Sample records for crystal diffraction analysis

  1. Quantitative analysis of crystalline pharmaceuticals in tablets by pattern-fitting procedure using X-ray diffraction pattern.

    PubMed

    Takehira, Rieko; Momose, Yasunori; Yamamura, Shigeo

    2010-10-15

    A pattern-fitting procedure using an X-ray diffraction pattern was applied to the quantitative analysis of binary system of crystalline pharmaceuticals in tablets. Orthorhombic crystals of isoniazid (INH) and mannitol (MAN) were used for the analysis. Tablets were prepared under various compression pressures using a direct compression method with various compositions of INH and MAN. Assuming that X-ray diffraction pattern of INH-MAN system consists of diffraction intensities from respective crystals, observed diffraction intensities were fitted to analytic expression based on X-ray diffraction theory and separated into two intensities from INH and MAN crystals by a nonlinear least-squares procedure. After separation, the contents of INH were determined by using the optimized normalization constants for INH and MAN. The correction parameter including all the factors that are beyond experimental control was required for quantitative analysis without calibration curve. The pattern-fitting procedure made it possible to determine crystalline phases in the range of 10-90% (w/w) of the INH contents. Further, certain characteristics of the crystals in the tablets, such as the preferred orientation, size of crystallite, and lattice disorder were determined simultaneously. This method can be adopted to analyze compounds whose crystal structures are known. It is a potentially powerful tool for the quantitative phase analysis and characterization of crystals in tablets and powders using X-ray diffraction patterns. Copyright 2010 Elsevier B.V. All rights reserved.

  2. Comparative Analysis of Thaumatin Crystals Grown on Earth and in Microgravity. Experiment 23

    NASA Technical Reports Server (NTRS)

    Ng, Joseph D.; Lorber, Bernard; Giege, Richard; Koszelak, Stanley; Day, John; Greenwood, Aaron; McPherson, Alexander

    1998-01-01

    The protein thaumatin was studied as a model macromolecule for crystallization in microgravity environment experiments conducted on two U.S. Space Shuttle missions (second United States Microgravity Laboratory (USML-2) and Life and Microgravity Spacelab (LMS)). In this investigation we evaluated and compared the quality of space- and Earth-grown thaumatin crystals using x-ray diffraction analysis and characterized them according to crystal size, diffraction resolution limit, and mosaicity. Two different approaches for growing thaumatin crystals in the microgravity environment, dialysis and liquid-liquid diffusion, were employed as a joint experiment by our two investigative teams. Thaumatin crystals grown under a microgravity environment were generally larger in volume with fewer total crystals. They diffracted to significantly higher resolution and with improved diffraction properties as judged by relative Wilson plots. The mosaicity for space-grown crystals was significantly less than for those grown on Earth. Increasing concentrations of protein in the crystallization chambers under microgravity lead to larger crystals. The data presented here lend further support to the idea that protein crystals of improved quality can be obtained in a microgravity environment.

  3. Dynamical effects in Bragg coherent x-ray diffraction imaging of finite crystals

    NASA Astrophysics Data System (ADS)

    Shabalin, A. G.; Yefanov, O. M.; Nosik, V. L.; Bushuev, V. A.; Vartanyants, I. A.

    2017-08-01

    We present simulations of Bragg coherent x-ray diffractive imaging (CXDI) data from finite crystals in the frame of the dynamical theory of x-ray diffraction. The developed approach is based on a numerical solution of modified Takagi-Taupin equations and can be applied for modeling of a broad range of x-ray diffraction experiments with finite three-dimensional crystals of arbitrary shape also in the presence of strain. We performed simulations for nanocrystals of a cubic and hemispherical shape of different sizes and provided a detailed analysis of artifacts in the Bragg CXDI reconstructions introduced by the dynamical diffraction. Based on our theoretical analysis we developed an analytical procedure to treat effects of refraction and absorption in the reconstruction. Our results elucidate limitations for the kinematical approach in the Bragg CXDI and suggest a natural criterion to distinguish between kinematical and dynamical cases in coherent x-ray diffraction on a finite crystal.

  4. Femtosecond X-ray Diffraction From Two-Dimensional Protein Crystals

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Frank, Matthias; Carlson, David B.; Hunter, Mark

    2014-02-28

    Here we present femtosecond x-ray diffraction patterns from two-dimensional (2-D) protein crystals using an x-ray free electron laser (XFEL). To date it has not been possible to acquire x-ray diffraction from individual 2-D protein crystals due to radiation damage. However, the intense and ultrafast pulses generated by an XFEL permits a new method of collecting diffraction data before the sample is destroyed. Utilizing a diffract-before-destroy methodology at the Linac Coherent Light Source, we observed Bragg diffraction to better than 8.5 Å resolution for two different 2-D protein crystal samples that were maintained at room temperature. These proof-of-principle results show promisemore » for structural analysis of both soluble and membrane proteins arranged as 2-D crystals without requiring cryogenic conditions or the formation of three-dimensional crystals.« less

  5. Crystallization and X-ray diffraction analysis of a catalytic domain of hyperthermophilic chitinase from Pyrococcus furiosus

    PubMed Central

    Mine, Shouhei; Nakamura, Tsutomu; Hirata, Kunio; Ishikawa, Kazuhiko; Hagihara, Yoshihisa; Uegaki, Koichi

    2006-01-01

    The crystallization and preliminary X-ray diffraction analysis of a catalytic domain of chitinase (PF1233 gene) from the hyperthermophilic archaeon Pyrococcus furiosus is reported. The recombinant protein, prepared using an Escherichia coli expression system, was crystallized by the hanging-drop vapour-diffusion method. An X-ray diffraction data set was collected at the undulator beamline BL44XU at SPring-8 to a resolution of 1.50 Å. The crystals belong to space group P212121, with unit-cell parameters a = 90.0, b = 92.8, c = 107.2 Å. PMID:16880559

  6. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhao, Haishuang; Krysiak, Yaşar; Hoffmann, Kristin

    The crystal structure and disorder phenomena of Al{sub 4}B{sub 2}O{sub 9}, an aluminum borate from the mullite-type family, were studied using automated diffraction tomography (ADT), a recently established method for collection and analysis of electron diffraction data. Al{sub 4}B{sub 2}O{sub 9}, prepared by sol-gel approach, crystallizes in the monoclinic space group C2/m. The ab initio structure determination based on three-dimensional electron diffraction data from single ordered crystals reveals that edge-connected AlO{sub 6} octahedra expanding along the b axis constitute the backbone. The ordered structure (A) was confirmed by TEM and HAADF-STEM images. Furthermore, disordered crystals with diffuse scattering along themore » b axis are observed. Analysis of the modulation pattern implies a mean superstructure (AAB) with a threefold b axis, where B corresponds to an A layer shifted by ½a and ½c. Diffraction patterns simulated for the AAB sequence including additional stacking disorder are in good agreement with experimental electron diffraction patterns. - Graphical abstract: Crystal structure and disorder phenomena of B-rich Al{sub 4}B{sub 2}O{sub 9} studied by automated electron diffraction tomography (ADT) and described by diffraction simulation using DISCUS. - Highlights: • Ab-initio structure solution by electron diffraction from single nanocrystals. • Detected modulation corresponding mainly to three-fold superstructure. • Diffuse diffraction streaks caused by stacking faults in disordered crystals. • Observed streaks explained by simulated electron diffraction patterns.« less

  7. Investigations on synthesis, growth and physicochemical properties of semi-organic NLO crystal bis(thiourea) ammonium nitrate for nonlinear frequency conversion

    NASA Astrophysics Data System (ADS)

    Anbarasi, A.; Ravi Kumar, S. M.; Sundar, G. J. Shanmuga; Mosses, M. Allen; Raj, M. Packiya; Prabhakaran, M.; Ravisankar, R.; Gunaseelan, R.

    2017-10-01

    Bis(thiourea) ammonium nitrate (BTAN), a new nonlinear optical crystal was grown successfully by slow evaporation technique using water as solvent at room temperature. The grown crystals were optically good quality with dimensions upto 10 × 6 × 3 mm3. Single crystal X-Ray diffraction analysis reveals that the crystal lattice is orthorhombic. From Powder X-ray diffraction analysis the diffraction planes have been indexed. The presence of the various functional groups of BTAN was identified through FTIR spectroscopic analysis. UV cut-off wavelength was observed from optical absorbance spectrum and it was found to be 240 nm. Second harmonic efficiency was determined using Kurtz powder method in comparison with KDP to confirm the nonlinearity of the material. Thermal analysis confirmed that grown crystal is thermally stable upto 184 °C. Microhardness studies show that hardness number (Hv) increases with load. Conductivity measurements such as dielectric, ac and photoconductivity were studied. Growth mechanism and surface features of the as grown single crystal was analysed by chemical etching analysis.

  8. Structural, optical, mechanical and dielectric studies of pure and doped L-Prolinium trichloroacetate single crystals.

    PubMed

    Renuka, N; Ramesh Babu, R; Vijayan, N; Vasanthakumar, Geetha; Krishna, Anuj; Ramamurthi, K

    2015-02-25

    In the present work, pure and metal substituted L-Prolinium trichloroacetate (LPTCA) single crystals were grown by slow evaporation method. The grown crystals were subjected to single crystal X-ray diffraction (XRD), powder X-ray diffraction, FTIR, UV-Visible-NIR, hardness, photoluminescence and dielectric studies. The dopant concentration in the crystals was measured by inductively coupled plasma (ICP) analysis. Single crystal X-ray diffraction studies of the pure and metal substituted LPTCA revealed that the grown crystals belong to the trigonal system. Ni(2+) and Co(2+) doping slightly altered the lattice parameters of LPTCA without affecting the basic structure of the crystal. FTIR spectral analysis confirms the presence of various functional groups in the grown crystals. The mechanical behavior of pure and doped crystals was analyzed by Vickers's microhardness test. The optical transmittance, dielectric and photoluminescence properties of the pure and doped crystals were analyzed. Copyright © 2014 Elsevier B.V. All rights reserved.

  9. Crystallization and preliminary X-ray diffraction analysis of a chitin-binding domain of hyperthermophilic chitinase from Pyrococcus furiosus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nakamura, Tsutomu; Ishikawa, Kazuhiko; Hagihara, Yoshihisa

    The expression, purification and preliminary X-ray diffraction studies of a chitin-binding domain of the chitinase from P. furiosus are reported. The crystallization and preliminary X-ray diffraction analysis of the chitin-binding domain of chitinase from a hyperthermophilic archaeon, Pyrococcus furiosus, are reported. The recombinant protein was prepared using an Escherichia coli overexpression system and was crystallized by the hanging-drop vapour-diffusion method. An X-ray diffraction data set was collected to 1.70 Å resolution. The crystal belonged to space group P4{sub 3}2{sub 1}2 or P4{sub 1}2{sub 1}2. The unit-cell parameters were determined to be a = b = 48.8, c = 85.0 Å.

  10. Purification, crystallization and preliminary X-ray diffraction analysis of aspartate semialdehyde dehydrogenase (Rv3708c) from Mycobacterium tuberculosis

    PubMed Central

    Vyas, Rajan; Kumar, Vijay; Panjikar, Santosh; Karthikeyan, Subramanian; Kishan, K. V. Radha; Tewari, Rupinder; Weiss, Manfred S.

    2008-01-01

    Aspartate semialdehyde dehydrogenase from Mycobacterium tuberculosis (Asd, ASADH, Rv3708c), which is the second enzyme in the lysine/homoserine-biosynthetic pathways, has been expressed heterologously in Escherichia coli. The enzyme was purified using affinity and gel-filtration chromatographic techniques and crystallized in two different crystal forms. Preliminary diffraction data analysis suggested the presence of up to four monomers in the asymmetric unit of the orthorhombic crystal form A and of one or two monomers in the cubic crystal form B. PMID:18323599

  11. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sathyalakshmi, R.; Bhagavannarayana, G.; Ramasamy, P.

    L-(+)-Glutamic acid hydro bromide, an isomorphic salt of L-glutamic acid hydrochloride, was synthesized and the synthesis was confirmed using Fourier transform infrared analysis. Solubility of the material in water was determined. L-Glutamic acid hydro bromide crystals were grown by low temperature solution growth using the solvent evaporation technique. Single crystal X-ray diffraction studies were carried out and the cell parameters, atomic co-ordinates, bond lengths and bond angles were reported. High-resolution X-ray diffraction studies were carried out and good crystallinity for the grown crystal was observed from the diffraction curve. The grown crystals were subjected to dielectric studies. Ultraviolet-visible-near infrared spectralmore » analysis shows good optical transmission in the visible and infrared region of the grown crystals. The second harmonic generation efficiency of L-glutamic acid hydro bromide crystal was determined using the Kurtz powder test and it was found that it had efficiency comparable with that of the potassium di-hydrogen phosphate crystal.« less

  12. Growth and characterization of organic NLO material: Clobetasol propionate

    NASA Astrophysics Data System (ADS)

    Purusothaman, R.; Rajesh, P.; Ramasamy, P.

    2015-06-01

    Single crystals of clobetasol propionate (CP) have been grown by slow evaporation solution technique using mixed solvent of methanol-acetone. The grown crystals were subjected to single crystal X-ray diffraction analysis to confirm their lattice parameter and space group. The powder X-ray diffraction pattern of the grown CP has been indexed. Thermal analysis was performed to study the thermal stability of the grown crystals. Photoluminescence spectrum shows broad emission peak observed at 421 nm. Nonlinear optical studies were carried out for the grown crystal and second harmonic generation (SHG) efficiency was found in the crystal.

  13. Preliminary crystallographic analysis of ADP-glucose pyrophosphorylase from Agrobacterium tumefaciens

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cupp-Vickery, Jill R., E-mail: jvickery@uci.edu; Igarashi, Robert Y.; Meyer, Christopher R.

    2005-03-01

    Crystallization and X-ray diffraction methods for native A. tumefaciens ADP-glucose pyrophosphorylase and its selenomethionyl derivative are described. Two crystal forms are identified, both of which diffract to 2 Å.

  14. Maximizing Macromolecule Crystal Size for Neutron Diffraction Experiments

    NASA Technical Reports Server (NTRS)

    Judge, R. A.; Kephart, R.; Leardi, R.; Myles, D. A.; Snell, E. H.; vanderWoerd, M.; Curreri, Peter A. (Technical Monitor)

    2002-01-01

    A challenge in neutron diffraction experiments is growing large (greater than 1 cu mm) macromolecule crystals. In taking up this challenge we have used statistical experiment design techniques to quickly identify crystallization conditions under which the largest crystals grow. These techniques provide the maximum information for minimal experimental effort, allowing optimal screening of crystallization variables in a simple experimental matrix, using the minimum amount of sample. Analysis of the results quickly tells the investigator what conditions are the most important for the crystallization. These can then be used to maximize the crystallization results in terms of reducing crystal numbers and providing large crystals of suitable habit. We have used these techniques to grow large crystals of Glucose isomerase. Glucose isomerase is an industrial enzyme used extensively in the food industry for the conversion of glucose to fructose. The aim of this study is the elucidation of the enzymatic mechanism at the molecular level. The accurate determination of hydrogen positions, which is critical for this, is a requirement that neutron diffraction is uniquely suited for. Preliminary neutron diffraction experiments with these crystals conducted at the Institute Laue-Langevin (Grenoble, France) reveal diffraction to beyond 2.5 angstrom. Macromolecular crystal growth is a process involving many parameters, and statistical experimental design is naturally suited to this field. These techniques are sample independent and provide an experimental strategy to maximize crystal volume and habit for neutron diffraction studies.

  15. Studies on the growth, structural, spectral and third-order nonlinear optical properties of ammonium 3-carboxy-4-hydroxy benzenesulfonate monohydrate single crystal.

    PubMed

    Silambarasan, A; Krishna Kumar, M; Thirunavukkarasu, A; Mohan Kumar, R; Umarani, P R

    2015-01-25

    An organic nonlinear optical bulk single crystal, Ammonium 3-carboxy-4-hydroxy benzenesulfonate monohydrate (ACHBS) was successfully grown by solution growth technique. Single crystal X-ray diffraction study confirms that, the grown crystal belongs to P21/c space group. Powder X-ray diffraction and high resolution X-ray diffraction analyses revealed the crystallinity of the grown crystal. Infrared spectral analysis showed the vibrational behavior of chemical bonds and its functional groups. The thermal stability and decomposition stages of the grown crystal were studied by TG-DTA analysis. UV-Visible transmittance studies showed the transparency region and cut-off wavelength of the grown crystal. The third-order nonlinear optical susceptibility of the grown crystal was estimated by Z-scan technique using He-Ne laser source. The mechanical property of the grown crystal was studied by using Vicker's microhardness test. Copyright © 2014 Elsevier B.V. All rights reserved.

  16. Crystallization and preliminary X-ray diffraction analysis of West Nile virus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kaufmann, Barbel; Plevka, Pavel; Kuhn, Richard J.

    2010-05-25

    West Nile virus, a human pathogen, is closely related to other medically important flaviviruses of global impact such as dengue virus. The infectious virus was purified from cell culture using polyethylene glycol (PEG) precipitation and density-gradient centrifugation. Thin amorphously shaped crystals of the lipid-enveloped virus were grown in quartz capillaries equilibrated by vapor diffusion. Crystal diffraction extended at best to a resolution of about 25 {angstrom} using synchrotron radiation. A preliminary analysis of the diffraction images indicated that the crystals had unit-cell parameters a {approx_equal} b {approx_equal} 480 {angstrom}, {gamma} = 120{sup o}, suggesting a tight hexagonal packing of onemore » virus particle per unit cell.« less

  17. Dislocation, crystallite size distribution and lattice strain of magnesium oxide nanoparticles

    NASA Astrophysics Data System (ADS)

    Sutapa, I. W.; Wahid Wahab, Abdul; Taba, P.; Nafie, N. L.

    2018-03-01

    The oxide of magnesium nanoparticles synthesized using sol-gel method and analysis of the structural properties was conducted. The functional groups of nanoparticles has been analysed by Fourier Transform Infrared Spectroscopy (FT-IR). Dislocations, average size of crystal, strain, stress, the energy density of crystal, crystallite size distribution and morphologies of the crystals were determined based on X-ray diffraction profile analysis. The morphological of the crystal was analysed based on the image resulted from SEM analysis. The crystallite size distribution was calculated with the contention that the particle size has a normal logarithmic form. The most orientations of crystal were determined based on the textural crystal from diffraction data of X-ray diffraction profile analysis. FT-IR results showed the stretching vibration mode of the Mg-O-Mg in the range of 400.11-525 cm-1 as a broad band. The average size crystal of nanoparticles resulted is 9.21 mm with dislocation value of crystal is 0.012 nm-2. The strains, stress, the energy density of crystal are 1.5 x 10-4 37.31 MPa; 0.72 MPa respectively. The highest texture coefficient value of the crystal is 0.98. This result is supported by morphological analysis using SEM which shows most of the regular cubic-shaped crystals. The synthesis method is suitable for simple and cost-effective synthesis model of MgO nanoparticles.

  18. Continuous diffraction of molecules and disordered molecular crystals

    PubMed Central

    Yefanov, Oleksandr M.; Ayyer, Kartik; White, Thomas A.; Barty, Anton; Morgan, Andrew; Mariani, Valerio; Oberthuer, Dominik; Pande, Kanupriya

    2017-01-01

    The intensities of far-field diffraction patterns of orientationally aligned molecules obey Wilson statistics, whether those molecules are in isolation (giving rise to a continuous diffraction pattern) or arranged in a crystal (giving rise to Bragg peaks). Ensembles of molecules in several orientations, but uncorrelated in position, give rise to the incoherent sum of the diffraction from those objects, modifying the statistics in a similar way as crystal twinning modifies the distribution of Bragg intensities. This situation arises in the continuous diffraction of laser-aligned molecules or translationally disordered molecular crystals. This paper develops the analysis of the intensity statistics of such continuous diffraction to obtain parameters such as scaling, beam coherence and the number of contributing independent object orientations. When measured, continuous molecular diffraction is generally weak and accompanied by a background that far exceeds the strength of the signal. Instead of just relying upon the smallest measured intensities or their mean value to guide the subtraction of the background, it is shown how all measured values can be utilized to estimate the background, noise and signal, by employing a modified ‘noisy Wilson’ distribution that explicitly includes the background. Parameters relating to the background and signal quantities can be estimated from the moments of the measured intensities. The analysis method is demonstrated on previously published continuous diffraction data measured from crystals of photosystem II [Ayyer et al. (2016 ▸), Nature, 530, 202–206]. PMID:28808434

  19. Synchrotron X-ray reciprocal-space mapping, topography and diffraction resolution studies of macromolecular crystal quality.

    PubMed

    Boggon, T J; Helliwell, J R; Judge, R A; Olczak, A; Siddons, D P; Snell, E H; Stojanoff, V

    2000-07-01

    A comprehensive study of microgravity and ground-grown chicken egg-white lysozyme crystals is presented using synchrotron X-ray reciprocal-space mapping, topography techniques and diffraction resolution. Microgravity crystals displayed reduced intrinsic mosaicities on average, but no differences in terms of strain over their ground-grown counterparts. Topographic analysis revealed that in the microgravity case the majority of the crystal was contributing to the peak of the reflection at the appropriate Bragg angle. In the ground-control case only a small volume of the crystal contributed to the intensity at the diffraction peak. The techniques prove to be highly complementary, with the reciprocal-space mapping providing a quantitative measure of the crystal mosaicity and strain (or variation in lattice spacing) and the topography providing a qualitative overall assessment of the crystal in terms of its X-ray diffraction properties. Structural data collection was also carried out at the synchrotron.

  20. Purification, crystallization and preliminary X-ray diffraction studies of parakeet (Psittacula krameri) haemoglobin

    PubMed Central

    Jaimohan, S. M.; Naresh, M. D.; Arumugam, V.; Mandal, A. B.

    2009-01-01

    Birds often show efficient oxygen management in order to meet the special demands of their metabolism. However, the structural studies of avian haemo­globins (Hbs) are inadequate for complete understanding of the mechanism involved. Towards this end, purification, crystallization and preliminary X-ray diffraction studies have been carried out for parakeet Hb. Parakeet Hb was crystallized as the met form in low-salt buffered conditions after extracting haemoglobin from crude blood by microcentrifugation and purifying the sample by column chromatography. Good-quality crystals were grown from 10% PEG 3350 and a crystal diffracted to about 2.8 Å resolution. Preliminary diffraction data showed that the Hb crystal belonged to the monoclinic system (space group C2), with unit-cell parameters a = 110.68, b = 64.27, c = 56.40 Å, β = 109.35°. Matthews volume analysis indicated that the crystals contained a half-tetramer in the asymmetric unit. PMID:19851014

  1. Purification, crystallization and preliminary X-ray diffraction studies of parakeet (Psittacula krameri) haemoglobin.

    PubMed

    Jaimohan, S M; Naresh, M D; Arumugam, V; Mandal, A B

    2009-10-01

    Birds often show efficient oxygen management in order to meet the special demands of their metabolism. However, the structural studies of avian haemoglobins (Hbs) are inadequate for complete understanding of the mechanism involved. Towards this end, purification, crystallization and preliminary X-ray diffraction studies have been carried out for parakeet Hb. Parakeet Hb was crystallized as the met form in low-salt buffered conditions after extracting haemoglobin from crude blood by microcentrifugation and purifying the sample by column chromatography. Good-quality crystals were grown from 10% PEG 3350 and a crystal diffracted to about 2.8 A resolution. Preliminary diffraction data showed that the Hb crystal belonged to the monoclinic system (space group C2), with unit-cell parameters a = 110.68, b = 64.27, c = 56.40 A, beta = 109.35 degrees . Matthews volume analysis indicated that the crystals contained a half-tetramer in the asymmetric unit.

  2. Synchrotron X-Ray Reciprocal Space Mapping, Topography and Diffraction Resolution Studies of Macromolecular Crystal Quality

    NASA Technical Reports Server (NTRS)

    Boggon, T. J.; Helliwell, J. R.; Judge, Russell A.; Siddons, D. P.; Snell, Edward H.; Stojanoff, V.

    2000-01-01

    A comprehensive study of microgravity and ground grown chicken egg white lysozyme crystals is presented using synchrotron X-ray reciprocal space mapping, topography techniques and diffraction resolution. Microgravity crystals displayed, on average, reduced intrinsic mosaicities but no differences in terms of stress over their earth grown counterparts. Topographic analysis revealed that in the microgravity case the majority of the crystal was contributing to the peak of the reflection at the appropriate Bragg angle. In the earth case at the diffraction peak only a small volume of the crystal contributed to the intensity. The techniques prove to be highly complementary with the reciprocal space mapping providing a quantitative measure of the crystal mosaicity and stress (or variation in lattice spacing) and topography providing a qualitative overall assessment of the crystal in terms of its X-ray diffraction properties. Structural data collection was also carried out both at the synchrotron and in the laboratory.

  3. Crystallization and preliminary X-ray diffraction analysis of restriction endonuclease EcoRII

    NASA Technical Reports Server (NTRS)

    Karpova, E. A.; Meehan, E.; Pusey, M. L.; Chen, L.

    1999-01-01

    Crystals of the restriction endonuclease EcoRII have been obtained by the vapor-diffusion technique in the presence of ammonium sulfate or polyethylene glycol. The best crystals were grown with ammonium sulfate as a precipitant. Crystals with dimensions of up to 0.6 x 0. 6 x 0.6 mm have been observed. The crystals diffract to about 4.0 A resolution at a cryo-temperature of 100 K using a rotating-anode X-ray source and a Rigaku R-AXIS IV imaging-plate detector. The space group has been determined to be either I23 or I2(1)3, with unit-cell parameters a = b = c = 160.3 A, alpha = beta = gamma = 90 degrees. The crystal asymmetric unit contains two protein molecules, and self-rotation function analysis shows a pseudo-twofold symmetry relating the two monomers. Attempts to improve the resolution of crystal diffraction and to search for heavy-atom derivatives are under way.

  4. A novel structure of gel grown strontium cyanurate crystal and its structural, optical, electrical characterization

    NASA Astrophysics Data System (ADS)

    Divya, R.; Nair, Lekshmi P.; Bijini, B. R.; Nair, C. M. K.; Gopakumar, N.; Babu, K. Rajendra

    2017-12-01

    Strontium cyanurate crystals with novel structure and unique optical property like mechanoluminescence have been grown by conventional gel method. Transparent crystals were obtained. The single crystal X-ray diffraction analysis reveals the exquisite structure of the grown crystal. The crystal is centrosymmetric and has a three dimensional polymeric structure. The powder X ray diffraction analysis confirms its crystalline nature. The functional groups present in the crystal were identified by Fourier transform infrared spectroscopy. Elemental analysis confirmed the composition of the complex. A study of thermal properties was done by thermo gravimetric analysis and differential thermal analysis. The optical properties like band gap, refractive index and extinction coefficient were evaluated from the UV visible spectral analysis. The etching study was done to reveal the dislocations in the crystal which in turn explains mechanoluminescence emission. The mechanoluminescence property exhibited by the crystal makes it suitable for stress sensing applications. Besides being a centrosymmetric crystal, it also exhibits NLO behavior. Dielectric properties were studied and theoretical calculations of Fermi energy, valence electron plasma energy, penn gap and polarisability have been done.

  5. Collection of X-ray diffraction data from macromolecular crystals

    PubMed Central

    Dauter, Zbigniew

    2017-01-01

    Diffraction data acquisition is the final experimental stage of the crystal structure analysis. All subsequent steps involve mainly computer calculations. Optimally measured and accurate data make the structure solution and refinement easier and lead to more faithful interpretation of the final models. Here, the important factors in data collection from macromolecular crystals are discussed and strategies appropriate for various applications, such as molecular replacement, anomalous phasing, atomic-resolution refinement etc., are presented. Criteria useful for judging the diffraction data quality are also discussed. PMID:28573573

  6. Solid state parameters, structure elucidation, High Resolution X-Ray Diffraction (HRXRD), phase matching, thermal and impedance analysis on L-Proline trichloroacetate (L-PTCA) NLO single crystals.

    PubMed

    Kalaiselvi, P; Raj, S Alfred Cecil; Jagannathan, K; Vijayan, N; Bhagavannarayana, G; Kalainathan, S

    2014-11-11

    Nonlinear optical single crystal of L-Proline trichloroacetate (L-PTCA) was successfully grown by Slow Evaporation Solution Technique (SEST). The grown crystals were subjected to single crystal X-ray diffraction analysis to confirm the structure. From the single crystal XRD data, solid state parameters were determined for the grown crystal. The crystalline perfection has been evaluated using high resolution X-ray diffractometer. The frequencies of various functional groups were identified from FTIR spectral analysis. The percentage of transmittance was obtained from UV Visible spectral analysis. TGA-DSC measurements indicate the thermal stability of the crystal. The dielectric constant, dielectric loss and ac conductivity were measured by the impedance analyzer. The DC conductivity was calculated by the cole-cole plot method. Copyright © 2014 Elsevier B.V. All rights reserved.

  7. Crystallization and preliminary X-ray analysis of gamma-glutamyltranspeptidase from Escherichia coli K-12.

    PubMed

    Kumagai, H; Nohara, S; Suzuki, H; Hashimoto, W; Yamamoto, K; Sakai, H; Sakabe, K; Fukuyama, K; Sakabe, N

    1993-12-20

    gamma-Glutamyltranspeptidase (EC 2.3.2.2) from Escherichia coli K-12 has been purified and crystallized by means of vapor diffusion in hanging drops. Two kinds of crystals on cell dimensions were found for X-ray diffraction analysis, one from ammonium sulfate and the other from polyethylene glycol 6000 as precipitants. The crystals of the orthorhombic form grown in the presence of 15% polyethylene glycol and 20 mM sodium acetate buffer were chosen for further analysis. The crystals belonged to space group P2(1)2(1)2(1), with cell dimensions of a = 128.1, b = 129.9 and c = 79.2 A, and two molecules constitute an asymmetric unit. These crystals diffracted to 2.0 A resolution and were suitable for X-ray crystallographic studies.

  8. Crystallization of human nicotinamide phosphoribosyltransferase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Takahashi, Ryo; Nakamura, Shota; Yoshida, Takuya

    2007-05-01

    Human nicotinamide phosphoribosyltransferase has been crystallized using microseeding methods and X-ray diffraction data have been collected at 2.0 Å resolution. In the NAD biosynthetic pathway, nicotinamide phosphoribosyltransferase (NMPRTase; EC 2.4.2.12) plays an important role in catalyzing the synthesis of nicotinamide mononucleotide from nicotinamide and 5′-phosphoribosyl-1′-pyrophosphate. Because the diffraction pattern of the initally obtained crystals was not suitable for structure analysis, the crystal quality was improved by successive use of the microseeding technique. The resultant crystals diffracted to 2.0 Å resolution. These crystals belonged to space group P21, with unit-cell parameters a = 60.56, b = 106.40, c = 82.78 Å.more » Here, the crystallization of human NMPRTase is reported in the free form; the crystals should be useful for inhibitor-soaking experiments on the enzyme.« less

  9. Increasing dissolution of trospium chloride by co-crystallization with urea

    NASA Astrophysics Data System (ADS)

    Skořepová, Eliška; Hušák, Michal; Čejka, Jan; Zámostný, Petr; Kratochvíl, Bohumil

    2014-08-01

    The search for various solid forms of an active pharmaceutical ingredient (API) is an important step in drug development. Our aim was to prepare co-crystals of trospium chloride, an anticholinergic drug used for the treatment of incontinence, and to investigate if they have advantageous properties for drug formulation. Phase identification was done by powder X-ray diffraction and single-crystal X-ray diffraction. The chemical composition was verified by solution NMR and the dissolution rate of the prepared phases was studied by IDR (intrinsic dissolution rate). For further analysis of phase stability and transitions, combined thermal analysis and temperature-resolved X-ray powder diffraction were used. Urea was selected as a co-crystallization partner. Trospium chloride urea (1:1) co-crystal was prepared by a solvent evaporation. From single-crystal data, the co-crystal structure was solved in a space group P21/c and compared to previously published structures of trospium chloride. Intrinsic dissolution rate revealed that the co-crystal dissolves 32% faster than pure API. However, its low thermal and pressure stability makes it a challenging choice for the final drug formulation.

  10. Growth and characterization of 4-chloro-3-nitrobenzophenone single crystals using vertical Bridgman technique

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Aravinth, K., E-mail: anandcgc@gmail.com; Babu, G. Anandha, E-mail: anandcgc@gmail.com; Ramasamy, P., E-mail: anandcgc@gmail.com

    2014-04-24

    4-chloro-3-nitrobenzophenone (4C3N) has been grown by using vertical Bridgman technique. The grown crystal was confirmed by Powder X-ray diffraction analysis. The crystalline perfection of the grown crystal was examined by high-resolution X-ray diffraction study. The fluorescence spectra of grown 4C3N single crystals exhibit emission peak at 575 nm. The micro hardness measurements were used to analyze the mechanical property of the grown crystal.

  11. Crystallization and preliminary X-ray diffraction analysis of a novel sphingomyelinase D from Loxosceles gaucho venom.

    PubMed

    Ullah, Anwar; Magalhães, Geraldo Santana; Masood, Rehana; Mariutti, Ricardo Barros; Coronado, Monika Aparecida; Murakami, Mário Tyago; Barbaro, Katia Cristina; Arni, Raghuvir Krishnaswamy

    2014-10-01

    Brown spider envenomation results in dermonecrosis, intravascular coagulation, haemolysis and renal failure, mainly owing to the action of sphingomyelinases D (SMases D), which catalyze the hydrolysis of sphingomyelin to produce ceramide 1-phosphate and choline or the hydrolysis of lysophosphatidylcholine to produce lysophosphatidic acid. Here, the heterologous expression, purification, crystallization and preliminary X-ray diffraction analysis of LgRec1, a novel SMase D from Loxosceles gaucho venom, are reported. The crystals belonged to space group P21212, with unit-cell parameters a = 52.98, b = 62.27, c = 84.84 Å and diffracted to a maximum resolution of 2.6 Å.

  12. Crystallization and preliminary X-ray diffraction analysis of a novel sphingomyelinase D from Loxosceles gaucho venom

    PubMed Central

    Ullah, Anwar; Magalhães, Geraldo Santana; Masood, Rehana; Mariutti, Ricardo Barros; Coronado, Monika Aparecida; Murakami, Mário Tyago; Barbaro, Katia Cristina; Arni, Raghuvir Krishnaswamy

    2014-01-01

    Brown spider envenomation results in dermonecrosis, intravascular coagulation, haemolysis and renal failure, mainly owing to the action of sphingomyelinases D (SMases D), which catalyze the hydrolysis of sphingomyelin to produce ceramide 1-phosphate and choline or the hydrolysis of lysophosphatidylcholine to produce lysophosphatidic acid. Here, the heterologous expression, purification, crystallization and preliminary X-ray diffraction analysis of LgRec1, a novel SMase D from Loxosceles gaucho venom, are reported. The crystals belonged to space group P21212, with unit-cell parameters a = 52.98, b = 62.27, c = 84.84 Å and diffracted to a maximum resolution of 2.6 Å. PMID:25286953

  13. Crystallization and preliminary X-ray diffraction analysis of the amidase domain of allophanate hydrolase from Pseudomonas sp. strain ADP

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Balotra, Sahil; Newman, Janet; French, Nigel G.

    2014-02-19

    The amidase domain of the allophanate hydrolase AtzF from Pseudomonas sp. strain ADP has been crystallized and preliminary X-ray diffraction data have been collected. The allophanate hydrolase from Pseudomonas sp. strain ADP was expressed and purified, and a tryptic digest fragment was subsequently identified, expressed and purified. This 50 kDa construct retained amidase activity and was crystallized. The crystals diffracted to 2.5 Å resolution and adopted space group P2{sub 1}, with unit-cell parameters a = 82.4, b = 179.2, c = 112.6 Å, β = 106.6°.

  14. A simple 2D composite image analysis technique for the crystal growth study of L-ascorbic acid.

    PubMed

    Kumar, Krishan; Kumar, Virender; Lal, Jatin; Kaur, Harmeet; Singh, Jasbir

    2017-06-01

    This work was destined for 2D crystal growth studies of L-ascorbic acid using the composite image analysis technique. Growth experiments on the L-ascorbic acid crystals were carried out by standard (optical) microscopy, laser diffraction analysis, and composite image analysis. For image analysis, the growth of L-ascorbic acid crystals was captured as digital 2D RGB images, which were then processed to composite images. After processing, the crystal boundaries emerged as white lines against the black (cancelled) background. The crystal boundaries were well differentiated by peaks in the intensity graphs generated for the composite images. The lengths of crystal boundaries measured from the intensity graphs of composite images were in good agreement (correlation coefficient "r" = 0.99) with the lengths measured by standard microscopy. On the contrary, the lengths measured by laser diffraction were poorly correlated with both techniques. Therefore, the composite image analysis can replace the standard microscopy technique for the crystal growth studies of L-ascorbic acid. © 2017 Wiley Periodicals, Inc.

  15. Fast two-dimensional grid and transmission X-ray microscopy scanning methods for visualizing and characterizing protein crystals

    PubMed Central

    Wojdyla, Justyna Aleksandra; Panepucci, Ezequiel; Martiel, Isabelle; Ebner, Simon; Huang, Chia-Ying; Caffrey, Martin; Bunk, Oliver; Wang, Meitian

    2016-01-01

    A fast continuous grid scan protocol has been incorporated into the Swiss Light Source (SLS) data acquisition and analysis software suite on the macromolecular crystallography (MX) beamlines. Its combination with fast readout single-photon counting hybrid pixel array detectors (PILATUS and EIGER) allows for diffraction-based identification of crystal diffraction hotspots and the location and centering of membrane protein microcrystals in the lipid cubic phase (LCP) in in meso in situ serial crystallography plates and silicon nitride supports. Diffraction-based continuous grid scans with both still and oscillation images are supported. Examples that include a grid scan of a large (50 nl) LCP bolus and analysis of the resulting diffraction images are presented. Scanning transmission X-ray microscopy (STXM) complements and benefits from fast grid scanning. STXM has been demonstrated at the SLS beamline X06SA for near-zero-dose detection of protein crystals mounted on different types of sample supports at room and cryogenic temperatures. Flash-cooled crystals in nylon loops were successfully identified in differential and integrated phase images. Crystals of just 10 µm thickness were visible in integrated phase images using data collected with the EIGER detector. STXM offers a truly low-dose method for locating crystals on solid supports prior to diffraction data collection at both synchrotron microfocusing and free-electron laser X-ray facilities. PMID:27275141

  16. Growth and characterization of barium complex of 1,3,5-triazinane-2,4,6-trione in gel: a corrosion inhibiting material

    NASA Astrophysics Data System (ADS)

    Divya, R.; Nair, Lekshmi P.; Bijini, B. R.; Nair, C. M. K.; Babu, K. Rajendra

    2018-05-01

    Good quality prismatic crystals of industrially applicable corrosion inhibiting barium complex of 1,3,5-triazinane-2,4,6-trione have been grown by conventional gel method. The crystal structure, packing, and nature of bonds are revealed in the single crystal X-ray diffraction analysis. The crystal has a three-dimensional polymeric structure having a triclinic crystal system with the space group P-1. The powder X-ray diffraction analysis confirms its crystalline nature. The functional groups present in the crystal are identified by Fourier transform infrared spectroscopy. Elemental analysis confirms the stoichiometry of the elements present in the complex. Thermogravimetric analysis and differential thermal analysis reveal its good thermal stability. The optical properties like band gap, refractive index and extinction coefficient are evaluated from the UV-visible spectral analysis. The singular property of the material, corrosion inhibition efficiency achieved by the adsorption of the sample molecules is determined by the weight loss method.

  17. Crystallization and preliminary X-ray diffraction analysis of red clover necrotic mosaic virus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Martin, Stanton L.; Guenther, Richard H.; Sit, Tim L.

    2010-11-12

    Red clover necrotic mosaic virus (RCNMV) is a species that belongs to the Tombusviridae family of plant viruses with a T = 3 icosahedral capsid. RCNMV virions were purified and were crystallized for X-ray analysis using the hanging-drop vapor-diffusion method. Self-rotation functions and systematic absences identified the space group as I23, with two virions in the unit cell. The crystals diffracted to better than 4 {angstrom} resolution but were very radiation-sensitive, causing rapid decay of the high-resolution reflections. The data were processed to 6 {angstrom} in the analysis presented here.

  18. X-ray evaluation of crystals for stellar spectrometers

    NASA Technical Reports Server (NTRS)

    Alexandropolos, N. G. (Editor)

    1974-01-01

    The report consists of three parts. The first part is an analysis of the principles involved in X-ray crystal evaluation and how they are applied to a number of crystals. The principles of crystal evaluation analysis as they apply to the special problems of X-ray astronomy are presented. A number of crystals were evaluated, and the energy dependence of the diffraction properties of (002) PET, (111) Ge, (101) ADP, (001) KAP, and (001) RAP are reported. The second part is a compilation of the diffraction properties of a number of crystals as reported by other authors. In the third part some technical details of a triple crystal spectrometer built by the author at Polytechnic Institute of Brooklyn are given. This spectrometer seems to be a most appropriate instrument for evaluation of crystal properties. (Modified author abstract)

  19. Expression, purification, crystallization and preliminary X-ray diffraction analysis of α-11 giardin from Giardia lamblia

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pathuri, Puja; Nguyen, Emily Tam; Luecke, Hartmut, E-mail: hudel@uci.edu

    2006-11-01

    α-11 giardin from the intestinal protozoan parasite, G. lamblia has been cloned, expressed, purified and crystallized under two different conditions and in two different space groups. Crystals from the first condition diffracted to 1.1 Å and belong to a primitive orthorhombic space group and crystals obtained in the second condition diffracted to 2.93 Å and belong to a primitive monoclinic space group. α-11 Giardin, a protein from the annexin superfamily, is a 35.0 kDa protein from the intestinal protozoan parasite Giardia lamblia which triggers a form of diarrhea called giardiasis. Here, the cloning, expression, purification and the crystallization of α-11more » giardin under two different conditions and in two different space groups is reported. Crystals from the first condition diffracted to 1.1 Å and belong to a primitive orthorhombic space group, while crystals from the second condition, which included calcium in the crystallization solution, diffracted to 2.93 Å and belong to a primitive monoclinic space group. Determination of the detailed atomic structure of α-11 giardin will provide a better insight into its biological function and might establish whether this class of proteins is a potential drug target against giardiasis.« less

  20. Studies on 2-amino-5-nitropyridinium nitrate (2A5NPN): A semi-organic third order nonlinear optical single crystal

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sivasubramani, V.; Pandian, Muthu Senthil, E-mail: senthilpandianm@ssn.edu.in; Ramasamy, P.

    2016-05-23

    2-amino-5-nitropyridinium nitrate (2A5NPN) is a semi-organic nonlinear optical crystal and optically good quality 2A5NPN single crystals were successfully grown by slow evaporation solution growth technique (SEST) at ambient temperature. The crystallographic structure of the grown crystal was determined by single crystal X-Ray diffraction analysis and it belongs to Monoclinic crystal system with centro symmetric crystalline nature. The crystallinity of the grown crystal was confirmed by powder X-ray diffraction analysis. The other physical properties of grown crystals are also characterized using TG-DTA, UV-Visible NIR, chemical etching, photoconductivity and Z-scan measurements. The Z-scan method reveals that the 2A5NPN crystal possesses multi photonmore » absorption behaviour and the significantly higher third order susceptibility and it is a promising potential NLO material.« less

  1. Purification, crystallization and X-ray diffraction analysis of the C-terminal protease domain of Venezuelan equine encephalitis virus nsP2

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Russo, Andrew T.; Watowich, Stanley J., E-mail: watowich@xray.utmb.edu

    2006-06-01

    The C-terminal protease domain of Venezuelan equine encephalitis virus (VEEV) nsP2 has been overexpressed in E. coli, purified and successfully crystallized. Native crystals diffract to beyond 2.5 Å resolution and isomorphous heavy-atom derivatives suitable for phase analysis have been identified. The C-terminal region of Venezuelan equine encephalitis virus (VEEV) nsP2 is responsible for proteolytic processing of the VEEV polyprotein replication complex. This action regulates the activity of the replication complex and is essential for viral replication, thus making nsP2 a very attractive target for development of VEEV therapeutics. The 338-amino-acid C-terminal region of VEEV nsP2 has been overexpressed in Escherichiamore » coli, purified and crystallized. Crystals diffract to beyond 2.5 Å resolution and belong to the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}. Isomorphous heavy-atom derivatives suitable for phase analysis have been obtained and work on building a complete structural model is under way.« less

  2. Crystal growth, structural, thermal and mechanical behavior of l-arginine 4-nitrophenolate 4-nitrophenol dihydrate (LAPP) single crystals.

    PubMed

    Mahadevan, M; Ramachandran, K; Anandan, P; Arivanandhan, M; Bhagavannarayana, G; Hayakawa, Y

    2014-12-10

    Single crystals of l-arginine 4-nitrophenolate 4-nitrophenol dihydrate (LAPP) have been grown successfully from the solution of l-arginine and 4-nitrophenol. Slow evaporation of solvent technique was adopted to grow the bulk single crystals. Single crystal X-ray diffraction analysis confirms the grown crystal has monoclinic crystal system with space group of P21. Powder X-ray diffraction analysis shows the good crystalline nature. The crystalline perfection of the grown single crystals was analyzed by HRXRD by employing a multicrystal X-ray diffractometer. The functional groups were identified from proton NMR spectroscopic analysis. Linear and nonlinear optical properties were determined by UV-Vis spectrophotometer and Kurtz powder technique respectively. It is found that the grown crystal has no absorption in the green wavelength region and the SHG efficiency was found to be 2.66 times that of the standard KDP. The Thermal stability of the crystal was found by obtaining TG/DTA curve. The mechanical behavior of the grown crystal has been studied by Vicker's microhardness method. Copyright © 2014 Elsevier B.V. All rights reserved.

  3. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Aoki, Ken-ichi; Tanaka, Nobutada, E-mail: ntanaka@pharm.showa-u.ac.jp; Ishikura, Shuhei

    Pig heart carbonyl reductase has been crystallized in the presence of NADPH. Diffraction data have been collected using synchrotron radiation. Pig heart carbonyl reductase (PHCR), which belongs to the short-chain dehydrogenase/reductase (SDR) family, has been crystallized by the hanging-drop vapour-diffusion method. Two crystal forms (I and II) have been obtained in the presence of NADPH. Form I crystals belong to the tetragonal space group P4{sub 2}, with unit-cell parameters a = b = 109.61, c = 94.31 Å, and diffract to 1.5 Å resolution. Form II crystals belong to the tetragonal space group P4{sub 1}2{sub 1}2, with unit-cell parameters amore » = b = 120.10, c = 147.00 Å, and diffract to 2.2 Å resolution. Both crystal forms are suitable for X-ray structure analysis at high resolution.« less

  4. Crystallization and preliminary X-ray diffraction analysis of the peripheral light-harvesting complex LH2 from Marichromatium purpuratum.

    PubMed

    Cranston, Laura J; Roszak, Aleksander W; Cogdell, Richard J

    2014-06-01

    LH2 from the purple photosynthetic bacterium Marichromatium (formerly known as Chromatium) purpuratum is an integral membrane pigment-protein complex that is involved in harvesting light energy and transferring it to the LH1-RC `core' complex. The purified LH2 complex was crystallized using the sitting-drop vapour-diffusion method at 294 K. The crystals diffracted to a resolution of 6 Å using synchrotron radiation and belonged to the tetragonal space group I4, with unit-cell parameters a=b=109.36, c=80.45 Å. The data appeared to be twinned, producing apparent diffraction symmetry I422. The tetragonal symmetry of the unit cell and diffraction for the crystals of the LH2 complex from this species reveal that this complex is an octamer.

  5. Crystallization and preliminary X-ray diffraction analysis of the peripheral light-harvesting complex LH2 from Marichromatium purpuratum

    PubMed Central

    Cranston, Laura J.; Roszak, Aleksander W.; Cogdell, Richard J.

    2014-01-01

    LH2 from the purple photosynthetic bacterium Marichromatium (formerly known as Chromatium) purpuratum is an integral membrane pigment–protein complex that is involved in harvesting light energy and transferring it to the LH1–RC ‘core’ complex. The purified LH2 complex was crystallized using the sitting-drop vapour-diffusion method at 294 K. The crystals diffracted to a resolution of 6 Å using synchrotron radiation and belonged to the tetragonal space group I4, with unit-cell parameters a = b = 109.36, c = 80.45 Å. The data appeared to be twinned, producing apparent diffraction symmetry I422. The tetragonal symmetry of the unit cell and diffraction for the crystals of the LH2 complex from this species reveal that this complex is an octamer. PMID:24915099

  6. The use of workflows in the design and implementation of complex experiments in macromolecular crystallography.

    PubMed

    Brockhauser, Sandor; Svensson, Olof; Bowler, Matthew W; Nanao, Max; Gordon, Elspeth; Leal, Ricardo M F; Popov, Alexander; Gerring, Matthew; McCarthy, Andrew A; Gotz, Andy

    2012-08-01

    The automation of beam delivery, sample handling and data analysis, together with increasing photon flux, diminishing focal spot size and the appearance of fast-readout detectors on synchrotron beamlines, have changed the way that many macromolecular crystallography experiments are planned and executed. Screening for the best diffracting crystal, or even the best diffracting part of a selected crystal, has been enabled by the development of microfocus beams, precise goniometers and fast-readout detectors that all require rapid feedback from the initial processing of images in order to be effective. All of these advances require the coupling of data feedback to the experimental control system and depend on immediate online data-analysis results during the experiment. To facilitate this, a Data Analysis WorkBench (DAWB) for the flexible creation of complex automated protocols has been developed. Here, example workflows designed and implemented using DAWB are presented for enhanced multi-step crystal characterizations, experiments involving crystal reorientation with kappa goniometers, crystal-burning experiments for empirically determining the radiation sensitivity of a crystal system and the application of mesh scans to find the best location of a crystal to obtain the highest diffraction quality. Beamline users interact with the prepared workflows through a specific brick within the beamline-control GUI MXCuBE.

  7. Preparation and Analysis of RNA Crystals

    NASA Technical Reports Server (NTRS)

    Todd, Paul

    2000-01-01

    The crystallization of RiboNucleic Acids (RNA) was studied from the standpoint of mechanisms of crystal growth in three tasks: (1) preparation of high-quality crystals of oligonuclotides for X-ray diffraction, (2) finding pathways to the growth of high-quality crystals for X-ray diffraction and (3) investigation of mechanisms of action of inertial acceleration on crystal growth. In these tasks: (1) RNA crystals were prepared and studied by X-ray diffraction; (2) a pathway to high-quality crystals was discovered and characterized; a combination of kinetic and equilibrium factors could be optimized as described below; and (3) an interplay between purity and gravity was found in a combination of space and ground experiments with nucleic acids and proteins. Most significantly, the rate of concentration of precipitant and RNA can be controlled by membrane-based methods of water removal or by diffusion of multivalent cations across an interface stabilized by a membrane. Oligonucleotide solutions are electrokinetically stabilized colloids, and crystals can form by the controlled addition of multivalent cations.

  8. A Medipix quantum area detector allows rotation electron diffraction data collection from submicrometre three-dimensional protein crystals

    PubMed Central

    Nederlof, Igor; van Genderen, Eric; Li, Yao-Wang; Abrahams, Jan Pieter

    2013-01-01

    When protein crystals are submicrometre-sized, X-ray radiation damage precludes conventional diffraction data collection. For crystals that are of the order of 100 nm in size, at best only single-shot diffraction patterns can be collected and rotation data collection has not been possible, irrespective of the diffraction technique used. Here, it is shown that at a very low electron dose (at most 0.1 e− Å−2), a Medipix2 quantum area detector is sufficiently sensitive to allow the collection of a 30-frame rotation series of 200 keV electron-diffraction data from a single ∼100 nm thick protein crystal. A highly parallel 200 keV electron beam (λ = 0.025 Å) allowed observation of the curvature of the Ewald sphere at low resolution, indicating a combined mosaic spread/beam divergence of at most 0.4°. This result shows that volumes of crystal with low mosaicity can be pinpointed in electron diffraction. It is also shown that strategies and data-analysis software (MOSFLM and SCALA) from X-ray protein crystallography can be used in principle for analysing electron-diffraction data from three-dimensional nanocrystals of proteins. PMID:23793148

  9. Crystallization and x-ray diffraction analysis of a putative bacterial class I labdane-related diterpene synthase [Crysallization and preliminary x-ray diffraction analysis of a bacterial class I labdane-related diterpene synthase

    DOE PAGES

    Serrano-Posada, Hugo; Centeno-Leija, Sara; Rojas-Trejo, Sonia; ...

    2015-08-25

    Here, labdane-related diterpenoids are natural products with potential pharmaceutical applications that are rarely found in bacteria. Here, a putative class I labdane-related diterpene synthase (LrdC) identified by genome mining in a streptomycete was successfully crystallized using the microbatch method. Crystals of the LrdC enzyme were obtained in a holo form with its natural cofactor Mg 2+ (LrdC-Mg 2+) and in complex with inorganic pyrophosphate (PP i) (LrdC-Mg 2+–PP i). Crystals of native LrdC-Mg 2+ diffracted to 2.50 Å resolution and belonged to the trigonal space group P3 221, with unit-cell parameters a = b = 107.1, c = 89.2 Å.more » Crystals of the LrdC-Mg 2+–PP i complex grown in the same conditions as the native enzyme with PEG 8000 diffracted to 2.36 Å resolution and also belonged to the trigonal space group P3 221. Crystals of the LrdC-Mg 2+–PP i complex grown in a second crystallization condition with PEG 3350 diffracted to 2.57 Å resolution and belonged to the monoclinic space group P2 1, with unit-cell parameters a = 49.9, b = 104.1, c = 66.5 Å, β = 111.4°. The structure was determined by the single-wavelength anomalous dispersion (SAD) technique using the osmium signal from a potassium hexachloroosmate (IV) derivative.« less

  10. Purification, crystallization and preliminary X-ray analysis of a thermostable glycoside hydrolase family 43 β-xylosidase from Geobacillus thermoleovorans IT-08

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rohman, Ali; Oosterwijk, Niels van; Kralj, Slavko

    2007-11-01

    The β-xylosidase was crystallized using PEG 6000 as precipitant. 5% PEG 6000 yielded bipyramid-shaped tetragonal crystals diffracting to 1.55 Å resolution, and 13% PEG 6000 gave rectangular monoclinic crystals diffracting to 1.80 Å resolution. The main enzymes involved in xylan-backbone hydrolysis are endo-1,4-β-xylanase and β-xylosidase. β-Xylosidase converts the xylo-oligosaccharides produced by endo-1,4-β-xylanase into xylose monomers. The β-xylosidase from the thermophilic Geobacillus thermoleovorans IT-08, a member of glycoside hydrolase family 43, was crystallized at room temperature using the hanging-drop vapour-diffusion method. Two crystal forms were observed. Bipyramid-shaped crystals belonging to space group P4{sub 3}2{sub 1}2, with unit-cell parameters a = bmore » = 62.53, c = 277.4 Å diffracted to 1.55 Å resolution. The rectangular crystals belonged to space group P2{sub 1}, with unit-cell parameters a = 57.94, b = 142.1, c = 153.9 Å, β = 90.5°, and diffracted to 1.80 Å resolution.« less

  11. Purification, crystallization and preliminary X-ray diffraction analysis of the kinase domain of human tousled-like kinase 2

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Garrote, Ana M.; Redondo, Pilar; Montoya, Guillermo, E-mail: gmontoya@cnio.es

    2014-02-19

    The C-terminal kinase domain of TLK2 (a human tousled-like kinase) has been cloned and overexpressed in Escherichia coli followed by purification to homogeneity. Crystallization experiments in the presence of ATP-γ-S yielded crystals suitable for X-ray diffraction analysis belonging to two different space groups: tetragonal I4{sub 1}22 and cubic P2{sub 1}3. Tousled-like kinases (TLKs) are an evolutionarily conserved family of serine/threonine protein kinases involved in chromatin dynamics, including DNA replication and repair, transcription and chromosome segregation. The two members of the family reported in humans, namely TLK1 and TLK2, localize to the cell nucleus and are capable of forming homo- ormore » hetero-oligomers by themselves. To characterize the role of TLK2, its C-terminal kinase domain was cloned and overexpressed in Escherichia coli followed by purification to homogeneity. Crystallization experiments in the presence of ATP-γ-S yielded crystals suitable for X-ray diffraction analysis belonging to two different space groups: tetragonal I4{sub 1}22 and cubic P2{sub 1}3. The latter produced the best diffracting crystal (3.4 Å resolution using synchrotron radiation), with unit-cell parameters a = b = c = 126.05 Å, α = β = γ = 90°. The asymmetric unit contained one protein molecule, with a Matthews coefficient of 4.59 Å{sup 3} Da{sup −1} and a solvent content of 73.23%.« less

  12. Insertion of Guest Molecules into a Mixed Ligand Metal-Organic Framework via Single-Crystal-to-Single Crystal Guest Exchange

    DTIC Science & Technology

    2014-07-01

    powder x-ray diffraction (PXRD), thermogravimentric analysis (TGA), and Fourier transform infrared (FTIR). 15. SUBJECT TERMS Metal organic frame work...the inclusion by using a variety of analytical techniques, such as powder x-ray diffraction (PXRD), thermo-gravimetric analysis (TGA), Fourier...Characterizations Analysis of the MOF and the complexes with the MOF and the guest molecules was performed using an Agilent GC-MS (Model 6890N GC and Model 5973N

  13. Crystallization and preliminary X-ray diffraction analysis of the wild-type haloalkane dehalogenase DhaA and its variant DhaA13 complexed with different ligands.

    PubMed

    Stsiapanava, Alena; Chaloupkova, Radka; Fortova, Andrea; Brynda, Jiri; Weiss, Manfred S; Damborsky, Jiri; Smatanova, Ivana Kuta

    2011-02-01

    Haloalkane dehalogenases make up an important class of hydrolytic enzymes which catalyse the cleavage of carbon-halogen bonds in halogenated aliphatic compounds. There is growing interest in these enzymes owing to their potential use in environmental and industrial applications. The haloalkane dehalogenase DhaA from Rhodococcus rhodochrous NCIMB 13064 can slowly detoxify the industrial pollutant 1,2,3-trichloropropane (TCP). Structural analysis of this enzyme complexed with target ligands was conducted in order to obtain detailed information about the structural limitations of its catalytic properties. In this study, the crystallization and preliminary X-ray analysis of complexes of wild-type DhaA with 2-propanol and with TCP and of complexes of the catalytically inactive variant DhaA13 with the dye coumarin and with TCP are described. The crystals of wild-type DhaA were plate-shaped and belonged to the triclinic space group P1, while the variant DhaA13 can form prism-shaped crystals belonging to the orthorhombic space group P2(1)2(1)2(1) as well as plate-shaped crystals belonging to the triclinic space group P1. Diffraction data for crystals of wild-type DhaA grown from crystallization solutions with different concentrations of 2-propanol were collected to 1.70 and 1.26 Å resolution, respectively. A prism-shaped crystal of DhaA13 complexed with TCP and a plate-shaped crystal of the same variant complexed with the dye coumarin diffracted X-rays to 1.60 and 1.33 Å resolution, respectively. A crystal of wild-type DhaA and a plate-shaped crystal of DhaA13, both complexed with TCP, diffracted to atomic resolutions of 1.04 and 0.97 Å, respectively.

  14. Purification, crystallization and preliminary X-ray diffraction analysis of royal palm tree (Roystonea regia) peroxidase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Watanabe, Leandra; Nascimento, Alessandro S.; Zamorano, Laura S.

    2007-09-01

    The purification, crystallization, X-ray diffraction data acquisition and molecular-replacement results of royal palm tree (R. regia) peroxidase are described. Royal palm tree peroxidase (RPTP), which was isolated from Roystonea regia leaves, has an unusually high stability that makes it a promising candidate for diverse applications in industry and analytical chemistry [Caramyshev et al. (2005 ▶), Biomacromolecules, 6, 1360–1366]. Here, the purification and crystallization of this plant peroxidase and its X-ray diffraction data collection are described. RPTP crystals were obtained by the hanging-drop vapour-diffusion method and diffraction data were collected to a resolution of 2.8 Å. The crystals belong to themore » trigonal space group P3{sub 1}21, with unit-cell parameters a = b = 116.83, c = 92.24 Å, and contain one protein molecule per asymmetric unit. The V{sub M} value and solvent content are 4.07 Å{sup 3} Da{sup −1} and 69.8%, respectively.« less

  15. Crystallization and preliminary crystallographic analysis of the Clostridium perfringens enterotoxin

    PubMed Central

    Briggs, David C.; Smedley, James G.; McClane, Bruce A.; Basak, Ajit K.

    2010-01-01

    Clostridium perfringens is a Gram-positive anaerobic species of bacterium that is notable for its ability to produce a plethora of toxins, including membrane-active toxins (α-toxins), pore-forming toxins (∊-toxins) and binary toxins (ι-toxins). Here, the crystallization of the full-length wild-type C. perfringens enterotoxin is reported, which is the causative agent of the second most prevalent food-borne illness in the United States and has been implicated in many other gastrointestinal pathologies. Several crystal forms were obtained. However, only two of these optimized crystal forms (I and II) were useable for X-ray diffraction data collection. The form I crystals diffracted to d min = 2.7 Å and belonged to space group C2, while the form II crystals diffracted to d min = 4 Å and belonged to space group P213. PMID:20606275

  16. Purification, crystallization and preliminary X-ray diffraction experiment of nattokinase from Bacillus subtilis natto.

    PubMed

    Yanagisawa, Yasuhide; Chatake, Toshiyuki; Chiba-Kamoshida, Kaori; Naito, Sawa; Ohsugi, Tadanori; Sumi, Hiroyuki; Yasuda, Ichiro; Morimoto, Yukio

    2010-12-01

    Nattokinase is a single polypeptide chain composed of 275 amino acids (molecular weight 27,724) which displays strong fibrinolytic activity. Moreover, it can activate other fibrinolytic enzymes such as pro-urokinase and tissue plasminogen activator. In the present study, native nattokinase from Bacillus subtilis natto was purified using gel-filtration chromatography and crystallized to give needle-like crystals which could be used for X-ray diffraction experiments. The crystals belonged to space group C2, with unit-cell parameters a=74.3, b=49.9, c=56.3 Å, β=95.2°. Diffraction images were processed to a resolution of 1.74 Å with an Rmerge of 5.2% (15.3% in the highest resolution shell) and a completeness of 69.8% (30.0% in the highest resolution shell). This study reports the first X-ray diffraction analysis of nattokinase.

  17. Purification, crystallization and preliminary X-ray diffraction experiment of nattokinase from Bacillus subtilis natto

    PubMed Central

    Yanagisawa, Yasuhide; Chatake, Toshiyuki; Chiba-Kamoshida, Kaori; Naito, Sawa; Ohsugi, Tadanori; Sumi, Hiroyuki; Yasuda, Ichiro; Morimoto, Yukio

    2010-01-01

    Nattokinase is a single polypeptide chain composed of 275 amino acids (molecular weight 27 724) which displays strong fibrinolytic activity. Moreover, it can activate other fibrinolytic enzymes such as pro-urokinase and tissue plasminogen activator. In the present study, native nattokinase from Bacillus subtilis natto was purified using gel-filtration chromatography and crystallized to give needle-like crystals which could be used for X-ray diffraction experiments. The crystals belonged to space group C2, with unit-cell parameters a = 74.3, b = 49.9, c = 56.3 Å, β = 95.2°. Diffraction images were processed to a resolution of 1.74 Å with an R merge of 5.2% (15.3% in the highest resolution shell) and a completeness of 69.8% (30.0% in the highest resolution shell). This study reports the first X-ray diffraction analysis of nattokinase. PMID:21139221

  18. Improving the dissolution and bioavailability of 6-mercaptopurine via co-crystallization with isonicotinamide.

    PubMed

    Wang, Jian-Rong; Yu, Xueping; Zhou, Chun; Lin, Yunfei; Chen, Chen; Pan, Guoyu; Mei, Xuefeng

    2015-03-01

    6-Mercaptopurine (6-MP) is a clinically important antitumor drug. The commercially available form was provided as monohydrate and belongs to BCS class II category. Co-crystallization screening by reaction crystallization method (RCM) and monitored by powder X-ray diffraction led to the discovery of a new co-crystal formed between 6-MP and isonicotinamide (co-crystal 1). Co-crystal 1 was thoroughly characterized by X-ray diffraction, FT-IR and Raman spectroscopy, and thermal analysis. Noticeably, the in vitro and in vivo studies revealed that co-crystal 1 possesses improved dissolution rate and superior bioavailability on animal model. Copyright © 2015 Elsevier Ltd. All rights reserved.

  19. Purification, crystallization and preliminary X-ray diffraction analysis of water-soluble chlorophyll-binding protein from Chenopodium album

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ohtsuki, Takayuki; Ohshima, Shigeru; Uchida, Akira, E-mail: auchida@biomol.sci.toho-u.ac.jp

    2007-09-01

    A water-soluble chlorophyll-binding protein with photoconvertibility from C. album was extracted, purified and crystallized in a darkroom. The crystal diffracted to around 2.0 Å resolution. A water-soluble chlorophyll-binding protein (WSCP) with photoconvertibility from Chenopodium album was extracted, purified and crystallized in a darkroom. Green crystals suitable for data collection appeared in about 10 d. A native data set was collected to 2.0 Å resolution at 100 K. The space group of the crystal was determined to be orthorhombic I222 or I2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 48.13, b = 60.59, c = 107.21 Å. Preliminary analysis ofmore » the X-ray data indicated that there is one molecule per asymmetric unit.« less

  20. Crystal growth, structure analysis and characterisation of 2 - (1, 3 - dioxoisoindolin - 2 - yl) acetic acid single crystal

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sankari, R. Siva, E-mail: sivasankari.sh@act.edu.in; Perumal, Rajesh Narayana

    2014-04-24

    Single crystal of dielectric material 2 - (1, 3 - dioxoisoindolin - 2 - yl) acetic acid has been grown by slow evaporation solution growth method. The grown crystal was harvested in 25 days. The crystal structure was analyzed by Single crystal X - ray diffraction. UV-vis-NIR analysis was performed to examine the optical property of the grown crystal. The thermal property of the grown crystal was studied by thermogravimetric analysis (TGA) and differential thermal analysis (DTA). The dielectric measurements were carried out and the dielectric constant was calculated and plotted at all frequencies.

  1. Additional evidence from x-ray powder diffraction patterns that icosahedral quasi-crystals of intermetallic compounds are twinned cubic crystals

    PubMed Central

    Pauling, Linus

    1988-01-01

    Analysis of the measured values of Q for the weak peaks (small maxima, usually considered to be background fluctuations, “noise”) on the x-ray powder diffraction curves for 17 rapidly quenched alloys leads directly to the conclusion that they are formed by an 820-atom or 1012-atom primitive cubic structure that by icosahedral twinning produces the so-called icosahedral quasi-crystals. PMID:16593948

  2. Applications of the diffraction and interference of light and electronic waves

    NASA Astrophysics Data System (ADS)

    Bahrim, Cristian; Lanning, Robert

    2010-10-01

    As part of a NSF sponsored program, called STAIRSTEP, at Lamar University we work on improving the basic knowledge of our physics majors in topics with broader impact in various areas of science and engineering [1]. The purpose is to facilitate a deeper understanding of some fundamental concepts in the field of optics through hands-on experience [2]. We choose to study the interference/diffraction of light and matter waves, because of its fundamental importance in physics with many applications. We target multiple goals in our field of study such as to understand the formation of electronic waves (wave packets) and their interaction with atoms in crystals (electron diffraction); the Fourier analysis of light with applications in spectroscopy, etc. We can show that a crystal lattice Fourier transforms the sinusoidal waves associated to free electrons fired toward the crystal. Our studies led to a simple and instructive recipe for discovering the arrangement of atoms in crystals from the analysis of the diffraction patterns produced by radiation or by electrons transmitted through crystals. [1] Doerschuk P. et al., 39th ASEE/IEEE Frontiers in Education Conference, San Antonio 2009, M3F-1. [2] Bahrim C, Innovation 2006 -- World Innovations in Engineering Education and Research, Chapter 17, iNEER Innovation Series, ISBN 0-9741252-5-3.

  3. Cloning, expression, purification, crystallization and preliminary X-ray diffraction analysis of the VP8* carbohydrate-binding protein of the human rotavirus strain Wa

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kraschnefski, Mark J.; Scott, Stacy A.; Holloway, Gavan

    2005-11-01

    The carbohydrate-binding component (VP8*{sub 64–223}) of the human Wa rotavirus spike protein has been overexpressed in E. coli, purified and crystallized in two different crystal forms. X-ray diffraction data have been collected that have enabled determination of the Wa VP8*{sub 64–223} structure by molecular replacement. Rotaviruses exhibit host-specificity and the first crystallographic information on a rotavirus strain that infects humans is reported here. Recognition and attachment to host cells, leading to invasion and infection, is critically linked to the function of the outer capsid spike protein of the rotavirus particle. In some strains the VP8* component of the spike proteinmore » is implicated in recognition and binding of sialic-acid-containing cell-surface carbohydrates, thereby enabling infection by the virus. The cloning, expression, purification, crystallization and initial X-ray diffraction analysis of the VP8* core from human Wa rotavirus is reported. Two crystal forms (trigonal P3{sub 2}21 and monoclinic P2{sub 1}) have been obtained and X-ray diffraction data have been collected, enabling determination of the VP8*{sub 64–223} structure by molecular replacement.« less

  4. Crystallization and preliminary X-ray diffraction analysis of the sialic acid-binding domain (VP8*) of porcine rotavirus strain CRW-8

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Scott, Stacy A.; Holloway, Gavan; Coulson, Barbara S.

