is presented with a novel environment during infection. We summarize how the adaptive immune response presents a well studied and appropriate experimental system that can be used to confirm and expand upon theoretical evolutionary models describing how seemingly small and innocuous mutations can drive rapid cellular evolution. PMID:22363338

  12. Characterization of the Campylobacter jejuni cryptic plasmid pTIW94 recovered from wild birds in the southeastern United States

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The complete nucleotide sequence of a cryptic plasmid, pTIW94, recovered from several Campylobacter jejuni isolates from wild birds in the southeastern United States, was determined. All plasmids were circular molecules of 3865 nucleotides, with a G+C content of 31.0%, similar to that of Campylobac...

  13. Acute promyelocytic leukemia with cryptic t(15;17) on isochromosome 17: a case report and review of literature

    PubMed Central

    Tang, Yuting; Wang, Ying; Hu, Liang; Meng, Fankai; Xu, Danmei; Wan, Kai; Huang, Lifang; Li, Chunrui; Zhou, Jianfeng


    Acute Promyelocytic Leukemia (APL) is one of the most curable leukemia which shows great sensitivity to all-trans retinoic acid (ATRA) although a small number of the patients present poor prognosis and short survival. Isochromosome 17 in APL which usually bears an additional copy of RARA/PML fusion gene is considered to be a negative factor on its prognosis. Cryptic t(15;17) on i(17q) leads to an extra copy of PML/RARA rather than RARA/PML which may confer a worse prognosis. We describe here a rare APL case with complex chromosomal abnormality including isochromosome 17 bearing cryptic t(15;17) showing poor outcome. The patient lacks a classic t(15;17) and fluorescence in situ hybridization (FISH) presents 2 PML/RARA fusion signals on both long arms of the isochromosome. The patient also acquired a secondary mutation at relapse when the initial karyotype was already a complex karyotype involving chromosome 13, 17 and 22 at the same time. The poor response of this patient to traditional chemotherapy like ATRA and novel therapy like arsenic trioxide (ATO) suggests that early auto-hematological stem cell transplantation may be the choice of APL with isochromosome 17 especially with cryptic t(15;17) on i(17q). We are the first to show a clear history and evidence of FISH of these kind of cases. A small summary of cases with cryptic t(15;17) on isochromosome 17 is also made. PMID:26823883

  14. Genome-wide data help identify an avian species-level lineage that is morphologically and vocally cryptic.


    Garg, Kritika M; Tizard, Robert; Ng, Nathaniel S R; Cros, Emilie; Dejtaradol, Ariya; Chattopadhyay, Balaji; Pwint, Nila; Päckert, Martin; Rheindt, Frank E


    Species identification has traditionally relied on morphology. However, morphological conservatism can lead to a high incidence of cryptic species, as characters other than morphological ones can be biologically important. In birds, the combined application of bioacoustic and molecular criteria has led to an avalanche of cryptic species discoveries over the last two decades in which findings of deep vocal differentiation have usually been corroborated by molecular data or vice versa. In this study, we use genome-wide DNA data to uncover an unusual case of cryptic speciation in two species within the South-east Asian Streak-eared Bulbul Pycnonotus blanfordi complex, in which both morphology and vocalizations have remained extremely similar. Despite a considerable pre-Pleistocene divergence of these two bulbul species, bioacoustic analysis failed to uncover differences in their main vocalization, but examination of live birds revealed important differences in eye color that had been overlooked in museum material. Our study demonstrates that genome-wide DNA data can be helpful in the detection of cryptic speciation, especially in species that have evolved limited morphological and behavioral differences. PMID:27233436

  15. Morphometric study of third-instar larvae from five morphotypes of the Anastrepha fraterculus cryptic species complex (Diptera, Tephritidae)

    PubMed Central

    Canal, Nelson A.; Hernández-Ortiz, Vicente; Salas, Juan O. Tigrero; Selivon, Denise


    Abstract The occurrence of cryptic species among economically important fruit flies strongly affects the development of management tactics for these pests. Tools for studying cryptic species not only facilitate evolutionary and systematic studies, but they also provide support for fruit fly management and quarantine activities. Previous studies have shown that the South American fruit fly, Anastrepha fraterculus, is a complex of cryptic species, but few studies have been performed on the morphology of its immature stages. An analysis of mandible shape and linear morphometric variability was applied to third-instar larvae of five morphotypes of the Anastrepha fraterculus complex: Mexican, Andean, Ecuadorian, Peruvian and Brazilian-1. Outline geometric morphometry was used to study the mouth hook shape and linear morphometry analysis was performed using 24 linear measurements of the body, cephalopharyngeal skeleton, mouth hook and hypopharyngeal sclerite. Different morphotypes were grouped accurately using canonical discriminant analyses of both the geometric and linear morphometry. The shape of the mandible differed among the morphotypes, and the anterior spiracle length, number of tubules of the anterior spiracle, length and height of the mouth hook and length of the cephalopharyngeal skeleton were the most significant variables in the linear morphometric analysis. Third-instar larvae provide useful characters for studies of cryptic species in the Anastrepha fraterculus complex. PMID:26798253

  16. Morphometric study of third-instar larvae from five morphotypes of the Anastrepha fraterculus cryptic species complex (Diptera, Tephritidae).