    2005-06-01

    The sialic acid-binding domain (VP8*) component of the porcine CRW-8 rotavirus spike protein has been overexpressed in E. coli, purified and co-crystallized with an N-acetylneuraminic acid derivative. X-ray diffraction data have been collected to 2.3 Å, which has enabled determination of the structure by molecular replacement. Rotavirus recognition and attachment to host cells involves interaction with the spike protein VP4 that projects outwards from the surface of the virus particle. An integral component of these spikes is the VP8* domain, which is implicated in the direct recognition and binding of sialic acid-containing cell-surface carbohydrates and facilitates subsequent invasion by themore » virus. The expression, purification, crystallization and preliminary X-ray diffraction analysis of VP8* from porcine CRW-8 rotavirus is reported. Diffraction data have been collected to 2.3 Å resolution, enabling the determination of the VP8* structure by molecular replacement.« less

  5. Expression, purification and preliminary X-ray diffraction studies of the transcriptional factor PyrR from Bacillus halodurans

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Arreola, Rodrigo; Vega-Miranda, Anita; Gómez-Puyou, Armando

    The gene-regulation factor PyrR from B. halodurans has been crystallized in two crystal forms. Preliminary crystallographic analysis showed that the protein forms tetramers in both space groups. The PyrR transcriptional regulator is widely distributed in bacteria. This RNA-binding protein is involved in the control of genes involved in pyrimidine biosynthesis, in which uridyl and guanyl nucleotides function as effectors. Here, the crystallization and preliminary X-ray diffraction analysis of two crystal forms of Bacillus halodurans PyrR are reported. One of the forms belongs to the monoclinic space group P2{sub 1} with unit-cell parameters a = 59.7, b = 87.4, c =more » 72.1 Å, β = 104.4°, while the other form belongs to the orthorhombic space group P22{sub 1}2{sub 1} with unit-cell parameters a = 72.7, b = 95.9, c = 177.1 Å. Preliminary X-ray diffraction data analysis and molecular-replacement solution revealed the presence of four and six monomers per asymmetric unit; a crystallographic tetramer is formed in both forms.« less

  6. Crystallization and preliminary X-ray diffraction analysis of two extracytoplasmic solute receptors of the DctP family from Bordetella pertussis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rucktooa, Prakash; Huvent, Isabelle; IFR 142, Institut Pasteur de Lille, 1 Rue du Professeur Calmette, BP 245, 59021 Lille CEDEX

    2006-10-01

    Sample preparation, crystallization and preliminary X-ray analysis are reported for two B. pertussis extracytoplasmic solute receptors. DctP6 and DctP7 are two Bordetella pertussis proteins which belong to the extracytoplasmic solute receptors (ESR) superfamily. ESRs are involved in the transport of substrates from the periplasm to the cytosol of Gram-negative bacteria. DctP6 and DctP7 have been crystallized and diffraction data were collected using a synchrotron-radiation source. DctP6 crystallized in space group P4{sub 1}2{sub 1}2, with unit-cell parameters a = 108.39, b = 108.39, c = 63.09 Å, while selenomethionyl-derivatized DctP7 crystallized in space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parametersmore » a = 64.87, b = 149.83, c = 170.65 Å. The three-dimensional structure of DctP7 will be determined by single-wavelength anomalous diffraction, while the DctP6 structure will be solved by molecular-replacement methods.« less

  7. Growth of single crystalline delafossite LaCuO2 by the travelling-solvent floating zone method

    NASA Astrophysics Data System (ADS)

    Mohan, A.; Büchner, B.; Wurmehl, S.; Hess, C.

    2014-09-01

    Single crystals of LaCuO2 have been grown for the first time using the travelling-solvent floating zone method. The crystal was grown in an Ar-atmosphere by reduction of La2Cu2O5, which was used as the feed rod composition for the growth. The grown crystal has been characterized with regard to phase purity and single crystallinity using powder X-ray diffraction, energy dispersive X-ray analysis, Laue diffraction and scanning electron microscopy.

  8. Crystallization of multiple forms of bovine seminal ribonuclease in the liganded and unliganded state

    NASA Astrophysics Data System (ADS)

    Sica, F.; Adinolfi, S.; Berisio, R.; De Lorenzo, C.; Mazzarella, L.; Piccoli, R.; Vitagliano, L.; Zagari, A.

    1999-01-01

    Bovine seminal ribonuclease (BS-RNase) is an intriguing homodimeric enzyme which exists as two conformational isomers, characterized by distinct catalytic and biological properties, referred to as M×M and M=M. Reduction of inter-chain disulfide bridges produces a stable monomeric derivative (M) which is still active. This paper reports the screening and optimization of crystallization conditions for growing single diffraction-quality crystals for the various BS-RNase forms. The crystallization trials were performed using both the vapor diffusion and microbatch methods. The M×M dimer was crystallized in the free form from polyethylene glycol (PEG) 4000 at pH 8.5 and as a complex with the substrate analog uridylyl(2'- 5')guanosine (UpG) from an unbuffered ammonium sulfate (AS) solution. These two crystal types diffract X-rays to 2.5 and 1.9 Å resolution, respectively. Two different crystal types were obtained both for the M=M dimer and for the monomeric derivative. (M=M)a crystals, grown from PEG 4000 (8% w/v) at pH 5.6, diffract X-rays to 4.0 Å. At higher PEG concentration (15% w/v) a different crystal type was obtained, (M=M)b, which showed a better diffraction limit (2.5 Å). For the monomer, type (M)a and (M)b crystals, diffracting X-rays to 2.5 Å resolution, were obtained from AS at pH 6.5 and from PEG 4000 at pH 8.5, respectively. A comparison with previously crystallized forms of the dimer M×M and its complexes with uridylyl(2'-5')adenosine and 2'-deoxycytidylyl(3'-5')-2'-deoxyadenosine is also presented. The three-dimensional structure analysis of (M×M)·UpG and (M=M)b is in progress.

  9. Order and disorder in crystals of hexameric NTPases from dsRNA bacteriophages.

    PubMed

    Mancini, Erika J; Grimes, Jonathan M; Malby, Robyn; Sutton, Geoffrey C; Kainov, Denis E; Juuti, Jarmo T; Makeyev, Eugene V; Tuma, Roman; Bamford, Dennis H; Stuart, David I

    2003-12-01

    The packaging of genomic RNA in members of the Cystoviridae is performed by P4, a hexameric protein with NTPase activity. Across family members such as Phi6, Phi8 and Phi13, the P4 proteins show low levels of sequence identity, but presumably have similar atomic structures. Initial structure-determination efforts for P4 from Phi6 and Phi8 were hampered by difficulties in obtaining crystals that gave ordered diffraction. Diffraction from crystals of full-length P4 showed a variety of disorder and anisotropy. Subsequently, crystals of Phi13 P4 were obtained which yielded well ordered diffraction to 1.7 A. Comparison of the packing arrangements of P4 hexamers in different crystal forms and analysis of the disorder provides insights into the flexibility of this family of proteins, which might be an integral part of their biological function.

  10. Crystallization and diffraction analysis of [beta]-N-acetylhexosaminidase from Aspergillus oryzae

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vanek, Ondrej; Brynd, Jirí; Hofbauerová, Katerina

    2012-05-08

    Fungal {beta}-N-acetylhexosaminidases are enzymes that are used in the chemoenzymatic synthesis of biologically interesting oligosaccharides. The enzyme from Aspergillus oryzae was produced and purified from its natural source and crystallized using the hanging-drop vapor-diffusion method. Diffraction data from two crystal forms (primitive monoclinic and primitive tetragonal) were collected to resolutions of 3.2 and 2.4 {angstrom}, respectively. Electrophoretic and quantitative N-terminal protein-sequencing analyses confirmed that the crystals are formed by a complete biologically active enzyme consisting of a glycosylated catalytic unit and a noncovalently attached propeptide.

  11. Purification, crystallization and preliminary X-ray crystallographic studies of Rv3705c from Mycobacterium tuberculosis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lu, Feifei; Gao, Feng; Li, Honglin

    The cloning, expression, purification, crystallization and preliminary X-ray diffraction analysis of Rv3705c from M. tuberculosis are described. The conserved protein Rv3705c from Mycobacterium tuberculosis has been cloned, expressed, purified and crystallized by the sitting-drop vapour-diffusion method using PEG 3350 as a precipitant. The Rv3705c crystals exhibited space group P6{sub 1}22 or P6{sub 5}22, with unit-cell parameters a = b = 198.0, c = 364.1 Å, α = β = 90, γ = 120°, and diffracted to a resolution of 3.3 Å.

  12. Influence of solvents on the habit modification of alpha lactose monohydrate single crystals

    NASA Astrophysics Data System (ADS)

    Parimaladevi, P.; Srinivasan, K.

    2013-02-01

    Restricted evaporation of solvent method was adopted for the growth of alpha lactose monohydrate single crystals from different solvents. The crystal habits of grown crystals were analysed. The form of crystallization was confirmed by powder x-ray diffraction analysis. Thermal behaviour of the grown crystals was studied by using differential scanning calorimetry.

  13. In situ high-pressure measurement of crystal solubility by using neutron diffraction

    NASA Astrophysics Data System (ADS)

    Chen, Ji; Hu, Qiwei; Fang, Leiming; He, Duanwei; Chen, Xiping; Xie, Lei; Chen, Bo; Li, Xin; Ni, Xiaolin; Fan, Cong; Liang, Akun

    2018-05-01

    Crystal solubility is one of the most important thermo-physical properties and plays a key role in industrial applications, fundamental science, and geoscientific research. However, high-pressure in situ measurements of crystal solubility remain very challenging. Here, we present a method involving high-pressure neutron diffraction for making high-precision in situ measurements of crystal solubility as a function of pressure over a wide range of pressures. For these experiments, we designed a piston-cylinder cell with a large chamber volume for high-pressure neutron diffraction. The solution pressures are continuously monitored in situ based on the equation of state of the sample crystal. The solubility at a high pressure can be obtained by applying a Rietveld quantitative multiphase analysis. To evaluate the proposed method, we measured the high-pressure solubility of NaCl in water up to 610 MPa. At a low pressure, the results are consistent with the previous results measured ex situ. At a higher pressure, more reliable data could be provided by using an in situ high-pressure neutron diffraction method.

  14. Three-dimensional Bragg coherent diffraction imaging of an extended ZnO crystal.

    PubMed

    Huang, Xiaojing; Harder, Ross; Leake, Steven; Clark, Jesse; Robinson, Ian

    2012-08-01

    A complex three-dimensional quantitative image of an extended zinc oxide (ZnO) crystal has been obtained using Bragg coherent diffraction imaging integrated with ptychography. By scanning a 2.5 µm-long arm of a ZnO tetrapod across a 1.3 µm X-ray beam with fine step sizes while measuring a three-dimensional diffraction pattern at each scan spot, the three-dimensional electron density and projected displacement field of the entire crystal were recovered. The simultaneously reconstructed complex wavefront of the illumination combined with its coherence properties determined by a partial coherence analysis implemented in the reconstruction process provide a comprehensive characterization of the incident X-ray beam.

  15. Crystallization and preliminary X-ray analysis of a family 19 glycosyl hydrolase from Carica papaya latex

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Huet, Joëlle, E-mail: jhuet@ulb.ac.be; Azarkan, Mohamed; Looze, Yvan

    2008-05-01

    A chitinase isolated from the latex of the tropical species Carica papaya has been crystallized. The addition of N-acetyl-d-glucosamine to the crystallization solution has improved the diffraction quality resolution of the crystal to 1.8 Å resolution. A chitinase isolated from the latex of the tropical species Carica papaya has been purified to homogeneity and crystallized. This enzyme belongs to glycosyl hydrolase family 19 and exhibits exceptional resistance to proteolysis. The initially observed crystals, which diffracted to a resolution of 2.0 Å, were improved through modification of the crystallization protocol. Well ordered crystals were subsequently obtained using N-acetyl-d-glucosamine, the monomer resultingmore » from the hydrolysis of chitin, as an additive to the crystallization solution. Here, the characterization of a chitinase crystal that belongs to the monoclinic space group P2{sub 1}, with unit-cell parameters a = 69.08, b = 44.79, c = 76.73 Å, β = 95.33° and two molecules per asymmetric unit, is reported. Diffraction data were collected to a resolution of 1.8 Å. Structure refinement is currently in progress.« less

  16. Purification, crystallization and X-ray crystallographic analysis of a putative exopolyphosphatase from Zymomonas mobilis

    PubMed Central

    Zhang, Aili; Guo, Erhong; Qian, Lanfang; Tang, Nga-Yeung; Watt, Rory M.; Bartlam, Mark

    2016-01-01

    Exopolyphosphatase (PPX) enzymes degrade inorganic polyphosphate (poly-P), which is essential for the survival of microbial cells in response to external stresses. In this study, a putative exopolyphosphatase from Zymomonas mobilis (ZmPPX) was crystallized. Crystals of the wild-type enzyme diffracted to 3.3 Å resolution and could not be optimized further. The truncation of 29 amino acids from the N-terminus resulted in crystals that diffracted to 1.8 Å resolution. The crystals belonged to space group C2, with unit-cell parameters a = 122.0, b = 47.1, c = 89.5 Å, α = γ = 90, β = 124.5°. An active-site mutant that crystallized in the same space group and with similar unit-cell parameters diffracted to 1.56 Å resolution. One molecule was identified per asymmetric unit. Analytical ultracentrifugation confirmed that ZmPPX forms a dimer in solution. It was confirmed that ZmPPX possesses exopolyphosphatase activity against a synthetic poly-P substrate. PMID:26919520

  17. Purification, crystallization and X-ray crystallographic analysis of a putative exopolyphosphatase from Zymomonas mobilis.

    PubMed

    Zhang, Aili; Guo, Erhong; Qian, Lanfang; Tang, Nga-Yeung; Watt, Rory M; Bartlam, Mark

    2016-03-01

    Exopolyphosphatase (PPX) enzymes degrade inorganic polyphosphate (poly-P), which is essential for the survival of microbial cells in response to external stresses. In this study, a putative exopolyphosphatase from Zymomonas mobilis (ZmPPX) was crystallized. Crystals of the wild-type enzyme diffracted to 3.3 Å resolution and could not be optimized further. The truncation of 29 amino acids from the N-terminus resulted in crystals that diffracted to 1.8 Å resolution. The crystals belonged to space group C2, with unit-cell parameters a = 122.0, b = 47.1, c = 89.5 Å, α = γ = 90, β = 124.5°. An active-site mutant that crystallized in the same space group and with similar unit-cell parameters diffracted to 1.56 Å resolution. One molecule was identified per asymmetric unit. Analytical ultracentrifugation confirmed that ZmPPX forms a dimer in solution. It was confirmed that ZmPPX possesses exopolyphosphatase activity against a synthetic poly-P substrate.

  18. Structural, mechanical, electrical and optical properties of a new lithium boro phthalate NLO crystal synthesized by a slow evaporation method

    NASA Astrophysics Data System (ADS)

    Mohanraj, K.; Balasubramanian, D.; Jhansi, N.

    2017-11-01

    A new non-linear optical (NLO) single crystal of lithium boro phthalate (LiBP) was grown by slow solvent evaporation technique. The powder sample was subjected to powder X-ray diffraction (PXRD) to find its crystalline nature and the crystal structure of the grown crystal was determined using single crystal X-ray (SXRD) diffraction analysis. The Fourier Transform Infrared (FTIR) spectrum was recorded for grown crystal to identify the various functional groups present in the compound. The mechanical property of the LiBP single crystal was studied using Vickers microhardness tester. The dielectric constant and dielectric loss measurements were carried out for the grown crystal at various temperatures. The grown crystal was subjected to UV-Visible Spectral Studies to analyze the linear optical behavior of the grown crystal. The Kurtz-Perry Powder technique was employed to measure the Second Harmonic Generation efficiency of the grown crystal.

  19. Crystal engineering: co-crystals of cinnamic acid derivatives with a pyridyl derivative co-crystallizer.

    PubMed

    Lorenzo, Daniel A; Forrest, Sebastian J K; Sparkes, Hazel A

    2016-02-01

    A number of hydrogen-bonded co-crystals, consisting of a cinnamic acid derivative and a pyridyl co-crystallizer, have been synthesized and their properties investigated by X-ray diffraction. Samples were prepared by recrystallization or solvent drop grinding of trans-cinnamic acid (1), 4-methylcinnamic acid (2), 4-methoxy cinnamic acid (3) or 3,4-methoxy cinnamic acid (4), with 4,4-dipyridyl (A), iso-nicotinamide (B) or nicotinamide (C). The X-ray single-crystal structures of seven novel co-crystals, obtained through recrystallization, are examined and the hydrogen-bonding interactions discussed. Consistent hydrogen-bonding motifs were observed for samples prepared when using 4,4-dipyridyl (A) or iso-nicotinamide (B) as the co-crystallizing agent. Powder X-ray diffraction analysis of the samples prepared by solvent drop grinding suggests the formation of ten co-crystals.

  20. Crystallization and preliminary X-ray diffraction analysis of the periplasmic domain of the Escherichia coli aspartate receptor Tar and its complex with aspartate

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mise, Takeshi; Matsunami, Hideyuki; Samatey, Fadel A.

    The periplasmic domain of the E. coli aspartate receptor Tar was cloned, expressed, purified and crystallized with and without bound ligand. The crystals obtained diffracted to resolutions of 1.58 and 1.95 Å, respectively. The cell-surface receptor Tar mediates bacterial chemotaxis toward an attractant, aspartate (Asp), and away from a repellent, Ni{sup 2+}. To understand the molecular mechanisms underlying the induction of Tar activity by its ligands, the Escherichia coli Tar periplasmic domain with and without bound aspartate (Asp-Tar and apo-Tar, respectively) were each crystallized in two different forms. Using ammonium sulfate as a precipitant, crystals of apo-Tar1 and Asp-Tar1 weremore » grown and diffracted to resolutions of 2.10 and 2.40 Å, respectively. Alternatively, using sodium chloride as a precipitant, crystals of apo-Tar2 and Asp-Tar2 were grown and diffracted to resolutions of 1.95 and 1.58 Å, respectively. Crystals of apo-Tar1 and Asp-Tar1 adopted space group P4{sub 1}2{sub 1}2, while those of apo-Tar2 and Asp-Tar2 adopted space groups P2{sub 1}2{sub 1}2{sub 1} and C2, respectively.« less

  1. Analysis of synthetic diamond single crystals by X-ray topography and double-crystal diffractometry

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Prokhorov, I. A., E-mail: igor.prokhorov@mail.ru; Ralchenko, V. G.; Bolshakov, A. P.

    2013-12-15

    Structural features of diamond single crystals synthesized under high pressure and homoepitaxial films grown by chemical vapor deposition (CVD) have been analyzed by double-crystal X-ray diffractometry and topography. The conditions of a diffraction analysis of diamond crystals using Ge monochromators have been optimized. The main structural defects (dislocations, stacking faults, growth striations, second-phase inclusions, etc.) formed during crystal growth have been revealed. The nitrogen concentration in high-pressure/high-temperature (HPHT) diamond substrates is estimated based on X-ray diffraction data. The formation of dislocation bundles at the film-substrate interface in the epitaxial structures has been revealed by plane-wave topography; these dislocations are likelymore » due to the relaxation of elastic macroscopic stresses caused by the lattice mismatch between the substrate and film. The critical thicknesses of plastic relaxation onset in CVD diamond films are calculated. The experimental techniques for studying the real diamond structure in optimizing crystal-growth technology are proven to be highly efficient.« less

  2. X-ray diffraction analysis and in vitro characterization of the UAM2 protein from Oryza sativa

    DOE PAGES

    Welner, Ditte Hededam; Tsai, Alex Yi-Lin; DeGiovanni, Andy M.; ...

    2017-03-29

    The role of seemingly non-enzymatic proteins in complexes interconverting UDP-arabinopyranose and UDP-arabinofuranose (UDP-arabinosemutases; UAMs) in the plant cytosol remains unknown. To shed light on their function, crystallographic and functional studies of the seemingly non-enzymatic UAM2 protein from Oryza sativa (OsUAM2) were undertaken. Here, X-ray diffraction data are reported, as well as analysis of the oligomeric state in the crystal and in solution. OsUAM2 crystallizes readily but forms highly radiation-sensitive crystals with limited diffraction power, requiring careful low-dose vector data acquisition. Using size-exclusion chromatography, it is shown that the protein is monomeric in solution. Finally, limited proteolysis was employed to demonstratemore » DTT-enhanced proteolytic digestion, indicating the existence of at least one intramolecular disulfide bridge or, alternatively, a requirement for a structural metal ion.« less

  3. Controlled dehydration improves the diffraction quality of two RNA crystals.

    PubMed

    Park, HaJeung; Tran, Tuan; Lee, Jun Hyuck; Park, Hyun; Disney, Matthew D

    2016-11-03

    Post-crystallization dehydration methods, applying either vapor diffusion or humidity control devices, have been widely used to improve the diffraction quality of protein crystals. Despite the fact that RNA crystals tend to diffract poorly, there is a dearth of reports on the application of dehydration methods to improve the diffraction quality of RNA crystals. We use dehydration techniques with a Free Mounting System (FMS, a humidity control device) to recover the poor diffraction quality of RNA crystals. These approaches were applied to RNA constructs that model various RNA-mediated repeat expansion disorders. The method we describe herein could serve as a general tool to improve diffraction quality of RNA crystals to facilitate structure determinations.

  4. LCP crystallization and X-ray diffraction analysis of VcmN, a MATE transporter from Vibrio cholerae

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kusakizako, Tsukasa; Tanaka, Yoshiki; Hipolito, Christopher J.

    A V. cholerae MATE transporter was crystallized using the lipidic cubic phase (LCP) method. X-ray diffraction data sets were collected from single crystals obtained in a sandwich plate and a sitting-drop plate to resolutions of 2.5 and 2.2 Å, respectively. Multidrug and toxic compound extrusion (MATE) transporters, one of the multidrug exporter families, efflux xenobiotics towards the extracellular side of the membrane. Since MATE transporters expressed in bacterial pathogens contribute to multidrug resistance, they are important therapeutic targets. Here, a MATE-transporter homologue from Vibrio cholerae, VcmN, was overexpressed in Escherichia coli, purified and crystallized in lipidic cubic phase (LCP). X-raymore » diffraction data were collected to 2.5 Å resolution from a single crystal obtained in a sandwich plate. The crystal belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 52.3, b = 93.7, c = 100.2 Å. As a result of further LCP crystallization trials, crystals of larger size were obtained using sitting-drop plates. X-ray diffraction data were collected to 2.2 Å resolution from a single crystal obtained in a sitting-drop plate. The crystal belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 61.9, b = 91.8, c = 100.9 Å. The present work provides valuable insights into the atomic resolution structure determination of membrane transporters.« less

  5. Macromolecule Crystal Quality Improvement in Microgravity: The Role of Impurities

    NASA Technical Reports Server (NTRS)

    Judge, Russell A.; Snell, Edward H.; Pusey, Marc L.; Sportiello, Michael G.; Todd, Paul; Bellamy, Henry; Borgstahl, Gloria E.; Pokros, Matt; Cassanto, John M.

    2000-01-01

    While macromolecule impurities may affect crystal size and morphology the over-riding question is; "How do macromolecule impurities effect crystal X-ray quality and diffraction resolution?" In the case of chicken egg white lysozyme, crystals can be grown in the presence of a number of impurities without affecting diffraction resolution. One impurity however, the lysozyme dimer, does negatively impact the X-ray crystal properties. Crystal quality improvement as a result of better partitioning of this impurity during crystallization in microgravity has been reported'. In our recent experimental work dimer partitioning was found to be not significantly different between the two environments. Mosaicity analysis of pure crystals showed a reduced mosaicity and increased signal to noise for the microgravity grown crystals. Dimer incorporation however, did greatly reduce the resolution limit in both ground and microgravity grown crystals. These results indicate that impurity effects in microgravity are complex and may rely on the conditions or techniques employed.

  6. Crystallization and preliminary crystallographic analysis of human common-type acylphosphatase

    PubMed Central

    Yeung, Rachel C. Y.; Lam, Sonia Y.; Wong, Kam-Bo

    2006-01-01

    Human acylphosphatase, an 11 kDa enzyme that catalyzes the hydrolysis of carboxyl phosphate bonds, has been studied extensively as a model system for amyloid-fibril formation. However, the structure is still not known of any isoform of human acylphosphatase. Here, the crystallization and preliminary X-­ray diffraction data analysis of human common-type acylphosphatase are reported. Crystals of human common-type acylphosphatase have been grown by the sitting-drop vapour-diffusion method at 289 K using polyethylene glycol 4000 as precipitant. Diffraction data were collected to 1.45 Å resolution at 100 K. The crystals belong to space group P212121, with unit-cell parameters a = 42.58, b = 47.23, c = 57.26 Å. PMID:16511269

  7. Crystallization and preliminary X-ray analysis of a protease inhibitor from the latex of Carica papaya

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Azarkan, Mohamed; Garcia-Pino, Abel; Dibiani, Rachid

    2006-12-01

    The Kunitz-type trypsin/chymotrypsin inhibitor isolated from C. papaya latex has been crystallized using the hanging-drop vapour-diffusion method. Two different crystal forms are observed, diffracting to 2.6 and 1.7 Å. A Kunitz-type protease inhibitor purified from the latex of green papaya (Carica papaya) fruits was crystallized in the presence and absence of divalent metal ions. Crystal form I, which is devoid of divalent cations, diffracts to a resolution of 2.6 Å and belongs to space group P3{sub 1} or P3{sub 2}. This crystal form is a merohedral twin with two molecules in the asymmetric unit and unit-cell parameters a = bmore » = 74.70, c = 78.97 Å. Crystal form II, which was grown in the presence of Co{sup 2+}, diffracts to a resolution of 1.7 Å and belongs to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 44.26, b = 81.99, c = 140.89 Å.« less

  8. Structure of CPV17 polyhedrin determined by the improved analysis of serial femtosecond crystallographic data

    DOE PAGES

    Ginn, Helen M.; Messerschmidt, Marc; Ji, Xiaoyun; ...

    2015-03-09

    The X-ray free-electron laser (XFEL) allows the analysis of small weakly diffracting protein crystals, but has required very many crystals to obtain good data. Here we use an XFEL to determine the room temperature atomic structure for the smallest cytoplasmic polyhedrosis virus polyhedra yet characterized, which we failed to solve at a synchrotron. These protein microcrystals, roughly a micron across, accrue within infected cells. We use a new physical model for XFEL diffraction, which better estimates the experimental signal, delivering a high-resolution XFEL structure (1.75 Å), using fewer crystals than previously required for this resolution. The crystal lattice and proteinmore » core are conserved compared with a polyhedrin with less than 10% sequence identity. We explain how the conserved biological phenotype, the crystal lattice, is maintained in the face of extreme environmental challenge and massive evolutionary divergence. Our improved methods should open up more challenging biological samples to XFEL analysis.« less

  9. Structural and optical properties of WTe2 single crystals synthesized by DVT technique

    NASA Astrophysics Data System (ADS)

    Dixit, Vijay; Vyas, Chirag; Pathak, V. M.; Soalanki, G. K.; Patel, K. D.

    2018-05-01

    Layered transition metal di-chalcogenide (LTMDCs) crystals have attracted much attention due to their potential in optoelectronic device applications recently due to realization of their monolayer based structures. In the present investigation we report growth of WTe2 single crystals by direct vapor transport (DVT) technique. These crystals are then characterized by energy dispersive analysis of x-rays (EDAX) to study stoichiometric composition after growth. The structural properties are studied by x-ray diffraction (XRD) and selected area electron diffraction (SAED) is used to confirm orthorhombic structure of grown WTe2 crystal. Surface morphological properties of the crystals are also studied by scanning electron microscope (SEM). The optical properties of the grown crystals are studied by UV-Visible spectroscopy which gives direct band gap of 1.44 eV for grown WTe2 single crystals.

  10. The statistical kinematical theory of X-ray diffraction as applied to reciprocal-space mapping

    PubMed

    Nesterets; Punegov

    2000-11-01

    The statistical kinematical X-ray diffraction theory is developed to describe reciprocal-space maps (RSMs) from deformed crystals with defects of the structure. The general solutions for coherent and diffuse components of the scattered intensity in reciprocal space are derived. As an example, the explicit expressions for intensity distributions in the case of spherical defects and of a mosaic crystal were obtained. The theory takes into account the instrumental function of the triple-crystal diffractometer and can therefore be used for experimental data analysis.

  11. Integrated nonlinear optical imaging microscope for on-axis crystal detection and centering at a synchrotron beamline

    PubMed Central

    Madden, Jeremy T.; Toth, Scott J.; Dettmar, Christopher M.; Newman, Justin A.; Oglesbee, Robert A.; Hedderich, Hartmut G.; Everly, R. Michael; Becker, Michael; Ronau, Judith A.; Buchanan, Susan K.; Cherezov, Vadim; Morrow, Marie E.; Xu, Shenglan; Ferguson, Dale; Makarov, Oleg; Das, Chittaranjan; Fischetti, Robert; Simpson, Garth J.

    2013-01-01

    Nonlinear optical (NLO) instrumentation has been integrated with synchrotron X-ray diffraction (XRD) for combined single-platform analysis, initially targeting applications for automated crystal centering. Second-harmonic-generation microscopy and two-photon-excited ultraviolet fluorescence microscopy were evaluated for crystal detection and assessed by X-ray raster scanning. Two optical designs were constructed and characterized; one positioned downstream of the sample and one integrated into the upstream optical path of the diffractometer. Both instruments enabled protein crystal identification with integration times between 80 and 150 µs per pixel, representing a ∼103–104-fold reduction in the per-pixel exposure time relative to X-ray raster scanning. Quantitative centering and analysis of phenylalanine hydroxylase from Chromobacterium violaceum cPAH, Trichinella spiralis deubiquitinating enzyme TsUCH37, human κ-opioid receptor complex kOR-T4L produced in lipidic cubic phase (LCP), intimin prepared in LCP, and α-cellulose samples were performed by collecting multiple NLO images. The crystalline samples were characterized by single-crystal diffraction patterns, while α-cellulose was characterized by fiber diffraction. Good agreement was observed between the sample positions identified by NLO and XRD raster measurements for all samples studied. PMID:23765294

  12. [Physicochemical properties of suplatast tosilate racemate and enantiomers].

    PubMed

    Ushio, T; Endo, K; Yamamoto, K

    1996-11-01

    The physicochemical properties of the enantiomer and racemates of suplatast tosilate (ST) were investigated by means of infrared spectroscopy, solid-state 13C CP/MAS NMR spectroscopy, thermal analysis, and X-ray diffraction analysis, and by measuring the solubility and hygroscopy. The infrared and NMR spectra and X-ray diffraction pattern of the enantiomer were distinctly different from those of the racemate. The melting point of the enantiomer was lower than that of the racemate by 5 degrees C, while the solubility of the enantiomer was 1.3 times higher than that of the racemate. The hygroscopic rate of the enantiomer was greater than that of the racemate. These results suggested that ST was classified into a racemic compound crystal. Furthermore, by comparing the relative peak intensity ratios on X-ray diffraction patterns of the crystals with various optical purities prepared by recrystallization, it was found that a mixture of racemic compound crystals and either of racemic mixture crystals or racemic solid solutions was obtained by recrystallization of ST in the content of 0 to 64%ee, while the recrystallization of ST in the content of more than 64%ee led to the formation of racemic mixture crystals or racemic solid solutions.

  13. Growth, crystalline perfection, spectral, thermal and theoretical studies on imidazolium L-tartrate crystals.

    PubMed

    Meena, K; Muthu, K; Meenatchi, V; Rajasekar, M; Bhagavannarayana, G; Meenakshisundaram, S P

    2014-04-24

    Transparent optical quality single crystals of imidazolium L-tartrate (IMLT) were grown by conventional slow evaporation solution growth technique. Crystal structure of the as-grown IMLT was determined by single crystal X-ray diffraction analysis. Thermal analysis reveals the purity of the crystal and the sample is stable up to the melting point. Good transmittance in the visible region is observed and the band gap energy is estimated using diffuse reflectance data by the application of Kubelka-Munk algorithm. The powder X-ray diffraction study reveals the crystallinity of the as-grown crystal and it is compared with that of the experimental one. An additional peak in high resolution X-ray diffraction (HRXRD) indicates the presence of an internal structural low angle boundary. Second harmonic generation (SHG) activity of IMLT is significant as estimated by Kurtz and Perry powder technique. HOMO-LUMO energies and first-order molecular hyperpolarizability of IMLT have been evaluated using density functional theory (DFT) employing B3LYP functional and 6-31G(d,p) basis set. The optimized geometry closely resembles the ORTEP. The vibrational patterns present in the molecule are confirmed by FT-IR coinciding with theoretical patterns. Copyright © 2014 Elsevier B.V. All rights reserved.

  14. Purification, crystallization and preliminary X-ray analysis of Enterococcus faecium aminoglycoside-2′′-phosphotransferase-Ib [APH(2′′)-Ib

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Walanj, Rupa; Young, Paul; Baker, Heather M.

    2005-04-01

    APH(2′′)-Ib is an enzyme responsible for high-level gentamicin resistance in E. faecium isolates. Native crystals of this enzyme have been prepared and preliminary X-ray diffraction experiments have been undertaken. Bacterial resistance to the aminoglycoside antibiotics is primarily the result of deactivation of the drugs. Three families of enzymes are responsible for this activity, with one such family being the aminoglycoside phosphotransferases (APHs). The gene encoding one of these enzymes, APH(2′′)-Ib, has been cloned and the protein (comprising 299 amino-acid residues) expressed in Escherichia coli, purified and crystallized in the presence of 16%(w/v) PEG 3350 and gentamicin. The crystals belong tomore » the monoclinic space group P2{sub 1}, with approximate unit-cell parameters a = 79.7, b = 58.8, c = 81.4 Å, β = 98.4°, and preliminary X-ray diffraction analysis is consistent with the presence of two molecules in the asymmetric unit. Synchrotron diffraction data to approximately 2.65 Å resolution were collected from a native APH(2′′)-Ib crystal at beamline BL9-2 at SSRL (Stanford, CA, USA). Selenium-substituted crystals have also been produced and structure determination is proceeding.« less

  15. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sanctis, Daniele de; Rêgo, Ana T.; Marçal, David

    The sorbitol operon regulator from K. pneumoniae has been overexpressed in E. coli, purified and crystallized. Diffraction data were collected to 3.2 Å. The sorbitol operon regulator (SorC) regulates the metabolism of l-sorbose in Klebsiella pneumonia. SorC was overexpressed in Escherichia coli and purified, and crystals were obtained of a tetrameric form. A single crystal showed X-ray diffraction to 3.20 Å. The crystal belongs to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 91.6, b = 113.3, c = 184.1 Å. Analysis of the molecular-replacement solution indicates the presence of four SorC molecules in the asymmetric unit.

  16. Thermal, mechanical, optical and dielectric properties of piperazinium hydrogen phosphite monohydrate NLO single crystal

    NASA Astrophysics Data System (ADS)

    Rajkumar, R.; Praveen Kumar, P.

    2018-05-01

    Optical transparent crystal of piperazinium hydrogen phosphite monohydrate (PHPM) was grown by slow evaporation method. The grown crystal was characterized by single crystal X-ray diffraction analysis and the crystal belongs to monoclinic system. The functional groups present in PHPM crystal were confirmed by FTIR analysis. UV-Visible spectrum shows that the PHPM crystal is transparent in the visible region. The mechanical behavior of PHPM crystal was characterized by Vickers hardness test. Thermal stability of PHPM crystal was analyzed by thermogravimetric analysis. Dielectric studies were also carried out for the grown crystal. The third-order nonlinear parameters such as nonlinear refractive index and nonlinear absorption coefficient have been calculated using Z scan technique.

  17. Crystallization and preliminary X-ray analysis of pyruvate kinase from Bacillus stearothermophilus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Suzuki, Kenichiro; Ito, Sohei; Shimizu-Ibuka, Akiko

    2005-08-01

    This report describes the crystallization and X-ray diffraction data collection of three types (wild-type, W416F/V435W and C9S/C268S) of B. stearothermophilus. Crystals of C9S/C268S belonged to space group P6{sub 2}22 and diffracted to a resolution of 2.4 Å. Pyruvate kinase (PK) from a moderate thermophile, Bacillus stearothermophilus (BstPK), is an allosteric enzyme activated by AMP and ribose 5-phosphate but not by fructose 1,6-bisphosphate (FBP). However, almost all other PKs are activated by FBP. The wild-type and W416F/V435W mutant BstPKs were crystallized by the hanging-drop vapour-diffusion method. However, they were unsuitable for structural analysis because their data sets exhibited low completeness. Amore » crystal suitable for structural analysis was obtained using C9S/C268S enzyme. The crystal belonged to space group P6{sub 2}22, with unit-cell parameters a = b = 145.97, c = 118.03 Å.« less

  18. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Madden, Jeremy T.; Toth, Scott J.; Dettmar, Christopher M.

    Nonlinear optical (NLO) instrumentation has been integrated with synchrotron X-ray diffraction (XRD) for combined single-platform analysis, initially targeting applications for automated crystal centering. Second-harmonic-generation microscopy and two-photon-excited ultraviolet fluorescence microscopy were evaluated for crystal detection and assessed by X-ray raster scanning. Two optical designs were constructed and characterized; one positioned downstream of the sample and one integrated into the upstream optical path of the diffractometer. Both instruments enabled protein crystal identification with integration times between 80 and 150 µs per pixel, representing a ~10 3–10 4-fold reduction in the per-pixel exposure time relative to X-ray raster scanning. Quantitative centering andmore » analysis of phenylalanine hydroxylase fromChromobacterium violaceumcPAH,Trichinella spiralisdeubiquitinating enzyme TsUCH37, human κ-opioid receptor complex kOR-T4L produced in lipidic cubic phase (LCP), intimin prepared in LCP, and α-cellulose samples were performed by collecting multiple NLO images. The crystalline samples were characterized by single-crystal diffraction patterns, while α-cellulose was characterized by fiber diffraction. Good agreement was observed between the sample positions identified by NLO and XRD raster measurements for all samples studied.« less

  19. Crystallization and preliminary X-ray analysis of a low density lipoprotein from human plasma.

    PubMed

    Prassl, R; Chapman, J M; Nigon, F; Sara, M; Eschenburg, S; Betzel, C; Saxena, A; Laggner, P

    1996-11-15

    Single crystals of human plasma low density lipoprotein (LDL), the major transport vehicle for cholesterol in blood, have been produced with a view to analysis of the three-dimensional structure by x-ray crystallography. Crystals with dimensions of approximately 200 x 100 x 50 microm have been reproducibly obtained from highly homogeneous LDL particle subspecies, isolated in the density ranges d = 1.0271-1. 0297 g/ml and d = 1.0297-1.0327 g/ml. Electron microscopic imaging of ultrathin-sectioned preparations of the crystals confirmed the existence of a regular, quasihexagonal arrangement of spherical particles of approximately 18 nm in diameter, thereby resembling the dimensions characteristic of LDL after dehydration and fixation. X-ray diffraction with synchrotron radiation under cryogenic conditions revealed the presence of well resolved diffraction spots, to a resolution of about 29 A. The diffraction patterns are indexed in terms of a triclinic lattice with unit cell dimensions of a = 16. 1 nm, b = 39.0 nm, c = 43.9 nm; alpha = 96.2 degrees, beta = 92.1 degrees, gamma = 102 degrees, and with space group P1.

  20. Crystallization and preliminary crystallographic analysis of two Streptococcus agalactiae proteins: the family II inorganic pyrophosphatase and the serine/threonine phosphatase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rantanen, Mika K.; Lehtiö, Lari; Rajagopal, Lakshmi

    Two S. agalactiae proteins, the inorganic pyrophosphatase and the serine/threonine phosphatase, were crystallized and diffraction data were collected and processed from these crystals. The data from the two protein crystals extended to 2.80 and 2.65 Å, respectively. Streptococcus agalactiae, which infects human neonates and causes sepsis and meningitis, has recently been shown to possess a eukaryotic-like serine/threonine protein phosphorylation signalling cascade. Through their target proteins, the S. agalactiae Ser/Thr kinase and Ser/Thr phosphatase together control the growth as well as the morphology and virulence of this organism. One of the targets is the S. agalactiae family II inorganic pyrophosphatase. Themore » inorganic pyrophosphatase and the serine/threonine phosphatase have therefore been purified and crystallized and diffraction data have been collected from their crystals. The data were processed using XDS. The inorganic pyrosphosphatase crystals diffracted to 2.80 Å and the Ser/Thr phosphatase crystals to 2.65 Å. Initial structure-solution experiments indicate that structure solution will be successful in both cases. Solving the structure of the proteins involved in this cascade is the first step towards understanding this phenomenon in atomic detail.« less

  1. Hirshfeld surface analyses and crystal structures of supramolecular self-assembly thiourea derivatives directed by non-covalent interactions

    NASA Astrophysics Data System (ADS)

    Gumus, Ilkay; Solmaz, Ummuhan; Binzet, Gun; Keskin, Ebru; Arslan, Birdal; Arslan, Hakan

    2018-04-01

    The novel N-(bis(3,5-dimethoxybenzyl)carbamothioyl)-4-R-benzamide (R: H, Cl, CH3 and OCH3) compounds have been synthesized and characterized by FT-IR, 1H NMR and 13C NMR spectroscopy. Their crystal structures were also determined by single-crystal X-ray diffraction studies. Hirshfeld surfaces analysis and their associated two dimensional fingerprint plots of compounds were used as theoretical approach to assess driving force for crystal structure formation via the intermolecular interactions in the crystal lattices of synthesized compounds. The study of X-ray single crystal diffraction and Hirshfeld surfaces analysis of the prepared compounds shows that hydrogen bonding and other weaker interactions such as Nsbnd H⋯S, weak Csbnd H⋯S, Csbnd H⋯O, Csbnd H⋯N and Csbnd H···π intermolecular interactions and π-π stacking, among molecules of synthesized compounds participate in a cooperative way to stabilize the supramolecular structures.

  2. The first 3-D LaIII-SrII heterometallic complex: Synthesis, structure and luminescent properties

    NASA Astrophysics Data System (ADS)

    Hong, Zhiwei; Ran, Jingwen; Li, Tao; Chen, Yanmei

    2016-10-01

    The first 3-D LaIII-SrII heterometallic complex, namely [La2Sr(pda)4(H2O)4]n·6nH2O (1, H2pda = pyridine-2,6-dicarboxylic acid), has been successfully synthesized under solvothermal conditions. Single crystal X-ray diffraction analysis reveals that complex 1 features a 3-D porous framework and displays a new topology. The crystal structure can be simplified to a 4,6-connected 3-D network with Schläfli symbol of {34·42·88·9}2{34·42}. The crystals also have been characterized by X-ray powder diffraction, elemental analysis, thermal analysis, and IR spectroscopy. The infrared spectral analysis indicates that complex 1 is a carboxylate coordinated compound, several water molecules exist in the compound. The thermal study shows that there are ten water molecules in the crystal structure. The luminescent property has also been investigated. It shows a blue-purple fluorescence emission.

  3. Crystallization and characterization of human chorionic gonadotropin in chemically deglycosylated and enzymatically desialylated states

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lustbader, J.W.; Birken, S.; Pileggi, N.F.

    1989-11-28

    Crystals suitable for X-ray diffraction studies at moderate resolution have been grown from two forms of human chorionic gonadotropin (hCG): HF-treated hCG and neuraminidase-treated hCG. The enzymatically desialylated form of hCG produced crystals that diffract to 2.8 {angstrom} as compared to the HF-treated hCG crystals that diffract to 3.0 {angstrom}. Although it was assumed that the high and heterogeneous carbohydrate content of the glycoprotein hormones inhibited their crystallization, this report suggests that it is the negatively charged surface sugars and neither the total carbohydrate content nor its heterogeneity which interferes with crystal formation. Chemical deglycosylation resulted in significantly increased proteinmore » degradation during crystal growth. Such peptide bond cleavages were observed to a much lesser extent in the crystals grown from neuraminidase-digested hCG. Sequence analysis of the HF-treated hCG crystals suggested that up to 45% of the molecules within the crystal had an acid-labile peptide bond cleaved. In contrast, the neuraminidase-treated hCG exhibited less than 9% of this type of cleavage. The manner in which hCG was treated prior to crystallization was found to be a very important factor in the extent of peptide bound cleavages occurring during crystal growth. HF treatment of glycoproteins may render glycoproteins more susceptible to peptide bond cleavage during crystal growth.« less

  4. Crystallization and preliminary X-ray diffraction analysis of the arginine repressor of the hyperthermophile Thermotoga neapolitana

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Massant, Jan, E-mail: jan.massant@vub.ac.be; Peeters, Eveline; Charlier, Daniel

    2006-01-01

    The arginine repressor of the hyperthermophile T. neapolitana was crystallized with and without its corepressor arginine. Both crystals diffracted to high resolution and belong to the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}, with similar unit-cell parameters. The arginine repressor of Thermotoga neapolitana (ArgRTnp) is a member of the family of multifunctional bacterial arginine repressors involved in the regulation of arginine metabolism. This hyperthermophilic repressor shows unique DNA-binding features that distinguish it from its homologues. ArgRTnp exists as a homotrimeric protein that assembles into hexamers at higher protein concentrations and/or in the presence of arginine. ArgRTnp was crystallized with andmore » without its corepressor arginine using the hanging-drop vapour-diffusion method. Crystals of the aporepressor diffracted to a resolution of 2.1 Å and belong to the orthorhombic P2{sub 1}2{sub 1}2{sub 1} space group, with unit-cell parameters a = 117.73, b = 134.15, c = 139.31 Å. Crystals of the repressor in the presence of its corepressor arginine diffracted to a resolution of 2.4 Å and belong to the same space group, with similar unit-cell parameters.« less

  5. Growth, structural, spectral, mechanical, thermal and dielectric characterization of phosphoric acid admixtured L-alanine (PLA) single crystals.

    PubMed

    Rose, A S J Lucia; Selvarajan, P; Perumal, S

    2011-10-15

    Phosphoric acid admixtured L-alanine (PLA) single crystals were grown successfully by solution method with slow evaporation technique at room temperature. Crystals of size 18 mm×12 mm×8 mm have been obtained in 28 days. The grown crystals were colorless and transparent. The solubility of the grown samples has been found out at various temperatures. The lattice parameters of the grown crystals were determined by X-ray diffraction technique. The reflection planes of the sample were confirmed by the powder X-ray diffraction study and diffraction peaks were indexed. Fourier transform infrared (FTIR) studies were used to confirm the presence of various functional groups in the crystals. UV-visible transmittance spectrum was recorded to study the optical transparency of grown crystal. The nonlinear optical (NLO) property of the grown crystal was confirmed by Kurtz-Perry powder technique and a study of its second harmonic generation efficiency in comparison with potassium dihydrogen phosphate (KDP) has been made. The mechanical strength of the crystal was estimated by Vickers hardness test. The grown crystals were subjected to thermo gravimetric and differential thermal analysis (TG/DTA). The dielectric behavior of the sample was also studied. Copyright © 2011 Elsevier B.V. All rights reserved.

  6. Cloning, purification, crystallization and preliminary crystallographic analysis of SecA from Enterococcus faecalis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Meining, Winfried, E-mail: wim@csb.ki.se; Scheuring, Johannes; Fischer, Markus

    2006-06-01

    SecA ATPase from E. faecalis has been cloned, overexpressed, purified and crystallized. Crystals belong to space group C2 and diffract to 2.4 Å resolution. The gene coding for SecA from Enterococcus faecalis was cloned and overexpressed in Escherichia coli. In this protein, the lysine at position 6 was replaced by an asparagine in order to reduce sensitivity towards proteases. The modified protein was purified and crystallized. Crystals diffracting to 2.4 Å resolution were obtained using the vapour-diffusion technique. The crystals belong to the monoclinic space group C2, with unit-cell parameters a = 203.4, b = 49.8, c = 100.8 Å,more » α = γ = 90.0, β = 119.1°. A selenomethionine derivative was prepared and is currently being tested in crystallization trials.« less

  7. X-ray characterization of curved crystals for hard x-ray astronomy

    NASA Astrophysics Data System (ADS)

    Buffagni, Elisa; Bonnini, Elisa; Ferrari, Claudio; Virgilli, Enrico; Frontera, Filippo

    2015-05-01

    Among the methods to focus photons the diffraction in crystals results as one of the most effective for high energy photons. An assembling of properly oriented crystals can form a lens able to focus x-rays at high energy via Laue diffraction in transmission geometry; this is a Laue lens. The x-ray diffraction theory provides that the maximum diffraction efficiency is achieved in ideal mosaic crystals, but real mosaic crystals show diffraction efficiencies several times lower than the ideal case due to technological problems. An alternative and convenient approach is the use of curved crystals. We have recently optimized an efficient method based on the surface damage of crystals to produce self-standing uniformly curved Si, GaAs and Ge tiles of thickness up to 2-3 mm and curvature radii R down to a few meters. We show that, for curved diffracting planes, such crystals have a diffraction efficiency nearly forty times higher than the diffraction efficiency of perfect similar flat crystals, thus very close to that of ideal mosaic crystals. Moreover, in an alternative configuration where the diffracting planes are perpendicular to the curved ones, a focusing effect occurs and will be shown. These results were obtained for several energies between 17 and 120 keV with lab sources or at high energy facilities such as LARIX at Ferrara (Italy), ESRF at Grenoble (France), and ANKA at Karlsruhe (Germany).

  8. Hydrogen bonds directed 2D → 3D interdigitated Cd(II) compound: Synthesis, crystal structure and dual-emission luminescent properties

    NASA Astrophysics Data System (ADS)

    Yu, Yuanyuan

    2017-06-01

    A new Cd(II) compound, namely [Cd2(btc)(phen)2Cl]n·n(H2O)·n(DMA) (1, H3btc = 1, 3, 5-benzenetricarboxylic acid, phen = 1,10-phenanthroline, DMA = N,N'-dimethylacetamide) has been synthesized and structurally characterized by single-crystal X-ray diffraction analysis. This compound crystallizes in monoclinic P21/n space group with a = 13.5729(7) Å, b = 20.1049(7) Å, c = 13.9450(6) Å, β = 104.671(4)°, Z = 4. Single-crystal X-ray diffraction analysis reveals that compound 1 features a 2D → 3D interdigitated framework directed by the intermolecular hydrogen bonds. In addition, the luminescent properties of compound 1 were also investigated in the solid state at room temperature.

  9. Crystallization and X-ray diffraction analysis of a putative bacterial class I labdane-related diterpene synthase.

    PubMed

    Serrano-Posada, Hugo; Centeno-Leija, Sara; Rojas-Trejo, Sonia; Stojanoff, Vivian; Rodríguez-Sanoja, Romina; Rudiño-Piñera, Enrique; Sánchez, Sergio

    2015-09-01

    Labdane-related diterpenoids are natural products with potential pharmaceutical applications that are rarely found in bacteria. Here, a putative class I labdane-related diterpene synthase (LrdC) identified by genome mining in a streptomycete was successfully crystallized using the microbatch method. Crystals of the LrdC enzyme were obtained in a holo form with its natural cofactor Mg(2+) (LrdC-Mg(2+)) and in complex with inorganic pyrophosphate (PPi) (LrdC-Mg(2+)-PPi). Crystals of native LrdC-Mg(2+) diffracted to 2.50 Å resolution and belonged to the trigonal space group P3221, with unit-cell parameters a = b = 107.1, c = 89.2 Å. Crystals of the LrdC-Mg(2+)-PPi complex grown in the same conditions as the native enzyme with PEG 8000 diffracted to 2.36 Å resolution and also belonged to the trigonal space group P3221. Crystals of the LrdC-Mg(2+)-PPi complex grown in a second crystallization condition with PEG 3350 diffracted to 2.57 Å resolution and belonged to the monoclinic space group P21, with unit-cell parameters a = 49.9, b = 104.1, c = 66.5 Å, β = 111.4°. The structure was determined by the single-wavelength anomalous dispersion (SAD) technique using the osmium signal from a potassium hexachloroosmate (IV) derivative.

  10. Polarization-resolved second-harmonic generation microscopy as a method to visualize protein-crystal domains

    PubMed Central

    DeWalt, Emma L.; Begue, Victoria J.; Ronau, Judith A.; Sullivan, Shane Z.; Das, Chittaranjan; Simpson, Garth J.

    2013-01-01

    Polarization-resolved second-harmonic generation (PR-SHG) microscopy is described and applied to identify the presence of multiple crystallographic domains within protein-crystal conglomerates, which was confirmed by synchrotron X-ray diffraction. Principal component analysis (PCA) of PR-SHG images resulted in principal component 2 (PC2) images with areas of contrasting negative and positive values for conglomerated crystals and PC2 images exhibiting uniformly positive or uniformly negative values for single crystals. Qualitative assessment of PC2 images allowed the identification of domains of different internal ordering within protein-crystal samples as well as differentiation between multi-domain conglomerated crystals and single crystals. PR-SHG assessments of crystalline domains were in good agreement with spatially resolved synchrotron X-ray diffraction measurements. These results have implications for improving the productive throughput of protein structure determination through early identification of multi-domain crystals. PMID:23275165

  11. In-situ neutron diffraction and crystal plasticity finite element modeling to study the kinematic stability of retained austenite in bearing steels

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Voothaluru, Rohit; Bedekar, Vikram; Xie, Qingge

    This work integrates in-situ neutron diffraction and crystal plasticity finite element modeling to study the kinematic stability of retained austenite in high carbon bearing steels. The presence of a kinematically metastable retained austenite in bearing steels can significantly affect the macro-mechanical and micro-mechanical material response. Mechanical characterization of metastable austenite is a critical component in accurately capturing the micro-mechanical behavior under typical application loads. Traditional mechanical characterization techniques are unable to discretely quantify the micro-mechanical response of the austenite, and as a result, the computational predictions rely heavily on trial and error or qualitative descriptions of the austenite phase. Inmore » order to overcome this, in the present work, we use in-situ neutron diffraction of a uniaxial tension test of an A485 Grade 1 bearing steel specimen. The mechanical response determined from the neutron diffraction analysis was incorporated into a hybrid crystal plasticity finite element model that accounts for the martensite's crystal plasticity and the stress-assisted transformation from austenite to martensite in bearing steels. Here, the modeling response was used to estimate the single crystal elastic constants of the austenite and martensite phases. Finally, the results show that using in-situ neutron diffraction, coupled with a crystal plasticity model, can successfully predict both the micro-mechanical and macro-mechanical responses of bearing steels while accounting for the martensitic transformation of the retained austenite.« less

  12. In-situ neutron diffraction and crystal plasticity finite element modeling to study the kinematic stability of retained austenite in bearing steels

    DOE PAGES

    Voothaluru, Rohit; Bedekar, Vikram; Xie, Qingge; ...

    2018-11-21

    This work integrates in-situ neutron diffraction and crystal plasticity finite element modeling to study the kinematic stability of retained austenite in high carbon bearing steels. The presence of a kinematically metastable retained austenite in bearing steels can significantly affect the macro-mechanical and micro-mechanical material response. Mechanical characterization of metastable austenite is a critical component in accurately capturing the micro-mechanical behavior under typical application loads. Traditional mechanical characterization techniques are unable to discretely quantify the micro-mechanical response of the austenite, and as a result, the computational predictions rely heavily on trial and error or qualitative descriptions of the austenite phase. Inmore » order to overcome this, in the present work, we use in-situ neutron diffraction of a uniaxial tension test of an A485 Grade 1 bearing steel specimen. The mechanical response determined from the neutron diffraction analysis was incorporated into a hybrid crystal plasticity finite element model that accounts for the martensite's crystal plasticity and the stress-assisted transformation from austenite to martensite in bearing steels. Here, the modeling response was used to estimate the single crystal elastic constants of the austenite and martensite phases. Finally, the results show that using in-situ neutron diffraction, coupled with a crystal plasticity model, can successfully predict both the micro-mechanical and macro-mechanical responses of bearing steels while accounting for the martensitic transformation of the retained austenite.« less

  13. Liquid-Crystal Point-Diffraction Interferometer for Wave-Front Measurements

    NASA Technical Reports Server (NTRS)

    Mercer, Carolyn R.; Creath, Katherine

    1996-01-01

    A new instrument, the liquid-crystal point-diffraction interferometer (LCPDI), is developed for the measurement of phase objects. This instrument maintains the compact, robust design of Linnik's point-diffraction interferometer and adds to it a phase-stepping capability for quantitative interferogram analysis. The result is a compact, simple to align, environmentally insensitive interferometer capable of accurately measuring optical wave fronts with very high data density and with automated data reduction. We describe the theory and design of the LCPDI. A focus shift was measured with the LCPDI, and the results are compared with theoretical results,

  14. Studies on the growth, structural, optical, mechanical properties of 8-hydroxyquinoline single crystal by vertical Bridgman technique

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Prabhakaran, SP.; Babu, R. Ramesh, E-mail: rampap2k@yahoo.co.in; Velusamy, P.

    2011-11-15

    Highlights: {yields} Growth of bulk single crystal of 8-hydroxyquinoline (8-HQ) by vertical Bridgman technique for the first time. {yields} The crystalline perfection is reasonably good. {yields} The photoluminescence spectrum shows that the material is suitable for blue light emission. -- Abstract: Single crystal of organic nonlinear optical material, 8-hydroxyquinoline (8-HQ) of dimension 52 mm (length) x 12 mm (dia.) was grown from melt using vertical Bridgman technique. The crystal system of the material was confirmed by powder X-ray diffraction analysis. The crystalline perfection of the grown crystal was examined by high-resolution X-ray diffraction study. Low angular spread around 400'' ofmore » the diffraction curve and the low full width half maximum values show that the crystalline perfection is reasonably good. The recorded photoluminescence spectrum shows that the material is suitable for blue light emission. Optical transmittance for the UV and visible region was measured and mechanical strength was estimated from Vicker's microhardness test along the growth face of the grown crystal.« less

  15. A Test of Macromolecular Crystallization in Microgravity: Large, Well-Ordered Insulin Crystals

    NASA Technical Reports Server (NTRS)

    Borgstahl, Gloria E. O.; Vahedi-Faridi, Ardeschir; Lovelace, Jeff; Bellamy, Henry D.; Snell, Edward H.; Whitaker, Ann F. (Technical Monitor)

    2001-01-01

    Crystals of insulin grown in microgravity on space shuttle mission STS-95 were extremely well-ordered and unusually large (many > 2 mm). The physical characteristics of six microgravity and six earth-grown crystals were examined by X-ray analysis employing superfine f slicing and unfocused synchrotron radiation. This experimental setup allowed hundreds of reflections to be precisely examined for each crystal in a short period of time. The microgravity crystals were on average 34 times larger, had 7 times lower mosaicity, had 54 times higher reflection peak heights and diffracted to significantly higher resolution than their earth grown counterparts. A single mosaic domain model could account for reflections in microgravity crystals whereas reflections from earth crystals required a model with multiple mosaic domains. This statistically significant and unbiased characterization indicates that the microgravity environment was useful for the improvement of crystal growth and resultant diffraction quality in insulin crystals and may be similarly useful for macromolecular crystals in general.

  16. Growth and characterization of diammonium copper disulphate hexahydrate single crystal

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Siva Sankari, R.; Perumal, Rajesh Narayana, E-mail: r.shankarisai@gmail.com

    2014-03-01

    Graphical abstract: Diammonium copper disulphate hexahydrate (DACS) is one of the most promising inorganic dielectric crystals with exceptional mechanical properties. Good quality crystals of DACS were grown by using solution method in a period of 30 days. The grown crystals were subjected to single crystal X-ray diffraction analysis in order to establish their crystalline nature. Thermo gravimetric, differential thermal analysis, FTIR, and UV–vis–NIR analysis were performed for the crystal. Several solid state physical parameters have been determined for the grown crystals. The dielectric constant and the dielectric loss and AC conductivity of the grown crystal were studied as a functionmore » of frequency and temperature has been calculated and plotted. - Highlights: • Diammonium copper disulphate is grown for the first time and CCDC number obtained. • Thermal analysis is done to see the stability range of the crystals. • Band gap and UV cut off wavelength of the crystal are determined to be 2.4 eV and 472.86 nm, respectively. • Dielectric constant, dielectric loss and AC conductivity are plotted as a function of applied field. - Abstract: Diammonium copper disulphate hexahydrate is one of the most promising inorganic crystals with exceptional dielectric properties. A good quality crystal was harvested in a 30-day period using solution growth method. The grown crystal was subjected to various characterization techniques like single crystal X-ray diffraction analysis, thermo gravimetric, differential thermal analysis, FTIR, and UV–vis–NIR analysis. Unit cell dimensions of the grown crystal have been identified from XRD studies. Functional groups of the title compounds have been identified from FTIR studies. Thermal stability of the samples was checked by TG/DTA studies. Band gap of the crystal was calculated. The dielectric constant and dielectric loss were studied as a function of frequency of the applied field. AC conductivity was plotted as a function of temperature.« less

  17. The use of a mini-κ goniometer head in macromolecular crystallography diffraction experiments

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Brockhauser, Sandor; UJF–EMBL–CNRS UMI 3265, 6 Rue Jules Horowitz, 38043 Grenoble; Ravelli, Raimond B. G.

    2013-07-01

    Hardware and software solutions for MX data-collection strategies using the EMBL/ESRF miniaturized multi-axis goniometer head are presented. Most macromolecular crystallography (MX) diffraction experiments at synchrotrons use a single-axis goniometer. This markedly contrasts with small-molecule crystallography, in which the majority of the diffraction data are collected using multi-axis goniometers. A novel miniaturized κ-goniometer head, the MK3, has been developed to allow macromolecular crystals to be aligned. It is available on the majority of the structural biology beamlines at the ESRF, as well as elsewhere. In addition, the Strategy for the Alignment of Crystals (STAC) software package has been developed to facilitatemore » the use of the MK3 and other similar devices. Use of the MK3 and STAC is streamlined by their incorporation into online analysis tools such as EDNA. The current use of STAC and MK3 on the MX beamlines at the ESRF is discussed. It is shown that the alignment of macromolecular crystals can result in improved diffraction data quality compared with data obtained from randomly aligned crystals.« less

  18. Protein Crystal Movements and Fluid Flows During Microgravity Growth

    NASA Technical Reports Server (NTRS)

    Boggon, Titus J.; Chayen, Naomi E.; Snell, Edward H.; Dong, Jun; Lautenschlager, Peter; Potthast, Lothar; Siddons, D. Peter; Stojanoff, Vivian; Gordon, Elspeth; Thompson, Andrew W.; hide

    1998-01-01

    The growth of protein crystals suitable for x-ray crystal structure analysis is an important topic. The quality (perfection) of protein crystals is now being evaluated by mosaicity analysis (rocking curves) and x-ray topographic images as well as the diffraction resolution limit and overall data quality. In yet another study, use of hanging drop vapour diffusion geometry on the IML-2 shuttle mission showed, again via CCD video monitoring, growing apocrustacyanin C(sub 1) protein crystal executing near cyclic movement, reminiscent of Marangoni convection flow of fluid, the crystals serving as "markers" of the fluid flow. A review is given here of existing results and experience over several microgravity missions. Some comment is given on gel protein crystal growth in attempts to 'mimic' the benefits of microgravity on Earth. Finally, the recent new results from our experiments on the shuttle mission LMS are described. These results include CCD video as well as interferometry during the mission, followed, on return to Earth, by reciprocal space mapping at the NSLS, Brookhaven, and full X-ray data collection on LMS and Earth control lysozyme crystals. Diffraction data recorded from LMS and ground control apocrustacyanin C(sub 1) crystals are also described.

  19. Study of Inverse Ni-based Photonic Crystal using the Microradian X-ray Diffraction

    NASA Astrophysics Data System (ADS)

    Vasilieva, A. V.; Grigoryeva, N. A.; Mistonov, A. A.; Sapoletova, N. A.; Napolskii, K. S.; Eliseev, A. A.; Lukashin, A. V.; Tretyakov, Yu D.; Petukhov, A. V.; Byelov, D.; Chernyshov, D.; Okorokov, A. I.; Bouwman, W. G.; Grigoriev, S. V.

    2010-10-01

    Inverse photonic nickel-based crystal films formed by electrocrystallization of metal inside the voids of polymer artificial opal have been studied using the microradian X-ray diffraction. Analysis of the diffraction images agrees with an face-centred cubic (FCC) structure with the lattice constant a0 = 650 ± 10 nm and indicates two types of stacking sequences coexisting in the crystal (twins of ABCABC... and ACBACB... ordering motifs), the ratio between them being 4:5 The transverse structural correlation length Ltran is 2.4 ± 0.1 μm, which corresponds to a sample thickness of 6 layers. The in-plane structural correlation length Llong is 3.4 ± 0.2 μm, and the structure mosaic is of order of 10°.

  20. Structural and electronic evolution of Cr[subscript 2]O[subscript 3] on compression to 55 GPa

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dera, Przemyslaw; Lavina, Barbara; Meng, Yue

    2016-08-15

    Synchrotron single-crystal x-ray diffraction experiments have been performed on corundum-type Cr{sub 2}O{sub 3} up to a pressure of 55 GPa in Ne and He pressure transmitting media. Diffraction experiments were complemented by measurements of optical absorption spectra with single crystal samples up to 60 GPa. Results of the diffraction data analysis rule out the earlier reported monoclinic distortion at 15-30 GPa, but indicate evidence of two discontinuous transitions of electronic or magnetic nature, most likely associated with a change in magnetic ordering and charge transfer. The compression mechanism established from single crystal refinements indicates much smaller distortion of the Cr{supmore » 3+} coordination environment than was previously assumed.« less

  1. Purification, crystallization and preliminary crystallographic analysis of biotin protein ligase from Staphylococcus aureus.

    PubMed

    Pendini, Nicole R; Polyak, Steve W; Booker, Grant W; Wallace, John C; Wilce, Matthew C J

    2008-06-01

    Biotin protein ligase from Staphylococcus aureus catalyses the biotinylation of acetyl-CoA carboxylase and pyruvate carboxylase. Recombinant biotin protein ligase from S. aureus has been cloned, expressed and purified. Crystals were grown using the hanging-drop vapour-diffusion method using PEG 8000 as the precipitant at 295 K. X-ray diffraction data were collected to 2.3 A resolution from crystals using synchrotron X-ray radiation at 100 K. The diffraction was consistent with the tetragonal space group P4(2)2(1)2, with unit-cell parameters a = b = 93.665, c = 131.95.

  2. Structural analysis of bacteriophage-encoded peptidoglycan hydrolase domain KMV36C: crystallization and preliminary X-ray diffraction

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Van Hecke, Kristof, E-mail: kristof.vanhecke@chem.kuleuven.be; Briers, Yves; Derua, Rita

    2008-04-01

    Crystallization and X-ray data collection of the C-terminus of gp36 from bacteriophage ϕKMV (KMV36C) are reported. The C-terminus of gp36 of bacteriophage ϕKMV (KMV36C) functions as a particle-associated muramidase, presumably as part of the injection needle of the ϕKMV genome during infection. Crystals of KMV36C were obtained by hanging-drop vapour diffusion and diffracted to a resolution of 1.6 Å. The crystals belong to the cubic space group P432, with unit-cell parameters a = b = c = 102.52 Å. KMV36C shows 30% sequence identity to T4 lysozyme (PDB code)

  3. Expression, purification, crystallization and preliminary X-ray analysis of an NAD-dependent glyceraldehyde-3-phosphate dehydrogenase from Helicobacter pylori

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Elliott, Paul R.; Mohammad, Shabaz; Melrose, Helen J.

    2008-08-01

    Glyceraldehyde-3-phosphate dehydrogenase B from H. pylori has been cloned, expressed, purified and crystallized in the presence of NAD. Crystals of GAPDHB diffracted to 2.8 Å resolution and belonged to space group P6{sub 5}22, with unit-cell parameters a = b = 166.1, c = 253.1 Å. Helicobacter pylori is a dangerous human pathogen that resides in the upper gastrointestinal tract. Little is known about its metabolism and with the onset of antibiotic resistance new treatments are required. In this study, the expression, purification, crystallization and preliminary X-ray diffraction of an NAD-dependent glyceraldehyde-3-phosphate dehydrogenase from H. pylori are reported.

  4. Crystallization and X-ray diffraction analysis of 6-­aminohexanoate-dimer hydrolase from Arthrobacter sp. KI72

    PubMed Central

    Ohki, Taku; Mizuno, Nobuhiro; Shibata, Naoki; Takeo, Masahiro; Negoro, Seiji; Higuchi, Yoshiki

    2005-01-01

    To investigate the structure–function relationship between 6-aminohexanoate-dimer hydrolase (EII) from Arthrobacter sp. and a cryptic protein (EII′) which shows 88% sequence identity to EII, a hybrid protein (named Hyb-24) of EII and EII′ was overexpressed, purified and crystallized using the sitting-drop vapour-diffusion method with ammonium sulfate as a precipitant in MES buffer pH 6.5. The crystal belongs to space group P3121 or P3221, with unit-cell parameters a = b = 96.37, c = 113.09 Å. Diffraction data were collected from native and methylmercuric chloride derivative crystals to resolutions of 1.75 and 1.80 Å, respectively. PMID:16511198

  5. Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3;-terminus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yeo, Hyun Koo; Lee, Jae Young

    2012-04-18

    The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapor diffusion and diffracted to 2.8 {angstrom} resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 {angstrom}, {alpha} = 91.37, {beta} = 93.21, {gamma} = 92.35{sup o}.

  6. Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus.

    PubMed

    Yeo, Hyun Koo; Lee, Jae Young

    2010-05-01

    The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapour diffusion and diffracted to 2.8 A resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 A, alpha = 91.37, beta = 93.21, gamma = 92.35 degrees .

  7. Cloning, expression, purification, crystallization and X-ray diffraction analysis of dihydrodipicolinate synthase from the human pathogenic bacterium Bartonella henselae strain Houston-1 at 2.1 Å resolution

    DOE PAGES

    Naqvi, Kubra F.; Staker, Bart L.; Dobson, Renwick C. J.; ...

    2016-01-01

    The enzyme dihydrodipicolinate synthase catalyzes the committed step in the synthesis of diaminopimelate and lysine to facilitate peptidoglycan and protein synthesis. Dihydrodipicolinate synthase catalyzes the condensation of L-aspartate 4-semialdehyde and pyruvate to synthesize L-2,3-dihydrodipicolinate. Here, the cloning, expression, purification, crystallization and X-ray diffraction analysis of dihydrodipicolinate synthase from the pathogenic bacteriumBartonella henselae, the causative bacterium of cat-scratch disease, are presented. Protein crystals were grown in conditions consisting of 20%(w/v) PEG 4000, 100 mMsodium citrate tribasic pH 5.5 and were shown to diffract to ~2.10 Å resolution. They belonged to space groupP2 12 12 1, with unit-cell parametersa= 79.96,b= 106.33,c= 136.25more » Å. The finalRvalues wereR r.i.m.= 0.098,R work= 0.183,R free= 0.233.« less

  8. Crystallization and crystal manipulation of a steric chaperone in complex with its lipase substrate

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pauwels, Kris, E-mail: krpauwel@vub.ac.be; Loris, Remy; Vandenbussche, Guy

    2005-08-01

    Crystals of the lipase of B. glumae in complex with its specific foldase were obtained in two forms. Crystallization, crystal manipulation and preliminary X-ray diffraction analysis are described. Bacterial lipases that are secreted via the type II secretion pathway require a lipase-specific foldase in order to obtain their native and biologically active conformation in the periplasmic space. The lipase–foldase complex from Burkholderia glumae (319 and 333 residues, respectively) was crystallized in two crystal forms. One crystal form belongs to space group P3{sub 1}21 (P3{sub 2}21), with unit-cell parameters a = b = 122.3, c = 98.2 Å. A procedure ismore » presented which improved the diffraction of these crystals from ∼5 to 2.95 Å. For the second crystal form, which belonged to space group C2 with unit-cell parameters a = 183.0, b = 75.7, c = 116.6 Å, X-ray data were collected to 1.85 Å.« less

  9. Phononic crystal diffraction gratings

    NASA Astrophysics Data System (ADS)

    Moiseyenko, Rayisa P.; Herbison, Sarah; Declercq, Nico F.; Laude, Vincent

    2012-02-01

    When a phononic crystal is interrogated by an external source of acoustic waves, there is necessarily a phenomenon of diffraction occurring on the external enclosing surfaces. Indeed, these external surfaces are periodic and the resulting acoustic diffraction grating has a periodicity that depends on the orientation of the phononic crystal. This work presents a combined experimental and theoretical study on the diffraction of bulk ultrasonic waves on the external surfaces of a 2D phononic crystal that consists of a triangular lattice of steel rods in a water matrix. The results of transmission experiments are compared with theoretical band structures obtained with the finite-element method. Angular spectrograms (showing frequency as a function of angle) determined from diffraction experiments are then compared with finite-element simulations of diffraction occurring on the surfaces of the crystal. The experimental results show that the diffraction that occurs on its external surfaces is highly frequency-dependent and has a definite relation with the Bloch modes of the phononic crystal. In particular, a strong influence of the presence of bandgaps and deaf bands on the diffraction efficiency is found. This observation opens perspectives for the design of efficient phononic crystal diffraction gratings.

  10. Expression, purification, crystallization and preliminary X-ray diffraction analysis of the DDX3 RNA helicase domain

    PubMed Central

    Rodamilans, Bernardo; Montoya, Guillermo

    2007-01-01

    DDX3 is a human RNA helicase that is involved in RNA processing and important human diseases. This enzyme belongs to the DEAD-box protein family, the members of which are characterized by the presence of nine conserved motifs including the Asp-Glu-Ala-Asp motif that defines the family. DDX3 has two distinct domains: an ATP-binding domain in the central region of the protein and a helicase domain in the carboxy-terminal region. The helicase domain of DDX3 was cloned and overexpressed in Escherichia coli. Crystallization experiments yielded crystals that were suitable for X-ray diffraction analysis. The final crystallization conditions were a reservoir solution consisting of 2 M ammonium sulfate, 0.1 M imidazole pH 6.4 plus 5 mM spermine tetrahydrochloride and a protein solution containing 10 mM HEPES, 500 mM ammonium sulfate pH 8.0. The crystals of the helicase domain belong to the monoclinic space group P21, with unit-cell parameters a = 43.85, b = 60.72, c = 88.39 Å, α = γ = 90, β = 101.02°, and contained three molecules per asymmetric unit. These crystals diffracted to a resolution limit of 2.2 Å using synchrotron radiation at the European Synchrotron Radiation Facility (ESRF) and the Swiss Light Source (SLS). PMID:17401195

  11. Expression, purification, crystallization and preliminary X-ray diffraction analysis of the DDX3 RNA helicase domain.

    PubMed

    Rodamilans, Bernardo; Montoya, Guillermo

    2007-04-01

    DDX3 is a human RNA helicase that is involved in RNA processing and important human diseases. This enzyme belongs to the DEAD-box protein family, the members of which are characterized by the presence of nine conserved motifs including the Asp-Glu-Ala-Asp motif that defines the family. DDX3 has two distinct domains: an ATP-binding domain in the central region of the protein and a helicase domain in the carboxy-terminal region. The helicase domain of DDX3 was cloned and overexpressed in Escherichia coli. Crystallization experiments yielded crystals that were suitable for X-ray diffraction analysis. The final crystallization conditions were a reservoir solution consisting of 2 M ammonium sulfate, 0.1 M imidazole pH 6.4 plus 5 mM spermine tetrahydrochloride and a protein solution containing 10 mM HEPES, 500 mM ammonium sulfate pH 8.0. The crystals of the helicase domain belong to the monoclinic space group P2(1), with unit-cell parameters a = 43.85, b = 60.72, c = 88.39 A, alpha = gamma = 90, beta = 101.02 degrees , and contained three molecules per asymmetric unit. These crystals diffracted to a resolution limit of 2.2 A using synchrotron radiation at the European Synchrotron Radiation Facility (ESRF) and the Swiss Light Source (SLS).

  12. Cloning, purification, crystallization and preliminary X-ray crystallographic analysis of MCAT from Synechocystis sp. PCC 6803.

    PubMed

    Liu, Yinghui; Zhang, Yanming; Cao, Xupeng; Xue, Song

    2013-11-01

    Malonyl-coenzymeA:acyl-carrier protein transacylase (MCAT), which catalyzes the transfer of the malonyl group from malonyl-CoA to acyl-carrier protein (ACP), is an essential enzyme in type II fatty-acid synthesis. The enzyme MCAT from Synechocystis sp. PCC 6803 (spMCAT), the first MCAT counterpart from a cyanobacterium, was cloned, purified and crystallized in order to determine its three-dimensional crystal structure. A higher-quality crystal with better diffraction was obtained by crystallization optimization. The crystal diffracted to 1.8 Å resolution and belonged to the orthorhombic space group P2(1)2(1)2, with unit-cell parameters a = 43.22, b = 149.21, c = 40.59 Å. Matthews coefficient calculations indicated that the crystal contained one spMCAT molecule in the asymmetric unit with a Matthews coefficient of 2.18 Å(3) Da(-1) and a solvent content of 43.65%.

  13. Hydrothermal Synthesis, Crystal Structure, and Photoluminescent Properties of Li[UO2(CH3COO)3]3[Co(H2O)6

    NASA Astrophysics Data System (ADS)

    AlDamen, Murad A.; Juwhari, Hassan K.; Al-zuheiri, Aya M.; Alnazer, Louy A.

    2017-12-01

    Single crystal of Li[UO2(CH3COO)3]3[Co(H2O)6] was prepared and found to crystallize in the monoclinic crystal system in the sp. gr. C2/ c, with Z = 2, and unit cell parameters a = 22.1857(15) Å, b = 13.6477(8) Å, c = 15.6921(10) Å, β = 117.842(9)°, V = 4201.3(4) Å3. The crystal was characterized by X-ray diffraction, Fourier transform infrared spectroscopy, and differential scanning calorimetry. The single crystal X-ray diffraction analysis revealed that the crystal has a lamellar structure in which a cobalt hydrate is sandwiched within the Li[UO2(CH3COO)3]3 2- chains. Furthermore, the room temperature photoluminescence spectrum of the complex was investigated in the solid state.

  14. Crystallization Dynamics of Organolead Halide Perovskite by Real-Time X-ray Diffraction.

    PubMed

    Miyadera, Tetsuhiko; Shibata, Yosei; Koganezawa, Tomoyuki; Murakami, Takurou N; Sugita, Takeshi; Tanigaki, Nobutaka; Chikamatsu, Masayuki

    2015-08-12

    We analyzed the crystallization process of the CH3NH3PbI3 perovskite by observing real-time X-ray diffraction immediately after combining a PbI2 thin film with a CH3NH3I solution. A detailed analysis of the transformation kinetics demonstrated the fractal diffusion of the CH3NH3I solution into the PbI2 film. Moreover, the perovskite crystal was found to be initially oriented based on the PbI2 crystal orientation but to gradually transition to a random orientation. The fluctuating characteristics of the crystallization process of perovskites, such as fractal penetration and orientational transformation, should be controlled to allow the fabrication of high-quality perovskite crystals. The characteristic reaction dynamics observed in this study should assist in establishing reproducible fabrication processes for perovskite solar cells.

  15. A combined experimental and in silico characterization to highlight additional structural features and properties of a potentially new drug

    NASA Astrophysics Data System (ADS)

    Bastos, Isadora T. S.; Costa, Fanny N.; Silva, Tiago F.; Barreiro, Eliezer J.; Lima, Lídia M.; Braz, Delson; Lombardo, Giuseppe M.; Punzo, Francesco; Ferreira, Fabio F.; Barroso, Regina C.

    2017-10-01

    LASSBio-1755 is a new cycloalkyl-N-acylhydrazone parent compound designed for the development of derivatives with antinociceptive and anti-inflammatory activities. Although single crystal X-ray diffraction has been considered as the golden standard in structure determination, we successfully used X-ray powder diffraction data in the structural determination of new synthesized compounds, in order to overcome the bottle-neck due to the difficulties experienced in harvesting good quality single crystals of the compounds. We therefore unequivocally assigned the relative configuration (E) to the imine double bond and a s-cis conformation of the amide function of the N-acylhydrazone compound. These features are confirmed by a computational analysis performed on the basis of molecular dynamics calculations, which are extended not only to the structural characteristics but also to the analysis of the anisotropic atomic displacement parameters, a further information - missed in a typical powder diffraction analysis. The so inferred data were used to perform additional cycles of refinement and eventually generate a new cif file with additional physical information. Furthermore, crystal morphology prediction was performed, which is in agreement with the experimental images acquired by scanning electron microscopy, thus providing useful information on possible alternative paths for better crystallization strategies.

  16. Growth and characterization of metal halide perovskite crystals: Benzyltributyl ammonium tetrachloro manganate(II) monohydrate

    NASA Astrophysics Data System (ADS)

    Dhandapani, M.; Sugandhi, K.; Nithya, S.; Muthuraja, P.; Balachandar, S.; Aranganayagam, K. R.

    2018-05-01

    The perovskite type organic-inorganic hybrid benzyltributyl ammoniumtetrachloro manganate (II) monohydrates (BTBA-Mn) are synthesized and the single crystals are grown by slow evaporation solution growth technique. The structure of the grown crystals are confirmed by using X-ray diffraction (XRD), unit cell parameter analysis, Fourier transform Infrared (FTIR), elemental analysis and 13C-NMR spectral studies. Thermogravimetry (TG), differential thermal analysis (DTA) and differential scanning colorimetric (DSC) analysis were carried out to understand thermal stability and occurrence of phase transition.

  17. Carbonate-based zeolitic imidazolate framework for highly selective CO2 capture.

    PubMed

    Basnayake, Sajani A; Su, Jie; Zou, Xiadong; Balkus, Kenneth J

    2015-02-16

    In this study, we report the formation of a new crystal structure, ZIF-CO3-1, which results from the reaction of Zn(2+), 2-methylimidazole, and carbonate. ZIF-CO3-1 can be synthesized solvothermally in N,N-dimethylformamide (DMF)/water (H2O) or by utilizing of CO2 gas at various temperatures in DMF/H2O or H2O. This reaction selectively consumes CO2 because CO2 is incorporated in the ZIF as carbonate. CO2 can be quantitatively released by acidifying the ZIF. Powder X-ray diffraction, single-crystal X-ray diffraction, FTIR spectroscopy, scanning electron microscopy, elemental analysis, and thermogravimetric analysis were used to characterize the ZIF structure. ZIF-CO3-1 (chemical formula C9H10N4O3Zn2), crystallizes in the orthorhombic crystal system with noncentrosymmetric space group Pba2.

  18. Crystallization and preliminary X-ray diffraction analysis of the small laccase from Streptomyces coelicolor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Skálová, Tereza, E-mail: skalova@imc.cas.cz; Dohnálek, Jan; Institute of Physics, Academy of Sciences of the Czech Republic, Cukrovarnicka 10, 162 53 Praha 6

    2007-12-01

    The expression, purification and crystallization of the small laccase from S. coelicolor are reported. Diffraction data were collected to 3 Å resolution. The small bacterial laccase from the actinobacterium Streptomyces coelicolor which lacks the second of the three domains of the laccases structurally characterized to date was crystallized. This multi-copper phenol oxidase crystallizes in a primitive tetragonal lattice, with unit-cell parameters a = b = 179.8, c = 175.3 Å. The crystals belong to either space group P4{sub 1}2{sub 1}2 or P4{sub 3}2{sub 1}2. The self-rotation function shows the presence of a noncrystallographic threefold axis in the structure. Phases willmore » be determined from the anomalous signal of the natively present copper ions.« less

  19. Crystallization and X-ray diffraction analysis of a novel immune-type receptor from Ictalurus punctatus and phasing by selenium anomalous dispersion methods

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ostrov, David A., E-mail: ostroda@pathology.ufl.edu; Hernández Prada, José A.; Haire, Robert N.

    2007-12-01

    A highly diversified novel immune-type receptor from catfish, NITR10, was crystallized to reveal novel mechanisms of immune recognition. X-ray diffraction data from crystals of a novel immune-type receptor (NITR10 from the catfish Ictalurus punctatus) were collected to 1.65 Å resolution and reduced to the primitive hexagonal lattice. Native and selenomethionine derivatives of NITR10 crystallized under different conditions yielded P3{sub 1}21 crystals. SeMet NITR10 was phased to a correlation coefficient of 0.77 by SAD methods and experimental electron-density maps were calculated to 1.65 Å. Five NITR10 molecules are predicted to be present in the asymmetric unit based on the Matthews coefficient.

  20. Crystallization and preliminary X-ray diffraction analysis of Leishmania major dihydroorotate dehydrogenase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cordeiro, Artur T.; Feliciano, Patricia R.; Nonato, M. Cristina, E-mail: cristy@fcfrp.usp.br

    2006-10-01

    Dihydroorotate dehydrogenase from L. major has been crystallized by the vapour-diffusion technique using lithium sulfate as the precipitant agent. A complete data set from a native crystal has been collected to 2.0 Å resolution using an in-house rotating-anode generator. Dihydroorotate dehydrogenases (DHODHs) are flavin-containing enzymes that catalyze the oxidation of l-dihydroorotate to orotate, the fourth step in the de novo pyrimidine nucleotide synthesis pathway. In this study, DHODH from Leishmania major has been crystallized by the vapour-diffusion technique using lithium sulfate as the precipitating agent. The crystals belong to space group P6{sub 1}, with unit-cell parameters a = 143.7, cmore » = 69.8 Å. X-ray diffraction data were collected to 2.0 Å resolution using an in-house rotating-anode generator. Analysis of the solvent content and the self-rotation function indicate the presence of two molecules in the asymmetric unit. The structure has been solved by the molecular-replacement technique.« less

  1. Synthesis, structural, spectroscopic and optical studies of charge transfer complex salts.

    PubMed

    Manikandan, Maruthappan; Mahalingam, Thaiyan; Hayakawa, Yasuhiro; Ravi, Ganesan

    2013-01-15

    New charge transfer molecular complex adducts of picric acid (C6H3N3O7) with triethylamine (C6H15N) and dimethylformamide (HCON(CH3)2) were synthesized successfully for the first time. Chemical composition and stoichiometry of the synthesized complex salts were verified by CHN elemental analysis. Solubility of the complex salts have been determined by gravimetric method and single crystals of two new salts were grown by low temperature solution growth technique. Crystal system, crystalline nature and cell parameters of the grown crystals were determined by single crystal X-ray diffraction (SXRD) and powder X-ray diffraction (PXRD) analyses. The formations of the charge-transfer complex, functional groups and the modes of vibrations have been confirmed by Fourier transform infrared (FTIR) spectroscopy. In order to know the linear and nonlinear optical suitability for device fabrication, UV-Vis (UV) spectral analysis and relative second harmonic generation (SHG) efficiency test were performed for the grown crystals. Copyright © 2012 Elsevier B.V. All rights reserved.

  2. Synthesis, structural, spectroscopic and optical studies of charge transfer complex salts

    NASA Astrophysics Data System (ADS)

    Manikandan, Maruthappan; Mahalingam, Thaiyan; Hayakawa, Yasuhiro; Ravi, Ganesan

    2013-01-01

    New charge transfer molecular complex adducts of picric acid (C6H3N3O7) with triethylamine (C6H15N) and dimethylformamide (HCON(CH3)2) were synthesized successfully for the first time. Chemical composition and stoichiometry of the synthesized complex salts were verified by CHN elemental analysis. Solubility of the complex salts have been determined by gravimetric method and single crystals of two new salts were grown by low temperature solution growth technique. Crystal system, crystalline nature and cell parameters of the grown crystals were determined by single crystal X-ray diffraction (SXRD) and powder X-ray diffraction (PXRD) analyses. The formations of the charge-transfer complex, functional groups and the modes of vibrations have been confirmed by Fourier transform infrared (FTIR) spectroscopy. In order to know the linear and nonlinear optical suitability for device fabrication, UV-Vis (UV) spectral analysis and relative second harmonic generation (SHG) efficiency test were performed for the grown crystals.

  3. Crystallization, X-ray diffraction analysis and SIRAS/molecular-replacenent phasing of three crystal forms of Anabaena sensory rhodopsin transducer

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vogeley, Lutz; Luecke, Hartmut, E-mail: hudel@uci.edu

    2006-04-01

    Crystals of Anabaena sensory rhodopsin transducer, the transducer for the cyanobacterial photosensor Anabaena sensory rhodopsin, obtained in the space groups P4, C2 and P2{sub 1}2{sub 1}2{sub 1} diffract to 1.8, 2.1 and 2.0 Å, respectively. Phases for these crystal forms were obtained by SIRAS phasing using an iodide quick-soak derivative (P4) and molecular replacement (C2 and P2{sub 1}2{sub 1}2{sub 1}). Anabaena sensory rhodopsin transducer (ASRT) is a 14.7 kDa soluble signaling protein associated with the membrane-embedded light receptor Anabaena sensory rhodopsin (ASR) from Anabaena sp., a freshwater cyanobacterium. Crystals of ASRT were obtained in three different space groups, P4, C2more » and P2{sub 1}2{sub 1}2{sub 1}, which diffract to 1.8, 2.1 and 2.0 Å, respectively. Phases for one of these crystal forms (P4) were obtained by SIRAS phasing using an iodide quick-soak derivative and a partial model was built. Phases for the remaining crystal forms were obtained by molecular replacement using the partial model from the P4 crystal form.« less

  4. Studies on synthesis, growth, structural, thermal, linear and nonlinear optical properties of organic picolinium maleate single crystals.

    PubMed

    Pandi, P; Peramaiyan, G; Sudhahar, S; Chakkaravarthi, G; Mohan Kumar, R; Bhagavannarayana, G; Jayavel, R

    2012-12-01

    Picolinium maleate (PM), an organic material has been synthesised and single crystals were grown by slow evaporation technique. The structure of the grown crystal was elucidated by using single crystal X-ray diffraction analysis. PM crystal belongs to the monoclinic crystallographic system with space group P2(1)/c. The crystalline perfection of the grown crystals was analyzed by high-resolution X-ray diffraction rocking curve measurements. The presence of functional groups in PM was identified by FTIR and FT-NMR spectral analyses. Thermal behaviour and stability of picolinium maleate were studied by TGA/DTA analyses. UV-Vis spectral studies reveal that PM crystals are transparent in the wavelength region 327-1100 nm. The laser damage threshold value of PM crystal was found to be 4.3 GW/cm(2) using Nd:YAG laser. The Kurtz and Perry powder second harmonic generation technique confirms the nonlinear optical property of the grown crystal. Copyright © 2012 Elsevier B.V. All rights reserved.

  5. Crystallization and preliminary X-ray crystallographic analysis of the heterodimeric crotoxin complex and the isolated subunits crotapotin and phospholipase A{sub 2}

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Santos, K. F.; Murakami, M. T.; Cintra, A. C. O.

    2007-04-01

    Crotoxin, a potent neurotoxin from the venom of the South American rattlesnake Crotalus durissus terrificus, exists as a heterodimer formed between a phospholipase A{sub 2} and a catalytically inactive acidic phospholipase A{sub 2} analogue (crotapotin). Large single crystals of the crotoxin complex and of the isolated subunits have been obtained. Crotoxin, a potent neurotoxin from the venom of the South American rattlesnake Crotalus durissus terrificus, exists as a heterodimer formed between a phospholipase A{sub 2} and a catalytically inactive acidic phospholipase A{sub 2} analogue (crotapotin). Large single crystals of the crotoxin complex and of the isolated subunits have been obtained.more » The crotoxin complex crystal belongs to the orthorhombic space group P2{sub 1}2{sub 1}2, with unit-cell parameters a = 38.2, b = 68.7, c = 84.2 Å, and diffracted to 1.75 Å resolution. The crystal of the phospholipase A{sub 2} domain belongs to the hexagonal space group P6{sub 1}22 (or its enantiomorph P6{sub 5}22), with unit-cell parameters a = b = 38.7, c = 286.7 Å, and diffracted to 2.6 Å resolution. The crotapotin crystal diffracted to 2.3 Å resolution; however, the highly diffuse diffraction pattern did not permit unambiguous assignment of the unit-cell parameters.« less

  6. Crystallographic site swapping of La3+ ion in BaA'LaTeO6 (A' = Na, K, Rb) double perovskite type compounds: diffraction and photoluminescence evidence for the site swapping.

    PubMed

    Phatak, R; Gupta, S K; Krishnan, K; Sali, S K; Godbole, S V; Das, A

    2014-02-28

    Double perovskite type compounds of the formula BaA'LaTeO6 (A' = Na, K, Rb) were synthesized by solid state route and their crystal structures were determined by Rietveld analysis using powder X-ray diffraction and neutron diffraction data. Na compound crystallizes in the monoclinic system with P2₁/n space group whereas, K and Rb compounds crystallize in Fm3m space group. All the three compounds show rock salt type ordering at B site. Crystal structure analysis shows that La ion occupies A site in Na compound whereas, it occupies B site in K and Rb compounds according to the general formula of AA'BB'O6 for a double perovskite type compound. Effect of this crystallographic site swapping of the La ion was also observed in the photoluminescence study by doping Eu(3+) in La(3+) site. The large decrease in the intensity of the electric dipole ((5)D0-(7)F2) transition in the Rb compound compared to the Na compound indicates that Eu(3+) ion resides in the centrosymmetric octahedral environment in the Rb compound.

  7. Growth, optical, thermal, mechanical and dielectric studies of sodium succinate hexahydrate (β phase) single crystal: A promising third order NLO material

    NASA Astrophysics Data System (ADS)

    Mageshwari, P. S. Latha; Priya, R.; Krishnan, S.; Joseph, V.; Das, S. Jerome

    2016-11-01

    A third order nonlinear optical (NLO)single crystals of sodium succinate hexahydrate (SSH) (β phase) has been grown by a slow evaporation growth technique using aqueous solution at ambient temperature. The lattice parameters and morphology of SSH were determined by single crystal X-ray diffraction analysis. SSH crystallizes in centrosymmetric monoclinic system with space group P 21 / c and the crystalline purity was analyzed by powder X-ray diffraction analysis. The UV-vis-NIR spectrum reveals that the crystal is transparent in the entire visible region. The recorded FT-IR spectrum verified the presence of various functional groups in the material. NMR analysis of the grown crystal confirms the structural elucidation and detects the major and minor functional groups present in the title compound. ICP-OES analysis proved the presence of sodium in SSH. TG-DTA/DSCanalysis was used to investigate the thermal stability of the material. The dielectric permittivity and dielectric loss of SSH were carried out as a function of frequency for different temperatures and the results were discussed. The mechanical stability was evaluated from Vicker's microhardness test. The third order nonlinear optical properties of SSH has been investigated employing Z-scan technique with He-Ne laser operating at 632.8 nm wavelength.

  8. Investigation on bandgap, diffraction, interference, and refraction effects of photonic crystal structure in GaN/InGaN LEDs for light extraction.

    PubMed

    Patra, Saroj Kanta; Adhikari, Sonachand; Pal, Suchandan

    2014-06-20

    In this paper, we have made a clear differentiation among bandgap, diffraction, interference, and refraction effects in photonic crystal structures (PhCs). For observing bandgap, diffraction, and refraction effects, PhCs are considered on the top p-GaN surface of light emitting diodes (LEDs), whereas for interference effect, hole type PhCs are considered to be embedded within n-GaN layer of LED. From analysis, it is observed that at a particular lattice periodicity, for which bandgap lies within the wavelength of interest shows a significant light extraction due to inhibition of guided mode. Beyond a certain periodicity, diffraction effect starts dominating and light extraction improves further. The interference effect is observed in embedded photonic crystal LEDs, where depth of etching supports constructive interference of outward light waves. We have also shed light on refraction effects exhibited by the PhCs and whether negative refraction properties of PhCs may be useful in case of LED light extraction.

  9. Diffraction Correlation to Reconstruct Highly Strained Particles

    NASA Astrophysics Data System (ADS)

    Brown, Douglas; Harder, Ross; Clark, Jesse; Kim, J. W.; Kiefer, Boris; Fullerton, Eric; Shpyrko, Oleg; Fohtung, Edwin

    2015-03-01

    Through the use of coherent x-ray diffraction a three-dimensional diffraction pattern of a highly strained nano-crystal can be recorded in reciprocal space by a detector. Only the intensities are recorded, resulting in a loss of the complex phase. The recorded diffraction pattern therefore requires computational processing to reconstruct the density and complex distribution of the diffracted nano-crystal. For highly strained crystals, standard methods using HIO and ER algorithms are no longer sufficient to reconstruct the diffraction pattern. Our solution is to correlate the symmetry in reciprocal space to generate an a priori shape constraint to guide the computational reconstruction of the diffraction pattern. This approach has improved the ability to accurately reconstruct highly strained nano-crystals.

  10. Microgravity

    NASA Image and Video Library

    2000-04-20

    Edward Snell, a National Research Council research fellow at NASA's Marshall Space Flight Center (MSFC), prepares a protein crystal for analysis by x-ray crystallography as part of NASA's structural biology program. The small, individual crystals are bombarded with x-rays to produce diffraction patterns, a map of the intensity of the x-rays as they reflect through the crystal.

  11. Synthesis, growth, structural characterization, Hirshfeld analysis and nonlinear optical studies of a methyl substituted chalcone

    NASA Astrophysics Data System (ADS)

    Prabhu, Shobha R.; Jayarama, A.; Chandrasekharan, K.; Upadhyaya, V.; Ng, Seik Weng

    2017-05-01

    A new chalcone compound (2E)-3-(3-methylphenyl)-1-(4-nitrophenyl)prop-2-en-1-one (3MPNP) with molecular formula C16H13NO3 has been synthesized and crystallized by slow solvent evaporation technique. The Fourier transform infrared, Fourier transform Raman and nuclear magnetic resonance techniques were used for structural characterization. UV-visible absorption studies were carried out to study the transparency of the crystal in the visible region. Differential scanning calorimetry study shows thermal stability of crystals up to temperature 122 °C. Single crystal X-ray diffraction and powder X-ray diffraction techniques were used to study crystal structure and cell parameters. The Hirshfeld surface and 2-D fingerprint analysis were performed to study the nature of interactions and their quantitative contributions towards the crystal packing. The third order non-linear optical properties have been studied using single beam Z-scan technique and the results show that the material is a potential candidate for optical device applications such as optical limiters and optical switches.

  12. Crystal structure, Raman scattering and magnetic properties of CuCr2-xZrxSe4 and CuCr2-xSnxSe4 selenospinels

    NASA Astrophysics Data System (ADS)

    Pinto, C.; Galdámez, A.; Barahona, P.; Moris, S.; Peña, O.

    2018-06-01

    Selenospinels, CuCr2-xMxSe4 (M = Zr and Sn), were synthesized via conventional solid-state reactions. The crystal structure of CuCr1.5Sn0.5Se4, CuCr1.7Sn0.3Se4, CuCr1.5Zr0.5Se4, and CuCr1.8Zr0.2Se4 were determined using single-crystal X-ray diffraction. All the phases crystallized in a cubic spinel-type structure. The chemical compositions of the single-crystals were examined using energy-dispersive X-ray analysis (EDS). Powder X-ray diffraction patterns of CuCr1.3Sn0.7Se4 and CuCr1.7Sn0.3Se4 were consistent with phases belonging to the Fd 3 bar m Space group. An analysis of the vibrational properties on the single-crystals was performed using Raman scattering measurements. The magnetic properties showed a spin glass behavior with increasing Sn content and ferromagnetic order for CuCr1.7Sn0.3Se4.

  13. Crystallization of a pentapeptide-repeat protein by reductive cyclic pentylation of free amines with glutaraldehyde

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vetting, Matthew W., E-mail: vetting@aecom.yu.edu; Hegde, Subray S.; Blanchard, John S.

    2009-05-01

    A method to modify proteins with glutaraldehyde under reducing conditions is presented. Treatment with glutaraldehyde and dimethylaminoborane was found to result in cyclic pentylation of free amines and facilitated the structural determination of a protein previously recalcitrant to the formation of diffraction quality crystals. The pentapeptide-repeat protein EfsQnr from Enterococcus faecalis protects DNA gyrase from inhibition by fluoroquinolones. EfsQnr was cloned and purified to homogeneity, but failed to produce diffraction-quality crystals in initial crystallization screens. Treatment of EfsQnr with glutaraldehyde and the strong reducing agent borane–dimethylamine resulted in a derivatized protein which produced crystals that diffracted to 1.6 Å resolution;more » their structure was subsequently determined by single-wavelength anomalous dispersion. Analysis of the derivatized protein using Fourier transform ion cyclotron resonance mass spectrometry indicated a mass increase of 68 Da per free amino group. Electron-density maps about a limited number of structurally ordered lysines indicated that the modification was a cyclic pentylation of free amines, producing piperidine groups.« less

  14. Resolution extension by image summing in serial femtosecond crystallography of two-dimensional membrane-protein crystals

    DOE PAGES

    Casadei, Cecilia M.; Tsai, Ching-Ju; Barty, Anton; ...

    2018-01-01

    Previous proof-of-concept measurements on single-layer two-dimensional membrane-protein crystals performed at X-ray free-electron lasers (FELs) have demonstrated that the collection of meaningful diffraction patterns, which is not possible at synchrotrons because of radiation-damage issues, is feasible. Here, the results obtained from the analysis of a thousand single-shot, room-temperature X-ray FEL diffraction images from two-dimensional crystals of a bacteriorhodopsin mutant are reported in detail. The high redundancy in the measurements boosts the intensity signal-to-noise ratio, so that the values of the diffracted intensities can be reliably determined down to the detector-edge resolution of 4 Å. The results show that two-dimensional serial crystallography atmore » X-ray FELs is a suitable method to study membrane proteins to near-atomic length scales at ambient temperature. The method presented here can be extended to pump–probe studies of optically triggered structural changes on submillisecond timescales in two-dimensional crystals, which allow functionally relevant large-scale motions that may be quenched in three-dimensional crystals.« less

  15. Resolution extension by image summing in serial femtosecond crystallography of two-dimensional membrane-protein crystals

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Casadei, Cecilia M.; Tsai, Ching-Ju; Barty, Anton

    Previous proof-of-concept measurements on single-layer two-dimensional membrane-protein crystals performed at X-ray free-electron lasers (FELs) have demonstrated that the collection of meaningful diffraction patterns, which is not possible at synchrotrons because of radiation-damage issues, is feasible. Here, the results obtained from the analysis of a thousand single-shot, room-temperature X-ray FEL diffraction images from two-dimensional crystals of a bacteriorhodopsin mutant are reported in detail. The high redundancy in the measurements boosts the intensity signal-to-noise ratio, so that the values of the diffracted intensities can be reliably determined down to the detector-edge resolution of 4 Å. The results show that two-dimensional serial crystallography atmore » X-ray FELs is a suitable method to study membrane proteins to near-atomic length scales at ambient temperature. The method presented here can be extended to pump–probe studies of optically triggered structural changes on submillisecond timescales in two-dimensional crystals, which allow functionally relevant large-scale motions that may be quenched in three-dimensional crystals.« less

  16. Purification, crystallization and preliminary X-ray analysis of the IgV domain of human nectin-4.

    PubMed

    Xu, Xiang; Zhang, Xiaoai; Lu, Guangwen; Cai, Yongping

    2012-08-01

    Nectin-4 belongs to a family of immunoglobulin-like cell adhesion molecules and is highly expressed in cancer cells. Recently, nectin-4 was found to be a receptor of measles virus and the IgV domain sustains strong binding to measles virus H protein. In this study, the successful expression and purification of human nectin-4 V domain (nectin-4v) is reported. The purified protein was crystallized using the sitting-drop vapour-diffusion method. The crystals diffracted to 1.8 Å resolution and belonged to space group P2(1), with unit-cell parameters a = 33.1, b = 51.7, c = 56.9 Å, β = 94.7°. Preliminary analysis of the diffraction data was also performed.

  17. Purification, crystallization and preliminary X-ray analysis of the IgV domain of human nectin-4

    PubMed Central

    Xu, Xiang; Zhang, Xiaoai; Lu, Guangwen; Cai, Yongping

    2012-01-01

    Nectin-4 belongs to a family of immunoglobulin-like cell adhesion molecules and is highly expressed in cancer cells. Recently, nectin-4 was found to be a receptor of measles virus and the IgV domain sustains strong binding to measles virus H protein. In this study, the successful expression and purification of human nectin-4 V domain (nectin-4v) is reported. The purified protein was crystallized using the sitting-drop vapour-diffusion method. The crystals diffracted to 1.8 Å resolution and belonged to space group P21, with unit-cell parameters a = 33.1, b = 51.7, c = 56.9 Å, β = 94.7°. Preliminary analysis of the diffraction data was also performed. PMID:22869128

  18. Purification, crystallization and preliminary X-ray diffraction analysis of GatD, a glutamine amidotransferase-like protein from Staphylococcus aureus peptidoglycan

    PubMed Central

    Vieira, Diana; Figueiredo, Teresa A.; Verma, Anil; Sobral, Rita G.; Ludovice, Ana M.; de Lencastre, Hermínia; Trincao, Jose

    2014-01-01

    Amidation of peptidoglycan is an essential feature in Staphylococcus aureus that is necessary for resistance to β-lactams and lysozyme. GatD, a 27 kDa type I glutamine amidotransferase-like protein, together with MurT ligase, catalyses the amidation reaction of the glutamic acid residues of the peptidoglycan of S. aureus. The native and the selenomethionine-derivative proteins were crystallized using the sitting-drop vapour-diffusion method with polyethylene glycol, sodium acetate and calcium acetate. The crystals obtained diffracted beyond 1.85 and 2.25 Å, respectively, and belonged to space group P212121. X-ray diffraction data sets were collected at Diamond Light Source (on beamlines I02 and I04) and were used to obtain initial phases. PMID:24817726

  19. Preliminary neutron diffraction analysis of challenging human manganese superoxide dismutase crystals

    DOE PAGES

    Azadmanesh, Jahaun; Trickel, Scott R.; Weiss, Kevin L.; ...

    2017-03-29

    Superoxide dismutases (SODs) are enzymes that protect against oxidative stress by dismutation of superoxide into oxygen and hydrogen peroxide through cyclic reduction and oxidation of the active-site metal. The complete enzymatic mechanisms of SODs are unknown since data on the positions of hydrogen are limited. Here, we present, methods for large crystal growth and neutron data collection of human manganese SOD (MnSOD) using perdeuteration and the MaNDi beamline at Oak Ridge National Laboratory. Furthermore, The crystal from which the human MnSOD data set was obtained is the crystal with the largest unit-cell edge (240 Å) from which data have beenmore » collectedvianeutron diffraction to sufficient resolution (2.30 Å) where hydrogen positions can be observed.« less

  20. Preliminary neutron diffraction analysis of challenging human manganese superoxide dismutase crystals

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Azadmanesh, Jahaun; Trickel, Scott R.; Weiss, Kevin L.

    Superoxide dismutases (SODs) are enzymes that protect against oxidative stress by dismutation of superoxide into oxygen and hydrogen peroxide through cyclic reduction and oxidation of the active-site metal. The complete enzymatic mechanisms of SODs are unknown since data on the positions of hydrogen are limited. Here, we present, methods for large crystal growth and neutron data collection of human manganese SOD (MnSOD) using perdeuteration and the MaNDi beamline at Oak Ridge National Laboratory. Furthermore, The crystal from which the human MnSOD data set was obtained is the crystal with the largest unit-cell edge (240 Å) from which data have beenmore » collectedvianeutron diffraction to sufficient resolution (2.30 Å) where hydrogen positions can be observed.« less

  1. Crystallization and preliminary X-ray diffraction analysis of FabG from Yersinia pestis.

    PubMed

    Nanson, Jeffrey David; Forwood, Jade Kenneth

    2014-01-01

    The type II fatty-acid biosynthesis pathway of bacteria provides enormous potential for antibacterial drug development owing to the structural differences between this and the type I fatty-acid biosynthesis system found in mammals. β-Ketoacyl-ACP reductase (FabG) is responsible for the reduction of the β-ketoacyl group linked to acyl carrier protein (ACP), and is essential for the formation of fatty acids and bacterial survival. Here, the cloning, expression, purification, crystallization and diffraction of FabG from Yersinia pestis (ypFabG), the highly virulent causative agent of plague, are reported. Recombinant FabG was expressed, purified to homogeneity and crystallized via the hanging-drop vapour-diffusion technique. Diffraction data were collected at the Australian Synchrotron to 2.30 Å resolution. The crystal displayed P2(1)2(1)2(1) symmetry, with unit-cell parameters a = 68.22, b = 98.68, c = 169.84 Å, and four ypFabG molecules in the asymmetric unit.

  2. Grazing-incidence X-ray diffraction from a crystal with subsurface defects

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gaevskii, A. Yu., E-mail: transilv@mail.ru; Golentus, I. E.

    2015-03-15

    The diffraction of X rays incident on a crystal surface under grazing angles under conditions of total external reflection has been investigated. An approach is proposed in which exact solutions to the dynamic problem of grazing-incidence diffraction in an ideal crystal are used as initial functions to calculate the diffuse component of diffraction in a crystal with defects. The diffuse component of diffraction is calculated for a crystal with surface defects of a dilatation-center type. Exact formulas of the continuum theory which take into account the mirror-image forces are used for defect-induced atomic displacements. Scattering intensity maps near Bragg peaksmore » are constructed for different scan modes, and the conditions for detecting primarily the diffuse component are determined. The results of dynamic calculations of grazing-incidence diffraction in defect-containing crystals are compared with calculations in the kinematic approximation.« less

  3. Optical-diffraction method for determining crystal orientation

    DOEpatents

    Sopori, B.L.

    1982-05-07

    Disclosed is an optical diffraction technique for characterizing the three-dimensional orientation of a crystal sample. An arbitrary surface of the crystal sample is texture etched so as to generate a pseudo-periodic diffraction grating on the surface. A laser light beam is then directed onto the etched surface, and the reflected light forms a farfield diffraction pattern in reflection. Parameters of the diffraction pattern, such as the geometry and angular dispersion of the diffracted beam are then related to grating shape of the etched surface which is in turn related to crystal orientation. This technique may be used for examining polycrystalline silicon for use in solar cells.

  4. Hydrothermal syntheses, crystal structures, and photophysical properties of two coordination polymers with mixed ligands

    NASA Astrophysics Data System (ADS)

    Yan, Li; Liu, Chun-Ling

    2017-10-01

    Two novel metal-organic coordination polymers [Cd(ipdt)(m-BDC)·3H2O]n (1) and [Pb(mip)2(NTC) ·2H2O]n (2) [ipdt = 2,6-Dimethoxy-4-(1H-1,3,7,8-tetraaza-cyclopenta[l]phenanthren-2-yl)-phenol, mip = 2-(3-methoxyphenyl)-1H-imidazo[4,5-f][1,10]phenanthroline, m-BDC = isophthalic acid, NTC = nicotinic acid] have been synthesized by hydrothermal reactions and characterized by elemental analysis, thermogravimetric (TG) analysis, infrared spectrum (IR) and single-crystal X-ray diffraction. Single-crystal X-ray diffraction reveals that 1 exhibits two-dimensional (2D) layer architecture, and 2 shows 1D chain architecture. TG analysis shows clear courses of weight loss, which corresponds to the decomposition of different ligands. The luminescent properties for the ligand ipdt, mip and complexes 1-2 are also discussed in detail, which should be acted as potential luminescent material.

  5. Crystal growth and characterization of the CMR compound La 1.2(Sr,Ca) 1.8Mn 2O 7

    NASA Astrophysics Data System (ADS)

    Velázquez, M.; Haut, C.; Hennion, B.; Revcolevschi, A.

    2000-12-01

    High-quality centimeter-sized single crystals of La 1.2Sr 1.8- yCa yMn 2O 7 (0.0⩽ y⩽0.2) were successfully grown using a floating zone method associated with an image furnace. We present the growth conditions together with a characterization of the single crystals by means of optical and electron microscopy, EDX and ICP⧸AES analysis, DTA-TGA measurements and redox titration, X-ray powder diffraction, Laue X-ray back-reflection and neutron diffraction. We also stress the main aspects of the complex thermodynamical and kinetic behaviors of these compounds.

  6. Purification, crystallization and preliminary crystallographic analysis of biotin protein ligase from Staphylococcus aureus

    PubMed Central

    Pendini, Nicole R.; Polyak, Steve W.; Booker, Grant W.; Wallace, John C.; Wilce, Matthew C. J.

    2008-01-01

    Biotin protein ligase from Staphylococcus aureus catalyses the biotinylation of acetyl-CoA carboxylase and pyruvate carboxylase. Recombinant biotin protein ligase from S. aureus has been cloned, expressed and purified. Crystals were grown using the hanging-drop vapour-diffusion method using PEG 8000 as the precipitant at 295 K. X-ray diffraction data were collected to 2.3 Å resolution from crystals using synchrotron X-ray radiation at 100 K. The diffraction was consistent with the tetragonal space group P42212, with unit-cell parameters a = b = 93.665, c = 131.95. PMID:18540065

  7. Crystallographic analysis of ground and space thermostable T1 lipase crystal obtained via counter diffusion method approach.

    PubMed

    Mohamad Aris, Sayangku Nor Ariati; Thean Chor, Adam Leow; Mohamad Ali, Mohd Shukuri; Basri, Mahiran; Salleh, Abu Bakar; Raja Abd Rahman, Raja Noor Zaliha

    2014-01-01

    Three-dimensional structure of thermostable lipase is much sought after nowadays as it is important for industrial application mainly found in the food, detergent, and pharmaceutical sectors. Crystallization utilizing the counter diffusion method in space was performed with the aim to obtain high resolution diffracting crystals with better internal order to improve the accuracy of the structure. Thermostable T1 lipase enzyme has been crystallized in laboratory on earth and also under microgravity condition aboard Progress spacecraft to the ISS in collaboration with JAXA (Japanese Aerospace Exploration Agency). This study is conducted with the aims of improving crystal packing and structure resolution. The diffraction data set for ground grown crystal was collected to 1.3 Å resolution and belonged to monoclinic C2 space group with unit cell parameters a = 117.40 Å, b = 80.95 Å, and c = 99.81 Å, whereas the diffraction data set for space grown crystal was collected to 1.1 Å resolution and belonged to monoclinic C2 space group with unit cell parameters a = 117.31 Å, b = 80.85 Å, and c = 99.81 Å. The major difference between the two crystal growth systems is the lack of convection and sedimentation in microgravity environment resulted in the growth of much higher quality crystals of T1 lipase.

  8. Crystallization and preliminary crystallographic analysis of maganese(II)-dependent 2,3-dihydroxybiphenyl 1,2-dioxygenase from Bacillus sp. JF8

    PubMed Central

    Senda, Miki; Hatta, Takashi; Kimbara, Kazuhide; Senda, Toshiya

    2010-01-01

    A thermostable manganese(II)-dependent 2,3-dihydroxybiphenyl-1,2-dioxygenase derived from Bacillus sp. JF8 was crystallized. The initial screening for crystallization was performed by the sitting-drop vapour-diffusion method using a crystallization robot, resulting in the growth of two crystal forms. The first crystal belonged to space group P1, with unit-cell parameters a = 62.7, b = 71.4, c = 93.6 Å, α = 71.2, β = 81.0, γ = 64.0°, and diffracted to 1.3 Å resolution. The second crystal belonged to space group I222, with unit-cell parameters a = 74.2, b = 90.8, c = 104.3 Å, and diffracted to 1.3 Å resolution. Molecular-replacement trials using homoprotocatechuate 2,3-dioxygenase from Arthrobacter globiformis (28% amino-acid sequence identity) as a search model provided a satisfactory solution for both crystal forms. PMID:20208161

  9. Analysis of submicron-sized niflumic acid crystals prepared by electrospray crystallization.

    PubMed

    Ambrus, Rita; Radacsi, Norbert; Szunyogh, Tímea; van der Heijden, Antoine E D M; Ter Horst, Joop H; Szabó-Révész, Piroska

    2013-03-25

    Interest in submicron-sized drug particles has emerged from both laboratory and industrial perspectives in the last decade. Production of crystals in the nano size scale offers a novel way to particles for drug formulation solving formulation problems of drugs with low solubility in class II of the Biopharmaceutical Classification System. In this work niflumic acid nanoparticles with a size range of 200-800nm were produced by the novel crystallization method, electrospray crystallization. Their properties were compared to those from evaporative and anti-solvent crystallizations, using the same organic solvent, acetone. There is a remarkable difference in the product crystal size depending on the applied methods. The size and morphology were analyzed by scanning electron microscopy and laser diffraction. The structure of the samples was investigated using differential scanning calorimetry, Fourier-transformed infrared spectroscopy and X-ray powder diffraction. The particles produced using electrospray crystallization process were probably changing from amorphous to crystalline state after the procedure. Copyright © 2012 Elsevier B.V. All rights reserved.

  10. Study of structural and optical properties of YAG and Nd:YAG single crystals

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kostić, S.; Lazarević, Z.Ž., E-mail: lzorica@yahoo.com; Radojević, V.

    2015-03-15

    Highlights: • Transparent YAG and pale pink Nd:YAG single crystals were produced by the Czochralski technique. • Growth mechanisms and shape of the liquid/solid interface and incorporation of Nd{sup 3+} were studied. • The structure of the crystals was investigated by X-ray diffraction, Raman and IR spectroscopy. • The 15 Raman and 17 IR modes were observed. • The obtained YAG and Nd:YAG single crystals were without core and of good optical quality. - Abstract: Yttrium aluminum garnet (YAG, Y{sub 3}Al{sub 5}O{sub 12}) and yttrium aluminum garnet doped with neodymium (Nd:YAG) single crystals were grown by the Czochralski technique. Themore » critical diameter and the critical rate of rotation were calculated. Suitable polishing and etching solutions were determined. As a result of our experiments, the transparent YAG and pale pink Nd:YAG single crystals were produced. The obtained crystals were studied by X-ray diffraction, Raman and IR spectroscopy. The crystal structure was confirmed by XRD. The 15 Raman and 17 IR modes were observed. The Raman and IR spectroscopy results are in accordance with X-ray diffraction analysis. The obtained YAG and Nd:YAG single crystals were without core and of good optical quality. The absence of a core was confirmed by viewing polished crystal slices. Also, it is important to emphasize that the obtained Nd:YAG single crystal has a concentration of 0.8 wt.% Nd{sup 3+} that is characteristic for laser materials.« less

  11. Growth and characterizaion of urea p-nitrophenol crystal: an organic nonlinear optical material for optoelectronic device application

    NASA Astrophysics Data System (ADS)

    Suresh, A.; Manikandan, N.; Jauhar, RO. MU.; Murugakoothan, P.; Vinitha, G.

    2018-06-01

    Urea p-nitrophenol, an organic nonlinear optical crystal was synthesized and grown adopting slow evaporation and seed rotation method. Single crystal X-ray diffraction study confirmed the formation of the desired crystal. High resolution X-ray diffraction study showed the defect nature of the crystal. The presence of functional groups in the material was confirmed by FTIR analysis. UV-Vis-NIR study indicates that the grown crystal has a wider transparency region with the lower cutoff wavelength at 423 nm. The grown crystal is thermally stable up to 120 °C as assessed by TG-DTA analysis. The optical homogeneity of the grown crystal was confirmed by birefringence study. The 1064 nm Nd-YAG laser was used to obtain laser induced surface damage threshold which was found to be 0.38, 0.25 and 0.33 GW/cm2 for (0 1 0), (1 1 - 1) and (0 1 1) planes, respectively. The dielectric study was performed to find the charge distribution inside the crystal. The hardness property of the titular material has been found using Vicker's microhardness study. The optical nonlinearity obtained from third order nonlinear optical measurements carried out using Z-scan technique showed that these samples could be exploited for optical limiting studies.

  12. Optical devices combining an organic semiconductor crystal with a two-dimensional inorganic diffraction grating

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kitazawa, Takenori; Yamao, Takeshi, E-mail: yamao@kit.ac.jp; Hotta, Shu

    2016-02-01

    We have fabricated optical devices using an organic semiconductor crystal as an emission layer in combination with a two-dimensional (2D) inorganic diffraction grating used as an optical cavity. We formed the inorganic diffraction grating by wet etching of aluminum-doped zinc oxide (AZO) under a 2D cyclic olefin copolymer (COC) diffraction grating used as a mask. The COC diffraction grating was fabricated by nanoimprint lithography. The AZO diffraction grating was composed of convex prominences arranged in a triangular lattice. The organic crystal placed on the AZO diffraction grating indicated narrowed peaks in its emission spectrum under ultraviolet light excitation. These aremore » detected parallel to the crystal plane. The peaks were shifted by rotating the optical devices around the normal to the crystal plane, which reflected the rotational symmetries of the triangular lattice through 60°.« less

  13. Dynamic X-ray diffraction sampling for protein crystal positioning

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Scarborough, Nicole M.; Godaliyadda, G. M. Dilshan P.; Ye, Dong Hye

    A sparse supervised learning approach for dynamic sampling (SLADS) is described for dose reduction in diffraction-based protein crystal positioning. Crystal centering is typically a prerequisite for macromolecular diffraction at synchrotron facilities, with X-ray diffraction mapping growing in popularity as a mechanism for localization. In X-ray raster scanning, diffraction is used to identify the crystal positions based on the detection of Bragg-like peaks in the scattering patterns; however, this additional X-ray exposure may result in detectable damage to the crystal prior to data collection. Dynamic sampling, in which preceding measurements inform the next most information-rich location to probe for image reconstruction,more » significantly reduced the X-ray dose experienced by protein crystals during positioning by diffraction raster scanning. The SLADS algorithm implemented herein is designed for single-pixel measurements and can select a new location to measure. In each step of SLADS, the algorithm selects the pixel, which, when measured, maximizes the expected reduction in distortion given previous measurements. Ground-truth diffraction data were obtained for a 5 µm-diameter beam and SLADS reconstructed the image sampling 31% of the total volume and only 9% of the interior of the crystal greatly reducing the X-ray dosage on the crystal. Furthermore, by usingin situtwo-photon-excited fluorescence microscopy measurements as a surrogate for diffraction imaging with a 1 µm-diameter beam, the SLADS algorithm enabled image reconstruction from a 7% sampling of the total volume and 12% sampling of the interior of the crystal. When implemented into the beamline at Argonne National Laboratory, without ground-truth images, an acceptable reconstruction was obtained with 3% of the image sampled and approximately 5% of the crystal. The incorporation of SLADS into X-ray diffraction acquisitions has the potential to significantly minimize the impact of X-ray exposure on the crystal by limiting the dose and area exposed for image reconstruction and crystal positioning using data collection hardware present in most macromolecular crystallography end-stations.« less

  14. Dynamic X-ray diffraction sampling for protein crystal positioning

    DOE PAGES

    Scarborough, Nicole M.; Godaliyadda, G. M. Dilshan P.; Ye, Dong Hye; ...

    2017-01-01

    A sparse supervised learning approach for dynamic sampling (SLADS) is described for dose reduction in diffraction-based protein crystal positioning. Crystal centering is typically a prerequisite for macromolecular diffraction at synchrotron facilities, with X-ray diffraction mapping growing in popularity as a mechanism for localization. In X-ray raster scanning, diffraction is used to identify the crystal positions based on the detection of Bragg-like peaks in the scattering patterns; however, this additional X-ray exposure may result in detectable damage to the crystal prior to data collection. Dynamic sampling, in which preceding measurements inform the next most information-rich location to probe for image reconstruction,more » significantly reduced the X-ray dose experienced by protein crystals during positioning by diffraction raster scanning. The SLADS algorithm implemented herein is designed for single-pixel measurements and can select a new location to measure. In each step of SLADS, the algorithm selects the pixel, which, when measured, maximizes the expected reduction in distortion given previous measurements. Ground-truth diffraction data were obtained for a 5 µm-diameter beam and SLADS reconstructed the image sampling 31% of the total volume and only 9% of the interior of the crystal greatly reducing the X-ray dosage on the crystal. Furthermore, by usingin situtwo-photon-excited fluorescence microscopy measurements as a surrogate for diffraction imaging with a 1 µm-diameter beam, the SLADS algorithm enabled image reconstruction from a 7% sampling of the total volume and 12% sampling of the interior of the crystal. When implemented into the beamline at Argonne National Laboratory, without ground-truth images, an acceptable reconstruction was obtained with 3% of the image sampled and approximately 5% of the crystal. The incorporation of SLADS into X-ray diffraction acquisitions has the potential to significantly minimize the impact of X-ray exposure on the crystal by limiting the dose and area exposed for image reconstruction and crystal positioning using data collection hardware present in most macromolecular crystallography end-stations.« less

  15. Dynamic X-ray diffraction sampling for protein crystal positioning

    PubMed Central

    Scarborough, Nicole M.; Godaliyadda, G. M. Dilshan P.; Ye, Dong Hye; Kissick, David J.; Zhang, Shijie; Newman, Justin A.; Sheedlo, Michael J.; Chowdhury, Azhad U.; Fischetti, Robert F.; Das, Chittaranjan; Buzzard, Gregery T.; Bouman, Charles A.; Simpson, Garth J.

    2017-01-01

    A sparse supervised learning approach for dynamic sampling (SLADS) is described for dose reduction in diffraction-based protein crystal positioning. Crystal centering is typically a prerequisite for macromolecular diffraction at synchrotron facilities, with X-ray diffraction mapping growing in popularity as a mechanism for localization. In X-ray raster scanning, diffraction is used to identify the crystal positions based on the detection of Bragg-like peaks in the scattering patterns; however, this additional X-ray exposure may result in detectable damage to the crystal prior to data collection. Dynamic sampling, in which preceding measurements inform the next most information-rich location to probe for image reconstruction, significantly reduced the X-ray dose experienced by protein crystals during positioning by diffraction raster scanning. The SLADS algorithm implemented herein is designed for single-pixel measurements and can select a new location to measure. In each step of SLADS, the algorithm selects the pixel, which, when measured, maximizes the expected reduction in distortion given previous measurements. Ground-truth diffraction data were obtained for a 5 µm-diameter beam and SLADS reconstructed the image sampling 31% of the total volume and only 9% of the interior of the crystal greatly reducing the X-ray dosage on the crystal. Using in situ two-photon-excited fluorescence microscopy measurements as a surrogate for diffraction imaging with a 1 µm-diameter beam, the SLADS algorithm enabled image reconstruction from a 7% sampling of the total volume and 12% sampling of the interior of the crystal. When implemented into the beamline at Argonne National Laboratory, without ground-truth images, an acceptable reconstruction was obtained with 3% of the image sampled and approximately 5% of the crystal. The incorporation of SLADS into X-ray diffraction acquisitions has the potential to significantly minimize the impact of X-ray exposure on the crystal by limiting the dose and area exposed for image reconstruction and crystal positioning using data collection hardware present in most macromolecular crystallography end-stations. PMID:28009558

  16. Dynamic X-ray diffraction sampling for protein crystal positioning.

    PubMed

    Scarborough, Nicole M; Godaliyadda, G M Dilshan P; Ye, Dong Hye; Kissick, David J; Zhang, Shijie; Newman, Justin A; Sheedlo, Michael J; Chowdhury, Azhad U; Fischetti, Robert F; Das, Chittaranjan; Buzzard, Gregery T; Bouman, Charles A; Simpson, Garth J

    2017-01-01

    A sparse supervised learning approach for dynamic sampling (SLADS) is described for dose reduction in diffraction-based protein crystal positioning. Crystal centering is typically a prerequisite for macromolecular diffraction at synchrotron facilities, with X-ray diffraction mapping growing in popularity as a mechanism for localization. In X-ray raster scanning, diffraction is used to identify the crystal positions based on the detection of Bragg-like peaks in the scattering patterns; however, this additional X-ray exposure may result in detectable damage to the crystal prior to data collection. Dynamic sampling, in which preceding measurements inform the next most information-rich location to probe for image reconstruction, significantly reduced the X-ray dose experienced by protein crystals during positioning by diffraction raster scanning. The SLADS algorithm implemented herein is designed for single-pixel measurements and can select a new location to measure. In each step of SLADS, the algorithm selects the pixel, which, when measured, maximizes the expected reduction in distortion given previous measurements. Ground-truth diffraction data were obtained for a 5 µm-diameter beam and SLADS reconstructed the image sampling 31% of the total volume and only 9% of the interior of the crystal greatly reducing the X-ray dosage on the crystal. Using in situ two-photon-excited fluorescence microscopy measurements as a surrogate for diffraction imaging with a 1 µm-diameter beam, the SLADS algorithm enabled image reconstruction from a 7% sampling of the total volume and 12% sampling of the interior of the crystal. When implemented into the beamline at Argonne National Laboratory, without ground-truth images, an acceptable reconstruction was obtained with 3% of the image sampled and approximately 5% of the crystal. The incorporation of SLADS into X-ray diffraction acquisitions has the potential to significantly minimize the impact of X-ray exposure on the crystal by limiting the dose and area exposed for image reconstruction and crystal positioning using data collection hardware present in most macromolecular crystallography end-stations.

  17. Crystallization and preliminary X-ray diffraction analysis of the lectin from Dioclea rostrata Benth seeds

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Delatorre, Plínio; Departamento de Ciências Biológicas, Universidade Regional do Cariri, Crato, CE 63195-000; Nascimento, Kyria Santiago

    2006-02-01

    D. rostrata lectin was crystallized by hanging-drop vapor diffusion. The crystal belongs to the orthorhombic space group I222 and diffracted to 1.87 Å resolution. Lectins from the Diocleinae subtribe (Leguminosae) are highly similar proteins that promote various biological activities with distinctly differing potencies. The structural basis for this experimental data is not yet fully understood. Dioclea rostrata lectin was purified and crystallized by hanging-drop vapour diffusion at 293 K. The crystal belongs to the orthorhombic space group I222, with unit-cell parameters a = 61.51, b = 88.22, c = 87.76 Å. Assuming the presence of one monomer per asymmetric unit,more » the solvent content was estimated to be about 47.9%. A complete data set was collected at 1.87 Å resolution.« less

  18. Structural and conformational properties of 1-decyl-3-methylimidazolium tetrafluoroborate under high pressure

    NASA Astrophysics Data System (ADS)

    Chen, Liucheng; Li, Haining; Zhu, Xiang; Su, Lei; Yang, Kun; Yuan, Chaosheng; Yang, Guoqiang; Li, Xiaodong

    2017-06-01

    In situ crystalization of 1-decyl-3-methylimidazolium tetrafluoroborate ([C10MIM][BF4]) from melt has been investigated under high pressure up to 3.4 GPa at room temperature by using Raman spectroscopy and synchrotron X-ray diffraction measurement. Raman spectral analysis indicated that [C10MIM][BF4] experienced two successive phase transitions at about 0.3 GPa and 1.6 GPa. And the polymorphism was also discussed in view of the conformational isomerism of [C10MIM]+ cation between gauche and trans conformers. Notably, liquid-crystal and crystal-crystal phase transitions were further confirmed by synchrotron X-ray diffraction measurement. Moreover, it also indicated that high structural flexibility of the cations with long alkyl chain might have effect on the degree of disorder of pressure-induced crystallization for ionic liquids.

  19. On the purification and preliminary crystallographic analysis of isoquinoline 1-oxidoreductase from Brevundimonas diminuta 7

    PubMed Central

    Boer, D. Roeland; Müller, Axel; Fetzner, Susanne; Lowe, David J.; Romão, Maria João

    2005-01-01

    Isoquinoline 1-oxidoreductase (IOR) from Brevundimonas diminuta is a mononuclear molybdoenzyme of the xanthine-dehydrogenase family of proteins and catalyzes the conversion of isoquinoline to isoquinoline-1-one. Its primary sequence and behaviour, specifically in its substrate specificity and lipophilicity, differ from other members of the family. A crystal structure of the enzyme is expected to provide an explanation for these differences. This paper describes the crystallization and preliminary X-ray diffraction experiments as well as an optimized purification protocol for IOR. Crystallization of IOR was achieved using two different crystallization buffers. Streak-seeding and cross-linking were essential to obtain well diffracting crystals. Suitable cryo-conditions were found and a structure solution was obtained by molecular replacement. However, phases need to be improved in order to obtain a more interpretable electron-density map. PMID:16508115

  20. A microcrystal selection technique in protein crystallization

    NASA Astrophysics Data System (ADS)

    Han, Qing; Lin, Sheng-Xiang

    1996-10-01

    The goal of protein crystallization is to obtain high quality single crystals for X-ray diffraction analysis. A new and easy technique was employed to control the number and quality of crystals by eliminating poor microcrystals after the spontaneous nucleation. The process was carried out with two samples: human 17β-hydroxysteroid dehydrogenase (17β-HSD) and hen egg white lysozyme. The present study suggests a useful method for the successful crystal growth of biomacromolecules.

  1. Synthesis, growth, structural and optical studies of a novel organic Piperazine (bis) p-toluenesulfonate single crystal.

    PubMed

    Rekha, P; Peramaiyan, G; NizamMohideen, M; Kumar, R Mohan; Kanagadurai, R

    2015-03-15

    A novel organic single crystal of Piperazinium (bis) p-toluenesulfonate (PPTS) was grown by a slow evaporation solution growth technique. The structure of the grown crystal was determined using single crystal X-ray diffraction analysis. The PPTS crystal belongs to the triclinic crystal system with space group of P1¯. The presence of functional groups was confirmed by FTIR spectral analysis. The optical transmittance range and cut-off wavelength were identified by UV-vis-NIR spectral studies. The luminescent properties of PPTS crystal were investigated. The thermal behavior of PPTS crystal was studied by TG-DT analyses. Copyright © 2014 Elsevier B.V. All rights reserved.

  2. Structural, spectral and birefringence studies of semiorganic nonlinear optical single crystal: Calcium5-sulfosalicylate

    NASA Astrophysics Data System (ADS)

    Shalini, D.; Kalainathan, S.; Ambika, V. Revathi; Hema, N.; Jayalakshmi, D.

    2017-11-01

    Semi-organic nonlinear optical crystal Calcium5-Sulfosalicylate (CA5SS) was grown by slow evaporation solution growth technique. The cell parameters and molecular structure of the grown crystal were studied by single crystal x-ray diffraction analysis. The presence of various functional groups of the grown crystal was confirmed using Fourier transform infrared (FT-IR), Fourier transform Raman (FT-Raman) analysis. UV-Visible spectrum shows that CA5SS crystals have high transmittance in the range of 330-900 nm. The refractive index, birefringence and transient photoluminescence properties of the grown crystal were analyzed. The frequency doubling of the grown crystal (CA5SS) were studied and compared with that of KDP.

  3. Mechanochemical synthesis and structural characterization of three novel cocrystals of dimethylglyoxime with N-heterocyclic aromatic compounds and acetamide

    NASA Astrophysics Data System (ADS)

    Abidi, Syed Sibte Asghar; Azim, Yasser; Gupta, Abhishek Kumar; Pradeep, Chullikkattil P.

    2017-12-01

    With an aim to explore the interactions of (RR'Cdbnd Nsbnd OH) oxime moiety of dimethylglyoxime (DMG) with pyridyl ring of N-heterocyclic aromatic compounds and acetamide, three novel cocrystals of dimethylglyoxime with acridine (ACR), 1,10-phenanthroline monohydrate (PT) and acetamide (ACT) are reported. These three cocrystals were obtained with a mechanochemical synthesis approach and were characterized by single crystal X-ray diffraction (SCXRD), powder X-ray diffraction (PXRD), fourier transform-infrared spectroscopy (FT-IR), differential scanning calorimetry (DSC) and thermogravimetric analysis (TGA). Additionally, Hirshfeld surface analysis is used to investigate the intermolecular interaction and the crystal packing of cocrystals.

  4. Preparation and guest-uptake protocol for a porous complex useful for 'crystal-free' crystallography.

    PubMed

    Inokuma, Yasuhide; Yoshioka, Shota; Ariyoshi, Junko; Arai, Tatsuhiko; Fujita, Makoto

    2014-02-01

    We recently reported a new method for single-crystal X-ray diffraction (SCD) analysis that does not require the crystallization of the target compound. In this 'crystal-free' crystallography, a tiny crystal of a porous complex is soaked in the solution of the target guest. The guest molecules are absorbed and oriented in the crystal pores and can be analyzed by X-ray diffraction. We describe here a detailed synthetic protocol for the preparation of uniform single crystals of the porous host complex and for the subsequent guest uptake. The protocol describes our most versatile porous complex, which is prepared from commercially available ZnI2 and 2,4,6-tri(4-pyridyl)-1,3,5-triazine. The host complex has large pores with a cross-section of 8 × 5 Å(2). Single crystals of the complex are grown from layered solutions of the two components. The pores of the as-synthesized complex are filled with nitrobenzene, which is replaced with the inert solvent cyclohexane. This solvent exchange is essential for the rapid and effective inclusion of target compounds. The most crucial and delicate step is the selection of high-quality single crystals from the mixture of crystals of various shapes and sizes. We suggest using the facial indices of the single crystals as a criterion for crystal selection. Single-crystal samples for X-ray analysis can be prepared by immersing the selected crystals in a cyclohexane/dichloromethane solution of target compound. After a very slow evaporation of the solvent, typically over 2 d, the final crystal can be picked and directly subjected to SCD analysis. The protocol can be completed within ∼16 d.

  5. X-ray Crystallography Facility

    NASA Technical Reports Server (NTRS)

    2000-01-01

    Edward Snell, a National Research Council research fellow at NASA's Marshall Space Flight Center (MSFC), prepares a protein crystal for analysis by x-ray crystallography as part of NASA's structural biology program. The small, individual crystals are bombarded with x-rays to produce diffraction patterns, a map of the intensity of the x-rays as they reflect through the crystal.

  6. A preliminary neutron diffraction study of rasburicase, a recombinant urate oxidase enzyme, complexed with 8-azaxanthin

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Budayova-Spano, Monika, E-mail: spano@embl-grenoble.fr; Institut Laue-Langevin, 6 Rue Jules Horowitz, BP 156, 38042 Grenoble; Bonneté, Françoise

    2006-03-01

    Neutron diffraction data of hydrogenated recombinant urate oxidase enzyme (Rasburicase), complexed with a purine-type inhibitor 8-azaxanthin, was collected to 2.1 Å resolution from a crystal grown in D{sub 2}O by careful control and optimization of crystallization conditions via knowledge of the phase diagram. Deuterium atoms were clearly seen in the neutron-scattering density map. Crystallization and preliminary neutron diffraction measurements of rasburicase, a recombinant urate oxidase enzyme expressed by a genetically modified Saccharomyces cerevisiae strain, complexed with a purine-type inhibitor (8-azaxanthin) are reported. Neutron Laue diffraction data were collected to 2.1 Å resolution using the LADI instrument from a crystal (grownmore » in D{sub 2}O) with volume 1.8 mm{sup 3}. The aim of this neutron diffraction study is to determine the protonation states of the inhibitor and residues within the active site. This will lead to improved comprehension of the enzymatic mechanism of this important enzyme, which is used as a protein drug to reduce toxic uric acid accumulation during chemotherapy. This paper illustrates the high quality of the neutron diffraction data collected, which are suitable for high-resolution structural analysis. In comparison with other neutron protein crystallography studies to date in which a hydrogenated protein has been used, the volume of the crystal was relatively small and yet the data still extend to high resolution. Furthermore, urate oxidase has one of the largest primitive unit-cell volumes (space group I222, unit-cell parameters a = 80, b = 96, c = 106 Å) and molecular weights (135 kDa for the homotetramer) so far successfully studied with neutrons.« less

  7. Crystallization, X-ray diffraction analysis and phasing of 17β-hydroxysteroid dehydrogenase from the fungus Cochliobolus lunatus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cassetta, Alberto, E-mail: alberto.cassetta@ic.cnr.it; Büdefeld, Tomaž; Lanišnik Rižner, Tea

    2005-12-01

    The expression, purification and crystallization of 17β-hydroxysteroid dehydrogenase from the filamentous fungus C. lunatus and its Y167F mutant, both in the apo form, are described. X-ray diffraction analysis and phasing by Patterson-search techniques are reported. 17β-Hydroxysteroid dehydrogenase from the filamentous fungus Cochliobolus lunatus (17β-HSDcl) is an NADP(H)-dependent enzyme that preferentially catalyses the oxidoreduction of oestrogens and androgens. The enzyme belongs to the short-chain dehydrogenase/reductase superfamily and is the only fungal hydroxysteroid dehydrogenase known to date. 17β-HSDcl has recently been characterized and cloned and has been the subject of several functional studies. Although several hypotheses on the physiological role of 17β-HSDclmore » in fungal metabolism have been formulated, its function is still unclear. An X-ray crystallographic study has been undertaken and the optimal conditions for crystallization of 17β-HSDcl (apo form) were established, resulting in well shaped crystals that diffracted to 1.7 Å resolution. The space group was identified as I4{sub 1}22, with unit-cell parameters a = b = 67.14, c = 266.77 Å. Phasing was successfully performed by Patterson search techniques. A catalytic inactive mutant Tyr167Phe was also engineered, expressed, purified and crystallized for functional and structural studies.« less

  8. Kinetic products in coordination networks: ab initio X-ray powder diffraction analysis.

    PubMed

    Martí-Rujas, Javier; Kawano, Masaki

    2013-02-19

    Porous coordination networks are materials that maintain their crystal structure as molecular "guests" enter and exit their pores. They are of great research interest with applications in areas such as catalysis, gas adsorption, proton conductivity, and drug release. As with zeolite preparation, the kinetic states in coordination network preparation play a crucial role in determining the final products. Controlling the kinetic state during self-assembly of coordination networks is a fundamental aspect of developing further functionalization of this class of materials. However, unlike for zeolites, there are few structural studies reporting the kinetic products made during self-assembly of coordination networks. Synthetic routes that produce the necessary selectivity are complex. The structural knowledge obtained from X-ray crystallography has been crucial for developing rational strategies for design of organic-inorganic hybrid networks. However, despite the explosive progress in the solid-state study of coordination networks during the last 15 years, researchers still do not understand many chemical reaction processes because of the difficulties in growing single crystals suitable for X-ray diffraction: Fast precipitation can lead to kinetic (metastable) products, but in microcrystalline form, unsuitable for single crystal X-ray analysis. X-ray powder diffraction (XRPD) routinely is used to check phase purity, crystallinity, and to monitor the stability of frameworks upon guest removal/inclusion under various conditions, but rarely is used for structure elucidation. Recent advances in structure determination of microcrystalline solids from ab initio XRPD have allowed three-dimensional structure determination when single crystals are not available. Thus, ab initio XRPD structure determination is becoming a powerful method for structure determination of microcrystalline solids, including porous coordination networks. Because of the great interest across scientific disciplines in coordination networks, especially porous coordination networks, the ability to determine crystal structures when the crystals are not suitable for single crystal X-ray analysis is of paramount importance. In this Account, we report the potential of kinetic control to synthesize new coordination networks and we describe ab initio XRPD structure determination to characterize these networks' crystal structures. We describe our recent work on selective instant synthesis to yield kinetically controlled porous coordination networks. We demonstrate that instant synthesis can selectively produce metastable networks that are not possible to synthesize by conventional solution chemistry. Using kinetic products, we provide mechanistic insights into thermally induced (573-723 K) (i.e., annealing method) structural transformations in porous coordination networks as well as examples of guest exchange/inclusion reactions. Finally, we describe a memory effect that allows the transfer of structural information from kinetic precursor structures to thermally stable structures through amorphous intermediate phases. We believe that ab initio XRPD structure determination will soon be used to investigate chemical processes that lead intrinsically to microcrystalline solids, which up to now have not been fully understood due to the unavailability of single crystals. For example, only recently have researchers used single-crystal X-ray diffraction to elucidate crystal-to-crystal chemical reactions taking place in the crystalline scaffold of coordination networks. The potential of ab initio X-ray powder diffraction analysis goes beyond single-crystal-to-single-crystal processes, potentially allowing members of this field to study intriguing in situ reactions, such as reactions within pores.

  9. Synthesis, growth, structural, optical, spectral, thermal and mechanical studies of 4-methoxy 4-nitrostilbene (MONS): a new organic nonlinear optical single crystal.