    Canal, Nelson A; Hernández-Ortiz, Vicente; Salas, Juan O Tigrero; Selivon, Denise


    The occurrence of cryptic species among economically important fruit flies strongly affects the development of management tactics for these pests. Tools for studying cryptic species not only facilitate evolutionary and systematic studies, but they also provide support for fruit fly management and quarantine activities. Previous studies have shown that the South American fruit fly, Anastrepha fraterculus, is a complex of cryptic species, but few studies have been performed on the morphology of its immature stages. An analysis of mandible shape and linear morphometric variability was applied to third-instar larvae of five morphotypes of the Anastrepha fraterculus complex: Mexican, Andean, Ecuadorian, Peruvian and Brazilian-1. Outline geometric morphometry was used to study the mouth hook shape and linear morphometry analysis was performed using 24 linear measurements of the body, cephalopharyngeal skeleton, mouth hook and hypopharyngeal sclerite. Different morphotypes were grouped accurately using canonical discriminant analyses of both the geometric and linear morphometry. The shape of the mandible differed among the morphotypes, and the anterior spiracle length, number of tubules of the anterior spiracle, length and height of the mouth hook and length of the cephalopharyngeal skeleton were the most significant variables in the linear morphometric analysis. Third-instar larvae provide useful characters for studies of cryptic species in the Anastrepha fraterculus complex.

  17. Monophyly, Distance and Character–Based Multigene Barcoding Reveal Extraordinary Cryptic Diversity in Nassarius: A Complex and Dangerous Community

    PubMed Central

    Zou, Shanmei; Li, Qi; Kong, Lingfeng


    Background Correct identification and cryptic biodiversity revelation for marine organisms are pressing since the marine life is important in maintaining the balance of ecological system and is facing the problem of biodiversity crisis or food safety. DNA barcoding has been proved successful to provide resolution beyond the boundaries of morphological information. Nassarius, the common mudsnail, plays an important role in marine environment and has problem in food safety, but the classification of it is quite confused because of the complex morphological diversity. Methodology/Principal Findings Here we report a comprehensive barcoding analysis of 22 Nassarius species. We integrated the mitochondrial and nuclear sequences and the morphological characters to determine 13 Nassarius species studied and reveal four cryptic species and one pair synonyms. Distance, monophyly, and character–based barcoding methods were employed. Conclusions/Significance Such successful identification and unexpected cryptic discovery is significant for Nassarius in food safety and species conversation and remind us to pay more attention to the hidden cryptic biodiversity ignored in marine life. Distance, monophyly, and character–based barcoding methods are all very helpful in identification but the character-based method shows some advantages. PMID:23071774

  18. Ecological differentiation of cryptic species within an asexual protist morphospecies: a case study of filamentous green alga Klebsormidium (Streptophyta).


    Škaloud, Pavel; Rindi, Fabio


    Taxa of microbial eukaryotes defined on morphological basis display a large degree of genetic diversity, implying the existence of numerous cryptic species. However, it has been postulated that genetic diversity merely mirrors accumulation of neutral mutations. As a case taxon to study cryptic diversity in protists, we used a widely distributed filamentous genus, Klebsormidium, specifically the lineage E (K. flaccidum/K. nitens complex) containing a number of morphologically similar strains. Fourteen clades were recognized in the phylogenetic analysis based on a concatenated ITS rDNA + rbcL data set of more than 70 strains. The results of inferred character evolution indicated the existence of phylogenetic signal in at least two phenotypic characters (production of hydro-repellent filaments and morphology of zoosporangia). Moreover, the lineages recovered exhibited strong ecological preferences to one of the three habitat types: natural subaerial substrata, artificial subaerial substrata, and aquatic habitats. We interpret these results as evidence of existence of a high number of cryptic species within the single morphospecies. We consider that the permanent existence of genetically and ecologically well-defined cryptic species is enabled by the mechanism of selective sweep.

  19. Conformally flat black holes in Poincaré gauge theory

    NASA Astrophysics Data System (ADS)

    Blagojević, M.; Cvetković, B.


    General criteria for the existence of conformally flat Riemannian solutions in three-dimensional Poincaré gauge theory without matter are formulated. Using these criteria, we show that the Oliva-Tempo-Troncoso black hole, a solution of the Bergshoeff-Hohm-Townsend gravity, is also an exact vacuum solution of the Poincaré gauge theory. The related conserved charges, calculated from the Hamiltonian boundary term, are shown to satisfy the first law of black hole thermodynamics. The form of the boundary term is verified by using the covariant Hamiltonian approach.

  20. Conservation Biology and real-world conservation.


    Robinson, John G


    In the 20 years since Conservation Biology was launched with the aim of disseminating scientific knowledge to help conserve biodiversity and the natural world, our discipline has hugely influenced the practice of conservation. But we have had less impact outside the profession itself and we have not transformed that practice into an enterprise large enough to achieve our conservation goals. As we look to the next 20 years, we need to become more relevant and important to the societies in which we live. To do so, the discipline of conservation biology must generate answers even when full scientific knowledge is lacking, structure scientific research around polices and debates that influence what we value as conservationists, go beyond the certitude of the biological sciences into the more contextual debates of the social sciences, engage scientifically with human-dominated landscapes, and address the question of how conservation can contribute to the improvement of human livelihoods and the quality of human life.