    PubMed

    Dinakaran, Paul M; Bhagavannarayana, G; Kalainathan, S

    2012-11-01

    4-Methoxy 4-nitrostilbene (MONS), a new organic nonlinear optical material has been synthesized. Based on the solubility data good quality single crystal with dimensions up to 38×11×3 mm(3) has been grown by slow evaporation method using ethyl methyl ketone (MEK) as a solvent. Powder XRD confirms the crystalline property and also the diffraction planes have been indexed. The lattice parameters for the grown MONS crystals were determined by using single crystal X-ray diffraction analysis and it reveals that the crystal lattice system is triclinic. The crystalline perfection of the grown crystals has been analysed by high resolution X-ray diffraction (HRXRD) rocking curve measurements. Fourier transform infrared (FTIR) spectrum for powdered MONS sample confirms the functional groups present in the grown crystal. The UV-vis absorption spectrum has been recorded in the range of 190-1100 nm and the cut off wavelength 499 nm has been determined. The optical constants of MONS have been determined through UV-vis-NIR spectroscopy. The MONS crystals were further subjected to other characterizations. i.e., (1)H NMR, TG/DTA, photoluminescence and microhardness test. The Kurtz and Perry powder technique confirms the NLO property of the grown crystal and the SHG efficiency of MONS was found to be 1.55× greater than that of KDP crystal. Copyright © 2012 Elsevier B.V. All rights reserved.

  10. Crystallization and preliminary X-ray diffraction analysis of a myotoxic Lys49-PLA{sub 2} from Bothrops jararacussu venom complexed with p-bromophenacyl bromide

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Marchi-Salvador, D. P.; Fernandes, C. A. H.; Amui, S. F.

    2006-06-01

    A non-catalytic and myotoxic Lys49-PLA{sub 2} from B. jararacussu venom was crystallized with BPB inhibitor and X-ray diffraction data were collected. Preliminary analysis indicates that the ligand is bound to the His48 residue. Structure determination may provide insights into the myotoxic and cytotoxic mechanisms of Lys49-PLA{sub 2}s. For the first time, a non-catalytic and myotoxic Lys49-PLA{sub 2} (BthTX-I from Bothrops jararacussu venom) has been crystallized with BPB inhibitor. X-ray diffraction data were collected and electron-density calculations showed that the ligand is bound to the His48 residue. BthTX-I with His48 chemically modified by BPB shows strongly reduced myotoxic and cytotoxic activities.more » This suggests a biological correlation between the modification of His48, which is associated with catalytic activity of PLA{sub 2}s, and other toxicological activities of Lys49-PLA{sub 2}s.« less

  11. Structural changes induced by lattice-electron interactions: SiO2 stishovite and FeTiO3 ilmenite.

    PubMed

    Yamanaka, Takamitsu

    2005-09-01

    The bright source and highly collimated beam of synchrotron radiation offers many advantages for single-crystal structure analysis under non-ambient conditions. The structure changes induced by the lattice-electron interaction under high pressure have been investigated using a diamond anvil pressure cell. The pressure dependence of electron density distributions around atoms is elucidated by a single-crystal diffraction study using deformation electron density analysis and the maximum entropy method. In order to understand the bonding electrons under pressure, diffraction intensity measurements of FeTiO3 ilmenite and gamma-SiO2 stishovite single crystals at high pressures were made using synchrotron radiation. Both diffraction studies describe the electron density distribution including bonding electrons and provide the effective charge of the cations. In both cases the valence electrons are more localized around the cations with increasing pressure. This is consistent with molecular orbital calculations, proving that the bonding electron density becomes smaller with pressure. The thermal displacement parameters of both samples are reduced with increasing pressure.

  12. The molecular and crystal structure of dextrans: a combined electron and X-ray diffraction study. II. A low temperature, hydrated polymorph.

    PubMed

    Guizard, C; Chanzy, H; Sarko, A

    1985-06-05

    The crystal and molecular structure of a dextran hydrate has been determined through combined electron and X-ray diffraction analysis, aided by stereochemical model refinement. A total of 65 hk0 electron diffraction intensities were measured on frozen single crystals held at the temperature of liquid nitrogen, to a resolution limit of 1.6 A. The X-ray intensities were measured from powder patterns recorded from collections of the single crystals. The structure crystallizes in a monoclinic unit cell with parameters a = 25.71 A, b = 10.21 A, c (chain axis) = 7.76 A and beta = 91.3 degrees. The space group is P2(1) with b axis unique. The unit cell contains six chains and eight water molecules, with three chains of the same polarity and four water molecules constituting the asymmetric unit. Along the chain direction the asymmetric unit is a dimer residue; however, the individual glucopyranose residues are very nearly related by a molecular 2-fold screw axis. The conformation of the chain is very similar to that in the anhydrous structure, but the chain packing differs in the two structures in that the rotational positions of the chains about the helix axes (the chain setting angles) are considerably different. The chains still pack in the form of sheets that are separated by water molecules. The difference in the chain setting angles between the anhydrous and hydrate structures corresponds to the angle between like unit cell axes observed in the diffraction diagrams recorded from hybrid crystals containing both polymorphs. Despite some beam damage effects, the structure was determined to a satisfactory degree of agreement, with the residuals R''(electron diffraction) = 0.258 and R(X-ray) = 0.127.

  13. Crystallisation and preliminary X-ray diffraction analysis of the protease from Southampton norovirus complexed with a Michael-acceptor inhibitor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Coates, Leighton; Cooper, Jon; Hussey, Robert

    2008-01-01

    Noroviruses are the predominant cause of human epidemic nonbacterial gastroenteritis. Viral replication requires a cysteine protease that cleaves a 200 kDa viral polyprotein into its constituent functional parts. Here, the crystallization of the recombinant protease from the Southampton norovirus is described. While the native crystals were found to diffract only to medium resolution (2.9 {angstrom}), cocrystals of an inhibitor complex diffracted X-rays to 1.7 {angstrom} resolution. The polypeptide inhibitor (Ac-EFQLQ-propenyl ethyl ester) possesses an amino-acid sequence designed to match the substrate specificity of the enzyme, but was synthesized with a reactive Michael acceptor group at the C-terminal end.

  14. Crystallization and preliminary X-ray diffraction analysis of recombinant phosphoribosylpyrophosphate synthetase from the Thermophilic thermus thermophilus strain HB27

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Abramchik, Yu. A.; Timofeev, V. I., E-mail: tostars@mail.ru; Muravieva, T. I.

    2017-01-15

    Phosphoribosylpyrophosphate synthetases (PRPP synthetases) are among the key enzymes essential for vital functions of organisms and are involved in the biosynthesis of purine and pyrimidine nucleotides, coenzymes, and the amino acids histidine and tryptophan. These enzymes are used in biotechnology for the combined chemoenzymatic synthesis of natural nucleotide analogs. Recombinant phosphoribosylpyrophosphate synthetase I from the thermophilic strain HB27 of the bacterium Thermus thermophilus (T. th HB27) has high thermal stability and shows maximum activity at 75°Ð¡, due to which this enzyme holds promise for biotechnological applications. In order to grow crystals and study them by X-ray crystallography, an enzyme sample,more » which was produced using a highly efficient producer strain, was purified by affinity and gel-filtration chromatography. The screening of crystallization conditions was performed by the vapor-diffusion technique. The crystals of the enzyme suitable for X-ray diffraction were grown by the counter-diffusion method through a gel layer. These crystals were used to collect the X-ray diffraction data set at the SPring-8 synchrotron radiation facility (Japan) to 3-Å resolution. The crystals belong to sp. gr. P2{sub 1} and have the following unitcell parameters: a = 107.7 Å, b = 112.6 Å, c = 110.2 Å, α = γ = 90°, β = 116.6°. The X-ray diffraction data set is suitable for determining the three-dimensional structure of the enzyme at 3.0-Å resolution.« less

  15. Crystallization and preliminary X-ray diffraction analysis of recombinant phosphoribosylpyrophosphate synthetase from the Thermophilic thermus thermophilus strain HB27

    NASA Astrophysics Data System (ADS)

    Abramchik, Yu. A.; Timofeev, V. I.; Muravieva, T. I.; Sinitsyna, E. V.; Esipov, R. S.; Kuranova, I. P.

    2017-01-01

    Phosphoribosylpyrophosphate synthetases (PRPP synthetases) are among the key enzymes essential for vital functions of organisms and are involved in the biosynthesis of purine and pyrimidine nucleotides, coenzymes, and the amino acids histidine and tryptophan. These enzymes are used in biotechnology for the combined chemoenzymatic synthesis of natural nucleotide analogs. Recombinant phosphoribosylpyrophosphate synthetase I from the thermophilic strain HB27 of the bacterium Thermus thermophilus ( T. th HB27) has high thermal stability and shows maximum activity at 75°C, due to which this enzyme holds promise for biotechnological applications. In order to grow crystals and study them by X-ray crystallography, an enzyme sample, which was produced using a highly efficient producer strain, was purified by affinity and gel-filtration chromatography. The screening of crystallization conditions was performed by the vapor-diffusion technique. The crystals of the enzyme suitable for X-ray diffraction were grown by the counter-diffusion method through a gel layer. These crystals were used to collect the X-ray diffraction data set at the SPring-8 synchrotron radiation facility (Japan) to 3-Å resolution. The crystals belong to sp. gr. P21 and have the following unitcell parameters: a = 107.7 Å, b = 112.6 Å, c = 110.2 Å, α = γ = 90°, β = 116.6°. The X-ray diffraction data set is suitable for determining the three-dimensional structure of the enzyme at 3.0-Å resolution.

  16. Crystallization and preliminary X-ray analysis of the isomerase domain of glucosamine-6-phosphate synthase from Candida albicans

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Olchowy, Jaroslaw; Jedrzejczak, Robert; Milewski, Slawomir

    2005-11-01

    The isomerase domain of glucosamine-6-phosphate synthase from C. albicans has been crystallized and X-ray diffraction data have been collected. Preliminary analysis of the data reveals the oligomeric structure of the eukaryotic synthase to be a ‘dimer’ of prokaryotic-like dimers. Glucosamine-6-phosphate synthase (EC 2.6.1.16) catalyses the first and practically irreversible step in the hexosamine metabolism pathway, the end product of which, uridine 5′-diphospho-N-acetyl d-glucosamine, is an essential substrate for assembly of the cell wall. The isomerase domain, consisting of residues 346–712 (42 kDa), of glucosamine-6-phosphate synthase from Candida albicans has been crystallized. X-ray analysis revealed that the crystals belonged to spacemore » group I4, with unit-cell parameters a = b = 149, c = 103 Å. Diffraction data were collected to 3.8 Å. Preliminary results from molecular replacement using the homologous bacterial monomer reveal that the asymmetric unit contains two monomers that resemble a bacterial dimer. The crystal lattice consists of pairs of such symmetry-related dimers forming elongated tetramers.« less

  17. Recombinant expression, purification, crystallization and preliminary X-ray diffraction analysis of the C-terminal DUF490(963-1138) domain of TamB from Escherichia coli.

    PubMed

    Josts, Inokentijs; Grinter, Rhys; Kelly, Sharon M; Mosbahi, Khedidja; Roszak, Aleksander; Cogdell, Richard; Smith, Brian O; Byron, Olwyn; Walker, Daniel

    2014-09-01

    TamB is a recently described inner membrane protein that, together with its partner protein TamA, is required for the efficient secretion of a subset of autotransporter proteins in Gram-negative bacteria. In this study, the C-terminal DUF490963-1138 domain of TamB was overexpressed in Escherichia coli K-12, purified and crystallized using the sitting-drop vapour-diffusion method. The crystals belonged to the primitive trigonal space group P3121, with unit-cell parameters a = b = 57.34, c = 220.74 Å, and diffracted to 2.1 Å resolution. Preliminary secondary-structure and X-ray diffraction analyses are reported. Two molecules are predicted to be present in the asymmetric unit. Experimental phasing using selenomethionine-labelled protein will be undertaken in the future.

  18. Three pharmaceuticals cocrystals of adefovir: Syntheses, structures and dissolution study

    NASA Astrophysics Data System (ADS)

    Zhang, Xiaoming; Sun, Fuxing; Zhang, Tingting; Jia, Jiangtao; Su, Hongmin; Wang, Chenhui; Zhu, Guangshan

    2015-11-01

    We report here three novel cocrystals, which are composed of adefovir as the API (Active Pharmaceutical Ingredient) with p-aminobenzoic acid (1, 2C8H12N5O4P·C7H6NO2·3H2O), 3,5-dihydroxybenzoic acid (2, C8H12N5O4P·C7H6O4·H2O) and 2,6-pyridinedicarboxlic acid (3, C8H12N5O4P·C7H5NO4) as CCFs (cocrystal formers) respectively by crystal engineering strategy. Their structures were characterized by single crystal X-ray diffraction, powder X-ray diffraction (PXRD) analysis, thermogravimetric analyses (TGA), elemental analysis (EA) and infrared spectral analysis (IR). The analysis of single crystal X-ray diffraction demonstrate that cocrystal 1 and 2 form a strong hydrogen-bonded assembly through the phosphoric acids of API with water in the lattice and carboxylic acids of CCF respectively. Cocrystal 3 is formed in which the phosphoric acid groups of API are also held by the carboxylic acid groups of CCF. The PXRD results indicate their high purity of as-synthesized samples. The TGA, EA, IR and dissolution study of API and the cocrystals were also measured and discussed.

  19. Synthesis, characterization and dissolution of three pharmaceutical cocrystals based on deferiprone

    NASA Astrophysics Data System (ADS)

    Zhang, Xiaoming; Tian, Yuyang; Jia, Jiangtao; Zhang, Tingting; Zhu, Guangshan

    2016-03-01

    In this paper we present three new cocrystals based on deferiprone which is the first oral medicine as iron chelator. Solitary deferiprone possesses some known problems due to its good solubility and frequent dosing side effects. For these three novel co crystals, deferiprone is the active pharmaceutical ingredient (API), p-hydroxybenzoic acid (1, C7H9NO2·C7H6O3), 2, 5-dihydroxybenzoic acid (2, C7H9NO2·C7H6O4) and maleic acid (3, C7H9NO2·C4H4O4) are used as cocrystal formers (CCFs), respectively. Their structures were characterized by single crystal X-ray diffraction, powder X-ray diffraction (PXRD) analysis, thermogravimetric analyses (TGA), differential thermal analysis (DTA), elemental analysis (EA) and infrared spectral analysis (IR). Single crystal X-ray diffraction demonstrates that all three cocrystals (1-3) possess strong hydrogen-bondings assembled through hydroxyl of API and carboxylic acids of CCFs. The PXRD results indicate their high purity of as-synthesized samples. TGA, DTA, EA, IR and dissolution study of API and cocrystals were also measured and discussed, respectively. The results suggest that the cocrystals exhibit low dissolution rates comparing with solitary deferiprone, which is very advantageous for the oral medicine with frequent dosing side effects.

  20. A new cadmium(II) complex with bridging dithiolate ligand: Synthesis, crystal structure and antifungal activity study

    NASA Astrophysics Data System (ADS)

    Singh, Mahesh Kumar; Sutradhar, Sanjit; Paul, Bijaya; Adhikari, Suman; Laskar, Folguni; Butcher, Raymond J.; Acharya, Sandeep; Das, Arijit

    2017-07-01

    A new polymeric complex of Cd(II) with 1,1-dicyanoethylene- 2,2-dithiolate [ i-MNT2- = {S2C:C(CN)2}2- ] as a bridging ligand has been synthesized and characterized on the basis of spectroscopy and single-crystal X-ray diffraction analysis. Single crystal X-ray diffraction analysis reveals that the Cadmium (II) complex is six coordinated 1D polymeric in nature. Biological screening effects in vitro of the synthesized polymeric complex has been tested against five fungi Synchitrium endobioticum, Pyricularia oryzae, Helminthosporium oryzae, Candida albicans(ATCC10231), Trichophyton mentagrophytes by the disc diffusion method. In vitro antifungal screening indicates that the complex exhibits fungistatic and fungicidal antifungal activity whereas K2i-MNT.H2O became silent on Synchitrium endobioticum, Pyricularia oryzae, Helminthosporium oryzae, Candida albicans (ATCC10231), Trichophyton mentagrophytes.

  1. Tutorial: Crystal orientations and EBSD — Or which way is up?

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Britton, T.B., E-mail: b.britton@imperial.ac.uk; Jiang, J.; Guo, Y.

    2016-07-15

    Electron backscatter diffraction (EBSD) is an automated technique that can measure the orientation of crystals in a sample very rapidly. There are many sophisticated software packages that present measured data. Unfortunately, due to crystal symmetry and differences in the set-up of microscope and EBSD software, there may be accuracy issues when linking the crystal orientation to a particular microstructural feature. In this paper we outline a series of conventions used to describe crystal orientations and coordinate systems. These conventions have been used to successfully demonstrate that a consistent frame of reference is used in the sample, unit cell, pole figuremore » and diffraction pattern frames of reference. We establish a coordinate system rooted in measurement of the diffraction pattern and subsequently link this to all other coordinate systems. A fundamental outcome of this analysis is to note that the beamshift coordinate system needs to be precisely defined for consistent 3D microstructure analysis. This is supported through a series of case studies examining particular features of the microscope settings and/or unambiguous crystallographic features. These case studies can be generated easily in most laboratories and represent an opportunity to demonstrate confidence in use of recorded orientation data. Finally, we include a simple software tool, written in both MATLAB® and Python, which the reader can use to compare consistency with their own microscope set-up and which may act as a springboard for further offline analysis. - Highlights: • Presentation of conventions used to describe crystal orientations • Three case studies that outline how conventions are consistent • Demonstrates a pathway for calibration and validation of EBSD based orientation measurements • EBSD computer code supplied for validation by the reader.« less

  2. Process for Encapsulating Protein Crystals

    NASA Technical Reports Server (NTRS)

    Morrison, Dennis R.; Mosier, Benjamin

    2003-01-01

    A process for growing protein crystals encapsulated within membranes has been invented. This process begins with the encapsulation of a nearly saturated aqueous protein solution inside semipermeable membranes to form microcapsules. The encapsulation is effected by use of special formulations of a dissolved protein and a surfactant in an aqueous first liquid phase, which is placed into contact with a second, immiscible liquid phase that contains one or more polymers that are insoluble in the first phase. The second phase becomes formed into the semipermeable membranes that surround microglobules of the first phase, thereby forming the microcapsules. Once formed, the microcapsules are then dehydrated osmotically by exposure to a concentrated salt or polymer solution. The dehydration forms supersaturated solutions inside the microcapsules, thereby enabling nucleation and growth of protein crystals inside the microcapsules. By suitable formulation of the polymer or salt solution and of other physical and chemical parameters, one can control the rate of transport of water out of the microcapsules through the membranes and thereby create physicochemical conditions that favor the growth, within each microcapsule, of one or a few large crystals suitable for analysis by x-ray diffraction. The membrane polymer can be formulated to consist of low-molecular-weight molecules that do not interfere with the x-ray diffraction analysis of the encapsulated crystals. During dehydration, an electrostatic field can be applied to exert additional control over the rate of dehydration. This protein-crystal-encapsulation process is expected to constitute the basis of protein-growth experiments to be performed on the space shuttle and the International Space Station. As envisioned, the experiments would involve the exposure of immiscible liquids to each other in sequences of steps under microgravitational conditions. The experiments are expected to contribute to knowledge of the precise conditions under which protein crystals form. By enhancing the ability to grow crystals suitable for x-ray diffraction analysis, this knowledge can be expected to benefit not only the space program but also medicine and the pharmaceutical industry.

  3. Spherical quartz crystals investigated with synchrotron radiation

    DOE PAGES

    Pereira, N. R.; Macrander, A. T.; Hill, K. W.; ...

    2015-10-27

    The quality of x-ray spectra and images obtained from plasmas with spherically bent crystals depends in part on the crystal's x-ray diffraction across the entire crystal surface. We employ the energy selectivity and high intensity of synchrotron radiation to examine typical spherical crystals from alpha-quartz for their diffraction quality, in a perpendicular geometry that is particularly convenient to examine sagittal focusing. The crystal's local diffraction is not ideal: the most noticeable problems come from isolated regions that so far have failed to correlate with visible imperfections. In conclusion, excluding diffraction from such problem spots has little effect on the focusmore » beyond a decrease in background.« less

  4. High-throughput crystallization screening.

    PubMed

    Skarina, Tatiana; Xu, Xiaohui; Evdokimova, Elena; Savchenko, Alexei

    2014-01-01

    Protein structure determination by X-ray crystallography is dependent on obtaining a single protein crystal suitable for diffraction data collection. Due to this requirement, protein crystallization represents a key step in protein structure determination. The conditions for protein crystallization have to be determined empirically for each protein, making this step also a bottleneck in the structure determination process. Typical protein crystallization practice involves parallel setup and monitoring of a considerable number of individual protein crystallization experiments (also called crystallization trials). In these trials the aliquots of purified protein are mixed with a range of solutions composed of a precipitating agent, buffer, and sometimes an additive that have been previously successful in prompting protein crystallization. The individual chemical conditions in which a particular protein shows signs of crystallization are used as a starting point for further crystallization experiments. The goal is optimizing the formation of individual protein crystals of sufficient size and quality to make them suitable for diffraction data collection. Thus the composition of the primary crystallization screen is critical for successful crystallization.Systematic analysis of crystallization experiments carried out on several hundred proteins as part of large-scale structural genomics efforts allowed the optimization of the protein crystallization protocol and identification of a minimal set of 96 crystallization solutions (the "TRAP" screen) that, in our experience, led to crystallization of the maximum number of proteins.

  5. (NZ)CH...O contacts assist crystallization of a ParB-like nuclease.

    PubMed

    Shaw, Neil; Cheng, Chongyun; Tempel, Wolfram; Chang, Jessie; Ng, Joseph; Wang, Xin-Yu; Perrett, Sarah; Rose, John; Rao, Zihe; Wang, Bi-Cheng; Liu, Zhi-Jie

    2007-07-07

    The major bottleneck for determination of 3 D structures of proteins using X-rays is the production of diffraction quality crystals. Often proteins are subjected to chemical modification to improve the chances of crystallization Here, we report the successful crystallization of a nuclease employing a reductive methylation protocol. The key to crystallization was the successful introduction of 44 new cohesive (NZ) CH...O contacts (3.2-3.7 A) by the addition of 2 methyl groups to the side chain amine nitrogen (NZ) of 9 lysine residues of the nuclease. The new contacts dramatically altered the crystallization properties of the protein, resulting in crystals that diffracted to 1.2 A resolution. Analytical ultracentrifugation analysis and thermodynamics results revealed a more compact protein structure with better solvent exclusion of buried Trp residues in the folded state of the methylated protein, assisting crystallization. In this study, introduction of novel cohesive (NZ)CH...O contacts by reductive methylation resulted in the crystallization of a protein that had previously resisted crystallization in spite of extensive purification and crystallization space screening. Introduction of (NZ)CH...O contacts could provide a solution to crystallization problems for a broad range of protein targets.

  6. Synthesis, crystal growth, optical, thermal, and mechanical properties of a nonlinear optical single crystal: ammonium sulfate hydrogen sulphamate (ASHS)

    NASA Astrophysics Data System (ADS)

    Sudhakar, K.; Nandhini, S.; Muniyappan, S.; Arumanayagam, T.; Vivek, P.; Murugakoothan, P.

    2018-04-01

    Ammonium sulfate hydrogen sulphamate (ASHS), an inorganic nonlinear optical crystal, was grown from the aqueous solution by slow evaporation solution growth technique. The single-crystal XRD confirms that the grown single crystal belongs to the orthorhombic system with the space group of Pna21. Powder XRD confirms the crystalline nature and the diffraction planes were indexed. Crystalline perfection of grown crystal was analysed by high-resolution X-ray diffraction rocking curve technique. UV-Vis-NIR studies revealed that ASHS crystal has optical transparency 65% and lower cut-off wavelength at 218 nm. The violet light emission of the crystal was identified by photoluminescence studies. The particle size-dependent second-harmonic generation efficiency for ASHS crystal was evaluated by Kurtz-Perry powder technique using Nd:YAG laser which established the existence of phase matching. Surface laser damage threshold value was evaluated using Nd:YAG laser. Optical homogeneity of the crystal was evaluated using modified channel spectrum method through birefringence study. Thermal analysis reveals that ASHS crystal is stable up to 213 °C. The mechanical behaviour of the ASHS crystal was analysed using Vickers microhardness study.

  7. Fabrication and Analysis of Photonic Crystals

    ERIC Educational Resources Information Center

    Campbell, Dean J.; Korte, Kylee E.; Xia, Younan

    2007-01-01

    These laboratory experiments are designed to explore aspects of nanoscale chemistry by constructing and spectroscopically analyzing thin films of photonic crystals. Films comprised of colloidal spheres and polydimethylsiloxane exhibit diffraction-based stop bands that shift reversibly upon exposure to some common solvents. Topics covered in these…

  8. On the nature and origin of the oxalate package in Solanum sisymbriifolium anthers.

    PubMed

    Burrieza, Hernán Pablo; López-Fernández, María Paula; Láinez, Verónica; Montenegro, Teresita; Maldonado, Sara

    2010-11-01

    This is a detailed study carried out in Solanum sisymbriifolium Lam. on the development of the circular cell cluster (CCC) during crystal deposition, as well as the composition of the crystals. Light microscopy and scanning and transmission electron microscopy (TEM) were used to characterize tissue throughout anther development. Energy dispersive X-ray analysis (EDAX) allowed the determination of the elemental composition of crystals that form in the CCC region, and infrared and x-ray diffraction analysis were used to specify the crystal salt composition. TEM analysis revealed that the crystals originated simultaneously within the vacuoles in association with a paracrystalline protein. Prior to the appearance of protein within vacuoles, protein paracrystals were visible in both rough endoplasmic reticulum and vesicles with ribosomes on their membranes. In vacuoles, paracrystals constitute nucleation sites for druse crystals formation. EDAX revealed that C, O, and Ca were the main elements, and K, Cl, Mg, P, S, and Si, the minor elements. X-ray powder diffraction of crystals detected the predominant presence of calcium oxalate, but also vestiges of calcite, quartz, and sylvite. The calcium oxalate coexisted in the three chemical forms, that is, whewellite, weddellite, and caoxite. Infrared spectrophotometry identified bands that characterize O-C-O, H-O, C-H bonds, all of calcium oxalate, and Si-O-Si, of quartz. These results were compared with studies of anthers carried out in other Solanaceae genera.

  9. Investigations on structural and photoluminescence mechanism of cerium doped L-Histidine hydrochloride mono hydrate single crystals for optical applications

    NASA Astrophysics Data System (ADS)

    Rajyalakshmi, S.; Ramachandra Rao, K.; Brahmaji, B.; Samatha, K.; Visweswara Rao, T. K.; Ramakrishna, Y.

    2017-02-01

    Semi organic nonlinear optical material of Ce3+ ion added L-Histidine hydrochloride monohydrate (LHHC) crystals have been grown successfully by the slow evaporation solution technique (SEST) as well as Sankaranarayanan-Ramasamy (SR) technique. Unit cell data have been measured from the single crystal X-ray diffraction analysis and High resolution X-ray diffraction analysis (HRXRD) study shows relatively a good crystalline perfection. Fourier transform infra-red spectroscopy (FTIR) spectra indicates that the Ce3+ ion is coordinated with carboxylate group of grown crystal. The lower UV-cutoff wavelength of the incorporation of Ce3+ ion in LHHC is 240 nm. The incorporation of Ce3+ ion in the crystal lattice was observed by energy dispersive X-ray analysis (EDAX). The nonlinear optical (NLO) efficiency of SR-grown crystal is 3.7 times greater with respect to potassium dihydrogen phosphate (KDP). We report first-time the photoluminescence (PL) mechanism of emission spectrum, which shows broad band located at 350 nm corresponding to 5d → 4f transition of Ce3+ ion and excited by 250 nm wavelength. The excitation spectrum shows a band at 258 nm due to the 4f → 5d transition of Ce3+ ion. The nature of decay curve of the grown crystal is bi-exponential with a long life time of τ2 is 8.8270 μs.

  10. Stabilization of Quinapril by Incorporating Hydrogen Bonding Interactions

    PubMed Central

    Roy, B. N.; Singh, G. P.; Godbole, H. M.; Nehate, S. P.

    2009-01-01

    In the present study stability of various known solvates of quinapril hydrochloride has been compared with nitromethane solvate. Nitromethane solvate was found to be more stable compared to other known solvates. Single crystal X-ray diffraction analysis of quinapril nitromethane solvate shows intermolecular hydrogen bonding between quinapril molecule and nitromethane. Stabilization of quinapril by forming strong hydrogen bonding network as in case of co-crystals was further studied by forming co-crystal with tris(hydroxymethyl)amino methane. Quinapril free base forms a stable salt with tris(hydroxymethyl)amino methane not reported earlier. Quinapril tris(hydroxymethyl)amino methane salt found to be stable even at 80° for 72 h i.e. hardly any formation of diketopiperazine and diacid impurity. As expected single crystal X-ray diffraction analysis reveals tris(hydroxymethyl)amino methane salt of quinapril shows complex hydrogen bonding network between the two entities along with ionic bond. The properties of this stable salt - stable in solid as well as solution phase, might lead to an alternate highly stable formulation. PMID:20502545

  11. Cloning, expression, purification, crystallization and preliminary X-ray diffraction analysis of macrophage growth locus A (MglA) protein from Francisella tularensis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Subburaman, P.; Austin, B.P.; Shaw, G.X.

    2010-11-03

    Francisella tularensis, a potential bioweapon, causes a rare infectious disease called tularemia in humans and animals. The macrophage growth locus A (MglA) protein from F. tularensis associates with RNA polymerase to positively regulate the expression of multiple virulence factors that are required for its survival and replication within macrophages. The MglA protein was overproduced in Escherichia coli, purified and crystallized. The crystals diffracted to 7.5 {angstrom} resolution at the Advanced Photon Source, Argonne National Laboratory and belonged to the hexagonal space group P6{sub 1} or P6{sub 5}, with unit-cell parameters a = b = 125, c = 54 {angstrom}.

  12. Spin-to-orbit conversion at acousto-optic diffraction of light: conservation of optical angular momentum.

    PubMed

    Skab, Ihor; Vlokh, Rostyslav

    2012-04-01

    Acousto-optic diffraction of light in optically active cubic crystals is analyzed from the viewpoint of conservation of optical angular momentum. It is shown that the availability of angular momentum in the diffracted optical beam can be necessarily inferred from the requirements of angular momentum conservation law. As follows from our analysis, a circularly polarized diffracted wave should bear an orbital angular momentum. The efficiency of the spin-to-orbit momentum conversion is governed by the efficiency of acousto-optic diffraction.

  13. Quantitative performance of a polarization diffraction grating polarimeter encoded onto two liquid-crystal-on-silicon displays

    NASA Astrophysics Data System (ADS)

    Cofré, Aarón; Vargas, Asticio; Torres-Ruiz, Fabián A.; Campos, Juan; Lizana, Angel; del Mar Sánchez-López, María; Moreno, Ignacio

    2017-11-01

    We present a quantitative analysis of the performance of a complete snapshot polarimeter based on a polarization diffraction grating (PDGr). The PDGr is generated in a common path polarization interferometer with a Z optical architecture that uses two liquid-crystal on silicon (LCoS) displays to imprint two different phase-only diffraction gratings onto two orthogonal linear states of polarization. As a result, we obtain a programmable PDGr capable to act as a simultaneous polarization state generator (PSG), yielding diffraction orders with different states of polarization. The same system is also shown to operate as a polarization state analyzer (PSA), therefore useful for the realization of a snapshot polarimeter. We analyze its performance using quantitative metrics such as the conditional number, and verify its reliability for the detection of states of polarization.

  14. Expression, purification, crystallization and preliminary X-ray analysis of conjugated polyketone reductase C2 (CPR-C2) from Candida parapsilosis IFO 0708

    PubMed Central

    Yamamura, Akihiro; Maruoka, Shintaro; Ohtsuka, Jun; Miyakawa, Takuya; Nagata, Koji; Kataoka, Michihiko; Kitamura, Nahoko; Shimizu, Sakayu; Tanokura, Masaru

    2009-01-01

    Conjugated polyketone reductase C2 (CPR-C2) from Candida parapsilosis IFO 0708 is a member of the NADPH-dependent aldo-keto reductase (AKR) superfamily and catalyzes the stereospecific reduction of ketopantoyl lactone to d-pantoyl lactone. A diffraction-quality crystal of recombinant CPR-C2 was obtained by the sitting-drop vapour-diffusion method using PEG 3350 as the precipitant. The crystal diffracted X-rays to 1.7 Å resolution on beamline NW12A of the Photon Factory-Advanced Ring (Tsukuba, Japan). The crystal belonged to space group P212121, with unit-cell parameters a = 55.02, b = 68.30, c = 68.93 Å. The Matthews coefficient (V M = 1.76 Å3 Da−1) indicated that the crystal contained one CPR-C2 molecule per asymmetric unit. PMID:19923737

  15. Expression, purification, crystallization and preliminary X-ray analysis of conjugated polyketone reductase C2 (CPR-C2) from Candida parapsilosis IFO 0708.

    PubMed

    Yamamura, Akihiro; Maruoka, Shintaro; Ohtsuka, Jun; Miyakawa, Takuya; Nagata, Koji; Kataoka, Michihiko; Kitamura, Nahoko; Shimizu, Sakayu; Tanokura, Masaru

    2009-11-01

    Conjugated polyketone reductase C2 (CPR-C2) from Candida parapsilosis IFO 0708 is a member of the NADPH-dependent aldo-keto reductase (AKR) superfamily and catalyzes the stereospecific reduction of ketopantoyl lactone to d-pantoyl lactone. A diffraction-quality crystal of recombinant CPR-C2 was obtained by the sitting-drop vapour-diffusion method using PEG 3350 as the precipitant. The crystal diffracted X-rays to 1.7 angstrom resolution on beamline NW12A of the Photon Factory-Advanced Ring (Tsukuba, Japan). The crystal belonged to space group P2(1)2(1)2(1), with unit-cell parameters a = 55.02, b = 68.30, c = 68.93 angstrom. The Matthews coefficient (V(M) = 1.76 angstrom(3) Da(-1)) indicated that the crystal contained one CPR-C2 molecule per asymmetric unit.

  16. Purification, crystallization, preliminary X-ray diffraction and molecular-replacement studies of great cormorant (Phalacrocorax carbo) haemoglobin.

    PubMed

    Jagadeesan, G; Malathy, P; Gunasekaran, K; Harikrishna Etti, S; Aravindhan, S

    2014-11-01

    Haemoglobin is the iron-containing oxygen-transport metalloprotein that is present in the red blood cells of all vertebrates. In recent decades, there has been substantial interest in attempting to understand the structural basis and functional diversity of avian haemoglobins. Towards this end, purification, crystallization, preliminary X-ray diffraction and molecular-replacement studies have been carried out on cormorant (Phalacrocorax carbo) haemoglobin. Crystals were grown by the hanging-drop vapour-diffusion method using PEG 3350, NaCl and glycerol as precipitants. The crystals belonged to the trigonal system P3₁21, with unit-cell parameters a=b=55.64, c=153.38 Å, β=120.00°; a complete data set was collected to a resolution of 3.5 Å. Matthews coefficient analysis indicated that the crystals contained a half-tetramer in the asymmetric unit.

  17. X-ray laser diffraction for structure determination of the rhodopsin-arrestin complex

    NASA Astrophysics Data System (ADS)

    Zhou, X. Edward; Gao, Xiang; Barty, Anton; Kang, Yanyong; He, Yuanzheng; Liu, Wei; Ishchenko, Andrii; White, Thomas A.; Yefanov, Oleksandr; Han, Gye Won; Xu, Qingping; de Waal, Parker W.; Suino-Powell, Kelly M.; Boutet, Sébastien; Williams, Garth J.; Wang, Meitian; Li, Dianfan; Caffrey, Martin; Chapman, Henry N.; Spence, John C. H.; Fromme, Petra; Weierstall, Uwe; Stevens, Raymond C.; Cherezov, Vadim; Melcher, Karsten; Xu, H. Eric

    2016-04-01

    Serial femtosecond X-ray crystallography (SFX) using an X-ray free electron laser (XFEL) is a recent advancement in structural biology for solving crystal structures of challenging membrane proteins, including G-protein coupled receptors (GPCRs), which often only produce microcrystals. An XFEL delivers highly intense X-ray pulses of femtosecond duration short enough to enable the collection of single diffraction images before significant radiation damage to crystals sets in. Here we report the deposition of the XFEL data and provide further details on crystallization, XFEL data collection and analysis, structure determination, and the validation of the structural model. The rhodopsin-arrestin crystal structure solved with SFX represents the first near-atomic resolution structure of a GPCR-arrestin complex, provides structural insights into understanding of arrestin-mediated GPCR signaling, and demonstrates the great potential of this SFX-XFEL technology for accelerating crystal structure determination of challenging proteins and protein complexes.

  18. Conformational dimorphism of isochroman-1-ones in the solid state

    NASA Astrophysics Data System (ADS)

    Babjaková, Eva; Hanulíková, Barbora; Dastychová, Lenka; Kuřitka, Ivo; Nečas, Marek; Vícha, Robert

    2014-12-01

    Isochroman-1-one derivatives, which are relatives of coumarins, display a broad spectrum of biological activity; therefore, these derivatives attract the attention of chemists. A series of new isochroman-1-ones were prepared by the reaction of benzyl-derived Grignard reagents with acyl chlorides. All of the prepared compounds were characterized using single-crystal X-ray diffraction as well as FT-IR, NMR and MS techniques. Single crystal X-ray diffraction analysis revealed that the isochromanones can adopt two distinct conformations in the solid state. For one of the compounds, two polymorphs with unique forms crystallized separately under different temperatures. The packing of all of the examined crystals is stabilized via weak intramolecular C-H⋯π and/or C-H⋯O interactions. Although the closed conformer was predominantly found in the actual crystals, the open conformer is thermochemically more stable for all of the examined compounds according to DFT calculations.

  19. X-ray laser diffraction for structure determination of the rhodopsin-arrestin complex.

    PubMed

    Zhou, X Edward; Gao, Xiang; Barty, Anton; Kang, Yanyong; He, Yuanzheng; Liu, Wei; Ishchenko, Andrii; White, Thomas A; Yefanov, Oleksandr; Han, Gye Won; Xu, Qingping; de Waal, Parker W; Suino-Powell, Kelly M; Boutet, Sébastien; Williams, Garth J; Wang, Meitian; Li, Dianfan; Caffrey, Martin; Chapman, Henry N; Spence, John C H; Fromme, Petra; Weierstall, Uwe; Stevens, Raymond C; Cherezov, Vadim; Melcher, Karsten; Xu, H Eric

    2016-04-12

    Serial femtosecond X-ray crystallography (SFX) using an X-ray free electron laser (XFEL) is a recent advancement in structural biology for solving crystal structures of challenging membrane proteins, including G-protein coupled receptors (GPCRs), which often only produce microcrystals. An XFEL delivers highly intense X-ray pulses of femtosecond duration short enough to enable the collection of single diffraction images before significant radiation damage to crystals sets in. Here we report the deposition of the XFEL data and provide further details on crystallization, XFEL data collection and analysis, structure determination, and the validation of the structural model. The rhodopsin-arrestin crystal structure solved with SFX represents the first near-atomic resolution structure of a GPCR-arrestin complex, provides structural insights into understanding of arrestin-mediated GPCR signaling, and demonstrates the great potential of this SFX-XFEL technology for accelerating crystal structure determination of challenging proteins and protein complexes.

  20. Purification, crystallization and preliminary X-ray analysis of urease from pigeon pea (Cajanus cajan)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Balasubramanian, Anuradha; Ponnuraj, Karthe, E-mail: pkarthe@hotmail.com

    Urease from pigeon pea was purified and crystallized and X-ray diffraction data were collected at 2.5 Å resolution. Urease is a seed protein that is common to most Leguminosae. It also occurs in many bacteria, fungi and several species of yeast. Urease catalyzes the hydrolysis of urea to ammonia and carbon dioxide, thus allowing organisms to use exogenous and internally generated urea as a nitrogen source. Urease from pigeon pea seeds has been purified to electrophoretic homogeneity using a series of steps involving ammonium sulfate fractionation, acid precipitation, ion-exchange and size-exclusion chromatography techniques. The pigeon pea urease was crystallized andmore » the resulting crystals diffracted to 2.5 Å resolution. The crystals belong to the rhombohedral space group R32, with unit-cell parameters a = b = 176.29, c = 346.44 Å.« less

  1. X-ray laser diffraction for structure determination of the rhodopsin-arrestin complex

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhou, X. Edward; Gao, Xiang; Barty, Anton

    Here, serial femtosecond X-ray crystallography (SFX) using an X-ray free electron laser (XFEL) is a recent advancement in structural biology for solving crystal structures of challenging membrane proteins, including G-protein coupled receptors (GPCRs), which often only produce microcrystals. An XFEL delivers highly intense X-ray pulses of femtosecond duration short enough to enable the collection of single diffraction images before significant radiation damage to crystals sets in. Here we report the deposition of the XFEL data and provide further details on crystallization, XFEL data collection and analysis, structure determination, and the validation of the structural model. The rhodopsin-arrestin crystal structure solvedmore » with SFX represents the first near-atomic resolution structure of a GPCR-arrestin complex, provides structural insights into understanding of arrestin-mediated GPCR signaling, and demonstrates the great potential of this SFX-XFEL technology for accelerating crystal structure determination of challenging proteins and protein complexes.« less

  2. X-ray laser diffraction for structure determination of the rhodopsin-arrestin complex

    PubMed Central

    Zhou, X. Edward; Gao, Xiang; Barty, Anton; Kang, Yanyong; He, Yuanzheng; Liu, Wei; Ishchenko, Andrii; White, Thomas A.; Yefanov, Oleksandr; Han, Gye Won; Xu, Qingping; de Waal, Parker W.; Suino-Powell, Kelly M.; Boutet, Sébastien; Williams, Garth J.; Wang, Meitian; Li, Dianfan; Caffrey, Martin; Chapman, Henry N.; Spence, John C.H.; Fromme, Petra; Weierstall, Uwe; Stevens, Raymond C.; Cherezov, Vadim; Melcher, Karsten; Xu, H. Eric

    2016-01-01

    Serial femtosecond X-ray crystallography (SFX) using an X-ray free electron laser (XFEL) is a recent advancement in structural biology for solving crystal structures of challenging membrane proteins, including G-protein coupled receptors (GPCRs), which often only produce microcrystals. An XFEL delivers highly intense X-ray pulses of femtosecond duration short enough to enable the collection of single diffraction images before significant radiation damage to crystals sets in. Here we report the deposition of the XFEL data and provide further details on crystallization, XFEL data collection and analysis, structure determination, and the validation of the structural model. The rhodopsin-arrestin crystal structure solved with SFX represents the first near-atomic resolution structure of a GPCR-arrestin complex, provides structural insights into understanding of arrestin-mediated GPCR signaling, and demonstrates the great potential of this SFX-XFEL technology for accelerating crystal structure determination of challenging proteins and protein complexes. PMID:27070998

  3. X-ray laser diffraction for structure determination of the rhodopsin-arrestin complex

    DOE PAGES

    Zhou, X. Edward; Gao, Xiang; Barty, Anton; ...

    2016-04-12

    Here, serial femtosecond X-ray crystallography (SFX) using an X-ray free electron laser (XFEL) is a recent advancement in structural biology for solving crystal structures of challenging membrane proteins, including G-protein coupled receptors (GPCRs), which often only produce microcrystals. An XFEL delivers highly intense X-ray pulses of femtosecond duration short enough to enable the collection of single diffraction images before significant radiation damage to crystals sets in. Here we report the deposition of the XFEL data and provide further details on crystallization, XFEL data collection and analysis, structure determination, and the validation of the structural model. The rhodopsin-arrestin crystal structure solvedmore » with SFX represents the first near-atomic resolution structure of a GPCR-arrestin complex, provides structural insights into understanding of arrestin-mediated GPCR signaling, and demonstrates the great potential of this SFX-XFEL technology for accelerating crystal structure determination of challenging proteins and protein complexes.« less

  4. Diffraction Techniques in Structural Biology

    PubMed Central

    Egli, Martin

    2016-01-01

    A detailed understanding of chemical and biological function and the mechanisms underlying the molecular activities ultimately requires atomic-resolution structural data. Diffraction-based techniques such as single-crystal X-ray crystallography, electron microscopy, and neutron diffraction are well established and they have paved the road to the stunning successes of modern-day structural biology. The major advances achieved in the last 20 years in all aspects of structural research, including sample preparation, crystallization, the construction of synchrotron and spallation sources, phasing approaches, and high-speed computing and visualization, now provide specialists and nonspecialists alike with a steady flow of molecular images of unprecedented detail. The present unit combines a general overview of diffraction methods with a detailed description of the process of a single-crystal X-ray structure determination experiment, from chemical synthesis or expression to phasing and refinement, analysis, and quality control. For novices it may serve as a stepping-stone to more in-depth treatises of the individual topics. Readers relying on structural information for interpreting functional data may find it a useful consumer guide. PMID:27248784

  5. Diffraction Techniques in Structural Biology

    PubMed Central

    Egli, Martin

    2010-01-01

    A detailed understanding of chemical and biological function and the mechanisms underlying the activities ultimately requires atomic-resolution structural data. Diffraction-based techniques such as single-crystal X-ray crystallography, electron microscopy and neutron diffraction are well established and have paved the road to the stunning successes of modern-day structural biology. The major advances achieved in the last 20 years in all aspects of structural research, including sample preparation, crystallization, the construction of synchrotron and spallation sources, phasing approaches and high-speed computing and visualization, now provide specialists and non-specialists alike with a steady flow of molecular images of unprecedented detail. The present chapter combines a general overview of diffraction methods with a step-by-step description of the process of a single-crystal X-ray structure determination experiment, from chemical synthesis or expression to phasing and refinement, analysis and quality control. For novices it may serve as a stepping-stone to more in-depth treatises of the individual topics. Readers relying on structural information for interpreting functional data may find it a useful consumer guide. PMID:20517991

  6. Diffraction Techniques in Structural Biology.

    PubMed

    Egli, Martin

    2016-06-01

    A detailed understanding of chemical and biological function and the mechanisms underlying the molecular activities ultimately requires atomic-resolution structural data. Diffraction-based techniques such as single-crystal X-ray crystallography, electron microscopy, and neutron diffraction are well established and they have paved the road to the stunning successes of modern-day structural biology. The major advances achieved in the last twenty years in all aspects of structural research, including sample preparation, crystallization, the construction of synchrotron and spallation sources, phasing approaches, and high-speed computing and visualization, now provide specialists and nonspecialists alike with a steady flow of molecular images of unprecedented detail. The present unit combines a general overview of diffraction methods with a detailed description of the process of a single-crystal X-ray structure determination experiment, from chemical synthesis or expression to phasing and refinement, analysis, and quality control. For novices it may serve as a stepping-stone to more in-depth treatises of the individual topics. Readers relying on structural information for interpreting functional data may find it a useful consumer guide. © 2016 by John Wiley & Sons, Inc. Copyright © 2016 John Wiley & Sons, Inc.

  7. A multi-dataset data-collection strategy produces better diffraction data

    PubMed Central

    Liu, Zhi-Jie; Chen, Lirong; Wu, Dong; Ding, Wei; Zhang, Hua; Zhou, Weihong; Fu, Zheng-Qing; Wang, Bi-Cheng

    2011-01-01

    A multi-dataset (MDS) data-collection strategy is proposed and analyzed for macromolecular crystal diffraction data acquisition. The theoretical analysis indicated that the MDS strategy can reduce the standard deviation (background noise) of diffraction data compared with the commonly used single-dataset strategy for a fixed X-ray dose. In order to validate the hypothesis experimentally, a data-quality evaluation process, termed a readiness test of the X-ray data-collection system, was developed. The anomalous signals of sulfur atoms in zinc-free insulin crystals were used as the probe to differentiate the quality of data collected using different data-collection strategies. The data-collection results using home-laboratory-based rotating-anode X-ray and synchrotron X-ray systems indicate that the diffraction data collected with the MDS strategy contain more accurate anomalous signals from sulfur atoms than the data collected with a regular data-collection strategy. In addition, the MDS strategy offered more advantages with respect to radiation-damage-sensitive crystals and better usage of rotating-anode as well as synchrotron X-rays. PMID:22011470

  8. Crystallization and X-ray diffraction analysis of salicylate synthase, a chorismate-utilizing enyme involved in siderophore biosynthesis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Parsons, James F., E-mail: parsonsj@umbi.umd.edu; Shi, Katherine; Calabrese, Kelly

    2006-03-01

    Salicylate synthase, which catalyzes the first step in the synthesis of the siderophore yersiniabactin, has been crystallized. Diffraction data have been collected to 2.5 Å. Bacteria have evolved elaborate schemes that help them thrive in environments where free iron is severely limited. Siderophores such as yersiniabactin are small iron-scavenging molecules that are deployed by bacteria during iron starvation. Several studies have linked siderophore production and virulence. Yersiniabactin, produced by several Enterobacteriaceae, is derived from the key metabolic intermediate chorismic acid via its conversion to salicylate by salicylate synthase. Crystals of salicylate synthase from the uropathogen Escherichia coli CFT073 have beenmore » grown by vapour diffusion using polyethylene glycol as the precipitant. The monoclinic (P2{sub 1}) crystals diffract to 2.5 Å. The unit-cell parameters are a = 57.27, b = 164.07, c = 59.04 Å, β = 108.8°. The solvent content of the crystals is 54% and there are two molecules of the 434-amino-acid protein in the asymmetric unit. It is anticipated that the structure will reveal key details about the reaction mechanism and the evolution of salicylate synthase.« less

  9. CFA-4 - a fluorinated metal-organic framework with exchangeable interchannel cations.

    PubMed

    Fritzsche, J; Grzywa, M; Denysenko, D; Bon, V; Senkovska, I; Kaskel, S; Volkmer, D

    2017-05-23

    The syntheses and crystal structures of the fluorinated linker 1,4-bis(3,5-bis(trifluoromethyl)-1H-pyrazole-4-yl)benzene (H 2 -tfpb; 1) and the novel metal-organic framework family M[CFA-4] (Coordination Framework Augsburg University-4), M[Cu 5 (tfpb) 3 ] (M = Cu(i), K, Cs, Ca(0.5)), are described. The ligand 1 is fully characterized by single crystal X-ray diffraction, photoluminescence-, NMR-, IR spectroscopy, and mass spectrometry. The copper(i)-containing MOF crystallizes in the hexagonal crystal system within the chiral space group P6 3 22 (no. 182) and the unit cell parameters are as follows: a = 23.630(5) Å, c = 41.390(5) Å, V = 20 015(6) Å 3 . M[CFA-4] features a porous 3-D structure constructed from pentanuclear copper(i) secondary building units {Cu(pz) 6 } - (pz = pyrazolate). Cu(I)[CFA-4] is fully characterized by synchrotron single crystal X-ray diffraction, thermogravimetric analysis, variable temperature powder X-ray diffraction, IR spectroscopy, photoluminescence and gas sorption measurements. Moreover, thermal stability and gas sorption properties of K[CFA-4] and Cu(I)[CFA-4] are compared.

  10. High Resolution X-Ray Diffraction of Macromolecules with Synchrotron Radiation

    NASA Technical Reports Server (NTRS)

    Stojanoff, Vivian; Boggon, Titus; Helliwell, John R.; Judge, Russell; Olczak, Alex; Snell, Edward H.; Siddons, D. Peter; Rose, M. Franklin (Technical Monitor)

    2000-01-01

    We recently combined synchrotron-based monochromatic X-ray diffraction topography methods with triple axis diffractometry and rocking curve measurements: high resolution X-ray diffraction imaging techniques, to better understand the quality of protein crystals. We discuss these methods in the light of results obtained on crystals grown under different conditions. These non destructive techniques are powerful tools in the characterization of the protein crystals and ultimately will allow to improve, develop, and understand protein crystal growth. High resolution X-ray diffraction imaging methods will be discussed in detail in light of recent results obtained on Hen Egg White Lysozyme crystals and other proteins.

  11. Crystallization and preliminary X-ray diffraction study of the protealysin precursor belonging to the peptidase family M4

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gromova, T. Yu., E-mail: duk@img.ras.ru; Demidyuk, I. V.; Kostrov, S. V.

    2008-09-15

    A protealysin precursor (the enzyme of the peptidase family M4) was crystallized for the first time. The crystal-growth conditions were found, and single crystals of the protein with dimensions of 0.3-0.5 mm were grown. The preliminary X-ray diffraction study of the enzyme was performed. The protealysin precursor was shown to crystallize in two crystal modifications suitable for the X-ray diffraction study of the three-dimensional structure of the protein molecule at atomic resolution.

  12. Synthesis, high-resolution NMR spectroscopic analysis, and single-crystal X-ray diffraction of isoxazoline tetracycles.

    PubMed

    Fascio, Mirta L; Alvarez-Larena, Angel; D'Accorso, Norma B

    2002-11-29

    Three isoxazoline tetracycles were obtained enantiomerically pure by intramolecular 1,3-dipolar cycloaddition. The characterization of the new compounds was performed by high-resolution 1H and 13C NMR spectroscopy. The relative configuration of the new chiral centers was determined by NOESY experiments and confirmed by single-crystal X-ray structural analysis.

  13. Growth and characterization of an organic single crystal: 2-[2-(4-Diethylamino-phenyl)-vinyl]-1-methyl-pyridinium iodide

    NASA Astrophysics Data System (ADS)

    Senthil, K.; Kalainathan, S.; Ruban Kumar, A.

    Optically transparent crystal of the organic salt DEASI (2-[2-(4-Diethylamino-phenyl)-vinyl]-1-methyl-pyridinium iodide) has been synthesized by using knoevenagel condensation reaction method. The synthesized material has been purified by successfully recrystallization process. Single crystals of DEASI have been grown by slow evaporation technique at room temperature. The solubility of the title material has been determined at different temperature in acetonitrile/methanol mixture. The cell parameters and crystallinity of the title crystal were determined by single crystal XRD. The powder diffraction was carried out to study the reflection plane of the grown crystal and diffraction peaks were indexed. The presence of different functional groups in the crystal was confirmed by Fourier transform infrared (FTIR) analysis. 1H NMR spectrum was recorded to confirm the presence of hydrogen nuclei in the synthesized material. The optical property of the title crystal was studied by UV-Vis-NIR spectroscopic analysis. The melting point and thermal property of DEASI were studied using TGA/DSC technique. The Vicker’s hardness (Hv) was carried out to know the category. The dielectric constant and dielectric loss of the compound decreases with an increase in frequencies. Chemical etching studies showed that the DEASI grows in the two dimensional growth mechanisms. The Kurtz-Perry powder second harmonic generation (SHG) test has done for title crystal.

  14. Growth and characterization of an organic single crystal: 2-[2-(4-diethylamino-phenyl)-vinyl]-1-methyl-pyridinium iodide.

    PubMed

    Senthil, K; Kalainathan, S; Ruban Kumar, A

    2014-05-05

    Optically transparent crystal of the organic salt DEASI (2-[2-(4-Diethylamino-phenyl)-vinyl]-1-methyl-pyridinium iodide) has been synthesized by using knoevenagel condensation reaction method. The synthesized material has been purified by successfully recrystallization process. Single crystals of DEASI have been grown by slow evaporation technique at room temperature. The solubility of the title material has been determined at different temperature in acetonitrile/methanol mixture. The cell parameters and crystallinity of the title crystal were determined by single crystal XRD. The powder diffraction was carried out to study the reflection plane of the grown crystal and diffraction peaks were indexed. The presence of different functional groups in the crystal was confirmed by Fourier transform infrared (FTIR) analysis. (1)H NMR spectrum was recorded to confirm the presence of hydrogen nuclei in the synthesized material. The optical property of the title crystal was studied by UV-Vis-NIR spectroscopic analysis. The melting point and thermal property of DEASI were studied using TGA/DSC technique. The Vicker's hardness (Hv) was carried out to know the category. The dielectric constant and dielectric loss of the compound decreases with an increase in frequencies. Chemical etching studies showed that the DEASI grows in the two dimensional growth mechanisms. The Kurtz-Perry powder second harmonic generation (SHG) test has done for title crystal. Copyright © 2014 Elsevier B.V. All rights reserved.

  15. High pressure single-crystal micro X-ray diffraction analysis with GSE_ADA/RSV software

    NASA Astrophysics Data System (ADS)

    Dera, Przemyslaw; Zhuravlev, Kirill; Prakapenka, Vitali; Rivers, Mark L.; Finkelstein, Gregory J.; Grubor-Urosevic, Ognjen; Tschauner, Oliver; Clark, Simon M.; Downs, Robert T.

    2013-08-01

    GSE_ADA/RSV is a free software package for custom analysis of single-crystal micro X-ray diffraction (SCμXRD) data, developed with particular emphasis on data from samples enclosed in diamond anvil cells and subject to high pressure conditions. The package has been in extensive use at the high pressure beamlines of Advanced Photon Source (APS), Argonne National Laboratory and Advanced Light Source (ALS), Lawrence Berkeley National Laboratory. The software is optimized for processing of wide-rotation images and includes a variety of peak intensity corrections and peak filtering features, which are custom-designed to make processing of high pressure SCμXRD easier and more reliable.

  16. Crystallographic Phasing from Weak Anomalous Signals

    PubMed Central

    Liu, Qun; Hendrickson, Wayne A.

    2015-01-01

    The exploitation of anomalous signals for biological structural solution is maturing. Single-wavelength anomalous diffraction (SAD) is dominant in de novo structure analysis. Nevertheless, for challenging structures where the resolution is low (dmin ≥ 3.5 Å) or where only lighter atoms (Z ≤ 20) are present, as for native macromolecules, solved SAD structures are still scarce. With the recent rapid development in crystal handling, beamline instrumentation, optimization of data collection strategies, use of multiple crystals and structure determination technologies, the weak anomalous diffraction signals are now robustly measured and should be used for routine SAD structure determination. The review covers these recent advances on weak anomalous signals measurement, analysis and utilization. PMID:26432413

  17. Native MS and ECD Characterization of a Fab-Antigen Complex May Facilitate Crystallization for X-ray Diffraction

    NASA Astrophysics Data System (ADS)

    Zhang, Ying; Cui, Weidong; Wecksler, Aaron T.; Zhang, Hao; Molina, Patricia; Deperalta, Galahad; Gross, Michael L.

    2016-07-01

    Native mass spectrometry (MS) and top-down electron-capture dissociation (ECD) combine as a powerful approach for characterizing large proteins and protein assemblies. Here, we report their use to study an antibody Fab (Fab-1)-VEGF complex in its near-native state. Native ESI with analysis by FTICR mass spectrometry confirms that VEGF is a dimer in solution and that its complex with Fab-1 has a binding stoichiometry of 2:2. Applying combinations of collisionally activated dissociation (CAD), ECD, and infrared multiphoton dissociation (IRMPD) allows identification of flexible regions of the complex, potentially serving as a guide for crystallization and X-ray diffraction analysis.

  18. Crystallographic phasing from weak anomalous signals.

    PubMed

    Liu, Qun; Hendrickson, Wayne A

    2015-10-01

    The exploitation of anomalous signals for biological structural solution is maturing. Single-wavelength anomalous diffraction (SAD) is dominant in de novo structure analysis. Nevertheless, for challenging structures where the resolution is low (dmin≥3.5Å) or where only lighter atoms (Z≤20) are present, as for native macromolecules, solved SAD structures are still scarce. With the recent rapid development in crystal handling, beamline instrumentation, optimization of data collection strategies, use of multiple crystals and structure determination technologies, the weak anomalous diffraction signals are now robustly measured and should be used for routine SAD structure determination. The review covers these recent advances on weak anomalous signals measurement, analysis and utilization. Copyright © 2015 Elsevier Ltd. All rights reserved.

  19. Single crystal X-ray diffraction study of the HgBa2CuO4+δ superconducting compound

    NASA Astrophysics Data System (ADS)

    Bordet, P.; Duc, F.; Lefloch, S.; Capponi, J. J.; Alexandre, E.; Rosa-Nunes, M.; Antipov, E. V.; Putilin, S.

    1996-02-01

    A high precision X-ray diffraction analysis up to sin θ/λ = 1.15 of a HgBa2CuO4+δ single crystal having a Tc of ~ 90 K is presented. The cell parameters are a = 3.8815(4), c = 9.485 (7) Å. The refinements indicate the existence of a split barium site due to the presence of excess oxygen in the mercury layer. The position of this excess oxygen might be slightly displaced from the (1/2 1/2 0) position. A 6% mercury deficiency is observed. Models, including mercury defects, substitution by copper cations, or carbonate groups, are compared. However, we obtain no definite evidence for either of the three models. A possible disorder of the Hg position, due to the formation of chemical bonds with neighbouring extra oxygen anions, could correlate to the refinements of mixed species at the Hg site. A low temperature single crystal x-ray diffraction study, and comparison of refinements for the same single crystal with different extra oxygen contents, are in progress to help clarify this problem.

  20. Crystallization and preliminary X-ray diffraction analysis of mouse 3(17)α-hydroxysteroid dehydrogenase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    El-Kabbani, Ossama, E-mail: ossama.el-kabbani@vcp.monash.edu.au; Ishikura, Syuhei; Wagner, Armin

    2005-07-01

    Orthorhombic crystals of mouse 3(17)α-hydroxysteroid dehydrogenase were obtained from buffered polyethylene glycol solutions. The crystals diffracted to a resolution of 1.8 Å at the Swiss Light Source beamline X06SA. The 3(17)α-hydroxysteroid dehydrogenase from mouse is involved in the metabolism of oestrogens, androgens, neurosteroids and xenobiotic compounds. The enzyme was crystallized by the hanging-drop vapour-diffusion method in space group P222{sub 1}, with unit-cell parameters a = 84.91, b = 84.90, c = 95.83 Å. The Matthews coefficient (V{sub M}) and the solvent content were 2.21 Å{sup 3} Da{sup −1} and 44.6%, respectively, assuming the presence of two molecules in the asymmetricmore » unit. Diffraction data were collected to a resolution of 1.8 Å at the Swiss Light Source beamline X06SA using a MAR CCD area detector and gave a data set with an overall R{sub merge} of 6.8% and a completeness of 91.1%.« less

  1. Purification, crystallization and preliminary X-ray analysis of Escherichia coli UDP-N-acetylmuramoyl:L-alanine ligase (MurC).

    PubMed

    Deva, Taru; Pryor, KellyAnn D; Leiting, Barbara; Baker, Edward N; Smith, Clyde A

    2003-08-01

    UDP-N-acetylmuramoyl:L-alanine ligase (MurC) is involved in the pathway leading from UDP-N-glucosamine to the UDP-N-acetylmuramoyl:pentapeptide unit, which is the building block for the peptidoglycan layer found in all bacterial cell walls. The pathways leading to the biosynthesis of the peptidoglycan layer are important targets for the development of novel antibiotics, since animal cells do not contain these pathways. MurC is the first of four similar ATP-dependent amide-bond ligases which share primary and tertiary structural similarities. The crystal structures of three of these have been determined by X-ray crystallography, giving insights into the binding of the carbohydrate substrate and the ATP. Diffraction-quality crystals of the enzyme MurC have been obtained in both native and selenomethionine forms and X-ray diffraction data have been collected at the Se edge at a synchrotron source. The crystals are orthorhombic, with unit-cell parameters a = 73.9, b = 93.6, c = 176.8 A, and diffraction has been observed to 2.6 A resolution.

  2. Expression, purification, crystallization and preliminary X-ray diffraction analysis of the VP8* sialic acid-binding domain of porcine rotavirus strain OSU

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Yang-De, E-mail: zhangyd1960@yahoo.com.cn; Li, Hao; Liu, Hui

    2007-02-01

    Porcine rotavirus strain OSU VP8* domain has been expressed, purified and crystallized. X-ray diffraction data from different crystal forms of the VP8* domain have been collected to 2.65 and 2.2 Å resolution, respectively. The rotavirus outer capsid spike protein VP4 is utilized in the process of rotavirus attachment to and membrane penetration of host cells. VP4 is cleaved by trypsin into two domains: VP8* and VP5*. The VP8* domain is implicated in initial interaction with sialic acid-containing cell-surface carbohydrates and triggers subsequent virus invasion. The VP8* domain from porcine OSU rotavirus was cloned and expressed in Escherichia coli. Different crystalmore » forms (orthorhombic P2{sub 1}2{sub 1}2{sub 1} and tetragonal P4{sub 1}2{sub 1}2) were harvested from two distinct crystallization conditions. Diffraction data have been collected to 2.65 and 2.2 Å resolution and the VP8*{sub 65–224} structure was determined by molecular replacement.« less

  3. Optical Anisotropy of Photonic Crystals of Cubic Symmetry Induced by Multiple Diffraction of Light

    NASA Astrophysics Data System (ADS)

    Ukleev, T. A.; Shevchenko, N. N.; Iurasova, D. I.; Sel'kin, A. V.

    2018-05-01

    The optical spectra of Bragg reflection from opal-like photonic crystals under conditions of the resonant enhancement of the multiple diffraction of light have been studied experimentally and theoretically using the photonic crystal structures prepared of monodisperse polystyrene globules. It is shown that the reflection signal registered in mutually orthogonal configurations of the polarizer and analyzer is related to the intrinsic optical anisotropy of the crystals and is a specific manifestation of the multiple Bragg diffraction in three-dimensional photonic crystals.

  4. Crystallization and X-ray diffraction analysis of the HMG domain of the chondrogenesis master regulator Sox9 in complex with a ChIP-Seq-identified DNA element

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vivekanandan, Saravanan; Moovarkumudalvan, Balasubramanian; Lescar, Julien

    Sox9 is a fundamental sex-determining gene and the master regulator of chondrogenesis, and is involved in the development of various vital organs such as testes, kidney, heart and brain, and in skeletal development. Similar to other known Sox transcription factors, Sox9 recognizes and binds DNA with the consensus sequence C(T/A)TTG(T/A)(T/A) through the highly conserved HMG domain. Nonetheless, the molecular basis of the functional specificity of Sox9 in key developmental processes is still unclear. As an initial step towards a mechanistic understanding of Sox9 transcriptional regulation, the current work describes the details of the purification of the mouse Sox9 HMG domainmore » (mSox9HMG), its crystallization in complex with a ChIP-Seq-identified FOXP2 promoter DNA element and the X-ray diffraction data analysis of this complex. The mSox9HMG–FOXP2 promoter DNA complex was crystallized by the hanging-drop vapour-diffusion method using 20% PEG 3350 in 200 mMsodium/potassium phosphate with 100 mMbis-tris propane at pH 8.5. The crystals diffracted to 2.7 Å resolution and the complex crystallized in the tetragonal space groupP4 12 12, with unit-cell parametersa=b= 99.49,c= 45.89 Å. Crystal-packing parameters revealed that asymmetric unit contained one mSox9HMG–FOXP2 promoter DNA complex with an estimated solvent content of 64%.« less

  5. Crystallization and preliminary X-ray diffraction analysis of mouse galectin-4 N-terminal carbohydrate recognition domain in complex with lactose

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Krejčiříková, Veronika; Fábry, Milan; Marková, Vladimíra

    2008-07-01

    Mouse galectin-4 carbohydrate binding domain was overexpressed in E. coli and crystallized in the presence of lactose. The crystals belong to tetragonal space group P42{sub 1}2 and diffraction data were collected to 2.1 Å resolution. Galectin-4 is thought to play a role in the process of tumour conversion of cells of the alimentary tract and the breast tissue; however, its exact function remains unknown. With the aim of elucidating the structural basis of mouse galectin-4 (mGal-4) binding specificity, we have undertaken X-ray analysis of the N-terminal domain, CRD1, of mGal-4 in complex with lactose (the basic building block of knownmore » galectin-4 carbohydrate ligands). Crystals of CRD1 in complex with lactose were obtained using vapour-diffusion techniques. The crystals belong to tetragonal space group P42{sub 1}2 with unit-cell parameters a = 91.1, b = 91.16, c = 57.10 Å and preliminary X-ray diffraction data were collected to 3.2 Å resolution. An optimized crystallization procedure and cryocooling protocol allowed us to extend resolution to 2.1 Å. Structure refinement is currently under way; the initial electron-density maps clearly show non-protein electron density in the vicinity of the carbohydrate binding site, indicating the presence of one lactose molecule. The structure will help to improve understanding of the binding specificity and function of the potential colon cancer marker galectin-4.« less

  6. Generation of Protein Crystals Using a Solution-Stirring Technique

    NASA Astrophysics Data System (ADS)

    Adachi, Hiroaki; Niino, Ai; Matsumura, Hiroyoshi; Takano, Kazufumi; Kinoshita, Takayoshi; Warizaya, Masaichi; Inoue, Tsuyoshi; Mori, Yusuke; Sasaki, Takatomo

    2004-06-01

    Crystals of bovine adenosine deaminase (ADA) were grown over a two week period in the presence of an inhibitor, whereas ADA crystals did not form using conventional crystallization methods when the inhibitor was excluded. To obtain ADA crystals in the absence of the inhibitor, a solution-stirring technique was used. The crystals obtained using this technique were found to be of high quality and were shown to have high structural resolution for X-ray diffraction analysis. The results of this study indicate that the stirring technique is a useful method for obtaining crystals of proteins that do not crystallize using conventional techniques.

  7. Purification, crystallization, preliminary X-ray diffraction and molecular-replacement studies of great cormorant (Phalacrocorax carbo) haemoglobin

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jagadeesan, G.; Malathy, P.; Gunasekaran, K.

    2014-10-25

    The great cormorant hemoglobin has been isolated, purified and crystallized and the three dimensional structure is solved using molecular replacement technique. Haemoglobin is the iron-containing oxygen-transport metalloprotein that is present in the red blood cells of all vertebrates. In recent decades, there has been substantial interest in attempting to understand the structural basis and functional diversity of avian haemoglobins. Towards this end, purification, crystallization, preliminary X-ray diffraction and molecular-replacement studies have been carried out on cormorant (Phalacrocorax carbo) haemoglobin. Crystals were grown by the hanging-drop vapour-diffusion method using PEG 3350, NaCl and glycerol as precipitants. The crystals belonged to themore » trigonal system P3{sub 1}21, with unit-cell parameters a = b = 55.64, c = 153.38 Å, β = 120.00°; a complete data set was collected to a resolution of 3.5 Å. Matthews coefficient analysis indicated that the crystals contained a half-tetramer in the asymmetric unit.« less

  8. Crystallization and preliminary X-ray crystallographic analysis of the tRNA-specific adenosine deaminase from Streptococcus pyogenes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ku, Min-Je; Lee, Won-Ho; Biotechnology and Genetic Engineering, Korea University, Seoul 136-701

    2005-04-01

    The tRNA-specific adenosine deaminase from the pathogenic bacteria S. pyogenes has been overexpressed and crystallized. The tRNA-specific adenosine deaminase from the pathogenic bacteria Streptococcus pyogenes (spTAD) has been overexpressed in Escherichia coli and crystallized in the presence of Zn{sup 2+} ion at 295 K using ammonium sulfate as a precipitant. Flash-cooled crystals of spTAD diffracted to 2.0 Å using 30%(v/v) glycerol as a cryoprotectant. X-ray diffraction data have been collected to 2.0 Å using synchrotron radiation. The crystal belongs to the tetragonal space group P4{sub 2}2{sub 1}2, with unit-cell parameters a = b = 81.042, c = 81.270 Å. Themore » asymmetric unit contains one subunit of spTAD, with a corresponding crystal volume per protein weight (V{sub M}) of 3.3 Å{sup 3} Da{sup −1} and a solvent content of 62.7%.« less

  9. Improving the diffraction of apoA-IV crystals through extreme dehydration.

    PubMed

    Deng, Xiaodi; Davidson, W Sean; Thompson, Thomas B

    2012-01-01

    Apolipoproteins are the protein component of high-density lipoproteins (HDL), which are necessary for mobilizing lipid-like molecules throughout the body. Apolipoproteins undergo self-association, especially at higher concentrations, making them difficult to crystallize. Here, the crystallization and diffraction of the core fragment of apolipoprotein A-IV (apoA-IV), consisting of residues 64-335, is presented. ApoA-IV(64-335) crystallized readily in a variety of hexagonal (P6) morphologies with similar unit-cell parameters, all containing a long axis of nearly 550 Å in length. Preliminary diffraction experiments with the different crystal morphologies all resulted in limited streaky diffraction to 3.5 Å resolution. Crystal dehydration was applied to the different morphologies with variable success and was also used as a quality indicator of crystal-growth conditions. The results show that the morphologies that withstood the most extreme dehydration conditions showed the greatest improvement in diffraction. One morphology in particular was able to withstand dehydration in 60% PEG 3350 for over 12 h, which resulted in well defined intensities to 2.7 Å resolution. These results suggest that the approach of integrating dehydration with variation in crystal-growth conditions might be a general technique to optimize diffraction. © 2012 International Union of Crystallography. All rights reserved.

  10. A history of neutrons in biology: the development of neutron protein crystallography at BNL and LANL.

    PubMed

    Schoenborn, Benno P

    2010-11-01

    The first neutron diffraction data were collected from crystals of myoglobin almost 42 years ago using a step-scan diffractometer with a single detector. Since then, major advances have been made in neutron sources, instrumentation and data collection and analysis, and in biochemistry. Fundamental discoveries about enzyme mechanisms, biological complex structures, protein hydration and H-atom positions have been and continue to be made using neutron diffraction. The promise of neutrons has not changed since the first crystal diffraction data were collected. Today, with the developments of beamlines at spallation neutron sources and the use of the Laue method for data collection, the field of neutrons in structural biology has renewed vitality.

  11. Crystallization and preliminary X-ray analysis of Leishmania major glyoxalase I

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ariza, Antonio; Vickers, Tim J.; Greig, Neil

    2005-08-01

    The detoxification enzyme glyoxalase I from L. major has been crystallized. Preliminary molecular-replacement calculations indicate the presence of three glyoxalase I dimers in the asymmetric unit. Glyoxalase I (GLO1) is a putative drug target for trypanosomatids, which are pathogenic protozoa that include the causative agents of leishmaniasis. Significant sequence and functional differences between Leishmania major and human GLO1 suggest that it may make a suitable template for rational inhibitor design. L. major GLO1 was crystallized in two forms: the first is extremely disordered and does not diffract, while the second, an orthorhombic form, produces diffraction to 2.0 Å. Molecular-replacement calculationsmore » indicate that there are three GLO1 dimers in the asymmetric unit, which take up a helical arrangement with their molecular dyads arranged approximately perpendicular to the c axis. Further analysis of these data are under way.« less

  12. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Aravind, Penmatsa; Rajini, Bheemreddy; Sharma, Yogendra

    The crystallization and preliminary X-ray diffraction analysis of AIM1g1, a βγ-crystallin domain of absent in melanoma (AIM1) protein from H. sapiens, is reported. AIM1g1 is a single βγ-crystallin domain from the protein absent in melanoma 1 (AIM1), which appears to play a role in the suppression of melanomas. This domain is known to bind calcium and its structure would help in identifying calcium-coordinating sites in vertebrate crystallins, which have hitherto been believed to have lost this ability during evolution. Crystallization of this domain was performed by the hanging-drop vapour-diffusion method. Crystals diffracted to a maximum resolution of 1.86 Å andmore » were found to belong to space group P6{sub 1} or P6{sub 5}, with unit-cell parameters a = b = 54.98, c = 59.73 Å. Solvent-content analysis indicated the presence of one monomer per asymmetric unit.« less

  13. A novel coordination polymer of Ni(II) based on 1,3,5-benzenetricarboxylic acid synthesis, characterization, crystal structure, thermal study, and luminescent properties

    NASA Astrophysics Data System (ADS)

    Saheli, Sania; Rezvani, Alireza

    2017-01-01

    A new metal-organic framework (MOF) formulated as [Ni(H2btc)(OH)(H2O)2] (1) (H3btc = 1,3,5-benzenetricarboxylic acid) was synthesized using the hydrothermal technique. The complex 1 was characterized by elemental analysis, infrared spectroscopy, and powder X-ray diffraction in addition to single crystal X-ray diffraction. X-ray crystal structural analysis displayed that the compound belonged to the monoclinic space group P21/n with cell parameters a = 6.8658(14) Å, b = 18.849(4) Å, c = 8.5608(17) Å. In the title complex, ligand is linked to metal centers through two μ-oxo bridges and forming a 2D layer which is led to form an interesting geometry. The thermal stability and fluorescence property of 1 have also been investigated.

  14. A new series of lanthanide coordination polymers with 2,2‧-bipyridine and glutaric acid: Synthesis, crystal structures and properties of [Ln(bipy)(glut)(NO3)

    NASA Astrophysics Data System (ADS)

    Wang, Chunguang; Xing, Yongheng; Li, Zhangpeng; Li, Jing; Zeng, Xiaoqing; Ge, Maofa; Niu, Shuyun

    2009-08-01

    A series of new lanthanide coordination polymers, with the formula [Ln(bipy)(glut)(NO 3)] (Ln = Eu ( 1), Tb ( 2), Sm ( 3), Pr ( 4); bipy = 2,2'-bipyridine; H 2glut = glutaric acid), have been synthesized under the hydrothermal condition and characterized by elemental analysis, IR spectroscopy, powder X-ray diffraction, and single-crystal X-ray diffraction. Structural analyses reveal that all four complexes are isostructural and crystallized in monoclinic system, P2 1/ c space group. For these complexes, the Ln 3+ are all linked through glutaric acid ligands to form 1D chain-like polymeric structures, and bipy and NO3- are coordinated on two sides of the chains. The thermogravimetric analysis of 1 and photoluminescent properties of 1 and 2 are discussed in detail.

  15. Growth and microtopographic study of CuInSe{sub 2} single crystals

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chauhan, Sanjaysinh M.; Chaki, Sunil, E-mail: sunilchaki@yahoo.co.in; Deshpande, M. P.

    2016-05-23

    The CuInSe{sub 2} single crystals were grown by chemical vapour transport (CVT) technique using iodine as transporting agent. The elemental composition of the as-grown CuInSe{sub 2} single crystals was determined by energy dispersive analysis of X-ray (EDAX). The unit cell crystal structure and lattice parameters were determined by X-ray diffraction (XRD) technique. The surface microtopographic study of the as-grown CuInSe{sub 2} single crystals surfaces were done to study the defects, growth mechanism, etc. of the CVT grown crystals.

  16. Micro-beam Laue alignment of multi-reflection Bragg coherent diffraction imaging measurements

    DOE PAGES

    Hofmann, Felix; Phillips, Nicholas W.; Harder, Ross J.; ...

    2017-08-08

    Multi-reflection Bragg coherent diffraction imaging has the potential to allow three-dimensional (3D) resolved measurements of the full lattice strain tensor in specific micro-crystals. Until now such measurements were hampered by the need for laborious, time-intensive alignment procedures. Here, in this paper, a different approach is demonstrated, using micro-beam Laue X-ray diffraction to first determine the lattice orientation of the micro-crystal. This information is then used to rapidly align coherent diffraction measurements of three or more reflections from the crystal. Based on these, 3D strain and stress fields in the crystal are successfully determined. This approach is demonstrated on a focusedmore » ion beam milled micro-crystal from which six reflections could be measured. Since information from more than three independent reflections is available, the reliability of the phases retrieved from the coherent diffraction data can be assessed. Lastly, our results show that rapid, reliable 3D coherent diffraction measurements of the full lattice strain tensor in specific micro-crystals are now feasible and can be successfully carried out even in heavily distorted samples.« less

  17. Micro-beam Laue alignment of multi-reflection Bragg coherent diffraction imaging measurements

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hofmann, Felix; Phillips, Nicholas W.; Harder, Ross J.

    Multi-reflection Bragg coherent diffraction imaging has the potential to allow three-dimensional (3D) resolved measurements of the full lattice strain tensor in specific micro-crystals. Until now such measurements were hampered by the need for laborious, time-intensive alignment procedures. Here, in this paper, a different approach is demonstrated, using micro-beam Laue X-ray diffraction to first determine the lattice orientation of the micro-crystal. This information is then used to rapidly align coherent diffraction measurements of three or more reflections from the crystal. Based on these, 3D strain and stress fields in the crystal are successfully determined. This approach is demonstrated on a focusedmore » ion beam milled micro-crystal from which six reflections could be measured. Since information from more than three independent reflections is available, the reliability of the phases retrieved from the coherent diffraction data can be assessed. Lastly, our results show that rapid, reliable 3D coherent diffraction measurements of the full lattice strain tensor in specific micro-crystals are now feasible and can be successfully carried out even in heavily distorted samples.« less

  18. Micro-beam Laue alignment of multi-reflection Bragg coherent diffraction imaging measurements.

    PubMed

    Hofmann, Felix; Phillips, Nicholas W; Harder, Ross J; Liu, Wenjun; Clark, Jesse N; Robinson, Ian K; Abbey, Brian

    2017-09-01

    Multi-reflection Bragg coherent diffraction imaging has the potential to allow three-dimensional (3D) resolved measurements of the full lattice strain tensor in specific micro-crystals. Until now such measurements were hampered by the need for laborious, time-intensive alignment procedures. Here a different approach is demonstrated, using micro-beam Laue X-ray diffraction to first determine the lattice orientation of the micro-crystal. This information is then used to rapidly align coherent diffraction measurements of three or more reflections from the crystal. Based on these, 3D strain and stress fields in the crystal are successfully determined. This approach is demonstrated on a focused ion beam milled micro-crystal from which six reflections could be measured. Since information from more than three independent reflections is available, the reliability of the phases retrieved from the coherent diffraction data can be assessed. Our results show that rapid, reliable 3D coherent diffraction measurements of the full lattice strain tensor in specific micro-crystals are now feasible and can be successfully carried out even in heavily distorted samples.

  19. Micro-beam Laue Alignment of Multi-Reflection Bragg Coherent Diffraction Imaging Measurements

    PubMed Central

    Hofmann, Felix; Phillips, Nicholas W.; Harder, Ross J.; Liu, Wenjun; Clark, Jesse N.; Robinson, Ian K.; Abbey, Brian

    2017-01-01

    Multi-reflection Bragg coherent diffraction imaging has the potential to allow 3D resolved measurements of the full lattice strain tensor in specific micro-crystals. Until now such measurements were hampered by the need for laborious, time-intensive alignment procedures. Here we demonstrate a different approach, using micro-beam Laue X-ray diffraction to first determine the lattice orientation of the micro-crystal. This information is then used to rapidly align coherent diffraction measurements of three or more reflections from the crystal. Based on these, 3D strain and stress fields in the crystal are successfully determined. This approach is demonstrated on a focussed ion beam milled micro-crystal from which six reflections could be measured. Since information from more than three independent reflections is available, the reliability of the phases retrieved from the coherent diffraction data can be assessed. Our results show that rapid, reliable 3D coherent diffraction measurements of the full lattice strain tensor in specific micro-crystals are now feasible and can be successfully carried out even in heavily distorted samples. PMID:28862628

  20. Phenylacetic acid co-crystals with acridine, caffeine, isonicotinamide and nicotinamide: Crystal structures, thermal analysis, FTIR spectroscopy and Hirshfeld surface analysis

    NASA Astrophysics Data System (ADS)

    Amombo Noa, Francoise M.; Jacobs, Ayesha

    2017-07-01

    Co-crystals of phenylacetic acid (PAA) with acridine (ACR), caffeine (CAF), isonicotinamide (INM) and nicotinamide (NAM) have been successfully prepared and characterised by single crystal X-ray diffraction, FTIR spectroscopy, thermal analysis and Hirshfeld surface analysis. The ACR, INM and NAM co-crystals with PAA exhibit the carboxylic acid-pyridine heterosynthon. Furthermore the amide-amide supramolecular homosynthon is observed in the PAA co-crystals with INM and NAM as well as Nsbnd H⋯O interactions between the acid and the respective base. The CAF co-crystal exhibits hydrogen bonding between the imidazole nitrogen and the COOH group of the PAA. The compounds demonstrate different stoichiometries; for PAA·ACR and PAA·INM a 1:1 ratio is displayed, a 2:1 in 2PAA·CAF and a 2:2 in the case of 2PAA·2NAM.

  1. Large Area Stress Distribution in Crystalline Materials Calculated from Lattice Deformation Identified by Electron Backscatter Diffraction

    NASA Astrophysics Data System (ADS)

    Shao, Yongliang; Zhang, Lei; Hao, Xiaopeng; Wu, Yongzhong; Dai, Yuanbin; Tian, Yuan; Huo, Qin

    2014-08-01

    We report a method to obtain the stress of crystalline materials directly from lattice deformation by Hooke's law. The lattice deformation was calculated using the crystallographic orientations obtained from electron backscatter diffraction (EBSD) technology. The stress distribution over a large area was obtained efficiently and accurately using this method. Wurtzite structure gallium nitride (GaN) crystal was used as the example of a hexagonal crystal system. With this method, the stress distribution of a GaN crystal was obtained. Raman spectroscopy was used to verify the stress distribution. The cause of the stress distribution found in the GaN crystal was discussed from theoretical analysis and EBSD data. Other properties related to lattice deformation, such as piezoelectricity, can also be analyzed by this novel approach based on EBSD data.

  2. Large area stress distribution in crystalline materials calculated from lattice deformation identified by electron backscatter diffraction.

    PubMed

    Shao, Yongliang; Zhang, Lei; Hao, Xiaopeng; Wu, Yongzhong; Dai, Yuanbin; Tian, Yuan; Huo, Qin

    2014-08-05

    We report a method to obtain the stress of crystalline materials directly from lattice deformation by Hooke's law. The lattice deformation was calculated using the crystallographic orientations obtained from electron backscatter diffraction (EBSD) technology. The stress distribution over a large area was obtained efficiently and accurately using this method. Wurtzite structure gallium nitride (GaN) crystal was used as the example of a hexagonal crystal system. With this method, the stress distribution of a GaN crystal was obtained. Raman spectroscopy was used to verify the stress distribution. The cause of the stress distribution found in the GaN crystal was discussed from theoretical analysis and EBSD data. Other properties related to lattice deformation, such as piezoelectricity, can also be analyzed by this novel approach based on EBSD data.

  3. Large Area Stress Distribution in Crystalline Materials Calculated from Lattice Deformation Identified by Electron Backscatter Diffraction

    PubMed Central

    Shao, Yongliang; Zhang, Lei; Hao, Xiaopeng; Wu, Yongzhong; Dai, Yuanbin; Tian, Yuan; Huo, Qin

    2014-01-01

    We report a method to obtain the stress of crystalline materials directly from lattice deformation by Hooke's law. The lattice deformation was calculated using the crystallographic orientations obtained from electron backscatter diffraction (EBSD) technology. The stress distribution over a large area was obtained efficiently and accurately using this method. Wurtzite structure gallium nitride (GaN) crystal was used as the example of a hexagonal crystal system. With this method, the stress distribution of a GaN crystal was obtained. Raman spectroscopy was used to verify the stress distribution. The cause of the stress distribution found in the GaN crystal was discussed from theoretical analysis and EBSD data. Other properties related to lattice deformation, such as piezoelectricity, can also be analyzed by this novel approach based on EBSD data. PMID:25091314

  4. Growth, nonlinear optical, thermal, dielectric and laser damage threshold studies of semiorganic crystal: monohydrate piperazine hydrogen phosphate.

    PubMed

    Krishnan, P; Gayathri, K; Bhagavannarayana, G; Gunasekaran, S; Anbalagan, G

    2013-02-01

    Monohydrate piperazine hydrogen phosphate (MPHP), a semi organic nonlinear optical material has been synthesized and single crystals were grown from aqueous solution by slow evaporation technique. Single crystal X-ray diffraction study on grown crystal reveals that they belong to monoclinic crystal system with space group P2(1)/c; (a=6.39Å; b=12.22Å; c=11.16Å; β=97.14°; V=864Å(3)). The structural perfection of the grown crystal was analyzed by high-resolution X-ray diffraction (HRXRD) rocking curve measurements. FTIR spectrum confirms the presence of the functional groups in synthesized material. UV-Vis spectrum indicates that the crystal is transparent in the entire visible region with a lower cut off wavelength of 387 nm. The variation of dielectric properties of the grown crystal with respect to frequency has been investigated at different temperatures. Thermal analysis carried out on the MPHP crystal shows that the crystal is stable up to 135°C. Relative powder second harmonic generation efficiency tested by Kurtz-Perry powder technique, which was about 0.638 times that of Potassium dihydrogen phosphate. Copyright © 2012 Elsevier B.V. All rights reserved.

  5. Mesoscopic monodisperse ferromagnetic colloids enable magnetically controlled photonic crystals.

    PubMed

    Xu, Xiangling; Majetich, Sara A; Asher, Sanford A

    2002-11-20

    We report here the first synthesis of mesoscopic, monodisperse particles which contain nanoscopic inclusions of ferromagnetic cobalt ferrites. These monodisperse ferromagnetic composite particles readily self-assemble into magnetically responsive photonic crystals that efficiently Bragg diffract incident light. Magnetic fields can be used to control the photonic crystal orientation and, thus, the diffracted wavelength. We demonstrate the use of these ferromagnetic particles to fabricate magneto-optical diffracting fluids and magnetically switchable diffracting mirrors.

  6. Inclined monochromator for high heat-load synchrotron x-ray radiation

    DOEpatents

    Khounsary, A.M.

    1994-02-15

    A double crystal monochromator is described including two identical, parallel crystals, each of which is cut such that the normal to the diffraction planes of interest makes an angle less than 90 degrees with the surface normal. Diffraction is symmetric, regardless of whether the crystals are symmetrically or asymmetrically cut, enabling operation of the monochromator with a fixed plane of diffraction. As a result of the inclination of the crystal surface, an incident beam has a footprint area which is elongated both vertically and horizontally when compared to that of the conventional monochromator, reducing the heat flux of the incident beam and enabling more efficient surface cooling. Because after inclination of the crystal only a fraction of thermal distortion lies in the diffraction plane, slope errors and the resultant misorientation of the diffracted beam are reduced. 11 figures.

  7. Inclined monochromator for high heat-load synchrotron x-ray radiation

    DOEpatents

    Khounsary, Ali M.

    1994-01-01

    A double crystal monochromator including two identical, parallel crystals, each of which is cut such that the normal to the diffraction planes of interest makes an angle less than 90 degrees with the surface normal. Diffraction is symmetric, regardless of whether the crystals are symmetrically or asymmetrically cut, enabling operation of the monochromator with a fixed plane of diffraction. As a result of the inclination of the crystal surface, an incident beam has a footprint area which is elongated both vertically and horizontally when compared to that of the conventional monochromator, reducing the heat flux of the incident beam and enabling more efficient surface cooling. Because after inclination of the crystal only a fraction of thermal distortion lies in the diffraction plane, slope errors and the resultant misorientation of the diffracted beam are reduced.

  8. Role of Molecular Structure on X-ray Diffraction in Thermotropic Uniaxial and Biaxial Nematic Liquid Crystal Phases

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Acharya, Bharat R.; Kang, Shin-Woong; Prasad, Veena

    2009-08-27

    X-ray diffraction is one of the most definitive methods to determine the structure of condensed matter phases, and it has been applied to unequivocally infer the structures of conventional calamitic and lyotropic liquid crystals. With the advent of bent-core and tetrapodic mesogens and the discovery of the biaxial nematic phase in them, the experimental results require more careful interpretation and analysis. Here, we present ab-initio calculations of X-ray diffraction patterns in the isotropic, uniaxial nematic, and biaxial nematic phases of bent-core mesogens. A simple Meier-Saupe-like molecular distribution function is employed to describe both aligned and unaligned mesophases. The distribution functionmore » is decomposed into two, polar and azimuthal, distribution functions to calculate the effect of the evolution of uniaxial and biaxial nematic orientational order. The calculations provide satisfactory semiquantitative interpretations of experimental results. The calculations presented here should provide a pathway to more refined and quantitative analysis of X-ray diffraction data from the biaxial nematic phase.« less

  9. Role of Molecular Structure on X-ray Diffraction in Uniaxial and Biaxial Phases of Thermotropic Liquid Crystals

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Acharya, Bharat R.; Kang, Shin-Woong; Prasad, Veena

    2009-04-29

    X-ray diffraction is one of the most definitive methods to determine the structure of condensed matter phases, and it has been applied to unequivocally infer the structures of conventional calamitic and lyotropic liquid crystals. With the advent of bent-core and tetrapodic mesogens and the discovery of the biaxial nematic phase in them, the experimental results require more careful interpretation and analysis. Here, we present ab-initio calculations of X-ray diffraction patterns in the isotropic, uniaxial nematic, and biaxial nematic phases of bent-core mesogens. A simple Meier-Saupe-like molecular distribution function is employed to describe both aligned and unaligned mesophases. The distribution functionmore » is decomposed into two, polar and azimuthal, distribution functions to calculate the effect of the evolution of uniaxial and biaxial nematic orientational order. The calculations provide satisfactory semiquantitative interpretations of experimental results. The calculations presented here should provide a pathway to more refined and quantitative analysis of X-ray diffraction data from the biaxial nematic phase.« less

  10. Glass transition in ferroic glass K x (ND4)1-x D2PO4: a complete x-ray diffraction line shape analysis

    NASA Astrophysics Data System (ADS)

    Ranjan Choudhury, Rajul; Chitra, R.; Jayakrishnan, V. B.

    2016-03-01

    Quenching of dynamic disorder in glassy systems is termed as the glass transition. Ferroic glasses belong to the class of paracrystalline materials having crystallographic order in-between that of a perfect crystal and amorphous material, a classic example of ferroic glass is the solid solution of ferroelectric deuterated potassium dihydrogen phosphate and antiferroelectric deuterated ammonium dihydrogen phosphate. Lowering temperature of this ferroic glass can lead to a glass transition to a quenched disordered state. The subtle atomic rearrangement that takes place at such a glass transition can be revealed by careful examination of the temperature induced changes occurring in the x-ray powder diffraction (XRD) patterns of these materials. Hence we report here results of a complete diffraction line shape analysis of the XRD patterns recorded at different temperatures from deuterated mixed crystals DK x A1-x DP with mixing concentration x ranging as 0 < x < 1. Changes observed in diffraction peak shapes have been explained on the basis of structural rearrangements induced by changing O-D-O hydrogen bond dynamics in these paracrystals.

  11. The High Resolution Powder Diffraction Beam Line at ESRF.

    PubMed

    Fitch, A N

    2004-01-01

    The optical design and performance of the high-resolution powder diffraction beam line BM16 at ESRF are discussed and illustrated. Some recent studies carried out on BM16 are described, including crystal structure solution and refinement, anomalous scattering, in situ measurements, residual strain in engineering components, investigation of microstructure, and grazing-incidence diffraction from surface layers. The beam line is built on a bending magnet, and operates in the energy range from 5 keV to 40 keV. After the move to an undulator source in 2002, it will benefit from an extented energy range up to 60 keV and increased flux and resolution. It is anticipated that enhancements to the data quality will be achieved, leading to the solution of larger crystal structures, and improvements in the accuracy of refined structures. The systematic exploitation of anisotropic thermal expansion will help reduce the effects of peak overlap in the analysis of powder diffraction data.

  12. Second harmonic generation and crystal growth of new chalcone derivatives

    NASA Astrophysics Data System (ADS)

    Patil, P. S.; Dharmaprakash, S. M.; Ramakrishna, K.; Fun, Hoong-Kun; Sai Santosh Kumar, R.; Narayana Rao, D.

    2007-05-01

    We report on the synthesis, crystal structure and optical characterization of chalcone derivatives developed for second-order nonlinear optics. The investigation of a series of five chalcone derivatives with the second harmonic generation powder test according to Kurtz and Perry revealed that these chalcones show efficient second-order nonlinear activity. Among them, high-quality single crystals of 3-Br-4'-methoxychalcone (3BMC) were grown by solvent evaporation solution growth technique. Grown crystals were characterized by X-ray powder diffraction (XRD), laser damage threshold, UV-vis-NIR and refractive index measurement studies. Infrared spectroscopy, thermogravimetric analysis and differential thermal analysis measurements were performed to study the molecular vibration and thermal behavior of 3BMC crystal. Thermal analysis does not show any structural phase transition.

  13. Diffractive-refractive optics: X-ray splitter.

    PubMed

    Hrdý, Jaromír

    2010-01-01

    The possibility of splitting a thin (e.g. undulator) X-ray beam based on diffraction-refraction effects is discussed. The beam is diffracted from a crystal whose diffracting surface has the shape of a roof with the ridge lying in the plane of diffraction. The crystal is cut asymmetrically. One half of the beam impinges on the left-hand part of the roof and the other half impinges on the right-hand side of the roof. Owing to refraction the left part of the beam is deviated to the left whereas the right part is deviated to the right. The device proposed consists of two channel-cut crystals with roof-like diffraction surfaces; the crystals are set in a dispersive position. The separation of the beams after splitting is calculated at a distance of 10 m from the crystals for various asymmetry and inclination angles. It is shown that such a splitting may be utilized for long beamlines. Advantages and disadvantages of this method are discussed.

  14. Purification, crystallization and preliminary X-ray diffraction analysis of adenosine triphosphate sulfurylase (ATPS) from the sulfate-reducing bacterium Desulfovibrio desulfuricans ATCC 27774

    PubMed Central

    Gavel, Olga Yu.; Kladova, Anna V.; Bursakov, Sergey A.; Dias, João M.; Texeira, Susana; Shnyrov, Valery L.; Moura, José J. G.; Moura, Isabel; Romão, Maria J.; Trincão, José

    2008-01-01

    Native zinc/cobalt-containing ATP sulfurylase (ATPS; EC 2.7.7.4; MgATP:sulfate adenylyltransferase) from Desulfovibrio desulfuricans ATCC 27774 was purified to homogeneity and crystallized. The orthorhombic crystals diffracted to beyond 2.5 Å resolution and the X-ray data collected should allow the determination of the structure of the zinc-bound form of this ATPS. Although previous biochemical studies of this protein indicated the presence of a homotrimer in solution, a dimer was found in the asymmetric unit. Elucidation of this structure will permit a better understanding of the role of the metal in the activity and stability of this family of enzymes. PMID:18607083

  15. Crystallization and preliminary X-ray diffraction analysis of a novel Arg49 phospholipase A{sub 2} homologue from Zhaoermia mangshanensis venom

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Murakami, Mário T.; Center for Applied Toxinology, CAT-CEPID, São Paulo, SP; Advanced Center for Genomics and Proteomics, UNESP-State University of São Paulo, São José do Rio Preto 15054-000

    2007-07-01

    A single crystal of zhaoermiatoxin with maximum dimensions of 0.2 × 0.2 × 0.5 mm was used for X-ray diffraction data collection to a resolution of 2.05 Å using synchrotron radiation and the diffraction pattern was indexed in the hexagonal space group P6{sub 4}, with unit-cell parameters a = 72.9, b = 72.9, c = 93.9 Å. Zhaoermiatoxin, an Arg49 phospholipase A{sub 2} homologue from Zhaoermia mangshanensis (formerly Trimeresurus mangshanensis, Ermia mangshanensis) venom is a novel member of the PLA{sub 2}-homologue family that possesses an arginine residue at position 49, probably arising from a secondary Lys49→Arg substitution that does notmore » alter the catalytic inactivity towards phospholipids. Like other Lys49 PLA{sub 2} homologues, zhaoermiatoxin induces oedema and strong myonecrosis without detectable PLA{sub 2} catalytic activity. A single crystal with maximum dimensions of 0.2 × 0.2 × 0.5 mm was used for X-ray diffraction data collection to a resolution of 2.05 Å using synchrotron radiation and the diffraction pattern was indexed in the hexagonal space group P6{sub 4}, with unit-cell parameters a = 72.9, b = 72.9, c = 93.9 Å.« less

  16. Crystal growth of triphenylphosphine oxide 4-nitrophenol (TP4N) for nonlinear optical (NLO) applications

    NASA Astrophysics Data System (ADS)

    Pandian, Muthu Senthil; Karuppasamy, P.; Kamalesh, T.; Ramasamy, P.; Verma, Sunil

    2018-04-01

    The optically good quality organic single crystals of triphenylphosphine oxide 4-nitrophenol (TP4N) were successfully grown by slow evaporation solution technique (SEST) using methanol as solvent. The lattice parameters of the grown crystal were confirmed by single crystal X-ray diffraction analysis. The optical transmittance, cut-off wavelength and band gap of the TP4N crystal were obtained by UV-Vis NIR spectrum analysis. The photoluminescence studies were carried out to find out the luminesce properties of TP4N single crystal. The photoconductivity studies reveal that the TP4N crystal has negative photoconductive nature. The third order nonlinear susceptibility (χ(3)) of TP4N crystal was evaluated using the Z-scan technique at 640 nm.

  17. Growth, optical, ICP and thermal studies of nonlinear optical single crystal: Sodium acid phthalate (NaAP)

    NASA Astrophysics Data System (ADS)

    Mahadevan, M.; Arivanandhan, M.; Elangovan, K.; Anandan, P.; Ramachandran, K.

    2017-07-01

    Good quality single crystals of sodium acid phthalate (NaAP) were grown by slow evaporation technique. Single crystal X-ray diffraction study of the grown crystal reveals that the crystal belongs to orthorhombic system with space group B2ab. Fourier transform infrared spectrum confirms the presence of the functional groups of the grown material. Inductively coupled plasma emission spectroscopy analysis is used to confirm the presence of Na element in the sample. Thermal analysis of the NaAP crystal shows that the crystal is stable up to 140°C. Optical transmittance of the grown crystal was recorded in the wavelength range from 200 and 800 nm using UV-Vis-NIR spectrophotometer. The second harmonic generation of NaAP was analysed using Kurtz powder technique.

  18. Solid-state amorphization of rebamipide and investigation on solubility and stability of the amorphous form.

    PubMed

    Xiong, Xinnuo; Xu, Kailin; Li, Shanshan; Tang, Peixiao; Xiao, Ying; Li, Hui

    2017-02-01

    Solid-state amorphization of crystalline rebamipide (RBM) was realized by ball milling and spray drying. The amorphous content of samples milled for various time was quantified using X-ray powder diffraction. Crystalline RBM and three amorphous RBM obtained by milling and spray drying were characterized by morphological analysis, X-ray diffraction, thermal analysis and vibrational spectroscopy. The crystal structure of RBM was first determined by single-crystal X-ray diffraction. In addition, the solubility and dissolution rate of the RBM samples were investigated in different media. Results indicated that the solubility and the dissolution rates of spray-dried RBM-PVP in different media were highly improved compared with crystalline RBM. The physical stabilities of the three amorphous RBM were systematically investigated, and the stability orders under different storage temperatures and levels of relative humidity (RH) were both as follows: spray dried RBM < milled RBM < spray dried RBM-PVP. A direct glass-to-crystal transformation was induced under high RH, and the transformation rate rose with increasing RH. However, amorphous RBM could stay stable at RH levels lower than 57.6% (25 °C).

  19. Structural studies of crystalline forms of triamterene with carboxylic acid, GRAS and API molecules

    PubMed Central

    Rehman, Abida

    2018-01-01

    Pharmaceutical salt solvates (dimethyl sulfoxide, DMSO) of the drug triamterene with the coformers acetic, succinic, adipic, pimelic, azelaic and nicotinic acid and ibuprofen are prepared by liquid-assisted grinding and solvent-evaporative crystallization. The modified ΔpK a rule as proposed by Cruz-Cabeza [(2012 ▸). CrystEngComm, 14, 6362–6365] is in close agreement with the results of this study. All adducts were characterized by X-ray diffraction and thermal analytical techniques, including single-crystal X-ray diffraction, powder X-ray diffraction, differential scanning calorimetry and thermal gravimetric analysis. Hydrogen-bonded motifs combined to form a variety of extended tapes and sheets. Analysis of the crystal structures showed that all adducts existed as salt solvates and contained the amino­pyridinium–carboxyl­ate heterodimer, except for the solvate containing triamterene, ibuprofen and DMSO, as a result of the presence of a strong and stable hemitriamterenium duplex. A search of the Cambridge Structural Database (CSD 5.36, Version 1.18) to determine the frequency of occurrence of the putative supramolecular synthons found in this study showed good agreement with previous work. PMID:29755747

  20. Testing the limits of sensitivity in a solid-state structural investigation by combined X-ray powder diffraction, solid-state NMR, and molecular modelling.

    PubMed

    Filip, Xenia; Borodi, Gheorghe; Filip, Claudiu

    2011-10-28

    A solid state structural investigation of ethoxzolamide is performed on microcrystalline powder by using a multi-technique approach that combines X-ray powder diffraction (XRPD) data analysis based on direct space methods with information from (13)C((15)N) solid-state Nuclear Magnetic Resonance (SS-NMR) and molecular modeling. Quantum chemical computations of the crystal were employed for geometry optimization and chemical shift calculations based on the Gauge Including Projector Augmented-Wave (GIPAW) method, whereas a systematic search in the conformational space was performed on the isolated molecule using a molecular mechanics (MM) approach. The applied methodology proved useful for: (i) removing ambiguities in the XRPD crystal structure determination process and further refining the derived structure solutions, and (ii) getting important insights into the relationship between the complex network of non-covalent interactions and the induced supra-molecular architectures/crystal packing patterns. It was found that ethoxzolamide provides an ideal case study for testing the accuracy with which this methodology allows to distinguish between various structural features emerging from the analysis of the powder diffraction data. This journal is © the Owner Societies 2011

  1. Crystallization and evaluation of hen egg-white lysozyme crystals for protein pH titration in the crystalline state

    PubMed Central

    Iwai, Wakari; Yagi, Daichi; Ishikawa, Takuya; Ohnishi, Yuki; Tanaka, Ichiro; Niimura, Nobuo

    2008-01-01

    To observe the ionized status of the amino acid residues in proteins at different pH (protein pH titration in the crystalline state) by neutron diffraction, hen egg-white lysozyme was crystallized over a wide pH range (2.5–8.0). Crystallization phase diagrams at pH 2.5, 6.0 and 7.5 were determined. At pH < 4.5 the border between the metastable region and the nucleation region shifted to the left (lower precipitant concentration) in the phase diagram, and at pH > 4.5 the border shifted to the right (higher precipitant concentration). The qualities of these crystals were characterized using the Wilson plot method. The qualities of all crystals at different pH were more or less equivalent (B-factor values within 25–40). It is expected that neutron diffraction analysis of these crystals of different pH provides equivalent data in quality for discussions of protein pH titration in the crystalline state of hen egg-white lysozyme. PMID:18421167

  2. Crystallization and evaluation of hen egg-white lysozyme crystals for protein pH titration in the crystalline state.

    PubMed

    Iwai, Wakari; Yagi, Daichi; Ishikawa, Takuya; Ohnishi, Yuki; Tanaka, Ichiro; Niimura, Nobuo

    2008-05-01

    To observe the ionized status of the amino acid residues in proteins at different pH (protein pH titration in the crystalline state) by neutron diffraction, hen egg-white lysozyme was crystallized over a wide pH range (2.5-8.0). Crystallization phase diagrams at pH 2.5, 6.0 and 7.5 were determined. At pH < 4.5 the border between the metastable region and the nucleation region shifted to the left (lower precipitant concentration) in the phase diagram, and at pH > 4.5 the border shifted to the right (higher precipitant concentration). The qualities of these crystals were characterized using the Wilson plot method. The qualities of all crystals at different pH were more or less equivalent (B-factor values within 25-40). It is expected that neutron diffraction analysis of these crystals of different pH provides equivalent data in quality for discussions of protein pH titration in the crystalline state of hen egg-white lysozyme.

  3. Characterization of a bent Laue double-crystal beam-expanding monochromator

    DOE PAGES

    Martinson, Mercedes; Samadi, Nazanin; Shi, Xianbo; ...

    2017-10-19

    A bent Laue double-crystal monochromator system has been designed for vertically expanding the X-ray beam at the Canadian Light Source's BioMedical Imaging and Therapy beamlines. Expansion by a factor of 12 has been achieved without deteriorating the transverse coherence of the beam, allowing phase-based imaging techniques to be performed with high flux and a large field of view. However, preliminary studies revealed a lack of uniformity in the beam, presumed to be caused by imperfect bending of the silicon crystal wafers used in the system. Results from finite-element analysis of the system predicted that the second crystal would be mostmore » severely affected and has been shown experimentally. It has been determined that the majority of the distortion occurs in the second crystal and is likely caused by an imperfection in the surface of the bending frame. Here, measurements were then taken to characterize the bending of the crystal using both mechanical and diffraction techniques. In particular, two techniques commonly used to map dislocations in crystal structures have been adapted to map local curvature of the bent crystals. One of these, a variation of Berg–Berrett topography, has been used to quantify the diffraction effects caused by the distortion of the crystal wafer. This technique produces a global mapping of the deviation of the diffraction angle relative to a perfect cylinder. Finally, this information is critical for improving bending and measuring tolerances of imperfections by correlating this mapping to areas of missing intensity in the beam.« less

  4. Characterization of a bent Laue double-crystal beam-expanding monochromator

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Martinson, Mercedes; Samadi, Nazanin; Shi, Xianbo

    A bent Laue double-crystal monochromator system has been designed for vertically expanding the X-ray beam at the Canadian Light Source's BioMedical Imaging and Therapy beamlines. Expansion by a factor of 12 has been achieved without deteriorating the transverse coherence of the beam, allowing phase-based imaging techniques to be performed with high flux and a large field of view. However, preliminary studies revealed a lack of uniformity in the beam, presumed to be caused by imperfect bending of the silicon crystal wafers used in the system. Results from finite-element analysis of the system predicted that the second crystal would be mostmore » severely affected and has been shown experimentally. It has been determined that the majority of the distortion occurs in the second crystal and is likely caused by an imperfection in the surface of the bending frame. Here, measurements were then taken to characterize the bending of the crystal using both mechanical and diffraction techniques. In particular, two techniques commonly used to map dislocations in crystal structures have been adapted to map local curvature of the bent crystals. One of these, a variation of Berg–Berrett topography, has been used to quantify the diffraction effects caused by the distortion of the crystal wafer. This technique produces a global mapping of the deviation of the diffraction angle relative to a perfect cylinder. Finally, this information is critical for improving bending and measuring tolerances of imperfections by correlating this mapping to areas of missing intensity in the beam.« less

  5. Microstructural analysis in the depth direction of a heteroepitaxial AlN thick film grown on a trench-patterned template by nanobeam X-ray diffraction

    NASA Astrophysics Data System (ADS)

    Shida, K.; Takeuchi, S.; Tohei, T.; Miyake, H.; Hiramatsu, K.; Sumitani, K.; Imai, Y.; Kimura, S.; Sakai, A.

    2018-04-01

    This work quantitatively assessed the three-dimensional distribution of crystal lattice distortions in an epitaxial AlN thick film grown on a trench-patterned template, using nanobeam X-ray diffraction. Position-dependent ω-2θ-φ mapping clearly demonstrated local tilting, spacing and twisting of lattice planes as well as fluctuations in these phenomena on a sub-micrometer scale comparable to the pitch of the trench-and-terrace patterning. Analysis of the crystal lattice distortion in the depth direction was performed using a newly developed method in which the X-ray nanobeam diffracted from the sample surface to specific depths can be selectively detected by employing a Pt wire profiler. This technique generated depth-resolved ω-2θ-φ maps confirming that fluctuations in lattice plane tilting and spacing greatly depend on the dislocation distribution and the history of the AlN epitaxial growth on the trench-patterned structure. It was also found that both fluctuations were reduced on approaching the AlN surface and, in particular, were sharply reduced at specific depths in the terrace regions. These sharp reductions are attributed to the formation of sacrificial zones with degraded crystal quality around the trenches and possibly lead to raising the crystal quality near the surface of the AlN film.

  6. Hydrogen positions in single nanocrystals revealed by electron diffraction

    NASA Astrophysics Data System (ADS)

    Palatinus, L.; Brázda, P.; Boullay, P.; Perez, O.; Klementová, M.; Petit, S.; Eigner, V.; Zaarour, M.; Mintova, S.

    2017-01-01

    The localization of hydrogen atoms is an essential part of crystal structure analysis, but it is difficult because of their small scattering power. We report the direct localization of hydrogen atoms in nanocrystalline materials, achieved using the recently developed approach of dynamical refinement of precession electron diffraction tomography data. We used this method to locate hydrogen atoms in both an organic (paracetamol) and an inorganic (framework cobalt aluminophosphate) material. The results demonstrate that the technique can reliably reveal fine structural details, including the positions of hydrogen atoms in single crystals with micro- to nanosized dimensions.

  7. Observing the overall rocking motion of a protein in a crystal

    NASA Astrophysics Data System (ADS)

    Ma, Peixiang; Xue, Yi; Coquelle, Nicolas; Haller, Jens D.; Yuwen, Tairan; Ayala, Isabel; Mikhailovskii, Oleg; Willbold, Dieter; Colletier, Jacques-Philippe; Skrynnikov, Nikolai R.; Schanda, Paul

    2015-10-01

    The large majority of three-dimensional structures of biological macromolecules have been determined by X-ray diffraction of crystalline samples. High-resolution structure determination crucially depends on the homogeneity of the protein crystal. Overall `rocking' motion of molecules in the crystal is expected to influence diffraction quality, and such motion may therefore affect the process of solving crystal structures. Yet, so far overall molecular motion has not directly been observed in protein crystals, and the timescale of such dynamics remains unclear. Here we use solid-state NMR, X-ray diffraction methods and μs-long molecular dynamics simulations to directly characterize the rigid-body motion of a protein in different crystal forms. For ubiquitin crystals investigated in this study we determine the range of possible correlation times of rocking motion, 0.1-100 μs. The amplitude of rocking varies from one crystal form to another and is correlated with the resolution obtainable in X-ray diffraction experiments.

  8. Hemispherical Laue camera

    DOEpatents

    Li, James C. M.; Chu, Sungnee G.

    1980-01-01

    A hemispherical Laue camera comprises a crystal sample mount for positioning a sample to be analyzed at the center of sphere of a hemispherical, X-radiation sensitive film cassette, a collimator, a stationary or rotating sample mount and a set of standard spherical projection spheres. X-radiation generated from an external source is directed through the collimator to impinge onto the single crystal sample on the stationary mount. The diffracted beam is recorded on the hemispherical X-radiation sensitive film mounted inside the hemispherical film cassette in either transmission or back-reflection geometry. The distances travelled by X-radiation diffracted from the crystal to the hemispherical film are the same for all crystal planes which satisfy Bragg's Law. The recorded diffraction spots or Laue spots on the film thereby preserve both the symmetry information of the crystal structure and the relative intensities which are directly related to the relative structure factors of the crystal orientations. The diffraction pattern on the exposed film is compared with the known diffraction pattern on one of the standard spherical projection spheres for a specific crystal structure to determine the orientation of the crystal sample. By replacing the stationary sample support with a rotating sample mount, the hemispherical Laue camera can be used for crystal structure determination in a manner previously provided in conventional Debye-Scherrer cameras.

  9. Goniometer-based femtosecond X-ray diffraction of mutant 30S ribosomal subunit crystals

    DOE PAGES

    Dao, E. Han; Sierra, Raymond G.; Laksmono, Hartawan; ...

    2015-04-30

    In this work, we collected radiation-damage-free data from a set of cryo-cooled crystals for a novel 30S ribosomal subunit mutant using goniometer-based femtosecond crystallography. Crystal quality assessment for these samples was conducted at the X-ray Pump Probe end-station of the Linac Coherent Light Source (LCLS) using recently introduced goniometer-based instrumentation. These 30S subunit crystals were genetically engineered to omit a 26-residue protein, Thx, which is present in the wild-type Thermus thermophilus 30S ribosomal subunit. We are primarily interested in elucidating the contribution of this ribosomal protein to the overall 30S subunit structure. To assess the viability of this study, femtosecondmore » X-ray diffraction patterns from these crystals were recorded at the LCLS during a protein crystal screening beam time. During our data collection, we successfully observed diffraction from these difficult-to-grow 30S ribosomal subunit crystals. Most of our crystals were found to diffract to low resolution, while one crystal diffracted to 3.2 Å resolution. These data suggest the feasibility of pursuing high-resolution data collection as well as the need to improve sample preparation and handling in order to collect a complete radiation-damage-free data set using an X-ray Free Electron Laser.« less

  10. Isolation, crystallization and preliminary crystallographic analysis of Salmonella typhimurium uridine phosphorylase crystallized with 2,2′-anhydrouridine

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Timofeev, Vladimir I.; Lashkov, Alexander A.; Gabdoulkhakov, Azat G.

    2007-10-01

    S. typhimurium uridine phosphorylase has been isolated and crystallized in the presence of ligand. Uridine phosphorylase (UPh; EC 2.4.2.3) is a member of the pyrimidine nucleoside phosphorylase family of enzymes which catalyzes the phosphorolytic cleavage of the C—N glycoside bond of uridine, with the formation of ribose 1-phosphate and uracil. This enzyme has been shown to be important in the activation and catabolism of fluoropyrimidines. Modulation of its enzymatic activity may affect the therapeutic efficacy of chemotherapeutic agents. The structural investigation of the bacterial uridine phosphorylases, both unliganded and complexed with substrate/product analogues and inhibitors, may help in understanding themore » catalytic mechanism of the phosphorolytic cleavage of uridine. Salmonella typhimurium uridine phosphorylase has been crystallized with 2,2′-anhydrouridine. X-ray diffraction data were collected to 2.15 Å. Preliminary analysis of the diffraction data indicates that the crystal belongs to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 88.52, b = 123.98, c = 133.52 Å. The solvent content is 45.51%, assuming the presence of one hexamer molecule per asymmetric unit.« less

  11. Beam-smiling in bent-Laue monochromators

    NASA Astrophysics Data System (ADS)

    Ren, B.; Dilmanian, F. A.; Chapman, L. D.; Wu, X. Y.; Zhong, Z.; Ivanov, I.; Thomlinson, W. C.; Huang, X.

    1997-07-01

    When a wide fan-shaped x-ray beam is diffracted by a bent crystal in the Laue geometry, the profile of the diffracted beam generally does not appear as a straight line, but as a line with its ends curved up or curved down. This effect, referred to as "beam-smiling", has been a major obstacle in developing bent-Laue crystal monochromators for medical applications of synchrotron x-ray. We modeled a cylindrically bent crystal using the Finite Element Analysis (FEA) method, and we carried out experiments at the National Synchrotron Light Source and Cornell High Energy Synchrotron Source. Our studies show that, while beam-smiling exists in most of the crystal's area because of anticlastic bending effects, there is a region parallel to the bending axis of the crystal where the diffracted beam is "smile-free". By applying asymmetrical bending, this smile-free region can be shifted vertically away from the geometric center of the crystal, as desired. This leads to a novel method of compensating for beam-smiling. We will discuss the method of "differential bending" for smile removal, beam-smiling in the Cauchios and the polychromatic geometry, and the implications of the method on developing single- and double-bent Laue monochromators. The experimental results will be discussed, concentrating on specific beam-smiling observation and removal as applied to the new monochromator of the Multiple Energy Computed Tomography [MECT] project of the Medical Department, Brookhaven National Laboratory.

  12. Structural, vibrational, thermal and optical studies of organic single crystal: Benzotriazolium p-toluene sulfonate (BTPTS)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kumar, R. Ramesh; Sathya, P.; Gopalakrishnan, R., E-mail: krgkrishnan@yahoo.com

    Benzotriazolium p-toluene sulfonate (BTPTS) was grown by solution growth technique. The powder X-ray diffraction analysis was carried out to evaluate crystal system of the compound. LeBail Profile fitting analysis was performed to extract the individual peak intensities. FTIR spectrum analysis was recorded to study vibration frequencies of the prepared organic salt. Thermal studies were carried out using TG-DSC analysis. Optical absorption and energy band gap of the title compound was evaluated by UV-Vis spectral study.

  13. Crystalline perfection, optical and piezoelectric properties of a novel semi-organic single crystal: Zinc guanidinium sulphate

    NASA Astrophysics Data System (ADS)

    Nandhini, S.; Murugakoothan, P.

    2018-04-01

    Zinc Guanidinium Sulfate (ZGuS), a semi-organic single crystal, was synthesized using slow evaporation solution growth technique. It is a non-centrosymmetric crystal with space group I4 ¯2d . The crystalline nature of the crystal and the strain were determined using powder X-ray diffraction analysis. The crystalline perfection of the grown crystal was revealed using HR-XRD analysis. The UV-vis-NIR transmittance spectrum depicts 60% transparency with lower-cut off wavelength of 210 nm. The emission spectrum of the crystal was determined using photoluminescence study. Piezoelectricity was confirmed by determining the piezoelectric charge coefficient (d33). These findings shows that the title compound can be employed for photonic and transducer applications.

  14. Study of the specific features of single-crystal boron microstructure

    NASA Astrophysics Data System (ADS)

    Blagov, A. E.; Vasil'ev, A. L.; Dmitriev, V. P.; Ivanova, A. G.; Kulikov, A. G.; Marchenkov, N. V.; Popov, P. A.; Presnyakov, M. Yu.; Prosekov, P. A.; Pisarevskii, Yu. V.; Targonskii, A. V.; Chernaya, T. S.; Chernyshov, D. Yu.

    2017-09-01

    A complex study of the structure of β-boron single crystal grown by the floating-zone method, with sizes significantly exceeding the analogs known in the literature, has been performed. The study includes X-ray diffraction analysis and X-ray diffractometry (measurement of pole figures and rocking curves), performed on both laboratory and synchrotron sources; atomic-resolution scanning transmission electron microscopy with spherical aberration correction; and energy-dispersive microanalysis. X-ray diffraction analysis using synchrotron radiation has been used to refine the β-boron structure and find impurity Si atoms. The relative variations in the unit-cell parameters a and c for the crystal bulk are found to be δ a/ a ≈ 0.4 and δ c/ c ≈ 0.1%. X-ray diffractometry has revealed that the single-crystal growth axis coincides with the [2\\bar 2013] crystallographic axis and makes an angle of 21.12° with the [0001] threefold axis. Electron microscopy data have confirmed that the sample under study is a β-boron crystal, which may contain 0.3-0.4 at % Si as an impurity. Planar defects (stacking faults and dislocations) are found. The results of additional measurements of the temperature dependence of the thermal conductivity of the crystal in the range of 50-300 K are indicative of its high structural quality.

  15. Effect of Li and NH4 doping on the crystal perfection, second harmonic generation efficiency and laser damage threshold of potassium pentaborate crystals

    NASA Astrophysics Data System (ADS)

    Vigneshwaran, A. N.; Kalainathan, S.; Raja, C. Ramachandra

    2018-03-01

    Potassium pentaborate (KB5) is an excellent nonlinear optical material especially in the UV region. In this work, Li and NH4 doped KB5 crystals were grown using slow evaporation solution growth method. The incorporation of dopant has been confirmed and analysed by Energy dispersive X-ray analysis (EDAX), Inductively coupled plasma (ICP) analysis and Raman spectroscopy. The crystalline perfection of pure and doped KB5 crystals was studied by High resolution X-ray diffraction (HRXRD) analysis. Structural grain boundaries were observed in doped crystals. Second harmonic generation was confirmed for pure and doped crystals and output values revealed the enhancement of SHG efficiency in doped crystals. Resistance against laser damage was carried out using 1064 nm Nd-YAG laser of pulse width 10 ns. The laser damage threshold value is increased in Li doped crystal and decreased in NH4 doped crystal when compared to pure KB5 crystal.

  16. Crystallization and preliminary X-ray diffraction analysis of P30, the transmembrane domain of pertactin, an autotransporter from Bordetella pertussis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhu, Yanshi; Black, Isobel; Roszak, Aleksander W.

    2007-07-01

    P30, the transmembrane C-terminal domain of pertactin from B. pertussis has been crystallized after refolding in vitro. Preliminary X-ray crystallographic data are reported. P30, the 32 kDa transmembrane C-terminal domain of pertactin from Bordetella pertussis, is supposed to form a β-barrel inserted into the outer membrane for the translocation of the passenger domain. P30 was cloned and expressed in inclusion bodies in Escherichia coli. After refolding and purification, the protein was crystallized using the sitting-drop vapour-diffusion method at 292 K. The crystals diffract to a resolution limit of 3.5 Å using synchrotron radiation and belong to the hexagonal space groupmore » P6{sub 1}22, with unit-cell parameters a = b = 123.27, c = 134.43 Å.« less

  17. Preparation, crystallization and preliminary X-ray analysis of the methionine synthase (MetE) from Streptococcus mutans

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fu, Tian-Min; Zhang, Xiao-Yan; Li, Lan-Fen

    2006-10-01

    Methionine synthase (MetE) from S. mutans was expressed, purified and crystallized. Diffraction data have been collected to 2.2 Å resolution. The Streptococcus mutans metE gene encodes methionine synthase (MetE), which catalyzes the direct transfer of a methyl group from methyltetrahydrofolate to homocysteine in the last step of methionine synthesis. metE was cloned into pET28a and the gene product was expressed at high levels in the Escherichia coli strain BL21 (DE3). MetE was purified to homogeneity using Ni{sup 2+}-chelating chromatography followed by size-exclusion chromatography. Crystals of the protein were obtained by the hanging-drop vapour-diffusion method and diffracted to 2.2 Å resolution.more » The crystal belongs to space group P2{sub 1}, with unit-cell parameters a = 52.85, b = 99.48, c = 77.88 Å, β = 94.55°.« less

  18. Preliminary X-ray crystallographic analysis of SMU.573, a putative sugar kinase from Streptococcus mutans

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhou, Yan-Feng; Li, Lan-Fen; Yang, Cheng

    2008-01-01

    SMU.573 from S. mutans was expressed in E. coli and crystallized. The crystals belong to space group I4 and 2.5 Å resolution diffraction data were collected at an in-house chromium radiation source. SMU.573 from Streptococcus mutans is a structurally and functionally uncharacterized protein that was selected for structural biology studies. Native and SeMet-labelled proteins were expressed with an N-His tag in Escherichia coli BL21 (DE3) and purified by Ni{sup 2+}-chelating and size-exclusion chromatography. Crystals of the SeMet-labelled protein were obtained by the hanging-drop vapour-diffusion method and a 2.5 Å resolution diffraction data set was collected using an in-house chromium radiationmore » source. The crystals belong to space group I4, with unit-cell parameters a = b = 96.53, c = 56.26 Å, α = β = γ = 90°.« less

  19. Purification, crystallization and preliminary crystallographic analysis of Est25: a ketoprofen-specific hormone-sensitive lipase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kim, SeungBum; Joo, Sangbum; Yoon, Hyun C.

    2007-07-01

    Est25, a ketoprofen-specific hormone-sensitive lipase from a metagenomic library, was crystallized and diffraction data were collected to 1.49 Å resolution. Ketoprofen, a nonsteroidal anti-inflammatory drug, inhibits the synthesis of prostaglandin. A novel hydrolase (Est25) with high ketoprofen specificity has previously been identified using a metagenomic library from environmental samples. Recombinant Est25 protein with a histidine tag at the N-terminus was expressed in Escherichia coli and purified in a homogenous form. Est25 was crystallized from 2.4 M sodium malonate pH 7.0 and X-ray diffraction data were collected to 1.49 Å using synchrotron radiation. The crystals belong to the monoclinic space groupmore » C2, with unit-cell parameters a = 197.8, b = 95.2, c = 99.4 Å, β = 97.1°.« less

  20. Crystallization and preliminary X-ray analysis of the stress-response PPM phosphatase RsbX from Bacillus subtilis

    PubMed Central

    Suganuma, Masatoshi; Teh, Aik Hong; Makino, Masatomo; Shimizu, Nobutaka; Kaneko, Tomonori; Hirata, Kunio; Yamamoto, Masaki; Kumasaka, Takashi

    2009-01-01

    RsbX from Bacillus subtilis is a manganese-dependent PPM phosphatase and negatively regulates the signal transduction of the general stress response by the dephosphorylation of RsbS and RsbR, which are activators of the alternative RNA polymerase σ factor SigB. In order to elucidate the structural–functional relationship of its Ser/Thr protein-phosphorylation mechanism, an X-ray crystallographic diffraction study of RsbX was performed. Recombinant RsbX was expressed in Escherichia coli, purified and crystallized. Crystals were obtained using the sitting-drop vapour-diffusion method and X-ray diffraction data were collected to 1.06 Å resolution with an R merge of 8.1%. The crystals belonged to the triclinic space group P1, with unit-cell parameters a = 33.3, b = 41.7, c = 68.6 Å, α = 98.8, β = 90.0, γ = 108.4°. PMID:19923733

  1. Crystallization and preliminary X-ray analysis of the stress-response PPM phosphatase RsbX from Bacillus subtilis.

    PubMed

    Suganuma, Masatoshi; Teh, Aik Hong; Makino, Masatomo; Shimizu, Nobutaka; Kaneko, Tomonori; Hirata, Kunio; Yamamoto, Masaki; Kumasaka, Takashi

    2009-11-01

    RsbX from Bacillus subtilis is a manganese-dependent PPM phosphatase and negatively regulates the signal transduction of the general stress response by the dephosphorylation of RsbS and RsbR, which are activators of the alternative RNA polymerase sigma factor SigB. In order to elucidate the structural-functional relationship of its Ser/Thr protein-phosphorylation mechanism, an X-ray crystallographic diffraction study of RsbX was performed. Recombinant RsbX was expressed in Escherichia coli, purified and crystallized. Crystals were obtained using the sitting-drop vapour-diffusion method and X-ray diffraction data were collected to 1.06 angstrom resolution with an R(merge) of 8.1%. The crystals belonged to the triclinic space group P1, with unit-cell parameters a = 33.3, b = 41.7, c = 68.6 angstrom , alpha = 98.8, beta = 90.0, gamma = 108.4 degrees.

  2. Isolation, crystallization in the macrogravitation field, preliminary X-ray investigation of uridine phosphorylase from Escherichia coli K-12.

    PubMed

    Mikhailov, A M; Smirnova, E A; Tsuprun, V L; Tagunova, I V; Vainshtein, B K; Linkova, E V; Komissarov, A A; Siprashvili, Z Z; Mironov, A S

    1992-03-01

    Uridine phosphorylase (UPH) from Escherichia coli K-12 has been purified to near homogeneity from a strain harbouring the udp gene, encoding UPH, on a multicopy plasmid. UPH was purified to electrophoretic homogeneity with the specific activity 230 units/mg with a recovery of 80%, yielding 120 mg of enzyme from 3g cells. Crystals of enzyme suitable for X-ray diffraction analysis were obtained in a preparative ultracentrifuge. The packing of the molecules in the crystals may be described by the space group P2(1)2(1)2(1) with the unit cell constants a = 90.4; b = 128.8; c = 136.8 A. There is one molecule per asymmetric unit, Vm = 2.4. These crystals diffract to at least 2.5-2.7 A resolution. The hexameric structure of UPH was directly demonstrated by electron microscopy study and image processing.

  3. Controlled vapor crystal growth of N a4I r3O8 : A three-dimensional quantum spin liquid candidate

    NASA Astrophysics Data System (ADS)

    Zheng, Hong; Zhang, Junjie; Stoumpos, Constantinos C.; Ren, Yang; Chen, Yu-Sheng; Dally, Rebecca; Wilson, Stephen D.; Islam, Zahirul; Mitchell, J. F.

    2018-04-01

    We report the successful bulk single-crystal growth of the hyperkagome lattice iridate N a4I r3O8 (Na438) by vapor transport using a sealed aluminum oxide tube as a container. Crystals were characterized by magnetization, x-ray diffraction, and energy-dispersive x-ray measurements, confirming their identity and properties. Single-crystal x-ray diffraction experiments revealed superlattice peaks indexed on a propagation vector q =(1 /3 ,1 /3 ,1 /3 ) based on the cubic substructure with cell parameter a =8.986 (1 )Å . This superlattice is three-dimensional and fully coherent. Polarization analysis rules out spin and/or orbital order as the underlying origin of the modulation and points to long-range ordering of Na ions at the notionally disordered Na sites as a plausible origin for the observed superlattice.

  4. Crystallization and preliminary crystallographic analysis of an acridone-producing novel multifunctional type III polyketide synthase from Huperzia serrata

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Morita, Hiroyuki; Kondo, Shin; Kato, Ryohei

    2007-07-01

    An acridone-producing novel type III polyketide synthase from H. serrata has been overexpressed in E. coli, purified and crystallized. Diffraction data have been collected to 2.0 Å. Polyketide synthase 1 (PKS1) from Huperzia serrata is a plant-specific type III polyketide synthase that shows an unusually versatile catalytic potential, producing various aromatic tetraketides, including chalcones, benzophenones, phlorogulucinols and acridones. Recombinant H. serrata PKS1 expressed in Escherichia coli was crystallized using the hanging-drop vapour-diffusion method. The crystals belonged to space group I222 or I2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 73.3, b = 85.0, c = 137.7 Å, α =more » β = γ = 90.0°. Diffraction data were collected to 2.0 Å resolution using synchrotron radiation at BL24XU of SPring-8.« less

  5. Crystallization and preliminary X-ray diffraction analysis of a cold-adapted catalase from Vibrio salmonicida

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Riise, Ellen Kristin; Lorentzen, Marit Sjo; Helland, Ronny

    2006-01-01

    Monoclinic (P2{sub 1}) crystals of a His-tagged form of V. salmonicida catalase without cofactor diffract X-rays to 1.96 Å. Catalase (EC 1.11.1.6) catalyses the breakdown of hydrogen peroxide to water and molecular oxygen. Recombinant Vibrio salmonicida catalase (VSC) possesses typical cold-adapted features, with higher catalytic efficiency, lower thermal stability and a lower temperature optimum than its mesophilic counterpart from Proteus mirabilis. Crystals of VSC were produced by the hanging-drop vapour-diffusion method using ammonium sulfate as precipitant. The crystals belong to the monoclinic space group P2{sub 1}, with unit-cell parameters a = 98.15, b = 217.76, c = 99.28 Å, βmore » = 110.48°. Data were collected to 1.96 Å and a molecular-replacement solution was found with eight molecules in the asymmetric unit.« less

  6. Controlled vapor crystal growth of N a 4 I r 3 O 8 : A three-dimensional quantum spin liquid candidate

    DOE PAGES

    Zheng, Hong; Zhang, Junjie; Stoumpos, Constantinos C.; ...

    2018-04-24

    In this work, we report the successful bulk single-crystal growth of the hyperkagome lattice iridate Na 4Ir 3O 8 (Na438) by vapor transport using a sealed aluminum oxide tube as a container. Crystals were characterized by magnetization, x-ray diffraction, and energy-dispersive x-ray measurements, confirming their identity and properties. Single-crystal x-ray diffraction experiments revealed superlattice peaks indexed on a propagation vector q=(1/3,1/3,1/3) based on the cubic substructure with cell parameter a=8.986(1)Å. This superlattice is three-dimensional and fully coherent. Polarization analysis rules out spin and/or orbital order as the underlying origin of the modulation and points to long-range ordering of Na ionsmore » at the notionally disordered Na sites as a plausible origin for the observed superlattice.« less

  7. Controlled vapor crystal growth of N a 4 I r 3 O 8 : A three-dimensional quantum spin liquid candidate

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zheng, Hong; Zhang, Junjie; Stoumpos, Constantinos C.

    In this work, we report the successful bulk single-crystal growth of the hyperkagome lattice iridate Na 4Ir 3O 8 (Na438) by vapor transport using a sealed aluminum oxide tube as a container. Crystals were characterized by magnetization, x-ray diffraction, and energy-dispersive x-ray measurements, confirming their identity and properties. Single-crystal x-ray diffraction experiments revealed superlattice peaks indexed on a propagation vector q=(1/3,1/3,1/3) based on the cubic substructure with cell parameter a=8.986(1)Å. This superlattice is three-dimensional and fully coherent. Polarization analysis rules out spin and/or orbital order as the underlying origin of the modulation and points to long-range ordering of Na ionsmore » at the notionally disordered Na sites as a plausible origin for the observed superlattice.« less

  8. Syntheses, structural characterization, and DPPH radical scavenging activity of cocrystals of caffeine with 1- and 2-naphthoxyacetic acids

    NASA Astrophysics Data System (ADS)

    Suresh Kumar, G. S.; Seethalakshmi, P. G.; Sumathi, D.; Bhuvanesh, N.; Kumaresan, S.

    2013-03-01

    Caffeine:1-naphthoxyacetic acid [(caf)(1-naa)] and caffeine:2-naphthoxyacetic acid [(caf)(2-naa)] cocrystals have been synthesized and single crystals were grown by slow evaporation technique. The structures of the grown crystals were elucidated using single crystal X-ray diffraction analysis. Both the cocrystals belong to the monoclinic crystallographic system with space group P21/c, Z = 4, and α = γ = 90°, whereas β = 111.4244(18)° for [(caf)(1-naa)] and β = 109.281(6)° for [(caf)(2-naa)]. The crystal packing is predominantly stabilized by hydrogen bonding and π-π stacking interactions. The presence of unionized -COOH functional group in both the cocrystals was identified by FTIR spectral analysis. Thermal behavior and stability of both the cocrystals were studied by TGA/DTA analyses. Solvent-free formation of these cocrystals was confirmed by powder X-ray diffraction analyses. The theoretical energy of cocrystals showed that the formers have higher energy than cocrystals 1 and 2. DPPH radical scavenging activity of cocrystals 1 and 2 is slightly greater than the formers.

  9. Hydrothermal synthesis, crystal structures, and enantioselective adsorption property of bis(L-histidinato)nickel(II) monohydrate

    NASA Astrophysics Data System (ADS)

    Ramos, Christian Paul L.; Conato, Marlon T.

    2018-05-01

    Despite the numerous researches in metal-organic frameworks (MOFs), there are only few reports on biologically important amino acids, histidine in particular, on its use as bridging ligand in the construction of open-framework architectures. In this work, hydrothermal synthesis was used to prepare a compound based on Ni2+ and histidine. The coordination assembly of imidazole side chain of histidine with divalent nickel ions in aqueous condition yielded purple prismatic solids. Single crystal X-ray diffraction (XRD) analysis of the product revealed structure for Ni(C6H8N3O2)2 • H2O that has a monoclinic (C2) structure with lattice parameters, a = 29.41, b = 8.27, c = 6.31 Å, β = 90.01 ˚. Circular dichroism - optical rotatory dispersion (CD-ORD), Powder X-ray diffraction (PXRD) and Fourier transform - infrared spectroscopy (FT-IR) analyses are conducted to further characterize the crystals. Enantioselective adsorption analysis using racemic mixture of 2-butanol confirmed bis(L-histidinato)nickel(II) monohydrate MOF crystal's enantioselective property preferentially favoring the adsorption of (S)-2-butanol isomer.

  10. Aqueous Sulfate Separation by Sequestration of [(SO 4) 2(H 2O) 4] 4 Clusters within Highly Insoluble Imine-Linked Bis-Guanidinium Crystals

    DOE PAGES

    Custelcean, Radu; Williams, Neil J.; Seipp, Charles A.; ...

    2015-12-18

    Quantitative removal of sulfate from seawater was achieved by selective crystallization of the anion with a bis(guanidinium) ligand self-assembled in situ through imine condensation of simple components. The resulting crystalline salt has an exceptionally low aqueous solubility, on a par with BaSO 4. Single-crystal X-ray diffraction analysis revealed pairs of sulfate anions clustered together with four water molecules within the crystals.

  11. Growth, structural, optical and surface analysis of piperazinium tartrate: A NLO single crystal

    NASA Astrophysics Data System (ADS)

    Gupta, Apurva; Raseel Rahman M., K.; Nair, Lekha

    2018-05-01

    Single crystal of piperazinium tartrate (PPZT) was grown by the slow evaporation solution growth technique at room temperature. Crystallinity of grown crystal was examined by powder X-ray diffraction. High transparency and wide band gap were observed in the UV-Visible spectroscopic studies. Intense and broad emissions were observed in the blue region, as that is indicated by photoluminescence spectroscopy. The quality of the grown PPZT single crystals were analyzed by the etching studies using the water as the etchant.

  12. Synthesis, growth, structural, spectral, thermal, chemical etching, linear and nonlinear optical and mechanical studies of an organic single crystal 4-chloro 4-nitrostilbene (CONS): a potential NLO material.

    PubMed

    Dinakaran, Paul M; Kalainathan, S

    2013-07-01

    4-Chloro 4-nitrostilbene (CONS) a new organic nonlinear optical material has been synthesized. Employing slow evaporation method, good optical quality single crystals (dimensions up to 6×2×3 mm(3)) have been grown using ethyl methyl ketone (EMK) as a solvent. The grown crystals have been subjected to various characterizations such as single crystal X-ray diffraction, powder XRD, Fourier Transform Infrared spectroscopy (FTIR), proton NMR, solid UV absorption, SHG studies. Single crystal X-ray diffraction reveals that the crystal system belongs to monoclinic with noncentrosymmetric space group P21. The UV-Vis absorption spectrum has been recorded and found that the cut off wavelength is 380 nm. Functional groups and the structure of the title compound have been confirmed by FTIR and (1)H NMR spectroscopic analyses respectively. Molecular mass of the CONS confirmed by the high resolution mass spectral analysis .The thermal behavior of the grown crystal has been studied by TG/DTA analysis and it shows the melting point is at 188.66 °C. Dislocations and growth pattern present in the grown crystal revealed by the etching study. The mechanical strength of the CONS crystal has been studied by Vicker's hardness measurement. The SHG efficiency of the grown crystal has been determined by Kurtz and Perry powder test which revealed that the CONS crystal (327 mV) has 15 times greater efficiency than that of KDP (21.7 mV). Copyright © 2013 Elsevier B.V. All rights reserved.

  13. Invited Review Article: Development of crystal lenses for energetic photons

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Smither, Robert K.

    2014-08-15

    This paper follows the development of crystal diffraction lenses designed to focus energetic photons. It begins with the search for a solution to the astrophysics problem of how to detect weak astrophysics sources of gamma rays and x-rays. This led to the basic designs for a lens and to the understanding of basic limitations of lens design. The discussion of the development of crystal diffraction lenses is divided into two parts: lenses using crystals with mosaic structure, and lenses that use crystals with curved crystal planes. This second group divides into two sub-groups: (1) Curved crystals that are used tomore » increase the acceptance angle of the diffraction of a monochromatic beam and to increase the energy bandwidth of the diffraction. (2) Curved crystals used to focus gamma ray beams. The paper describes how these two types of crystals affect the design of the corresponding crystal lenses in different fields: astrophysics, medical imaging, detection of weak, distant, gamma-ray sources, etc. The designs of crystal lenses for these applications are given in enough detail to allow the reader to design a lens for his own application.« less

  14. Measuring the x-ray resolving power of bent potassium acid phthalate diffraction crystals

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Haugh, M. J., E-mail: haughmj@nv.doe.gov; Jacoby, K. D.; Wu, M.

    2014-11-15

    This report presents the results from measuring the X-ray resolving power of a curved potassium acid phthalate (KAP(001)) spectrometer crystal using two independent methods. It is part of a continuing effort to measure the fundamental diffraction properties of bent crystals that are used to study various characteristics of high temperature plasmas. Bent crystals like KAP(001) do not usually have the same diffraction properties as corresponding flat crystals. Models that do exist to calculate the effect of bending the crystal on the diffraction properties have simplifying assumptions and their accuracy limits have not been adequately determined. The type of crystals thatmore » we measured is being used in a spectrometer on the Z machine at Sandia National Laboratories in Albuquerque, New Mexico. The first technique for measuring the crystal resolving power measures the X-ray spectral line width of the characteristic lines from several metal anodes. The second method uses a diode X-ray source and a double crystal diffractometer arrangement to measure the reflectivity curve of the KAP(001) crystal. The width of that curve is inversely proportional to the crystal resolving power. The measurement results are analyzed and discussed.« less

  15. Growth, structural, optical, piezoelectric and etching analysis of L-lysine p-nitrophenolate monohydrate single crystals

    NASA Astrophysics Data System (ADS)

    Alexandar, A.; Lakshmanan, A.; Sakthy Priya, S.; Surendran, P.; Rameshkumar, P.

    2017-09-01

    Nonlinear optical single crystals of L-lysine p-nitrophenolate monohydrate (LLPNP) were grown in aqueous solution by the slow evaporation solution technique (SEST). The grown crystals were subjected to powder X-ray diffraction analysis, (PXRD) and it was found that the title compound was crystallized in the orthorhombic crystal system with noncentrosymmetric space group of P212121. The vibrational frequencies of various functional groups present in the crystal were analyzed using the FTIR spectrum with a wavenumber range between 450 cm-1 and 4000 cm-1. The microhardness analysis of the sample revealed that the crystal belongs to the soft material category. Piezoelectric analysis was performed to measure the value of the piezoelectric (d33) coefficient. Blue light emission of the material was confirmed using the photoluminescence spectrum. Thermal stability of the grown crystal was analyzed using a melting point apparatus and it was found that the LLPNP is stable upto 175∘C. Etching analysis was performed at various durations, in order to identify the surface properties of the LLPNP crystal.

  16. Individual analysis of inter and intragrain defects in electrically characterized polycrystalline silicon nanowire TFTs by multicomponent dark-field imaging based on nanobeam electron diffraction two-dimensional mapping

    NASA Astrophysics Data System (ADS)

    Asano, Takanori; Takaishi, Riichiro; Oda, Minoru; Sakuma, Kiwamu; Saitoh, Masumi; Tanaka, Hiroki

    2018-04-01

    We visualize the grain structures for individual nanosized thin film transistors (TFTs), which are electrically characterized, with an improved data processing technique for the dark-field image reconstruction of nanobeam electron diffraction maps. Our individual crystal analysis gives the one-to-one correspondence of TFTs with different grain boundary structures, such as random and coherent boundaries, to the characteristic degradations of ON-current and threshold voltage. Furthermore, the local crystalline uniformity inside a single grain is detected as the difference in diffraction intensity distribution.

  17. Overcoming a hemihedral twinning problem in tetrahydrofolate-dependent O -demethylase crystals by the microseeding method

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Harada, Ayaka; Sato, Yukari; Kamimura, Naofumi

    2016-11-30

    A tetrahydrofolate-dependentO-demethylase, LigM, from Sphingobiumsp. SYK-6 was crystallized by the hanging-drop vapour-diffusion method. However, the obtained P3 121 orP3 221 crystals, which diffracted to 2.5–3.3 Å resolution, were hemihedrally twinned. To overcome the twinning problem, microseeding using P3 121/P3 2 21 crystals as microseeds was performed with optimization of the reservoir conditions. As a result, another crystal form was obtained. The newly obtained crystal diffracted to 2.5–3.0 Å resolution and belonged to space group P2 12 12, with unit-cell parametersa= 102.0,b= 117.3,c = 128.1 Å. The P2 12 12 crystals diffracted to better than 2.0 Å resolution after optimizing themore » cryoconditions. Phasing using the single anomalous diffraction method was successful at 3.0 Å resolution with a Pt-derivative crystal. This experience suggested that microseeding is an effective method to overcome the twinning problem, even when twinned crystals are utilized as microseeds.« less

  18. Growth and characterization of unidirectional benzil single crystal for photonic applications

    NASA Astrophysics Data System (ADS)

    Saranraj, A.; Thirupathy, J.; Dhas, S. Sahaya Jude; Jose, M.; Vinitha, G.; Dhas, S. A. Martin Britto

    2018-06-01

    Organic nonlinear optical benzil single crystal of fine quality with the dimensions of 168 × 14 mm2 was successfully grown in (100) plane from saturated solution by unidirectional SR method. The structural identity of the grown crystal was confirmed by powder XRD. High-resolution X-ray diffraction analysis indicates the crystalline perfection of the grown benzil crystal. The optical analysis was carried out by UV-visible spectroscopy which shows that the benzil crystal's cut off wavelength is 437 nm. The dielectric constant and dielectric loss of benzil crystal are found to be very much depending upon temperature and frequency. Ferroelectric nature of grown crystal was identified by P- E hysteresis analysis and to find the values of spontaneous polarization and coercive field. The laser damage threshold energy was studied with the help of Nd:YAG laser. The presence of third harmonic generation was identified by z-scan techniques.

  19. Overexpression, purification and crystallization of a choline-binding protein CbpI from Streptococcus pneumoniae

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Paterson, Neil G., E-mail: neison@chem.gla.ac.uk; Riboldi-Tunicliffe, Alan; Mitchell, Timothy J.

    2006-07-01

    The choline-binding protein CbpI from S. pneumoniae has been purified and crystallized and diffraction data have been collected to 3.5 Å resolution. The choline-binding protein CbpI from Streptococcus pneumoniae is a 23.4 kDa protein with no known function. The protein has been successfully purified initially using Ni–NTA chromatography and to homogeneity using Q-Sepharose ion-exchange resin as an affinity column. CbpI was crystallized using PEG 3350 as a precipitant and X-ray crystallographic analysis showed that the crystals belonged to the tetragonal space group P4, with unit-cell parameters a = b = 83.31, c = 80.29 Å, α = β = γmore » = 90°. The crystal contains two molecules in the asymmetric unit with a solvent content of 55.7% (V{sub M} = 2.77 Å{sup 3} Da{sup −1}) and shows a diffraction limit of 3.5 Å.« less

  20. Acousto-optic interaction in alpha-BaB(2)O(4)and Li(2)B(4)O(7) crystals.

    PubMed

    Martynyuk-Lototska, Irina; Mys, Oksana; Dudok, Taras; Adamiv, Volodymyr; Smirnov, Yevgen; Vlokh, Rostyslav

    2008-07-01

    Experimental studies and analysis of acousto-optic diffraction in alpha-BaB(2)O(4) and Li(2)B(4)O(7) crystals are given. Ultrasonic wave velocity, elastic compliance and stiffness coefficients, and piezo-optic and photoelastic coefficients of alpha-BaB(2)O(4) and Li(2)B(4)O(7) crystals are determined. The acousto-optic figure of merit has been estimated for different possible geometries of acousto-optic interaction. It is shown that the acousto-optic figures of merit for alpha-BaB(2)O(4) crystals reach the value M(2)=(270 +/- 70) x 10(-15) s(3)/kg for the case of interaction with the slowest ultrasonic wave. The directions of propagation and polarization of those acoustic waves are obtained on the basis of construction of acoustic slowness surfaces. The acousto-optic diffraction is experimentally studied for alpha-BaB(2)O(4) and Li(2)B(4)O(7) crystals.

  1. Crystallization and preliminary X-ray diffraction analysis of ScrY, a specific bacterial outer membrane porin.

    PubMed

    Forst, D; Schülein, K; Wacker, T; Diederichs, K; Kreutz, W; Benz, R; Welte, W

    1993-01-05

    The sucrose-specific outer membrane porin ScrY of Salmonella typhimurium was isolated from Escherichia coli K-12 strain KS 26 containing the plasmid pPSO112. The protein was purified to homogeneity by differential extraction of the cell envelope in the presence of the detergents sodium dodecyl sulfate and lauryl (dimethyl)-amine oxide (LDAO). The porin had apparent molecular weights of 58 kDa and 120 kDa for the monomer and for the trimer, respectively, on SDS/PAGE. The purified trimers were crystallized using poly(ethylene glycol) 2000 and the detergents octylglucoside (OG) and hexyl-(dimethyl)-amine oxide (C6DAO). X-ray diffraction of the crystals showed reflections to 2.3 A. The space group of the crystals was R3 and the lattice constants of the hexagonal axes were a = b = 112.85 A and c = 149.9 A. The crystal volume per unit of protein molecular weight was 3.47 A3/Da.

  2. An internal affinity-tag for purification and crystallization of the siderophore receptor FhuA, integral outer membrane protein from Escherichia coli K-12.

    PubMed

    Ferguson, A D; Breed, J; Diederichs, K; Welte, W; Coulton, J W

    1998-07-01

    FhuA (Mr 78,992, 714 amino acids), siderophore receptor for ferrichrome-iron in the outer membrane of Escherichia coli, was affinity tagged, rapidly purified, and crystallized. To obtain FhuA in quantities sufficient for crystallization, a hexahistidine tag was genetically inserted into the fhuA gene after amino acid 405, which resides in a known surface-exposed loop. Recombinant FhuA405.H6 was overexpressed in an E. coli strain that is devoid of several major porins and using metal-chelate chromatography was purified in large amounts to homogeneity. FhuA crystals were grown using the hanging drop vapor diffusion technique and were suitable for X-ray diffraction analysis. On a rotating anode X-ray source, diffraction was observed to 3.0 A resolution. The crystals belong to space group P6(1) or P6(5) with unit cell dimensions of a=b=174 A, c=88 A (alpha=beta=90 degrees, gamma=120 degrees).

  3. Crystallization, X-ray diffraction analysis and preliminary structure determination of the polygalacturonase PehA from Agrobacterium vitis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vordtriede, Paul B.; Yoder, Marilyn D., E-mail: yoderm@umkc.edu

    2008-07-01

    The acidic polygalacturonase PehA from A. vitis has been crystallized. A molecular-replacement solution indicated a right-handed parallel β-helix fold. Polygalacturonases are pectate-degrading enzymes that belong to glycoside hydrolase family 28 and hydrolyze the α-1,4 glycosidic bond between neighboring galacturonasyl residues of the homogalacturonan substrate. The acidic polygalacturonase PehA from Agrobacterium vitis was overexpressed in Escherichia coli, where it accumulated in the periplasmic fraction. It was purified to homogeneity via a two-step chromatography procedure and crystallized using the hanging-drop vapour-diffusion technique. PehA crystals belonged to space group P2{sub 1}, with unit-cell parameters a = 52.387, b = 62.738, c = 149.165more » Å, β = 89.98°. Crystals diffracted to 1.59 Å resolution and contained two molecules per asymmetric unit. An initial structure determination by molecular replacement indicated a right-handed parallel β-helix fold.« less

  4. Crystallization and preliminary X-ray crystallographic analysis of the GluR0 ligand-binding core from Nostoc punctiforme

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lee, Jun Hyuck; Park, Soo Jeong; Rho, Seong-Hwan

    2005-11-01

    The GluR0 ligand-binding core from N. punctiforme was expressed, purified and crystallized in the presence of l-glutamate. A diffraction data set was collected to a resolution of 2.1 Å. GluR0 from Nostoc punctiforme (NpGluR0) is a bacterial homologue of the ionotropic glutamate receptor. The ligand-binding core of NpGluR0 was crystallized at 294 K using the hanging-drop vapour-diffusion method. The l-glutamate-complexed crystal belongs to space group C222{sub 1}, with unit-cell parameters a = 78.0, b = 145.1, c = 132.1 Å. The crystals contain three subunits in the asymmetric unit, with a V{sub M} value of 2.49 Å{sup 3} Da{sup −1}.more » The diffraction limit of the l-glutamate complex data set was 2.1 Å using synchrotron X-ray radiation at beamline BL-4A of the Pohang Accelerator Laboratory (Pohang, Korea)« less

  5. The crystal structure of paramagnetic copper(II) oxalate (CuC₂O₄): formation and thermal decomposition of randomly stacked anisotropic nano-sized crystallites.

    PubMed

    Christensen, Axel Nørlund; Lebech, Bente; Andersen, Niels Hessel; Grivel, Jean-Claude

    2014-11-28

    Synthetic copper(II) oxalate, CuC2O4, was obtained in a precipitation reaction between a copper(II) solution and an aqueous solution of oxalic acid. The product was identified from its conventional X-ray powder patterns which match that of the copper mineral Moolooite reported to have the composition CuC2O4·0.44H2O. Time resolved in situ investigations of the thermal decomposition of copper(II) oxalate using synchrotron X-ray powder diffraction showed that in air the compound converts to Cu2O at 215 °C and oxidizes to CuO at 345 °C. Thermo gravimetric analysis performed in an inert Ar-gas reveals that the material contains no crystal water and reduces to pure Cu at 295 °C. Magnetic susceptibility measurements in the temperature range from 2 K to 300 K show intriguing paramagnetic behaviour with no sign of magnetic order down to 2 K. A crystal structure investigation is made based on powder diffraction data using one neutron diffraction pattern obtained at 5 K (λ = 1.5949(1) Å) combined with one conventional and two synchrotron X-ray diffraction patterns obtained at ambient temperature using λ = 1.54056, 1.0981 and λ = 0.50483(1) Å, respectively. Based on the X-ray synchrotron data the resulting crystal structure is described in the monoclinic space group P2₁/c (#14) in the P12₁/n1 setting with unit cell parameters a = 5.9598(1) Å, b = 5.6089(1) Å, c = 5.1138 (1) Å, β = 115.320(1)°. The composition is CuC2O4 with atomic coordinates determined by FullProf refinement of the neutron diffraction data. The crystal structure consists of a random stacking of CuC2O4 micro-crystallites where half the Cu-atoms are placed at (2a) and the other half at (2b) positions with the corresponding oxalate molecules centred around the corresponding (2b) and (2a) site positions, respectively. The diffraction patterns obtained for both kinds of radiation show considerable broadening of several Bragg peaks caused by highly anisotropic microstructural size and strain effects. In contrast to the water reported to be present in Moolooite, neither thermogravimetric nor the in situ thermal decomposition investigations and crystal structure analysis of the neutron diffraction data revealed any trace of water. An appendix contains details about the profile parameters for the diffractometers used at the European Synchrotron Radiation Facility and the Institute Max von Laue-Paul Langevin.

  6. Crystallization and preliminary X-ray crystallographic analysis of YfcM: an important factor for EF-P hydroxylation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kobayashi, Kan; RIKEN, 2-1 Hirosawa, Wako, Saitama 351-0198; Suzuki, Takehiro

    2014-08-27

    E. coli YfcM was expressed, purified and crystallized. Crystals of YfcM were obtained by the in situ proteolysis crystallization method. Using these crystals, an X-ray diffraction data set was collected at 1.45 Å resolution. Elongation factor P (EF-P) plays an essential role in the translation of polyproline-containing proteins in bacteria. It becomes functional by the post-translational modification of its highly conserved lysine residue. It is first β-lysylated by PoxA and then hydroxylated by YfcM. In this work, the YfcM protein from Escherichia coli was overexpressed, purified and crystallized. The crystal of YfcM was obtained by the in situ proteolysis crystallizationmore » method and diffracted X-rays to 1.45 Å resolution. It belonged to space group C2, with unit-cell parameters a = 124.4, b = 37.0, c = 37.6 Å, β = 101.2°. The calculated Matthews coefficient (V{sub M}) of the crystal was 1.91 Å{sup 3} Da{sup −1}, indicating that one YfcM molecule is present in the asymmetric unit with a solvent content of 35.7%.« less

  7. Growth, crystalline perfection, spectral and optical characterization of a novel optical material: l-tryptophan p-nitrophenol trisolvate single crystal.

    PubMed

    Sivakumar, N; Srividya, J; Mohana, J; Anbalagan, G

    2015-03-15

    l-tryptophan p-nitrophenol trisolvate (LTPN), an organic nonlinear optical material was synthesized using ethanol-water mixed solvent and the crystals were grown by a slow solvent evaporation method. The crystal structure and morphology were studied by single crystal X-ray diffraction analysis. The crystalline perfection of the LTPN crystal was analyzed by high-resolution X-ray diffraction study. The molecular structure of the crystal was confirmed by observing the various characteristic functional groups of the material using vibrational spectroscopy. The cut-off wavelength, optical transmission, refractive index and band gap energy were determined using UV-visible data. The variation of refractive index with wavelength shows the normal behavior. The second harmonic generation of the crystal was confirmed and the efficiency was measured using Kurtz Perry powder method. Single and multiple shot methods were employed to measure surface laser damage of the crystal. The photoluminescence spectral study revealed that the emission may be associated with the radiative recombination of trapped electrons and holes. Microhardness measurements revealed that LTPN belongs to a soft material category. Copyright © 2014 Elsevier B.V. All rights reserved.

  8. Empirically testing vaterite structural models using neutron diffraction and thermal analysis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chakoumakos, Bryan C.; Pracheil, Brenda M.; Koenigs, Ryan

    Otoliths, calcium carbonate (CaCO 3) ear bones, are among the most commonly used age and growth structures of fishes. Most fish otoliths are comprised of the most dense CaCO 3 polymorph, aragonite. Sturgeon otoliths, in contrast, have been characterized as the rare and structurally enigmatic polymorph, vaterite a metastable polymorph of CaCO 3. Vaterite is an important material ranging from biomedical to personal care applications although its crystal structure is highly debated. We characterized the structure of sturgeon otoliths using thermal analysis and neutron powder diffraction, which is used non-destructively. We confirmed that while sturgeon otoliths are primarily composed ofmore » vaterite, they also contain the denser CaCO 3 polymorph, calcite. For the vaterite fraction, neutron diffraction data provide enhanced discrimination of the carbonate group compared to x-ray diffraction data, owing to the different relative neutron scattering lengths, and thus offer the opportunity to uniquely test the more than one dozen crystal structural models that have been proposed for vaterite. Of those, space group P6 522 model, a = 7.1443(4)Å , c = 25.350(4)Å , V = 1121.5(2)Å 3 provides the best fit to the neutron powder diffraction data, and allows for a structure refinement using rigid carbonate groups.« less

  9. Empirically testing vaterite structural models using neutron diffraction and thermal analysis

    DOE PAGES

    Chakoumakos, Bryan C.; Pracheil, Brenda M.; Koenigs, Ryan; ...

    2016-11-18

    Otoliths, calcium carbonate (CaCO 3) ear bones, are among the most commonly used age and growth structures of fishes. Most fish otoliths are comprised of the most dense CaCO 3 polymorph, aragonite. Sturgeon otoliths, in contrast, have been characterized as the rare and structurally enigmatic polymorph, vaterite a metastable polymorph of CaCO 3. Vaterite is an important material ranging from biomedical to personal care applications although its crystal structure is highly debated. We characterized the structure of sturgeon otoliths using thermal analysis and neutron powder diffraction, which is used non-destructively. We confirmed that while sturgeon otoliths are primarily composed ofmore » vaterite, they also contain the denser CaCO 3 polymorph, calcite. For the vaterite fraction, neutron diffraction data provide enhanced discrimination of the carbonate group compared to x-ray diffraction data, owing to the different relative neutron scattering lengths, and thus offer the opportunity to uniquely test the more than one dozen crystal structural models that have been proposed for vaterite. Of those, space group P6 522 model, a = 7.1443(4)Å , c = 25.350(4)Å , V = 1121.5(2)Å 3 provides the best fit to the neutron powder diffraction data, and allows for a structure refinement using rigid carbonate groups.« less

  10. Observation of divergent-beam X-ray diffraction from a crystal of diamond using synchrotron radiation.

    PubMed

    Glazer, A M; Collins, S P; Zekria, D; Liu, J; Golshan, M

    2004-03-01

    In 1947 Kathleen Lonsdale conducted a series of experiments on X-ray diffraction using a divergent beam external to a crystal sample. Unlike the Kossel technique, where divergent X-rays are excited by the presence of fluorescing atoms within the crystal, the use of an external divergent source made it possible to study non-fluorescing crystals. The resulting photographs not only illustrated the complexity of X-ray diffraction from crystals in a truly beautiful way, but also demonstrated unprecedented experimental precision. This long-forgotten work is repeated here using a synchrotron radiation source and, once again, considerable merit is found in Lonsdale's technique. The results of this experiment suggest that, through the use of modern 'third-generation' synchrotron sources, divergent-beam diffraction could soon enjoy a renaissance for high-precision lattice-parameter determination and the study of crystal perfection.

  11. Surface-treated self-standing curved crystals as high-efficiency elements for X- and γ-ray optics: theory and experiment.

    PubMed

    Bonnini, Elisa; Buffagni, Elisa; Zappettini, Andrea; Doyle, Stephen; Ferrari, Claudio

    2015-06-01

    The efficiency of a Laue lens for X- and γ-ray focusing in the energy range 60-600 keV is closely linked to the diffraction efficiency of the single crystals composing the lens. A powerful focusing system is crucial for applications like medical imaging and X-ray astronomy where wide beams must be focused. Mosaic crystals with a high density, such as Cu or Au, and bent crystals with curved diffracting planes (CDPs) are considered for the realization of a focusing system for γ-rays, owing to their high diffraction efficiency in a predetermined angular range. In this work, a comparison of the efficiency of CDP crystals and Cu and Au mosaic crystals was performed on the basis of the theory of X-ray diffraction. Si, GaAs and Ge CDP crystals with optimized thicknesses and moderate radii of curvature of several tens of metres demonstrate comparable or superior performance with respect to the higher atomic number mosaic crystals generally used. In order to increase the efficiency of the lens further, a stack of several CDP crystals is proposed as an optical element. CDP crystals were obtained by a surface-damage method, and a stack of two surface-damaged bent Si crystals was prepared and tested. Rocking curves of the stack were performed with synchrotron radiation at 19 keV to check the lattice alignment: they exhibited only one diffraction peak.

  12. The Question of Impurities in Macromolecule Crystal Quality Improvement in Microgravity

    NASA Technical Reports Server (NTRS)

    Judge, Russell A.; Snell, Edward H.; Pusey, Marc L.; Sportiello, Michael G.; Todd, Paul; Bellamy, Henry; Borgstahl, Gloria E.; Pokros, Matthew; Cassanto, John M.

    2000-01-01

    While macromolecule impurities may affect crystal size and morphology the over-riding question is how do macromolecule impurities effect crystal X-ray quality and diffraction resolution. In the case of chicken egg white lysozyme previous researchers have reported that crystals grown in the presence of ovalbumin, ovotransferrin, and turkey egg white lysozyme show no difference in diffraction resolution compared to those grown in pure solutions. One impurity however, a naturally occurring lysozyme dimer, does negatively impact the X-ray crystal properties. For this impurity it has been reported that crystal quality improvement in microgravity may be due to improved impurity partitioning during crystallization. In this study we have examined the incorporation of the dimer into lysozyme crystals, both on the ground and in microgravity experiments, and have performed detailed X-ray analysis of the crystals using a new technique for finely probing the mosaicity of the crystal at the Stanford Synchrotron Radiation Laboratory. Dimer partitioning was not significantly different in microgravity compared to the ground based experiments, although it is significantly better than that previously reported in microgravity. Mosaicity analysis of pure crystals, 1422 indexed reflections (microgravity) and 752 indexed reflections (ground), gave average results of 0.0066 and 0.0092 degrees (FWHM) respectively. The microgravity crystals also provided an increased signal to noise. Dimer incorporation increased the average mosaicity in microgravity but not on the ground. However, dimer incorporation did greatly reduce the resolution limit in both ground and microgravity grown crystals. The data is being treated anisotropically to explore these effects. These results indicate that impurity effects in microgravity are complex and that the conditions or techniques employed may greatly affect the role of impurities.

  13. Crystallization and preliminary crystallographic analysis of a family 43 β-d-xylosidase from Geobacillus stearothermophilus T-6

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Brüx, Christian; Niefind, Karsten; Ben-David, Alon

    2005-12-01

    The crystallization and preliminary X-ray analysis of a β-d-xylosidase from G. stearothermophilus T-6, a family 43 glycoside hydrolase, is described. Native and catalytic inactive mutants of the enzymes were crystallized in two different space groups, orthorhombic P2{sub 1}2{sub 1}2 and tetragonal P4{sub 1}2{sub 1}2 (or the enantiomorphic space group P4{sub 3}2{sub 1}2), using a sensitive cryoprotocol. The latter crystal form diffracted X-rays to a resolution of 2.2 Å. β-d-Xylosidases (EC 3.2.1.37) are hemicellulases that cleave single xylose units from the nonreducing end of xylooligomers. In this study, the crystallization and preliminary X-ray analysis of a β-d-xylosidase from Geobacillus stearothermophilus T-6more » (XynB3), a family 43 glycoside hydrolase, is described. XynB3 is a 535-amino-acid protein with a calculated molecular weight of 61 891 Da. Purified recombinant native and catalytic inactive mutant proteins were crystallized and cocrystallized with xylobiose in two different space groups, P2{sub 1}2{sub 1}2 (unit-cell parameters a = 98.32, b = 99.36, c = 258.64 Å) and P4{sub 1}2{sub 1}2 (or the enantiomorphic space group P4{sub 3}2{sub 1}2; unit-cell parameters a = b = 140.15, c = 233.11 Å), depending on the detergent. Transferring crystals to cryoconditions required a very careful protocol. Orthorhombic crystals diffract to 2.5 Å and tetragonal crystals to 2.2 Å.« less

  14. Crystallization and preliminary X-ray diffraction analysis of hemextin A: a unique anticoagulant protein from Hemachatus haemachatus venom

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Banerjee, Yajnavalka; Kumar, Sundramurthy; Jobichen, Chacko

    2007-08-01

    Crystals of hemextin A, a three-finger toxin isolated and purified from African Ringhals cobra (H. haemachatus), are orthorhombic, space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 49.27, b = 49.51, c = 57.87 Å, and diffract to 1.5 Å resolution. Hemextin A was isolated and purified from African Ringhals cobra (Hemachatus haemachatus). It is a three-finger toxin that specifically inhibits blood coagulation factor VIIa and clot formation and that also interacts with hemextin B to form a unique anticoagulant complex. Hemextin A was crystallized by the hanging-drop vapour-diffusion method by equilibration against 0.2 M ammonium acetate, 0.1more » M sodium acetate trihydrate pH 4.6 and 30% PEG 4000 as the precipitating agent. The crystals belong to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 49.27, b = 49.51, c = 57.87 Å and two molecules in the asymmetric unit. They diffracted to 1.5 Å resolution at beamline X25 at BNL.« less

  15. Order-disorder-reorder process in thermally treated dolomite samples: a combined powder and single-crystal X-ray diffraction study

    NASA Astrophysics Data System (ADS)

    Zucchini, A.; Comodi, P.; Katerinopoulou, A.; Balic-Zunic, T.; McCammon, C.; Frondini, F.

    2012-04-01

    A combined powder and single-crystal X-ray diffraction analysis of dolomite [CaMg(CO3)2] heated to 1,200°C at 3 GPa was made to study the order-disorder-reorder process. The order/disorder transition is inferred to start below 1,100°C, and complete disorder is attained at approximately 1,200°C. Twinned crystals characterized by high internal order were found in samples annealed over 1,100°C, and their fraction was found to increase with temperature. Evidences of twinning domains combined with probable remaining disordered portions of the structure imply that reordering processes occur during the quench. Twin domains are hereby proposed as a witness to thermally induced intra-layer-type cation disordering.

  16. Synthesis, crystal structure, thermal and nonlinear optical properties of new metal-organic single crystal: Tetrabromo (piperazinium) zincate (II) (TBPZ)

    NASA Astrophysics Data System (ADS)

    Boopathi, K.; Babu, S. Moorthy; Ramasamy, P.

    2018-04-01

    Tetrabromo (piperazinium) zincate, a new metal-organic crystal has been synthesized and its single crystal grown by slow evaporation method. The grown crystal has characterized by structural, spectral, thermal, linear and nonlinear optical properties. Single crystal X-ray diffractions study reveals that grown crystal belongs to orthorhombic crystal system with space group P212121. The presence of functional groups is identified by FT-IR spectral analysis. Thermal stability of the crystal was ascertained by TG-DTA measurement. The second order harmonic generation efficiency was measured using Kurtz and Perry technique and it was found to be 1.5 times that of KDP.

  17. Synthesis, crystal growth and characterization of a phase matchable nonlinear optical single crystal: p-chloro dibenzylideneacetone

    NASA Astrophysics Data System (ADS)

    Ravindra, H. J.; John Kiran, A.; Nooji, Satheesha Rai; Dharmaprakash, S. M.; Chandrasekharan, K.; Kalluraya, Balakrishna; Rotermund, Fabian

    2008-05-01

    Good quality single crystals of p-chloro dibenzylideneacetone (CDBA) of size 13 mm×8 mm×2 mm were grown by slow evaporation solution growth technique. The grown crystals were confirmed by elemental analysis, Fourier transform infrared (FTIR) analysis and single crystal X-ray diffraction techniques. From the thermo gravimetric/differential thermal (TG/DT) analysis, the CDBA was found to be thermally stable up to 250 °C. The mechanical stability of the crystal is comparable with that of the other reported chalcones. The lower optical cut-off wavelength for this crystal was observed at 440 nm. The laser damage threshold of the crystal was 0.6 GW/cm 2 at 532 nm. The second harmonic generation conversion efficiency of the powder sample of CDBA was found to be 4.5 times greater than that of urea. We also demonstrate the existence of the phase matching property in this crystal using Kurtz powder technique.

  18. Diffraction of real and virtual photons in a pyrolytic graphite crystal as source of intensive quasimonochromatic X-ray beam

    NASA Astrophysics Data System (ADS)

    Bogomazova, E. A.; Kalinin, B. N.; Naumenko, G. A.; Padalko, D. V.; Potylitsyn, A. P.; Sharafutdinov, A. F.; Vnukov, I. E.

    2003-01-01

    A series of experiments on the parametric X-rays radiation (PXR) generation and radiation soft component diffraction of relativistic electrons in pyrolytic graphite (PG) crystals have been carried out at the Tomsk synchrotron. It is shown that the experimental results with PG crystals are explained by the kinematic PXR theory if we take into account a contribution of the real photons diffraction (transition radiation, bremsstrahlung and PXR photons as well). The measurements of the emission spectrum of channeled electrons in the photon energy range much smaller than the characteristic energy of channeling radiation have been performed with a crystal-diffraction spectrometer. For electrons incident along the <1 1 0> axis of a silicon crystal, the radiation intensity in the energy range 30⩽ ω⩽360 keV exceeds the bremsstrahlung one almost by an order of magnitude. Different possibilities to create an effective source of the monochromatic X-ray beam based on the real and virtual photons diffraction in the PG crystals have been considered.

  19. Inorganic pyrophosphatase crystals from Thermococcus thioreducens for X-ray and neutron diffraction.

    PubMed

    Hughes, Ronny C; Coates, Leighton; Blakeley, Matthew P; Tomanicek, Steve J; Langan, Paul; Kovalevsky, Andrey Y; García-Ruiz, Juan M; Ng, Joseph D

    2012-12-01

    Inorganic pyrophosphatase (IPPase) from the archaeon Thermococcus thioreducens was cloned, overexpressed in Escherichia coli, purified and crystallized in restricted geometry, resulting in large crystal volumes exceeding 5 mm3. IPPase is thermally stable and is able to resist denaturation at temperatures above 348 K. Owing to the high temperature tolerance of the enzyme, the protein was amenable to room-temperature manipulation at the level of protein preparation, crystallization and X-ray and neutron diffraction analyses. A complete synchrotron X-ray diffraction data set to 1.85 Å resolution was collected at room temperature from a single crystal of IPPase (monoclinic space group C2, unit-cell parameters a=106.11, b=95.46, c=113.68 Å, α=γ=90.0, β=98.12°). As large-volume crystals of IPPase can be obtained, preliminary neutron diffraction tests were undertaken. Consequently, Laue diffraction images were obtained, with reflections observed to 2.1 Å resolution with I/σ(I) greater than 2.5. The preliminary crystallographic results reported here set in place future structure-function and mechanism studies of IPPase.

  20. Crystallization and preliminary crystallographic analysis of the catechol 2,3-dioxygenase PheB from Bacillus stearothermophilus BR219

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sugimoto, Keisuke; Matsufuzi, Kazuki; Ohnuma, Hiroaki

    2006-02-01

    PheB, an extradiol-cleaving catecholic dioxygenase, was crystallized by the hanging-drop vapour-diffusion method using PEG 4000 as a precipitant. The crystal belongs to the orthorhombic system, space group P2{sub 1}2{sub 1}2{sub 1}, and diffracts to 2.3 Å resolution. Class II extradiol-cleaving catecholic dioxygenase, a key enzyme of aromatic compound degradation in bacteria, cleaves the aromatic ring of catechol by adding two O atoms. PheB is one of the class II extradiol-cleaving catecholic dioxygenases and shows a high substrate specificity for catechol derivatives, which have one aromatic ring. In order to reveal the mechanism of the substrate specificity of PheB, PheB hasmore » been crystallized by the hanging-drop vapour-diffusion method using PEG 4000 as a precipitant. The space group of the obtained crystal was P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 65.5, b = 119.2, c = 158.7 Å. The crystal diffracted to 2.3 Å resolution.« less

  1. Monoclinic nanodomains in morphotropic phase boundary Pb(Mg{sub 1/3}Nb{sub 2/3})O{sub 3}–PbTiO{sub 3}

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sato, Y., E-mail: y-sato@sigma.t.u-tokyo.ac.jp; Hirayama, T.; Ikuhara, Y.

    2014-02-24

    Crystalline structure is a fundamental characteristic of many materials, and drastic changes in properties may accompany crystal phase transitions. A prominent example of this is the morphotropic phase boundary of (Pb(Mg{sub 1/3}Nb{sub 2/3})O{sub 3}-PbTiO{sub 3}) single crystal, a region that exhibits a high piezoelectric effect. Although the highest piezoelectricity is often attributed to a monoclinic crystal phase, formation of ferroelectric nanodomains (NDs) complicates understanding of this crystal structure. In this Letter, we report dedicated transmission electron microscopy and electron diffraction analysis to understand the crystal structure at the ND level. Splitting of diffraction spots, caused by very small lattice distortionmore » in the NDs, is important to understanding crystal structure and has been unambiguously observed. The results can be explained by monoclinic phase NDs. Combining these results with our previous findings on ND dynamics [Sato et al. Phys. Rev. Lett. 107, 187601 (2011)], monoclinic NDs can potentially make a considerable contribution to the piezoelectricity in these materials.« less

  2. Crystal growth, structural, optical, spectral and thermal studies of tris( L-phenylalanine) L-phenylalaninium nitrate: A new organic nonlinear optical material

    NASA Astrophysics Data System (ADS)

    Prakash, M.; Geetha, D.; Lydia Caroline, M.

    2011-10-01

    Tris( L-phenylalanine) L-phenylalaninium nitrate, C 9H 12NO 2+·NO 3-·3C 9H 11NO 2 (TPLPN), a new organic nonlinear optical material was grown from aqueous solution by slow evaporation solution growth at room temperature. The grown crystals were subjected to powder X-ray diffraction and single crystal X-ray diffraction studies to confirm the crystalline nature and crystal structure. The modes of vibration of different molecular groups present in TPLPN have been identified by FTIR spectral analysis. The presence of hydrogen and carbon in the grown crystal were confirmed by using proton and carbon nuclear magnetic resonance (NMR) spectral analyses. The optical transmission spectral study establishes good transmitting ability of the crystal in the entire visible region. The thermogravimetric (TG) and differential thermal analyses (DTA) were carried out to understand the thermal stability of the sample. The nonlinear optical property of the compound observed using Kurtz powder second harmonic generation test assets the suitability of the grown material for the frequency conversion of laser radiation of Nd:YAG.

  3. Measuring the X-ray Resolving Power of Bent Potassium Acid Phthalate Diffraction Crystals

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Haugh, M. J.; Wu, M.; Jacoby, K. D.

    2014-11-01

    This report presents the results from measuring the X-ray resolving power of a curved potassium acid phthalate (KAP(001)) spectrometer crystal using two independent methods. It is part of a continuing effort to measure the fundamental diffraction properties of bent crystals that are used to study various characteristics of high temperature plasmas. Bent crystals like KAP(001) do not usually have the same diffraction properties as corresponding flat crystals. Models that do exist to calculate the effect of bending the crystal on the diffraction properties have simplifying assumptions and their accuracy limits have not been adequately determined. The type of crystals thatmore » we measured is being used in a spectrometer on the Z machine at Sandia National Laboratories (SNL) in Albuquerque, NM. The first technique for measuring the crystal resolving power measures the X-ray spectral line width of the characteristic lines from several metal anodes. The second method uses a diode X-ray source and a dual goniometer arrangement to measure the reflectivity curve of the KAP(001) crystal. The width of that curve is inversely proportional to the crystal resolving power. The measurement results are analyzed and discussed.« less

  4. Measuring the x-ray resolving power of bent potassium acid phthalate diffraction crystalsa)

    NASA Astrophysics Data System (ADS)

    Haugh, M. J.; Wu, M.; Jacoby, K. D.; Loisel, G. P.

    2014-11-01

    This report presents the results from measuring the X-ray resolving power of a curved potassium acid phthalate (KAP(001)) spectrometer crystal using two independent methods. It is part of a continuing effort to measure the fundamental diffraction properties of bent crystals that are used to study various characteristics of high temperature plasmas. Bent crystals like KAP(001) do not usually have the same diffraction properties as corresponding flat crystals. Models that do exist to calculate the effect of bending the crystal on the diffraction properties have simplifying assumptions and their accuracy limits have not been adequately determined. The type of crystals that we measured is being used in a spectrometer on the Z machine at Sandia National Laboratories in Albuquerque, New Mexico. The first technique for measuring the crystal resolving power measures the X-ray spectral line width of the characteristic lines from several metal anodes. The second method uses a diode X-ray source and a double crystal diffractometer arrangement to measure the reflectivity curve of the KAP(001) crystal. The width of that curve is inversely proportional to the crystal resolving power. The measurement results are analyzed and discussed.

  5. Single Crystal Membranes

    NASA Technical Reports Server (NTRS)

    Stormont, R. W.; Morrison, A.

    1974-01-01

    Single crystal a- and c-axis tubes and ribbons of sodium beta-alumina and sodium magnesium beta-alumina were grown from sodium oxide rich melts. Additional experiments grew ribbon crystals containing sodium magnesium beta, beta double prime, beta triple prime, and beta quadruple prime. A high pressure crystal growth chamber, sodium oxide rich melts, and iridium for all surfaces in contact with the melt were combined with the edge-defined, film-fed growth technique to grow the single crystal beta-alumina tubes and ribbons. The crystals were characterized using metallographic and X-ray diffraction techniques, and wet chemical analysis was used to determine the sodium, magnesium, and aluminum content of the grown crystals.

  6. Microfluidic Chips for In Situ Crystal X-ray Diffraction and In Situ Dynamic Light Scattering for Serial Crystallography.

    PubMed

    Gicquel, Yannig; Schubert, Robin; Kapis, Svetlana; Bourenkov, Gleb; Schneider, Thomas; Perbandt, Markus; Betzel, Christian; Chapman, Henry N; Heymann, Michael

    2018-04-24

    This protocol describes fabricating microfluidic devices with low X-ray background optimized for goniometer based fixed target serial crystallography. The devices are patterned from epoxy glue using soft lithography and are suitable for in situ X-ray diffraction experiments at room temperature. The sample wells are lidded on both sides with polymeric polyimide foil windows that allow diffraction data collection with low X-ray background. This fabrication method is undemanding and inexpensive. After the sourcing of a SU-8 master wafer, all fabrication can be completed outside of a cleanroom in a typical research lab environment. The chip design and fabrication protocol utilize capillary valving to microfluidically split an aqueous reaction into defined nanoliter sized droplets. This loading mechanism avoids the sample loss from channel dead-volume and can easily be performed manually without using pumps or other equipment for fluid actuation. We describe how isolated nanoliter sized drops of protein solution can be monitored in situ by dynamic light scattering to control protein crystal nucleation and growth. After suitable crystals are grown, complete X-ray diffraction datasets can be collected using goniometer based in situ fixed target serial X-ray crystallography at room temperature. The protocol provides custom scripts to process diffraction datasets using a suite of software tools to solve and refine the protein crystal structure. This approach avoids the artefacts possibly induced during cryo-preservation or manual crystal handling in conventional crystallography experiments. We present and compare three protein structures that were solved using small crystals with dimensions of approximately 10-20 µm grown in chip. By crystallizing and diffracting in situ, handling and hence mechanical disturbances of fragile crystals is minimized. The protocol details how to fabricate a custom X-ray transparent microfluidic chip suitable for in situ serial crystallography. As almost every crystal can be used for diffraction data collection, these microfluidic chips are a very efficient crystal delivery method.

  7. Simulations of X-ray diffraction of shock-compressed single-crystal tantalum with synchrotron undulator sources.

    PubMed

    Tang, M X; Zhang, Y Y; E, J C; Luo, S N

    2018-05-01

    Polychromatic synchrotron undulator X-ray sources are useful for ultrafast single-crystal diffraction under shock compression. Here, simulations of X-ray diffraction of shock-compressed single-crystal tantalum with realistic undulator sources are reported, based on large-scale molecular dynamics simulations. Purely elastic deformation, elastic-plastic two-wave structure, and severe plastic deformation under different impact velocities are explored, as well as an edge release case. Transmission-mode diffraction simulations consider crystallographic orientation, loading direction, incident beam direction, X-ray spectrum bandwidth and realistic detector size. Diffraction patterns and reciprocal space nodes are obtained from atomic configurations for different loading (elastic and plastic) and detection conditions, and interpretation of the diffraction patterns is discussed.

  8. Three-dimensional Bragg diffraction in growth-disordered opals

    NASA Astrophysics Data System (ADS)

    Baryshev, A. V.; Kaplyanskii, Alexander A.; Kosobukin, Vladimir A.; Limonov, M. F.; Samusev, K. B.; Usvyat, D. E.

    2003-06-01

    After artificial opals as well as opal-based infilled and inverted composites are considered to be promising representatives of photonic crystal materials. Earlier, photonic stop gaps in opals were studied mainly in transmission or specular reflection geometries corresponding to "one-dimensional" Bragg diffraction. On the contrary, this work was aimed at observing the typical patterns of optical Bragg diffraction in which phenomenon opal crystal structure acts as a three-dimensional diffraction grating. Although our experiments were performed for artificial opals possessing unavoidable imperfections a well-pronounced diffraction peaks were observed characteristic of a crystal structure. Each of the diffraction maxima reveals a photonic stop gap in the specified direction, while the spectral width of the peak is a measure of the photonic stop gap width.

  9. Simulations of X-ray diffraction of shock-compressed single-crystal tantalum with synchrotron undulator sources

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tang, M. X.; Zhang, Y. Y.; E, J. C.

    Polychromatic synchrotron undulator X-ray sources are useful for ultrafast single-crystal diffraction under shock compression. Here, simulations of X-ray diffraction of shock-compressed single-crystal tantalum with realistic undulator sources are reported, based on large-scale molecular dynamics simulations. Purely elastic deformation, elastic–plastic two-wave structure, and severe plastic deformation under different impact velocities are explored, as well as an edge release case. Transmission-mode diffraction simulations consider crystallographic orientation, loading direction, incident beam direction, X-ray spectrum bandwidth and realistic detector size. Diffraction patterns and reciprocal space nodes are obtained from atomic configurations for different loading (elastic and plastic) and detection conditions, and interpretation of themore » diffraction patterns is discussed.« less

  10. Diffraction and Imaging Study of Imperfections of Protein Crystals with Coherent X-rays

    NASA Technical Reports Server (NTRS)

    Hu, Z. W.; Thomas, B. R.; Chernov, A. A.; Chu, Y. S.; Lai, B.

    2004-01-01

    High angular-resolution x-ray diffraction and phase contrast x-ray imaging were combined to study defects and perfection of protein crystals. Imperfections including line defects, inclusions and other microdefects were observed in the diffraction images of a uniformly grown lysozyme crystal. The observed line defects carry distinct dislocation features running approximately along the <110> growth front and have been found to originate mostly in a central growth area and occasionally in outer growth regions. Slow dehydration led to the broadening of a fairly symmetric 4 4 0 rocking curve by a factor of approximately 2.6, which was primarily attributed to the dehydration-induced microscopic effects that are clearly shown in diffraction images. X-ray imaging and diffraction characterization of the quality of apoferritin crystals will also be discussed in the presentation.

  11. Crystallization and preliminary X-ray diffraction analysis of three myotoxic phospholipases A2 from Bothrops brazili venom

    PubMed Central

    Fernandes, Carlos A. H.; Gartuzo, Elaine C. G.; Pagotto, Ivan; Comparetti, Edson J.; Huancahuire-Vega, Salomón; Ponce-Soto, Luis Alberto; Costa, Tássia R.; Marangoni, Sergio; Soares, Andreimar M.; Fontes, Marcos R. M.

    2012-01-01

    Two myotoxic and noncatalytic Lys49-phospholipases A2 (braziliantoxin-II and MT-II) and a myotoxic and catalytic phospholipase A2 (braziliantoxin-III) from the venom of the Amazonian snake Bothrops brazili were crystallized. The crystals diffracted to resolutions in the range 2.56–2.05 Å and belonged to space groups P3121 (braziliantoxin-II), P6522 (braziliantoxin-III) and P21 (MT-II). The structures were solved by molecular-replacement techniques. Both of the Lys49-phospholipases A2 (braziliantoxin-II and MT-II) contained a dimer in the asymmetric unit, while the Asp49-phospholipase A2 braziliantoxin-III contained a monomer in its asymmetric unit. Analysis of the quaternary assemblies of the braziliantoxin-II and MT-II structures using the PISA program indicated that both models have a dimeric conformation in solution. The same analysis of the braziliantoxin-III structure indicated that this protein does not dimerize in solution and probably acts as a monomer in vivo, similar to other snake-venom Asp49-phospholipases A2. PMID:22869126

  12. Double layer zinc-UDP coordination polymers: structure and properties.

    PubMed

    Qiu, Qi-Ming; Gu, Leilei; Ma, Hongwei; Yan, Li; Liu, Minghua; Li, Hui

    2018-05-17

    A homochiral Zn-UDP coordination polymer with an alternating parallel ABAB sequence was constructed and studied by X-ray single crystal diffraction analysis. Its crystal structure shows that there are potentially open sites in the 2D layers. The activation of the sites makes the coordination polymer a fluorescent sensor for novel heterogeneous detection of amino acids.

  13. Structural analysis of as-deposited and annealed low-temperature gallium arsenide

    NASA Astrophysics Data System (ADS)

    Matyi, R. J.; Melloch, M. R.; Woodall, J. M.

    1993-04-01

    The structure of GaAs grown at low substrate temperatures (LT-GaAs) by molecular beam epitaxy has been studied using high resolution X-ray diffraction methods. Double crystal rocking curves from the as-deposited LT-GaAs show well defined interference fringes, indicating a high level of structural perfection. Triple crystal diffraction analysis of the as-deposited sample showed significantly less diffuse scattering near the LT-GaAs 004 reciprocal lattice point compared with the substrate 004 reciprocal lattice point, suggesting that despite the incorporation of approximately 1% excess arsenic, the epitaxial layer had superior crystalline perfection than did the GaAs substrate. Triple crystal scans of annealed LT-GaAs showed an increase in the integrated diffuse intensity by approximately a factor of three as the anneal temperature was increased from 700 to 900°C. Analogous to the effects of SiO2 precipitates in annealed Czochralski silicon, the diffuse intensity is attributed to distortions in the epitaxial LT-GaAs lattice by arsenic precipitates.

  14. Modified Bridgman-Stockbarger growth and characterization of LiInSe{sub 2} single crystal

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vijayakumar, P., E-mail: ramasamyp@ssn.edu.in; Magesh, M., E-mail: ramasamyp@ssn.edu.in; Arunkumar, A., E-mail: ramasamyp@ssn.edu.in

    2014-04-24

    The LiInSe{sub 2} polycrystalline materials were successfully synthesized from melt and temperature oscillation method. 8 mm diameter and 32 mm length single crystal was grown from Bridgman-Stockbarger method with steady ampoule rotation. Crystalline phase was confirmed by powder XRD pattern. Thermo gravimetric and differential thermal analysis confirms that the melting point of the grown crystal is 897°C. Rutherford backscattering analysis (RBS) gives the crystal composition as Li{sub 0.8}In{sub 1.16}Se{sub 2.04}. The crystalline perfection of the grown crystal was analyzed by High resolution X-ray diffraction measurements (HRXRD). The electrical properties of the grown crystal were analyzed by Hall effect measurements andmore » it confirms the n-type semiconducting nature.« less

  15. Organobase catalyzed 1,4-conjugate addition of 4-hydroxycoumarin on chalcones: Synthesis, NMR and single-crystal X-ray diffraction studies of novel warfarin analogues

    NASA Astrophysics Data System (ADS)

    Talhi, Oualid; Fernandes, José A.; Pinto, Diana C. G. A.; Almeida Paz, Filipe A.; Silva, Artur M. S.

    2015-08-01

    The synthesis of a new series of warfarin analogues by convenient organobase catalyzed 1,4-conjugate addition of 4-hydroxycoumarin to chalcone derivatives is described. 1H NMR spectroscopy evidenced the presence of a predominant acyclic open-form together with the cyclic hemiketal tautomers of the resulting Michael adducts. The acyclic open-form has been unequivocally proved by single-crystal X-ray diffraction analysis. The use of the B ring ortho-hydroxychalcone synthons in this reaction has led to a diastereoselective synthesis of warfarin bicyclo[3.3.1]nonane ketal derivatives.

  16. Low Temperature Magnetic Ordering of the Magnetic Ionic Plastic Crystal, Choline[FeCl4

    NASA Astrophysics Data System (ADS)

    de Pedro, I.; García-Saiz, A.; Andreica, D.; Fernández Barquín, L.; Fernández-Díaz, M. T.; Blanco, J. A.; Amato, A.; Rodríguez Fernández, J.

    2015-11-01

    We report on the nature of the low temperature magnetic ordering of a magnetic ionic plastic crystal, Choline[FeCl4]. This investigation was carried out using heat capacity measurements, neutron diffraction experiments and muon spin relaxation (μSR) spectroscopy. The calorimetric measurements show the onset of an unusual magnetic ordering below 4 K with a possible second magnetic phase transition below 2 K. Low temperature neutron diffraction data reveal a three dimensional antiferromagnetic ordering at 2 K compatible with the previous magnetometry results. The analysis of μSR spectra indicates a magnetic phase transition below 2.2 K. At 1.6 K, the analysis of the shape of the μSR spectra suggests the existence of an additional magnetic phase with features of a possible incommensurate magnetic structure.

  17. Real-time observation of the isothermal crystallization kinetics in a deeply supercooled liquid

    NASA Astrophysics Data System (ADS)

    Zanatta, M.; Cormier, L.; Hennet, L.; Petrillo, C.; Sacchetti, F.

    2017-03-01

    Below the melting temperature Tm, crystals are the stable phase of typical elemental or molecular systems. However, cooling down a liquid below Tm, crystallization is anything but inevitable. The liquid can be supercooled, eventually forming a glass below the glass transition temperature Tg. Despite their long lifetimes and the presence of strong barriers that produces an apparent stability, supercooled liquids and glasses remain intrinsically a metastable state and thermodynamically unstable towards the crystal. Here we investigated the isothermal crystallization kinetics of the prototypical strong glassformer GeO2 in the deep supercooled liquid at 1100 K, about half-way between Tm and Tg. The crystallization process has been observed through time-resolved neutron diffraction for about three days. Data show a continuous reorganization of the amorphous structure towards the alpha-quartz phase with the final material composed by crystalline domains plunged into a low-density, residual amorphous matrix. A quantitative analysis of the diffraction patterns allows determining the time evolution of the relative fractions of crystal and amorphous, that was interpreted through an empirical model for the crystallization kinetics. This approach provides a very good description of the experimental data and identifies a predator-prey-like mechanism between crystal and amorphous, where the density variation acts as a blocking barrier.

  18. Crystallinity properties and crystallization behavior of chocolate fat blends.

    PubMed

    da Silva, Thais Lomonaco Teodoro; Grimaldi, Renato; Calligaris, Guilherme Andrade; Cardoso, Lisandro Pavie; Gonçalves, Lireny Aparecida Guaraldo

    2017-06-01

    Cocoa butter (CB) provides unique crystallization characteristics to chocolates and confectionary products; hence, it is an important value-add product. However, other alternative fats that minimally affect the crystallization behaviour of chocolates and confectionary products are now being increasingly used. This study analyzed the crystallization behaviour of CB, cocoa butter substitutes (CBSs), and their blends. Blends were prepared using CBS concentrations: 5, 10, 15, 20 and 37.5%. CB, CBS, and their blends were evaluated by following analysis: solid fat content, isothermal analysis, polarized light microscopic, thermal behaviour, X-ray diffraction and consistency. Crystallization analysis showed an incompatibility between the 2 fats, with a reduction in the crystallinity and increase in liquid content in all the blends. Eutectic crystallization at 20 °C was only observed for the blend containing 20% CBSs. This was considered as a positive result because previous studies have indicated that CBS concentration in CB blends should not be more than 5%.

  19. Crystallization and X-ray diffraction analysis of the RNA primer/promoter-binding domain of influenza A virus RNA-dependent RNA polymerase PB2

    PubMed Central

    Kuzuhara, Takashi; Kise, Daisuke; Yoshida, Hiroko; Horita, Takahiro; Murazaki, Yoshimi; Utsunomiya, Hiroko; Tsuge, Hideaki

    2009-01-01

    The C-terminal domain protein (amino-acid residues 535–759) of the PB2 subunit of the RNA-dependent RNA polymerase from the highly pathogenic influenza A virus was expressed as a soluble protein in Escherichia coli and crystallized using sodium formate as a precipitant. Data sets were collected from crystals of native and selenomethionine-substituted protein on the KEK NW12 beamline at the Photon Factory and the crystals diffracted to a maximum resolution of 2.44 Å for the SeMet-derivative crystal. The native crystals were found to belong to space group P3221, with unit-cell parameters a = b = 52.5, c = 156.3 Å. The Matthews value (V M) was 2.7 Å3 Da−1, assuming the presence of one molecule in the asymmetric unit. The SeMet-derivative crystals were found to belong to the same space group, with unit-cell parameters a = b = 52.6, c = 156.4 Å. Attempts are being made to solve the structure by multi-wavelength anomalous dispersion phasing. PMID:19194006

  20. Assessment of microcrystal quality by transmission electron microscopy for efficient serial femtosecond crystallography.

    PubMed

    Barnes, Christopher O; Kovaleva, Elena G; Fu, Xiaofeng; Stevenson, Hilary P; Brewster, Aaron S; DePonte, Daniel P; Baxter, Elizabeth L; Cohen, Aina E; Calero, Guillermo

    2016-07-15

    Serial femtosecond crystallography (SFX) employing high-intensity X-ray free-electron laser (XFEL) sources has enabled structural studies on microcrystalline protein samples at non-cryogenic temperatures. However, the identification and optimization of conditions that produce well diffracting microcrystals remains an experimental challenge. Here, we report parallel SFX and transmission electron microscopy (TEM) experiments using fragmented microcrystals of wild type (WT) homoprotocatechuate 2,3-dioxygenase (HPCD) and an active site variant (H200Q). Despite identical crystallization conditions and morphology, as well as similar crystal size and density, the indexing efficiency of the diffraction data collected using the H200Q variant sample was over 7-fold higher compared to the diffraction results obtained using the WT sample. TEM analysis revealed an abundance of protein aggregates, crystal conglomerates and a smaller population of highly ordered lattices in the WT sample as compared to the H200Q variant sample. While not reported herein, the 1.75 Å resolution structure of the H200Q variant was determined from ∼16 min of beam time, demonstrating the utility of TEM analysis in evaluating sample monodispersity and lattice quality, parameters critical to the efficiency of SFX experiments. Copyright © 2016 Elsevier Inc. All rights reserved.

  1. Effect of L-Valine on the growth and characterization of Sodium Acid Phthalate (SAP) single crystals.

    PubMed

    Nirmala, L Ruby; Thomas Joseph Prakash, J

    2013-06-01

    Undoped and amino acid doped good quality single crystals of Sodium Acid Phthalate crystals (SAP) were grown by slow evaporation solution growth technique which are semiorganic in nature. The effect of amino acid (L-Valine) dopant on the growth and the properties of SAP single crystal was investigated. The single crystal X-ray diffraction studies and FT-IR studies were carried out to identify the crystal structure and the presence of functional groups in undoped and L-Valine doped SAP crystals. The transparent nature of the grown crystal was observed using UV-Visible spectrum. The thermal decomposition of the doped SAP crystals was investigated by thermo gravimetric analysis (TGA) and differential thermal analysis (DTA). The enhancement in the NLO property of the undoped and L-Valine doped SAP crystals using KDP crystal as a reference was studied using SHG measurements. Vickers micro hardness measurements are used for the study of mechanical strength of the grown crystals. Copyright © 2013 Elsevier B.V. All rights reserved.

  2. Crystallization and X-ray diffraction analysis of an 'all-locked' nucleic acid duplex derived from a tRNA(Ser) microhelix.

    PubMed

    Behling, Katja; Eichert, André; Fürste, Jens P; Betzel, Christian; Erdmann, Volker A; Förster, Charlotte

    2009-08-01

    Modified nucleic acids are of great interest with respect to their nuclease resistance and enhanced thermostability. In therapeutical and diagnostic applications, such molecules can substitute for labile natural nucleic acids that are targeted against particular diseases or applied in gene therapy. The so-called 'locked nucleic acids' contain modified sugar moieties such as 2'-O,4'-C-methylene-bridged beta-D-ribofuranose and are known to be very stable nucleic acid derivatives. The structure of locked nucleic acids in single or multiple LNA-substituted natural nucleic acids and in LNA-DNA or LNA-RNA heteroduplexes has been well investigated, but the X-ray structure of an ;all-locked' nucleic acid double helix has not been described to date. Here, the crystallization and X-ray diffraction data analysis of an 'all-locked' nucleic acid helix, which was designed as an LNA originating from a tRNA(Ser) microhelix RNA structure, is presented. The crystals belonged to space group C2, with unit-cell parameters a = 77.91, b = 40.74, c = 30.06 A, beta = 91.02 degrees . A high-resolution and a low-resolution data set were recorded, with the high-resolution data showing diffraction to 1.9 A resolution. The crystals contained two double helices per asymmetric unit, with a Matthews coefficient of 2.48 A(3) Da(-1) and a solvent content of 66.49% for the merged data.

  3. Growth, structural, optical, thermal and mechanical properties of ammonium pentaborate single crystal.

    PubMed

    Balakrishnan, T; Bhagavannarayana, G; Ramamurthi, K

    2008-11-15

    Nonlinear optical single crystals of ammonium pentaborate (APB) were grown by the slow cooling method from aqueous solution. Grown crystal was characterized by powder X-ray diffraction (PXRD) and FT-IR spectral analysis. Perfection of the grown crystal was evaluated by high-resolution X-ray diffractometry (HRXRD). The effect of nylon threading on the perfection of the grown bigger crystal was also studied by HRXRD. The range and percentage of optical transmission was ascertained by recording UV-vis-NIR spectrum. Thermal properties were investigated by TG-DTA and DSC analyses. Its mechanical hardness was estimated by Vickers microhardness tester.

  4. Microgravity

    NASA Image and Video Library

    2000-05-01

    A collage of protein and virus crystals, many of which were grown on the U.S. Space Shuttle or Russian Space Station, Mir. The crystals include the proteins canavalin; mouse monoclonal antibody; a sweet protein, thaumatin; and a fungal protease. Viruses are represented here by crystals of turnip yellow mosaic virus and satellite tobacco mosaic virus. The crystals are photographed under polarized light (thus causing the colors) and range in size from a few hundred microns in edge length up to more than a millimeter. All the crystals are grown from aqueous solutions and are useful for X-ray diffraction analysis. Credit: Dr. Alex McPherson, University of California, Irvine.

  5. The use of heterogeneous and epitaxial nucleants to promote the growth of protein crystals

    NASA Technical Reports Server (NTRS)

    Mcpherson, Alexander; Shlichta, P.

    1988-01-01

    Fifty different mineral samples were tested as potential heterogeneous or epitaxial nucleants for four commonly crystallized proteins. It was found, using conventional protein crystallization techniques, that for each protein there was a set of mineral substrates that promoted nucleation of crystals at lower critical levels of supersaturation than required for spontaneous growth. In at least one case, the growth of lysozyme on the mineral apophyllite, it was shown by lattice analysis and X-ray diffraction that the nucleation and growth of the protein crystal on the mineral was likely to be truly epitaxial.

  6. Purification, crystallization and preliminary X-ray diffraction of human S100A15

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Boeshans, Karen M.; Wolf, Ronald; Voscopoulos, Christopher

    2006-05-01

    S100 proteins are differentially expressed during epithelial cell maturation, tumorigenesis and inflammation. The novel human S100A15 protein has been cloned, expressed, purified and crystallized in two crystal forms, a triclinic and a monoclinic form, which diffract to 1.7 and 2.0 Å, respectively. Human S100A15 is a novel member of the S100 family of EF-hand calcium-binding proteins and was recently identified in psoriasis, where it is significantly upregulated in lesional skin. The protein is implicated as an effector in calcium-mediated signal transduction pathways. Although its biological function is unclear, the association of the 11.2 kDa S100A15 with psoriasis suggests that itmore » contributes to the pathogenesis of the disease and could provide a molecular target for therapy. To provide insight into the function of S100A15, the protein was crystallized to visualize its structure and to further the understanding of how the many similar calcium-binding mediator proteins in the cell distinguish their cognate target molecules. The S100A15 protein has been cloned, expressed and purified to homogeneity and produced two crystal forms. Crystals of form I are triclinic, with unit-cell parameters a = 33.5, b = 44.3, c = 44.8 Å, α = 71.2, β = 68.1, γ = 67.8° and an estimated two molecules in the asymmetric unit, and diffract to 1.7 Å resolution. Crystals of form II are monoclinic, with unit-cell parameters a = 82.1, b = 33.6, c = 52.2 Å, β = 128.2° and an estimated one molecule in the asymmetric unit, and diffract to 2.0 Å resolution. This structural analysis of the human S100A15 will further aid in the phylogenic comparison between the other members of the S100 protein family, especially the highly homologous paralog S100A7.« less

  7. Protein Crystals Grown in Space

    NASA Technical Reports Server (NTRS)

    2000-01-01

    A collage of protein and virus crystals, many of which were grown on the U.S. Space Shuttle or Russian Space Station, Mir. The crystals include the proteins canavalin; mouse monoclonal antibody; a sweet protein, thaumatin; and a fungal protease. Viruses are represented here by crystals of turnip yellow mosaic virus and satellite tobacco mosaic virus. The crystals are photographed under polarized light (thus causing the colors) and range in size from a few hundred microns in edge length up to more than a millimeter. All the crystals are grown from aqueous solutions and are useful for X-ray diffraction analysis. Credit: Dr. Alex McPherson, University of California, Irvine.

  8. The use of analytical surface tools in the fundamental study of wear. [atomic nature of wear

    NASA Technical Reports Server (NTRS)

    Buckley, D. H.

    1977-01-01

    Various techniques and surface tools available for the study of the atomic nature of the wear of materials are reviewed These include chemical etching, x-ray diffraction, electron diffraction, scanning electron microscopy, low-energy electron diffraction, Auger emission spectroscopy analysis, electron spectroscopy for chemical analysis, field ion microscopy, and the atom probe. Properties of the surface and wear surface regions which affect wear, such as surface energy, crystal structure, crystallographic orientation, mode of dislocation behavior, and cohesive binding, are discussed. A number of mechanisms involved in the generation of wear particles are identified with the aid of the aforementioned tools.

  9. Crystal structure and density of helium to 232 kbar

    NASA Technical Reports Server (NTRS)

    Mao, H. K.; Wu, Y.; Jephcoat, A. P.; Hemley, R. J.; Bell, P. M.; Bassett, W. A.

    1988-01-01

    The properties of helium and hydrogen at high pressure are topics of great interest to the understanding of planetary interiors. These materials constitute 95 percent of the entire solar system. A technique was presented for the measurement of X-ray diffraction from single-crystals of low-Z condenses gases in a diamond-anvil cell at high pressure. The first such single-crystal X-ray diffraction measurements on solid hydrogen to 26.5 GPa were presented. The application of this technique to the problem of the crystal structure, equation of state, and phase diagram of solid helium is reported. Crucial for X-ray diffraction studies of these materials is the use of a synchrotron radiation source which provides high brillance, narrow collimation of the incident and diffracted X-ray beams to reduce the background noise, and energy-dispersive diffraction techniques with polychromatic (white) radiation, which provides high detection efficiency.

  10. A putative siderophore-interacting protein from the marine bacterium Shewanella frigidimarina NCIMB 400: cloning, expression, purification, crystallization and X-ray diffraction analysis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Trindade, Inês B.; Fonseca, Bruno M.; Matias, Pedro M.

    The gene encoding a putative siderophore-interacting protein from the marine bacterium S. frigidimarina was successfully cloned, followed by expression and purification of the gene product. Optimized crystals diffracted to 1.35 Å resolution and preliminary crystallographic analysis is promising with respect to structure determination and increased insight into the poorly understood molecular mechanisms underlying iron acquisition. Siderophore-binding proteins (SIPs) perform a key role in iron acquisition in multiple organisms. In the genome of the marine bacterium Shewanella frigidimarina NCIMB 400, the gene tagged as SFRI-RS12295 encodes a protein from this family. Here, the cloning, expression, purification and crystallization of this proteinmore » are reported, together with its preliminary X-ray crystallographic analysis to 1.35 Å resolution. The SIP crystals belonged to the monoclinic space group P2{sub 1}, with unit-cell parameters a = 48.04, b = 78.31, c = 67.71 Å, α = 90, β = 99.94, γ = 90°, and are predicted to contain two molecules per asymmetric unit. Structure determination by molecular replacement and the use of previously determined ∼2 Å resolution SIP structures with ∼30% sequence identity as templates are ongoing.« less

  11. Purification, crystallization and preliminary X-ray analysis of phycocyanin and phycoerythrin from Porphyra yezoensis Ueda

    PubMed Central

    Cai, Chuner; Wu, Lian; Li, Chunxia; He, Peimin; Li, Jie; Zhou, Jiahai

    2011-01-01

    Porphyra yezoensis is one of the most important and widely cultured seaweeds in China. Phycobiliproteins exhibit excellent spectroscopic properties and play versatile roles in the biomedical, food, cosmetics and chemical synthetic dye industries. Here, the purification and crystallization of phycoerythrin and phycocyanin, two phycobiliproteins extracted from P. yezoensis, are described. Using a novel protocol including co-precipitation with ammonium sulfate and hydroxyapatite column chromatography, both phycobiliproteins were produced on a large scale with improved quality and yield compared with those previously reported. Native PAGE analysis indicated that phycoerythrin and phycocyanin exist as (αβ)3 heterohexamers in solution. The crystals of phycoerythrin diffracted to 2.07 Å resolution and belonged to space group R3. The unit-cell parameters referred to hexagonal axes are a = b = 187.7, c = 59.7 Å, with nine (αβ)2 heterotetramers per unit cell. The crystals of phycocyanin diffracted to 2.70 Å resolution in space group P21. Matthews coefficient analysis shows that 10–19 (αβ) heterodimers of phycocyanin in the asymmetric unit would be reasonable. A self-rotation function calculation clarified this ambiguity and indicated that 12 (αβ) heterodimers of phycocyanin are assembled in the asymmetric unit. PMID:21543866

  12. A novel conformation of gel grown biologically active cadmium nicotinate

    NASA Astrophysics Data System (ADS)

    Nair, Lekshmi P.; Bijini, B. R.; Divya, R.; Nair, Prabitha B.; Eapen, S. M.; Dileep Kumar, B. S.; Nishanth Kumar, S.; Nair, C. M. K.; Deepa, M.; Rajendra Babu, K.

    2017-11-01

    The elimination of toxic heavy metals by the formation of stable co-ordination compounds with biologically active ligands is applicable in drug designing. A new crystalline complex of cadmium with nicotinic acid is grown at ambient temperature using the single gel diffusion method in which the crystal structure is different from those already reported. Single crystal x-ray diffraction reveals the identity of crystal structure belonging to monoclinic system, P21/c space group with cell dimensions a = 17.220 (2) Å, b = 10.2480 (2) Å, c = 7.229(9) Å, β = 91.829(4)°. Powder x-ray diffraction analysis confirmed the crystallinity of the sample. The unidentate mode of co-ordination between the metal atom and the carboxylate group is supported by the Fourier Transform Infra Red spectral data. Thermal analysis ensures the thermal stability of the complex. Kinetic and thermodynamic parameters are also calculated. The stoichiometry of the complex is confirmed by the elemental analysis. The UV-visible spectral analysis shows the wide transparency window of the complex in the visible region. The band gap of the complex is found to be 3.92 eV. The complex shows excellent antibacterial and antifungal activity.

  13. A simple technique to reduce evaporation of crystallization droplets by using plate lids with apertures for adding liquids.

    PubMed

    Zipper, Lauren E; Aristide, Xavier; Bishop, Dylan P; Joshi, Ishita; Kharzeev, Julia; Patel, Krishna B; Santiago, Brianna M; Joshi, Karan; Dorsinvil, Kahille; Sweet, Robert M; Soares, Alexei S

    2014-12-01

    A method is described for using plate lids to reduce evaporation in low-volume vapor-diffusion crystallization experiments. The plate lids contain apertures through which the protein and precipitants were added to different crystallization microplates (the reservoir was filled before fitting the lids). Plate lids were designed for each of these commonly used crystallization microplates. This system minimizes the dehydration of crystallization droplets containing just a few nanolitres of protein and precipitant, and results in more reproducible diffraction from the crystals. For each lid design, changes in the weight of the plates were used to deduce the rate of evaporation under different conditions of temperature, air movement, droplet size and precipitant. For comparison, the state of dehydration was also visually assessed throughout the experiment. Finally, X-ray diffraction methods were used to compare the diffraction of protein crystals that were conventionally prepared against those that were prepared on plates with plate lids. The measurements revealed that the plate lids reduced the rate of evaporation by 63-82%. Crystals grown in 5 nl drops that were set up with plate lids diffracted to higher resolution than similar crystals from drops that were set up without plate lids. The results demonstrate that plate lids can be instrumental for improving few-nanolitre crystallizations.

  14. Clay pigment structure characterisation as a guide for provenance determination--a comparison between laboratory powder micro-XRD and synchrotron radiation XRD.

    PubMed

    Švarcová, Silvie; Bezdička, Petr; Hradil, David; Hradilová, Janka; Žižak, Ivo

    2011-01-01

    Application of X-ray diffraction (XRD)-based techniques in the analysis of painted artworks is not only beneficial for indisputable identification of crystal constituents in colour layers, but it can also bring insight in material crystal structure, which can be affected by their geological formation, manufacturing procedure or secondary changes. This knowledge might be helpful for art historic evaluation of an artwork as well as for its conservation. By way of example of kaolinite, we show that classification of its crystal structure order based on XRD data is useful for estimation of its provenance. We found kaolinite in the preparation layer of a Gothic wall painting in a Czech church situated near Karlovy Vary, where there are important kaolin deposits. Comparing reference kaolin materials from eight various Czech deposits, we found that these can be differentiated just according to the kaolinite crystallinity. Within this study, we compared laboratory powder X-ray micro-diffraction (micro-XRD) with synchrotron radiation X-ray diffraction analysing the same real sample. We found that both techniques led to the same results.

  15. Crystallization and X-ray diffraction studies of a complete bacterial fatty-acid synthase type I

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Enderle, Mathias; Max-Planck-Institute of Biochemistry, Am Klopferspitz 18, 82152 Martinsried; McCarthy, Andrew

    Bacterial and fungal type I fatty-acid synthases (FAS I) are evolutionarily connected, as bacterial FAS I is considered to be the ancestor of fungal FAS I. In this work, the production, crystallization and X-ray diffraction data analysis of a bacterial FAS I are reported. While a deep understanding of the fungal and mammalian multi-enzyme type I fatty-acid synthases (FAS I) has been achieved in recent years, the bacterial FAS I family, which is narrowly distributed within the Actinomycetales genera Mycobacterium, Corynebacterium and Nocardia, is still poorly understood. This is of particular relevance for two reasons: (i) although homologous to fungalmore » FAS I, cryo-electron microscopic studies have shown that bacterial FAS I has unique structural and functional properties, and (ii) M. tuberculosis FAS I is a drug target for the therapeutic treatment of tuberculosis (TB) and therefore is of extraordinary importance as a drug target. Crystals of FAS I from C. efficiens, a homologue of M. tuberculosis FAS I, were produced and diffracted X-rays to about 4.5 Å resolution.« less

  16. Rapid time-resolved diffraction studies of protein structures using synchrotron radiation

    NASA Astrophysics Data System (ADS)

    Bartunik, Hans D.; Bartunik, Lesley J.

    1992-07-01

    The crystal structure of intermediate states in biological reactions of proteins of multi-protein complexes may be studied by time-resolved X-ray diffraction techniques which make use of the high spectral brilliance, continuous wavelength distribution and pulsed time structure of synchrotron radiation. Laue diffraction methods provide a means of investigating intermediate structures with lifetimes in the millisecond time range at presently operational facilities. Third-generation storage rings which are under construction may permit one to reach a time resolution of one microsecond for non-cyclic and one nanosecond for cyclic reactions. The number of individual exposures required for exploring reciprocal space and hence the total time scale strongly depend on the lattice order that may be affected, e.g., by conformational changes. Time-resolved experiments require high population of a specific intermediate which has to be homogeneous over the crystal volume. A number of external excitation techniques have been developed including in situ liberation of active metabolites by laser pulse photolysis of photolabile inactive precursors. First applications to crystal structure analysis of catalytic intermediates of enzymes demonstrate the potential of time-resolved protein crystallography.

  17. Growth and physicochemical properties of second-order nonlinear optical 2-amino-5-chloropyridinium trichloroacetate single crystals

    NASA Astrophysics Data System (ADS)

    Renugadevi, R.; Kesavasamy, R.

    2015-09-01

    The growth of organic nonlinear optical (NLO) crystal 2-amino-5-chloropyridinium trichloroacetate (2A5CPTCA) has been synthesized and single crystals have been grown from methanol solvent by slow evaporation technique. The grown crystals were subjected to various characterization analyses in order to find out the suitability for device fabrication. Single crystal X-ray diffraction analysis reveals that 2A5CPTCA crystallizes in monoclinic system with the space group Cc. The grown crystal was further characterized by Fourier transform infrared spectral analysis to find out the functional groups. The nuclear magnetic resonance spectroscopy is a research technique that exploits the magnetic properties of certain atomic nuclei. The optical transparency window in the visible and near-IR (200--1100 nm) regions was found to be good for NLO applications. Thermogravimetric analysis and differential thermal analysis were used to study its thermal properties. The powder second harmonic generation efficiency measurement with Nd:YAG laser (1064 nm) radiation shows that the highest value when compared with the standard potassium dihydrogen phosphate crystal.

  18. Growth and characterization of benzyl 4-hydroxybenzoate single crystal by vertical Bridgman technique for optical applications

    NASA Astrophysics Data System (ADS)

    Solanki, S. Siva Bala; Rajesh, N. P.; Suthan, T.

    2018-07-01

    The benzyl 4-hydroxybenzoate single crystal has been grown by vertical Bridgman technique. The grown crystal was confirmed by single crystal X-ray diffraction studies. The presence of functional groups in the crystal was confirmed by Fourier transform infrared (FTIR) spectral studies. The thermal behaviour of the grown crystal was analyzed by thermogravimetric analysis (TGA), differential thermal analysis (DTA) and differential scanning calorimetric (DSC) studies. Optical behaviour of the grown benzyl 4-hydroxybenzoate crystal was studied by UV-Vis-NIR spectral analysis. Fluorescence spectrum shows near violet light emission. The second harmonic generation behaviour of benzyl 4-hydroxybenzoate was analyzed. The laser damage threshold value of benzyl 4-hydroxybenzoate was measured as 2.16 GW/cm2. The dielectric measurements of benzyl 4-hydroxybenzoate crystal were carried out with different frequencies 1 kHz to 1 MHz versus different temperatures ranging from 313 to 353 K. Photoconductivity study shows that the grown benzyl 4-hydroxybenzoate crystal belongs to negative photoconductivity property. The mechanical strength of the crystal was calculated by Vickers microhardness study.

  19. X-ray diffraction analysis of LiCu2O2 crystals with additives of silver atoms

    NASA Astrophysics Data System (ADS)

    Sirotinkin, V. P.; Bush, A. A.; Kamentsev, K. E.; Dau, H. S.; Yakovlev, K. A.; Tishchenko, E. A.

    2015-09-01

    Silver-containing LiCu2O2 crystals up to 4 × 8 × 8 mm in size were grown by the crystallization of 80(1- x)CuO · 20 x AgNO3 · 20Li2CO3 (0 ≤ х ≤ 0.5) mixture melt. According to the X-ray spectral and Rietveld X-ray diffraction data, the maximum amount of silver incorporated in the LiCu2O2 structure is about 4 at % relative to the copper content. It was established that silver atoms occupy statistically crystallographic positions of lithium atoms. The incorporation of silver atoms is accompanied by a noticeable increase in parameter с of the LiCu2O2 rhombic unit cell, a slight increase in parameter а, and a slight decrease in parameter b.

  20. Crystallization and preliminary X-ray diffraction analysis of crotoxin B from Crotalus durissus collilineatus venom

    PubMed Central

    Salvador, G. H. M.; Fernandes, C. A. H.; Corrêa, L. C.; Santos-Filho, N. A.; Soares, A. M.; Fontes, M. R. M.

    2009-01-01

    Crotoxin B is a basic phospholipase A2 found in the venom of several Crotalus durissus ssp. rattlesnakes and is one of the subunits that constitute crotoxin, the main component of the venom of these snakes. This heterodimeric toxin is related to important envenomation effects such as neurological disorders, myotoxicity and renal failure. Although crotoxin was first crystallized in 1938, the first structural data only became available in 2007 (for crotoxin B from C. durissus terrificus) and showed an ambiguous result for the biological assembly, which could be either dimeric or tetrameric. In this work, the crystallization, X-ray diffraction data collection at 2.2 Å resolution and molecular-replacement solution of a dimeric complex formed by two crotoxin B isoforms from C. durissus collilineatus venom is presented. PMID:19851009

  1. Crystallization and Preliminary X-ray Diffraction Analysis of Hemextin A: A Unique Anticoagulant Protein from Hemachatus haemachatus Venom

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Banerjee,Y.; Kumar, S.; Jobichen, C.

    2007-01-01

    Hemextin A was isolated and purified from African Ringhals cobra (Hemachatus haemachatus). It is a three-finger toxin that specifically inhibits blood coagulation factor VIIa and clot formation and that also interacts with hemextin B to form a unique anticoagulant complex. Hemextin A was crystallized by the hanging-drop vapor-diffusion method by equilibration against 0.2 M ammonium acetate, 0.1 M sodium acetate trihydrate pH 4.6 and 30% PEG 4000 as the precipitating agent. The crystals belong to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 49.27, b = 49.51, c = 57.87 {angstrom} and two molecules in the asymmetricmore » unit. They diffracted to 1.5 {angstrom} resolution at beamline X25 at BNL.« less

  2. Multi-crystal native SAD analysis at 6 keV.

    PubMed

    Liu, Qun; Guo, Youzhong; Chang, Yanqi; Cai, Zheng; Assur, Zahra; Mancia, Filippo; Greene, Mark I; Hendrickson, Wayne A

    2014-10-01

    Anomalous diffraction signals from typical native macromolecules are very weak, frustrating their use in de novo structure determination. Here, native SAD procedures are described to enhance signal to noise in anomalous diffraction by using multiple crystals in combination with synchrotron X-rays at 6 keV. Increased anomalous signals were obtained at 6 keV compared with 7 keV X-ray energy, which was used for previous native SAD analyses. A feasibility test of multi-crystal-based native SAD phasing was performed at 3.2 Å resolution for a known tyrosine protein kinase domain, and real-life applications were made to two novel membrane proteins at about 3.0 Å resolution. The three applications collectively serve to validate the robust feasibility of native SAD phasing at lower energy.

  3. Crystallization of PTP Domains.

    PubMed

    Levy, Colin; Adams, James; Tabernero, Lydia

    2016-01-01

    Protein crystallography is the most powerful method to obtain atomic resolution information on the three-dimensional structure of proteins. An essential step towards determining the crystallographic structure of a protein is to produce good quality crystals from a concentrated sample of purified protein. These crystals are then used to obtain X-ray diffraction data necessary to determine the 3D structure by direct phasing or molecular replacement if the model of a homologous protein is available. Here, we describe the main approaches and techniques to obtain suitable crystals for X-ray diffraction. We include tools and guidance on how to evaluate and design the protein construct, how to prepare Se-methionine derivatized protein, how to assess the stability and quality of the sample, and how to crystallize and prepare crystals for diffraction experiments. While general strategies for protein crystallization are summarized, specific examples of the application of these strategies to the crystallization of PTP domains are discussed.

  4. High resolution synchrotron X-radiation diffraction imaging of crystals grown in microgravity and closely related terrestrial crystals

    NASA Technical Reports Server (NTRS)

    Steiner, Bruce; Dobbyn, Ronald C.; Black, David; Burdette, Harold; Kuriyama, Masao; Fripp, Archibald; Simchik, Richard

    1991-01-01

    Irregularities in three crystals grown in space and in four terrestrial crystals grown under otherwise comparable conditions have been observed in high resolution diffraction imaging. The images provide important new clues to the nature and origins of irregularities in each crystal. For two of the materials, mercuric iodide and lead tin telluride, more than one phase (an array of non-diffracting inclusions) was observed in terrestrial samples; but the formation of these multiple phases appears to have been suppressed in directly comparable crystals grown in microgravity. The terrestrial seed crystal of triglycine sulfate displayed an unexpected layered structure, which propagated during directly comparable space growth. Terrestrial Bridgman regrowth of gallium arsenide revealed a mesoscopic structure substantially different from that of the original Czochralski material. A directly comparable crystal is to be grown shortly in space.

  5. Imperfection and radiation damage in protein crystals studied with coherent radiation

    PubMed Central

    Nave, Colin; Sutton, Geoff; Evans, Gwyndaf; Owen, Robin; Rau, Christoph; Robinson, Ian; Stuart, David Ian

    2016-01-01

    Fringes and speckles occur within diffraction spots when a crystal is illuminated with coherent radiation during X-ray diffraction. The additional information in these features provides insight into the imperfections in the crystal at the sub-micrometre scale. In addition, these features can provide more accurate intensity measurements (e.g. by model-based profile fitting), detwinning (by distinguishing the various components), phasing (by exploiting sampling of the molecular transform) and refinement (by distinguishing regions with different unit-cell parameters). In order to exploit these potential benefits, the features due to coherent diffraction have to be recorded and any change due to radiation damage properly modelled. Initial results from recording coherent diffraction at cryotemperatures from polyhedrin crystals of approximately 2 µm in size are described. These measurements allowed information about the type of crystal imperfections to be obtained at the sub-micrometre level, together with the changes due to radiation damage. PMID:26698068

  6. A pseudo-tetragonal tungsten bronze superstructure: a combined solution of the crystal structure of K6.4(Nb,Ta)(36.3)O94 with advanced transmission electron microscopy and neutron diffraction.

    PubMed

    Paria Sena, Robert; Babaryk, Artem A; Khainakov, Sergiy; Garcia-Granda, Santiago; Slobodyanik, Nikolay S; Van Tendeloo, Gustaaf; Abakumov, Artem M; Hadermann, Joke

    2016-01-21

    The crystal structure of the K6.4Nb28.2Ta8.1O94 pseudo-tetragonal tungsten bronze-type oxide was determined using a combination of X-ray powder diffraction, neutron diffraction and transmission electron microscopy techniques, including electron diffraction, high angle annular dark field scanning transmission electron microscopy (HAADF-STEM), annular bright field STEM (ABF-STEM) and energy-dispersive X-ray compositional mapping (STEM-EDX). The compound crystallizes in the space group Pbam with unit cell parameters a = 37.468(9) Å, b = 12.493(3) Å, c = 3.95333(15) Å. The structure consists of corner sharing (Nb,Ta)O6 octahedra forming trigonal, tetragonal and pentagonal tunnels. All tetragonal tunnels are occupied by K(+) ions, while 1/3 of the pentagonal tunnels are preferentially occupied by Nb(5+)/Ta(5+) and 2/3 are occupied by K(+) in a regular pattern. A fractional substitution of K(+) in the pentagonal tunnels by Nb(5+)/Ta(5+) is suggested by the analysis of the HAADF-STEM images. In contrast to similar structures, such as K2Nb8O21, also parts of the trigonal tunnels are fractionally occupied by K(+) cations.

  7. Crystal growth, structural, optical, mechanical and thermal properties of a new nonlinear optical single crystal: L-Ornithine monohydrochloride.

    PubMed

    Balakrishnan, T; Ramamurthi, K

    2009-03-01

    Amino acid family crystals exhibit excellent nonlinear optical and electro optical properties. l-Ornithine monohydrochloride single crystal, belongs to the amino acid group, was grown by the slow evaporation solution growth technique at room temperature. The grown crystals were characterized by single crystal and powder X-ray diffraction analysis, Fourier transform infrared (FTIR) spectroscopy, TGA, DTA and DSC analyses. UV-vis-NIR spectrum shows excellent transmission in the UV, visible and NIR region (300-1600nm). The mechanical properties of grown crystals were studied using Vickers microhardness tester. Its second harmonic generation efficiency was tested using Nd:YAG laser and is 1.25 times that of KDP.

  8. Solid-state reaction kinetics of neodymium doped magnesium hydrogen phosphate system

    NASA Astrophysics Data System (ADS)

    Gupta, Rashmi; Slathia, Goldy; Bamzai, K. K.

    2018-05-01

    Neodymium doped magnesium hydrogen phosphate (NdMHP) crystals were grown by using gel encapsulation technique. Structural characterization of the grown crystals has been carried out by single crystal X-ray diffraction (XRD) and it revealed that NdMHP crystals crystallize in orthorhombic crystal system with space group Pbca. Kinetics of the decomposition of the grown crystals has been studied by non-isothermal analysis. The estimation of decomposition temperatures and weight loss has been made from the thermogravimetric/differential thermo analytical (TG/DTA) in conjuncture with DSC studies. The various steps involved in the thermal decomposition of the material have been analysed using Horowitz-Metzger, Coats-Redfern and Piloyan-Novikova equations for evaluating various kinetic parameters.

  9. Crystallization and X-ray diffraction of crystals formed in water-plasticized amorphous lactose.

    PubMed

    Jouppila, K; Kansikas, J; Roos, Y H

    1998-01-01

    Effects of storage time and relative humidity on crystallization and crystal forms produced from amorphous lactose were investigated. Crystallization was observed from time-dependent loss of sorbed water and increasing intensities of peaks in X-ray diffraction patterns. The rate of crystallization increased with increasing storage relative humidity. Lactose crystallized mainly as alpha-lactose monohydrate and anhydrous crystals with alpha- and beta-lactose in a molar ratio of 5:3. The results suggested that the crystal form was defined by the early nucleation process. The crystallization data are important in modeling of crystallization phenomena and prediction of stability of lactose-containing food and pharmaceutical materials.

  10. Synthesis, crystal structure and characterization of a new organic-inorganic hybrid material 4-(ammonium methyl) pipyridinium hexachloro stanate (II) trihydrate

    NASA Astrophysics Data System (ADS)

    Lassoued, Mohamed Saber; Abdelbaky, Mohammed S. M.; Lassoued, Abdelmajid; Ammar, Salah; Gadri, Abdellatif; Ben Salah, Abdelhamid; García-Granda, Santiago

    2018-03-01

    The present paper undertakes the study of (C6H16N2) SnCl6·3H2O which is a new hybrid compound. It was prepared and characterized by single crystal X-ray diffraction, X-ray powder, Hirshfeld surface, Spectroscopy measurement, thermal study and photoluminescence properties. The single crystal X-ray diffraction studies revealed that the compound crystallizes in monoclinic Cc space group with cell parameters a = 8.3309(9) Å, b = 22.956(2) Å, c = 9.8381(9) Å, β = 101.334(9) ° and Z = 4. The atomic arrangement shows an alternation of organic and inorganic entities. The cohesion between these entities is performed via Nsbnd H⋯Cl, Nsbnd H⋯O, Osbnd H⋯Cl and Osbnd H⋯O hydrogen bonding to form a three-dimensional network. Hirshfeld surface analysis was used to investigate intermolecular interactions, as well 2D finger plots were conducted to reveal the contribution of these interactions in the crystal structure quantitatively. The X-ray powder is in agreement with the X-ray structure. Scanning electron microscope (SEM) was carried out. Furthermore, the room temperature infrared (IR) spectrum of the title compound was recorded and analyzed on the basis of data found in the literature. Solid state 13C NMR spectrum shows four signals, confirming the solid state structure determined by X-ray diffraction. Besides, the thermal analysis studies were performed, but no phase transition was found in the temperature range between 30 and 450 °C. The optical and PL properties of the compound were investigated in the solid state at room temperature and exhibited three bands at 348 and 401 cm-1 and a strong fluorescence at 480 nm.

  11. Energy-dispersive neutron imaging and diffraction of magnetically driven twins in a Ni2MnGa single crystal magnetic shape memory alloy

    NASA Astrophysics Data System (ADS)

    Kabra, Saurabh; Kelleher, Joe; Kockelmann, Winfried; Gutmann, Matthias; Tremsin, Anton

    2016-09-01

    Single crystals of a partially twinned magnetic shape memory alloy, Ni2MnGa, were imaged using neutron diffraction and energy-resolved imaging techniques at the ISIS spallation neutron source. Single crystal neutron diffraction showed that the crystal produces two twin variants with a specific crystallographic relationship. Transmission images were captured using a time of flight MCP/Timepix neutron counting detector. The twinned and untwinned regions were clearly distinguishable in images corresponding to narrow-energy transmission images. Further, the spatially-resolved transmission spectra were used to elucidate the orientations of the crystallites in the different volumes of the crystal.

  12. Crystallization of Mitochondrial Respiratory Complex II from Chicken Heart: a Membrane Protein Complex Diffracting to 2.0 Å.

    PubMed Central

    Huang, Li-shar; Borders, Toni M.; Shen, John T.; Wang, Chung-Jen; Berry, Edward

    2006-01-01

    Synopsis A multi-subunit mitochondrial membrane protein complex involved in the Krebs Cycle and respiratory chain has been crystallized in a form suitable for near-atomic resolution structure determination. A procedure is presented for preparation of diffraction-quality crystals of a vertebrate mitochondrial respiratory Complex II. The crystals have the potential to diffract to at least 2.0 Å with optimization of post-crystal-growth treatment and cryoprotection. This should allow determination of the structure of this important and medically relevant membrane protein complex at near-atomic resolution and provide great detail of the mode of binding of substrates and inhibitors at the two substrate-binding sites. PMID:15805592

  13. Application of Powder Diffraction Methods to the Analysis of the Atomic Structure of Nanocrystals: The Concept of the Apparent Lattice Parameter (ALP)

    NASA Technical Reports Server (NTRS)

    Palosz, B.; Grzanka, E.; Gierlotka, S.; Stelmakh, S.; Pielaszek, R.; Bismayer, U.; Weber, H.-P.; Palosz, W.; Curreri, Peter A. (Technical Monitor)

    2002-01-01

    The applicability of standard methods of elaboration of powder diffraction data for determination of the structure of nano-size crystallites is analysed. Based on our theoretical calculations of powder diffraction data we show, that the assumption of the infinite crystal lattice for nanocrystals smaller than 20 nm in size is not justified. Application of conventional tools developed for elaboration of powder diffraction data, like the Rietveld method, may lead to erroneous interpretation of the experimental results. An alternate evaluation of diffraction data of nanoparticles, based on the so-called 'apparent lattice parameter' (alp) is introduced. We assume a model of nanocrystal having a grain core with well-defined crystal structure, surrounded by a surface shell with the atomic structure similar to that of the core but being under a strain (compressive or tensile). The two structural components, the core and the shell, form essentially a composite crystal with interfering, inseparable diffraction properties. Because the structure of such a nanocrystal is not uniform, it defies the basic definitions of an unambiguous crystallographic phase. Consequently, a set of lattice parameters used for characterization of simple crystal phases is insufficient for a proper description of the complex structure of nanocrystals. We developed a method of evaluation of powder diffraction data of nanocrystals, which refers to a core-shell model and is based on the 'apparent lattice parameter' methodology. For a given diffraction pattem, the alp values are calculated for every individual Bragg reflection. For nanocrystals the alp values depend on the diffraction vector Q. By modeling different a0tomic structures of nanocrystals and calculating theoretically corresponding diffraction patterns using the Debye functions we showed, that alp-Q plots show characteristic shapes which can be used for evaluation of the atomic structure of the core-shell system. We show, that using a simple model of a nanocrystal with spherical shape and centro-symmetric strain at the surface shell we obtain theoretical alp-Q values which match very well the alp-Q plots determined experimentally for Sic, GaN, and diamond nanopowders. The theoretical models are defined by the lattice parameter of the grain core, thickness of the surface shell, and the magnitude and distribution of the strain field in the surface shell. According to our calculations, the part of the diffraction pattern measured at relatively low diffraction vectors Q (below 10/angstrom) provides information on the surface strain, whle determination of the lattice parameters in the grain core requires measurements at large Q-values (above 15 - 20/angstrom).

  14. Investigation on synthesis, growth and characterization of CdIn2S2Se2 single crystal grown by vertical Bridgman method

    NASA Astrophysics Data System (ADS)

    Vijayakumar, P.; Ramasamy, P.

    2017-06-01

    CdIn2S2Se2 polycrystalline material has been synthesized by melt oscillation method. Vertical Bridgman method was used to grow a good quality CdIn2S2Se2 single crystal. The crystalline phase and growth orientation were confirmed by powder X-ray diffraction pattern and unit cell parameters were determined by single crystal X-ray diffraction analysis. The structural uniformity of CdIn2S2Se2 was studied using Raman scattering spectroscopy at room temperature. The stoichiometric composition variation along the CdIn2S2Se2 was measured using energy dispersive spectrometry. The transmission spectra of CdIn2S2Se2 single crystal gave 42% transmission in the NIR region. Thermal property of CdIn2S2Se2 has been studied using differential thermal analysis. Thermal diffusivity, specific heat capacity and thermal conductivity were also measured. Electrical property was measured using Hall Effect measurement and it confirms the n-type semiconducting nature. The hardness behavior has been measured using Vickers micro hardness measurement and the indentation size effect has been observed.

  15. 2D-crystallization of Rhodococcus 20S proteasome at the liquid-liquid interface

    NASA Astrophysics Data System (ADS)

    Aoyama, Kazuhiro

    1996-10-01

    The 2D-crystallization method using the liquid-liquid interface between a aqueous phase (protein solution) and a thin organic liquid (dehydroabietylamine) layer has been applied to the Rhodococcus 20S proteasome. The 20S proteasome is known to be the core complex of the 26S proteasome, which is the central protease of the ubiquitin-dependent pathway. Two types of ordered arrays were obtained, both large enough for high resolution analysis by electron crystallography. The first one had a four-fold symmetry, whereas the second one was found out to be a hexagonally close-packed array. By image analysis based on a real space correlation averaging (CAV) technique, the close-packed array was found to be hexagonally packed, but the molecules had presumably rotational freedom. The four-fold array was found to be a true crystal with p4 symmetry. Lattice constants were a = b = 20.0 nm and α = 90°. The unit cell of this crystal contained two molecules. The diffraction pattern computed from the original picture showed spots up to (4, 5) that corresponds to 3.1 nm resolution. After applying an unbending procedure, the diffraction pattern showed spots extending to 1.8 nm resolution.

  16. Growing Larger Crystals for Neutron Diffraction

    NASA Technical Reports Server (NTRS)

    Pusey, Marc

    2003-01-01

    Obtaining crystals of suitable size and high quality has been a major bottleneck in macromolecular crystallography. With the advent of advanced X-ray sources and methods the question of size has rapidly dwindled, almost to the point where if one can see the crystal then it was big enough. Quality is another issue, and major national and commercial efforts were established to take advantage of the microgravity environment in an effort to obtain higher quality crystals. Studies of the macromolecule crystallization process were carried out in many labs in an effort to understand what affected the resultant crystal quality on Earth, and how microgravity improved the process. While technological improvements are resulting in a diminishing of the minimum crystal size required, neutron diffraction structural studies still require considerably larger crystals, by several orders of magnitude, than X-ray studies. From a crystal growth physics perspective there is no reason why these 'large' crystals cannot be obtained: the question is generally more one of supply than limitations mechanism. This talk will discuss our laboratory s current model for macromolecule crystal growth, with highlights pertaining to the growth of crystals suitable for neutron diffraction studies.

  17. Crystallization and preliminary X-ray crystallographic analysis of two vascular apoptosis-inducing proteins (VAPs) from Crotalus atrox venom

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Igarashi, Tomoko; Oishi, Yuko; Araki, Satohiko

    Vascular apoptosis-inducing protein 1 (VAP1) and VAP2 from C. atrox venom were crystallized in variety of different crystal forms. Diffraction data sets were obtained to 2.5 and 2.15 Å resolution for VAP1 and VAP2, respectively. VAPs are haemorrhagic snake-venom toxins belonging to the reprolysin family of zinc metalloproteinases. In vitro, VAPs induce apoptosis specifically in cultured vascular endothelial cells. VAPs have a modular structure that bears structural homology to mammalian ADAMs (a disintegrin and metalloproteinases). VAP1 is a homodimer with a MW of 110 kDa in which the monomers are connected by a single disulfide bridge. VAP2 is homologous tomore » VAP1 and exists as a monomer with a MW of 55 kDa. In the current study, several crystal forms of VAP1 and VAP2 were obtained using the vapour-diffusion method and diffraction data sets were collected using SPring-8 beamlines. The best crystals of VAP1 and VAP2 generated data sets to 2.5 and 2.15 Å resolution, respectively.« less

  18. Analysis of holographic polymer-dispersed liquid crystals (HPDLCs) for tunable low frequency diffractive optical elements recording

    NASA Astrophysics Data System (ADS)

    Fernández, R.; Gallego, S.; Márquez, A.; Francés, J.; Martínez, F. J.; Pascual, I.; Beléndez, A.

    2018-02-01

    Holographic polymer dispersed liquid crystals (HPDLCs) are the result of the optimization of the photopolymer fabrication techniques. They are made by recording in a photopolymerization induced phase separation process (PIPS) in which the liquid crystal molecules diffuse to dark zones in the diffraction grating originated. Thanks to the addition of liquid crystal molecules to the composition, this material has a dynamic behavior by reorientation of the liquid crystal molecules applying an electrical field. In this sense, it is possible to use this material to make dynamic devices. In this work, we study the behavior of this material working in low frequencies with different spatial periods of blazed gratings, a sharp profile whose recording is possible thanks to the addition of a Holoeye LCoS-Pluto spatial light modulator with a resolution of 1920 × 1080 pixels (HD) and a pixel size of 8 × 8 μm2. This device allows us to have an accurate and dynamic control of the phase and amplitude of the recording beam.

  19. Ultrasonic acoustic levitation for fast frame rate X-ray protein crystallography at room temperature.

    PubMed

    Tsujino, Soichiro; Tomizaki, Takashi

    2016-05-06

    Increasing the data acquisition rate of X-ray diffraction images for macromolecular crystals at room temperature at synchrotrons has the potential to significantly accelerate both structural analysis of biomolecules and structure-based drug developments. Using lysozyme model crystals, we demonstrated the rapid acquisition of X-ray diffraction datasets by combining a high frame rate pixel array detector with ultrasonic acoustic levitation of protein crystals in liquid droplets. The rapid spinning of the crystal within a levitating droplet ensured an efficient sampling of the reciprocal space. The datasets were processed with a program suite developed for serial femtosecond crystallography (SFX). The structure, which was solved by molecular replacement, was found to be identical to the structure obtained by the conventional oscillation method for up to a 1.8-Å resolution limit. In particular, the absence of protein crystal damage resulting from the acoustic levitation was carefully established. These results represent a key step towards a fully automated sample handling and measurement pipeline, which has promising prospects for a high acquisition rate and high sample efficiency for room temperature X-ray crystallography.

  20. Ultrasonic acoustic levitation for fast frame rate X-ray protein crystallography at room temperature

    NASA Astrophysics Data System (ADS)

    Tsujino, Soichiro; Tomizaki, Takashi

    2016-05-01

    Increasing the data acquisition rate of X-ray diffraction images for macromolecular crystals at room temperature at synchrotrons has the potential to significantly accelerate both structural analysis of biomolecules and structure-based drug developments. Using lysozyme model crystals, we demonstrated the rapid acquisition of X-ray diffraction datasets by combining a high frame rate pixel array detector with ultrasonic acoustic levitation of protein crystals in liquid droplets. The rapid spinning of the crystal within a levitating droplet ensured an efficient sampling of the reciprocal space. The datasets were processed with a program suite developed for serial femtosecond crystallography (SFX). The structure, which was solved by molecular replacement, was found to be identical to the structure obtained by the conventional oscillation method for up to a 1.8-Å resolution limit. In particular, the absence of protein crystal damage resulting from the acoustic levitation was carefully established. These results represent a key step towards a fully automated sample handling and measurement pipeline, which has promising prospects for a high acquisition rate and high sample efficiency for room temperature X-ray crystallography.

  1. Ultrasonic acoustic levitation for fast frame rate X-ray protein crystallography at room temperature

    PubMed Central

    Tsujino, Soichiro; Tomizaki, Takashi

    2016-01-01

    Increasing the data acquisition rate of X-ray diffraction images for macromolecular crystals at room temperature at synchrotrons has the potential to significantly accelerate both structural analysis of biomolecules and structure-based drug developments. Using lysozyme model crystals, we demonstrated the rapid acquisition of X-ray diffraction datasets by combining a high frame rate pixel array detector with ultrasonic acoustic levitation of protein crystals in liquid droplets. The rapid spinning of the crystal within a levitating droplet ensured an efficient sampling of the reciprocal space. The datasets were processed with a program suite developed for serial femtosecond crystallography (SFX). The structure, which was solved by molecular replacement, was found to be identical to the structure obtained by the conventional oscillation method for up to a 1.8-Å resolution limit. In particular, the absence of protein crystal damage resulting from the acoustic levitation was carefully established. These results represent a key step towards a fully automated sample handling and measurement pipeline, which has promising prospects for a high acquisition rate and high sample efficiency for room temperature X-ray crystallography. PMID:27150272

  2. Purification, crystallization and preliminary X-ray diffraction of SecDF, a translocon-associated membrane protein, from Thermus thermophilus

    PubMed Central

    Tsukazaki, Tomoya; Mori, Hiroyuki; Fukai, Shuya; Numata, Tomoyuki; Perederina, Anna; Adachi, Hiroaki; Matsumura, Hiroyoshi; Takano, Kazufumi; Murakami, Satoshi; Inoue, Tsuyoshi; Mori, Yusuke; Sasaki, Takatomo; Vassylyev, Dmitry G.; Nureki, Osamu; Ito, Koreaki

    2006-01-01

    Thermus thermophilus has a multi-path membrane protein, TSecDF, as a single-chain homologue of Escherichia coli SecD and SecF, which form a translocon-associated complex required for efficient preprotein translocation and membrane-protein integration. Here, the cloning, expression in E. coli, purification and crystallization of TSecDF are reported. Overproduced TSecDF was solubilized with dodecylmaltoside, chromatographically purified and crystallized by vapour diffusion in the presence of polyethylene glycol. The crystals yielded a maximum resolution of 4.2 Å upon X-ray irradiation, revealing that they belonged to space group P43212. Attempts were made to improve the diffraction quality of the crystals by combinations of micro-stirring, laser-light irradiation and dehydration, which led to the eventual collection of complete data sets at 3.74 Å resolution and preliminary success in the single-wavelength anomalous dispersion analysis. These results provide information that is essential for the determination of the three-dimensional structure of this important membrane component of the protein-translocation machinery. PMID:16582489

  3. Purification, crystallization and preliminary X-ray analysis of the glucosamine-6-phosphate N-acetyltransferase from human liver

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Juan; Zhou, Yan-Feng; Li, Lan-Fen

    2006-11-01

    Glucosamine-6-phosphate N-acetyltransferase from human liver was expressed, purified and crystallized. Diffraction data have been collected to 2.6 Å resolution. Glucosamine-6-phosphate N-acetyltransferase from human liver, which catalyzes the transfer of an acetyl group from acetyl coenzyme A (AcCoA) to the primary amine of d-glucosamine 6-phosphate to form N-acetyl-d-glucosamine 6-phosphate, was expressed in a soluble form from Escherichia coli strain BL21 (DE3). The protein was purified to homogeneity using Ni{sup 2+}-chelating chromatography followed by size-exclusion chromatography. Crystals of the protein were obtained by the hanging-drop vapour-diffusion method and diffracted to 2.6 Å resolution. The crystals belonged to space group P4{sub 1}2{sub 1}2more » or P4{sub 3}2{sub 1}2, with unit-cell parameters a = b = 50.08, c = 142.88 Å.« less

  4. Purification, crystallization and preliminary X-ray diffraction analysis of a soluble variant of the monoglyceride lipase Yju3p from the yeast Saccharomyces cerevisiae

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rengachari, Srinivasan; Aschauer, Philipp; Sturm, Christian

    A soluble variant of the monoglyceride lipase Yju3p was successfully expressed, purified and crystallized. Diffraction data were collected to 2.4 Å resolution. The protein Yju3p is the orthologue of monoglyceride lipases in the yeast Saccharomyces cerevisiae. A soluble variant of this lipase termed s-Yju3p (38.3 kDa) was generated and purified to homogeneity by affinity and size-exclusion chromatography. s-Yju3p was crystallized in a vapour-diffusion setup at 293 K and a complete data set was collected to 2.4 Å resolution. The crystal form was orthorhombic (space group P2{sub 1}2{sub 1}2{sub 1}), with unit-cell parameters a = 77.2, b = 108.6, c =more » 167.7 Å. The asymmetric unit contained four molecules with a solvent content of 46.4%.« less

  5. Crystallization and preliminary X-ray diffraction analysis of a class II phospholipase D from Loxosceles intermedia venom

    PubMed Central

    Ullah, Anwar; de Giuseppe, Priscila Oliveira; Murakami, Mario Tyago; Trevisan-Silva, Dilza; Wille, Ana Carolina Martins; Chaves-Moreira, Daniele; Gremski, Luiza Helena; da Silveira, Rafael Bertoni; Sennf-Ribeiro, Andrea; Chaim, Olga Meiri; Veiga, Silvio Sanches; Arni, Raghuvir Krishnaswamy

    2011-01-01

    Phospholipases D are the major dermonecrotic component of Loxosceles venom and catalyze the hydrolysis of phospholipids, resulting in the formation of lipid mediators such as ceramide-1-phosphate and lysophosphatidic acid which can induce pathological and biological responses. Phospholipases D can be classified into two classes depending on their catalytic efficiency and the presence of an additional disulfide bridge. In this work, both wild-type and H12A-mutant forms of the class II phospholipase D from L. intermedia venom were crystallized. Wild-type and H12A-mutant crystals were grown under very similar conditions using PEG 200 as a precipitant and belonged to space group P1211, with unit-cell parameters a = 50.1, b = 49.5, c = 56.5 Å, β = 105.9°. Wild-type and H12A-mutant crystals diffracted to maximum resolutions of 1.95 and 1.60 Å, respectively. PMID:21301094

  6. Purification, crystallization, small-angle X-ray scattering and preliminary X-ray diffraction analysis of the SH2 domain of the Csk-homologous kinase.

    PubMed

    Gunn, Natalie J; Gorman, Michael A; Dobson, Renwick C J; Parker, Michael W; Mulhern, Terrence D

    2011-03-01

    The C-terminal Src kinase (Csk) and Csk-homologous kinase (CHK) are endogenous inhibitors of the proto-oncogenic Src family of protein tyrosine kinases (SFKs). Phosphotyrosyl peptide binding to their Src-homology 2 (SH2) domains activates Csk and CHK, enhancing their ability to suppress SFK signalling; however, the detailed mechanistic basis of this activation event is unclear. The CHK SH2 was expressed in Escherichia coli and the purified protein was characterized as monomeric by synchrotron small-angle X-ray scattering in-line with size-exclusion chromatography. The CHK SH2 crystallized in 0.2 M sodium bromide, 0.1 M bis-Tris propane pH 6.5 and 20% polyethylene glycol 3350 and the best crystals diffracted to ∼1.6 Å resolution. The crystals belonged to space group P2, with unit-cell parameters a=25.8, b=34.6, c=63.2 Å, β=99.4°.

  7. Purification, crystallization and preliminary X-ray diffraction analysis of the glyoxalase II from Leishmania infantum

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Trincão, José; Sousa Silva, Marta; Barata, Lídia

    2006-08-01

    A glyoxalase II from L. infantum was cloned, purified and crystallized and its structure was solved by X-ray crystallography. In trypanosomatids, trypanothione replaces glutathione in all glutathione-dependent processes. Of the two enzymes involved in the glyoxalase pathway, glyoxalase I and glyoxalase II, the latter shows absolute specificity towards trypanothione thioester, making this enzyme an excellent model to understand the molecular basis of trypanothione binding. Cloned glyoxalase II from Leishmania infantum was overexpressed in Escherichia coli, purified and crystallized. Crystals belong to space group C222{sub 1} (unit-cell parameters a = 65.6, b = 88.3, c = 85.2 Å) and diffract beyondmore » 2.15 Å using synchrotron radiation. The structure was solved by molecular replacement using the human glyoxalase II structure as a search model. These results, together with future detailed kinetic characterization using lactoyltrypanothione, should shed light on the evolutionary selection of trypanothione instead of glutathione by trypano-somatids.« less

  8. Crystal Structure Variations of Sn Nanoparticles upon Heating

    NASA Astrophysics Data System (ADS)

    Mittal, Jagjiwan; Lin, Kwang-Lung

    2018-04-01

    Structural changes in Sn nanoparticles during heating below the melting point have been investigated using differential scanning calorimetry (DSC), x-ray diffraction (XRD) analysis, electron diffraction (ED), and high-resolution transmission electron microscopy (HRTEM). DSC revealed that the heat required to melt the nanoparticles (28.43 J/g) was about half compared with Sn metal (52.80 J/g), which was attributed to the large surface energy contribution for the nanoparticles. ED and XRD analyses of the Sn nanoparticles revealed increased intensity for crystal planes having large interplaner distances compared with regular crystal planes with increasing heat treatment temperature (HTT). HRTEM revealed an increase in interlayer spacing at the surface and near joints between nanoparticles with the HTT, leading to an amorphous structure of nanoparticles at the surface at 220°C. These results highlight the changes that occur in the morphology and crystal structure of Sn nanoparticles at the surface and in the interior with increase of the heat treatment temperature.

  9. Sagittal focusing of synchrotron radiation X-rays using a winged crystal

    PubMed Central

    Nisawa, A.; Yoneda, Y.; Ueno, G.; Murakami, H.; Okajima, Y.; Yamamoto, K.; Senba, Y.; Uesugi, K.; Tanaka, Y.; Yamamoto, M.; Goto, S.; Ishikawa, T.

    2013-01-01

    A Si(111) winged crystal has been designed to minimize anticlastic bending and improve sagittal focusing efficiency. The crystal was thin with wide stiffening wings. The length-to-width ratio of the crystal was optimized by finite element analysis, and the optimal value was larger than the ‘golden value’. The analysis showed that the slope error owing to anticlastic bending is less than the Darwin width. The X-rays were focused two-dimensionally using the crystal and a tangentially bent mirror. The observed profiles of the focal spot agreed well with the results of a ray-tracing calculation in the energy range from 8 to 17.5 keV. X-ray diffraction measurements with a high signal-to-noise ratio using this focusing system were demonstrated for a small protein crystal. PMID:23412477

  10. Observation of sagittal X-ray diffraction by surface acoustic waves in Bragg geometry.

    PubMed

    Vadilonga, Simone; Zizak, Ivo; Roshchupkin, Dmitry; Evgenii, Emelin; Petsiuk, Andrei; Leitenberger, Wolfram; Erko, Alexei

    2017-04-01

    X-ray Bragg diffraction in sagittal geometry on a Y-cut langasite crystal (La 3 Ga 5 SiO 14 ) modulated by Λ = 3 µm Rayleigh surface acoustic waves was studied at the BESSY II synchrotron radiation facility. Owing to the crystal lattice modulation by the surface acoustic wave diffraction, satellites appear. Their intensity and angular separation depend on the amplitude and wavelength of the ultrasonic superlattice. Experimental results are compared with the corresponding theoretical model that exploits the kinematical diffraction theory. This experiment shows that the propagation of the surface acoustic waves creates a dynamical diffraction grating on the crystal surface, and this can be used for space-time modulation of an X-ray beam.

  11. Observation of sagittal X-ray diffraction by surface acoustic waves in Bragg geometry1

    PubMed Central

    Vadilonga, Simone; Zizak, Ivo; Roshchupkin, Dmitry; Evgenii, Emelin; Petsiuk, Andrei; Leitenberger, Wolfram; Erko, Alexei

    2017-01-01

    X-ray Bragg diffraction in sagittal geometry on a Y-cut langasite crystal (La3Ga5SiO14) modulated by Λ = 3 µm Rayleigh surface acoustic waves was studied at the BESSY II synchrotron radiation facility. Owing to the crystal lattice modulation by the surface acoustic wave diffraction, satellites appear. Their intensity and angular separation depend on the amplitude and wavelength of the ultrasonic superlattice. Experimental results are compared with the corresponding theoretical model that exploits the kinematical diffraction theory. This experiment shows that the propagation of the surface acoustic waves creates a dynamical diffraction grating on the crystal surface, and this can be used for space–time modulation of an X-ray beam. PMID:28381976

  12. Crystal structure and vibrational spectra of melaminium arsenate

    NASA Astrophysics Data System (ADS)

    Anbalagan, G.; Marchewka, M. K.; Pawlus, K.; Kanagathara, N.

    2015-01-01

    The crystals of the new melaminium arsenate (MAS) [C3H7N6+ṡH2AsO4-] were obtained by the slow evaporation of an aqueous solution at room temperature. Single crystal X-ray diffraction analysis reveals that the crystal belongs to triclinic system with centro symmetric space group P-1. The crystals are built up from single protonated melaminium residues and single dissociated arsenate H2AsO4- anions. The protonated melaminium ring is almost planar. A combination of ionic and donor-acceptor hydrogen-bond interactions linking together the melaminium and arsenate residues forms a three-dimensional network. Vibrational spectroscopic analysis is reported on the basis of FT-IR and FT-Raman spectra recorded at room temperature. Hydrogen bonded network present in the crystal gives notable vibrational effect. DSC has also been performed for the crystal shows no phase transition in the studied temperature range (113-293 K).

  13. Highly efficient acousto-optic diffraction in Sn2P2S6 crystals.

    PubMed

    Martynyuk-Lototska, I Yu; Mys, O G; Grabar, A A; Stoika, I M; Vysochanskii, Yu M; Vlokh, R O

    2008-01-01

    We have studied the acousto-optic (AO) diffraction in Sn2P2S6 crystals and found that they manifest high values of an AO figure of merit. The above crystals may therefore be used as highly efficient materials in different AO applications.

  14. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zipper, Lauren E.; Aristide, Xavier; Bishop, Dylan P.

    A method is described for using plate lids to reduce evaporation in low-volume vapor-diffusion crystallization experiments. The plate lids contain apertures through which the protein and precipitants were added to different crystallization microplates (the reservoir was filled before fitting the lids). Plate lids were designed for each of these commonly used crystallization microplates. This system minimizes the dehydration of crystallization droplets containing just a few nanolitres of protein and precipitant, and results in more reproducible diffraction from the crystals. For each lid design, changes in the weight of the plates were used to deduce the rate of evaporation under differentmore » conditions of temperature, air movement, droplet size and precipitant. For comparison, the state of dehydration was also visually assessed throughout the experiment. Finally, X-ray diffraction methods were used to compare the diffraction of protein crystals that were conventionally prepared against those that were prepared on plates with plate lids. The measurements revealed that the plate lids reduced the rate of evaporation by 63–82%. Crystals grown in 5 nl drops that were set up with plate lids diffracted to higher resolution than similar crystals from drops that were set up without plate lids. Ultimately, the results demonstrate that plate lids can be instrumental for improving few-nanolitre crystallizations.« less

  15. Electron Probe Microanalysis | Materials Science | NREL

    Science.gov Websites

    surveys of the area of interest before performing a more accurate quantitative analysis with WDS. WDS - Four spectrometers with ten diffracting crystals. The use of a single-channel analyzer allows much

  16. Crystallization and initial X-ray analysis of polyhydroxyalkanoate granule-associated protein from Aeromonas hydrophila

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhao, Minglian; Li, Zhenguo; Zheng, Wei

    The phasin PhaP{sub Ah} from A. hydrophila strain 4AK4 was crystallized using the hanging-drop vapour-diffusion method. Polyhydroxyalkanoate (PHA) granule-associated proteins (phasins) were discovered in PHA-accumulating bacteria. They play a crucial role as a structural protein during initial PHA-granule formation and granule growth and also serve as interfaces for granule stabilization in vivo. The phasin PhaP{sub Ah} from Aeromonas hydrophila strain 4AK4 was crystallized using the hanging-drop vapour-diffusion method. Single crystals were cryocooled for X-ray diffraction analysis. The phasin crystals belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 80.8, b = 108.9, c = 134.4 Å.

  17. Electron backscatter diffraction as a domain analysis technique in BiFeO(3)-PbTiO(3) single crystals.

    PubMed

    Burnett, T L; Comyn, T P; Merson, E; Bell, A J; Mingard, K; Hegarty, T; Cain, M

    2008-05-01

    xBiFeO(3)-(1-x)PbTiO(3) single crystals were grown via a flux method for a range of compositions. Presented here is a study of the domain configuration in the 0.5BiFeO(3)-0.5PbTiO(3) composition using electron backscatter diffraction to demonstrate the ability of the technique to map ferroelastic domain structures at the micron and submicron scale. The micron-scale domains exhibit an angle of approximately 85 degrees between each variant, indicative of a ferroelastic domain wall in a tetragonal system with a spontaneous strain, c/a - 1 of 0.10, in excellent agreement with the lattice parameters derived from x-ray diffraction. Contrast seen in forescatter images is attributed to variations in the direction of the electrical polarization vector, providing images of ferroelectric domain patterns.

  18. Synthesis, structural characterization, DFT studies and in-vitro antidiabetic activity of new mixed ligand oxovanadium(IV) complex with tridentate Schiff base

    NASA Astrophysics Data System (ADS)

    Patel, R. N.; Singh, Yogendra Pratap

    2018-02-01

    The mixed ligand oxovanadium(IV) complex [VO(L1)(L2)] [L1 = N'-[(Z)-phenyl(pyridin-2-yl)methylidene]benzohydrazide and L2 = Benzohydrazide] has been synthesized in aerobic condition. The complex was characterized by elemental analysis spectroscopic (UV-vis, IR, epr) and electrochemical methods. X-ray diffraction pattern was also used to characterize this complex, which has a distorted octahedral structure. Single crystal diffraction analysis reveals that Csbnd H⋯π (aryl/metal chelate rings) interactions contribute to the stabilization of the crystal structure in given dimension. The room temperature magnetic susceptibility data shows paramagnetic nature of the complex. The complex was also tested for in-vitro antidiabetic activity. Moderate α-glucosidase inhibition is shown by this complex, which may be considered as α-glucosidase inhibitors.

  19. RBS/C, HRTEM and HRXRD study of damage accumulation in irradiated SrTiO3

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jagielski, Jacek; Jozwik, Przemyslaw A.; Jozwik Biala, Iwona

    2013-05-14

    Damage accumulation in argon-irradiated SrTiO3 single crystals has been studied by using combination of Rutherford Backscattering/Channeling (RBS/C), High Resolution Transmission Electron Microscopy (HRTEM) and High Resolution X-Ray Diffraction (HRXRD) techniques. The RBS/C spectra were fitted using McChasy, a Monte Carlo simulation code allowing the quantitative analysis of amorphous-like and dislocation-like types of defects. The results were interpreted by using a Multi-Step Damage Accumulation model which assumes, that the damage accumulation occurs in a series of structural transformations, the defect transformations are triggered by a stress caused by formation of a free volume in the irradiated crystal. This assumption has beenmore » confirmed by High Resolution Transmission Electron Microscopy and High Resolution X-Ray Diffraction analysis.« less

  20. Thermal behaviour and microanalysis of coal subbituminus

    NASA Astrophysics Data System (ADS)

    Heriyanti; Prendika, W.; Ashyar, R.; Sutrisno

    2018-04-01

    Differential scanning calorimetry (DSC) and X-ray powder diffraction (XRD) is used to study the thermal behaviour of sub-bituminous coal. The DSC experiment was performed in air atmosphere up to 125 °C at a heating rate of 25 °C min1. The DSC curve showed that the distinct transitional stages in the coal samples studied. Thermal heating temperature intervals, peak and dissociation energy of the coal samples were also determined. The XRD analysis was used to evaluate the diffraction pattern and crystal structure of the compounds in the coal sample at various temperatures (25-350 °C). The XRD analysis of various temperatures obtained compounds from the coal sample, dominated by quartz (SiO2) and corundum (Al2O3). The increase in temperature of the thermal treatment showed a better crystal formation.

  1. Synthesis and Crystal Structure of Dibromido{2-[(4-tert-butylmethylphenyl) iminomethyl]pyridine-κ2 N, N'}Zinc

    NASA Astrophysics Data System (ADS)

    Khalaj, M.; Ghazanfarpour-Darjani, M.; Seftejani, F. B.; Lalegani, A.

    2017-12-01

    The title compound [Zn( dip)Br2] was synthesized using the Schiff base bidentate ligand (E)-4- tert-butyl- N-(pyridine-2-ylmethylene)benzeneamine ( dip) and zinc(II) bromide salts. It has been characterized by elemental analysis, X-ray diffraction, and optical spectroscopy. The X-ray diffraction analysis demonstrates that in this structure, the zinc(II) ion is located on an inversion center and exhibits a ZnN2Br2 tetrahedral geometry. In this structure the dip ligand is coordinated with zinc(II) ion in a cyclic-bidentate fashion forming a five-membered metallocyclic ring. The compound crystallizes in the monoclinic sp. gr. P21/ m with a = 9.2700(13) Å, b = 7.6128(11) Å, c = 12.3880(17) Å, and β = 97.021(3)°.

  2. Crystal growth, structural, optical, spectral and thermal studies of tris(L-phenylalanine)L-phenylalaninium nitrate: a new organic nonlinear optical material.

    PubMed

    Prakash, M; Geetha, D; Lydia Caroline, M

    2011-10-15

    Tris(L-phenylalanine)L-phenylalaninium nitrate, C(9)H(12)NO(2)(+)·NO(3)(-)·3C(9)H(11)NO(2) (TPLPN), a new organic nonlinear optical material was grown from aqueous solution by slow evaporation solution growth at room temperature. The grown crystals were subjected to powder X-ray diffraction and single crystal X-ray diffraction studies to confirm the crystalline nature and crystal structure. The modes of vibration of different molecular groups present in TPLPN have been identified by FTIR spectral analysis. The presence of hydrogen and carbon in the grown crystal were confirmed by using proton and carbon nuclear magnetic resonance (NMR) spectral analyses. The optical transmission spectral study establishes good transmitting ability of the crystal in the entire visible region. The thermogravimetric (TG) and differential thermal analyses (DTA) were carried out to understand the thermal stability of the sample. The nonlinear optical property of the compound observed using Kurtz powder second harmonic generation test assets the suitability of the grown material for the frequency conversion of laser radiation of Nd:YAG. Copyright © 2011 Elsevier B.V. All rights reserved.

  3. Crystallization and preliminary crystallographic analysis of orotidine 5′-monophosphate decarboxylase from the human malaria parasite Plasmodium falciparum

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Krungkrai, Sudaratana R.; Department of Molecular Protozoology, Research Institute for Microbial Diseases, Osaka University, 3-1 Yamadaoka, Suita, Osaka 565-0871; Tokuoka, Keiji

    Orotidine 5′-monophosphate decarboxylase of human malaria parasite P. falciparum was crystallized by the seeding method in a hanging drop using PEG 3000 as a precipitant. A complete set of diffraction data from a native crystal was collected to 2.7 Å resolution at 100 K using synchrotron radiation. Orotidine 5′-monophosphate (OMP) decarboxylase (OMPDC; EC 4.1.1.23) catalyzes the final step in the de novo synthesis of uridine 5′-monophosphate (UMP) and defects in the enzyme are lethal in the malaria parasite Plasmodium falciparum. Active recombinant P. falciparum OMPDC (PfOMPDC) was crystallized by the seeding method in a hanging drop using PEG 3000 asmore » a precipitant. A complete set of diffraction data from a native crystal was collected to 2.7 Å resolution at 100 K using synchrotron radiation at the Swiss Light Source. The crystal exhibits trigonal symmetry (space group R3), with hexagonal unit-cell parameters a = b = 201.81, c = 44.03 Å. With a dimer in the asymmetric unit, the solvent content is 46% (V{sub M} = 2.3 Å{sup 3} Da{sup −1})« less

  4. Q-space analysis of light scattering by ice crystals

    NASA Astrophysics Data System (ADS)

    Heinson, Yuli W.; Maughan, Justin B.; Ding, Jiachen; Chakrabarti, Amitabha; Yang, Ping; Sorensen, Christopher M.

    2016-12-01

    Q-space analysis is applied to extensive simulations of the single-scattering properties of ice crystals with various habits/shapes over a range of sizes. The analysis uncovers features common to all the shapes: a forward scattering regime with intensity quantitatively related to the Rayleigh scattering by the particle and the internal coupling parameter, followed by a Guinier regime dependent upon the particle size, a complex power law regime with incipient two dimensional diffraction effects, and, in some cases, an enhanced backscattering regime. The effects of significant absorption on the scattering profile are also studied. The overall features found for the ice crystals are similar to features in scattering from same sized spheres.

  5. Growth and characterization of ammonium nickel-cobalt sulfate Tutton's salt for UV light applications

    NASA Astrophysics Data System (ADS)

    Ghosh, Santunu; Oliveira, Michelle; Pacheco, Tiago S.; Perpétuo, Genivaldo J.; Franco, Carlos J.

    2018-04-01

    We have obtained a set of sample crystals of the family of Tutton's salt comprise in the isomorphic series with general chemical formula (NH4)2NixCo(1-x) (SO4)2·6H2O, by employing growth from solutions by slow evaporation technique. The samples crystals were characterized by ICP-AES, X-ray powder diffraction analysis, thermogravimetric analysis, UV-Vis-NIR, Raman and FTIR spectroscopy. This type of material has been studied because of its physical and chemical properties not yet understood and they have potential technological applications. Chemical analysis of the samples by ICP-AES method allowed us to investigate the efficiency of the method of growth used. Thermogravimetric analysis provides the information about the thermal stability of the obtained crystals for high temperature applications, and powder X-ray diffraction analysis at ambient and high temperature reveals the structural quality and structural change of the samples respectively. We have used Raman spectroscopy in the range 100-4000 cm-1 and FTIR spectroscopy in the range 400-4000 cm-1 to understand the internal vibrational mode of the octahedral complexes [Ni(H2O)6]2+ and [Co(H2O)6]2+, SO42- and NH4+ tetrahedra. The transmittance of our mixed ammonium nickel cobalt sulfate hexahydrate (ACNSH) crystals is 75% in the UV region, which indicates that they are ideal to use in UV light filters and UV sensors.

  6. X-ray plane-wave diffraction effects in a crystal with third-order nonlinearity

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Balyan, M. K., E-mail: mbalyan@ysu.am

    The two-wave dynamical diffraction in the Laue geometry has been theoretically considered for a plane X-ray wave in a crystal with a third-order nonlinear response to the external field. An analytical solution to the problem stated is found for certain diffraction conditions. A nonlinear pendulum effect is analyzed. The nonlinear extinction length is found to depend on the incident-wave intensity. A pendulum effect of a new type is revealed: the intensities of the transmitted and diffracted waves periodically depend on the incidentwave intensity at a fixed crystal thickness. The rocking curves and Borrmann nonlinear effect are numerically calculated.

  7. The Growth of Protein Crystals Using McDUCK

    NASA Technical Reports Server (NTRS)

    Ewing, Felicia; Wilson, Lori; Nadarajah, Arunan; Pusey, Marc

    1998-01-01

    Most of the current microgravity crystal growth hardware is optimized to produce crystals within the limited time available on orbit. This often results in the actual nucleation and growth process being rushed or the system not coming to equilibrium within the limited time available. Longer duration hardware exists, but one cannot readily pick out crystals grown early versus those which nucleated and grew more slowly. We have devised a long duration apparatus, the Multi-chamber Dialysis Unit for Crystallization Kinetics, or McDUCK. This apparatus-is a series of protein chambers, stacked upon a precipitant reservoir chamber. All chambers are separated by a dialysis membrane, which serves to pass small molecules while retaining the protein. The volume of the Precipitant chamber is equal to the sum of the volumes of the protein chamber. In operation, the appropriate chambers are filled with precipitant solution or protein solution, and the McDUCK is placed standing upright, with the precipitant chamber on the bottom. The precipitant diffuses upwards over time, with the time to reach equilibration a function of the diffusivity of the precipitant and the overall length of the diffusion pathway. Typical equilibration times are approximately 2-4 months, and one can readily separate rapid from slow nucleation and growth crystals. An advantage on Earth is that the vertical precipitant concentration gradient dominates that of the solute, thus dampening out solute density gradient driven convective flows. However, large Earth-grown crystals have so far tended to be more two dimensional. Preliminary X-ray diffraction analysis of lysozyme crystals grown in McDUCK have indicated that the best, and largest, come from the middle chambers, suggesting that there is an optimal growth rate. Further, the improvements in diffraction resolution have been better signal to noise ratios in the low resolution data, not an increase in resolution overall. Due to the persistently large crystals grown we are currently proposing McDUCK for the growth of macromolecule crystals for use in neutron diffraction studies.

  8. Towards protein-crystal centering using second-harmonic generation (SHG) microscopy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kissick, David J.; Dettmar, Christopher M.; Becker, Michael

    2013-05-01

    The potential of second-harmonic generation (SHG) microscopy for automated crystal centering to guide synchrotron X-ray diffraction of protein crystals has been explored. The potential of second-harmonic generation (SHG) microscopy for automated crystal centering to guide synchrotron X-ray diffraction of protein crystals was explored. These studies included (i) comparison of microcrystal positions in cryoloops as determined by SHG imaging and by X-ray diffraction rastering and (ii) X-ray structure determinations of selected proteins to investigate the potential for laser-induced damage from SHG imaging. In studies using β{sub 2} adrenergic receptor membrane-protein crystals prepared in lipidic mesophase, the crystal locations identified by SHGmore » images obtained in transmission mode were found to correlate well with the crystal locations identified by raster scanning using an X-ray minibeam. SHG imaging was found to provide about 2 µm spatial resolution and shorter image-acquisition times. The general insensitivity of SHG images to optical scatter enabled the reliable identification of microcrystals within opaque cryocooled lipidic mesophases that were not identified by conventional bright-field imaging. The potential impact of extended exposure of protein crystals to five times a typical imaging dose from an ultrafast laser source was also assessed. Measurements of myoglobin and thaumatin crystals resulted in no statistically significant differences between structures obtained from diffraction data acquired from exposed and unexposed regions of single crystals. Practical constraints for integrating SHG imaging into an active beamline for routine automated crystal centering are discussed.« less

  9. Sequential x-ray diffraction topography at 1-BM x-ray optics testing beamline at the advanced photon source

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Stoupin, Stanislav, E-mail: sstoupin@aps.anl.gov; Shvyd’ko, Yuri; Trakhtenberg, Emil

    2016-07-27

    We report progress on implementation and commissioning of sequential X-ray diffraction topography at 1-BM Optics Testing Beamline of the Advanced Photon Source to accommodate growing needs of strain characterization in diffractive crystal optics and other semiconductor single crystals. The setup enables evaluation of strain in single crystals in the nearly-nondispersive double-crystal geometry. Si asymmetric collimator crystals of different crystallographic orientations were designed, fabricated and characterized using in-house capabilities. Imaging the exit beam using digital area detectors permits rapid sequential acquisition of X-ray topographs at different angular positions on the rocking curve of a crystal under investigation. Results on sensitivity andmore » spatial resolution are reported based on experiments with high-quality Si and diamond crystals. The new setup complements laboratory-based X-ray topography capabilities of the Optics group at the Advanced Photon Source.« less

  10. The collection of MicroED data for macromolecular crystallography.

    PubMed

    Shi, Dan; Nannenga, Brent L; de la Cruz, M Jason; Liu, Jinyang; Sawtelle, Steven; Calero, Guillermo; Reyes, Francis E; Hattne, Johan; Gonen, Tamir

    2016-05-01

    The formation of large, well-ordered crystals for crystallographic experiments remains a crucial bottleneck to the structural understanding of many important biological systems. To help alleviate this problem in crystallography, we have developed the MicroED method for the collection of electron diffraction data from 3D microcrystals and nanocrystals of radiation-sensitive biological material. In this approach, liquid solutions containing protein microcrystals are deposited on carbon-coated electron microscopy grids and are vitrified by plunging them into liquid ethane. MicroED data are collected for each selected crystal using cryo-electron microscopy, in which the crystal is diffracted using very few electrons as the stage is continuously rotated. This protocol gives advice on how to identify microcrystals by light microscopy or by negative-stain electron microscopy in samples obtained from standard protein crystallization experiments. The protocol also includes information about custom-designed equipment for controlling crystal rotation and software for recording experimental parameters in diffraction image metadata. Identifying microcrystals, preparing samples and setting up the microscope for diffraction data collection take approximately half an hour for each step. Screening microcrystals for quality diffraction takes roughly an hour, and the collection of a single data set is ∼10 min in duration. Complete data sets and resulting high-resolution structures can be obtained from a single crystal or by merging data from multiple crystals.

  11. Structural investigations of Pu{sup III} phosphate by X-ray diffraction, MAS-NMR and XANES spectroscopy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Popa, Karin; Raison, Philippe E., E-mail: philippe.raison@ec.europa.eu; Martel, Laura

    2015-10-15

    PuPO{sub 4} was prepared by a solid state reaction method and its crystal structure at room temperature was solved by powder X-ray diffraction combined with Rietveld refinement. High resolution XANES measurements confirm the +III valence state of plutonium, in agreement with valence bond derivation. The presence of the americium (as β{sup −} decay product of plutonium) in the +III oxidation state was determined based on XANES spectroscopy. High resolution solid state {sup 31}P NMR agrees with the XANES results and the presence of a solid-solution. - Graphical abstract: A full structural analysis of PuPO{sub 4} based on Rietveld analysis ofmore » room temperature X-ray diffraction data, XANES and MAS NMR measurements was performed. - Highlights: • The crystal structure of PuPO{sub 4} monazite is solved. • In PuPO{sub 4} plutonium is strictly trivalent. • The presence of a minute amount of Am{sup III} is highlighted. • We propose PuPO{sub 4} as a potential reference material for spectroscopic and microscopic studies.« less

  12. New investigations of the guanine trichloro cuprate(II) complex crystal

    NASA Astrophysics Data System (ADS)

    Fabijanić, Ivana; Matković-Čalogović, Dubravka; Pilepić, Viktor; Ivanišević, Irena; Mohaček-Grošev, Vlasta; Sanković, Krešimir

    2017-01-01

    Crystals of the guanine trichloro cuprate(II) complex, (HGua)2[Cu2Cl6]·2H2O (HGua = protonated guanine), were prepared and analysed by spectroscopic (IR, Raman) and computational methods. A new single-crystal X-ray diffraction analysis was conducted to obtain data with lower standard uncertainties than those in the previously published structure. Raman and IR spectroscopy and quantum-mechanical analysis gave us new insight into the vibrational states of the (HGua)2[Cu2Cl6]·2H2O crystal. The vibrational spectra of the crystal were assigned by performing a normal coordinate analysis for a free dimer with a centre of inversion as the only symmetry element. The stretching vibration observed at 279 cm-1 in the infrared spectrum corresponds to the N-Cu bond. The noncovalent interaction (NCI) plots and quantum theory of atoms in molecules (QTAIM) analysis of the electron density obtained from periodic DFT calculations elucidated the interactions that exist within the crystal structure. Closed-shell ionic attractions, as well as weak and medium strength hydrogen bonds, prevailed in the crystal packing.

  13. Syntheses, structures and luminescent properties of two novel Zn (II) coordination polymers

    NASA Astrophysics Data System (ADS)

    Huang, Ya-Ru; Gao, Ling-Ling; Wang, Xiao-Qing; Fan, Li-Ming; Hu, Tuo-Ping

    2018-02-01

    Two new coordination polymers, namely [Zn(TZMB)]n (1) and {[Zn(TZMB)](H2TZMB)]·(C2H5OH)0.5(H2O)2.5}n (2), (H2TZMB = 4,4‧-(1H-1,2,4-triazol-1-yl)methylene-bis(benzonic acid), have been synthesized under hydrothermal conditions and characterized by single-crystal X-ray diffraction analysis, elemental analysis (EA), IR spectrum analysis (IR), powder X-ray diffraction (PXRD), and thermogravimetric (TG) analysis. Single X-ray diffraction analysis reveals that complex 1 is a 3D 3,6-connected net with the point symbol of (6110.84)(63)2 and complex 2 is a 2D 3-connected net with the point symbol of (63). Furthermore, luminescent properties of complexes 1 and 2 were also investigated in detail.

  14. Cloning, expression, purification, crystallization and X-ray crystallographic analysis of recombinant human C1ORF123 protein.

    PubMed

    Rahaman, Siti Nurulnabila A; Mat Yusop, Jastina; Mohamed-Hussein, Zeti-Azura; Ho, Kok Lian; Teh, Aik-Hong; Waterman, Jitka; Ng, Chyan Leong

    2016-03-01

    C1ORF123 is a human hypothetical protein found in open reading frame 123 of chromosome 1. The protein belongs to the DUF866 protein family comprising eukaryote-conserved proteins with unknown function. Recent proteomic and bioinformatic analyses identified the presence of C1ORF123 in brain, frontal cortex and synapses, as well as its involvement in endocrine function and polycystic ovary syndrome (PCOS), indicating the importance of its biological role. In order to provide a better understanding of the biological function of the human C1ORF123 protein, the characterization and analysis of recombinant C1ORF123 (rC1ORF123), including overexpression and purification, verification by mass spectrometry and a Western blot using anti-C1ORF123 antibodies, crystallization and X-ray diffraction analysis of the protein crystals, are reported here. The rC1ORF123 protein was crystallized by the hanging-drop vapor-diffusion method with a reservoir solution comprised of 20% PEG 3350, 0.2 M magnesium chloride hexahydrate, 0.1 M sodium citrate pH 6.5. The crystals diffracted to 1.9 Å resolution and belonged to an orthorhombic space group with unit-cell parameters a = 59.32, b = 65.35, c = 95.05 Å. The calculated Matthews coefficient (VM) value of 2.27 Å(3) Da(-1) suggests that there are two molecules per asymmetric unit, with an estimated solvent content of 45.7%.

  15. Crystallization of toxic glycol solvates of rifampin from glycerin and propylene glycol contaminated with ethylene glycol or diethylene glycol.

    PubMed

    de Villiers, Melgardt M; Caira, Mino R; Li, Jinjing; Strydom, Schalk J; Bourne, Susan A; Liebenberg, Wilna

    2011-06-06

    This study was initiated when it was suspected that syringe blockage experienced upon administration of a compounded rifampin suspension was caused by the recrystallization of toxic glycol solvates of the drug. Single crystal X-ray structure analysis, powder X-ray diffraction, thermal analysis and gas chromatography were used to identify the ethylene glycol in the solvate crystals recovered from the suspension. Controlled crystallization and solubility studies were used to determine the ease with which toxic glycol solvates crystallized from glycerin and propylene glycol contaminated with either ethylene or diethylene glycol. The single crystal structures of two distinct ethylene glycol solvates of rifampin were solved while thermal analysis, GC analysis and solubility studies confirmed that diethylene glycol solvates of the drug also crystallized. Controlled crystallization studies showed that crystallization of the rifampin solvates from glycerin and propylene glycol depended on the level of contamination and changes in the solubility of the drug in the contaminated solvents. Although the exact source of the ethylene glycol found in the compounded rifampin suspension is not known, the results of this study show how important it is to ensure that the drug and excipients comply with pharmacopeial or FDA standards.

  16. A simple technique to reduce evaporation of crystallization droplets by using plate lids with apertures for adding liquids

    PubMed Central

    Zipper, Lauren E.; Aristide, Xavier; Bishop, Dylan P.; Joshi, Ishita; Kharzeev, Julia; Patel, Krishna B.; Santiago, Brianna M.; Joshi, Karan; Dorsinvil, Kahille; Sweet, Robert M.; Soares, Alexei S.

    2014-01-01

    A method is described for using plate lids to reduce evaporation in low-volume vapor-diffusion crystallization experiments. The plate lids contain apertures through which the protein and precipitants were added to different crystallization microplates (the reservoir was filled before fitting the lids). Plate lids were designed for each of these commonly used crystallization microplates. This system minimizes the dehydration of crystallization droplets containing just a few nanolitres of protein and precipitant, and results in more reproducible diffraction from the crystals. For each lid design, changes in the weight of the plates were used to deduce the rate of evaporation under different conditions of temperature, air movement, droplet size and precipitant. For comparison, the state of dehydration was also visually assessed throughout the experiment. Finally, X-ray diffraction methods were used to compare the diffraction of protein crystals that were conventionally prepared against those that were prepared on plates with plate lids. The measurements revealed that the plate lids reduced the rate of evaporation by 63–82%. Crystals grown in 5 nl drops that were set up with plate lids diffracted to higher resolution than similar crystals from drops that were set up without plate lids. The results demonstrate that plate lids can be instrumental for improving few-nanolitre crystallizations. PMID:25484231

  17. A simple technique to reduce evaporation of crystallization droplets by using plate lids with apertures for adding liquids

    DOE PAGES

    Zipper, Lauren E.; Aristide, Xavier; Bishop, Dylan P.; ...

    2014-11-28

    A method is described for using plate lids to reduce evaporation in low-volume vapor-diffusion crystallization experiments. The plate lids contain apertures through which the protein and precipitants were added to different crystallization microplates (the reservoir was filled before fitting the lids). Plate lids were designed for each of these commonly used crystallization microplates. This system minimizes the dehydration of crystallization droplets containing just a few nanolitres of protein and precipitant, and results in more reproducible diffraction from the crystals. For each lid design, changes in the weight of the plates were used to deduce the rate of evaporation under differentmore » conditions of temperature, air movement, droplet size and precipitant. For comparison, the state of dehydration was also visually assessed throughout the experiment. Finally, X-ray diffraction methods were used to compare the diffraction of protein crystals that were conventionally prepared against those that were prepared on plates with plate lids. The measurements revealed that the plate lids reduced the rate of evaporation by 63–82%. Crystals grown in 5 nl drops that were set up with plate lids diffracted to higher resolution than similar crystals from drops that were set up without plate lids. Ultimately, the results demonstrate that plate lids can be instrumental for improving few-nanolitre crystallizations.« less

  18. New supramolecular cocrystal of 2-amino-5-chloropyridine with 3-methylbenzoic acids: Syntheses, structural characterization, Hirshfeld surfaces and quantum chemical investigations

    NASA Astrophysics Data System (ADS)

    Thanigaimani, Kaliyaperumal; Khalib, Nuridayanti Che; Temel, Ersin; Arshad, Suhana; Razak, Ibrahim Abdul

    2015-11-01

    2-amino-5-chloropyridine: 3-methylbenzoic acid [(2A5CP) (3MBA)] (I) cocrystal was synthesized and its single crystal was grown by slow evaporation technique. The structure of the grown crystal was elucidated by using single crystal X-ray diffraction technique. The cocrystal belongs to the monoclinic crystallographic system with space group P21/c, Z = 4, and a = 13.3155 (5) Å, b = 5.5980 (2) Å, c = 18.3787 (7) Å, β = 110.045 (2)°. The crystal structure is stabilized by Npyridine-H•••Odbnd C, Cdbnd O-H•••Npyridine and C-H⋯O type hydrogen bonding interactions. The presence of unionized -COOH functional group in the cocrystal was identified both by spectral methods and X-ray structural analysis. The experimental studies obtained by using the methods of single crystal X-ray analysis, powder X-ray diffraction (PXRD) analysis, FTIR, 1H NMR and 13C NMR spectroscopies confirmed the predicted cocrystal. The supramolecular assembly of the cocrystal was analyzed and discussed. The molecular geometry, vibrational frequencies of the compound in the ground state were calculated by using the density functional theory (DFT) method with 6-311++G (d,p) basis set and were compared with the experimental data. Additionally, HOMO-LUMO energy gap, natural bond orbital (NBO) analysis and nonlinear optical (NLO) properties of the compound were performed at B3LYP/6-311++G (d,p) level. Hirshfeld surfaces were used to confirm the existence of inter-molecular interactions in the compound.

  19. Optical, mechanical and thermal behaviors of Nitrilotriacetic acid single crystal

    NASA Astrophysics Data System (ADS)

    Deepa, B.; Philominathan, P.

    2017-11-01

    An organic nonlinear single crystal of Nitrilotriacetic acid (NTAA) was grown for the first time by employing a simple slow evaporation technique. Single crystal X-ray diffraction (XRD) analysis reveals that the grown crystal belongs to the monoclinic system with noncentrosymmetric space group CC. Fourier transform infrared (FTIR) spectral study ascertains the presence of functional groups in NTAA. The molecular structure of the grown crystal was confirmed by Nuclear Magnetic Resonance (NMR) spectral analysis. The optical parameters such as transmittance, absorption coefficient and band gap were calculated from UV-Visible and fluorescence studies. Dielectric measurements were carried out for different frequency and temperature. The mechanical strength of the grown crystal was measured using Vickers microhardness test. The high thermal stability and the melting point of the grown crystal were also estimated using thermogravimetric (TGA) and differential thermal analyses (DTA). The confirmation of the grown crystals belonging to nonlinear optical crystals was performed by Kurtz-Perry technique and found as suitable candidate for optoelectronics applications.

  20. Crystallization and preliminary crystallographic analysis of an aminoglycoside kinase from Legionella pneumophila

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lemke, Christopher T.; Hwang, Jiyoung; Xiong, Bing

    2005-06-01

    Two crystal forms of the antibiotic resistance enzyme APH(9)-Ia from L. pneumophila are reported. 9-Aminoglycoside phosphotransferase type Ia [APH(9)-Ia] is a resistance factor in Legionella pneuemophila, the causative agent of legionnaires’ disease. It is responsible for providing intrinsic resistance to the antibiotic spectinomycin. APH(9)-Ia phosphorylates one of the hydroxyl moieties of spectinomycin in an ATP-dependent manner, abolishing the antibiotic properties of this drug. Here, the crystallization and preliminary X-ray studies of this enzyme in two crystal forms is reported. One of the these crystal forms provides diffraction data to a resolution of 1.7 Å.

  1. Prediction and theoretical characterization of p-type organic semiconductor crystals for field-effect transistor applications.

    PubMed

    Atahan-Evrenk, Sule; Aspuru-Guzik, Alán

    2014-01-01

    The theoretical prediction and characterization of the solid-state structure of organic semiconductors has tremendous potential for the discovery of new high performance materials. To date, the theoretical analysis mostly relied on the availability of crystal structures obtained through X-ray diffraction. However, the theoretical prediction of the crystal structures of organic semiconductor molecules remains a challenge. This review highlights some of the recent advances in the determination of structure-property relationships of the known organic semiconductor single-crystals and summarizes a few available studies on the prediction of the crystal structures of p-type organic semiconductors for transistor applications.

  2. Improved ferroelectric and pyroelectric parameters in iminodiacetic acid doped TGS crystal

    NASA Astrophysics Data System (ADS)

    Rai, Chitharanjan; Sreenivas, K.; Dharmaprakash, S. M.

    2010-01-01

    Single crystals of Iminodiacetic acid (HN(CH 2COOH) 2) doped Triglycine sulphate (IDATGS) has been grown from aqueous solution at constant temperature by slow evaporation technique. The concentration of the dopant in the TGS solution was 2 mol%. The X-ray diffraction analysis indicates that there is significant change in the lattice parameters compared to pure TGS crystal. The IDATGS crystal has larger transition temperature and observed higher and uniform figure of merit over most part of the ferroelectric phase. These crystals also exhibit higher internal bias field and micro-hardness number compared to pure TGS. Therefore IDATGS may be a potential material for IR detectors.

  3. Crystallization of Spätzle, a cystine-knot protein involved in embryonic development and innate immunity in Drosophila melanogaster

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hoffmann, Anita; Neumann, Piotr; Schierhorn, Angelika

    2008-08-01

    Crystallization of the cystine-knot protein Spätzle occurred following serendipitous limited degradation of the pro-Spätzle propeptide during the crystallization experiment. The Spätzle protein is involved in both the definition of the dorsal–ventral axis during embryonic development and in the adult innate immune response. The disulfide-linked dimeric cystine-knot protein has been expressed as a proprotein in inclusion bodies in Escherichia coli and refolded in vitro by rapid dilution. Initial orthorhombic crystals that diffracted to 7 Å resolution were obtained after three months by the sitting-drop vapour-diffusion method. Optimization of the crystallization conditions resulted in orthorhombic crystals (space group P2{sub 1}2{sub 1}2{sub 1},more » with unit-cell parameters a = 53.0, b = 59.2, c = 62.5 Å) that diffracted to 2.8 Å resolution in-house. The small volume of the asymmetric unit indicated that it was not possible for the crystals to contain the complete pro-Spätzle dimer. Mass spectrometry, N-terminal sequencing and Western-blot analysis revealed that the crystals contained the C-terminal disulfide-linked cystine-knot dimer. Comparison of various crystallization experiments indicated that degradation of the N-terminal prodomain was dependent on the buffer conditions.« less

  4. Crystalline structures, thermal properties and crystallizing mechanism of polyamide 6 nanotubes in confined space

    NASA Astrophysics Data System (ADS)

    Li, Xiaoru; Peng, Zhi; Yang, Chao; Han, Ping; Song, Guojun; Cong, Longliang

    2016-09-01

    The polyamide 6 (PA6) nanotubes were prepared by infiltrating the anodic aluminum oxide templates with polymer solution. Crystalline regions in the nanotube walls were detected by high-resolution transmission electron microscopy (HRTEM). X-ray diffraction (XRD), Fast Fourier Transform (FFT) and differential scanning calorimetry (DSC) techniques were employed to investigate crystallization, crystal faces and thermodynamics. It was found that the crystals were transformed from α-form in bulk to γ-form in nanotubes. It was made a detailed analysis in this article. Moreover, schematic diagram for the crystallizing mechanism of PA6 nanotubes was given to explain PA6 molecules how to crystallize in the nano-pores.

  5. Purification, isolation, crystallization, and preliminary X-ray diffraction study of the BTB domain of the centrosomal protein 190 from Drosophila melanogaster

    NASA Astrophysics Data System (ADS)

    Boyko, K. M.; Nikolaeva, A. Yu.; Kachalova, G. S.; Bonchuk, A. N.; Popov, V. O.

    2017-11-01

    The spatial organization of the genome is controlled by a special class of architectural proteins, including proteins containing BTB domains that are able to dimerize or multimerize. The centrosomal protein 190 is one of such architectural proteins. The purification, crystallization, and preliminary X-ray diffraction study of the BTB domain of the centrosomal protein 190 are reported. The crystallization conditions were found by the vapor-diffusion technique. The crystals diffracted to 1.5 Å resolution and belonged to sp. gr. P3221. The structure was solved by the molecular replacement method. The structure refinement is currently underway.

  6. In cellulo serial crystallography of alcohol oxidase crystals inside yeast cells

    DOE PAGES

    Jakobi, Arjen J.; Passon, Daniel M.; Knoops, Kevin; ...

    2016-03-01

    The possibility of using femtosecond pulses from an X-ray free-electron laser to collect diffraction data from protein crystals formed in their native cellular organelle has been explored. X-ray diffraction of submicrometre-sized alcohol oxidase crystals formed in peroxisomes within cells of genetically modified variants of the methylotrophic yeast Hansenula polymorpha is reported and characterized. Furthermore, the observations are supported by synchrotron radiation-based powder diffraction data and electron microscopy. Based on these findings, the concept of in cellulo serial crystallography on protein targets imported into yeast peroxisomes without the need for protein purification as a requirement for subsequent crystallization is outlined.

  7. In cellulo serial crystallography of alcohol oxidase crystals inside yeast cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jakobi, Arjen J.; Passon, Daniel M.; Knoops, Kevin

    The possibility of using femtosecond pulses from an X-ray free-electron laser to collect diffraction data from protein crystals formed in their native cellular organelle has been explored. X-ray diffraction of submicrometre-sized alcohol oxidase crystals formed in peroxisomes within cells of genetically modified variants of the methylotrophic yeast Hansenula polymorpha is reported and characterized. Furthermore, the observations are supported by synchrotron radiation-based powder diffraction data and electron microscopy. Based on these findings, the concept of in cellulo serial crystallography on protein targets imported into yeast peroxisomes without the need for protein purification as a requirement for subsequent crystallization is outlined.

  8. In cellulo serial crystallography of alcohol oxidase crystals inside yeast cells

    PubMed Central

    Jakobi, Arjen J.; Passon, Daniel M.; Knoops, Kèvin; Stellato, Francesco; Liang, Mengning; White, Thomas A.; Seine, Thomas; Messerschmidt, Marc; Chapman, Henry N.; Wilmanns, Matthias

    2016-01-01

    The possibility of using femtosecond pulses from an X-ray free-electron laser to collect diffraction data from protein crystals formed in their native cellular organelle has been explored. X-ray diffraction of submicrometre-sized alcohol oxidase crystals formed in peroxisomes within cells of genetically modified variants of the methylotrophic yeast Hansenula polymorpha is reported and characterized. The observations are supported by synchrotron radiation-based powder diffraction data and electron microscopy. Based on these findings, the concept of in cellulo serial crystallography on protein targets imported into yeast peroxisomes without the need for protein purification as a requirement for subsequent crystallization is outlined. PMID:27006771

  9. [Does carbonate originate from carbonate-calcium crystal component of the human urinary calculus?].

    PubMed

    Yuzawa, Masayuki; Nakano, Kazuhiko; Kumamaru, Takatoshi; Nukui, Akinori; Ikeda, Hitoshi; Suzuki, Kazumi; Kobayashi, Minoru; Sugaya, Yasuhiro; Morita, Tatsuo

    2008-09-01

    It gives important information in selecting the appropriate treatment for urolithiasis to confirm the component of urinary calculus. Presently component analysis of the urinary calculus is generally performed by infrared spectroscopy which is employed by companies providing laboratory testing services in Japan. The infrared spectroscopy determines the molecular components from the absorption spectra in consequence of atomic vibrations. It has the drawback that an accurate crystal structure cannot be analyzed compared with the X-ray diffraction method which analyzes the crystal constituent based on the diffraction of X-rays on crystal lattice. The components of the urinary calculus including carbonate are carbonate apatite and calcium carbonate such as calcite. Although the latter is reported to be very rare component in human urinary calculus, the results by infrared spectroscopy often show that calcium carbonate is included in calculus. The infrared spectroscopy can confirm the existence of carbonate but cannot determine whether carbonate is originated from carbonate apatite or calcium carbonate. Thus, it is not clear whether calcium carbonate is included in human urinary calculus component in Japan. In this study, we examined human urinary calculus including carbonate by use of X-ray structural analysis in order to elucidate the origin of carbonate in human urinary calculus. We examined 17 human calculi which were reported to contain calcium carbonate by infrared spectroscopy performed in the clinical laboratory. Fifteen calculi were obtained from urinary tract, and two were from gall bladder. The stones were analyzed by X-ray powder method after crushed finely. The reports from the clinical laboratory showed that all urinary culculi consisted of calcium carbonate and calcium phosphate, while the gallstones consisted of calcium carbonate. But the components of all urinary calculi were revealed to be carbonate apatite by X-ray diffraction. The components of gallstones were shown to be calcium carbonate (one calcite and the other aragonite) not only by infrared spectroscopy but by X-ray diffraction. It was shown that component analysis of the calculus could be more accurately performed by adding X-ray diffraction method to infrared spectroscopy. It was shown that calcium carbonate existed in a gallstone. As for the carbonate in human urinary calculi, present study showed that it was not calcium carbonate origin but carbonate apatite origin.

  10. Connecting heterogeneous single slip to diffraction peak evolution in high-energy monochromatic X-ray experiments

    PubMed Central

    Pagan, Darren C.; Miller, Matthew P.

    2014-01-01

    A forward modeling diffraction framework is introduced and employed to identify slip system activity in high-energy diffraction microscopy (HEDM) experiments. In the framework, diffraction simulations are conducted on virtual mosaic crystals with orientation gradients consistent with Nye’s model of heterogeneous single slip. Simulated diffraction peaks are then compared against experimental measurements to identify slip system activity. Simulation results compared against diffraction data measured in situ from a silicon single-crystal specimen plastically deformed under single-slip conditions indicate that slip system activity can be identified during HEDM experiments. PMID:24904242

  11. Room-temperature serial crystallography using a kinetically optimized microfluidic device for protein crystallization and on-chip X-ray diffraction

    PubMed Central

    Heymann, Michael; Opthalage, Achini; Wierman, Jennifer L.; Akella, Sathish; Szebenyi, Doletha M. E.; Gruner, Sol M.; Fraden, Seth

    2014-01-01

    An emulsion-based serial crystallographic technology has been developed, in which nanolitre-sized droplets of protein solution are encapsulated in oil and stabilized by surfactant. Once the first crystal in a drop is nucleated, the small volume generates a negative feedback mechanism that lowers the supersaturation. This mechanism is exploited to produce one crystal per drop. Diffraction data are measured, one crystal at a time, from a series of room-temperature crystals stored on an X-ray semi-transparent microfluidic chip, and a 93% complete data set is obtained by merging single diffraction frames taken from different unoriented crystals. As proof of concept, the structure of glucose isomerase was solved to 2.1 Å, demonstrating the feasibility of high-throughput serial X-ray crystallography using synchrotron radiation. PMID:25295176

  12. The Third Ambient Aspirin Polymorph

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shtukenberg, Alexander G.; Hu, Chunhua T.; Zhu, Qiang

    Polymorphism in aspirin (acetylsalicylic acid), one of the most widely consumed medications, was equivocal until the structure of a second polymorph II, similar in structure to the original form I, was reported in 2005. Here, the third ambient polymorph of aspirin is described. Lastly, it was crystallized from the melt and its structure was determined using a combination of X-ray powder diffraction analysis and crystal structure prediction algorithms.

  13. The Third Ambient Aspirin Polymorph

    DOE PAGES

    Shtukenberg, Alexander G.; Hu, Chunhua T.; Zhu, Qiang; ...

    2017-05-17

    Polymorphism in aspirin (acetylsalicylic acid), one of the most widely consumed medications, was equivocal until the structure of a second polymorph II, similar in structure to the original form I, was reported in 2005. Here, the third ambient polymorph of aspirin is described. Lastly, it was crystallized from the melt and its structure was determined using a combination of X-ray powder diffraction analysis and crystal structure prediction algorithms.

  14. Impact of Heterogeneity and Lattice Bond Strength on DNA Triangle Crystal Growth.

    PubMed

    Stahl, Evi; Praetorius, Florian; de Oliveira Mann, Carina C; Hopfner, Karl-Peter; Dietz, Hendrik

    2016-09-07

    One key goal of DNA nanotechnology is the bottom-up construction of macroscopic crystalline materials. Beyond applications in fields such as photonics or plasmonics, DNA-based crystal matrices could possibly facilitate the diffraction-based structural analysis of guest molecules. Seeman and co-workers reported in 2009 the first designed crystal matrices based on a 38 kDa DNA triangle that was composed of seven chains. The crystal lattice was stabilized, unprecedentedly, by Watson-Crick base pairing. However, 3D crystallization of larger designed DNA objects that include more chains such as DNA origami remains an unsolved problem. Larger objects would offer more degrees of freedom and design options with respect to tailoring lattice geometry and for positioning other objects within a crystal lattice. The greater rigidity of multilayer DNA origami could also positively influence the diffractive properties of crystals composed of such particles. Here, we rationally explore the role of heterogeneity and Watson-Crick interaction strengths in crystal growth using 40 variants of the original DNA triangle as model multichain objects. Crystal growth of the triangle was remarkably robust despite massive chemical, geometrical, and thermodynamical sample heterogeneity that we introduced, but the crystal growth sensitively depended on the sequences of base pairs next to the Watson-Crick sticky ends of the triangle. Our results point to weak lattice interactions and high concentrations as decisive factors for achieving productive crystallization, while sample heterogeneity and impurities played a minor role.

  15. Diffractive-refractive optics: (+,-,-,+) X-ray crystal monochromator with harmonics separation.

    PubMed

    Hrdý, Jaromír; Mikulík, Petr; Oberta, Peter

    2011-03-01

    A new kind of two channel-cut crystals X-ray monochromator in dispersive (+,-,-,+) position which spatially separates harmonics is proposed. The diffracting surfaces are oriented so that the diffraction is inclined. Owing to refraction the diffracted beam is sagittally deviated. The deviation depends on wavelength and is much higher for the first harmonics than for higher harmonics. This leads to spatial harmonics separation. The idea is supported by ray-tracing simulation.

  16. Crystallization and preliminary X-ray diffraction studies of the ferredoxin reductase component in the Rieske nonhaem iron oxygenase system carbazole 1,9a-dioxygenase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ashikawa, Yuji; Uchimura, Hiromasa; Fujimoto, Zui

    2007-06-01

    The NAD(P)H:ferredoxin oxidoreductase in carbazole 1,9a-dioxygenase from Janthinobacterium sp. J3 was crystallized and diffraction data were collected to 2.60 Å resolution. Carbazole 1,9a-dioxygenase (CARDO), which consists of an oxygenase component (CARDO-O) and the electron-transport components ferredoxin (CARDO-F) and ferredoxin reductase (CARDO-R), catalyzes dihydroxylation at the C1 and C9a positions of carbazole. CARDO-R was crystallized at 277 K using the hanging-drop vapour-diffusion method with the precipitant PEG 8000. Two crystal types (types I and II) were obtained. The type I crystal diffracted to a maximum resolution of 2.80 Å and belonged to space group P4{sub 2}2{sub 1}2, with unit-cell parameters amore » = b = 158.7, c = 81.4 Å. The type II crystal was obtained in drops from which type I crystals had been removed; it diffracted to 2.60 Å resolution and belonged to the same space group, with unit-cell parameters a = b = 161.8, c = 79.5 Å.« less

  17. Protein preparation and preliminary X-ray crystallographic analysis of a putative glucosamine 6-phosphate deaminase from Streptococcus mutants

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hu, Guan-Jing; Li, Lan-Fen; Li, Dan

    2007-09-01

    A glucosamine 6-phosphate deaminase homologue from S. mutans was expressed, purified and crystallized. Diffraction data have been collected to 2.4 Å resolution. The SMU.636 protein from Streptococcus mutans is a putative glucosamine 6-phosphate deaminase with 233 residues. The smu.636 gene was PCR-amplified from S. mutans genomic DNA and cloned into the expression vector pET-28a(+). The resultant His-tagged fusion protein was expressed in Escherichia coli and purified to homogeneity in two steps. Crystals of the fusion protein were obtained by the hanging-drop vapour-diffusion method. The crystals diffracted to 2.4 Å resolution and belong to space group P2{sub 1}2{sub 1}2{sub 1}, withmore » unit-cell parameters a = 53.83, b = 82.13, c = 134.70 Å.« less

  18. X-ray diffraction analysis of LiCu{sub 2}O{sub 2} crystals with additives of silver atoms

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sirotinkin, V. P., E-mail: irotinkin.vladimir@mail.ru; Bush, A. A.; Kamentsev, K. E.

    2015-09-15

    Silver-containing LiCu{sub 2}O{sub 2} crystals up to 4 × 8 × 8 mm in size were grown by the crystallization of 80(1-x)CuO · 20{sub x}AgNO{sub 3} · 20Li{sub 2}CO{sub 3} (0 ≤ x ≤ 0.5) mixture melt. According to the X-ray spectral and Rietveld X-ray diffraction data, the maximum amount of silver incorporated in the LiCu{sub 2}O{sub 2} structure is about 4 at % relative to the copper content. It was established that silver atoms occupy statistically crystallographic positions of lithium atoms. The incorporation of silver atoms is accompanied by a noticeable increase in parameter c of the LiCu{sub 2}O{submore » 2} rhombic unit cell, a slight increase in parameter a, and a slight decrease in parameter b.« less

  19. Crystallization and preliminary X-ray diffraction analysis of the P3 RNA domain of yeast ribonuclease MRP in a complex with RNase P/MRP protein components Pop6 and Pop7.

    PubMed

    Perederina, Anna; Esakova, Olga; Quan, Chao; Khanova, Elena; Krasilnikov, Andrey S

    2010-01-01

    Eukaryotic ribonucleases P and MRP are closely related RNA-based enzymes which contain a catalytic RNA component and several protein subunits. The roles of the protein subunits in the structure and function of eukaryotic ribonucleases P and MRP are not clear. Crystals of a complex that included a circularly permuted 46-nucleotide-long P3 domain of the RNA component of Saccharomyces cerevisiae ribonuclease MRP and selenomethionine derivatives of the shared ribonuclease P/MRP protein components Pop6 (18.2 kDa) and Pop7 (15.8 kDa) were obtained using the sitting-drop vapour-diffusion method. The crystals belonged to space group P4(2)22 (unit-cell parameters a = b = 127.2, c = 76.8 A, alpha = beta = gamma = 90 degrees ) and diffracted to 3.25 A resolution.

  20. Crystallization and preliminary X-ray data analysis of β-alanine synthase from Drosophila melanogaster

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lundgren, Stina; Andersen, Birgit; Piškur, Jure

    2007-10-01

    β-Alanine synthase catalyzes the last step in the reductive degradation pathway for uracil and thymine. Crystals of the recombinant enzyme from D. melanogaster belong to space group C2. Diffraction data to 3.3 Å resolution were collected and analyzed. β-Alanine synthase catalyzes the last step in the reductive degradation pathway for uracil and thymine, which represents the main clearance route for the widely used anticancer drug 5-fluorouracil. Crystals of the recombinant enzyme from Drosophila melanogaster, which is closely related to the human enzyme, were obtained by the hanging-drop vapour-diffusion method. They diffracted to 3.3 Å at a synchrotron-radiation source, belong tomore » space group C2 (unit-cell parameters a = 278.9, b = 95.0, c = 199.3 Å, β = 125.8°) and contain 8–10 molecules per asymmetric unit.« less

  1. Purification, crystallization and preliminary X-ray diffraction analysis of the carbohydrate-binding region of the Streptococcus gordonii adhesin GspB

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pyburn, Tasia M.; Yankovskaya, Victoria; Bensing, Barbara A.

    2012-07-11

    The carbohydrate-binding region of the bacterial adhesin GspB from Streptococcus gordonii strain M99 (GspB{sub BR}) was expressed in Escherichia coli and purified using affinity and size-exclusion chromatography. Separate sparse-matrix screening of GspB{sub BR} buffered in either 20 mM Tris pH 7.4 or 20 mM HEPES pH 7.5 resulted in different crystallographic behavior such that different precipitants, salts and additives supported crystallization of GspB{sub BR} in each buffer. While both sets of conditions supported crystal growth in space group P2{sub 1}2{sub 1}2{sub 1}, the crystals had distinct unit-cell parameters of a = 33.3, b = 86.7, c = 117.9 {angstrom} formore » crystal form 1 and a = 34.6, b = 98.3, c = 99.0 {angstrom} for crystal form 2. Additive screening improved the crystals grown in both conditions such that diffraction extended to beyond 2 {angstrom} resolution. A complete data set has been collected to 1.3 {angstrom} resolution with an overall R{sub merge} value of 0.04 and an R{sub merge} value of 0.33 in the highest resolution shell.« less

  2. Neutron and X-ray single-crystal diffraction from protein microcrystals via magnetically oriented microcrystal arrays in gels.

    PubMed

    Tsukui, Shu; Kimura, Fumiko; Kusaka, Katsuhiro; Baba, Seiki; Mizuno, Nobuhiro; Kimura, Tsunehisa

    2016-07-01

    Protein microcrystals magnetically aligned in D2O hydrogels were subjected to neutron diffraction measurements, and reflections were observed for the first time to a resolution of 3.4 Å from lysozyme microcrystals (∼10 × 10 × 50 µm). This result demonstrated the possibility that magnetically oriented microcrystals consolidated in D2O gels may provide a promising means to obtain single-crystal neutron diffraction from proteins that do not crystallize at the sizes required for neutron diffraction structure determination. In addition, lysozyme microcrystals aligned in H2O hydrogels allowed structure determination at a resolution of 1.76 Å at room temperature by X-ray diffraction. The use of gels has advantages since the microcrystals are measured under hydrated conditions.

  3. Crystallization and preliminary X-ray crystallographic analysis of strictosidine synthase from Rauvolfia: the first member of a novel enzyme family.

    PubMed

    Ma, Xueyan; Koepke, Juergen; Fritzsch, Günter; Diem, Ralf; Kutchan, Toni M; Michel, Hartmut; Stöckigt, Joachim

    2004-10-01

    Strictosidine synthase is a central enzyme involved in the biosynthesis of almost all plant monoterpenoid indole alkaloids. Strictosidine synthase from Rauvolfia serpentina was heterologously expressed in Escherichia coli. Crystals of the purified recombinant enzyme have been obtained by the hanging-drop technique at 303 K with potassium sodium tartrate tetrahydrate as precipitant. The crystals belong to the space group R3 with cell dimensions of a=b=150.3 A and c=122.4 A. Under cryoconditions (120 K), the crystals diffract to about 2.95 A.

  4. Teaching Crystallography to Noncrystallographers.

    ERIC Educational Resources Information Center

    Glusker, Jenny P.

    1988-01-01

    Addresses the requirements of high school students and noncrystallographers in lectures on crystals, diffraction, and structure analysis. Discusses basic understanding and a sequence that addresses these requirements. Suggests visual and descriptive teaching methods used in this effort. (CW)

  5. Synthesis, crystal growth, structural, thermal and optical properties of naphthalene picrate an organic NLO material.

    PubMed

    Chandramohan, A; Bharathikannan, R; Kandavelu, V; Chandrasekaran, J; Kandhaswamy, M A

    2008-12-01

    Crystalline substance of naphthalene picrate (NP) was synthesized and single crystals were grown using slow evaporation solution growth technique. The solubility of the naphthalene picrate complex was estimated using different solvents such as chloroform and benzene. The material was characterized by elemental analysis, powder X-ray diffraction (XRD), nuclear magnetic resonance (NMR) and fourier transform-infrared (FT-IR) techniques. The electronic absorption was studied through UV-vis spectrophotometer. Thermal behavior and stability of the crystal were studied using thermogravimetric (TG) and differential thermal analysis (DTA) techniques. The second harmonic generation (SHG) of the material was confirmed using Nd:YAG laser.

  6. Investigating the Effect of Impurities on Macromolecule Crystal Growth in Microgravity

    NASA Technical Reports Server (NTRS)

    Snell, Edward H.; Judge, Russell A.; Crawford, Lisa; Forsythe, Elizabeth L.; Pusey, Marc L.; Sportiello, Michael; Todd, Paul; Bellamy, Henry; Lovelace, Jeff; Cassanto, John M.; hide

    2001-01-01

    Chicken egg-white lysozyme (CEWL) crystals were grown in microgravity and on the ground in the presence of various amounts of a naturally occurring lysozyme dimer impurity. No significant favorable differences in impurity incorporation between microgravity and ground crystal samples were observed. At low impurity concentration the microgravity crystals preferentially incorporated the dimer. The presence of the dimer in the crystallization solutions in microgravity reduced crystal size, increased mosaicity and reduced the signal to noise ratio of the X-ray data. Microgravity samples proved more sensitive to impurity. Accurate indexing of the reflections proved critical to the X-ray analysis. The largest crystals with the best X-ray diffraction properties were grown from pure solution in microgravity.

  7. Analysis of Short and Long Range Atomic Order in Nanocrystalline Diamonds with Application of Powder Diffractometry

    NASA Technical Reports Server (NTRS)

    Palosz, B.; Grzanka, E.; Stelmakh, S.; Pielaszek, R.; Bismayer, U.; Neuefiend, J.; Weber, H.-P.; Proffen, T.; VonDreele, R.; Palosz, W.; hide

    2002-01-01

    Fundamental limitations, with respect to nanocrystalline materials, of the traditional elaboration of powder diffraction data like the Rietveld method are discussed. A tentative method of the analysis of powder diffraction patterns of nanocrystals is introduced which is based on the examination of the variation of lattice parameters calculated from individual Bragg lines (named the "apparent lattice parameter", alp). We examine the application of our methodology using theoretical diffraction patterns computed for models of nanocrystals with a perfect crystal lattice and for grains with a two-phase, core-shell structure. We use the method for the analysis of X-ray and neutron experimental diffraction data of nanocrystalline diamond powders of 4, 6 and 12 nm in diameter. The effects of an internal pressure and strain at the grain surface is discussed. This is based on the dependence of the alp values oil the diffraction vector Q and on the PDF analysis. It is shown, that the experimental results support well the concept of the two-phase structure of nanocrystalline diamond.

  8. Three-dimensional reconstruction of the size and shape of protein microcrystals using Bragg coherent diffractive imaging

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Coughlan, H. D.; Darmanin, C.; Kirkwood, H. J.

    2016-03-14

    Three-dimensional imaging of protein crystals during X-ray diffraction experiments opens up a range of possibilities for optimising crystal quality and gaining new insights into the fundamental processes that drive radiation damage. Obtaining this information at the appropriate lengthscales however is extremely challenging. One approach that has been recently demonstrated as a promising avenue for charactering the size and shape of protein crystals at nanometre lengthscales is Bragg Coherent Diffractive Imaging (BCDI). BCDI is a recently developed technique that is able to recover the phase of the continuous diffraction intensity signal around individual Bragg peaks. When data is collected at multiplemore » points on a rocking curve a Reciprocal Space Map (RSM) can be assembled and then inverted using BCDI to obtain a three-dimensional image of the crystal. The first demonstration of two-dimensional BCDI of protein crystals was reported by Boutet at al., recently this work was extended to the study of radiation damage of micron-sized crystals. Here we present the first three-dimensional reconstructions of a Lysozyme protein crystal using BDI. The results are validated against RSM and TEM data and have implications for both radiation damage studies and for developing new approaches to structure retrieval from micron-sized protein crystals.« less

  9. Crystal growth, structural, optical, thermal, mechanical, laser damage threshold and electrical properties of triphenylphosphine oxide 4-nitrophenol (TP4N) single crystals for nonlinear optical applications

    NASA Astrophysics Data System (ADS)

    Karuppasamy, P.; Senthil Pandian, Muthu; Ramasamy, P.; Verma, Sunil

    2018-05-01

    The optically good quality single crystals of triphenylphosphine oxide 4-nitrophenol (TP4N) with maximum dimension of 15 × 10 × 5 mm3 were grown by slow evaporation solution technique (SEST) at room temperature. The cell dimensions of the grown TP4N crystal were confirmed by single crystal X-ray diffraction (SXRD) and the crystalline purity was confirmed and planes were indexed by powder X-ray diffraction (PXRD) analysis. Functional groups of TP4N crystal were confirmed by Fourier transform infrared (FTIR) spectral analysis. The optical transmittance of the grown crystal was determined by the UV-Vis NIR spectral analysis and it has good optical transparency in the entire visible region. The band tail (Urbach) energy of the grown crystal was analyzed and it appears to be minimum, which indicates that the TP4N has good crystallinity. The position of valence band (Ev) and conduction band (Ec) of the TP4N have been determined from the electron affinity energy (EA) and the ionization energy (EI) of its elements and using the optical band gap. The thermal behaviour of the grown crystal was investigated by thermogravimetric and differential thermal analysis (TG-DTA). Vickers microhardness analysis was carried out to identify the mechanical stability of the grown crystal and their indentation size effect (ISE) was explained by the Meyer's law (ML), Hays-Kendall's (HK) approach, proportional specimen resistance (PSR) model, modified PSR model (MPSR), elastic/plastic deformation (EPD) model and indentation induced cracking (IIC) model. Chemical etching study was carried out to find the etch pit density (EPD) of the grown crystal. Laser damage threshold (LDT) value was measured by using Nd:YAG laser (1064 nm). The dielectric permittivity (ε՛) and dielectric loss (tan δ) as a function of frequency was measured. The electronic polarizability (α) of the TP4N crystal was calculated. It is well matched to the value which was calculated from Clausius-Mossotti relation, Lorentz-Lorentz equation, optical band gap and coupled dipole method (CDM). The Z-scan technique was carried out using solid state laser (640 nm) to analyze the nonlinear optical properties of the TP4N crystal. It exhibits the self-defocusing and saturable absorbance effect during analysis of closed and open aperture respectively. The nonlinear optical parameters such as refractive index (n2), absorption coefficient (β) and the third order nonlinear optical susceptibility (χ(3)) were analyzed.

  10. Crystallization of the C-terminal domain of the addiction antidote CcdA in complex with its toxin CcdB

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Buts, Lieven; De Jonge, Natalie; Loris, Remy, E-mail: reloris@vub.ac.be

    2005-10-01

    The CcdA C-terminal domain was crystallized in complex with CcdB in two crystal forms that diffract to beyond 2.0 Å resolution. CcdA and CcdB are the antidote and toxin of the ccd addiction module of Escherichia coli plasmid F. The CcdA C-terminal domain (CcdA{sub C36}; 36 amino acids) was crystallized in complex with CcdB (dimer of 2 × 101 amino acids) in three different crystal forms, two of which diffract to high resolution. Form II belongs to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 37.6, b = 60.5, c = 83.8 Å and diffracts to 1.8more » Å resolution. Form III belongs to space group P2{sub 1}, with unit-cell parameters a = 41.0, b = 37.9, c = 69.6 Å, β = 96.9°, and diffracts to 1.9 Å resolution.« less

  11. Spectroscopic characterization of zinc oxide nanorods synthesized by solid-state reaction

    NASA Astrophysics Data System (ADS)

    Prasad, Virendra; D'Souza, Charlene; Yadav, Deepti; Shaikh, A. J.; Vigneshwaran, Nadanathangam

    2006-09-01

    Well-crystallized zinc oxide nanorods have been fabricated by single step solid-state reaction using zinc acetate and sodium hydroxide, at room temperature. The sodium lauryl sulfate (SLS) stabilized zinc oxide nanorods were characterized by using X-ray diffraction, Fourier transform infrared spectroscopy, transmission electron microscopy and photoluminescence spectroscopy. The X-ray diffraction revealed the wurtzite structure of zinc oxide. The size estimation by XRD and TEM confirmed that the ZnO nanorods are made of single crystals. The growth of zinc oxide crystals into rod shape was found to be closely related to its hexagonal nature. The mass ratio of SLS:ZnO in the nanorods was found to be 1:10 based on the thermogravimetric analysis. Blue shift of photoluminescence emission was noticed in the ZnO nanorods when compared to that of ZnO bulk. FT-IR analysis confirmed the binding of SLS with ZnO nanorods. Apart from ease of preparation, this method has the advantage of eco-friendliness since the solvent and other harmful chemicals were eliminated in the synthesis protocol.

  12. Precession technique and electron diffractometry as new tools for crystal structure analysis and chemical bonding determination.

    PubMed

    Avilov, A; Kuligin, K; Nicolopoulos, S; Nickolskiy, M; Boulahya, K; Portillo, J; Lepeshov, G; Sobolev, B; Collette, J P; Martin, N; Robins, A C; Fischione, P

    2007-01-01

    We have developed a new fast electron diffractometer working with high dynamic range and linearity for crystal structure determinations. Electron diffraction (ED) patterns can be scanned serially in front of a Faraday cage detector; the total measurement time for several hundred ED reflections can be tens of seconds having high statistical accuracy for all measured intensities (1-2%). This new tool can be installed to any type of TEM without any column modification and is linked to a specially developed electron beam precession "Spinning Star" system. Precession of the electron beam (Vincent-Midgley technique) reduces dynamical effects allowing also use of accurate intensities for crystal structure analysis. We describe the technical characteristics of this new tool together with the first experimental results. Accurate measurement of electron diffraction intensities by electron diffractometer opens new possibilities not only for revealing unknown structures, but also for electrostatic potential determination and chemical bonding investigation. As an example, we present detailed atomic bonding information of CaF(2) as revealed for the first time by precise electron diffractometry.

  13. Graphene-based microfluidics for serial crystallography.

    PubMed

    Sui, Shuo; Wang, Yuxi; Kolewe, Kristopher W; Srajer, Vukica; Henning, Robert; Schiffman, Jessica D; Dimitrakopoulos, Christos; Perry, Sarah L

    2016-08-02

    Microfluidic strategies to enable the growth and subsequent serial crystallographic analysis of micro-crystals have the potential to facilitate both structural characterization and dynamic structural studies of protein targets that have been resistant to single-crystal strategies. However, adapting microfluidic crystallization platforms for micro-crystallography requires a dramatic decrease in the overall device thickness. We report a robust strategy for the straightforward incorporation of single-layer graphene into ultra-thin microfluidic devices. This architecture allows for a total material thickness of only ∼1 μm, facilitating on-chip X-ray diffraction analysis while creating a sample environment that is stable against significant water loss over several weeks. We demonstrate excellent signal-to-noise in our X-ray diffraction measurements using a 1.5 μs polychromatic X-ray exposure, and validate our approach via on-chip structure determination using hen egg white lysozyme (HEWL) as a model system. Although this work is focused on the use of graphene for protein crystallography, we anticipate that this technology should find utility in a wide range of both X-ray and other lab on a chip applications.

  14. Monte Carlo analysis of neutron diffuse scattering data

    NASA Astrophysics Data System (ADS)

    Goossens, D. J.; Heerdegen, A. P.; Welberry, T. R.; Gutmann, M. J.

    2006-11-01

    This paper presents a discussion of a technique developed for the analysis of neutron diffuse scattering data. The technique involves processing the data into reciprocal space sections and modelling the diffuse scattering in these sections. A Monte Carlo modelling approach is used in which the crystal energy is a function of interatomic distances between molecules and torsional rotations within molecules. The parameters of the model are the spring constants governing the interactions, as they determine the correlations which evolve when the model crystal structure is relaxed at finite temperature. When the model crystal has reached equilibrium its diffraction pattern is calculated and a χ2 goodness-of-fit test between observed and calculated data slices is performed. This allows a least-squares refinement of the fit parameters and so automated refinement can proceed. The first application of this methodology to neutron, rather than X-ray, data is outlined. The sample studied was deuterated benzil, d-benzil, C14D10O2, for which data was collected using time-of-flight Laue diffraction on SXD at ISIS.

  15. High-level expression and deuteration of sperm whale myoglobin: A study of its solvent structure by X-ray and neutron diffraction methods

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shu, F.; Ramakrishnan, V.; Schoenborn, B.P.

    1994-12-31

    Neutron diffraction has become one of the best ways to study light atoms, such as hydrogens. Hydrogen however has a negative coherent scattering factor, and a large incoherent scattering factor, while deuterium has virtually no incoherent scattering, but a large positive coherent scattering factor. Beside causing high background due to its incoherent scattering, the negative coherent scattering of hydrogen tends to cancel out the positive contribution from other atoms in a neutron density map. Therefore a fully deuterated sample will yield better diffraction data with stronger density in the hydrogen position. On this basis, a sperm whale myoglobin gene modifiedmore » to include part of the A cII protein gene has been cloned into the T7 expression system. Milligram amounts of fully deuterated holo-myoglobin have been obtained and used for crystallization. The synthetic sperm whale myoglobin crystallized in P2{sub 1} space group isomorphous with the native protein crystal. A complete X-ray diffraction dataset at 1.5{Angstrom} has been collected. This X-ray dataset, and a neutron data set collected previously on a protonated carbon-monoxymyoglobin crystal have been used for solvent structure studies. Both X-ray and neutron data have shown that there are ordered hydration layers around the protein surface. Solvent shell analysis on the neutron data further has shown that the first hydration layer behaves differently around polar and apolar regions of the protein surface. Finally, the structure of per-deuterated myoglobin has been refined using all reflections to a R factor of 17%.« less

  16. Structural, chemical and physical properties of pure and La3+ doped L-Threonine acetate crystals

    NASA Astrophysics Data System (ADS)

    Senthamizhan, A.; Sambathkumar, K.; Nithiyanantham, S.; Venkatachalapathy, M.; Rajkamal, N.

    2017-12-01

    The pure and La3+ doped L- Threonine crystals can be grown by slow evaporation techniques. The crystal structure were examined through X-Ray diffraction (XRD) analysis, confirmed the P212121 system. The quantitative nature of dopant can be analyzed with Inductively Coupled Plasma (ICP) study. The Fourier Transform Infra-Red (FTIR) and Fourier Transform (FT- Raman) investigations yields the possible stretching/bonding with their functional groups and the qualitative/quantitative nature of both crystals is analyzed. The optical behavior of crystals can be studied through Ultra Violet (UV) - Visible spectrometer. The mechanical, thermal and decomposition studies can be carried out through Vickers hardness test, Thermo Gravometric Analysis (TGA) and Differential Thermal Analysis (DTA). The Non Linear Optical (NLO) properties are found more than Potassium Phosphate (KDP) through Kurtz powders technique. The dielectric and optical absorption studies for both pure and L-doped crystals were studied and interpreted all the properties. The La3+ dopant increases the properties are investigated.

  17. Synthesis and structure identification of 2-amino-4, 6- dimethyl pyrimidine with gallic acid and pimelic acid

    NASA Astrophysics Data System (ADS)

    Mekala, R.; Jagdish, P.; Mathammal, R.

    2018-07-01

    Reaction of 2-amino-4, 6- dimethyl pyrimidine with carboxylic acid such as gallic acid and pimelic acid, yielded a salt and co-crystal, respectively. The new crystal forms were obtained from slow evaporation technique. The crystal structure and hydrogen bond interaction of the two crystals were determined by single X-ray diffraction analysis. Inter molecular interactions of the compounds were investigated using the 3D Hirshfeld surfaces and the associated 2D fingerprint plots. The functional groups were identified by the FTIR, FT-Raman spectral studies. The presence of carbon and hydrogen in the two samples were identified by the 1H and 13C NMR analysis. The excited energy was observed using UV-Visible spectral analysis. The fluorescence spectra revealed the emission state of the two samples. The thermal behaviour and stability of the two compounds were evaluated by the TGA-DSC analysis.

  18. Pair distribution function analysis of sulfide glassy electrolytes for all-solid-state batteries: Understanding the improvement of ionic conductivity under annealing condition.

    PubMed

    Shiotani, Shinya; Ohara, Koji; Tsukasaki, Hirofumi; Mori, Shigeo; Kanno, Ryoji

    2017-08-01

    In general, the ionic conductivity of sulfide glasses decreases with their crystallization, although it increases for a few sulphide glasses owing to the crystallization of a highly conductive new phase (e.g., Li 7 P 3 S 11 : 70Li 2 S-30P 2 S 5 ). We found that the ionic conductivity of 75Li 2 S-25P 2 S 5 sulfide glass, which consists of glassy and crystalline phases, is improved by optimizing the conditions of the heat treatment, i.e., annealing. A different mechanism of high ionic conductivity from the conventional mechanism is expected in the glassy phase. Here, we report the glassy structure of 75Li 2 S-25P 2 S 5 immediately before the crystallization by using the differential pair distribution function (d-PDF) analysis of high-energy X-ray diffraction. Even though the ionic conductivity increases during the optimum annealing, the d-PDF analysis indicated that the glassy structure undergoes no structural change in the sulfide glass-ceramic electrolyte at a crystallinity of 33.1%. We observed the formation of a nanocrystalline phase in the X-ray and electron diffraction patterns before the crystallization, which means that Bragg peaks were deformed. Thus, the ionic conductivity in the mixture of glassy and crystalline phases is improved by the coexistence of the nanocrystalline phase.

  19. Macromolecular diffractive imaging using imperfect crystals

    PubMed Central

    Ayyer, Kartik; Yefanov, Oleksandr; Oberthür, Dominik; Roy-Chowdhury, Shatabdi; Galli, Lorenzo; Mariani, Valerio; Basu, Shibom; Coe, Jesse; Conrad, Chelsie E.; Fromme, Raimund; Schaffer, Alexander; Dörner, Katerina; James, Daniel; Kupitz, Christopher; Metz, Markus; Nelson, Garrett; Lourdu Xavier, Paulraj; Beyerlein, Kenneth R.; Schmidt, Marius; Sarrou, Iosifina; Spence, John C. H.; Weierstall, Uwe; White, Thomas A.; Yang, Jay-How; Zhao, Yun; Liang, Mengning; Aquila, Andrew; Hunter, Mark S.; Robinson, Joseph S.; Koglin, Jason E.; Boutet, Sébastien; Fromme, Petra; Barty, Anton; Chapman, Henry N.

    2016-01-01

    The three-dimensional structures of macromolecules and their complexes are predominantly elucidated by X-ray protein crystallography. A major limitation is access to high-quality crystals, to ensure X-ray diffraction extends to sufficiently large scattering angles and hence yields sufficiently high-resolution information that the crystal structure can be solved. The observation that crystals with shrunken unit-cell volumes and tighter macromolecular packing often produce higher-resolution Bragg peaks1,2 hints that crystallographic resolution for some macromolecules may be limited not by their heterogeneity but rather by a deviation of strict positional ordering of the crystalline lattice. Such displacements of molecules from the ideal lattice give rise to a continuous diffraction pattern, equal to the incoherent sum of diffraction from rigid single molecular complexes aligned along several discrete crystallographic orientations and hence with an increased information content3. Although such continuous diffraction patterns have long been observed—and are of interest as a source of information about the dynamics of proteins4 —they have not been used for structure determination. Here we show for crystals of the integral membrane protein complex photosystem II that lattice disorder increases the information content and the resolution of the diffraction pattern well beyond the 4.5 Å limit of measurable Bragg peaks, which allows us to directly phase5 the pattern. With the molecular envelope conventionally determined at 4.5 Å as a constraint, we then obtain a static image of the photosystem II dimer at 3.5 Å resolution. This result shows that continuous diffraction can be used to overcome long-supposed resolution limits of macromolecular crystallography, with a method that puts great value in commonly encountered imperfect crystals and opens up the possibility for model-free phasing6,7. PMID:26863980

  20. Crystal Structure of 17α-Dihydroequilin, C18H22O2, from Synchrotron Powder Diffraction Data and Density Functional Theory

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kaduk, James; Gindhart, Amy; Blanton, Thomas

    The crystal structure of 17α-dihydroequilin has been solved and refined using synchrotron X-ray powder diffraction data, and optimized using density functional techniques. 17α-dihydroequilin crystallizes in space group P212121 (#19) with a = 6.76849(1) Å, b = 8.96849(1) Å, c = 23.39031(5) Å, V = 1419.915(3) Å3, and Z = 4. Both hydroxyl groups form hydrogen bonds to each other, resulting in zig-zag chains along the b-axis. The powder diffraction pattern has been submitted to ICDD for inclusion in the Powder Diffraction File™ as the entry 00-066-1608.

  1. Synthesis, growth and characterization of a nonlinear optical crystal: Bis l-proline hydrogen nitrate.

    PubMed

    Selvaraju, K; Kirubavathi, K

    2013-11-01

    The single crystals of bis l-proline hydrogen nitrate (BLPHN) belonging to non-centrosymmetric space group were successfully grown by the slow evaporation solution growth technique. The BLPHN crystals of size 10×7×3mm(3) were obtained in 35days. Initially, the solubility tests were carried out for two solvents such as deionized water and mixed of deionized water-acetone. Among the two solvents, the solubility of BLPHN was found to be the highest in deionized water, so crystallization of BLPHN was done from its aqueous solution. As grown, crystals were characterized by single crystal X-ray diffraction studies and optical transmission spectral studies. Infrared spectroscopy, thermo gravimetric analysis and differential thermal analysis measurements were performed to study the molecular vibration and thermal behavior of the grown BLPHN crystals. Nonlinear optical (NLO) behavior of BLPHN crystal was studied by Kurtz and Perry powder method. Copyright © 2013 Elsevier B.V. All rights reserved.

  2. Synthesis, crystal structure, vibrational spectroscopy and photoluminescence of new hybrid compound containing chlorate anions of stanate (II)

    NASA Astrophysics Data System (ADS)

    Lassoued, Mohamed Saber; Abdelbaky, Mohammed S. M.; Lassoued, Abdelmajid; Meroño, Rafael Mendoza; Gadri, Abdellatif; Ammar, Salah; Ben Salah, Abdelhamid; García-Granda, Santiago

    2017-08-01

    The present work aimed at studying a new organic-inorganic bis (4-amino quinolinium) hexachloro stanate (II) dihydrate compound. It was prepared and characterized by single crystal X-ray diffraction, X-ray powder, Hirshfeld surface, Spectroscopy measurement, thermal study and photoluminescence properties. It was found to crystallize in the monoclinic system (P21/c space group) with the following lattice parameters: a = 7.2558(6) Å, b = 13.4876(5) Å, c = 17.2107(13) Å, β = 102.028 (12)°. Its crystal structure was determined and refined down to an R value of 0.06 and a wR value of 0.087. The structure consisted of two different alternating organic-inorganic layers. The crystal packing was stabilized by Nsbnd H⋯Cl and Osbnd H⋯Cl hydrogen bonds and π-π interactions. Hirshfeld surface analysis was used to investigate intermolecular interactions, as well 2D finger plots were conducted to reveal the contribution of these interactions in the crystal structure quantitatively. The X-ray powder is in agreement with the X-ray structure. Scanning electronic microscopy (SEM) was carried out. Furthermore, the room temperature Infra Red (IR) spectrum of the title compound was analyzed on the basis of data found in the literature. Solid state 13C NMR spectrum shows ten signals, confirming the solid state structure determined by X-ray diffraction. Thermal analysis shows two anomalies at 380 and 610 °C. The optical properties of the crystal were studied using optical absorption UV-visible and photoluminescence (PL) spectroscopy, which were investigated at room temperature.

  3. Studies on the growth aspects, structural, thermal, dielectric and third order nonlinear optical properties of solution grown 4-methylpyridinium p-nitrophenolate single crystal

    NASA Astrophysics Data System (ADS)

    Devi, S. Reena; Kalaiyarasi, S.; Zahid, I. MD.; Kumar, R. Mohan

    2016-11-01

    An ionic organic optical crystal of 4-methylpyridinium p-nitrophenolate was grown from methanol by slow evaporation method at ambient temperature. Powder and single crystal X-ray diffraction studies revealed the crystal system and its crystalline perfection. The rocking curve recorded from HRXRD study confirmed the crystal quality. FTIR spectral analysis confirmed the functional groups present in the title compound. UV-visible spectral study revealed the optical window and band gap of grown crystal. The thermal, electrical and surface laser damage threshold properties of harvested crystal were examined by using TGA/DTA, LCR/Impedance Analyzer and Nd:YAG laser system respectively. The third order nonlinear optical property of grown crystal was elucidated by Z-scan technique.

  4. Simulating Picosecond X-ray Diffraction from shocked crystals by Post-processing Molecular Dynamics Calculations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kimminau, G; Nagler, B; Higginbotham, A

    2008-06-19

    Calculations of the x-ray diffraction patterns from shocked crystals derived from the results of Non-Equilibrium-Molecular-Dynamics (NEMD) simulations are presented. The atomic coordinates predicted by the NEMD simulations combined with atomic form factors are used to generate a discrete distribution of electron density. A Fast-Fourier-Transform (FFT) of this distribution provides an image of the crystal in reciprocal space, which can be further processed to produce quantitative simulated data for direct comparison with experiments that employ picosecond x-ray diffraction from laser-irradiated crystalline targets.

  5. X-ray diffraction imaging (topography) of electroopticcrystals by synchrotron radiation

    NASA Technical Reports Server (NTRS)

    Steiner, Bruce; Kuriyama, Masao; Dobbyn, Ronald C.; Laor, Uri

    1988-01-01

    Information of special interest to crystal growers and device physicists now available from monochromatic synchrotron diffraction imaging (topography) is reviewed. Illustrations are taken from a variety of electro-optic crystals. Aspects of the detailed understanding of crystal growth processes obtainable from carefully selected samples are described. Finally, new experimental opportunities now available for exploitation are indicated.

  6. An Excel Spreadsheet for a One-Dimensional Fourier Map in X-ray Crystallography

    ERIC Educational Resources Information Center

    Clegg, William

    2004-01-01

    The teaching of crystal structure determination with single-crystal X-ray diffraction at undergraduate level faces numerous challenges. Single-crystal X-ray diffraction is used in a vast range of chemical research projects and forms the basis for a high proportion of structural results that are presented to high-school, undergraduate, and graduate…

  7. Three-dimensional reconstruction for coherent diffraction patterns obtained by XFEL.

    PubMed

    Nakano, Miki; Miyashita, Osamu; Jonic, Slavica; Song, Changyong; Nam, Daewoong; Joti, Yasumasa; Tama, Florence

    2017-07-01

    The three-dimensional (3D) structural analysis of single particles using an X-ray free-electron laser (XFEL) is a new structural biology technique that enables observations of molecules that are difficult to crystallize, such as flexible biomolecular complexes and living tissue in the state close to physiological conditions. In order to restore the 3D structure from the diffraction patterns obtained by the XFEL, computational algorithms are necessary as the orientation of the incident beam with respect to the sample needs to be estimated. A program package for XFEL single-particle analysis based on the Xmipp software package, that is commonly used for image processing in 3D cryo-electron microscopy, has been developed. The reconstruction program has been tested using diffraction patterns of an aerosol nanoparticle obtained by tomographic coherent X-ray diffraction microscopy.

  8. Crystallization and preliminary X-ray analysis of copper amine oxidase from Escherichia coli K-12.

    PubMed

    Roh, J H; Suzuki, H; Kumagai, H; Yamashita, M; Azakami, H; Murooka, Y; Mikami, B

    1994-05-13

    Copper-containing monoamine oxidase (MAO) from Escherichia coli was overproduced in the periplasmic space by expression of the cloned gene. The purified MAO has been crystallized by means of the hanging drop technique using sodium citrate as a precipitant. The crystals belong to the orthorhombic system, space group P2(1)2(1)2(1), with unit cell dimensions of a = 136.1 A, b = 168.4 A and c = 81.6 A. The asymmetric unit contains one molecule of MAO, with a crystal volume per protein mass (Vm) of 2.88 A3/Da and a solvent content of 58% by volume. The crystals diffract X-rays to a resolution limit of at least 2.7 A and are resistant to X-ray radiation damage. They appear to be suitable for X-ray structure analysis.

  9. Comparative analysis of anti-polyglutamine Fab crystals grown on Earth and in microgravity.

    PubMed

    Owens, Gwen E; New, Danielle M; Olvera, Alejandra I; Manzella, Julia Ashlyn; Macon, Brittney L; Dunn, Joshua C; Cooper, David A; Rouleau, Robyn L; Connor, Daniel S; Bjorkman, Pamela J

    2016-10-01

    Huntington's disease is one of nine neurodegenerative diseases caused by a polyglutamine (polyQ)-repeat expansion. An anti-polyQ antigen-binding fragment, MW1 Fab, was crystallized both on Earth and on the International Space Station, a microgravity environment where convection is limited. Once the crystals returned to Earth, the number, size and morphology of all crystals were recorded, and X-ray data were collected from representative crystals. The results generally agreed with previous microgravity crystallization studies. On average, microgravity-grown crystals were 20% larger than control crystals grown on Earth, and microgravity-grown crystals had a slightly improved mosaicity (decreased by 0.03°) and diffraction resolution (decreased by 0.2 Å) compared with control crystals grown on Earth. However, the highest resolution and lowest mosaicity crystals were formed on Earth, and the highest-quality crystal overall was formed on Earth after return from microgravity.

  10. Comparative analysis of anti-polyglutamine Fab crystals grown on Earth and in microgravity

    PubMed Central

    Owens, Gwen E.; New, Danielle M.; Olvera, Alejandra I.; Manzella, Julia Ashlyn; Macon, Brittney L.; Dunn, Joshua C.; Cooper, David A.; Rouleau, Robyn L.; Connor, Daniel S.; Bjorkman, Pamela J.

    2016-01-01

    Huntington’s disease is one of nine neurodegenerative diseases caused by a polyglutamine (polyQ)-repeat expansion. An anti-polyQ antigen-binding fragment, MW1 Fab, was crystallized both on Earth and on the International Space Station, a microgravity environment where convection is limited. Once the crystals returned to Earth, the number, size and morphology of all crystals were recorded, and X-ray data were collected from representative crystals. The results generally agreed with previous microgravity crystallization studies. On average, microgravity-grown crystals were 20% larger than control crystals grown on Earth, and microgravity-grown crystals had a slightly improved mosaicity (decreased by 0.03°) and diffraction resolution (decreased by 0.2 Å) compared with control crystals grown on Earth. However, the highest resolution and lowest mosaicity crystals were formed on Earth, and the highest-quality crystal overall was formed on Earth after return from microgravity. PMID:27710941

  11. Crystallization processes in Ge{sub 2}Sb{sub 2}Se{sub 4}Te glass

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Svoboda, Roman, E-mail: roman.svoboda@upce.cz; Bezdička, Petr; Gutwirth, Jan

    2015-01-15

    Highlights: • Crystallization kinetics of Ge{sub 2}Sb{sub 2}Se{sub 4}Te glass was studied in dependence on particle size by DSC. • All studied fractions were described in terms of the SB autocatalytic model. • Relatively high amount of Te enhances manifestation of bulk crystallization mechanisms. • XRD analysis of samples crystallized under different conditions showed correlation with DSC data. • XRD analysis revealed a new crystallization mechanism indistinguishable by DSC. - Abstract: Differential scanning calorimetry (DSC) and X-ray diffraction (XRD) analysis were used to study crystallization in Ge{sub 2}Sb{sub 2}Se{sub 4}Te glass under non-isothermal conditions as a function of the particlemore » size. The crystallization kinetics was described in terms of the autocatalytic Šesták–Berggren model. An extensive discussion of all aspects of a full-scale kinetic study of a crystallization process was undertaken. Dominance of the crystallization process originating from mechanically induced strains and heterogeneities was confirmed. Substitution of Se by Te was found to enhance the manifestation of the bulk crystallization mechanisms (at the expense of surface crystallization). The XRD analysis showed significant dependence of the crystalline structural parameters on the crystallization conditions (initial particle size of the glassy grains and applied heating rate). Based on this information, a new microstructural crystallization mechanism, indistinguishable by DSC, was proposed.« less

  12. Polymorphism of Alprazolam (Xanax): a review of its crystalline phases and identification, crystallographic characterization, and crystal structure of a new polymorph (form III).

    PubMed

    de Armas, Héctor Novoa; Peeters, Oswald M; Van den Mooter, Guy; Blaton, Norbert

    2007-05-01

    A new polymorphic form of Alprazolam (Xanax), 8-chloro-1-methyl-6-phenyl-4H-[1,2,4]triazolo-[4,3-alpha][1,4]benzodiazepine, C(17)H(13)ClN(4), has been investigated by means of X-ray powder diffraction (XRPD), single crystal X-ray diffraction, and differential scanning calorimetry (DSC). This polymorphic form (form III) was obtained during DSC experiments after the exothermic recrystallization of the melt of form I. The crystal unit cell dimensions for form III were determined from diffractometer methods. The monoclinic unit cell found for this polymorph using XRPD after indexing the powder diffractogram was confirmed by the cell parameters obtained from single crystal X-ray diffractometry on a crystal isolated from the DSC pans. The single crystal unit cell parameters are: a = 28.929(9), b = 13.844(8), c = 7.361(3) angstroms, beta = 92.82(3) degrees , V = 2944(2) angstroms(3), Z = 8, space group P2(1) (No.4), Dx = 1.393 Mg/m(3). The structure obtained from single crystal X-ray diffraction was used as initial model for Rietveld refinement on the powder diffraction data of form III. The temperature phase transformations of alprazolam were also studied using high temperature XRPD. A review of the different phases available in the Powder Diffraction File (PDF) database for this drug is described bringing some clarification and corrections. (c) 2007 Wiley-Liss, Inc. and the American Pharmacists Association.

  13. Overcoming a hemihedral twinning problem in tetrahydrofolate-dependent O -demethylase crystals by the microseeding method

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Harada, Ayaka; Sato, Yukari; Kamimura, Naofumi

    2016-11-30

    A tetrahydrofolate-dependentO-demethylase, LigM, fromSphingobiumsp. SYK-6 was crystallized by the hanging-drop vapour-diffusion method. However, the obtainedP3 121 orP3 221 crystals, which diffracted to 2.5–3.3 Å resolution, were hemihedrally twinned. To overcome the twinning problem, microseeding usingP3 121/P3 221 crystals as microseeds was performed with optimization of the reservoir conditions. As a result, another crystal form was obtained. The newly obtained crystal diffracted to 2.5–3.0 Å resolution and belonged to space groupP2 12 12, with unit-cell parametersa= 102.0,b= 117.3,c= 128.1 Å. TheP2 12 12 crystals diffracted to better than 2.0 Å resolution after optimizing the cryoconditions. Phasing using the single anomalous diffractionmore » method was successful at 3.0 Å resolution with a Pt-derivative crystal. This experience suggested that microseeding is an effective method to overcome the twinning problem, even when twinned crystals are utilized as microseeds.« less

  14. Quinoline derivative containing monomeric and polymeric metal carboxylates: Synthesis, crystal structure and gas adsorption study over a 2D layered framework

    NASA Astrophysics Data System (ADS)

    Gayen, Saikat; Saha, Debraj; Koner, Subratanath

    2018-06-01

    A new supramolecular metal-carboxylate framework [Co(mqc)2]n (1), and another monomeric compound [Zn (mqc)2(H2O)] (2) (mqcH = 4-methoxy 2-quinolinecarboxylic acid) have been synthesized solvothermally and characterized by single crystal X-ray diffraction, elemental analysis, IR spectra, UV-vis spectra, powdered X-ray diffraction (PXRD) and thermogravimetric analysis. Compound 1 is a 2D coordination polymer, extended to a 3D porous supramolecular network having void space in between 2D layers. Compound 1 exhibits gas uptake capacity of N2, H2, CO2 and CH4 like small gas molecules in which moderately high uptake of H2 and CO2 takes place among the 2D MOFs. While the Zn variety, compound 2 features a one-dimensional chain like structure through strong intermolecular hydrogen-bonding.

  15. Structural analysis and martensitic transformation in equiatomic HfPd alloy

    NASA Astrophysics Data System (ADS)

    Hisada, S.; Matsuda, M.; Takashima, K.; Yamabe-Mitarai, Y.

    2018-02-01

    We investigated the crystal structure and the martensitic transformation in equiatomic HfPd alloy. The analysis of the crystal structure by electron diffraction and Rietveld refinement using X-ray diffraction data indicates that the space group of the martensitic phase is Cmcm, and the lattice parameters are a = 0.329 nm, b = 1.021 nm, and c = 0.438 nm. Martensitic variants are composed of the plate-like morphology of several hundred nm, and the boundaries between the variants have (021)Cmcm twin relations. This (021)Cmcm twin boundary seems to be sharp without ledge and steps. Differential scanning calorimetry measurement indicates that each martensitic transformation temperature is determined to be Ms = 819 K, Mf = 794 K, As = 928 K, and Af = 954 K. Based on the dimension change using a thermo-mechanical analyzer, the expansion and shrinkage of the sample occurred with the forward and reverse martensitic transformation, respectively.

  16. Thermoelectric properties and thermal stability of Bi-doped PbTe single crystal

    NASA Astrophysics Data System (ADS)

    Chen, Zhong; Li, Decong; Deng, Shuping; Tang, Yu; Sun, Luqi; Liu, Wenting; Shen, Lanxian; Yang, Peizhi; Deng, Shukang

    2018-06-01

    In this study, n-type Bi-doped single-crystal PbTe thermoelectric materials were prepared by melting and slow cooling method according to the stoichiometric ratio of Pb:Bi:Te = 1-x:x:1 (x = 0, 0.1, 0.15, 0.2, 0.25). The X-ray diffraction patterns of Pb1-xBixTe samples show that all main diffraction peaks are well matched with the PbTe matrix, which has a face-centered cubic structure with the space group Fm 3 bar m . Electron probe microanalysis reveals that Pb content decreases gradually, and Te content remains invariant basically with the increase of Bi content, indicating that Bi atoms are more likely to replace Pb atoms. Thermal analysis shows that the prepared samples possess relatively high thermal stability. Simultaneously, transmission electron microscopy and selected area electron diffraction pattern indicate that the prepared samples have typical single-crystal structures with good mechanical properties. Moreover, the electrical conductivity of the prepared samples improved significantly compared with that of the pure sample, and the maximum ZT value of 0.84 was obtained at 600 K by the sample with x = 0.2.

  17. Purification, crystallization and preliminary X-ray diffraction studies of N-acetylglucosamine-phosphate mutase from Candida albicans

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nishitani, Yuichi; Maruyama, Daisuke; Nonaka, Tsuyoshi

    2006-04-01

    Preliminary X-ray diffraction studies on N-acetylglucosamine-phosphate mutase from C. albicans are reported. N-acetylglucosamine-phosphate mutase (AGM1) is an essential enzyme in the synthesis of UDP-N-acetylglucosamine (UDP-GlcNAc) in eukaryotes and belongs to the α-d-phosphohexomutase superfamily. AGM1 from Candida albicans (CaAGM1) was purified and crystallized by the sitting-drop vapour-diffusion method. The crystals obtained belong to the primitive monoclinic space group P2{sub 1}, with unit-cell parameters a = 60.2, b = 130.2, c = 78.0 Å, β = 106.7°. The crystals diffract X-rays to beyond 1.8 Å resolution using synchrotron radiation.

  18. Static and Dynamical Structural Investigations of Metal-Oxide Nanocrystals by Powder X-ray Diffraction: Colloidal Tungsten Oxide as a Case Study

    DOE PAGES

    Caliandro, Rocco; Sibillano, Teresa; Belviso, B. Danilo; ...

    2016-02-02

    In this study, we have developed a general X-ray powder diffraction (XPD) methodology for the simultaneous structural and compositional characterization of inorganic nanomaterials. The approach is validated on colloidal tungsten oxide nanocrystals (WO 3-x NCs), as a model polymorphic nanoscale material system. Rod-shaped WO 3-x NCs with different crystal structure and stoichiometry are comparatively investigated under an inert atmosphere and after prolonged air exposure. An initial structural model for the as-synthesized NCs is preliminarily identified by means of Rietveld analysis against several reference crystal phases, followed by atomic pair distribution function (PDF) refinement of the best-matching candidates (static analysis). Subtlemore » stoichiometry deviations from the corresponding bulk standards are revealed. NCs exposed to air at room temperature are monitored by XPD measurements at scheduled time intervals. The static PDF analysis is complemented with an investigation into the evolution of the WO 3-x NC structure, performed by applying the modulation enhanced diffraction technique to the whole time series of XPD profiles (dynamical analysis). Prolonged contact with ambient air is found to cause an appreciable increase in the static disorder of the O atoms in the WO 3-x NC lattice, rather than a variation in stoichiometry. Finally, the time behavior of such structural change is identified on the basis of multivariate analysis.« less

  19. Use of a miniature diamond-anvil cell in high-pressure single-crystal neutron Laue diffraction

    PubMed Central

    Binns, Jack; Kamenev, Konstantin V.; McIntyre, Garry J.; Moggach, Stephen A.; Parsons, Simon

    2016-01-01

    The first high-pressure neutron diffraction study in a miniature diamond-anvil cell of a single crystal of size typical for X-ray diffraction is reported. This is made possible by modern Laue diffraction using a large solid-angle image-plate detector. An unexpected finding is that even reflections whose diffracted beams pass through the cell body are reliably observed, albeit with some attenuation. The cell body does limit the range of usable incident angles, but the crystallographic completeness for a high-symmetry unit cell is only slightly less than for a data collection without the cell. Data collections for two sizes of hexamine single crystals, with and without the pressure cell, and at 300 and 150 K, show that sample size and temperature are the most important factors that influence data quality. Despite the smaller crystal size and dominant parasitic scattering from the diamond-anvil cell, the data collected allow a full anisotropic refinement of hexamine with bond lengths and angles that agree with literature data within experimental error. This technique is shown to be suitable for low-symmetry crystals, and in these cases the transmission of diffracted beams through the cell body results in much higher completeness values than are possible with X-rays. The way is now open for joint X-ray and neutron studies on the same sample under identical conditions. PMID:27158503

  20. Blazed vector gratings fabricated using photosensitive polymer liquid crystals and control of polarization diffraction

    NASA Astrophysics Data System (ADS)

    Ono, Hiroshi; Kuzuwata, Mitsuru; Sasaki, Tomoyuki; Noda, Kohei; Kawatsuki, Nobuhiro

    2014-03-01

    The blazed vector grating possessing antisymmetric distributions of the birefringence were fabricated by exposing the line-focused linearly polarized ultraviolet light on the photosensitive polymer liquid crystals. The polarization states of the diffraction beams can be highly and widely controlled by designing the blazed structures, and the diffraction properties were well-explained by Jones calculus.

Top